Apoptosis is rapidly triggered by antisense depletion of MCL-1 in differentiating U937 cells.

PubMed

Moulding, D A; Giles, R V; Spiller, D G; White, M R; Tidd, D M; Edwards, S W

2000-09-01

Mcl-1 is a member of the Bcl-2 protein family, which has been shown to delay apoptosis in transfection and/or overexpression experiments. As yet no gene knockout mice have been engineered, and so there is little evidence to show that loss of Mcl-1 expression is sufficient to trigger apoptosis. U937 cells constitutively express the antiapoptotic protein Bcl-2; but during differentiation, in response to the phorbol ester PMA (phorbol 12 beta-myristate 13 alpha-acetate), Mcl-1 is transiently induced. The purpose of this investigation was to determine the functional role played by Mcl-1 in this differentiation program. Mcl-1 expression was specifically disrupted by chimeric methylphosphonate/phosphodiester antisense oligodeoxynucleotides to just 5% of control levels. The depletion of Mcl-1 messenger RNA (mRNA) and protein was both rapid and specific, as indicated by the use of control oligodeoxynucleotides and analysis of the expression of other BCL2 family members and PMA-induced tumor necrosis factor-alpha (TNF-alpha). Specific depletion of Mcl-1 mRNA and protein, in the absence of changes in cellular levels of Bcl-2, results in a rapid entry into apoptosis. Levels of the proapoptotic protein Bax remained unchanged during differentiation, while Bak expression doubled within 24 hours. Apoptosis was detected within 4 hours of Mcl-1 antisense treatment by a variety of parameters including a novel live cell imaging technique allowing correlation of antisense treatment and apoptosis in individual cells. The induction of Mcl-1 is required to prevent apoptosis during differentiation of U937 cells, and the constitutive expression of Bcl-2 is unable to compensate for the loss of Mcl-1. (Blood. 2000;96:1756-1763)

Effect of antisense oligodeoxynucleotides for ICAM-1 on renal ischaemia–reperfusion injury in the anaesthetised rat

PubMed Central

Kiew, Lik Voon; Munavvar, Abdul Sattar; Law, Chung Hiong; Azizan, Abdullah Nor; Nazarina, Abdul Rahman; Sidik, Khalifah; Johns, Edward J

2004-01-01

An antisense oligodeoxynucleotide (As-ODN) to the 3′ untranslated region of the mRNA sequence expressing the intracellular adhesion molecule-1 (ICAM-1) was employed to determine ICAM-1's role in renal ischaemia–reperfusion injury in the rat. Wistar-Kyoto rats receiving i.v. either lipofectin–As-ODN (As-ODN group), lipofectin–reverse ODN (Rv-ODN group) or lipofectin (ischaemia control group) 8 h prior to study were anaesthetized and subjected to 30 min of renal artery occlusion. Renal haemodynamic and excretory parameters were monitored before and after renal ischaemia. On termination of the study renal tissue was subjected to histological and Western blot analysis. Renal blood flow decreased in the 3 h post-ischaemia period in the ischaemia control and Rv-ODN groups, but was maintained in the As-ODN group. Glomerular filtration rate was depressed initially but gradually increased to 10% above basal levels in the ischaemia control and Rv-ODN groups, but was below basal levels (20%) in the As-ODN group. There was a three- to fourfold increase in sodium and water excretion following ischaemia in the ischaemia control and reverse-ODN groups but not in the As-ODN treated group. The As-ODN ameliorated the histological evidence of ischaemic damage and reduced ICAM-1 protein levels to a greater extent in the medulla than cortex. These observations suggested that in the post-ischaemic period afferent and efferent arteriolar tone was increased with a loss of reabsorptive capacity which was in part due to ICAM-1. The possibility arises that the action of ICAM-1 at vascular and tubular sites in the deeper regions of the kidney contributes to the ischaemia–reperfusion injury. PMID:15047774

Antisense antibiotics: a brief review of novel target discovery and delivery.

PubMed

Bai, Hui; Xue, Xiaoyan; Hou, Zheng; Zhou, Ying; Meng, Jingru; Luo, Xiaoxing

2010-06-01

The nightmare of multi-drug resistant bacteria will still haunt if no panacea is ever found. Efforts on seeking desirable natural products with bactericidal property and screening chemically modified derivatives of traditional antibiotics have lagged behind the emergence of new multi-drug resistant bacteria. The concept of using antisense antibiotics, now as revolutionary as is on threshold has experienced ups and downs in the past decade. In the past five years, however, significant technology advances in the fields of microbial genomics, structural modification of oligonucleotides and efficient delivery system have led to fundamental progress in the research and in vivo application of this paradigm. The wealthy information provided in the microbial genomics era has allowed the identification and/or validation of a number of essential genes that may serve as possible targets for antisense inhibition; antisense oligodeoxynucleotides (ODNs) based on the 3rd generation of modified structures, e.g., peptide nucleic acids (PNAs) and phosphorodiamidate morpholino oligomers (PMOs) have shown great potency in gene expression inhibition in a sequence-specific and dosedependent manner at low micromolar concentrations; and cell penetrating peptide mediated delivery system has enabled the effective display of intracellular antisense inhibition of targeted genes both in vitro and in vivo. The new methods show promise in the discovery of novel gene-specific antisense antibiotics that will be useful in the future battle against drug-resistant bacterial infections. This review describes this promising paradigm, the targets that have been identified and the recent technologies on which it is delivered.

Conformationally restricted analogs of BD1008 and an antisense oligodeoxynucleotide targeting sigma1 receptors produce anti-cocaine effects in mice.

PubMed

Matsumoto, R R; McCracken, K A; Friedman, M J; Pouw, B; De Costa, B R; Bowen, W D

2001-05-11

Cocaine's ability to interact with sigma receptors suggests that these proteins mediate some of its behavioral effects. Therefore, three novel sigma receptor ligands with antagonist activity were evaluated in Swiss Webster mice: BD1018 (3S-1-[2-(3,4-dichlorophenyl)ethyl]-1,4-diazabicyclo[4.3.0]nonane), BD1063 (1-[2-(3,4-dichlorophenyl)ethyl]-4-methylpiperazine), and LR132 (1R,2S-(+)-cis-N-[2-(3,4-dichlorophenyl)ethyl]-2-(1-pyrrolidinyl)cyclohexylamine). Competition binding assays demonstrated that all three compounds have high affinities for sigma1 receptors. The three compounds vary in their affinities for sigma2 receptors and exhibit negligible affinities for dopamine, opioid, GABA(A) and NMDA receptors. In behavioral studies, pre-treatment of mice with BD1018, BD1063, or LR132 significantly attenuated cocaine-induced convulsions and lethality. Moreover, post-treatment with LR132 prevented cocaine-induced lethality in a significant proportion of animals. In contrast to the protection provided by the putative antagonists, the well-characterized sigma receptor agonist di-o-tolylguanidine (DTG) and the novel sigma receptor agonist BD1031 (3R-1-[2-(3,4-dichlorophenyl)ethyl]-1,4-diazabicyclo[4.3.0]nonane) each worsened the behavioral toxicity of cocaine. At doses where alone, they produced no significant effects on locomotion, BD1018, BD1063 and LR132 significantly attenuated the locomotor stimulatory effects of cocaine. To further validate the hypothesis that the anti-cocaine effects of the novel ligands involved antagonism of sigma receptors, an antisense oligodeoxynucleotide against sigma1 receptors was also shown to significantly attenuate the convulsive and locomotor stimulatory effects of cocaine. Together, the data suggests that functional antagonism of sigma receptors is capable of attenuating a number of cocaine-induced behaviors.

Antisense protein kinase A RIalpha inhibits 7,12-dimethylbenz(a)anthracene-induction of mammary cancer: blockade at the initial phase of carcinogenesis.

PubMed

Nesterova, Maria V; Cho-Chung, Yoon S

2004-07-01

There are two types of cyclic AMP (cAMP)-dependent protein kinase (PKA), type I (PKA-I) and type II (PKA-II), which share a common catalytic (C) subunit but contain distinct regulatory (R) subunits, RI versus RII, respectively. Evidence suggests that increased expression of PKA-I and its regulatory subunit (RIalpha) correlates with tumorigenesis and tumor growth. We investigated the effect of sequence-specific inhibition of RIalpha gene expression at the initial phase of 7,12-dimethylbenz(alphaa)anthracene (DMBA)-induced mammary carcinogenesis. Antisense RIalpha oligodeoxynucleotide (ODN) targeted against PKA RIalpha was administered (0.1 mg/day/rat, i.p.) 1 day before DMBA intubation and during the first 9 days post-DMBA intubation to determine the anticarcinogenic effects. Antisense RIalpha, in a sequence-specific manner, inhibited the tumor production. At 90 days after DMBA intubation, untreated controls and RIalpha-antisense-treated rats exhibited an average mean number of tumors per rat of 4.2 and 1.8, respectively, and 90% of control and 45% of antisense-treated animals had tumors. The antisense also delayed the first tumor appearance. An increase in RIalpha and PKA-I levels in the mammary gland and liver preceded DMBA-induced tumor production, and antisense down-regulation of RIalpha restored normal levels of PKA-I and PKA-II in these tissues. Antisense RIalpha in the liver induced the phase II enzymes, glutathione S-transferase and quinone oxidoreductase, c-fos protein, and activator protein 1 (AP-1)- and cAMP response element (CRE)-directed transcription. In the mammary glands, antisense RIalpha promoted DNA repair processes. In contrast, the CRE transcription-factor decoy could not mimic these effects of antisense RIalpha. The results demonstrate that RIalpha antisense produces dual anticarcinogenic effects: (a) increasing DMBA detoxification in the liver by increasing phase II enzyme activities, increasing CRE-binding-protein phosphorylation and

C-fos mediates antipsychotic-induced neurotensin gene expression in the rodent striatum.

PubMed

Robertson, G S; Tetzlaff, W; Bedard, A; St-Jean, M; Wigle, N

1995-07-01

The ubiquitous inducibility of the immediate-early gene c-fos in the central nervous system has led to the search for downstream genes which are regulated by its product, Fos. Recent evidence suggests that c-fos induction by a single injection of the classical antipsychotic haloperidol may contribute to the subsequent increase in neurotensin gene expression in the rodent striatum. Consistent with this proposal, in the present study haloperidol-induced Fos-like immunoreactivity and neurotensin/neuromedin N messenger RNA were found to be expressed by the same population of striatal neurons. Moreover, inhibition of haloperidol-induced c-fos expression by intrastriatal injection of antisense phosphorothioate oligodeoxynucleotides complimentary either to bases 109-126 or 127-144 of c-fos attenuated the subsequent increase in neurotensin/neuromedin N messenger RNA. However, injection of a sense phosphorothioate oligodeoxynucleotide corresponding to bases 127-144 of c-fos did not reduce haloperidol-induced c-fos or neurotensin/neuromedin N expression. Furthermore, constitutive expression of Jun-like immunoreactivity in the striatum was not reduced by either the sense or antisense phosphorothioate oligodeoxynucleotides. Similarly, the sense and antisense phosphorothioate oligodeoxynucleotide failed to reduce proenkephalin messenger RNA, which is located in the same striatal neurons that express haloperidol-induced neurotensin/neuromedin N messenger RNA, which is located in the same striatal neurons that express haloperidol-induced neurotensin/neuromedin N messenger RNA. Lastly, haloperidol-induced increases in nerve growth factor I-A-, JunB- and FosB-like immunoreactivity and fosB messenger RNA were not decreased by intrastriatal injection of either the sense or antisense phosphorothioate oligodeoxynucleotides. These results indicate that the antisense phosphorothioate oligodeoxynucleotides attenuated haloperidol-induced neurotensin/neuromedin N expression by selectively

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the

Identification of antisense nucleic acid hybridization sites in mRNA molecules with self-quenching fluorescent reporter molecules

PubMed Central

Gifford, Lida K.; Opalinska, Joanna B.; Jordan, David; Pattanayak, Vikram; Greenham, Paul; Kalota, Anna; Robbins, Michelle; Vernovsky, Kathy; Rodriguez, Lesbeth C.; Do, Bao T.; Lu, Ponzy; Gewirtz, Alan M.

2005-01-01

We describe a physical mRNA mapping strategy employing fluorescent self-quenching reporter molecules (SQRMs) that facilitates the identification of mRNA sequence accessible for hybridization with antisense nucleic acids in vitro and in vivo, real time. SQRMs are 20–30 base oligodeoxynucleotides with 5–6 bp complementary ends to which a 5′ fluorophore and 3′ quenching group are attached. Alone, the SQRM complementary ends form a stem that holds the fluorophore and quencher in contact. When the SQRM forms base pairs with its target, the structure separates the fluorophore from the quencher. This event can be reported by fluorescence emission when the fluorophore is excited. The stem–loop of the SQRM suggests that SQRM be made to target natural stem–loop structures formed during mRNA synthesis. The general utility of this method is demonstrated by SQRM identification of targetable sequence within c-myb and bcl-6 mRNA. Corresponding antisense oligonucleotides reduce these gene products in cells. PMID:15718294

Antisense imaging of epidermal growth factor-induced p21(WAF-1/CIP-1) gene expression in MDA-MB-468 human breast cancer xenografts.

PubMed

Wang, Judy; Chen, Paul; Mrkobrada, Marko; Hu, Meiduo; Vallis, Katherine A; Reilly, Raymond M

2003-09-01

Molecular imaging of the expression of key genes which determine the response to DNA damage following cancer treatment may predict the effectiveness of a particular treatment strategy. A prominent early response gene for DNA damage is the gene encoding p21(WAF-1/CIP-1), a cyclin-dependent kinase inhibitor that regulates progression through the cell cycle. In this study, we explored the feasibility of imaging p21(WAF-1/CIP-1) gene expression at the mRNA level using an 18-mer phosphorothioated antisense oligodeoxynucleotide (ODN) labeled with (111)In. The known induction of the p21(WAF-1/CIP-1) gene in MDA-MB-468 human breast cancer cells following exposure to epidermal growth factor (EGF) was used as an experimental tool. Treatment of MDA-MB-468 cells in vitro with EGF (20 n M) increased the ratio of p21(WAF-1/CIP-1) mRNA/beta-actin mRNA threefold within 2 h as measured by the reverse transcription polymerase chain reaction (RT-PCR). A concentration-dependent inhibition of EGF-induced p21(WAF-1/CIP-1) protein expression was achieved in MDA-MB-468 cells by treatment with antisense ODNs with up to a tenfold decrease observed at 1 microM. There was a fourfold lower inhibition of p21(WAF-1/CIP-1) protein expression by control sense or random sequence ODNs. Intratumoral injections of EGF (15 microg/dayx3 days) were employed to induce p21(WAF-1/CIP-1) gene expression in MDA-MB-468 xenografts implanted subcutaneously into athymic mice. RT-PCR of explanted tumors showed a threefold increased level of p21(WAF-1/CIP-1) mRNA compared with normal saline-treated tumors. Successful imaging of EGF-induced p21(WAF-1/CIP-1) gene expression in MDA-MB-468 xenografts was achieved at 48 h post injection of (111)In-labeled antisense ODNs (3.7 MBq; 2 microg). Tumors displaying basal levels of p21(WAF-1/CIP-1) gene expression in the absence of EGF treatment could not be visualized. Biodistribution studies showed a significantly higher tumor accumulation of (111)In-labeled antisense ODNs in

Repression of Meiotic Genes by Antisense Transcription and by Fkh2 Transcription Factor in Schizosaccharomyces pombe

PubMed Central

Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.

2012-01-01

In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the “unspliced” signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression. PMID:22238674

Oligodeoxynucleotide nanostructure formation in the presence of polypropyleneimine dendrimers and their uptake in breast cancer cells

NASA Astrophysics Data System (ADS)

Chen, Alex M.; Santhakumaran, Latha M.; Nair, Sandhya K.; Amenta, Peter S.; Thomas, Thresia; He, Huixin; Thomas, T. J.

2006-11-01

We studied the efficacy of five generations of polypropyleneimine (PPI) dendrimer to provoke nanostructure formation from a 21-nucleotide antisense oligodeoxynucleotide (ODN). Nanostructure formation was observed with all generations of dendrimer by light scattering and microscopic techniques. The efficacy of the dendrimers increased with generation number. Atomic force microscopy (AFM) was used to study the morphology of the structures at different condensation stages. Based on the observed nanostructures, we propose a zipping condensation mechanism, which is very different from the condensation pathways of high molecular weight DNA polymers. Electron microscopy showed the presence of toroidal nanoparticles. Confocal microscopic analysis showed that the nanostructures formed with G-4 and G-5 dendrimers could undergo facile cellular uptake in a breast cancer cell line, MDA-MB-231, whereas nanostructures formed with G-1 to G-3 dendrimers lacked this ability. Nanoparticles formed with G-1 to G-3 dendrimers showed significantly lower zeta potential (5.2-6.5 mV) than those (12-18 mV) of particles formed with G-4 and G-5 dendrimers. These results show that the structure and charge density of the dendrimers are important in ODN nanoparticle formation and cellular transport and that G-4 and G-5 dendrimers are useful in cellular delivery of antisense ODN.

Discrimination of heterogenous mRNAs encoding strychnine-sensitive glycine receptors in Xenopus oocytes by antisense oligonucleotides.

PubMed Central

Akagi, H; Patton, D E; Miledi, R

1989-01-01

Three synthetic oligodeoxynucleotides complementary to different parts of an RNA encoding a glycine receptor subunit were used to discriminate heterogenous mRNAs coding for glycine receptors in adult and neonatal rat spinal cord. Injection of the three antisense oligonucleotides into Xenopus oocytes specifically inhibited the expression of glycine receptors by adult spinal cord mRNA. In contrast, the antisense oligonucleotides were much less potent in inhibiting the expression of glycine receptors encoded by neonatal spinal cord mRNA. Northern blot analysis revealed that the oligonucleotides hybridized mostly to an adult cord transcript of approximately 10 kilobases in size. This band was also present in neonatal spinal cord mRNA but its density was about one-fourth of the adult cord message. There was no intense band in the low molecular weight position (approximately 2 kilobases), the existence of which was expected from electrophysiological studies with size-fractionated mRNA of neonatal spinal cord. Our results suggest that in the rat spinal cord there are at least three different types of mRNAs encoding functional strychnine-sensitive glycine receptors. Images PMID:2479016

Therapeutic Efficacy of Adenoviral-Mediated p53 Gene Transfer Is Synergistically Enhanced by Combined Use of Antisense Oligodeoxynucleotide Targeting Clusterin Gene in a Human Bladder Cancer Model1

PubMed Central

Miyake, Hideaki; Yamanaka, Kazuki; Muramaki, Mototsugu; Hara, Isao; Gleave, Martin E

2005-01-01

Abstract To establish a more effective therapeutic strategy against advanced bladder cancer, we investigated the effects of combined treatment with antisense (AS) oligodeoxynucleotide (ODN) targeting the antiapoptotic gene clusterin and adenoviral-mediated p53 gene transfer (Ad5CMV-p53) using the human bladder cancer KoTCC-1 model. Clusterin expression in KoTCC-1 cells was highly upregulated by Ad5CMV-p53 treatment; however, AS clusterin ODN treatment further suppressed clusterin expression in KoTCC-1 cells after Ad5CMV-p53 treatment. AS clusterin ODN treatment synergistically enhanced the cytotoxic effect of Ad5CMV-p53, and DNA fragmentation characteristic of apoptosis was observed only after combined treatment with AS clusterin ODN and Ad5CMV-p53, but not after treatment with either agent alone. Administration of AS clusterin ODN and Ad5CMV-p53 into nude mice resulted in a significant inhibition of KoTCC-1 tumor growth as well as lymph node metastases compared to administration of either agent alone. Furthermore, combined treatment with AS clusterin ODN, Ad5CMV-p53, and cisplatin completely eradicated KoTCC-1 tumors and lymph node metastases in 60% and 100% of mice, respectively. These findings suggest that combined treatment with AS clusterin ODN and Ad5CMV-p53 could be a novel strategy to inhibit bladder cancer progression, and that further additional use of a chemotherapeutic agent may substantially enhance the efficacy of this combined regimen. PMID:15802022

Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province

2015-02-06

Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less

Antisense oligonucleotides suppress cell-volume-induced activation of chloride channels.

PubMed

Gschwentner, M; Nagl, U O; Wöll, E; Schmarda, A; Ritter, M; Paulmichl, M

1995-08-01

Cell volume regulation is an essential feature of most cells. After swelling in hypotonic media, the simultaneous activation of potassium and chloride channels is believed to be the initial, time-determining step in cell volume regulation. The activation of both pathways is functionally linked and enables the cells to lose ions and water, subsequently leading to cell shrinkage and readjustment of the initial volume. NIH 3T3 fibroblasts efficiently regulate their volume after swelling and bear chloride channels that are activated by decreasing extracellular osmolarity. The chloride current elicited in these cells after swelling is reminiscent of the current found in oocytes expressing an outwardly rectifying chloride current termed ICln. Introduction of antisense oligodeoxynucleotides complementary to the first 30 nucleotides of the coding region of the ICln channel into NIH 3T3 fibroblasts suppresses the activation of the swelling-induced chloride current. The experiments directly demonstrate an unambiguous link between a volume-activated chloride current and a cloned protein involved in chloride transport.

[Inhibitory effect of VEGF antisense phosphorothioate oligodeoxynucleotides on the growth of human salivary adenoid cystic carcinoma xenografts in nude mice].

PubMed

Li, Xiao-guang; Wang, Xu-xia; Li, Teng-yu; Wang, Yan-xiu; Gao, Jing; Ni, Chun-xiao

2012-12-01

To investigate the inhibitory effect of VEGF antisense phosphorothioate oligodeoxynucleoiides on the growth of human salivary adenoid cystic carcinoma (SACC) xenografts in nude mice. The VEGF-ASODN was synthesised artificially. After the model of human SACC xenografts in nude mice was established, they were random1y divided into three groups: antisense group, scrambled group and normal saline group. A control group without cancer was also established. Antisense(66 μg), scrambled sequence(66 μg) and normal saline(once every 3 days and 7 times in all) were injected in three experimental groups, respectively. Two days after therapy, the mice were sacrificed. Serums were used for detection of VEGF protein. All tumors were measured and weighted. The quantity of VEGF mRNA and protein and PLI, MVD was detected by hybridization in situ and immunohistochemistry. SPSS13.0 software package was used for statistical analysis. The VEGF-ASODN could suppress the expression of VEGF in human SACC xenografts in nude mice and reduce VEGF protein in serum of nude mice significantly. It cou1d also reduce the volume and weight of xenografts and could reduce the expression of VEGF mRNA and its protein, PCNA and CD34. By inhibiting the expression of VEGF, VEGF-ASODN can inhabit proliferation of human SACC xenografts in nude mice.

Widespread antisense transcription of Populus genome under drought.

PubMed

Yuan, Yinan; Chen, Su

2018-06-06

Antisense transcription is widespread in many genomes and plays important regulatory roles in gene expression. The objective of our study was to investigate the extent and functional relevance of antisense transcription in forest trees. We employed Populus, a model tree species, to probe the antisense transcriptional response of tree genome under drought, through stranded RNA-seq analysis. We detected nearly 48% of annotated Populus gene loci with antisense transcripts and 44% of them with co-transcription from both DNA strands. Global distribution of reads pattern across annotated gene regions uncovered that antisense transcription was enriched in untranslated regions while sense reads were predominantly mapped in coding exons. We further detected 1185 drought-responsive sense and antisense gene loci and identified a strong positive correlation between the expression of antisense and sense transcripts. Additionally, we assessed the antisense expression in introns and found a strong correlation between intronic expression and exonic expression, confirming antisense transcription of introns contributes to transcriptional activity of Populus genome under drought. Finally, we functionally characterized drought-responsive sense-antisense transcript pairs through gene ontology analysis and discovered that functional groups including transcription factors and histones were concordantly regulated at both sense and antisense transcriptional level. Overall, our study demonstrated the extensive occurrence of antisense transcripts of Populus genes under drought and provided insights into genome structure, regulation pattern and functional significance of drought-responsive antisense genes in forest trees. Datasets generated in this study serve as a foundation for future genetic analysis to improve our understanding of gene regulation by antisense transcription.

Immune stimulation by a CpG-containing oligodeoxynucleotide is enhanced when encapsulated and delivered in lipid particles.

PubMed

Mui, B; Raney, S G; Semple, S C; Hope, M J

2001-09-01

The therapeutic benefit from phosphorothioate oligodeoxynucleotides (PS ODN) containing immune stimulatory sequences (ISS) has been demonstrated in animal models of cancer and infection. In particular, when CpG-containing PS ODN are administered to mice, activation of macrophages and dendritic, NK, T, and B cells occurs, resulting in the release of an array of cytokines, including interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor-alpha (TNF-alpha). We have previously described stabilized antisense-lipid particles (SALP) for the i.v. administration of antisense ODN [Biochim Biophys Acta (2001) 1510:152--166]. Given the propensity for SALP to target macrophages in vivo it was of interest to determine whether they could enhance the potency of CpG ODN to induce an immune response. In this report we show that when CpG-containing SALP are administered intravenously to ICR mice the plasma concentrations of IL-12, IFN-gamma, IL-6, monocyte chemoattractant protein-1, and TNF-alpha are greatly increased compared with the same dose of free ODN. The pattern of cytokine induction indicates that the immune response is T helper cell type 1-biased, similar to that observed for PS CpG ODN ISS in general. Furthermore, when phosphodiester (PO) ODN is substituted for PS ODN in the SALP formulation cytokine induction is even greater at the early time points, in marked contrast to free PO ODN, which is inactive. These results demonstrate that the immunogenicity of ISS is not only enhanced by encapsulation in lipid particles, which more closely mimic the way ISS DNA would normally be presented to antigen presenting cells by pathogens in vivo, but also SALP enable unmodified PO CpG ODN to be used as immune stimulants.

Regulating gene expression in human leukemia cells using light-activated oligodeoxynucleotides

PubMed Central

Tang, XinJing; Swaminathan, Jyothishmathi; Gewirtz, Alan M.; Dmochowski, Ivan J.

2008-01-01

Light-activated antisense oligodeoxynucleotides (asODNs) were developed to control the degradation of target mRNA in living cells by RNase H. A 20-mer asODN previously shown to target c-myb, a hematopoietic transcription factor, was covalently attached via a photocleavable linker (PL) to partially complementary 20-mer sense strands (sODNs). In the ‘caged’ state, the sODN blocked hybridization of the asODN to c-myb mRNA. Six asODN-PL-sODN conjugates, C1-C6, were synthesized. C5, with twelve complementary bases, gave the largest decrease in melting temperature (Tm) upon UV irradiation (ΔTm = −29°C). The most thermally stable conjugate, C6 (Tm = 84°C), gave the lowest background RNase H activity, with just 8.6% degradation of an RNA 40-mer after 1 h incubation. In biochemical assays with C6, RNA digestion increased 10-fold 10 min after UV irradiation. Finally, phosphorothioated analogs S-C5 and S-C6 were synthesized to test activity in cultured K562 (human leukemia) cells. No knockdown of c-myb mRNA or protein was observed with intact S-C5 or S-C6, whereas more than half of c-myb mRNA was degraded 24 h after photoactivation. Two-fold photomodulation of c-MYB protein levels was also observed with S-C5. However, no photomodulation of c-MYB protein levels was observed with S-C6, perhaps due to the greater stability of this duplex. PMID:18056083

Spleen-specific suppression of TNF-alpha by cationic hydrogel-delivered antisense nucleotides for the prevention of arthritis in animal models.

PubMed

Dong, Lei; Xia, Suhua; Chen, Huan; Chen, Jiangning; Zhang, Junfeng

2009-09-01

This study developed a transplantable platform based on cationic hydrogels to deliver antisense oligodeoxynucleotides (ASOs) targeting the mRNA of TNF-alpha. Cationic agarose (c-agarose) was obtained by conjugating ethylenediamine to agarose via an N,N'-carbonyldiimidazole (CDI)-activation method. ASO-c-agarose system was constructed by mixing ASO in cationic agarose gel of proper concentration and gelation temperature. In vivo assessment of ASO distribution suggested that the system specifically target to spleen, wherein the c-agarose-delivered ASO had a concentration remarkably 50-fold higher than that of the naked ASO. The distribution of c-agarose-delivered ASO was scarcely detectable in liver and kidney. Next, three types of animal models were setup to evaluate the therapeutic efficacies of ASO-Gel, including the adjuvant-induced arthritis (AA), carrageen/lipopolysaccharide (LPS)-induced arthritis (CLA) and collagen-induced arthritis (CIA) models. The effects of ASO-c-agarose in alleviating inflammation and tissue destruction were evidenced in more than 90% of the testing animals, with decrease of main inflammatory cytokines, lightening of joint swelling and tissue damage, as well as increase in their body weights. All these findings suggest that this highly operable devise for the conveyance of antisense nucleotides together with its spleen-targeting property, could become a useful means of antisense-based therapeutics against rheumatoid arthritis and other diseases.

Effect of anti-sense oligodeoxynucleotides homeobox B2 on the proliferation and expression of primary human umbilical vein endothelial cells.

PubMed

Liu, Xusheng; Zhang, Xiaoqi

2002-02-01

To explore the effect of homeobox B2 (HOXB2) anti sense oligodeoxynucleotides (asodn) on the proliferation and expression of primary human umbilical vein endothelial cells (HUVECs). Various concentrations of HOXB2 asodn modified by thiophosphate transfected the induction of liposome into HUVECs. MTT a nd RT-PCR methods were employed to determine the effect of different conc ent rations of asodn on the endothelial proliferation and the expression level of HOXB2 mRNA. After the transfection of HOXB2 asodn, the endothelial proliferation was inhibited in a dose-dependent fashion. Simultaneously, the expression of HOXB2 mRNA decreased significantly. HOXB2 plays an important role in the proliferation of endothelia.

Inhibition of B cell proliferation by antisense DNA to both alpha and beta forms of Fc epsilon R II.

PubMed

Bhatti, L; Behle, K; Stevens, R H

1992-10-01

Epstein-Barr Virus (EBV) infection activates B lymphocyte proliferation through partially understood mechanisms, resulting in phenotypic changes, including the appearance of new antigens. One such antigen is Fc epsilon R II/CD-23 which may be relevant for B cell proliferation. We have used anti-sense oligonucleotides to study the importance of the two forms of this molecule for proliferation in the EBV-transformed, Fc epsilon R II +ve lymphoblastoid B cell line, RPMI 8866. Anti-sense oligodeoxynucleotides were generated to the two forms of Fc epsilon R II; Fc epsilon R IIa (alpha) and IIb (beta) which differ only in their intracytoplasmic domains. Addition of increasing concentrations of anti-sense oligonucleotides, ranging from 1 to 30 microM, significantly decreased cellular proliferation as measured by the incorporation of [3H]thymidine (inhibition range 8-88%). Optimum inhibition of cellular proliferation was apparent at 15 microM concentration of both anti-sense Fc epsilon R IIa and IIb (Fc epsilon R IIa, mean +/- SE = 75 +/- 7% inhibition, p less than 0.001; Fc epsilon R IIb, mean +/- SE = 71 +/- 7% inhibition, p less than 0.001). Anti-sense oligonucleotides complementary to the common part of Fc epsilon R II resulted in a similar inhibition of proliferation. Sense oligonucleotides did not induce significant inhibition. Preincubation of sense and anti-sense oligonucleotides resulted in an abrogation of proliferation inhibition. Moreover, none of these oligonucleotides had any effect on a Fc epsilon R II -ve cell line. Incubation with both anti-sense IIa and IIb resulted in additive, but not synergistic inhibition of proliferation. Addition of soluble Fc epsilon R II did not reverse inhibition of proliferation, suggesting that membrane-bound or intracellular rather than soluble Fc epsilon R II was important for the induced proliferation. Analysis of cell surface expression for Fc epsilon II indicated that while there was a pronounced effect on cell number

Antisense Therapy in Neurology

PubMed Central

Lee, Joshua J.A.; Yokota, Toshifumi

2013-01-01

Antisense therapy is an approach to fighting diseases using short DNA-like molecules called antisense oligonucleotides. Recently, antisense therapy has emerged as an exciting and promising strategy for the treatment of various neurodegenerative and neuromuscular disorders. Previous and ongoing pre-clinical and clinical trials have provided encouraging early results. Spinal muscular atrophy (SMA), Huntington’s disease (HD), amyotrophic lateral sclerosis (ALS), Duchenne muscular dystrophy (DMD), Fukuyama congenital muscular dystrophy (FCMD), dysferlinopathy (including limb-girdle muscular dystrophy 2B; LGMD2B, Miyoshi myopathy; MM, and distal myopathy with anterior tibial onset; DMAT), and myotonic dystrophy (DM) are all reported to be promising targets for antisense therapy. This paper focuses on the current progress of antisense therapies in neurology. PMID:25562650

Pharmacology of Antisense Drugs.

PubMed

Bennett, C Frank; Baker, Brenda F; Pham, Nguyen; Swayze, Eric; Geary, Richard S

2017-01-06

Recent studies have led to a greater appreciation of the diverse roles RNAs play in maintaining normal cellular function and how they contribute to disease pathology, broadening the number of potential therapeutic targets. Antisense oligonucleotides are the most direct means to target RNA in a selective manner and have become an established platform technology for drug discovery. There are multiple molecular mechanisms by which antisense oligonucleotides can be used to modulate RNAs in cells, including promoting the degradation of the targeted RNA or modulating RNA function without degradation. Antisense drugs utilizing various antisense mechanisms are demonstrating therapeutic potential for the treatment of a broad variety of diseases. This review focuses on some of the advances that have taken place in translating antisense technology from the bench to the clinic.

Identification of sequence motifs significantly associated with antisense activity.

PubMed

McQuisten, Kyle A; Peek, Andrew S

2007-06-07

Silencing Complex (RISC) in RNAi. The independence of motif position and antisense activity also allows us to bypass consideration of this feature in the modelling process, promoting model efficiency and reducing the chance of overfitting when predicting antisense activity. The increase in SVR correlation with significant features compared to nearest-neighbour features indicates that thermodynamics alone is likely not the only factor in determining antisense efficiency.

Efficient encapsulation of antisense oligonucleotides in lipid vesicles using ionizable aminolipids: formation of novel small multilamellar vesicle structures.

PubMed

Semple, S C; Klimuk, S K; Harasym, T O; Dos Santos, N; Ansell, S M; Wong, K F; Maurer, N; Stark, H; Cullis, P R; Hope, M J; Scherrer, P

2001-02-09

Typical methods used for encapsulating antisense oligodeoxynucleotides (ODN) and plasmid DNA in lipid vesicles result in very low encapsulation efficiencies or employ cationic lipids that exhibit unfavorable pharmacokinetic and toxicity characteristics when administered intravenously. In this study, we describe and characterize a novel formulation process that utilizes an ionizable aminolipid (1,2-dioleoyl-3-dimethylammonium propane, DODAP) and an ethanol-containing buffer system for encapsulating large quantities (0.15--0.25 g ODN/g lipid) of polyanionic ODN in lipid vesicles. This process requires the presence of up to 40% ethanol (v/v) and initial formulation at acidic pH values where the DODAP is positively charged. In addition, the presence of a poly(ethylene glycol)-lipid was required during the formulation process to prevent aggregation. The 'stabilized antisense-lipid particles' (SALP) formed are stable on adjustment of the external pH to neutral pH values and the formulation process allows encapsulation efficiencies of up to 70%. ODN encapsulation was confirmed by nuclease protection assays and (31)P NMR measurements. Cryo-electron microscopy indicated that the final particles consisted of a mixed population of unilamellar and small multilamellar vesicles (80--140 nm diameter), the relative proportion of which was dependent on the initial ODN to lipid ratio. Finally, SALP exhibited significantly enhanced circulation lifetimes in mice relative to free antisense ODN, cationic lipid/ODN complexes and SALP prepared with quaternary aminolipids. Given the small particle sizes and improved encapsulation efficiency, ODN to lipid ratios, and circulation times of this formulation compared to others, we believe SALP represent a viable candidate for systemic applications involving nucleic acid therapeutics.

Effect of antisense oligonucleotides against cholesteryl ester transfer protein on the development of atherosclerosis in cholesterol-fed rabbits.

PubMed

Sugano, M; Makino, N; Sawada, S; Otsuka, S; Watanabe, M; Okamoto, H; Kamada, M; Mizushima, A

1998-02-27

Cholesteryl ester transfer protein (CETP) is the enzyme that facilitates the transfer of cholesteryl ester from high density lipoprotein (HDL) to apolipoprotein B (apoB)-containing lipoproteins. However, the exact role of CETP in the development of atherosclerosis has not been determined. In the present study, we examined the effect of the suppression of increased plasma CETP by intravenous injection with antisense oligodeoxynucleotides (ODNs) against CETP targeted to the liver on the development of atherosclerosis in rabbits fed a cholesterol diet. The ODNs against rabbit CETP were coupled to asialoglycoprotein (ASOR) carrier molecules, which serve as an important method to regulate liver gene expression. Twenty-two male Japanese White rabbits were used in the experiment. Eighteen animals were fed a standard rabbit chow supplemented with 0.3% cholesterol throughout the experiment for 16 weeks. At 8 weeks, they were divided into three groups (six animals in each group), among which the plasma total and HDL cholesterol concentrations did not significantly change. The control group received nothing, the sense group were injected with the sense ODNs complex, and the antisense group were injected with the antisense ODNs complex, respectively, for subsequent 8 weeks. ASOR. poly(L-lysine) ODNs complex were injected via the ear veins twice a week. Four animals were fed a standard rabbit diet for 16 weeks. The total cholesterol concentrations and the CETP mass in the animals injected with antisense ODNs were all significantly decreased in 12 and 16 weeks compared with those injected with sense ODNs and the control animals. The HDL cholesterol concentrations measured by the precipitation assay did not significantly change among the groups fed a cholesterol diet, and triglyceride concentrations did not significantly change in the four groups. However, at the end of the study, when the HDL cholesterol concentrations were measured after the isolation by ultracentrifugation and

2'-O-[2-[2-(N,N-Dimethylamino)ethoxy]ethyl] Modified Antisense Oligonucleotides: Symbiosis of Charge Interaction Factors and Stereoelectronic Effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prhavc, M.; Prakash, T.P.; Minasov, G.

Oligonucleotides with a novel, 2'-O-[2-[2-(N,N-dimethylamino)ethoxy]ethyl] (2'-O-DMAEOE) modification have been synthesized. This modification, a cationic analogue of the 2'-O-(2-methoxyethyl) (2'-O-MOE) modification, exhibits high binding affinity to target RNA (but not to DNA) and exceptional resistance to nuclease degradation. Analysis of the crystal structure of a self-complementary oligonucleotide containing a single 2'-O-DMAEOE modification explains the importance of charge factors and gauche effects on the observed antisense properties. 2'-O-DMAEOE modified oligonucleotides are ideal candidates for antisense drugs.

Disruption of Msx-1 and Msx-2 reveals roles for these genes in craniofacial, eye, and axial development.

PubMed

Foerst-Potts, L; Sadler, T W

1997-05-01

In mouse embryos, the muscle segment homeobox genes, Msx-1 and Msx-2 are expressed during critical stages of neural tube, neural crest, and craniofacial development, suggesting that these genes play important roles in organogenesis and cell differentiation. Although the patterns of expression are intriguing, little is known about the function of these genes in vertebrate embryonic development. Therefore, the expression of both genes, separately and together, was disrupted using antisense oligodeoxynucleotides and whole embryo culture techniques. Antisense attenuation of Msx-1 during early stages of neurulation produced hypoplasia of the maxillary, mandibular, and frontonasal prominences, eye anomalies, and somite and neural tube abnormalities. Eye defects consisted of enlarged optic vesicles, which may ultimately result in micropthalmia similar to that observed in Small eye mice homozygous for mutations in the Pax-6 gene. Histological sections and SEM analysis revealed a thinning of the neuroepithelium in the diencephalon and optic vesicle and mesenchymal deficiencies in the craniofacial region. Injections of Msx-2 antisense oligodeoxynucleotides produced similar malformations as those targeting Msx-1, with the exception that there was an increase in number and severity of neural tube and somite defects. Embryos injected with the combination of Msx-1 + Msx-2 antisense oligodeoxynucleotides showed no novel abnormalities, suggesting that the genes do not operate in a redundant manner.

Human Herpesvirus-8-Transformed Endothelial Cells Have Functionally Activated Vascular Endothelial Growth Factor/Vascular Endothelial Growth Factor Receptor

PubMed Central

Masood, Rizwan; Cesarman, Ethel; Smith, D. Lynne; Gill, Parkash S.; Flore, Ornella

2002-01-01

Kaposi’s sarcoma is a vascular tumor commonly associated with human immunodeficiency virus (HIV)-1 and human herpesvirus (HHV-8) also known as Kaposi’s sarcoma-associated herpesvirus. The principal features of this tumor are abnormal proliferation of vascular structures lined with spindle-shaped endothelial cells. HHV-8 may transform a subpopulation of endothelial cells in vitro via viral and cellular gene expression. We hypothesized that among the cellular genes, vascular endothelial growth factors (VEGFs) and their cognate receptors may be involved in viral-mediated transformation. We have shown that HHV-8-transformed endothelial cells (EC-HHV-8) express higher levels of VEGF, VEGF-C, VEGF-D, and PlGF in addition to VEGF receptors-1, -2, and -3. Furthermore, antibodies to VEGF receptor-2 inhibited cell proliferation and viability. Similarly, inhibition of VEGF gene expression with antisense oligonucleotides inhibited EC-HHV-8 cell proliferation/viability. The growth and viability of primary endothelial cells and a fibroblast cell line however were unaffected by either the VEGF receptor-2 antibody or the VEGF antisense oligodeoxynucleotides. VEGF and VEGF receptors are thus induced in EC-HHV-8 and participate in the transformation. Inhibitors of VEGF may thus modulate the disease process during development and progression. PMID:11786394

Antisense-based RNA therapy of factor V deficiency: in vitro and ex vivo rescue of a F5 deep-intronic splicing mutation.

PubMed

Nuzzo, Francesca; Radu, Claudia; Baralle, Marco; Spiezia, Luca; Hackeng, Tilman M; Simioni, Paolo; Castoldi, Elisabetta

2013-11-28

Antisense molecules are emerging as a powerful tool to correct splicing defects. Recently, we identified a homozygous deep-intronic mutation (F5 c.1296+268A>G) activating a cryptic donor splice site in a patient with severe coagulation factor V (FV) deficiency and life-threatening bleeding episodes. Here, we assessed the ability of 2 mutation-specific antisense molecules (a morpholino oligonucleotide [MO] and an engineered U7 small nuclear RNA [snRNA]) to correct this splicing defect. COS-1 and HepG2 cells transfected with a F5 minigene construct containing the patient's mutation expressed aberrant messenger RNA (mRNA) in excess of normal mRNA. Treatment with mutation-specific antisense MO (1-5 µM) or a construct expressing antisense U7snRNA (0.25-2 µg) dose-dependently increased the relative amount of correctly spliced mRNA by 1 to 2 orders of magnitude, whereas control MO and U7snRNA were ineffective. Patient-derived megakaryocytes obtained by differentiation of circulating progenitor cells did not express FV, but became positive for FV at immunofluorescence staining after administration of antisense MO or U7snRNA. However, treatment adversely affected cell viability, mainly because of the transfection reagents used to deliver the antisense molecules. Our data provide in vitro and ex vivo proof of principle for the efficacy of RNA therapy in severe FV deficiency, but additional cytotoxicity studies are warranted.

Targeting Cancer with Antisense Oligomers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hnatowich, DJ

With financial assistance from the Department of Energy, we have shown definitively that radiolabeled antisense DNAs and other oligomers will accumulate in target cancer cells in vitro and in vivo by an antisense mechanism. We have also shown that the number of mRNA targets for our antisense oligomers in the cancer cell types that we have investigated so far is sufficient to provide and antisense image and/or radiotherapy of cancer in mice. These studies have been reported in about 10 publications. However our observation over the past several years has shown that radiolabeled antisense oligomers administered intravenously in their nativemore » and naked form will accumulate and be retained in target xenografts by an antisense mechanism but will also accumulate at high levels in normal organs such as liver, spleen and kidneys. We have investigated unsuccessfully several commercially available vectors. Thus the use of radiolabeled antisense oligomers for the imaging of cancer must await novel approaches to delivery. This laboratory has therefore pursued two new paths, optical imaging of tumor and Auger radiotherapy. We are developing a novel method of optical imaging tumor using antisense oligomers with a fluorophore is administered while hybridized with a shorter complementary oligomer with an inhibitor. In culture and in tumored mice that the duplex remains intact and thus nonfluorescent until it encounters its target mRNA at which time it dissociates and the antisense oligomer binds along with its fluorophore to the target. Simultaneous with the above, we have also observed, as have others, that antisense oligomers migrate rapidly and quantitatively to the nucleus upon crossing cell membranes. The Auger electron radiotherapy path results from this observation since the nuclear migration properties could be used effectively to bring and to retain in the nucleus an Auger emitting radionuclide such as 111In or 125I bound to the antisense oligomer. Since the object

Antisense oligonucleotides as therapeutics for hyperlipidaemias.

PubMed

Crooke, Rosanne M

2005-07-01

Hyperlipidaemia, due to elevations of low-density lipoprotein cholesterol (LDL-C) or triglycerides (TGs), is recognised as a significant risk factor contributing to the development of coronary heart disease (CHD), the leading cause of morbidity and mortality in the Western world. Even though a variety of established antihyperlipidaemic agents are available, the majority of high-risk patients do not reach their lipid goals, indicating the need for new and more effective therapeutics to be used alone or as combination agents with existing drugs. Antisense oligonucleotides (ASOs), designed to specifically and selectively inhibit novel targets involved in cholesterol/TG homeostasis, represent a new class of agents that may prove beneficial for the treatment of hyperlipidaemias resulting from various genetic, metabolic or behavioural factors. This article describes the antisense technology platform, highlights the advantages of these novel drugs for the treatment of hyperlipidaemia and reviews the current research in this area.

Antithrombotic Effect of Antisense Factor XI Oligonucleotide Treatment in Primates

PubMed Central

Crosby, Jeffrey R.; Marzec, Ulla; Revenko, Alexey S.; Zhao, Chenguang; Gao, Dacao; Matafonov, Anton; Gailani, David; MacLeod, A. Robert; Tucker, Erik I.; Gruber, Andras; Hanson, Stephen R.; Monia, Brett P.

2013-01-01

Objective During coagulation, factor IX (FIX) is activated by two distinct mechanisms mediated by the active proteases of either factors VII (FVIIa) or XI (FXIa). Both coagulation factors may contribute to thrombosis; factor XI, however, plays only a limited role in the arrest of bleeding. Therefore, therapeutic targeting of FXI may produce an antithrombotic effect with relatively low hemostatic risk. Approach and Results We have reported that reducing FXI levels with FXI antisense oligonucleotides (ASOs) produces antithrombotic activity in mice, and that administration of FXI ASOs to primates decreases circulating FXI levels and activity in a dose- and time-dependent manner. Here we evaluated the relationship between FXI plasma levels and thrombogenicity in an established baboon model of thrombosis and hemostasis. In previous studies with this model, antibody-induced inhibition of FXI produced potent antithrombotic effects. In the present report, ASO-mediated reduction of FXI plasma levels by ≥50% resulted in a demonstrable and sustained antithrombotic effect without an increased risk of bleeding. Conclusion These results indicate that reducing FXI levels using ASOs is a promising alternative to direct FXI inhibition, and that targeting FXI may be potentially safer than conventional antithrombotic therapies that can markedly impair primary hemostasis. PMID:23559626

Anti-sense suppression of epidermal growth factor receptor expression alters cellular proliferation, cell-adhesion and tumorigenicity in ovarian cancer cells.

PubMed

Alper, O; De Santis, M L; Stromberg, K; Hacker, N F; Cho-Chung, Y S; Salomon, D S

2000-11-15

Over-expression of epidermal growth factor receptor (EGFR) in ovarian cancer has been well documented. Human NIH:OVCAR-8 ovarian carcinoma cells were transfected with an expression vector containing the anti-sense orientation of truncated human EGFR cDNA. EGFR anti-sense over-expression resulted in decreased EGFR protein and mRNA expression, cell proliferation and tumor formation in nude mice. In accordance with the reduced levels of EGFR in EGFR anti-sense-expressing cells, tyrosine phosphorylation of EGFR was decreased compared to untransfected parental cells treated with EGF. In EGFR anti-sense-transfected cells, expression of erbB-3, but not erbB-2, was increased. In addition, basal and heregulin-beta 1-stimulated tyrosine phosphorylation of erbB-3 was higher in EGFR anti-sense vector-transfected cells. A morphological alteration in EGFR anti-sense gene-expressing cells was correlated with a decrease in the expression of E-cadherin, alpha-catenin and, to a lesser extent, beta-catenin. Changes in the expression of these proteins were associated with a reduction in complex formation among E-cadherin, beta-catenin and alpha-catenin and between beta-catenin and EGFR in EGFR anti-sense-expressing cells compared to sense-transfected control cells. These results demonstrate that EGFR expression in ovarian carcinoma cells regulates expression of cell adhesion proteins that may enhance cell growth and invasiveness. Copyright 2000 Wiley-Liss, Inc.

A method to identify and characterize Z-DNA binding proteins using a linear oligodeoxynucleotide

NASA Technical Reports Server (NTRS)

Herbert, A. G.; Rich, A.

1993-01-01

An oligodeoxynucleotide that readily flips to the Z-DNA conformation in 10mM MgCl2 was produced by using Klenow enzyme to incorporate 5-bromodeoxycytosine and deoxyguanosine into a (dC-dG)22 template. During synthesis the oligomer can be labeled with 32P to high specific activity. The labeled oligodeoxynucleotide can be used in bandshift experiment to detect proteins that bind Z-DNA. This allows the binding specificity of such proteins to be determined with high reliability using unlabeled linear and supercoiled DNA competitors. In addition, because the radioactive oligodeoxynucleotide contains bromine atoms, DNA-protein complexes can be readily crosslinked using UV light. This allows an estimate to be made of the molecular weight of the proteins that bind to the radioactive probe. Both techniques are demonstrated using a goat polyclonal anti-Z-DNA antiserum.

In vivo evaluation of the effects of simultaneous inhibition of GLUT-1 and HIF-1α by antisense oligodeoxynucleotides on the radiosensitivity of laryngeal carcinoma using micro 18F-FDG PET/CT

PubMed Central

Shen, Li-Fang; Zhao, Xin; Zhou, Shui-Hong; Lu, Zhong-Jie; Zhao, Kui; Fan, Jun; Zhou, Min-Li

2017-01-01

Purpose Hypoxia-inducible factor 1α (HIF-1α) and glucose transporter-1 (GLUT-1) are two important hypoxic markers associated with the radioresistance of cancers including laryngeal carcinoma. We evaluated whether the simultaneous inhibition of GLUT-1 and HIF-1α expression improved the radiosensitivity of laryngeal carcinoma. We explored whether the expression of HIF-1α and GLUT-1 was correlated with 2′-deoxy-2’-[18F]fluoro-D-glucose (18F-FDG) uptake and whether 18F-FDG positron emission tomography-computed tomography (PET/CT) was appropriate for early evaluation of the response of laryngeal carcinoma to targeted treatment in vivo. Materials and Methods To verify the above hypotheses, an in vivo model was applied by subcutaneously injecting Hep-2 (2 × 107/mL × 0.2 mL) and Tu212 cells (2 × 107/mL × 0.2 mL) into nude mice. The effects of HIF-1α antisense oligodeoxynucleotides (AS-ODNs) (100 μg) and GLUT-1 AS-ODNs (100 μg) on the radiosensitivity of laryngeal carcinoma were assessed by tumor volume and weight, microvessel density (MVD), apoptosis index (AI) and necrosis in vivo based on a full factorial (23) design. 18F-FDG-PET/CT was taken before and after the treatment of xenografts. The relationships between HIF-1α and GLUT-1 expression and 18F-FDG uptake in xenografts were estimated and the value of 18F-FDG-PET/CT was assessed after treating the xenografts. Results 10 Gy X-ray irradiation decreased the weight of Hep-2 xenografts 8 and 12 days after treatment, and the weights of Tu212 xenografts 8 days after treatment. GLUT-1 AS-ODNs decreased the weight of Tu212 xenografts 12 days after treatment. There was a synergistic interaction among the three treatments (GLUT-1 AS-ODNs, HIF-1α AS-ODNs and 10Gy X-ray irradiation) in increasing apoptosis, decreasing MVD, and increasing necrosis in Hep-2 xenografts 8 days after treatment (p < 0.05) and in Tu212 xenografts 12 days after treatment (p < 0.001). Standardized uptake value (tumor/normal tissue

In vivo evaluation of the effects of simultaneous inhibition of GLUT-1 and HIF-1α by antisense oligodeoxynucleotides on the radiosensitivity of laryngeal carcinoma using micro 18F-FDG PET/CT.

PubMed

Shen, Li-Fang; Zhao, Xin; Zhou, Shui-Hong; Lu, Zhong-Jie; Zhao, Kui; Fan, Jun; Zhou, Min-Li

2017-05-23

Hypoxia-inducible factor 1α (HIF-1α) and glucose transporter-1 (GLUT-1) are two important hypoxic markers associated with the radioresistance of cancers including laryngeal carcinoma. We evaluated whether the simultaneous inhibition of GLUT-1 and HIF-1α expression improved the radiosensitivity of laryngeal carcinoma. We explored whether the expression of HIF-1α and GLUT-1 was correlated with 2'-deoxy-2'-[18F]fluoro-D-glucose (18F-FDG) uptake and whether 18F-FDG positron emission tomography-computed tomography (PET/CT) was appropriate for early evaluation of the response of laryngeal carcinoma to targeted treatment in vivo. To verify the above hypotheses, an in vivo model was applied by subcutaneously injecting Hep-2 (2 × 107/mL × 0.2 mL) and Tu212 cells (2 × 107/mL × 0.2 mL) into nude mice. The effects of HIF-1α antisense oligodeoxynucleotides (AS-ODNs) (100 μg) and GLUT-1 AS-ODNs (100 μg) on the radiosensitivity of laryngeal carcinoma were assessed by tumor volume and weight, microvessel density (MVD), apoptosis index (AI) and necrosis in vivo based on a full factorial (23) design. 18F-FDG-PET/CT was taken before and after the treatment of xenografts. The relationships between HIF-1α and GLUT-1 expression and 18F-FDG uptake in xenografts were estimated and the value of 18F-FDG-PET/CT was assessed after treating the xenografts. 10 Gy X-ray irradiation decreased the weight of Hep-2 xenografts 8 and 12 days after treatment, and the weights of Tu212 xenografts 8 days after treatment. GLUT-1 AS-ODNs decreased the weight of Tu212 xenografts 12 days after treatment. There was a synergistic interaction among the three treatments (GLUT-1 AS-ODNs, HIF-1α AS-ODNs and 10Gy X-ray irradiation) in increasing apoptosis, decreasing MVD, and increasing necrosis in Hep-2 xenografts 8 days after treatment (p < 0.05) and in Tu212 xenografts 12 days after treatment (p < 0.001). Standardized uptake value (tumor/normal tissue)( SUVmaxT/N) did not show a statistically

Antisense technology: an emerging platform for cardiovascular disease therapeutics.

PubMed

Lee, Richard G; Crosby, Jeff; Baker, Brenda F; Graham, Mark J; Crooke, Rosanne M

2013-12-01

Antisense oligonucleotides and small interfering RNAs, which suppress the translation of specific mRNA target proteins, are emerging as important therapeutic modalities for the treatment of cardiovascular disease. Over the last 25 years, the advances in all aspects of antisense technology, as well as a detailed understanding of the mechanism of action of antisense drugs, have enabled their use as therapeutic agents. These advancements culminated in the FDA approval of the first chronically administered cardiovascular antisense therapeutic, mipomersen, which targets hepatic apolipoprotein B mRNA. This review provides a brief history of antisense technology, highlights the progression of mipomersen from preclinical studies to multiple Phase III registration trials, and gives an update on the status of other cardiovascular antisense therapeutics currently in the clinic.

Factor XI Antisense Oligonucleotide for Prevention of Venous Thrombosis

PubMed Central

Büller, Harry R.; Bethune, Claudette; Bhanot, Sanjay; Gailani, David; Monia, Brett P.; Raskob, Gary E.; Segers, Annelise; Verhamme, Peter; Weitz, Jeffrey I.

2015-01-01

BACKGROUND Experimental data indicate that reducing factor XI levels attenuates thrombosis without causing bleeding, but the role of factor XI in the prevention of postoperative venous thrombosis in humans is unknown. FXI-ASO (ISIS 416858) is a second-generation antisense oligonucleotide that specifically reduces factor XI levels. We compared the efficacy and safety of FXI-ASO with those of enoxaparin in patients undergoing total knee arthroplasty. METHODS In this open-label, parallel-group study, we randomly assigned 300 patients who were undergoing elective primary unilateral total knee arthroplasty to receive one of two doses of FXI-ASO (200 mg or 300 mg) or 40 mg of enoxaparin once daily. The primary efficacy outcome was the incidence of venous thromboembolism (assessed by mandatory bilateral venography or report of symptomatic events). The principal safety outcome was major or clinically relevant nonmajor bleeding. RESULTS Around the time of surgery, the mean (±SE) factor XI levels were 0.38±0.01 units per milliliter in the 200-mg FXI-ASO group, 0.20±0.01 units per milliliter in the 300-mg FXI-ASO group, and 0.93±0.02 units per milliliter in the enoxaparin group. The primary efficacy outcome occurred in 36 of 134 patients (27%) who received the 200-mg dose of FXI-ASO and in 3 of 71 patients (4%) who received the 300-mg dose of FXI-ASO, as compared with 21 of 69 patients (30%) who received enoxaparin. The 200-mg regimen was noninferior, and the 300-mg regimen was superior, to enoxaparin (P<0.001). Bleeding occurred in 3%, 3%, and 8% of the patients in the three study groups, respectively. CONCLUSIONS This study showed that factor XI contributes to postoperative venous thromboembolism; reducing factor XI levels in patients undergoing elective primary unilateral total knee arthroplasty was an effective method for its prevention and appeared to be safe with respect to the risk of bleeding. (Funded by Isis Pharmaceuticals; FXI-ASO TKA ClinicalTrials.gov number

Oligodeoxynucleotides as Anti-Cancer Therapeutics and Diagnostics | NCI Technology Transfer Center | TTC

Cancer.gov

The National Cancer Institute Laboratory of Experimental Immunology is seeking statements of capability or interest from parties interested in licensing or collaborative research to further develop, evaluate, or commercialize anti-cancer oligodeoxynucleotides.  

Activation of human B cells by phosphorothioate oligodeoxynucleotides.

PubMed Central

Liang, H; Nishioka, Y; Reich, C F; Pisetsky, D S; Lipsky, P E

1996-01-01

To investigate the potential of DNA to elicit immune responses in man, we examined the capacity of a variety of oligodeoxynucleotides (ODNs) to stimulate highly purified T cell-depleted human peripheral blood B cells. Among 47 ODNs of various sequences tested, 12 phosphorothioate oligodeoxynucleotides (sODNs) induced marked B cell proliferation and Ig production. IL-2 augmented both proliferation and production of IgM, IgG, and IgA, as well as IgM anti-DNA antibodies, but was not necessary for B cell stimulation. Similarly, T cells enhanced stimulation, but were not necessary for B cell activation. After stimulation with the active sODNs, more than 95% of B cells expressed CD25 and CD86. In addition, B cells stimulated with sODNs expressed all six of the major immunoglobulin VH gene families. These results indicate that the human B cell response to sODN is polyclonal. Active sODN coupled to Sepharose beads stimulated B cells as effectively as the free sODN, suggesting that stimulation resulted from engagement of surface receptors. These data indicate that sODNs can directly induce polyclonal activation of human B cells in a T cell-independent manner by engaging as yet unknown B cell surface receptors. PMID:8787674

Natural Antisense Transcripts: Molecular Mechanisms and Implications in Breast Cancers.

PubMed

Latgé, Guillaume; Poulet, Christophe; Bours, Vincent; Josse, Claire; Jerusalem, Guy

2018-01-02

Natural antisense transcripts are RNA sequences that can be transcribed from both DNA strands at the same locus but in the opposite direction from the gene transcript. Because strand-specific high-throughput sequencing of the antisense transcriptome has only been available for less than a decade, many natural antisense transcripts were first described as long non-coding RNAs. Although the precise biological roles of natural antisense transcripts are not known yet, an increasing number of studies report their implication in gene expression regulation. Their expression levels are altered in many physiological and pathological conditions, including breast cancers. Among the potential clinical utilities of the natural antisense transcripts, the non-coding|coding transcript pairs are of high interest for treatment. Indeed, these pairs can be targeted by antisense oligonucleotides to specifically tune the expression of the coding-gene. Here, we describe the current knowledge about natural antisense transcripts, their varying molecular mechanisms as gene expression regulators, and their potential as prognostic or predictive biomarkers in breast cancers.

Intravesical NGF Antisense Therapy Using Lipid Nanoparticle for Interstitial Cystitis

DTIC Science & Technology

2016-12-01

bladder symptoms including urinary frequency and urgency. Previous studies have indicated that overexpression of nerve growth factor (NGF) is an... studies indicate overexpression of nerve growth factor (NGF) as a key factor in the symptom development of IC/BPS. NGF antisense oligonucleotides hold...Stability Testing  Ex -vivo stress testing II-2. Research Accomplishment Description AIM 1 Regulatory approval for animal research ; Obtain

Antisense Transcription Is Pervasive but Rarely Conserved in Enteric Bacteria

PubMed Central

Raghavan, Rahul; Sloan, Daniel B.; Ochman, Howard

2012-01-01

ABSTRACT Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell’s transcription machinery. PMID:22872780

Natural Antisense Transcripts: Molecular Mechanisms and Implications in Breast Cancers

PubMed Central

Latgé, Guillaume; Poulet, Christophe; Bours, Vincent; Jerusalem, Guy

2018-01-01

Natural antisense transcripts are RNA sequences that can be transcribed from both DNA strands at the same locus but in the opposite direction from the gene transcript. Because strand-specific high-throughput sequencing of the antisense transcriptome has only been available for less than a decade, many natural antisense transcripts were first described as long non-coding RNAs. Although the precise biological roles of natural antisense transcripts are not known yet, an increasing number of studies report their implication in gene expression regulation. Their expression levels are altered in many physiological and pathological conditions, including breast cancers. Among the potential clinical utilities of the natural antisense transcripts, the non-coding|coding transcript pairs are of high interest for treatment. Indeed, these pairs can be targeted by antisense oligonucleotides to specifically tune the expression of the coding-gene. Here, we describe the current knowledge about natural antisense transcripts, their varying molecular mechanisms as gene expression regulators, and their potential as prognostic or predictive biomarkers in breast cancers. PMID:29301303

Modulation of lipoprotein metabolism by antisense technology: preclinical drug discovery methodology.

PubMed

Crooke, Rosanne M; Graham, Mark J

2013-01-01

Antisense oligonucleotides (ASOs) are a new class of specific therapeutic agents that alter the intermediary metabolism of mRNA, resulting in the suppression of disease-associated gene products. ASOs exert their pharmacological effects after hybridizing, via Watson-Crick base pairing, to a specific target RNA. If appropriately designed, this event results in the recruitment of RNase H, the degradation of targeted mRNA or pre-mRNA, and subsequent inhibition of the synthesis of a specific protein. A key advantage of the technology is the ability to selectively inhibit targets that cannot be modulated by traditional therapeutics such as structural proteins, transcription factors, and, of topical interest, lipoproteins. In this chapter, we will first provide an overview of antisense technology, then more specifically describe the status of lipoprotein-related genes that have been studied using the antisense platform, and finally, outline the general methodology required to design and evaluate the in vitro and in vivo efficacy of those drugs.

Human Immunodeficiency Virus-Type 1 LTR DNA contains an intrinsic gene producing antisense RNA and protein products

PubMed Central

Ludwig, Linda B; Ambrus, Julian L; Krawczyk, Kristie A; Sharma, Sanjay; Brooks, Stephen; Hsiao, Chiu-Bin; Schwartz, Stanley A

2006-01-01

Background While viruses have long been shown to capitalize on their limited genomic size by utilizing both strands of DNA or complementary DNA/RNA intermediates to code for viral proteins, it has been assumed that human retroviruses have all their major proteins translated only from the plus or sense strand of RNA, despite their requirement for a dsDNA proviral intermediate. Several studies, however, have suggested the presence of antisense transcription for both HIV-1 and HTLV-1. More recently an antisense transcript responsible for the HTLV-1 bZIP factor (HBZ) protein has been described. In this study we investigated the possibility of an antisense gene contained within the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR). Results Inspection of published sequences revealed a potential transcription initiator element (INR) situated downstream of, and in reverse orientation to, the usual HIV-1 promoter and transcription start site. This antisense initiator (HIVaINR) suggested the possibility of an antisense gene responsible for RNA and protein production. We show that antisense transcripts are generated, in vitro and in vivo, originating from the TAR DNA of the HIV-1 LTR. To test the possibility that protein(s) could be translated from this novel HIV-1 antisense RNA, recombinant HIV antisense gene-FLAG vectors were designed. Recombinant protein(s) were produced and isolated utilizing carboxy-terminal FLAG epitope (DYKDDDDK) sequences. In addition, affinity-purified antisera to an internal peptide derived from the HIV antisense protein (HAP) sequences identified HAPs from HIV+ human peripheral blood lymphocytes. Conclusion HIV-1 contains an antisense gene in the U3-R regions of the LTR responsible for both an antisense RNA transcript and proteins. This antisense transcript has tremendous potential for intrinsic RNA regulation because of its overlap with the beginning of all HIV-1 sense RNA transcripts by 25 nucleotides. The novel HAPs are

[Effects of HOXB2 antisense oligodeoxynucleotides on the biological properties of primary human umbilical vein endothelial cells].

PubMed

Zhang, Xiaoqi; Liu, Xusheng

2002-07-01

To explore the effects of HOXB2 antisense oligodeoxynuc leotides (Asodn) on the biological properties of primary human umbilical vein endothelial cells (ECs). Fluorescent labelled Asodn was transfected into the endothelial cells of human unbilical vein mediated liposome and its distribution within endothelia was observed. (3)H-TdR incorporation test was employed to determine its effects on the DNA synthesis. Flow cytometry was applied to determine the change of the cell cycle. In the same time, RT-PCR was adopted to study the influence of Asodn on the expression of target genes. Fifteen minutes after the transfection, weak nucleic staining was observed. The fluorescent staining was the strongest 4 approximately 8 hours after the transfection and began to weaken in 16 hours. The proportion of cells in G1/0 phase in Asodn group was 53.4 +/- 3.1, significantly higher than that in control group (35.8 +/- 7.3, P < 0.01), and the proportion of cells in S phase in Asodn group was 42.2 +/- 3.5, significantly lower than that in control group (60.8 +/- 6.2, P < 0.01). The expression of HOXB2 mRNA was remarkably decreased during 24 to 48 hours. HOXB2 Asodn exerts inhibitory effects on EC proliferation dose-dependently, delays the conversion of G1 phase to S Phase, and inhibits the expression of HOXB2 mRNA. HOXB2 gene plays an important role in proliferation of endothelial cells and the mechanism is related to cell cycle.

Antisense Oligodeoxynucleotide Inhibition of HIV Gene Expression

DTIC Science & Technology

1989-03-20

synthesis using trimethoxybenzyl side chain protection for Gln, the highly efficient benzotriazolyloxy tris(dimethylamino) phosphonium hexafluorophosphate ...0 - P - 0 -0 - O - - OH + Li OLi OLi OLi R 0 Fig. 11. Fai.t atom bombardment ma.ss spectroscopy of the lithium salt of 5’-trityl-CUAA, sputtered from

Involvement of basic fibroblast growth factor in suramin-induced inhibition of V79/AP4 fibroblast cell proliferation.

PubMed Central

Bernardini, N.; Giannessi, F.; Bianchi, F.; Dolfi, A.; Lupetti, M.; Citti, L.; Danesi, R.; Del Tacca, M.

1993-01-01

The V79/AP4 Chinese hamster fibroblasts were densely stained with the anti-basic fibroblast growth factor (bFGF) antibody demonstrating an endogenous production of the peptide. The in vitro proliferation of these cells was stimulated by exogenous bFGF and the maximum growth (259% increase in 3H-thymidine incorporation into DNA) was reached with bFGF 10 ng ml-1. Inhibition of bFGF-mediated mitogenic pathway was obtained with a 15-mer antisense oligodeoxynucleotide targeted against bFGF mRNA and with suramin, a drug which blocks the biological activity of heparin-binding growth factors. bFGF antisense oligomer reduced the synthesis of DNA by 79.5 and 89.5% at 20 and 60 microM, respectively; this effect was reversed by the addition of exogenous bFGF to the culture medium. A short-term exposure to suramin 300 micrograms ml-1 produced a modest reduction in 3H-thymidine incorporation but suppressed the mitogenic effect of bFGF on V79/AP4 cells. In cells treated with suramin 300 micrograms ml-1 the drug concentration increased linearly over 3 days, reaching 13.15 micrograms mg-1 of protein; cell proliferation was inhibited in a dose-related manner as evaluated by the colony formation assay (IC50: 344.22 micrograms ml-1) and by the number of mitoses observed in culture. Furthermore, the drug induced ultrastructural alterations, consisting of perinuclear cisternae swelling, chromatin condensation, nucleolar segregation and cytoplasmic vacuolations. These findings demonstrated that the endogenous production of bFGF plays an important role in V79/AP4 fibroblasts proliferation, and the inhibition of bFGF-mediated mitogenic signalling with bFGF antisense oligomer or suramin is an effective mean of reducing cell growth. Images Figure 1 Figure 5 Figure 6 PMID:7685616

HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period

PubMed Central

2012-01-01

Background Recent evidence proposes a novel concept that mammalian natural antisense RNAs play important roles in cellular homeostasis by regulating the expression of several genes. Identification and characterization of retroviral antisense RNA would provide new insights into mechanisms of replication and pathogenesis. HIV-1 encoded-antisense RNAs have been reported, although their structures and functions remain to be studied. We have tried to identify and characterize antisense RNAs of HIV-1 and their function in viral infection. Results Characterization of transcripts of HEK293T cells that were transiently transfected with an expression plasmid with HIV-1NL4–3 DNA in the antisense orientation showed that various antisense transcripts can be expressed. By screening and characterizing antisense RNAs in HIV-1NL4–3-infected cells, we defined the primary structure of a major form of HIV-1 antisense RNAs, which corresponds to a variant of previously reported ASP mRNA. This 2.6 kb RNA was transcribed from the U3 region of the 3′ LTR and terminated at the env region in acutely or chronically infected cell lines and acutely infected human peripheral blood mononuclear cells. Reporter assays clearly demonstrated that the HIV-1 LTR harbours promoter activity in the reverse orientation. Mutation analyses suggested the involvement of NF-κΒ binding sites in the regulation of antisense transcription. The antisense RNA was localized in the nuclei of the infected cells. The expression of this antisense RNA suppressed HIV-1 replication for more than one month. Furthermore, the specific knockdown of this antisense RNA enhanced HIV-1 gene expression and replication. Conclusions The results of the present study identified an accurate structure of the major form of antisense RNAs expressed from the HIV-1NL4–3 provirus and demonstrated its nuclear localization. Functional studies collectively demonstrated a new role of the antisense RNA in viral replication. Thus, we suggest

A simple method for N-15 labelling of exocyclic amino groups in synthetic oligodeoxynucleotides

PubMed Central

Acedo, Montse; Fàbrega, Carme; Aviño, Anna; Goodman, Myron; Fagan, Patricia; Wemmer, David; Eritja, Ramon

1994-01-01

The use of the ammonia deprotection step to introduce 15N labels at specific exocyclic amino positions of adenine, cytosine, guanine or 2-aminopurine of oligodeoxynucleotides is described. PMID:8065910

Voltage-gated calcium channel and antisense oligonucleotides thereto

NASA Technical Reports Server (NTRS)

Friedman, Peter A. (Inventor); Duncan, Randall L. (Inventor); Hruska, Keith A. (Inventor); Barry, Elizabeth L. R. (Inventor)

1998-01-01

An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

Antisense oligonucleotide inhibition of apolipoprotein C-III reduces plasma triglycerides in rodents, nonhuman primates, and humans.

PubMed

Graham, Mark J; Lee, Richard G; Bell, Thomas A; Fu, Wuxia; Mullick, Adam E; Alexander, Veronica J; Singleton, Walter; Viney, Nick; Geary, Richard; Su, John; Baker, Brenda F; Burkey, Jennifer; Crooke, Stanley T; Crooke, Rosanne M

2013-05-24

Elevated plasma triglyceride levels have been recognized as a risk factor for the development of coronary heart disease. Apolipoprotein C-III (apoC-III) represents both an independent risk factor and a key regulatory factor of plasma triglyceride concentrations. Furthermore, elevated apoC-III levels have been associated with metabolic syndrome and type 2 diabetes mellitus. To date, no selective apoC-III therapeutic agent has been evaluated in the clinic. To test the hypothesis that selective inhibition of apoC-III with antisense drugs in preclinical models and in healthy volunteers would reduce plasma apoC-III and triglyceride levels. Rodent- and human-specific second-generation antisense oligonucleotides were identified and evaluated in preclinical models, including rats, mice, human apoC-III transgenic mice, and nonhuman primates. We demonstrated the selective reduction of both apoC-III and triglyceride in all preclinical pharmacological evaluations. We also showed that inhibition of apoC-III was well tolerated and not associated with increased liver triglyceride deposition or hepatotoxicity. A double-blind, placebo-controlled, phase I clinical study was performed in healthy subjects. Administration of the human apoC-III antisense drug resulted in dose-dependent reductions in plasma apoC-III, concomitant lowering of triglyceride levels, and produced no clinically meaningful signals in the safety evaluations. Antisense inhibition of apoC-III in preclinical models and in a phase I clinical trial with healthy subjects produced potent, selective reductions in plasma apoC-III and triglyceride, 2 known risk factors for cardiovascular disease. This compelling pharmacological profile supports further clinical investigations in hypertriglyceridemic subjects.

Evidence from immunoneutralization and antisense studies that the inhibitory actions of glucocorticoids on growth hormone release in vitro require annexin 1 (lipocortin 1)

PubMed Central

Taylor, A D; Christian, H C; Morris, J F; Flower, R J; Buckingham, J C

2000-01-01

Our previous studies have identified a role for annexin 1 as a mediator of glucocorticoid action in the neuroendocrine system. The present study centred on growth hormone (GH) and exploited antisense and immunoneutralization strategies to examine in vitro the potential role of annexin 1 in effecting the regulatory actions of glucocorticoids on the secretion of this pituitary hormone. Rat anterior pituitary tissue responded in vitro to growth hormone releasing hormone, forskolin, 8-Bromo-cyclic adenosine 3′5′-monophosphate (8-Br-cyclic AMP) and an L-Ca2+ channel opener (BAY K8644) with concentration-dependent increases GH release which were readily inhibited by corticosterone and dexamethasone. The inhibitory actions of the steroids on GH release elicited by the above secretagogues were effectively reversed by an annexin 1 antisense oligodeoxynucleotide (ODN), but not by control (sense or scrambled) ODNs, as also were the glucocorticoid-induced increases in annexin 1. Similarly, a specific anti-annexin 1 monoclonal antibody quenched the corticosterone-induced suppression of secretagogue-evoked GH release while an isotype matched control antibody was without effect. Transmission electron micrographs showed that the integrity and ultrastructural morphology of the pituitary cells were well preserved at the end of the incubation and unaffected by exposure to the ODNs, antibodies, steroids or secretagogues. The results provide novel evidence for a role for annexin 1 as a mediator of the inhibitory actions of glucocorticoids on the secretion of GH by the anterior pituitary gland and suggest that its actions are effected at a point distal to the formation of cyclic AMP and Ca2+ entry. PMID:11090102

Evidence from immunoneutralization and antisense studies that the inhibitory actions of glucocorticoids on growth hormone release in vitro require annexin 1 (lipocortin 1).

PubMed

Taylor, A D; Christian, H C; Morris, J F; Flower, R J; Buckingham, J C

2000-12-01

1. Our previous studies have identified a role for annexin 1 as a mediator of glucocorticoid action in the neuroendocrine system. The present study centred on growth hormone (GH) and exploited antisense and immunoneutralization strategies to examine in vitro the potential role of annexin 1 in effecting the regulatory actions of glucocorticoids on the secretion of this pituitary hormone. 2. Rat anterior pituitary tissue responded in vitro to growth hormone releasing hormone, forskolin, 8-Bromo-cyclic adenosine 3'5'-monophosphate (8-Br-cyclic AMP) and an L-Ca(2+) channel opener (BAY K8644) with concentration-dependent increases GH release which were readily inhibited by corticosterone and dexamethasone. 3. The inhibitory actions of the steroids on GH release elicited by the above secretagogues were effectively reversed by an annexin 1 antisense oligodeoxynucleotide (ODN), but not by control (sense or scrambled) ODNs, as also were the glucocorticoid-induced increases in annexin 1. Similarly, a specific anti-annexin 1 monoclonal antibody quenched the corticosterone-induced suppression of secretagogue-evoked GH release while an isotype matched control antibody was without effect. 4. Transmission electron micrographs showed that the integrity and ultrastructural morphology of the pituitary cells were well preserved at the end of the incubation and unaffected by exposure to the ODNs, antibodies, steroids or secretagogues. 5. The results provide novel evidence for a role for annexin 1 as a mediator of the inhibitory actions of glucocorticoids on the secretion of GH by the anterior pituitary gland and suggest that its actions are effected at a point distal to the formation of cyclic AMP and Ca(2+) entry.

Antisense transcription is pervasive but rarely conserved in enteric bacteria.

PubMed

Raghavan, Rahul; Sloan, Daniel B; Ochman, Howard

2012-01-01

Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell's transcription machinery. IMPORTANCE Application of high-throughput methods has revealed the expression throughout bacterial genomes of transcripts encoded on the strand complementary to protein-coding genes. Because transcription is costly, it is usually assumed that these transcripts, termed antisense RNAs (asRNAs), serve some function; however, the role of most asRNAs is unclear, raising questions about their relevance in cellular processes. Because natural selection conserves functional elements, comparisons between related species provide a method for assessing

Reciprocal repression between microRNA-133 and calcineurin regulates cardiac hypertrophy: a novel mechanism for progressive cardiac hypertrophy.

PubMed

Dong, De-Li; Chen, Chang; Huo, Rong; Wang, Ning; Li, Zhe; Tu, Yu-Jie; Hu, Jun-Tao; Chu, Xia; Huang, Wei; Yang, Bao-Feng

2010-04-01

Cardiac hypertrophy involves a remodeling process of the heart in response to diverse pathological stimuli. Both calcineurin/nuclear factor of activated T cells pathway and microRNA-133 (miR-133) have been shown to play a critical role in cardiac hypertrophy. It has been recognized that the expression and activity of calcineurin increases and miR-133 expression decreases in the hypertrophic heart, and inhibition of calcineurin or increase of miR-133 expression protects against cardiac hypertrophy. Here we tested the interaction between miR-133 and calcineurin in cardiac hypertrophy. Cardiac hypertrophy in vivo and in vitro was induced by transverse aortic constriction and phenylephrine treatment. mRNA levels were measured by using real-time PCR methods. Luciferase assays showed that transfection of miR-133 in HEK293 cells downregulated calcineurin expression, which was reversed by cotransfection with the miR-133-specific 2'-O-methyl antisense inhibitory oligoribonucleotides. These results were confirmed in cultured primary cardiomyocytes. miR-133 expression was downregulated, and calcineurin activity was enhanced in both in vivo and in vitro cardiac hypertrophy models. Treatment of cells and animals with cyclosporin A, an inhibitor of calcineurin, prevented miR-133 downregulation. Moreover, the antisense oligodeoxynucleotides against the catalytic subunits of calcineurin Abeta and the decoy oligodeoxynucleotides targeting nuclear factor of activated T cells transcription factor, a calcineurin downstream effector, increased miR-133 expression in cultured primary cardiomyocytes. Our data show that reciprocal repression between miR-133 and calcineurin regulates cardiac hypertrophy.

Attenuation of alpha2A-adrenergic receptor expression in neonatal rat brain by RNA interference or antisense oligonucleotide reduced anxiety in adulthood.

PubMed

Shishkina, G T; Kalinina, T S; Dygalo, N N

2004-01-01

Brain alpha2-adrenergic receptors (alpha2-ARs) have been implicated in the regulation of anxiety, which is associated with stress. Environmental treatments during neonatal development could modulate the level of brain alpha2-AR expression and alter anxiety in adults, suggesting possible involvement of these receptors in early-life programming of anxiety state. The present study was undertaken to determine whether the reduction of the expression of A subtype of these receptors most abundant in the neonatal brain affects anxiety-related behavior in adulthood. We attenuated the expression of alpha2A-ARs during neonatal life by two different sequence specific approaches, antisense technology and RNA interference. Treatment of rats with the antisense oligodeoxynucleotide or short interfering RNA (siRNA) against alpha2A-ARs on the days 2-4 of their life, produced a marked acute decrease in the levels of both alpha2A-AR mRNA and [3H]RX821002 binding sites in the brainstem into which drugs were injected. The decrease of alpha2A-AR expression in the neonatal brainstem influenced the development of this receptor system in the brain regions as evidenced by the increased number of [3H]RX821002 binding sites in the hypothalamus of adult animals with both neonatal alpha2A-AR knockdown treatments; also in the frontal cortex of antisense-treated, and in the hippocampus of siRNA-treated adult rats. These adult animals also demonstrated a decreased anxiety in the elevated plus-maze as evidenced by an increased number of the open arm entries, greater proportion of time spent in the open arms, and more than a two-fold increase in the number of exploratory head dips. The results provide the first evidence that the reduction in the brain expression of a gene encoding for alpha2A-AR during neonatal life led to the long-term neurochemical and behavioral alterations. The data suggests that alterations in the expression of the receptor-specific gene during critical periods of brain

Upping the Antisense Ante.

