Runge, D M; Runge, D; Dorko, K; Pisarov, L A; Leckel, K; Kostrubsky, V E; Thomas, D; Strom, S C; Michalopoulos, G K
1999-02-01
Serum-free primary cultures of hepatocytes are a useful tool to study factors triggering hepatocyte proliferation and regeneration. We have developed a chemically defined serum-free system that allows human hepatocyte proliferation in the presence of epidermal growth factor and hepatocyte growth factor. DNA synthesis and accumulation were determined by [3H]thymidine incorporation and fluorometry, respectively. Western blot analyses and co-immunoprecipitations were used to investigate the association of proteins involved in epidermal growth factor and hepatocyte growth factor activation and signaling: epidermal growth factor receptor, hepatocyte growth factor receptor (MET), urokinase-type plasminogen activator and its receptor, and a member of the signal transducer and activator of transcription family, STAT-3. Primary human hepatocytes proliferated under serum-free conditions in a chemically defined medium for up to 12 days. Epidermal growth factor-receptor and MET were present and functional, decreasing over time. MET, urokinase-type plasminogen activator and urokinase-type plasminogen activator receptor co-precipitated to varying degrees during the culture period. STAT-3 co-precipitated with epidermal growth factor-receptor and MET to varying degrees. Proliferation of human hepatocytes can improve by modification of a chemically defined medium originally used for rat hepatocyte cultures. In these long-term cultures of human hepatocytes, hepatocyte growth factor and epidermal growth factor can stimulate growth and differentiation by interacting with their receptors and initiating downstream signaling. This involves complex formation of the receptors with other plasma membrane components for MET (urokinase-type plasminogen activator in context of its receptor) and activation of STAT-3 for both receptors.
Engl, Tobias; Boost, Kim A; Leckel, Kerstin; Beecken, Wolf-Dietrich; Jonas, Dietger; Oppermann, Elsie; Auth, Marcus K H; Schaudt, André; Bechstein, Wolf-Otto; Blaheta, Roman A
2004-08-01
In vitro culture models that employ human liver cells could be potent tools for predictive studies on drug toxicity and metabolism in the pharmaceutical industry. However, an adequate receptor responsiveness is necessary to allow intracellular signalling and metabolic activity. We tested the ability of three-dimensionally arranged human hepatocytes to respond to the growth factors hepatocyte growth factor (HGF) or epidermal growth factor (EGF). Isolated adult human hepatocytes were cultivated within a three-dimensional collagen gel (sandwich) or on a two-dimensional collagen matrix. Cells were treated with HGF or EGF and expression and phosphorylative activity of HGF receptors (HGFr, c-met) or EGF receptors (EGFr) were measured by flow cytometry and Western blot. Increasing HGFr and EGFr levels were detected in hepatocytes growing two-dimensionally. However, both receptors were not activated in presence of growth factors. In contrast, when hepatocytes were plated within a three-dimensional matrix, HGFr and EGFr levels remained constantly low. However, both receptors became strongly phosphorylated by soluble HGF or EGF. We conclude that cultivation of human hepatocytes in a three-dimensionally arranged in vitro system allows the maintenance of specific functional activities. The necessity of cell dimensionality for HGFr and EGFr function should be considered when an adequate in vitro system has to be introduced for drug testing.
[Proliferation of hepatocytes after delivery of exogenous hepatocyte growth factor gene].
Lin, Yong; Xie, Wei fen; Chen, Wei-zhong; Zhang, Xin; Zeng, Xin; Chen, Yue-xiang; Yang, Xiu-jiang; Zhang, Zhong-bing
2003-06-01
To explore the proliferation of primary cultured rats hepatocytes after delivery of exogenous hepatocyte growth factor (HGF) gene which was inserted into the genome of replication-deficient recombinant adenovirus vector. The recombinant adenovirus-AdHGF which could express HGF was generated by homologous recombination. After the HGF gene was delivered into the hepatocytes, the expression of both HGF and c-met/HGF receptor mRNA in the cells was detected by RT-PCR and the level of HGF in the culture supernatant was also assayed by ELISA. On the other hand, cell proliferation was compared between before and after delivery of the HGF gene by MTS assay and the percentages of cell cycles were analyzed by flow cytometry. In addition, the expression of proliferating cell nuclear antigen (PCNA) was determined by immunocytofluorescent stain. 4 x 10(10) efu/ml titer of AdHGF was obtained after recombination, RT-PCR indicated that the expression of HGF mRNA in hepatocytes increased on the third day after infected by the viruses and c-met/HGF receptor mRNA was also up-regulated. The HGF level in the culture supernatant assayed by ELISA was (5,939.0+/-414.39) pg/ml, which was much higher than that in the control (208.1pg/ml+/-37.20pg/ml, F=13.661, P<0.01). In addition, the proliferation of hepatocytes infected with AdHGF increased significantly according to MTS method (F>or=15.158, P<0.01) and more hepatocytes in G0/G1 stages changed into S stage (chi2=41.616, P<0.01), accordingly, PCNA index increased from 6.42+/- 1.88 to 14.56+/-2.85 (F=42.122, P<0.01). show that HGF gene delivered into hepatocytes by AdHGF can be expressed with high efficiency in the cells, which can stimulate hepatocytes proliferation. It may be an effective tool for hepatocyte transplantation by gene modified donor hepatocytes.
Epidermal growth factor-stimulated protein phosphorylation in rat hepatocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Connelly, P.A.; Sisk, R.B.; Johnson, R.M.
1987-05-01
Epidermal growth factor (EGF) causes a 6-fold increase in the phosphorylation state of a cytosolic protein (pp36, M/sub r/ = 36,000, pI = 5.5) in hepatocytes isolated from fasted, male, Wistar rats. Stimulation of /sup 32/P incorporation is observed as early as 1 min following treatment of hepatocytes with EGF and is still present at 30 min after exposure to the growth factor. The phosphate incorporated into pp36 in response to EGF is located predominantly in serine but not tyrosine residues. Phosphorylation of pp36 does not occur in response to insulin or to agents which specifically activate the cAMP-dependent proteinmore » kinase (S/sub p/ -cAMPS), protein kinase C (PMA) or Ca/sup 2 +//calmodulin-dependent protein kinases (A23187) in these cells. Prior treatment of hepatocytes with the cAMP analog, S/sub p/-cAMPS, or ADP-ribosylation of N/sub i/, the inhibitory GTP-binding protein of the adenylate cyclase complex, does not prevent EGF-stimulated phosphorylation of pp36. However, as seen in other cell types, pretreatment of hepatocytes with PMA abolishes all EGF-mediated responses including phosphorylation of pp36. These results suggest that EGP specifically activates an uncharacterized, serine protein kinase in hepatocytes that is distal to the intrinsic EGF receptor tyrosine protein kinase. The rapid activation of this kinase suggests that it may play an important role in the early response of the cell to EGF.« less
Gao, C; Jokerst, R; Gondipalli, P; Cai, S R; Kennedy, S; Flye, M W; Ponder, K P
1999-12-01
The liver regenerates by replication of differentiated hepatocytes after damage or removal of part of the liver. Although several growth factors and signaling pathways are activated during regeneration, it is unclear as to which of these are essential for hepatocyte replication. We show here that low- (1 mg/kg) and high- (10 mg/kg) dose hepatocyte growth factor (HGF) induced replication of 2.1% and 11.1% of hepatocytes in rats, respectively. Lipopolysaccharide (LPS), an inducer of the acute phase response, augmented hepatocyte replication in response to low- and high-dose HGF by 4- and 2-fold, respectively. HGF alone induced moderate levels of c-Jun-N-terminal kinase (JNK) and p44/p42 mitogen-activated protein kinase (MAPK), resulting in moderate levels of AP-1-DNA binding activity. The combination of LPS + HGF increased JNK and AP-1-DNA binding activity more than levels seen with LPS or HGF alone. The activation of Stat3 that was observed after administration of LPS + HGF, but not HGF alone, could contribute to increased transcription of AP-1 components. Because phosphorylation of the c-Jun component of AP-1 by JNK increases its ability to activate transcription, the AP-1 in hepatocytes from animals treated with LPS + HGF may be more active than in rats treated with LPS or HGF alone. LPS may contribute to hepatocyte replication by potentiating the effect of HGF on the activation of both AP-1-DNA binding and transcriptional activity.
Joaquin, M; Rosa, J L; Salvadó, C; López, S; Nakamura, T; Bartrons, R; Gil, J; Tauler, A
1996-01-01
Hepatocyte growth factor (HGF) and transforming growth factor beta (TGF-beta) are believed to be of major importance for hepatic regeneration after liver damage. We have studied the effect of these growth factors on fructose 2,6-bisphosphate (Fru-2,6-P2) levels and the expression of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (6PF2K/Fru-2,6-BPase) in rat hepatocyte primary cultures. Our results demonstrate that HGF activates the expression of the 6PF2K/Fru-2,6-BPase gene by increasing the levels of its mRNA. As a consequence of this activation, the amount of 6PF2K/Fru-2,6-BPase protein and 6-phosphofructo-2-kinase activity increased, which was reflected by a rise in Fru-2,6-P2 levels. In contrast, TGF-beta decreased the levels of 6PF2K/Fru-2,6-BPase mRNA, which led to a decrease in the amount of 6PF2K/Fru-2,6-BPase protein and Fru-2,6-P2. The different actions of HGF and TGF-beta on 6PF2K/Fru-2,6-BPase gene expression are concomitant with their effect on cell proliferation. Here we show that, in the absence of hormones, primary cultures of hepatocytes express the F-type isoenzyme. In addition, HGF increases the expression of this isoenzyme, and dexamethasone activates the L-type isoform. HGF and TGF-beta were able to inhibit this activation. PMID:8660288
[Ischemic brain injury and hepatocyte growth factor].
Takeo, Satoshi; Takagi, Norio; Takagi, Keiko
2007-11-01
Cerebral ischemia causes an irreversible and neurodegenerative disorder that may lead to progressive dementia and global cognitive deterioration. Since the overall process of ischemic brain injuries is extremely complex, treatment with endogenous multifunctional factors would be better choices for preventing complicated ischemic brain injuries. Hepatocyte growth factor, HGF, is a multifunctional cytokine originally identified and purified as a potent mitogen for hepatocyte. The activation of the c-Met/HGF receptor evokes diverse cellular responses, including mitogenic, morphogenic, angiogenic and anti-apoptotic activities in various types of cell. Previous studies showed that HGF and c-Met were expressed in various brain regions under normal conditions and that HGF enhanced the survival of hippocampal and cortical neurons during the aging of cells in culture. The protective effects of HGF on in vivo ischemic brain injuries and their mechanisms have not fully understood. To elucidate therapeutic potencies of HGF for ischemic brain injuries, we examined effects of HGF on ischemia-induced learning and memory dysfunction, neuronal cell death and endothelial cell damage by using the 4-vessel occlusion model and the microsphere embolism model in rats. Our findings suggested that treatment with HGF was capable of protecting hippocampal neurons against ischemia-induced cell death through the prevention of apoptosis-inducing factor translocation to the nucleus. Furthermore, we demonstrated that HGF had the ability to prevent tissue degeneration and improved learning and memory function after cerebral embolism, possibly through prevention of cerebral vessel injuries. As HGF has a potent cerebroprotective effect, it could be a prospective agent for the therapy against complicated ischemic brain diseases.
Iwai, Mineko; Matsuda, Masahiko; Iwai, Yoshiaki
2003-01-01
A cell colony (IM95m) that produces hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), and interleukin-8 (IL-8) was cloned from gastric cancer cells (IM95 cell line). In culture medium, the highest levels of HGF, VEGF, and IL-8 were about 1.1, 0.9, and 0.17 ng/ml culture medium at 3 d from 10(5) cells. IM95m may be useful in elucidating the role of tumor cells in angiogenesis.
Moghadam, Samira; Erfanmanesh, Maryam; Esmaeilzadeh, Abdolreza
2017-11-01
An autoimmune demyelination disease of the Central Nervous System, Multiple Sclerosis, is a chronic inflammation which mostly involves young adults. Suffering people face functional loss with a severe pain. Most current MS treatments are focused on the immune response suppression. Approved drugs suppress the inflammatory process, but factually, there is no definite cure for Multiple Sclerosis. Recently developed knowledge has demonstrated that gene and cell therapy as a hopeful approach in tissue regeneration. The authors propose a novel combined immune gene therapy for Multiple Sclerosis treatment using anti-inflammatory and remyelination of Interleukine-35 and Hepatocyte Growth Factor properties, respectively. In this hypothesis Interleukine-35 and Hepatocyte Growth Factor introduce to Mesenchymal Stem Cells of EAE mouse model via an adenovirus based vector. It is expected that Interleukine-35 and Hepatocyte Growth Factor genes expressed from MSCs could effectively perform in immunotherapy of Multiple Sclerosis. Copyright © 2017. Published by Elsevier Ltd.
Hepatocyte growth factor (HGF) modulates GABAergic inhibition and seizure susceptibility
Bae, Mihyun H.; Bissonette, Gregory B.; Mars, Wendy M.; Michalopoulos, George K.; Achim, Cristian L.; Depireux, Didier A.; Powell, Elizabeth M.
2009-01-01
Disrupted ontogeny of forebrain inhibitory interneurons leads to neurological disorders, including epilepsy. Adult mice lacking the urokinase plasminogen activator receptor (Plaur) have decreased numbers of neocortical GABAergic interneurons and spontaneous seizures, attributed to a reduction of hepatocyte growth factor/scatter factor (HGF/SF). We report that by increasing endogenous HGF/SF concentration in the postnatal Plaur null mouse brain maintains the interneuron populations in the adult, reverses the seizure behavior and stabilizes the spontaneous electroencephalogram activity. The perinatal intervention provides a pathway to reverse potential birth defects and ameliorate seizures in the adult. PMID:19853606
Zhou, Qing-Jun; Huang, Yan-Dan; Xiang, Li-Xin; Shao, Jian-Zhong; Zhou, Guo-Shun; Yao, Hang; Dai, Li-Cheng; Lu, Yong-Liang
2007-01-01
The feasibility of transforming embryonic endoderm into different cell types is tightly controlled by mesodermal and septum transversumal signalings during early embryonic development. Here, an induction protocol tracing embryonic liver development was designed, in which, three growth factors, acid fibroblast growth factor, basic fibroblast growth factor and bone morphological protein-4 that secreted from pre-cardiac mesoderm and septum transversum mesenchyme, respectively, were employed to investigate their specific potency of modulating the mature hepatocyte proportion during the differentiation process. Results showed that hepatic differentiation took place spontaneously at a low level, however, supplements of the three growth factors gave rise to a significant up-regulation of mature hepatocytes. Bone morphological protein-4 highlighted the differentiation ratio to 40-55%, showing the most effective promotion, and also exhibited a synergistic effect with the other two fibroblast factors, whereas no similar phenomenon was observed between the other two factors, which was reported for the first time. Our study not only provides a high-performance system of embryonic stem cells differentiating into hepatocytes, which would supply a sufficient hepatic population for related studies, but also make it clear of the inductive effects of three important growth factors, which could support for further investigation on the mechanisms of mesodermal and septumal derived signalings that regulate hepatic differentiation.
Kataoka, Hiroaki; Kawaguchi, Makiko; Fukushima, Tsuyoshi; Shimomura, Takeshi
2018-03-01
The growth, survival, and metabolic activities of multicellular organisms at the cellular level are regulated by intracellular signaling, systemic homeostasis and the pericellular microenvironment. Pericellular proteolysis has a crucial role in processing bioactive molecules in the microenvironment and thereby has profound effects on cellular functions. Hepatocyte growth factor activator inhibitor type 1 (HAI-1) and HAI-2 are type I transmembrane serine protease inhibitors expressed by most epithelial cells. They regulate the pericellular activities of circulating hepatocyte growth factor activator and cellular type II transmembrane serine proteases (TTSPs), proteases required for the activation of hepatocyte growth factor (HGF)/scatter factor (SF). Activated HGF/SF transduces pleiotropic signals through its receptor tyrosine kinase, MET (coded by the proto-oncogene MET), which are necessary for cellular migration, survival, growth and triggering stem cells for accelerated healing. HAI-1 and HAI-2 are also required for normal epithelial functions through regulation of TTSP-mediated activation of other proteases and protease-activated receptor 2, and also through suppressing excess degradation of epithelial junctional proteins. This review summarizes current knowledge regarding the mechanism of pericellular HGF/SF activation and highlights emerging roles of HAIs in epithelial development and integrity, as well as tumorigenesis and progression of transformed epithelial cells. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
Dong, Jia; Lübberstedt, Marc; Urbaniak, Thomas; Nüssler, Andreas K.N.; Knobeloch, Daniel; Gerlach, Jörg C.; Zeilinger, Katrin
2008-01-01
Optimization of cell culture media based on statistical experimental design methodology is a widely used approach for improving cultivation conditions. We applied this methodology to refine the composition of an established culture medium for growth of a human hepatoma cell line, C3A. A selection of growth factors and nutrient supplements were systematically screened according to standard design of experiments (DoE) procedures. The results of the screening indicated that the medium additives hepatocyte growth factor, oncostatin M, and fibroblast growth factor 4 significantly influenced the metabolic activities of the C3A cell line. Surface response methodology revealed that the optimum levels for these factors were 30 ng/ml for hepatocyte growth factor and 35 ng/ml for oncostatin M. Additional experiments on primary human hepatocyte cultures showed high variance in metabolic activities between cells from different individuals, making determination of optimal levels of factors more difficult. Still, it was possible to conclude that hepatocyte growth factor, epidermal growth factor, and oncostatin M had decisive effects on the metabolic functions of primary human hepatocytes. PMID:19003182
Dong, Jia; Mandenius, Carl-Fredrik; Lübberstedt, Marc; Urbaniak, Thomas; Nüssler, Andreas K N; Knobeloch, Daniel; Gerlach, Jörg C; Zeilinger, Katrin
2008-07-01
Optimization of cell culture media based on statistical experimental design methodology is a widely used approach for improving cultivation conditions. We applied this methodology to refine the composition of an established culture medium for growth of a human hepatoma cell line, C3A. A selection of growth factors and nutrient supplements were systematically screened according to standard design of experiments (DoE) procedures. The results of the screening indicated that the medium additives hepatocyte growth factor, oncostatin M, and fibroblast growth factor 4 significantly influenced the metabolic activities of the C3A cell line. Surface response methodology revealed that the optimum levels for these factors were 30 ng/ml for hepatocyte growth factor and 35 ng/ml for oncostatin M. Additional experiments on primary human hepatocyte cultures showed high variance in metabolic activities between cells from different individuals, making determination of optimal levels of factors more difficult. Still, it was possible to conclude that hepatocyte growth factor, epidermal growth factor, and oncostatin M had decisive effects on the metabolic functions of primary human hepatocytes.
Gorin, Caroline; Rochefort, Gael Y.; Bascetin, Rumeyza; Ying, Hanru; Lesieur, Julie; Sadoine, Jérémy; Beckouche, Nathan; Berndt, Sarah; Novais, Anita; Lesage, Matthieu; Hosten, Benoit; Vercellino, Laetitia; Merlet, Pascal; Le-Denmat, Dominique; Marchiol, Carmen; Letourneur, Didier; Nicoletti, Antonino; Vital, Sibylle Opsahl; Poliard, Anne; Salmon, Benjamin; Germain, Stéphane
2016-01-01
Tissue engineering strategies based on implanting cellularized biomaterials are promising therapeutic approaches for the reconstruction of large tissue defects. A major hurdle for the reliable establishment of such therapeutic approaches is the lack of rapid blood perfusion of the tissue construct to provide oxygen and nutrients. Numerous sources of mesenchymal stem cells (MSCs) displaying angiogenic potential have been characterized in the past years, including the adult dental pulp. Establishment of efficient strategies for improving angiogenesis in tissue constructs is nevertheless still an important challenge. Hypoxia was proposed as a priming treatment owing to its capacity to enhance the angiogenic potential of stem cells through vascular endothelial growth factor (VEGF) release. The present study aimed to characterize additional key factors regulating the angiogenic capacity of such MSCs, namely, dental pulp stem cells derived from deciduous teeth (SHED). We identified fibroblast growth factor-2 (FGF-2) as a potent inducer of the release of VEGF and hepatocyte growth factor (HGF) by SHED. We found that FGF-2 limited hypoxia-induced downregulation of HGF release. Using three-dimensional culture models of angiogenesis, we demonstrated that VEGF and HGF were both responsible for the high angiogenic potential of SHED through direct targeting of endothelial cells. In addition, FGF-2 treatment increased the fraction of Stro-1+/CD146+ progenitor cells. We then applied in vitro FGF-2 priming to SHED before encapsulation in hydrogels and in vivo subcutaneous implantation. Our results showed that FGF-2 priming is more efficient than hypoxia at increasing SHED-induced vascularization compared with nonprimed controls. Altogether, these data demonstrate that FGF-2 priming enhances the angiogenic potential of SHED through the secretion of both HGF and VEGF. Significance The results from the present study show that fibroblast growth factor-2 (FGF-2) priming is more
Fibroblast growth factor 7 inhibits cholesterol 7{alpha}-hydroxylase gene expression in hepatocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Zhichao; Yu, Xuemei; Wu, Weibin
2012-07-13
Highlights: Black-Right-Pointing-Pointer FGF7 strongly and rapidly down-regulates the expression of CYP7A1 in hepatocytes. Black-Right-Pointing-Pointer FGF7 suppresses the expression of CYP7A1 via FGFR2 and downstream JNK activation. Black-Right-Pointing-Pointer Blocking FGF7 abrogates HSC-induced inhibition of CYP7A1 expression in hepatocytes. -- Abstract: Cholesterol 7{alpha}-hydroxylase (CYP7A1) is the initial and rate-limiting enzyme for bile acid synthesis. Transcription of the CYP7A1 gene is regulated by bile acids, nuclear receptors and cytokines. Fibroblast growth factor 7 (FGF7) secreted from activated hepatic stellate cells (HSC) during chronic liver fibrosis regulates hepatocyte survival and liver regeneration. In the carbon tetrachloride (CCl{sub 4})-induced fibrotic mouse liver, we demonstrated thatmore » the expression of CYP7A1 was largely decreased while the expression of FGF7 was significantly increased. We further demonstrated that FGF7 inhibited CYP7A1 gene expression in hepatocytes. Knockdown study by short interfering RNA, kinase inhibition and phosphorylation assays revealed that the suppression of CYP7A1 expression by FGF7 was mediated by FGFR2 and its downstream JNK signaling cascade. The FGF7 neutralizing antibody restored CYP7A1 expression in Hep3B cells treated with conditioned medium from HSC. In summary, the data suggest that FGF7 is a novel regulator of CYP7A1 expression in hepatocytes and may prevent hepatocytes from accumulating toxic bile acids during liver injury and fibrosis.« less
Hepatocyte growth factor in renal failure: promise and reality.
Vargas, G A; Hoeflich, A; Jehle, P M
2000-04-01
Can science discover some secrets of Greek mythology? In the case of Prometheus, we can now suppose that his amazing hepatic regeneration was caused by a peptide growth factor called hepatocyte growth factor (HGF). Increasing evidence indicates that HGF acts as a multifunctional cytokine on different cell types. This review addresses the molecular mechanisms that are responsible for the pleiotropic effects of HGF. HGF binds with high affinity to its specific tyrosine kinase receptor c-met, thereby stimulating not only cell proliferation and differentiation, but also cell migration and tumorigenesis. The three fundamental principles of medicine-prevention, diagnosis, and therapy-may be benefited by the rational use of HGF. In renal tubular cells, HGF induces mitogenic and morphogenetic responses. In animal models of toxic or ischemic acute renal failure, HGF acts in a renotropic and nephroprotective manner. HGF expression is rapidly up-regulated in the remnant kidney of nephrectomized rats, inducing compensatory growth. In a mouse model of chronic renal disease, HGF inhibits the progression of tubulointerstitial fibrosis and kidney dysfunction. Increased HGF mRNA transcripts were detected in mesenchymal and tubular epithelial cells of rejecting kidney. In transplanted patients, elevated HGF levels may indicate renal rejection. When HGF is considered as a therapeutic agent in human medicine, for example, to stimulate kidney regeneration after acute injury, strategies need to be developed to stimulate cell regeneration and differentiation without an induction of tumorigenesis.