ERIC Educational Resources Information Center

Weiss, Rick

1991-01-01

Discussed is a designer-drug technology called antisense which blocks messenger RNA's ability to carry information to protein producing sites in the cell. The applications of this drug to AIDS research, cancer therapy, and other diseases are discussed. (KR)

Synthetic Oligodeoxynucleotides (ODN) Containing Suppressive TTAGGG Motifs Inhibit AIM2 Inflammasome Activation

PubMed Central

Kaminski, John J.; Schattgen, Stefan A.; Tzeng, Te-Chen; Bode, Christian; Klinman, Dennis M.; Fitzgerald, Katherine A.

2013-01-01

Synthetic oligodeoxynucleotides comprised of the immunosuppressive motif TTAGGG block TLR9 signaling, prevent STAT1 and STAT4 phosphorylation and attenuate a variety of inflammatory responses in vivo. Here, we demonstrate that such suppressive oligodeoxynucleotides (sup ODN) abrogate activation of cytosolic nucleic acid sensing pathways. Pretreatment of dendritic cells and macrophages with the suppressive ODN-A151 abrogated type I IFN, TNFα and ISG induction in response to cytosolic dsDNA. In addition, A151 abrogated caspase-1-dependent IL-1β and IL-18 maturation in dendritic cells stimulated with dsDNA and murine cytomegalovirus (MCMV). Inhibition was dependent on A151’s phosphorothioate backbone while substitution of the guanosine residues for adenosine negatively affected potency. A151 mediates these effects by binding to AIM2 in a manner that is competitive with immune-stimulatory DNA and as a consequence prevents AIM2 inflammasome complex formation. Collectively, these findings reveal a new route by which suppressive ODNs modulate the immune system and unveil novel applications for suppressive ODNs in the treatment of infectious and autoimmune diseases. PMID:23986531

Trigeminal nerve injury-induced thrombospondin-4 up-regulation contributes to orofacial neuropathic pain states in a rat model.

PubMed

Li, K-W; Kim, D-S; Zaucke, F; Luo, Z D

2014-04-01

Injury to the trigeminal nerve often results in the development of chronic pain states including tactile allodynia, or hypersensitivity to light touch, in orofacial area, but its underlying mechanisms are poorly understood. Peripheral nerve injury has been shown to cause up-regulation of thrombospondin-4 (TSP4) in dorsal spinal cord that correlates with neuropathic pain development. In this study, we examined whether injury-induced TSP4 is critical in mediating orofacial pain development in a rat model of chronic constriction injury to the infraorbital nerve. Orofacial sensitivity to mechanical stimulation was examined in a unilateral infraorbital nerve ligation rat model. The levels of TSP4 in trigeminal ganglia and associated spinal subnucleus caudalis and C1/C2 spinal cord (Vc/C2) from injured rats were examined at time points correlating with the initiation and peak orofacial hypersensitivity. TSP4 antisense and mismatch oligodeoxynucleotides were intrathecally injected into injured rats to see if antisense oligodeoxynucleotide treatment could reverse injury-induced TSP4 up-regulation and orofacial behavioural hypersensitivity. Our data indicated that trigeminal nerve injury induced TSP4 up-regulation in Vc/C2 at a time point correlated with orofacial tactile allodynia. In addition, intrathecal treatment with TSP4 antisense, but not mismatch, oligodeoxynucleotides blocked both injury-induced TSP4 up-regulation in Vc/C2 and behavioural hypersensitivity. Our data support that infraorbital nerve injury leads to TSP4 up-regulation in trigeminal spinal complex that contributes to orofacial neuropathic pain states. Blocking this pathway may provide an alternative approach in management of orofacial neuropathic pain states. © 2013 European Pain Federation - EFIC®

Antisense therapy and emerging applications for the management of dyslipidemia.

PubMed

Toth, Peter P

2011-01-01

Because a significant percentage of patients who require high-dose statin therapy for dyslipidemia experience treatment-related muscle symptoms and an inconsistent clinical response, alternative or adjunctive approaches to the management of dyslipidemia are needed. One alternative approach, antisense therapy, may offer an effective and well-tolerated option for patients not satisfactorily responsive to or intolerant to standard pharmacologic dyslipidemia therapies. This review provides an overview of antisense technology and its potential role in the management of dyslipidemia. Source material was obtained primarily from the published literature identified through a search of the PubMed database. Antisense technology is an evolving approach to therapy that has gone through a series of refinements to enhance molecular stability, potency, and tolerability. Mipomersen is an antisense molecule capable of producing clinically meaningful reductions in low-density lipoprotein cholesterol in patients with severe familial hypercholesterolemia. Further long-term clinical studies are required to more clearly quantify its impact on risk for cardiovascular events and establish whether it increases risk for hepatosteatosis. Antisense therapy represents a potentially effective and well-tolerated emerging treatment modality for numerous diseases. In the treatment of hypercholesterolemia, the antisense therapy mipomersen may provide a possible treatment option for patients with treatment-resistant dyslipidemia. Copyright © 2011 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Release profile and stability evaluation of optimized chitosan/alginate nanoparticles as EGFR antisense vector

PubMed Central

Azizi, Ebrahim; Namazi, Alireza; Haririan, Ismaeil; Fouladdel, Shamileh; Khoshayand, Mohammad R; Shotorbani, Parisa Y; Nomani, Alireza; Gazori, Taraneh

2010-01-01

Chitosan/alginate nanoparticles which had been optimized in our previous study using two different N/P ratios were chosen and their ability to release epidermal growth factor receptor (EGFR) antisense was investigated. In addition, the stability of these nanoparticles in aqueous medium and after freeze-drying was investigated. In the case of both N/P ratios (5, 25), nanoparticles started releasing EGFR antisense as soon as they were exposed to the medium and the release lasted for approximately 50 hours. Nanoparticle size, shape, zeta potential, and release profile did not show any significant change after the freeze-drying process (followed by reswelling). The nanoparticles were reswellable again after freeze-drying in phosphate buffer with a pH of 7.4 over a period of six hours. Agarose gel electrophoresis of the nanoparticles with the two different N/P ratios showed that these nanoparticles could protect EGFR antisense molecules for six hours. PMID:20957167

Antiviral effects of herpes simplex virus specific anti-sense nucleic acids.

PubMed

Cantin, E M; Podsakoff, G; Willey, D E; Openshaw, H

1992-01-01

We have targeted mRNA sequences encompassing the translation initiation codon of the essential herpes simplex virus type 1 (HSV-1) IE3 gene with three kinds of anti-sense molecule. Addition of a 15mer oligodeoxyribonucleoside methylphosphonate to tissue culture cells resulted in suppression of viral replication. HSV-1 replication was also inhibited in cultured cells containing anti-sense vectors expressing transcripts complementary to the IE3 mRNA. We have also constructed a ribozyme which upon base pairing with the target IE3 mRNA induces cleavage at the predicted GUC site. A major obstacle to anti-sense studies in animals is drug delivery of preformed antisense molecules to ganglionic neurons, the site of HSV latency and reactivation. We speculate as to how this may be accomplished through carrier compounds which are taken up by nerve terminals and transported by retrograde axoplasmic flow. By the same route, HSV itself may be used as an anti-sense vector.

Antisense imaging of gene expression in the brain in vivo

NASA Astrophysics Data System (ADS)

Shi, Ningya; Boado, Ruben J.; Pardridge, William M.

2000-12-01

Antisense radiopharmaceuticals could be used to image gene expression in the brain in vivo, should these polar molecules be made transportable through the blood-brain barrier. The present studies describe an antisense imaging agent comprised of an iodinated peptide nucleic acid (PNA) conjugated to a monoclonal antibody to the rat transferrin receptor by using avidin-biotin technology. The PNA was a 16-mer antisense to the sequence around the methionine initiation codon of the luciferase mRNA. C6 rat glioma cells were permanently transfected with a luciferase expression plasmid, and C6 experimental brain tumors were developed in adult rats. The expression of the luciferase transgene in the tumors in vivo was confirmed by measurement of luciferase enzyme activity in the tumor extract. The [125I]PNA conjugate was injected intravenously in anesthetized animals with brain tumors and killed 2 h later for frozen sectioning of brain and film autoradiography. No image of the luciferase gene expression was obtained after the administration of either the unconjugated antiluciferase PNA or a PNA conjugate that was antisense to the mRNA of a viral transcript. In contrast, tumors were imaged in all rats administered the [125I]PNA that was antisense to the luciferase sequence and was conjugated to the targeting antibody. In conclusion, these studies demonstrate gene expression in the brain in vivo can be imaged with antisense radiopharmaceuticals that are conjugated to a brain drug-targeting system.

A riboswitch-regulated antisense RNA in Listeria monocytogenes.

PubMed

Mellin, J R; Tiensuu, Teresa; Bécavin, Christophe; Gouin, Edith; Johansson, Jörgen; Cossart, Pascale

2013-08-06

Riboswitches are ligand-binding elements located in 5' untranslated regions of messenger RNAs, which regulate expression of downstream genes. In Listeria monocytogenes, a vitamin B12-binding (B12) riboswitch was identified, not upstream of a gene but downstream, and antisense to the adjacent gene, pocR, suggesting it might regulate pocR in a nonclassical manner. In Salmonella enterica, PocR is a transcription factor that is activated by 1,2-propanediol, and subsequently activates expression of the pdu genes. The pdu genes mediate propanediol catabolism and are implicated in pathogenesis. As enzymes involved in propanediol catabolism require B12 as a cofactor, we hypothesized that the Listeria B12 riboswitch might be involved in pocR regulation. Here we demonstrate that the B12 riboswitch is transcribed as part of a noncoding antisense RNA, herein named AspocR. In the presence of B12, the riboswitch induces transcriptional termination, causing aspocR to be transcribed as a short transcript. In contrast, in the absence of B12, aspocR is transcribed as a long antisense RNA, which inhibits pocR expression. Regulation by AspocR ensures that pocR, and consequently the pdu genes, are maximally expressed only when both propanediol and B12 are present. Strikingly, AspocR can inhibit pocR expression in trans, suggesting it acts through a direct interaction with pocR mRNA. Together, this study demonstrates how pocR and the pdu genes can be regulated by B12 in bacteria and extends the classical definition of riboswitches from elements governing solely the expression of mRNAs to a wider role in controlling transcription of noncoding RNAs.

Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides

PubMed Central

Wefers, Benedikt; Meyer, Melanie; Ortiz, Oskar; Hrabé de Angelis, Martin; Hansen, Jens; Wurst, Wolfgang; Kühn, Ralf

2013-01-01

The study of genetic disease mechanisms relies mostly on targeted mouse mutants that are derived from engineered embryonic stem (ES) cells. Nevertheless, the establishment of mutant ES cells is laborious and time-consuming, restricting the study of the increasing number of human disease mutations discovered by high-throughput genomic analysis. Here, we present an advanced approach for the production of mouse disease models by microinjection of transcription activator-like effector nucleases (TALENs) and synthetic oligodeoxynucleotides into one-cell embryos. Within 2 d of embryo injection, we created and corrected chocolate missense mutations in the small GTPase RAB38; a regulator of intracellular vesicle trafficking and phenotypic model of Hermansky-Pudlak syndrome. Because ES cell cultures and targeting vectors are not required, this technology enables instant germline modifications, making heterozygous mutants available within 18 wk. The key features of direct mutagenesis by TALENs and oligodeoxynucleotides, minimal effort and high speed, catalyze the generation of future in vivo models for the study of human disease mechanisms and interventions. PMID:23426636

Antisense apolipoprotein B therapy: where do we stand?

PubMed

Akdim, Fatima; Stroes, Erik S G; Kastelein, John J P

2007-08-01

Antisense oligonucleotides are novel therapeutic agents that reduce the number of specific mRNAs available for translation of the encoded protein. ISIS 301012 is an antisense oligonucleotide developed to reduce the hepatic synthesis of apolipoprotein B-100. Apolipoprotein B-100 is made in the liver, and antisense oligonucleotides preferentially distribute to that organ, so antisense apolipoprotein B-100 may have potential as an efficacious lipid-lowering agent. Recently, in healthy volunteers and in mild dyslipidaemic patients, this strategy as monotherapy or in conjunction with statins has shown unparalleled efficacy in reducing apolipoprotein B-100 and LDL-cholesterol. Tolerance for this novel therapy is encouraging and safety concerns currently only relate to mild injection-site reactions and rare liver-function test abnormalities. It should be noted, however, that these safety results were obtained in relatively few individuals. ISIS 301012 has initially shown promising results in experimental animal models, and in clinical trials in humans. Besides the effect of reducing apolipoprotein B-100 and LDL-cholesterol, this compound also significantly lowers plasma triglycerides. Safety concerns related to the drug include increased liver-function tests. To date no evidence of hepatic steatosis has been reported. Nonetheless, clinical trials of longer duration are required to demonstrate further safety.

The Seeds of Lotus japonicus Lines Transformed with Sense, Antisense, and Sense/Antisense Galactomannan Galactosyltransferase Constructs Have Structurally Altered Galactomannans in Their Endosperm Cell Walls1

PubMed Central

Edwards, Mary E.; Choo, Tze-Siang; Dickson, Cathryn A.; Scott, Catherine; Gidley, Michael J.; Reid, J.S. Grant

2004-01-01

Galactomannan biosynthesis in legume seed endosperms involves two Golgi membrane-bound glycosyltransferases, mannan synthase and galactomannan galactosyltransferase (GMGT). GMGT specificity is an important factor regulating the distribution and amount of (1→6)-α-galactose (Gal) substitution of the (1→4)-β-linked mannan backbone. The model legume Lotus japonicus is shown now to have endospermic seeds with endosperm cell walls that contain a high-Gal galactomannan (mannose [Man]/Gal = 1.2-1.3). Galactomannan biosynthesis in developing L. japonicus endosperms has been mapped, and a cDNA encoding a functional GMGT has been obtained from L. japonicus endosperms during galactomannan deposition. L. japonicus has been transformed with sense, antisense, and sense/antisense (“hairpin loop”) constructs of the GMGT cDNA. Some of the sense, antisense, and sense/antisense transgenic lines exhibited galactomannans with altered (higher) Man/Gal values in their (T1 generation) seeds, at frequencies that were consistent with posttranscriptional silencing of GMGT. For T1 generation individuals, transgene inheritance was correlated with galactomannan composition and amount in the endosperm. All the azygous individuals had unchanged galactomannans, whereas those that had inherited a GMGT transgene exhibited a range of Man/Gal values, up to about 6 in some lines. For Man/Gal values up to 4, the results were consistent with lowered Gal substitution of a constant amount of mannan backbone. Further lowering of Gal substitution was accompanied by a slight decrease in the amount of mannan backbone. Microsomal membranes prepared from the developing T2 generation endosperms of transgenic lines showed reduced GMGT activity relative to mannan synthase. The results demonstrate structural modification of a plant cell wall polysaccharide by designed regulation of a Golgi-bound glycosyltransferase. PMID:14988472

Antisense oligonucleotide technologies in drug discovery.

PubMed

Aboul-Fadl, Tarek

2006-09-01

The principle of antisense oligonucleotide (AS-OD) technologies is based on the specific inhibition of unwanted gene expression by blocking mRNA activity. It has long appeared to be an ideal strategy to leverage new genomic knowledge for drug discovery and development. In recent years, AS-OD technologies have been widely used as potent and promising tools for this purpose. There is a rapid increase in the number of antisense molecules progressing in clinical trials. AS-OD technologies provide a simple and efficient approach for drug discovery and development and are expected to become a reality in the near future. This editorial describes the established and emerging AS-OD technologies in drug discovery.

Knockdown of mortalin within the medial prefrontal cortex impairs normal sensorimotor gating.

PubMed

Gabriele, Nicole; Pontoriero, Giuseppe F; Thomas, Nancy; Shethwala, Shazli K; Pristupa, Zdenek B; Gabriele, Joseph P

2010-11-01

The 70-kDa mitochondrial heat shock protein, mortalin, is a ubiquitously expressed, multifunctional protein that is capable of binding the neurotransmitter, dopamine, within the brain. Dopamine dysregulation has been implicated in many of the abnormal neurological behaviors. Although studies have indicated that mortalin is differentially regulated in response to dopaminergic modulation, research has yet to elucidate the role of mortalin in the regulation of dopaminergic activity. This study seeks to investigate the role of mortalin in the regulation of dopamine-dependent behavior, specifically as it pertains to schizophrenia (SCZ). Mortalin expression was knocked down through the infusion of antisense oligodeoxynucleotide molecules into the medial prefrontal cortex (mPFC). Rats infused with mortalin antisense oligodeoxynucleotide molecules exhibited significant prepulse inhibition deficits, suggestive of defects in normal sensorimotor gating. Furthermore, mortalin misexpression within the mPFC was coupled to a significant increase in mortalin protein expression within the nucleus accumbens at the molecular level. These findings demonstrate that mortalin plays an essential role in the regulation of dopamine-dependent behavior and plays an even greater role in the pathogenesis of SCZ.

Cocaine alters Homer1 natural antisense transcript in the nucleus accumbens.

PubMed

Sartor, Gregory C; Powell, Samuel K; Velmeshev, Dmitry; Lin, David Y; Magistri, Marco; Wiedner, Hannah J; Malvezzi, Andrea M; Andrade, Nadja S; Faghihi, Mohammad A; Wahlestedt, Claes

2017-12-01

Natural antisense transcripts (NATs) are an abundant class of long noncoding RNAs that have recently been shown to be key regulators of chromatin dynamics and gene expression in nervous system development and neurological disorders. However, it is currently unclear if NAT-based mechanisms also play a role in drug-induced neuroadaptations. Aberrant regulation of gene expression is one critical factor underlying the long-lasting behavioral abnormalities that characterize substance use disorder, and it is possible that some drug-induced transcriptional responses are mediated, in part, by perturbations in NAT activity. To test this hypothesis, we used an automated algorithm that mines the NCBI AceView transcriptomics database to identify NAT overlapping genes linked to addiction. We found that 22% of the genes examined contain NATs and that expression of Homer1 natural antisense transcript (Homer1-AS) was altered in the nucleus accumbens (NAc) of mice 2h and 10days following repeated cocaine administration. In in vitro studies, depletion of Homer1-AS lead to an increase in the corresponding sense gene expression, indicating a potential regulatory mechanisms of Homer1 expression by its corresponding antisense transcript. Future in vivo studies are needed to definitely determine a role for Homer1-AS in cocaine-induced behavioral and molecular adaptations. Copyright © 2017 Elsevier Inc. All rights reserved.

Characterization of Antisense Transformed Plants Deficient in the Tobacco Anionic Peroxidase.

PubMed

Lagrimini, L. M.; Gingas, V.; Finger, F.; Rothstein, S.; Liu, TTY.

1997-08-01

On the basis of the biological compounds that they metabolize, plant peroxidases have long been implicated in plant growth, cell wall biogenesis, lignification, and host defenses. Transgenic tobacco (Nicotiana tabacum L.) plants that underexpress anionic peroxidase were generated using antisense RNA. The antisense RNA was found to be specific for the anionic isoenzyme and highly effective, reducing endogenous transcript levels and total peroxidase activity by as much as 1600-fold. Antisense-transformed plants appeared normal at initial observation; however, growth studies showed that plants with reduced peroxidase activity grow taller and flower sooner than control plants. In contrast, previously transformed plants overproducing anionic peroxidase were shorter and flowered later than controls. Axillary buds were more developed in antisense-transformed plants and less developed in plants overproducing this enzyme. It was found that the lignin content in leaf, stem, and root was unchanged in antisense-transformed plants, which does not support a role for anionic peroxidase in the lignification of secondary xylem vessels. However, studies of wounded tissue show some reduction in wound-induced deposition of lignin-like polymers. The data support a possible role for tobacco anionic peroxidase in host defenses but not without a reduction in growth potential.

Improved therapeutic effectiveness by combining recombinant p14(ARF) with antisense complementary DNA of EGFR in laryngeal squamous cell carcinoma.

PubMed

Liu, Feng; Du, JinTao; Xian, Junming; Liu, Yafeng; Liu, Shixi; Lin, Yan

2015-01-01

The tumor suppressor p14(ARF) and proto-oncogene epidermal growth factor receptor (EGFR) play important roles in the development of laryngeal squamous cell carcinoma (LSCC). This study was aimed to determine whether combining recombinant p14(ARF) with antisense complementary DNA of EGFR could improve the therapeutic effectiveness in LSCC. After human larynx cancer cells (Hep-2) were infected with recombinant adenoviruses (Ad-p14(ARF) and Ad-antisense EGFR) together or alone in vitro, the proliferation and cell cycle distribution of Hep-2 cells were detected by MTT assay and flow cytometer analysis, respectively. Furthermore, the antitumor effects of recombinant adenoviruses together or alone on Hep-2 xenografts were examined in vivo. The levels of p14(ARF) and EGFR expressed in Hep-2 cells and xenografts were determined by western blot assay. Ad-p14(ARF) combining with Ad-antisense EGFR markedly inhibited the Hep-2 proliferation compared with alone (P=0.001, P=0.002 respectively). Combination of Ad-p14(ARF) and Ad-antisense EGFR led to the proportion of Hep-2 cells in G0/G1 phases increased by up to 86.9%. The down-expression of EGFR protein and overexpression of p14(ARF) protein were observed in vitro and in vivo, and this effect was preserved when Ad-p14(ARF) was combined with Ad-antisense EGFR. Besides, Ad-p14(ARF) plus Ad-antisense EGFR significantly (P<0.05) increased the antitumor activity against Hep-2 tumor xenografts comparing with Ad-p14(ARF) or Ad-antisense EGFR alone. Combination Ad-p14(ARF) with Ad-antisense EGFR significantly increased the antitumor responses in LSCC. An effectively potential gene therapy to prevent proliferation of LSCC was provided. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification of antisense long noncoding RNAs that function as SINEUPs in human cells.

PubMed

Schein, Aleks; Zucchelli, Silvia; Kauppinen, Sakari; Gustincich, Stefano; Carninci, Piero

2016-09-20

Mammalian genomes encode numerous natural antisense long noncoding RNAs (lncRNAs) that regulate gene expression. Recently, an antisense lncRNA to mouse Ubiquitin carboxyl-terminal hydrolase L1 (Uchl1) was reported to increase UCHL1 protein synthesis, representing a new functional class of lncRNAs, designated as SINEUPs, for SINE element-containing translation UP-regulators. Here, we show that an antisense lncRNA to the human protein phosphatase 1 regulatory subunit 12A (PPP1R12A), named as R12A-AS1, which overlaps with the 5' UTR and first coding exon of the PPP1R12A mRNA, functions as a SINEUP, increasing PPP1R12A protein translation in human cells. The SINEUP activity depends on the aforementioned sense-antisense interaction and a free right Alu monomer repeat element at the 3' end of R12A-AS1. In addition, we identify another human antisense lncRNA with SINEUP activity. Our results demonstrate for the first time that human natural antisense lncRNAs can up-regulate protein translation, suggesting that endogenous SINEUPs may be widespread and present in many mammalian species.

Characterization of Antisense Transformed Plants Deficient in the Tobacco Anionic Peroxidase.

PubMed Central

Lagrimini, L. M.; Gingas, V.; Finger, F.; Rothstein, S.; Liu, TTY.

1997-01-01

On the basis of the biological compounds that they metabolize, plant peroxidases have long been implicated in plant growth, cell wall biogenesis, lignification, and host defenses. Transgenic tobacco (Nicotiana tabacum L.) plants that underexpress anionic peroxidase were generated using antisense RNA. The antisense RNA was found to be specific for the anionic isoenzyme and highly effective, reducing endogenous transcript levels and total peroxidase activity by as much as 1600-fold. Antisense-transformed plants appeared normal at initial observation; however, growth studies showed that plants with reduced peroxidase activity grow taller and flower sooner than control plants. In contrast, previously transformed plants overproducing anionic peroxidase were shorter and flowered later than controls. Axillary buds were more developed in antisense-transformed plants and less developed in plants overproducing this enzyme. It was found that the lignin content in leaf, stem, and root was unchanged in antisense-transformed plants, which does not support a role for anionic peroxidase in the lignification of secondary xylem vessels. However, studies of wounded tissue show some reduction in wound-induced deposition of lignin-like polymers. The data support a possible role for tobacco anionic peroxidase in host defenses but not without a reduction in growth potential. PMID:12223765

Comparison and evaluation of gene therapy and epigenetic approaches for wound healing.

PubMed

Cutroneo, K R; Chiu, J F

2000-01-01

During the past decade considerable evidence has mounted concerning the importance of growth factors in the wound healing process both for cell replication and for stimulating reparative cells to synthesize and secrete extracellular matrix components. During normal wound healing the growth factor concentration has to be maintained at a certain level. If the growth factor concentration is too low, normal healing fails to occur. Whereas if the growth factor concentration is too high due to either over-expression of the growth factor or too much growth factor being applied to the wound, aberrant wound healing will occur. One approach for controlling the amount of growth factor at the wound site during normal healing is through gene therapy and the titration of gene dosage. However if a narrow window exists between the beneficial therapeutic effect and toxic effects with increasing gene dosage, an agent may be necessary to give in combination with gene therapy to regulate the over-expression of growth factor. In addition to genetic approaches to regulate wound healing, epigenetic approaches also exist. Antisense oligodeoxynucleotides have been shown to regulate wound repair in certain model systems and to determine the protein(s) necessary for normal wound healing. A novel approach to regulate the activity of collagen genes, thereby affecting fibrosis, is to use a sense oligodeoxynucleotide having the same sequence of the cis element which regulates the promoter activity of a particular collagen gene. This exogenous oligodeoxynucleotide will compete with the cis element in the collagen gene for the trans-acting factor which regulates promoter activity. These epigenetic approaches afford the opportunity to regulate over-expression of growth factor and therefore preclude the potential toxic effects of gene therapy. Both genetic and epigenetic approaches for regulating the wound healing process, either normal or aberrant wound healing, have certain advantages and

Antisense oligonucleotide against GSK-3β in brain of SAMP8 mice improves learning and memory and decreases oxidative stress: Involvement of transcription factor Nrf2 and implications for Alzheimer disease.

PubMed

Farr, Susan A; Ripley, Jessica L; Sultana, Rukhsana; Zhang, Zhaoshu; Niehoff, Michael L; Platt, Thomas L; Murphy, M Paul; Morley, John E; Kumar, Vijaya; Butterfield, D Allan

2014-02-01

Glycogen synthase kinase (GSK)-3β is a multifunctional protein that has been implicated in the pathological characteristics of Alzheimer's disease (AD), including the heightened levels of neurofibrillary tangles, amyloid-beta (Aβ), and neurodegeneration. In this study we used 12-month-old SAMP8 mice, an AD model, to examine the effects GSK-3β may cause regarding the cognitive impairment and oxidative stress associated with AD. To suppress the level of GSK-3β, SAMP8 mice were treated with an antisense oligonucleotide (GAO) directed at this kinase. We measured a decreased level of GSK-3β in the cortex of the mice, indicating the success of the antisense treatment. Learning and memory assessments of the SAMP8 mice were tested post-antisense treatment using an aversive T-maze and object recognition test, both of which observably improved. In cortex samples of the SAMP8 mice, decreased levels of protein carbonyl and protein-bound HNE were measured, indicating decreased oxidative stress. Nuclear factor erythroid-2-related factor 2 (Nrf2) is a transcription factor known to increase the level of many antioxidants, including glutathione-S transferase (GST), and is negatively regulated by the activity of GSK-3β. Our results indicated the increased nuclear localization of Nrf2 and level of GST, suggesting the increased activity of the transcription factor as a result of GSK-3β suppression, consistent with the decreased oxidative stress observed. Consistent with the improved learning and memory, and consistent with GSK-3b being a tau kinase, we observed decreased tau phosphorylation in brain of GAO-treated SAMP8 mice compared to that of RAO-treated SAMP8 mice. Lastly, we examined the ability of GAO to cross the blood-brain barrier and determined it to be possible. The results presented in this study demonstrate that reducing GSK-3 with a phosphorothionated antisense against GSK-3 improves learning and memory, reduces oxidative stress, possibly coincident with increased

C-fos down-regulation inhibits testosterone-dependent male sexual behavior and the associated learning

PubMed Central

Niessen, Neville-Andrew; Balthazart, Jacques; Ball, Gregory F.; Charlier, Thierry D.

2013-01-01

Environmental stimulation results in an increased expression of transcription factors called immediate early genes (IEG) in specific neuronal populations. In male Japanese quail, copulation with a female increases the expression of the IEGs zenk and c-fos in the medial preoptic nucleus (POM), a key nucleus controlling male sexual behavior. The functional significance of this increased IEG expression that follows performance of copulatory behavior is unknown. We addressed this question by repeatedly quantifying the performance of appetitive (learned social proximity response) and consummatory (actual copulation) sexual behavior in castrated, testosterone-treated males that received daily intracerebroventricular injection of an antisense oligodeoxynucleotide targeting c-fos or control vehicle. Daily antisense injections significantly inhibited expression of copulatory behavior as well as acquisition of the learned social proximity response. A strong reduction of the proximity response was still observed in antisense-treated birds that copulated with a female, ruling out the indirect effect of the absence of interactions with females on the learning process. After a two-day interruption of behavioral testing but not of antisense injections, birds were submitted to a final copulatory test that confirmed the behavioral inhibition in antisense-injected birds. Brains were collected 90 min after the behavioral testing for quantification of c-fos immunoreactive cells. A significant reduction of the number of c-fos-positive cells in POM but not in other brain regions was observed following antisense injection. Together, data suggest that c-fos expression in POM modulates copulatory behavior and sexual learning in male quail. PMID:23895306

Bcl-2 antisense therapy in B-cell malignancies.

PubMed

Chanan-Khan, Asher

2005-07-01

Bcl-2 is an apoptosis regulating protein, overexpression of which is associated with chemotherapy resistant disease, aggressive clinical course, and poor survival in patients with B-cell lymphoproliferative disorders. Overexpression of Bcl-2 protein results in an aberrant intrinsic apoptotic pathway that confers a protective effect on malignant cells against a death signal (e.g., chemotherapy or radiotherapy). Downregulation of this oncoprotein, thus, represents a possible new way to target clinically aggressive disease. Preclinical studies have shown that this oncoprotein can be effectively decreased by Bcl-2 antisense in malignant lymphoid cells and can reverse chemotherapy resistance, as well as enhance the anti-apoptotic potential of both chemotherapeutic and biologic agents. Ongoing clinical trials are exploring the role of Bcl-2 downregulation with oblimersen (Bcl-2 antisense) in patients with non-Hodgkin's lymphoma, chronic lymphocytic leukemia and multiple myeloma. Early results from these studies are promising and support the proof of the principle. As these studies are completed and mature data emerges, the role of Bcl-2 antisense therapy in the treatment of B-cell malignancies will become clearer.

Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs

PubMed Central

Shen, Xiulong; Corey, David R

2018-01-01

Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946

Episome-generated N-myc antisense RNA restricts the differentiation potential of primitive neuroectodermal cell lines.

PubMed Central

Whitesell, L; Rosolen, A; Neckers, L M

1991-01-01

Neuroectodermal tumors of childhood provide a unique opportunity to examine the role of genes potentially regulating neuronal growth and differentiation because many cell lines derived from these tumors are composed of at least two distinct morphologic cell types. These types display variant phenotypic characteristics and spontaneously interconvert, or transdifferentiate, in vitro. The factors that regulate transdifferentiation are unknown. Application of antisense approaches to the transdifferentiation process has allowed us to explore the precise role that N-myc may play in regulating developing systems. We now report construction of an episomally replicating expression vector designed to generate RNA antisense to part of the human N-myc gene. Such a vector is able to specifically inhibit N-myc expression in cell lines carrying both normal and amplified N-myc alleles. Inhibition of N-myc expression blocks transdifferentiation in these lines, with accumulation of cells of an intermediate phenotype. A concomitant decrease in growth rate but not loss of tumorigenicity was observed in the N-myc nonamplified cell line CHP-100. Vector-generated antisense RNA should allow identification of genes specifically regulated by the proto-oncogene N-myc. Images PMID:1996098

Oligodeoxynucleotide Probes for Detecting Intact Cells

NASA Technical Reports Server (NTRS)

Rosson, Reinhardt A.; Maurina-Brunker, Julie; Langley, Kim; Pynnonen, Christine M.

2004-01-01

A rapid, sensitive test using chemiluminescent oligodeoxynucleotide probes has been developed for detecting, identifying, and enumerating intact cells. The test is intended especially for use in detecting and enumerating bacteria and yeasts in potable water. As in related tests that have been developed recently for similar purposes, the oligodeoxynucleotide probes used in this test are typically targeted at either singlecopy deoxyribonucleic acid (DNA) genes (such as virulence genes) or the multiple copies (10,000 to 50,000 copies per cell) of 16S ribosomal ribonucleic acids (rRNAs). Some of those tests involve radioisotope or fluorescent labeling of the probes for reporting hybridization of probes to target nucleic acids. Others of those tests involve labeling with enzymes plus the use of chemiluminescent or chromogenic substrates to report hybridization via color or the emission of light, respectively. The present test is of the last-mentioned type. The chemiluminescence in the present test can be detected easily with relatively simple instrumentation. In developing the present test, the hybridization approach was chosen because hybridization techniques are very specific. Hybridization detects stable, inheritable genetic targets within microorganisms. These targets are not dependent on products of gene expression that can vary with growth conditions or physiological states of organisms in test samples. Therefore, unique probes can be designed to detect and identify specific genera or species of bacteria or yeast (in terms of rRNA target sequences) or can be designed to detect and identify virulence genes (genomic target sequences). Because of the inherent specificity of this system, there are few problems of cross-reactivity. Hybridization tests are rapid, but hybridization tests now available commercially lack sensitivity; typically, between 10(exp 6) and 10(exp 7) cells of the target organism are needed to ensure a reliable test. Consequently, the numbers of

A Simple Procedure for Constructing 5'-Amino-Terminated Oligodeoxynucleotides in Aqueous Solution

NASA Technical Reports Server (NTRS)

Bruick, Richard K.; Koppitz, Marcus; Joyce, Gerald F.; Orgel, Leslie E.

1997-01-01

A rapid method for the synthesis of oligodeoxynucleotides (ODNs) terminated by 5'-amino-5'-deoxythymidine is described. A 3'-phosphorylated ODN (the donor) is incubated in aqueous solution with 5'-amino- 5'-deoxythymidine in the presence of N-(3-dimethylaminopropyl)-)N'-ethylcarbodiimide hydrochloride (EDC), extending the donor by one residue via a phosphoramidate bond. Template- directed ligation of the extended donor and an acceptor ODN, followed by acid hydrolysis, yields the acceptor ODN extended by a single 5'-amino-5'-deoxythymidine residue at its 5'terminus.

miRNA-dependent gene silencing involving Ago2-mediated cleavage of a circular antisense RNA

PubMed Central

Hansen, Thomas B; Wiklund, Erik D; Bramsen, Jesper B; Villadsen, Sune B; Statham, Aaron L; Clark, Susan J; Kjems, Jørgen

2011-01-01

MicroRNAs (miRNAs) are ∼22 nt non-coding RNAs that typically bind to the 3′ UTR of target mRNAs in the cytoplasm, resulting in mRNA destabilization and translational repression. Here, we report that miRNAs can also regulate gene expression by targeting non-coding antisense transcripts in human cells. Specifically, we show that miR-671 directs cleavage of a circular antisense transcript of the Cerebellar Degeneration-Related protein 1 (CDR1) locus in an Ago2-slicer-dependent manner. The resulting downregulation of circular antisense has a concomitant decrease in CDR1 mRNA levels, independently of heterochromatin formation. This study provides the first evidence for non-coding antisense transcripts as functional miRNA targets, and a novel regulatory mechanism involving a positive correlation between mRNA and antisense circular RNA levels. PMID:21964070

Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

PubMed

Nakashima, N; Tamura, T

2013-06-01

Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

TGF-beta antisense oligonucleotides reduce mRNA expression of matrix metalloproteinases in cultured wound-healing-related cells.

PubMed

Philipp, Katrin; Riedel, Frank; Germann, Günter; Hörmann, Karl; Sauerbier, Michael

2005-02-01

The pathology of chronic dermal ulcers is characterized by excessive proteolytic activity which degrades extracellular matrix. The transforming growth factor-beta (TGF-beta) has been identified as an important component of wound healing. Recent developments in molecular therapy offer exciting prospects for the modulation of wound healing, specifically those targeting TGF-beta. We investigated the effect of TGF-beta antisense oligonucleotides on the mRNA expression of matrix metalloproteinases in cultured human keratinocytes, fibroblasts and endothelial cells using multiplex RT-PCR. The treatment of keratinocytes and fibroblasts with TGF-beta antisense oligonucleotides resulted in a significant decrease of expression of mRNA of MMP-1 and MMP-9 compared to controls. Accordingly, a decreased expression of MMP-1 mRNA in endothelial cells was detectable. Other MMPs were not affected. Affecting all dermal wound-healing-related cell types, TGF-beta antisense oligonucleotide technology may be a potential therapeutic option for the inhibition of proteolytic tissue destruction in chronic wounds. Pharmaceutical intervention in this area ultimately may help clinicians to proactively intervene in an effort to prevent normal wounds from becoming chronic.

An "egr-1" ("zif268") Antisense Oligodeoxynucleotide Infused into the Amygdala Disrupts Fear Conditioning

ERIC Educational Resources Information Center

Donley, Melanie P.; Rosen, Jeffrey B.; Malkani, Seema; Wallace, Karin J.

2004-01-01

Studies of gene expression following fear conditioning have demonstrated that the inducible transcription factor, "egr-1," is increased in the lateral nucleus of the amygdala shortly following fear conditioning. These studies suggest that "egr-1" and its protein product Egr-1 in the amygdala are important for learning and memory of fear. To…

Bcl-2 antisense therapy in B-cell malignant proliferative disorders.

PubMed

Chanan-Khan, Asher; Czuczman, Myron S

2004-08-01

Overexpression of Bcl-2 oncogene has been clinically associated with an aggressive clinical course, chemotherapy and radiotherapy resistance, and poor survival in patients with malignant B-cell disorders. Patients with relapsed or refractory chronic lymphocytic leukemia, multiple myeloma, or non-Hodgkin's lymphoma have limited therapeutic options. Preclinical and early clinical data have shown that Bcl-2 oncoprotein can be decreased by Bcl-2 antisense therapy. Also, downregulation of Bcl-2 protein can result in reversal of chemotherapy resistance and improved antitumor activity of biologic agents. Various clinical trials are evaluating the role of targeting Bcl-2 as a mechanism to enhance the antitumor potential of chemotherapy and immunotherapy. Early results from these clinical studies are encouraging and confirm the proof of principle for antisense therapy. As current data mature, these trials will hopefully validate preliminary results and establish Bcl-2 antisense as an important addition to the current armamentarium used in the treatment of patients with B-cell neoplasms.

Two Distinct Repressive Mechanisms for Histone 3 Lysine 4 Methylation through Promoting 3′-End Antisense Transcription

PubMed Central

Margaritis, Thanasis; Oreal, Vincent; Brabers, Nathalie; Maestroni, Laetitia; Vitaliano-Prunier, Adeline; Benschop, Joris J.; van Hooff, Sander; van Leenen, Dik

2012-01-01

Histone H3 di- and trimethylation on lysine 4 are major chromatin marks that correlate with active transcription. The influence of these modifications on transcription itself is, however, poorly understood. We have investigated the roles of H3K4 methylation in Saccharomyces cerevisiae by determining genome-wide expression-profiles of mutants in the Set1 complex, COMPASS, that lays down these marks. Loss of H3K4 trimethylation has virtually no effect on steady-state or dynamically-changing mRNA levels. Combined loss of H3K4 tri- and dimethylation results in steady-state mRNA upregulation and delays in the repression kinetics of specific groups of genes. COMPASS-repressed genes have distinct H3K4 methylation patterns, with enrichment of H3K4me3 at the 3′-end, indicating that repression is coupled to 3′-end antisense transcription. Further analyses reveal that repression is mediated by H3K4me3-dependent 3′-end antisense transcription in two ways. For a small group of genes including PHO84, repression is mediated by a previously reported trans-effect that requires the antisense transcript itself. For the majority of COMPASS-repressed genes, however, it is the process of 3′-end antisense transcription itself that is the important factor for repression. Strand-specific qPCR analyses of various mutants indicate that this more prevalent mechanism of COMPASS-mediated repression requires H3K4me3-dependent 3′-end antisense transcription to lay down H3K4me2, which seems to serve as the actual repressive mark. Removal of the 3′-end antisense promoter also results in derepression of sense transcription and renders sense transcription insensitive to the additional loss of SET1. The derepression observed in COMPASS mutants is mimicked by reduction of global histone H3 and H4 levels, suggesting that the H3K4me2 repressive effect is linked to establishment of a repressive chromatin structure. These results indicate that in S. cerevisiae, the non-redundant role of H3K4

Transdominant Rev and Protease Mutant Proteins of HIV-SIV as Potential Antiviral Agents in Vitro and in Vivo (AIDS)

DTIC Science & Technology

1993-10-30

hammerhead ribozymes (7-9) and a hairpin ribozyme (10) directed against HIV-l RNA has been shown to confer significant resistance to HIV-I infection...antisense oligodeoxynucleotides (ODN) directed to the Rev Response Element (RRE) and ribozymes that target viral mRNAs. The ribozyme approach, in...particular, has yielded extremely encouraging positive data. We showed that a hairpin ribozyme designed to cleave HIV-1 RNA in the 5’ leader sequence

Antisense Treatments for Biothreat Agents

DTIC Science & Technology

2006-08-01

2001) 19(4):360-364. 82. Nekhotiaeva N, Awasthi SK, Nielsen PE, Good L: Inhibition of Staphylococcus aureus gene expression and growth using...to PNA enhanced the entry of the antisense molecules and reduced expression of the bacterial target genes both in E coli [81] and Staphylococcus ... aureus [82]. Peptide-tagged PMOs can also efficiently inhibit bacterial growth in pure and infected cultures [75]. In a recent study, we observed that

Noncoding transcripts in sense and antisense orientation regulate the epigenetic state of ribosomal RNA genes.

PubMed

Bierhoff, H; Schmitz, K; Maass, F; Ye, J; Grummt, I

2010-01-01

Alternative transcription of the same gene in sense and antisense orientation regulates expression of protein-coding genes. Here we show that noncoding RNA (ncRNA) in sense and antisense orientation also controls transcription of rRNA genes (rDNA). rDNA exists in two types of chromatin--a euchromatic conformation that is permissive to transcription and a heterochromatic conformation that is transcriptionally silent. Silencing of rDNA is mediated by NoRC, a chromatin-remodeling complex that triggers heterochromatin formation. NoRC function requires RNA that is complementary to the rDNA promoter (pRNA). pRNA forms a DNA:RNA triplex with a regulatory element in the rDNA promoter, and this triplex structure is recognized by DNMT3b. The results imply that triplex-mediated targeting of DNMT3b to specific sequences may be a common pathway in epigenetic regulation. We also show that rDNA is transcribed in antisense orientation. The level of antisense RNA (asRNA) is down-regulated in cancer cells and up-regulated in senescent cells. Ectopic asRNA triggers trimethylation of histone H4 at lysine 20 (H4K20me3), suggesting that antisense transcripts guide the histone methyltransferase Suv4-20 to rDNA. The results reveal that noncoding RNAs in sense and antisense orientation are important determinants of the epigenetic state of rDNA.

RNA editing and regulation of Drosophila 4f-rnp expression by sas-10 antisense readthrough mRNA transcripts

PubMed Central

PETERS, NICK T.; ROHRBACH, JUSTIN A.; ZALEWSKI, BRIAN A.; BYRKETT, COLLEEN M.; VAUGHN, JACK C.

2003-01-01

We have previously described an example of extensively A-to-G edited cDNA derived from adult heads of the fruitfly Drosophila melanogaster. In that study, the source of the predicted antisense RNA pairing strand for template recognition by dADAR editase was not identified, and the biological significance of the observed hyperediting was not known. Here, we address each of these questions. 4f-rnp and sas-10 are closely adjacent X-linked genes located on opposite DNA strands that produce convergent transcripts. We show that developmentally regulated antisense sas-10 readthrough mRNA arises by activation of an upstream promoter P2 during the late embryo stage of fly development. The sas-10 readthrough transcripts pair with 4f-rnp mRNA to form double-stranded molecules, as indicated by A-to-G editing observed in both RNA strands. It would be predicted that perfect RNA duplexes would be targeted for modification/degradation by enzyme pathways that recognize double-stranded RNAs, leading to decline in 4f-rnp mRNA levels, and this is what we observe. The observation using quantitative RT-PCR that sas-10 readthrough and 4f-rnp transcript levels are inversely related suggests a role for the antisense RNA in posttranscriptional regulation of 4f-rnp gene expression during development. Potential molecular mechanisms that could lead to this result are discussed, one of which is targeted transcript degradation via the RNAi pathway. Insofar as the dADAR editase and RNAi pathways are known to be constitutive in this system, it is likely that control of antisense RNA transcription is the rate-limiting factor. The results provide insight into roles of naturally occurring antisense RNAs in regulation of eukaryotic gene expression. PMID:12756328

Cis-encoded non-coding antisense RNAs in streptococci and other low GC Gram (+) bacterial pathogens

PubMed Central

Cho, Kyu Hong; Kim, Jeong-Ho

2015-01-01

Due to recent advances of bioinformatics and high throughput sequencing technology, discovery of regulatory non-coding RNAs in bacteria has been increased to a great extent. Based on this bandwagon, many studies searching for trans-acting small non-coding RNAs in streptococci have been performed intensively, especially in the important human pathogen, group A and B streptococci. However, studies for cis-encoded non-coding antisense RNAs in streptococci have been scarce. A recent study shows antisense RNAs are involved in virulence gene regulation in group B streptococcus, S. agalactiae. This suggests antisense RNAs could have important roles in the pathogenesis of streptococcal pathogens. In this review, we describe recent discoveries of chromosomal cis-encoded antisense RNAs in streptococcal pathogens and other low GC Gram (+) bacteria to provide a guide for future studies. PMID:25859258

Versatile Method for the Site-Specific Modification of DNA with Boron Clusters: Anti-Epidermal Growth Factor Receptor (EGFR) Antisense Oligonucleotide Case.

PubMed

Ebenryter-Olbińska, Katarzyna; Kaniowski, Damian; Sobczak, Milena; Wojtczak, Błażej A; Janczak, Sławomir; Wielgus, Ewelina; Nawrot, Barbara; Leśnikowski, Zbigniew J

2017-11-21

A general and convenient approach for the incorporation of different types of boron clusters into specific locations of the DNA-oligonucleotide chain based on the automated phosphoramidite method of oligonucleotide synthesis and post-synthetic "click chemistry" modification has been developed. Pronounced effects of boron-cluster modification on the physico- and biochemical properties of the antisense oligonucleotides were observed. The silencing activity of antisense oligonucleotides bearing a single boron cluster modification in the middle of the oligonucleotide chain was substantially higher than that of unmodified oligonucleotides. This finding may be of importance for the design of therapeutic nucleic acids with improved properties. The proposed synthetic methodology broadens the availability of nucleic acid-boron cluster conjugates and opens up new avenues for their potential practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Histone deacetylation during brain development is essential for permanent masculinization of sexual behavior.

PubMed

Matsuda, Ken Ichi; Mori, Hiroko; Nugent, Bridget M; Pfaff, Donald W; McCarthy, Margaret M; Kawata, Mitsuhiro

2011-07-01

Epigenetic histone modifications are emerging as important mechanisms for conveyance of and maintenance of effects of the hormonal milieu to the developing brain. We hypothesized that alteration of histone acetylation status early in development by sex steroid hormones is important for sexual differentiation of the brain. It was found that during the critical period for sexual differentiation, histones associated with promoters of essential genes in masculinization of the brain (estrogen receptor α and aromatase) in the medial preoptic area, an area necessary for male sexual behavior, were differentially acetylated between the sexes. Consistent with these findings, binding of histone deacetylase (HDAC) 2 and 4 to the promoters was higher in males than in females. To examine the involvement of histone deacetylation on masculinization of the brain at the behavioral level, we inhibited HDAC in vivo by intracerebroventricular infusion of the HDAC inhibitor trichostatin A or antisense oligodeoxynucleotide directed against the mRNA for HDAC2 and -4 in newborn male rats. Aspects of male sexual behavior in adulthood were significantly reduced by administration of either trichostatin A or antisense oligodeoxynucleotide. These results demonstrate that HDAC activity during the early postnatal period plays a crucial role in the masculinization of the brain via modifications of histone acetylation status.

Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

PubMed Central

Pierce, M L; Ruffner, D E

1998-01-01

Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

Oxidative generation of guanine radicals by carbonate radicals and their reactions with nitrogen dioxide to form site specific 5-guanidino-4-nitroimidazole lesions in oligodeoxynucleotides.

PubMed

Joffe, Avrum; Mock, Steven; Yun, Byeong Hwa; Kolbanovskiy, Alexander; Geacintov, Nicholas E; Shafirovich, Vladimir

2003-08-01

A simple photochemical approach is described for synthesizing site specific, stable 5-guanidino-4-nitroimidazole (NIm) adducts in single- and double-stranded oligodeoxynucleotides containing single and multiple guanine residues. The DNA sequences employed, 5'-d(ACC CG(1)C G(2)TC CG(3)C G(4)CC) and 5'-d(ACC CG(1)C G(2)TC C), were a portion of exon 5 of the p53 tumor suppressor gene, including the codons 157 (G(2)) and 158 (G(3)) mutation hot spots in the former sequence with four Gs and the codon 157 (G(2)) mutation hot spot in the latter sequence with two Gs. The nitration of oligodeoxynucleotides was initiated by the selective photodissociation of persulfate anions to sulfate radicals induced by UV laser pulses (308 nm). In aqueous solutions, of bicarbonate and nitrite anions, the sulfate radicals generate carbonate anion radicals and nitrogen dioxide radicals by one electron oxidation of the respective anions. The guanine residue in the oligodeoxynucleotide is oxidized by the carbonate anion radical to form the neutral guanine radical. While the nitrogen dioxide radicals do not react with any of the intact DNA bases, they readily combine with the guanine radicals at either the C8 or the C5 positions. The C8 addition generates the well-known 8-nitroguanine (8-nitro-G) lesions, whereas the C5 attack produces unstable adducts, which rapidly decompose to NIm lesions. The maximum yields of the nitro products (NIm + 8-nitro-G) were typically in the range of 20-40%, depending on the number of guanine residues in the sequence. The ratio of the NIm to 8-nitro-G lesions gradually decreases from 3.4 in the model compound, 2',3',5'-tri-O-acetylguanosine, to 2.1-2.6 in the single-stranded oligodeoxynucleotides and to 0.8-1.1 in the duplexes. The adduct of the 5'-d(ACC CG(1)C G(2)TC C) oligodeoxynucleotide containing the NIm lesion in codon 157 (G(2)) was isolated in HPLC-pure form. The integrity of this adduct was established by a detailed analysis of exonuclease digestion

Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

PubMed

Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J

1994-08-16

We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.

An in vivo and in silico approach to study cis-antisense: a short cut to higher order response

NASA Astrophysics Data System (ADS)

Courtney, Colleen; Varanasi, Usha; Chatterjee, Anushree

2014-03-01

Antisense interactions are present in all domains of life. Typically sense, antisense RNA pairs originate from overlapping genes with convergent face to face promoters, and are speculated to be involved in gene regulation. Recent studies indicate the role of transcriptional interference (TI) in regulating expression of genes in convergent orientation. Modeling antisense, TI gene regulation mechanisms allows us to understand how organisms control gene expression. We present a modeling and experimental framework to understand convergent transcription that combines the effects of transcriptional interference and cis-antisense regulation. Our model shows that combining transcriptional interference and antisense RNA interaction adds multiple-levels of regulation which affords a highly tunable biological output, ranging from first order response to complex higher-order response. To study this system we created a library of experimental constructs with engineered TI and antisense interaction by using face-to-face inducible promoters separated by carefully tailored overlapping DNA sequences to control expression of a set of fluorescent reporter proteins. Studying this gene expression mechanism allows for an understanding of higher order behavior of gene expression networks.

Sense-antisense (complementary) peptide interactions and the proteomic code; potential opportunities in biology and pharmaceutical science.

PubMed

Miller, Andrew D

2015-02-01

A sense peptide can be defined as a peptide whose sequence is coded by the nucleotide sequence (read 5' → 3') of the sense (positive) strand of DNA. Conversely, an antisense (complementary) peptide is coded by the corresponding nucleotide sequence (read 5' → 3') of the antisense (negative) strand of DNA. Research has been accumulating steadily to suggest that sense peptides are capable of specific interactions with their corresponding antisense peptides. Unfortunately, although more and more examples of specific sense-antisense peptide interactions are emerging, the very idea of such interactions does not conform to standard biology dogma and so there remains a sizeable challenge to lift this concept from being perceived as a peripheral phenomenon if not worse, into becoming part of the scientific mainstream. Specific interactions have now been exploited for the inhibition of number of widely different protein-protein and protein-receptor interactions in vitro and in vivo. Further, antisense peptides have also been used to induce the production of antibodies targeted to specific receptors or else the production of anti-idiotypic antibodies targeted against auto-antibodies. Such illustrations of utility would seem to suggest that observed sense-antisense peptide interactions are not just the consequence of a sequence of coincidental 'lucky-hits'. Indeed, at the very least, one might conclude that sense-antisense peptide interactions represent a potentially new and different source of leads for drug discovery. But could there be more to come from studies in this area? Studies on the potential mechanism of sense-antisense peptide interactions suggest that interactions may be driven by amino acid residue interactions specified from the genetic code. If so, such specified amino acid residue interactions could form the basis for an even wider amino acid residue interaction code (proteomic code) that links gene sequences to actual protein structure and function, even

Natural antisense RNAs as mRNA regulatory elements in bacteria: a review on function and applications.

PubMed

Saberi, Fatemeh; Kamali, Mehdi; Najafi, Ali; Yazdanparast, Alavieh; Moghaddam, Mehrdad Moosazadeh

2016-01-01

Naturally occurring antisense RNAs are small, diffusible, untranslated transcripts that pair to target RNAs at specific regions of complementarity to control their biological function by regulating gene expression at the post-transcriptional level. This review focuses on known cases of antisense RNA control in prokaryotes and provides an overview of some natural RNA-based mechanisms that bacteria use to modulate gene expression, such as mRNA sensors, riboswitches and antisense RNAs. We also highlight recent advances in RNA-based technology. The review shows that studies on both natural and synthetic systems are reciprocally beneficial.

ISIS 301012 gene therapy for hypercholesterolemia: sense, antisense, or nonsense?

PubMed

Ito, Matthew K

2007-10-01

To present an overview of antisense technology and to review and assess available literature on the chemistry, pharmacology, pharmacokinetics, drug interactions, preclinical and clinical studies, dosing, and adverse events of ISIS 301012 in the treatment of hyperlipidemia. PubMed database searches were conducted from 1966 to May 2007 using the search terms ISIS 301012, antisense, oligonucleotide, hypercholesterolemia, hyperlipidemia, and apolipoprotein B. Bibliographies of relevant review articles and information from the manufacturer were reviewed for additional references. Available English-language literature, including abstracts, preclinical, and clinical trials, review articles, and scientific presentations were examined. Apolipoprotein B is an important structural protein on the surface of atherogenic lipoproteins such as remnant very-low-density lipoprotein and low-density lipoprotein and facilitates the clearance of these particles from the circulation by binding to the low-density lipoprotein receptor. Overproduction of apolipoprotein B or reduced receptor-mediated clearance of lipoproteins leads to elevated serum cholesterol levels and premature atherosclerosis. ISIS 301012 is an antisense oligonucleotide that inhibits apolipoprotein B production by binding directly to and reducing the expression of apolipoprotein B messenger RNA. In a clinical trial, ISIS 301012 50-400 mg administered weekly via subcutaneous injection for 4 weeks reduced apolipoprotein B by 14.3-47.4% and low-density lipoprotein cholesterol by 5.9-40% at 55 days. The most frequent adverse event was injection-site erythema that resolved spontaneously. Studies are ongoing to further define the safety, efficacy, and pharmacokinetics of ISIS 301012 as add-on therapy in patients with heterozygous and homozygous familial hypercholesterolemia. No pharmacokinetic interactions have been demonstrated with ezetimibe and simvastatin. ISIS 301012 is the first agent to enter clinical trials utilizing

Antisense oligonucleotides as innovative therapeutic strategy in the treatment of high-grade gliomas.

PubMed

Caruso, Gerardo; Caffo, Mariella; Raudino, Giuseppe; Alafaci, Concetta; Salpietro, Francesco M; Tomasello, Francesco

2010-01-01

Despite the intensive recent research in cancer therapy, the prognosis in patients affected by high-grade gliomas is still very unfavorable. The efficacy of classical anti-cancer strategies is seriously limited by lack of specific therapies against malignant cells. The extracellular matrix plays a pivotal role in processes such as differentiation, apoptosis, and migration in both the normal and the pathologic nervous system. Glial tumors seem to be able to create a favorable environment for the invasion of glioma cells in cerebral parenchyma when they combine with the extracellular matrix via cell surface receptors. Glioma cells synthesize matrix proteins, such as tenascin, laminin, fibronectin that facilitate the tumor cell's motility. New treatments have shown to hit the acting molecules in the tumor growth and to increase the efficacy and minimize the toxicity. Antisense oligonucleotides are synthetic stretches of DNA which hybridize with specific mRNA strands. The specificity of hybridization makes antisense method an interesting strategy to selectively modulate the expression of genes involved in tumorigenesis. In this review we will focus on the mechanisms of action of antisense oligonucleotides and report clinical and experimental studies on the treatment of high-grade gliomas. We will also report the patents of preclinical and/or clinical studies that adopt the antisense oligonucleotide therapy list in cerebral gliomas.

Flowering time control: another window to the connection between antisense RNA and chromatin.

PubMed

Ietswaart, Robert; Wu, Zhe; Dean, Caroline

2012-09-01

A high proportion of all eukaryotic genes express antisense RNA (asRNA), which accumulates to varying degrees at different loci. Whether there is a general function for asRNA is unknown, but its widespread occurrence and frequent regulation by stress suggest an important role. The best-characterized plant gene exhibiting a complex antisense transcript pattern is the Arabidopsis floral regulator FLOWERING LOCUS C (FLC). Changes occur in the accumulation, splicing, and polyadenylation of this antisense transcript, termed COOLAIR, in different environments and genotypes. These changes are associated with altered chromatin regulation and differential FLC expression, provoking mechanistic comparisons with many well-studied loci in yeast and mammals. Detailed analysis of these specific examples may shed light on the complex interplay between asRNA and chromatin modifications in different genomes. Copyright © 2012 Elsevier Ltd. All rights reserved.

Intra-Amygdala Injections of CREB Antisense Impair Inhibitory Avoidance Memory: Role of Norepinephrine and Acetylcholine

ERIC Educational Resources Information Center

Canal, Clinton E.; Chang, Qing; Gold, Paul E.

2008-01-01

Infusions of CREB antisense into the amygdala prior to training impair memory for aversive tasks, suggesting that the antisense may interfere with CRE-mediated gene transcription and protein synthesis important for the formation of new memories within the amygdala. However, the amygdala also appears to modulate memory formation in distributed…

cis-antisense RNA, another level of gene regulation in bacteria.

PubMed

Georg, Jens; Hess, Wolfgang R

2011-06-01

A substantial amount of antisense transcription is a hallmark of gene expression in eukaryotes. However, antisense transcription was first demonstrated in bacteria almost 50 years ago. The transcriptomes of bacteria as different as Helicobacter pylori, Bacillus subtilis, Escherichia coli, Synechocystis sp. strain PCC6803, Mycoplasma pneumoniae, Sinorhizobium meliloti, Geobacter sulfurreducens, Vibrio cholerae, Chlamydia trachomatis, Pseudomonas syringae, and Staphylococcus aureus have now been reported to contain antisense RNA (asRNA) transcripts for a high percentage of genes. Bacterial asRNAs share functional similarities with trans-acting regulatory RNAs, but in addition, they use their own distinct mechanisms. Among their confirmed functional roles are transcription termination, codegradation, control of translation, transcriptional interference, and enhanced stability of their respective target transcripts. Here, we review recent publications indicating that asRNAs occur as frequently in simple unicellular bacteria as they do in higher organisms, and we provide a comprehensive overview of the experimentally confirmed characteristics of asRNA actions and intimately linked quantitative aspects. Emerging functional data suggest that asRNAs in bacteria mediate a plethora of effects and are involved in far more processes than were previously anticipated. Thus, the functional impact of asRNAs should be considered when developing new strategies against pathogenic bacteria and when optimizing bacterial strains for biotechnology.

cis-Antisense RNA, Another Level of Gene Regulation in Bacteria

PubMed Central

Georg, Jens; Hess, Wolfgang R.

2011-01-01

Summary: A substantial amount of antisense transcription is a hallmark of gene expression in eukaryotes. However, antisense transcription was first demonstrated in bacteria almost 50 years ago. The transcriptomes of bacteria as different as Helicobacter pylori, Bacillus subtilis, Escherichia coli, Synechocystis sp. strain PCC6803, Mycoplasma pneumoniae, Sinorhizobium meliloti, Geobacter sulfurreducens, Vibrio cholerae, Chlamydia trachomatis, Pseudomonas syringae, and Staphylococcus aureus have now been reported to contain antisense RNA (asRNA) transcripts for a high percentage of genes. Bacterial asRNAs share functional similarities with trans-acting regulatory RNAs, but in addition, they use their own distinct mechanisms. Among their confirmed functional roles are transcription termination, codegradation, control of translation, transcriptional interference, and enhanced stability of their respective target transcripts. Here, we review recent publications indicating that asRNAs occur as frequently in simple unicellular bacteria as they do in higher organisms, and we provide a comprehensive overview of the experimentally confirmed characteristics of asRNA actions and intimately linked quantitative aspects. Emerging functional data suggest that asRNAs in bacteria mediate a plethora of effects and are involved in far more processes than were previously anticipated. Thus, the functional impact of asRNAs should be considered when developing new strategies against pathogenic bacteria and when optimizing bacterial strains for biotechnology. PMID:21646430

PLGA-PEG-PLGA microspheres as a delivery vehicle for antisense oligonucleotides to CTGF: Implications on post-surgical peritoneal adhesion prevention

NASA Astrophysics Data System (ADS)

Azeke, John Imuetinyan-Jesu, Jr.

Abdominal adhesions are the aberrant result of peritoneal wound healing commonly associated with surgery and inflammation. A subject of a large number of studies since the first half of the last century, peritoneal adhesion prevention has, for the most part, evaded the scientific community and continues to cost Americans an estimated $2-4 billion annually. It is known that transforming growth factor-beta (TGF-beta) plays a key role in the wound healing cascade; however, suppression of this multifunctional growth factor's activity may have more harmful consequences than can be tolerated. As a result, much attention has fallen on connective tissue growth factor (CTGF), a downstream mediator of TGF-beta's fibrotic action. It has been demonstrated in several in vitro models, that the suppression of CTGF hinders fibroblast proliferation, a necessary condition for fibrosis. Furthermore, antisense oligonucleotides (antisense oligos, AO) to CTGF have been shown to knock down CTGF mRNA levels by specifically hindering the translation of CTGF protein. Antisense technologies have met with a great deal of excitement as a viable means of preventing diseases such as adhesions by hindering protein translation at the mRNA level. However, the great challenge associated with the use of these drugs lies in the short circulation time when administered "naked". Viral delivery systems, although excellent platforms in metabolic studies, are not ideal for diagnostic use because of the inherent danger associated with viral vectors. Microparticles made of biodegradable polymers have therefore presented themselves as a viable means of delivering these drugs to target cells over extended periods. Herein, we present two in vivo studies confirming the up-regulation of TGF-beta protein and CTGF mRNA following injury to the uterine tissues of female rats. We were able to selectively knockdown post-operative CTGF protein levels following surgery, however, our observations led us to conclude that

Diversity of Antisense and Other Non-Coding RNAs in Archaea Revealed by Comparative Small RNA Sequencing in Four Pyrobaculum Species

PubMed Central

Bernick, David L.; Dennis, Patrick P.; Lui, Lauren M.; Lowe, Todd M.

2012-01-01

A great diversity of small, non-coding RNA (ncRNA) molecules with roles in gene regulation and RNA processing have been intensely studied in eukaryotic and bacterial model organisms, yet our knowledge of possible parallel roles for small RNAs (sRNA) in archaea is limited. We employed RNA-seq to identify novel sRNA across multiple species of the hyperthermophilic genus Pyrobaculum, known for unusual RNA gene characteristics. By comparing transcriptional data collected in parallel among four species, we were able to identify conserved RNA genes fitting into known and novel families. Among our findings, we highlight three novel cis-antisense sRNAs encoded opposite to key regulatory (ferric uptake regulator), metabolic (triose-phosphate isomerase), and core transcriptional apparatus genes (transcription factor B). We also found a large increase in the number of conserved C/D box sRNA genes over what had been previously recognized; many of these genes are encoded antisense to protein coding genes. The conserved opposition to orthologous genes across the Pyrobaculum genus suggests similarities to other cis-antisense regulatory systems. Furthermore, the genus-specific nature of these sRNAs indicates they are relatively recent, stable adaptations. PMID:22783241

Notch-1 regulates pulmonary neuroendocrine cell differentiation in cell lines and in transgenic mice.

PubMed

Shan, Lin; Aster, Jon C; Sklar, Jeffrey; Sunday, Mary E

2007-02-01

The notch gene family encodes transmembrane receptors that regulate cell differentiation by interacting with surface ligands on adjacent cells. Previously, we demonstrated that tumor necrosis factor-alpha (TNF) induces neuroendocrine (NE) cell differentiation in H82, but not H526, undifferentiated small cell lung carcinoma lines. We now test the hypothesis that TNF mediates NE cell differentiation in part by altering Notch gene expression. First, using RT-PCR, we determined that TNF treatment of H82, but not H526, transiently decreases notch-1 mRNA in parallel with induction of gene expression for the NE-specific marker DOPA decarboxylase (DDC). Second, we treated H82 and H526 with notch-1 antisense vs. sense oligodeoxynucleotides. Using quantitative RT-PCR and Western analyses we demonstrate that DDC mRNA and protein are increased in H82 by notch-1 antisense, whereas notch-1 mRNA and activated Notch-1 protein are decreased. mRNA for Hes1, a transcription factor downstream from activated Notch, is also decreased by Notch-1 antisense in H82 but not H526. After 7 days of Notch-1 antisense treatment, neural cell adhesion molecule (NCAM) immunoreactivity is induced in H82 but not H526. Third, we generated transgenic mice bearing notch-1 driven by the neural/NE-specific calcitonin promoter, which express activated Notch-1 in developing lung epithelium. Newborn NotchCal mouse lungs have high levels of hes1 mRNA, reflecting increased activated Notch, compared with wild-type. NotchCal lungs have decreased CGRP-positive NE cells, decreased protein gene product 9.5 (PGP9.5)-positive NE cells, and decreased gastrin-releasing peptide (GRP), CGRP, and DDC mRNA levels compared with normal littermates. Cumulatively, these observations provide further support for a role for Notch-1 signaling in regulating pulmonary NE cell differentiation.

Identification and Characterization of a Cis Antisense RNA of the rpoH Gene of Salmonella enterica Serovar Typhi.

PubMed

Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang

2018-01-01

Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .

Review on investigations of antisense oligonucleotides with the use of mass spectrometry.

PubMed

Studzińska, Sylwia

2018-01-01

Antisense oligonucleotides have been investigated as potential drugs for years. They inhibit target gene or protein expression. The present review summarizes their modifications, modes of action, and applications of liquid chromatography coupled with mass spectrometry for qualitative and quantitative analysis of these compounds. The most recent reports on a given topic were given prominence, while some early studies were reviewed in order to provide a theoretical background. The present review covers the issues of using ion-exchange chromatography, ion-pair reversed-phase high performance liquid chromatography and hydrophilic interaction chromatography for the separation of antisense oligonucleotides. The application of mass spectrometry was described with regard to the ionization type used for the determination of these potential therapeutics. Moreover, the current approaches and applications of mass spectrometry for quantitative analysis of antisense oligonucleotides and their metabolites as well as their impurities during in vitro and in vivo studies were discussed. Finally, certain conclusions and perspectives on the determination of therapeutic oligonucleotides in various samples were briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.

Safety of antisense oligonucleotide and siRNA-based therapeutics.

PubMed

Chi, Xuan; Gatti, Philip; Papoian, Thomas

2017-05-01

Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events. Published by Elsevier Ltd.

Improving Breast Cancer Diagnosis by Antisense Targeting

DTIC Science & Technology

2007-08-01

aminohexanoic acid linker (21st Century Biochemicals, Mar- lboro, MA). The biotinylated cholesterol was synthesized by reacting biotinyl-3,6...radiolabel was placed on the MORF. The model carriers were a tat and a polyarginine peptide and cholesterol . The 25 mer MORF was selected as a suitable test...the MORF/streptavidin/ cholesterol accumulations were lower but stil1 significant). Furthermore, accumulations of the antisense MORF/streptavidin

Antisense oligonucleotides for the treatment of dyslipidaemia.

PubMed

Visser, Maartje E; Witztum, Joseph L; Stroes, Erik S G; Kastelein, John J P

2012-06-01

Antisense oligonucleotides (ASOs) are short synthetic analogues of natural nucleic acids designed to specifically bind to a target messenger RNA (mRNA) by Watson-Crick hybridization, inducing selective degradation of the mRNA or prohibiting translation of the selected mRNA into protein. Antisense technology has the ability to inhibit unique targets with high specificity and can be used to inhibit synthesis of a wide range of proteins that could influence lipoprotein levels and other targets. A number of different classes of antisense agents are under development. To date, mipomersen, a 2'-O-methoxyethyl phosphorothioate 20-mer ASO, is the most advanced ASO in clinical development. It is a second-generation ASO developed to inhibit the synthesis of apolipoprotein B (apoB)-100 in the liver. In Phase 3 clinical trials, mipomersen has been shown to significantly reduce plasma low-density lipoprotein cholesterol (LDL-c) as well as other atherogenic apoB containing lipoproteins such as lipoprotein (a) [Lp(a)] and small-dense LDL particles. Although concerns have been raised because of an increase in intrahepatic triglyceride content, preliminary data from long-term studies suggest that with continued treatment, liver fat levels tend to stabilize or decline. Further studies are needed to evaluate potential clinical relevance of these changes. Proprotein convertase subtilisin/kexin-9 (PCSK9) is another promising novel target for lowering LDL-c by ASOs. Both second-generation ASOs and ASOs using locked nucleic acid technology have been developed to inhibit PCSK9 and are under clinical development. Other targets currently being addressed include apoC-III and apo(a) or Lp(a). By directly inhibiting the synthesis of specific proteins, ASO technology offers a promising new approach to influence the metabolism of lipids and to control lipoprotein levels. Its application to a wide variety of potential targets can be expected if these agents prove to be clinically safe and

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Analysis of Antisense Expression by Whole Genome Tiling Microarrays and siRNAs Suggests Mis-Annotation of Arabidopsis Orphan Protein-Coding Genes

PubMed Central

Richardson, Casey R.; Luo, Qing-Jun; Gontcharova, Viktoria; Jiang, Ying-Wen; Samanta, Manoj; Youn, Eunseog; Rock, Christopher D.

2010-01-01

Background MicroRNAs (miRNAs) and trans-acting small-interfering RNAs (tasi-RNAs) are small (20–22 nt long) RNAs (smRNAs) generated from hairpin secondary structures or antisense transcripts, respectively, that regulate gene expression by Watson-Crick pairing to a target mRNA and altering expression by mechanisms related to RNA interference. The high sequence homology of plant miRNAs to their targets has been the mainstay of miRNA prediction algorithms, which are limited in their predictive power for other kingdoms because miRNA complementarity is less conserved yet transitive processes (production of antisense smRNAs) are active in eukaryotes. We hypothesize that antisense transcription and associated smRNAs are biomarkers which can be computationally modeled for gene discovery. Principal Findings We explored rice (Oryza sativa) sense and antisense gene expression in publicly available whole genome tiling array transcriptome data and sequenced smRNA libraries (as well as C. elegans) and found evidence of transitivity of MIRNA genes similar to that found in Arabidopsis. Statistical analysis of antisense transcript abundances, presence of antisense ESTs, and association with smRNAs suggests several hundred Arabidopsis ‘orphan’ hypothetical genes are non-coding RNAs. Consistent with this hypothesis, we found novel Arabidopsis homologues of some MIRNA genes on the antisense strand of previously annotated protein-coding genes. A Support Vector Machine (SVM) was applied using thermodynamic energy of binding plus novel expression features of sense/antisense transcription topology and siRNA abundances to build a prediction model of miRNA targets. The SVM when trained on targets could predict the “ancient” (deeply conserved) class of validated Arabidopsis MIRNA genes with an accuracy of 84%, and 76% for “new” rapidly-evolving MIRNA genes. Conclusions Antisense and smRNA expression features and computational methods may identify novel MIRNA genes and other non

Fear extinction requires Arc/Arg3.1 expression in the basolateral amygdala.

PubMed

Onoue, Kousuke; Nakayama, Daisuke; Ikegaya, Yuji; Matsuki, Norio; Nomura, Hiroshi

2014-04-23

Prolonged re-exposure to a fear-eliciting cue in the absence of an aversive event extinguishes the fear response to the cue, and has been clinically used as an exposure therapy. Arc (also known as Arg3.1) is implicated in synaptic and experience-dependent plasticity. Arc is regulated by the transcription factor cAMP response element binding protein, which is upregulated with and necessary for fear extinction. Because Arc expression is also activated with fear extinction, we hypothesized that Arc expression is required for fear extinction. Extinction training increased the proportion of Arc-labeled cells in the basolateral amygdala (BLA). Arc was transcribed during latter part of extinction training, which is possibly associated with fear extinction, as well as former part of extinction training. Intra-BLA infusions of Arc antisense oligodeoxynucleotide (ODN) before extinction training impaired long-term but not short-term extinction memory. Intra-BLA infusions of Arc antisense ODN 3 h after extinction training had no effect on fear extinction. Our findings demonstrate that Arc is required for long-term extinction of conditioned fear and contribute to the understanding of extinction as a therapeutic manner.

AntiHunter 2.0: increased speed and sensitivity in searching BLAST output for EST antisense transcripts.

PubMed

Lavorgna, Giovanni; Triunfo, Riccardo; Santoni, Federico; Orfanelli, Ugo; Noci, Sara; Bulfone, Alessandro; Zanetti, Gianluigi; Casari, Giorgio

2005-07-01

An increasing number of eukaryotic and prokaryotic genes are being found to have natural antisense transcripts (NATs). There is also growing evidence to suggest that antisense transcription could play a key role in many human diseases. Consequently, there have been several recent attempts to set up computational procedures aimed at identifying novel NATs. Our group has developed the AntiHunter program for the identification of expressed sequence tag (EST) antisense transcripts from BLAST output. In order to perform an analysis, the program requires a genomic sequence plus an associated list of transcript names and coordinates of the genomic region. After masking the repeated regions, the program carries out a BLASTN search of this sequence in the selected EST database, reporting via email the EST entries that reveal an antisense transcript according to the user-supplied list. Here, we present the newly developed version 2.0 of the AntiHunter tool. Several improvements have been added to this version of the program in order to increase its ability to detect a larger number of antisense ESTs. As a result, AntiHunter can now detect, on average, >45% more antisense ESTs with little or no increase in the percentage of the false positives. We also raised the maximum query size to 3 Mb (previously 1 Mb). Moreover, we found that a reasonable trade-off between the program search sensitivity and the maximum allowed size of the input-query sequence could be obtained by querying the database with the MEGABLAST program, rather than by using the BLAST one. We now offer this new opportunity to users, i.e. if choosing the MEGABLAST option, users can input a query sequence up to 30 Mb long, thus considerably improving the possibility to analyze longer query regions. The AntiHunter tool is freely available at http://bioinfo.crs4.it/AH2.0.

Expression of cathepsin S antisense transcripts by adenovirus in retinal pigment epithelial cells.

PubMed

Rakoczy, P E; Lai, M C; Baines, M G; Spilsbury, K; Constable, I J

1998-10-01

To show the production of sense or antisense transcripts by recombinant adenoviruses, to investigate whether the transcripts produced were suitable for downregulating the expression of the targeted gene, cathepsin S (CatS), and to examine the effect of antisense transcript production on the biologic function of retinal pigment epithelial (RPE) cells, including the regulation of endogenous aspartic protease expression. Ad.MLP.CatSAS, Ad.RSV.CatSAS, and Ad.MLP.CatSS recombinant viruses were produced by homologous recombination. The recombinant viruses were tested by restriction enzyme digestion to confirm the orientation of the inserts. The expression of antisense transcripts was tested by northern blot analysis. Western blot analysis was used to study the regulation of the endogenous CatS protein in ARPE19 cells. The biologic effect of CatS downregulation in ARPE19 cells was tested by proliferation and phagocytosis assays, de novo cathepsin D (CatD) synthesis, and measurement of aspartic protease activity. After characterization of the recombinant adenovirus constructs, the production of antisense and sense CatS transcripts was shown in ARPE19 cells. The transcripts appeared at approximately 1.9 kb 48 hours after transduction, and the expression of the antisense transcripts was similar in constructs carrying either the MLP or the RSV promoter. Western blot analysis showed that ARPE19 cells transduced with Ad.MLP.CatSAS and Ad.RSV.CatSAS had no detectable CatS. In contrast, there was a strong signal appearing at 24 kDa in ARPE19 cells transduced with Ad.MLP.CatSS. ARPE19 cells were transduced to a high level. The transduction of ARPE19 cells with the recombinant adenoviruses did not affect the morphologic appearance of the cells, their proliferation, or their phagocytosing ability. However, ARPE19 cells transduced by Ad.MLP.CatSAS recombinant adenovirus showed a significant downregulation of de novo CatD synthesis and a twofold decrease in aspartic protease activity

Suppression of cell division by pKi-67 antisense-RNA and recombinant protein.

PubMed

Duchrow, M; Schmidt, M H; Zingler, M; Anemüller, S; Bruch, H P; Broll, R

2001-01-01

The human antigen defined by the monoclonal antibody Ki-67 (pKi-67) is a human nuclear protein strongly associated with cell proliferation and found in all tissues studied. It is widely used as a marker of proliferating cells, yet its function is unknown. To investigate its function we suppressed pKi-67 expression by antisense RNA and overexpressed a partial structure of pKi-67 in HeLa cells. A BrdU-incorporation assay showed a significant decrease in DNA synthesis after antisense inhibition. Cell cycle analysis indicated a higher proportion of cells in G1 phase and a lower proportion of cells in S phase while the number of G(2)/M phase cells remained constant. Overexpression of a recombinant protein encoding three of the repetitive elements from exon 13 of pKi-67 had a similar effect to that obtained by antisense inhibition. The similarity of the effect of expressing 'Ki-67 repeats' and pKi-67 antisense RNA could be explained by a negative effect on the folding of the endogenous protein in the endoplasmatic reticulum. Furthermore excessive self-association of pKi-67 via the repeat structure could inhibit its nuclear transport, preventing it from getting to its presumptive site of action. We conclude that the Ki-67 protein has an important role in the regulation of the cell cycle, which is mediated in part by its repetitive elements. Copyright 2001 S. Karger AG, Basel

Natural antisense transcripts associated with salinity response in alfalfa

USDA-ARS?s Scientific Manuscript database

Natural antisense transcripts (NATs) are long non-coding RNAs (lncRNAs) complimentary to the messenger (sense) RNA (Wang et al. 2014). Many of them are involved in regulation of their own sense transcripts thus playing pivotal biological roles in all processes of organismal development and responses...

Identification and Characterization of a Cis-Encoded Antisense RNA Associated with the Replication Process of Salmonella enterica Serovar Typhi

PubMed Central

Dadzie, Isaac; Xu, Shungao; Ni, Bin; Zhang, Xiaolei; Zhang, Haifang; Sheng, Xiumei; Xu, Huaxi; Huang, Xinxiang

2013-01-01

Antisense RNAs that originate from the complementary strand of protein coding genes are involved in the regulation of gene expression in all domains of life. In bacteria, some of these antisense RNAs are transcriptional noise whiles others play a vital role to adapt the cell to changing environmental conditions. By deep sequencing analysis of transcriptome of Salmonella enterica serovar Typhi, a partial RNA sequence encoded in-cis to the dnaA gene was revealed. Northern blot and RACE analysis confirmed the transcription of this antisense RNA which was expressed mostly in the stationary phase of the bacterial growth and also under iron limitation and osmotic stress. Pulse expression analysis showed that overexpression of the antisense RNA resulted in a significant increase in the mRNA levels of dnaA, which will ultimately enhance their translation. Our findings have revealed that antisense RNA of dnaA is indeed transcribed not merely as a by-product of the cell's transcription machinery but plays a vital role as far as stability of dnaA mRNA is concerned. PMID:23637809

COOLAIR Antisense RNAs Form Evolutionarily Conserved Elaborate Secondary Structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hawkes, Emily J.; Hennelly, Scott P.; Novikova, Irina V.

There is considerable debate about the functionality of long non-coding RNAs (lncRNAs). Lack of sequence conservation has been used to argue against functional relevance. Here, we investigated antisense lncRNAs, called COOLAIR, at the A. thaliana FLC locus and experimentally determined their secondary structure. The major COOLAIR variants are highly structured, organized by exon. The distally polyadenylated transcript has a complex multi-domain structure, altered by a single non-coding SNP defining a functionally distinct A. thaliana FLC haplotype. The A. thaliana COOLAIR secondary structure was used to predict COOLAIR exons in evolutionarily divergent Brassicaceae species. These predictions were validated through chemical probingmore » and cloning. Despite the relatively low nucleotide sequence identity, the structures, including multi-helix junctions, show remarkable evolutionary conservation. In a number of places, the structure is conserved through covariation of a non-contiguous DNA sequence. This structural conservation supports a functional role for COOLAIR transcripts rather than, or in addition to, antisense transcription.« less

COOLAIR Antisense RNAs Form Evolutionarily Conserved Elaborate Secondary Structures

DOE PAGES

Hawkes, Emily J.; Hennelly, Scott P.; Novikova, Irina V.; ...

2016-09-20

There is considerable debate about the functionality of long non-coding RNAs (lncRNAs). Lack of sequence conservation has been used to argue against functional relevance. Here, we investigated antisense lncRNAs, called COOLAIR, at the A. thaliana FLC locus and experimentally determined their secondary structure. The major COOLAIR variants are highly structured, organized by exon. The distally polyadenylated transcript has a complex multi-domain structure, altered by a single non-coding SNP defining a functionally distinct A. thaliana FLC haplotype. The A. thaliana COOLAIR secondary structure was used to predict COOLAIR exons in evolutionarily divergent Brassicaceae species. These predictions were validated through chemical probingmore » and cloning. Despite the relatively low nucleotide sequence identity, the structures, including multi-helix junctions, show remarkable evolutionary conservation. In a number of places, the structure is conserved through covariation of a non-contiguous DNA sequence. This structural conservation supports a functional role for COOLAIR transcripts rather than, or in addition to, antisense transcription.« less

Angubindin-1 opens the blood-brain barrier in vivo for delivery of antisense oligonucleotide to the central nervous system.

PubMed

Zeniya, Satoshi; Kuwahara, Hiroya; Daizo, Kaiichi; Watari, Akihiro; Kondoh, Masuo; Yoshida-Tanaka, Kie; Kaburagi, Hidetoshi; Asada, Ken; Nagata, Tetsuya; Nagahama, Masahiro; Yagi, Kiyohito; Yokota, Takanori

2018-05-17

Within the field of RNA therapeutics, antisense oligonucleotide-based therapeutics are a potentially powerful means of treating intractable diseases. However, if these therapeutics are used for the treatment of neurological disorders, safe yet efficient methods of delivering antisense oligonucleotides across the blood-brain barrier to the central nervous system must be developed. Here, we examined the use of angubindin-1, a binder to the tricellular tight junction, to modulate paracellular transport between brain microvascular endothelial cells in the blood-brain barrier for the delivery of antisense oligonucleotides to the central nervous system. This proof-of-concept study demonstrated that intravenously injected angubindin-1 increased the permeability of the blood-brain barrier and enabled transient delivery of subsequently administered antisense oligonucleotides into the mouse brain and spinal cord, leading to silencing of a target RNA without any overt adverse effects. We also found that two bicellular tight junction modulators did not produce such a silencing effect, suggesting that the tricellular tight junction is likely a better target for the delivery of antisense oligonucleotides than the bicellular tight junction. Our delivery strategy of modulating the tricellular tight junction in the blood-brain barrier via angubindin-1 provides a novel avenue of research for the development of antisense oligonucleotide-based therapeutics for the treatment of neurological disorders. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

A long antisense RNA in plant chloroplasts.

PubMed

Georg, J; Honsel, A; Voss, B; Rennenberg, H; Hess, W R

2010-05-01

Based on computational prediction of RNA secondary structures, a long antisense RNA (asRNA) was found in chloroplasts of Arabidopsis, Nicotiana tabacum and poplar, which occurs in two to three major transcripts. Mapping of primary 5' ends, northern hybridizations and quantitative real-time reverse transcription polymerase chain reaction (qPCR) experiments demonstrated that these transcripts originate from a promoter that is typical for the plastid-encoded RNA polymerase and are over their full length in antisense orientation to the gene ndhB and therefore were designated asRNA_ndhB. The asRNA_ndhB transcripts predominantly accumulate in young leaves and at physiological growth temperatures. Two nucleotide positions in the mRNA that are subject to C-to-U RNA editing and which were previously found to be sensitive to elevated temperatures are covered by asRNA_ndhB. Nevertheless, the correlation between the accumulation of asRNA_ndhB and RNA editing appeared weak in a temperature shift experiment. With asRNA_ndhB, we describe the first asRNA of plant chloroplasts that covers RNA editing sites, as well as a group II intron splice acceptor site, and that is under developmental control, raising the possibility that long asRNAs could be involved in RNA maturation or the control of RNA stability.

On the role of methacrylic acid copolymers in the intracellular delivery of antisense oligonucleotides.

PubMed

Yessine, Marie-Andrée; Meier, Christian; Petereit, Hans-Ulrich; Leroux, Jean-Christophe

2006-05-01

The delivery of active biomacromolecules to the cytoplasm is a major challenge as it is generally hindered by the endosomal/lysosomal barrier. Synthetic titratable polyanions can overcome this barrier by destabilizing membrane bilayers at pH values typically found in endosomes. This study investigates how anionic polyelectrolytes can enhance the cytoplasmic delivery of an antisense oligonucleotide (ODN). Novel methacrylic acid (MAA) copolymers were examined for their pH-sensitive properties and ability to destabilize cell membranes in a pH-dependent manner. Ternary complex formulations prepared with the ODN, a cationic lipid and a MAA copolymer were systematically characterized with respect to their size, zeta potential, antisense activity, cytotoxicity and cellular uptake using the A549 human lung carcinoma cell line. The MAA copolymer substantially increased the activity of the antisense ODN in inhibiting the expression of protein kinase C-alpha. Uptake, cytotoxicity and antisense activity were strongly dependent on copolymer concentration. Metabolic inhibitors demonstrated that endocytosis was the major internalization pathway of the complexes, and that endosomal acidification was essential for ODN activity. Confocal microscopy analysis of cells incubated with fluorescently-labeled complexes revealed selective delivery of the ODN, but not of the copolymer, to the cytoplasm/nucleus. This study provides new insight into the mechanisms of intracellular delivery of macromolecular drugs, using synthetic anionic polyelectrolytes.

A multifactor regulatory circuit involving H-NS, VirF and an antisense RNA modulates transcription of the virulence gene icsA of Shigella flexneri.

PubMed

Tran, Chi Nhan; Giangrossi, Mara; Prosseda, Gianni; Brandi, Anna; Di Martino, Maria Letizia; Colonna, Bianca; Falconi, Maurizio

2011-10-01

The icsA gene of Shigella encodes a structural protein involved in colonization of the intestinal mucosa by bacteria. This gene is expressed upon invasion of the host and is controlled by a complex regulatory circuit involving the nucleoid protein H-NS, the AraC-like transcriptional activator VirF, and a 450 nt antisense RNA (RnaG) acting as transcriptional attenuator. We investigated on the interplay of these factors at the molecular level. DNase I footprints reveal that both H-NS and VirF bind to a region including the icsA and RnaG promoters. H-NS is shown to repress icsA transcription at 30°C but not at 37°C, suggesting a significant involvement of this protein in the temperature-regulated expression of icsA. We also demonstrate that VirF directly stimulates icsA transcription and is able to alleviate H-NS repression in vitro. According to these results, icsA expression is derepressed in hns- background and overexpressed when VirF is provided in trans. Moreover, we find that RnaG-mediated transcription attenuation depends on 80 nt at its 5'-end, a stretch carrying the antisense region. Bases engaged in the initial contact leading to sense-antisense pairing have been identified using synthetic RNA and DNA oligonucleotides designed to rebuild and mutagenize the two stem-loop motifs of the antisense region.

AP-1 Oligodeoxynucleotides Reduce Aortic Elastolysis in a Murine Model of Marfan Syndrome.

PubMed

Arif, Rawa; Zaradzki, Marcin; Remes, Anca; Seppelt, Philipp; Kunze, Reiner; Schröder, Hannes; Schwill, Simon; Ensminger, Stephan M; Robinson, Peter N; Karck, Matthias; Müller, Oliver J; Hecker, Markus; Wagner, Andreas H; Kallenbach, Klaus

2017-12-15

Marfan syndrome is characterized by high expression of matrix metalloproteinases (MMPs) in aortic smooth muscle cells (AoSMCs) associated with medial elastolysis and aortic root aneurysm. We aimed to reduce aortic elastolysis through decrease of MMP expression with decoy oligodeoxynucleotides (dODNs) neutralizing the transcription factor activating factor-1 (AP-1). AP-1 abundance in nuclear extracts as well as MMP-2 and MMP-9 expression were significantly increased in isolated mAoSMC of mgR/mgR Marfan mice compared to wild-type cells. Exposure to AP-1 neutralizing dODNs resulted in a significant reduction of basal and interleukin-1β-stimulated MMP expression and activity in mAoSMCs. Moreover, increased migration and formation of superoxide radical anions was substantially decreased in mAoSMCs by AP-1 dODN treatment. Aortic grafts from donor Marfan mice were treated with AP-1- dODN ex vivo and implanted as infrarenal aortic interposition grafts in mgR/mgR mice. Pretreatment of aortic grafts with AP-1 dODN led to reduced elastolysis, macrophage infiltration, and MMP activity. Permeability of the endothelial monolayer was increased for dODN in mgR/mgR aortae with observed loss of tight junction proteins ZO-1 and occludin, enabling dODN to reach the tunica media. Targeting AP-1 activity offers a new potential strategy to treat the vascular phenotype associated with Marfan syndrome. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Inhibition of memory consolidation after active avoidance conditioning by antisense intervention with ependymin gene expression.

PubMed

Schmidt, R; Brysch, W; Rother, S; Schlingensiepen, K H

1995-10-01

A rapid increase in ependymin mRNA expression demonstrated by semiquantitative in situ hybridization after avoidance conditioning on goldfish suggested a molecular demand for newly synthesized ependymin translation product. To inhibit de novo synthesis of ependymin molecules without interference with preexisting ones, 18 mer anti-ependymin mRNA-phosphorothioate oligodeoxynucleotides (S-ODNs) were injected into the perimeningeal brain fluid before active avoidance training. S-ODN-injected animals learned the avoidance response; however, they were amnesic in the test. When injected into overtrained animals, S-ODNs did not interfere with retrieval or performance of the avoidance response. Fish treated with randomized S-ODN sequences served as further controls. Incorporation of S-ODNs was analyzed by injection of fluorescein isothiocyanate (FITC)-conjugated oligodeoxynucleotide probes. Microscopic observation revealed strong FITC-S-ODN fluorescence in reticular-shaped fibroblasts, the only known site of ependymin synthesis. Results demonstrate that selective inhibition of ependymin gene expression in vivo can specifically prevent memory formation. We conclude that in particular the newly synthesized ependymin molecules are involved in memory consolidation, possibly because they have not yet undergone irreversible molecular changes, which have been reported of this glycoprotein in a low-calcium microenvironment.

Antisense long non-coding RNAs in rainbow trout: Discovery and potential role in muscle growth and quality traits

USDA-ARS?s Scientific Manuscript database

Endogenous mRNA-antisense transcripts are involved in regulation of a wide range of biological processes including muscle development and quality traits of farm animals. Standard RNA-Seq can be used to identify sense-antisense transcripts. However, strand-specific RNA-Seq is required to resolve ambi...

Bacterial antisense RNAs are mainly the product of transcriptional noise.

PubMed

Lloréns-Rico, Verónica; Cano, Jaime; Kamminga, Tjerko; Gil, Rosario; Latorre, Amparo; Chen, Wei-Hua; Bork, Peer; Glass, John I; Serrano, Luis; Lluch-Senar, Maria

2016-03-01

cis-Encoded antisense RNAs (asRNAs) are widespread along bacterial transcriptomes. However, the role of most of these RNAs remains unknown, and there is an ongoing discussion as to what extent these transcripts are the result of transcriptional noise. We show, by comparative transcriptomics of 20 bacterial species and one chloroplast, that the number of asRNAs is exponentially dependent on the genomic AT content and that expression of asRNA at low levels exerts little impact in terms of energy consumption. A transcription model simulating mRNA and asRNA production indicates that the asRNA regulatory effect is only observed above certain expression thresholds, substantially higher than physiological transcript levels. These predictions were verified experimentally by overexpressing nine different asRNAs in Mycoplasma pneumoniae. Our results suggest that most of the antisense transcripts found in bacteria are the consequence of transcriptional noise, arising at spurious promoters throughout the genome.

Novel interactions between the HTLV antisense proteins HBZ and APH-2 and the NFAR protein family: Implications for the HTLV lifecycles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, Jane; Hall, William W.; Ratner, Lee

The human T-cell leukaemia virus type 1 and type 2 (HTLV-1/HTLV-2) antisense proteins HBZ and APH-2 play key roles in the HTLV lifecycles and persistence in the host. Nuclear Factors Associated with double-stranded RNA (NFAR) proteins NF90/110 function in the lifecycles of several viruses and participate in host innate immunity against infection and oncogenesis. Using GST pulldown and co-immunoprecipitation assays we demonstrate specific novel interactions between HBZ/APH-2 and NF90/110 and characterised the protein domains involved. Moreover we show that NF90/110 significantly enhance Tax mediated LTR activation, an effect that was abolished by HBZ but enhanced by APH-2. Additionally we foundmore » that HBZ and APH-2 modulate the promoter activity of survivin and are capable of antagonising NF110-mediated survivin activation. Thus interactions between HTLV antisense proteins and the NFAR protein family have an overall positive impact on HTLV infection. Hence NFARs may represent potential therapeutic targets in HTLV infected cells. - Highlights: • This study demonstrates for the first time interactions between NF90/110 and the HTLV antisense proteins HBZ and APH-2. • We show that NF90/110 significantly enhance LTR activation by the HTLV Tax protein, an effect that is abolished by HBZ but enhanced by APH-2. • The study shows that even though the HTLV antisense proteins activate survivin expression they antagonize the ability of NF90/110 to do so. • Overall we found that NF90/110 positively regulate HTLV infection and as such might represent a therapeutic target in infected cells.« less

Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

PubMed

Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

2013-10-01

Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

Incorporation of the catalytic domain of a hammerhead ribozyme into antisense RNA enhances its inhibitory effect on the replication of human immunodeficiency virus type 1.

PubMed Central

Homann, M; Tzortzakaki, S; Rittner, K; Sczakiel, G; Tabler, M

1993-01-01

The catalytic domain of a hammerhead ribozyme was incorporated into a 413 nucleotides long antisense RNA directed against the 5'-leader/gag region of the human immunodeficiency virus type 1 (HIV-1) (pos. +222 to +634). The resulting catalytic antisense RNA was shown to cleave its target RNA in vitro specifically at physiological ion strength and temperature. We compared the antiviral effectiveness of this catalytic antisense RNA with that of the corresponding unmodified antisense RNA and with a mutated catalytic antisense RNA, which did not cleave the substrate RNA in vitro. Each of these RNAs was co-transfected into human SW480 cells together with infectious complete proviral HIV-1 DNA, followed by analysis of HIV-1 replication. The presence of the catalytically active domain resulted in 4 to 7 fold stronger inhibition of HIV-1 replication as compared to the parental antisense RNA and the inactive mutant. Kinetic and structural studies performed in vitro indicated that the ability for double strand formation was not changed in catalytic antisense RNA versus parental antisense RNA. Together, these data suggest that the ability to cleave target RNA is a crucial prerequisite for the observed increase of inhibition of the replication of HIV-1. Images PMID:8332489

Mipomersen, an antisense apolipoprotein B synthesis inhibitor.

PubMed

Bell, Damon A; Hooper, Amanda J; Burnett, John R

2011-02-01

mipomersen is a second-generation antisense oligonucleotide (ASO) targeted to human apolipoprotein (apo) B-100, a large protein synthesized by the liver that plays a fundamental role in human lipoprotein metabolism. Mipomersen predominantly distributes to the liver and decreases the production of apoB-100, the primary structural protein of the atherogenic lipoproteins including low density lipoprotein (LDL), thereby reducing plasma LDL-cholesterol and apoB-100 concentrations. the mode of action, preclinical development and clinical trials of mipomersen, an antisense apoB synthesis inhibitor. The paper provides an understanding of the pharmacokinetic and pharmacodynamic characteristics of mipomersen and insight into its clinical efficacy and safety. In clinical trials, mipomersen produced dose-dependent and prolonged reductions in LDL-cholesterol and other apoB-containing lipoproteins, including lipoprotein (a) [Lp(a)] in healthy volunteers and in patients with mild to moderate hypercholesterolemia. Mipomersen has been shown to decrease apoB, LDL-cholesterol and Lp(a) in patients with heterozygous and homozygous familial hypercholesterolemia on maximally tolerated lipid-lowering therapy. mipomersen shows promise as an adjunctive agent by reducing apoB-containing lipoproteins in patients at high risk of atherosclerotic cardiovascular disease who are not at target or are intolerant of statins. Although the short-term efficacy and safety of mipomersen has been established, concern exists regarding the long-term potential for hepatic steatosis with this ASO.

RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes

PubMed Central

Le Rhun, Anaïs; Beer, Yan Yan; Reimegård, Johan; Chylinski, Krzysztof; Charpentier, Emmanuelle

2016-01-01

ABSTRACT Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation. PMID:26580233

RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes.

PubMed

Le Rhun, Anaïs; Beer, Yan Yan; Reimegård, Johan; Chylinski, Krzysztof; Charpentier, Emmanuelle

2016-01-01

Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation.

Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

PubMed Central

Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

2000-01-01

Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

Cellular uptake mediated by epidermal growth factor receptor facilitates the intracellular activity of phosphorothioate-modified antisense oligonucleotides

PubMed Central

Wang, Shiyu; Allen, Nickolas; Vickers, Timothy A; Revenko, Alexey S; Sun, Hong; Liang, Xue-hai; Crooke, Stanley T

2018-01-01

Abstract Chemically modified antisense oligonucleotides (ASOs) with phosphorothioate (PS) linkages have been extensively studied as research and therapeutic agents. PS-ASOs can enter the cell and trigger cleavage of complementary RNA by RNase H1 even in the absence of transfection reagent. A number of cell surface proteins have been identified that bind PS-ASOs and mediate their cellular uptake; however, the mechanisms that lead to productive internalization of PS-ASOs are not well understood. Here, we characterized the interaction between PS-ASOs and epidermal growth factor receptor (EGFR). We found that PS-ASOs trafficked together with EGF and EGFR into clathrin-coated pit structures. Their co-localization was also observed at early endosomes and inside enlarged late endosomes. Reduction of EGFR decreased PS-ASO activity without affecting EGF-mediated signaling pathways and overexpression of EGFR increased PS-ASO activity in cells. Furthermore, reduction of EGFR delays PS-ASO trafficking from early to late endosomes. Thus, EGFR binds to PS-ASOs at the cell surface and mediates essential steps for active (productive) cellular uptake of PS-ASOs through its cargo-dependent trafficking processes which migrate PS-ASOs from early to late endosomes. This EGFR-mediated process can also serve as an additional model to better understand the mechanism of intracellular uptake and endosomal release of PS-ASOs. PMID:29514240

Suramin inhibits bFGF-induced endothelial cell proliferation and angiogenesis in the chick chorioallantoic membrane.

PubMed Central

Danesi, R.; Del Bianchi, S.; Soldani, P.; Campagni, A.; La Rocca, R. V.; Myers, C. E.; Paparelli, A.; Del Tacca, M.

1993-01-01

The effects of suramin, an inhibitor of growth factor mitogenic activity, were evaluated on basic fibroblast growth factor (bFGF)-induced proliferation of bovine aortic endothelial cells and on angiogenesis in the chorioallantoic membrane (CAM) of chick embryos. The role of bFGF gene expression in endothelial cell growth was also investigated by using an antisense oligodeoxynucleotide to bFGF. The 4-fold increase in [3H]-thymidine uptake in endothelial cells in vitro upon stimulation with 10 ng ml-1 of bFGF was inhibited by suramin 300 micrograms ml-1. bFGF antisense oligomer (10 microM) reduced [3H]-thymidine incorporation in exponentially growing cells by 76%; this effect was reversed by bFGF 10 ng ml-1. In the CAM of chick embryos suramin 50 micrograms was a more potent inhibitor of angiogenesis than the combination of heparin 60 micrograms/hydrocortisone 50 micrograms; the mean value of the area with reduced vascularity was significantly larger in suramin-treated CAMs (2.4 cm2) than in heparin/hydrocortisone (0.6 cm2), while the reduction of vascular density was similar (- 35 and - 29% compared to controls, respectively), In conclusion, the effects of treatments with bFGF and bFGF antisense oligomer demonstrate that bFGF plays a relevant role in endothelial cell proliferation and may be the target of suramin since the drug is able to suppress basal and bFGF-induced endothelial cell growth; in addition to this, suramin is a more potent angiogenesis inhibitor in the CAM than the combination of heparin/hydrocortisone. Images Figure 1 Figure 4 PMID:7692920

Bacterial antisense RNAs are mainly the product of transcriptional noise

PubMed Central

Lloréns-Rico, Verónica; Cano, Jaime; Kamminga, Tjerko; Gil, Rosario; Latorre, Amparo; Chen, Wei-Hua; Bork, Peer; Glass, John I.; Serrano, Luis; Lluch-Senar, Maria

2016-01-01

cis-Encoded antisense RNAs (asRNAs) are widespread along bacterial transcriptomes. However, the role of most of these RNAs remains unknown, and there is an ongoing discussion as to what extent these transcripts are the result of transcriptional noise. We show, by comparative transcriptomics of 20 bacterial species and one chloroplast, that the number of asRNAs is exponentially dependent on the genomic AT content and that expression of asRNA at low levels exerts little impact in terms of energy consumption. A transcription model simulating mRNA and asRNA production indicates that the asRNA regulatory effect is only observed above certain expression thresholds, substantially higher than physiological transcript levels. These predictions were verified experimentally by overexpressing nine different asRNAs in Mycoplasma pneumoniae. Our results suggest that most of the antisense transcripts found in bacteria are the consequence of transcriptional noise, arising at spurious promoters throughout the genome. PMID:26973873

Reduction of methylviologen-mediated oxidative stress tolerance in antisense transgenic tobacco seedlings through restricted expression of StAPX.

PubMed

Sun, Wei-Hong; Wang, Yong; He, Hua-Gang; Li, Xue; Song, Wan; Du, Bin; Meng, Qing-Wei

2013-07-01

Ascorbate peroxidases are directly involved in reactive oxygen species (ROS) scavenging by reducing hydrogen peroxide to water. The tomato thylakoid-bound ascorbate peroxidase gene (StAPX) was introduced into tobacco. RNA gel blot analysis confirmed that StAPX in tomato leaves was induced by methylviologen-mediated oxidative stress. The sense transgenic seedlings exhibited higher tAPX activity than that of the wild type (WT) plants under oxidative stress conditions, while the antisense seedlings exhibited lower tAPX activity. Lower APX activities of antisense transgenic seedlings caused higher malondialdehyde contents and relative electrical conductivity. The sense transgenic seedlings with higher tAPX activity maintained higher chlorophyll content and showed the importance of tAPX in maintaining the optimal chloroplast development under methylviologen stress conditions, whereas the antisense lines maintained lower chlorophyll content than WT seedlings. Results indicated that the over-expression of StAPX enhanced tolerance to methylviologen-mediated oxidative stress in sense transgenic tobacco early seedlings, whereas the suppression of StAPX in antisense transgenic seedlings showed high sensitivity to oxidative stress.

Synthesis of peptide nucleic acids containing pyridazine derivatives as cytosine and thymine analogs, and their duplexes with complementary oligodeoxynucleotides.

PubMed

Tomori, Takahito; Miyatake, Yuya; Sato, Yuta; Kanamori, Takashi; Masaki, Yoshiaki; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

2015-03-20

Synthesis of peptide nucleic acids (PNAs) is reported with new pyridazine-type nucleobases: 3-aminopyridazine (aPz) and 1-aminophthalazine (aPh) as cytosine analogs, and pyridazin-3-one (Pz(O)) and phthalazin-1-one (Ph(O)) as thymine analogs. The PNAs having an aPz or a Pz(O) formed duplexes with each complementary oligodeoxynucleotide forming a base pair with G or A, respectively, as evaluated by using UV melting analyses and circular dichroism (CD) spectra.

NF-κB Decoy Oligodeoxynucleotide Enhanced Osteogenesis in Mesenchymal Stem Cells Exposed to Polyethylene Particle

PubMed Central

Lin, Tzu-Hua; Sato, Taishi; Barcay, Katherine R.; Waters, Heather; Loi, Florence; Zhang, Ruth; Pajarinen, Jukka; Egashira, Kensuke; Yao, Zhenyu

2015-01-01

Excessive generation of wear particles after total joint replacement may lead to local inflammation and periprosthetic osteolysis. Modulation of the key transcription factor NF-κB in immune cells could potentially mitigate the osteolytic process. We previously showed that local delivery of ultrahigh-molecular-weight polyethylene (UHMWPE) particles recruited osteoprogenitor cells and reduced osteolysis. However, the biological effects of modulating the NF-κB signaling pathway on osteoprogenitor/mesenchymal stem cells (MSCs) remain unclear. Here we showed that decoy oligodeoxynucleotide (ODN) increased cell viability when primary murine MSCs were exposed to UHMWPE particles, but had no effects on cellular apoptosis. Decoy ODN increased transforming growth factor-beta 1 (TGF-β1) and osteoprotegerin (OPG) in MSCs exposed to UHMWPE particles. Mechanistic studies showed that decoy ODN upregulated OPG expression through a TGF-β1-dependent pathway. By measuring the alkaline phosphatase activity, osteocalcin levels, Runx2 and osteopontin expression, and performing a bone mineralization assay, we found that decoy ODN increased MSC osteogenic ability when the cells were exposed to UHMWPE particles. Furthermore, the cellular response to decoy ODN and UHMWPE particles with regard to cell phenotype, cell viability, and osteogenic ability was confirmed using primary human MSCs. Our results suggest that modulation of wear particle-induced inflammation by NF-κB decoy ODN had no adverse effects on MSCs and may potentially further mitigate periprosthetic osteolysis by protecting MSC viability and osteogenic ability. PMID:25518013

Regulation of adhesion and growth of fibrosarcoma cells by NF-kappa B RelA involves transforming growth factor beta.

PubMed Central

Perez, J R; Higgins-Sochaski, K A; Maltese, J Y; Narayanan, R

1994-01-01

The NF-kappa B transcription factor is a pleiotropic activator that participates in the induction of a wide variety of cellular genes. Antisense oligomer inhibition of the RelA subunit of NF-kappa B results in a block of cellular adhesion and inhibition of tumor cell growth. Investigation of the molecular basis for these effects showed that in vitro inhibition of the growth of transformed fibroblasts by relA antisense oligonucleotides can be reversed by the parental-cell-conditioned medium. Cytokine profile analysis of these cells treated with relA antisense oligonucleotides revealed inhibition of transforming growth factor beta 1 (TGF-beta 1 to the transformed fibroblasts reversed the inhibitory effects of relA antisense oligomers on soft agar colony formation and cell adhesion to the substratum. Direct inhibition of TGF-beta 1 expression by antisense phosphorothioates to TGF-beta 1 mimicked the in vitro effects of blocking cell adhesion that are elicited by antisense relA oligomers. These results may explain the in vitro effects of relA antisense oligomers on fibrosarcoma cell growth and adhesion. Images PMID:8035811

Knockdown of long noncoding antisense RNA brain-derived neurotrophic factor attenuates hypoxia/reoxygenation-induced nerve cell apoptosis through the BDNF-TrkB-PI3K/Akt signaling pathway.

PubMed

Zhong, Jian-Bin; Li, Xie; Zhong, Si-Ming; Liu, Jiu-Di; Chen, Chi-Bang; Wu, Xiao-Yan

2017-09-27

Brain-derived neurotrophic factor (BDNF) plays an important role in neuronal cell apoptosis. The antisense RNA of brain-derived neurotrophic factor (BDNF-AS) is a natural antisense transcript that is transcribed opposite the gene that encodes BDNF. The aim of this study was to determine whether knockdown of BDNF-AS can suppress hypoxia/reoxygenation (H/R)-induced neuronal cell apoptosis and whether this is mediated by the BDNF-TrkB-PI3K/Akt pathway. We detected the expression of BDNF and BDNF-AS in brain tissue from 20 patients with cerebral infarction and five patients with other diseases (but no cerebral ischemia). We found that BDNF expression was significantly downregulated in patients with cerebral infarction, whereas the expression of BDNF-AS was significantly upregulated. In both human cortical neurons (HCN2) and human astrocytes, H/R significantly induced the expression of BDNF-AS, but significantly decreased BDNF expression. H/R also significantly induced apoptosis and reduced the mitochondrial membrane potential in these cells. Following downregulation of BDNF-AS by siRNA in human cortical neurons and human astrocyte cells, BDNF expression was significantly upregulated and the H/R-induced upregulation of BDNF-AS was significantly attenuated. BDNF-AS siRNA inhibited H/R-induced cell apoptosis and ameliorated the H/R-induced suppression of mitochondrial membrane potential. H/R inhibited the expression of BDNF, p-AKT/AKT, and TrKB, and this inhibition was recovered by BDNF-AS siRNA. In summary, this study indicates that BDNF-AS siRNA induces activation of the BDNF-TrkB-PI3K/Akt pathway following H/R-induced neurotoxicity. These findings will be useful toward the application of BDNF-AS siRNA for the treatment of neurodegenerative diseases.

Inhibition of human papillomavirus expression using DNAzymes.

PubMed

Benítez-Hess, María Luisa; Reyes-Gutiérrez, Pablo; Alvarez-Salas, Luis Marat

2011-01-01

Deoxyribozymes (DXZs) are catalytic oligodeoxynucleotides capable of performing diverse functions including the specific cleavage of a target RNA. These molecules represent a new type of therapeutic oligonucleotides combining the efficiency of ribozymes and the intracellular endurance and simplicity of modified antisense oligonucleotides. Commonly used DXZs include the 8-17 and 10-23 motifs, which have been engineered to destroy disease-associated genes with remarkable efficiency. Targeting DXZs to disease-associated transcripts requires extensive biochemical testing to establish target RNA accessibility, catalytic efficiency, and nuclease sensibility. The usage of modified nucleotides to render nuclease-resistance DXZs must be counterweighted against deleterious consequences on catalytic activity. Further intracellular testing is required to establish the effect of microenvironmental conditions on DXZ activity and off-target issues. Application of modified DXZs to cervical cancer results in specific growth inhibition, cell death, and apoptosis. Thus, DXZs represent a highly effective antisense moiety with minimal secondary effects.

Effects of intratracheal administration of nuclear factor-kappaB decoy oligodeoxynucleotides on long-term cigarette smoke-induced lung inflammation and pathology in mice

PubMed Central

2009-01-01

To determine if nuclear factor-κB (NF-κB) activation may be a key factor in lung inflammation and respiratory dysfunction, we investigated whether NF-κB can be blocked by intratracheal administration of NF-κB decoy oligodeoxynucleotides (ODNs), and whether decoy ODN-mediated NF-κB inhibition can prevent smoke-induced lung inflammation, respiratory dysfunction, and improve pathological alteration in the small airways and lung parenchyma in the long-term smoke-induced mouse model system. We also detected changes in transcriptional factors. In vivo, the transfection efficiency of NF-κB decoy ODNs to alveolar macrophages in BALF was measured by fluorescein isothiocyanate (FITC)-labeled NF-κB decoy ODNs and flow cytometry post intratracheal ODN administration. Pulmonary function was measured by pressure sensors, and pathological changes were assessed using histology and the pathological Mias software. NF-κB and activator protein 1(AP-1) activity was detected by the electrophoretic motility shift assay (EMSA). Mouse cytokine and chemokine pulmonary expression profiles were investigated by enzyme-linked immunosorbent assay (ELISA) in bronchoalveolar lavage fluid (BALF) and lung tissue homogenates, respectively, after repeated exposure to cigarette smoke. After 24 h, the percentage of transfected alveolar macrophages was 30.00 ± 3.30%. Analysis of respiratory function indicated that transfection of NF-κB decoy ODNs significantly impacted peak expiratory flow (PEF), and bronchoalveolar lavage cytology displayed evidence of decreased macrophage infiltration in airways compared to normal saline-treated or scramble NF-κB decoy ODNs smoke exposed mice. NF-κB decoy ODNs inhibited significantly level of macrophage inflammatory protein (MIP) 1α and monocyte chemoattractant protein 1(MCP-1) in lung homogenates compared to normal saline-treated smoke exposed mice. In contrast, these NF-κB decoy ODNs-treated mice showed significant increase in the level of tumor

Intercalation of aflatoxin B sub 1 in two oligodeoxynucleotide adducts: Comparative sup 1 H NMR analysis of d(ATC sup AFB GAT)ter dot d(ATCGAT) and d(AT sup ATB GCAT) sub 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gopalakrishnan, S.; Harris, T.M.; Stone, M.P.

8,9-Dihydro-8-(N7-guanyl-(d(ATCGAT)))-9-hydroxyaflatoxin B{sub 1}{center dot}d(ATCGAT) and 8,9-dihydro-8-(N7-guanyl-(d(ATGCAT)))-9-hydroxyafltoxin B{sub 1}{center dot}8,9-dihydro-8-(N7-guanyl-(d(ATGCAT)))-9-hydroxyaflatoxin B{sub 1} were prepared by direct addition of aflatoxin B{sub 1} 8,9-expoxide to d(ATCGAT){sub 2} and d(ATGCAT){sub 2}, respectively. {sup 1}H NOE experiments, nonselective {sup 1}H T{sub 1} relaxation measurements, and {sup 1}H chemical shift perturbations demonstrate that in both modified oligodeoxynucleotides the aflatoxin moiety is intercalated above the 5{prime}-face of the modified guanine. The oligodeoxynucleotides remain right-handed, and perturbation of the B-DNA structure is localized adjacent to the adducted guanine. Aflatoxin-oligodeoxynucleotide {sup 1}H NOEs are observed between aflatoxin and the 5{prime}-neighbor base pair and include both the major groove andmore » the minor groove. The protons at C8 and C9 of the aflatoxin terminal furan ring exhibit slower spin-lattice relaxation as compared to other oligodeoxynucleotide protons, which supports the conclusion that they face into the major groove. Increased shielding is observed for aflatoxin protons. The difference in reaction stoichiometry is consistent with an intercalated transition-state complex between aflatoxin B{sub 1} 8,9-epoxide and B-DNA. Intercalation provides excellent positioning for nucleophilic attack by guanine N7 on aflatoxin B{sub 1} 8,9-epoxide, which probably accounts for the observed efficiency of adduct formation despite the relatively low DNA binding affinity observed for aflatoxin B{sub 1}.« less

Peripheral administration of antisense oligonucleotides targeting the amyloid-β protein precursor reverses AβPP and LRP-1 overexpression in the aged SAMP8 mouse brain.

PubMed

Erickson, Michelle A; Niehoff, Michael L; Farr, Susan A; Morley, John E; Dillman, Lucy A; Lynch, Kristin M; Banks, William A

2012-01-01

The senescence accelerated mouse-prone 8 (SAMP8) mouse model of Alzheimer's disease has a natural mutation leading to age-related increases in the amyloid-β protein precursor (AβPP) and amyloid-β (Aβ) in the brain, memory impairment, and deficits in Aβ removal from the brain. Previous studies show that centrally administered antisense oligonucleotide directed against AβPP can decrease AβPP expression and Aβ production in the brains of aged SAMP8 mice, and improve memory. The same antisense crosses the blood-brain barrier and reverses memory deficits when injected intravenously. Here, we give 6 μg of AβPP or control antisense 3 times over 2 week intervals to 12 month old SAMP8 mice. Object recognition test was done 48 hours later, followed by removal of whole brains for immunoblot analysis of AβPP, low-density lipoprotein-related protein-1 (LRP-1), p-glycoprotein (Pgp), receptor for advanced glycation endproducts (RAGE), or ELISA of soluble Aβ(40). Our results show that AβPP antisense completely reverses a 30% age-associated increase in AβPP signal (p < 0.05 versus untreated 4 month old SAMP8). Soluble Aβ(40) increased with age, but was not reversed by antisense. LRP-1 large and small subunits increased significantly with age (147.7%, p < 0.01 and 123.7%, p < 0.05 respectively), and AβPP antisense completely reversed these increases (p < 0.05). Pgp and RAGE were not significantly altered with age or antisense. Antisense also caused improvements in memory (p < 0.001). Together, these data support the therapeutic potential of AβPP antisense and show a unique association between AβPP and LRP-1 expression in the SAMP8 mouse.

[Antisense polynucleotides and prospects for their use in fighting viruses].

PubMed

Tikhonenko, T I

1989-01-01

Natural or synthetic anti-sense (as) polynucleotides complementary to distinct functional regions of mRNA (asRNA or asDNA) are able to inhibit the expression of any target gene. If certain viral mRNAs important for virus replication are targeted the inhibition of viral infection by asRNA or asDNA takes place. Inhibitory effects of complementary polynucleotides on gene activity in eukaryotic cells is due to the disturbance of translation of corresponding mRNAs as well as to the impairment of their splicing or transportation from the nuclei to cytoplasm. In prokaryotic cells, obviously, only the first factor is operating. The recombinant genes programming anti-viral asRNA can confer the resistance to the infection by other virus to the transformed cells. The resistance to viral infection observed in transgenic animals, expressing asRNA genes, may be considered as a new unnatural form of informational immunity.

Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.

PubMed

Bourinet, Emmanuel; Alloui, Abdelkrim; Monteil, Arnaud; Barrère, Christian; Couette, Brigitte; Poirot, Olivier; Pages, Anne; McRory, John; Snutch, Terrance P; Eschalier, Alain; Nargeot, Joël

2005-01-26

Analgesic therapies are still limited and sometimes poorly effective, therefore finding new targets for the development of innovative drugs is urgently needed. In order to validate the potential utility of blocking T-type calcium channels to reduce nociception, we explored the effects of intrathecally administered oligodeoxynucleotide antisenses, specific to the recently identified T-type calcium channel family (CaV3.1, CaV3.2, and CaV3.3), on reactions to noxious stimuli in healthy and mononeuropathic rats. Our results demonstrate that the antisense targeting CaV3.2 induced a knockdown of the CaV3.2 mRNA and protein expression as well as a large reduction of 'CaV3.2-like' T-type currents in nociceptive dorsal root ganglion neurons. Concomitantly, the antisense treatment resulted in major antinociceptive, anti-hyperalgesic, and anti-allodynic effects, suggesting that CaV3.2 plays a major pronociceptive role in acute and chronic pain states. Taken together, the results provide direct evidence linking CaV3.2 T-type channels to pain perception and suggest that CaV3.2 may offer a specific molecular target for the treatment of pain.

A Vector Library for Silencing Central Carbon Metabolism Genes with Antisense RNAs in Escherichia coli

PubMed Central

Ohno, Satoshi; Yoshikawa, Katsunori; Shimizu, Hiroshi; Tamura, Tomohiro

2014-01-01

We describe here the construction of a series of 71 vectors to silence central carbon metabolism genes in Escherichia coli. The vectors inducibly express antisense RNAs called paired-terminus antisense RNAs, which have a higher silencing efficacy than ordinary antisense RNAs. By measuring mRNA amounts, measuring activities of target proteins, or observing specific phenotypes, it was confirmed that all the vectors were able to silence the expression of target genes efficiently. Using this vector set, each of the central carbon metabolism genes was silenced individually, and the accumulation of metabolites was investigated. We were able to obtain accurate information on ways to increase the production of pyruvate, an industrially valuable compound, from the silencing results. Furthermore, the experimental results of pyruvate accumulation were compared to in silico predictions, and both sets of results were consistent. Compared to the gene disruption approach, the silencing approach has an advantage in that any E. coli strain can be used and multiple gene silencing is easily possible in any combination. PMID:24212579

Central and peripheral administration of antisense oligonucleotide targeting amyloid-β protein precursor improves learning and memory and reduces neuroinflammatory cytokines in Tg2576 (AβPPswe) mice.

PubMed

Farr, Susan A; Erickson, Michelle A; Niehoff, Michael L; Banks, William A; Morley, John E

2014-01-01

Alzheimer's disease (AD) is a progressive neurodegenerative disease. Currently, there are no therapies to stop or reverse the symptoms of AD. We have developed an antisense oligonucleotide (OL-1) against the amyloid-β protein precursor (AβPP) that can decrease AβPP expression and amyloid-β protein (Aβ) production. This antisense rapidly crosses the blood-brain barrier, reverses learning and memory impairments, reduces oxidative stress, and restores brain-to-blood efflux of Aβ in SAMP8 mice. Here, we examined the effects of this AβPP antisense in the Tg2576 mouse model of AD. We administered the OL-1 antisense into the lateral ventricle 3 times at 2week intervals. Seventy-two hours after the third injection, we tested learning and memory in T-maze foot shock avoidance. In the second study, we injected the mice with OL-1 antisense 3 times at 2-week intervals via the tail vein. Seventy-two hours later, we tested learning and memory T-maze, novel object recognition, and elevated plus maze. At the end of behavioral testing, brain tissue was collected. OL-1 antisense administered centrally improved acquisition and retention of T-maze foot shock avoidance. OL-1 antisense administered via tail vein improved learning and memory in both T-maze foot shock avoidance and novel object-place recognition. In the elevated plus maze, the mice which received OL-1 antisense spent less time in the open arms and had fewer entries into the open arms indicating reduced disinhibitation. Biochemical analyses reveal significant reduction of AβPP signal and a reduction of measures of neuroinflammation. The current findings support the therapeutic potential of OL-1 AβPP antisense.

[Inhibiting target gene expression and controlling growth of Epstein-Barr virus transformed cells by antisense RNA transcripts].

PubMed

Chen, Jian-jing; Raab-Traub, Nancy; Yao, Qing-yun; Zhang, Feng; Huang, Mei-ling; Kuang, Zhu-ji; Zhang, Xiao-shi; Ye, Yan-li; Gu, Li

2002-01-01

The latent membrane protein gene (LMP) of Epstein-Barr virus (EBV) was thought to play an important role in the carcinogenesis of nasopharyngeal carcinoma (NPC). In this study, the authors investigated the effects of antisense RNA (AsRNA) on LMP for down regulating at the target gene over expression in EBV transformed lymphoid cells, and set up an antisense system to inhibit LMP expression. Constructing the single strand antisense transcription system in vitro, the authors have got large amount of AsRNA. Designing and setting up an antisense tracing system in situ (ATSIS), the authors could observe the living particles of AsRNA/sense RNA duplex dimer. With time lapse phase-contrast microscopy, the agglutination phenotype on living cells was easily detected by MTT test, the inhibition rate on EBV transformed cells was calculated. LMP 1.9 fragment ligated into pGEM vector in reverse orientation have been constructed and produced a plentiful amount of AsLMPmRNA which could incorporated into both B95-8 and C1936 cell lines by endophagocytosis and formed the duplex dimer of As/Sense RNA. This particles have been visualized in situ when labelling 35S isotope by ATSIS. When AsLMPmRNA acted as agents for specific inhibition to LMP over expression, the transform phenotype of cell agglutination have been suppressed and MTT particle formatin was apparently reduced both two EBV tansformed cell lines. AsLMPmRNA targets at sense strand have a high effectiveness of down-regulation on EBV-LMP overexpression. This down regulating function of LMP and growth inhibition on transformed cell is demonstrated by the antisenes tracing system in situ (ATSIS). The results provide a clue to overcome the latent EBV infection in human bodies all living long time and to prevent it inducing NPC in high incidence area by antisense strategies.

Targeted delivery of an antisense oligonucleotide in the retina: uptake, distribution, stability, and effect.

PubMed

Rakoczy, P E; Lai, M C; Watson, M; Seydel, U; Constable, I

1996-01-01

In this article, we describe the preliminary results of the development of an animal model that will enable us to study the effect of photoreceptor-derived debris accumulation on the normal function of the retina in vivo. An antisense oligonucleotide (Cat 5), saline, and two control oligonucleotides were injected into the vitreous of 7-week-old RCS-rdy+ rats. The uptake, distribution, and persistence of the antisense oligonucleotide in the retina was demonstrated by fluorescent confocal microscopy, and the stability of the oligonucleotide was shown by GeneScan analysis using a fluorescein-labeled derivative of Cat 5 (Cat 5F). The accumulation of photoreceptor-derived debris was monitored by the number of undigested phagosomes in the RPE layer by light microscopy. Following intravitreal injection of Cat 5F, penetration of the oligonucleotide was observed in the ganglion cell layer in 2 hours and in the photoreceptor and pigment epithelial layers 3 days later. However, at 7, 28, and 56 days postinjection, only the RPE layer had significant amounts of Cat 5F present. Using GeneScan analysis, it was demonstrated that the fluorescein-labeled oligonucleotide present in the RPE layer was not degraded and it retained its original 19-mer length. There was no statistically significant difference in the number of phagosomes found in the RPE layer of control uninjected, saline-injected, and two sense and two antisense oligonucleotides-injected animals at 7 and 28 days postinjection. In contrast, the number of phagosomes was significantly higher (p < 0.001) in the RPE layer of Cat 5 antisense oligonucleotide-injected animals at 7 and 28 days postinjection. This difference, however, disappeared by 56 days postinjection. The inner nuclear layers of the retina of control and experimental animals were not affected by the injections.

Activation of Notch3 in Glomeruli Promotes the Development of Rapidly Progressive Renal Disease

PubMed Central

El Machhour, Fala; Keuylian, Zela; Kavvadas, Panagiotis; Dussaule, Jean-Claude

2015-01-01

Notch3 expression is found in the glomerular podocytes of patients with lupus nephritis or focal segmental GN but not in normal kidneys. Here, we show that activation of the Notch3 receptor in the glomeruli is a turning point inducing phenotypic changes in podocytes promoting renal inflammation and fibrosis and leading to disease progression. In a model of rapidly progressive GN, Notch3 expression was induced by several-fold in podocytes concurrently with disease progression. By contrast, mice lacking Notch3 expression were protected because they exhibited less proteinuria, uremia, and inflammatory infiltration. Podocyte outgrowth from glomeruli isolated from wild-type mice during the early phase of the disease was higher than outgrowth from glomeruli of mice lacking Notch3. In vitro studies confirmed that podocytes expressing active Notch3 reorganize their cytoskeleton toward a proliferative/migratory and inflammatory phenotype. We then administered antisense oligodeoxynucleotides targeting Notch3 or scramble control oligodeoxynucleotides in wild-type mice concomitant to disease induction. Both groups developed chronic renal disease, but mice injected with Notch3 antisense had lower values of plasma urea and proteinuria and inflammatory infiltration. The improvement of renal function was accompanied by fewer deposits of fibrin within the glomeruli and by decreased peritubular inflammation. Finally, abnormal Notch3 staining was observed in biopsy samples of patients with crescentic GN. These results demonstrate that abnormal activation of Notch3 may be involved in the progression of renal disease by promoting migratory and proinflammatory pathways. Inhibiting Notch3 activation could be a novel, promising approach to treat GN. PMID:25421557

Comparison of three techniques for generation of tolerogenic dendritic cells: siRNA, oligonucleotide antisense, and antibody blocking.

PubMed

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Moazzeni, Mohammad; Soheili, Zahra Soheila; Samiee, Shahram

2010-12-01

In recent years, a new view of dendritic cells (DCs) as a main regulator of immunity to induce and maintain tolerance has been established. In vitro manipulation of their development and maturation is a topic of DC therapeutic application, which utilizes their inherent tolerogenicity. In this field, the therapeutic potential of antisense, siRNA, and blocking antibody are an interesting goal. In the present study, the efficiency of these three methods--siRNA, antisense, and blocking antibody--against CD40 molecule and its function in DCs and BCL1 cell line are compared. DCs were separated from mouse spleen and then cultured in vitro using Lipofectamine 2000 to deliver both silencers; the efficacy of transfection was estimated by flow cytometry. mRNA expression and protein synthesis were assessed by real time-PCR and flow cytometry, respectively. By Annexin V and propidium iodine staining, we could evaluate the viability of transfected cells. Knocking down the CD40 gene into separate groups of DCs by siRNA, antisense, and blocking antibody treated DCs can cause an increase in IL-4, decrease in IL-12, IFN-γ production, and allostimulation activity. Our results indicated that, in comparison to antisense and blocking antibody, siRNAs appear to be quantitatively more efficient in CD40 downregulation and their differences are significant.

Antisense suppression of violaxanthin de-epoxidase in tobacco does not affect plant performance in controlled growth conditions.

PubMed

Chang, S H; Bugos, R C; Sun, W H; Yamamoto, H Y

2000-01-01

Violaxanthin de-epoxidase (VDE) catalyzes the de-epoxidation of violaxanthin to antheraxanthin and zeaxanthin in the xanthophyll cycle. Tobacco was transformed with an antisense VDE construct under control of the cauliflower mosaic virus 35S promoter to determine the effect of reduced levels of VDE on plant growth. Screening of 40 independent transformants revealed 18 antisense lines with reduced levels of VDE activity with two in particular (TAS32 and TAS39) having greater than 95% reduction in VDE activity. Northern analysis demonstrated that these transformants had greatly suppressed levels of VDE mRNA. De-epoxidation of violaxanthin was inhibited to such an extent that no zeaxanthin and only very low levels of antheraxanthin could be detected after exposure of leaves to high light (2000 mumol m(-2) s(-1) for 20 min) with no observable effect on levels of other carotenoids and chlorophyll. Non-photochemical quenching was greatly reduced in the antisense VDE tobacco, demonstrating that a significant level of the non-photochemical quenching in tobacco requires de-epoxidation of violaxanthin. Although the antisense plants demonstrated a greatly impaired de-epoxidation of violaxanthin, no effect on plant growth or photosynthetic rate was found when plants were grown at a photon flux density of 500 or 1000 mumol m(-2) s(-1) under controlled growth conditions as compared to wild-type tobacco.

HTLV Deregulation of the NF-κB Pathway: An Update on Tax and Antisense Proteins Role

PubMed Central

Fochi, Stefania; Mutascio, Simona; Bertazzoni, Umberto; Zipeto, Donato; Romanelli, Maria G.

2018-01-01

Human T-cell lymphotropic virus type 1 (HTLV-1) is the causative agent of adult T-cell leukemia (ATL), an aggressive CD4+/CD25+ T-cell malignancy and of a severe neurodegenerative disease, HTLV-1 associated myelopathy/tropical spastic paraparesis (HAM/TSP). The chronic activation or deregulation of the canonical and non-canonical nuclear factor kappa B (NF-κB) pathways play a crucial role in tumorigenesis. The HTLV-1 Tax-1 oncoprotein is a potent activator of the NF-κB transcription factors and the NF-κB response is required for promoting the development of HTLV-1 transformed cell lines. The homologous retrovirus HTLV-2, which also expresses a Tax-2 transforming protein, is not associated with ATL. In this review, we provide an updated synopsis of the role of Tax-1 in the deregulation of the NF-κB pathway, highlighting the differences with the homologous Tax-2. Special emphasis is directed toward the understanding of the molecular mechanisms involved in NF-κB activation resulting from Tax interaction with host factors affecting several cellular processes, such as cell cycle, apoptosis, senescence, cell proliferation, autophagy, and post-translational modifications. We also discuss the current knowledge on the role of the antisense viral protein HBZ in down-regulating the NF-κB activation induced by Tax, and its implication in cellular senescence. In addition, we review the recent studies on the mechanism of HBZ-mediated inhibition of NF-κB activity as compared to that exerted by the HTLV-2 antisense protein, APH-2. Finally, we discuss recent advances aimed at understanding the role exerted in the development of ATL by the perturbation of NF-κB pathway by viral regulatory proteins. PMID:29515558

HTLV Deregulation of the NF-κB Pathway: An Update on Tax and Antisense Proteins Role.

PubMed

Fochi, Stefania; Mutascio, Simona; Bertazzoni, Umberto; Zipeto, Donato; Romanelli, Maria G

2018-01-01

Human T-cell lymphotropic virus type 1 (HTLV-1) is the causative agent of adult T-cell leukemia (ATL), an aggressive CD4 + /CD25 + T-cell malignancy and of a severe neurodegenerative disease, HTLV-1 associated myelopathy/tropical spastic paraparesis (HAM/TSP). The chronic activation or deregulation of the canonical and non-canonical nuclear factor kappa B (NF-κB) pathways play a crucial role in tumorigenesis. The HTLV-1 Tax-1 oncoprotein is a potent activator of the NF-κB transcription factors and the NF-κB response is required for promoting the development of HTLV-1 transformed cell lines. The homologous retrovirus HTLV-2, which also expresses a Tax-2 transforming protein, is not associated with ATL. In this review, we provide an updated synopsis of the role of Tax-1 in the deregulation of the NF-κB pathway, highlighting the differences with the homologous Tax-2. Special emphasis is directed toward the understanding of the molecular mechanisms involved in NF-κB activation resulting from Tax interaction with host factors affecting several cellular processes, such as cell cycle, apoptosis, senescence, cell proliferation, autophagy, and post-translational modifications. We also discuss the current knowledge on the role of the antisense viral protein HBZ in down-regulating the NF-κB activation induced by Tax, and its implication in cellular senescence. In addition, we review the recent studies on the mechanism of HBZ-mediated inhibition of NF-κB activity as compared to that exerted by the HTLV-2 antisense protein, APH-2. Finally, we discuss recent advances aimed at understanding the role exerted in the development of ATL by the perturbation of NF-κB pathway by viral regulatory proteins.

Two classes of small antisense RNAs in fungal RNA silencing triggered by non-integrative transgenes

PubMed Central

Nicolás, Francisco E.; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M.

2003-01-01

Transformation of Mucor circinelloides with self-replicative plasmids containing a wild-type copy of the carotenogenic gene carB causes silencing of the carB function in 3% of transformants. Genomic analyses revealed a relationship between silenced phenotype and number of copies of plasmids. This phenotype results from a reduction of the steady-state levels of carB mRNA, a reduction that is not due to differences in the level of transcription, indicating that silencing is post-transcriptional. Small sense and antisense RNAs have been found to be associated with gene silencing in M.circinelloides. Two size classes of small antisense RNAs, differentially accumulated during the vegetative growth of silenced transformants, have been detected: a long 25-nucleotide RNA and a short 21-nucleotide RNA. Secondary sense and antisense RNAs corresponding to sequences of the endogenous gene downstream of the initial triggering molecule have also been detected, revealing the existence of spreading of RNA targeting in fungi. These findings, together with the self-replicative nature of the triggering molecules, make M.circinelloides a suitable organism for investigating some unresolved questions in RNA silencing. PMID:12881432

Extremely High Expression of Antisense RNA for Wilms' Tumor 1 in Active Osteoclasts: Suppression of Wilms' Tumor 1 Protein Expression during Osteoclastogenesis.

PubMed

Li, Yin-Ji; Kukita, Akiko; Kyumoto-Nakamura, Yukari; Kukita, Toshio

2016-09-01

Wilms' tumor 1 (WT1), a zinc-finger transcription regulator of the early growth response family, identified as the product of a tumor suppressor gene of Wilms' tumors, bears potential ability to induce macrophage differentiation in blood cell differentiation. Herein, we examined the involvement of WT1 in the regulation of osteoclastogenesis. We detected a high level of WT1 protein expression in osteoclast precursors; however, WT1 expression was markedly suppressed during osteoclastogenesis. We examined expression of WT1 transcripts in bone tissue by RNA in situ hybridization. We found a high level of antisense transcripts in osteoclasts actively resorbing bone in mandible of newborn rats. Expression of antisense WT1 RNA in mandible was also confirmed by Northern blot analysis and strand-specific RT-PCR. Overexpression of antisense WT1 RNA in RAW-D cells, an osteoclast precursor cell line, resulted in a marked enhancement of osteoclastogenesis, suggesting that antisense WT1 RNA functions to suppress expression of WT1 protein in osteoclastogenesis. High level expression of antisense WT1 RNA may contribute to commitment to osteoclastogenesis, and may allow osteoclasts to maintain or stabilize their differentiation state. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides.

PubMed

Graham, Mark J; Lee, Richard G; Brandt, Teresa A; Tai, Li-Jung; Fu, Wuxia; Peralta, Raechel; Yu, Rosie; Hurh, Eunju; Paz, Erika; McEvoy, Bradley W; Baker, Brenda F; Pham, Nguyen C; Digenio, Andres; Hughes, Steven G; Geary, Richard S; Witztum, Joseph L; Crooke, Rosanne M; Tsimikas, Sotirios

2017-07-20

Epidemiologic and genomewide association studies have linked loss-of-function variants in ANGPTL3, encoding angiopoietin-like 3, with low levels of plasma lipoproteins. We evaluated antisense oligonucleotides (ASOs) targeting Angptl3 messenger RNA (mRNA) for effects on plasma lipid levels, triglyceride clearance, liver triglyceride content, insulin sensitivity, and atherosclerosis in mice. Subsequently, 44 human participants (with triglyceride levels of either 90 to 150 mg per deciliter [1.0 to 1.7 mmol per liter] or >150 mg per deciliter, depending on the dose group) were randomly assigned to receive subcutaneous injections of placebo or an antisense oligonucleotide targeting ANGPTL3 mRNA in a single dose (20, 40, or 80 mg) or multiple doses (10, 20, 40, or 60 mg per week for 6 weeks). The main end points were safety, side-effect profile, pharmacokinetic and pharmacodynamic measures, and changes in levels of lipids and lipoproteins. The treated mice had dose-dependent reductions in levels of hepatic Angptl3 mRNA, Angptl3 protein, triglycerides, and low-density lipoprotein (LDL) cholesterol, as well as reductions in liver triglyceride content and atherosclerosis progression and increases in insulin sensitivity. After 6 weeks of treatment, persons in the multiple-dose groups had reductions in levels of ANGPTL3 protein (reductions of 46.6 to 84.5% from baseline, P<0.01 for all doses vs. placebo) and in levels of triglycerides (reductions of 33.2 to 63.1%), LDL cholesterol (1.3 to 32.9%), very-low-density lipoprotein cholesterol (27.9 to 60.0%), non-high-density lipoprotein cholesterol (10.0 to 36.6%), apolipoprotein B (3.4 to 25.7%), and apolipoprotein C-III (18.9 to 58.8%). Three participants who received the antisense oligonucleotide and three who received placebo reported dizziness or headache. There were no serious adverse events. Oligonucleotides targeting mouse Angptl3 retarded the progression of atherosclerosis and reduced levels of atherogenic lipoproteins in

Post-transcriptional gene silencing triggered by sense transgenes involves uncapped antisense RNA and differs from silencing intentionally triggered by antisense transgenes

PubMed Central

Parent, Jean-Sébastien; Jauvion, Vincent; Bouché, Nicolas; Béclin, Christophe; Hachet, Mélanie; Zytnicki, Matthias; Vaucheret, Hervé

2015-01-01

Although post-transcriptional gene silencing (PTGS) has been studied for more than a decade, there is still a gap in our understanding of how de novo silencing is initiated against genetic elements that are not supposed to produce double-stranded (ds)RNA. Given the pervasive transcription occurring throughout eukaryote genomes, we tested the hypothesis that unintended transcription could produce antisense (as)RNA molecules that participate to the initiation of PTGS triggered by sense transgenes (S-PTGS). Our results reveal a higher level of asRNA in Arabidopsis thaliana lines that spontaneously trigger S-PTGS than in lines that do not. However, PTGS triggered by antisense transgenes (AS-PTGS) differs from S-PTGS. In particular, a hypomorphic ago1 mutation that suppresses S-PTGS prevents the degradation of asRNA but not sense RNA during AS-PTGS, suggesting a different treatment of coding and non-coding RNA by AGO1, likely because of AGO1 association to polysomes. Moreover, the intended asRNA produced during AS-PTGS is capped whereas the asRNA produced during S-PTGS derives from 3′ maturation of a read-through transcript and is uncapped. Thus, we propose that uncapped asRNA corresponds to the aberrant RNA molecule that is converted to dsRNA by RNA-DEPENDENT RNA POLYMERASE 6 in siRNA-bodies to initiate S-PTGS, whereas capped asRNA must anneal with sense RNA to produce dsRNA that initiate AS-PTGS. PMID:26209135

Method for phosphorothioate antisense DNA sequencing by capillary electrophoresis with UV detection.

PubMed

Froim, D; Hopkins, C E; Belenky, A; Cohen, A S

1997-11-01

The progress of antisense DNA therapy demands development of reliable and convenient methods for sequencing short single-stranded oligonucleotides. A method of phosphorothioate antisense DNA sequencing analysis using UV detection coupled to capillary electrophoresis (CE) has been developed based on a modified chain termination sequencing method. The proposed method reduces the sequencing cost since it uses affordable CE-UV instrumentation and requires no labeling with minimal sample processing before analysis. Cycle sequencing with ThermoSequenase generates quantities of sequencing products that are readily detectable by UV. Discrimination of undesired components from sequencing products in the reaction mixture, previously accomplished by fluorescent or radioactive labeling, is now achieved by bringing concentrations of undesired components below the UV detection range which yields a 'clean', well defined sequence. UV detection coupled with CE offers additional conveniences for sequencing since it can be accomplished with commercially available CE-UV equipment and is readily amenable to automation.

Method for phosphorothioate antisense DNA sequencing by capillary electrophoresis with UV detection.

PubMed Central

Froim, D; Hopkins, C E; Belenky, A; Cohen, A S

1997-01-01

The progress of antisense DNA therapy demands development of reliable and convenient methods for sequencing short single-stranded oligonucleotides. A method of phosphorothioate antisense DNA sequencing analysis using UV detection coupled to capillary electrophoresis (CE) has been developed based on a modified chain termination sequencing method. The proposed method reduces the sequencing cost since it uses affordable CE-UV instrumentation and requires no labeling with minimal sample processing before analysis. Cycle sequencing with ThermoSequenase generates quantities of sequencing products that are readily detectable by UV. Discrimination of undesired components from sequencing products in the reaction mixture, previously accomplished by fluorescent or radioactive labeling, is now achieved by bringing concentrations of undesired components below the UV detection range which yields a 'clean', well defined sequence. UV detection coupled with CE offers additional conveniences for sequencing since it can be accomplished with commercially available CE-UV equipment and is readily amenable to automation. PMID:9336449

Physicochemical and biological properties of self-assembled antisense/poly(amidoamine) dendrimer nanoparticles: the effect of dendrimer generation and charge ratio

PubMed Central

Nomani, Alireza; Haririan, Ismaeil; Rahimnia, Ramin; Fouladdel, Shamileh; Gazori, Tarane; Dinarvand, Rassoul; Omidi, Yadollah; Azizi, Ebrahim

2010-01-01

To gain a deeper understanding of the physicochemical phenomenon of self-assembled nanoparticles of different generations and ratios of poly (amidoamine) dendrimer (PAMAM) dendrimer and a short-stranded DNA (antisense oligonucleotide), multiple methods were used to characterize these nanoparticles including photon correlation spectroscopy (PCS); zeta potential measurement; and atomic force microscopy (AFM). PCS and AFM results revealed that, in contrast to larger molecules of DNA, smaller molecules produce more heterodisperse and large nanoparticles when they are condensed with a cationic dendrimer. AFM images also showed that such nanoparticles were spherical. The stability of the antisense content of the nanoparticles was investigated over different charge ratios using polyacrylamide gel electrophoresis. It was clear from such analyses that much more than charge neutrality point was required to obtain stable nanoparticles. For cell uptake, self-assembled nanoparticles were prepared with PAMAM G5 and 5’-FITC labeled antisense and the uptake experiment was carried out in T47D cell culture. This investigation also shows that the cytotoxicity of the nanoparticles was dependent upon the generation and charge ratio of the PAMAM dendrimer, and the antisense concentration had no significant effect on the cytotoxicity. PMID:20517481

A quick and simple FISH protocol with hybridization-sensitive fluorescent linear oligodeoxynucleotide probes

PubMed Central

Wang, Dan Ohtan; Matsuno, Hitomi; Ikeda, Shuji; Nakamura, Akiko; Yanagisawa, Hiroyuki; Hayashi, Yasunori; Okamoto, Akimitsu

2012-01-01

Fluorescence in situ hybridization (FISH) is a powerful tool used in karyotyping, cytogenotyping, cancer diagnosis, species specification, and gene-expression analysis. Although widely used, conventional FISH protocols are cumbersome and time consuming. We have now developed a FISH method using exciton-controlled hybridization-sensitive fluorescent oligodeoxynucleotide (ECHO) probes. ECHO–FISH uses a 25-min protocol from fixation to mounting that includes no stringency washing steps. We use ECHO–FISH to detect both specific DNA and RNA sequences with multicolor probes. ECHO–FISH is highly reproducible, stringent, and compatible with other fluorescent cellular labeling techniques. The resolution allows detection of intranuclear speckles of poly(A) RNA in HeLa cells and dissociated hippocampal primary cultures, and mRNAs in the distal dendrites of hippocampal neurons. We also demonstrate detection of telomeric and centromeric DNA on metaphase mouse chromosomes. The simplicity of the ECHO–FISH method will likely accelerate cytogenetic and gene-expression analysis with high resolution. PMID:22101241

PCSK9 LNA antisense oligonucleotides induce sustained reduction of LDL cholesterol in nonhuman primates.

PubMed

Lindholm, Marie W; Elmén, Joacim; Fisker, Niels; Hansen, Henrik F; Persson, Robert; Møller, Marianne R; Rosenbohm, Christoph; Ørum, Henrik; Straarup, Ellen M; Koch, Troels

2012-02-01

Proprotein convertase subtilisin/kexin type 9 (PCSK9) has emerged as a therapeutic target for the reduction of low-density lipoprotein cholesterol (LDL-C). PCSK9 increases the degradation of the LDL receptor, resulting in high LDL-C in individuals with high PCSK9 activity. Here, we show that two locked nucleic acid (LNA) antisense oligonucleotides targeting PCSK9 produce sustained reduction of LDL-C in nonhuman primates after a loading dose (20 mg/kg) and four weekly maintenance doses (5 mg/kg). PCSK9 messenger RNA (mRNA) and serum PCSK9 protein were reduced by 85% which resulted in a 50% reduction in circulating LDL-C. Serum total cholesterol (TC) levels were reduced to the same extent as LDL-C with no reduction in high-density lipoprotein levels, demonstrating a specific pharmacological effect on LDL-C. The reduction in hepatic PCSK9 mRNA correlated with liver LNA oligonucleotide content. This verified that anti-PCSK9 LNA oligonucleotides regulated LDL-C through an antisense mechanism. The compounds were well tolerated with no observed effects on toxicological parameters (liver and kidney histology, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine). The pharmacologic evidence and initial safety profile of the compounds used in this study indicate that LNA antisense oligonucleotides targeting PCSK9 provide a viable therapeutic strategy and are potential complements to statins in managing high LDL-C.

Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Hongmei; Ma, Leyuan; Zhao, Cong

To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leavesmore » and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.« less

Antisense Oligonucleotides Modulating Activation of a Nonsense-Mediated RNA Decay Switch Exon in the ATM Gene.

PubMed

Kralovicova, Jana; Moreno, Pedro M D; Cross, Nicholas C P; Pêgo, Ana Paula; Vorechovsky, Igor

2016-12-01

ATM (ataxia-telangiectasia, mutated) is an important cancer susceptibility gene that encodes a key apical kinase in the DNA damage response pathway. ATM mutations in the germ line result in ataxia-telangiectasia (A-T), a rare genetic syndrome associated with hypersensitivity to double-strand DNA breaks and predisposition to lymphoid malignancies. ATM expression is limited by a tightly regulated nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28. In this study, we identify antisense oligonucleotides that modulate NSE inclusion in mature transcripts by systematically targeting the entire 3.1-kb-long intron. Their identification was assisted by a segmental deletion analysis of transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression was achieved by delivering optimized splice-switching oligonucleotides to embryonic and lymphoblastoid cells using chitosan-based nanoparticles. Together, these results provide a basis for possible sequence-specific radiosensitization of cancer cells, highlight the power of intronic antisense oligonucleotides to modify gene expression, and demonstrate transposon-mediated regulation of NSEs.

CpG Oligodeoxynucleotides Facilitate Delivery of Whole Inactivated H9N2 Influenza Virus via Transepithelial Dendrites of Dendritic Cells in Nasal Mucosa

PubMed Central

Qin, Tao; Yin, Yinyan; Yu, Qinghua; Huang, Lulu; Wang, Xiaoqing; Lin, Jian

2015-01-01

ABSTRACT The spread of the low-pathogenicity avian H9N2 influenza virus has seriously increased the risk of a new influenza pandemic. Although whole inactivated virus (WIV) vaccine via intranasal pathway is the effective method of blocking virus transmission, the mucosal barrier seems to be a major factor hampering its development. CpG oligodeoxynucleotides, a known adjuvant, can target downstream dendritic cells (DCs) and effectively enhance the mucosal and systemic immune responses. However, the ability of CpGs to assist H9N2 WIV in transepithelial transport remains unknown. Here, in vitro and in vivo, we showed that CpGs provided assistance for H9N2 WIV in recruiting DCs to the nasal epithelial cells (ECs) and forming transepithelial dendrites (TEDs) to capture luminal viruses. CD103+ DCs participated in this process. Chemokine CCL20 from nasal ECs played a key role in driving DC recruitment and TED formation. Virus-loaded DCs quickly migrated into the draining cervical lymph nodes (CLNs) for antigen presentation. In addition, the competence of CpGs was independent of direct epithelial transport via the transcellular or paracellular pathway. Taken together, our data demonstrated that CpGs enhanced the transport of H9N2 WIV via TEDs of nasal DCs, which might be a novel mechanism for optimal adaptive immune responses. IMPORTANCE This paper demonstrates by both an in vivo and an in vitro coculture model that CpG oligodeoxynucleotides, known as an adjuvant generally targeting downstream immune responses, also are crucial for the transport of H9N2 WIV across nasal epithelial cells (ECs) via the uptake of transepithelial dendrites (TEDs). Our results prove for the first time to our knowledge that the immune-potentiating mechanism of CpGs is based on strengthening the transepithelial uptake of H9N2 WIV in nasal mucosa. These findings provide a fresh perspective for further improvement of intranasal influenza vaccines, which are urgently needed in the face of the

Oxacillin sensitization of methicillin-resistant Staphylococcus aureus and methicillin-resistant Staphylococcus pseudintermedius by antisense peptide nucleic acids in vitro.

PubMed

Goh, Shan; Loeffler, Anette; Lloyd, David H; Nair, Sean P; Good, Liam

2015-11-11

Antibiotic resistance genes can be targeted by antisense agents, which can reduce their expression and thus restore cellular susceptibility to existing antibiotics. Antisense inhibitors can be gene and pathogen specific, or designed to inhibit a group of bacteria having conserved sequences within resistance genes. Here, we aimed to develop antisense peptide nucleic acids (PNAs) that could be used to effectively restore susceptibility to β-lactams in methicillin-resistant Staphylococcus aureus (MRSA) and methicillin-resistant Staphylococcus pseudintermedius (MRSP). Antisense PNAs specific for conserved regions of the mobilisable gene mecA, and the growth essential gene, ftsZ, were designed. Clinical MRSA and MRSP strains of high oxacillin resistance were treated with PNAs and assayed for reduction in colony forming units on oxacillin plates, reduction in target gene mRNA levels, and cell size. Anti-mecA PNA at 7.5 and 2.5 μM reduced mecA mRNA in MRSA and MRSP (p < 0.05). At these PNA concentrations, 66 % of MRSA and 92 % of MRSP cells were killed by oxacillin (p < 0.01). Anti-ftsZ PNA at 7.5 and 2.5 μM reduced ftsZ mRNA in MRSA and MRSP, respectively (p ≤ 0.05). At these PNA concentrations, 86 % of MRSA cells and 95 % of MRSP cells were killed by oxacillin (p < 0.05). Anti-ftsZ PNAs resulted in swelling of bacterial cells. Scrambled PNA controls did not affect MRSA but sensitized MRSP moderately to oxacillin without affecting mRNA levels. The antisense PNAs effects observed provide in vitro proof of concept that this approach can be used to reverse β-lactam resistance in staphylococci. Further studies are warranted as clinical treatment alternatives are needed.

Antisense reduction of tau in adult mice protects against seizures.

PubMed

DeVos, Sarah L; Goncharoff, Dustin K; Chen, Guo; Kebodeaux, Carey S; Yamada, Kaoru; Stewart, Floy R; Schuler, Dorothy R; Maloney, Susan E; Wozniak, David F; Rigo, Frank; Bennett, C Frank; Cirrito, John R; Holtzman, David M; Miller, Timothy M

2013-07-31

Tau, a microtubule-associated protein, is implicated in the pathogenesis of Alzheimer's Disease (AD) in regard to both neurofibrillary tangle formation and neuronal network hyperexcitability. The genetic ablation of tau substantially reduces hyperexcitability in AD mouse lines, induced seizure models, and genetic in vivo models of epilepsy. These data demonstrate that tau is an important regulator of network excitability. However, developmental compensation in the genetic tau knock-out line may account for the protective effect against seizures. To test the efficacy of a tau reducing therapy for disorders with a detrimental hyperexcitability profile in adult animals, we identified antisense oligonucleotides that selectively decrease endogenous tau expression throughout the entire mouse CNS--brain and spinal cord tissue, interstitial fluid, and CSF--while having no effect on baseline motor or cognitive behavior. In two chemically induced seizure models, mice with reduced tau protein had less severe seizures than control mice. Total tau protein levels and seizure severity were highly correlated, such that those mice with the most severe seizures also had the highest levels of tau. Our results demonstrate that endogenous tau is integral for regulating neuronal hyperexcitability in adult animals and suggest that an antisense oligonucleotide reduction of tau could benefit those with epilepsy and perhaps other disorders associated with tau-mediated neuronal hyperexcitability.

Post-transcriptional gene silencing triggered by sense transgenes involves uncapped antisense RNA and differs from silencing intentionally triggered by antisense transgenes.

PubMed

Parent, Jean-Sébastien; Jauvion, Vincent; Bouché, Nicolas; Béclin, Christophe; Hachet, Mélanie; Zytnicki, Matthias; Vaucheret, Hervé

2015-09-30

Although post-transcriptional gene silencing (PTGS) has been studied for more than a decade, there is still a gap in our understanding of how de novo silencing is initiated against genetic elements that are not supposed to produce double-stranded (ds)RNA. Given the pervasive transcription occurring throughout eukaryote genomes, we tested the hypothesis that unintended transcription could produce antisense (as)RNA molecules that participate to the initiation of PTGS triggered by sense transgenes (S-PTGS). Our results reveal a higher level of asRNA in Arabidopsis thaliana lines that spontaneously trigger S-PTGS than in lines that do not. However, PTGS triggered by antisense transgenes (AS-PTGS) differs from S-PTGS. In particular, a hypomorphic ago1 mutation that suppresses S-PTGS prevents the degradation of asRNA but not sense RNA during AS-PTGS, suggesting a different treatment of coding and non-coding RNA by AGO1, likely because of AGO1 association to polysomes. Moreover, the intended asRNA produced during AS-PTGS is capped whereas the asRNA produced during S-PTGS derives from 3' maturation of a read-through transcript and is uncapped. Thus, we propose that uncapped asRNA corresponds to the aberrant RNA molecule that is converted to dsRNA by RNA-DEPENDENT RNA POLYMERASE 6 in siRNA-bodies to initiate S-PTGS, whereas capped asRNA must anneal with sense RNA to produce dsRNA that initiate AS-PTGS. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Pressure-Mediated Oligonucleotide Transfection of Rat and Human Cardiovascular Tissues

NASA Astrophysics Data System (ADS)

Mann, Michael J.; Gibbons, Gary H.; Hutchinson, Howard; Poston, Robert S.; Hoyt, E. Grant; Robbins, Robert C.; Dzau, Victor J.

1999-05-01

The application of gene therapy to human disease is currently restricted by the relatively low efficiency and potential hazards of methods of oligonucleotide or gene delivery. Antisense or transcription factor decoy oligonucleotides have been shown to be effective at altering gene expression in cell culture expreriments, but their in vivo application is limited by the efficiency of cellular delivery, the intracellular stability of the compounds, and their duration of activity. We report herein the development of a highly efficient method for naked oligodeoxynucleotide (ODN) transfection into cardiovascular tissues by using controlled, nondistending pressure without the use of viral vectors, lipid formulations, or exposure to other adjunctive, potentially hazardous substances. In this study, we have documented the ability of ex vivo, pressure-mediated transfection to achieve nuclear localization of fluorescent (FITC)-labeled ODN in approximately 90% and 50% of cells in intact human saphenous vein and rat myocardium, respectively. We have further documented that pressure-mediated delivery of antisense ODN can functionally inhibited target gene expression in both of these tissues in a sequence-specific manner at the mRNA and protein levels. This oligonucleotide transfection system may represent a safe means of achieving the intraoperative genetic engineering of failure-resistant human bypass grafts and may provide an avenue for the genetic manipulation of cardiac allograft rejection, allograft vasculopathy, or other transplant diseases.

Activation of Notch3 in Glomeruli Promotes the Development of Rapidly Progressive Renal Disease.

PubMed

El Machhour, Fala; Keuylian, Zela; Kavvadas, Panagiotis; Dussaule, Jean-Claude; Chatziantoniou, Christos

2015-07-01

Notch3 expression is found in the glomerular podocytes of patients with lupus nephritis or focal segmental GN but not in normal kidneys. Here, we show that activation of the Notch3 receptor in the glomeruli is a turning point inducing phenotypic changes in podocytes promoting renal inflammation and fibrosis and leading to disease progression. In a model of rapidly progressive GN, Notch3 expression was induced by several-fold in podocytes concurrently with disease progression. By contrast, mice lacking Notch3 expression were protected because they exhibited less proteinuria, uremia, and inflammatory infiltration. Podocyte outgrowth from glomeruli isolated from wild-type mice during the early phase of the disease was higher than outgrowth from glomeruli of mice lacking Notch3. In vitro studies confirmed that podocytes expressing active Notch3 reorganize their cytoskeleton toward a proliferative/migratory and inflammatory phenotype. We then administered antisense oligodeoxynucleotides targeting Notch3 or scramble control oligodeoxynucleotides in wild-type mice concomitant to disease induction. Both groups developed chronic renal disease, but mice injected with Notch3 antisense had lower values of plasma urea and proteinuria and inflammatory infiltration. The improvement of renal function was accompanied by fewer deposits of fibrin within the glomeruli and by decreased peritubular inflammation. Finally, abnormal Notch3 staining was observed in biopsy samples of patients with crescentic GN. These results demonstrate that abnormal activation of Notch3 may be involved in the progression of renal disease by promoting migratory and proinflammatory pathways. Inhibiting Notch3 activation could be a novel, promising approach to treat GN. Copyright © 2015 by the American Society of Nephrology.

[CpG-oligodeoxynucleotide stimulation improves the success for karyotypic analysis of chronic lymphocytic leukemia cells].

PubMed

Liu, Qiong; Xu, Wei; Qiu, Hai-rong; Wang, Rong; Yu, Hui; Fan, Lei; Miao, Kou-rong; Li, Jian-yong

2009-09-01

To explore the effect of CpG-oligodeoxynucleotides (ODN) in chromosome study of chronic lymphocytic leukemia (CLL). Blood or bone marrow cells of 70 CLL patients were cultured for 72 h with PHA, CpG-ODN and CpG-ODN combined with IL-2, respectively. Routine karyotype analysis with R banding technique and interphase fluorescence in situ hybridization (FISH) were performed. The metaphase number>or=20 was considered as successful stimulation, which in PHA, CpG-ODN and CpG-ODN combined IL-2 groups were 90.0%, 68.6% and 68.6%, respectively, and the detection rates of chromosome aberrations were 3.2%, 43.6% and 43.6%, respectively. The aberrations rates detected by interphase FISH with a panel of probes was 64.3%. CpG-ODN DSP30 can effectively raise the detection rate of chromosome aberrations in CLL patients.

Post-transcriptional inducible gene regulation by natural antisense RNA.

PubMed

Nishizawa, Mikio; Ikeya, Yukinobu; Okumura, Tadayoshi; Kimura, Tominori

2015-01-01

Accumulating data indicate the existence of natural antisense transcripts (asRNAs), frequently transcribed from eukaryotic genes and do not encode proteins in many cases. However, their importance has been overlooked due to their heterogeneity, low expression level, and unknown function. Genes induced in responses to various stimuli are transcriptionally regulated by the activation of a gene promoter and post-transcriptionally regulated by controlling mRNA stability and translatability. A low-copy-number asRNA may post-transcriptionally regulate gene expression with cis-controlling elements on the mRNA. The asRNA itself may act as regulatory RNA in concert with trans-acting factors, including various RNA-binding proteins that bind to cis-controlling elements, microRNAs, and drugs. A novel mechanism that regulates mRNA stability includes the interaction of asRNA with mRNA by hybridization to loops in secondary structures. Furthermore, recent studies have shown that the functional network of mRNAs, asRNAs, and microRNAs finely tunes the levels of mRNA expression. The post-transcriptional mechanisms via these RNA-RNA interactions may play pivotal roles to regulate inducible gene expression and present the possibility of the involvement of asRNAs in various diseases.

Biological functions of proline in morphogenesis and osmotolerance revealed in antisense transgenic Arabidopsis thaliana.

PubMed

Nanjo, T; Kobayashi, M; Yoshiba, Y; Sanada, Y; Wada, K; Tsukaya, H; Kakubari, Y; Yamaguchi-Shinozaki, K; Shinozaki, K

1999-04-01

Many organisms, including higher plants, accumulate free proline (Pro) in response to osmotic stress. Although various studies have focused on the ability of Pro as a compatible osmolyte involved in osmotolerance, its specific role throughout plant growth is still unclear. It has been reported that Pro is synthesized from Glu catalyzed by a key enzyme, delta 1-pyrroline-5-carboxylate synthetase (P5CS), in plants. To elucidate essential roles of Pro, we generated antisense transgenic Arabidopsis plants with a P5CS cDNA. Several transgenics accumulated Pro at a significantly lower level than wild-type plants, providing direct evidence for a key role of P5CS in Pro production in Arabidopsis. These antisense transgenics showed morphological alterations in leaves and a defect in elongation of inflorescences. Furthermore, transgenic leaves were hypersensitive to osmotic stress. Microscopic analysis of transgenic leaves, in which the mutated phenotype clearly occurred, showed morphological abnormalities of epidermal and parenchymatous cells and retardation of differentiation of vascular systems. These phenotypes were suppressed by exogenous L-Pro but not by D-Pro or other Pro analogues. In addition, Pro deficiency did not broadly affect all proteins but specifically affected structural proteins of cell walls in the antisense transgenic plants. These results indicate that Pro is not just an osmoregulator in stressed plants but has a unique function involved in osmotolerance as well as in morphogenesis as a major constituent of cell wall structural proteins in plants.