Rana, B; Mischoulon, D; Xie, Y; Bucher, N L; Farmer, S R
1994-01-01
Previous investigations have shown that culture of freshly isolated hepatocytes under conventional conditions, i.e., on dried rat tail collagen in the presence of growth factors, facilitates cell growth but also causes an extensive down-regulation of most liver-specific functions. This dedifferentiation process can be prevented if the cells are cultured on a reconstituted basement membrane gel matrix derived from the Englebreth-Holm-Swarm mouse sarcoma tumor (EHS gel). To gain insight into the mechanisms regulating this response to extracellular matrix, we are analyzing the activities of two families of transcription factors, C/EBP and AP-1, which control the transcription of hepatic and growth-responsive genes, respectively. We demonstrate that isolation of hepatocytes from the normal quiescent rat liver by collagenase perfusion activates the immediate-early growth response program, as indicated by increased expression of c-jun, junB, c-fos, and c-myc mRNAs. Adhesion of these activated cells to dried rat tail collagen augments the elevated levels of these mRNAs for the initial 1 to 2 h postplating; junB and c-myc mRNA levels then drop steeply, with junB returning to normal quiescence and the c-myc level remaining slightly elevated during the 3-day culture period. Levels of c-jun mRNA and AP-1 DNA binding activity, however, remain elevated from the outset, while C/EBP alpha mRNA expression is down-regulated, resulting in a decrease in the steady-state levels of the 42- and 30-kDa C/EBP alpha polypeptides and C/EBP alpha DNA binding activity. In contrast, C/EBP beta mRNA production remains at near-normal hepatic levels for 5 to 8 days of culture, although its DNA binding activity decreases severalfold during this time. Adhesion of hepatocytes to the EHS gel for the same period of time dramatically alters this program: it arrests growth and inhibits AP-1 DNA binding activity and the expression of c-jun, junB, and c-myc mRNAs, but, in addition, it restores C/EBP alpha
Giannoni, Paolo; Scaglione, Silvia; Quarto, Rodolfo; Narcisi, Roberto; Parodi, Manuela; Balleari, Enrico; Barbieri, Federica; Pattarozzi, Alessandra; Florio, Tullio; Ferrini, Silvano; Corte, Giorgio; de Totero, Daniela
2011-07-01
Chronic lymphocytic leukemia cells are characterized by an apparent longevity in vivo which is lost when they are cultured in vitro. Cellular interactions and factors provided by the microenvironment appear essential to cell survival and may protect leukemic cells from the cytotoxicity of conventional therapies. Understanding the cross-talk between leukemic cells and stroma is of interest for identifying signals supporting disease progression and for developing novel therapeutic strategies. Different cell types, sharing a common mesenchymal origin and representative of various bone marrow components, were used to challenge the viability of leukemic cells in co-cultures and in contact-free culture systems. Using a bioinformatic approach we searched for genes shared by lineages prolonging leukemic cell survival and further analyzed their biological role in signal transduction experiments. Human bone marrow stromal cells, fibroblasts, trabecular bone-derived cells and an osteoblast-like cell line strongly enhanced survival of leukemic cells, while endothelial cells and chondrocytes did not. Gene expression profile analysis indicated two soluble factors, hepatocyte growth factor and CXCL12, as potentially involved. We demonstrated that hepatocyte growth factor and CXCL12 are produced only by mesenchymal lineages that sustain the survival of leukemic cells. Indeed chronic lymphocytic leukemic cells express a functional hepatocyte growth factor receptor (c-MET) and hepatocyte growth factor enhanced the viability of these cells through STAT3 phosphorylation, which was blocked by a c-MET tyrosine kinase inhibitor. The role of hepatocyte growth factor was confirmed by its short interfering RNA-mediated knock-down in mesenchymal cells. The finding that hepatocyte growth factor prolongs the survival of chronic lymphocytic leukemic cells is novel and we suggest that the interaction between hepatocyte growth factor-producing mesenchymal and neoplastic cells contributes to
Giannoni, Paolo; Scaglione, Silvia; Quarto, Rodolfo; Narcisi, Roberto; Parodi, Manuela; Balleari, Enrico; Barbieri, Federica; Pattarozzi, Alessandra; Florio, Tullio; Ferrini, Silvano; Corte, Giorgio; de Totero, Daniela
2011-01-01
Background Chronic lymphocytic leukemia cells are characterized by an apparent longevity in vivo which is lost when they are cultured in vitro. Cellular interactions and factors provided by the microenvironment appear essential to cell survival and may protect leukemic cells from the cytotoxicity of conventional therapies. Understanding the cross-talk between leukemic cells and stroma is of interest for identifying signals supporting disease progression and for developing novel therapeutic strategies. Design and Methods Different cell types, sharing a common mesenchymal origin and representative of various bone marrow components, were used to challenge the viability of leukemic cells in co-cultures and in contact-free culture systems. Using a bioinformatic approach we searched for genes shared by lineages prolonging leukemic cell survival and further analyzed their biological role in signal transduction experiments. Results Human bone marrow stromal cells, fibroblasts, trabecular bone-derived cells and an osteoblast-like cell line strongly enhanced survival of leukemic cells, while endothelial cells and chondrocytes did not. Gene expression profile analysis indicated two soluble factors, hepatocyte growth factor and CXCL12, as potentially involved. We demonstrated that hepatocyte growth factor and CXCL12 are produced only by mesenchymal lineages that sustain the survival of leukemic cells. Indeed chronic lymphocytic leukemic cells express a functional hepatocyte growth factor receptor (c-MET) and hepatocyte growth factor enhanced the viability of these cells through STAT3 phosphorylation, which was blocked by a c-MET tyrosine kinase inhibitor. The role of hepatocyte growth factor was confirmed by its short interfering RNA-mediated knock-down in mesenchymal cells. Conclusions The finding that hepatocyte growth factor prolongs the survival of chronic lymphocytic leukemic cells is novel and we suggest that the interaction between hepatocyte growth factor
Yamada, Tadaaki; Takeuchi, Shinji; Kita, Kenji; Bando, Hideaki; Nakamura, Takahiro; Matsumoto, Kunio; Yano, Seiji
2012-02-01
Epidermal growth factor receptor (EGFR) is an attractive drug target in lung cancer, with several anti-EGFR antibodies and small-molecule inhibitors showing efficacy in lung cancer patients. Patients, however, may develop resistance to EGFR inhibitors. We demonstrated previously that hepatocyte growth factor (HGF) induced resistance to EGFR tyrosine kinase inhibitors in lung cancers harboring EGFR mutations. We therefore determined whether HGF could induce resistance to the anti-EGFR antibody (EGFR Ab) cetuximab in lung cancer cells, regardless of EGFR gene status. Cetuximab sensitivity and signal transduction in lung cancer cells were examined in the presence or absence of HGF, HGF-producing fibroblasts, and cells tranfected with the HGF gene in vitro and in vivo. HGF induced resistance to cetuximab in H292 (EGFR wild) and Ma-1(EGFR mutant) cells. Western blotting showed that HGF-induced resistance was mediated by the Met/Gab1/Akt signaling pathway. Resistance of H292 and Ma-1 cells to cetuximab was also induced by coculture with lung fibroblasts producing high levels of HGF and by cells stably transfected with the HGF gene. This resistance was abrogated by treatment with anti-HGF neutralizing antibody. HGF-mediated resistance is a novel mechanism of resistance to EGFR Ab in lung cancers, with fibroblast-derived HGF inducing cetuximab resistance in H292 tumors in vivo. The involvement of HGF-Met-mediated signaling should be assessed in acquired resistance to EGFR Ab in lung cancer, regardless of EGFR gene status.
The effect of hepatocyte growth factor on secretory functions in human eosinophils.
Yamauchi, Yumiko; Ueki, Shigeharu; Konno, Yasunori; Ito, Wataru; Takeda, Masahide; Nakamura, Yuka; Nishikawa, Junko; Moritoki, Yuki; Omokawa, Ayumi; Saga, Tomoo; Hirokawa, Makoto
2016-12-01
Hepatocyte growth factor (HGF), originally identified as a potent mitogen for mature hepatocytes, is now recognized as a humoral mediator in inflammatory and immune responses. Previous studies indicated that HGF negatively regulated allergic airway inflammation. In view of eosinophils playing a role in the pathogenesis of asthma, especially in airway remodeling as a rich source of pro-fibrogenic mediators, the effects of HGF on the different types of eosinophil secretory functions were examined in this study. We found that HGF significantly inhibited IL-5-induced secretion of TGF-β and VEGF from human eosinophils. The inhibitory effect is not associated with TGF-β transcription; rather, it is associated with ultrastructural granule emptying and loss of intracellular TGF-β contents, indicating HGF inhibits the process of piecemeal degranulation. The effect of HGF on extracellular trap cell death (ETosis) that mediates cytolytic degranulation was also investigated; however, immobilized IgG- or phorbol myristate acetate-induced ETosis was only minimally attenuated by HGF. These results reveal the effect of HGF on the distinct pathways of eosinophil secretory functions and also provide novel insights into the role of HGF in the pathogenesis of allergic inflammation. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Woo-Ram; Park, Ji-Hyun; Kim, Kyung-Hyun
Melittin is a cationic, hemolytic peptide that is the main toxic component in the venom of the honey bee (Apis mellifera). Melittin has multiple effects, including anti-bacterial, anti-viral and anti-inflammatory, in various cell types. However, the anti-apoptotic mechanisms of melittin have not been fully elucidated in hepatocytes. Apoptosis contributes to liver inflammation and fibrosis. Knowledge of the apoptotic mechanisms is important to develop new and effective therapies for treatment of cirrhosis, portal hypertension, liver cancer, and other liver diseases. In the present study, we investigated the anti-apoptotic effect of melittin on transforming growth factor (TGF)-{beta}1-induced apoptosis in hepatocytes. TGF-{beta}1-treated hepatocytesmore » were exposed to low doses (0.5 and 1 {mu}g/mL) and high dose (2 {mu}g/mL) of melittin. The low doses significantly protected these cells from DNA damage in TGF-{beta}1-induced apoptosis compared to the high dose. Also, melittin suppressed TGF-{beta}1-induced apoptotic activation of the Bcl-2 family and caspase family of proteins, which resulted in the inhibition of poly-ADP-ribose polymerase (PARP) cleavage. These results demonstrate that TGF-{beta}1 induces hepatocyte apoptosis and that an optimal dose of melittin exerts anti-apoptotic effects against TGF-{beta}1-induced injury to hepatocytes via the mitochondrial pathway. These results suggest that an optimal dose of melittin can serve to protect cells against TGF-{beta}1-mediated injury. - Highlights: > We investigated the anti-apoptotic effect of melittin on TGF-{beta}1-induced hepatocyte. > TGF-{beta}1 induces hepatocyte apoptosis. > TGF-{beta}1-treated hepatocytes were exposed to low doses and high dose of melittin. > Optimal dose of melittin exerts anti-apoptotic effects to hepatocytes.« less
Crystal Structure of a Two-domain Fragment of Hepatocyte Growth Factor Activator Inhibitor-1
Hong, Zebin; De Meulemeester, Laura; Jacobi, Annemarie; Pedersen, Jan Skov; Morth, J. Preben; Andreasen, Peter A.; Jensen, Jan K.
2016-01-01
Hepatocyte growth factor activator inhibitor-1 (HAI-1) is a type I transmembrane protein and inhibitor of several serine proteases, including hepatocyte growth factor activator and matriptase. The protein is essential for development as knock-out mice die in utero due to placental defects caused by misregulated extracellular proteolysis. HAI-1 contains two Kunitz-type inhibitor domains (Kunitz), which are generally thought of as a functionally self-contained protease inhibitor unit. This is not the case for HAI-1, where our results reveal how interdomain interactions have evolved to stimulate the inhibitory activity of an integrated Kunitz. Here we present an x-ray crystal structure of an HAI-1 fragment covering the internal domain and Kunitz-1. The structure reveals not only that the previously uncharacterized internal domain is a member of the polycystic kidney disease domain family but also how the two domains engage in interdomain interactions. Supported by solution small angle x-ray scattering and a combination of site-directed mutagenesis and functional assays, we show that interdomain interactions not only stabilize the fold of the internal domain but also stimulate the inhibitory activity of Kunitz-1. By completing our structural characterization of the previously unknown N-terminal region of HAI-1, we provide new insight into the interplay between tertiary structure and the inhibitory activity of a multidomain protease inhibitor. We propose a previously unseen mechanism by which the association of an auxiliary domain stimulates the inhibitory activity of a Kunitz-type inhibitor (i.e. the first structure of an intramolecular interaction between a Kunitz and another domain). PMID:27189939
GROWTH INHIBITORY ACTIONS OF PROTHROMBIN ON NORMAL HEPATOCYTES
Carr, Brian I.; Kar, Siddhartha; Wang, Meifang; Wang, Ziqiu
2007-01-01
Most hepatomas have a defect in prothrombin carboxylation, and can secrete under-carboxylated prothrombin or des-γ-carboxy-prothrombin (DCP), the function of which is unknown. We considered that prothrombin-DCP axis might also be involved in growth control. Hepatocytes and hepatoma cells were treated with prothrombin, and DNA synthesis and cytoskeleton were studied. Prothrombin inhibited DNA synthesis in hepatocytes on fibronectin, but not collagen matrix. Hepatoma cell lines were not inhibited. We found that hepatoma cell matrix conferred resistance to hepatocytes. Prothrombin decreased fibronectin but not collagen amounts, but only in the presence of hepatocytes and not hepatoma cells, indicating that it has a differential action on matrix proteins. It also caused changes in cell shape and actin depolymerization. In vivo, there was a decrease in plasma prothrombin activity after a partial hepatectomy (PH) concomitant with a peak of DNA synthesis by the hepatocyte at 24 h after PH. Injection of warfarin at the time of PH, further inhibited PT activity and enhanced this 24 h peak of DNA synthesis. Furthermore, repeated injection of prothrombin lowered the peak DNA synthesis after PH. The data support the hypothesis that prothrombin can act as a hepatocyte growth inhibitor, likely at the level of fibronectin loss and result in cytoskeletal changes. Hepatomas resist this action, possibly due to their different matrix proteins. This represents a novel mechanism for growth regulation and provides a possible biological significance for the tumor marker DCP. PMID:17490900
Kos, L; Aronzon, A; Takayama, H; Maina, F; Ponzetto, C; Merlino, G; Pavan, W
1999-02-01
The mechanisms governing development of neural crest-derived melanocytes, and how alterations in these pathways lead to hypopigmentation disorders, are not completely understood. Hepatocyte growth factor/scatter factor (HGF/SF) signaling through the tyrosine-kinase receptor, MET, is capable of promoting the proliferation, increasing the motility, and maintaining high tyrosinase activity and melanin synthesis of melanocytes in vitro. In addition, transgenic mice that ubiquitously overexpress HGF/SF demonstrate hyperpigmentation in the skin and leptomenigenes and develop melanomas. To investigate whether HGF/ SF-MET signaling is involved in the development of neural crest-derived melanocytes, transgenic embryos, ubiquitously overexpressing HGF/SF, were analyzed. In HGF/SF transgenic embryos, the distribution of melanoblasts along the characteristic migratory pathway was not affected. However, additional ectopically localized melanoblasts were also observed in the dorsal root ganglia and neural tube, as early as 11.5 days post coitus (p.c.). We utilized an in vitro neural crest culture assay to further explore the role of HGF/SF-MET signaling in neural crest development. HGF/SF added to neural crest cultures increased melanoblast number, permitted differentiation into pigmented melanocytes, promoted melanoblast survival, and could replace mast-cell growth factor/Steel factor (MGF) in explant cultures. To examine whether HGF/SF-MET signaling is required for the proper development of melanocytes, embryos with a targeted Met null mutation (Met-/-) were analysed. In Met-/- embryos, melanoblast number and location were not overtly affected up to 14 days p.c. These results demonstrate that HGF/SF-MET signaling influences, but is not required for, the initial development of neural crest-derived melanocytes in vivo and in vitro.
Mechanisms of Hepatocyte Growth Factor Activation in Cancer Tissues
Kawaguchi, Makiko; Kataoka, Hiroaki
2014-01-01
Hepatocyte growth factor/scatter factor (HGF/SF) plays critical roles in cancer progression through its specific receptor, MET. HGF/SF is usually synthesized and secreted as an inactive proform (pro-HGF/SF) by stromal cells, such as fibroblasts. Several serine proteases are reported to convert pro-HGF/SF to mature HGF/SF and among these, HGF activator (HGFA) and matriptase are the most potent activators. Increased activities of both proteases have been observed in various cancers. HGFA is synthesized mainly by the liver and secreted as an inactive pro-form. In cancer tissues, pro-HGFA is likely activated by thrombin and/or human kallikrein 1-related peptidase (KLK)-4 and KLK-5. Matriptase is a type II transmembrane serine protease that is expressed by most epithelial cells and is also synthesized as an inactive zymogen. Matriptase activation is likely to be mediated by autoactivation or by other trypsin-like proteases. Recent studies revealed that matriptase autoactivation is promoted by an acidic environment. Given the mildly acidic extracellular environment of solid tumors, matriptase activation may, thus, be accelerated in the tumor microenvironment. HGFA and matriptase activities are regulated by HGFA inhibitor (HAI)-1 (HAI-1) and/or HAI-2 in the pericellular microenvironment. HAIs may have an important role in cancer cell biology by regulating HGF/SF-activating proteases. PMID:25268161
Stock, Peggy; Bielohuby, Maximilian; Staege, Martin S; Hsu, Mei-Ju; Bidlingmaier, Martin; Christ, Bruno
2017-03-01
Hepatocyte transplantation is an alternative to whole liver transplantation. Yet, efficient liver repopulation by transplanted hepatocytes is low in livers of old animals. This restraint might be because of the poor proliferative capacity of aged donor hepatocytes or the regenerative impairment of the recipient livers. The age-dependent liver repopulation by transplanted wild-type hepatocytes was investigated in juvenile and senescent rats deficient in dipeptidyl-peptidase IV. Repopulation was quantified by flow cytometry and histochemical estimation of dipeptidyl-peptidase IV enzyme activity of donor cells in the negative host liver. As a potential pathway involved, expression of cell cycle proteins was assessed. Irrespective of the age of the donor hepatocytes, large cell clusters appeared in juvenile, but only small clusters in senescent host livers. Because juvenile and senescent donor hepatocytes were likewise functional, host-derived factor(s) impaired senescent host liver repopulation. Growth hormone levels were significantly higher in juvenile than in senescent rats, suggesting that growth hormone might promote host liver repopulation. Indeed, short-term treatment with growth hormone augmented senescent host liver repopulation involving the growth hormone-mediated release of the transcriptional blockade of genes associated with cell cycle progression. Short-term growth hormone substitution might improve liver repopulation by transplanted hepatocytes, thus augmenting the therapeutic benefit of clinical hepatocyte transplantation in older patients. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Galimi, F; Bagnara, G P; Bonsi, L; Cottone, E; Follenzi, A; Simeone, A; Comoglio, P M
1994-12-01
Hepatocyte growth factor (HGF) is a mesenchymal derived growth factor known to induce proliferation and "scattering" of epithelial and endothelial cells. Its receptor is the tyrosine kinase encoded by the c-MET protooncogene. Here we show that highly purified recombinant HGF stimulates hemopoietic progenitors to form colonies in vitro. In the presence of erythropoietin, picomolar concentrations of HGF induced the formation of erythroid burst-forming unit colonies from CD34-positive cells purified from human bone marrow, peripheral blood, or umbilical cord blood. The growth stimulatory activity was restricted to the erythroid lineage. HGF also stimulated the formation of multipotent CFU-GEMM colonies. This effect is synergized by stem cell factor, the ligand of the tyrosine kinase receptor encoded by the c-KIT protooncogene, which is active on early hemopoietic progenitors. By flow cytometry analysis, the receptor for HGF was found to be expressed on the cell surface in a fraction of CD34+ progenitors. Moreover, in situ hybridization experiments showed that HGF receptor mRNA is highly expressed in embryonic erythroid cells (megaloblasts). HGF mRNA was also found to be produced in the embryonal liver. These data show that HGF plays a direct role in the control of proliferation and differentiation of erythroid progenitors, and they suggest that it may be one of the long-sought mediators of paracrine interactions between stromal and hemopoietic cells within the hemopoietic microenvironment.
2011-01-01
Background Short half-life and low levels of growth factors in the niche of injured microenvironment necessitates the exogenous and sustainable delivery of growth factors along with stem cells to augment the regeneration of injured tissues. Methods Here, recombinant human hepatocyte growth factor (HGF) was incorporated into chitosan nanoparticles (CNP) by ionic gelation method and studied for its morphological and physiological characteristics. Cirrhotic mice received either hematopoietic stem cells (HSC) or mesenchymal stemcells (MSC) with or without HGF incorporated chitosan nanoparticles (HGF-CNP) and saline as control. Biochemical, histological, immunostaining and gene expression assays were carried out using serum and liver tissue samples. One way analysis of variance was used for statics application Results Serum levels of selected liver protein and enzymes were significantly increased in the combination of MSC and HGF-CNP (MSC+HGF-CNP) treated group. Immunopositive staining for albumin (Alb) and cytokeratin 18 (CK18), and reverse transcription-polymerase chain reaction (RT-PCR) for Alb, alpha fetoprotein (AFP), CK18, cytokeratin 19 (CK19) ascertained that MSC-HGF-CNP treatment could be an effective combination to repopulate liver parenchymal cells in the liver cirrhosis. Zymogram and western blotting for matrix metalloproteinases 2 and 9 (MMP2 and MMP9) revealed that MMP2 actively involved in the fibrolysis of cirrhotic tissue. Immunostaining for alpha smooth muscle actin (αSMA) and type I collagen showed decreased expression in the MSC+HGF-CNP treatment. These results indicated that HGF-CNP enhanced the differentiation of stem cells into hepatocytes and supported the reversal of fibrolysis of extracellular matrix (ECM). Conclusion Bone marrow stem cells were isolated, characterized and transplanted in mice model. Biodegradable biopolymeric nanoparticles were prepared with the pleotrophic protein molecule and it worked well for the differentiation of stem
Bae, Sung Hae; Ryu, Hoon; Rhee, Ki-Jong; Oh, Ji-Eun; Baik, Soon Koo; Shim, Kwang Yong; Kong, Jee Hyun; Hyun, Shin Young; Pack, Hyun Sung; Im, Changjo; Shin, Ha Cheol; Kim, Yong Man; Kim, Hyun Soo; Eom, Young Woo; Lee, Jong In
2015-04-01
l-ascorbic acid 2-phosphate (Asc-2P) acts as an antioxidant and a stimulator of hepatocyte growth factor (HGF) production. Previously, we reported that depletion of growth factors such as fibroblast growth factor (FGF)-2, epidermal growth factor (EGF), FGF-4 and HGF during serial passage could induce autophagy, senescence and down-regulation of stemness (proliferation via FGF-2/-4 and differentiation via HGF). In this study, we investigated the proliferation and differentiation potential of BMSCs by FGF-2 and Asc-2P. Co-treatment with FGF-2 and Asc-2P induced optimal proliferation of BMSCs and increased the accumulation rate of BMSC numbers during a 2-month culture period. Moreover, differentiation potential was maintained by co-treatment with FGF-2 and Asc-2P via HGF expression. Adipogenic differentiation potential by FGF-2 and Asc-2P was dramatically suppressed by c-Met inhibitors (SU11274). These data suggest that co-treatment with FGF-2 and Asc-2P would be beneficial in obtaining BMSCs that possess "stemness" during long-term culture.
Kittas, Aristotelis; Delobelle, Aurélien; Schmitt, Sabrina; Breuhahn, Kai; Guziolowski, Carito; Grabe, Niels
2016-01-01
An effective means to analyze mRNA expression data is to take advantage of established knowledge from pathway databases, using methods such as pathway-enrichment analyses. However, pathway databases are not case-specific and expression data could be used to infer gene-regulation patterns in the context of specific pathways. In addition, canonical pathways may not always describe the signaling mechanisms properly, because interactions can frequently occur between genes in different pathways. Relatively few methods have been proposed to date for generating and analyzing such networks, preserving the causality between gene interactions and reasoning over the qualitative logic of regulatory effects. We present an algorithm (MCWalk) integrated with a logic programming approach, to discover subgraphs in large-scale signaling networks by random walks in a fully automated pipeline. As an exemplary application, we uncover the signal transduction mechanisms in a gene interaction network describing hepatocyte growth factor-stimulated cell migration and proliferation from gene-expression measured with microarray and RT-qPCR using in-house perturbation experiments in a keratinocyte-fibroblast co-culture. The resulting subgraphs illustrate possible associations of hepatocyte growth factor receptor c-Met nodes, differentially expressed genes and cellular states. Using perturbation experiments and Answer Set programming, we are able to select those which are more consistent with the experimental data. We discover key regulator nodes by measuring the frequency with which they are traversed when connecting signaling between receptors and significantly regulated genes and predict their expression-shift consistently with the measured data. The Java implementation of MCWalk is publicly available under the MIT license at: https://bitbucket.org/akittas/biosubg. © 2015 FEBS.
Hepatocyte growth factor, a biomarker of macroangiopathy in diabetes mellitus
Konya, Hiroyuki; Miuchi, Masayuki; Satani, Kahori; Matsutani, Satoshi; Tsunoda, Taku; Yano, Yuzo; Katsuno, Tomoyuki; Hamaguchi, Tomoya; Miyagawa, Jun-Ichiro; Namba, Mitsuyoshi
2014-01-01
Atherosclerotic involvements are an essential causal element of prospect in diabetes mellitus (DM), with carotid atherosclerosis (CA) being a common risk-factor for prospective crisis of coronary artery diseases (CAD) and/or cerebral infarction (CI) in DM subjects. From another point of view, several reports have supplied augmenting proof that hepatocyte growth factor (HGF) has a physiopathological part in DM involvements. HGF has been a mesenchymal-derived polyphenic factor which modulates development, motion, and morphosis of diverse cells, and has been regarded as a humor intermediator of epithelial-mesenchymal interplays. The serum concentrations of HGF have been elevated in subjects with CAD and CI, especially during the acute phase of both disturbances. In our study with 89 type 2 DM patients, the association between serum concentrations of HGF and risk-factors for macrovascular complications inclusive of CA were examined. The average of serum HGF levels in the subjects was more elevated than the reference interval. The serum HGF concentrations associated positively with both intimal-media thickness (IMT) (r = 0.24, P = 0.0248) and plaque score (r = 0.27, P = 0.0126), indicating a relationship between the elevated HGF concentrations and advancement of CA involvements. Multivariate statistical analysis accentuated that serum concentrations of HGF would be associated independently with IMT (standardized = 0.28, P = 0.0499). The review indicates what is presently known regarding serum HGF might be a new and meaningful biomarker of macroangiopathy in DM subjects. PMID:25317245
Human hepatocyte growth factor promotes functional recovery in primates after spinal cord injury.
Kitamura, Kazuya; Fujiyoshi, Kanehiro; Yamane, Jun-Ichi; Toyota, Fumika; Hikishima, Keigo; Nomura, Tatsuji; Funakoshi, Hiroshi; Nakamura, Toshikazu; Aoki, Masashi; Toyama, Yoshiaki; Okano, Hideyuki; Nakamura, Masaya
2011-01-01
Many therapeutic interventions for spinal cord injury (SCI) using neurotrophic factors have focused on reducing the area damaged by secondary, post-injury degeneration, to promote functional recovery. Hepatocyte growth factor (HGF), which is a potent mitogen for mature hepatocytes and a mediator of the inflammatory responses to tissue injury, was recently highlighted as a potent neurotrophic factor in the central nervous system. We previously reported that introducing exogenous HGF into the injured rodent spinal cord using a herpes simplex virus-1 vector significantly reduces the area of damaged tissue and promotes functional recovery. However, that study did not examine the therapeutic effects of administering HGF after injury, which is the most critical issue for clinical application. To translate this strategy to human treatment, we induced a contusive cervical SCI in the common marmoset, a primate, and then administered recombinant human HGF (rhHGF) intrathecally. Motor function was assessed using an original open field scoring system focusing on manual function, including reach-and-grasp performance and hand placement in walking. The intrathecal rhHGF preserved the corticospinal fibers and myelinated areas, thereby promoting functional recovery. In vivo magnetic resonance imaging showed significant preservation of the intact spinal cord parenchyma. rhHGF-treatment did not give rise to an abnormal outgrowth of calcitonin gene related peptide positive fibers compared to the control group, indicating that this treatment did not induce or exacerbate allodynia. This is the first study to report the efficacy of rhHGF for treating SCI in non-human primates. In addition, this is the first presentation of a novel scale for assessing neurological motor performance in non-human primates after contusive cervical SCI.