Preliminary evaluation of cytosine-phosphate-guanine oligodeoxynucleotides bound to gelatine nanoparticles as immunotherapy for canine atopic dermatitis.

PubMed

Wagner, I; Geh, K J; Hubert, M; Winter, G; Weber, K; Classen, J; Klinger, C; Mueller, R S

2017-07-29

Cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODN) are a promising new immunotherapeutic treatment option for canine atopic dermatitis (AD). The aim of this uncontrolled pilot study was to evaluate clinical and immunological effects of gelatine nanoparticle (GNP)-bound CpG ODN (CpG GNP) on atopic dogs. Eighteen dogs with AD were treated for 8 weeks (group 1, n=8) or 18 weeks (group 2, n=10). Before inclusion and after 2 weeks, 4 weeks, 6 weeks (group 1+2), 8 weeks, 12 weeks and 16 weeks (group 2) 75 µg CpG ODN/dog (bound to 1.5 mg GNP) were injected subcutaneously. Pruritus was evaluated daily by the owner. Lesions were evaluated and serum concentrations and mRNA expressions of interferon-γ, tumour necrosis factor-α, transforming growth factor-β, interleukin (IL) 10 and IL-4 (only mRNA expression) were determined at inclusion and after 8 weeks (group 1+2) and 18 weeks (group 2). Lesions and pruritus improved significantly from baseline to week 8. Mean improvements from baseline to week 18 were 23 per cent and 44 per cent for lesions and pruritus, respectively, an improvement of ≥50 per cent was seen in six out of nine and three out of six dogs, respectively. IL-4 mRNA expression decreased significantly. The results of this study show a clinical improvement of canine AD with CpG GNP comparable to allergen immunotherapy. Controlled studies are needed to confirm these findings. British Veterinary Association.

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

PubMed Central

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

PubMed

Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

2015-01-01

CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

Double blind, placebo controlled trial of the remission inducing and steroid sparing properties of an ICAM-1 antisense oligodeoxynucleotide, alicaforsen (ISIS 2302), in active steroid dependent Crohn's disease

PubMed Central

Yacyshyn, B R; Chey, W Y; Goff, J; Salzberg, B; Baerg, R; Buchman, A L; Tami, J; Yu, R; Gibiansky, E; Shanahan, W R

2002-01-01

Background and aims: To evaluate the safety and efficacy of the intercellular adhesion molecule 1 (ICAM-1) antisense phosphorothioate oligonucleotide alicaforsen (ISIS 2302) in Crohn's disease. Methods: Active (Crohn's disease activity index (CDAI) 200–350), steroid dependent (prednisone 10–40 mg) Crohn's patients were randomised into three treatment groups: placebo versus ISIS 2302 (2 mg/kg intravenously three times a week) for two or four weeks. Patients were treated in months 1 and 3, with steroid withdrawal attempted by week 10. The primary end point (steroid free remission) was a CDAI <150 off steroids at the end of week 14. Results: A total of 299 patients were enrolled, with a mean baseline CDAI of 276 and steroid dose of 23 mg/day. Rates of steroid free remission were equivalent for the two and four week ISIS 2302 groups (20.2% and 21.2%) and the placebo group (18.8%). At week 14, steroid withdrawal was successful in more ISIS 2302 patients compared with placebo treated patients (78% v 64%; p=0.032). Steroid free remission was highly correlated with exposure (p=0.0064). Other clinical responses were correlated with exposure, with significant results versus placebo being observed in the highest area under the curve subgroup. CDAI scores decreased by 136 (112) at week 14 versus 52 (107) for placebo (p=0.027) and inflammatory bowel disease score questionnaire improved by 43 (31) versus 15 (36) for placebo (p=0.027). Conclusions: Although the primary outcomes failed to demonstrate efficacy, pharmacodynamic modelling suggests that alicaforsen (ISIS 2302) may be an effective therapy for steroid dependent Crohn's disease. PMID:12077088

Nanoparticle Delivery of Antisense Oligonucleotides and Their Application in the Exon Skipping Strategy for Duchenne Muscular Dystrophy

PubMed Central

Falzarano, Maria Sofia; Passarelli, Chiara

2014-01-01

Antisense therapy is a powerful tool for inducing post-transcriptional modifications and thereby regulating target genes associated with disease. There are several classes of antisense oligonucleotides (AONs) with therapeutic use, such as double-stranded RNAs (interfering RNAs, utilized for gene silencing, and single-stranded AONs with various chemistries, which are useful for antisense targeting of micro-RNAs and mRNAs. In particular, the use of AONs for exon skipping, by targeting pre-mRNA, is proving to be a highly promising therapy for some genetic disorders like Duchenne muscular dystrophy and spinal muscular atrophy. However, AONs are unable to cross the plasma membrane unaided, and several other obstacles still remain to be overcome, in particular their instability due to their nuclease sensitivity and their lack of tissue specificity. Various drug delivery systems have been explored to improve the bioavailability of nucleic acids, and nanoparticles (NPs) have been suggested as potential vectors for DNA/RNA. This review describes the recent progress in AON conjugation with natural and synthetic delivery systems, and provides an overview of the efficacy of NP-AON complexes as an exon-skipping treatment for Duchenne muscular dystrophy. PMID:24506782

Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research

Cancer.gov

Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional

CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

PubMed

Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

2010-11-23

Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

Natural antisense transcripts are significantly involved in regulation of drought stress in maize.

PubMed

Xu, Jie; Wang, Qi; Freeling, Micheal; Zhang, Xuecai; Xu, Yunbi; Mao, Yan; Tang, Xin; Wu, Fengkai; Lan, Hai; Cao, Moju; Rong, Tingzhao; Lisch, Damon; Lu, Yanli

2017-05-19

Natural antisense transcripts (NATs) are a prominent and complex class of regulatory RNAs. Using strand-specific RNA sequencing, we identified 1769 sense and antisense transcript pairs (NAT pairs) in two maize inbreds with different sensitivity to drought, as well as in two derivative recombination inbred lines (RILs). A significantly higher proportion of NATs relative to non-NATs are specifically expressed under water stress (WS). Surprisingly, expression of sense and antisense transcripts produced by NAT pairs is significantly correlated, particularly under WS. We found an unexpected large proportion of NATs with protein coding potential, as estimated by ribosome release scores. Small RNAs significantly accumulate within NAT pairs, with 21 nt smRNA particularly enriched in overlapping regions of these pairs of genes. The abundance of these smRNAs is significantly altered in the leafbladeless1 mutant, suggesting that these genes may be regulated by the tasiRNA pathway. Further, NATs are significantly hypomethylated and include fewer transposable element sequences relative to non-NAT genes. NAT gene regions also exhibit higher levels of H3K36me3, H3K9ac, and H3K4me3, but lower levels of H3K27me3, indicating that NAT gene pairs generally exhibit an open chromatin configuration. Finally, NAT pairs in 368 diverse maize inbreds and 19 segregating populations were specifically enriched for polymorphisms associated with drought tolerance. Taken together, the data highlight the potential impact of that small RNAs and histone modifications have in regulation of NAT expression, and the significance of NATs in response to WS. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Sense and antisense transcripts of the developmentally regulated murine hsp70.2 gene are expressed in distinct and only partially overlapping areas in the adult brain

NASA Technical Reports Server (NTRS)

Murashov, A. K.; Wolgemuth, D. J.

1996-01-01

We have examined the spatial pattern of expression of a member of the hsp70 gene family, hsp70.2, in the mouse central nervous system. Surprisingly, RNA blot analysis and in situ hybridization revealed abundant expression of an 'antisense' hsp70.2 transcript in several areas of adult mouse brain. Two different transcripts recognized by sense and antisense riboprobes for the hsp70.2 gene were expressed in distinct and only partially overlapping neuronal populations. RNA blot analysis revealed low levels of the 2.7 kb transcript of hsp70.2 in several areas of the brain, with highest signal in the hippocampus. Abundant expression of a slightly larger (approximately 2.8 kb) 'antisense' transcript was detected in several brain regions, notably in the brainstem, cerebellum, mesencephalic tectum, thalamus, cortex, and hippocampus. In situ hybridization revealed that the sense and antisense transcripts were both predominantly neuronal and localized to the same cell types in the granular layer of the cerebellum, trapezoid nucleus of the superior olivary complex, locus coeruleus and hippocampus. The hsp70.2 antisense transcripts were particularly abundant in the frontal cortex, dentate gyrus, subthalamic nucleus, zona incerta, superior and inferior colliculi, central gray, brainstem, and cerebellar Purkinje cells. Our findings have revealed a distinct cellular and spatial localization of both sense and antisense transcripts, demonstrating a new level of complexity in the function of the heat shock genes.

Capillary electrophoretic separation-based approach to determine the labeling kinetics of oligodeoxynucleotides

PubMed Central

Kanavarioti, Anastassia; Greenman, Kevin L.; Hamalainen, Mark; Jain, Aakriti; Johns, Adam M.; Melville, Chris R.; Kemmish, Kent; Andregg, William

2014-01-01

With the recent advances in electron microscopy (EM), computation, and nanofabrication, the original idea of reading DNA sequence directly from an image can now be tested. One approach is to develop heavy atom labels that can provide the contrast required for EM imaging. While evaluating tentative labels for the respective nucleobases in synthetic oligodeoxynucleotides (oligos), we developed a streamlined capillary electrophoresis (CE) protocol to assess the label stability, reactivity, and selectivity. We report our protocol using osmium tetroxide 2,2′-bipyridine (Osbipy) as a thymidine (T) specific label. The observed rates show that the labeling process is kinetically independent of both the oligo length, and the base composition. The conditions, i.e. temperature, optimal Osbipy concentration, and molar ratio of reagents, to promote 100% conversion of the starting oligo to labeled product were established. Hence the optimized conditions developed with the oligos could be leveraged to allow osmylation of effectively all Ts in single-stranded (ss) DNA, while achieving minimal mislabeling. In addition, the approach and methods employed here may be adapted to the evaluation of other prospective contrasting agents/labels to facilitate next-generation DNA sequencing by EM. PMID:23147698

Inhibition of bone resorption in vitro by antisense RNA and DNA molecules targeted against carbonic anhydrase II or two subunits of vacuolar H(+)-ATPase.

PubMed Central

Laitala, T; Väänänen, H K

1994-01-01

The bone resorbing cells, osteoclasts, express high levels of carbonic anhydrase II (CA II) and vacuolar H(+)-ATPase (V-ATPase) during bone resorption. We have used antisense RNA and DNA molecules targeted against CA II, and against 16- and 60-kD subunits of vacuolar H(+)-ATPase (V-ATPase), to block the expression of these proteins in vitro. Osteoclastic bone resorption was studied in two in vitro culture systems: release of 45Calcium from prelabeled newborn mouse calvaria cultures, and resorption pit assays performed with rat osteoclasts cultured on bovine bone slices. Both antisense RNA and DNA against CA II and the V-ATPase were used to compare their specificities as regards inhibiting bone resorption in vitro. The antisense molecules inhibited the synthesis of these proteins by decreasing the amounts of mRNA in the cells in a highly specific manner. In osteoclast cultures treated with the 16-kD V-ATPase antisense RNA, acidification of an unknown population of intracellular vesicles was highly stimulated. The acidification of these vesicles was not sensitive to amiloride or bafilomycin A1. This suggests the existence of a back-up system for acidification of intracellular vesicles, when the expression of the V-ATPase is blocked. Our results further indicate that blocking the expression of CA II and V-ATPase with antisense RNA or DNA leads to decreased bone resorption. Images PMID:8200964

Permissive Sense and Antisense Transcription from the 5′ and 3′ Long Terminal Repeats of Human T-Cell Leukemia Virus Type 1

PubMed Central

Polakowski, Nicholas; Hoang, Kimson

2016-01-01

ABSTRACT Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus, and, as such, its genome becomes chromosomally integrated following infection. The resulting provirus contains identical 5′ and 3′ peripheral long terminal repeats (LTRs) containing bidirectional promoters. Antisense transcription from the 3′ LTR regulates expression of a single gene, hbz, while sense transcription from the 5′ LTR controls expression of all other viral genes, including tax. Both the HBZ and Tax proteins are implicated in the development of adult T-cell leukemia (ATL), a T-cell malignancy caused by HTLV-1 infection. However, these proteins appear to harbor opposing molecular functions, indicating that they may act independently and at different time points prior to leukemogenesis. Here, we used bidirectional reporter constructs to test whether transcriptional interference serves as a mechanism that inhibits simultaneous expression of Tax and HBZ. We found that sense transcription did not interfere with antisense transcription from the 3′ LTR and vice versa, even with strong transcription emanating from the opposing direction. Therefore, bidirectional transcription across the provirus might not restrict hbz or tax expression. Single-cell analyses revealed that antisense transcription predominates in the absence of Tax, which transactivates viral sense transcription. Interestingly, a population of Tax-expressing cells exhibited antisense but not activated sense transcription. Consistent with the ability of Tax to induce cell cycle arrest, this population was arrested in G0/G1 phase. These results imply that cell cycle arrest inhibits Tax-mediated activation of sense transcription without affecting antisense transcription, which may be important for long-term viral latency. IMPORTANCE The chromosomally integrated form of the retrovirus human T-cell leukemia virus type 1 (HTLV-1) contains identical DNA sequences, known as long terminal repeats (LTRs), at its 5′ and 3�

The role of antisense oligonucleotide therapy in patients with familial hypercholesterolemia: risks, benefits, and management recommendations.

PubMed

Agarwala, Anandita; Jones, Peter; Nambi, Vijay

2015-01-01

Antisense oligonucleotide therapy is a promising approach for the treatment of a broad variety of medical conditions. It functions at the cellular level by interfering with RNA function, often leading to degradation of specifically targeted abnormal gene products implicated in the disease process. Mipomersen is a novel antisense oligonucleotide directed at apolipoprotein (apoB)-100, the primary apolipoprotein associated with low-density lipoprotein cholesterol (LDL-C), which has recently been approved for the treatment of familial hypercholesterolemia. A number of clinical studies have demonstrated its efficacy in lowering LDL-C and apoB levels in patients with elevated LDL-C despite maximal medical therapy using conventional lipid-lowering agents. This review outlines the risks and benefits of therapy and provides recommendations on the use of mipomersen.

Marfan syndrome, magnesium status and medical prevention of cardiovascular complications by hemodynamic treatments and antisense gene therapy.

PubMed

Igondjo-Tchen, S; Pagès, N; Bac, P; Godeau, G; Durlach, J

2003-03-01

The medical management of Marfan Syndrome (MFS) mainly relies on early prevention of the aortic complications. Hemodynamic treatments try to diminish the forcefulness of cardiac contractions and to reduce blood pressure: for example long term administration of propranolol may significantly reduce the rate of increase in aortic ratio (aortic diameter/expected aortic diameter). Retardation of aortic dilatation may be most often observed by early treatment started when the baseline end-diastolic aortic root diameter is < 40 mm. It seems better to use beta-blockers without intrinsic sympathomimetic activity. Successful acceptance of beta-blockers may be limited by side-effects, but the efficiency of alternative hypotensive agents (calcium channel inhibitors, ACE inhibitors) is not yet validated. Gene therapy might constitute an etiologic specific treatment of MFS. FBN1-RZ1 hammerhead antisense ribozyme is able to suppress expression of the mutant FBN1 allele. The use of ribozymes as systemic therapeutic agents will depend on efficient delivery to its target, but the various proposed vectors raise yet unsolved problems. A hydrogel angioplasty balloon might be a possible vector for delivering an antisense ribozyme in the aortic wall specifically. Ribozymes--as deoxyribonucleotides--may be taken up by tissue upon local application. Further research should study ex vivo local application of antisense ribozyme on human aortic wall, before assessing in vivo efficiency and tolerance of this aortic local vectorisation. It is always necessary to maintain a balanced magnesium intake in patients with MFS. Firstly to prevent the multiple noxious effects of magnesium deficiency on cardiovascular targets. Secondly to ensure the best efficiency and the least toxicity of the hemodynamic drugs used as long term prophylactic treatment for cardiovascular complications and of the etiologic antisense magnesium-dependent gene therapy, in the future.

Enzymatic and antisense effects of a specific anti-Ki-ras ribozyme in vitro and in cell culture.

PubMed Central

Giannini, C D; Roth, W K; Piiper, A; Zeuzem, S

1999-01-01

Due to their mode of action, ribozymes show antisense effects in addition to their specific cleavage activity. In the present study we investigated whether a hammerhead ribozyme is capable of cleaving mutated Ki-ras mRNA in a pancreatic carcinoma cell line and whether antisense effects contribute to the activity of the ribozyme. A 2[prime]-O-allyl modified hammerhead ribozyme was designed to cleave specifically the mutated form of the Ki- ras mRNA (GUU motif in codon 12). The activity was monitored by RT-PCR on Ki- ras RNA expression by determination of the relative amount of wild type to mutant Ki-ras mRNA, by 5-bromo-2[prime]-deoxy-uridine incorporation on cell proliferation and by colony formation in soft agar on malignancy in the human pancreatic adenocarcinoma cell line CFPAC-1, which is heterozygous for the Ki-ras mutation. A catalytically inactive ribozyme was used as control to differentiate between antisense and cleavage activity and a ribozyme with random guide sequences as negative control. The catalytically active anti-Ki-ras ribozyme was at least 2-fold more potent in decreasing cellular Ki-ras mRNA levels, inhibiting cell proliferation and colony formation in soft agar than the catalytically inactive ribozyme. The catalytically active anti-Ki-ras ribozyme, but not the catalytically inactive or random ribozyme, increased the ratio of wild type to mutated Ki-ras mRNA in CFPAC-1 cells. In conclusion, both cleavage activity and antisense effects contribute to the activity of the catalytically active anti-Ki-ras hammerhead ribozyme. Specific ribozymes might be useful in the treatment of pancreatic carcinomas containing an oncogenic GTT mutation in codon 12 of the Ki-ras gene. PMID:10373591

The Antisense RNA As1_flv4 in the Cyanobacterium Synechocystis sp. PCC 6803 Prevents Premature Expression of the flv4-2 Operon upon Shift in Inorganic Carbon Supply*

PubMed Central

Eisenhut, Marion; Georg, Jens; Klähn, Stephan; Sakurai, Isamu; Mustila, Henna; Zhang, Pengpeng; Hess, Wolfgang R.; Aro, Eva-Mari

2012-01-01

The functional relevance of natural cis-antisense transcripts is mostly unknown. Here we have characterized the association of three antisense RNAs and one intergenically encoded noncoding RNA with an operon that plays a crucial role in photoprotection of photosystem II under low carbon conditions in the cyanobacterium Synechocystis sp. PCC 6803. Cyanobacteria show strong gene expression dynamics in response to a shift of cells from high carbon to low levels of inorganic carbon (Ci), but the regulatory mechanisms are poorly understood. Among the most up-regulated genes in Synechocystis are flv4, sll0218, and flv2, which are organized in the flv4-2 operon. The flavodiiron proteins encoded by this operon open up an alternative electron transfer route, likely starting from the QB site in photosystem II, under photooxidative stress conditions. Our expression analysis of cells shifted from high carbon to low carbon demonstrated an inversely correlated transcript accumulation of the flv4-2 operon mRNA and one antisense RNA to flv4, designated as As1_flv4. Overexpression of As1_flv4 led to a decrease in flv4-2 mRNA. The promoter activity of as1_flv4 was transiently stimulated by Ci limitation and negatively regulated by the AbrB-like transcription regulator Sll0822, whereas the flv4-2 operon was positively regulated by the transcription factor NdhR. The results indicate that the tightly regulated antisense RNA As1_flv4 establishes a transient threshold for flv4-2 expression in the early phase after a change in Ci conditions. Thus, it prevents unfavorable synthesis of the proteins from the flv4-2 operon. PMID:22854963

Antisense transcriptional interference mediates condition-specific gene repression in budding yeast.

PubMed

Nevers, Alicia; Doyen, Antonia; Malabat, Christophe; Néron, Bertrand; Kergrohen, Thomas; Jacquier, Alain; Badis, Gwenael

2018-05-18

Pervasive transcription generates many unstable non-coding transcripts in budding yeast. The transcription of such noncoding RNAs, in particular antisense RNAs (asRNAs), has been shown in a few examples to repress the expression of the associated mRNAs. Yet, such mechanism is not known to commonly contribute to the regulation of a given class of genes. Using a mutant context that stabilized pervasive transcripts, we observed that the least expressed mRNAs during the exponential phase were associated with high levels of asRNAs. These asRNAs also overlapped their corresponding gene promoters with a much higher frequency than average. Interrupting antisense transcription of a subset of genes corresponding to quiescence-enriched mRNAs restored their expression. The underlying mechanism acts in cis and involves several chromatin modifiers. Our results convey that transcription interference represses up to 30% of the 590 least expressed genes, which includes 163 genes with quiescence-enriched mRNAs. We also found that pervasive transcripts constitute a higher fraction of the transcriptome in quiescence relative to the exponential phase, consistent with gene expression itself playing an important role to suppress pervasive transcription. Accordingly, the HIS1 asRNA, normally only present in quiescence, is expressed in exponential phase upon HIS1 mRNA transcription interruption.

Antisense RNA that Affects Rhodopseudomonas palustris Quorum-Sensing Signal Receptor Expression

DTIC Science & Technology

2012-01-01

antisense molecules were produced, we performed a Northern blot analysis with RNA harvested from wild-type and rpaR-mutant R. palustris cells by using...aeruginosa, cells were grown to late-log phase, harvested by cen- trifugation, suspended in SDS/PAGE buffer, and lysed by boiling and sonication. Cell...a selectable DNA fragment. Gene 29:303–313. 17. Egland KA, Greenberg EP (1999) Quorum sensing in Vibrio fischeri: Elements of the luxl promoter. Mol

Evidence for a major role of antisense RNAs in cyanobacterial gene regulation

PubMed Central

Georg, Jens; Voß, Björn; Scholz, Ingeborg; Mitschke, Jan; Wilde, Annegret; Hess, Wolfgang R

2009-01-01

Information on the numbers and functions of naturally occurring antisense RNAs (asRNAs) in eubacteria has thus far remained incomplete. Here, we screened the model cyanobacterium Synechocystis sp. PCC 6803 for asRNAs using four different methods. In the final data set, the number of known noncoding RNAs rose from 6 earlier identified to 60 and of asRNAs from 1 to 73 (28 were verified using at least three methods). Among these, there are many asRNAs to housekeeping, regulatory or metabolic genes, as well as to genes encoding electron transport proteins. Transferring cultures to high light, carbon-limited conditions or darkness influenced the expression levels of several asRNAs, suggesting their functional relevance. Examples include the asRNA to rpl1, which accumulates in a light-dependent manner and may be required for processing the L11 r-operon and the SyR7 noncoding RNA, which is antisense to the murF 5′ UTR, possibly modulating murein biosynthesis. Extrapolated to the whole genome, ∼10% of all genes in Synechocystis are influenced by asRNAs. Thus, chromosomally encoded asRNAs may have an important function in eubacterial regulatory networks. PMID:19756044

Evidence for a major role of antisense RNAs in cyanobacterial gene regulation.

PubMed

Georg, Jens; Voss, Björn; Scholz, Ingeborg; Mitschke, Jan; Wilde, Annegret; Hess, Wolfgang R

2009-01-01

Information on the numbers and functions of naturally occurring antisense RNAs (asRNAs) in eubacteria has thus far remained incomplete. Here, we screened the model cyanobacterium Synechocystis sp. PCC 6803 for asRNAs using four different methods. In the final data set, the number of known noncoding RNAs rose from 6 earlier identified to 60 and of asRNAs from 1 to 73 (28 were verified using at least three methods). Among these, there are many asRNAs to housekeeping, regulatory or metabolic genes, as well as to genes encoding electron transport proteins. Transferring cultures to high light, carbon-limited conditions or darkness influenced the expression levels of several asRNAs, suggesting their functional relevance. Examples include the asRNA to rpl1, which accumulates in a light-dependent manner and may be required for processing the L11 r-operon and the SyR7 noncoding RNA, which is antisense to the murF 5' UTR, possibly modulating murein biosynthesis. Extrapolated to the whole genome, approximately 10% of all genes in Synechocystis are influenced by asRNAs. Thus, chromosomally encoded asRNAs may have an important function in eubacterial regulatory networks.

CD8 T cell response and evolutionary pressure to HIV-1 cryptic epitopes derived from antisense transcription

PubMed Central

Carlson, Jonathan; Yan, Jiyu; Akinsiku, Olusimidele T.; Schaefer, Malinda; Sabbaj, Steffanie; Bet, Anne; Levy, David N.; Heath, Sonya; Tang, Jianming; Kaslow, Richard A.; Walker, Bruce D.; Ndung’u, Thumbi; Goulder, Philip J.; Heckerman, David; Hunter, Eric; Goepfert, Paul A.

2010-01-01

Retroviruses pack multiple genes into relatively small genomes by encoding several genes in the same genomic region with overlapping reading frames. Both sense and antisense HIV-1 transcripts contain open reading frames for known functional proteins as well as numerous alternative reading frames (ARFs). At least some ARFs have the potential to encode proteins of unknown function, and their antigenic properties can be considered as cryptic epitopes (CEs). To examine the extent of active immune response to virally encoded CEs, we analyzed human leukocyte antigen class I–associated polymorphisms in HIV-1 gag, pol, and nef genes from a large cohort of South Africans with chronic infection. In all, 391 CEs and 168 conventional epitopes were predicted, with the majority (307; 79%) of CEs derived from antisense transcripts. In further evaluation of CD8 T cell responses to a subset of the predicted CEs in patients with primary or chronic infection, both sense- and antisense-encoded CEs were immunogenic at both stages of infection. In addition, CEs often mutated during the first year of infection, which was consistent with immune selection for escape variants. These findings indicate that the HIV-1 genome might encode and deploy a large potential repertoire of unconventional epitopes to enhance vaccine-induced antiviral immunity. PMID:20065064

Clinical pharmacological properties of mipomersen (Kynamro), a second generation antisense inhibitor of apolipoprotein B

PubMed Central

Crooke, Stanley T; Geary, Richard S

2013-01-01

Mipomersen is a second generation antisense oligonucleotide that targets apolipoprotein B. It has been studied thoroughly in clinical trials (more than 800 subjects), including four randomized double-blind placebo controlled phase 3 studies involving 391 patients, and is in registration for the treatment of severe hypercholesterolaemia. The pharmacokinetic and pharmacodynamic properties of mipomersen are well characterized. Mipomersen is rapidly and extensively absorbed after subcutaneous administration and has an elimination half-life of approximately 30 days across species. It is cleared by nuclease metabolism and renal excretion of the metabolites. Mipomersen reduces all apolipoprotein B containing atherogenic particles and displays dose dependent reductions between 50–400 mg week−1, both as a single agent and in the presence of maximal lipid lowering therapy. No drug–drug interactions have been identified. Mipomersen is a representative of second generation antisense drugs, all of which have similar properties, and is thus representative of the behaviour of the class of drugs. PMID:23013161

Ultrasound microbubble-mediated transfection of NF-κB decoy oligodeoxynucleotide into gingival tissues inhibits periodontitis in rats in vivo

PubMed Central

Yamaguchi, Hiroyuki; Hosomichi, Jun; Suzuki, Jun-ichi; Hatano, Kasumi; Usumi-Fujita, Risa; Shimizu, Yasuhiro; Kaneko, Sawa; Ono, Takashi

2017-01-01

Periodontitis is a chronic infectious disease for which the fundamental treatment is to reduce the load of subgingival pathogenic bacteria by debridement. However, previous investigators attempted to implement a nuclear factor kappa B (NF-κB) decoy oligodeoxynucleotide (ODN) as a suppressor of periodontitis progression. Although we recently reported the effectiveness of the ultrasound-microbubble method as a tool for transfecting the NF-κB decoy ODN into healthy rodent gingival tissue, this technique has not yet been applied to the pathological gingiva of periodontitis animal models. Therefore, the aim of this study was to investigate the effectiveness of the technique in transfecting the NF-κB decoy ODN into rats with ligature-induced periodontitis. Micro computed tomography (micro-CT) analysis demonstrated a significant reduction in alveolar bone loss following treatment with the NF-κB decoy ODN in the experimental group. RT-PCR showed that NF-κB decoy ODN treatment resulted in significantly reduced expression of inflammatory cytokine transcripts within rat gingival tissues. Thus, we established a transcutaneous transfection model of NF-κB decoy ODN treatment of periodontal tissues using the ultrasound-microbubble technique. Our findings suggest that the NF-κB decoy ODN could be used as a significant suppressor of gingival inflammation and periodontal disease progression. PMID:29091721

Inhaled ENaC antisense oligonucleotide ameliorates cystic fibrosis-like lung disease in mice.

PubMed

Crosby, Jeff R; Zhao, Chenguang; Jiang, Chong; Bai, Dong; Katz, Melanie; Greenlee, Sarah; Kawabe, Hiroshi; McCaleb, Michael; Rotin, Daniela; Guo, Shuling; Monia, Brett P

2017-11-01

Epithelial sodium channel (ENaC, Scnn1) hyperactivity in the lung leads to airway surface dehydration and mucus accumulation in cystic fibrosis (CF) patients and in mice with CF-like lung disease. We identified several potent ENaC specific antisense oligonucleotides (ASOs) and tested them by inhalation in mouse models of CF-like lung disease. The inhaled ASOs distributed into lung airway epithelial cells and decreased ENaC expression by inducing RNase H1-dependent degradation of the targeted Scnn1a mRNA. Aerosol delivered ENaC ASO down-regulated mucus marker expression and ameliorated goblet cell metaplasia, inflammation, and airway hyper-responsiveness. Lack of systemic activity of ASOs delivered via the aerosol route ensures the safety of this approach. Our results demonstrate that antisense inhibition of ENaC in airway epithelial cells could be an effective and safe approach for the prevention and reversal of lung symptoms in CF and potentially other inflammatory diseases of the lung. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research

Cancer.gov

Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional therapies if an appropriate target can be identified.

Phase I study of the c-raf-1 antisense oligonucleotide ISIS 5132 in combination with carboplatin and paclitaxel in patients with previously untreated, advanced non-small cell lung cancer.

PubMed

Fidias, Panos; Pennell, Nathan A; Boral, Anthony L; Shapiro, Geoffrey I; Skarin, Arthur T; Eder, Joseph P; Kwoh, T Jesse; Geary, Richard S; Johnson, Bruce E; Lynch, Thomas J; Supko, Jeffrey G

2009-09-01

A phase I trial was performed to evaluate the administration of carboplatin/paclitaxel in combination with ISIS-5132, a phosphorothioate antisense oligodeoxynucleotide inhibitor of c-raf-1 kinase expression, in patients with advanced non-small cell lung cancer (NSCLC). Previously untreated patients with stage IIIB/IV NSCLC received ISIS 5132 by continuous intravenous infusion at 2.0 mg/kg/d for 14 days. Starting doses were paclitaxel 175 mg/m(2) and carboplatin targeting an area under the free platinum plasma concentration-time curve (AUC(fp)) of 5 mg . min/ml (dose level 1). The carboplatin dose was then increased to AUC(fp) 6 mg . min/ml (dose level 2) after which the paclitaxel dose was increased to 200 mg/m(2) (dose level 3). The maximum tolerated dose was established by toxicity during the first two 21-day cycles of therapy. The pharmacokinetics of all three agents was determined before and during the ISIS 5132 infusion. Thirteen patients were treated with the carboplatin/paclitaxel/ISIS 5132 combination. Dose-limiting neutropenia occurred in two patients at dose level 3. Grade 3 and 4 nonhematologic toxicities were infrequent and limited to nausea and constipation. The maximum tolerated doses were carboplatin AUC(fp) 6 mg . min/ml, paclitaxel 175 mg/m(2), and ISIS 5132 2.0 mg/kg/d for 14 days. There were no objective responses and the concurrent infusion of ISIS 5132 did not alter the plasma pharmacokinetics of paclitaxel or total platinum. ISIS 5132 can be safely combined with standard doses of carboplatin and paclitaxel. Combining cytotoxic chemotherapeutic agents with inhibitors of aberrant signal transduction mediated by Raf proteins produced no objective responses in the dose and schedule administered in this study.

Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

PubMed

Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

2016-04-15

Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Antisense and sense poly(A)-RNAs from the Xenopus laevis pyruvate dehydrogenase gene loci are regulated with message production during embryogenesis.

PubMed

Islam, N; Poitras, L; Gagnon, F; Moss, T

1996-10-17

The structure and temporal expression of two Xenopus cDNAs encoding the beta subunit of pyruvate dehydrogenase (XPdhE1 beta) have been determined. XPdhE1 beta was 88% homologous to mature human PdhE1 beta, but the putative N-terminal mitochondrial signal peptide was poorly conserved. Zygotic expression of XPdhE1 beta mRNA was detected at neural tube closure and increased until stage 40. RT-PCR cloning identified a short homology to a protein kinase open reading frame within the 3' non-coding sequence of the XPdhE1 beta cDNAs. This homology, which occurred on the antisense cDNA strand, was shown by strand specific RT-PCR to be transcribed in vivo as part of an antisense RNA. Northern analysis showed that this RNA formed part of an abundant and heterogeneous population of antisense and sense poly(A)-RNAs transcribed from the XPdhE1 beta loci and coordinately regulated with message production.

Small-interfering RNAs from natural antisense transcripts derived from a cellulose synthase gene modulate cell wall biosynthesis in barley

PubMed Central

Held, Michael A.; Penning, Bryan; Brandt, Amanda S.; Kessans, Sarah A.; Yong, Weidong; Scofield, Steven R.; Carpita, Nicholas C.

2008-01-01

Small-interfering RNAs (siRNAs) from natural cis-antisense pairs derived from the 3′-coding region of the barley (Hordeum vulgare) CesA6 cellulose synthase gene substantially increase in abundance during leaf elongation. Strand-specific RT-PCR confirmed the presence of an antisense transcript of HvCesA6 that extends ≥1230 bp from the 3′ end of the CesA-coding sequence. The increases in abundance of the CesA6 antisense transcript and the 21-nt and 24-nt siRNAs derived from the transcript are coincident with the down-regulation of primary wall CesAs, several Csl genes, and GT8 glycosyl transferase genes, and are correlated with the reduction in rates of cellulose and (1 → 3),(1 → 4)-β-D-glucan synthesis. Virus induced gene silencing using unique target sequences derived from HvCesA genes attenuated expression not only of the HvCesA6 gene, but also of numerous nontarget Csls and the distantly related GT8 genes and reduced the incorporation of D-14C-Glc into cellulose and into mixed-linkage (1 → 3),(1 → 4)-β-D-glucans of the developing leaves. Unique target sequences for CslF and CslH conversely silenced the same genes and lowered rates of cellulose and (1 → 3),(1 → 4)-β-D-glucan synthesis. Our results indicate that the expression of individual members of the CesA/Csl superfamily and glycosyl transferases share common regulatory control points, and siRNAs from natural cis-antisense pairs derived from the CesA/Csl superfamily could function in this global regulation of cell-wall synthesis. PMID:19075248

Suppression of wear particle induced pro-inflammatory cytokine and chemokine production in macrophages via NF-κB decoy oligodeoxynucleotide: A preliminary report

PubMed Central

Lin, Tzu-hua; Yao, Zhenyu; Sato, Taishi; Keeney, Michael; Li, Chenguang; Pajarinen, Jukka; Yang, Fan; Egashira, Kensuke; Goodman, Stuart B.

2014-01-01

Total joint replacement (TJR) is a very cost-effective surgery for end-stage arthritis. One important goal is to decrease the revision rate especially because TJR has been extended to younger patients. Continuous production of ultra-high molecular weight polyethylene (UHMWPE) wear particles induces macrophage infiltration and chronic inflammation, which can lead to peri-prosthetic osteolysis. Targeting individual pro-inflammatory cytokines directly has not reversed the osteolytic process in clinical trials, due to compensatory upregulation of other pro-inflammatory factors. We hypothesized that targeting the important transcription factor NF-κB could mitigate the inflammatory response to wear particles, potentially diminishing osteolysis. In the current study, we suppressed NF-κB activity in mouse RAW264.7 and human THP1 macrophage cell lines, as well as primary mouse and human macrophages, via competitive binding with double strand decoy oligodeoxynucleotide (ODN) containing an NF-κB binding element. We found that macrophage exposure to UHMWPE particles induced multiple pro-inflammatory cytokine and chemokine expression including TNF-α, MCP1, MIP1α and others. Importantly, the decoy ODN significantly suppressed the induced cytokine and chemokine expression in both murine and human macrophages, and resulted in suppression of macrophage recruitment. The strategic use of decoy NF-κB ODN, delivered locally, could potentially diminish particle-induced peri-prosthetic osteolysis. PMID:24814879

Adenovirus-mediated transfer of HPV 16 E6/E7 antisense RNA combined with cisplatin inhibits cellular growth and induces apoptosis in HPV-positive head and neck cancer cells.

PubMed

Kojima, Yasutaka; Otsuki, Naoki; Kubo, Mie; Kitamoto, Junko; Takata, Eri; Saito, Hiroki; Kosaka, Kyoko; Morishita, Naoya; Uehara, Natsumi; Shirakawa, Toshiro; Nibu, Ken-Ich

2018-05-24

Human papillomavirus (HPV) infection has been identified as an etiologic factor of head and neck cancers (HNCs). We explored the potential use of antisense HPV RNA transcripts for gene therapy and its effect in combination with cisplatin (CDDP) for HPV-positive HNCs. We introduced the antisense RNA transcripts of the E6 and E7 genes of HPV type 16 into UM-SCC-47 cells harboring HPV 16 and YCU-T892 cells that were HPV-negative using a recombinant adenoviral vector, Ad-E6/E7-AS. We then analyzed the effects of the introduction of Ad-E7-AS on cell and tumor growth and the synergistic effect with CDDP in vitro and in vivo. After infection of Ad-E6/E7-AS, the cellular growth of UM-SCC-47 cells were suppressed, but not that of YCU-T892 cells. E7 protein expression was suppressed, and p53 and pRb protein expression increased after infection of Ad-E7-AS. Cell growth and tumorigenicity were greatly suppressed in combination with CDDP compared with Ad-E7-AS or CDDP treatment alone in vitro. Ad-E7-AS combined with CDDP treatment significantly reduced the volumes of established subcutaneous tumors. Transfection with HPV 16 E7 antisense RNA combined with CDDP treatment might be a potentially useful approach to the therapy of HPV 16-positive HNC.

Sensible use of antisense: how to use oligonucleotides as research tools.

PubMed

Myers, K J; Dean, N M

2000-01-01

In the past decade, there has been a vast increase in the amount of gene sequence information that has the potential to revolutionize the way diseases are both categorized and treated. Old diagnoses, largely anatomical or descriptive in nature, are likely to be superceded by the molecular characterization of the disease. The recognition that certain genes drive key disease processes will also enable the rational design of gene-specific therapeutics. Antisense oligonucleotides represent a technology that should play multiple roles in this process.

Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications

PubMed Central

Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.

2007-01-01

Antisense-mediated modulation of splicing is one of the few fields where antisense oligonucleotides (AONs) have been able to live up to their expectations. In this approach, AONs are implemented to restore cryptic splicing, to change levels of alternatively spliced genes, or, in case of Duchenne muscular dystrophy (DMD), to skip an exon in order to restore a disrupted reading frame. The latter allows the generation of internally deleted, but largely functional, dystrophin proteins and would convert a severe DMD into a milder Becker muscular dystrophy phenotype. In fact, exon skipping is currently one of the most promising therapeutic tools for DMD, and a successful first-in-man trial has recently been completed. In this review the applicability of exon skipping for DMD and other diseases is described. For DMD AONs have been designed for numerous exons, which has given us insight into their mode of action, splicing in general, and splicing of the DMD gene in particular. In addition, retrospective analysis resulted in guidelines for AON design for DMD and most likely other genes as well. This knowledge allows us to optimize therapeutic exon skipping, but also opens up a range of other applications for the exon skipping approach. PMID:17684229

Antisense inhibition of proprotein convertase subtilisin/kexin type 9 reduces serum LDL in hyperlipidemic mice.

PubMed

Graham, Mark J; Lemonidis, Kristina M; Whipple, Charles P; Subramaniam, Amuthakannan; Monia, Brett P; Crooke, Stanley T; Crooke, Rosanne M

2007-04-01

Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a member of a family of proteases that is thought to promote the degradation of the low density lipoprotein receptor (LDLR) through an as yet undefined mechanism. We developed second generation antisense oligonucleotide (ASO) inhibitors targeting murine PCSK9 to determine their potential as lipid-lowering agents. Administration of a PCSK9 ASO to high fat-fed mice for 6 weeks reduced total cholesterol and LDL by 53% and 38%, respectively. Moreover, inhibition of PCSK9 expression resulted in a 2-fold increase in hepatic LDLR protein levels. This phenotype closely resembles that reported previously in Pcsk9-deficient mice. The absence of cholesterol lowering in Ldlr-deficient mice effectively demonstrated a critical role for this receptor in mediating the lipid-lowering effects of PCSK9 inhibition. Antisense inhibition of PCSK9 is an attractive and novel therapeutic approach for treating hypercholesterolemia in human.

Clinical pharmacological properties of mipomersen (Kynamro), a second generation antisense inhibitor of apolipoprotein B.

PubMed

Crooke, Stanley T; Geary, Richard S

2013-08-01

Mipomersen is a second generation antisense oligonucleotide that targets apolipoprotein B. It has been studied thoroughly in clinical trials (more than 800 subjects), including four randomized double-blind placebo controlled phase 3 studies involving 391 patients, and is in registration for the treatment of severe hypercholesterolaemia. The pharmacokinetic and pharmacodynamic properties of mipomersen are well characterized. Mipomersen is rapidly and extensively absorbed after subcutaneous administration and has an elimination half-life of approximately 30 days across species. It is cleared by nuclease metabolism and renal excretion of the metabolites. Mipomersen reduces all apolipoprotein B containing atherogenic particles and displays dose dependent reductions between 50-400 mg week⁻¹ , both as a single agent and in the presence of maximal lipid lowering therapy. No drug-drug interactions have been identified. Mipomersen is a representative of second generation antisense drugs, all of which have similar properties, and is thus representative of the behaviour of the class of drugs. © 2012 The Authors. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

Antisense Oligonucleotide-Mediated Transcript Knockdown in Zebrafish.

PubMed

Pauli, Andrea; Montague, Tessa G; Lennox, Kim A; Behlke, Mark A; Schier, Alexander F

2015-01-01

Antisense oligonucleotides (ASOs) are synthetic, single-strand RNA-DNA hybrids that induce catalytic degradation of complementary cellular RNAs via RNase H. ASOs are widely used as gene knockdown reagents in tissue culture and in Xenopus and mouse model systems. To test their effectiveness in zebrafish, we targeted 20 developmental genes and compared the morphological changes with mutant and morpholino (MO)-induced phenotypes. ASO-mediated transcript knockdown reproduced the published loss-of-function phenotypes for oep, chordin, dnd, ctnnb2, bmp7a, alk8, smad2 and smad5 in a dosage-sensitive manner. ASOs knocked down both maternal and zygotic transcripts, as well as the long noncoding RNA (lncRNA) MALAT1. ASOs were only effective within a narrow concentration range and were toxic at higher concentrations. Despite this drawback, quantitation of knockdown efficiency and the ability to degrade lncRNAs make ASOs a useful knockdown reagent in zebrafish.

Antisense oligonucleotide inhibition of cholesteryl ester transfer protein enhances RCT in hyperlipidemic, CETP transgenic, LDLr-/- mice.

PubMed

Bell, Thomas A; Graham, Mark J; Lee, Richard G; Mullick, Adam E; Fu, Wuxia; Norris, Dan; Crooke, Rosanne M

2013-10-01

Due to their ability to promote positive effects across all of the lipoprotein classes, cholesteryl ester transfer protein (CETP) inhibitors are currently being developed as therapeutic agents for cardiovascular disease. In these studies, we compared an antisense oligonucleotide (ASO) inhibitor of CETP to the CETP small molecule inhibitor anacetrapib. In hyperlipidemic CETP transgenic (tg) mice, both drugs provided comparable reductions in total plasma cholesterol, decreases in CETP activity, and increases in HDL cholesterol. However, only mice treated with the antisense inhibitor showed an enhanced effect on macrophage reverse cholesterol transport, presumably due to differences in HDL apolipoprotein composition and decreases in plasma triglyceride. Additionally, the ASO-mediated reductions in CETP mRNA were associated with less accumulation of aortic cholesterol. These preliminary findings suggest that CETP ASOs may represent an alternative means to inhibit that target and to support their continued development as a treatment for cardiovascular disease in man.

Strategies to identify natural antisense transcripts.

PubMed

Sun, Yulong; Li, Dijie; Zhang, Ru; Peng, Shang; Zhang, Ge; Yang, Tuanmin; Qian, Airong

2017-01-01

Natural antisense transcripts, originally considered as transcriptional noises arising from so-called "junk DNA″, are recently recognized as important modulators for gene regulation. They are prevalent in nearly all realms of life and have been found to modulate gene expression positively or negatively. By affecting almost all stages of gene expression range from pre-transcriptional, transcriptional and post-transcriptional to translation, NATs are fundamentally involved in various biological processes. However, compared to increasing huge data from transcriptional analysis especially high-throughput sequencing technologies (such as RNA-seq), limited functional NATs (around 70) are so far reported, which hinder our advanced comprehensive understanding for this field. Hence, efficient strategies for identifying NATs are urgently desired. In this review, we discussed the current strategies for identifying NATs, with a focus on the advantages, disadvantages, and applications of methods isolating functional NATs. Moreover, publicly available databases for NATs were also discussed. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Apolipoprotein B antisense inhibition--update on mipomersen.

PubMed

Gebhard, Catherine; Huard, Gabriel; Kritikou, Ekaterini A; Tardif, Jean-Claude

2013-01-01

Dyslipidemia is one of the main risk factors leading to cardiovascular disease (CVD). The standard of therapy, administration of statins, in conjunction with lifestyle and habit changes, can improve high cholesterol levels in the majority of patients. However, some patients with familial hypercholesterolemia (FH) need low-density-lipoprotein cholesterol (LDL-C) apheresis, as the available medications fail to reduce LDL-C levels sufficiently even at maximum doses. Intense research on cholesterol reducing agents and rapid progress in drug design have yielded many approaches that reduce cholesterol absorption or inhibit its synthesis. Antisense oligonucleotides (ASOs) targeting the production of apolipoprotein B-100 (apoB-100), inhibitors of proprotein convertase subtilisin/kexin type 9, microsomal triglyceride transfer protein inhibitors, squalene synthase inhibitors, peroxisome proliferator-activated receptor agonists, and thyroid hormone receptor agonists are some of the evolving approaches for lipid-lowering therapies. We provide an overview of the apoB ASO approach and its potential role in the management of dyslipidemia. Mipomersen (ISIS-301012, KYNAMRO™) is a synthetic ASO targeting the mRNA of apoB-100, which is an essential component of LDL particles and related atherogenic lipoproteins. ASOs bind to target mRNAs and induce their degradation thereby resulting in reduced levels of the corresponding protein levels. Mipomersen has been investigated in different indications including homozygous and heterozygous FH, as well as in high-risk hypercholesterolemic patients. Recent phase II and III clinical studies have shown a 25-47% reduction in LDL-C levels in mipomersen-treated patients. If future studies continue to show such promising results, mipomersen would likely be a viable additional lipid-lowering therapy for high-risk populations.

Large-scale analysis of antisense transcription in wheat using the Affymetrix GeneChip Wheat Genome Array

USDA-ARS?s Scientific Manuscript database

Natural antisense transcripts (NATs) are transcripts of the opposite DNA strand to the sense-strand either at the same locus (cis-encoded) or a different locus (trans-encoded). They can affect gene expression at multiple stages including transcription, RNA processing and transport, and translation....

Cholesterol-lowering Action of BNA-based Antisense Oligonucleotides Targeting PCSK9 in Atherogenic Diet-induced Hypercholesterolemic Mice.

PubMed

Yamamoto, Tsuyoshi; Harada-Shiba, Mariko; Nakatani, Moeka; Wada, Shunsuke; Yasuhara, Hidenori; Narukawa, Keisuke; Sasaki, Kiyomi; Shibata, Masa-Aki; Torigoe, Hidetaka; Yamaoka, Tetsuji; Imanishi, Takeshi; Obika, Satoshi

2012-05-15

Recent findings in molecular biology implicate the involvement of proprotein convertase subtilisin/kexin type 9 (PCSK9) in low-density lipoprotein receptor (LDLR) protein regulation. The cholesterol-lowering potential of anti-PCSK9 antisense oligonucleotides (AONs) modified with bridged nucleic acids (BNA-AONs) including 2',4'-BNA (also called as locked nucleic acid (LNA)) and 2',4'-BNA(NC) chemistries were demonstrated both in vitro and in vivo. An in vitro transfection study revealed that all of the BNA-AONs induce dose-dependent reductions in PCSK9 messenger RNA (mRNA) levels concomitantly with increases in LDLR protein levels. BNA-AONs were administered to atherogenic diet-fed C57BL/6J mice twice weekly for 6 weeks; 2',4'-BNA-AON that targeted murine PCSK9 induced a dose-dependent reduction in hepatic PCSK9 mRNA and LDL cholesterol (LDL-C); the 43% reduction of serum LDL-C was achieved at a dose of 20 mg/kg/injection with only moderate increases in toxicological indicators. In addition, the serum high-density lipoprotein cholesterol (HDL-C) levels increased. These results support antisense inhibition of PCSK9 as a potential therapeutic approach. When compared with 2',4'-BNA-AON, 2',4'-BNA(NC)-AON showed an earlier LDL-C-lowering effect and was more tolerable in mice. Our results validate the optimization of 2',4'-BNA(NC)-based anti-PCSK9 antisense molecules to produce a promising therapeutic agent for the treatment of hypercholesterolemia.

Integrated Safety Assessment of 2′-O-Methoxyethyl Chimeric Antisense Oligonucleotides in NonHuman Primates and Healthy Human Volunteers

PubMed Central

Crooke, Stanley T; Baker, Brenda F; Kwoh, T Jesse; Cheng, Wei; Schulz, Dan J; Xia, Shuting; Salgado, Nelson; Bui, Huynh-Hoa; Hart, Christopher E; Burel, Sebastien A; Younis, Husam S; Geary, Richard S; Henry, Scott P; Bhanot, Sanjay

2016-01-01

The common chemical and biological properties of antisense oligonucleotides provide the opportunity to identify and characterize chemical class effects across species. The chemical class that has proven to be the most versatile and best characterized is the 2′-O-methoxyethyl chimeric antisense oligonucleotides. In this report we present an integrated safety assessment of data obtained from controlled dose-ranging studies in nonhuman primates (macaques) and healthy human volunteers for 12 unique 2′-O-methoxyethyl chimeric antisense oligonucleotides. Safety was assessed by the incidence of safety signals in standardized laboratory tests for kidney and liver function, hematology, and complement activation; as well as by the mean test results as a function of dose level over time. At high doses a number of toxicities were observed in nonhuman primates. However, no class safety effects were identified in healthy human volunteers from this integrated data analysis. Effects on complement in nonhuman primates were not observed in humans. Nonhuman primates predicted safe doses in humans, but over predicted risk of complement activation and effects on platelets. Although limited to a single chemical class, comparisons from this analysis are considered valid and accurate based on the carefully controlled setting for the specified study populations and within the total exposures studied. PMID:27357629

Analysis of 14-3-3 Family Member Function in Xenopus Embryos by Microinjection of Antisense Morpholino Oligos

NASA Astrophysics Data System (ADS)

Lau, Jeffrey M. C.; Muslin, Anthony J.

The 14-3-3 intracellular phosphoserine/threonine-binding proteins are adapter molecules that regulate signal transduction, cell cycle, nutrient sensing, apoptotic, and cytoskeletal pathways. There are seven 14-3-3 family members, encoded by separate genes, in vertebrate organisms. To evaluate the role of individual 14-3-3 proteins in vertebrate embryonic development, we utilized an antisense morpholino oligo microinjection technique in Xenopus laevis embryos. By use of this method, we showed that embryos lacking specific 14-3-3 proteins displayed unique phenotypic abnormalities. Specifically, embryos lacking 14-3-3 τ exhibited gastrulation and axial patterning defects, but embryos lacking 14-3-3 γ exhibited eye defects without other abnormalities, and embryos lacking 14-3-3 ζ appeared completely normal. These and other results demonstrate the power and specificity of the morpholino antisense oligo microinjection technique.

Antisense oligonucleotide directed to human apolipoprotein B-100 reduces lipoprotein(a) levels and oxidized phospholipids on human apolipoprotein B-100 particles in lipoprotein(a) transgenic mice.

PubMed

Merki, Esther; Graham, Mark J; Mullick, Adam E; Miller, Elizabeth R; Crooke, Rosanne M; Pitas, Robert E; Witztum, Joseph L; Tsimikas, Sotirios

2008-08-12

Lipoprotein (a) [Lp(a)] is a genetic cardiovascular risk factor that preferentially binds oxidized phospholipids (OxPL) in plasma. There is a lack of therapeutic agents that reduce plasma Lp(a) levels. Transgenic mice overexpressing human apolipoprotein B-100 (h-apoB-100 [h-apoB mice]) or h-apoB-100 plus human apo(a) to generate genuine Lp(a) particles [Lp(a) mice] were treated with the antisense oligonucleotide mipomersen directed to h-apoB-100 mRNA or control antisense oligonucleotide for 11 weeks by intraperitoneal injection. Mice were then followed up for an additional 10 weeks off therapy. Lp(a) levels [apo(a) bound to apoB-100] and apo(a) levels ["free" apo(a) plus apo(a) bound to apoB-100] were measured by chemiluminescent enzyme-linked immunoassay and commercial assays, respectively. The content of OxPL on h-apoB-100 particles (OxPL/h-apoB) was measured by capturing h-apoB-100 in microtiter wells and detecting OxPL by antibody E06. As expected, mipomersen significantly reduced plasma h-apoB-100 levels in both groups of mice. In Lp(a) mice, mipomersen significantly reduced Lp(a) levels by approximately 75% compared with baseline (P<0.0001) but had no effect on apo(a) levels or hepatic apo(a) mRNA expression. OxPL/h-apoB levels were much higher at baseline in Lp(a) mice compared with h-ApoB mice (P<0.0001) but decreased in a time-dependent fashion with mipomersen. There was no effect of the control antisense oligonucleotide on lipoprotein levels or oxidative parameters. Mipomersen significantly reduced Lp(a) and OxPL/apoB levels in Lp(a) mice. The present study demonstrates that h-apoB-100 is a limiting factor in Lp(a) particle synthesis in this Lp(a) transgenic model. If applicable to humans, mipomersen may represent a novel therapeutic approach to reducing Lp(a) levels and their associated OxPL.

Distinct transcripts are recognized by sense and antisense riboprobes for a member of the murine HSP70 gene family, HSP70.2, in various reproductive tissues

NASA Technical Reports Server (NTRS)

Murashov, A. K.; Wolgemuth, D. J.

1996-01-01

The expression of hsp70.2, an hsp70 gene family member, originally characterized by its high levels of expression in germ cells in the adult mouse testis, was detected in several other reproductive tissues, including epididymis, prostate, and seminal vesicles, as well as in extraembryonic tissues of mid-gestation fetuses. In addition, hybridization with RNA probes transcribed in the sense orientation surprisingly indicated the presence of slightly larger "antisense" transcripts in several tissues. The levels of antisense transcripts varied among the tissues, with the highest signal detected in the prostate and no signal being detectable in the testis. Consistent with these results, in situ hybridization analysis clearly localized the sense-orientation transcripts to pachytene spermatocytes, while no antisense-orientation transcripts were observed in adjacent sections of the same tubules. Our findings have thus shown that although hsp70.2 was expressed abundantly and in a highly stage-specific manner in the male germ line, it was also expressed in other murine tissues. Furthermore, we have made the surprising observation of antisense transcription of the hsp70.2 gene in several mouse tissues, revealing another level of complexity in the regulation and function of heat shock proteins.

Alternate-strand triple-helix formation by the 3'-3'-linked oligodeoxynucleotides with the intercalators at the junction point.

PubMed

Ueno, Y; Mikawa, M; Hoshika, S; Takeba, M; Kitade, Y; Matsuda, A

2001-01-01

3'-3'-Linked oligodeoxynucleotides (ODNs) with the anthraquinonyl group at the junction point were synthesized on a DNA synthesizer using a controlled pore glass (CPG), which has pentaerythritol carrying the intercalator at one of the four hydroxymethyl groups. Stability of the triplexes with the target duplexes was studied by thermal denaturation. The 3'-3'-linked ODNs with the anthraquinonyl group enhanced the thermal stability of the triplexes when compared with those without the intercalator and the unmodified nonamer. The inhibitory activity of the 3'-3'-linked ODNs against the cleavage of the target DNA by the restriction enzyme Hind III was tested. It was found that the 3'-3'-linked ODN with the anthraquinonyl group at the junction point inhibited the cleavage by the enzyme more effectively than the nonamer and the 3'-3'-linked ODN without the intercalator.

Orlistat and antisense-miRNA-loaded PLGA-PEG nanoparticles for enhanced triple negative breast cancer therapy

PubMed Central

Bhargava-Shah, Aarohi; Foygel, Kira; Devulapally, Rammohan; Paulmurugan, Ramasamy

2016-01-01

Background: This study explores the use of hydrophilic poly(ethylene glycol)-conjugated poly(lactic-co-glycolic acid) nanoparticles (PLGA-PEG-NPs) as delivery system to improve the antitumor effect of antiobesity drug orlistat for triple-negative breast cancer (TNBC) therapy by improving its bioavailability. Materials & methods: PLGA-PEG-NPs were synthesized by emulsion-diffusion-evaporation method, and the experiments were conducted in vitro in MDA-MB-231 and SKBr3 TNBC and normal breast fibroblast cells. Results: Delivery of orlistat via PLGA-PEG-NPs reduced its IC50 compared with free orlistat. Combined treatment of orlistat-loaded NPs and doxorubicin or antisense-miR-21-loaded NPs significantly enhanced apoptotic effect compared with independent doxorubicin, anti-miR-21-loaded NPs, orlistat-loaded NPs or free orlistat treatments. Conclusion: We demonstrate that orlistat in combination with antisense-miR-21 or current chemotherapy holds great promise as a novel and versatile treatment agent for TNBC. PMID:26787319

Targeting of Repeated Sequences Unique to a Gene Results in Significant Increases in Antisense Oligonucleotide Potency

PubMed Central

Vickers, Timothy A.; Freier, Susan M.; Bui, Huynh-Hoa; Watt, Andrew; Crooke, Stanley T.

2014-01-01

A new strategy for identifying potent RNase H-dependent antisense oligonucleotides (ASOs) is presented. Our analysis of the human transcriptome revealed that a significant proportion of genes contain unique repeated sequences of 16 or more nucleotides in length. Activities of ASOs targeting these repeated sites in several representative genes were compared to those of ASOs targeting unique single sites in the same transcript. Antisense activity at repeated sites was also evaluated in a highly controlled minigene system. Targeting both native and minigene repeat sites resulted in significant increases in potency as compared to targeting of non-repeated sites. The increased potency at these sites is a result of increased frequency of ASO/RNA interactions which, in turn, increases the probability of a productive interaction between the ASO/RNA heteroduplex and human RNase H1 in the cell. These results suggest a new, highly efficient strategy for rapid identification of highly potent ASOs. PMID:25334092

The ICAM-1 antisense oligonucleotide ISIS-3082 prevents the development of postoperative ileus in mice

PubMed Central

The, Frans O; de Jonge, Wouter J; Bennink, Roel J; van den Wijngaard, Rene M; Boeckxstaens, Guy E

2005-01-01

Intestinal manipulation (IM) during abdominal surgery triggers the influx of inflammatory cells, leading to postoperative ileus. Prevention of this local muscle inflammation, using intercellular adhesion molecule-1 (ICAM-1) and leukocyte function-associated antigen-1-specific antibodies, has been shown to shorten postoperative ileus. However, the therapeutic use of antibodies has considerable disadvantages. The aim of the current study was to evaluate the effect of ISIS-3082, a mouse-specific ICAM-1 antisense oligonucleotide, on postoperative ileus in mice. Mice underwent a laparotomy or a laparotomy combined with IM after treatment with ICAM-1 antibodies, 0.1–10 mg kg−1 ISIS-3082, saline or ISIS-8997 (scrambled control antisense oligonucleotides, 1 and 3 mg kg−1). At 24 h after surgery, gastric emptying of a 99mTC labelled semi-liquid meal was determined using scintigraphy. Intestinal inflammation was assessed by myeloperoxidase (MPO) activity in ileal muscle whole mounts. IM significantly reduced gastric emptying compared to laparotomy. Pretreatment with ISIS-3082 (0.1–1 mg kg−1) as well as ICAM-1 antibodies (10 mg kg−1), but not ISIS-8997 or saline, improved gastric emptying in a dose-dependent manner. This effect diminished with higher doses of ISIS-3082 (3–10 mg kg−1). Similarly, ISIS-3082 (0.1–1 mg kg−1) and ICAM-1 antibodies, but not ISIS-8997 or higher doses of ISIS-3082 (3–10 mg kg−1), reduced manipulation-induced inflammation. Immunohistochemistry showed reduction of ICAM-1 expression with ISIS-3082 only. ISIS-3082 pretreatment prevents postoperative ileus in mice by reduction of manipulation-induced local intestinal muscle inflammation. Our data suggest that targeting ICAM-1 using antisense oligonucleotides may represent a new therapeutic approach to the prevention of postoperative ileus. PMID:15997238

The ICAM-1 antisense oligonucleotide ISIS-3082 prevents the development of postoperative ileus in mice.

PubMed

The, Frans O; de Jonge, Wouter J; Bennink, Roel J; van den Wijngaard, Rene M; Boeckxstaens, Guy E

2005-09-01

Intestinal manipulation (IM) during abdominal surgery triggers the influx of inflammatory cells, leading to postoperative ileus. Prevention of this local muscle inflammation, using intercellular adhesion molecule-1 (ICAM-1) and leukocyte function-associated antigen-1-specific antibodies, has been shown to shorten postoperative ileus. However, the therapeutic use of antibodies has considerable disadvantages. The aim of the current study was to evaluate the effect of ISIS-3082, a mouse-specific ICAM-1 antisense oligonucleotide, on postoperative ileus in mice. Mice underwent a laparotomy or a laparotomy combined with IM after treatment with ICAM-1 antibodies, 0.1-10 mg kg(-1) ISIS-3082, saline or ISIS-8997 (scrambled control antisense oligonucleotides, 1 and 3 mg kg(-1)). At 24 h after surgery, gastric emptying of a 99mTC labelled semi-liquid meal was determined using scintigraphy. Intestinal inflammation was assessed by myeloperoxidase (MPO) activity in ileal muscle whole mounts. IM significantly reduced gastric emptying compared to laparotomy. Pretreatment with ISIS-3082 (0.1-1 mg kg(-1)) as well as ICAM-1 antibodies (10 mg kg(-1)), but not ISIS-8997 or saline, improved gastric emptying in a dose-dependent manner. This effect diminished with higher doses of ISIS-3082 (3-10 mg kg(-1)). Similarly, ISIS-3082 (0.1-1 mg kg(-1)) and ICAM-1 antibodies, but not ISIS-8997 or higher doses of ISIS-3082 (3-10 mg kg(-1)), reduced manipulation-induced inflammation. Immunohistochemistry showed reduction of ICAM-1 expression with ISIS-3082 only. ISIS-3082 pretreatment prevents postoperative ileus in mice by reduction of manipulation-induced local intestinal muscle inflammation. Our data suggest that targeting ICAM-1 using antisense oligonucleotides may represent a new therapeutic approach to the prevention of postoperative ileus.

High Boron-loaded DNA-Oligomers as Potential Boron Neutron Capture Therapy and Antisense Oligonucleotide Dual-Action Anticancer Agents.

PubMed

Kaniowski, Damian; Ebenryter-Olbińska, Katarzyna; Sobczak, Milena; Wojtczak, Błażej; Janczak, Sławomir; Leśnikowski, Zbigniew J; Nawrot, Barbara

2017-08-23

Boron cluster-modified therapeutic nucleic acids with improved properties are of interest in gene therapy and in cancer boron neutron capture therapy (BNCT). High metallacarborane-loaded antisense oligonucleotides (ASOs) targeting epidermal growth factor receptor (EGFR) were synthesized through post-synthetic Cu (I)-assisted "click" conjugation of alkyne-modified DNA-oligonucleotides with a boron cluster alkyl azide component. The obtained oligomers exhibited increased lipophilicity compared to their non-modified precursors, while their binding affinity to complementary DNA and RNA strands was slightly decreased. Multiple metallacarborane residues present in the oligonucleotide chain, each containing 18 B-H groups, enabled the use of IR spectroscopy as a convenient analytical method for these oligomers based on the diagnostic B-H signal at 2400-2650 cm -1 . The silencing activity of boron cluster-modified ASOs used at higher concentrations was similar to that of unmodified oligonucleotides. The screened ASOs, when used in low concentrations (up to 50 μM), exhibited pro-oxidative properties by inducing ROS production and an increase in mitochondrial activities in HeLa cells. In contrast, when used at higher concentrations, the ASOs exhibited anti-oxidative properties by lowering ROS species levels. In the HeLa cells (tested in the MTT assay) treated (without lipofectamine) or transfected with the screened compounds, the mitochondrial activity remained equal to the control level or only slightly changed (±30%). These findings may be useful in the design of dual-action boron cluster-modified therapeutic nucleic acids with combined antisense and anti-oxidant properties.

Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation

PubMed Central

Kozhuharova, Ana; Sharma, Harshita; Ohyama, Takako; Fasolo, Francesca; Yamazaki, Toshio; Cotella, Diego; Santoro, Claudio; Zucchelli, Silvia; Gustincich, Stefano; Carninci, Piero

2018-01-01

SINEUPs are antisense long noncoding RNAs, in which an embedded SINE B2 element UP-regulates translation of partially overlapping target sense mRNAs. SINEUPs contain two functional domains. First, the binding domain (BD) is located in the region antisense to the target, providing specific targeting to the overlapping mRNA. Second, the inverted SINE B2 represents the effector domain (ED) and enhances translation. To adapt SINEUP technology to a broader number of targets, we took advantage of a high-throughput, semi-automated imaging system to optimize synthetic SINEUP BD and ED design in HEK293T cell lines. Using SINEUP-GFP as a model SINEUP, we extensively screened variants of the BD to map features needed for optimal design. We found that most active SINEUPs overlap an AUG-Kozak sequence. Moreover, we report our screening of the inverted SINE B2 sequence to identify active sub-domains and map the length of the minimal active ED. Our synthetic SINEUP-GFP screening of both BDs and EDs constitutes a broad test with flexible applications to any target gene of interest. PMID:29414979

Intratumoral Epidermal Growth Factor Receptor Antisense DNA Therapy in Head and Neck Cancer: First Human Application and Potential Antitumor Mechanisms

PubMed Central

Lai, Stephen Y.; Koppikar, Priya; Thomas, Sufi M.; Childs, Erin E.; Egloff, Ann Marie; Seethala, Raja R.; Branstetter, Barton F.; Gooding, William E.; Muthukrishnan, Ashok; Mountz, James M.; Lui, Vivian W.Y.; Shin, Dong M.; Agarwala, Sanjiv S.; Johnson, Rita; Couture, Larry A.; Myers, Eugene N.; Johnson, Jonas T.; Mills, Gordon; Argiris, Athanassios; Grandis, Jennifer R.

2009-01-01

Purpose Squamous cell carcinoma of the head and neck (SCCHN) is characterized by upregulation of the epidermal growth factor receptor (EGFR). We developed a novel strategy to target EGFR by using a therapeutic gene that consisted of an EGFR antisense (AS) gene sequence under U6 promoter control. A phase I clinical trial was conducted to evaluate the safety and biologic effects of EGFR AS. Patients and Methods Patients with advanced SCCHN who were refractory to standard therapies and who had at least one assessable and accessible lesion were enrolled. The EGFR AS dose was escalated in successive cohorts (six dose levels; 60 to 1,920 μg/injection). Patients received four weekly intratumoral EGFR AS injections. Tumor biopsies were performed before and after completion of therapy. Treatment response was assessed by tumor volume measurements (positron emission tomography/computed tomography), and levels of target proteins were assessed by immunohistochemistry. Results Seventeen assessable patients were treated. No grades 3 to 4 or dose-limiting toxicities were noted, and a maximum-tolerated dose was not reached. Five patients (29%) achieved a clinical response, which included two complete responses (CRs) and three partial responses (PRs); two additional patients had stable disease (SD) as the best response. Patients with disease control (CR + PR + SD) had tumors with higher EGFR and lower STAT3 expression at baseline compared with patients who had progressive disease (P = .0312 and P = .095, respectively). Conclusion Intratumoral EGFR AS was safe and resulted in antitumor activity in patients with advanced SCCHN. Baseline levels of high EGFR and low STAT3 may be associated with antitumor effects. PMID:19204206

Tetrahedral DNA Nanoparticle Vector for Intracellular Delivery of Targeted Peptide Nucleic Acid Antisense Agents to Restore Antibiotic Sensitivity in Cefotaxime-Resistant Escherichia coli.

PubMed

Readman, John Benedict; Dickson, George; Coldham, Nick G

2017-06-01

The bacterial cell wall presents a barrier to the uptake of unmodified synthetic antisense oligonucleotides, such as peptide nucleic acids, and so is one of the greatest obstacles to the development of their use as therapeutic anti-bacterial agents. Cell-penetrating peptides have been covalently attached to antisense agents, to facilitate penetration of the bacterial cell wall and deliver their cargo into the cytoplasm. Although they are an effective vector for antisense oligonucleotides, they are not specific for bacterial cells and can exhibit growth inhibitory properties at higher doses. Using a bacterial cell growth assay in the presence of cefotaxime (CTX 16 mg/L), we have developed and evaluated a self-assembling non-toxic DNA tetrahedron nanoparticle vector incorporating a targeted anti-bla CTX-M-group 1 antisense peptide nucleic acid (PNA4) in its structure for penetration of the bacterial cell wall. A dose-dependent CTX potentiating effect was observed when PNA4 (0-40 μM) was incorporated into the structure of a DNA tetrahedron vector. The minimum inhibitory concentration (to CTX) of an Escherichia coli field isolate harboring a plasmid carrying bla CTX-M-3 was reduced from 35 to 16 mg/L in the presence of PNA4 carried by the DNA tetrahedron vector (40 μM), contrasting with no reduction in MIC in the presence of PNA4 alone. No growth inhibitory effects of the DNA tetrahedron vector alone were observed.

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

Shine-Dalgarno sequence enhances the efficiency of lacZ repression by artificial anti-lac antisense RNAs in Escherichia coli.

PubMed

Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro

2010-11-01

Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system

PubMed Central

Ross, Joseph A.; Ellis, Michael J.; Hossain, Shahan; Haniford, David B.

2013-01-01

Hfq functions in post-transcriptional gene regulation in a wide range of bacteria, usually by promoting base-pairing of mRNAs and trans-encoded sRNAs that share partial sequence complementarity. It is less clear if Hfq is required for pairing of cis-encoded RNAs (i.e., antisense RNAs) with their target mRNAs. In the current work, we have characterized the interactions between Escherichia coli Hfq and the components of the Tn10/IS10 antisense system, RNA-IN and RNA-OUT. We show that Hfq interacts with RNA-OUT through its proximal RNA-binding surface, as is typical for Hfq and trans-encoded sRNAs. In contrast, RNA-IN binds both proximal and distal RNA-binding surfaces in Hfq with a higher affinity for the latter, as is typical for mRNA interactions in canonical sRNA-mRNA pairs. Importantly, an amino acid substitution in Hfq that interferes with RNA binding to the proximal site negatively impacts RNA-IN:OUT pairing in vitro and suppresses the ability of Hfq to negatively regulate IS10 transposition in vivo. We also show that Hfq binding to RNA-IN and RNA-OUT alters secondary structure elements in both of these RNAs and speculate that this could be important in how Hfq facilitates RNA-IN:OUT pairing. Based on the results presented here, we suggest that Hfq could be involved in regulating RNA pairing in other antisense systems, including systems encoded by other transposable elements. PMID:23510801

Different effects of antisense RelA p65 and NF-kappaB1 p50 oligonucleotides on the nuclear factor-kappaB mediated expression of ICAM-1 in human coronary endothelial and smooth muscle cells.

PubMed

Voisard, R; Huber, N; Baur, R; Susa, M; Ickrath, O; Both, A; Koenig, W; Hombach, V

2001-01-01

Activation of nuclear factor-kappaB (NF-kappaB) is one of the key events in early atherosclerosis and restenosis. We hypothesized that tumor necrosis factor-alpha (TNF-alpha) induced and NF-kappaB mediated expression of intercellular adhesion molecule-1 (ICAM-1) can be inhibited by antisense RelA p65 and NF-kappaB1 p50 oligonucleotides (RelA p65 and NF-kappaB1 p50). Smooth muscle cells (SMC) from human coronary plaque material (HCPSMC, plaque material of 52 patients), SMC from the human coronary media (HCMSMC), human endothelial cells (EC) from umbilical veins (HUVEC), and human coronary EC (HCAEC) were successfully isolated (HCPSMC, HUVEC), identified and cultured (HCPSMC, HCMSMC, HUVEC, HCAEC). 12 hrs prior to TNF-alpha stimulus (20 ng/mL, 6 hrs) RelA p65 and NF-kappaB1 p50 (1, 2, 4, 10, 20, and 30 microM) and controls were added for a period of 18 hrs. In HUVEC and HCAEC there was a dose dependent inhibition of ICAM-1 expression after adding of both RelA p65 and NF-kappaB1 p50. No inhibitory effect was seen after incubation of HCMSMC with RelA p65 and NF-kappaB1 p50. A moderate inhibition of ICAM-1 expression was found after simultaneous addition of RelA p65 and NF-kappaB1 p50 to HCPSMC, no inhibitory effect was detected after individual addition of RelA p65 and NF-kappaB1 p50. The data point out that differences exist in the NF-kappaB mediated expression of ICAM-1 between EC and SMC. Experimental antisense strategies directed against RelA p65 and NF-kappaB1 p50 in early atherosclerosis and restenosis are promising in HCAEC but will be confronted with redundant pathways in HCMSMC and HCPSMC.

Testing the neurovascular hypothesis of Alzheimer's disease: LRP-1 antisense reduces blood-brain barrier clearance, increases brain levels of amyloid-beta protein, and impairs cognition.

PubMed

Jaeger, Laura B; Dohgu, Shinya; Hwang, Mark C; Farr, Susan A; Murphy, M Paul; Fleegal-DeMotta, Melissa A; Lynch, Jessica L; Robinson, Sandra M; Niehoff, Michael L; Johnson, Steven N; Kumar, Vijaya B; Banks, William A

2009-01-01

Decreased clearance is the main reason amyloid-beta protein (Abeta) is increased in the brains of patients with Alzheimer's disease (AD). The neurovascular hypothesis states that this decreased clearance is caused by impairment of low density lipoprotein receptor related protein-1 (LRP-1), the major brain-to-blood transporter of Abeta at the blood-brain barrier (BBB). As deletion of the LRP-1 gene is a lethal mutation, we tested the neurovascular hypothesis by developing a cocktail of phosphorothioate antisenses directed against LRP-1 mRNA. We found these antisenses in comparison to random antisense selectively decreased LRP-1 expression, reduced BBB clearance of Abeta42, increased brain levels of Abeta42, and impaired learning ability and recognition memory in mice. These results support dysfunction of LRP-1 at the BBB as a mechanism by which brain levels of Abeta could increase and AD would be promoted.

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

PubMed

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

2017-10-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

2017-01-01

Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

CpG oligodeoxynucleotides are a potent adjuvant for an inactivated polio vaccine produced from Sabin strains of poliovirus.

PubMed

Yang, Chunting; Shi, Huiying; Zhou, Jun; Liang, Yanwen; Xu, Honglin

2009-11-05

Poliovirus transmission is controlled globally through world-wide use of a live attenuated oral polio vaccine (OPV). However, the imminence of global poliovirus eradication calls for a switch to the inactivated polio vaccine (IPV). Given the limited manufacturing capacity and high cost of IPV, this switch is unlikely in most developing and undeveloped countries. Adjuvantation is an effective strategy for antigen sparing. In this study, we evaluated the adjuvanticity of CpG oligodeoxynucleotides (CpG-ODN) for an experimental IPV produced from Sabin strains of poliovirus. Our results showed that CpG-ODN, alone or in combination with alum, can significantly enhance both the humoral and cellular immune responses to IPV in mice, and, consequently, the antigen dose could be reduced substantially. Therefore, our study suggests that the global use of IPV could be facilitated by using CpG-ODN or other feasible adjuvants.

Asymmetric localization of natural antisense RNA of neuropeptide sensorin in Aplysia sensory neurons during aging and activity.

PubMed

Kadakkuzha, Beena M; Liu, Xin-An; Narvaez, Maria; Kaye, Alexandra; Akhmedov, Komolitdin; Puthanveettil, Sathyanarayanan V

2014-01-01

Despite the advances in our understanding of transcriptome, regulation and function of its non-coding components continue to be poorly understood. Here we searched for natural antisense transcript for sensorin (NAT-SRN), a neuropeptide expressed in the presynaptic sensory neurons of gill-withdrawal reflex of the marine snail Aplysia californica. Sensorin (SRN) has a key role in learning and long-term memory storage in Aplysia. We have now identified NAT-SRN in the central nervous system (CNS) and have confirmed its expression by northern blotting and fluorescent RNA in situ hybridization. Quantitative analysis of NAT-SRN in micro-dissected cell bodies and processes of sensory neurons suggest that NAT-SRN is present in the distal neuronal processes along with sense transcripts. Importantly, aging is associated with reduction in levels of NAT-SRN in sensory neuron processes. Furthermore, we find that forskolin, an activator of CREB signaling, differentially alters the distribution of SRN and NAT-SRN. These studies reveal novel insights into physiological regulation of natural antisense RNAs.

Retroviral gene transfer of an antisense construct against membrane type 1 matrix metalloproteinase reduces the invasiveness of rheumatoid arthritis synovial fibroblasts.

PubMed

Rutkauskaite, Edita; Volkmer, Dagmar; Shigeyama, Yukio; Schedel, Jörg; Pap, Geza; Müller-Ladner, Ulf; Meinecke, Ingmar; Alexander, Dorothea; Gay, Renate E; Drynda, Susanne; Neumann, Wolfram; Michel, Beat A; Aicher, Wilhelm K; Gay, Steffen; Pap, Thomas

2005-07-01

Membrane type 1 matrix metalloproteinase (MT1-MMP) is expressed prominently in rheumatoid arthritis synovial fibroblasts (RASFs), but the specific contribution of MT1-MMP to fibroblast-mediated destruction of articular cartilage is incompletely understood. This study used gene transfer of an antisense expression construct to assess the effects of MT1-MMP inhibition on the invasiveness of RASFs. Retroviral gene transfer of a pLXIN vector-based antisense RNA expression construct (MT1-MMPalphaS) to MT1-MMP was used to stably transduce RASFs. Levels of MT1-MMP RNA and protein were determined by quantitative polymerase chain reaction, Western blotting, and immunocytochemistry in MT1-MMPalphaS-transduced RASFs as well as in control cells, with monitoring for 60 days. The effects of MT1-MMPalphaS on the invasiveness of RASFs were analyzed in the SCID mouse co-implantation model of RA. MT1-MMPalphaS-transduced RASFs produced high levels of antisense RNA that exceeded endogenous levels of MT1-MMP messenger RNA by 15-fold and resulted in a down-regulation of MT1-MMP at the protein level. Inhibition of MT1-MMP production was maintained for 60 days and significantly reduced the invasiveness of RASFs in the SCID mouse model. Whereas prominent invasion into cartilage by non-transduced and mock-transduced RASFs was observed (mean invasion scores 3.0 and 3.1, respectively), MT1-MMPalphaS-transduced cells showed only moderate invasiveness (mean invasion score 1.8; P < 0.05). The data demonstrate that an antisense RNA expression construct against MT1-MMP can be generated and expressed in RASFs for at least 60 days. Inhibition of MT1-MMP significantly reduces the cartilage degradation by RASFs.

Antisense inhibition of apoB synthesis with mipomersen reduces plasma apoC-III and apoC-III-containing lipoproteins.

PubMed

Furtado, Jeremy D; Wedel, Mark K; Sacks, Frank M

2012-04-01

Mipomersen, an antisense oligonucleotide that reduces hepatic production of apoB, has been shown in phase 2 studies to decrease plasma apoB, LDL cholesterol (LDL-C), and triglycerides. ApoC-III inhibits VLDL and LDL clearance, and it stimulates inflammatory responses in vascular cells. Concentrations of VLDL or LDL with apoC-III independently predict cardiovascular disease. We performed an exploratory posthoc analysis on a subset of hypercholesterolemic subjects obtained from a randomized controlled dose-ranging phase 2 study of mipomersen receiving 100, 200, or 300 mg/wk, or placebo for 13 wk (n = 8 each). ApoC-III-containing lipoproteins were isolated by immuno-affinity chromatography and ultracentrifugation. Mipomersen 200 and 300 mg/wk reduced total apoC-III from baseline by 6 mg/dl (38-42%) compared with placebo group (P < 0.01), and it reduced apoC-III in both apoB lipoproteins and HDL. Mipomersen 100, 200, and 300 mg doses reduced apoB concentration of LDL with apoC-III (27%, 38%, and 46%; P < 0.05). Mipomersen reduced apoC-III concentration in HDL. The drug had no effect on apoE concentration in total plasma and in apoB lipoproteins. In summary, antisense inhibition of apoB synthesis reduced plasma concentrations of apoC-III and apoC-III-containing lipoproteins. Lower concentrations of apoC-III and LDL with apoC-III are associated with reduced risk of coronary heart disease (CHD) in epidemiologic studies independent of traditional risk factors.