Human Hepatocyte Growth Factor Promotes Functional Recovery in Primates after Spinal Cord Injury
Kitamura, Kazuya; Fujiyoshi, Kanehiro; Yamane, Jun-ichi; Toyota, Fumika; Hikishima, Keigo; Nomura, Tatsuji; Funakoshi, Hiroshi; Nakamura, Toshikazu; Aoki, Masashi; Toyama, Yoshiaki; Okano, Hideyuki; Nakamura, Masaya
2011-01-01
Many therapeutic interventions for spinal cord injury (SCI) using neurotrophic factors have focused on reducing the area damaged by secondary, post-injury degeneration, to promote functional recovery. Hepatocyte growth factor (HGF), which is a potent mitogen for mature hepatocytes and a mediator of the inflammatory responses to tissue injury, was recently highlighted as a potent neurotrophic factor in the central nervous system. We previously reported that introducing exogenous HGF into the injured rodent spinal cord using a herpes simplex virus-1 vector significantly reduces the area of damaged tissue and promotes functional recovery. However, that study did not examine the therapeutic effects of administering HGF after injury, which is the most critical issue for clinical application. To translate this strategy to human treatment, we induced a contusive cervical SCI in the common marmoset, a primate, and then administered recombinant human HGF (rhHGF) intrathecally. Motor function was assessed using an original open field scoring system focusing on manual function, including reach-and-grasp performance and hand placement in walking. The intrathecal rhHGF preserved the corticospinal fibers and myelinated areas, thereby promoting functional recovery. In vivo magnetic resonance imaging showed significant preservation of the intact spinal cord parenchyma. rhHGF-treatment did not give rise to an abnormal outgrowth of calcitonin gene related peptide positive fibers compared to the control group, indicating that this treatment did not induce or exacerbate allodynia. This is the first study to report the efficacy of rhHGF for treating SCI in non-human primates. In addition, this is the first presentation of a novel scale for assessing neurological motor performance in non-human primates after contusive cervical SCI. PMID:22140459
1996-01-01
Mature adult parenchymal hepatocytes, typically of restricted capacity to proliferate in culture, can now enter into clonal growth under the influence of hepatocyte growth factor (scatter factor) (HGF/SF), epidermal growth factor (EGF), and transforming growth factor alpha (TGFalpha) in the presence of a new chemically defined medium (HGM). The expanding populations of hepatocytes lose expression of hepatocyte specific genes (albumin, cytochrome P450 IIB1), acquire expression of markers expressed by bile duct epithelium (cytokeratin 19), produce TGFalpha and acidic FGF and assume a very simplified morphologic phenotype by electron microscopy. A major change associated with this transition is the decrease in ratio between transcription factors C/EBPalpha and C/EBPbeta, as well as the emergence in the proliferating hepatocytes of transcription factors AP1, NFkappaB. The liver associated transcription factors HNFI, HNF3, and HNF4 are preserved throughout this process. After population expansion and clonal growth, the proliferating hepatocytes can return to mature hepatocyte phenotype in the presence of EHS gel (Matrigel). This includes complete restoration of electron microscopic structure and albumin expression. The hepatocyte cultures however can instead be induced to form acinar/ductular structures akin to bile ductules (in the presence of HGF/SF and type I collagen). These transformations affect the entire population of the hepatocytes and occur even when DNA synthesis is inhibited. Similar acinar/ductular structures are seen in embryonic liver when HGF/SF and its receptor are expressed at high levels. These findings strongly support the hypothesis that mature hepatocytes can function as or be a source of bipotential facultative hepatic stem cells (hepatoblasts). These studies also provide evidence for the growth factor and matrix signals that govern these complex phenotypic transitions of facultative stem cells which are crucial for recovery from acute and
Walesky, Chad; Gunewardena, Sumedha; Terwilliger, Ernest F; Edwards, Genea; Borude, Prachi; Apte, Udayan
2013-01-01
Hepatocyte nuclear factor-4α (HNF4α) is known as the master regulator of hepatocyte differentiation. Recent studies indicate that HNF4α may inhibit hepatocyte proliferation via mechanisms that have yet to be identified. Using a HNF4α knockdown mouse model based on delivery of inducible Cre recombinase via an adeno-associated virus 8 viral vector, we investigated the role of HNF4α in the regulation of hepatocyte proliferation. Hepatocyte-specific deletion of HNF4α resulted in increased hepatocyte proliferation. Global gene expression analysis showed that a majority of the downregulated genes were previously known HNF4α target genes involved in hepatic differentiation. Interestingly, ≥500 upregulated genes were associated with cell proliferation and cancer. Furthermore, we identified potential negative target genes of HNF4α, many of which are involved in the stimulation of proliferation. Using chromatin immunoprecipitation analysis, we confirmed binding of HNF4α at three of these genes. Furthermore, overexpression of HNF4α in mouse hepatocellular carcinoma cells resulted in a decrease in promitogenic gene expression and cell cycle arrest. Taken together, these data indicate that, apart from its role in hepatocyte differentiation, HNF4α actively inhibits hepatocyte proliferation by repression of specific promitogenic genes.
Gorin, Caroline; Rochefort, Gael Y; Bascetin, Rumeyza; Ying, Hanru; Lesieur, Julie; Sadoine, Jérémy; Beckouche, Nathan; Berndt, Sarah; Novais, Anita; Lesage, Matthieu; Hosten, Benoit; Vercellino, Laetitia; Merlet, Pascal; Le-Denmat, Dominique; Marchiol, Carmen; Letourneur, Didier; Nicoletti, Antonino; Vital, Sibylle Opsahl; Poliard, Anne; Salmon, Benjamin; Muller, Laurent; Chaussain, Catherine; Germain, Stéphane
2016-03-01
Tissue engineering strategies based on implanting cellularized biomaterials are promising therapeutic approaches for the reconstruction of large tissue defects. A major hurdle for the reliable establishment of such therapeutic approaches is the lack of rapid blood perfusion of the tissue construct to provide oxygen and nutrients. Numerous sources of mesenchymal stem cells (MSCs) displaying angiogenic potential have been characterized in the past years, including the adult dental pulp. Establishment of efficient strategies for improving angiogenesis in tissue constructs is nevertheless still an important challenge. Hypoxia was proposed as a priming treatment owing to its capacity to enhance the angiogenic potential of stem cells through vascular endothelial growth factor (VEGF) release. The present study aimed to characterize additional key factors regulating the angiogenic capacity of such MSCs, namely, dental pulp stem cells derived from deciduous teeth (SHED). We identified fibroblast growth factor-2 (FGF-2) as a potent inducer of the release of VEGF and hepatocyte growth factor (HGF) by SHED. We found that FGF-2 limited hypoxia-induced downregulation of HGF release. Using three-dimensional culture models of angiogenesis, we demonstrated that VEGF and HGF were both responsible for the high angiogenic potential of SHED through direct targeting of endothelial cells. In addition, FGF-2 treatment increased the fraction of Stro-1+/CD146+ progenitor cells. We then applied in vitro FGF-2 priming to SHED before encapsulation in hydrogels and in vivo subcutaneous implantation. Our results showed that FGF-2 priming is more efficient than hypoxia at increasing SHED-induced vascularization compared with nonprimed controls. Altogether, these data demonstrate that FGF-2 priming enhances the angiogenic potential of SHED through the secretion of both HGF and VEGF. ©AlphaMed Press.
Yan, Xiao-Di; Yao, Min; Wang, Li; Zhang, Hai-Jian; Yan, Mei-Juan; Gu, Xing; Shi, Yun; Chen, Jie; Dong, Zhi-Zhen; Yao, Deng-Fu
2013-01-01
AIM: To investigate the dynamic features of insulin-like growth factor-I receptor (IGF-IR) expression in rat hepatocarcinogenesis, and the relationship between IGF-IR and hepatocytes malignant transformation at mRNA or protein level. METHODS: Hepatoma models were made by inducing with 2-fluorenylacetamide (2-FAA) on male Sprague-Dawley rats. Morphological changes of hepatocytes were observed by pathological Hematoxylin and eosin staining, the dynamic expressions of liver and serum IGF-IR were quantitatively analyzed by an enzyme-linked immunosorbent assay. The distribution of hepatic IGF-IR was located by immunohistochemistry. The fragments of IGF-IR gene were amplified by reverse transcription-polymerase chain reaction, and confirmed by sequencing. RESULTS: Rat hepatocytes after induced by 2-FAA were changed dynamically from granule-like degeneration, precancerous to hepatoma formation with the progressing increasing of hepatic mRNA or IGF-IR expression. The incidences of liver IGF-IR, IGF-IR mRNA, specific IGF-IR concentration (ng/mg wet liver), and serum IGF-IR level (ng/mL) were 0.0%, 0.0%, 0.63 ± 0.17, and 1.33 ± 0.47 in the control; 50.0%, 61.1%, 0.65 ± 0.2, and 1.51 ± 0.46 in the degeneration; 88.9%, 100%, 0.66 ± 0.14, and 1.92 ± 0.29 in the precancerosis; and 100%, 100%, 0.96 ± 0.09, and 2.43 ± 0.57 in the cancerous group, respectively. IGF-IR expression in the cancerous group was significantly higher (P < 0.01) than that in any of other groups at mRNA or protein level. The closely positive IGF-IR relationship was found between livers and sera (r = 0.91, t = 14.222, P < 0.01), respectively. CONCLUSION: IGF-IR expression may participate in rat hepatocarcinogenesis and its abnormality should be an early marker for hepatocytes malignant transformation. PMID:24106410
Betsunoh, Hironori; Mukai, Shoichiro; Akiyama, Yutaka; Fukushima, Tsuyoshi; Minamiguchi, Naoki; Hasui, Yoshihiro; Osada, Yukio; Kataoka, Hiroaki
2007-04-01
Cell surface proteolysis is important for the generation of bioactive proteins mediating tumor progression. Recent studies suggest that the membrane-anchored cell surface proteinases matriptase and hepsin have significant roles in tumors. We analyzed the expression and clinical relevance of matriptase and hepsin, and their inhibitors hepatocyte growth factor activator inhibitor type 1 (HAI-1) and type 2 (HAI-2) in 66 cases of conventional renal cell carcinomas (RCC). The mRNA level was evaluated in paired samples from tumor and non-tumorous renal tissues by real-time reverse transcription-polymerase chain reaction. As matriptase and hepsin potently activate the proform of hepatocyte growth factor (HGF), the expression of HGF and its receptor, c-Met, was also analyzed. Although upregulation of matriptase was observed occasionally in RCC, the expression level was not associated with prognostic parameters. Hepsin was downregulated in RCC, particularly in early stage disease, but upregulated in advanced stages. There was a trend of higher hepsin expression in RCC with distant metastasis, and Kaplan-Meier survival curves showed that high hepsin expression was associated with reduced overall survival (P<0.01, log-rank test). Moreover, multivariate analysis indicated that hepsin was an independent prognostic factor. Overexpression of HGF or c-Met also showed reduced overall survival. We also observed a tendency of low HAI-2 expression with reduced overall survival and a statistical association between high hepsin and low HAI-2 level. No associations were observed between matriptase and HAI-1 and HAI-2. Our findings suggest that the balance between hepsin and its inhibitor, HAI-2, may have prognostic value in RCC.
Reinke's edema: investigations on the role of MIB-1 and hepatocyte growth factor.
Artico, M; Bronzetti, E; Ionta, B; Bruno, M; Greco, A; Ruoppolo, G; De Virgilio, A; Longo, L; De Vincentiis, M
2010-07-08
Reinke's edema is a benign disease of the human vocal fold, which mainly affects the sub-epithelial layer of the vocal fold. Microscopic observations show a strongly oedematous epithelium with loosened intercellular junctions, a disruption of the extracellular connections between mucosal epithelium and connective tissue, closely adherent to the thyroarytenoid muscle. Thickening of the basal layer of epithelium, known as Reinke's space, high deposition of fibronectin and chronic inflammatory infiltration it is also visible. We analyzed, together with the hepatocyte growth factor (HGF), the expression level of MIB-1 in samples harvested from patients affected by Reinke's edema, in order to define its biological role and consider it as a possible prognostic factor in the follow-up after surgical treatment. We observed a moderate expression of HGF in the lamina propria of the human vocal fold and in the basal membrane of the mucosal epithelium. Our finding suggests that this growth factor acts as an antifibrotic agent in Reinke's space and affects the fibronectin deposition in the lamina propria. MIB-1, on the contrary, showed a weak expression in the basement membrane of the mucosal epithelium and a total absence in the lamina propria deep layer, thus suggesting that only the superficial layer is actively involved in the reparatory process with a high regenerative capacity, together with a high deposition of fibronectin. The latter is necessary for the cellular connections reconstruction, after the inflammatory infiltration.
Reinke's Edema: investigations on the role of MIB-1 and hepatocyte growth factor
Artico, M.; Bronzetti, E.; Ionta, B.; Bruno, M.; Greco, A.; Ruoppolo, G.; De Virgilio, A.; Longo, L.; De Vincentiis, M.
2010-01-01
Reinke's edema is a benign disease of the human vocal fold, which mainly affects the sub-epithelial layer of the vocal fold. Microscopic observations show a strongly oedematous epithelium with loosened intercellular junctions, a disruption of the extracellular connections between mucosal epithelium and connective tissue, closely adherent to the thyroarytenoid muscle. Thickening of the basal layer of epithelium, known as Reinke's space, high deposition of fibronectin and chronic inflammatory infiltration it is also visible. We analyzed, together with the hepatocyte growth factor (HGF), the expression level of MIB-1 in samples harvested from patients affected by Reinke's edema, in order to define its biological role and consider it as a possible prognostic factor in the follow-up after surgical treatment. We observed a moderate expression of HGF in the lamina propria of the human vocal fold and in the basal membrane of the mucosal epithelium. Our finding suggests that this growth factor acts as an anti - fibrotic agent in Reinke's space and affects the fibronectin deposition in the lamina propria. MIB-1, on the contrary, showed a weak expression in the basement membrane of the mucosal epithelium and a total absence in the lamina propria deep layer, thus suggesting that only the superficial layer is actively involved in the reparatory process with a high regenerative capacity, together with a high deposition of fibronectin. The latter is necessary for the cellular connections reconstruction, after the inflammatory infiltration. PMID:20819770
Zhang, Haiyang; Wang, Yi; Bai, Ming; Wang, Junyi; Zhu, Kegan; Liu, Rui; Ge, Shaohua; Li, JiaLu; Ning, Tao; Deng, Ting; Fan, Qian; Li, Hongli; Sun, Wu; Ying, Guoguang; Ba, Yi
2018-03-01
Exosomes derived from cells have been found to mediate signal transduction between cells and to act as efficient carriers to deliver drugs and small RNA. Hepatocyte growth factor (HGF) is known to promote the growth of both cancer cells and vascular cells, and the HGF-cMET pathway is a potential clinical target. Here, we characterized the inhibitory effect of HGF siRNA on tumor growth and angiogenesis in gastric cancer. In addition, we showed that HGF siRNA packed in exosomes can be transported into cancer cells, where it dramatically downregulates HGF expression. A cell co-culture model was used to show that exosomes loaded with HGF siRNA suppress proliferation and migration of both cancer cells and vascular cells. Moreover, exosomes were able to transfer HGF siRNA in vivo, decreasing the growth rates of tumors and blood vessels. The results of our study demonstrate that exosomes have potential for use in targeted cancer therapy by delivering siRNA. © 2018 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Li, Xinwei; Guan, Yuan; Li, Ying; Wu, Dianjun; Liu, Lei; Deng, Qinghua; Li, Xiaobing; Wang, Zhe; Liu, Guowen
2016-01-15
Fatty liver is a major metabolic disorder of dairy cows. One important reason is that hepatic very low-density lipoproteins (VLDL) assembly was significant decreased in dairy cows with fatty liver. In addition, the impairment of insulin-like growth factor (IGF)-1 synthesis was involved in the development of fatty liver. Therefore, the objective of this study was to investigate the effects of IGF-1 on the VLDL assembly in cow hepatocytes. In this study, cow hepatocytes were cultured and then transfected with Ad-GFP-IGF-1 (inhibited the IGF-1 expression) and Ad-GFP (negative control), and treated with different concentrations of IGF-1, respectively. The results showed that IGF-1 increased the mRNA abundance of apolipoprotein B100 (ApoB100), apolipoprotein E (ApoE), microsomal triglyceride transfer protein (MTTP), and low-density lipoprotein receptor (LDLR) and then increased the VLDL assembly in cow hepatocytes. Nevertheless, impairment of IGF-1 expression by Ad-GFP-IGF-1 could inhibit above genes expression and VLDL assembly in hepatocytes. Taken together, these results indicate that IGF-1 increases the VLDL assembly and impairment of IGF-1 expression decreases the VLDL assembly in cow hepatocytes. Copyright © 2016 Elsevier Inc. All rights reserved.
Felici, Angelina; Giubellino, Alessio; Bottaro, Donald P.
2012-01-01
Hepatocyte growth factor (HGF)-stimulated mitogenesis, motogenesis and morphogenesis in various cell types begins with activation of the Met receptor tyrosine kinase and the recruitment of intracellular adaptors and kinase substrates. The adapter protein Gab1 is a critical effector and substrate of activated Met, mediating morphogenesis, among other activities, in epithelial cells. To define its role downstream of Met in hematopoietic cells, Gab1 was expressed in the HGF-responsive, Gab1-negative murine myeloid cell line 32D. Interestingly, the adhesion and motility of Gab1-expressing cells were significantly greater than parental cells, independent of growth factor treatment. Downstream of activated Met, Gab1 expression was specifically associated with rapid Shp-2 recruitment and activation, increased mitogenic potency, suppression of GATA-1 expression and concomitant upregulation of GATA-2 transcription. In addition to enhanced proliferation, continuous culture of Gab1-expressing 32D cells in HGF resulted in cell attachment, filopodia extension and phenotypic changes suggestive of monocytic differentiation. Our results suggest that in myeloid cells, Gab1 is likely to enhance HGF mitogenicity by coupling Met to Shp-2 and GATA-2 expression, thereby potentially contributing to normal myeloid differentiation as well as oncogenic transformation. PMID:20506405
Cao, Jun; Shang, Chang-zhen; Lü, Li-hong; Qiu, De-chuan; Ren, Meng; Chen, Ya-jin; Min, Jun
2010-11-01
To establish an efficient culture system to support embryonic stem (ES) cell differentiation into hepatocytes that coexpress F-VIII and F-IX. Mouse E14 ES cells were cultured in differentiation medium containing sodium butyrate (SB), basic fibroblast growth factor (bFGF), and/or bone morphogenetic protein 4 (BMP4) to induce the differentiation of endoderm cells and hepatic progenitor cells. Hepatocyte growth factor, oncostatin M, and dexamethasone were then used to induce the maturation of ES cell-derived hepatocytes. The mRNA expression levels of endoderm-specific genes and hepatocyte-specific genes, including the levels of F-VIII and F-IX, were detected by RT-PCR and real-time PCR during various stages of differentiation. Protein expression was examined by immunofluorescence and Western blot. At the final stage of differentiation, flow cytometry was performed to determine the percentage of cells coexpressing F-VIII and F-IX, and ELISA was used to detect the levels of F-VIII and F-IX protein secreted into the culture medium. The expression of endoderm-specific and hepatocyte-specific markers was upregulated to highest level in response to the combination of SB, bFGF, and BMP4. Treatment with the three inducers during hepatic progenitor differentiation significantly enhanced the mRNA and protein levels of F-VIII and F-IX in ES cell-derived hepatocytes. More importantly, F-VIII and F-IX were coexpressed with high efficiency at the final stage of differentiation, and they were also secreted into the culture medium. We have established a novel in vitro differentiation protocol for ES-derived hepatocytes that coexpress F-VIII and F-IX that may provide a foundation for stem cell replacement therapy for hemophilia.
Measurement of Blood Coagulation Factor Synthesis in Cultures of Human Hepatocytes.
Heinz, Stefan; Braspenning, Joris
2015-01-01
An important function of the liver is the synthesis and secretion of blood coagulation factors. Within the liver, hepatocytes are involved in the synthesis of most blood coagulation factors, such as fibrinogen, prothrombin, factor V, VII, IX, X, XI, XII, as well as protein C and S, and antithrombin, whereas liver sinusoidal endothelial cells produce factor VIII and von Willebrand factor. Here, we describe methods for the detection and quantification of most blood coagulation factors in hepatocytes in vitro. Hepatocyte cultures indeed provide a valuable tool to study blood coagulation factors. In addition, the generation and expansion of hepatocytes or hepatocyte-like cells may be used in future for cell-based therapies of liver diseases, including blood coagulation factor deficiencies.
Vyas, Bimal; Ishikawa, Keiko; Duflo, Suzy; Chen, Xia; Thibeault, Susan L
2010-05-01
The role of myofibroblasts in vocal fold scarring has not been extensively studied, partly because of the lack of a robust in vitro model. The objective of this investigation was to develop and characterize a myofibroblast in vitro model that could be utilized to investigate the molecular mechanism of myofibroblast differentiation and function in injured vocal fold tissue. Differentiation of human primary vocal fold fibroblasts (hVFFs) to myofibroblasts was stimulated with 5, 10, or 20 ng/mL of recombinant transforming growth factor-beta1 (TGF-beta1). Cultures were analyzed by immunofluorescence and Western blotting, with an alpha-smooth muscle actin (alpha-SMA) antibody used as a myofibroblast marker. Normal rabbit vocal folds were treated with 10 ng/mL of TGF-beta1 for 7 days for in vivo corroboration. The effects of interleukin-6 (IL-6) and hepatocyte growth factor (HGF) on myofibroblast differentiation were studied with Western blots. The hVFFs demonstrated positive alpha-SMA labeling in cells stimulated by 10 and 20 ng/mL TGF-beta1, indicating that hVFFs were capable of differentiation to myofibroblasts. Transforming growth factor-beta1 induced the largest increase in alpha-SMA at 10 ng/mL on day 5 of treatment. Both HGF and IL-6 suppressed the expression of TGF-beta1-induced alpha-SMA. Our work characterizes a useful in vitro model of TGF-beta1-mediated vocal fold fibroblast-myofibroblast differentiation. The extent of differentiation appears to be attenuated by HGF, suggesting a potential mechanism to support prior work indicating that HGF plays a protective role in reducing scar formation in vocal fold injuries. Paradoxically, IL-6, which has been shown to play a profibrotic role in dermal studies, also attenuated the TGF-beta1 response.
Zhou, Dan; Cheng, Hongjing; Liu, Jinyu; Zhang, Lei
2017-06-01
Chronic liver disease has become a major health problem that causes serious damage to human health. Since the existing treatment effect was not ideal, we need to seek new treatment methods. We utilized the gene recombination technology to obtain the human hair mesenchymal stem cells which overexpression of human hepatocyte growth factor (hHGF). Furthermore, we verified the property of transfected cells through detecting surface marker by flow cytometry. We show here establishment of the hHGF-overexpressing lentivirus vector, and successfully transfection to human hair follicle mesenchymal stem cells. The verified experiments could demonstrate the human hair follicle mesenchymal stem cells which have been transfected still have the properties of stem cells. We successfully constructed human hair follicle mesenchymal stem cells which overexpression hHGF, and maintain the same properties compared with pro-transfected cells.
Increase in the circulating level of hepatocyte growth factor in pancreatic cancer patients.
Kemik, Ozgur; Purisa, Sevim; Kemik, Ahu Sarbay; Tuzun, Sefa
2009-01-01
Hepatocyte growth factor (HGF) has been reported the cause of many biological events, including cell proliferation, invasiveness, morphogenesis, and angiogenesis. Elevated HGF content in tumor tissue was reported to predict a more aggressive biology in breast and gastric cancer patients. Eighty patients with invasive pancreatic cancer investigated. Venous blood samples were collected before the surgery. Sera were obtained by centrifugation and stored at -70 degrees C until assayed. The control group created from healthy individuals. Serum concentrations of soluble HGF were measured by the quantitative sandwich enzyme immunoassay technique. The mean value of serum soluble HGF in patients with invasive pancreatic cancer was 497.2 +/- 53.8 pg/ml and that of control group was 53.6 +/- 7.5 pg/ml and the difference was significant (p < 0.001). The serum levels of soluble HGF might reflect the severity of invasive pancreatic cancer and deserve further evaluation (Tab. 2, Ref. 19). Full Text (Free, PDF) www.bmj.sk.
Divergent mechanisms of insulin-like growth factor I and II on rat hepatocyte proliferation.
Raper, S; Kothary, P; Ishoo, E; Dikin, M; Kokudo, N; Hashimoto, M; DeMatteo, R P
1995-07-21
Insulin-like growth factors I and II are peptides with a structural homology for proinsulin, and are involved in hepatocyte proliferation. IGF-I and IGF-II, however, have different metabolic roles, and their mechanisms of action are incompletely known. We hypothesized that IGF-I and IGF-II act by different signal transduction pathways. To test this hypothesis, hepatocytes from 200 g male Sprague-Dawley rats were isolated by a two-step collagenase perfusion technique and plated at a density of 10(5) cells/16 mm Primaria plate. Proliferation was measured by [3H]thymidine ([3H]thy) incorporation into DNA, and an autoradiographic nuclear labeling index (LI). To analyze signal transduction, cyclic AMP (cAMP) levels were measured 5 min after addition of reagents by a radioimmunoassay. Reagents (doses) used were: IGF-I (2 nM), IGF-II (2 nM), the inhibitory peptide somatostatin-14 (SS14) (10 nM), and the adenylyl cyclase antagonist dideoxyadenosine (DDA) (10 microM). A summary of the findings is as follows: (1) IGF-I stimulates [3H]thy, LI and cAMP accumulation. (2) IGF-II stimulates [3H]thy and LI but not cAMP; (3) IGF-I but not IGF-II effects are inhibited by SS14 and DDA. We conclude that the hepatotrophic effects of IGF-I and IGF-II occur by different mechanisms: IGF-I is cAMP-dependent, IGF-II is cAMP-independent.
Hepatitis A complicated with acute renal failure and high hepatocyte growth factor: A case report.
Oe, Shinji; Shibata, Michihiko; Miyagawa, Koichiro; Honma, Yuichi; Hiura, Masaaki; Abe, Shintaro; Harada, Masaru
2015-08-28
A 58-year-old man was admitted to our hospital. Laboratory data showed severe liver injury and that the patient was positive for immunoglobulin M anti-hepatitis A virus (HAV) antibodies. He was also complicated with severe renal dysfunction and had an extremely high level of serum hepatocyte growth factor (HGF). Therefore, he was diagnosed with severe acute liver failure with acute renal failure (ARF) caused by HAV infection. Prognosis was expected to be poor because of complications by ARF and high serum HGF. However, liver and renal functions both improved rapidly without intensive treatment, and he was subsequently discharged from our hospital on the 21(st) hospital day. Although complication with ARF and high levels of serum HGF are both important factors predicting poor prognosis in acute liver failure patients, the present case achieved a favorable outcome. Endogenous HGF might play an important role as a regenerative effector in injured livers and kidneys.
Cahill, Emer F.; Kennelly, Helen; Carty, Fiona; Mahon, Bernard P.
2016-01-01
The incidence of idiopathic pulmonary fibrosis is on the rise and existing treatments have failed to halt or reverse disease progression. Mesenchymal stromal cells (MSCs) have potent cytoprotective effects, can promote tissue repair, and have demonstrated efficacy in a range of fibrotic lung diseases; however, the exact mechanisms of action remain to be elucidated. Chemical antagonists and short hairpin RNA knockdown were used to identify the mechanisms of action used by MSCs in promoting wound healing, proliferation, and inhibiting apoptosis. Using the bleomycin induced fibrosis model, the protective effects of early or late MSC administration were examined. The role for hepatocyte growth factor (HGF) in MSC protection against bleomycin lung injury was examined using HGF knockdown MSC. Terminal deoxynucleotidyl transferase (TdT) dUTP nick-end labeling assay was performed on ex vivo lung sections to examine the effects of MSC on apoptosis. MSC conditioned media (CM) enhanced wound closure and inhibited apoptosis of pulmonary cells in vitro. HGF was required for MSC CM enhancement of epithelial cell proliferation and inhibition of apoptosis. In contrast, MSC required COX-2 for CM to inhibit fibroblast proliferation. In a murine model, early administration of MSC protected against bleomycin induced lung fibrosis and correlated with reduced levels of the proinflammatory cytokine interleukin-1β, reduced levels of apoptosis, and significantly increased levels of HGF. These protective effects were in part mediated by MSC derived HGF as HGF knockdown MSC were unable to protect against fibrosis in vivo. These findings delineate the mechanisms of MSC protection in a preclinical model of fibrotic lung disease. Significance The mechanisms used by mesenchymal stromal cells (MSCs) in mediating protective effects in chronic models of lung disease are not understood and remain to be elucidated. These findings from in vitro studies highlight an important role for the MSC
Renoprotective effects of hepatocyte growth factor in the stenotic kidney
Stewart, Nicholas
2013-01-01
Renal microvascular (MV) damage and loss contribute to the progression of renal injury in renal artery stenosis (RAS). Hepatocyte growth factor (HGF) is a powerful angiogenic and antifibrotic cytokine that we showed to be decreased in the stenotic kidney. We hypothesized that renal HGF therapy will improve renal function mainly by protecting the renal microcirculation. Unilateral RAS was induced in 15 pigs. Six weeks later, single-kidney RBF and GFR were quantified in vivo using multidetector computed tomography (CT). Then, intrarenal rh-HGF or vehicle was randomly administered into the stenotic kidney (RAS, n = 8; RAS+HGF, n = 7). Pigs were observed for 4 additional weeks before CT studies were repeated. Renal MV density was quantified by 3D micro-CT ex vivo and histology, and expression of angiogenic and inflammatory factors, apoptosis, and fibrosis was determined. HGF therapy improved RBF and GFR compared with vehicle-treated pigs. This was accompanied by improved renal expression of angiogenic cytokines (VEGF, p-Akt) and tissue-healing promoters (SDF-1, CXCR4, MMP-9), reduced MV remodeling, apoptosis, and fibrosis, and attenuated renal inflammation. However, HGF therapy did not improve renal MV density, which was similarly reduced in RAS and RAS+HGF compared with controls. Using a clinically relevant animal model of RAS, we showed novel therapeutic effects of a targeted renal intervention. Our results show distinct actions on the existing renal microcirculation and promising renoprotective effects of HGF therapy in RAS. Furthermore, these effects imply plasticity of the stenotic kidney to recuperate its function and underscore the importance of MV integrity in the progression of renal injury in RAS. PMID:23269649
Human Hepatocyte Growth Factor (hHGF)-Modified Hepatic Oval Cells Improve Liver Transplant Survival
Li, Li; Ran, Jiang-Hua; Li, Xue-Hua; Liu, Zhi-Heng; Liu, Gui-Jie; Gao, Yan-Chao; Zhang, Xue-Li; Sun, Hiu-Dong
2012-01-01
Despite progress in the field of immunosuppression, acute rejection is still a common postoperative complication following liver transplantation. This study aims to investigate the capacity of the human hepatocyte growth factor (hHGF) in modifying hepatic oval cells (HOCs) administered simultaneously with orthotopic liver transplantation as a means of improving graft survival. HOCs were activated and isolated using a modified 2-acetylaminofluorene/partial hepatectomy (2-AAF/PH) model in male Lewis rats. A HOC line stably expressing the HGF gene was established following stable transfection of the pBLAST2-hHGF plasmid. Our results demonstrated that hHGF-modified HOCs could efficiently differentiate into hepatocytes and bile duct epithelial cells in vitro. Administration of HOCs at the time of liver transplantation induced a wider distribution of SRY-positive donor cells in liver tissues. Administration of hHGF-HOC at the time of transplantation remarkably prolonged the median survival time and improved liver function for recipients compared to these parameters in the other treatment groups (P<0.05). Moreover, hHGF-HOC administration at the time of liver transplantation significantly suppressed elevation of interleukin-2 (IL-2), tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ) levels while increasing the production of IL-10 and TGF-β1 (P<0.05). HOC or hHGF-HOC administration promoted cell proliferation, reduced cell apoptosis, and decreased liver allograft rejection rates. Furthermore, hHGF-modified HOCs more efficiently reduced acute allograft rejection (P<0.05 versus HOC transplantation only). Our results indicate that the combination of hHGF-modified HOCs with liver transplantation decreased host anti-graft immune responses resulting in a reduction of allograft rejection rates and prolonging graft survival in recipient rats. This suggests that HOC-based cell transplantation therapies can be developed as a means of treating severe liver injuries. PMID
Yokozaki, H; Tahara, H; Oue, N; Tahara, E
2000-01-01
A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.
Meneghello, Giulia; Storm, Michael P; Chaudhuri, Julian B; De Bank, Paul A; Ellis, Marianne J
2015-03-01
The scale-up of tissue engineering cell culture must ensure that conditions are maintained while also being cost effective. Here we analyse the stability of hepatocyte growth factor (HGF) to investigate whether concentrations change under dynamic conditions, and compare commercial recombinant human HGF as an additive in 'standard medium', to HGF secreted by the osteosarcoma cell line MG63 as a 'preconditioned medium'. After 3 h under flow conditions, HGF in the standard medium degraded to 40% of its original concentration but HGF in the preconditioned medium remained at 100%. The concentration of secreted HGF was 10 times greater than the working concentration of commercially-available HGF. Thus HGF within this medium has increased stability; MG63-derived HGF should therefore be investigated as a cost-effective alternative to current lyophilised powders for use in in vitro models. Furthermore, we recommend that those intending to use HGF (or other growth factors) should consider similar stability testing before embarking on experiments with media flow.
Hepatocyte growth factor sensitizes brain tumors to c-MET kinase inhibition
Zhang, Ying; Farenholtz, Kaitlyn E.; Yang, Yanzhi; Guessous, Fadila; diPierro, Charles G.; Calvert, Valerie S.; Deng, Jianghong; Schiff, David; Xin, Wenjun; Lee, Jae K.; Purow, Benjamin; Christensen, James; Petricoin, Emanuel; Abounader, Roger
2013-01-01
Purpose The receptor tyrosine kinase (RTK) c-MET and its ligand hepatocyte growth factor (HGF) are deregulated and promote malignancy in cancer and brain tumors. Consequently, clinically applicable c-MET inhibitors have been developed. The purpose of this study was to investigate the not well known molecular determinants that predict responsiveness to c-MET inhibitors, and to explore new strategies for improving inhibitor efficacy in brain tumors. Experimental design We investigated the molecular factors and pathway activation signatures that determine sensitivity to c-MET inhibitors in a panel of glioblastoma and medulloblastoma cells, glioblastoma stem cells (GSCs), and established cell line-derived xenografts using functional assays, reverse protein microarrays, and in vivo tumor volume measurements, but validation with animal survival analyses remains to be done. We also explored new approaches for improving the efficacy of the inhibitors in vitro and in vivo. Results We found that HGF co-expression is a key predictor of response to c-MET inhibition among the examined factors, and identified an ERK/JAK/p53 pathway activation signature that differentiates c-MET inhibition in responsive and non-responsive cells. Surprisingly, we also found that short pre-treatment of cells and tumors with exogenous HGF moderately but statistically significantly enhanced the anti-tumor effects of c-MET inhibition. We observed a similar ligand-induced sensitization effect to an EGFR small molecule kinase inhibitor. Conclusions These findings allow the identification of a subset of patients that will be responsive to c-MET inhibition, and propose ligand pre-treatment as a potential new strategy for improving the anti-cancer efficacy of RTK inhibitors. PMID:23386689
Hepatocyte growth factor is crucial for development of the carapace in turtles
Kawashima-Ohya, Yoshie; Narita, Yuichi; Nagashima, Hiroshi; Usuda, Ryo; Kuratani, Shigeru
2011-01-01
Turtles are characterized by their shell, composed of a dorsal carapace and a ventral plastron. The carapace first appears as the turtle-specific carapacial ridge (CR) on the lateral aspect of the embryonic flank. Accompanying the acquisition of the shell, unlike in other amniotes, hypaxial muscles in turtle embryos appear as thin threads of fibrous tissue. To understand carapacial evolution from the perspective of muscle development, we compared the development of the muscle plate, the anlage of hypaxial muscles, between the Chinese soft-shelled turtle, Pelodiscus sinensis, and chicken embryos. We found that the ventrolateral lip (VLL) of the thoracic dermomyotome of P. sinensis delaminates early and produces sparse muscle plate in the lateral body wall. Expression patterns of the regulatory genes for myotome differentiation, such as Myf5, myogenin, Pax3, and Pax7 have been conserved among amniotes, including turtles. However, in P. sinensis embryos, the gene hepatocyte growth factor (HGF), encoding a regulatory factor for delamination of the dermomyotomal VLL, was uniquely expressed in sclerotome and the lateral body wall at the interlimb level. Implantation of COS-7 cells expressing a HGF antagonist into the turtle embryo inhibited CR formation. We conclude that the de novo expression of HGF in the turtle mesoderm would have played an innovative role resulting in the acquisition of the turtle-specific body plan. PMID:21535464
Xu, Wenyi; Wu, Lizhen; Yu, Miao; Chen, Feng-Jung; Arshad, Muhammad; Xia, Xiayu; Ren, Hao; Yu, Jinhai; Xu, Li; Xu, Dijin; Li, John Zhong; Li, Peng; Zhou, Linkang
2016-01-01
Lipid droplets (LDs) are dynamic subcellular organelles whose growth is closely linked to obesity and hepatic steatosis. Cell death-inducing DNA fragmentation factor-α-like effector (CIDE) proteins, including Cidea, Cideb, and Cidec (also called Fsp27), play important roles in lipid metabolism. Cidea and Cidec are LD-associated proteins that promote atypical LD fusion in adipocytes. Here, we find that CIDE proteins are all localized to LD-LD contact sites (LDCSs) and promote lipid transfer, LD fusion, and growth in hepatocytes. We have identified two types of hepatocytes, one with small LDs (small LD-containing hepatocytes, SLHs) and one with large LDs (large LD-containing hepatocytes, LLHs) in the liver. Cideb is localized to LDCSs and promotes lipid exchange and LD fusion in both SLHs and LLHs, whereas Cidea and Cidec are specifically localized to the LDCSs and promote lipid exchange and LD fusion in LLHs. Cideb-deficient SLHs have reduced LD sizes and lower lipid exchange activities. Fasting dramatically induces the expression of Cidea/Cidec and increases the percentage of LLHs in the liver. The majority of the hepatocytes from the liver of obese mice are Cidea/Cidec-positive LLHs. Knocking down Cidea or Cidec significantly reduced lipid storage in the livers of obese animals. Our data reveal that CIDE proteins play differential roles in promoting LD fusion and lipid storage; Cideb promotes lipid storage under normal diet conditions, whereas Cidea and Cidec are responsible for liver steatosis under fasting and obese conditions. PMID:26733203
Xu, Wenyi; Wu, Lizhen; Yu, Miao; Chen, Feng-Jung; Arshad, Muhammad; Xia, Xiayu; Ren, Hao; Yu, Jinhai; Xu, Li; Xu, Dijin; Li, John Zhong; Li, Peng; Zhou, Linkang
2016-02-26
Lipid droplets (LDs) are dynamic subcellular organelles whose growth is closely linked to obesity and hepatic steatosis. Cell death-inducing DNA fragmentation factor-α-like effector (CIDE) proteins, including Cidea, Cideb, and Cidec (also called Fsp27), play important roles in lipid metabolism. Cidea and Cidec are LD-associated proteins that promote atypical LD fusion in adipocytes. Here, we find that CIDE proteins are all localized to LD-LD contact sites (LDCSs) and promote lipid transfer, LD fusion, and growth in hepatocytes. We have identified two types of hepatocytes, one with small LDs (small LD-containing hepatocytes, SLHs) and one with large LDs (large LD-containing hepatocytes, LLHs) in the liver. Cideb is localized to LDCSs and promotes lipid exchange and LD fusion in both SLHs and LLHs, whereas Cidea and Cidec are specifically localized to the LDCSs and promote lipid exchange and LD fusion in LLHs. Cideb-deficient SLHs have reduced LD sizes and lower lipid exchange activities. Fasting dramatically induces the expression of Cidea/Cidec and increases the percentage of LLHs in the liver. The majority of the hepatocytes from the liver of obese mice are Cidea/Cidec-positive LLHs. Knocking down Cidea or Cidec significantly reduced lipid storage in the livers of obese animals. Our data reveal that CIDE proteins play differential roles in promoting LD fusion and lipid storage; Cideb promotes lipid storage under normal diet conditions, whereas Cidea and Cidec are responsible for liver steatosis under fasting and obese conditions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
HSP27 is required for invasion and metastasis triggered by hepatocyte growth factor.
Pavan, Simona; Musiani, Daniele; Torchiaro, Erica; Migliardi, Giorgia; Gai, Marta; Di Cunto, Ferdinando; Erriquez, Jessica; Olivero, Martina; Di Renzo, Maria Flavia
2014-03-15
The hepatocyte growth factor (HGF) also known as scatter factor activates cancer cell invasion and metastasis. We show that in ovarian cancer cells HGF induced the phosphorylation of the small heat shock protein of 27 kDa (HSP27) by activating the p38MAPK. HSP27 is increased in many cancers at advanced stage including ovarian cancer and associated with cancer resistance to therapy and poor patients' survival. The phosphorylation of HSP27 regulates both its chaperone activity and its control of cytoskeletal stability. We show that HSP27 was necessary for the remodeling of actin filaments induced by HGF and that motility in vitro depended on the p38MAPK-MK2 axis. In vivo, HSP27 silencing impaired the ability of the highly metastatic, HGF-secreting ovarian cancer cells to give rise to spontaneous metastases. This was due to defective motility across the vessel wall and reduced growth. Indeed, HSP27 silencing impaired the ability of circulating ovarian cancer cells to home to the lungs and to form experimental hematogenous metastases and the capability of cancer cells to grow as subcutaneous xenografts. Moreover, HSP27 suppression resulted in the sensitization of xenografts to low doses of the chemotherapeutic paclitaxel, likely because HSP27 protected microtubules from bundling caused by the drug. Altogether, these data show that the HSP27 is required for the proinvasive and prometastatic activity of HGF and suggest that HSP27 might be not only a marker of progression of ovarian cancer, but also a suitable target for therapy. © 2013 UICC.
Shibata, Shumei; Miwa, Toru; Wu, Hsiao-Huei; Levitt, Pat; Ohyama, Takahiro
2016-08-03
The stria vascularis is a nonsensory structure that is essential for auditory hair cell function by maintaining potassium concentration of the scala media. During mouse embryonic development, a subpopulation of neural crest cell-derived melanocytes migrates and incorporates into a subregion of the cochlear epithelium, forming the intermediate cell layer of the stria vascularis. The relation of this developmental process to stria vascularis function is currently unknown. In characterizing the molecular differentiation of developing peripheral auditory structures, we discovered that hepatocyte growth factor (Hgf) is expressed in the future stria vascularis of the cochlear epithelium. Its receptor tyrosine kinase, c-Met, is expressed in the cochlear epithelium and melanocyte-derived intermediate cells in the stria vascularis. Genetic dissection of HGF signaling via c-MET reveals that the incorporation of the melanocytes into the future stria vascularis of the cochlear duct requires c-MET signaling. In addition, inactivation of either the ligand or receptor developmentally resulted in a profound hearing loss at young adult stages. These results suggest a novel connection between HGF signaling and deafness via melanocyte deficiencies. We found the roles of hepatocyte growth factor (HGF) signaling in stria vascularis development for the first time and that lack of HGF signaling in the inner ear leads to profound hearing loss in the mouse. Our findings reveal a novel mechanism that may underlie human deafness DFNB39 and DFNB97. Our findings reveal an additional example of context-dependent c-MET signaling diversity, required here for proper cellular invasion developmentally that is essential for specific aspects of auditory-related organogenesis. Copyright © 2016 the authors 0270-6474/16/368200-10$15.00/0.
Hepatocyte Growth Factor Gene-Modified Mesenchymal Stem Cells Augment Sinonasal Wound Healing
Li, Jing; Li, Yong; Yang, Chen; Lin, Hai; Duan, Hong-Gang
2015-01-01
This study was designed to investigate the effects of hepatocyte growth factor (HGF) transgenic mesenchymal stem cells (HGF-MSCs) on wound healing in the sinonasal mucosa and nasal epithelial cells (NECs). We also sought to determine whether HGF-MSCs and MSCs can migrate into the injured mucosa and differentiate into ciliated cells. Human HGF-overexpressing umbilical cord MSCs (hHGF-UCMSCs) were established, and upregulation of hHGF expression was confirmed by real-time PCR (RT-PCR) and enzyme-linked immunosorbant assay (ELISA). To investigate the paracrine effect of human MSCs (hMSCs) on nasal epithelial repair, hMSC- and HGF-MSC-conditioned media (CM) were used in NEC proliferation assays and in an in vitro scratch-wound repair model. The in vivo sinonasal wound-healing model was established, and all enrolled rabbits were randomly assigned to four groups: the GFP-MSC group, the HGF-MSC group, the Ad-HGF group, and the surgery control group. The average decreased diameter was recorded, and the medial wall of the maxillary sinus was removed for histological analysis and scanning electron microscopy. Collagen deposition in the wound tissue was detected via Masson trichrome (M&T) staining. The distribution of MSCs and HGF-MSCs was observed by immunofluorescence. MSCs improved nasal wound healing both in vivo and in vitro. HGF overexpression in MSCs augmented the curative effects. Reduced collagen deposition and transforming growth factor beta1 (TGF-β1) expression were detected in the HGF-MSC group compared with the MSC-, Ad-HGF-, and phosphate-buffered saline-treated groups based on M&T staining and ELISA. The enhanced therapeutic effects of HGF-MSCs were accompanied by decreased level of the fibrogenic cytokine TGF-β1. In addition, both HGF-MSCs and MSCs can migrate to the injured mucosa and epithelial layer. PMID:25835956
Plasma hepatocyte growth factor is a novel marker of AL cardiac amyloidosis.
Swiger, Kristopher J; Friedman, Eitan A; Brittain, Evan L; Tomasek, Kelsey A; Huang, Shi; Su, Yan R; Sawyer, Douglas B; Lenihan, Daniel J
2016-12-01
Cardiac amyloidosis is an infiltrative cardiomyopathy that is challenging to diagnose. We hypothesized that the novel biomarkers hepatocyte growth factor (HGF), galectin-3 (GAL-3), interleukin-6 (IL-6), and vascular endothelial growth factor (VEGF) would be elevated in cardiac amyloidosis and may be able to discriminate from non-cardiac systemic amyloidosis or other cardiomyopathies with similar clinical or morphologic characteristics. Patients were selected from the Vanderbilt Main Heart Registry according to the following groups: (1) amyloid light-chain (AL) cardiac amyloidosis (n = 26); (2) transthyretin (ATTR) cardiac amyloidosis (n = 7); (3) left ventricular hypertrophy (LVH) (n = 45); (4) systolic heart failure (n = 42); and (5) non-cardiac systemic amyloidosis (n = 7). Biomarkers were measured in stored plasma samples. Biomarkers' discrimination performance in predicting AL cardiac amyloidosis (i.e., Concordance index) was reported. A survival analysis was used to explore the relationship between HGF levels and mortality among AL cardiac amyloidosis patients. HGF levels were markedly elevated in patients with AL cardiac amyloidosis (median = 622, interquartile range (IQR): 299-1228 pg/mL) compared with the other groups, including those with non-cardiac systemic amyloidosis (median = 134, IQR: 94-163 pg/mL, p < 0.001). HGF was not a specific marker for ATTR amyloidosis. Gal-3 was elevated in all groups with amyloidosis but could not differentiate between those with and without cardiac involvement. There was no difference in IL-6 or VEGF between those with AL cardiac amyloidosis compared to other groups (p = 0.13 and 0.057, respectively). HGF may be a specific marker that distinguishes AL cardiac amyloidosis from other cardiomyopathies with similar clinical or morphologic characteristics. Further studies are necessary to determine whether HGF levels predict the likelihood of survival.
Hepatocyte Growth Factor Gene-Modified Mesenchymal Stem Cells Augment Sinonasal Wound Healing.
Li, Jing; Zheng, Chun-Quan; Li, Yong; Yang, Chen; Lin, Hai; Duan, Hong-Gang
2015-08-01
This study was designed to investigate the effects of hepatocyte growth factor (HGF) transgenic mesenchymal stem cells (HGF-MSCs) on wound healing in the sinonasal mucosa and nasal epithelial cells (NECs). We also sought to determine whether HGF-MSCs and MSCs can migrate into the injured mucosa and differentiate into ciliated cells. Human HGF-overexpressing umbilical cord MSCs (hHGF-UCMSCs) were established, and upregulation of hHGF expression was confirmed by real-time PCR (RT-PCR) and enzyme-linked immunosorbant assay (ELISA). To investigate the paracrine effect of human MSCs (hMSCs) on nasal epithelial repair, hMSC- and HGF-MSC-conditioned media (CM) were used in NEC proliferation assays and in an in vitro scratch-wound repair model. The in vivo sinonasal wound-healing model was established, and all enrolled rabbits were randomly assigned to four groups: the GFP-MSC group, the HGF-MSC group, the Ad-HGF group, and the surgery control group. The average decreased diameter was recorded, and the medial wall of the maxillary sinus was removed for histological analysis and scanning electron microscopy. Collagen deposition in the wound tissue was detected via Masson trichrome (M&T) staining. The distribution of MSCs and HGF-MSCs was observed by immunofluorescence. MSCs improved nasal wound healing both in vivo and in vitro. HGF overexpression in MSCs augmented the curative effects. Reduced collagen deposition and transforming growth factor beta1 (TGF-β1) expression were detected in the HGF-MSC group compared with the MSC-, Ad-HGF-, and phosphate-buffered saline-treated groups based on M&T staining and ELISA. The enhanced therapeutic effects of HGF-MSCs were accompanied by decreased level of the fibrogenic cytokine TGF-β1. In addition, both HGF-MSCs and MSCs can migrate to the injured mucosa and epithelial layer.
Cao, Xiaobo; Littlejohn, James; Rodarte, Charles; Zhang, Lidong; Martino, Benjamin; Rascoe, Philip; Hamid, Kamran; Jupiter, Daniel; Smythe, W. Roy
2009-01-01
Bcl-xl and the hepatocyte growth factor (HGF) receptor c-Met are both highly expressed in mesotheliomas, where they protect cells from apoptosis and can confer resistance to conventional therapeutic agents. In our current study, we investigate a model for the transcriptional control of Bcl-xl that involves ETS transcription factors and the HGF/Met axis. In addition, the effects of activated c-Met on the phosphorylation of the ETS family transcriptional factors were examined. The transient expression of ETS-2 and PU.1 cDNAs in mesothelioma cell lines resulted in an increase in the promoter activity of Bcl-xl and consequently in its mRNA and protein expression levels, whereas the transcriptional repressor Tel suppressed Bcl-xl transcription. The activation of the HGF/Met axis led to rapid phosphorylation of ETS family transcription factors in mesothelioma cells through the mitogen-activated protein kinase pathway and via nuclear accumulation of ETS-2 and PU.1. A chromatin immunoprecipitation assay further demonstrated that the activation of c-Met enhanced the binding of ETS transcriptional factors to the Bcl-x promoter. Finally, we determined the Bcl-xl and phosphorylated c-Met expression levels in mesothelioma patient samples; these data suggest a strong correlation between Bcl-xl and phosphorylated c-Met levels. Taken together, these findings support a role for c-Met as an inhibitor of apoptosis and an activator of Bcl-xl. PMID:19834061
Modulation of Myostatin/Hepatocyte Growth Factor Balance by Different Hemodialysis Modalities.
Esposito, Pasquale; La Porta, Edoardo; Calatroni, Marta; Grignano, Maria Antonietta; Milanesi, Samantha; Verzola, Daniela; Battaglia, Yuri; Gregorini, Marilena; Libetta, Carmelo; Garibotto, Giacomo; Rampino, Teresa
2017-01-01
Background. In this study we investigated the relevance of myostatin and Hepatocyte Growth Factor (HGF) in patients undergoing hemodialysis HD and the influence of different HD modalities on their levels. Methods. We performed a prospective crossover study in which HD patients were randomized to undergo 3-month treatment periods with bicarbonate hemodialysis (BHD) followed by online hemodiafiltration (HDF). Clinical data, laboratory parameters, and myostatin and HGF serum levels were collected and compared. Results. Ten patients and six controls (C) were evaluated. In any experimental condition myostatin and HGF levels were higher in HD than in C. At enrollment and after BHD there were not significant correlations, whereas at the end of the HDF treatment period myostatin and HGF were inversely correlated ( r -0.65, p < 0.05), myostatin serum levels inversely correlated with transferrin ( r -0.73, p < 0.05), and HGF levels that resulted positively correlated with BMI ( r 0.67, p < 0.05). Moving from BHD to HDF, clinical and laboratory parameters were unchanged, as well as serum HGF, whereas myostatin levels significantly decreased (6.3 ± 4.1 versus 4.3 ± 3.1 ng/ml, p < 0.05). Conclusions. Modulation of myostatin levels and myostatin/HGF balance by the use of different HD modalities might represent a novel approach to the prevention and treatment of HD-related muscle wasting syndrome.