Antisense inhibition of apoB synthesis with mipomersen reduces plasma apoC-III and apoC-III-containing lipoproteins

PubMed Central

Furtado, Jeremy D.; Wedel, Mark K.; Sacks, Frank M.

2012-01-01

Mipomersen, an antisense oligonucleotide that reduces hepatic production of apoB, has been shown in phase 2 studies to decrease plasma apoB, LDL cholesterol (LDL-C), and triglycerides. ApoC-III inhibits VLDL and LDL clearance, and it stimulates inflammatory responses in vascular cells. Concentrations of VLDL or LDL with apoC-III independently predict cardiovascular disease. We performed an exploratory posthoc analysis on a subset of hypercholesterolemic subjects obtained from a randomized controlled dose-ranging phase 2 study of mipomersen receiving 100, 200, or 300 mg/wk, or placebo for 13 wk (n = 8 each). ApoC-III–containing lipoproteins were isolated by immuno-affinity chromatography and ultracentrifugation. Mipomersen 200 and 300 mg/wk reduced total apoC-III from baseline by 6 mg/dl (38–42%) compared with placebo group (P < 0.01), and it reduced apoC-III in both apoB lipoproteins and HDL. Mipomersen 100, 200, and 300 mg doses reduced apoB concentration of LDL with apoC-III (27%, 38%, and 46%; P < 0.05). Mipomersen reduced apoC-III concentration in HDL. The drug had no effect on apoE concentration in total plasma and in apoB lipoproteins. In summary, antisense inhibition of apoB synthesis reduced plasma concentrations of apoC-III and apoC-III–containing lipoproteins. Lower concentrations of apoC-III and LDL with apoC-III are associated with reduced risk of coronary heart disease (CHD) in epidemiologic studies independent of traditional risk factors. PMID:22301884

Upregulation of endothelial receptor for oxidized LDL (LOX-1) by oxidized LDL and implications in apoptosis of human coronary artery endothelial cells: evidence from use of antisense LOX-1 mRNA and chemical inhibitors.

PubMed

Li, D; Mehta, J L

2000-04-01

A specific lectin-like endothelial receptor for oxidized low density lipoprotein (LOX-1), distinct from the scavenger receptor in monocytes/macrophages, has been identified and cloned. In this study, we examined the regulation of LOX-1 by oxidized low density lipoprotein (ox-LDL) and determined the role of LOX-1 in ox-LDL-induced apoptosis of cultured human coronary artery endothelial cells (HCAECs). Incubation of HCAECs with ox-LDL (40 microg/mL), but not native LDL, for 24 hours markedly increased LOX-1 expression (mRNA and protein). After 48 hours of preincubation of HCAECs with a specific antisense to LOX-1 mRNA (antisense LOX-1), ox-LDL-mediated upregulation of LOX-1 was suppressed (P<0.01). In contrast, treatment of HCAECs with sense LOX-1 had no effect. Ox-LDL also induced apoptosis (determined by terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling and DNA laddering) of HCAECs in a concentration- and time-dependent fashion. LOX-1 played an important role in ox-LDL-mediated apoptosis of HCAECs because antisense LOX-1 inhibited this effect of ox-LDL. Polyinosinic acid and carrageenan, 2 different chemical inhibitors of LOX-1, also decreased ox-LDL-mediated apoptosis of HCAECs. Nuclear factor (NF)-kappaB was markedly activated in ox-LDL-treated HCAECs. The critical role of NF-kappaB activation became evident in experiments with antisense LOX-1, which abolished ox-LDL-mediated NF-kappaB activation. In this process, an NF-kappaB inhibitor, caffeic acid phenethyl ester, also inhibited ox-LDL-mediated apoptosis of HCAECs. These findings indicate that ox-LDL upregulates its own endothelial receptor. Ox-LDL-induced apoptosis is mediated by the action of LOX-1. In this process, NF-kappaB activation may play an important role as a signal transduction mechanism.

Mechanisms Mediating Vibration-induced Chronic Musculoskeletal Pain Analyzed in the Rat

PubMed Central

Dina, Olayinka A.; Joseph, Elizabeth K.; Levine, Jon D.; Green, Paul G.

2009-01-01

While occupational exposure to vibration is a common cause of acute and chronic musculoskeletal pain, eliminating exposure produces limited symptomatic improvement, and re-exposure precipitates rapid recurrence or exacerbation. To evaluate mechanisms underlying these pain syndromes, we have developed a model in the rat, in which exposure to vibration (60–80 Hz) induces, in skeletal muscle, both acute mechanical hyperalgesia as well as long-term changes characterized by enhanced hyperalgesia to a pro-inflammatory cytokine or re-exposure to vibration. Exposure of a hind limb to vibration produced mechanical hyperalgesia measured in the gastrocnemius muscle of the exposed hind limb, which persisted for ~2 weeks. When nociceptive thresholds had returned to baseline, exposure to a pro-inflammatory cytokine or re-exposure to vibration produced markedly prolonged hyperalgesia. The chronic prolongation of vibration- and cytokine-hyperalgesia induced by vibration was prevented by spinal intrathecal injection of oligodeoxynucleotide (ODN) antisense to protein kinase Cε, a second messenger in nociceptors implicated in the induction and maintenance of chronic pain. Vibration-induced hyperalgesia was inhibited by spinal intrathecal administration of ODN antisense to receptors for the type-1 tumor necrosis factor-α (TNFα) receptor. Finally, in TNFα-pretreated muscle, subsequent vibration-induced hyperalgesia was markedly prolonged. Perspective These studies establish a model of vibration-induced acute and chronic musculoskeletal pain, and identify the proinflammatory cytokine TNFα and the second messenger PKCε as targets against which therapies might be directed to prevent and/or treat this common and very debilitating chronic pain syndrome. PMID:19962353

Mechanisms mediating vibration-induced chronic musculoskeletal pain analyzed in the rat.

PubMed

Dina, Olayinka A; Joseph, Elizabeth K; Levine, Jon D; Green, Paul G

2010-04-01

While occupational exposure to vibration is a common cause of acute and chronic musculoskeletal pain, eliminating exposure produces limited symptomatic improvement, and reexposure precipitates rapid recurrence or exacerbation. To evaluate mechanisms underlying these pain syndromes, we have developed a model in the rat, in which exposure to vibration (60-80Hz) induces, in skeletal muscle, both acute mechanical hyperalgesia as well as long-term changes characterized by enhanced hyperalgesia to a proinflammatory cytokine or reexposure to vibration. Exposure of a hind limb to vibration-produced mechanical hyperalgesia measured in the gastrocnemius muscle of the exposed hind limb, which persisted for approximately 2 weeks. When nociceptive thresholds had returned to baseline, exposure to a proinflammatory cytokine or reexposure to vibration produced markedly prolonged hyperalgesia. The chronic prolongation of vibration- and cytokine-hyperalgesia was prevented by spinal intrathecal injection of oligodeoxynucleotide (ODN) antisense to protein kinase Cepsilon, a second messenger in nociceptors implicated in the induction and maintenance of chronic pain. Vibration-induced hyperalgesia was inhibited by spinal intrathecal administration of ODN antisense to receptors for the type-1 tumor necrosis factor-alpha (TNFalpha) receptor. Finally, in TNFalpha-pretreated muscle, subsequent vibration-induced hyperalgesia was markedly prolonged. These studies establish a model of vibration-induced acute and chronic musculoskeletal pain, and identify the proinflammatory cytokine TNFalpha and the second messenger protein kinase Cepsilon as targets against which therapies might be directed to prevent and/or treat this common and very debilitating chronic pain syndrome. Copyright 2010 American Pain Society. All rights reserved.

Neonate intestinal immune response to CpG oligodeoxynucleotide stimulation.

PubMed

Lacroix-Lamandé, Sonia; Rochereau, Nicolas; Mancassola, Roselyne; Barrier, Mathieu; Clauzon, Amandine; Laurent, Fabrice

2009-12-14

The development of mucosal vaccines is crucial to efficiently control infectious agents for which mucosae are the primary site of entry. Major drawbacks of these protective strategies are the lack of effective mucosal adjuvant. Synthetic oligodeoxynucleotides that contain several unmethylated cytosine-guanine dinucleotide (CpG-ODN) motifs are now recognized as promising adjuvants displaying mucosal adjuvant activity through direct activation of TLR9-expressing cells. However, little is known about the efficacy of these molecules in stimulating the intestinal immune system in neonates. First, newborn mice received CpG-ODN orally, and the intestinal cytokine and chemokine response was measured. We observed that oral administration of CpG-ODN induces CXC and CC chemokine responses and a cellular infiltration in the intestine of neonates as detected by immunohistochemistry. We next compared the efficiency of the oral route to intraperitoneal administration in stimulating the intestinal immune responses of both adults and neonates. Neonates were more responsive to TLR9-stimulation than adults whatever the CpG-ODN administration route. Their intestinal epithelial cells (IECs) indirectly responded to TLR9 stimulation and contributed to the CXC chemokine response, whereas other TLR9-bearing cells of the lamina-propria produced CC chemokines and Th1-type cytokines. Moreover, we showed that the intestine of adult exhibited a significantly higher level of IL10 at homeostasis than neonates, which might be responsible for the unresponsiveness to TLR9-stimulation, as confirmed by our findings in IL10-deficient mice. This is the first report that deciphers the role played by CpG-ODN in the intestine of neonates. This work clearly demonstrates that an intraperitoneal administration of CpG-ODN is more efficient in neonates than in adults to stimulate an intestinal chemokine response due to their lower IL-10 intestinal level. In addition we report the efficiency of the oral route at

Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.

PubMed

Echigoya, Yusuke; Lim, Kenji Rowel Q; Trieu, Nhu; Bao, Bo; Miskew Nichols, Bailey; Vila, Maria Candida; Novak, James S; Hara, Yuko; Lee, Joshua; Touznik, Aleksander; Mamchaoui, Kamel; Aoki, Yoshitsugu; Takeda, Shin'ichi; Nagaraju, Kanneboyina; Mouly, Vincent; Maruyama, Rika; Duddy, William; Yokota, Toshifumi

2017-11-01

Duchenne muscular dystrophy (DMD), the most common lethal genetic disorder, is caused by mutations in the dystrophin (DMD) gene. Exon skipping is a therapeutic approach that uses antisense oligonucleotides (AOs) to modulate splicing and restore the reading frame, leading to truncated, yet functional protein expression. In 2016, the US Food and Drug Administration (FDA) conditionally approved the first phosphorodiamidate morpholino oligomer (morpholino)-based AO drug, eteplirsen, developed for DMD exon 51 skipping. Eteplirsen remains controversial with insufficient evidence of its therapeutic effect in patients. We recently developed an in silico tool to design antisense morpholino sequences for exon skipping. Here, we designed morpholino AOs targeting DMD exon 51 using the in silico tool and quantitatively evaluated the effects in immortalized DMD muscle cells in vitro. To our surprise, most of the newly designed morpholinos induced exon 51 skipping more efficiently compared with the eteplirsen sequence. The efficacy of exon 51 skipping and rescue of dystrophin protein expression were increased by up to more than 12-fold and 7-fold, respectively, compared with the eteplirsen sequence. Significant in vivo efficacy of the most effective morpholino, determined in vitro, was confirmed in mice carrying the human DMD gene. These findings underscore the importance of AO sequence optimization for exon skipping. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

PubMed

Hanagata, Nobutaka

2017-01-01

Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Prevention of Asthma Exacerbation in a Mouse Model by Simultaneous Inhibition of NF-κB and STAT6 Activation Using a Chimeric Decoy Strategy.

PubMed

Miyake, Tetsuo; Miyake, Takashi; Sakaguchi, Makoto; Nankai, Hirokazu; Nakazawa, Takahiro; Morishita, Ryuichi

2018-03-02

Transactivation of inflammatory and immune mediators in asthma is tightly regulated by nuclear factor κB (NF-κB) and signal transducer and activator of transcription 6 (STAT6). Therefore, we investigated the efficacy of simultaneous inhibition of NF-κB and STAT6 using a chimeric decoy strategy to prevent asthma exacerbation. The effects of decoy oligodeoxynucleotides were evaluated using an ovalbumin-induced mouse asthma model. Ovalbumin-sensitized mice received intratracheal administration of decoy oligodeoxynucleotides 3 days before ovalbumin challenge. Fluorescent-dye-labeled decoy oligodeoxynucleotides could be detected in lymphocytes and macrophages in the lung, and activation of NF-κB and STAT6 was inhibited by chimeric decoy oligodeoxynucleotide transfer. Consequently, treatment with chimeric or NF-κB decoy oligodeoxynucleotides protected against methacholine-induced airway hyperresponsiveness, whereas the effect of chimeric decoy oligodeoxynucleotides was significantly greater than that of NF-κB decoy oligodeoxynucleotides. Treatment with chimeric decoy oligodeoxynucleotides suppressed airway inflammation through inhibition of overexpression of interleukin-4 (IL-4), IL-5, and IL-13 and inflammatory infiltrates. Histamine levels in the lung were reduced via suppression of mast cell accumulation. A significant reduction in mucin secretion was observed due to suppression of MUC5AC gene expression. Interestingly, the inhibitory effects on IL-5, IL-13, and histamine secretion were achieved by transfer of chimeric decoy oligodeoxynucleotides only. This novel therapeutic approach could be useful to treat patients with various types of asthma. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Antisense inhibition of tomato fruit sucrose synthase decreases fruit setting and the sucrose unloading capacity of young fruit.

PubMed Central

D'Aoust, M A; Yelle, S; Nguyen-Quoc, B

1999-01-01

The role of sucrose synthase (SuSy) in tomato fruit was studied in transgenic tomato (Lycopersicon esculentum) plants expressing an antisense fragment of fruit-specific SuSy RNA (TOMSSF) under the control of the cauliflower mosaic virus 35S promoter. Constitutive expression of the antisense RNA markedly inhibited SuSy activity in flowers and fruit pericarp tissues. However, inhibition was only slight in the endosperm and was undetectable in the embryo, shoot, petiole, and leaf tissues. The activity of sucrose phosphate synthase decreased in parallel with that of SuSy, but acid invertase activity did not increase in response to the reduced SuSy activity. The only effect on the carbohydrate content of young fruit was a slight reduction in starch accumulation. The in vitro sucrose import capacity of fruits was not reduced by SuSy inhibition at 23 days after anthesis, and the rate of starch synthesized from the imported sucrose was not lessened even when SuSy activity was decreased by 98%. However, the sucrose unloading capacity of 7-day-old fruit was substantially decreased in lines with low SuSy activity. In addition, the SuSy antisense fruit from the first week of flowering had a slower growth rate. A reduced fruit set, leading to markedly less fruit per plant at maturity, was observed for the plants with the least SuSy activity. These results suggest that SuSy participates in the control of sucrose import capacity of young tomato fruit, which is a determinant for fruit set and development. PMID:10590167

A lignin-specific peroxidase in tobacco whose antisense suppression leads to vascular tissue modification

NASA Technical Reports Server (NTRS)

Blee, Kristopher A.; Choi, Joon W.; O'Connell, Ann P.; Schuch, Wolfgang; Lewis, Norman G.; Bolwell, G. Paul

2003-01-01

A tobacco peroxidase isoenzyme (TP60) was down-regulated in tobacco using an antisense strategy, this affording transformants with lignin reductions of up to 40-50% of wild type (control) plants. Significantly, both guaiacyl and syringyl levels decreased in essentially a linear manner with the reductions in lignin amounts, as determined by both thioacidolysis and nitrobenzene oxidative analyses. These data provisionally suggest that a feedback mechanism is operative in lignifying cells, which prevents build-up of monolignols should oxidative capacity for their subsequent metabolism be reduced. Prior to this study, the only known rate-limiting processes in the monolignol/lignin pathways involved that of Phe supply and the relative activities of cinnamate-4-hydroxylase/p-coumarate-3-hydroxylase, respectively. These transformants thus provide an additional experimental means in which to further dissect and delineate the factors involved in monolignol targeting to precise regions in the cell wall, and of subsequent lignin assembly. Interestingly, the lignin down-regulated tobacco phenotypes displayed no readily observable differences in overall growth and development profiles, although the vascular apparatus was modified.

[Inhibition of monocytes adhesion to the intima of arterial wall by local expression of antisense monocyte chemotactic protein-1].

PubMed

Wu, Q; Qiao, H; Wang, Z; Zhang, H; Liu, P; Xu, M; Ren, G; Zhao, S; She, M

2000-04-01

To study the mechanism of monocyte recruitment in atherogenesis and to clarify the effect of monocyte chemotactic protein-1 (MCP-1) in this process. Femoral arteries isolated from the rabbits which had been fed with a high cholesterol diet and locally perfused with MM-LDL within the artery beforehand, were used as the models. Antisense MCP-1cDNA was transferred into the arterial wall by injecting recombinant LNCX-anti-MCP-1/liposomal complex in the femoral sheath and the periarterial tissue. Expression of antisense MCP-1 mediated by recombinant LNCX plasmid/lipsomal complex gene transfer enabled to inhibit MCP-1 gene expression and adhesion of monocyte to the intima. MCP-1 plays an important role on the recruitment of monocytes in the arterial wall, which provides a potential clue in developing a gene therapy project for the prevention and treatment of atherogenesis.

Inhibition of adenovirus 5 replication in COS-1 cells by antisense RNAs against the viral E1a region.

PubMed

Miroshnichenko, O I; Ponomareva, T I; Tikchonenko, T I

1989-12-07

To study the effect of antisense E1a RNA (asRNA) on adenovirus development, two types of adenovirus 5 E1a antisense constructs have been engineered. One was complementary to the viral DNA region [nucleotide (nt) positions 500-720] regulated by the metallothionein-I promoter, and the other was complementary to the DNA regions (nt positions 630-1570) under control of the long terminal repeat Moloney mouse leukosis virus promoter. Both asRNA constructs were cloned into a plasmid containing the simian virus 40 origin of replication, the gene controlling geneticin (G418) resistance (G418R), and other regulatory elements. The COS-1 cells, which contained up to 100 copies of the engineered plasmids, synthesized antiviral asRNAs, which provided 71 to over 95% inhibition of adenoviral replication, in comparison to the control cells not synthesizing asRNAs.

Inhibition of G protein-coupled P2Y2 receptor induced analgesia in a rat model of trigeminal neuropathic pain.

PubMed

Li, Na; Lu, Zhan-ying; Yu, Li-hua; Burnstock, Geoffrey; Deng, Xiao-ming; Ma, Bei

2014-03-18

ATP and P2X receptors play important roles in the modulation of trigeminal neuropathic pain, while the role of G protein-coupled P2Y₂ receptors and the underlying mechanisms are less clear. The threshold and frequency of action potentials, fast inactivating transient K+ channels (IA) are important regulators of membrane excitability in sensory neurons because of its vital role in the control of the spike onset. In this study, pain behavior tests, QT-RT-PCR, immunohistochemical staining, and patch-clamp recording, were used to investigate the role of P2Y₂ receptors in pain behaviour. In control rats: 1) UTP, an agonist of P2Y₂/P2Y₄ receptors, caused a significant decrease in the mean threshold intensities for evoking action potentials and a striking increase in the mean number of spikes evoked by TG neurons. 2) UTP significantly inhibited IA and the expression of Kv1.4, Kv3.4 and Kv4.2 subunits in TG neurons, which could be reversed by the P2 receptor antagonist suramin and the ERK antagonist U0126. In ION-CCI (chronic constriction injury of infraorbital nerve) rats: 1) mRNA levels of Kv1.4, Kv3.4 and Kv4.2 subunits were significantly decreased, while the protein level of phosphorylated ERK was significantly increased. 2) When blocking P2Y₂ receptors by suramin or injection of P2Y2R antisense oligodeoxynucleotides both led to a time- and dose-dependent reverse of allodynia in ION-CCI rats. 3) Injection of P2Y₂ receptor antisense oligodeoxynucleotides induced a pronounced decrease in phosphorylated ERK expression and a significant increase in Kv1.4, Kv3.4 and Kv4.2 subunit expression in trigeminal ganglia. Our data suggest that inhibition of P2Y₂ receptors leads to down-regulation of ERK-mediated phosphorylation and increase of the expression of I(A)-related Kv channels in trigeminal ganglion neurons, which might contribute to the clinical treatment of trigeminal neuropathic pain.

Differential production of immunoglobulin classes and subclasses by mucosal-type human B-lymphocytes exposed in vitro to CpG oligodeoxynucleotides.

PubMed

Cognasse, Fabrice; Acquart, Sophie; Beniguel, Lydie; Sabido, Odile; Chavarin, Patricia; Genin, Christian; Garraud, Olivier

2005-01-01

As B-lymphocytes play an important role in innate and adaptive immunity, we aimed to examine the effects of CpG oligodeoxynucleotides (ODNs) on purified tonsil-originating CD19+ B-cells, representing mucosal B-cells. We screened various K-type ODNs, reactive with human B-cells, and tested for the production of immunoglobulins in vitro. Using one CpG-ODN, DSP30, we observed that it could upregulate not only Toll-like receptor 9 (TLR9) mRNA expression in activated B-cells, but also the early expression of CD69 followed by the sequential expression of CD80, CD86 and the nuclear factor (NF)-kappaB pathway. Furthermore, mRNA expression of certain B-cell-derived cytokines was influenced by exposure to DSP30, with a strong upregulation of interleukin 6 (IL-6) and downregulation of IL1-beta. Stimulation of B-cells, co-stimulated with IL-2, IL-10 and soluble CD40 ligand (sCD40L) with different CpG-ODNs, had differing effects on the terminal differentiation in vitro of B-cells into immunoglobulin-secreting cells. TLR9 is involved in innate immunity and the recognition of bound CpG DNA from invading bacterial pathogens. As tonsillar B-cells are mucosal-type B-lymphocytes, this study suggests that CpG-ODNs show promise as mucosal adjuvants in modulating the local production of immunoglobulins of certain classes and subclasses, a crucial issue in vaccine perspectives.

Antisense Oligonucleotides Targeting Parasite Inositol 1,4,5-Trisphosphate Receptor Inhibits Mammalian Host Cell Invasion by Trypanosoma cruzi

NASA Astrophysics Data System (ADS)

Hashimoto, Muneaki; Nara, Takeshi; Hirawake, Hiroko; Morales, Jorge; Enomoto, Masahiro; Mikoshiba, Katsuhiko

2014-02-01

Chagas disease is caused by an intracellular parasitic protist, Trypanosoma cruzi. As there are no highly effective drugs against this agent that also demonstrate low toxicity, there is an urgent need for development of new drugs to treat Chagas disease. We have previously demonstrated that the parasite inositol 1,4,5-trisphosphate receptor (TcIP3R) is crucial for invasion of the mammalian host cell by T. cruzi. Here, we report that TcIP3R is a short-lived protein and that its expression is significantly suppressed in trypomastigotes. Treatment of trypomastigotes, an infective stage of T. cruzi, with antisense oligonucleotides specific to TcIP3R deceased TcIP3R protein levels and impaired trypomastigote invasion of host cells. Due to the resulting instability and very low expression level of TcIP3R in trypomastigotes indicates that TcIP3R is a promising target for antisense therapy in Chagas disease.

Evolutionary conservation of cold-induced antisense RNAs of FLOWERING LOCUS C in Arabidopsis thaliana perennial relatives.

PubMed

Castaings, Loren; Bergonzi, Sara; Albani, Maria C; Kemi, Ulla; Savolainen, Outi; Coupland, George

2014-07-17

Antisense RNA (asRNA) COOLAIR is expressed at A. thaliana FLOWERING LOCUS C (FLC) in response to winter temperatures. Its contribution to cold-induced silencing of FLC was proposed but its functional and evolutionary significance remain unclear. Here we identify a highly conserved block containing the COOLAIR first exon and core promoter at the 3' end of several FLC orthologues. Furthermore, asRNAs related to COOLAIR are expressed at FLC loci in the perennials A. alpina and A. lyrata, although some splicing variants differ from A. thaliana. Study of the A. alpina orthologue, PERPETUAL FLOWERING 1 (PEP1), demonstrates that AaCOOLAIR is induced each winter of the perennial life cycle. Introduction of PEP1 into A. thaliana reveals that AaCOOLAIR cis-elements confer cold-inducibility in this heterologous species while the difference between PEP1 and FLC mRNA patterns depends on both cis-elements and species-specific trans-acting factors. Thus, expression of COOLAIR is highly conserved, supporting its importance in FLC regulation.

An endogenous RNA transcript antisense to CNG(alpha)1 cation channel mRNA.

PubMed

Cheng, Chin-Hung; Yew, David Tai-Wai; Kwan, Hiu-Yee; Zhou, Qing; Huang, Yu; Liu, Yong; Chan, Wing-Yee; Yao, Xiaoqiang

2002-10-01

CNG channels are cyclic nucleotide-gated Ca(2+)-permeable channels that are suggested to be involved in the activity-dependent alterations of synaptic strength that are thought to underlie information storage in the CNS. In this study, we isolated an endogenous RNA transcript antisense to CNG(alpha)1 mRNA. This transcript was capable of down-regulating the expression of sense CNG(alpha)1 in the Xenopus oocyte expression system. RT-PCR, Northern blot, and in situ hybridization analyses showed that the transcript was coexpressed with CNG(alpha)1 mRNA in many regions of human brain, notably in those regions that were involved in long-term potentiation and long-term depression, such as hippocampal CA1 and CA3, dentate gyrus, and cerebellar Purkinje layer. Comparison of expression patterns between adult and fetal cerebral cortex revealed that there were concurrent developmental changes in the expression levels of anti-CNG1 and CNG(alpha)1. Treatment of human glioma cell T98 with thyroid hormone T(3) caused a significant increase in anti-CNG1 expression and a parallel decrease in sense CNG(alpha)1 expression. These data suggest that the suppression of CNG(alpha)1 expression by anti-CNG1 may play an important role in neuronal functions, especially in synaptic plasticity and cortical development. Endogenous antisense RNA-mediated regulation may represent a new mechanism through which the activity of ion channels can be regulated in the human CNS.

Natural antisense transcript-targeted regulation of inducible nitric oxide synthase mRNA levels.

PubMed

Yoshigai, Emi; Hara, Takafumi; Araki, Yoshiro; Tanaka, Yoshito; Oishi, Masaharu; Tokuhara, Katsuji; Kaibori, Masaki; Okumura, Tadayoshi; Kwon, A-Hon; Nishizawa, Mikio

2013-04-01

Natural antisense transcripts (asRNAs) are frequently transcribed from mammalian genes. Recently, we found that non-coding asRNAs are transcribed from the 3' untranslated region (3'UTR) of the rat and mouse genes encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide. The iNOS asRNA stabilizes iNOS mRNA by interacting with the mRNA 3'UTR. Furthermore, single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence were found to reduce iNOS mRNA levels by interfering with mRNA-asRNA interactions in rat hepatocytes. This method was named natural antisense transcript-targeted regulation (NATRE) technology. In this study, we detected human iNOS asRNA expressed in hepatocarcinoma and colon carcinoma tissues. The human iNOS asRNA harbored a sequence complementary to an evolutionarily conserved region of the iNOS mRNA 3'UTR. When introduced into hepatocytes, iNOS sense oligonucleotides that were modified by substitution with partial phosphorothioate bonds and locked nucleic acids or 2'-O-methyl nucleic acids greatly reduced levels of iNOS mRNA and iNOS protein. Moreover, sense oligonucleotides and short interfering RNAs decreased iNOS mRNA to comparable levels. These results suggest that NATRE technology using iNOS sense oligonucleotides could potentially be used to treat human inflammatory diseases and cancers by reducing iNOS mRNA levels. Copyright © 2013 Elsevier Inc. All rights reserved.

Chemical modifications of antisense morpholino oligomers enhance their efficacy against Ebola virus infection.

PubMed

Swenson, Dana L; Warfield, Kelly L; Warren, Travis K; Lovejoy, Candace; Hassinger, Jed N; Ruthel, Gordon; Blouch, Robert E; Moulton, Hong M; Weller, Dwight D; Iversen, Patrick L; Bavari, Sina

2009-05-01

Phosphorodiamidate morpholino oligomers (PMOs) are uncharged nucleic acid-like molecules designed to inactivate the expression of specific genes via the antisense-based steric hindrance of mRNA translation. PMOs have been successful at knocking out viral gene expression and replication in the case of acute viral infections in animal models and have been well tolerated in human clinical trials. We propose that antisense PMOs represent a promising class of therapeutic agents that may be useful for combating filoviral infections. We have previously shown that mice treated with a PMO whose sequence is complementary to a region spanning the start codon of VP24 mRNA were protected against lethal Ebola virus challenge. In the present study, we report on the abilities of two additional VP24-specific PMOs to reduce the cell-free translation of a VP24 reporter, to inhibit the in vitro replication of Ebola virus, and to protect mice against lethal challenge when the PMOs are delivered prior to infection. Additionally, structure-activity relationship evaluations were conducted to assess the enhancement of antiviral efficacy associated with PMO chemical modifications that included conjugation with peptides of various lengths and compositions, positioning of conjugated peptides to either the 5' or the 3' terminus, and the conferring of charge modifications by the addition of piperazine moieties. Conjugation with arginine-rich peptides greatly enhanced the antiviral efficacy of VP24-specific PMOs in infected cells and mice during lethal Ebola virus challenge.

Antisense expression of the peptide transport gene AtPTR2-B delays flowering and arrests seed development in transgenic Arabidopsis plants.

PubMed Central

Song, W; Koh, S; Czako, M; Marton, L; Drenkard, E; Becker, J M; Stacey, G

1997-01-01

Previously, we identified a peptide transport gene, AtPTR2-B, from Arabidopsis thaliana that was constitutively expressed in all plant organs, suggesting an important physiological role in plant growth and development. To evaluate the function of this transporter, transgenic Arabidopsis plants were constructed expressing antisense or sense AtPTR2-B. Genomic Southern analysis indicated that four independent antisense and three independent sense AtPTR2-B transgenic lines were obtained, which was confirmed by analysis of the segregation of the kanamycin resistance gene carried on the T-DNA. RNA blot data showed that the endogenous AtPTR2-B mRNA levels were significantly reduced in transgenic leaves and flowers, but not in transgenic roots. Consistent with this reduction in endogenous AtPTR2-B mRNA levels, all four antisense lines and one sense line exhibited significant phenotypic changes, including late flowering and arrested seed development. These phenotypic changes could be explained by a defect in nitrogen nutrition due to the reduced peptide transport activity conferred by AtPTR2-B. These results suggest that AtPTR2-B may play a general role in plant nutrition. The AtPTR2-B gene was mapped to chromosome 2, which is closely linked to the restriction fragment length polymorphism marker m246. PMID:9232875

Fbis report. Science and technology: China, October 18, 1995

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1995-10-18

;Partial Contents: Nanomaterials Fabrication, Applications Research Advances Noted; CAST Announces World`s First Space-Grown Large-Diameter GaAs Monocrystal; Assay of Antiviral Activity of Antisense Phosphorothioate Oligodeoxynucleotide Against Dengue Virus; Expression and Antigenicity of Chimeric Proteins of Cholera Toxin B Subunit With Hepatitis C Virus; CNCOFIEC Signs Agreement With IBM for New Intelligent Building; Latest Reports on Optical Computing, Memory; BIDC To Introduce S3 Company`s Multimedia Accelerator Chipset; Virtual Private PCN Ring Network Based on ATM VP Cross-Connection; Beijing Gets Nation`s First Frame Relay Network; Situation of Power Industry Development and International Cooperation; Diagrams of China`s Nuclear Waste Containment Vessels; Chinese-Developed Containment Vesselmore » Material Reaches World Standards; Second Fuel Elements for Qinshan Plant Passes Inspection; and Geothermal Deep-Well Electric Pump Technology Developed.« less

Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9.

PubMed

Prykhozhij, Sergey V; Fuller, Charlotte; Steele, Shelby L; Veinotte, Chansey J; Razaghi, Babak; Robitaille, Johane M; McMaster, Christopher R; Shlien, Adam; Malkin, David; Berman, Jason N

2018-06-14

We have optimized point mutation knock-ins into zebrafish genomic sites using clustered regularly interspaced palindromic repeats (CRISPR)/Cas9 reagents and single-stranded oligodeoxynucleotides. The efficiency of knock-ins was assessed by a novel application of allele-specific polymerase chain reaction and confirmed by high-throughput sequencing. Anti-sense asymmetric oligo design was found to be the most successful optimization strategy. However, cut site proximity to the mutation and phosphorothioate oligo modifications also greatly improved knock-in efficiency. A previously unrecognized risk of off-target trans knock-ins was identified that we obviated through the development of a workflow for correct knock-in detection. Together these strategies greatly facilitate the study of human genetic diseases in zebrafish, with additional applicability to enhance CRISPR-based approaches in other animal model systems.

Directing traffic on DNA-How transcription factors relieve or induce transcriptional interference.

PubMed

Hao, Nan; Palmer, Adam C; Dodd, Ian B; Shearwin, Keith E

2017-03-15

Transcriptional interference (TI) is increasingly recognized as a widespread mechanism of gene control, particularly given the pervasive nature of transcription, both sense and antisense, across all kingdoms of life. Here, we discuss how transcription factor binding kinetics strongly influence the ability of a transcription factor to relieve or induce TI.

Audiogenic seizure activity following HSV-1 GAD65 sense or antisense injection into inferior colliculus of Long-Evans rat.

PubMed

Coleman, James R; Thompson, Karen C; Wilson, Marlene A; Wilson, Steven P

2017-06-01

Herpes virus technology involving manipulation of GAD65 was used to study effects on audiogenic seizures (AGS). Audiogenic seizure behaviors were examined following injections of replication-defective herpes simplex virus (HSV-1) vectors incorporating sense or antisense toward GAD65 along with 10% lac-Z into the central nucleus of inferior colliculus (CNIC) of Long-Evans rats. In seizure-sensitive animals developmentally primed by intense sound exposure, injection of GAD65 in the sense orientation increased wild running latencies and reduced incidence of clonus compared with lac-Z only, unoperated, and vehicle seizure groups. In contrast, infection of CNIC with GAD65 antisense virus resulted in 100% incidence of wild running and clonus behaviors in AGS animals. Unprimed animals not operated continued to show uniform absence of seizure activity. Administration of GAD65 antisense virus into CNIC produced novel wild running and clonus behaviors in some unprimed animals. Staining for β-galactosidase in all vector animals revealed no differences in pattern or numbers of immunoreactive cells at injection sites. Qualitatively, typical small and medium multipolar/stellate and medium fusiform neurons appeared in the CNIC of vector animals. These results demonstrate that HSV-1 vector constructs implanted into the CNIC can predictably influence incidence and severity of AGS and suggest that viral vectors can be useful in studying GABA mechanisms with potential for therapeutic application in epilepsy. This article is part of a Special Issue entitled "Genetic and Reflex Epilepsies, Audiogenic Seizures and Strains: From Experimental Models to the Clinic". Copyright © 2016 Elsevier Inc. All rights reserved.

Cellular uptake and ex vivo urothelial penetration by oligodeoxynucleotides for optimizing treatment of transitional cell carcinoma.

PubMed

Bolenz, Christian; Trojan, Lutz; Gabriel, Ute; Honeck, Patrick; Wendt-Nordahl, Gunnar; Schaaf, Axel; Alken, Peter; Michel, Maurice Stephan

2008-10-01

To evaluate cellular uptake and urothelial penetration of oligodeoxynucleotides (ODNs) in transitional cell carcinoma (TCC) cell lines and in a porcine ex vivo model, respectively. A panel of human TCC cell lines (RT 112, HT 1197 and UM-UC3) were exposed tofluorescein-labeled ODNs. Transfection rates were assessed byfluorescence microscopy and fluorescence-activated cell sorting (FACS). Intravesical treatment with ODNs was performed in a porcine ex vivo model. Urothelial penetration was evaluated using fluorescence microscopy of cryosections. Treatment with ODNs provided transfection rates of at least 96.8% of TCC cells, irrespective of use of a transfection agent. Effective urothelial penetration by ODNs was detected when compared with controls (p = 0.0325). The addition of a liposomal transfection agent significantly increased the penetration depth, allowing affection of deep urothelial cell layers (p = 0.0082). High transfection rates of ODNs can be achieved in TCC cells. Urothelial penetration of ODNs was observed down to the deepest cell layers when a transfection agent is added, suggesting a high potential for complementing the chemoresection effects on residual tumor areas during intravesical therapy of non-muscle-invasive TCC.

Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

NASA Astrophysics Data System (ADS)

Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

1997-09-01

Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

Employment of Oligodeoxynucleotide plus Interleukin-2 Improves Cytogenetic Analysis in Splenic Marginal Zone Lymphoma

PubMed Central

Bardi, Antonella; Cavazzini, Francesco; Rigolin, Gian Matteo; Tammiso, Elisa; Volta, Eleonora; Pezzolo, Elisa; Formigaro, Luca; Sofritti, Olga; Daghia, Giulia; Ambrosio, Cristina; Rizzotto, Lara; Abass, Awad E.; D'Auria, Fiorella; Musto, Pellegrino; Cuneo, Antonio

2011-01-01

To compare the efficiency of novel mitogenic agents and traditional mitosis inductors, 18 patients with splenic marginal zone lymphoma (SMZL) were studied. Three cultures using oligodeoxynucleotide (ODN) plus interleukin-2 (IL-2), or TPA, or LPS were setup in each patient. Seventeen/18 cases with ODN + IL2 had moderate/good proliferation (94, 4%) as compared with 10/18 cases with TPA and LPS (55%) (P = .015); 14/18 (77, 7%) cases with ODN + IL2 had sufficient good quality of banding as compared with 8/18 cases (44, 4%) with TPA and LPS. The karyotype could be defined from ODN + IL2-stimulated cultures in all 18 patients, 14 of whom (77, 7%) had a cytogenetic aberration, whereas clonal aberrations could be documented in 9 and in 3 cases by stimulation with LPS and TPA, respectively. Recurrent chromosome aberrations in our series were represented by aberrations of chromosome 14q in 5 patients, by trisomy 12 and 7q deletion in 4 cases each, and by abnormalities involving 11q and 13q in two cases each. These findings show that stimulation with ODN + IL2 offers more mitotic figures of better quality and results in an increased rate of clonal aberrations in SMZL, making this method ideal for prospective studies aiming at the definition of the prognostic impact of cytogenetic aberrations in this disorder. PMID:21629757

Zinc-finger Nuclease-induced Gene Repair With Oligodeoxynucleotides: Wanted and Unwanted Target Locus Modifications

PubMed Central

Radecke, Sarah; Radecke, Frank; Cathomen, Toni; Schwarz, Klaus

2010-01-01

Correcting a mutated gene directly at its endogenous locus represents an alternative to gene therapy protocols based on viral vectors with their risk of insertional mutagenesis. When solely a single-stranded oligodeoxynucleotide (ssODN) is used as a repair matrix, the efficiency of the targeted gene correction is low. However, as shown with the homing endonuclease I-SceI, ssODN-mediated gene correction can be enhanced by concomitantly inducing a DNA double-strand break (DSB) close to the mutation. Because I-SceI is hardly adjustable to cut at any desired position in the human genome, here, customizable zinc-finger nucleases (ZFNs) were used to stimulate ssODN-mediated repair of a mutated single-copy reporter locus stably integrated into human embryonic kidney-293 cells. The ZFNs induced faithful gene repair at a frequency of 0.16%. Six times more often, ZFN-induced DSBs were found to be modified by unfaithful addition of ssODN between the termini and about 60 times more often by nonhomologous end joining-related deletions and insertions. Additionally, ZFN off-target activity based on binding mismatch sites at the locus of interest was detected in in vitro cleavage assays and also in chromosomal DNA isolated from treated cells. Therefore, the specificity of ZFN-induced ssODN-mediated gene repair needs to be improved, especially regarding clinical applications. PMID:20068556

Bioconjugation of Oligodeoxynucleotides Carrying 1,4-Dicarbonyl Groups via Reductive Amination with Lysine Residues.

PubMed

Yang, Bo; Jinnouchi, Akiko; Usui, Kazuteru; Katayama, Tsutomu; Fujii, Masayuki; Suemune, Hiroshi; Aso, Mariko

2015-08-19

We evaluated the efficacy of bioconjugation of oligodeoxynucleotides (ODNs) containing 1,4-dicarbonyl groups, a C4'-oxidized abasic site (OAS), and a newly designed 2'-methoxy analogue, via reductive amination with lysine residues. Dicarbonyls, aldehyde and ketone at C1- and C4-positions of deoxyribose in the ring-opened form of OAS allowed efficient reaction with amines. Kinetic studies indicated that reductive amination of OAS-containing ODNs with a proximal amine on the complementary strand proceeded 10 times faster than the corresponding reaction of an ODN containing an abasic site with C1-aldehyde. Efficient reductive amination between the DNA-binding domain of Escherichia coli DnaA protein and ODNs carrying OAS in the DnaA-binding sequence proceeded at the lysine residue in proximity to the phosphate group at the 5'-position of the OAS, in contrast to unsuccessful conjugation with abasic site ODNs, even though they have similar aldehydes. Theoretical calculation indicated that the C1-aldehyde of OAS was more accessible to the target lysine than that of the abasic site. These results demonstrate the potential utility of cross-linking strategies that use dicarbonyl-containing ODNs for the study of protein-nucleic acid interactions. Conjugation with a lysine-containing peptide that lacked specific affinity for ODN was also successful, further highlighting the advantages of 1,4-dicarbonyls.

RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification.

PubMed

Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang; Li, Jinghong

2017-08-01

RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5'-ASO could block RNA splicing by inhibiting the first step, while 3'-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs.

Orthopaedic wear particle-induced bone loss and exogenous macrophage infiltration is mitigated by local infusion of NF-κB decoy oligodeoxynucleotide.

PubMed

Lin, Tzuhua; Pajarinen, Jukka; Nabeshima, Akira; Córdova, Luis A; Loi, Florence; Gibon, Emmanuel; Lu, Laura; Nathan, Karthik; Jämsen, Eemeli; Yao, Zhenyu; Goodman, Stuart B

2017-11-01

Excessive production of wear particles from total joint replacements induces chronic inflammation, macrophage infiltration, and consequent bone loss (periprosthetic osteolysis). This inflammation and bone remodeling are critically regulated by the transcription factor NF-κB. We previously demonstrated that inhibition of NF-κB signaling by using the decoy oligodeoxynucleotide (ODN) mitigates polyethylene wear particle-induced bone loss using in vitro and in vivo models. However, the mechanisms of NF-κB decoy ODN action, and in particular its impact on systemic macrophage recruitment, remain unknown. In the current study, this systemic macrophage infiltration was examined in our established murine femoral continuous particle infusion model. RAW264.7 murine macrophages expressing a luciferase reporter gene were injected into the systemic circulation. Quantification of bioluminescence showed that NF-κB decoy ODN reduced the homing of these reporter macrophages into the distal femurs exposed to continuous particle delivery. Particle-induced reduction in bone mineral density at the distal diaphysis of the femur was also mitigated by infusion of decoy ODN. Histological staining showed that the decoy ODN infusion decreased osteoclast and macrophage numbers, but had no significant effects on osteoblasts. Local infusion of NF-κB decoy ODN reduced systemic macrophage infiltration and mitigated particle-induced bone loss, thus providing a potential strategy to treat periprosthetic osteolysis. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 3169-3175, 2017. © 2017 Wiley Periodicals, Inc.

The excludon: a new concept in bacterial antisense RNA-mediated gene regulation.

PubMed

Sesto, Nina; Wurtzel, Omri; Archambaud, Cristel; Sorek, Rotem; Cossart, Pascale

2013-02-01

In recent years, non-coding RNAs have emerged as key regulators of gene expression. Among these RNAs, the antisense RNAs (asRNAs) are particularly abundant, but in most cases the function and mechanism of action for a particular asRNA remains elusive. Here, we highlight a recently discovered paradigm termed the excludon, which defines a genomic locus encoding an unusually long asRNA that spans divergent genes or operons with related or opposing functions. Because these asRNAs can inhibit the expression of one operon while functioning as an mRNA for the adjacent operon, they act as fine-tuning regulatory switches in bacteria.

Cross-species comparison of in vivo PK/PD relationships for second-generation antisense oligonucleotides targeting apolipoprotein B-100.

PubMed

Yu, Rosie Z; Lemonidis, Kristina M; Graham, Mark J; Matson, John E; Crooke, Rosanne M; Tribble, Diane L; Wedel, Mark K; Levin, Arthur A; Geary, Richard S

2009-03-01

The in vivo pharmacokinetics/pharmacodynamics of 2'-O-(2-methoxyethyl) (2'-MOE) modified antisense oligonucleotides (ASOs), targeting apolipoprotein B-100 (apoB-100), were characterized in multiple species. The species-specific apoB antisense inhibitors demonstrated target apoB mRNA reduction in a drug concentration and time-dependent fashion in mice, monkeys, and humans. Consistent with the concentration-dependent decreases in liver apoB mRNA, reductions in serum apoB, and LDL-C, and total cholesterol were concurrently observed in animal models and humans. Additionally, the long duration of effect after cessation of dosing correlated well with the elimination half-life of 2'-MOE modified apoB ASOs studied in mice (t(1/2) congruent with 20 days) and humans (t(1/2) congruent with 30 days) following parental administrations. The plasma concentrations of ISIS 301012, observed in the terminal elimination phase of both mice and monkeys were in equilibrium with liver. The partition ratios between liver and plasma were similar, approximately 6000:1, across species, and thus provide a surrogate for tissue exposure in humans. Using an inhibitory E(max) model, the ASO liver EC(50s) were 101+/-32, 119+/-15, and 300+/-191 microg/g of ASO in high-fat-fed (HF) mice, transgenic mice containing the human apoB transgene, and monkeys, respectively. The estimated liver EC(50) in man, extrapolated from trough plasma exposure, was 81+/-122 microg/g. Therefore, extraordinary consistency of the exposure-response relationship for the apoB antisense inhibitor was observed across species, including human. The cross-species PK/PD relationships provide confidence in the use of pharmacology animal models to predict human dosing for second-generation ASOs targeting the liver.

Targeting DMPK with Antisense Oligonucleotide Improves Muscle Strength in Myotonic Dystrophy Type 1 Mice.

PubMed

Jauvin, Dominic; Chrétien, Jessina; Pandey, Sanjay K; Martineau, Laurie; Revillod, Lucille; Bassez, Guillaume; Lachon, Aline; MacLeod, A Robert; Gourdon, Geneviève; Wheeler, Thurman M; Thornton, Charles A; Bennett, C Frank; Puymirat, Jack

2017-06-16

Myotonic dystrophy type 1 (DM1), a dominant hereditary muscular dystrophy, is caused by an abnormal expansion of a (CTG) n trinucleotide repeat in the 3' UTR of the human dystrophia myotonica protein kinase (DMPK) gene. As a consequence, mutant transcripts containing expanded CUG repeats are retained in nuclear foci and alter the function of splicing regulatory factors members of the MBNL and CELF families, resulting in alternative splicing misregulation of specific transcripts in affected DM1 tissues. In the present study, we treated DMSXL mice systemically with a 2'-4'-constrained, ethyl-modified (ISIS 486178) antisense oligonucleotide (ASO) targeted to the 3' UTR of the DMPK gene, which led to a 70% reduction in CUG exp RNA abundance and foci in different skeletal muscles and a 30% reduction in the heart. Furthermore, treatment with ISIS 486178 ASO improved body weight, muscle strength, and muscle histology, whereas no overt toxicity was detected. This is evidence that the reduction of CUG exp RNA improves muscle strength in DM1, suggesting that muscle weakness in DM1 patients may be improved following elimination of toxic RNAs. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Improved strategies for postoligomerization synthesis of oligodeoxynucleotides bearing structurally defined adducts at the N2 position of deoxyguanosine.

PubMed

DeCorte, B L; Tsarouhtsis, D; Kuchimanchi, S; Cooper, M D; Horton, P; Harris, C M; Harris, T M

1996-01-01

Improved methodology has been developed for preparation of oligodeoxynucleotides bearing adducts on the N2 position of guanine in which the adduction reaction is carried out in homogeneous solution rather than while the oligonucleotide is immobilized on a solid matrix. The methodology utilizes a new synthon, 2-fluoro-O6-(trimethylsilylethyl)-2'-deoxyinosine (3). Nucleoside 3 is stable to the conditions of oligonucleotide synthesis, but the O6 protection is eliminated under very mild conditions following displacement of the 2-fluoro group by amine nucleophiles. Oligonucleotides containing 3 could be removed from the solid support by treatment with 0.1 M NaOH (8 h, rt) without disruption of 3. Reaction of the crude, partially deprotected oligonucleotide with (R)-2-amino-2-phenylethanol in homogeneous solution, followed by removal of the remaining protective groups with NH4OH (60 degrees C, 8 h) and then 0.1% acetic acid, gave the adducted oligonucleotide in good purity and yield. Alternatively, fully deprotected oligonucleotide containing 3 could be prepared by use of labile phenoxyacetyl-type protecting groups on the exocyclic amino groups.

Intravenous administration of stabilized antisense lipid particles (SALP) leads to activation and expansion of liver natural killer cells.

PubMed

Bramson, J L; Bodner, C A; Johnson, J; Semple, S; Hope, M J

2000-06-01

Stabilized antisense lipid particles (SALP) have been developed for the systemic delivery of oligonucleotides. The impact of intravenous SALP administration was measured with respect to activation of natural killer (NK) and NK1.1+ T (NKT) cells in the livers of immunocompetent mice. Treatment with a SALP containing a highly mitogenic oligonucleotide (INX-6295) generated an increase in NK cytolytic activity and cell number within the liver but did not appear to affect the number of hepatic NKT cells or their cytolytic activity. The same results were observed after intravenous administration of the mitogenic oligonucleotide alone. Interestingly, treatment with a SALP containing a weakly mitogenic oligonucleotide (INX-6300) also activated the liver NK cells, whereas the oligonucleotide alone was unable to elicit these effects. The NK stimulatory activity of a SALP containing INX-6300 required both lipid and oligonucleotide components. These results demonstrate that in addition to modifying the pharmacokinetics and biodistribution of intravenously administered oligonucleotides, SALP possess immunostimulatory activity independent of oligonucleotide mitogenicity, which can serve as an adjuvant to antisense therapies for cancer.

Control of enzymatic browning in potato (Solanum tuberosum L.) by sense and antisense RNA from tomato polyphenol oxidase.

PubMed

Coetzer, C; Corsini, D; Love, S; Pavek, J; Tumer, N

2001-02-01

Polyphenol oxidase (PPO) activity of Russet Burbank potato was inhibited by sense and antisense PPO RNAs expressed from a tomato PPO cDNA under the control of the 35S promoter from the cauliflower mosaic virus. Transgenic Russet Burbank potato plants from 37 different lines were grown in the field. PPO activity and the level of enzymatic browning were measured in the tubers harvested from the field. Of the tubers from 28 transgenic lines that were sampled, tubers from 5 lines exhibited reduced browning. The level of PPO activity correlated with the reduction in enzymatic browning in these lines. These results indicate that expression of tomato PPO RNA in sense or antisense orientation inhibits PPO activity and enzymatic browning in the major commercial potato cultivar. Expression of tomato PPO RNA in sense orientation led to the greatest decrease in PPO activity and enzymatic browning, possibly due to cosuppression. These results suggest that expression of closely related heterologous genes can be used to prevent enzymatic browning in a wide variety of food crops without the application of various food additives.

Knockdown of connexin43-mediated regulation of the zone of polarizing activity in the developing chick limb leads to digit truncation.

PubMed

Law, Lee Yong; Lin, Jun Sheng; Becker, David L; Green, Colin R

2002-12-01

In the developing chick wing, the use of antisense oligodeoxynucleotides to transiently knock down the expression of the gap junction protein, connexin43 (Cx43), results in limb patterning defects, including deletion of the anterior digits. To understand more about how such defects arise, the effects of transient Cx43 knockdown on the expression patterns of several genes known to play pivotal roles in limb formation were examined. Sonic hedgehog (Shh), which is normally expressed in the zone of polarizing activity (ZPA) and is required to maintain both the ZPA and the apical ectodermal ridge (AER), was found to be downregulated in treated limbs within 30 h. Bone morphogenetic protein-2 (Bmp-2), a gene downstream of Shh, was similarly downregulated. Fibroblast growth factor-8 expression, however, was unaltered 30 h after treatment but was greatly reduced at 48 h post-treatment, when the AER begins to regress. Expressions of Bmp-4 and Muscle segment homeobox-like gene (Msx-1) were not affected at any of the time points examined. Cx43 expression is therefore involved in some, but not all patterning cascades, and appears to play a role in the regulation of ZPA activity.

Active coping of prenatally stressed rats in the forced swimming test: involvement of the Nurr1 gene.

PubMed

Montes, Pedro; Ruiz-Sánchez, Elizabeth; Calvillo, Minerva; Rojas, Patricia

2016-09-01

Depending on genetic predisposition, prenatal stress may result in vulnerability or resilience to develop psychiatric disorders in adulthood. Nurr1 is an immediate early gene, important in the brain for the stress response. We tested the hypothesis that prenatal stress and the decrease of hippocampal Nurr1 alter offspring behavioral responses in the forced swimming test (FST). Pregnant Wistar rats were exposed to restraint stress (45 min, thrice daily) from gestation day 14. Prenatally stressed (PS) and non-prenatally stressed (NPS) male offspring were treated bilaterally with a Nurr1 antisense oligodeoxynucleotide (ODN; or control) into the hippocampus at 97 d of age. After 1 h, the rats were exposed to the FST (acute stressor) to analyze their behavioral responses. Thirty minutes after the FST, we analyzed the gene expression of Nurr1, Bdnf and Nr3c1 (genes for Nurr1, brain-derived neurotrophic factor (BDNF) and glucocorticoid receptor (GR), respectively) in the hippocampus, prefrontal cortex (PFC) and hypothalamus. Results showed that the decrease of hippocampal Nurr1 after the antisense ODN in adult NPS rats induces immobility (indicating depressive-like behavior). The PS adult rats, including the group with decreased hippocampal Nurr1, presented low immobility in the FST. This low immobility was concordant with maintenance of Nurr1 and Bdnf expression levels in the three analyzed brain regions; Nr3c1 gene expression was also maintained in the PFC and hypothalamus. These findings suggest that Nurr1 and associated genes could participate in the brain modifications induced by prenatal stress, allowing active coping (resilience) with acute stress in adulthood.

Current status of antisense RNA-mediated gene regulation in Listeria monocytogenes.

PubMed

Schultze, Tilman; Izar, Benjamin; Qing, Xiaoxing; Mannala, Gopala K; Hain, Torsten

2014-01-01

Listeria monocytogenes is a Gram-positive human-pathogen bacterium that served as an experimental model for investigating fundamental processes of adaptive immunity and virulence. Recent novel technologies allowed the identification of several hundred non-coding RNAs (ncRNAs) in the Listeria genome and provided insight into an unexpected complex transcriptional machinery. In this review, we discuss ncRNAs that are encoded on the opposite strand of the target gene and are therefore termed antisense RNAs (asRNAs). We highlight mechanistic and functional concepts of asRNAs in L. monocytogenes and put these in context of asRNAs in other bacteria. Understanding asRNAs will further broaden our knowledge of RNA-mediated gene regulation and may provide targets for diagnostic and antimicrobial development.

Antisense Morpholino Oligonucleotides Reduce Neurofilament Synthesis and Inhibit Axon Regeneration in Lamprey Reticulospinal Neurons.

PubMed

Zhang, Guixin; Jin, Li-qing; Hu, Jianli; Rodemer, William; Selzer, Michael E

2015-01-01

The sea lamprey has been used as a model for the study of axonal regeneration after spinal cord injury. Previous studies have suggested that, unlike developing axons in mammal, the tips of regenerating axons in lamprey spinal cord are simple in shape, packed with neurofilaments (NFs), and contain very little F-actin. Thus it has been proposed that regeneration of axons in the central nervous system of mature vertebrates is not based on the canonical actin-dependent pulling mechanism of growth cones, but involves an internal protrusive force, perhaps generated by the transport or assembly of NFs in the distal axon. In order to assess this hypothesis, expression of NFs was manipulated by antisense morpholino oligonucleotides (MO). A standard, company-supplied MO was used as control. Axon retraction and regeneration were assessed at 2, 4 and 9 weeks after MOs were applied to a spinal cord transection (TX) site. Antisense MO inhibited NF180 expression compared to control MO. The effect of inhibiting NF expression on axon retraction and regeneration was studied by measuring the distance of axon tips from the TX site at 2 and 4 weeks post-TX, and counting the number of reticulospinal neurons (RNs) retrogradely labeled by fluorescently-tagged dextran injected caudal to the injury at 9 weeks post-TX. There was no statistically significant effect of MO on axon retraction at 2 weeks post-TX. However, at both 4 and 9 weeks post-TX, inhibition of NF expression inhibited axon regeneration.

Antisense oligonucleotide therapeutics for iron-sulphur cluster deficiency myopathy.

PubMed

Kollberg, Gittan; Holme, Elisabeth

2009-12-01

Iron-sulphur cluster deficiency myopathy is caused by a deep intronic mutation in ISCU resulting in inclusion of a cryptic exon in the mature mRNA. ISCU encodes the iron-sulphur cluster assembly protein IscU. Iron-sulphur clusters are essential for most basic redox transformations including the respiratory-chain function. Most patients are homozygous for the mutation with a phenotype characterized by a non-progressive myopathy with childhood onset of early fatigue, dyspnoea and palpitation on trivial exercise. A more severe phenotype with early onset of a slowly progressive severe muscle weakness, severe exercise intolerance and cardiomyopathy is caused by a missense mutation in compound with the intronic mutation. Treatment of cultured fibroblasts derived from three homozygous patients with an antisense phosphorodiamidate morpholino oligonucleotide for 48 h resulted in 100% restoration of the normal splicing pattern. The restoration was stable and after 21 days the correctly spliced mRNA still was the dominating RNA species.

Antisense GLUT-1 protects mesangial cells from glucose induction of GLUT-1 and fibronectin expression.

PubMed

Heilig, C W; Kreisberg, J I; Freytag, S; Murakami, T; Ebina, Y; Guo, L; Heilig, K; Loberg, R; Qu, X; Jin, Y; Henry, D; Brosius, F C

2001-04-01

A stable clone of rat mesangial cells expressing antisense GLUT-1 (i.e., MCGT1AS cells) was developed to protect them from high glucose exposure. GLUT-1 protein was reduced 50%, and the 2-deoxy-[(3)H]glucose uptake rate was reduced 33% in MCGT1AS. MCLacZ control cells and MCGT1 GLUT-1-overexpressing cells were used for comparisons. In MCLacZ, 20 mM D-glucose increased GLUT-1 transcription 90% vs. no increase in MCGT1AS. Glucose (8 mM) and 12 mM xylitol [a hexose monophosphate (HMP) shunt substrate] did not stimulate GLUT-1 transcription. An 87% replacement of the standard 8 mM D-glucose with 3-O-methylglucose reduced GLUT-1 transcription 80%. D-Glucose (20 mM) increased fibronectin mRNA and protein by 47 and 100%, respectively, in MCLacZ vs. no increases in MCGT1AS. Fibronectin synthesis was elevated 48% in MCGT1 and reduced 44% in MCGT1AS. We conclude that 1) transcription of GLUT-1 in response to D-glucose depends on glucose metabolism, although not through the HMP shunt, and 2) antisense GLUT-1 treatment of mesangial cells blocks D-glucose-induced GLUT-1 and fibronectin expression, thereby demonstrating a protective effect that could be beneficial in the setting of diabetes.

Antisense RNAs transcribed from the upstream region of the precore/core promoter of hepatitis B virus.

PubMed

Moriyama, Kosei; Hayashida, Kazuhiro; Shimada, Mitsuo; Nakano, Shuji; Nakashima, Yoshiyuki; Fukumaki, Yasuyuki

2003-07-01

The bidirectional activity of the precore/core promoter of hepatitis B virus (HBV) has been demonstrated in cultured cell lines. However, HBV antisense transcripts (asRNAs) have not been demonstrated in vivo. In the present study using liver tissue from patients with chronic hepatitis, an anchored 5'RACE mapping the 5' ends at position 1680/1681, 1655 or 1609/1602 was carried out. In limited cases, RLM-3'RACE detected asRNAs to terminate at four or five consecutive dT residues in the 0.7 kb downstream region. PCR of oligo(dT)-primed cDNA did not amplify a typical polyadenylated asRNA. RT-PCR using various primers did not detect any spliced forms. Competitive RT-PCR estimated the copy numbers of the asRNAs to be 0.05-0.4 % of total sense RNAs. All sequenced asRNAs had ORF6 but, in one patient, the asRNA initiating at position 1680/1681 had additional initiation and termination codons in front of ORF6. Therefore, asRNAs are transcribed by RNA polymerase III at a low level, encompass a dispensable ORF6 gene and might be retained in the nucleus. The endogenous asRNAs complementary to the common ends of all sense RNAs suggest antisense-mediated self-regulation of hepadnavirus.

Antisense oligonucleotide–mediated MDM4 exon 6 skipping impairs tumor growth

PubMed Central

Dewaele, Michael; Tabaglio, Tommaso; Willekens, Karen; Bezzi, Marco; Teo, Shun Xie; Low, Diana H.P.; Koh, Cheryl M.; Rambow, Florian; Fiers, Mark; Rogiers, Aljosja; Radaelli, Enrico; Al-Haddawi, Muthafar; Tan, Soo Yong; Hermans, Els; Amant, Frederic; Yan, Hualong; Lakshmanan, Manikandan; Koumar, Ratnacaram Chandrahas; Lim, Soon Thye; Derheimer, Frederick A.; Campbell, Robert M.; Bonday, Zahid; Tergaonkar, Vinay; Shackleton, Mark; Blattner, Christine; Marine, Jean-Christophe; Guccione, Ernesto

2015-01-01

MDM4 is a promising target for cancer therapy, as it is undetectable in most normal adult tissues but often upregulated in cancer cells to dampen p53 tumor-suppressor function. The mechanisms that underlie MDM4 upregulation in cancer cells are largely unknown. Here, we have shown that this key oncogenic event mainly depends on a specific alternative splicing switch. We determined that while a nonsense-mediated, decay-targeted isoform of MDM4 (MDM4-S) is produced in normal adult tissues as a result of exon 6 skipping, enhanced exon 6 inclusion leads to expression of full-length MDM4 in a large number of human cancers. Although this alternative splicing event is likely regulated by multiple splicing factors, we identified the SRSF3 oncoprotein as a key enhancer of exon 6 inclusion. In multiple human melanoma cell lines and in melanoma patient–derived xenograft (PDX) mouse models, antisense oligonucleotide–mediated (ASO-mediated) skipping of exon 6 decreased MDM4 abundance, inhibited melanoma growth, and enhanced sensitivity to MAPK-targeting therapeutics. Additionally, ASO-based MDM4 targeting reduced diffuse large B cell lymphoma PDX growth. As full-length MDM4 is enhanced in multiple human tumors, our data indicate that this strategy is applicable to a wide range of tumor types. We conclude that enhanced MDM4 exon 6 inclusion is a common oncogenic event and has potential as a clinically compatible therapeutic target. PMID:26595814

A guanidine-rich regulatory oligodeoxynucleotide improves type-2 diabetes in obese mice by blocking T-cell differentiation

PubMed Central

Cheng, Xiang; Wang, Jing; Xia, Ni; Yan, Xin-Xin; Tang, Ting-Ting; Chen, Han; Zhang, Hong-Jian; Liu, Juan; Kong, Wen; Sjöberg, Sara; Folco, Eduardo; Libby, Peter; Liao, Yu-Hua; Shi, Guo-Ping

2012-01-01

T lymphocytes exhibit pro-inflammatory or anti-inflammatory activities in obesity and diabetes, depending on their subtypes. Guanidine-rich immunosuppressive oligodeoxynucleotides (ODNs) effectively control Th1/Th2-cell counterbalance. This study reveals a non-toxic regulatory ODN (ODNR01) that inhibits Th1- and Th17-cell polarization by binding to STAT1/3/4 and blocking their phosphorylation without affecting Th2 and regulatory T cells. ODNR01 improves glucose tolerance and insulin sensitivity in both diet-induced obese (DIO) and genetically generated obese (ob/ob) mice. Mechanistic studies show that ODNR01 suppresses Th1- and Th17-cell differentiation in white adipose tissue, thereby reducing macrophage accumulation and M1 macrophage inflammatory molecule expression without affecting M2 macrophages. While ODNR01 shows no effect on diabetes in lymphocyte-free Rag1-deficient DIO mice, it enhances glucose tolerance and insulin sensitivity in CD4+ T-cell-reconstituted Rag1-deficient DIO mice, suggesting its beneficial effect on insulin resistance is T-cell-dependent. Therefore, regulatory ODNR01 reduces obesity-associated insulin resistance through modulation of T-cell differentiation. PMID:23027613

CpG-B Oligodeoxynucleotides Inhibit TLR-Dependent and -Independent Induction of Type I IFN in Dendritic Cells

PubMed Central

Liu, Yi C.; Gray, Reginald C.; Hardy, Gareth A. D.; Kuchtey, John; Abbott, Derek W.; Emancipator, Steven N.; Harding, Clifford V.

2010-01-01

CpG oligodeoxynucleotides (ODNs) signal through TLR9 to induce type I IFN (IFN-αβ) in dendritic cells (DCs). CpG-A ODNs are more efficacious than CpG-B ODNs for induction of IFN-αβ. Because IFN-αβ may contribute to autoimmunity, it is important to identify mechanisms to inhibit induction of IFN-αβ. In our studies, CpG-B ODN inhibited induction of IFN-αβ by CpG-A ODN, whereas induction of TNF-α and IL-12p40 by CpG-A ODN was not affected. CpG-B inhibition of IFN-αβ was observed in FLT3 ligand-induced murine DCs, purified murine myeloid DCs, plasmacytoid DCs, and human PBMCs. CpG-B ODN inhibited induction of IFN-αβ by agonists of multiple receptors, including MyD88-dependent TLRs (CpG-AODN signaling via TLR9, or R837 or Sendai virus signaling via TLR7) and MyD88-independent receptors (polyinosinic:polycytidylic acid signaling via TLR3 or ds break-DNA signaling via a cytosolic pathway). CpG-B ODN did not inhibit the IFN-αβ positive feedback loop second-wave IFN-αβ, because IFN-αβ–induced expression of IFN-αβ was unaffected, and CpG-B inhibition of IFN-αβ was manifested in IFN-αβR−/− DCs, which lack the positive feedback mechanism. Rather, CpG-B ODN inhibited early TLR-induced first wave IFN-α4 and IFN-β. Chromatin immunoprecipitation revealed that association of IFN regulatory factor 1 with the IFN-α4 and IFN-β promoters was induced by CpG-A ODN but not CpG-B ODN. Moreover, CpG-A–induced association of IFN regulatory factor 1 with these promoters was inhibited by CpG-B ODN. Our studies demonstrate a novel mechanism of transcriptional regulation of first-wave IFN-αβ that selectively inhibits induction of IFN-αβ downstream of multiple receptors and may provide targets for future therapeutic inhibition of IFN-αβ expression in vivo. PMID:20181884

Antagonism of immunostimulatory CpG-oligodeoxynucleotides by quinacrine, chloroquine, and structurally related compounds.

PubMed

Macfarlane, D E; Manzel, L

1998-02-01

Phosphorothioate oligodeoxynucleotides containing CpG (CpG-ODN) activate immune responses. We report that quinacrine, chloroquine, and structurally related compounds completely inhibit the antiapoptotic effect of CpG-ODN on WEHI 231 murine B lymphoma cells and inhibit CpG-ODN-induced secretion of IL-6 by WEHI 231. They also inhibit IL-6 synthesis and thymidine uptake by human unfractionated PBMC induced by CpG-ODN. The compounds did not inhibit LPS-induced responses. Half-maximal inhibition required 10 nM quinacrine or 100 nM chloroquine. Inhibition was noncompetitive with respect to CpG-ODN. Quinine, quinidine, and primaquine were much less powerful. Quinacrine was effective even when added after the CpG-ODN. Near-toxic concentrations of ammonia plus bafilomycin A1 (used to inhibit vesicular acidification) did not reduce the efficacy of the quinacrine, but the effects of both quinacrine and chloroquine were enhanced by inhibition of the multidrug resistance efflux pump by verapamil. Agents that bind to DNA, including propidium iodide, Hoechst dye 33258, and coralyne chloride did not inhibit CpG-ODN effect, nor did 4-bromophenacyl bromide, an inhibitor of phospholipase A2. Examination of the structure-activity relationship of seventy 4-aminoquinoline and 9-aminoacridine analogues reveals that increased activity was conferred by bulky hydrophobic substituents on positions 2 and 6 of the quinoline nucleus. No correlation was found between published antimalarial activity and ability to block CpG-ODN-induced effects. These results are discussed in the light of the ability of quinacrine and chloroquine to induce remission of rheumatoid arthritis and lupus erythematosus.

Biodegradable polymer nanocarriers for therapeutic antisense microRNA delivery in living animals

NASA Astrophysics Data System (ADS)

Paulmurugan, Ramasamy; Sekar, Narayana M.; Sekar, Thillai V.

2012-03-01

MicroRNAs are endogenous regulators of gene expression, deregulated in several cellular diseases including cancer. Altering the cellular microenvironment by modulating the microRNAs functions can regulate different genes involved in major cellular processes, and this approach is now being investigated as a promising new generation of molecularly targeted anti-cancer therapies. AntagomiRs (Antisense-miRNAs) are a novel class of chemically modified stable oligonucleotides used for blocking the functions of endogenous microRNAs, which are overexpressed. A key challenge in achieving effective microRNAbased therapeutics lies in the development of an efficient delivery system capable of specifically delivering antisense oligonucleotides and target cancer cells in living animals. We are now developing an effective delivery system designed to selectively deliver antagomiR- 21 and antagomiR-10b to triple negative breast cancer cells, and to revert tumor cell metastasis and invasiveness. The FDA-approved biodegradable PLGA-nanoparticles were selected as a carrier for antagomiRs delivery. Chemically modified antagomiRs (antagomiR-21 and antagomiR-10b) were co-encapsulated in PEGylated-PLGA-nanoparticles by using the double-emulsification (W/O/W) solvent evaporation method, and the resulting average particle size of 150-200nm was used for different in vitro and in vivo experiments. The antagomiR encapsulated PLGA-nanoparticles were evaluated for their in vitro antagomiRs delivery, intracellular release profile, and antagomiRs functional effects, by measuring the endogenous cellular targets, and the cell growth and metastasis. The xenografts of tumor cells in living mice were used for evaluating the anti-metastatic and anti-invasive properties of cells. The results showed that the use of PLGA for antagomiR delivery is not only efficient in crossing cell membrane, but can also maintain functional intracellular antagomiRs level for a extended period of time and achieve

PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice.

PubMed

Zinker, Bradley A; Rondinone, Cristina M; Trevillyan, James M; Gum, Rebecca J; Clampit, Jill E; Waring, Jeffrey F; Xie, Nancy; Wilcox, Denise; Jacobson, Peer; Frost, Leigh; Kroeger, Paul E; Reilly, Regina M; Koterski, Sandra; Opgenorth, Terry J; Ulrich, Roger G; Crosby, Seth; Butler, Madeline; Murray, Susan F; McKay, Robert A; Bhanot, Sanjay; Monia, Brett P; Jirousek, Michael R

2002-08-20

The role of protein-tyrosine phosphatase 1B (PTP1B) in diabetes was investigated using an antisense oligonucleotide in ob/ob and db/db mice. PTP1B antisense oligonucleotide treatment normalized plasma glucose levels, postprandial glucose excursion, and HbA(1C). Hyperinsulinemia was also reduced with improved insulin sensitivity. PTP1B protein and mRNA were reduced in liver and fat with no effect in skeletal muscle. Insulin signaling proteins, insulin receptor substrate 2 and phosphatidylinositol 3 (PI3)-kinase regulatory subunit p50alpha, were increased and PI3-kinase p85alpha expression was decreased in liver and fat. These changes in protein expression correlated with increased insulin-stimulated protein kinase B phosphorylation. The expression of liver gluconeogenic enzymes, phosphoenolpyruvate carboxykinase, and fructose-1,6-bisphosphatase was also down-regulated. These findings suggest that PTP1B modulates insulin signaling in liver and fat, and that therapeutic modalities targeting PTP1B inhibition may have clinical benefit in type 2 diabetes.

Chimeric Antisense Oligonucleotide Conjugated to α-Tocopherol

PubMed Central

Nishina, Tomoko; Numata, Junna; Nishina, Kazutaka; Yoshida-Tanaka, Kie; Nitta, Keiko; Piao, Wenying; Iwata, Rintaro; Ito, Shingo; Kuwahara, Hiroya; Wada, Takeshi; Mizusawa, Hidehiro; Yokota, Takanori

2015-01-01

We developed an efficient system for delivering short interfering RNA (siRNA) to the liver by using α-tocopherol conjugation. The α-tocopherol–conjugated siRNA was effective and safe for RNA interference–mediated gene silencing in vivo. In contrast, when the 13-mer LNA (locked nucleic acid)-DNA gapmer antisense oligonucleotide (ASO) was directly conjugated with α-tocopherol it showed markedly reduced silencing activity in mouse liver. Here, therefore, we tried to extend the 5′-end of the ASO sequence by using 5′-α-tocopherol–conjugated 4- to 7-mers of unlocked nucleic acid (UNA) as a “second wing.” Intravenous injection of mice with this α-tocopherol–conjugated chimeric ASO achieved more potent silencing than ASO alone in the liver, suggesting increased delivery of the ASO to the liver. Within the cells, the UNA wing was cleaved or degraded and α-tocopherol was released from the 13-mer gapmer ASO, resulting in activation of the gapmer. The α-tocopherol–conjugated chimeric ASO showed high efficacy, with hepatic tropism, and was effective and safe for gene silencing in vivo. We have thus identified a new, effective LNA-DNA gapmer structure in which drug delivery system (DDS) molecules are bound to ASO with UNA sequences. PMID:25584900

Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

NASA Astrophysics Data System (ADS)

Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

1996-06-01

cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

Antisense Suppression of the Small Chloroplast Protein CP12 in Tobacco Alters Carbon Partitioning and Severely Restricts Growth1[W

PubMed Central

Howard, Thomas P.; Fryer, Michael J.; Singh, Prashant; Metodiev, Metodi; Lytovchenko, Anna; Obata, Toshihiro; Fernie, Alisdair R.; Kruger, Nicholas J.; Quick, W. Paul; Lloyd, Julie C.; Raines, Christine A.

2011-01-01

The thioredoxin-regulated chloroplast protein CP12 forms a multienzyme complex with the Calvin-Benson cycle enzymes phosphoribulokinase (PRK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). PRK and GAPDH are inactivated when present in this complex, a process shown in vitro to be dependent upon oxidized CP12. The importance of CP12 in vivo in higher plants, however, has not been investigated. Here, antisense suppression of CP12 in tobacco (Nicotiana tabacum) was observed to impact on NAD-induced PRK and GAPDH complex formation but had little effect on enzyme activity. Additionally, only minor changes in photosynthetic carbon fixation were observed. Despite this, antisense plants displayed changes in growth rates and morphology, including dwarfism and reduced apical dominance. The hypothesis that CP12 is essential to separate oxidative pentose phosphate pathway activity from Calvin-Benson cycle activity, as proposed in cyanobacteria, was tested. No evidence was found to support this role in tobacco. Evidence was seen, however, for a restriction to malate valve capacity, with decreases in NADP-malate dehydrogenase activity (but not protein levels) and pyridine nucleotide content. Antisense repression of CP12 also led to significant changes in carbon partitioning, with increased carbon allocation to the cell wall and the organic acids malate and fumarate and decreased allocation to starch and soluble carbohydrates. Severe decreases were also seen in 2-oxoglutarate content, a key indicator of cellular carbon sufficiency. The data presented here indicate that in tobacco, CP12 has a role in redox-mediated regulation of carbon partitioning from the chloroplast and provides strong in vivo evidence that CP12 is required for normal growth and development in plants. PMID:21865489

Expression of Antisense Long Noncoding RNAs as Potential Regulators in Rainbow Trout with Different Tolerance to Plant-Based Diets.

PubMed

Abernathy, Jason; Overturf, Ken

2018-01-04

Reformulation of aquafeeds in salmonid diets to include more plant proteins is critical for sustainable aquaculture. However, increasing plant proteins can lead to stunted growth and enteritis. Toward an understanding of the regulatory mechanisms behind plant protein utilization, directional RNA sequencing of liver tissues from a rainbow trout strain selected for growth on an all plant-protein diet and a control strain, both fed a plant diet for 12 weeks, were utilized to construct long noncoding RNAs. Antisense long noncoding RNAs were selected for differential expression and functional analyses since they have been shown to have regulatory actions within a genome. A total of 142 unique antisense long noncoding RNAs were differentially expressed between strains, 60 of which could be mapped to a gene. Genes underlying these noncoding RNAs are indicated in lipid metabolism and immunity. Six noncoding transcripts were also found to overlap with differentially expressed protein-coding genes, all of which were co-expressed. Associating variation in regulatory elements between rainbow trout strains with differing tolerance to plant-protein diets will assist in future studies toward increased gains throughout carnivorous aquaculture.

Secretion of prebeta HDL increases with the suppression of cholesteryl ester transfer protein in Hep G2 cells.

PubMed

Sawada, S; Sugano, M; Makino, N; Okamoto, H; Tsuchida, K

1999-10-01

Prebeta HDL are small, protein rich lipoproteins that are predominantly composed of apo A-I, without apo A-II. Prebeta HDL are secreted from the liver as nascent HDL and/or are produced in the incubated plasma by cholesteryl ester transfer protein (CETP). However, the role of CETP in the secretion of HDL from the liver has yet to be determined. In the present study, we examined the effect of the suppression of hepatic CETP by antisense oligodeoxynucleotides (ODNs) against CETP targeted to the liver on the secretion of apo A-I using a Hep G2 cell culture. The ODNs against CETP were coupled to asialoglycoprotein (ASOR) carrier molecules, which serve as an important method for the regulation of liver gene expression. Hep G2 cells were cultured in DMEM supplemented with 10 FBS. After 2 days, the medium was changed to DMEM with EGF and the cells were divided into three groups. The control group received saline, while the sense group was mixed with the sense ODNs complex and the antisense group was mixed with the antisense ODNs complex, respectively, for 2 days. Both the hepatic CETP mRNA and the CETP mass in the medium in the antisense group decreased significantly more than in the sense and the control groups (CETP mass: 1.697 + /- 0.410 ng/mg cell protein vs. 2.367 + /- 0.22 and 2.360 + /- 0.139, n = 3 in each determination). In contrast, both the hepatic apo A-I mRNA and the apo A-I mass in the medium in the antisense group were significantly higher than those in the sense and the control groups (apo A-I mass; 1.877 + /- 0.215 micro/mg cell protein vs. 1.213 + /- 0.282 and 1.097 + /- 0.144, n = 3 in each determination). The increase in apo A-I was mainly due to the increase in prebeta apo A-I. These findings may partly explain why HDL and apo A-I increase in patients with CETP deficiency, while also indicating the possibility that the original level of prebeta HDL is sufficient in such patients.

Specific RNP capture with antisense LNA/DNA mixmers

PubMed Central

Rogell, Birgit; Fischer, Bernd; Rettel, Mandy; Krijgsveld, Jeroen; Castello, Alfredo; Hentze, Matthias W.

2017-01-01

RNA-binding proteins (RBPs) play essential roles in RNA biology, responding to cellular and environmental stimuli to regulate gene expression. Important advances have helped to determine the (near) complete repertoires of cellular RBPs. However, identification of RBPs associated with specific transcripts remains a challenge. Here, we describe “specific ribonucleoprotein (RNP) capture,” a versatile method for the determination of the proteins bound to specific transcripts in vitro and in cellular systems. Specific RNP capture uses UV irradiation to covalently stabilize protein–RNA interactions taking place at “zero distance.” Proteins bound to the target RNA are captured by hybridization with antisense locked nucleic acid (LNA)/DNA oligonucleotides covalently coupled to a magnetic resin. After stringent washing, interacting proteins are identified by quantitative mass spectrometry. Applied to in vitro extracts, specific RNP capture identifies the RBPs bound to a reporter mRNA containing the Sex-lethal (Sxl) binding motifs, revealing that the Sxl homolog sister of Sex lethal (Ssx) displays similar binding preferences. This method also revealed the repertoire of RBPs binding to 18S or 28S rRNAs in HeLa cells, including previously unknown rRNA-binding proteins. PMID:28476952

Gene therapy of murine teratocarcinoma: separate functions for insulin-like growth factors I and II in immunogenicity and differentiation.

PubMed Central

Trojan, J; Johnson, T R; Rudin, S D; Blossey, B K; Kelley, K M; Shevelev, A; Abdul-Karim, F W; Anthony, D D; Tykocinski, M L; Ilan, J

1994-01-01

Teratocarcinoma is a germ-line carcinoma giving rise to an embryoid tumor with structures derived from the three embryonic layers: mesoderm, endoderm, and ectoderm. Teratocarcinoma is widely used as an in vitro model system to study regulation of cell determination and differentiation during mammalian embryogenesis. Murine embryonic carcinoma (EC) PCC3 cells express insulin-like growth factor I(IGF-I) and its receptor, while all derivative tumor structures express IGF-I and IGF-II and their receptors. Therefore the system lends itself to dissect the role of these two growth factors during EC differentiation. With an episomal antisense strategy, we define a role for IGF-I in tumorigenicity and evasion of immune surveillance. Antisense IGF-I EC transfectants are shown to elicit a curative anti-tumor immune response with tumor regression at distal sites. In contrast, IGF-II is shown to drive determination and differentiation in EC cells. Since IGF-I and IGF-II bind to type I receptor and antisense sequence used for IGF-II cannot form duplex with endogenous IGF-I transcripts, it follows that this receptor is not involved in determination and differentiation. Images PMID:8016120

Widespread anti-sense transcription in apple is correlated with siRNA production and indicates a large potential for transcriptional and/or post-transcriptional control.