Wang, Tsu-Wei; Zhang, Huailin; Gyetko, Margaret R.; Parent, Jack M.
2011-01-01
Neural progenitor cells persist throughout life in the forebrain subventricular zone (SVZ). They generate neuroblasts that migrate to the olfactory bulb and differentiate into interneurons, but mechanisms underlying these processes are poorly understood. Hepatocyte growth factor/scatter factor (HGF/SF) is a pleiotropic factor that influences cell motility, proliferation and morphogenesis in neural and non-neural tissues. HGF and its receptor, c-Met, are present in the rodent SVZ-olfactory bulb pathway. Using in vitro neurogenesis assays and in vivo studies of partially HGF-deficient mice, we find that HGF promotes SVZ cell proliferation and progenitor cell maintenance, while slowing differentiation and possibly altering cell fate choices. HGF also acts as a chemoattractant for SVZ neuroblasts in co-culture assays. Decreased HGF signaling induces ectopic SVZ neuroblast migration and alters the timing of migration to the olfactory bulb. These results suggest that HGF influences multiple steps in postnatal forebrain neurogenesis. HGF is a mitogen for SVZ neural progenitors, and regulates their differentiation and olfactory bulb migration. PMID:21683144
Housley, R M; Morris, C F; Boyle, W; Ring, B; Biltz, R; Tarpley, J E; Aukerman, S L; Devine, P L; Whitehead, R H; Pierce, G F
1994-01-01
Keratinocyte growth factor (KGF), a member of the fibroblast growth factor (FGF) family, was identified as a specific keratinocyte mitogen after isolation from a lung fibroblast line. Recently, recombinant (r)KGF was found to influence proliferation and differentiation patterns of multiple epithelial cell lineages within skin, lung, and the reproductive tract. In the present study, we designed experiments to identify additional target tissues, and focused on the rat gastrointestinal (GI) system, since a putative receptor, K-sam, was originally identified in a gastric carcinoma. Expression of KGF receptor and KGF mRNA was detected within the entire GI tract, suggesting the gut both synthesized and responded to KGF. Therefore, rKGF was administered to adult rats and was found to induce markedly increased proliferation of epithelial cells from the foregut to the colon, and of hepatocytes, one day after systemic treatment. Daily treatment resulted in the marked selective induction of mucin-producing cell lineages throughout the GI tract in a dose-dependent fashion. Other cell lineages were either unaffected (e.g., Paneth cells), or relatively decreased (e.g., parietal cells, enterocytes) in rKGF-treated rats. The direct effect of rKGF was confirmed by demonstrating markedly increased carcinoembryonic antigen production in a human colon carcinoma cell line, LIM1899. Serum levels of albumin were specifically and significantly elevated after daily treatment. These results demonstrate rKGF can induce epithelial cell activation throughout the GI tract and liver. Further, endogenous KGF may be a normal paracrine mediator of growth within the gut. Images PMID:7962522
Yamamoto, Koji; Kawaguchi, Makiko; Shimomura, Takeshi; Izumi, Aya; Konari, Kazuomi; Honda, Arata; Lin, Chen-Yong; Johnson, Michael D; Yamashita, Yoshihiro; Fukushima, Tsuyoshi; Kataoka, Hiroaki
2018-02-20
Hepatocyte growth factor activator inhibitor (HAI)-1/ SPINT1 and HAI-2/ SPINT2 are membrane-anchored protease inhibitors having homologous Kunitz-type inhibitor domains. They regulate membrane-anchored serine proteases, such as matriptase and prostasin. Whereas HAI-1 suppresses the neoplastic progression of keratinocytes to invasive squamous cell carcinoma (SCC) through matriptase inhibition, the role of HAI-2 in keratinocytes is poorly understood. In vitro homozygous knockout of the SPINT2 gene suppressed the proliferation of two oral SCC (OSCC) lines (SAS and HSC3) but not the growth of a non-tumorigenic keratinocyte line (HaCaT). Reversion of HAI-2 abrogated the growth suppression. Matrigel invasion of both OSCC lines was also suppressed by the loss of HAI-2. The levels of prostasin protein were markedly increased in HAI-2-deficient cells, and knockdown of prostasin alleviated the HAI-2 loss-induced suppression of OSCC cell invasion. Therefore, HAI-2 has a pro-invasive role in OSCC cells through suppression of prostasin. In surgically resected OSCC tissues, HAI-2 immunoreactivity increased along with neoplastic progression, showing intense immunoreactivities in invasive OSCC cells. In summary, HAI-2 is required for invasive growth of OSCC cells and may contribute to OSCC progression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, Yanlan; Chen, Yicheng; Ding, Guoqing
The hepatocyte growth factor and its receptor c-Met are correlated with castration-resistance in prostate cancer. Although HGF has been considered as an attractive target for therapeutic antibodies, the lack of cross-reactivity of monoclonal antibodies with human/mouse HGFs is a major obstacle in preclinical developments. We generated a panel of anti-HGF RabMAbs either blocking HGF/c-Met interaction or inhibiting c-Met phosphorylation. We selected one RabMAb with mouse cross-reactivity and demonstrated that it blocked HGF-stimulated downstream activation in PC-3 and DU145 cells. Anti-HGF RabMAb inhibited not only the growth of PC-3 cells but also HGF-dependent proliferation in HUVECs. We further demonstrated the efficacymore » and potency of the anti-HGF RabMAb in tumor xenograft mice models. Through these in vitro and in vivo experiments, we explored a novel therapeutic antibody for advanced prostate cancer. - Highlights: • HGF is an attractive target for castration-refractory prostate cancer. • We generated and characterized a panel of anti-HGF rabbit monoclonal antibodies. • More than half of these anti-HGF RabMAbs was cross-reactive with mouse HGF. • Anti-HGF RabMAb blocks HGF-stimulated phosphorylation and cell growth in vitro. • Anti-HGF RabMAb inhibits tumor growth and angiogenesis in xenograft mice.« less
Harvey, P; Clark, I M; Jaurand, M-C; Warn, R M; Edwards, D R
2000-01-01
Hepatocyte growth factor/scatter factor (HGF/SF) is a multifunctional factor involved both in development and tissue repair, as well as pathological processes such as cancer and metastasis. It has been identified in vivo in many types of tumours together with its tyrosine kinase receptor, Met. We show here that exogenous HGF/SF acts as a strong chemoattractant for human mesothelioma cell lines. The factor also enhanced cell adhesion to and invasion into Matrigel. The mesothelioma cell lines synthesized a panel of matrix metalloproteinases critical for tumour progression such as MMP-1, 2, 3, 9 and membrane-bound MT1-MMP. HGF/SF stimulated the expression of MMP-1, 9 and MT1-MMP and had a slight effect on expression of the MMP inhibitor TIMP-1 but not TIMP-2. However, there was no simple correlation between the levels of MMPs and TIMPs of the cell lines and their different invasion properties or between HGF/SF stimulatory effects on MMP expression and invasion. In addition, effects of protease inhibitors on invasion suggested that serine proteases were also expressed in human mesothelioma cell lines and were involved in HGF/SF-induced invasion. The results show a predominant role for HGF/SF in mesothelioma cell invasion, stimulating simultaneously adhesion, motility, invasion and regulation of MMP and TIMP levels. © 2000 Cancer Research Campaign PMID:11027427
Utley, Sarah; James, David; Mavila, Nirmala; Nguyen, Marie V.; Vendryes, Christopher; Salisbury, S. Michael; Phan, Jennifer; Wang, Kasper S.
2014-01-01
Background & Aims Fibroblast Growth Factors (FGFs) promote the proliferation and survival of hepatic progenitor cells (HPCs) via AKT-dependent β-catenin activation. Moreover, the emergence of hepatocytes expressing the HPC marker A6 during 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC)-induced liver injury is mediated partly by FGF and β-catenin signaling. Herein, we investigate the role of FGF signaling and AKT-mediated β-catenin activation in acute DDC liver injury. Methods Transgenic mice were fed DDC chow for 14 days concurrent with either Fgf10 over-expression or inhibition of FGF signaling via expression of soluble dominant-negative FGF Receptor (R)-2IIIb. Results After 14 days of DDC treatment, there was an increase in periportal cells expressing FGFR1, FGFR2, and AKT-activated phospho-Serine 552 (pSer552) β-CATENIN in association with up-regulation of genes encoding FGFR2IIIb ligands, Fgf7, Fgf10, and Fgf22. In response to Fgf10 over-expression, there was an increase in the number of pSer552-β-CATENIN(positive)+ive periportal cells as well as cells co-positive for A6 and hepatocyte marker, Hepatocyte Nuclear Factor-4α (HNF4α). A similar expansion of A6+ive cells was observed after Fgf10 over-expression with regular chow and after partial hepatectomy during ethanol toxicity. Inhibition of FGF signaling increased the periportal A6+iveHNF4α+ive cell population while reducing centrolobular A6+ive HNF4α+ive cells. AKT inhibition with Wortmannin attenuated FGF10-mediated A6+iveHNF4α+ive cell expansion. In vitro analyses using FGF10 treated HepG2 cells demonstrated AKT-mediated β-CATENIN activation but not enhanced cell migration. Conclusion During acute DDC treatment, FGF signaling promotes the expansion of A6-expressing liver cells partly via AKT-dependent activation of β-CATENIN expansion of A6+ive periportal cells and possibly by reprogramming of centrolobular hepatocytes. PMID:24365171
Role of hepatocyte growth factor in the development of dendritic cells from CD34+ bone marrow cells.
Ovali, E; Ratip, S; Kibaroglu, A; Tekelioglu, Y; Cetiner, M; Karti, S; Aydin, F; Bayik, M; Akoglu, T
2000-05-01
Hepatocyte growth factor (HGF) is known to augment the effects of stem cell factor, interleukin-3, granulocyte-macrophage colony-stimulating factor (GM-CSF), erythropoetin, and granulocyte colony-stimulating factor, all of which are involved in hematopoiesis. HGF is also known to have a role in immune responses. The aim of this study was to investigate whether HGF is involved in the development of dendritic cells (DC) from CD34+ bone marrow cells. CD34+ cells obtained from three healthy donors were incubated in various combinations of HGF, GM-CSF, and tumor necrosis factor (TNF) for 12 days. Developing cell populations were analyzed for surface markers, morphology and functional capacities by flow cytometry, light microscopy and mixed lymphocyte reaction, respectively. Incubation with HGF alone generated greater number of dendritic cells from CD34+ bone marrow cells than incubation with GM-CSF, or a combination of GM-CSF with TNF. HGF was also found to potentiate the effect of GM-CSF on DC and monocyte development. The effects of HGF were inhibited by the concurrent use of TNF. HGF appears to be a significant factor in the development of dendritic cells from CD34+ bone marrow cells.
Hepatocyte growth factor: a regulator of extracellular matrix genes in mouse mesangial cells.
Laping, N J; Olson, B A; Ho, T; Ziyadeh, F N; Albrightson, C R
2000-04-01
The potential role of hepatocyte growth factor (HGF) in regulating extracellular matrix in mouse mesangial cells (MMC) was evaluated. Functional HGF receptors were deed in MMC by HGF-induced extracellular acidification, a response that was inhibited by the HGF inhibitor HGF/NK2, a splice variant expressing the N-terminal domain through the second kringle domain HGF also increased fibronectin and collagen alpha1 (IV) mRNA levels in these cells; the increases were associated with a concentration-dependent increase in transcriptional activity of the collagen alpha1 (IV) gene. HGF also stimulated fibronectin and collagen alpha1 (IV) mRNA levels in primary rabbit proximal tubule epithelial cells To evaluate the potential consequences of chronic elevation of HGF on renal fuction, HGF was administered continuously for 18 days to normal and diabetic C57BLKS/J lepr(db) mice. In the diabetic mice, HGF reduced creatinine clearance and increased microalbuminuria, indicating that chronic exposure to HGF impairs renal function. Thus, chronically elevated HGF may contribute to the progression of chronic renal disease in diabetes by decreasing the glomerular filtration rate and possibly promoting the accumulation of extracellular matrix.
Naked gene therapy of hepatocyte growth factor for dextran sulfate sodium-induced colitis in mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanbe, Takamasa; Murai, Rie; Mukoyama, Tomoyuki
Ulcerative colitis (UC) is progressive and relapsing disease. To explore the therapeutic effects of naked gene therapy of hepatocyte growth factor (HGF) on UC, the SR{alpha} promoter driving HGF gene was intrarectally administered to the mice in which colitis was induced by dextran sulfate sodium (DSS). Expression of the transgene was seen in surface epithelium, lamina propria, and muscularis mucosae. The HGF-treated mice showed reduced colonic mucosal damage and increased body weights, compared with control mice (P < 0.01 and P < 0.05, respectively). The HGF-treated mice displayed increased number of PCNA-positive cells and decreased number of apoptotic cells thanmore » in control mice (P < 0.01, each). Phosphorylated AKT was dramatically increased after HGF gene administration, however, phosphorylated ERK1/2 was not altered. Microarray analysis revealed that HGF induced expression of proliferation- and apoptosis-associated genes. These data suggest that naked HGF gene delivery causes therapeutic effects through regulation of many downstream genes.« less
Benkhoucha, Mahdia; Molnarfi, Nicolas; Dunand-Sauthier, Isabelle; Merkler, Doron; Schneiter, Gregory; Bruscoli, Stefano; Riccardi, Carlo; Tabata, Yasuhiko; Funakoshi, Hiroshi; Nakamura, Toshikazu; Reith, Walter; Santiago-Raber, Marie-Laure; Lalive, Patrice H
2014-09-15
Autoimmune neuroinflammation, including multiple sclerosis and its animal model, experimental autoimmune encephalomyelitis (EAE), a prototype for T cell-mediated autoimmunity, is believed to result from immune tolerance dysfunction leading to demyelination and substantial neurodegeneration. We previously showed that CNS-restricted expression of hepatocyte growth factor (HGF), a potent neuroprotective factor, reduced CNS inflammation and clinical deficits associated with EAE. In this study, we demonstrate that systemic HGF treatment ameliorates EAE through the development of tolerogenic dendritic cells (DCs) with high expression levels of glucocorticoid-induced leucine zipper (GILZ), a transcriptional repressor of gene expression and a key endogenous regulator of the inflammatory response. RNA interference-directed neutralization of GILZ expression by DCs suppressed the induction of tolerance caused by HGF. Finally, adoptive transfer of HGF-treated DCs from wild-type but not GILZ gene-deficient mice potently mediated functional recovery in recipient mice with established EAE through effective modulation of autoaggressive T cell responses. Altogether, these results show that by inducing GILZ in DCs, HGF reproduces the mechanism of immune regulation induced by potent immunomodulatory factors such as IL-10, TGF-β1, and glucocorticoids and therefore that HGF therapy may have potential in the treatment of autoimmune dysfunctions. Copyright © 2014 by The American Association of Immunologists, Inc.
Khurana, Satish; Jaiswal, Amit K; Mukhopadhyay, Asok
2010-02-12
Hematopoietic stem cells can directly transdifferentiate into hepatocytes because of cellular plasticity, but the molecular basis of transdifferentiation is not known. Here, we show the molecular basis using lineage-depleted oncostatin M receptor beta-expressing (Lin(-)OSMRbeta(+)) mouse bone marrow cells in a hepatic differentiation culture system. Differentiation of the cells was marked by the expression of albumin. Hepatocyte nuclear factor (HNF)-4alpha was expressed and translocated into the nuclei of the differentiating cells. Suppression of its activation in OSM-neutralized culture medium inhibited cellular differentiation. Ectopic expression of full-length HNF4alpha in 32D myeloid cells resulted in decreased myeloid colony-forming potential and increased expression of hepatocyte-specific genes and proteins. Nevertheless, the neohepatocytes produced in culture expressed active P450 enzyme. The obligatory role of HNF4alpha in hepatic differentiation was confirmed by transfecting Lin(-)OSMRbeta(+) cells with dominant negative HNF4alpha in the differentiation culture because its expression inhibited the transcription of the albumin and tyrosine aminotransferase genes. The loss and gain of functional activities strongly suggested that HNF4alpha plays a central role in the transdifferentiation process. For the first time, this report demonstrates the mechanism of transdifferentiation of hematopoietic cells into hepatocytes, in which HNF4alpha serves as a molecular switch.
Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes
Basma, Hesham; Soto-Gutiérrez, Alejandro; Yannam, Govardhana Rao; Liu, Liping; Ito, Ryotaro; Yamamoto, Toshiyuki; Ellis, Ewa; Carson, Steven D.; Sato, Shintaro; Chen, Yong; Muirhead, David; Navarro-Álvarez, Nalu; Wong, Ron; Roy-Chowdhury, Jayanta; Platt, Jeffrey L.; Mercer, David F.; Miller, John D.; Strom, Stephen C.; Kobayashi, Noaya; Fox, Ira J.
2009-01-01
Background & Aims The ability to obtain unlimited numbers of human hepatocytes would improve development of cell-based therapies for liver diseases, facilitate the study of liver biology and improve the early stages of drug discovery. Embryonic stem cells are pluripotent, can potentially differentiate into any cell type and could therefore be developed as a source of human hepatocytes. Methods To generate human hepatocytes, human embryonic stem cells were differentiated by sequential culture in fibroblast growth factor 2 and human Activin-A, hepatocyte growth factor, and dexamethasone. Functional hepatocytes were isolated by sorting for surface asialoglycoprotein receptor expression. Characterization was performed by real-time PCR, imunohistochemistry, immunoblot, functional assays and transplantation. Results Embryonic stem cell-derived hepatocytes expressed liver-specific genes but not genes representing other lineages, secreted functional human liver-specific proteins similar to those of primary human hepatocytes and demonstrated human hepatocyte cytochrome P450 metabolic activity. Serum from rodents given injections of embryonic stem cell-derived hepatocytes contained significant amounts of human albumin and alpha-1-antitrypsin. Colonies of cytokeratin-18 and human albumin-expressing cells were present in the livers of recipient animals. Conclusion Human embryonic stem cells can be differentiated into cells with many characteristics of primary human hepatocytes. Hepatocyte-like cells can be enriched and recovered based on asialoglycoprotein receptor expression and could potentially be used in drug discovery research and developed as therapeutics. PMID:19026649
In vitro differentiation of rat bone marrow mesenchymal stem cells into hepatocytes.
Feng, Zhihui; Li, Changying; Jiao, Shuxian; Hu, Bin; Zhao, Lin
2011-01-01
To investigate the mechanism and regulation of differentiation from bone marrow mesenchymal stem cells (BMSCs) into hepatocytes and to find a new source for therapies of hepatic diseases. We isolated BMSCs for subsequent differentiation in the presence of hepatocyte growth factor (HGF) or beta-nerve growth factor (beta-NGF). Cell morphology was observed and cell surface phenotypings were detected by flow cytometry. a1-antitrypsin (AAT) expression of the hepatocytes was confirmed by immunocytochemistry and albumin expression was validated by real time PCR and western blotting. The expression of high-affinity nerve growth factor receptor (TrkA) and the activation of Erk pathway were detected by western blotting. Hepatocyte functional activity was confirmed by uptake of indocyanine green (ICG) assay. Small round cells appeared in the presence of HGF on day 10 or beta-NGF on day 12. Differentiated cells expressed albumin and had functional characteristics of hepatocytes, such as uptake of ICG. BMSCs were positive for TrkA. HGF and beta-NGF significantly upregulated the protein levels of phospho-Erk. BMSCs could differentiate into hepatocytes in the differentiation media including HGF or beta-NGF. Combination of HGF and beta-NGF significantly increased the efficiency of hepatic differentiation.
Ju, Guan-qun; Cheng, Jun; Zhong, Liang; Wu, Shuai; Zou, Xiang-yu; Zhang, Guang-yuan; Gu, Di; Miao, Shuai; Zhu, Ying-jian; Sun, Jie; Du, Tao
2015-01-01
During acute kidney injury (AKI), tubular cell dedifferentiation initiates cell regeneration; hepatocyte growth factor (HGF) is involved in modulating cell dedifferentiation. Mesenchymal stem cell (MSC)-derived microvesicles (MVs) deliver RNA into injured tubular cells and alter their gene expression, thus regenerating these cells. We boldly speculated that MVs might induce HGF synthesis via RNA transfer, thereby facilitating tubular cell dedifferentiation and regeneration. In a rat model of unilateral AKI, the administration of MVs promoted kidney recovery. One of the mechanisms of action is the acceleration of tubular cell dedifferentiation and growth. Both in vivo and in vitro, rat HGF expression in damaged rat tubular cells was greatly enhanced by MV treatment. In addition, human HGF mRNA present in MVs was delivered into rat tubular cells and translated into the HGF protein as another mechanism of HGF induction. RNase treatment abrogated all MV effects. In the in vitro experimental setting, the conditioned medium of MV-treated injured tubular cells, which contains a higher concentration of HGF, strongly stimulated cell dedifferentiation and growth, as well as Erk1/2 signaling activation. Intriguingly, these effects were completely abrogated by either c-Met inhibitor or MEK inhibitor, suggesting that HGF induction is a crucial contributor to the acceleration of cell dedifferentiation and growth. All these findings indicate that MV-induced HGF synthesis in damaged tubular cells via RNA transfer facilitates cell dedifferentiation and growth, which are important regenerative mechanisms.
Gauldie, J; Richards, C; Harnish, D; Lansdorp, P; Baumann, H
1987-01-01
One of the oldest and most preserved of the homeostatic responses of the body to injury is the acute phase protein response associated with inflammation. The liver responds to hormone-like mediators by the increased synthesis of a series of plasma proteins called acute phase reactants. In these studies, we examined the relationship of hepatocyte-stimulating factor derived from peripheral blood monocytes to interferon beta 2 (IFN-beta 2), which has been cloned. Antibodies raised against fibroblast-derived IFN-beta having neutralizing activity against both IFN-beta 1 and -beta 2 inhibited the major hepatocyte-stimulating activity derived from monocytes. Fibroblast-derived mediator elicited the identical stimulated response in human HepG2 cells and primary rat hepatocytes as the monocyte cytokine. Finally, recombinant-derived human B-cell stimulatory factor type 2 (IFN-beta 2) from Escherichia coli induced the synthesis of all major acute phase proteins studied in human hepatoma HepG2 and primary rat hepatocyte cultures. These data demonstrate that monocyte-derived hepatocyte-stimulating factor and IFN-beta 2 share immunological and functional identity and that IFN-beta 2, also known as B-cell stimulatory factor and hybridoma plasmacytoma growth factor, has the hepatocyte as a major physiologic target and thereby is essential in controlling the hepatic acute phase response. Images PMID:2444978
Hepatocytic differentiation of mesenchymal stem cells in cocultures with fetal liver cells.
Lange, Claudia; Bruns, Helge; Kluth, Dietrich; Zander, Axel-R; Fiegel, Henning-C
2006-04-21
To investigate the hepatocytic differentiation of mesenchymal stem cells (MSCs) in co-cultures with fetal liver cells (FLC) and the possibility to expand differentiated hepatocytic cells. MSCs were marked with green fluorescent protein (GFP) by retroviral gene transduction. Clonal marked MSCs were either cultured under liver stimulating conditions using fibronectin-coated culture dishes and medium supplemented with stem cell factor (SCF), hepatocyte growth factor (HGF), epidermal growth factor (EGF), and fibroblast growth factor 4 (FGF-4) alone, or in presence of freshly isolated FLC. Cells in co-cultures were harvested, and GFP+ or GFP- cells were separated using fluorescence activated cell sorting. Reverse transcription-polymerase chain reaction (RT-PCR) for the liver specific markers cytokeratin-18 (CK-18), albumin, and alpha-fetoprotein (AFP) was performed in different cell populations. Under the specified culture conditions, rat MSCs co-cultured with FLC expressed albumin, CK-18, and AFP-RNA over two weeks. At wk 3, MSCs lost hepatocytic gene expression, probably due to overgrowth of the cocultured FLC. FLC also showed a stable liver specific gene expression in the co-cultures and a very high growth potential. The rat MSCs from bone marrow can differentiate hepatocytic cells in the presence of FLC in vitro and the presence of MSCs in co-cultures also provides a beneficial environment for expansion and differentiation of FLC.
Gordin, Maya; Tesio, Melania; Cohen, Sivan; Gore, Yael; Lantner, Frida; Leng, Lin; Bucala, Richard; Shachar, Idit
2010-08-15
The signals regulating the survival of mature splenic B cells have become a major focus in recent studies of B cell immunology. Durable B cell persistence in the periphery is dependent on survival signals that are transduced by cell surface receptors. In this study, we describe a novel biological mechanism involved in mature B cell homeostasis, the hepatocyte growth factor/scatter factor (HGF)/c-Met pathway. We demonstrate that c-Met activation by HGF leads to a survival cascade, whereas its blockade results in induction of mature B cell death. Our results emphasize a unique and critical function for c-Met signaling in the previously described macrophage migration inhibitory factor/CD74-induced survival pathway. Macrophage migration inhibitory factor recruits c-Met to the CD74/CD44 complex and thereby enables the induction of a signaling cascade within the cell. This signal results in HGF secretion, which stimulates the survival of the mature B cell population in an autocrine manner. Thus, the CD74-HGF/c-Met axis defines a novel physiologic survival pathway in mature B cells, resulting in the control of the humoral immune response.
Desai, Seema S.; Tung, Jason C.; Zhou, Vivian X.; Grenert, James P.; Malato, Yann; Rezvani, Milad; Español-Suñer, Regina; Willenbring, Holger; Weaver, Valerie M.; Chang, Tammy T.