PubMed

Celton, Jean-Marc; Gaillard, Sylvain; Bruneau, Maryline; Pelletier, Sandra; Aubourg, Sébastien; Martin-Magniette, Marie-Laure; Navarro, Lionel; Laurens, François; Renou, Jean-Pierre

2014-07-01

Characterizing the transcriptome of eukaryotic organisms is essential for studying gene regulation and its impact on phenotype. The realization that anti-sense (AS) and noncoding RNA transcription is pervasive in many genomes has emphasized our limited understanding of gene transcription and post-transcriptional regulation. Numerous mechanisms including convergent transcription, anti-correlated expression of sense and AS transcripts, and RNAi remain ill-defined. Here, we have combined microarray analysis and high-throughput sequencing of small RNAs (sRNAs) to unravel the complexity of transcriptional and potential post-transcriptional regulation in eight organs of apple (Malus × domestica). The percentage of AS transcript expression is higher than that identified in annual plants such as rice and Arabidopsis thaliana. Furthermore, we show that a majority of AS transcripts are transcribed beyond 3'UTR regions, and may cover a significant portion of the predicted sense transcripts. Finally we demonstrate at a genome-wide scale that anti-sense transcript expression is correlated with the presence of both short (21-23 nt) and long (> 30 nt) siRNAs, and that the sRNA coverage depth varies with the level of AS transcript expression. Our study provides a new insight on the functional role of anti-sense transcripts at the genome-wide level, and a new basis for the understanding of sRNA biogenesis in plants. © 2014 INRA. New Phytologist © 2014 New Phytologist Trust.

Antisense sequences of the nbl gene induce apoptosis in the human promyelocytic leukemia cell line HL-60.

PubMed

Naora, H; Nishida, T; Shindo, Y; Adachi, M; Naora, H

1998-04-01

Apoptosis is induced by the transcriptional inhibitor actinomycin D (Act D) in various cell types, particularly many leukemic cell lines such as HL-60. A common feature of these cell lines is their high constitutive expression level of the nbl gene, which was originally isolated by virtue of its abundance in a Namalwa Burkitt lymphoma cDNA library. In contrast, cell lines which constitutively express nbl at low levels appear not to undergo typical apoptotic death in response to Act D. Apoptotic induction by Act D in cells which normally express nbl at high levels was found in this study to be closely associated with a decline in nbl mRNA levels, raising the possibility that apoptosis could be induced by lowering nbl expression levels in such cells. Transient expression of nbl antisense sequences in HL-60 cells decreased cell viability, and induced typical apoptotic morphology such as cell shrinkage, chromatin condensation and nuclear fragmentation. Incubation with nbl antisense oligomers also induced similar features in HL-60 cells and in another high nb-expressing cell line, Jurkat, but had little effect in HepG2 cells which constitutively express nbl at low levels. These findings suggest that lowering constitutively high levels of nbl expression can induce apoptosis.

Divergently overlapping cis-encoded antisense RNA regulating toxin-antitoxin systems from E. coli: hok/sok, ldr/rdl, symE/symR.

PubMed

Kawano, Mitsuoki

2012-12-01

Toxin-antitoxin (TA) systems are categorized into three classes based on the type of antitoxin. In type I TA systems, the antitoxin is a small antisense RNA that inhibits translation of small toxic proteins by binding to the corresponding mRNAs. Those type I TA systems were originally identified as plasmid stabilization modules rendering a post-segregational killing (PSK) effect on the host cells. The type I TA loci also exist on the Escherichia coli chromosome but their biological functions are less clear. Genetic organization and regulatory elements of hok/sok and ldr/rdl families are very similar and the toxins are predicted to contain a transmembrane domain, but otherwise share no detectable sequence similarity. This review will give an overview of the type I TA modules of E. coli K-12, especially hok/sok, ldr/rdl and SOS-inducible symE/symR systems, which are regulated by divergently overlapping cis-encoded antisense RNAs.

Receptor-Mediated Uptake of Phosphorothioate Antisense Oligonucleotides in Different Cell Types of the Liver.

PubMed

Miller, Colton M; Tanowitz, Michael; Donner, Aaron J; Prakash, Thazha P; Swayze, Eric E; Harris, Edward N; Seth, Punit P

2018-06-01

Oligonucleotide therapeutics have emerged as a third distinct platform for drug discovery within the pharmaceutical industry. Five oligonucleotide-based drugs have been approved by the US FDA and over 100 oligonucleotides drugs are currently at different stages of human trials. Several of these oligonucleotide drugs are modified using the phosphorothioate (PS) backbone modification where one of the nonbridging oxygen atoms of the phosphodiester linkage is replaced with sulfur. In this review, we summarize our knowledge on receptor-mediated uptake of PS antisense oligonucleotides (ASOs) within different cell types of the liver-a privileged organ for the discovery of oligonucleotide-based therapeutics.

Effects of probiotics, probiotic DNA and the CpG oligodeoxynucleotides on ovalbumin-sensitized Brown-Norway rats via TLR9/NF-κB pathway.

PubMed

Zhong, Yan; Huang, Juan; Tang, Wenjing; Chen, Bing; Cai, Wei

2012-10-01

The aim of the study was to investigate the effect of living probiotics, probiotic DNA and the synthetic oligodeoxynucleotides containing CpG motifs (CpG-ODN) on both immune response and intestinal barrier function in ovalbumin-sensitized rat and the underlying mechanisms. Brown-Norway rats were orally sensitized with ovalbumin, and living probiotics, probiotic DNA extraction, synthetic CpG-ODN or non-CpG ODN control was administered. In the living probiotics, probiotic DNA and CpG-ODN groups, the allergic response was significantly inhibited, the Th1/Th2 cytokine balance was shifted away from Th2 side, the percentage of CD4(+) CD25(+high) Treg cells was increased, and the intestinal barrier function was improved. The levels of toll-like receptor (TLR) 9 mRNA and nuclear factor (NF)-κB activity, as well as the IκB-α phosphorylation (p-IκB-α) was significantly increased in these three intervention groups compared with the OVA-positive group, whereas no such effects were found in the non-CpG ODN control group. These data show that the probiotic genomic DNA and the synthetic CpG-ODN was comparable with living probiotics in preventing food allergic response by immune modulation and intestinal barrier function enhancement, and the activation of TLR9/NF-κB signal pathway might be involved in this process. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Stimulated-single fiber electromyography monitoring of anti-sense induced changes in experimental autoimmune myasthenia gravis.

PubMed

Boneva, Neli; Hamra-Amitay, Yasmine; Wirguin, Itzhak; Brenner, Talma

2006-05-01

The neuromuscular weakness associated with myasthenia gravis (MG) can be transiently relieved by pharmacological inhibitors of acetylcholinesterase (AChE). Here, we expand the anticholinesterase repertoire to include 2'-O-methyl-protected antisense oligonucleotides targeted to AChE mRNA (EN101). Using stimulated-single fiber electromyography, we show that EN101 treatment of rats with experimental autoimmune myasthenia gravis (EAMG), improved the mean consecutive difference (MCD) and blocking for 24h. This treatment was more efficient than pyridostigmine and was accompanied by marked improvement in stamina and clinical profile.

JACALIN-LECTIN LIKE1 Regulates the Nuclear Accumulation of GLYCINE-RICH RNA-BINDING PROTEIN7, Influencing the RNA Processing of FLOWERING LOCUS C Antisense Transcripts and Flowering Time in Arabidopsis1[OPEN

PubMed Central

Xiao, Jun; Li, Chunhua; Xu, Shujuan; Xing, Lijing; Xu, Yunyuan; Chong, Kang

2015-01-01

Lectins selectively recognize sugars or glycans for defense in living cells, but less is known about their roles in the development process and the functional network with other factors. Here, we show that Arabidopsis (Arabidopsis thaliana) JACALIN-LECTIN LIKE1 (AtJAC1) functions in flowering time control. Loss of function of AtJAC1 leads to precocious flowering, whereas overexpression of AtJAC1 causes delayed flowering. AtJAC1 influences flowering through regulation of the key flowering repressor gene FLOWERING LOCUS C (FLC). Genetic analysis revealed that AtJAC1’s function is mostly dependent on GLYCINE-RICH RNA-BINDING PROTEIN7 (GRP7), an upstream regulator of FLC. Biochemical and cell biological data indicated that AtJAC1 interacted physically with GRP7 specifically in the cytoplasm. AtJAC1 influences the nucleocytoplasmic distribution of GRP7, with predominant nuclear localization of GRP7 when AtJAC1 function is lost but retention of GRP7 in the cytoplasm when AtJAC1 is overexpressed. A temporal inducible assay suggested that AtJAC1’s regulation of flowering could be compromised by the nuclear accumulation of GRP7. In addition, GRP7 binds to the antisense precursor messenger RNA of FLC through a conserved RNA motif. Loss of GRP7 function leads to the elevation of total FLC antisense transcripts and reduced proximal-distal polyadenylation ratio, as well as histone methylation changes in the FLC gene body region and increased total functional sense FLC transcript. Attenuating the direct binding of GRP7 with competing artificial RNAs leads to changes of FLC antisense precursor messenger RNA processing and flowering transition. Taken together, our study indicates that AtJAC1 coordinates with GRP7 in shaping plant development through the regulation of RNA processing in Arabidopsis. PMID:26392261

PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice

PubMed Central

Zinker, Bradley A.; Rondinone, Cristina M.; Trevillyan, James M.; Gum, Rebecca J.; Clampit, Jill E.; Waring, Jeffrey F.; Xie, Nancy; Wilcox, Denise; Jacobson, Peer; Frost, Leigh; Kroeger, Paul E.; Reilly, Regina M.; Koterski, Sandra; Opgenorth, Terry J.; Ulrich, Roger G.; Crosby, Seth; Butler, Madeline; Murray, Susan F.; McKay, Robert A.; Bhanot, Sanjay; Monia, Brett P.; Jirousek, Michael R.

2002-01-01

The role of protein-tyrosine phosphatase 1B (PTP1B) in diabetes was investigated using an antisense oligonucleotide in ob/ob and db/db mice. PTP1B antisense oligonucleotide treatment normalized plasma glucose levels, postprandial glucose excursion, and HbA1C. Hyperinsulinemia was also reduced with improved insulin sensitivity. PTP1B protein and mRNA were reduced in liver and fat with no effect in skeletal muscle. Insulin signaling proteins, insulin receptor substrate 2 and phosphatidylinositol 3 (PI3)-kinase regulatory subunit p50α, were increased and PI3-kinase p85α expression was decreased in liver and fat. These changes in protein expression correlated with increased insulin-stimulated protein kinase B phosphorylation. The expression of liver gluconeogenic enzymes, phosphoenolpyruvate carboxykinase, and fructose-1,6-bisphosphatase was also down-regulated. These findings suggest that PTP1B modulates insulin signaling in liver and fat, and that therapeutic modalities targeting PTP1B inhibition may have clinical benefit in type 2 diabetes. PMID:12169659

Transient decrease in nociceptor GRK2 expression produces long–term enhancement in inflammatory pain

PubMed Central

Ferrari, Luiz F.; Bogen, Oliver; Alessandri–Haber, Nicole; Levine, Emma; Gear, Robert W.; Levine, Jon D.

2012-01-01

In heterozygous mice, attenuation of G-protein-coupled receptor kinase 2 (GRK2) level in nociceptors is associated with enhanced and prolonged inflammatory hyperalgesia. To further elucidate the role of GRK2 in nociceptor function we reversibly decreased GRK2 expression using intrathecal antisense oligodeoxynucleotide (AS-ODN). GRK2 AS-ODN administration led to an enhanced and prolonged hyperalgesia induced by prostaglandin E 2, epinephrine and carrageenan. Morover, this effect persisted unattenuated 2 weeks after the last dose of antisense, well after GRK2 protein recovered, suggesting that transient attenuation of GRK2 produced neuroplastic changes in nociceptor function. Unlike hyperalgesic priming induced by transient attenuation of GRK2 produced neuroplastic changes in nociceptor function. Unlike hyperalgesic priming induced by transient activation of protein kinase C epsilon (PKCε), (Aley et al., 2000, Parada et al., 2003b), the enhanced and prolonged hyperalgesia following attenuation of GRK2 is PKCε- and cytoplasmic polyadenylation element binding protein (CPEB)-independent and is protein kinase A (PKA)- and Src tyrosine kinase (Src)-dependent. Finally, rats treated with GRK2 AS-ODN exhibited enhanced and prolonged hyperalgesia induced by direct activation of second messengers, adenyl cyclase, Epac or PKA, suggesting changes downstream of G-protein-coupled receptors. Because inflammation can produce a decrease in GRK2, such a mechanism could help explain a predilection to develop chronic pain, after resolution of acute inflammation. PMID:22796071

Intracellular Progesterone Receptor Mediates the Increase in Glioblastoma Growth Induced by Progesterone in the Rat Brain.

PubMed

Germán-Castelán, Liliana; Manjarrez-Marmolejo, Joaquín; González-Arenas, Aliesha; Camacho-Arroyo, Ignacio

2016-08-01

Progesterone (P) is a steroid hormone involved in the development of several types of cancer including astrocytomas, the most common and malignant brain tumors. We undertook this study to investigate the effects of P on the growth and infiltration of a tumor caused by the xenotransplant of U87 cells derived from a human astrocytoma grade IV (glioblastoma) in the cerebral cortex of male rats and the participation of intracellular progesterone receptor (PR) on these effects. Eight weeks after the implantation of U87 cells in the cerebral cortex, we administered phosphorothioated antisense oligodeoxynucleotides (ODNs) to silence the expression of PR. This treatment lasted 15 days and was administered at the site of glioblastoma cells implantation using Alzet osmotic pumps. Vehicle (propylene glycol) or P 4 (400 μg/100 g) was subcutaneously injected for 14 days starting 1 day after the beginning of ODN administration. We observed that P significantly increased glioblastoma tumor area and infiltration length as compared with vehicle, whereas PR antisense ODNs blocked these effects. P, through the interaction with PR, increases the area and infiltration of a brain tumor formed from the xenotransplant of human glioblastoma-derived U87 cells in the cerebral cortex of the rat. Copyright © 2016 IMSS. Published by Elsevier Inc. All rights reserved.

Reduced wood stiffness and strength, and altered stem form, in young antisense 4CL transgenic poplars with reduced lignin contents

Treesearch

Steven L. Voelker; Barbara Lachenbruch; Frederick C. Meinzer; Peter Kitin; Steven H. Strauss

2011-01-01

Reduced lignin content in perennial crops has been sought as a means to improve biomass processability for paper and biofuels production, but it is unclear how this could affect wood properties and tree form. Here, we studied a nontransgenic control and 14 transgenic events containing an antisense 4-coumarate:coenzyme A ligase (4CL) to discern the...

DLEU2 encodes an antisense RNA for the putative bicistronic RFP2/LEU5 gene in humans and mouse.

PubMed

Corcoran, Martin M; Hammarsund, Marianne; Zhu, Chaoyong; Lerner, Mikael; Kapanadze, Bagrat; Wilson, Bill; Larsson, Catharina; Forsberg, Lars; Ibbotson, Rachel E; Einhorn, Stefan; Oscier, David G; Grandér, Dan; Sangfelt, Olle

2004-08-01

Our group previously identified two novel genes, RFP2/LEU5 and DLEU2, within a 13q14.3 genomic region of loss seen in various malignancies. However, no specific inactivating mutations were found in these or other genes in the vicinity of the deletion, suggesting that a nonclassical tumor-suppressor mechanism may be involved. Here, we present data showing that the DLEU2 gene encodes a putative noncoding antisense RNA, with one exon directly overlapping the first exon of the RFP2/LEU5 gene in the opposite orientation. In addition, the RFP2/LEU5 transcript can be alternatively spliced to produce either several monocistronic transcripts or a putative bicistronic transcript encoding two separate open-reading frames, adding to the complexity of the locus. The finding that these gene structures are conserved in the mouse, including the putative bicistronic RFP2/LEU5 transcript as well as the antisense relationship with DLEU2, further underlines the significance of this unusual organization and suggests a biological function for DLEU2 in the regulation of RFP2/LEU5. Copyright 2004 Wiley-Liss, Inc.

CD133 antisense suppresses cancer cell growth and increases sensitivity to cisplatin in vitro.

PubMed

Blancas-Mosqueda, Marisol; Zapata-Benavides, Pablo; Zamora-Ávila, Diana; Saavedra-Alonso, Santiago; Manilla-Muñoz, Edgar; Franco-Molina, Moisés; DE LA Peña, Carmen Mondragón; Rodríguez-Padilla, Cristina

2012-11-01

The increased incidence of cancer in recent years is associated with a high rate of mortality. Numerous types of cancer have a low percentage of CD133(+) cells, which have similar features to stem cells. The CD133 molecule is involved in apoptosis and cell proliferation. The aim of this study was to determine the biological effect of CD133 suppression and its role in the chemosensitization of cancer cell lines. RT-PCR and immunocytochemical analyses indicated that CD133 was expressed in the cancer cell lines B16F10, MCF7 and INER51. Downregulation of CD133 by transfection with an antisense sequence (As-CD133) resulted in a decrease in cancer cell viability of up to 52, 47 and 22% in B16F10, MCF-7 and INER51 cancer cell lines, respectively. This decreased viability appeared to be due to the induction of apoptosis. In addition, treatment with As-CD133 in combination with cisplatin had a synergic effect in all of the cancer cell lines analyzed, and in particular, significantly decreased the viability of B16F10 cancer cells compared with each treatment separately (3.1% viability for the combined treatment compared with 48% for 0.4 μg As-CD133 and 25% for 5 ng/μl cisplatin; P<0.05). The results indicate that the downregulation of CD133 by antisense is a potential therapeutic target for cancer and has a synergistic effect when administered with minimal doses of the chemotherapeutic drug cisplatin, suggesting that this combination strategy may be applied in cancer treatment.

CD133 antisense suppresses cancer cell growth and increases sensitivity to cisplatin in vitro

PubMed Central

BLANCAS-MOSQUEDA, MARISOL; ZAPATA-BENAVIDES, PABLO; ZAMORA-ÁVILA, DIANA; SAAVEDRA-ALONSO, SANTIAGO; MANILLA-MUÑOZ, EDGAR; FRANCO-MOLINA, MOISÉS; DE LA PEÑA, CARMEN MONDRAGÓN; RODRÍGUEZ-PADILLA, CRISTINA

2012-01-01

The increased incidence of cancer in recent years is associated with a high rate of mortality. Numerous types of cancer have a low percentage of CD133+ cells, which have similar features to stem cells. The CD133 molecule is involved in apoptosis and cell proliferation. The aim of this study was to determine the biological effect of CD133 suppression and its role in the chemosensitization of cancer cell lines. RT-PCR and immunocytochemical analyses indicated that CD133 was expressed in the cancer cell lines B16F10, MCF7 and INER51. Downregulation of CD133 by transfection with an antisense sequence (As-CD133) resulted in a decrease in cancer cell viability of up to 52, 47 and 22% in B16F10, MCF-7 and INER51 cancer cell lines, respectively. This decreased viability appeared to be due to the induction of apoptosis. In addition, treatment with As-CD133 in combination with cisplatin had a synergic effect in all of the cancer cell lines analyzed, and in particular, significantly decreased the viability of B16F10 cancer cells compared with each treatment separately (3.1% viability for the combined treatment compared with 48% for 0.4 μg As-CD133 and 25% for 5 ng/μl cisplatin; P<0.05). The results indicate that the downregulation of CD133 by antisense is a potential therapeutic target for cancer and has a synergistic effect when administered with minimal doses of the chemotherapeutic drug cisplatin, suggesting that this combination strategy may be applied in cancer treatment. PMID:23226746

REM sleep enhancement and behavioral cataplexy following orexin (hypocretin)-II receptor antisense perfusion in the pontine reticular formation.

PubMed

Thakkar, M M; Ramesh, V; Cape, E G; Winston, S; Strecker, R E; McCarley, R W

1999-01-01

Orexin (hypocretin)-containing neurons of the hypothalamus project to brainstem sites that are involved in the neural control of REM sleep, including the locus coeruleus, the dorsal raphe nucleus, the cholinergic zone of the mesopontine tegmentum, and the pontine reticular formation (PRF). Orexin knockout mice exhibit narcolepsy/cataplexy, and a mutant and defective gene for the orexin type II receptor is present in dogs with an inherited form of narcolepsy/cataplexy. However, the physiological systems mediating these effects have not been described. We reasoned that, since the effector neurons for the majority of REM sleep signs, including muscle atonia, were located in the PRF, this region was likely implicated in the production of these orexin-related abnormalities. To test this possibility, we used microdialysis perfusion of orexin type II receptor antisense in the PRF of rats. Ten to 24 hours after antisense perfusion, REM sleep increased two- to three-fold during both the light period (quiescent phase) and the dark period (active phase), and infrared video showed episodes of behavioral cataplexy. Moreover, preliminary data indicated no REM-related effects following perfusion with nonsense DNA, or when perfusion sites were outside the PRF. More work is needed to provide precise localization of the most effective site of orexin-induced inhibition of REM sleep phenomena.

Rescue of peripheral vestibular function in Usher syndrome mice using a splice-switching antisense oligonucleotide.

PubMed

Vijayakumar, Sarath; Depreux, Frederic F; Jodelka, Francine M; Lentz, Jennifer J; Rigo, Frank; Jones, Timothy A; Hastings, Michelle L

2017-09-15

Usher syndrome type 1C (USH1C/harmonin) is associated with profound retinal, auditory and vestibular dysfunction. We have previously reported on an antisense oligonucleotide (ASO-29) that dramatically improves auditory function and balance behavior in mice homozygous for the harmonin mutation Ush1c c.216G > A following a single systemic administration. The findings were suggestive of improved vestibular function; however, no direct vestibular assessment was made. Here, we measured vestibular sensory evoked potentials (VsEPs) to directly assess vestibular function in Usher mice. We report that VsEPs are absent or abnormal in Usher mice, indicating profound loss of vestibular function. Strikingly, Usher mice receiving ASO-29 treatment have normal or elevated vestibular response thresholds when treated during a critical period between postnatal day 1 and 5, respectively. In contrast, treatment of mice with ASO-29 treatment at P15 was minimally effective at rescuing vestibular function. Interestingly, ASO-29 treatment at P1, P5 or P15 resulted in sufficient vestibular recovery to support normal balance behaviors, suggesting a therapeutic benefit to balance with ASO-29 treatment at P15 despite the profound vestibular functional deficits that persist with treatment at this later time. These findings provide the first direct evidence of an effective treatment of peripheral vestibular function in a mouse model of USH1C and reveal the potential for using antisense technology to treat vestibular dysfunction. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Specific RNP capture with antisense LNA/DNA mixmers.

PubMed

Rogell, Birgit; Fischer, Bernd; Rettel, Mandy; Krijgsveld, Jeroen; Castello, Alfredo; Hentze, Matthias W

2017-08-01

RNA-binding proteins (RBPs) play essential roles in RNA biology, responding to cellular and environmental stimuli to regulate gene expression. Important advances have helped to determine the (near) complete repertoires of cellular RBPs. However, identification of RBPs associated with specific transcripts remains a challenge. Here, we describe "specific ribonucleoprotein (RNP) capture," a versatile method for the determination of the proteins bound to specific transcripts in vitro and in cellular systems. Specific RNP capture uses UV irradiation to covalently stabilize protein-RNA interactions taking place at "zero distance." Proteins bound to the target RNA are captured by hybridization with antisense locked nucleic acid (LNA)/DNA oligonucleotides covalently coupled to a magnetic resin. After stringent washing, interacting proteins are identified by quantitative mass spectrometry. Applied to in vitro extracts, specific RNP capture identifies the RBPs bound to a reporter mRNA containing the Sex-lethal (Sxl) binding motifs, revealing that the Sxl homolog sister of Sex lethal (Ssx) displays similar binding preferences. This method also revealed the repertoire of RBPs binding to 18S or 28S rRNAs in HeLa cells, including previously unknown rRNA-binding proteins. © 2017 Rogell et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

FAS-antisense 1 lncRNA and production of soluble versus membrane Fas in B-cell lymphoma

PubMed Central

Sehgal, Lalit; Mathur, Rohit; Braun, Frank K.; Wise, Jillian F.; Berkova, Zuzana; Neelapu, Sattva; Kwak, Larry W.; Samaniego, Felipe

2018-01-01

Impaired Fas-mediated apoptosis is associated with poor clinical outcomes and cancer chemoresistance. Soluble Fas receptor (sFas), produced by skipping of exon 6, inhibits apoptosis by sequestering Fas ligand. Serum sFas is associated with poor prognosis of non-Hodgkin's lymphomas. We found that the alternative splicing of Fas in lymphomas is tightly regulated by a lncRNA corresponding to an antisense transcript of Fas (FAS-AS1). Levels of FAS-AS1 correlate inversely with production of sFas and FAS-AS1 binding to the RBM5 inhibits RBM5-mediated exon 6 skipping. EZH2, often mutated or overexpressed in lymphomas, hyper-methylates the FAS-AS1 promoter and represses the FAS-AS1 expression. EZH2-mediated repression of FAS-AS1 promoter can be released by DZNeP or overcome by ectopic expression of FAS-AS1, both of which increase levels of FAS-AS1 and correspondingly decrease expression of sFas. Treatment with Bruton’s tyrosine kinase (BTK) inhibitor or EZH2 knockdown decreases the levels of EZH2, RBM5 and sFas thereby enhances Fas-mediated apoptosis. This is the first report showing functional regulation of Fas repression by its antisense RNA. Our results reveal new therapeutic targets in lymphomas and provide a rationale for the use of EZH2 inhibitors or ibrutinib in combination with chemotherapeutic agents that recruit Fas for effective cell killing. PMID:24811343

Regulation of corneal repair by particle-mediated gene transfer of opioid growth factor receptor complementary DNA.

PubMed

Zagon, Ian S; Sassani, Joseph W; Malefyt, Kristin J; McLaughlin, Patricia J

2006-11-01

To determine whether molecular manipulation of the opioid growth factor receptor (OGFr) alters corneal reepithelialization following central corneal abrasion in rats. The plasmid pcDNA3.1 + OGFr, carrying the rat OGFr complementary DNA in both the sense and antisense orientations, and empty vector (EV), were delivered by gene gun to the rat cornea. After 24 hours, corneas were abraded and reepithelialization was documented by fluorescein photography. Twenty-four hours after wounding, DNA synthesis (with bromodeoxyuridine) was examined. Eyes transfected with sense constructs of OGFr had corneal defects that were 24%, 52%, and 50% larger than the EV group at 16, 24, and 28 hours, respectively. Conversely, corneas transfected with antisense constructs of OGFr had corneal defects that were 56% and 48% smaller than the EV group at 16 and 24 hours, respectively. Bromodeoxyuridine labeling in the basal and suprabasal layers of the antisense group were increased 3.3- and 3.7-fold, respectively, in DNA synthesis from corresponding EV layers; DNA synthesis was comparable in the sense and EV groups. Excess OGFr delays reepithelialization, whereas attenuation of OGFr accelerates repair of the corneal surface. Clinical Relevance Inhibition of opioid growth factor action using gene therapy could be important in the treatment of corneal diseases such as nonhealing and recurrent erosions, diabetic keratopathy, and neurotrophic keratitis.

Long noncoding AFAP1-antisense RNA 1 is upregulated and promotes tumorigenesis in gastric cancer.

PubMed

Ye, Fei; Gong, Yi; Chen, Xiangheng; Yu, Meiying; Zuo, Zhongkun; Pei, Dongni; Liu, Wei; Wang, Qunwei; Zhou, Jun; Duan, Lunxi; Zhang, Leiyi; Li, Xiaojing; Tang, Tenglong; Huang, Jiangsheng

2018-05-01

Long noncoding RNA serves important roles in gastric cancer (GC). However, the prognostic significance and tumorigenesis effect of AFAP1-antisense RNA 1 (AS1) in GC remain to be clarified. The present study was conducted in order to determine the expression level of AFAP1-AS1 by reverse transcription-quantitative polymerase chain reaction. It was demonstrated that AFAP1-AS1 expression level was higher in GC tissues in comparison with adjacent tissues. By analyzing 66 GC tissue specimens, AFAP1-AS1 expression level was found to be markedly associated with tumor size, clinical stage and differentiation. By performing multivariate Cox regression test, AFAP1-AS1 expression level was confirmed to be an independent factor for poor prognosis in patients with GC. Furthermore, SGC-7901 and BGC-823 cells were used for further investigation following transfection of an AFAP1-AS1 short hairpin RNA lentiviral vector. Knockdown of AFAP1-AS1 significantly inhibited GC cell proliferation, migration and invasion abilities in vitro . Finally, nude mice experiments confirmed that downregulation of AFAP1-AS1 in GC cells suppressed tumor growth in vivo . In conclusion, the results of the present study suggested that AFAP1-AS1 may serve as a valuable prognostic indicator and therapeutic target for GC.

Defining Global Gene Expression Changes of the Hypothalamic-Pituitary-Gonadal Axis in Female sGnRH-Antisense Transgenic Common Carp (Cyprinus carpio)

PubMed Central

Xu, Jing; Huang, Wei; Zhong, Chengrong; Luo, Daji; Li, Shuangfei; Zhu, Zuoyan; Hu, Wei

2011-01-01

Background The hypothalamic-pituitary-gonadal (HPG) axis is critical in the development and regulation of reproduction in fish. The inhibition of neuropeptide gonadotropin-releasing hormone (GnRH) expression may diminish or severely hamper gonadal development due to it being the key regulator of the axis, and then provide a model for the comprehensive study of the expression patterns of genes with respect to the fish reproductive system. Methodology/Principal Findings In a previous study we injected 342 fertilized eggs from the common carp (Cyprinus carpio) with a gene construct that expressed antisense sGnRH. Four years later, we found a total of 38 transgenic fish with abnormal or missing gonads. From this group we selected the 12 sterile females with abnormal ovaries in which we combined suppression subtractive hybridization (SSH) and cDNA microarray analysis to define changes in gene expression of the HPG axis in the present study. As a result, nine, 28, and 212 genes were separately identified as being differentially expressed in hypothalamus, pituitary, and ovary, of which 87 genes were novel. The number of down- and up-regulated genes was five and four (hypothalamus), 16 and 12 (pituitary), 119 and 93 (ovary), respectively. Functional analyses showed that these genes involved in several biological processes, such as biosynthesis, organogenesis, metabolism pathways, immune systems, transport links, and apoptosis. Within these categories, significant genes for neuropeptides, gonadotropins, metabolic, oogenesis and inflammatory factors were identified. Conclusions/Significance This study indicated the progressive scaling-up effect of hypothalamic sGnRH antisense on the pituitary and ovary receptors of female carp and provided comprehensive data with respect to global changes in gene expression throughout the HPG signaling pathway, contributing towards improving our understanding of the molecular mechanisms and regulative pathways in the reproductive system of

Legionella Pneumophila and Dendrimers-Mediated Antisense Therapy.

PubMed

Pashaei-Asl, Roghiyeh; Khodadadi, Khodadad; Pashaei-Asl, Fatima; Haqshenas, Gholamreza; Ahmadian, Nasser; Pashaiasl, Maryam; Hajihosseini Baghdadabadi, Reza

2017-06-01

Finding novel and effective antibiotics for treatment of Legionella disease is a challenging field. Treatment with antibiotics usually cures Legionella infection; however, if the resultant disease is not timely recognized and treated properly, it leads to poor prognosis and high case fatality rate. Legionella pneumophila DrrA protein (Defects in Rab1 recruitment protein A)/also known as SidM affects host cell vesicular trafficking through modification of the activity of cellular small guanosine triphosphatase )GTPase( Rab (Ras-related in brain) function which facilitates intracellular bacterial replication within a supporter vacuole. Also, Legionella pneumophila LepA and LepB (Legionella effector protein A and B) proteins suppress host-cell Rab1 protein's function resulting in the cell lysis and release of bacteria that subsequently infect neighbour cells. Legionella readily develops resistant to antibiotics and, therefore, new drugs with different modes of action and therapeutic strategic approaches are urgently required among antimicrobial drug therapies;gene therapy is a novel approach for Legionnaires disease treatment. On the contrary to the conventional treatment approaches that target bacterial proteins, new treatment interventions target DNA (Deoxyribonucleic acid), RNA (Ribonucleic acid) species, and different protein families or macromolecular complexes of these components. The above approaches can overcome the problems in therapy of Legionella infections caused by antibiotics resistance pathogens. Targeting Legionella genes involved in manipulating cellular vesicular trafficking using a dendrimer-mediated antisense therapy is a promising approach to inhibit bacterial replication within the target cells.

Antisense oligonucleotides targeting translation inhibitory elements in 5' UTRs can selectively increase protein levels.

PubMed

Liang, Xue-Hai; Sun, Hong; Shen, Wen; Wang, Shiyu; Yao, Joyee; Migawa, Michael T; Bui, Huynh-Hoa; Damle, Sagar S; Riney, Stan; Graham, Mark J; Crooke, Rosanne M; Crooke, Stanley T

2017-09-19

A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting agents that counter the function of negative regulatory elements present in the 5' UTRs of some mRNAs. We recently showed that translation can be enhanced by antisense oligonucleotides (ASOs) that target upstream open reading frames. Here we report the amount of a protein can also be selectively increased using ASOs designed to hybridize to other translation inhibitory elements in 5' UTRs. Levels of human RNASEH1, LDLR, and ACP1 and of mouse ACP1 and ARF1 were increased up to 2.7-fold in different cell types and species upon treatment with chemically modified ASOs targeting 5' UTR inhibitory regions in the mRNAs encoding these proteins. The activities of ASOs in enhancing translation were sequence and position dependent and required helicase activity. The ASOs appear to improve the recruitment of translation initiation factors to the target mRNA. Importantly, ASOs targeting ACP1 mRNA significantly increased the level of ACP1 protein in mice, suggesting that this approach has therapeutic and research potentials. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Ultra Deep Sequencing of Listeria monocytogenes sRNA Transcriptome Revealed New Antisense RNAs

PubMed Central

Behrens, Sebastian; Widder, Stefanie; Mannala, Gopala Krishna; Qing, Xiaoxing; Madhugiri, Ramakanth; Kefer, Nathalie; Mraheil, Mobarak Abu; Rattei, Thomas; Hain, Torsten

2014-01-01

Listeria monocytogenes, a gram-positive pathogen, and causative agent of listeriosis, has become a widely used model organism for intracellular infections. Recent studies have identified small non-coding RNAs (sRNAs) as important factors for regulating gene expression and pathogenicity of L. monocytogenes. Increased speed and reduced costs of high throughput sequencing (HTS) techniques have made RNA sequencing (RNA-Seq) the state-of-the-art method to study bacterial transcriptomes. We created a large transcriptome dataset of L. monocytogenes containing a total of 21 million reads, using the SOLiD sequencing technology. The dataset contained cDNA sequences generated from L. monocytogenes RNA collected under intracellular and extracellular condition and additionally was size fractioned into three different size ranges from <40 nt, 40–150 nt and >150 nt. We report here, the identification of nine new sRNAs candidates of L. monocytogenes and a reevaluation of known sRNAs of L. monocytogenes EGD-e. Automatic comparison to known sRNAs revealed a high recovery rate of 55%, which was increased to 90% by manual revision of the data. Moreover, thorough classification of known sRNAs shed further light on their possible biological functions. Interestingly among the newly identified sRNA candidates are antisense RNAs (asRNAs) associated to the housekeeping genes purA, fumC and pgi and potentially their regulation, emphasizing the significance of sRNAs for metabolic adaptation in L. monocytogenes. PMID:24498259

Fluorescence Characterization of Gold Modified Liposomes with Antisense N-myc DNA Bound to the Magnetisable Particles with Encapsulated Anticancer Drugs (Doxorubicin, Ellipticine and Etoposide).

PubMed

Skalickova, Sylvie; Nejdl, Lukas; Kudr, Jiri; Ruttkay-Nedecky, Branislav; Jimenez, Ana Maria Jimenez; Kopel, Pavel; Kremplova, Monika; Masarik, Michal; Stiborova, Marie; Eckschlager, Tomas; Adam, Vojtech; Kizek, Rene

2016-02-25

Liposome-based drug delivery systems hold great potential for cancer therapy. The aim of this study was to design a nanodevice for targeted anchoring of liposomes (with and without cholesterol) with encapsulated anticancer drugs and antisense N-myc gene oligonucleotide attached to its surface. To meet this main aim, liposomes with encapsulated doxorubicin, ellipticine and etoposide were prepared. They were further characterized by measuring their fluorescence intensity, whereas the encapsulation efficiency was estimated to be 16%. The hybridization process of individual oligonucleotides forming the nanoconstruct was investigated spectrophotometrically and electrochemically. The concentrations of ellipticine, doxorubicin and etoposide attached to the nanoconstruct in gold nanoparticle-modified liposomes were found to be 14, 5 and 2 µg·mL(-1), respectively. The study succeeded in demonstrating that liposomes are suitable for the transport of anticancer drugs and the antisense oligonucleotide, which can block the expression of the N-myc gene.

Inhibition of connective tissue growth factor (CTGF/CCN2) expression decreases the survival and myogenic differentiation of human rhabdomyosarcoma cells.

PubMed

Croci, Stefania; Landuzzi, Lorena; Astolfi, Annalisa; Nicoletti, Giordano; Rosolen, Angelo; Sartori, Francesca; Follo, Matilde Y; Oliver, Noelynn; De Giovanni, Carla; Nanni, Patrizia; Lollini, Pier-Luigi

2004-03-01

Connective tissue growth factor (CTGF/CCN2), a cysteine-rich protein of the CCN (Cyr61, CTGF, Nov) family of genes, emerged from a microarray screen of genes expressed by human rhabdomyosarcoma cells. Rhabdomyosarcoma is a soft tissue sarcoma of childhood deriving from skeletal muscle cells. In this study, we investigated the role of CTGF in rhabdomyosarcoma. Human rhabdomyosarcoma cells of the embryonal (RD/12, RD/18, CCA) and the alveolar histotype (RMZ-RC2, SJ-RH4, SJ-RH30), rhabdomyosarcoma tumor specimens, and normal skeletal muscle cells expressed CTGF. To determine the function of CTGF, we treated rhabdomyosarcoma cells with a CTGF antisense oligonucleotide or with a CTGF small interfering RNA (siRNA). Both treatments inhibited rhabdomyosarcoma cell growth, suggesting the existence of a new autocrine loop based on CTGF. CTGF antisense oligonucleotide-mediated growth inhibition was specifically due to a significant increase in apoptosis, whereas cell proliferation was unchanged. CTGF antisense oligonucleotide induced a strong decrease in the level of myogenic differentiation of rhabdomyosarcoma cells, whereas the addition of recombinant CTGF significantly increased the proportion of myosin-positive cells. CTGF emerges as a survival and differentiation factor and could be a new therapeutic target in human rhabdomyosarcoma.

Targeted Blockage of Signal Transducer and Activator of Transcription 5 Signaling Pathway with Decoy Oligodeoxynucleotides Suppresses Leukemic K562 Cell Growth

PubMed Central

Wang, Xiaozhong; Zeng, Jianming; Shi, Mei; Zhao, Shiqiao; Bai, Weijun; Cao, Weixi; Tu, Zhiguang; Huang, Zonggan

2011-01-01

The protein signal transducer and activator of transcription 5 (STAT5) of the JAK/STAT pathway is constitutively activated because of its phosphorylation by tyrosine kinase activity of fusion protein BCR-ABL in chronic myelogenous leukemia (CML) cells. This study investigated the potential therapeutic effect of STAT5 decoy oligodeoxynucleotides (ODN) using leukemia K562 cells as a model. Our results showed that transfection of 21-mer-long STAT5 decoy ODN into K562 cells effectively inhibited cell proliferation and induced cell apoptosis. Further, STAT5 decoy ODN downregulated STAT5 targets bcl-xL, cyclinD1, and c-myc at both mRNA and protein levels in a sequence-specific manner. Collectively, these data demonstrate the therapeutic effect of blocking the STAT5 signal pathway by cis-element decoy for cancer characterized by constitutive STAT5 activation. Thus, our study provides support for STAT5 as a potential target downstream of BCR-ABL for CML treatment and helps establish the concept of targeting STAT5 by decoy ODN as a novel therapy approach for imatinib-resistant CML. PMID:21091189

Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions

PubMed Central

Vazquez-Anderson, Jorge; Mihailovic, Mia K.; Baldridge, Kevin C.; Reyes, Kristofer G.; Haning, Katie; Cho, Seung Hee; Amador, Paul; Powell, Warren B.

2017-01-01

Abstract Current approaches to design efficient antisense RNAs (asRNAs) rely primarily on a thermodynamic understanding of RNA–RNA interactions. However, these approaches depend on structure predictions and have limited accuracy, arguably due to overlooking important cellular environment factors. In this work, we develop a biophysical model to describe asRNA–RNA hybridization that incorporates in vivo factors using large-scale experimental hybridization data for three model RNAs: a group I intron, CsrB and a tRNA. A unique element of our model is the estimation of the availability of the target region to interact with a given asRNA using a differential entropic consideration of suboptimal structures. We showcase the utility of this model by evaluating its prediction capabilities in four additional RNAs: a group II intron, Spinach II, 2-MS2 binding domain and glgC 5΄ UTR. Additionally, we demonstrate the applicability of this approach to other bacterial species by predicting sRNA–mRNA binding regions in two newly discovered, though uncharacterized, regulatory RNAs. PMID:28334800

Stimulation of Chronic Lymphocytic Leukemia (CLL) Cells with CpG Oligodeoxynucleotide (ODN) Gives Consistent Karyotypic Results among Laboratories: a CLL Research Consortium (CRC)h Study

PubMed Central

Heerema, Nyla A.; Byrd, John C.; Cin, Paola Dal; Dell’ Aquila, Marie L.; Koduru, Prasad; Aviram, Ayala; Smoley, Stephanie; Rassenti, Laura Z.; Greaves, Andrew W.; Brown, Jennifer R.; Rai, Kanti R.; Kipps, Thomas J.; Kay, Neil E.; van Dyke, Daniel

2010-01-01

Cytogenetic abnormalities in CLL are important prognostic indicators. Historically, only interphase cytogenetics was clinically useful in CLL because traditional mitogens are not effective mitotic stimulants. Recently, CpG-oligodeoxynucleotide (ODN) stimulation has shown effectiveness in CLL. The CLL Research Consortium (CRC) tested the effectiveness and reproducibility of CpG-ODN stimulation to detect chromosomally abnormal clones by five laboratories. More clonal abnormalities were observed after culture of CLL cells with CpG-ODN than with pokeweed mitogen (PWM)+12-O-tetradecanoyl-phorobol-13-acetate (TPA). All clonal abnormalities in PWM+TPA cultures were observed in CpG-ODN cultures, whereas CpG-ODN identified some clones not found by PWM+TPA. CpG-ODN stimulation of one normal control and 12 CLL samples showed that excepting clones of del(13q) in low frequencies and one translocation, results in all five laboratories were consistent, and all abnormalities were concordant with FISH. Thus, abnormal clones in CLL are more readily detected with CpG-ODN stimulation than with traditional B-cell mitogens. After CpG-ODN stimulation, abnormalities were reproducible among cytogenetic laboratories. CpG-ODN did not appear to induce aberrations in cell culture and enhanced detection of abnormalities and complexity in CLL. Since karyotypic complexity is prognostic and is not detectable by standard FISH analyses, stimulation with CpG-ODN is useful to identify this additional prognostic factor in CLL. PMID:21156225

Regulation of an antisense RNA with the transition of neonatal to IIb myosin heavy chain during postnatal development and hypothyroidism in rat skeletal muscle.

PubMed

Pandorf, Clay E; Jiang, Weihua; Qin, Anqi X; Bodell, Paul W; Baldwin, Kenneth M; Haddad, Fadia

2012-04-01

Postnatal development of fast skeletal muscle is characterized by a transition in expression of myosin heavy chain (MHC) isoforms, from primarily neonatal MHC at birth to primarily IIb MHC in adults, in a tightly coordinated manner. These isoforms are encoded by distinct genes, which are separated by ∼17 kb on rat chromosome 10. The neonatal-to-IIb MHC transition is inhibited by a hypothyroid state. We examined RNA products [mRNA, pre-mRNA, and natural antisense transcript (NAT)] of developmental and adult-expressed MHC genes (embryonic, neonatal, I, IIa, IIx, and IIb) at 2, 10, 20, and 40 days after birth in normal and thyroid-deficient rat neonates treated with propylthiouracil. We found that a long noncoding antisense-oriented RNA transcript, termed bII NAT, is transcribed from a site within the IIb-Neo intergenic region and across most of the IIb MHC gene. NATs have previously been shown to mediate transcriptional repression of sense-oriented counterparts. The bII NAT is transcriptionally regulated during postnatal development and in response to hypothyroidism. Evidence for a regulatory mechanism is suggested by an inverse relationship between IIb MHC and bII NAT in normal and hypothyroid-treated muscle. Neonatal MHC transcription is coordinately expressed with bII NAT. A comparative phylogenetic analysis also suggests that bII NAT-mediated regulation has been a conserved trait of placental mammals for most of the eutherian evolutionary history. The evidence in support of the regulatory model implicates long noncoding antisense RNA as a mechanism to coordinate the transition between neonatal and IIb MHC during postnatal development.

The Antisense RNA Approach: a New Application for In Vivo Investigation of the Stress Response of Oenococcus oeni, a Wine-Associated Lactic Acid Bacterium

PubMed Central

Darsonval, Maud; Msadek, Tarek; Alexandre, Hervé

2015-01-01

Oenococcus oeni is a wine-associated lactic acid bacterium mostly responsible for malolactic fermentation in wine. In wine, O. oeni grows in an environment hostile to bacterial growth (low pH, low temperature, and ethanol) that induces stress response mechanisms. To survive, O. oeni is known to set up transitional stress response mechanisms through the synthesis of heat stress proteins (HSPs) encoded by the hsp genes, notably a unique small HSP named Lo18. Despite the availability of the genome sequence, characterization of O. oeni genes is limited, and little is known about the in vivo role of Lo18. Due to the lack of genetic tools for O. oeni, an efficient expression vector in O. oeni is still lacking, and deletion or inactivation of the hsp18 gene is not presently practicable. As an alternative approach, with the goal of understanding the biological function of the O. oeni hsp18 gene in vivo, we have developed an expression vector to produce antisense RNA targeting of hsp18 mRNA. Recombinant strains were exposed to multiple stresses inducing hsp18 gene expression: heat shock and acid shock. We showed that antisense attenuation of hsp18 affects O. oeni survival under stress conditions. These results confirm the involvement of Lo18 in heat and acid tolerance of O. oeni. Results of anisotropy experiments also confirm a membrane-protective role for Lo18, as previous observations had already suggested. This study describes a new, efficient tool to demonstrate the use of antisense technology for modulating gene expression in O. oeni. PMID:26452552

Oral and intraperitoneal administration of phosphorothioate oligodeoxynucleotides leads to control of Cryptosporidium parvum infection in neonatal mice.

PubMed

Barrier, Mathieu; Lacroix-Lamandé, Sonia; Mancassola, Roselyne; Auray, Gaël; Bernardet, Nelly; Chaussé, Anne-Marie; Uematsu, Satoshi; Akira, Shizuo; Laurent, Fabrice

2006-05-15

Neonates are particularly vulnerable to infections, in part because of the incomplete development of their immune system. Recent advances in immunostimulatory treatments based on conserved microbial components led us to assess the potential of oligodeoxynucleotides (ODNs) for decreasing the sensitivity of neonates to Cryptosporidium parvum infection. Neonate mice were treated orally or intraperitoneally (ip) with CpG ODNs or non-CpG ODNs 24 h before C. parvum infection, and parasite load and cytokine up-regulation were evaluated. CpG ODN 1668 and non-CpG ODN 1668 administered orally, as well as CpG ODN 1668 administered ip, induced an 80%-95% decrease in intestinal parasite load 6 days after infection. Intraperitoneal and oral pretreatment with CpG ODN 1668 led to a strong initial up-regulation of cytokines and CD69 messenger RNA in the intestine and a decrease in parasite load by a Toll-like receptor 9 (TLR9)-dependent mechanism. By contrast, oral administration of non-CpG ODN 1668 decreased parasite load by a TLR9-independent mechanism. The control of neonatal C. parvum infection by ip or oral administration of ODNs is feasible by 2 different mechanisms: (1) the well-known interaction involving CpG/TLR9, leading to the production of cytokines and lymphocyte activation, and (2) a new unknown mechanism that is independent of TLR9 and effective orally.

Role of antisense RNAs in evolution of yeast regulatory complexity.

PubMed

Lin, Chih-Hsu; Tsai, Zing Tsung-Yeh; Wang, Daryi

2013-01-01

Antisense RNAs (asRNAs) are known to regulate gene expression. However, a genome-wide mechanism of asRNA regulation is unclear, and there is no good explanation why partial asRNAs are not functional. To explore its regulatory role, we investigated asRNAs using an evolutionary approach, as genome-wide experimental data are limited. We found that the percentage of genes coupling with asRNAs in Saccharomyces cerevisiae is negatively associated with regulatory complexity and evolutionary age. Nevertheless, asRNAs evolve more slowly when their sense genes are under more complex regulation. Older genes coupling with asRNAs are more likely to demonstrate inverse expression, reflecting the role of these asRNAs as repressors. Our analyses provide novel evidence, suggesting a minor contribution of asRNAs in developing regulatory complexity. Although our results support the leaky hypothesis for asRNA transcription, our evidence also suggests that partial asRNAs may have evolved as repressors. Our study deepens the understanding of asRNA regulatory evolution. Copyright © 2013 Elsevier Inc. All rights reserved.

CTCF regulates the human p53 gene through direct interaction with its natural antisense transcript, Wrap53

PubMed Central

Saldaña-Meyer, Ricardo; González-Buendía, Edgar; Guerrero, Georgina; Narendra, Varun; Bonasio, Roberto; Recillas-Targa, Félix; Reinberg, Danny

2014-01-01

The multifunctional CCCTC-binding factor (CTCF) protein exhibits a broad range of functions, including that of insulator and higher-order chromatin organizer. We found that CTCF comprises a previously unrecognized region that is necessary and sufficient to bind RNA (RNA-binding region [RBR]) and is distinct from its DNA-binding domain. Depletion of cellular CTCF led to a decrease in not only levels of p53 mRNA, as expected, but also those of Wrap53 RNA, an antisense transcript originated from the p53 locus. PAR-CLIP-seq (photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation [PAR-CLIP] combined with deep sequencing) analyses indicate that CTCF binds a multitude of transcripts genome-wide as well as to Wrap53 RNA. Apart from its established role at the p53 promoter, CTCF regulates p53 expression through its physical interaction with Wrap53 RNA. Cells harboring a CTCF mutant in its RBR exhibit a defective p53 response to DNA damage. Moreover, the RBR facilitates CTCF multimerization in an RNA-dependent manner, which may bear directly on its role in establishing higher-order chromatin structures in vivo. PMID:24696455

Comparison of the pharmacological profiles of murine antisense oligonucleotides targeting apolipoprotein B and microsomal triglyceride transfer protein

PubMed Central

Lee, Richard G.; Fu, Wuxia; Graham, Mark J.; Mullick, Adam E.; Sipe, Donna; Gattis, Danielle; Bell, Thomas A.; Booten, Sheri; Crooke, Rosanne M.

2013-01-01

Therapeutic agents that suppress apolipoprotein B (apoB) and microsomal triglyceride transfer protein (MTP) levels/activity are being developed in the clinic to benefit patients who are unable to reach target LDL-C levels with maximally tolerated lipid-lowering drugs. To compare and contrast the metabolic consequences of reducing these targets, murine-specific apoB or MTP antisense oligonucleotides (ASOs) were administered to chow-fed and high fat-fed C57BL/6 or to chow-fed and Western diet-fed LDLr−/− mice for periods ranging from 2 to 12 weeks, and detailed analyses of various factors affecting fatty acid metabolism were performed. Administration of these drugs significantly reduced target hepatic mRNA and protein, leading to similar reductions in hepatic VLDL/triglyceride secretion. MTP ASO treatment consistently led to increases in hepatic triglyceride accumulation and biomarkers of hepatotoxicity relative to apoB ASO due in part to enhanced expression of peroxisome proliferator activated receptor γ target genes and the inability to reduce hepatic fatty acid synthesis. Thus, although both drugs effectively lowered LDL-C levels in mice, the apoB ASO produced a more positive liver safety profile. PMID:23220583

Delayed Time-to-Treatment of an Antisense Morpholino Oligomer Is Effective against Lethal Marburg Virus Infection in Cynomolgus Macaques.

PubMed

Warren, Travis K; Whitehouse, Chris A; Wells, Jay; Welch, Lisa; Charleston, Jay S; Heald, Alison; Nichols, Donald K; Mattix, Marc E; Palacios, Gustavo; Kugleman, Jeffrey R; Iversen, Patrick L; Bavari, Sina

2016-02-01

Marburg virus (MARV) is an Ebola-like virus in the family Filovirdae that causes sporadic outbreaks of severe hemorrhagic fever with a case fatality rate as high as 90%. AVI-7288, a positively charged antisense phosphorodiamidate morpholino oligomer (PMOplus) targeting the viral nucleoprotein gene, was evaluated as a potential therapeutic intervention for MARV infection following delayed treatment of 1, 24, 48, and 96 h post-infection (PI) in a nonhuman primate lethal challenge model. A total of 30 cynomolgus macaques were divided into 5 groups of 6 and infected with 1,830 plaque forming units of MARV subcutaneously. AVI-7288 was administered by bolus infusion daily for 14 days at 15 mg/kg body weight. Survival was the primary endpoint of the study. While none (0 of 6) of the saline group survived, 83-100% of infected monkeys survived when treatment was initiated 1, 24, 48, or 96 h post-infection (PI). The antisense treatment also reduced serum viremia and inflammatory cytokines in all treatment groups compared to vehicle controls. The antibody immune response to virus was preserved and tissue viral antigen was cleared in AVI-7288 treated animals. These data show that AVI-7288 protects NHPs against an otherwise lethal MARV infection when treatment is initiated up to 96 h PI.

The 5′-tail of antisense RNAII of pMV158 plays a critical role in binding to the target mRNA and in translation inhibition of repB

PubMed Central

López-Aguilar, Celeste; Romero-López, Cristina; Espinosa, Manuel; Berzal-Herranz, Alfredo; del Solar, Gloria

2015-01-01

Rolling-circle replication of streptococcal plasmid pMV158 is controlled by the concerted action of two trans-acting elements, namely transcriptional repressor CopG and antisense RNAII, which inhibit expression of the repB gene encoding the replication initiator protein. The pMV158-encoded antisense RNAII exerts its activity of replication control by inhibiting translation of the essential repB gene. RNAII is the smallest and simplest among the characterized antisense RNAs involved in control of plasmid replication. Structure analysis of RNAII revealed that it folds into an 8-bp-long stem containing a 1-nt bulge and closed by a 6-nt apical loop. This hairpin is flanked by a 17-nt-long single-stranded 5′-tail and an 8-nt-long 3′-terminal U-rich stretch. Here, the 3′ and 5′ regions of the 5′-tail of RNAII are shown to play a critical role in the binding to the target mRNA and in the inhibition of repB translation, respectively. In contrast, the apical loop of the single hairpin of RNAII plays a rather secondary role and the upper stem region hardly contributes to the binding or inhibition processes. The entire 5′-tail is required for efficient inhibition of repB translation, though only the 8-nt-long region adjacent to the hairpin seems to be essential for rapid binding to the mRNA. These results show that a “kissing” interaction involving base-pairing between complementary hairpin loops in RNAII and mRNA is not critical for efficient RNA/RNA binding or repB translation inhibition. A singular binding mechanism is envisaged whereby initial pairing between complementary single-stranded regions in the antisense and sense RNAs progresses upwards into the corresponding hairpin stems to form the intermolecular duplex. PMID:26175752

Control of phosphorothioate stereochemistry substantially increases the efficacy of antisense oligonucleotides.

PubMed

Iwamoto, Naoki; Butler, David C D; Svrzikapa, Nenad; Mohapatra, Susovan; Zlatev, Ivan; Sah, Dinah W Y; Meena; Standley, Stephany M; Lu, Genliang; Apponi, Luciano H; Frank-Kamenetsky, Maria; Zhang, Jason Jingxin; Vargeese, Chandra; Verdine, Gregory L

2017-09-01

Whereas stereochemical purity in drugs has become the standard for small molecules, stereoisomeric mixtures containing as many as a half million components persist in antisense oligonucleotide (ASO) therapeutics because it has been feasible neither to separate the individual stereoisomers, nor to synthesize stereochemically pure ASOs. Here we report the development of a scalable synthetic process that yields therapeutic ASOs having high stereochemical and chemical purity. Using this method, we synthesized rationally designed stereopure components of mipomersen, a drug comprising 524,288 stereoisomers. We demonstrate that phosphorothioate (PS) stereochemistry substantially affects the pharmacologic properties of ASOs. We report that Sp-configured PS linkages are stabilized relative to Rp, providing stereochemical protection from pharmacologic inactivation of the drug. Further, we elucidated a triplet stereochemical code in the stereopure ASOs, 3'-SpSpRp, that promotes target RNA cleavage by RNase H1 in vitro and provides a more durable response in mice than stereorandom ASOs.

Role of histone modifications and early termination in pervasive transcription and antisense-mediated gene silencing in yeast.

PubMed

Castelnuovo, Manuele; Zaugg, Judith B; Guffanti, Elisa; Maffioletti, Andrea; Camblong, Jurgi; Xu, Zhenyu; Clauder-Münster, Sandra; Steinmetz, Lars M; Luscombe, Nicholas M; Stutz, Françoise

2014-04-01

Most genomes, including yeast Saccharomyces cerevisiae, are pervasively transcribed producing numerous non-coding RNAs, many of which are unstable and eliminated by nuclear or cytoplasmic surveillance pathways. We previously showed that accumulation of PHO84 antisense RNA (asRNA), in cells lacking the nuclear exosome component Rrp6, is paralleled by repression of sense transcription in a process dependent on the Hda1 histone deacetylase (HDAC) and the H3K4 histone methyl transferase Set1. Here we investigate this process genome-wide and measure the whole transcriptome of various histone modification mutants in a Δrrp6 strain using tiling arrays. We confirm widespread occurrence of potentially antisense-dependent gene regulation and identify three functionally distinct classes of genes that accumulate asRNAs in the absence of Rrp6. These classes differ in whether the genes are silenced by the asRNA and whether the silencing is HDACs and histone methyl transferase-dependent. Among the distinguishing features of asRNAs with regulatory potential, we identify weak early termination by Nrd1/Nab3/Sen1, extension of the asRNA into the open reading frame promoter and dependence of the silencing capacity on Set1 and the HDACs Hda1 and Rpd3 particularly at promoters undergoing extensive chromatin remodelling. Finally, depending on the efficiency of Nrd1/Nab3/Sen1 early termination, asRNA levels are modulated and their capability of silencing is changed.

Role of histone modifications and early termination in pervasive transcription and antisense-mediated gene silencing in yeast

PubMed Central

Castelnuovo, Manuele; Zaugg, Judith B.; Guffanti, Elisa; Maffioletti, Andrea; Camblong, Jurgi; Xu, Zhenyu; Clauder-Münster, Sandra; Steinmetz, Lars M.; Luscombe, Nicholas M.; Stutz, Françoise

2014-01-01

Most genomes, including yeast Saccharomyces cerevisiae, are pervasively transcribed producing numerous non-coding RNAs, many of which are unstable and eliminated by nuclear or cytoplasmic surveillance pathways. We previously showed that accumulation of PHO84 antisense RNA (asRNA), in cells lacking the nuclear exosome component Rrp6, is paralleled by repression of sense transcription in a process dependent on the Hda1 histone deacetylase (HDAC) and the H3K4 histone methyl transferase Set1. Here we investigate this process genome-wide and measure the whole transcriptome of various histone modification mutants in a Δrrp6 strain using tiling arrays. We confirm widespread occurrence of potentially antisense-dependent gene regulation and identify three functionally distinct classes of genes that accumulate asRNAs in the absence of Rrp6. These classes differ in whether the genes are silenced by the asRNA and whether the silencing is HDACs and histone methyl transferase-dependent. Among the distinguishing features of asRNAs with regulatory potential, we identify weak early termination by Nrd1/Nab3/Sen1, extension of the asRNA into the open reading frame promoter and dependence of the silencing capacity on Set1 and the HDACs Hda1 and Rpd3 particularly at promoters undergoing extensive chromatin remodelling. Finally, depending on the efficiency of Nrd1/Nab3/Sen1 early termination, asRNA levels are modulated and their capability of silencing is changed. PMID:24497191

The protein DIIIC-2, aggregated with a specific oligodeoxynucleotide and adjuvanted in alum, protects mice and monkeys against DENV-2.

PubMed

Gil, Lázaro; Marcos, Ernesto; Izquierdo, Alienys; Lazo, Laura; Valdés, Iris; Ambala, Peris; Ochola, Lucy; Hitler, Rikoi; Suzarte, Edith; Álvarez, Mayling; Kimiti, Prisilla; Ndung'u, James; Kariuki, Thomas; Guzmán, María Guadalupe; Guillén, Gerardo; Hermida, Lisset

2015-01-01

Previously, we reported the ability of the chimeric protein DIIIC-2 (domain III of the dengue envelope protein fused to the capsid protein of dengue-2 virus), to induce immunity and protection in mice, when it is highly aggregated with a non-defined oligodeoxynucleotide (ODN) and adjuvanted in alum. In this work, three different defined ODNs were studied as aggregating agents. Our results suggest that the nature of the ODN influences the capacity of protein DIIIC-2 to activate cell-mediated immunity in mice. Consequently, the ODN 39M was selected to perform further experiments in mice and nonhuman primates. Mice receiving the preparation 39M-DIIIC-2 were solidly protected against dengue virus (DENV) challenge. Moreover, monkeys immunized with the same preparation developed neutralizing antibodies, as measured by four different neutralization tests varying the virus strains and the cell lines used. Two of the immunized monkeys were completely protected against challenge, whereas the third animal had a single day of low-titer viremia. This is the first work describing the induction of short-term protection in monkeys by a formulation that is suitable for human use combining a recombinant protein from DENV with alum.

MiR-132 regulated olfactory bulb proteins linked to olfactory learning in greater short-nosed fruit bat Cynopterus sphinx.

PubMed

Mukilan, Murugan; Rajathei, David Mary; Jeyaraj, Edwin; Kayalvizhi, Nagarajan; Rajan, Koilmani Emmanuvel

2018-05-30

Earlier, we showed that micro RNA-132 (miR-132) regulate the immediate early genes (IEGs) in the olfactory bulb (OB) of fruit bat Cynopterus sphinx during olfactory learning. This study was designed to examine whether the miR-132 regulate other proteins in OB during olfactory learning. To test this, miR-132 anti-sense oligodeoxynucleotide (AS-ODN) was delivered to the OB and then trained to novel odor. The 2-dimensional gel electrophoresis analysis showed that inhibition of miR-132 altered olfactory training induced expression of 321 proteins. Further, liquid chromatography-mass spectrometry (LC-MS/MS) analysis reveals the identity of differently expressed proteins such as phosphoribosyl transferase domain containing protein (PRTFDC 1), Sorting nexin-8 (SNX8), Creatine kinase B-type (CKB) and Annexin A11 (ANX A11). Among them PRTFDC 1 showing 189 matching peptides with highest sequence coverage (67.0%) and protein-protein interaction analysis showed that PRTFDC 1 is a homolog of hypoxanthine phosphoribosyltransferase-1 (HPRT-1). Subsequent immunohistochemical analysis (IHC) showed that inhibition of miR-132 down-regulated HPRT expression in OB of C. sphinx. In addition, western blot analysis depicts that HPRT, serotonin transporter (SERT), N-methyl-d-asparate (NMDA) receptors (2A,B) were down-regulated, but not altered in OB of non-sense oligodeoxynucleotide (NS-ODN) infused groups. These analyses suggest that miR-132 regulates the process of olfactory learning and memory formation through SERT and NMDA receptors signalling, which is possibly associated with the PRTFDC1-HPRT interaction. Copyright © 2017. Published by Elsevier B.V.

[Effects of adenoviral vector containing human angiotensin II type 1 receptor antisense cDNA on biological action of human pulmonary artery smooth muscle cells].

PubMed

Tu, Ming-li; Wang, Han-qin; Lei, Huai-ding; Luo, Guo-shi; Liu, Xian-jun; Liu, Wei-shun; Xiong, Chang; Liu, Yu-quan; Ren, Si-qun

2005-04-01

To investigate the effect of human angiotensin II (AngII) type 1 receptor (AT(1)R) antisense cDNA (ahAT(1)) on migration, proliferation, and apoptosis of cultured human pulmonary artery smooth muscle cells (PASMC). Two recombinant adenoviral vectors, AdCMVahAT(1) containing full length antisense cDNA targeting to human AT(1)R mRNA, and AdCMVLacZ containing LacZ, were constructed by orientation clone technology and homologous recombination. The PASMC was divided into 3 groups (DMEM, AdCMVLacZ, AdCMVahAT(1)) and different interventions were given to different groups. AT(1)R expression was detected by RT-PCR and immunohistochemistry method; migration of PASMC was measured by Boyden's Chamer method. Other PASMC was divided into 4 groups (DMEM, AngII, AdCMVLacZ + AngII and AdCMVahAT(1) + AngII), and only the last 2 groups were respectively transfected with AdCMVLacZ and AdCMVahAT(1) before administration of AngII. From 6 h to 96 h after stimulation by AngII (10(-7) mol/L), proliferation index (PI) and apoptosis of PASMC were determined by flow cytometry. At the 48 h the level of AT(1)R mRNA was significantly less in PASMC transfected AdCMVahAT(1) than that in group DMEM and in group AdCMVLacZ. The protein level showed a same difference (P < 0.01). At 24 h the migration distance of PASMC also was significantly less in group AdCMVahAT(1) than that in group DMEM and Group AdCMVLacZ (P < 0.01). Stimulated by AngII for 48 h, in group AngII the PI of PASMC markedly increased (P < 0.01 vs group DMEM). But in Group AdCMVahAT(1) + AngII PI of PASMC clearly decreased (P < 0.01 vs group AngII and group DMEM respectively). There was no statistic difference of PI between group AdCMVLacZ + AngII and group AngII. Moreover, apoptosis peak emerged only in group AdCMVahAT(1) + AngII. The rate of apoptosis in those PASMC used AdCMVahAT(1) and AngII was 24.70 +/- 4.04 (P < 0.01 vs the other 3 groups respectively). These results indicate that AngII stimulates proliferation via AT(1

Regulation of an antisense RNA with the transition of neonatal to IIb myosin heavy chain during postnatal development and hypothyroidism in rat skeletal muscle

PubMed Central

Jiang, Weihua; Qin, Anqi X.; Bodell, Paul W.; Baldwin, Kenneth M.; Haddad, Fadia

2012-01-01

Postnatal development of fast skeletal muscle is characterized by a transition in expression of myosin heavy chain (MHC) isoforms, from primarily neonatal MHC at birth to primarily IIb MHC in adults, in a tightly coordinated manner. These isoforms are encoded by distinct genes, which are separated by ∼17 kb on rat chromosome 10. The neonatal-to-IIb MHC transition is inhibited by a hypothyroid state. We examined RNA products [mRNA, pre-mRNA, and natural antisense transcript (NAT)] of developmental and adult-expressed MHC genes (embryonic, neonatal, I, IIa, IIx, and IIb) at 2, 10, 20, and 40 days after birth in normal and thyroid-deficient rat neonates treated with propylthiouracil. We found that a long noncoding antisense-oriented RNA transcript, termed bII NAT, is transcribed from a site within the IIb-Neo intergenic region and across most of the IIb MHC gene. NATs have previously been shown to mediate transcriptional repression of sense-oriented counterparts. The bII NAT is transcriptionally regulated during postnatal development and in response to hypothyroidism. Evidence for a regulatory mechanism is suggested by an inverse relationship between IIb MHC and bII NAT in normal and hypothyroid-treated muscle. Neonatal MHC transcription is coordinately expressed with bII NAT. A comparative phylogenetic analysis also suggests that bII NAT-mediated regulation has been a conserved trait of placental mammals for most of the eutherian evolutionary history. The evidence in support of the regulatory model implicates long noncoding antisense RNA as a mechanism to coordinate the transition between neonatal and IIb MHC during postnatal development. PMID:22262309

Combining Single Strand Oligodeoxynucleotides and CRISPR/Cas9 to Correct Gene Mutations in β-Thalassemia-induced Pluripotent Stem Cells.

PubMed

Niu, Xiaohua; He, Wenyin; Song, Bing; Ou, Zhanhui; Fan, Di; Chen, Yuchang; Fan, Yong; Sun, Xiaofang

2016-08-05

β-Thalassemia (β-Thal) is one of the most common genetic diseases in the world. The generation of patient-specific β-Thal-induced pluripotent stem cells (iPSCs), correction of the disease-causing mutations in those cells, and then differentiation into hematopoietic stem cells offers a new therapeutic strategy for this disease. Here, we designed a CRISPR/Cas9 to specifically target the Homo sapiens hemoglobin β (HBB) gene CD41/42(-CTTT) mutation. We demonstrated that the combination of single strand oligodeoxynucleotides with CRISPR/Cas9 was capable of correcting the HBB gene CD41/42 mutation in β-Thal iPSCs. After applying a correction-specific PCR assay to purify the corrected clones followed by sequencing to confirm mutation correction, we verified that the purified clones retained full pluripotency and exhibited normal karyotyping. Additionally, whole-exome sequencing showed that the mutation load to the exomes was minimal after CRISPR/Cas9 targeting. Furthermore, the corrected iPSCs were selected for erythroblast differentiation and restored the expression of HBB protein compared with the parental iPSCs. This method provides an efficient and safe strategy to correct the HBB gene mutation in β-Thal iPSCs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes

PubMed Central

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard

2013-01-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863

Anti-sense oligonucleotide therapies for the treatment of hyperlipidaemia.

PubMed

Wierzbicki, Anthony S; Viljoen, Adie

2016-09-01

Anti-sense oligonucleotide (ASO) therapies are a new development in clinical pharmacology offering greater specificity compared to small molecule inhibitors and the ability to target intracellular process' not susceptible to antibody-based therapies. This article reviews the chemical biology of ASOs and related RNA therapeutics. It then reviews the data on their use to treat hyperlipidaemia. Data on mipomersen - an ASO to apolipoprotein B-100(apoB) licensed for treatment of homozygous familial hypercholesterolaemia (FH) is presented. Few effective therapies are available to reduce atehrogenic lipoprotein (a) levels. An ASO therapy to apolipoprotein(a) (ISIS Apo(a)Rx) specifically reduced lipoprotein (a) levels by up to 78%. Treatment options for patients with familial chylomicronaemia syndrome (lipoprotein lipase deficiency; LPLD) or lipodystrophies are highly limited and often inadequate. Volanesorsen, an ASO to apolipoprotein C-3, shows promise in the treatment of LPLD and severe hypertriglyceridaemia as it increases clearance of triglyceride-rich lipoproteins and can normalise triglycerides in these patients. The uptake of the novel ASO therapies is likely to be limited to selected niche groups or orphan diseases. These will include homozygous FH, severe heterozygous FH for mipomersen; LPLD deficiency and lipodystrophy syndromes for volanesorsen and treatment of patients with high elevated Lp(a) levels.

Combination Antisense Treatment for Destructive Exon Skipping of Myostatin and Open Reading Frame Rescue of Dystrophin in Neonatal mdx Mice.

PubMed

Lu-Nguyen, Ngoc B; Jarmin, Susan A; Saleh, Amer F; Popplewell, Linda; Gait, Michael J; Dickson, George

2015-08-01

The fatal X-linked Duchenne muscular dystrophy (DMD), characterized by progressive muscle wasting and muscle weakness, is caused by mutations within the DMD gene. The use of antisense oligonucleotides (AOs) modulating pre-mRNA splicing to restore the disrupted dystrophin reading frame, subsequently generating a shortened but functional protein has emerged as a potential strategy in DMD treatment. AO therapy has recently been applied to induce out-of-frame exon skipping of myostatin pre-mRNA, knocking-down expression of myostatin protein, and such an approach is suggested to enhance muscle hypertrophy/hyperplasia and to reduce muscle necrosis. Within this study, we investigated dual exon skipping of dystrophin and myostatin pre-mRNAs using phosphorodiamidate morpholino oligomers conjugated with an arginine-rich peptide (B-PMOs). Intraperitoneal administration of B-PMOs was performed in neonatal mdx males on the day of birth, and at weeks 3 and 6. At week 9, we observed in treated mice (as compared to age-matched, saline-injected controls) normalization of muscle mass, a recovery in dystrophin expression, and a decrease in muscle necrosis, particularly in the diaphragm. Our data provide a proof of concept for antisense therapy combining dystrophin restoration and myostatin inhibition for the treatment of DMD.

Antisense inhibition of apolipoprotein (a) to lower plasma lipoprotein (a) levels in humans

PubMed Central

Graham, Mark J.; Viney, Nick; Crooke, Rosanne M.; Tsimikas, Sotirios

2016-01-01

Epidemiological, genetic association, and Mendelian randomization studies have provided strong evidence that lipoprotein (a) [Lp(a)] is an independent causal risk factor for CVD, including myocardial infarction, stroke, peripheral arterial disease, and calcific aortic valve stenosis. Lp(a) levels >50 mg/dl are highly prevalent (20% of the general population) and are overrepresented in patients with CVD and aortic stenosis. These data support the notion that Lp(a) should be a target of therapy for CVD event reduction and to reduce progression of aortic stenosis. However, effective therapies to specifically reduce plasma Lp(a) levels are lacking. Recent animal and human studies have shown that Lp(a) can be specifically targeted with second generation antisense oligonucleotides (ASOs) that inhibit apo(a) mRNA translation. In apo(a) transgenic mice, an apo(a) ASO reduced plasma apo(a)/Lp(a) levels and their associated oxidized phospholipid (OxPL) levels by 86 and 93%, respectively. In cynomolgus monkeys, a second generation apo(a) ASO, ISIS-APO(a)Rx, significantly reduced hepatic apo(a) mRNA expression and plasma Lp(a) levels by >80%. Finally, in a phase I study in normal volunteers, ISIS-APO(a)Rx ASO reduced Lp(a) levels and their associated OxPL levels up to 89 and 93%, respectively, with minimal effects on other lipoproteins. ISIS-APO(a)Rx represents the first specific and potent drug in clinical development to lower Lp(a) levels and may be beneficial in reducing CVD events and progression of calcific aortic valve stenosis. PMID:26538546

Regulation of S-like ribonuclease levels in Arabidopsis. Antisense inhibition of RNS1 or RNS2 elevates anthocyanin accumulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bariola, P.A.; MacIntosh, G.C.; Green, P.J.

1999-01-01

The S-like ribonucleases (RNases) RNS1 and RNS2 of Arabidopsis are members of the widespread T{sub 2} ribonuclease family, whose members also include the S-RNases, involved in gametophytic self-incompatibility in plants. Both RNS1 and RNS2 mRNAs have been shown previously to be induced by inorganic phosphate (Pi) starvation. In this study the authors examined this regulation at the protein level and determined the effects of diminishing RNS1 and RNS2 expression using antisense techniques. The Pi-starvation control of RNS1 and RNS2 was confirmed using antibodies specific for each protein. These specific antibodies also demonstrated that RNS1 is secreted, whereas RNS2 is intracellular.more » By introducing antisense constructs, mRNA accumulation was inhibited by up to 90% for RNS1 and up to 65% for NS2. These plants contained abnormally high levels of anthocyanins, the production of which is often associated with several forms of stress, including Pi starvation. This effect demonstrates that diminishing the amounts of either RNS1 or RNS2 leads to effects that cannot be compensated for by the actions of other RNases, even though Arabidopsis contains a large number of different RNase activities. These results, together with the differential localization of the proteins, imply that RNS1 and RNS2 have distinct functions in the plant.« less

A limited CpG-containing oligodeoxynucleotide therapy regimen induces sustained suppression of allergic airway inflammation in mice

PubMed Central

Kozy, Heather M.; Lum, Jeremy A.; Sweetwood, Rosemary; Chu, Mabel; Cunningham, Cameron R.; Salamon, Hugh; Lloyd, Clare M.; Coffman, Robert L.; Hessel, Edith M.

2015-01-01

Background CpG-containing oligodeoxynucleotides (CpG-ODN) are potent inhibitors of Th2-mediated allergic airway disease in sensitized mice challenged with allergen. A single treatment has transient effects but a limited series of treatments has potential to achieve clinically meaningful sustained inhibition of allergic airway disease. Objective To optimize the treatment regimen and determine the mechanisms of action in mice of an inhaled form of CpG-ODN being developed for human asthma treatment. Methods A limited series of weekly intranasal 1018 ISS (CpG-ODN; B-class) treatments were given to ragweed allergen-sensitized mice chronically exposed to allergen during and after the 1018 ISS treatment regimen. Treatment effects were evaluated by measuring effect on lung Th2 cytokines and eosinophilia as well as lung dendritic cell function and T cell responses. Results Twelve intranasal 1018 ISS treatments induced significant suppression of BAL eosinophilia and IL-4, IL-5, and IL-13 levels and suppression was maintained through 13 weekly ragweed exposures administered after treatment cessation. At least 5 treatments were required for lasting Th2 suppression. CpG-ODN induced moderate Th1 responses but Th2 suppression did not require IFN-γ. Th2 suppression was associated with induction of a regulatory T cell response. Conclusion A short series of CpG-ODN treatments results in sustained suppression of allergic lung inflammation induced by a clinically relevant allergen. PMID:24464743

Amelioration of collagen-induced arthritis using antigen-loaded dendritic cells modified with NF-κB decoy oligodeoxynucleotides

PubMed Central

Jiang, Hongmei; Hu, Henggui; Zhang, Yali; Yue, Ping; Ning, Lichang; Zhou, Yan; Shi, Ping; Yuan, Rui

2017-01-01

Dendritic cells (DCs) play an important role in the initiation of autoimmunity in rheumatoid arthritis (RA); therefore, the use of DCs needs to be explored to develop new therapeutic approaches for RA. Here, we investigated the therapeutic effect of bovine type II collagen (BIIC)-loaded DCs modified with NF-κB decoy oligodeoxynucleotides (ODNs) on collagen-induced arthritis (CIA) in rats and explored the underlying mechanisms. DCs treated with BIIC and NF-κB decoy ODNs exhibited features of immature DCs with low levels of costimulatory molecule (CD80 and CD86) expression. The development of arthritis in rats with CIA injected with BIIC + NF-κB decoy ODN-propagated DCs (BIIC–decoy DCs) was significantly ameliorated compared to that in rats injected with BIIC-propagated DCs or phosphate-buffered saline. We also found that the BIIC–decoy DCs exerted antiarthritis effects by inhibiting self-lymphocyte proliferative response and suppressing IFN-γ and anti-BIIC antibody production and inducing IL-10 antibody production. Additionally, antihuman serum antibodies were successfully produced in the rats treated with BIIC–decoy DCs but not in those treated with NF-κB decoy ODN-propagated DCs; moreover, the BIIC–decoy DCs did not affect immune function in the normal rats. These findings suggested that NF-κB decoy ODN-modified DCs loaded with a specific antigen might offer a practical method for the treatment of human RA. PMID:29075103

Antisense suppression of phospholipase D alpha retards abscisic acid- and ethylene-promoted senescence of postharvest Arabidopsis leaves.

PubMed Central

Fan, L; Zheng, S; Wang, X

1997-01-01

Membrane disruption has been proposed to be a key event in plant senescence, and phospholipase D (PLD; EC 3.1.4.4) has been thought to play an important role in membrane deterioration. We recently cloned and biochemically characterized three different PLDs from Arabidopsis. In this study, we investigated the role of the most prevalent phospholipid-hydrolyzing enzyme, PLD alpha, in membrane degradation and senescence in Arabidopsis. The expression of PLD alpha was suppressed by introducing a PLD alpha antisense cDNA fragment into Arabidopsis. When incubated with abscisic acid and ethylene, leaves detached from the PLD alpha-deficient transgenic plants showed a slower rate of senescence than did those from wild-type and transgenic control plants. The retardation of senescence was demonstrated by delayed leaf yellowing, lower ion leakage, greater photosynthetic activity, and higher content of chlorophyll and phospholipids in the PLD alpha antisense leaves than in those of the wild type. Treatment of detached leaves with abscisic acid and ethylene stimulated PLD alpha expression, as indicated by increases in PLD alpha mRNA, protein, and activity. In the absence of abscisic acid and ethylene, however, detached leaves from the PLD alpha-deficient and wild-type plants showed a similar rate of senescence. In addition, the suppression of PLD alpha did not alter natural plant growth and development. These data suggest that PLD alpha is an important mediator in phytohormone-promoted senescence in detached leaves but is not a direct promoter of natural senescence. The physiological relevance of these findings is discussed. PMID:9437863

Stability of HTLV-2 antisense protein is controlled by PML nuclear bodies in a SUMO-dependent manner.

PubMed

Dubuisson, Louise; Lormières, Florence; Fochi, Stefania; Turpin, Jocelyn; Pasquier, Amandine; Douceron, Estelle; Oliva, Anaïs; Bazarbachi, Ali; Lallemand-Breitenbach, Valérie; De Thé, Hugues; Journo, Chloé; Mahieux, Renaud

2018-05-01

Since the identification of the antisense protein of HTLV-2 (APH-2) and the demonstration that APH-2 mRNA is expressed in vivo in most HTLV-2 carriers, much effort has been dedicated to the elucidation of similarities and/or differences between APH-2 and HBZ, the antisense protein of HTLV-1. Similar to HBZ, APH-2 negatively regulates HTLV-2 transcription. However, it does not promote cell proliferation. In contrast to HBZ, APH-2 half-life is very short. Here, we show that APH-2 is addressed to PML nuclear bodies in T-cells, as well as in different cell types. Covalent SUMOylation of APH-2 is readily detected, indicating that APH-2 might be addressed to the PML nuclear bodies in a SUMO-dependent manner. We further show that silencing of PML increases expression of APH-2, while expression of HBZ is unaffected. On the other hand, SUMO-1 overexpression leads to a specific loss of APH-2 expression that is restored upon proteasome inhibition. Furthermore, the carboxy-terminal LAGLL motif of APH-2 is responsible for both the targeting of the protein to PML nuclear bodies and its short half-life. Taken together, these observations indicate that natural APH-2 targeting to PML nuclear bodies induces proteasomal degradation of the viral protein in a SUMO-dependent manner. Hence, this study deciphers the molecular and cellular bases of APH-2 short half-life in comparison to HBZ and highlights key differences in the post-translational mechanisms that control the expression of both proteins.

An antisense RNA in a lytic cyanophage links psbA to a gene encoding a homing endonuclease.

PubMed

Millard, Andrew D; Gierga, Gregor; Clokie, Martha R J; Evans, David J; Hess, Wolfgang R; Scanlan, David J

2010-09-01

Cyanophage genomes frequently possess the psbA gene, encoding the D1 polypeptide of photosystem II. This protein is believed to maintain host photosynthetic capacity during infection and enhance phage fitness under high-light conditions. Although the first documented cyanophage-encoded psbA gene contained a group I intron, this feature has not been widely reported since, despite a plethora of new sequences becoming available. In this study, we show that in cyanophage S-PM2, this intron is spliced during the entire infection cycle. Furthermore, we report the widespread occurrence of psbA introns in marine metagenomic libraries, and with psbA often adjacent to a homing endonuclease (HE). Bioinformatic analysis of the intergenic region between psbA and the adjacent HE gene F-CphI in S-PM2 showed the presence of an antisense RNA (asRNA) connecting these two separate genetic elements. The asRNA is co-regulated with psbA and F-CphI, suggesting its involvement with their expression. Analysis of scaffolds from global ocean survey datasets shows this asRNA to be commonly associated with the 3' end of cyanophage psbA genes, implying that this potential mechanism of regulating marine 'viral' photosynthesis is evolutionarily conserved. Although antisense transcription is commonly found in eukaryotic and increasingly also in prokaryotic organisms, there has been no indication for asRNAs in lytic phages so far. We propose that this asRNA also provides a means of preventing the formation of mobile group I introns within cyanophage psbA genes.

PlantNATsDB: a comprehensive database of plant natural antisense transcripts.

PubMed

Chen, Dijun; Yuan, Chunhui; Zhang, Jian; Zhang, Zhao; Bai, Lin; Meng, Yijun; Chen, Ling-Ling; Chen, Ming

2012-01-01

Natural antisense transcripts (NATs), as one type of regulatory RNAs, occur prevalently in plant genomes and play significant roles in physiological and pathological processes. Although their important biological functions have been reported widely, a comprehensive database is lacking up to now. Consequently, we constructed a plant NAT database (PlantNATsDB) involving approximately 2 million NAT pairs in 69 plant species. GO annotation and high-throughput small RNA sequencing data currently available were integrated to investigate the biological function of NATs. PlantNATsDB provides various user-friendly web interfaces to facilitate the presentation of NATs and an integrated, graphical network browser to display the complex networks formed by different NATs. Moreover, a 'Gene Set Analysis' module based on GO annotation was designed to dig out the statistical significantly overrepresented GO categories from the specific NAT network. PlantNATsDB is currently the most comprehensive resource of NATs in the plant kingdom, which can serve as a reference database to investigate the regulatory function of NATs. The PlantNATsDB is freely available at http://bis.zju.edu.cn/pnatdb/.

The successes and future prospects of the linear antisense RNA amplification methodology.

PubMed

Li, Jifen; Eberwine, James

2018-05-01

It has been over a quarter of a century since the introduction of the linear RNA amplification methodology known as antisense RNA (aRNA) amplification. Whereas most molecular biology techniques are rapidly replaced owing to the fast-moving nature of development in the field, the aRNA procedure has become a base that can be built upon through varied uses of the technology. The technique was originally developed to assess RNA populations from small amounts of starting material, including single cells, but over time its use has evolved to include the detection of various cellular entities such as proteins, RNA-binding-protein-associated cargoes, and genomic DNA. In this Perspective we detail the linear aRNA amplification procedure and its use in assessing various components of a cell's chemical phenotype. This procedure is particularly useful in efforts to multiplex the simultaneous detection of various cellular processes. These efforts are necessary to identify the quantitative chemical phenotype of cells that underlies cellular function.

Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions.

PubMed

Vazquez-Anderson, Jorge; Mihailovic, Mia K; Baldridge, Kevin C; Reyes, Kristofer G; Haning, Katie; Cho, Seung Hee; Amador, Paul; Powell, Warren B; Contreras, Lydia M

2017-05-19

Current approaches to design efficient antisense RNAs (asRNAs) rely primarily on a thermodynamic understanding of RNA-RNA interactions. However, these approaches depend on structure predictions and have limited accuracy, arguably due to overlooking important cellular environment factors. In this work, we develop a biophysical model to describe asRNA-RNA hybridization that incorporates in vivo factors using large-scale experimental hybridization data for three model RNAs: a group I intron, CsrB and a tRNA. A unique element of our model is the estimation of the availability of the target region to interact with a given asRNA using a differential entropic consideration of suboptimal structures. We showcase the utility of this model by evaluating its prediction capabilities in four additional RNAs: a group II intron, Spinach II, 2-MS2 binding domain and glgC 5΄ UTR. Additionally, we demonstrate the applicability of this approach to other bacterial species by predicting sRNA-mRNA binding regions in two newly discovered, though uncharacterized, regulatory RNAs. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Crosslinking transcription factors to their recognition sequences with PtII complexes

NASA Technical Reports Server (NTRS)

Chu, B. C.; Orgel, L. E.

1992-01-01

We have prepared phosphorothioate-containing cyclic oligodeoxynucleotides that fold into 'dumbbells' containing CRE and TRE sequences, the binding sequences for the CREB and JUN proteins, respectively. Six phosphorothioate residues were introduced into each of the recognition sequences. K2PtCl4 crosslinks CRE to CREB and TRE to JUN. The extent of crosslinking is about eight times greater than that observed with standard oligodeoxynucleotides and amounts to 30-50% of the efficiency of non-covalent association as estimated by gel-shift assays. Crosslinking is reversed by incubation with NaCN. The crosslinking reaction is specific--a dumbbell oligonucleotide with six phosphorothioate groups introduced into the Sp1 recognition sequence could not be crosslinked efficiently to CREB or JUN proteins with K2PtCl4. The binding of TRE to CREB is not strong enough for effective detection by gel-shift assays, but the TRE-CREB complex is crosslinked efficiently by K2PtCl4 and can then readily be detected.

A Phase I, Randomised, First-in-Human Study of an Antisense Oligonucleotide Directed Against SOD1 Delivered Intrathecally in SOD1-Familial ALS Patients

PubMed Central

Miller, Timothy; Pestronk, Alan; David, William; Rothstein, Jeffrey; Simpson, Ericka; Appel, Stanley H.; Andres, Patricia L.; Mahoney, Katy; Allred, Peggy; Alexander, Katie; Ostrow, Lyle W.; Schoenfeld, David; Macklin, Eric A.; Norris, Daniel A.; Manousakis, Georgios; Crisp, Matthew; Smith, Richard; Bennett, C.F.; Bishop, Kathie; Cudkowicz, Merit E

2013-01-01

Objective To evaluate the safety, tolerability, and pharmacokinetics of an antisense oligonucleotide designed to inhibit SOD1 expression (ISIS 333611) following intrathecal administration in patients with SOD1-related familial amyotrophic lateral sclerosis (ALS). Background Mutations in SOD1 cause 13% of familial ALS. In animal studies, ISIS 333611 delivered to the cerebrospinal fluid (CSF) distributed to the brain and spinal cord, decreased SOD1 mRNA and protein levels in spinal cord tissue, and prolonged survival in the SOD1G93A rat ALS model. Methods In a randomized, placebo controlled Phase 1 trial, ISIS 333611 was delivered by intrathecal infusion using an external pump over 11.5 hours at increasing doses to four cohorts of eight SOD1 positive ALS subjects (randomized 6 drug: 2 placebo/cohort). Subjects were allowed to re-enroll in subsequent cohorts. Safety and tolerability assessments were made during the infusion and periodically over 28 days following the infusion. CSF and plasma drug levels were measured. Findings No dose-limiting toxicities were identified at doses up to 3.0 mg. No safety or tolerability concerns related to ISIS 333611 were identified. There were no serious adverse events (AEs) in ISIS 333611-treated subjects. Re-enrollment and re-dosing of subjects with ISIS 333611 was also well tolerated. Dose-dependent CSF and plasma concentrations were observed. Interpretation In this first clinical study to report intrathecal delivery of an antisense oligonucleotide, ISIS 333611 was well tolerated when administered as an intrathecal infusion in subjects with SOD1 familial ALS. CSF and plasma drug levels were consistent with levels predicted from preclinical studies. These results suggest that antisense oligonucleotide delivery to the central nervous system may be a feasible therapeutic strategy for neurological disorders. Source of funding ALS Association, Muscular Dystrophy Association, Isis Pharmaceuticals PMID:23541756

Exploration of Using Antisense Peptide Nucleic Acid (PNA)-cell Penetrating Peptide (CPP) as a Novel Bactericide against Fire Blight Pathogen Erwinia amylovora.

PubMed

Patel, Ravi R; Sundin, George W; Yang, Ching-Hong; Wang, Jie; Huntley, Regan B; Yuan, Xiaochen; Zeng, Quan

2017-01-01

Erwinia amylovora is a Gram-negative bacterial plant pathogen in the family Enterobacteriaceae and is the causal agent of fire blight, a devastating disease of apple and pear. Fire blight is traditionally managed by the application of the antibiotic streptomycin during bloom, but this strategy has been challenged by the development and spread of streptomycin resistance. Thus, there is an urgent need for effective, specific, and sustainable control alternatives for fire blight. Antisense antimicrobials are oligomers of nucleic acid homologs with antisense sequence of essential genes in bacteria. The binding of these molecules to the mRNA of essential genes can result in translational repression and antimicrobial effect. Here, we explored the possibility of developing antisense antimicrobials against E. amylovora and using these compounds in fire blight control. We determined that a 10-nucleotide oligomer of peptide nucleic acid (PNA) targeting the start codon region of an essential gene acpP is able to cause complete growth inhibition of E. amylovora . We found that conjugation of cell penetrating peptide (CPP) to PNA is essential for the antimicrobial effect, with CPP1 [(KFF)3K] being the most effective against E. amylovora . The minimal inhibitory concentration (MIC) of anti- acpP -CPP1 (2.5 μM) is comparable to the MIC of streptomycin (2 μM). Examination of the antimicrobial mechanisms demonstrated that anti- acpP -CPP1 caused dose-dependent reduction of acpP mRNA in E. amylovora upon treatment and resulted in cell death (bactericidal effect). Anti- acpP -CPP1 (100 μM) is able to effectively limit the pathogen growth on stigmas of apple flowers, although less effective than streptomycin. Finally, unlike streptomycin that does not display any specificity in inhibiting pathogen growth, anti- acpP -CPP1 has more specific antimicrobial effect against E. amylovora . In summary, we demonstrated that PNA-CPP can cause an effective, specific antimicrobial effect

Exploration of Using Antisense Peptide Nucleic Acid (PNA)-cell Penetrating Peptide (CPP) as a Novel Bactericide against Fire Blight Pathogen Erwinia amylovora

PubMed Central

Patel, Ravi R.; Sundin, George W.; Yang, Ching-Hong; Wang, Jie; Huntley, Regan B.; Yuan, Xiaochen; Zeng, Quan

2017-01-01

Erwinia amylovora is a Gram-negative bacterial plant pathogen in the family Enterobacteriaceae and is the causal agent of fire blight, a devastating disease of apple and pear. Fire blight is traditionally managed by the application of the antibiotic streptomycin during bloom, but this strategy has been challenged by the development and spread of streptomycin resistance. Thus, there is an urgent need for effective, specific, and sustainable control alternatives for fire blight. Antisense antimicrobials are oligomers of nucleic acid homologs with antisense sequence of essential genes in bacteria. The binding of these molecules to the mRNA of essential genes can result in translational repression and antimicrobial effect. Here, we explored the possibility of developing antisense antimicrobials against E. amylovora and using these compounds in fire blight control. We determined that a 10-nucleotide oligomer of peptide nucleic acid (PNA) targeting the start codon region of an essential gene acpP is able to cause complete growth inhibition of E. amylovora. We found that conjugation of cell penetrating peptide (CPP) to PNA is essential for the antimicrobial effect, with CPP1 [(KFF)3K] being the most effective against E. amylovora. The minimal inhibitory concentration (MIC) of anti-acpP-CPP1 (2.5 μM) is comparable to the MIC of streptomycin (2 μM). Examination of the antimicrobial mechanisms demonstrated that anti-acpP-CPP1 caused dose-dependent reduction of acpP mRNA in E. amylovora upon treatment and resulted in cell death (bactericidal effect). Anti-acpP-CPP1 (100 μM) is able to effectively limit the pathogen growth on stigmas of apple flowers, although less effective than streptomycin. Finally, unlike streptomycin that does not display any specificity in inhibiting pathogen growth, anti-acpP-CPP1 has more specific antimicrobial effect against E. amylovora. In summary, we demonstrated that PNA–CPP can cause an effective, specific antimicrobial effect against E

Reversal of human allergen-specific CRTH2+ T(H)2 cells by IL-12 or the PS-DSP30 oligodeoxynucleotide.

PubMed

Annunziato, F; Cosmi, L; Manetti, R; Brugnolo, F; Parronchi, P; Maggi, E; Nagata, K; Romagnani, S

2001-11-01

The chemoattractant receptor homologous molecule expressed on T(H)2 cells (CRTH2) is a receptor for prostaglandin D(2), which among human T cells is selectively expressed by T(H)2 and type 2 cytotoxic effectors. Our purpose was to assess whether the cytokine production profile of T(H)2 effectors could be reversed by exploiting their selective expression of CRTH2. CRTH2(+) T cells were purified from the blood of allergic subjects, stimulated with the specific allergen in the absence or presence of IL-12, and assessed by flow cytometry at the single-cell level for their ability to produce IL-4 and/or IFN-gamma after antigen or polyclonal stimulation. Both IL-12 and the PS-DSP30 oligodeoxynucleotide enabled CRTH2(+) allergen-stimulated T(H)2 cells to produce IFN-gamma. This change in the profile of cytokine production by T(H)2 cells from allergic subjects was related to the upregulation of IL-12 receptor beta2 chain and was associated with the loss of CRTH2. These data demonstrate that the cytokine production pattern of fully differentiated T(H)2 effectors can be changed to a less polarized profile, thus providing the physiologic basis for new immunotherapeutic strategies in allergic disorders.

Dose-Dependent Lowering of Mutant Huntingtin Using Antisense Oligonucleotides in Huntington Disease Patients.

PubMed

van Roon-Mom, Willeke M C; Roos, Raymund A C; de Bot, Susanne T

2018-04-01

On December 11 of 2017, Ionis Pharmaceuticals published a press release announcing dose-dependent reductions of mutant huntingtin protein in their HTTRx Phase 1/2a study in Huntington disease (HD) patients. The results from this Ionis trial have gained much attention from the patient community and the oligonucleotide therapeutics field, since it is the first trial targeting the cause of HD, namely the mutant huntingtin protein, using antisense oligonucleotides (ASOs). The press release also states that the primary endpoints of the study (safety and tolerability) were met, but does not contain data. This news follows the approval of another therapeutic ASO nusinersen (trade name Spinraza) for a neurological disease, spinal muscular atrophy, by the U.S. Food and Drug Administration and European Medicines Agency, in 2016 and 2017, respectively. Combined, this offers hope for the development of the HTTRx therapy for HD patients.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes.

PubMed

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard

2012-04-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

NATpipe: an integrative pipeline for systematical discovery of natural antisense transcripts (NATs) and phase-distributed nat-siRNAs from de novo assembled transcriptomes

PubMed Central

Yu, Dongliang; Meng, Yijun; Zuo, Ziwei; Xue, Jie; Wang, Huizhong

2016-01-01

Nat-siRNAs (small interfering RNAs originated from natural antisense transcripts) are a class of functional small RNA (sRNA) species discovered in both plants and animals. These siRNAs are highly enriched within the annealed regions of the NAT (natural antisense transcript) pairs. To date, great research efforts have been taken for systematical identification of the NATs in various organisms. However, developing a freely available and easy-to-use program for NAT prediction is strongly demanded by researchers. Here, we proposed an integrative pipeline named NATpipe for systematical discovery of NATs from de novo assembled transcriptomes. By utilizing sRNA sequencing data, the pipeline also allowed users to search for phase-distributed nat-siRNAs within the perfectly annealed regions of the NAT pairs. Additionally, more reliable nat-siRNA loci could be identified based on degradome sequencing data. A case study on the non-model plant Dendrobium officinale was performed to illustrate the utility of NATpipe. Finally, we hope that NATpipe would be a useful tool for NAT prediction, nat-siRNA discovery, and related functional studies. NATpipe is available at www.bioinfolab.cn/NATpipe/NATpipe.zip. PMID:26858106

[Anti-sense miRNA-21 oligonucleotide inhibits Tb 3.1 human tongue squamous cell carcinoma growth in vitro].

PubMed

Tao, Ying-jie; Ren, Yu; Dong, Jia-bin; Zhang, Lun; Cheng, Jun-ping; Zhou, Xuan

2011-02-01

To investigate the effect of micro RNA-21 (miRNA-21) knocking on the Tb3.1 human tongue squamous cell carcinoma growth. Anti-sense miRNA-21 oligonucleotide was delivered with oligofectamine to suppress Tb 3.1 tongue cancer cell growth in vitro. Real-time polymerase chain reaction (PCR) was conducted to detect the miRNA-21 expression after transfection. Methyl thiazolyl tetrazolium (MTT) assay was used to determine Tb 3.1 cell survival rate. Apoptosis were examined by flow-cytometry. Matrigel matrix and transwell assay were used to determine Tb 3.1 cell colony formation and migration ability. Antigen KI-67 (Ki67), B cell lymphoma (Bcl-2), phosphatase and tensin homolog (PTEN), matrirx metalloproteinase 2 (MMP-2, MMP-9) and tissue inhibitor of metalloproteinase 1 (TIMP-1) protein expression in Tb 3.1 cell were measured by Western blotting. miRNA-21 expression was decreased in miRNA-21 antisense oligonucleotide (ASODN) group. The survival rate of Tb 3.1 cells with AS-miRNA-21 transfection was significantly suppressed (F = 27.02, P = 0.00) and early phase apoptosis (F = 26.641, P = 0.001) induced in Tb 3.1 cell. Ki67, Bcl-2, MMP-2 and MMP-9 protein were down regulated while PTEN and TIMP-1 protein expression was increased. Blocking miRNA-21 expression in Tb3.1 cell could suppress cancer cell growth in vitro and miRNA-21 can serve as a novel target candidate for human tongue cancer gene therapy.

Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

PubMed

Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

2014-01-23

Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

PubMed Central

Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

2014-01-01

Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

Antisense pre-treatment increases gene therapy efficacy in dystrophic muscles.

PubMed

Peccate, Cécile; Mollard, Amédée; Le Hir, Maëva; Julien, Laura; McClorey, Graham; Jarmin, Susan; Le Heron, Anita; Dickson, George; Benkhelifa-Ziyyat, Sofia; Piétri-Rouxel, France; Wood, Matthew J; Voit, Thomas; Lorain, Stéphanie

2016-08-15

In preclinical models for Duchenne muscular dystrophy, dystrophin restoration during adeno-associated virus (AAV)-U7-mediated exon-skipping therapy was shown to decrease drastically after six months in treated muscles. This decline in efficacy is strongly correlated with the loss of the therapeutic AAV genomes, probably due to alterations of the dystrophic myofiber membranes. To improve the membrane integrity of the dystrophic myofibers at the time of AAV-U7 injection, mdx muscles were pre-treated with a single dose of the peptide-phosphorodiamidate morpholino (PPMO) antisense oligonucleotides that induced temporary dystrophin expression at the sarcolemma. The PPMO pre-treatment allowed efficient maintenance of AAV genomes in mdx muscles and enhanced the AAV-U7 therapy effect with a ten-fold increase of the protein level after 6 months. PPMO pre-treatment was also beneficial to AAV-mediated gene therapy with transfer of micro-dystrophin cDNA into muscles. Therefore, avoiding vector genome loss after AAV injection by PPMO pre-treatment would allow efficient long-term restoration of dystrophin and the use of lower and thus safer vector doses for Duchenne patients. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Neuron-derived orphan receptor 1 promoted human pulmonary artery smooth muscle cells proliferation.

PubMed

Wang, Chang-Guo; Lei, Wei; Li, Chang; Zeng, Da-Xiong; Huang, Jian-An

2015-05-01

As a transcription factor of the nuclear receptor superfamily, neuron-derived orphan receptor 1 (NOR1) is induced rapidly in response to various extracellular stimuli. But, it is still unclear its role in pulmonary artery smooth muscle cells proliferation. Human PASMCs were cultured in vitro and stimulated by serum. The special antisense oligodeoxynucleotides (AS-ODNs) were used to knockdown human NOR1 gene expression. Real-time PCR and Western-blot were used to evaluate the gene expression and protein levels. Fetal bovine serum (FBS) induced human PASMCs proliferation in a dose dependent manner. Furthermore, FBS promoted NOR1 gene expression in a dose dependent manner and a time dependent manner. 10% FBS induced a maximal NOR1 mRNA levels at 2 h. FBS also induced a significant higher NOR1 protein levels as compared with control. The NOR1 over-expressed plasmid significantly promoted DNA synthesis and cells proliferation. Moreover, the special AS-ODNs against human NOR1 not only prevented NOR1 expression but also inhibited DNA synthesis and cells proliferation significantly. The NOR1 over-expression plasmid could up-regulate cyclin D1 expression markedly, but the AS-ODNs inhibited cyclin D1 expression significantly. So, we concluded that NOR1 could promote human PASMCs proliferation. Cyclin D1 might be involved in this process.

Inhibition of Lactate Transport Erases Drug Memory and Prevents Drug Relapse.

PubMed

Zhang, Yan; Xue, Yanxue; Meng, Shiqiu; Luo, Yixiao; Liang, Jie; Li, Jiali; Ai, Sizhi; Sun, Chengyu; Shen, Haowei; Zhu, Weili; Wu, Ping; Lu, Lin; Shi, Jie

2016-06-01

Drug memories that associate drug-paired stimuli with the effects of abused drugs contribute to relapse. Exposure to drug-associated contexts causes consolidated drug memories to be in a labile state, during which manipulations can be given to impair drug memories. Although substantial evidence demonstrates the crucial role of neuronal signaling in addiction, little is known about the contribution of astrocyte-neuron communication. Rats were trained for cocaine-induced conditioned place preference (CPP) or self-administration and microinjected with the glycogen phosphorylation inhibitor 1,4-dideoxy-1,4-imino-D-arabinitol into the basolateral amygdala (BLA) immediately after retrieval. The concentration of lactate was measured immediately after retrieval via microdialysis, and the CPP score and number of nosepokes were recorded 24 hours later. Furthermore, we used antisense oligodeoxynucleotides to disrupt the expression of astrocytic lactate transporters (monocarboxylate transporters 1 and 2) in the BLA after retrieval, tested the expression of CPP 1 day later, and injected L-lactate into the BLA 15 minutes before retrieval to rescue the effects of the oligodeoxynucleotides. Injection of 1,4-dideoxy-1,4-imino-D-arabinitol into the BLA immediately after retrieval prevented the subsequent expression of cocaine-induced CPP, decreased the concentration of lactate in the BLA, and reduced the number of nosepokes for cocaine self-administration. Disrupting the expression of monocarboxylate transporters 1 and 2 in the BLA also caused subsequent deficits in the expression of cocaine-induced CPP, which was rescued by pretreatment with L-lactate. Our results suggest that astrocyte-neuron lactate transport in the BLA is critical for the reconsolidation of cocaine memory. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

A long natural-antisense RNA is accumulated in the conidia of Aspergillus oryzae.

PubMed

Tsujii, Masaru; Okuda, Satoshi; Ishi, Kazutomo; Madokoro, Kana; Takeuchi, Michio; Yamagata, Youhei

2016-01-01

Analysis of expressed sequence tag libraries from various culture conditions revealed the existence of conidia-specific transcripts assembled to putative conidiation-specific reductase gene (csrA) in Aspergillus oryzae. However, the all transcripts were transcribed with opposite direction to the gene csrA. The sequence analysis of the transcript revealed that the RNA overlapped mRNA of csrA with 3'-end, and did not code protein longer than 60 amino acid residues. We designated the transcript Conidia Specific Long Natural-antisense RNA (CSLNR). The real-time PCR analysis demonstrated that the CSLNR is conidia-specific transcript, which cannot be transcribed in the absence of brlA, and the amount of CSLNR was much more than that of the transcript from csrA in conidia. Furthermore, the csrA deletion, also lacking coding region of CSLNR in A. oryzae reduced the number of conidia. Overexpression of CsrA demonstrated the inhibition of growth and conidiation, while CSLNR did not affect conidiation.

Paired termini stabilize antisense RNAs and enhance conditional gene silencing in Escherichia coli.

PubMed

Nakashima, Nobutaka; Tamura, Tomohiro; Good, Liam

2006-01-01

Reliable methods for conditional gene silencing in bacteria have been elusive. To improve silencing by expressed antisense RNAs (asRNAs), we systematically altered several design parameters and targeted multiple reporter and essential genes in Escherichia coli. A paired termini (PT) design, where flanking inverted repeats create paired dsRNA termini, proved effective. PTasRNAs targeted against the ackA gene within the acetate kinase-phosphotransacetylase operon (ackA-pta) triggered target mRNA decay and a 78% reduction in AckA activity with high genetic penetrance. PTasRNAs are abundant and stable and function through an RNase III independent mechanism that requires a large stoichiometric excess of asRNA. Conditional ackA silencing reduced carbon flux to acetate and increased heterologous gene expression. The PT design also improved silencing of the essential fabI gene. Full anti-fabI PTasRNA induction prevented growth and partial induction sensitized cells to a FabI inhibitor. PTasRNAs have potential for functional genomics, antimicrobial discovery and metabolic flux control.

Poly(ester amine) Composed of Polyethylenimine and Pluronic Enhance Delivery of Antisense Oligonucleotides In Vitro and in Dystrophic mdx Mice

PubMed Central

Wang, Mingxing; Wu, Bo; Tucker, Jason D; Bollinger, Lauren E; Lu, Peijuan; Lu, Qilong

2016-01-01

A series of poly(esteramine)s (PEAs) constructed from low molecular weight polyethyleneimine (LPEI) and Pluronic were evaluated for the delivery of antisense oligonuclotides (AOs), 2′-O-methyl phosphorothioate RNA (2′-OMePS) and phosphorodiamidate morpholino oligomer (PMO) in cell culture and dystrophic mdx mice. Improved exon-skipping efficiency of both 2′-OMePS and PMO was observed in the C2C12E50 cell line with all PEA polymers compared with PEI 25k or LF-2k. The degree of efficiency was found in the order of PEA 01, PEA 04 > PEA 05 > others. The in vivo study in mdx mice demonstrated enhanced exon-skipping of 2′-OMePS with the order of PEA 06 > PEA 04, PEA 07 > PEA 03 > PEA 01 > others, and much higher than PEI 25k formulated 2′-OMePS. Exon-skipping efficiency of PMO in formulation with the PEAs were significantly enhanced in the order of PEA 02 > PEA 10 > PEA 01, PEA 03 > PEA 05, PEA 07, PEA 08 > others, with PEA 02 reaching fourfold of Endo-porter formulated PMO. PEAs improve PMO delivery more effectively than 2′-OMePS delivery in vivo, and the systemic delivery evaluation further highlight the efficiency of PEA for PMO delivery in all skeletal muscle. The results suggest that the flexibility of PEA polymers could be explored for delivery of different AO chemistries, especially for antisense therapy. PMID:27483024

CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

PubMed

Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

2009-04-06

The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

Latency of Epstein-Barr virus is stabilized by antisense-mediated control of the viral immediate-early gene BZLF-1.

PubMed

Prang, N; Wolf, H; Schwarzmann, F

1999-12-01

The ability of the Epstein-Barr virus (EBV) to avoid lytic replication and to establish a latent infection in B-lymphocytes is fundamental for its lifelong persistence and the pathogenesis of various EBV-associated diseases. The viral immediate-early gene BZLF-1 plays a key role for the induction of lytic replication and its activity is strictly regulated on different levels of gene expression. Recently, it was demonstrated that BZLF-1 is also controlled by a posttranscriptional mechanism. Transient synthesis of a mutated competitor RNA saturated this mechanism and caused both expression of the BZLF-1 protein and the induction of lytic viral replication. Using short overlapping fragments of the competitor, it is shown that this control acts on the unspliced primary transcript. RT-PCR demonstrated unspliced BZLF-1 RNA in latently infected B-lymphocytes in the absence of BZLF-1 protein. Due to the complementarity of the gene BZLF-1 and the latency-associated gene EBNA-1 on the opposite strand of the genome, we propose an antisense-mediated mechanism. RNase protection assays demonstrated transcripts in antisense orientation to the BZLF-1 transcript during latency, which comprise a comparable constellation to other herpesviruses. A combined RNAse protection/RT-PCR assay detected the double-stranded hybrid RNA, consisting of the unspliced BZLF-1 transcript and a noncoding intron of the EBNA-1 gene. Binding of BZLF-1 transcripts is suggested to be an important backup control mechanism in addition to transcriptional regulation, stabilizing latency and preventing inappropriate lytic viral replication in vivo. Copyright 1999 Wiley-Liss, Inc.

Gene silencing by siRNAs and antisense oligonucleotides in the laboratory and the clinic

PubMed Central

Watts, Jonathan K.; Corey, David R.

2014-01-01

Synthetic nucleic acids are commonly used laboratory tools for modulating gene expression and have the potential to be widely used in the clinic. Progress towards nucleic acid drugs, however, has been slow and many challenges remain to be overcome before their full impact on patient care can be understood. Antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) are the two most widely used strategies for silencing gene expression. We first describe these two approaches and contrast their relative strengths and weaknesses for laboratory applications. We then review the choices faced during development of clinical candidates and the current state of clinical trials. Attitudes towards clinical development of nucleic acid silencing strategies have repeatedly swung from optimism to depression during the past twenty years. Our goal is to provide the information needed to design robust studies with oligonucleotides, making use of the strengths of each oligonucleotide technology. PMID:22069063

Antisense myb inhibition of purified erythroid progenitors in development and differentiation is linked to cycling activity and expression of DNA polymerase alpha

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valtieri, M.; Venturelli, D.; Care, A.

These studies aimed to determine the expression and functional role of c-myb in erythroid progenitors with different cycling activities. In the first series of experiments the erythroid burst-forming unit (BFU-E) and colony-forming unit (CFU-E) populations from adult peripheral blood (PB), bone marrow (BM), and embryonic-fetal liver (FL) were treated with either c-myb antisense oligomers or 3H-thymidine (3H-TdR). A direct correlation was always observed between the inhibitory effect of anti-myb oligomers and the level of cycling activity. Thus, the inhibitory effect of antisense c-myb on the number of BFU-E colonies was 28.3% +/- 15.8% in PB, 53.4% +/- 9.3% in BM,more » and 68.2% +/- 24.5% in FL. Both adult and embryonic CFU-E were markedly inhibited. Using purified PB progenitors, we observed a similar pattern, although with slightly lower inhibitory effects. In the 3H-TdR suicide assay the killing index of BFU-E was 8.9% +/- 4.2% in PB, 29.4% +/- 6.5% in BM, and 40.1% +/- 9.6% in FL. The values for adult and embryonic CFU-E were 55.7% +/- 7.9% and 60.98% +/- 6.6%, respectively. We then investigated the kinetics of c-myb mRNA level during the erythroid differentiation of purified adult PB and FL BFU-E, as evaluated in liquid-phase culture by reverse transcription-polymerase chain reaction. Adult erythroid precursors showed a gradual increase of c-myb mRNA from day 4 through day 8 of culture and a sharp decrease at later times, whereas the expression of c-myb mRNA and protein in differentiation embryonic precursors peaked 2 days earlier. In both cases, c-myb mRNA level peaked at the CFU-E stage of differentiation. Finally, highly purified adult PB BFU-E were stimulated into cycling by a 3-day treatment with interleukin-3 in liquid phase: both the sensitivity to c-myb antisense oligomers and the 3H-TdR suicide index showed a gradual, strictly parallel increase.« less

The Effects of 2′-O-Methoxyethyl Containing Antisense Oligonucleotides on Platelets in Human Clinical Trials

PubMed Central

Baker, Brenda F.; Witztum, Joseph L.; Kwoh, T. Jesse; Pham, Nguyen C.; Salgado, Nelson; McEvoy, Bradley W.; Cheng, Wei; Hughes, Steven G.; Bhanot, Sanjay; Geary, Richard S.

2017-01-01

A thorough analysis of clinical trial data in the Ionis integrated safety database (ISDB) was performed to determine if there is a class effect on platelet numbers and function in subjects treated with 2′-O-methoxyethyl (2′MOE)-modified antisense oligonucleotides (ASOs). The Ionis ISDB includes over 2,600 human subjects treated with 16 different 2′MOE ASOs in placebo-controlled and open-label clinical trials over a range of doses up to 624 mg/week and treatment durations as long as 4.6 years. This analysis showed that there is no class generic effect on platelet numbers and no incidence of confirmed platelet levels below 50 K/μL in subjects treated with 2′MOE ASOs. Only 7 of 2,638 (0.3%) subjects treated with a 2′MOE ASO experienced a confirmed postbaseline (BSLN) platelet count between 100 and 50 K/μL. Three of sixteen 2′MOE ASOs had >10% incidence of platelet decreases >30% from BSLN, suggesting that certain sequences may associate with clinically insignificant platelet declines. Further to these results, we found no evidence that 2′MOE ASOs alter platelet function, as measured by the lack of clinically relevant bleeding in the presence or absence of other drugs that alter platelet function and/or number and by the results from trials conducted with the factor XI (FXI) ASO. PMID:28145801

The macrophage as a Trojan horse for antisense oligonucleotide delivery.

PubMed

Novak, James S; Jaiswal, Jyoti K; Partridge, Terence A

2018-06-04

The gateway to the promised land of gene therapy has been obstructed by the problem of accurate and efficient delivery of therapeutic agents to their target sites. This is true both of constructs designed to directly express proteins of interest, and of constructs or agents aimed at modifying the expression of endogenous genes. It is recognized as a major impediment to the effective application of genetic therapies currently or incipiently in clinical trial. Our recent study has examined the mechanism underlying delivery of therapeutic antisense oligonucleotides (ASO) for treating the devastating muscle disease Duchenne muscular dystrophy [1]. Working to understand the mode of ASO delivery in DMD, we discovered that inflammatory cells act as a depot that locally stores the intravenously administered ASO. This local depot of ASO then becomes available to the muscle fibres by way of satellite cells that deliver their cargo by fusion with damaged fibres during muscle repair. This finding points to a potentially novel strategy for systemic ASO delivery, involving the use of the inflammatory cell as a Trojan horse. Such an approach would have the benefit not only of enhancing tissue-specific delivery of ASO, but also of reducing the impact of their rapid clearance from the circulation. Here, we discuss the issues surrounding ASO-mediated exon skipping efficacy for DMD, and outline research aimed at improving targeted ASO delivery.

Phase I study of liposome-encapsulated c-raf antisense oligodeoxyribonucleotide infusion in combination with radiation therapy in patients with advanced malignancies.

PubMed

Dritschilo, Anatoly; Huang, Chao H; Rudin, Charles M; Marshall, John; Collins, Brian; Dul, Jeanne L; Zhang, Chuanbo; Kumar, Deepak; Gokhale, Prafulla C; Ahmad, Ateeq; Ahmad, Imran; Sherman, Jeffrey W; Kasid, Usha N

2006-02-15

Raf proteins are key elements of growth-related cellular signaling pathways and are a component of cancer cell resistance to radiation therapy. Antisense oligonucleotides to c-raf-1 permit highly selective inhibition of the gene product and offer a strategy for sensitizing cancer cells to radiation therapy. In this dose escalation study, we evaluated the safety of combined liposomal formulation of raf antisense oligonucleotide (LErafAON) and radiation therapy in patients with advanced malignancies. Patients with advanced solid tumors were treated with LErafAON in a phase I dose escalation study while receiving palliative radiation therapy. Drug-related and radiation-related toxicities were monitored. Pharmacokinetics and expression of c-raf-1 mRNA and Raf-1 protein were determined in peripheral blood mononuclear cells. Seventeen patients with palliative indications for radiation therapy were entered into this study. Thirteen patients received daily infusions of LErafAON and four received twice-weekly infusions. Radiation therapy was delivered in daily 300-cGy fractions over 2 weeks. Patients tolerated radiation, and no unexpected radiation-related side effects were observed. Drug-related reactions (grade > or =2), such as back pain, chills, dyspnea, fatigue, fever, flushing, and hypertension, were observed in most patients and were managed by premedication with corticosteroids and antihistamines. Serious adverse events occurred in five patients, including acute infusion-related symptoms, abnormal liver function tests, hypoxia, dehydration, diarrhea, esophagitis, fever, hypokalemia, pharyngitis, and tachypnea. Twelve of 17 patients were evaluable for tumor response at completion of treatment; four showed partial response, four showed stable disease, and four experienced progressive disease. The intact rafAON was detected in plasma for 30 minutes to several hours. Six patients with partial response or stable disease were evaluable for c-raf-1 mRNA and/or Raf-1

78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

Stability of dendriplexes formed by anti-HIV genetic material and poly(propylene imine) dendrimers in the presence of glucosaminoglycans.

PubMed

Szewczyk, Michal; Drzewinska, Joanna; Dzmitruk, Volha; Shcharbin, Dzmitry; Klajnert, Barbara; Appelhans, Dietmar; Bryszewska, Maria

2012-12-20

There are several barriers to the application of dendriplexes formed by poly(propylene imine) dendrimers and genetic material for gene therapy. One limitation is their interaction with extracellular matrix components such as glucosaminoglycans. These can displace the genetic material from the dendriplexes, affecting their transfection activity. In this study, we analyzed the interaction between dendriplexes and the four main glucosaminoglycans (heparin, heparan sulfate, chondroitin sulfate, and hyaluronic acid) by fluorescence polarization and gel electrophoresis. Dendriplexes were formed by combining three anti-HIV antisense oligodeoxynucleotides with three poly(propylene imine) dendrimers of the fourth generation: unmodified and partially modified with maltose and maltotriose (open shell glycodendrimers). The data showed that the effect of glucosaminoglycans on dendriplexes depends on the glucosaminoglycan type and the oligosaccharide serving as the surface group of the dendrimer. Heparin at physiological concentrations destroys dendriplexes formed by open shell glycodendrimers, but dendriplexes based on unmodified poly(propylene imine) dendrimers are stable in its presence. The other glucosaminoglycans at physiological concentrations cannot destroy dendriplexes formed by any of the dendrimers studied.

TGF-beta1 expression in EL4 lymphoma cells overexpressing growth hormone.

PubMed

Farmer, John T; Weigent, Douglas A

2006-03-01

Our previous studies show that growth hormone overexpression (GHo) upregulates the expression of the IGF-1R and IGF-2R resulting in the protection of the EL4 lymphoma cell line from apoptosis. In this study, we report that GHo also increases TGF-beta1 protein expression measured by luciferase promoter assay, Western analysis, and ELISA. Further, the data show that antibody to TGF-betaR2 decreases TGF-beta1 promoter activity to the level of vector alone control cells. GHo cells treated with (125)I-rh-latent TGF-beta1 showed increased activation of latent TGF-beta1 as measured by an increase in the active 24kDa, TGF-beta1 compared to vector alone control cells. The ability of endogenous GH to increase TGF-beta1 expression is blocked in EL4 cells by antisense but not sense oligodeoxynucleotides or in cells cultured with antibody to growth hormone (GH). The data suggest that endogenous GH may protect from apoptosis through the IGF-1R receptor while limiting cellular growth through increased expression and activation of TGF-beta1.

Sensitization of B-cell chronic lymphocytic leukemia cells to recombinant immunotoxin by immunostimulatory phosphorothioate oligodeoxynucleotides.

PubMed

Decker, Thomas; Hipp, Susanne; Kreitman, Robert J; Pastan, Ira; Peschel, Christian; Licht, Thomas

2002-02-15

A recombinant anti-CD25 immunotoxin, LMB-2, has shown clinical efficacy in hairy cell leukemia and T-cell neoplasms. Its activity in B-cell chronic lymphocytic leukemia (B-CLL) is inferior but might be improved if B-CLL cells expressed higher numbers of CD25 binding sites. It was recently reported that DSP30, a phosphorothioate CpG-oligodeoxynucleotide (CpG-ODN) induces immunogenicity of B-CLL cells by up-regulation of CD25 and other antigens. The present study investigated the antitumor activity of LMB-2 in the presence of DSP30. To this end, B-CLL cells from peripheral blood of patients were isolated immunomagnetically to more than 98% purity. Incubation with DSP30 for 48 hours augmented CD25 expression in 14 of 15 B-CLL samples, as assessed by flow cytometry. DSP30 increased LMB-2 cytotoxicity dose dependently whereas a control ODN with no CpG motif did not. LMB-2 displayed no antitumor cell activity in the absence of CpG-ODN as determined colorimetrically with an (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay. In contrast, B-CLL growth was inhibited in 12 of 13 samples with 50% inhibition concentrations (IC(50)) in the range of LMB-2 plasma levels achieved in clinical studies. Two samples were not evaluable because of spontaneous B-CLL cell death in the presence of DSP30. Control experiments with an immunotoxin that does not recognize hematopoietic cells, and an anti-CD22 immunotoxin, confirmed that sensitization to LMB-2 was specifically due to up-regulation of CD25. LMB-2 was much less toxic to normal B and T lymphocytes compared with B-CLL cells. In summary, immunostimulatory CpG-ODNs efficiently sensitize B-CLL cells to a recombinant immunotoxin by modulation of its target. This new treatment strategy deserves further attention.

Sustained delivery and efficacy of polymeric nanoparticles containing osteopontin and bone sialoprotein antisenses in rats with breast cancer bone metastasis.

PubMed

Elazar, Victoria; Adwan, Hassan; Bäuerle, Tobias; Rohekar, Keren; Golomb, Gershon; Berger, Martin R

2010-04-01

Poor prognosis in mammary carcinoma is associated with a certain expression profile of a defined set of genes including osteopontin and bone sialoprotein. Efficient and specific delivery of antisenses (AS) and a protection of the sequences from degradation are the crucial conditions for AS therapeutic efficiency. We hypothesized that effective and safe AS delivery direceted against these genes could be achieved by polymeric nanoparticles (NP) fabricated from a biocompatible polymer. Due to their nano-size range and small negative charge, AS-NP can overcome the absorption barrier offering increased resistance to nuclease degradation, sustained duration of AS administration, and consequently, prolonged antisense action. The ASs designed against OPN and BSP-II were successfully encapsulated in NP composed of the biodegradable and biocompatible polylactide-co-glycolide polymer (PLGA), exhibiting sustained release and stability of the ASs. The therapeutic efficacy of the AS-NP delivery system was examined in vitro, and in a breast cancer bone metastasis animal model of MDA-MB-231 human breast cancer cells in nude rats. Treatment with OPN-AS or BSP-AS loaded NP in comparison with osmotic mini-pumps (locoregional injection and SC implants, respectively) resulted in a significant decrease in both, tumor bone metastasis incidence and in the size of the lesions in rats with metastases. Despite its smaller dose, AS-NP exhibited a better therapeutic efficacy than osmotic mini-pumps in terms of lesion ratio at later time periods (8-12 weeks). It may be concluded that AS delivery by NP is a promising therapeutic modality providing stability of the encapsulated AS and a sustained release.

Deletion of the Noncoding GNAS Antisense Transcript Causes Pseudohypoparathyroidism Type Ib and Biparental Defects of GNAS Methylation in cis

PubMed Central

Chillambhi, Smitha; Turan, Serap; Hwang, Daw-Yang; Chen, Hung-Chun; Jüppner, Harald; Bastepe, Murat

2010-01-01

Context: GNAS encodes the α-subunit of the stimulatory G protein as well as additional imprinted transcripts including the maternally expressed NESP55 and the paternally expressed XLαs, antisense, and A/B transcripts. Most patients with pseudohypoparathyroidism type Ib (PHP-Ib) exhibit imprinting defects affecting the maternal GNAS allele, which are thought to reduce/abolish Gsα expression in renal proximal tubules and thereby cause resistance to PTH. Objective: Our objective was to define the genetic defect in a previously unreported family with autosomal dominant PHP-Ib. Design and Setting: Analyses of serum and urine chemistries and of genomic DNA and lymphoblastoid-derived RNA were conducted at a tertiary hospital and research laboratory. Patients: Affected individuals presented with muscle weakness and/or paresthesia and showed hypocalcemia, hyperphosphatemia, and elevated serum PTH. Obligate carriers were healthy and revealed no obvious abnormality in mineral ion homeostasis. Results: A novel 4.2-kb microdeletion was discovered in the affected individuals and the obligate carriers, ablating two noncoding GNAS antisense exons while preserving the NESP55 exon. On maternal transmission, the deletion causes loss of all maternal GNAS imprints, partial gain of NESP55 methylation, and PTH resistance. Paternal transmission of the mutation leads to epigenetic alterations in cis, including a partial loss of NESP55 methylation and a partial gain of A/B methylation. Conclusions: The identified deletion points to a unique cis-acting element located telomeric of the NESP55 exon that is critical for imprinting both GNAS alleles. These findings provide novel insights into the molecular mechanisms underlying PHP and GNAS imprinting. PMID:20444925

Fas-Antisense Long Noncoding RNA and Acute Myeloid Leukemia: Is There any Relation?

PubMed

Sayad, Arezou; Hajifathali, Abbas; Hamidieh, Amir Ali; Esfandi, Farbod; Taheri, Mohammad

2018-01-27

In recent years, lncRNAs have been considered as potential predictive biomarkers for prognosis of different human cancers. One example is the FAS antisense RNA 1 (FAS-AS1) located in the 10q23.31 region which is transcribed from the opposite strand of the FAS gene. FAS has an important role in regulation of apoptotic pathways and there is an inverse correlation between FAS-AS1 expression level and production of the soluble form of Fas, so that it might have potential as a therapeutic target to improve chemotherapy effectiveness. In the present study we therefore evaluated FAS-AS1 expression in blood samples of de novo AML patients and healthy controls using real-time quantitative reverse transcription-PCR (qRT-PCR). Our results indicated that the expression level of FAS-AS1 lncRNA demonstrated no significant difference between AML patients and healthy individuals. We conclude from the obtained data that FAS-AS1 is not an informative and reliable biomarker for AML diagnosis, although our results need to be confirmed in further studies. Creative Commons Attribution License

Paired termini stabilize antisense RNAs and enhance conditional gene silencing in Escherichia coli

PubMed Central

Nakashima, Nobutaka; Tamura, Tomohiro; Good, Liam

2006-01-01

Reliable methods for conditional gene silencing in bacteria have been elusive. To improve silencing by expressed antisense RNAs (asRNAs), we systematically altered several design parameters and targeted multiple reporter and essential genes in Escherichia coli. A paired termini (PT) design, where flanking inverted repeats create paired dsRNA termini, proved effective. PTasRNAs targeted against the ackA gene within the acetate kinase-phosphotransacetylase operon (ackA-pta) triggered target mRNA decay and a 78% reduction in AckA activity with high genetic penetrance. PTasRNAs are abundant and stable and function through an RNase III independent mechanism that requires a large stoichiometric excess of asRNA. Conditional ackA silencing reduced carbon flux to acetate and increased heterologous gene expression. The PT design also improved silencing of the essential fabI gene. Full anti-fabI PTasRNA induction prevented growth and partial induction sensitized cells to a FabI inhibitor. PTasRNAs have potential for functional genomics, antimicrobial discovery and metabolic flux control. PMID:17062631

Spirodi(iminohydantoin) Products from Oxidation of 2′-Deoxyguanosine in the Presence of NH4Cl in Nucleoside and Oligodeoxynucleotide Contexts

PubMed Central

2015-01-01

Upon oxidation of the heterocyclic ring in 2′-deoxyguanosine (dG), the initial electrophilic intermediate displays a wide range of reactivities with nucleophiles leading to many downstream products. In the present study, the product profiles were mapped when aqueous solutions of dG were allowed to react with NH4Cl in the presence of the photooxidants riboflavin and Rose Bengal as well as the diffusible one-electron oxidant Na2IrCl6. Product characterization identified the 2′-deoxyribonucleosides of spiroiminodihydantoin, 5-guanidinohydantoin, and oxazolone resulting from H2O as the nucleophile. When NH3 was the nucleophile, a set of constitutional isomers that are diastereotopic were also observed, giving characteristic masses of dG + 31. ESI+-MS/MS of these NH3 adducts identified them to be spirocycles with substitution of either the C5 or C8 carbonyl with an amine. The NH3 adducts exhibit acid-catalyzed hydrolysis to spiroiminodihydantoin. Quantification of the NH3 and H2O adducts resulting from oxidation of dG in the nucleoside, single-stranded, and duplex oligodeoxynucleotide contexts were monitored allowing mechanisms for product formation to be proposed. These data also provide a cautionary note to those who purify their oligonucleotide samples with ammonium salts before oxidation because this will lead to unwanted side reactions in which ammonia participates in product formation. PMID:25539403

Oligonucleotide treatment causes flax β-glucanase up-regulation via changes in gene-body methylation.

PubMed

Wojtasik, Wioleta; Kulma, Anna; Boba, Aleksandra; Szopa, Jan

2014-10-05

Nowadays, the challenge for biotechnology is to develop tools for agriculture and industry to provide plants characterized by productivity and quality that will satisfy the growing demand for different kinds of natural products. To meet the challenge, the generation and application of genetically modified plants is justified. However, the strong social resistance to genetically modified organisms and restrictive regulations in European Union countries necessitated the development of a new technology for new plant types generation which uses the knowledge resulting from analysis of genetically modified plants to generate favourably altered plants while omitting the introduction of heterologous genes to their genome. Four-year experiments led to the development of a technology inducing heritable epigenetic gene activation without transgenesis. The method comprises the induction of changes in methylation/demethylation of the endogenous gene by the plant's treatment with short oligodeoxynucleotides antisense to the coding region. In vitro cultured plants and F3 generation flax plants overproducing the β-1,3-glucanase gene (EMO-βGlu flax) were characterized by up-regulation of β-glucanase and chitinase genes, decreases in the methylation of CCGG sequences in the β-glucanase gene and in total DNA methylation and, more importantly, reasonable resistance against Fusarium infection. In addition, EMO-βGlu flax obtained by this technology showed similar features as those obtained by genetic engineering. To our best knowledge, this is the first report on plant gene activation by treatment with oligodeoxynucleotides homologous to the coding region of the gene. Apart from the evident effectiveness, the most important issue is that the EMO method allows generation of favourably altered plants, whose cultivation makes the plant producer independent from the complicated procedure of obtaining an agreement on GMO release into the environment and whose products might be more

Survival of Mice with Gastrointestinal Acute Radiation Syndrome through Control of Bacterial Translocation.

PubMed

Suzuki, Fujio; Loucas, Bradford D; Ito, Ichiaki; Asai, Akira; Suzuki, Sumihiro; Kobayashi, Makiko

2018-07-01

Macrophages (Mϕ) with the M2b phenotype (Pheno2b-Mϕ) in bacterial translocation sites have been described as cells responsible for the increased susceptibility of mice with gastrointestinal acute radiation syndrome to sepsis caused by gut bacteria. In this study, we tried to reduce the mortality of mice exposed to 7-10 Gy of gamma rays by controlling Pheno2b-Mϕ polarization in bacterial translocation sites. MicroRNA-222 was induced in association with gamma irradiation. Pheno2b-Mϕ polarization was promoted and maintained in gamma-irradiated mice through the reduction of a long noncoding RNA growth arrest-specific transcript 5 (a CCL1 gene silencer) influenced by this microRNA. Therefore, the host resistance of 7-9-Gy gamma-irradiated mice to sepsis caused by bacterial translocation was improved after treatment with CCL1 antisense oligodeoxynucleotide. However, the mortality of 10-Gy gamma-irradiated mice was not alleviated by this treatment. The crypts and villi in the ileum of 10-Gy gamma-irradiated mice were severely damaged, but these were markedly improved after transplantation of intestinal lineage cells differentiated from murine embryonic stem cells. All 10-Gy gamma-irradiated mice given both of the oligodeoxynucleotide and intestinal lineage cells survived, whereas all of the same mice given either of them died. These results indicate that high mortality rates of mice irradiated with 7-10 Gy of gamma rays are reducible by depleting CCL1 in combination with the intestinal lineage cell transplantation. These findings support the novel therapeutic possibility of victims who have gastrointestinal acute radiation syndrome for the reduction of their high mortality rates. Copyright © 2018 by The American Association of Immunologists, Inc.

Identification of a novel antisense long non-coding RNA PLA2G16-AS that regulates the expression of PLA2G16 in pigs.

PubMed

Liu, Pengliang; Jin, Long; Zhao, Lirui; Long, Keren; Song, Yang; Tang, Qianzi; Ma, Jideng; Wang, Xun; Tang, Guoqing; Jiang, Yanzhi; Zhu, Li; Li, Xuewei; Li, Mingzhou

2018-05-31

Natural antisense transcripts (NATs) are widely present in mammalian genomes and act as pivotal regulator molecules to control gene expression. However, studies on the NATs of pigs are relatively rare. Here, we identified a novel antisense transcript, designated PLA2G16-AS, transcribed from the phospholipase A2 group XVI locus (PLA2G16) in the porcine genome, which is a well-known regulatory molecule of fat deposition. PLA2G16-AS and PLA2G16 were dominantly expressed in porcine adipose tissue, and were differentially expressed between Tibetan pigs and Rongchang pigs. In addition, PLA2G16-AS has a weak sequence conservation among different vertebrates. PLA2G16-AS was also shown to form an RNA-RNA duplex with PLA2G16, and to regulate PLA2G16 expression at the mRNA level. Moreover, the overexpression of PLA2G16-AS increased the stability of PLA2G16 mRNA in porcine cells. We envision that our findings of a NAT for a regulatory gene associated with lipolysis might further our understanding of the molecular regulation of fat deposition. Copyright © 2017. Published by Elsevier B.V.

Antisense Oligonucleotides for the Treatment of Spinal Muscular Atrophy

PubMed Central

Porensky, Paul N.

2013-01-01

Abstract Spinal muscular atrophy (SMA) is an autosomal recessive disease affecting ∼1 in 10,000 live births. The most striking component is the loss of α-motor neurons in the ventral horn of the spinal cord, resulting in progressive paralysis and eventually premature death. There is no current treatment paradigm other than supportive care, though the past 15 years has seen a striking advancement in understanding of both SMA genetics and molecular mechanisms. A variety of disease-modifying interventions are rapidly bridging the translational gap from the laboratory to clinical trials, including the application of antisense oligonucleotide (ASO) therapy for the correction of aberrant RNA splicing characteristic of SMA. Survival motor neuron (SMN) is a ubiquitously expressed 38-kD protein. Humans have two genes that produce SMN, SMN1 and SMN2, the former of which is deleted or nonfunctional in the majority of patients with SMA. These two genes are nearly identical with one exception, a C to T transition (C6T) within exon 7 of SMN2. C6T disrupts a modulator of splicing, leading to the exclusion of exon 7 from ∼90% of the mRNA transcript. The resultant truncated Δ7SMN protein does not oligomerize efficiently and is rapidly degraded. SMA can therefore be considered a disease of too little SMN protein. A number of cis-acting splice modifiers have been identified in the region of exon 7, the steric block of which enhances the retention of the exon and a resultant full-length mRNA sequence. ASOs targeted to these splice motifs have shown impressive phenotype rescue in multiple SMA mouse models. PMID:23544870

Antisense RNA Strategies for Metabolic Engineering of Clostridium acetobutylicum

PubMed Central

Desai, Ruchir P.; Papoutsakis, Eleftherios T.

1999-01-01

We examined the effectiveness of antisense RNA (as RNA) strategies for metabolic engineering of Clostridium acetobutylicum. Strain ATCC 824(pRD4) was developed to produce a 102-nucleotide asRNA with 87% complementarity to the butyrate kinase (BK) gene. Strain ATCC 824(pRD4) exhibited 85 to 90% lower BK and acetate kinase specific activities than the control strain. Strain ATCC 824(pRD4) also exhibited 45 to 50% lower phosphotransbutyrylase (PTB) and phosphotransacetylase specific activities than the control strain. This strain exhibited earlier induction of solventogenesis, which resulted in 50 and 35% higher final concentrations of acetone and butanol, respectively, than the concentrations in the control. Strain ATCC 824(pRD1) was developed to putatively produce a 698-nucleotide asRNA with 96% complementarity to the PTB gene. Strain ATCC 824(pRD1) exhibited 70 and 80% lower PTB and BK activities, respectively, than the control exhibited. It also exhibited 300% higher levels of a lactate dehydrogenase activity than the control exhibited. The growth yields of ATCC 824(pRD1) were 28% less than the growth yields of the control. While the levels of acids were not affected in ATCC 824(pRD1) fermentations, the acetone and butanol concentrations were 96 and 75% lower, respectively, than the concentrations in the control fermentations. The lower level of solvent production by ATCC 824(pRD1) was compensated for by ∼100-fold higher levels of lactate production. The lack of any significant impact on butyrate formation fluxes by the lower PTB and BK levels suggests that butyrate formation fluxes are not controlled by the levels of the butyrate formation enzymes. PMID:10049845

Antisense RNA strategies for metabolic engineering of Clostridium acetobutylicum.

PubMed

Desai, R P; Papoutsakis, E T

1999-03-01

We examined the effectiveness of antisense RNA (as RNA) strategies for metabolic engineering of Clostridium acetobutylicum. Strain ATCC 824(pRD4) was developed to produce a 102-nucleotide asRNA with 87% complementarity to the butyrate kinase (BK) gene. Strain ATCC 824(pRD4) exhibited 85 to 90% lower BK and acetate kinase specific activities than the control strain. Strain ATCC 824(pRD4) also exhibited 45 to 50% lower phosphotransbutyrylase (PTB) and phosphotransacetylase specific activities than the control strain. This strain exhibited earlier induction of solventogenesis, which resulted in 50 and 35% higher final concentrations of acetone and butanol, respectively, than the concentrations in the control. Strain ATCC 824(pRD1) was developed to putatively produce a 698-nucleotide asRNA with 96% complementarity to the PTB gene. Strain ATCC 824(pRD1) exhibited 70 and 80% lower PTB and BK activities, respectively, than the control exhibited. It also exhibited 300% higher levels of a lactate dehydrogenase activity than the control exhibited. The growth yields of ATCC 824(pRD1) were 28% less than the growth yields of the control. While the levels of acids were not affected in ATCC 824(pRD1) fermentations, the acetone and butanol concentrations were 96 and 75% lower, respectively, than the concentrations in the control fermentations. The lower level of solvent production by ATCC 824(pRD1) was compensated for by approximately 100-fold higher levels of lactate production. The lack of any significant impact on butyrate formation fluxes by the lower PTB and BK levels suggests that butyrate formation fluxes are not controlled by the levels of the butyrate formation enzymes.

TSUNAMI: an antisense method to phenocopy splicing-associated diseases in animals

PubMed Central

Sahashi, Kentaro; Hua, Yimin; Ling, Karen K.Y.; Hung, Gene; Rigo, Frank; Horev, Guy; Katsuno, Masahisa; Sobue, Gen; Ko, Chien-Ping; Bennett, C. Frank; Krainer, Adrian R.

2012-01-01

Antisense oligonucleotides (ASOs) are versatile molecules that can be designed to specifically alter splicing patterns of target pre-mRNAs. Here we exploit this feature to phenocopy a genetic disease. Spinal muscular atrophy (SMA) is a motor neuron disease caused by loss-of-function mutations in the SMN1 gene. The related SMN2 gene expresses suboptimal levels of functional SMN protein due to alternative splicing that skips exon 7; correcting this defect—e.g., with ASOs—is a promising therapeutic approach. We describe the use of ASOs that exacerbate SMN2 missplicing and phenocopy SMA in a dose-dependent manner when administered to transgenic Smn−/− mice. Intracerebroventricular ASO injection in neonatal mice recapitulates SMA-like progressive motor dysfunction, growth impairment, and shortened life span, with α-motor neuron loss and abnormal neuromuscular junctions. These SMA-like phenotypes are prevented by a therapeutic ASO that restores correct SMN2 splicing. We uncovered starvation-induced splicing changes, particularly in SMN2, which likely accelerate disease progression. These results constitute proof of principle that ASOs designed to cause sustained splicing defects can be used to induce pathogenesis and rapidly and accurately model splicing-associated diseases in animals. This approach allows the dissection of pathogenesis mechanisms, including spatial and temporal features of disease onset and progression, as well as testing of candidate therapeutics. PMID:22895255

IB4(+) nociceptors mediate persistent muscle pain induced by GDNF.

PubMed

Alvarez, Pedro; Chen, Xiaojie; Bogen, Oliver; Green, Paul G; Levine, Jon D

2012-11-01

Skeletal muscle is a well-known source of glial cell line-derived neurotrophic factor (GDNF), which can produce mechanical hyperalgesia. Since some neuromuscular diseases are associated with both increased release of GDNF and intense muscle pain, we explored the role of GDNF as an endogenous mediator in muscle pain. Intramuscularly injected GDNF induced a dose-dependent (0.1-10 ng/20 μl) persistent (up to 3 wk) mechanical hyperalgesia in the rat. Once hyperalgesia subsided, injection of prostaglandin E(2) at the site induced a prolonged mechanical hyperalgesia (>72 h) compared with naïve rats (<4 h; hyperalgesic priming). Selective neurotoxic destruction of IB4(+) nociceptors attenuated both GDNF hyperalgesia and hyperalgesic priming. Ergonomic muscular injury induced by eccentric exercise or mechanical vibration increased muscle GDNF levels at 24 h, a time point where rats also exhibited marked muscle hyperalgesia. Intrathecal antisense oligodeoxynucleotides to mRNA encoding GFRα1, the canonical binding receptor for GDNF, reversibly inhibited eccentric exercise- and mechanical vibration-induced muscle hyperalgesia. Finally, electrophysiological recordings from nociceptors innervating the gastrocnemius muscle in anesthetized rats, revealed significant increase in response to sustained mechanical stimulation after local GDNF injection. In conclusion, these data indicate that GDNF plays a role as an endogenous mediator in acute and induction of chronic muscle pain, an effect likely to be produced by GDNF action at GFRα1 receptors located in IB4(+) nociceptors.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Vascular endothelial cells mediate mechanical stimulation-induced enhancement of endothelin hyperalgesia via activation of P2X2/3 receptors on nociceptors.

PubMed

Joseph, Elizabeth K; Green, Paul G; Bogen, Oliver; Alvarez, Pedro; Levine, Jon D

2013-02-13

Endothelin-1 (ET-1) is unique among a broad range of hyperalgesic agents in that it induces hyperalgesia in rats that is markedly enhanced by repeated mechanical stimulation at the site of administration. Antagonists to the ET-1 receptors, ET(A) and ET(B), attenuated both initial as well as stimulation-induced enhancement of hyperalgesia (SIEH) by endothelin. However, administering antisense oligodeoxynucleotide to attenuate ET(A) receptor expression on nociceptors attenuated ET-1 hyperalgesia but had no effect on SIEH, suggesting that this is mediated via a non-neuronal cell. Because vascular endothelial cells are both stretch sensitive and express ET(A) and ET(B) receptors, we tested the hypothesis that SIEH is dependent on endothelial cells by impairing vascular endothelial function with octoxynol-9 administration; this procedure eliminated SIEH without attenuating ET-1 hyperalgesia. A role for protein kinase Cε (PKCε), a second messenger implicated in the induction and maintenance of chronic pain, was explored. Intrathecal antisense for PKCε did not inhibit either ET-1 hyperalgesia or SIEH, suggesting no role for neuronal PKCε; however, administration of a PKCε inhibitor at the site of testing selectively attenuated SIEH. Compatible with endothelial cells releasing ATP in response to mechanical stimulation, P2X(2/3) receptor antagonists eliminated SIEH. The endothelium also appears to contribute to hyperalgesia in two ergonomic pain models (eccentric exercise and hindlimb vibration) and in a model of endometriosis. We propose that SIEH is produced by an effect of ET-1 on vascular endothelial cells, sensitizing its release of ATP in response to mechanical stimulation; ATP in turn acts at the nociceptor P2X(2/3) receptor.

Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides.

PubMed

Igreja, Susana; Clarke, Luka A; Botelho, Hugo M; Marques, Luís; Amaral, Margarida D

2016-02-01

Cystic fibrosis (CF), the most common life-threatening genetic disease in Caucasians, is caused by ∼2,000 different mutations in the CF transmembrane conductance regulator (CFTR) gene. A significant fraction of these (∼13%) affect pre-mRNA splicing for which novel therapies have been somewhat neglected. We have previously described the effect of the CFTR splicing mutation c.2657+5G>A in IVS16, showing that it originates transcripts lacking exon 16 as well as wild-type transcripts. Here, we tested an RNA-based antisense oligonucleotide (AON) strategy to correct the aberrant splicing caused by this mutation. Two AONs (AON1/2) complementary to the pre-mRNA IVS16 mutant region were designed and their effect on splicing was assessed at the RNA and protein levels, on intracellular protein localization and function. To this end, we used the 2657+5G>A mutant CFTR minigene stably expressed in HEK293 Flp-In cells that express a single copy of the transgene. RNA data from AON1-treated mutant cells show that exon 16 inclusion was almost completely restored (to 95%), also resulting in increased levels of correctly localized CFTR protein at the plasma membrane (PM) and with increased function. A novel two-color CFTR splicing reporter minigene developed here allowed the quantitative monitoring of splicing by automated microscopy localization of CFTR at the PM. The AON strategy is thus a promising therapeutic approach for the specific correction of alternative splicing. © 2015 WILEY PERIODICALS, INC.

Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

PubMed

Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

2011-10-01

Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

Antisense Proline-Arginine RAN dipeptides linked to C9ORF72-ALS/FTD form toxic nuclear aggregates that initiate in vitro and in vivo neuronal death

PubMed Central

Wen, Xinmei; Tan, Wenzhi; Westergard, Thomas; Krishnamurthy, Karthik; ShamamandriMarkandaiah, Shashirekha; Shi, Yingxiao; Lin, Shaoyu; Shneider, Neil A.; Monaghan, John; Pandey, Udai B.; Pasinelli, Piera; Ichida, Justin K.; Trotti, Davide

2015-01-01

SUMMARY Expanded GGGGCC nucleotide repeats within the C9ORF72 gene are the most common genetic mutation associated with both amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Sense and antisense transcripts of these expansions are translated to form five dipeptide repeat proteins (DRPs). We employed primary cortical and motor neuron cultures, live-cell imaging, and transgenic fly models and found that the arginine-rich dipeptides, in particular Proline-Arginine (PR), are potently neurotoxic. Factors that anticipated their neurotoxicity included aggregation in nucleoli, decreased number of processing bodies, and stress granules formation, implying global translational dysregulation as path accountable for toxicity. Nuclear PR aggregates were also found in human-induced motor neurons and postmortem spinal cord tissues from C9ORF72 ALS and ALS/FTD patients. Intronic G4C2 transcripts, but not loss of C9ORF72 protein, are also toxic to motor and cortical neurons. Interestingly, G4C2 transcript-mediated neurotoxicity synergizes with that of PR aggregates, suggesting convergence of mechanisms. PMID:25521377

RNA therapeutics: RNAi and antisense mechanisms and clinical applications.

PubMed

Chery, Jessica

2016-07-01

RNA therapeutics refers to the use of oligonucleotides to target primarily ribonucleic acids (RNA) for therapeutic efforts or in research studies to elucidate functions of genes. Oligonucleotides are distinct from other pharmacological modalities, such as small molecules and antibodies that target mainly proteins, due to their mechanisms of action and chemical properties. Nucleic acids come in two forms: deoxyribonucleic acids (DNA) and ribonucleic acids (RNA). Although DNA is more stable, RNA offers more structural variety ranging from messenger RNA (mRNA) that codes for protein to non-coding RNAs, microRNA (miRNA), transfer RNA (tRNA), short interfering RNAs (siRNAs), ribosomal RNA (rRNA), and long-noncoding RNAs (lncRNAs). As our understanding of the wide variety of RNAs deepens, researchers have sought to target RNA since >80% of the genome is estimated to be transcribed. These transcripts include non-coding RNAs such as miRNAs and siRNAs that function in gene regulation by playing key roles in the transfer of genetic information from DNA to protein, the final product of the central dogma in biology 1 . Currently there are two main approaches used to target RNA: double stranded RNA-mediated interference (RNAi) and antisense oligonucleotides (ASO). Both approaches are currently in clinical trials for targeting of RNAs involved in various diseases, such as cancer and neurodegeneration. In fact, ASOs targeting spinal muscular atrophy and amyotrophic lateral sclerosis have shown positive results in clinical trials 2 . Advantages of ASOs include higher affinity due to the development of chemical modifications that increase affinity, selectivity while decreasing toxicity due to off-target effects. This review will highlight the major therapeutic approaches of RNA medicine currently being applied with a focus on RNAi and ASOs.

Use of versican variant V3 and versican antisense expression to engineer cultured human skin containing increased content of insoluble elastin.

PubMed

Merrilees, Mervyn J; Falk, Ben A; Zuo, Ning; Dickinson, Michelle E; May, Barnaby C H; Wight, Thomas N

2017-01-01

Skin substitutes for repair of dermal wounds are deficient in functional elastic fibres. We report that the content of insoluble elastin in the dermis of cultured human skin can be increased though the use of two approaches that enhance elastogenesis by dermal fibroblasts, forced expression of versican variant V3, which lacks glycosaminoglycan (GAG) chains, and forced expression of versican antisense to decrease levels of versican variant V1 with GAG chains. Human dermal fibroblasts transduced with V3 or anti-versican were cultured under standard conditions over a period of 4 weeks to produce dermal sheets, with growth enhanced though multiple seedings for the first 3 weeks. Human keratinocytes, cultured in supplemented media, were added to the 4-week dermal sheets and the skin layer cultured for a further week. At 5 weeks, keratinocytes were multilayered and differentiated, with desmosome junctions thoughout and keratin deposits in the upper squamous layers. The dermal layer was composed of layered fibroblasts surrounded by extracellular matrix of collagen bundles and, in control cultures, small scattered elastin deposits. Forced expression of V3 and versican antisense slowed growth, decreased versican V1 expression, increased tropoelastin expression and/or the deposition of large aggregates of insoluble elastin in the dermal layer, and increased tissue stiffness, as measured by nano-indentation. Skin sheets were also cultured on Endoform Dermal Template™, the biodegradable wound dressing made from the lamina propria of sheep foregut. Skin structure and the enhanced deposition of elastin by forced expression of V3 and anti-versican were preserved on this supportive substrate. Copyright © 2014 John Wiley & Sons, Ltd. Copyright © 2014 John Wiley & Sons, Ltd.

Statistical Evaluation of the Rodin–Ohno Hypothesis: Sense/Antisense Coding of Ancestral Class I and II Aminoacyl-tRNA Synthetases

PubMed Central

Chandrasekaran, Srinivas Niranj; Yardimci, Galip Gürkan; Erdogan, Ozgün; Roach, Jeffrey; Carter, Charles W.

2013-01-01

We tested the idea that ancestral class I and II aminoacyl-tRNA synthetases arose on opposite strands of the same gene. We assembled excerpted 94-residue Urgenes for class I tryptophanyl-tRNA synthetase (TrpRS) and class II Histidyl-tRNA synthetase (HisRS) from a diverse group of species, by identifying and catenating three blocks coding for secondary structures that position the most highly conserved, active-site residues. The codon middle-base pairing frequency was 0.35 ± 0.0002 in all-by-all sense/antisense alignments for 211 TrpRS and 207 HisRS sequences, compared with frequencies between 0.22 ± 0.0009 and 0.27 ± 0.0005 for eight different representations of the null hypothesis. Clustering algorithms demonstrate further that profiles of middle-base pairing in the synthetase antisense alignments are correlated along the sequences from one species-pair to another, whereas this is not the case for similar operations on sets representing the null hypothesis. Most probable reconstructed sequences for ancestral nodes of maximum likelihood trees show that middle-base pairing frequency increases to approximately 0.42 ± 0.002 as bacterial trees approach their roots; ancestral nodes from trees including archaeal sequences show a less pronounced increase. Thus, contemporary and reconstructed sequences all validate important bioinformatic predictions based on descent from opposite strands of the same ancestral gene. They further provide novel evidence for the hypothesis that bacteria lie closer than archaea to the origin of translation. Moreover, the inverse polarity of genetic coding, together with a priori α-helix propensities suggest that in-frame coding on opposite strands leads to similar secondary structures with opposite polarity, as observed in TrpRS and HisRS crystal structures. PMID:23576570

Antisense Inhibition of the Iron-Sulphur Subunit of Succinate Dehydrogenase Enhances Photosynthesis and Growth in Tomato via an Organic Acid–Mediated Effect on Stomatal Aperture[W][OA

PubMed Central

Araújo, Wagner L.; Nunes-Nesi, Adriano; Osorio, Sonia; Usadel, Björn; Fuentes, Daniela; Nagy, Réka; Balbo, Ilse; Lehmann, Martin; Studart-Witkowski, Claudia; Tohge, Takayuki; Martinoia, Enrico; Jordana, Xavier; DaMatta, Fábio M.; Fernie, Alisdair R.

2011-01-01

Transgenic tomato (Solanum lycopersicum) plants expressing a fragment of the Sl SDH2-2 gene encoding the iron sulfur subunit of the succinate dehydrogenase protein complex in the antisense orientation under the control of the 35S promoter exhibit an enhanced rate of photosynthesis. The rate of the tricarboxylic acid (TCA) cycle was reduced in these transformants, and there were changes in the levels of metabolites associated with the TCA cycle. Furthermore, in comparison to wild-type plants, carbon dioxide assimilation was enhanced by up to 25% in the transgenic plants under ambient conditions, and mature plants were characterized by an increased biomass. Analysis of additional photosynthetic parameters revealed that the rate of transpiration and stomatal conductance were markedly elevated in the transgenic plants. The transformants displayed a strongly enhanced assimilation rate under both ambient and suboptimal environmental conditions, as well as an elevated maximal stomatal aperture. By contrast, when the Sl SDH2-2 gene was repressed by antisense RNA in a guard cell–specific manner, changes in neither stomatal aperture nor photosynthesis were observed. The data obtained are discussed in the context of the role of TCA cycle intermediates both generally with respect to photosynthetic metabolism and specifically with respect to their role in the regulation of stomatal aperture. PMID:21307286

Poly-L-arginine synergizes with oligodeoxynucleotides containing CpG-motifs (CpG-ODN) for enhanced and prolonged immune responses and prevents the CpG-ODN-induced systemic release of pro-inflammatory cytokines.

PubMed

Lingnau, Karen; Egyed, Alena; Schellack, Carola; Mattner, Frank; Buschle, Michael; Schmidt, Walter

2002-10-04

This study describes an entirely synthetic vaccine composed of antigenic peptides (T cell epitopes), oligodeoxynucleotides containing CpG-motifs (CpG-ODN) and poly-L-arginine (pR). CpG-ODN are known to be potent inducers of predominantly type 1-like immune responses, while polycationic amino acids, like pR, facilitate the uptake of antigens into antigen presenting cells (APCs). We demonstrate that the application of peptides and pR/CpG-ODN results in strongly enhanced peptide-specific immune responses as compared to the application of peptides with either of the immunomodulators alone. High numbers of antigen-specific T cells can be observed even after only one injection of the vaccine for a remarkably long period of time (at least 372 days). Furthermore, the potentially harmful systemic release of pro-inflammatory cytokines induced upon injection of CpG-ODN is inhibited. Thus, the combined application of CpG-ODN and pR may represent a novel vaccine strategy in humans.

Inhibition of Gene Expression in Escherichia coli by Antisense Phosphorodiamidate Morpholino Oligomers

PubMed Central

Geller, B. L.; Deere, J. D.; Stein, D. A.; Kroeker, A. D.; Moulton, H. M.; Iversen, P. L.

2003-01-01

Antisense phosphorodiamidate morpholino oligomers (PMOs) were tested for the ability to inhibit gene expression in Escherichia coli. PMOs targeted to either a myc-luciferase reporter gene product or 16S rRNA did not inhibit luciferase expression or growth. However, in a strain with defective lipopolysaccharide (lpxA mutant), which has a leaky outer membrane, PMOs targeted to the myc-luciferase or acyl carrier protein (acpP) mRNA significantly inhibited their targets in a dose-dependent response. A significant improvement was made by covalently joining the peptide (KFF)3KC to the end of PMOs. In strains with an intact outer membrane, (KFF)3KC-myc PMO inhibited luciferase expression by 63%. A second (KFF)3KC-PMO conjugate targeted to lacI mRNA induced β-galactosidase in a dose-dependent response. The end of the PMO to which (KFF)3KC is attached affected the efficiency of target inhibition but in various ways depending on the PMO. Another peptide-lacI PMO conjugate was synthesized with the cationic peptide CRRRQRRKKR and was found not to induce β-galactosidase. We conclude that the outer membrane of E. coli inhibits entry of PMOs and that (KFF)3KC-PMO conjugates are transported across both membranes and specifically inhibit expression of their genetic targets. PMID:14506035

Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

PubMed

Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

2005-02-01

CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

Glycogen Reduction in Myotubes of Late-Onset Pompe Disease Patients Using Antisense Technology.

PubMed

Goina, Elisa; Peruzzo, Paolo; Bembi, Bruno; Dardis, Andrea; Buratti, Emanuele

2017-09-06

Glycogen storage disease type II (GSDII) is a lysosomal disorder caused by the deficient activity of acid alpha-glucosidase (GAA) enzyme, leading to the accumulation of glycogen within the lysosomes. The disease has been classified in infantile and late-onset forms. Most late-onset patients share a splicing mutation c.-32-13T > G in intron 1 of the GAA gene that prevents efficient recognition of exon 2 by the spliceosome. In this study, we have mapped the splicing silencers of GAA exon 2 and developed antisense morpholino oligonucleotides (AMOs) to inhibit those regions and rescue normal splicing in the presence of the c.-32-13T > G mutation. Using a minigene approach and patient fibroblasts, we successfully increased inclusion of exon 2 in the mRNA and GAA enzyme production by targeting a specific silencer with a combination of AMOs. Most importantly, the use of these AMOs in patient myotubes results in a decreased accumulation of glycogen. To our knowledge, this is the only therapeutic approach resulting in a decrease of glycogen accumulation in patient tissues beside enzyme replacement therapy (ERT) and TFEB overexpression. As a result, it may represent a highly novel and promising therapeutic line for GSDII. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

CpG oligodeoxynucleotide induces apoptosis and cell cycle arrest in A20 lymphoma cells via TLR9-mediated pathways.

PubMed

Qi, Xu-Feng; Zheng, Li; Kim, Cheol-Su; Lee, Kyu-Jae; Kim, Dong-Heui; Cai, Dong-Qing; Qin, Jun-Wen; Yu, Yan-Hong; Wu, Zheng; Kim, Soo-Ki

2013-07-01

Recent studies have suggested that the anti-cancer activity of CpG-oligodeoxynucleotides (CpG-ODNs) is owing to their immunomodulatory effects in tumor-bearing host. The purpose of this study is to investigate the directly cytotoxic activity of KSK-CpG, a novel CpG-ODN with an alternative CpG motif, against A20 and EL4 lymphoma cells in comparison with previously used murine CpG motif (1826-CpG). To evaluate the potential cytotoxic effects of KSK-CpG on lymphoma cells, cell viability assay, confocal microscopy, flow cytometry, DNA fragmentation, Western blotting, and reverse transcription-polymerase chain reaction (RT-PCR) analysis were used. We found that KSK-CpG induced direct cytotoxicity in A20 lymphoma cells, but not in EL4 lymphoma cells, at least in part via TLR9-mediated pathways. Apoptotic cell death was demonstrated to play an important role in CpG-ODNs-induced cytotoxicity. In addition, both mitochondrial membrane potential decrease and G1-phase arrest were involved in KSK-CpG-induced apoptosis in A20 cells. The activities of apoptotic molecules such as caspase-3, PARP, and Bax were increased, but the activation of p27 Kip1 and ERK were decreased in KSK-CpG-treated A20 cells. Furthermore, autocrine IFN-γ partially contributed to apoptotic cell death in KSK-CpG-treated A20 cells. Collectively, our findings suggest that KSK-CpG induces apoptotic cell death in A20 lymphoma cells at least in part by inducing G1-phase arrest and autocrine IFN-γ via increasing TLR9 expression, without the need for immune system of tumor-bearing host. This new understanding supports the development of TLR9-targeted therapy with CpG-ODN as a direct therapeutic agent for treating B lymphoma. Copyright © 2013 Elsevier Ltd. All rights reserved.

Memory-influencing intra-basolateral amygdala drug infusions modulate expression of Arc protein in the hippocampus.