2016-01-01
Matrix rigidity has important effects on cell behavior and is increased during liver fibrosis; however, its effect on primary hepatocyte function is unknown. We hypothesized that increased matrix rigidity in fibrotic livers would activate mechanotransduction in hepatocytes and lead to inhibition of hepatic-specific functions. To determine the physiologically relevant ranges of matrix stiffness at the cellular level, we performed detailed atomic force microscopy analysis across liver lobules from normal and fibrotic livers. We determined that normal liver matrix stiffness was around 150Pa and increased to 1–6kPa in areas near fibrillar collagen deposition in fibrotic livers. In vitro culture of primary hepatocytes on collagen matrix of tunable rigidity demonstrated that fibrotic levels of matrix stiffness had profound effects on cytoskeletal tension and significantly inhibited hepatocyte-specific functions. Normal liver stiffness maintained functional gene regulation by hepatocyte nuclear factor 4 alpha (HNF4α) whereas fibrotic matrix stiffness inhibited the HNF4α transcriptional network. Fibrotic levels of matrix stiffness activated mechanotransduction in primary hepatocytes through focal adhesion kinase (FAK). In addition, blockade of the Rho/Rho-associated protein kinase (ROCK) pathway rescued HNF4α expression from hepatocytes cultured on stiff matrix. Conclusion Fibrotic levels of matrix stiffness significantly inhibit hepatocyte-specific functions in part by inhibiting the HNF4α transcriptional network mediated through the Rho/ROCK pathway. Increased appreciation of the role of matrix rigidity in modulating hepatocyte function will advance our understanding of the mechanisms of hepatocyte dysfunction in liver cirrhosis and spur development of novel treatments for chronic liver disease. PMID:26755329
Rozance, Paul J; Anderson, Miranda; Martinez, Marina; Fahy, Anna; Macko, Antoni R; Kailey, Jenai; Seedorf, Gregory J; Abman, Steven H; Hay, William W; Limesand, Sean W
2015-02-01
Hepatocyte growth factor (HGF) and vascular endothelial growth factor A (VEGFA) are paracrine hormones that mediate communication between pancreatic islet endothelial cells (ECs) and β-cells. Our objective was to determine the impact of intrauterine growth restriction (IUGR) on pancreatic vascularity and paracrine signaling between the EC and β-cell. Vessel density was less in IUGR pancreata than in controls. HGF concentrations were also lower in islet EC-conditioned media (ECCM) from IUGR, and islets incubated with control islet ECCM responded by increasing insulin content, which was absent with IUGR ECCM. The effect of ECCM on islet insulin content was blocked with an inhibitory anti-HGF antibody. The HGF receptor was not different between control and IUGR islets, but VEGFA was lower and the high-affinity VEGF receptor was higher in IUGR islets and ECs, respectively. These findings show that paracrine actions from ECs increase islet insulin content, and in IUGR ECs, secretion of HGF was diminished. Given the potential feed-forward regulation of β-cell VEGFA and islet EC HGF, these two growth factors are highly integrated in normal pancreatic islet development, and this regulation is decreased in IUGR fetuses, resulting in lower pancreatic islet insulin concentrations and insulin secretion. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.
Boissinot, Marjorie; Vilaine, Mathias; Hermouet, Sylvie
2014-01-01
Met is the receptor of hepatocyte growth factor (HGF), a cytoprotective cytokine. Disturbing the equilibrium between Met and its ligand may lead to inappropriate cell survival, accumulation of genetic abnormalities and eventually, malignancy. Abnormal activation of the HGF/Met axis is established in solid tumours and in chronic haematological malignancies, including myeloma, acute myeloid leukaemia, chronic myelogenous leukaemia (CML), and myeloproliferative neoplasms (MPNs). The molecular mechanisms potentially responsible for the abnormal activation of HGF/Met pathways are described and discussed. Importantly, inCML and in MPNs, the production of HGF is independent of Bcr-Abl and JAK2V617F, the main molecular markers of these diseases. In vitro studies showed that blocking HGF/Met function with neutralizing antibodies or Met inhibitors significantly impairs the growth of JAK2V617F-mutated cells. With personalised medicine and curative treatment in view, blocking activation of HGF/Met could be a useful addition in the treatment of CML and MPNs for those patients with high HGF/MET expression not controlled by current treatments (Bcr-Abl inhibitors in CML; phlebotomy, hydroxurea, JAK inhibitors in MPNs). PMID:25119536
Kheolamai, Pakpoom; Dickson, Alan J
2009-04-23
Induction of stem cell differentiation toward functional hepatocytes is hampered by lack of knowledge of the hepatocyte differentiation processes. The overall objective of this project is to characterize key stages in the hepatocyte differentiation process. We established a mouse embryonic stem (mES) cell culture system which exhibited changes in gene expression profiles similar to those observed in the development of endodermal and hepatocyte-lineage cells previously described in the normal mouse embryo. Transgenic mES cells were established that permitted isolation of enriched hepatocyte-lineage populations. This approach has isolated mES-derived hepatocyte-lineage cells that express several markers of mature hepatocytes including albumin, glucose-6-phosphatase, tyrosine aminotransferase, cytochrome P450-3a, phosphoenolpyruvate carboxykinase and tryptophan 2,3-dioxygenase. In addition, our results show that the up-regulation of the expression levels of hepatocyte nuclear factor-3alpha, -4alpha, -6, and CCAAT-enhancer binding protein-beta might be critical for passage into late-stage differentiation towards functional hepatocytes. These data present important steps for definition of regulatory phenomena that direct specific cell fate determination. The mES cell culture system generated in this study provides a model for studying transition between stages of the hepatocyte development and has significant potential value for studying the molecular basis of hepatocyte differentiation in vitro.
Hepatocyte Ploidy Is a Diversity Factor for Liver Homeostasis
Kreutz, Clemens; MacNelly, Sabine; Follo, Marie; Wäldin, Astrid; Binninger-Lacour, Petra; Timmer, Jens; Bartolomé-Rodríguez, María M.
2017-01-01
Polyploidy, the existence of cells containing more than one pair of chromosomes, is a well-known feature of mammalian hepatocytes. Polyploid hepatocytes are found either as cells with a single polyploid nucleus or as multinucleated cells with diploid or even polyploid nuclei. In this study, we evaluate the degree of polyploidy in the murine liver by accounting both DNA content and number of nuclei per cell. We demonstrate that mouse hepatocytes with diploid nuclei have distinct metabolic characteristics compared to cells with polyploid nuclei. In addition to strong differential gene expression, comprising metabolic as well as signaling compounds, we found a strongly decreased insulin binding of nuclear polyploid cells. Our observations were associated with nuclear ploidy but not with total ploidy within a cell. We therefore suggest ploidy of the nuclei as an new diversity factor of hepatocytes and hypothesize that hepatocytes with polyploid nuclei may have distinct biological functions than mono-nuclear ones. This diversity is independent from the well-known heterogeneity related to the cells' position along the porto-central liver-axis. PMID:29163206
Two-signal requirement for growth-promoting function of Yap in hepatocytes
Su, Tian; Bondar, Tanya; Zhou, Xu; Zhang, Cuiling; He, Hang; Medzhitov, Ruslan
2015-01-01
The transcriptional coactivator Yes-associated protein (Yap) promotes proliferation and inhibits apoptosis, suggesting that Yap functions as an oncogene. Most oncogenes, however, require a combination of at least two signals to promote proliferation. In this study, we present evidence that Yap activation is insufficient to promote growth in the otherwise normal tissue. Using a mosaic mouse model, we demonstrate that Yap overexpression in a fraction of hepatocytes does not lead to their clonal expansion, as proliferation is counterbalanced by increased apoptosis. To shift the activity of Yap towards growth, a second signal provided by tissue damage or inflammation is required. In response to liver injury, Yap drives clonal expansion, suppresses hepatocyte differentiation, and promotes a progenitor phenotype. These results suggest that Yap activation is insufficient to promote growth in the absence of a second signal thus coordinating tissue homeostasis and repair. DOI: http://dx.doi.org/10.7554/eLife.02948.001 PMID:25667983
Schiering, Nikolaus; Knapp, Stefan; Marconi, Marina; Flocco, Maria M; Cui, Jean; Perego, Rita; Rusconi, Luisa; Cristiani, Cinzia
2003-10-28
The protooncogene c-met codes for the hepatocyte growth factor receptor tyrosine kinase. Binding of its ligand, hepatocyte growth factor/scatter factor, stimulates receptor autophosphorylation, which leads to pleiotropic downstream signaling events in epithelial cells, including cell growth, motility, and invasion. These events are mediated by interaction of cytoplasmic effectors, generally through Src homology 2 (SH2) domains, with two phosphotyrosine-containing sequence motifs in the unique C-terminal tail of c-Met (supersite). There is a strong link between aberrant c-Met activity and oncogenesis, which makes this kinase an important cancer drug target. The furanosylated indolocarbazole K-252a belongs to a family of microbial alkaloids that also includes staurosporine. It was recently shown to be a potent inhibitor of c-Met. Here we report the crystal structures of an unphosphorylated c-Met kinase domain harboring a human cancer mutation and its complex with K-252a at 1.8-A resolution. The structure follows the well established architecture of protein kinases. It adopts a unique, inhibitory conformation of the activation loop, a catalytically noncompetent orientation of helix alphaC, and reveals the complete C-terminal docking site. The first SH2-binding motif (1349YVHV) adopts an extended conformation, whereas the second motif (1356YVNV), a binding site for Grb2-SH2, folds as a type II Beta-turn. The intermediate portion of the supersite (1353NATY) assumes a type I Beta-turn conformation as in an Shc-phosphotyrosine binding domain peptide complex. K-252a is bound in the adenosine pocket with an analogous binding mode to those observed in previously reported structures of protein kinases in complex with staurosporine.
Desai, Seema S; Tung, Jason C; Zhou, Vivian X; Grenert, James P; Malato, Yann; Rezvani, Milad; Español-Suñer, Regina; Willenbring, Holger; Weaver, Valerie M; Chang, Tammy T
2016-07-01
Matrix rigidity has important effects on cell behavior and is increased during liver fibrosis; however, its effect on primary hepatocyte function is unknown. We hypothesized that increased matrix rigidity in fibrotic livers would activate mechanotransduction in hepatocytes and lead to inhibition of liver-specific functions. To determine the physiologically relevant ranges of matrix stiffness at the cellular level, we performed detailed atomic force microscopy analysis across liver lobules from normal and fibrotic livers. We determined that normal liver matrix stiffness was around 150 Pa and increased to 1-6 kPa in areas near fibrillar collagen deposition in fibrotic livers. In vitro culture of primary hepatocytes on collagen matrix of tunable rigidity demonstrated that fibrotic levels of matrix stiffness had profound effects on cytoskeletal tension and significantly inhibited hepatocyte-specific functions. Normal liver stiffness maintained functional gene regulation by hepatocyte nuclear factor 4 alpha (HNF4α), whereas fibrotic matrix stiffness inhibited the HNF4α transcriptional network. Fibrotic levels of matrix stiffness activated mechanotransduction in primary hepatocytes through focal adhesion kinase. In addition, blockade of the Rho/Rho-associated protein kinase pathway rescued HNF4α expression from hepatocytes cultured on stiff matrix. Fibrotic levels of matrix stiffness significantly inhibit hepatocyte-specific functions in part by inhibiting the HNF4α transcriptional network mediated through the Rho/Rho-associated protein kinase pathway. Increased appreciation of the role of matrix rigidity in modulating hepatocyte function will advance our understanding of the mechanisms of hepatocyte dysfunction in liver cirrhosis and spur development of novel treatments for chronic liver disease. (Hepatology 2016;64:261-275). © 2016 by the American Association for the Study of Liver Diseases.
Polyploidization delay in rat hepatocytes under liver growth inhibition by hypokinesia
NASA Technical Reports Server (NTRS)
Faktor, V. M.; Malyutin, V. F.; Li, S. Y.; Brodskiy, V. Y.
1981-01-01
A study of young rats, weighing 55 to 59 g, after being for 10 days in conditions of limited mobility, shows a retardation of body growth as well as that of liver growth. The decrease in the rate of growth is accompanied by a reduction of cell proliferation and by delay polyploidization of hepatocytes in the liver of experimental rats. The materials, methods, and results of research are discussed.
Preventive effects of the deleted form of hepatocyte growth factor against various liver injuries.
Masunaga, H; Fujise, N; Shiota, A; Ogawa, H; Sato, Y; Imai, E; Yasuda, H; Higashio, K
1998-01-26
The effects of a naturally occurring deleted form of hepatocyte growth factor (HGF) on hepatic disorder were studied in various models of hepatic failure. The pretreatment of rats and mice with the deleted form of HGF prevented the liver injuries and coagulopathy induced by endotoxin, dimethylnitrosamine and acetaminophen and reduced the mortality due to hepatic dysfunction induced by these hepatotoxins. The concurrent administration of the deleted form of HGF also prevented the liver injury and hepatic fibrosis in mice treated with alpha-naphthylisothiocyanate and in rats treated with dimethylnitrosamine. Moreover, the deleted form of HGF normalized the results of the bromosulphalein-clearance test and ameliorated jaundice in rats with periportal cholangiolitic hepatopathy induced by alpha-naphthylisothiocyanate. The deleted form of HGF also reversed the coagulopathy in rats with hepatic disorder induced by dimethylnitrosamine or by 70% resection of cirrhotic liver (induced by carbon tetrachloride). In Long Evans cinnamon rats receiving vehicle, 20 out of 21 animals died within 4 days after the onset of jaundice. After infusion of the deleted form of HGF for 4 days, 7 out of 20 Long-Evans cinnamon rats survived. These results indicate that the deleted form of HGF could have therapeutic potency in patients with severe hepatic failure.
Xu, Yi; Zhao, Hui; Zheng, Ying; Gu, Qing; Ma, Jianxing
2010-01-01
Purpose To study the antiangiogenic activity of two small peptides (H-RN and H-FT) derived from the hepatocyte growth factor kringle 1 domain (HGF K1) using in vitro and in vivo assays. Methods RF/6A rhesus macaque choroid-retina endothelial cells were used for in vitro studies. The inhibiting effect of two peptides on a vascular endothelial growth factor (VEGF)-stimulated cell proliferation, cell migration, and endothelial cell tube formation were investigated. For in vivo assays, the antiangiogenic activity of H-RN and H-FT in the chick chorioallantoic membrane model (CAM) and a mice oxygen-induced retinopathy model (OIR) were studied. A recombinant mouse VEGF-neutralizing antibody, bevacizumab, and a scrambled peptide were used as two control groups in separate studies. Results H-RN effectively inhibited VEGF-stimulated RF/6A cell proliferation, migration, and tube formation on Matrigel™, while H-FT did not. H-RN was also able to inhibit angiogenesis when applied to the CAM, and had antineovascularization activity in the retinal neovascularization of a mouse OIR model when administrated as an intravitreous injection. The antiangiogenic activity of H-RN was not as strong as that of VEGF antibodies. The H-FT and scrambled peptide had no such activity. Conclusions H-RN, a new peptide derived from the HGF K1 domain, was shown to have antiangiogenic activity in vitro and in vivo. It may lead to new potential drug discoveries and the development of new treatments for pathological retinal angiogenesis. PMID:21031024
Modulation of hepatocyte growth factor gene expression by estrogen in mouse ovary.
Liu, Y; Lin, L; Zarnegar, R
1994-09-01
Hepatocyte growth factor (HGF) is expressed in a variety of tissues and cell types under normal conditions and in response to various stimuli such as tissue injury. In the present study, we demonstrate that the transcription of the HGF gene is stimulated by estrogen in mouse ovary. A single injection of 17 beta-estradiol results in a dramatic and transient elevation of the levels of mouse HGF mRNA. Sequence analysis has found that two putative estrogen responsive elements (ERE) reside at -872 in the 5'-flanking region and at +511 in the first intron, respectively, of the mouse HGF gene. To test whether these ERE elements are responsible for estrogen induction of HGF gene expression, chimeric plasmids containing variable regions of the 5'-flanking sequence of HGF gene and the coding region for chloramphenicol acetyltransferase (CAT) gene were transiently transfected into both human endometrial carcinoma RL 95-2 cells and mouse fibroblast NIH 3T3 cells to assess hormone responsiveness. Transfection results indicate that the ERE elements of the mouse HGF gene can confer estrogen action to either homologous or heterologous promoters. Nuclear protein extracts either from RL95-2 cells transfected with the estrogen receptor expression vector or from mouse liver bound in vitro to ERE elements specifically, as shown by band shift assay. Therefore, our results demonstrate that the HGF gene is transcriptionally regulated by estrogen in mouse ovary; and such regulation is mediated via a direct interaction of the estrogen receptor complex with cis-acting ERE elements identified in the mouse HGF gene.
Hang, Hua-Lian; Liu, Xin-Yu; Wang, Hai-Tian; Xu, Ning; Bian, Jian-Min; Zhang, Jian-Jun; Xia, Lei; Xia, Qiang
2017-11-15
Immortalized human hepatocytes (IHH) could provide an unlimited supply of hepatocytes, but insufficient differentiation and phenotypic instability restrict their clinical application. This study aimed to determine the role of hepatocyte nuclear factor 4A (HNF4A) in hepatic differentiation of IHH, and whether encapsulation of IHH overexpressing HNF4A could improve liver function and survival in rats with acute liver failure (ALF). Primary human hepatocytes were transduced with lentivirus-mediated catalytic subunit of human telomerase reverse transcriptase (hTERT) to establish IHH. Cells were analyzed for telomerase activity, proliferative capacity, hepatocyte markers, and tumorigenicity (c-myc) expression. Hepatocyte markers, hepatocellular functions, and morphology were studied in the HNF4A-overexpressing IHH. Hepatocyte markers and karyotype analysis were completed in the primary hepatocytes using shRNA knockdown of HNF4A. Nuclear translocation of β-catenin was assessed. Rat models of ALF were treated with encapsulated IHH or HNF4A-overexpressing IHH. A HNF4A-positive IHH line was established, which was non-tumorigenic and conserved properties of primary hepatocytes. HNF4A overexpression significantly enhanced mRNA levels of genes related to hepatic differentiation in IHH. Urea levels were increased by the overexpression of HNF4A, as measured 24h after ammonium chloride addition, similar to that of primary hepatocytes. Chromosomal abnormalities were observed in primary hepatocytes transfected with HNF4A shRNA. HNF4α overexpression could significantly promote β-catenin activation. Transplantation of HNF4A overexpressing IHH resulted in better liver function and survival of rats with ALF compared with IHH. HNF4A improved hepatic differentiation of IHH. Transplantation of HNF4A-overexpressing IHH could improve the liver function and survival in a rat model of ALF. Copyright © 2017 Elsevier Inc. All rights reserved.
Le Goff, Arnaud; Ji, Zongling; Leclercq, Bérénice; Bourette, Roland P.; Mougel, Alexandra; Guerardel, Cateline; de Launoit, Yvan; Vicogne, Jérôme; Goormachtigh, Gautier; Fafeur, Véronique
2012-01-01
The GRB2-associated binder 1 (GAB1) docking/scaffold protein is a key mediator of the MET-tyrosine kinase receptor activated by hepatocyte growth factor/scatter factor (HGF/SF). Activated MET promotes recruitment and tyrosine phosphorylation of GAB1, which in turn recruits multiple proteins and mediates MET signaling leading to cell survival, motility, and morphogenesis. We previously reported that, without its ligand, MET is a functional caspase target during apoptosis, allowing the generation of a p40-MET fragment that amplifies apoptosis. In this study we established that GAB1 is also a functional caspase target by evidencing a caspase-cleaved p35-GAB1 fragment that contains the MET binding domain. GAB1 is cleaved by caspases before MET, and the resulting p35-GAB1 fragment is phosphorylated by MET upon HGF/SF binding and can interact with a subset of GAB1 partners, PI3K, and GRB2 but not with SHP2. This p35-GAB1 fragment favors cell survival by maintaining HGF/SF-induced MET activation of AKT and by hindering p40-MET pro-apoptotic function. These data demonstrate an anti-apoptotic role of caspase-cleaved GAB1 in HGF/SF-MET signaling. PMID:22915589
Avetisyan, Marina; Wang, Hongtao; Schill, Ellen Merrick; Bery, Saya; Grider, John R.; Hassell, John A.; Stappenbeck, Thaddeus
2015-01-01
Factors providing trophic support to diverse enteric neuron subtypes remain poorly understood. We tested the hypothesis that hepatocyte growth factor (HGF) and the HGF receptor MET might support some types of enteric neurons. HGF and MET are expressed in fetal and adult enteric nervous system. In vitro, HGF increased enteric neuron differentiation and neurite length, but only if vanishingly small amounts (1 pg/ml) of glial cell line-derived neurotrophic factor were included in culture media. HGF effects were blocked by phosphatidylinositol-3 kinase inhibitor and by MET-blocking antibody. Both of these inhibitors and MEK inhibition reduced neurite length. In adult mice, MET was restricted to a subset of calcitonin gene-related peptide-immunoreactive (IR) myenteric plexus neurons thought to be intrinsic primary afferent neurons (IPANs). Conditional MET kinase domain inactivation (Metfl/fl; Wnt1Cre+) caused a dramatic loss of myenteric plexus MET-IR neurites and 1–1′-dioctodecyl-3,3,3′,3′-tetramethylindocarbocyamine perchlorate (DiI) labeling suggested reduced MET-IR neurite length. In vitro, Metfl/fl; Wnt1Cre+ mouse bowel had markedly reduced peristalsis in response to mucosal deformation, but normal response to radial muscle stretch. However, whole-bowel transit, small-bowel transit, and colonic-bead expulsion were normal in Metfl/fl; Wnt1Cre+ mice. Finally, Metfl/fl; Wnt1Cre+ mice had more bowel injury and reduced epithelial cell proliferation compared with WT animals after dextran sodium sulfate treatment. These results suggest that HGF/MET signaling is important for development and function of a subset IPANs and that these cells regulate intestinal motility and epithelial cell proliferation in response to bowel injury. SIGNIFICANCE STATEMENT The enteric nervous system has many neuronal subtypes that coordinate and control intestinal activity. Trophic factors that support these neuron types and enhance neurite growth after fetal development are not well
2014-01-01
Background Autologous transplantation of modified mesenchymal stem cells (MSCs) is a promising candidate for the treatment of the refractory clinical disease, avascular necrosis of the femoral head (ANFH). Our previous attempts by compounding MSCs with medical fibrin glue to treat ANFH in animal model have achieved excellent effects. However, the underlying molecular mechanism is unclear, especially on the transgenic gene expression. Methods Rabbit MSCs were isolated and compounded with fibrin glue. Following degrading of fibrin glue, proliferation, viability, expression of transgenic hepatocyte growth factor gene as well as osteogenic differentiation of MSCs were evaluated together with that of uncompounded MSCs. Fibrin glue-compounded MSCs were transplanted into the lesion of ANFH model, and the therapeutic efficacy was compared with uncompounded MSCs. One-Way ANOVA was used to determine the statistical significance among treatment groups. Results Fibrin glue compounding will not affect molecular activities of MSCs, including hepatocyte growth factor (HGF) secretion, cell proliferation and viability, and osteogenic differentiation in vitro. When applying fibrin glue-compounded MSCs for the therapy of ANFH in vivo, fibrin glue functioned as a drug delivery system and provided a sustaining microenvironment for MSCs which helped the relatively long-term secretion of HGF in the femoral head lesion and resulted in improved therapeutic efficacy when compared with uncompounded MSCs as indicated by hematoxylin-eosin staining and immunohistochemistry of osteocalcin, CD105 and HGF. Conclusion Transplantation of fibrin glue-compounding MSCs is a promising novel method for ANFH therapy. PMID:24885252
Phin, Sophie; Marchand-Adam, Sylvain; Fabre, Aurélie; Marchal-Somme, Joëlle; Bantsimba-Malanda, Claudie; Kataoka, Hiroaki; Soler, Paul; Crestani, Bruno
2010-03-01
Hepatocyte growth factor (HGF) is a growth factor for alveolar epithelial cells. Activation of pro-HGF to HGF is regulated by the HGF activator (HGFA), a serine protease, and a specific inhibitor (HGFA inhibitor-1, HAI-1). An imbalance in the HGFA/HAI-1 system might contribute to lung fibrosis. Pro-HGF activation capacity from bronchoalveolar lavage (BAL) fluid was evaluated 3, 7, and 14 days after the intratracheal bleomycin injection (Bleo) in mice with or without thrombin. BAL fluid from naïve mice was used as control. HGFA and HAI-1 mRNA were evaluated by QPCR in the whole lung or by Western blot in BAL fluid. BAL fluid from control mice and Bleo mice activated pro-HGF in vitro at a similar degree. Thrombin accelerated proHGF activation by Bleo BAL on Day 3 and Day 7, but not on Day 14, or in control BAL. Incubation of pro-HGF with BAL from Bleo Day 3 and Day 7 mice increased phosphorylation of HGFR on A549 cells. Thrombin-induced pro-HGF activation was inhibited by an anti-HGFA antibody and accelerated by an anti-HAI-1 antibody. Active HGFA was not detected in control BAL and was strongly induced in Bleo BAL. HGFA concentrations were higher on Day 3 and Day 7 than on Day 14. HAI-1 was detected at low levels in control BAL and increased strongly by Day 3 with stable concentrations until Day 14. By demonstrating an imbalance between HGFA and HAI-1 expression in BAL fluid, our results highlight a defective thrombin-dependent proHGF activation system at the fibrotic phase of bleomycin-induced pulmonary fibrosis.