PubMed

McIntyre, Christa K; Miyashita, Teiko; Setlow, Barry; Marjon, Kristopher D; Steward, Oswald; Guzowski, John F; McGaugh, James L

2005-07-26

Activation of beta-adrenoceptors in the basolateral complex of the amygdala (BLA) modulates memory storage processes and long-term potentiation in downstream targets of BLA efferents, including the hippocampus. Here, we show that this activation also increases hippocampal levels of activity-regulated cytoskeletal protein (Arc), an immediate-early gene (also termed Arg 3.1) implicated in hippocampal synaptic plasticity and memory consolidation processes. Infusions of the beta-adrenoreceptor agonist, clenbuterol, into the BLA immediately after training on an inhibitory avoidance task enhanced memory tested 48 h later. The same dose of clenbuterol significantly increased Arc protein levels in the dorsal hippocampus. Additionally, posttraining intra-BLA infusions of a memory-impairing dose of lidocaine significantly reduced Arc protein levels in the dorsal hippocampus. Increases in Arc protein levels were not accompanied by increases in Arc mRNA, suggesting that amygdala modulation of Arc protein and synaptic plasticity in efferent brain regions occurs at a posttranscriptional level. Finally, infusions of Arc antisense oligodeoxynucleotides into the dorsal hippocampus impaired performance of an inhibitory avoidance task, indicating that the changes in Arc protein expression are related to the observed changes in memory performance.

Memory-influencing intra-basolateral amygdala drug infusions modulate expression of Arc protein in the hippocampus

PubMed Central

McIntyre, Christa K.; Miyashita, Teiko; Setlow, Barry; Marjon, Kristopher D.; Steward, Oswald; Guzowski, John F.; McGaugh, James L.

2005-01-01

Activation of β-adrenoceptors in the basolateral complex of the amygdala (BLA) modulates memory storage processes and long-term potentiation in downstream targets of BLA efferents, including the hippocampus. Here, we show that this activation also increases hippocampal levels of activity-regulated cytoskeletal protein (Arc), an immediate-early gene (also termed Arg 3.1) implicated in hippocampal synaptic plasticity and memory consolidation processes. Infusions of the β-adrenoreceptor agonist, clenbuterol, into the BLA immediately after training on an inhibitory avoidance task enhanced memory tested 48 h later. The same dose of clenbuterol significantly increased Arc protein levels in the dorsal hippocampus. Additionally, posttraining intra-BLA infusions of a memory-impairing dose of lidocaine significantly reduced Arc protein levels in the dorsal hippocampus. Increases in Arc protein levels were not accompanied by increases in Arc mRNA, suggesting that amygdala modulation of Arc protein and synaptic plasticity in efferent brain regions occurs at a posttranscriptional level. Finally, infusions of Arc antisense oligodeoxynucleotides into the dorsal hippocampus impaired performance of an inhibitory avoidance task, indicating that the changes in Arc protein expression are related to the observed changes in memory performance. PMID:16020527

Persistent increased PKMζ in long-term and remote spatial memory.

PubMed

Hsieh, Changchi; Tsokas, Panayiotis; Serrano, Peter; Hernández, A Iván; Tian, Dezhi; Cottrell, James E; Shouval, Harel Z; Fenton, André Antonio; Sacktor, Todd Charlton

2017-02-01

PKMζ is an autonomously active PKC isoform that is thought to maintain both LTP and long-term memory. Whereas persistent increases in PKMζ protein sustain the kinase's action in LTP, the molecular mechanism for the persistent action of PKMζ during long-term memory has not been characterized. PKMζ inhibitors disrupt spatial memory when introduced into the dorsal hippocampus from 1day to 1month after training. Therefore, if the mechanisms of PKMζ's persistent action in LTP maintenance and long-term memory were similar, persistent increases in PKMζ would last for the duration of the memory, far longer than most other learning-induced gene products. Here we find that spatial conditioning by aversive active place avoidance or appetitive radial arm maze induces PKMζ increases in dorsal hippocampus that persist from 1day to 1month, coinciding with the strength and duration of memory retention. Suppressing the increase by intrahippocampal injections of PKMζ-antisense oligodeoxynucleotides prevents the formation of long-term memory. Thus, similar to LTP maintenance, the persistent increase in the amount of autonomously active PKMζ sustains the kinase's action during long-term and remote spatial memory maintenance. Copyright © 2016. Published by Elsevier Inc.

Cell-adhesion molecules in memory formation.

PubMed

Schmidt, R

1995-01-23

After learning events the CNS of higher organisms selects, which acquired informations are permanently stored as a memory trace. This period of memory consolidation is susceptible to interference by biochemical inhibitors of transcription and translation. Ependymin is a specific CNS glycoprotein functionally involved in memory consolidation in goldfish: after active shock-avoidance conditioning ependymin mRNA is rapidly induced in meningeal fibroblasts followed by enhanced synthesis and secretion of several closely related forms of the protein. Intracranial injections of anti-ependymin antisera or antisense oligodeoxynucleotides interfere specifically with memory consolidation, indicating that only de novo synthesized ependymin molecules are involved. Ependymin is capable of directing the growth of central axons in vitro and participates in neuronal regeneration in situ, presumably by its HNK-1 cell-adhesion epitope. Experiments reviewed in this article suggest a model that involves two regulation mechanisms for the function of ependymin in behavioural plasticity: while hormones appear to determine, how much of this cell adhesion molecule is synthesized after learning, local changes of metal cation concentrations in the micro-environment of activated neurons may polymerize ependymin at those synapses, that have to be consolidated to improve their efficacy for future use.

TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

PubMed Central

Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

2016-01-01

Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

PubMed

Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

2016-07-01

Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

[Chromosome study on chronic lymphocytic leukemia using CpG-oligodeoxynucleotide as immunostimulant agent].

PubMed

Wu, Yafang; Xue, Yongquan; Chen, Suning; Yao, Li; Jiang, Hui; Zhang, Jun; Shen, Juan; Pan, Jinlan; Wang, Yong; Bai, Shuxiao

2010-02-01

To investigate whether CpG-oligodeoxynucleotide (CpG-ODN) can improve the detection rate of the karyotypic abnormalities in chronic lymphocytic leukemia (CLL). The bone marrow (BM) or peripheral blood (PB) cells from 57 cases of CLL were collected and cultured with CpG-ODN DSP30+interleukin-2 (IL-2), phytohemagglutinin (PHA), pokeweed (PWM) or IL-2, respectively. Five days later cells were harvested for chromosome preparation. Karyotypic analysis was done using R banding technique. Panel fluorescence in situ hybridization (FISH) was carried out on 19 cases of CLL with normal karyotypes using the following probes: Cen12, D13S25, Rb1, ATM, p53, MYB and IgH. Genomic DNA from 21 cases of them was extracted from BM or PB leukocytes. The immunoglobulin variable heavy chain (IgVH) was amplified by polymerase chain reaction (PCR) and sequenced. CD38 and ZAP70 expressions in the leukemic cells were determined by flow cytometry (FCM). The detection rate of karyotypic abnormalities in the CpG-ODN+IL-2 group (43.85%) was obviously higher than that in the PHA (15.09%), PWM (17.31%) and IL-2 (3.13%) groups (P<0.01). Fifty-two types of karyotypic abnormalities were found. Among them, trisomy12 (+12) or +12 with other abnormalities were the most common, while translocations were the most frequent structural abnormalities including 3 unbalanced and 11 balanced translocations, among them 7 had rearrangements involving 14q32. Thirteen cases showed one or more abnormalities on FISH including trisomy 12 and p53 deletion each in one case, IgH rearrangement and partial deletion each in one case, 13q14.3 deletion in 11 cases of which 5 cases also had Rb1 deletion, 1 case had Rb1 partial deletion. No case with ATM or MYB deletions was found. PCR detected IgVH mutations in 10/21 cases. FCM showed 10/45 cases were CD38 positive, but 35 /45 were CD38 negative, 11/27 cases expressed ZAP70, but 16/27 did not. Among the 26 cases examined for CD38 and ZAP70 expressions simultaneously, 5 cases

Thiolated chitosan nanoparticles as a delivery system for antisense therapy: evaluation against EGFR in T47D breast cancer cells.

PubMed

Talaei, Fatemeh; Azizi, Ebrahim; Dinarvand, Rassoul; Atyabi, Fatemeh

2011-01-01

Thiolated chitosan has high transfection and mucoadhesive properties. We investigated the potential of two recently synthesized polymers: NAC-C (N-acetyl cysteine-chitosan) and NAP-C (N-acetyl penicillamine-chitosan) in anticancer drug delivery targeting epidermal growth factor receptor (EGFR). Doxorubicin (DOX) and antisense oligonucleotide (ASOND)-loaded polymer nanoparticles were prepared in water by a gelation process. Particle characterization, drug loading, and drug release were evaluated. To verify drug delivery efficiency in vitro experiments on a breast cancer cell line (T47D) were performed. EGFR gene and protein expression was analyzed by real time quantitative polymerase chain reaction and Western blotting, respectively. A loading percentage of 63% ± 5% for ASOND and 70% ± 5% for DOX was achieved. Drug release data after 15 hours showed that ASOND and DOX were completely released from chitosan-based particles while a lower and more sustained release of only 22% ± 8% was measured for thiolated particles. In a cytosol simulated release medium/reducing environment, such as found intracellularly, polymer-based nanoparticles dissociated, liberating approximately 50% of both active substances within 7 hours. ASOND-loaded polymer nanoparticles had higher stability and high mucoadhesive properties. The ASOND-loaded thiolated particles significantly suppressed EGFR gene expression in T47D cells compared with ASOND-loaded chitosan particles and downregulated EGFR protein expression in cells. This study could facilitate future investigations into the functionality of NAP-C and NAC-C polymers as an efficient ASOND delivery system in vitro and in vivo.

[Optimizing condition for oligofectamine-mediated SP1 decoy oligodeoxynucleotides transfection into SV-40-PED cells].

PubMed

Huang, Yabing; Xu, Jing; Chen, Song

2007-08-01

To determine the optimizing parameters in transfecting the SV-40-PED cells mediated by oligofectamine. With a change of Decoy oligodeoxynucleotides (ODNs)/oligofectamine in ratio and the transfection time, the uptake rate and the mean fluorescence intensity of SP1 ODNs in the SV-40-PED cells were measured by flow cytometry to evaluate the transfection efficiencies. 4 microl oligofectamine with different concentrations of ODNs(2.5, 5.0, 7.5, 10.0 and 12.5 microl) were put into 100 microl of DMEM without serum and antibiotics. the (SV-40-PED) cells were transfected after 20 min at room temperature. the final concentration of SP1 decay ODNs were 50,100, 150, 200 and 250 nmol/L. Transfection effieiency was detected at 26 h after transfection. The intracellular distribution of SP1 ODNs was determined with a fluorescence microscope. The lactate dehydrogenase (LDH) activity in the supernatant was measured to assess the cytotoxicity. The uptake of SP1 ODNs into the SV-40-PED cells was significantly improved by oligofectamine. The cell appearance did not change much in the groups of 50, 100 and 150 nmol/L. In the groups of 200 and 250 nmol/L, the cell reverted after being shrinked and altered to round. At 26 h after the transfection, there was no marked change in the cell form at the concentration of 250 nmol/L. There was floatation at 48 and 72 h after the transfection. Under the fluorescence microscope, we observed fluorescent materials distributed in the cell nucleus in the successfully-transferred groups. We could see the nucleoli clearly in the groups of 200 nmol/L and 250 nmol/L. There was a stronger fluorescence intensity with a higher concentration and the fluorescent materials gathered at the cell nucleus. At the final concentration of 250 nmol/L, the LDH level was 137.12+/-3.92 U/L in the 72-h group, which was significantly higher those that in the 26-h group (49.61+/-17.13 U/L) and the 48-h group (120.26 +/- 8.42 U/L) (P<0.01). At 26 h after the transfection

Immunostimulation by cytosine-phosphate-guanine oligodeoxynucleotides in combination with IL-2 can improve the success rate of karyotype analysis in chronic lymphocytic leukaemia.

PubMed

Lin, Xiaolan; Chen, Jiadi; Huang, Huifang

2016-07-01

To assess whether immunostimulatory cytosine-phosphate-guanine oligodeoxynucleotides (CpG-ODN) combined with interleukin-2 (IL-2) improves the number of mitotic metaphases and the detection rate of chromosomal abnormalities in chronic lymphocytic leukaemia (CLL). Bone marrow specimens were collected from 36 patients with CLL. CLL cells were cultured with CpG-ODN type DSP30 plus IL-2 for 72 h, following which R-banding analysis was conducted. Conventional culture without the immunostimulant served as the control group. The incidence of genetic abnormalities was measured by fluorescence in situ hybridisation (FISH) using a panel of five specific probes: D13S25 (13q14.3), RB1 (13q14), P53 (17p13), ATM (11q22.3) and CSP12 (trisomy 12, +12). In the control group, chromosome analysis achieved a success rate of only 22.2, and 11.1% of abnormal karyotypes were detected. After immunostimulation with DSP30 plus IL-2, chromosome analysis achieved a success rate of up to 91.6, and 41.6% of abnormal karyotypes were detected. FISH analysis detected 77.7% of abnormalities. FISH combined with CpG-ODN DSP30 plus IL-2 improved the detection rate of chromosomal abnormalities in CLL to 83.3%. CpG-ODN DSP30 combined with IL-2 is effective in improving the detection rate of chromosomal abnormalities in CLL cells. This combination with FISH analysis is conducive to increasing the detection rate of genetic abnormalities in CLL.

[Influence of antisense RNA and sequences of viral transactivators traps on RNA synthesis of HTLV-1 virus].

PubMed

Borisenko, A S; Kotus, E V; Kaloshin, A A

2008-01-01

Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.

Nuclear receptor coactivators function in estrogen receptor- and progestin receptor-dependent aspects of sexual behavior in female rats

PubMed Central

Molenda-Figueira, Heather A.; Williams, Casey A.; Griffin, Andreana L.; Rutledge, Eric M.; Blaustein, Jeffrey D.; Tetel, Marc J.

2008-01-01

The ovarian hormones, estradiol (E) and progesterone (P) facilitate the expression of sexual behavior in female rats. E and P mediate many of these behavioral effects by binding to their respective intracellular receptors in specific brain regions. Nuclear receptor coactivators, including Steroid Receptor Coactivator-1 (SRC-1) and CREB Binding Protein (CBP), dramatically enhance ligand-dependent steroid receptor transcriptional activity in vitro. Previously, our lab has shown that SRC-1 and CBP modulate estrogen receptor (ER)-mediated induction of progestin receptor (PR) gene expression in the ventromedial nucleus of the hypothalamus (VMN) and hormone-dependent sexual receptivity in female rats. Female sexual behaviors can be activated by high doses of E alone in ovariectomized rats, and thus are believed to be ER-dependent. However, the full repertoire of female sexual behavior, in particular, proceptive behaviors such as hopping, darting and ear wiggling, are considered to be PR-dependent. In the present experiments, the function of SRC-1 and CBP in distinct ER- (Exp. 1) and PR- (Exp. 2) dependent aspects of female sexual behavior was investigated. In Exp. 1, infusion of antisense oligodeoxynucleotides to SRC-1 and CBP mRNA into the VMN decreased lordosis intensity in rats treated with E alone, suggesting that these coactivators modulate ER-mediated female sexual behavior. In Exp. 2, antisense to SRC-1 and CBP mRNA around the time of P administration reduced PR-dependent ear wiggling and hopping and darting. Taken together, these data suggest that SRC-1 and CBP modulate ER and PR action in brain and influence distinct aspects of hormone-dependent sexual behaviors. These findings support our previous studies and provide further evidence that SRC-1 and CBP function together to regulate ovarian hormone action in behaviorally-relevant brain regions. PMID:16769066

Modulation of tumor eIF4E by antisense inhibition: A phase I/II translational clinical trial of ISIS 183750-an antisense oligonucleotide against eIF4E-in combination with irinotecan in solid tumors and irinotecan-refractory colorectal cancer.

PubMed

Duffy, A G; Makarova-Rusher, O V; Ulahannan, S V; Rahma, O E; Fioravanti, S; Walker, M; Abdullah, S; Raffeld, M; Anderson, V; Abi-Jaoudeh, N; Levy, E; Wood, B J; Lee, S; Tomita, Y; Trepel, J B; Steinberg, S M; Revenko, A S; MacLeod, A R; Peer, C J; Figg, W D; Greten, T F

2016-10-01

The eukaryotic translation initiation factor 4E (eIF4E) is a potent oncogene that is found to be dysregulated in 30% of human cancer, including colorectal carcinogenesis (CRC). ISIS 183750 is a second-generation antisense oligonucleotide (ASO) designed to inhibit the production of the eIF4E protein. In preclinical studies we found that EIF4e ASOs reduced expression of EIF4e mRNA and inhibited proliferation of colorectal carcinoma cells. An additive antiproliferative effect was observed in combination with irinotecan. We then performed a clinical trial evaluating this combination in patients with refractory cancer. No dose-limiting toxicities were seen but based on pharmacokinetic data and tolerability the dose of irinotecan was reduced to 160 mg/m(2) biweekly. Efficacy was evaluated in 15 patients with irinotecan-refractory colorectal cancer. The median time of disease control was 22.1 weeks. After ISIS 183750 treatment, peripheral blood levels of eIF4E mRNA were decreased in 13 of 19 patients. Matched pre- and posttreatment tumor biopsies showed decreased eIF4E mRNA levels in five of nine patients. In tumor tissue, the intracellular and stromal presence of ISIS 183750 was detected by IHC in all biopsied patients. Although there were no objective responses stable disease was seen in seven of 15 (47%) patients who were progressing before study entry, six of whom were stable at the time of the week 16 CT scan. We were also able to confirm through mandatory pre- and posttherapy tumor biopsies penetration of the ASO into the site of metastasis. © 2016 UICC.

The reduction in small ribosomal subunit abundance in ethanol-stressed cells of Bacillus subtilis is mediated by a SigB-dependent antisense RNA.

PubMed

Mars, Ruben A T; Mendonça, Karoline; Denham, Emma L; van Dijl, Jan Maarten

2015-10-01

One of the best-characterized general stress responses in bacteria is the σB-mediated stress response of the Gram-positive soil bacterium Bacillus subtilis. The σB regulon contains approximately 200 protein-encoding genes and 136 putative regulatory RNAs. One of these σB-dependent RNAs, named S1136-S1134, was recently mapped as being transcribed from the S1136 promoter on the opposite strand of the essential rpsD gene, which encodes the ribosomal primary-binding protein S4. Accordingly, S1136-S1134 transcription results in an rpsD-overlapping antisense RNA (asRNA). Upon exposure of B. subtilis to ethanol, the S1136 promoter was found to be induced, while rpsD transcription was downregulated. By quantitative PCR, we show that the activation of transcription from the S1136 promoter is directly responsible for the downregulation of rpsD upon ethanol exposure. We also show that this downregulation of rpsD leads to a reduced level of the small (30S) ribosomal subunit upon ethanol stress. The activation of the S1136 promoter thus represents the first example of antisense transcription-mediated regulation in the general stress response of B. subtilis and implicates the reduction of ribosomal protein abundance as a new aspect in the σB-dependent stress response. We propose that the observed reduction in the level of the small ribosomal subunit, which contains the ribosome-decoding center, may protect B. subtilis cells against misreading and spurious translation of possibly toxic aberrant peptides under conditions of ethanol stress. Copyright © 2015 Elsevier B.V. All rights reserved.

[Inhibition of antisense-endothelin converting enzyme RNA on interleukin-5 released from dust mite-challenged peripheral blood mononuclear cells in patients with allergic asthma].

PubMed

Li, Li; Xu, Ju; Zhong, Nan-shan

2003-09-01

To investigate the effect of antisense endothelin converting enzyme (ECE) RNA on levels of cytokines released from CD(4)(+) lymphocytes in patients with allergic diseases responsive to house dust mites. Peripheral blood mononuclear cells (PBMCs) were separated from 21 patients who were sensitive to dust mites. PBMCs from those patients were divided into two groups. No stimulation group (A group) induded A(1) group (anti-ECE epithelial cells + PBMCs) and A(2) group (control cells + PBMCs). Stimulation group (B group) included B(1) group (anti-ECE epithelial cells + PBMCs + dust mites extract) and B(2) group (control cells + PBMCs + dust mites extract). House dust mite extract (20 microg/ml) was added to the culture of stimulation group as described above. After 72 hours, supernatants from both groups were collected and the levels of IL-5 and IFN-ggr; released into the supernatants were detected by enzyme-linked immunoabsorbent assay. IL-5 levels were increased significantly after treatment with dust mite in twelve of 21 cases. No significant differences of IL-5 were found between the groups of A(1)[(6.0 +/- 1.3) x 10(-9) g/L] and A(2) [(7.5 +/- 1.1) x 10(-9) g/L] before house dust mite stimulation in the 12 cases (P > 0.05), and no significant differences in IFN-ggr; were found between the groups of A(1) [(63 +/- 26) x 10(-9) g/L] and A(2) [(70 +/- 52) x 10(-9) g/L] before house dust mite stimulation (P > 0.05). IL-5 level was increased in both groups after stimulation but it was significantly lower in the B(1) group [(8.2 +/- 1.6) x 10(-9) g/L] than that in the B(2) [(12.0 +/- 1.8) x 10(-9) g/L] (P = 0.047). It seemed that increased IFN-ggr; level after stimulation was higher in B(2) [(153 +/- 71) x 10(-9) g/L] than that in the B(1) group (100 +/- 41) x 10(-9) g/L], but there was no statistic significance (P > 0.05). In addition, our results also showed that the release of IL-5 was significantly increased in those cases with asthma, or asthma plus allergic rhinitis

Predictive dose-based estimation of systemic exposure multiples in mouse and monkey relative to human for antisense oligonucleotides with 2'-o-(2-methoxyethyl) modifications.

PubMed

Yu, Rosie Z; Grundy, John S; Henry, Scott P; Kim, Tae-Won; Norris, Daniel A; Burkey, Jennifer; Wang, Yanfeng; Vick, Andrew; Geary, Richard S

2015-01-20

Evaluation of species differences and systemic exposure multiples (or ratios) in toxicological animal species versus human is an ongoing exercise during the course of drug development. The systemic exposure ratios are best estimated by directly comparing area under the plasma concentration-time curves (AUCs), and sometimes by comparing the dose administered, with the dose being adjusted either by body surface area (BSA) or body weight (BW). In this study, the association between AUC ratio and the administered dose ratio from animals to human were studied using a retrospective data-driven approach. The dataset included nine antisense oligonucleotides (ASOs) with 2'-O-(2-methoxyethyl) modifications, evaluated in two animal species (mouse and monkey) following single and repeated parenteral administrations. We found that plasma AUCs were similar between ASOs within the same species, and are predictable to human exposure using a single animal species, either mouse or monkey. Between monkey and human, the plasma exposure ratio can be predicted directly based on BW-adjusted dose ratios, whereas between mouse and human, the exposure ratio would be nearly fivefold lower in mouse compared to human based on BW-adjusted dose values. Thus, multiplying a factor of 5 for the mouse BW-adjusted dose would likely provide a reasonable AUC exposure estimate in human at steady-state.

Loss of tumorigenic potential by human lung tumor cells in the presence of antisense RNA specific to the ectopically synthesized alpha subunit of human chorionic gonadotropin.

PubMed

Rivera, R T; Pasion, S G; Wong, D T; Fei, Y B; Biswas, D K

1989-06-01

A clonal strain of human lung tumor cells in culture (ChaGo), derived from a bronchogenic carcinoma, synthesizes and secretes large amounts of alpha (alpha) and a comparatively lower level of beta (beta) subunit of the glycoprotein hormone, human chorionic gonadotropin (HCG). ChaGo cells lost their characteristic anchorage-independent growth phenotype in the presence of anti-alpha-HCG antibody. The effect of the antibody was partially reversed by addition of alpha-HCG to the culture medium. ChaGo cells were transfected with an expression vector (pRSV-anti-alpha-HCG), that directs synthesis of RNA complementary to alpha-HCG mRNA. The transfectants produced alpha-HCG antisense RNA which was associated with the reduced level of alpha-HCG. Transfectants also displayed several altered phenotypic properties, including altered morphology, less mitosis, reduced growth rate, loss of anchorage-independent growth, and loss of tumorigenicity in nude mice. Treatment of transfectants with 8,bromo-cAMP resulted in increased accumulation of alpha-HCG mRNA, no change in the level of alpha-HCG antisense RNA, release of the inhibition of [3H]thymidine incorporation, and restoration of anchorage-independent growth phenotype. The overexpression of c-myc, observed in ChaGo cells, was unaffected by the reduced level of alpha-HCG. These results suggest that ectopic synthesis of the alpha subunit of HCG plays a functional role in the transformation of these human lung cells.

NELL2 participates in formation of the sexually dimorphic nucleus of the pre-optic area in rats.

PubMed

Jeong, Jin Kwon; Ryu, Byung Jun; Choi, Jungil; Kim, Dong Hee; Choi, Eun Jung; Park, Jeong Woo; Park, Joong Jean; Lee, Byung Ju

2008-08-01

Formation of the sexually dimorphic nucleus of the pre-optic area (SDN-POA) in the rat hypothalamus shows a sexually differential development of neurons. Volume of the SDN-POA in males is much bigger than that in females which is because of a neuroprotective effect of estradiol converted from circulating testosterone during a critical period of brain development. We found that neural epidermal growth factor-like like-2 (NELL2), a neural tissue-enriched protein, is a potential downstream target of estrogen. In this study, we examined a possible role of NELL2 in the development of the SDN-POA and in the normalcy of sexual behavior in the male rats. NELL2 was expressed and co-localized with estrogen receptor alpha in the SDN-POA. A blockade of NELL2 synthesis in the brain during postnatal day 0 (d0) to d4 by an intracerebroventricular injection of an antisense NELL2 oligodeoxynucleotide, resulted in a decrease in volume of the SDN-POA in males. Interestingly, it reduced some components of the male sexual behavior such as mounting and intromission, but not the sexual partner preference in adulthood. In vitro study using the hippocampal neuroprecursor HiB5 cells showed that NELL2 has a protective effect from a cell death condition. These data suggest that a relevant expression of NELL2 in the neonatal brain is important for the estrogen-induced normal development of the SDN-POA and the normalcy of sexual behavior in male rats.

Investigation into the mechanism(s) that leads to platelet decreases in cynomolgus monkeys during administration of ISIS-104838, a 2'-MOE-modified antisense oligonucleotide.

PubMed

Narayanan, P K; Shen, L; Curtis, B R; Bourdon, M; Nolan, J P; Zhou, F; Christian, B; Gupta, S; Schaubhut, J L; Greenlee, S; Hoffmaster, C; Burel, S; Witztum, J L; Engelhardt, J A; Henry, S P

2018-05-29

ISIS 104838, a 2'-O-methoxyethyl (2'-MOE)-modified antisense oligonucleotide (ASO), causes a moderate, reproducible, dose-dependent, but self-limiting decrease in platelet (PLT) counts in monkeys and humans. To determine the etiology of PLT decrease in cynomolgus monkeys, a 12-week repeat dose toxicology study in 5 cynomolgus monkeys given subcutaneous injections of ISIS 104838 (30 to 60 mg/kg/week). Monkeys were also injected intravenously with 111In-oxine-labeled PLTs to investigate PLT sequestration. In response to continued dosing, PLT counts were decreased by 50 to 90% by day 30 in all monkeys. PLT decreases were accompanied by 2- to 4.5-fold increases in immunoglobulin M(IgM), which were typified by a 2-to-5-fold increase in anti-platelet factor 4 (PF4) IgM and anti-PLT IgM, respectively. Monocyte chemotactic protein 1 (MCP-1) increased upon dosing of ISIS 104838, concomitant with a 2- to 6-fold increase in monocyte-derived extracellular vesicles (EVs), indicating monocyte activation but not PLT activation. Despite a 2- to- 3-fold increase in von Willebrand factor (VWF) antigen in all monkeys following ASO administration, only two monkeys showed a 2 to 4-fold increase in endothelial EVs. Additionally, a 25-45% increase in PLT sequestration in liver and spleen was also observed. Collectively, these results suggest the overall increase in total IgM, anti-PLT IgM and/or anti-PF4 IgM, in concert with monocyte activation contributed to increased PLT sequestration in spleen and liver, leading to decreased PLTs in peripheral blood.

Modification of the plasma clearance and liver uptake of steroid ester-conjugated oligodeoxynucleotides by association with (lactosylated) low-density lipoprotein.

PubMed

Rump, E T; de Vrueh, R L; Manoharan, M; Waarlo, I H; van Veghel, R; Biessen, E A; van Berkel, T J; Bijsterbosch, M K

2000-06-01

Low-density lipoprotein (LDL) has been proposed as carrier for the selective delivery of anticancer drugs to tumor cells. We reported earlier the association of several lipidic steroid-conjugated anticancer oligodeoxynucleotides (ODNs) with LDL. In the present study, we determined the stability of these complexes. When the complexes were incubated with a mixture of high-density lipoprotein and albumin, or with rat plasma, the oleoyl steroid-conjugated ODNs appeared to be more stably associated with LDL than the cholesteryl-conjugated ODN. Intravenously injected free lipid-ODNs were very rapidly cleared from the circulation of rats. The area under the curve (AUC) of the lipid-ODNs in plasma was <0.4 microg x min/mL. After complexation with LDL, plasma clearance of the lipid-ODNs was delayed. This was most evident for ODN-5, the ODN conjugated with the oleoyl ester of lithocholic acid (AUC = 6.82 +/- 1.34 microg x min/mL). The AUC of ODN-4, a cholesteryl-conjugated ODN, was 1.49 +/- 0.37 microg x min/mL. In addition, the liver uptake of the LDL-complexed lipid-ODNs was reduced. The lipid-ODNs were also administered as a complex with lactosylated LDL, a modified LDL particle that is selectively taken up by the liver. A high proportion of ODN-5 was transported to the liver along with lactosylated LDL (69.1 +/- 8.1% of the dose at 15 min after injection), whereas much less ODN-4 was transported (36.6 +/- 0.1% of the dose at 15 min after injection). We conclude that the oleoyl ester of lithocholic acid is a more potent lipid anchor than the other steroid lipid anchors. Because of the stable association, the oleoyl ester of lithocholic acid is an interesting candidate for tumor targeting of anticancer ODNs with lipoproteins.

Antisense Oligonucleotide-mediated Exon Skipping as a Systemic Therapeutic Approach for Recessive Dystrophic Epidermolysis Bullosa.

PubMed

Bremer, Jeroen; Bornert, Olivier; Nyström, Alexander; Gostynski, Antoni; Jonkman, Marcel F; Aartsma-Rus, Annemieke; van den Akker, Peter C; Pasmooij, Anna Mg

2016-10-18

The "generalized severe" form of recessive dystrophic epidermolysis bullosa (RDEB-gen sev) is caused by bi-allelic null mutations in COL7A1, encoding type VII collagen. The absence of type VII collagen leads to blistering of the skin and mucous membranes upon the slightest trauma. Because most patients carry exonic point mutations or small insertions/deletions, most exons of COL7A1 are in-frame, and low levels of type VII collagen already drastically improve the disease phenotype, this gene seems a perfect candidate for antisense oligonucleotide (AON)-mediated exon skipping. In this study, we examined the feasibility of AON-mediated exon skipping in vitro in primary cultured keratinocytes and fibroblasts, and systemically in vivo using a human skin-graft mouse model. We show that treatment with AONs designed against exon 105 leads to in-frame exon 105 skipping at the RNA level and restores type VII collagen protein production in vitro. Moreover, we demonstrate that systemic delivery in vivo induces de novo expression of type VII collagen in skin grafts generated from patient cells. Our data demonstrate strong proof-of-concept for AON-mediated exon skipping as a systemic therapeutic strategy for RDEB.

Synthesis, biophysical properties and biological activity of second generation antisense oligonucleotides containing chiral phosphorothioate linkages

PubMed Central

Wan, W. Brad; Migawa, Michael T.; Vasquez, Guillermo; Murray, Heather M.; Nichols, Josh G.; Gaus, Hans; Berdeja, Andres; Lee, Sam; Hart, Christopher E.; Lima, Walt F.; Swayze, Eric E.; Seth, Punit P.

2014-01-01

Bicyclic oxazaphospholidine monomers were used to prepare a series of phosphorothioate (PS)-modified gapmer antisense oligonucleotides (ASOs) with control of the chirality of each of the PS linkages within the 10-base gap. The stereoselectivity was determined to be 98% for each coupling. The objective of this work was to study how PS chirality influences biophysical and biological properties of the ASO including binding affinity (Tm), nuclease stability, activity in vitro and in vivo, RNase H activation and cleavage patterns (both human and E. coli) in a gapmer context. Compounds that had nine or more Sp-linkages in the gap were found to be poorly active in vitro, while compounds with uniform Rp-gaps exhibited activity very similar to that of the stereo-random parent ASOs. Conversely, when tested in vivo, the full Rp-gap compound was found to be quickly metabolized resulting in low activity. A total of 31 ASOs were prepared with control of the PS chirally of each linkage within the gap in an attempt to identify favorable Rp/Sp positions. We conclude that a mix of Rp and Sp is required to achieve a balance between good activity and nuclease stability. PMID:25398895

Use of antisense RNA to modify the composition of cellulosomes produced by Clostridium cellulolyticum.

PubMed

Perret, Stéphanie; Maamar, Hédia; Bélaich, Jean-Pierre; Tardif, Chantal

2004-01-01

The enzymatic composition of the cellulosomes produced by Clostridium cellulolyticum was modified by inhibiting the synthesis of Cel48F that is the major cellulase of the cellulosomes. The strain ATCC 35319 (pSOSasrF) was developed to over-produce a 469 nucleotide-long antisense-RNA (asRNA) directed against the ribosome-binding site region and the beginning of the coding region of the cel48F mRNAs. The cellulolytic system secreted by the asRNA-producing strain showed a markedly lower amount of Cel48F, compared to the control strain transformed with the empty plasmid (pSOSzero). This was correlated with a 30% decrease of the specific activity of the cellulolytic system on Avicel cellulose, indicating that Cel48F plays an important role in the recalcitrant cellulose degradation. However, only minor effects were observed on the growth parameters on cellulose. In both transformant strains, cellulosome production was found to be reduced and two unknown proteins (P105 and P98) appeared as major components of their cellulolytic systems. These proteins did not contain any dockerin domain and were shown to be not included into the cellulosomes; they are expected to participate to the non-cellulosomal cellulolytic system of C. cellulolyticum.

Programmable control of bacterial gene expression with the combined CRISPR and antisense RNA system

PubMed Central

Lee, Young Je; Hoynes-O'Connor, Allison; Leong, Matthew C.; Moon, Tae Seok

2016-01-01

A central goal of synthetic biology is to implement diverse cellular functions by predictably controlling gene expression. Though research has focused more on protein regulators than RNA regulators, recent advances in our understanding of RNA folding and functions have motivated the use of RNA regulators. RNA regulators provide an advantage because they are easier to design and engineer than protein regulators, potentially have a lower burden on the cell and are highly orthogonal. Here, we combine the CRISPR system from Streptococcus pyogenes and synthetic antisense RNAs (asRNAs) in Escherichia coli strains to repress or derepress a target gene in a programmable manner. Specifically, we demonstrate for the first time that the gene target repressed by the CRISPR system can be derepressed by expressing an asRNA that sequesters a small guide RNA (sgRNA). Furthermore, we demonstrate that tunable levels of derepression can be achieved (up to 95%) by designing asRNAs that target different regions of a sgRNA and by altering the hybridization free energy of the sgRNA–asRNA complex. This new system, which we call the combined CRISPR and asRNA system, can be used to reversibly repress or derepress multiple target genes simultaneously, allowing for rational reprogramming of cellular functions. PMID:26837577

Mipomersen: a safe and effective antisense therapy adjunct to statins in patients with hypercholesterolemia.

PubMed

Ricotta, Daniel N; Frishman, William

2012-01-01

Mipomersen is an antisense oligonucleotide inhibitor of apolipoprotein (apo) B-100 currently in phase 3 of development for the treatment of hyperlipidemia in patients with a high risk for cardiovascular disease. The drug acts by inhibiting the production of apoB-100, which is the structural core for all atherogenic lipids, including low-density lipoprotein cholesterol (LDL-C). The agent has been shown to produce significant reductions in LDL-C from baseline values compared with placebos. Clinical trials have demonstrated that mipomersen reduces LDL-C up to 44% in patients with familial hypercholesterolemia and patients with significantly elevated LDL despite taking maximum doses of statins. Unlike other medications that target apoB-100, such as microsomal triglyceride transfer proteins, mipomersen does not cause hepatic steatosis or intestinal steatosis and does not affect dietary fat absorption. Adverse side effects encountered with mipomersen include flu-like symptoms, injection site reactions, and elevated liver transaminases. If future studies continue to show such promising results, mipomersen would likely be a viable additional lipid-lowering therapy for patients who are at high cardiovascular risk, intolerant to statins, and/or not at target lipid levels despite maximum doses of statin therapy. Clinical outcome studies looking at cardiovascular disease end points still need to be done.

Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3;#8242;-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.

The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structuresmore » of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F {hor_ellipsis} H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py) {hor_ellipsis} H-C(Pu) pseudo hydrogen bonds in nucleic acid structures.« less

Antisense protein tyrosine phosphatase 1B reverses activation of p38 mitogen-activated protein kinase in liver of ob/ob mice.

PubMed

Gum, Rebecca J; Gaede, Lori L; Heindel, Matthew A; Waring, Jeffrey F; Trevillyan, James M; Zinker, Bradley A; Stark, Margery E; Wilcox, Denise; Jirousek, Michael R; Rondinone, Cristina M; Ulrich, Roger G

2003-06-01

Phosphorylation of stress-activated kinase p38, a MAPK family member, was increased in liver of ob/ob diabetic mice relative to lean littermates. Treatment of ob/ob mice with protein tyrosine phosphatase 1B (PTP1B) antisense oligonucleotides (ASO) reduced phosphorylation of p38 in liver-to below lean littermate levels-and normalized plasma glucose while reducing plasma insulin. Phosphorylation of ERK, but not JNK, was also decreased in ASO-treated mice. PTP1B ASO decreased TNFalpha protein levels and phosphorylation of the transcription factor cAMP response element binding protein (CREB) in liver, both of which can occur through decreased phosphorylation of p38 and both of which have been implicated in insulin resistance or hyperglycemia. Decreased p38 phosphorylation was not directly due to decreased phosphorylation of the kinases that normally phosphorylate p38-MKK3 and MKK6. Additionally, p38 phosphorylation was not enhanced in liver upon insulin stimulation of ASO-treated ob/ob mice (despite increased activation of other signaling molecules) corroborating that p38 is not directly affected via the insulin receptor. Instead, decreased phosphorylation of p38 may be due to increased expression of MAPK phosphatases, particularly the p38/ERK phosphatase PAC1 (phosphatase of activated cells). This study demonstrates that reduction of PTP1B protein using ASO reduces activation of p38 and its substrates TNFalpha and CREB in liver of diabetic mice, which correlates with decreased hyperglycemia and hyperinsulinemia.

A locked nucleic acid antisense oligonucleotide (LNA) silences PCSK9 and enhances LDLR expression in vitro and in vivo.

PubMed

Gupta, Nidhi; Fisker, Niels; Asselin, Marie-Claude; Lindholm, Marie; Rosenbohm, Christoph; Ørum, Henrik; Elmén, Joacim; Seidah, Nabil G; Straarup, Ellen Marie

2010-05-17

The proprotein convertase subtilisin/kexin type 9 (PCSK9) is an important factor in the etiology of familial hypercholesterolemia (FH) and is also an attractive therapeutic target to reduce low density lipoprotein (LDL) cholesterol. PCSK9 accelerates the degradation of hepatic low density lipoprotein receptor (LDLR) and low levels of hepatic PCSK9 activity are associated with reduced levels of circulating LDL-cholesterol. The present study presents the first evidence for the efficacy of a locked nucleic acid (LNA) antisense oligonucleotide (LNA ASO) that targets both human and mouse PCSK9. We employed human hepatocytes derived cell lines HepG2 and HuH7 and a pancreatic mouse beta-TC3 cell line known to express high endogenous levels of PCSK9. LNA ASO efficiently reduced the mRNA and protein levels of PCSK9 with a concomitant increase in LDLR protein levels after transfection in these cells. In vivo efficacy of LNA ASO was further investigated in mice by tail vein intravenous administration of LNA ASO in saline solution. The level of PCSK9 mRNA was reduced by approximately 60%, an effect lasting more than 16 days. Hepatic LDLR protein levels were significantly up-regulated by 2.5-3 folds for at least 8 days and approximately 2 fold for 16 days. Finally, measurement of liver alanine aminotransferase (ALT) levels revealed that long term LNA ASO treatment (7 weeks) does not cause hepatotoxicity. LNA-mediated PCSK9 mRNA inhibition displayed potent reduction of PCSK9 in cell lines and mouse liver. Our data clearly revealed the efficacy and safety of LNA ASO in reducing PCSK9 levels, an approach that is now ready for testing in primates. The major significance and take home message of this work is the development of a novel and promising approach for human therapeutic intervention of the PCSK9 pathway and hence for reducing some of the cardiovascular risk factors associated with the metabolic syndrome.

Complex formation and vectorization of a phosphorothioate oligonucleotide with an amphipathic leucine- and lysine-rich peptide: study at molecular and cellular levels.

PubMed

Boukhalfa-Heniche, Fatima-Zohra; Hernández, Belén; Gaillard, Stéphane; Coïc, Yves-Marie; Huynh-Dinh, Tam; Lecouvey, Marc; Seksek, Olivier; Ghomi, Mahmoud

2004-04-15

Optical spectroscopic techniques such as CD, Raman scattering, and fluorescence imaging allowed us to analyze the complex formation and vectorization of a single-stranded 20-mer phosphorothioate oligodeoxynucleotide with a 15-mer amphipathic peptide at molecular and cellular levels. Different solvent mixtures (methanol and water) and molecular ratios of peptide/oligodeoxynucleotide complexes were tested in order to overcome the problems related to solubility. Optimal conditions for both spectroscopic and cellular experiments were obtained with the molecular ratio peptide/oligodeoxynucleotide equal to 21:4, corresponding to a 7:5 ratio for their respective +/- charge ratio. At the molecular level, CD and Raman spectra were consistent with a alpha-helix conformation of the peptide in water or in a methanol-water mixture. The presence of methanol increased considerably the solubility of the peptide without altering its alpha-helix conformation, as evidenced by CD and Raman spectroscopies. UV absorption melting profile of the oligodeoxynucleotide gave rise to a flat melting profile, corresponding to its random structure in solution. Raman spectra of oligodeoxynucleotide/peptide complexes could only be studied in methanol/water mixture solutions. Drastic changes observed in Raman spectra have undoubtedly shown: (a) the perturbation occurred in the peptide secondary structure, and (b) possible interaction between the lysine residues of the peptide and the oligodeoxynucleotide. At the cellular level, the complex was prepared in a mixture of 10% methanol and 90% cell medium. Cellular uptake in optimal conditions for the oligodeoxynucleotide delivery with low cytotoxicity was controlled by fluorescence imaging allowing to specifically locate the compacted oligonucleotide labeled with fluorescein at its 5'-terminus with the peptide into human glioma cells after 1 h of incubation at 37 degrees C. Copyright 2004 Wiley Periodicals, Inc.

Clinical, biochemical, and molecular studies in pyridoxine-dependent epilepsy. Antisense therapy as possible new therapeutic option.

PubMed

Pérez, Belén; Gutiérrez-Solana, Luis González; Verdú, Alfonso; Merinero, Begoña; Yuste-Checa, Patricia; Ruiz-Sala, Pedro; Calvo, Rocio; Jalan, Anil; Marín, Laura López; Campos, Oscar; Ruiz, Maria Ángeles; San Miguel, Marta; Vázquez, Maria; Castro, Margarita; Ferrer, Isaac; Navarrete, Rosa; Desviat, Lourdes Ruiz; Lapunzina, Pablo; Ugarte, Magdalena; Pérez-Cerdá, Celia

2013-02-01

analysis showed the silent nucleotide change c.75C>T to be a novel splicing mutation creating a new donor splice site inside exon 1. Antisense therapy of the aberrant mRNA splicing in a lymphoblast cell line harboring mutation c.75C>T was successful. The present results broaden our knowledge of PDE, provide information regarding the genetic background of PDE in Spain, afford data of use when making molecular-based prenatal diagnosis, and provide a cellular proof-of concept for antisense therapy application. Wiley Periodicals, Inc. © 2013 International League Against Epilepsy.

Glutamine-rich toxic proteins GrtA, GrtB and GrtC together with the antisense RNA AsgR constitute a toxin-antitoxin-like system in Corynebacterium glutamicum.

PubMed

Maeda, Tomoya; Tanaka, Yuya; Inui, Masayuki

2018-06-01

The Corynebacterium glutamicum R grtA (cgR_2936), grtB (cgR_2934) and grtC (cgR_2933) genes were identified as paralogs encoding glutamine-rich toxic proteins. We also identified a new antisense small RNA AsgR (antisense sRNA for grtA) that overlaps the 3' end of the grtA gene. Single over-expressions of grtA, grtB and grtC resulted in complete inhibition of Escherichia coli cell growth. This growth was rescued by co-expression of AsgR. Similar effects were observed in C. glutamicum, although the toxicities of these proteins were moderate. Inhibition of AsgR transcription resulted in increased levels and prolonged half-lives of grtA, grtB and grtC mRNAs. We also found that the expression levels of grtA, grtB and grtC were increased in an RNase III deletion mutant. Primer extension analysis revealed the RNase III cleavage site to be in the 3' untranslated region (3'-UTR) of the grtA mRNA. The expression levels of grtA, grtB and grtC were increased after exposure to several stresses, including heat shock, treatment with penicillin G, lysozyme or H 2 O 2 . The deletions of grtABC and asgR genes resulted in decreased survival rate under several stresses. These results indicate that GrtABC and AsgR constitute a type I toxin-antitoxin-like system in C. glutamicum. © 2018 John Wiley & Sons Ltd.

Steric antisense inhibition of AMPA receptor Q/R editing reveals tight coupling to intronic editing sites and splicing

PubMed Central

Penn, Andrew C.; Balik, Ales; Greger, Ingo H.

2013-01-01

Adenosine-to-Inosine (A-to-I) RNA editing is a post-transcriptional mechanism, evolved to diversify the transcriptome in metazoa. In addition to wide-spread editing in non-coding regions protein recoding by RNA editing allows for fine tuning of protein function. Functional consequences are only known for some editing sites and the combinatorial effect between multiple sites (functional epistasis) is currently unclear. Similarly, the interplay between RNA editing and splicing, which impacts on post-transcriptional gene regulation, has not been resolved. Here, we describe a versatile antisense approach, which will aid resolving these open questions. We have developed and characterized morpholino oligos targeting the most efficiently edited site—the AMPA receptor GluA2 Q/R site. We show that inhibition of editing closely correlates with intronic editing efficiency, which is linked to splicing efficiency. In addition to providing a versatile tool our data underscore the unique efficiency of a physiologically pivotal editing site. PMID:23172291

Thiolated chitosan nanoparticles as a delivery system for antisense therapy: evaluation against EGFR in T47D breast cancer cells

PubMed Central

Talaei, Fatemeh; Azizi, Ebrahim; Dinarvand, Rassoul; Atyabi, Fatemeh

2011-01-01

Thiolated chitosan has high transfection and mucoadhesive properties. We investigated the potential of two recently synthesized polymers: NAC-C (N-acetyl cysteine-chitosan) and NAP-C (N-acetyl penicillamine-chitosan) in anticancer drug delivery targeting epidermal growth factor receptor (EGFR). Doxorubicin (DOX) and antisense oligonucleotide (ASOND)-loaded polymer nanoparticles were prepared in water by a gelation process. Particle characterization, drug loading, and drug release were evaluated. To verify drug delivery efficiency in vitro experiments on a breast cancer cell line (T47D) were performed. EGFR gene and protein expression was analyzed by real time quantitative polymerase chain reaction and Western blotting, respectively. A loading percentage of 63% ± 5% for ASOND and 70% ± 5% for DOX was achieved. Drug release data after 15 hours showed that ASOND and DOX were completely released from chitosan-based particles while a lower and more sustained release of only 22% ± 8% was measured for thiolated particles. In a cytosol simulated release medium/reducing environment, such as found intracellularly, polymer-based nanoparticles dissociated, liberating approximately 50% of both active substances within 7 hours. ASOND-loaded polymer nanoparticles had higher stability and high mucoadhesive properties. The ASOND-loaded thiolated particles significantly suppressed EGFR gene expression in T47D cells compared with ASOND-loaded chitosan particles and downregulated EGFR protein expression in cells. This study could facilitate future investigations into the functionality of NAP-C and NAC-C polymers as an efficient ASOND delivery system in vitro and in vivo. PMID:21976973

Development of Design Rules for Reliable Antisense RNA Behavior in E. coli.

PubMed

Hoynes-O'Connor, Allison; Moon, Tae Seok

2016-12-16

A key driver of synthetic biology is the development of designable genetic parts with predictable behaviors that can be quickly implemented in complex genetic systems. However, the intrinsic complexity of gene regulation can make the rational design of genetic parts challenging. This challenge is apparent in the design of antisense RNA (asRNA) regulators. Though asRNAs are well-known regulators, the literature governing their design is conflicting and leaves the synthetic biology community without clear asRNA design rules. The goal of this study is to perform a comprehensive experimental characterization and statistical analysis of 121 unique asRNA regulators in order to resolve the conflicts that currently exist in the literature. asRNAs usually consist of two regions, the Hfq binding site and the target binding region (TBR). First, the behaviors of several high-performing Hfq binding sites were compared, in terms of their ability to improve repression efficiencies and their orthogonality. Next, a large-scale analysis of TBR design parameters identified asRNA length, the thermodynamics of asRNA-mRNA complex formation, and the percent of target mismatch as key parameters for TBR design. These parameters were used to develop simple asRNA design rules. Finally, these design rules were applied to construct both a simple and a complex genetic circuit containing different asRNAs, and predictable behavior was observed in both circuits. The results presented in this study will drive synthetic biology forward by providing useful design guidelines for the construction of asRNA regulators with predictable behaviors.

Antisense RNA to the first N-glycosylation gene, ALG7, inhibits protein N-glycosylation and secretion by Xenopus oocytes.

PubMed

Kukuruzinska, M A; Apekin, V; Lamkin, M S; Hiltz, A; Rodriguez, A; Lin, C C; Paz, M A; Oppenheim, F G

1994-02-15

N-Glycosylation has been shown to affect the rate of glycoprotein transport through the secretory pathway. In order to identify the critical components in the N-glycosylation pathway that directly influence protein secretion, we have studied the effects of downregulation of the first gene in the dolichol pathway, ALG7, on the synthesis, glycosylation and secretion of native and heterologous proteins by Xenopus laevis oocytes. Our strategy involved the use of ALG7 antisense RNA (asRNA) to lower the effective abundance of the ALG7 protein in oocytes. The results showed that there was an inverse dose-response relationship between ALG7 asRNA and the amount of glycosylated and secreted proteins. These effects were also observed for heterologously expressed rat parotid amylase. Since ALG7 asRNA did not inhibit overall protein synthesis, we conclude that downregulation of ALG7 expression directly lowered protein export.

Antisense oligonucleotide-mediated correction of transcriptional dysregulation is correlated with behavioral benefits in the YAC128 mouse model of Huntington's disease.

PubMed

Stanek, Lisa M; Yang, Wendy; Angus, Stuart; Sardi, Pablo S; Hayden, Michael R; Hung, Gene H; Bennett, C Frank; Cheng, Seng H; Shihabuddin, Lamya S

2013-01-01

Huntington's disease (HD) is a neurological disorder caused by mutations in the huntingtin (HTT) gene, the product of which leads to selective and progressive neuronal cell death in the striatum and cortex. Transcriptional dysregulation has emerged as a core pathologic feature in the CNS of human and animal models of HD. It is still unclear whether perturbations in gene expression are a consequence of the disease or importantly, contribute to the pathogenesis of HD. To examine if transcriptional dysregulation can be ameliorated with antisense oligonucleotides that reduce levels of mutant Htt and provide therapeutic benefit in the YAC128 mouse model of HD. Quantitative real-time PCR analysis was used to evaluate dysregulation of a subset of striatal genes in the YAC128 mouse model. Transcripts were then evaluated following ICV delivery of antisense oligonucleotides (ASO). Rota rod and Porsolt swim tests were used to evaluate phenotypic deficits in these mice following ASO treatment. Transcriptional dysregulation was detected in the YAC128 mouse model and appears to progress with age. ICV delivery of ASOs directed against mutant Htt resulted in reduction in mutant Htt levels and amelioration in behavioral deficits in the YAC128 mouse model. These improvements were correlated with improvements in the levels of several dysregulated striatal transcripts. The role of transcriptional dysregulation in the pathogenesis of Huntington's disease is not well understood, however, a wealth of evidence now strongly suggests that changes in transcriptional signatures are a prominent feature in the brains of both HD patients and animal models of the disease. Our study is the first to show that a therapeutic agent capable of improving an HD disease phenotype is concomitantly correlated with normalization of a subset of dysregulated striatal transcripts. Our data suggests that correction of these disease-altered transcripts may underlie, at least in part, the therapeutic efficacy

Control of seed dormancy in Arabidopsis by a cis-acting noncoding antisense transcript.

PubMed

Fedak, Halina; Palusinska, Malgorzata; Krzyczmonik, Katarzyna; Brzezniak, Lien; Yatusevich, Ruslan; Pietras, Zbigniew; Kaczanowski, Szymon; Swiezewski, Szymon

2016-11-29

Seed dormancy is one of the most crucial process transitions in a plant's life cycle. Its timing is tightly controlled by the expression level of the Delay of Germination 1 gene (DOG1). DOG1 is the major quantitative trait locus for seed dormancy in Arabidopsis and has been shown to control dormancy in many other plant species. This is reflected by the evolutionary conservation of the functional short alternatively polyadenylated form of the DOG1 mRNA. Notably, the 3' region of DOG1, including the last exon that is not included in this transcript isoform, shows a high level of conservation at the DNA level, but the encoded polypeptide is poorly conserved. Here, we demonstrate that this region of DOG1 contains a promoter for the transcription of a noncoding antisense RNA, asDOG1, that is 5' capped, polyadenylated, and relatively stable. This promoter is autonomous and asDOG1 has an expression profile that is different from known DOG1 transcripts. Using several approaches we show that asDOG1 strongly suppresses DOG1 expression during seed maturation in cis, but is unable to do so in trans Therefore, the negative regulation of seed dormancy by asDOG1 in cis results in allele-specific suppression of DOG1 expression and promotes germination. Given the evolutionary conservation of the asDOG1 promoter, we propose that this cis-constrained noncoding RNA-mediated mechanism limiting the duration of seed dormancy functions across the Brassicaceae.

Tuning growth cycles of Brassica crops via natural antisense transcripts of BrFLC.

PubMed

Li, Xiaorong; Zhang, Shaofeng; Bai, Jinjuan; He, Yuke

2016-03-01

Several oilseed and vegetable crops of Brassica are biennials that require a prolonged winter cold for flowering, a process called vernalization. FLOWERING LOCUS C (FLC) is a central repressor of flowering. Here, we report that the overexpression of natural antisense transcripts (NATs) of Brassica rapa FLC (BrFLC) greatly shortens plant growth cycles. In rapid-, medium- and slow-cycling crop types, there are four copies of the BrFLC genes, which show extensive variation in sequences and expression levels. In Bre, a biennial crop type that requires vernalization, five NATs derived from the BrFLC2 locus are rapidly induced under cold conditions, while all four BrFLC genes are gradually down-regulated. The transgenic Bre lines overexpressing a long NAT of BrFLC2 do not require vernalization, resulting in a gradient of shortened growth cycles. Among them, a subset of lines both flower and set seeds as early as Yellow sarson, an annual crop type in which all four BrFLC genes have non-sense mutations and are nonfunctional in flowering repression. Our results demonstrate that the growth cycles of biennial crops of Brassica can be altered by changing the expression levels of BrFLC2 NATs. Thus, BrFLC2 NATs and their transgenic lines are useful for the genetic manipulation of crop growth cycles. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Strategies for In Vivo Screening and Mitigation of Hepatotoxicity Associated with Antisense Drugs.

PubMed

Kamola, Piotr J; Maratou, Klio; Wilson, Paul A; Rush, Kay; Mullaney, Tanya; McKevitt, Tom; Evans, Paula; Ridings, Jim; Chowdhury, Probash; Roulois, Aude; Fairchild, Ann; McCawley, Sean; Cartwright, Karen; Gooderham, Nigel J; Gant, Timothy W; Moores, Kitty; Hughes, Stephen A; Edbrooke, Mark R; Clark, Kenneth; Parry, Joel D

2017-09-15

Antisense oligonucleotide (ASO) gapmers downregulate gene expression by inducing enzyme-dependent degradation of targeted RNA and represent a promising therapeutic platform for addressing previously undruggable genes. Unfortunately, their therapeutic application, particularly that of the more potent chemistries (e.g., locked-nucleic-acid-containing gapmers), has been hampered by their frequent hepatoxicity, which could be driven by hybridization-mediated interactions. An early de-risking of this liability is a crucial component of developing safe, ASO-based drugs. To rank ASOs based on their effect on the liver, we have developed an acute screen in the mouse that can be applied early in the drug development cycle. A single-dose (3-day) screen with streamlined endpoints (i.e., plasma transaminase levels and liver weights) was observed to be predictive of ASO hepatotoxicity ranking established based on a repeat-dose (15 day) study. Furthermore, to study the underlying mechanisms of liver toxicity, we applied transcriptome profiling and pathway analyses and show that adverse in vivo liver phenotypes correlate with the number of potent, hybridization-mediated off-target effects (OTEs). We propose that a combination of in silico OTE predictions, streamlined in vivo hepatotoxicity screening, and a transcriptome-wide selectivity screen is a valid approach to identifying and progressing safer compounds. Copyright © 2017 GSK R&D. Published by Elsevier Inc. All rights reserved.

Thiolated polycarbophil as an adjuvant for permeation enhancement in nasal delivery of antisense oligonucleotides.

PubMed

Vetter, A; Martien, R; Bernkop-Schnürch, A

2010-03-01

The purpose of this study was to investigate the effect of thiolated polycarbophil as an adjuvant to enhance the permeation and improve the stability of a phosphorothioate antisense oligonucleotide (PTO-ODN) on the nasal mucosa. Polycarbophil-cysteine (PCP-Cys) was synthesized by the covalent attachment of L-cysteine to the polymeric backbone. Cytotoxicity tests were examined on human nasal epithelial cells from surgery of nasal polyps confirmed by histological studies. Deoxyribonuclease I activity in respiratory region of the porcine nasal cavity was analyzed by an enzymatic assay. The enzymatic degradation of PTO-ODNs on freshly excised porcine nasal mucosa was analyzed and protection of PCP-cysteine toward DNase I degradation was evaluated. Permeation studies were performed in Ussing-type diffusion chambers. PCP-Cys/GSH did not arise a remarkable mortal effect. Porcine respiratory mucosa was shown to possess nuclease activity corresponding to 0.69 Kunitz units/mL. PTO-ODNs were degraded by incubation with nasal mucosa. In the presence of 0.45% thiolated polycarbophil and 0.5% glutathione (GSH), this degradation process could be lowered. In the presence of thiolated polycarbophil and GSH the uptake of PTO-ODNs from the nasal mucosa was 1.7-fold improved. According to these results thiolated polycarbophil/GSH might be a promising excipient for nasal administration of PTO-ODNs. 2009 Wiley-Liss, Inc. and the American Pharmacists Association

Antisense oligonucleotide reduction of apoB-ameliorated atherosclerosis in LDL receptor-deficient mice[S

PubMed Central

Mullick, Adam E.; Fu, Wuxia; Graham, Mark J.; Lee, Richard G.; Witchell, Donna; Bell, Thomas A.; Whipple, Charles P.; Crooke, Rosanne M.

2011-01-01

Chronic elevations of plasma apolipoprotein B (apoB) are strongly associated with cardiovascular disease. We have previously demonstrated that inhibition of hepatic apoB mRNA using antisense oligonucleotides (ASO) results in reductions of apoB, VLDL, and LDL in several preclinical animal models and humans. In this study, we evaluated the anti-atherogenic effects of a murine-specific apoB ASO (ISIS 147764) in hypercholesterolemic LDLr deficient (LDLr−/−) mice. ISIS 147764 was administered weekly at 25-100 mg/kg for 10-12 weeks and produced dose-dependent reductions of hepatic apoB mRNA and plasma LDL by 60-90%. No effects on these parameters were seen in mice receiving control ASOs. ApoB ASO treatment also produced dose-dependent reductions of aortic en face and sinus atherosclerosis from 50-90%, with high-dose treatment displaying less disease than the saline-treated, chow-fed LDLr−/− mice. No changes in intestinal cholesterol absorption were seen with apoB ASO treatment, suggesting that the cholesterol-lowering pharmacology of 147764 was primarily due to inhibition of hepatic apoB synthesis and secretion. In summary, ASO-mediated suppression of apoB mRNA expression profoundly reduced plasma lipids and atherogenesis in LDLr−/− mice, leading to the hypothesis that apoB inhibition in humans with impaired LDLr activity may produce similar effects. PMID:21343632

Programmable control of bacterial gene expression with the combined CRISPR and antisense RNA system.

PubMed

Lee, Young Je; Hoynes-O'Connor, Allison; Leong, Matthew C; Moon, Tae Seok

2016-03-18

A central goal of synthetic biology is to implement diverse cellular functions by predictably controlling gene expression. Though research has focused more on protein regulators than RNA regulators, recent advances in our understanding of RNA folding and functions have motivated the use of RNA regulators. RNA regulators provide an advantage because they are easier to design and engineer than protein regulators, potentially have a lower burden on the cell and are highly orthogonal. Here, we combine the CRISPR system from Streptococcus pyogenes and synthetic antisense RNAs (asRNAs) in Escherichia coli strains to repress or derepress a target gene in a programmable manner. Specifically, we demonstrate for the first time that the gene target repressed by the CRISPR system can be derepressed by expressing an asRNA that sequesters a small guide RNA (sgRNA). Furthermore, we demonstrate that tunable levels of derepression can be achieved (up to 95%) by designing asRNAs that target different regions of a sgRNA and by altering the hybridization free energy of the sgRNA-asRNA complex. This new system, which we call the combined CRISPR and asRNA system, can be used to reversibly repress or derepress multiple target genes simultaneously, allowing for rational reprogramming of cellular functions. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Antisense inhibition of hyaluronan synthase-2 in human osteosarcoma cells inhibits hyaluronan retention and tumorigenicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishida, Yoshihiro; Knudson, Warren; Knudson, Cheryl B.

2005-07-01

Osteosarcoma is a common malignant bone tumor associated with childhood and adolescence. The results of numerous studies have suggested that hyaluronan plays an important role in regulating the aggressive behavior of various types of cancer cells. However, no studies have addressed hyaluronan with respect to osteosarcomas. In this investigation, the mRNA expression copy number of three mammalian hyaluronan synthases (HAS) was determined using competitive RT-PCR in the osteoblastic osteosarcoma cell line, MG-63. MG-63 are highly malignant osteosarcoma cells with an abundant hyaluronan-rich matrix. The results demonstrated that HAS-2 is the predominant HAS in MG-63. Accumulation of intracellular hyaluronan increased inmore » association with the proliferative phase of these cells. The selective inhibition of HAS-2 mRNA in MG-63 cells by antisense phosphorothioate oligonucleotides resulted in reduced hyaluronan accumulation by these cells. As expected, the reduction in hyaluronan disrupted the assembly of cell-associated matrices. However, of most interest, coincident with the reduction in hyaluronan, there was a substantial decrease in cell proliferation, a decrease in cell motility and a decrease in cell invasiveness. These data suggest that hyaluronan synthesized by HAS-2 in MG-63 plays a crucial role in osteosarcoma cell proliferation, motility, and invasion.« less

Therapeutic correction of ApoER2 splicing in Alzheimer's disease mice using antisense oligonucleotides.

PubMed

Hinrich, Anthony J; Jodelka, Francine M; Chang, Jennifer L; Brutman, Daniella; Bruno, Angela M; Briggs, Clark A; James, Bryan D; Stutzmann, Grace E; Bennett, David A; Miller, Steven A; Rigo, Frank; Marr, Robert A; Hastings, Michelle L

2016-04-01

Apolipoprotein E receptor 2 (ApoER2) is an apolipoprotein E receptor involved in long-term potentiation, learning, and memory. Given its role in cognition and its association with the Alzheimer's disease (AD) risk gene, apoE, ApoER2 has been proposed to be involved in AD, though a role for the receptor in the disease is not clear. ApoER2 signaling requires amino acids encoded by alternatively spliced exon 19. Here, we report that the balance of ApoER2 exon 19 splicing is deregulated in postmortem brain tissue from AD patients and in a transgenic mouse model of AD To test the role of deregulated ApoER2 splicing in AD, we designed an antisense oligonucleotide (ASO) that increases exon 19 splicing. Treatment of AD mice with a single dose of ASO corrected ApoER2 splicing for up to 6 months and improved synaptic function and learning and memory. These results reveal an association between ApoER2 isoform expression and AD, and provide preclinical evidence for the utility of ASOs as a therapeutic approach to mitigate Alzheimer's disease symptoms by improving ApoER2 exon 19 splicing. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

Seamless Genetic Conversion of SMN2 to SMN1 via CRISPR/Cpf1 and Single-Stranded Oligodeoxynucleotides in Spinal Muscular Atrophy Patient-Specific Induced Pluripotent Stem Cells.

PubMed

Zhou, Miaojin; Hu, Zhiqing; Qiu, Liyan; Zhou, Tao; Feng, Mai; Hu, Qian; Zeng, Baitao; Li, Zhuo; Sun, Qianru; Wu, Yong; Liu, Xionghao; Wu, Lingqian; Liang, Desheng

2018-05-09

Spinal muscular atrophy (SMA) is a kind of neuromuscular disease characterized by progressive motor neuron loss in the spinal cord. It is caused by mutations in the survival motor neuron 1 (SMN1) gene. SMN1 has a paralogous gene, survival motor neuron 2 (SMN2), in humans that is present in almost all SMA patients. The generation and genetic correction of SMA patient-specific induced pluripotent stem cells (iPSCs) is a viable, autologous therapeutic strategy for the disease. Here, c-Myc-free and non-integrating iPSCs were generated from the urine cells of an SMA patient using an episomal iPSC reprogramming vector, and a unique crRNA was designed that does not have similar sequences (≤3 mismatches) anywhere in the human reference genome. In situ gene conversion of the SMN2 gene to an SMN1-like gene in SMA-iPSCs was achieved using CRISPR/Cpf1 and single-stranded oligodeoxynucleotide with a high efficiency of 4/36. Seamlessly gene-converted iPSC lines contained no exogenous sequences and retained a normal karyotype. Significantly, the SMN expression and gems localization were rescued in the gene-converted iPSCs and their derived motor neurons. This is the first report of an efficient gene conversion mediated by Cpf1 homology-directed repair in human cells and may provide a universal gene therapeutic approach for most SMA patients.

Molecular and functional characterization of tumor-induced factor (TIF): Hamster homolog of CXCL3 (GROγ) displays tumor suppressive activity.

PubMed

Jin, Lili; Li, Zhou-Fang; Wang, Da-Kui; Sun, Meina; Qi, Wei; Ma, Qiang; Zhang, Li; Chu, Chun; Chan, Elaine Y M; Lee, Susanna S T; Wise, Helen; To, Ka-Fai; Shi, Ying; Zhou, Naiming; Cheung, Wing-Tai

2018-02-01

Previously our lab has created a mouse ovarian xenograft model of copy number variation (CNV)-mediated G protein-coupled receptor (GPCR) MAS-driven tumorigenesis, and RNA profiling identified a putative chemokine tumor-induced factor (Tif). Sequence analysis and chemotactic study suggested that Tif was likely to be a hamster homolog of human GROγ (CXCL3) [IJC 125 (2009): 1316-1327]. In the present study, we report the molecular and functional characterization of the Tif gene. Genomic study of CHO-K1 cells indicated that Tif gene consisted of 4 exons, characterized with an antisense B1 element which is embedded in the fourth exon. Two Tif transcripts were identified which shared identical sequences except that a string of 71-nt derived from the antisense B1 element was deficient in the shorter transcript. Of interests, B1-like RNA ladder was detected in xenografts. Functional studies showed that TIF induced chemotaxis and neovessel formation. Pharmacological studies suggested that TIF activated Gi-coupled CXCR2 and induced both calcium mobilization and ERK1/2 phosphorylation, and suppressed forskolin-stimulated cAMP accumulation. In addition, secreted matured TIF functioned as an autocrine factor and promoted anchorage-independent growth. Unexpectedly, TIF delayed the onset of tumor formation, possibly via suppressing proliferation of stromal fibroblasts. However, TIF did not exert any inhibitory effect on tumor growth. Potentially, TIF could be used for preventing cancer relapse. Copyright © 2017 Elsevier Ltd. All rights reserved.

CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

PubMed Central

Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

2004-01-01

Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use

Activity-dependent expression of miR-132 regulates immediate-early gene induction during olfactory learning in the greater short-nosed fruit bat, Cynopterus sphinx.

PubMed

Mukilan, Murugan; Ragu Varman, Durairaj; Sudhakar, Sivasubramaniam; Rajan, Koilmani Emmanuvel

2015-04-01

The activity-dependent expression of immediate-early genes (IEGs) and microRNA (miR)-132 has been implicated in synaptic plasticity and the formation of long-term memory (LTM). In the present study, we show that olfactory training induces the expression of IEGs (EGR-1, C-fos, C-jun) and miR-132 at similar time scale in olfactory bulb (OB) of Cynopterus sphinx. We examined the role of miR-132 in the OB using antisense oligodeoxynucleotide (AS-ODN) and demonstrated that a local infusion of AS-ODN in the OB 2h prior to training impaired olfactory memory formation in C. sphinx. However, the infusion of AS-ODN post-training did not cause a deficit in memory formation. Furthermore, the inhibition of miR-132 reduced the olfactory training-induced expression of IEGs and post synaptic density protein-95 (PSD-95) in the OB. Additionally, we show that miR-132 regulates the activation of calcium/calmodulin-dependent protein kinase-II (CaMKII) and cAMP response element binding protein (CREB), possibly through miR-148a. These data suggest that olfactory training induces the expression of miR-132 and IEGs, which in turn activates post-synaptic proteins that regulate olfactory memory formation. Copyright © 2015 Elsevier Inc. All rights reserved.

Phosphatase of Regenerating Liver-3 Promotes Motility and Metastasis of Mouse Melanoma Cells

PubMed Central

Wu, Xiaopeng; Zeng, Hu; Zhang, Xianming; Zhao, Ying; Sha, Haibo; Ge, Xiaomei; Zhang, Minyue; Gao, Xiang; Xu, Qiang

2004-01-01

Recent reports suggested that phosphatase of regenerating liver (PRL)-3 might be involved in colorectal carcinoma metastasis with an unknown mechanism. Here we demonstrated that PRL-3 expression was up-regulated in human liver carcinoma compared with normal liver. PRL-3 was also highly expressed in metastatic melanoma B16-BL6 cells but not in its lowly metastatic parental cell line, B16 cells. B16 cells transfected with PRL-3 cDNA displayed morphological transformation from epithelial-like shape to fibroblast-like shape. PRL-3-overexpressed cells showed much higher migratory ability, which could be reversed by specific anti-sense oligodeoxynucleotide and the phosphatase inhibitors sodium orthovanadate or potassium bisperoxo oxovanadate V. Meanwhile, the expression of the catalytically inactive PRL-3 mutations (D72A or C104S) significantly reduced the cell migratory capability. In addition, PRL-3 transfectants demonstrated altered extracellular matrix adhesive property and up-regulated integrin-mediated cell spreading efficiency. Furthermore, we confirmed that PRL-3 could facilitate lung and liver metastasis of B16 cells in an experimental metastasis model in mice, consistent with accelerated proliferation and growth rate both in vitro and in vivo. Together, these observations provide convincing evidence that PRL-3 truly plays a causal role in tumor metastasis. PMID:15161639

Crosstalk between Activated Microglia and Neurons in the Spinal Dorsal Horn Contributes to Stress-induced Hyperalgesia

PubMed Central

Qi, Jian; Chen, Chen; Meng, Qing-Xi; Wu, Yan; Wu, Haitao; Zhao, Ting-Bao

2016-01-01

Stress has been shown to enhance pain sensitivity resulting in stress-induced hyperalgesia. However, the underlying mechanisms have yet to be elucidated. Using single-prolonged stress combined with Complete Freund’s Adjuvant injection model, we explored the reciprocal regulatory relationship between neurons and microglia, which is critical for the maintenance of posttraumatic stress disorder (PTSD)-induced hyperalgesia. In our assay, significant mechanical allodynia was observed. Additionally, activated neurons in spinal dorsal horn were observed by analysis of Fos expression. And, microglia were also significantly activated with the presence of increased Iba-1 expression. Intrathecal administration of c-fos antisense oligodeoxynucleotides (ASO) or minocycline (a specific microglia inhibitor) attenuated mechanical allodynia. Moreover, intrathecal administration of c-fos ASO significantly suppressed the activation of neurons and microglia. Interestingly, inhibition of microglia activation by minocycline significantly suppressed the activation of both neurons and microglia in spinal dorsal horn. P38 inhibitor SB203580 suppressed IL-6 production, and inhibition of IL-6 receptor (IL-6R) activation by tocilizumab suppressed Fos expression. Together, our data suggest that the presence of a “crosstalk” between activated microglia and neurons in the spinal dorsal horn, which might contribute to the stress-induced hyperactivated state, leading to an increased pain sensitivity. PMID:27995982

A cis-antisense RNA acts in trans in Staphylococcus aureus to control translation of a human cytolytic peptide.

PubMed

Sayed, Nour; Jousselin, Ambre; Felden, Brice

2011-12-25

Antisense RNAs (asRNAs) pair to RNAs expressed from the complementary strand, and their functions are thought to depend on nucleotide overlap with genes on the opposite strand. There is little information on the roles and mechanisms of asRNAs. We show that a cis asRNA acts in trans, using a domain outside its target complementary sequence. SprA1 small regulatory RNA (sRNA) and SprA1(AS) asRNA are concomitantly expressed in S. aureus. SprA1(AS) forms a complex with SprA1, preventing translation of the SprA1-encoded open reading frame by occluding translation initiation signals through pairing interactions. The SprA1 peptide sequence is within two RNA pseudoknots. SprA1(AS) represses production of the SprA1-encoded cytolytic peptide in trans, as its overlapping region is dispensable for regulation. These findings demonstrate that sometimes asRNA functional domains are not their gene-target complementary sequences, suggesting there is a need for mechanistic re-evaluation of asRNAs expressed in prokaryotes and eukaryotes.

A CpG-containing oligodeoxynucleotide as an efficient adjuvant counterbalancing the Th1/Th2 immune response in diphtheria-tetanus-pertussis vaccine.

PubMed

Sugai, Toshiyuki; Mori, Masaaki; Nakazawa, Masatoshi; Ichino, Motohide; Naruto, Takuya; Kobayashi, Naoki; Kobayashi, Yoshinori; Minami, Mutsuhiko; Yokota, Shumpei

2005-11-16

Adjuvants in vaccines are immune stimulants that play an important role in the induction of effective and appropriate immune responses to vaccine component(s). Diphtheria-tetanus-pertussis (DPT) vaccine contains not only aluminum hydrate (alum) to enhance the immune response to the vaccine ingredients, but also, both for that purpose and as a principal ingredient, pertussis toxin (PT). However, both adjuvants strongly promote T helper (Th) 2 type immune responses. Th1 and Th2 type immune responses are counterbalanced in vivo, and a Th2-prone immune response is not effective against intracellular infections but promotes IgE production, which is related to allergic disease. In this study, we used the CpG motif contained in oligodeoxynucleotide (CpG-ODN), which has an adjuvant effect and also induces the Th1 response, as an adjuvant to this vaccine, and we investigated its adjuvanticity and its potential to modulate immune responses to DPT vaccine. Administration of DPT vaccine with CpG-ODN (DPT-alum/ODN) to mice significantly reduced the total IgE levels and increased the anti-PT specific IgG2a titer in serum, in comparison with ordinary DPT vaccine (DPT-alum). Moreover, we investigated the antibody response to orally administrated ovalbumin (OVA) after vaccine administration. In the DPT-alum/ODN-administered group, the OVA specific IgE production in serum greatly decreased in comparison with that in the DPT-alum-administered group. These data indicate that CpG-ODN was not useful only as an efficient vaccine adjuvant but also shifted the immune responses substantially toward Th1 and modulated the Th1/Th2 immune response in DPT vaccine. These data suggested new applications of CpG-ODN as adjuvants in DPT vaccine.

Oligodeoxynucleotides Can Transiently Up- and Downregulate CHS Gene Expression in Flax by Changing DNA Methylation in a Sequence-Specific Manner

PubMed Central

Dzialo, Magdalena; Szopa, Jan; Czuj, Tadeusz; Zuk, Magdalena

2017-01-01

Chalcone synthase (CHS) has been recognized as an essential enzyme in the phenylpropanoid biosynthesis pathway. Apart from the leading role in the production of phenolic compounds with many valuable biological activities beneficial to biomedicine, CHS is well appreciated in science. Genetic engineering greatly facilitates expanding knowledge on the function and genetics of CHS in plants. The CHS gene is one of the most intensively studied genes in flax. In our study, we investigated engineering of the CHS gene through genetic and epigenetic approaches. Considering the numerous restrictions concerning the application of genetically modified (GM) crops, the main purpose of this research was optimization of the plant's modulation via epigenetics. In our study, plants modified through two methods were compared: a widely popular agrotransformation and a relatively recent oligodeoxynucleotide (ODN) strategy. It was recently highlighted that the ODN technique can be a rapid and time-serving antecedent in quick analysis of gene function before taking vector-mediated transformation. In order to understand the molecular background of epigenetic variation in more detail and evaluate the use of ODNs as a tool for predictable and stable gene engineering, we concentrated on the integration of gene expression and gene-body methylation. The treatment of flax with a series of short oligonucleotides homologous to a different part of CHS gene isoforms revealed that those directed to regulatory gene regions (5′- and 3′-UTR) activated gene expression, directed to non-coding region (introns) caused gen activity reduction, while those homologous to a coding region may have a variable influence on its activity. Gene expression changes were accompanied by changes in its methylation status. However, only certain (CCGG) motifs along the gene sequence were affected. The analyzed DNA motifs of the CHS flax gene are more accessible for methylation when located within a CpG island. The

Oligodeoxynucleotides Can Transiently Up- and Downregulate CHS Gene Expression in Flax by Changing DNA Methylation in a Sequence-Specific Manner.

PubMed

Dzialo, Magdalena; Szopa, Jan; Czuj, Tadeusz; Zuk, Magdalena

2017-01-01

Chalcone synthase (CHS) has been recognized as an essential enzyme in the phenylpropanoid biosynthesis pathway. Apart from the leading role in the production of phenolic compounds with many valuable biological activities beneficial to biomedicine, CHS is well appreciated in science. Genetic engineering greatly facilitates expanding knowledge on the function and genetics of CHS in plants. The CHS gene is one of the most intensively studied genes in flax. In our study, we investigated engineering of the CHS gene through genetic and epigenetic approaches. Considering the numerous restrictions concerning the application of genetically modified (GM) crops, the main purpose of this research was optimization of the plant's modulation via epigenetics. In our study, plants modified through two methods were compared: a widely popular agrotransformation and a relatively recent oligodeoxynucleotide (ODN) strategy. It was recently highlighted that the ODN technique can be a rapid and time-serving antecedent in quick analysis of gene function before taking vector-mediated transformation. In order to understand the molecular background of epigenetic variation in more detail and evaluate the use of ODNs as a tool for predictable and stable gene engineering, we concentrated on the integration of gene expression and gene-body methylation. The treatment of flax with a series of short oligonucleotides homologous to a different part of CHS gene isoforms revealed that those directed to regulatory gene regions (5'- and 3'-UTR) activated gene expression, directed to non-coding region (introns) caused gen activity reduction, while those homologous to a coding region may have a variable influence on its activity. Gene expression changes were accompanied by changes in its methylation status. However, only certain (CCGG) motifs along the gene sequence were affected. The analyzed DNA motifs of the CHS flax gene are more accessible for methylation when located within a CpG island. The

Embryonic essential myosin light chain regulates fetal lung development in rats.

PubMed

Santos, Marta; Moura, Rute S; Gonzaga, Sílvia; Nogueira-Silva, Cristina; Ohlmeier, Steffen; Correia-Pinto, Jorge

2007-09-01

Congenital diaphragmatic hernia (CDH) is currently the most life-threatening congenital anomaly the major finding of which is lung hypoplasia. Lung hypoplasia pathophysiology involves early developmental molecular insult in branching morphogenesis and a late mechanical insult by abdominal herniation in maturation and differentiation processes. Since early determinants of lung hypoplasia might appear as promising targets for prenatal therapy, proteomics analysis of normal and nitrofen-induced hypoplastic lungs was performed at 17.5 days after conception. The major differentially expressed protein was identified by mass spectrometry as myosin light chain 1a (MLC1a). Embryonic essential MLC1a and regulatory myosin light chain 2 (MLC2) were characterized throughout normal and abnormal lung development by immunohistochemistry and Western blot. Disruption of MLC1a expression was assessed in normal lung explant cultures by antisense oligodeoxynucleotides. Since early stages of normal lung development, MLC1a was expressed in vascular smooth muscle (VSM) cells of pulmonary artery, and MLC2 was present in parabronchial smooth muscle and VSM cells of pulmonary vessels. In addition, early smooth muscle differentiation delay was observed by immunohistochemistry of alpha-smooth muscle actin and transforming growth factor-beta1. Disruption of MLC1a expression during normal pulmonary development led to significant growth and branching impairment, suggesting a role in branching morphogenesis. Both MLC1a and MLC2 were absent from hypoplastic fetal lungs during pseudoglandular stage of lung development, whereas their expression partially recovered by prenatal treatment with vitamin A. Thus, a deficiency in contractile proteins MLC1a and MLC2 might have a role among the early molecular determinants of lung hypoplasia in the rat model of nitrofen-induced CDH.

75 FR 60761 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-01

... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...