Bielinski, Suzette J; Berardi, Cecilia; Decker, Paul A; Larson, Nicholas B; Bell, Elizabeth J; Pankow, James S; Sale, Michele M; Tang, Weihong; Hanson, Naomi Q; Wassel, Christina L; de Andrade, Mariza; Budoff, Matthew J; Polak, Joseph F; Sicotte, Hugues; Tsai, Michael Y
2017-08-01
To determine if hepatocyte growth factor (HGF), a promising biomarker of coronary heart disease (CHD) given its release into circulation in response to endothelial damage, is associated with subclinical and clinical CHD in a racial/ethnic diverse population. HGF was measured in 6738 participants of the Multi-Ethnic Study of Atherosclerosis (MESA). Highest mean HGF values (pg/mL) were observed in Hispanic, followed by African, non-Hispanic white, then Chinese Americans. In all races/ethnicities, HGF levels were associated with older age, higher systolic blood pressure (SBP) and body mass index, lower high-density lipoprotein, diabetes and current smoking. In fully adjusted models, each SD higher HGF was associated with an average increase in coronary artery calcium (CAC) of 55 Agatston units for non-Hispanic whites (p<0.001) and 51 Agatston units for African-Americans (p=0.007) but was not in the other race/ethnic groups (interaction p=0.02). There were 529 incident CHD events, and CHD risk was 41% higher in African (p<0.001), 17% in non-Hispanic white (p=0.026) and Chinese (p=0.36), and 6% in Hispanic Americans (p=0.56) per SD increase in HGF. In a large and diverse population-based cohort, we report that HGF is associated with subclinical and incident CHD. We demonstrate evidence of racial/ethnic heterogeneity within these associations, as the results are most compelling in African-Americans and non-Hispanic white Americans. We provide evidence that HGF is a biomarker of atherosclerotic disease that is independent of traditional risk factors. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Trapp, Thorsten; Kögler, Gesine; El-Khattouti, Abdelouahid; Sorg, Rüdiger V; Besselmann, Michael; Föcking, Melanie; Bührle, Christian P; Trompeter, Ingo; Fischer, Johannes C; Wernet, Peter
2008-11-21
An under-agarose chemotaxis assay was used to investigate whether unrestricted somatic stem cells (USSC) that were recently characterized in human cord blood are attracted by neuronal injury in vitro. USSC migrated toward extracts of post-ischemic brain tissue of mice in which stroke had been induced. Moreover, apoptotic neurons secrete factors that strongly attracted USSC, whereas necrotic and healthy neurons did not. Investigating the expression of growth factors and chemokines in lesioned brain tissue and neurons and of their respective receptors in USSC revealed expression of hepatocyte growth factor (HGF) in post-ischemic brain and in apoptotic but not in necrotic neurons and of the HGF receptor c-MET in USSC. Neuronal lesion-triggered migration was observed in vitro and in vivo only when c-MET was expressed at a high level in USSC. Neutralization of the bioactivity of HGF with an antibody inhibited migration of USSC toward neuronal injury. This, together with the finding that human recombinant HGF attracts USSC, document that HGF signaling is necessary for the tropism of USSC for neuronal injury. Our data demonstrate that USSC have the capacity to migrate toward apoptotic neurons and injured brain. Together with their neural differentiation potential, this suggests a neuroregenerative potential of USSC. Moreover, we provide evidence for a hitherto unrecognized pivotal role of the HGF/c-MET axis in guiding stem cells toward brain injury, which may partly account for the capability of HGF to improve function in the diseased central nervous system.
Ogunwobi, Olorunseun O.
2013-01-01
Advanced hepatocellular carcinoma (HCC) is an important cause of cancer mortality. Epithelial-mesenchymal transition (EMT) has been shown to be an important biological process in cancer progression and metastasis. We have focused on elucidating factors that induce EMT to promote carcinogenesis and subsequent metastasis in HCC using the BNL CL.2 (BNL) and BNL 1ME A. 7R.1 (1MEA) cell lines. BNL cells are normal hepatocytes whereas the 1MEA cells are HCC cells derived from chemical transformation of the BNL cells. Their morphological characteristics were examined. Expression levels of hepatocyte growth factor (HGF), markers of EMT and mediators of HGF signaling were determined and functional characteristics were compared. BNL cells were treated with HGF and effects on EMT-marker and mediators of HGF signaling were analyzed. BNL cells display characteristic epithelial morphology whereas 1MEA cells display mesenchymal characteristics. 1MEA cells express and secrete more HGF than BNL cells. There was significantly decreased expression of E-cadherin, albumin, AAT and increased expression of fibronectin, collagen-1, vimentin, snail and slug in 1MEA cells. There was also increased expression of cyclooxygenase-2 (COX-2), Akt and phosphorylated Akt (pAkt) in 1MEA cells. Moreover, 1MEA cells had increased migratory capacity inhibited by inhibition of COX-2 and Akt but not extracellular signal regulated kinase (ERK). Molecular mesenchymal characteristics of 1MEA cells were reversed by inhibition of COX-2, Akt and ERK. Treatment of BNL cells with HGF led to decreased expression of E-cadherin and increased expression of fibronectin, vimentin, snail, slug, COX-2, Akt, pAkt and increased migration, invasiveness and clonogenicity. We conclude that development of HCC is associated with upregulation of HGF which promotes EMT and carcinogenesis via upregulation of COX-2 and Akt. Consequently, HGF signaling may be targeted for therapy in advanced and metastatic HCC. PMID:21744257
Ogunwobi, Olorunseun O; Liu, Chen
2011-12-01
Advanced hepatocellular carcinoma (HCC) is an important cause of cancer mortality. Epithelial-mesenchymal transition (EMT) has been shown to be an important biological process in cancer progression and metastasis. We have focused on elucidating factors that induce EMT to promote carcinogenesis and subsequent metastasis in HCC using the BNL CL.2 (BNL) and BNL 1ME A. 7R.1 (1MEA) cell lines. BNL cells are normal hepatocytes whereas the 1MEA cells are HCC cells derived from chemical transformation of the BNL cells. Their morphological characteristics were examined. Expression levels of hepatocyte growth factor (HGF), markers of EMT and mediators of HGF signaling were determined and functional characteristics were compared. BNL cells were treated with HGF and effects on EMT-marker and mediators of HGF signaling were analyzed. BNL cells display characteristic epithelial morphology whereas 1MEA cells display mesenchymal characteristics. 1MEA cells express and secrete more HGF than BNL cells. There was significantly decreased expression of E-cadherin, albumin, AAT and increased expression of fibronectin, collagen-1, vimentin, snail and slug in 1MEA cells. There was also increased expression of cyclooxygenase-2 (COX-2), Akt and phosphorylated Akt (pAkt) in 1MEA cells. Moreover, 1MEA cells had increased migratory capacity inhibited by inhibition of COX-2 and Akt but not extracellular signal regulated kinase (ERK). Molecular mesenchymal characteristics of 1MEA cells were reversed by inhibition of COX-2, Akt and ERK. Treatment of BNL cells with HGF led to decreased expression of E-cadherin and increased expression of fibronectin, vimentin, snail, slug, COX-2, Akt, pAkt and increased migration, invasiveness and clonogenicity. We conclude that development of HCC is associated with upregulation of HGF which promotes EMT and carcinogenesis via upregulation of COX-2 and Akt. Consequently, HGF signaling may be targeted for therapy in advanced and metastatic HCC.
Tari, Kaveh; Atashi, Amir; Kaviani, Saied; AkhavanRahnama, Mahshid; Anbarlou, Azadeh; Mossahebi-Mohammadi, Majid
2017-01-01
Hepatocyte Growth Factor (HGF) plays a pivotal role in hematopoiesis, motility, growth and mobilization of hematopoietic stem/progenitor cells (HSPCs). HGF mainly is produced by bone marrow mesenchymal stem cells (BM-MSCs). MSCs express erythropoietin (EPO) receptor. In this study, we aimed to assess the effect of EPO on HGF secretion in BM-MSCs. The BM-MSCs treated with EPO (4 IU/ml) for 6, 24 and 48 h. HGF gene expression and protein level were assessed using quantitative real time PCR (qRT-PCR) and Enzyme-linked immunosorbant Assay. In order to show the effect of secreted HGF on migration of HSPCs, hematopoietic stem cells (HSCs) were isolated from cord blood and evaluated using transwell migration assay. We observed a significant increase in level of HGF in cell supernatant after 48 h compared to control group (P < 0.05). Also, qRT-PCR results demonstrated a significant elevation in HGF expression level after 24 and 48 h treatment with EPO compared to control group (P < 0.05). Finally, migration assay results showed a significant increase in migration of HSCs in treated group after 48 h. Our data indicated that EPO may play an important role in stem cell mobilization through up regulating HGF in MSCs and inducing migration of HSCs. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Yang, Junwei; Dai, Chunsun; Liu, Youhua
2005-01-01
Hepatocyte growth factor (HGF) is a potent antifibrotic cytokine that blocks tubular epithelial to mesenchymal transition (EMT) induced by TGF-beta1. However, the underlying mechanism remains largely unknown. This study investigated the signaling events that lead to HGF blockade of the TGF-beta1-initiated EMT. Incubation of human kidney epithelial cells HKC with HGF only marginally affected the expression of TGF-beta1 and its type I and type II receptors, suggesting that disruption of TGF-beta1 signaling likely plays a critical role in mediating HGF inhibition of TGF-beta1 action. However, HGF neither affected TGF-beta1-induced Smad-2 phosphorylation and its subsequent nuclear translocation nor influenced the expression of inhibitory Smad-6 and -7 in tubular epithelial cells. HGF specifically induced the expression of Smad transcriptional co-repressor SnoN but not Ski and TG-interacting factor at both mRNA and protein levels in HKC cells. SnoN physically interacted with activated Smad-2 by forming transcriptionally inactive complex and overrode the profibrotic action of TGF-beta1. In vivo, HGF did not affect Smad-2 activation and its nuclear accumulation in tubular epithelium, but it restored SnoN protein abundance in the fibrotic kidney in obstructive nephropathy. Hence, HGF blocks EMT by antagonizing TGF-beta1's action via upregulating Smad transcriptional co-repressor SnoN expression. These findings not only identify a novel mode of interaction between the signals activated by HGF receptor tyrosine kinase and TGF-beta receptor serine/threonine kinases but also illustrate the feasibility of confining Smad activity as an effective strategy for blocking renal fibrosis.
Chen, Li; Zhang, Feng; Kong, Desong; Zhu, Xiaojing; Chen, Wenxing; Wang, Aiyun; Zheng, Shizhong
2013-10-25
Herbal hepatotoxicity has been increasingly reported in clinical context, but the underlying mechanisms are poorly understood. Saikosaponin D (SSD) is a major component of saikosaponins isolated from Bupleurum falactum, a herb that has been linked to hepatotoxicity. Our current study was to examine the toxic effect of SSD on human hepatocyte LO2 cells and explore the possible mechanism. The results demonstrated that SSD reduced cell viability and led to dramatic morphological alterations in LO2 cells. Hoechst staining and flow cytometry analyses showed that SSD stimulated hepatocyte apoptosis. SSD-treated cells exhibited apparent nuclear condensation and fragmentation, and the apoptotic cells were increased by SSD dose-dependently. Subsequent experiments showed that SSD decreased mitochondrial membrane potential and downregulated Bcl-2 but upregulated Bax. Moreover, caspase-9 and caspase-3 were activated in SSD-treated LO2 cells. These data consistently indicated that SSD stimulated mitochondrial apoptosis in hepatocytes. Mechanistic investigations showed that SSD disrupted p38 signaling and that p38 specific inhibitor SB203580 mimicked the pro-apoptotic effect of SSD. In addition, platelet-derived growth factor-β receptor (PDGF-βR) blocker imatinib reduced p38 phosphorylation and also mimicked the pro-apoptotic effect of SSD in LO2 cells. These data collectively indicated that SSD induced apoptosis by interrupting PDGF-βR/p38 pathway in LO2 hepatocytes. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Alterations of Growth Factors in Autism and Attention-Deficit/Hyperactivity Disorder
Galvez-Contreras, Alma Y.; Campos-Ordonez, Tania; Gonzalez-Castaneda, Rocio E.; Gonzalez-Perez, Oscar
2017-01-01
Growth factors (GFs) are cytokines that regulate the neural development. Recent evidence indicates that alterations in the expression level of GFs during embryogenesis are linked to the pathophysiology and clinical manifestations of attention-deficit/hyperactivity disorder (ADHD) and autism spectrum disorders (ASD). In this concise review, we summarize the current evidence that supports the role of brain-derived neurotrophic factor, insulin-like growth factor 2, hepatocyte growth factor (HGF), glial-derived neurotrophic factor, nerve growth factor, neurotrophins 3 and 4, and epidermal growth factor in the pathogenesis of ADHD and ASD. We also highlight the potential use of these GFs as clinical markers for diagnosis and prognosis of these neurodevelopmental disorders. PMID:28751869
Badie, B; Schartner, J; Klaver, J; Vorpahl, J
1999-05-01
Considered as immune effector cells of the central nervous system, microglia represent a major component of the inflammatory cells found in malignant gliomas. Although their role in brain tumor biology is unclear, accumulation of microglia in malignant brain tumors may be mediated through active secretion of cytokines by glioma cells. Because hepatocyte growth factor/scatter factor (HGF/SF) has been shown to modulate glioma motility through an autocrine mechanism, and because microglia have been reported to express the HGF/SF receptor Met, we hypothesized that microglia recruitment by gliomas may also occur through the secretion of HGF/SF. The effect of glioma cells in augmenting BV-2 murine microglia motility was studied by using an in vitro Boyden chamber migration assay. To determine the chemokines involved in microglia migration, neutralizing monoclonal antibodies against monocyte chemotactic protein-1 and HGF/SF were tested. Immunoblotting was used to check for the expression of HGF/SF by glioma cells, and the expression of Met by BV-2 cells was examined by flow cytometry. BV-2 migration was noted within 7 hours of incubation with both human (U251 MG and U373 MG) and murine (GL261) glioma cell lines. This migration corresponded to HGF/SF secretion by glioma cells and was completely inhibited by neutralizing monoclonal antibody against HGF/SF, but not monocyte chemotactic protein-1. Exposure of BV-2 cells to recombinant HGF/SF, but not monocyte chemotactic protein-1, resulted in their migration and down-regulation of Met in a dose-dependent fashion. HGF/SF, which plays a role in glioma motility and mitogenesis, may also act as a chemokine for microglia and may be responsible for the microglia infiltration in malignant gliomas. This active recruitment of microglia may play an important role in glioma biology.
[The expression of serum hepatocyte growth factor in OSAHS].
Zhou, S L; Meng, B; Ding, J H
2017-05-05
Objective: To investigate the clinical significance of detecting peripheral blood hepatocyte growth factor(HGF) in OSAHS patients. Method: Ninety-six cases of OSAHS patients in our hospital were selected as OSAHS group,and were divided into 3 subgroups according to the PSG results:mild,medium and severe. Each group included 32 cases,Thirty-five cases of healthy persons were selected as control group. ELISA method was utilized to detect the HGF level of peripheral blood. HGF concentration was measured in 32 patients with severe OSAHS after 3 months of comprehensive treatment. The relationship between serum HGF and sleep respiration events was further analyzed. Result: The HGF concentration of peripheral blood increased with the severity of OSAHS.The serum levels of HGF in the control,mild,medium and severe group were(487.75±46.74)pg/ml,(519.44±50.77)pg/ml,(753.52±58.91) pg/ml and(829.49±61.74)pg/ml,respectively. There were significant differences among groups( F =117.733, P <0.01). HGF concentration in peripheral blood of OSAHS patients was unrelated to sex,age,and BMI( P >0.05),and positively correlated with AHI,negatively correlated with LSaO₂( P <0.01). After comprehensive treatment,the serum HGF concentration and AHI in severe OSAHS group were significantly decreased,while LSaO₂ was significantly increased. Conclusion: The level of HGF was increased in OSAHS patients and was positively correlated with the severity of OSAHS. Determining the level of HGF in peripheral blood is important for evaluating the severity of OSAHS and the degree of vascular endothelial dysfunction,and assessing the risk of cardiovascular disease. Copyright© by the Editorial Department of Journal of Clinical Otorhinolaryngology Head and Neck Surgery.
Shi, Xiao-Lei; Gu, Jin-Yang; Zhang, Yue; Han, Bing; Xiao, Jiang-Qiang; Yuan, Xian-Wen; Zhang, Ning; Ding, Yi-Tao
2011-01-01
AIM: To investigate whether the function of hepatocytes co-cultured with bone marrow mesenchymal stem cells (MSCs) could be maintained in serum from acute-on-chronic liver failure (ACLF) patients. METHODS: Hepatocyte supportive functions and cytotoxicity of sera from 18 patients with viral hepatitis B-induced ACLF and 18 healthy volunteers were evaluated for porcine hepatocytes co-cultured with MSCs and hepatocyte mono-layered culture, respectively. Chemokine profile was also examined for the normal serum and liver failure serum. RESULTS: Hepatocyte growth factor (HGF) and Tumor necrosis factor; tumor necrosis factor (TNF)-α were remarkably elevated in response to ACLF while epidermal growth factor (EGF) and VEGF levels were significantly decreased. Liver failure serum samples induced a higher detachment rate, lower viability and decreased liver support functions in the homo-hepatocyte culture. Hepatocytes co-cultured with MSCs could tolerate the cytotoxicity of the serum from ACLF patients and had similar liver support functions compared with the hepatocytes cultured with healthy human serum in vitro. In addition, co-cultured hepatocytes maintained a proliferative capability despite of the insult from liver failure serum. CONCLUSION: ACLF serum does not impair the cell morphology, viability, proliferation and overall metabolic capacities of hepatocyte co-cultured with MSCs in vitro. PMID:21633639
Larson, Nicholas B.; Berardi, Cecilia; Decker, Paul A.; Wassel, Christina L.; Kirsch, Phillip S.; Pankow, James S.; Sale, Michele M.; de Andrade, Mariza; Sicotte, Hugues; Tang, Weihong; Hanson, Naomi Q.; Tsai, Michael Y.; Taylor, Kent D.; Bielinski, Suzette J.
2015-01-01
Summary Hepatocyte growth factor (HGF) is a mesenchyme-derived pleiotropic factor that regulates cell growth, motility, mitogenesis, and morphogenesis in a variety of cells, and increased serum levels of HGF have been linked to a number of clinical and subclinical cardiovascular disease phenotypes. However, little is currently known regarding what genetic factors influence HGF levels, despite evidence of substantial genetic contributions to HGF variation. Based upon ethnicity-stratified single-variant association analysis and trans-ethnic meta-analysis of 6201 participants of the Multi-Ethnic Study of Atherosclerosis (MESA), we discovered five statistically significant common and low-frequency variants: HGF missense polymorphism rs5745687 (p.E299K) as well as four variants (rs16844364, rs4690098, rs114303452, rs3748034) within or in proximity to HGFAC. We also identified two significant ethnicity-specific gene-level associations (A1BG in African Americans; FASN in Chinese Americans) based upon low-frequency/rare variants, while meta-analysis of gene-level results identified a significant association for HGFAC. However, identified single-variant associations explained modest proportions of the total trait variation and were not significantly associated with coronary artery calcium or coronary heart disease. Our findings indicate genetic factors influencing circulating HGF levels may be complex and ethnically diverse. PMID:25998175
Wang, Yue; Weil, Brent R.; Herrmann, Jeremy L.; Abarbanell, Aaron M.; Tan, Jiangning; Markel, Troy A.; Kelly, Megan L.
2009-01-01
Human bone marrow mesenchymal stem cells (MSCs) are a potent source of growth factors, which are partly responsible for their beneficial paracrine effects. We reported previously that transforming growth factor-α (TGF-α), a putative mediator of wound healing and the injury response, increases the release of vascular endothelial growth factor (VEGF), augments tumor necrosis factor-α (TNF-α)-stimulated VEGF production, and activates mitogen-activated protein kinases and phosphatidylinositol 3-kinase (PI-3K) pathway in human MSCs. The experiments described in this report indicate that TGF-α increases MSC-derived hepatocyte growth factor (HGF) production. TGF-α-stimulated HGF production was abolished by inhibition of MEK, p38, PI-3K, or by small interfering RNA (siRNA) targeting TNF receptor 2 (TNFR2), but was not attenuated by siRNA targeting TNF receptor 1 (TNFR1). Ablation of TNFR1 significantly increased basal and stimulated HGF. A potent synergy between TGF-α and TNF-α was noted in MSC HGF production. This synergistic effect was abolished by MEK, P38, PI-3K inhibition, or by ablation of both TNF receptors using siRNA. We conclude that 1) novel cross talk occurs between tumor necrosis factor receptor and TGF-α/epidermal growth factor receptor in stimulating MSC HGF production; 2) this cross talk is mediated, at least partially, via activation of MEK, p38, and PI-3K; 3) TGF-α stimulates MSCs to produce HGF by MEK, p38, PI-3K, and TNFR2-dependent mechanisms; and 4) TNFR1 acts to decrease basal TGF-α and TNF-α-stimulated HGF. PMID:19692652
Lan, Hai-Nan; Jiang, Hai-Long; Li, Wei; Wu, Tian-Cheng; Hong, Pan; Li, Yu Meng; Zhang, Hui; Cui, Huan-Zhong; Zheng, Xin
2015-01-01
B-32 is one of a panel of monoclonal anti-idiotypic antibodies to growth hormone (GH) that we developed. To characterize and identify its potential role as a novel growth hormone receptor (GHR) agonist, we determined that B-32 behaved as a typical Ab2β based on a series of enzyme-linked immunosorbent assay assays. The results of fluorescence-activated cell sorting, indirect immunofluorescence and competitive receptor binding assays demonstrated that B-32 specifically binds to the GHR expressed on target cells. Next, we examined the resulting signal transduction pathways triggered by this antibody in primary porcine hepatocytes. We found that B-32 can activate the GHR and Janus kinase (2)/signal transducers and activators of transcription (JAK2/STAT5) signalling pathways. The phosphorylation kinetics of JAK2/STAT5 induced by either GH or B-32 were analysed in dose-response and time course experiments. In addition, B32 could also stimulate porcine hepatocytes to secrete insulin-like growth factors-1. Our work indicates that a monoclonal anti-idiotypic antibody to GH (B-32) can serve as a GHR agonist or GH mimic and has application potential in domestic animal (pig) production. PMID:25656185
Tasnim, Farah; Phan, Derek; Toh, Yi-Chin; Yu, Hanry
2015-11-01
Significant efforts have been invested into the differentiation of stem cells into functional hepatocyte-like cells that can be used for cell therapy, disease modeling and drug screening. Most of these efforts have been concentrated on the use of growth factors to recapitulate developmental signals under in vitro conditions. Using small molecules instead of growth factors would provide an attractive alternative since small molecules are cell-permeable and cheaper than growth factors. We have developed a protocol for the differentiation of human embryonic stem cells into hepatocyte-like cells using a predominantly small molecule-based approach (SM-Hep). This 3 step differentiation strategy involves the use of optimized concentrations of LY294002 and bromo-indirubin-3'-oxime (BIO) for the generation of definitive endoderm; sodium butyrate and dimethyl sulfoxide (DMSO) for the generation of hepatoblasts and SB431542 for differentiation into hepatocyte-like cells. Activin A is the only growth factor required in this protocol. Our results showed that SM-Hep were morphologically and functionally similar or better compared to the hepatocytes derived from the growth-factor induced differentiation (GF-Hep) in terms of expression of hepatic markers, urea and albumin production and cytochrome P450 (CYP1A2 and CYP3A4) activities. Cell viability assays following treatment with paradigm hepatotoxicants Acetaminophen, Chlorpromazine, Diclofenac, Digoxin, Quinidine and Troglitazone showed that their sensitivity to these drugs was similar to human primary hepatocytes (PHHs). Using SM-Hep would result in 67% and 81% cost reduction compared to GF-Hep and PHHs respectively. Therefore, SM-Hep can serve as a robust and cost effective replacement for PHHs for drug screening and development. Copyright © 2015 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Tongxin; Li, Qi; Sun, Quanquan
2014-06-20
Highlights: • We demonstrated that irradiation induced MET overexpression and activation. • The aberrant MET signal mediated by HGF induced proliferation and radioresistance of NPC cells. • MET inhibitor PHA-665752 effectively suppressed HGF induced cell proliferation and radioresistance in NPC cells. • PHA-665752 suppressed the three downstream pathway of HGF/MET signal in a dose-dependent manner. - Abstract: Although ionizing radiation (IR) has provided considerable improvements in nasopharyngeal carcinoma (NPC), in subsets of patients, radioresistance is still a major problem in the treatment. In this study, we demonstrated that irradiation induced MET overexpression and activation, and the aberrant MET signal mediatedmore » by hepatocyte growth factor (HGF) induced radioresistance. We also found that MET inhibitor PHA-665752 effectively suppressed HGF induced cell proliferation and radioresistance in NPC cells. Further investigation indicated that PHA-665752 suppressed the phosphorylation of the Akt, ERK1/2, and STAT3 proteins in a dose-dependent manner. Our data indicated that the combination of IR with a MET inhibitor, such as PHA-665752, might be a promising therapeutic strategy for NPC.« less
Lee, Eun Ju; Hwang, Injoo; Lee, Ji Yeon; Park, Jong Nam; Kim, Keun Cheon; Kim, Gi-Hwan; Kang, Chang-Mo; Kim, Irene; Lee, Seo-Yeon; Kim, Hyo-Soo
2018-03-07
Human embryonic stem cell-derived mesenchymal stem cells (hE-MSCs) have greater proliferative capacity than other human mesenchymal stem cells (hMSCs), suggesting that they may have wider applications in regenerative cellular therapy. In this study, to uncover the anti-senescence mechanism in hE-MSCs, we compared hE-MSCs with adult bone marrow (hBM-MSCs) and found that hepatocyte growth factor (HGF) was more abundantly expressed in hE-MSCs than in hBM-MSCs and that it induced the transcription of RAD51 and facilitated its SUMOylation at K70. RAD51 induction/modification by HGF not only increased telomere length but also increased mtDNA replication, leading to increased ATP generation. Moreover, HGF-treated hBM-MSCs showed significantly better therapeutic efficacy than naive hBM-MSCs. Together, the data suggest that the RAD51-mediated effects of HGF prevent hMSC senescence by promoting telomere lengthening and inducing mtDNA replication and function, which opens the prospect of developing novel therapies for liver disease. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Coleman, Kimberly D; Ghosh, Mimi; Crist, Sarah G; Wright, Jacqueline A; Rossoll, Richard M; Wira, Charles R; Fahey, John V
2012-01-01
Hepatocyte Growth Factor (HGF) secretion facilitates epithelial cell growth and development in the female reproductive tract (FRT) and may contribute to pathological conditions such as cancer and endometriosis. We hypothesized that estradiol and poly (I:C), a synthetic RNA mimic, may have a regulatory effect on HGF secretion by stromal fibroblasts from FRT tissues. Following hysterectomies, normal tissue from the uterus, endocervix, and ectocervix were dispersed into stromal cell fractions by enzymatic digestion and differential filtering. Stromal fibroblasts were cultured and treated with estradiol and/or poly (I:C), and conditioned media were analyzed for HGF via enzyme-linked immunosorbent assay. Treating uterine fibroblasts with estradiol or poly (I:C) significantly increased HGF secretion. When uterine fibroblasts were co-treated with estradiol and poly (I:C), the effect on HGF secretion was additive. In contrast, stromal fibroblasts from endo- and ecto-cervix were unresponsive to estradiol, but were stimulated to secrete HGF by poly (I:C). HGF secretion is uniquely regulated in the uterus, but not in ecto- and endo-cervix, by estradiol. Moreover, potential viral pathogens further induce HGF. These findings have potential applications in understanding both hormonal regulation of normal tissue as well as the role of HGF in tumorogenesis, endometriosis, and human immunodeficiency virus infection. © 2011 John Wiley & Sons A/S.
Xu, G G; Geng, Z; Zhou, X C; He, Y G; He, T T; Mei, J X; Yang, Y J; Liu, Y Q; Xu, C S
2015-05-29
In general, the phospholipase C (PLC) signaling pathway is involved in many physiological activities, including cell growth. However, little is known regarding how the PLC signaling pathway participates in regulating hepatocyte (HC) growth during liver regeneration (LR). To further explore the influence of the PLC signaling pathway on HCs at the cellular level, HCs of high purity and vitality were isolated using Percoll density-gradient centrifugation after partial hepatectomy. The genes of the PLC signaling pathway and target genes of transcription factors in the pathway were obtained by searching the pathways and transcription factor databases, and changes in gene expression of isolated HCs were examined using the Rat Genome 230 2.0 Microarray. The results suggested that various genes involved in the pathway (including 151 known genes and 39 homologous genes) and cell growth (including 262 known genes and 37 homologous genes) were associated with LR. Subsequently, the synergetic effect of these genes in LR was analyzed using a mathematical model (Et) according to their expression profiles. The results showed that the Et values of G protein-coupled receptor/PLC, integrin/PLC, and growth factor receptor/PLC branches of the PLC pathway were all significantly strengthened during the progression and termination phases of LR. The synergetic effect of target genes, in parallel with target gene-related cell growth, was also enhanced during whole rat LR, suggesting the potential positive effect of PLC on HC growth. The present data indicate that the PLC signaling pathway may promote HC growth through 3 mechanisms during rat LR after partial hepatectomy.
Dong, Ruizeng; Guo, Jianmin; Zhang, Zewei; Zhou, Yimin; Hua, Yonghong
2018-03-18
The aim of this study was to identify the anti-cancer mechanism of Polyphyllin I (PPI) on gastric cancer cells via its activity on cancer-associated fibroblasts (CAFs). We cultured purified gastric CAFs obtained from fresh human gastric cancer tissue and examined the effect of Polyphyllin I on CAF proliferation using a colorimetric viability assay. In addition, we established a nude mouse xenograft model to examine the effect of Polyphyllin I administration on tumorigenesis. Using Western analysis, we quantified protein expression of the CAF-derived cytokines fibroblast activation protein alpha (FAP), secreted protein acidic and cysteine rich (SPARC), stromal cell-derived factor 1 (SDF-1), hepatocyte growth factor tenascin-C (TNC), and hepatocyte growth factor (HGF) in both in vitro and in vivo models. We found that Polyphyllin I inhibits the proliferation of CAFs in a concentration-dependent manner. Following treatment with 2 μg/ml PPI for 24 h in vitro, the expression of FAP, SDF-1 and HGF protein in CAFs was significantly lower than that in the control group, but there was no significant difference in SPARC and TNC protein expression between the two groups. In the nude mouse xenograft model, the tumor inhibition rate was 45.5% when PPI was administered early and 29.4% with administration in the third week. The expression of FAP and HGF in the xenografts was significantly decreased, while the expression of SPARC, SDF-1, and TNC was largely unaltered. Altogether, these data suggest that Polyphyllin I can inhibit the proliferation of gastric cancer cells by downregulating the expression of FAP and HGF in CAFs in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.
Huard, Jérémy; Mueller, Stephanie; Gilles, Ernst D; Klingmüller, Ursula; Klamt, Steffen
2012-01-01
During liver regeneration, quiescent hepatocytes re-enter the cell cycle to proliferate and compensate for lost tissue. Multiple signals including hepatocyte growth factor, epidermal growth factor, tumor necrosis factor α, interleukin-6, insulin and transforming growth factor β orchestrate these responses and are integrated during the G1 phase of the cell cycle. To investigate how these inputs influence DNA synthesis as a measure for proliferation, we established a large-scale integrated logical model connecting multiple signaling pathways and the cell cycle. We constructed our model based upon established literature knowledge, and successively improved and validated its structure using hepatocyte-specific literature as well as experimental DNA synthesis data. Model analyses showed that activation of the mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways was sufficient and necessary for triggering DNA synthesis. In addition, we identified key species in these pathways that mediate DNA replication. Our model predicted oncogenic mutations that were compared with the COSMIC database, and proposed intervention targets to block hepatocyte growth factor-induced DNA synthesis, which we validated experimentally. Our integrative approach demonstrates that, despite the complexity and size of the underlying interlaced network, logical modeling enables an integrative understanding of signaling-controlled proliferation at the cellular level, and thus can provide intervention strategies for distinct perturbation scenarios at various regulatory levels. PMID:22443451
Bukong, Terence N; Lo, Tracie; Szabo, Gyongyi; Dolganiuc, Angela
2012-05-01
Liver diseases are common in the United States and often require liver transplantation; however, donated organs are limited and thus alternative sources for liver cells are in high demand. Embryonic stem cells (ESC) can provide a continuous and readily available source of liver cells. ESC differentiation to liver cells is yet to be fully understood and comprehensive differentiation protocols are yet to be defined. Here, we aimed to achieve human (h)ESC differentiation into mature hepatocytes using defined recombinant differentiation factors and metabolites. Embryonic stem cell H1 line was sub-cultured on feeder layer. We induced hESCs into endodermal differentiation succeeded by early/late hepatic specification and finally into hepatocyte maturation using step combinations of Activin A and fibroblast growth factor (FGF)-2 for 7 days; followed by FGF-4 and bone morphogenic protein 2 (BMP2) for 7 days, succeeded by FGF-10 + hepatocyte growth factor 4 + epidermal growth factor for 14 days. Specific inhibitors/stimulators were added sequentially throughout differentiation. Cells were analysed by PCR, flow cytometry, microscopy or functional assays. Our hESC differentiation protocol resulted in viable cells with hepatocyte shape and morphology. We observed gradual changes in cell transcriptome, including up-regulation of differentiation-promoting GATA4, GATA6, POU5F1 and HNF4 transcription factors, steady levels of stemness-promoting SOX-2 and low levels of Nanog, as defined by PCR. The hESC-derived hepatocytes expressed alpha-antitrypsin, CD81, cytokeratin 8 and low density lipoprotein (LDL) receptor. The levels of alpha-fetoprotein and proliferation marker Ki-67 in hESC-derived hepatocytes remained elevated. Unlike stem cells, the hESC-derived hepatocytes performed LDL uptake, produced albumin and alanine aminotransferase and had functional alcohol dehydrogenase. We report a novel protocol for hESC differentiation into morphological and functional yet immature
Hansel, Marc C; Gramignoli, Roberto; Blake, William; Davila, Julio; Skvorak, Kristen; Dorko, Kenneth; Tahan, Veysel; Lee, Brian R; Tafaleng, Edgar; Guzman-Lepe, Jorge; Soto-Gutierrez, Alejandro; Fox, Ira J; Strom, Stephen C
2014-01-01
Hepatocyte transplantation has been used to treat liver disease. The availability of cells for these procedures is quite limited. Human embryonic stem cells (hESCs) and induced pluripotent stem cells (hiPSCs) may be a useful source of hepatocytes for basic research and transplantation if efficient and effective differentiation protocols were developed and problems with tumorigenicity could be overcome. Recent evidence suggests that the cell of origin may affect hiPSC differentiation. Thus, hiPSCs generated from hepatocytes may differentiate back to hepatocytes more efficiently than hiPSCs from other cell types. We examined the efficiency of reprogramming adult and fetal human hepatocytes. The present studies report the generation of 40 hiPSC lines from primary human hepatocytes under feeder-free conditions. Of these, 37 hiPSC lines were generated from fetal hepatocytes, 2 hiPSC lines from normal hepatocytes, and 1 hiPSC line from hepatocytes of a patient with Crigler-Najjar syndrome, type 1. All lines were confirmed reprogrammed and expressed markers of pluripotency by gene expression, flow cytometry, immunocytochemistry, and teratoma formation. Fetal hepatocytes were reprogrammed at a frequency over 50-fold higher than adult hepatocytes. Adult hepatocytes were only reprogrammed with six factors, while fetal hepatocytes could be reprogrammed with three (OCT4, SOX2, NANOG) or four factors (OCT4, SOX2, NANOG, LIN28 or OCT4, SOX2, KLF4, C-MYC). The increased reprogramming efficiency of fetal cells was not due to increased transduction efficiency or vector toxicity. These studies confirm that hiPSCs can be generated from adult and fetal hepatocytes including those with genetic diseases. Fetal hepatocytes reprogram much more efficiently than adult hepatocytes, although both could serve as useful sources of hiPSC-derived hepatocytes for basic research or transplantation.
Zhu, Zhengbao; Xu, Tan; Guo, Daoxia; Huangfu, Xinfeng; Zhong, Chongke; Yang, Jingyuan; Wang, Aili; Chen, Chung-Shiuan; Peng, Yanbo; Xu, Tian; Wang, Jinchao; Sun, Yingxian; Peng, Hao; Li, Qunwei; Ju, Zhong; Geng, Deqin; Chen, Jing; Zhang, Yonghong; He, Jiang
2018-02-01
Serum hepatocyte growth factor (HGF) is positively associated with poor prognosis of heart failure and myocardial infarction, and it can also predict the risk of ischemic stroke in population. The goal of this study was to investigate the association between serum HGF and prognosis of ischemic stroke. A total of 3027 acute ischemic stroke patients were included in this post hoc analysis of the CATIS (China Antihypertensive Trial in Acute Ischemic Stroke). The primary outcome was composite outcome of death or major disability (modified Rankin Scale score ≥3) within 3 months. After multivariate adjustment, elevated HGF levels were associated with an increased risk of primary outcome (odds ratio, 1.50; 95% confidence interval, 1.10-2.03; P trend =0.015) when 2 extreme quartiles were compared. Each SD increase of log-transformed HGF was associated with 14% (95% confidence interval, 2%-27%) increased risk of primary outcome. Adding HGF quartiles to a model containing conventional risk factors improved the predictive power for primary outcome (net reclassification improvement: 17.50%, P <0.001; integrated discrimination index: 0.23%, P =0.022). The association between serum HGF and primary outcome could be modified by heparin pre-treatment ( P interaction =0.001), and a positive linear dose-response relationship between HGF and primary outcome was observed in patients without heparin pre-treatment ( P linearity <0.001) but not in those with heparin pre-treatment. Serum HGF levels were higher in the more severe stroke at baseline, and elevated HGF levels were probably associated with 3-month poor prognosis independently of stroke severity among ischemic stroke patients, especially in those without heparin pre-treatment. Further studies from other samples of ischemic stroke patients are needed to validate our findings. © 2018 American Heart Association, Inc.
Zhao, Qinjun; Ren, Hongying; Li, Xiyuan; Chen, Zhong; Zhang, Xiangyu; Gong, Wei; Liu, Yongjun; Pang, Tianxiang; Han, Zhong Chao
2009-01-01
Mesenchymal stromal cells (MSC) isolated from several human tissues have been known to differentiate into the hepatic lineage in vitro, but the immunogenicity of the differentiated hepatocyte-like cells (DHC) has not been reported. Umbilical cord (UC) MSC are thought to be an attractive cell source for cell therapy because of their young age and low infection rate compared with adult tissue MSC. Hepatic differentiation of UC-MSC was induced with a 2-step protocol. The expressions of hepatic markers were detected by RT-PCR and immunofluorescence staining. Albumin production and urea secretion were measured by ELISA and colorimetric assay respectively. The immunosuppressive properties of DHC was detected by mixed lymphocyte culture. After incubation with specific growth factors, including hepatocyte growth factor (HGF) and basic fibroblast growth factor (bFGF), UC MSC exhibited a high hepatic differentiation ability in an adherent culture condition. The differentiated UC MSC showed hepatocyte-like morphology and expressed several liver-specific markers at gene and protein levels. Furthermore, the DHC exhibited hepatocyte-specific functions, including albumin secretion, low-density lipoprotein uptake and urea production. More importantly, DHC did not express major histocompatibility complex (MHC) II antigen and were not able to induce lymphocyte proliferation in mixed lymphocyte culture, as undifferentiated UC MSC did. Our results indicate that UC MSC are able to differentiate into functional hepatocyte-like cells that still retain their low immunogenicity in vitro. More importantly, DHC incorporated into the parenchyma of liver when transplanted into mice with CCl(4)-induced liver injury. Therefore, DHC may be an ideal source for cell therapy of liver diseases.
Sakugawa, Chihiro; Haruyama, Yukihiro; Tanaka, Hiroyuki; Fukushima, Tsuyoshi; Kawaguchi, Makiko; Kataoka, Hiroaki
2017-12-04
Hepatocyte growth factor activator inhibitor type 1 (HAI-1) is a membrane-bound serine protease inhibitor that is expressed on the surface of epithelial cells. Evidence has suggested that decreased cell surface HAI-1 in carcinoma cells results in enhanced invasiveness. However, little is known regarding the expression of HAI-1 in pancreatic ductal adenocarcinoma (PDAC). This study aimed to analyze HAI-1 expression in PDAC and its impact on patient prognosis. HAI-1 immunohistochemistry was performed on samples from 67 PDAC cases. HAI-1 expression was increased in intraepithelial neoplasia compared to the adjacent non-neoplastic ductal epithelium. Of the 67 samples tested, 58% (39/67) of PDAC cases showed diffuse (> 75%) immunoreactivity in PDAC cells. The remaining cases showed reduced HAI-1 immunoreactivity in a substantial number of cancer cells. Although there was no correlation between HAI-1 status and tumor size, histologic grade or lymph node metastasis, diffuse HAI-1 positive cases showed longer disease-free survival (DFS; p = 0.006, log-rank test). In conclusion, HAI-1 is upregulated in pancreatic intraepithelial neoplasia and broadly expressed in PDAC cells. However, PDAC cases having areas of reduced HAI-1 immunoreactivity may show shorter DFS.
Cao, Xiao-Pei; Han, Dong-Mei; Zhao, Li; Guo, Zi-Kuan; Xiao, Feng-Jun; Zhang, Yi-Kun; Zhang, Xiao-Yan; Wang, Li-Sheng; Wang, Heng-Xiang; Wang, Hua
2016-03-01
Specific and effective therapy for prevention or reversal of bronchiolitis obliterans (BO) is lacking. In this study, we evaluated the therapeutic effect of hepatocyte growth factor (HGF) gene modified mesenchymal stromal cells (MSCs) on BO. A mouse model of experimental BO was established by subcutaneously transplanting the tracheas from C57BL/6 mice into Balb/C recipients, which were then administered saline, Ad-HGF-modified human umbilical cord-MSCs (MSCs-HGF) or Ad-Null-modified MSCs (MSCs-Null). The therapeutic effects of MSCs-Null and MSCs-HGF were evaluated by using fluorescence-activated cell sorting (FACS) for lymphocyte immunophenotype of spleen, enzyme-linked immunosorbent assay (ELISA) and real-time polymerase chain reaction (rt-PCR) for cytokine expression, and histopathological analysis for the transplanted trachea. The histopathologic recovery of allograft tracheas was improved significantly after MSCs-Null and MSCs-HGF treatment and the beneficial effects were particularly observed in MSCs-HGF-treated mice. Furthermore, the allo-transplantation-induced immunophenotype disorders of the spleen, including regulatory T (Treg), T helper (Th)1, Th2 and Th17, were attenuated in both cell-treated groups. MSCs-HGF treatment reduced expression and secretion of inflammation cytokines interferon-gamma (IFN-γ), and increased expression of anti-inflammatory cytokine interleukin (IL)-4 and IL-10. It also decreased the expression level of the profibrosis factor transforming growth factor (TGF)-β. Treatment of BO with HGF gene modified MSCs results in reduction of local inflammation and promotion in recovery of allograft trachea histopathology. These findings might provide an effective therapeutic strategy for BO. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dragomir, Ana-Cristina; Laskin, Jeffrey D.; Laskin, Debra L., E-mail: laskin@eohsi.rutgers.edu
2011-06-15
Toxic doses of acetaminophen (AA) cause hepatocellular necrosis. Evidence suggests that activated macrophages contribute to the pathogenic process; however, the factors that activate these cells are unknown. In these studies, we assessed the role of mediators released from AA-injured hepatocytes in macrophage activation. Treatment of macrophages with conditioned medium (CM) collected 24 hr after treatment of mouse hepatocytes with 5 mM AA (CM-AA) resulted in increased production of reactive oxygen species (ROS). Macrophage expression of heme oxygenase-1 (HO-1) and catalase mRNA was also upregulated by CM-AA, as well as cyclooxygenase (COX)-2 and 12/15-lipoxygenase (LOX). CM-AA also upregulated expression of themore » proinflammatory chemokines, MIP-1{alpha} and MIP-2. The effects of CM-AA on expression of COX-2, MIP-1{alpha} and MIP-2 were inhibited by blockade of p44/42 MAP kinase, suggesting a biochemical mechanism mediating macrophage activation. Hepatocytes injured by AA were found to release HMGB1, a potent macrophage activator. This was inhibited by pretreatment of hepatocytes with ethyl pyruvate (EP), which blocks HMGB1 release. EP also blocked CM-AA induced ROS production and antioxidant expression, and reduced expression of COX-2, but not MIP-1{alpha} or MIP-2. These findings suggest that HMGB1 released by AA-injured hepatocytes contributes to macrophage activation. This is supported by our observation that expression of the HMGB1 receptor RAGE is upregulated in macrophages in response to CM-AA. These data indicate that AA-injured hepatocytes contribute to the inflammatory environment in the liver through the release of mediators such as HMGB1. Blocking HMGB1/RAGE may be a useful approach to limiting classical macrophage activation and AA-induced hepatotoxicity. - Research Highlights: > These studies analyze macrophage activation by mediators released from acetaminophen-damaged hepatocytes. > Factors released from acetaminophen-injured hepatocytes induce
Brandt, Amanda M; Kania, Joanna M; Gonzalez, Madison L; Johnson, Sally E
2018-06-16
Hepatocyte growth factor (HGF) signals mediate mouse skeletal muscle stem cell, or satellite cell (SC), reentry into the cell cycle and myoblast proliferation. Because the athletic horse experiences exercise-induced muscle damage, the objective of the experiment was to determine the effect of HGF on equine SC (eqSC) bioactivity. Fresh isolates of adult eqSC were incubated with increasing concentrations of HGF and the initial time to DNA synthesis was measured. Media supplementation with HGF did not shorten (P > 0.05) the duration of G0/G1 transition suggesting the growth factor does not affect activation. Treatment with 25 ng/mL HGF increased (P < 0.05) eqSC proliferation that was coincident with phosphorylation of extracellular signal-regulated kinase (ERK)1/2 and AKT serine/threonine kinase 1 (AKT1). Chemical inhibition of the upstream effectors of ERK1/2 or AKT1 elicited no effect (P > 0.05) on HGF-mediated EdU incorporation. By contrast, treatment of eqSC with 2 µm Gö6983, a pan-protein kinase C (PKC) inhibitor, blocked (P < 0.05) HGF-initiated mitotic activity. Gene expression analysis revealed that eqSC express PKCα, -δ and -ε isoforms. Knockdown of PKCδ with a small interfering RNA (siRNA) prevented (P > 0.05) HGF-mediated EdU incorporation. The siPKCδ was specific to the kinase and did not affect (P > 0.05) expression of either PKCα or PKCε. Treatment of confluent eqSCs with 25 ng/mL HGF suppressed (P < 0.05) nuclear myogenin expression during the early stages of differentiation. These results demonstrate that HGF may not affect activation but can act as a mitogen and modest suppressor of differentiation.
Strategies for immortalization of primary hepatocytes
Eva, Ramboer; Bram, De Craene; Joery, De Kock; Tamara, Vanhaecke; Geert, Berx; Vera, Rogiers; Mathieu, Vinken
2014-01-01
The liver has the unique capacity to regenerate in response to a damaging event. Liver regeneration is hereby largely driven by hepatocyte proliferation, which in turn relies on cell cycling. The hepatocyte cell cycle is a complex process that is tightly regulated by several well-established mechanisms. In vitro, isolated hepatocytes do not longer retain this proliferative capacity. However, in vitro cell growth can be boosted by immortalization of hepatocytes. Well-defined immortalization genes can be artificially overexpressed in hepatocytes or the cells can be conditionally immortalized leading to controlled cell proliferation. This paper discusses the current immortalization techniques and provides a state-of-the-art overview of the actually available immortalized hepatocyte-derived cell lines and their applications. PMID:24911463
Li, Fan; Liu, Yang; Cai, Yingyu; Li, Xin; Bai, Min; Sun, Ting; Du, Lianfang
2018-05-01
This study investigated the impact of ultrasound (US) irradiation on the hepatic differentiation of human bone marrow mesenchymal stem cells (hBMSCs) induced by hepatocyte growth factor (HGF) and the possible mechanisms. We treated hBMSCs, using HGF with and without US irradiation. Cell viability and stem cell surface markers were analyzed. Hepatocyte-like cell markers and functional markers including α-fetoprotein (αFP/AFP), cytokeratin 18 (CK18), albumin (ALB) and glycogen content were analyzed at the time point of day 1, 3 and 5 after treatment. The involvement of Wnt/β-catenin signaling pathway was evaluated as well. The results showed that the US treatment at 1.0 W/cm 2 or 1.5 W/cm 2 for 30 s or 60 s conditions yielded favorable cell viability and engendered stem cell differentiation. At day 5, the expressions of AFP, CK18, ALB and the glycogen content were significantly elevated in the US-treated group at both messenger ribonucleic acid and protein levels (all p <0.05), in comparison with HGF and control groups. Among all the US treated groups, the expression levels of specific hepatic markers in the (1.5 W/cm 2 for 60 s) group were the highest. Furthermore, Wnt1, β-Catenin, c-Myc and Cyclin D1 were significantly increased after US irradiation (all p <0.05), and the enhancements of c-Myc and Cyclin D1 could be obviously impaired by the inhibitor ICG-001 (p <0.05, p <0.05), in accordance with decreased ALB and CK18 expression and glycogen content (all p <0.05). In conclusion, US irradiation was able to promote the hBMSCs' differentiation mediated by HGF in vitro safely, easily and controllably. The activation of Wnt/β-catenin signaling pathway was involved in this process. US irradiation could serve as a potentially beneficial tool for the research and application of stem cell differentiation. Copyright © 2018 World Federation for Ultrasound in Medicine and Biology. Published by Elsevier Inc. All rights reserved.
Risal, Prabodh; Cho, Baik Hwan; Sylvester, Karl G; Kim, Jae-Chun; Kim, Hyoung Tae; Jeong, Yeon Jun
2011-09-01
Hepatocytes are an important research tool used for numerous applications. However, a short life span and a limited capacity to replicate in vitro limit the usefulness of primary hepatocyte cultures. We have hypothesized that in vivo priming of hepatocyte could make them more susceptible to growth factors in the medium for continuous proliferation in vitro. Here, a novel approach used to establish hepatocyte cell lines that included hepatocyte priming in vivo prior to culture with a 3,5-diethoxycarbonyl-1,4-dihydrocollidine diet was attempted. The cell line grew in a monolayer while maintaining a granular cytoplasm and a round nucleus. Electron microscopy displayed hepatocyte-like features including mitochondria, glycogen granules, and the presence of bile canaliculi. This cell line expressed many mature hepatocyte-specific genes including albumin, alpha1-antitrypsin, glucose 6-phosphatase, and tyrosine aminotransferase. Functional characteristic of hepatocytes like the ability to store glycogen, lipid, and synthesis of urea is well demonstrated by this cell line. These cells demonstrated anchorage dependent growth properties in soft agar and did not form tumors after transplantation into nude mice. This cell line can be sustained in culture for more than 100 passages (>1.5 years) without undergoing noticeable morphological changes or transformation. This novel method resulted in the establishment of an immortal, non-transformed hepatocyte cell line with functional characteristics that may aid research of cell metabolism, toxicology, and hepatocyte transplantation.
Small-Molecule-Directed Hepatocyte-Like Cell Differentiation of Human Pluripotent Stem Cells.
Mathapati, Santosh; Siller, Richard; Impellizzeri, Agata A R; Lycke, Max; Vegheim, Karianne; Almaas, Runar; Sullivan, Gareth J
2016-08-17
Hepatocyte-like cells (HLCs) generated in vitro from human pluripotent stem cells (hPSCs) provide an invaluable resource for basic research, regenerative medicine, drug screening, toxicology, and modeling of liver disease and development. This unit describes a small-molecule-driven protocol for in vitro differentiation of hPSCs into HLCs without the use of growth factors. hPSCs are coaxed through a developmentally relevant route via the primitive streak to definitive endoderm (DE) using the small molecule CHIR99021 (a Wnt agonist), replacing the conventional growth factors Wnt3A and activin A. The small-molecule-derived DE is then differentiated to hepatoblast-like cells in the presence of dimethyl sulfoxide. The resulting hepatoblasts are then differentiated to HLCs with N-hexanoic-Tyr, Ile-6 aminohexanoic amide (Dihexa, a hepatocyte growth factor agonist) and dexamethasone. The protocol provides an efficient and reproducible procedure for differentiation of hPSCs into HLCs utilizing small molecules. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.
Splicing factor SRSF3 is crucial for hepatocyte differentiation and metabolic function
Sen, Supriya; Jumaa, Hassan; Webster, Nicholas J.G.
2015-01-01
SR family RNA binding proteins regulate splicing of nascent RNAs in vitro but their physiological role in vivo is largely unexplored, as genetic deletion of many SR protein genes results in embryonic lethality. Here we show that SRSF3HKO mice carrying a hepatocyte-specific deletion of Srsf3 (homologous to human SRSF3/SRp20) have a disrupted hepatic architecture and show pre- and postnatal growth retardation. SRSF3HKO mice exhibit impaired hepatocyte maturation with alterations in glucose and lipid homeostasis characterized by reduced glycogen storage, fasting hypoglycemia, increased insulin sensitivity and reduced cholesterol synthesis. We identify various splicing alterations in the SRSF3HKO liver that explain the in vivo phenotype. In particular, loss of SRSF3 causes aberrant splicing of Hnf1α, Ern1, Hmgcs1, Dhcr7 and Scap genes, which are critical regulators of glucose and lipid metabolism. Our study provides the first evidence for a SRSF3-driven genetic programme required for morphological and functional differentiation of hepatocytes that may have relevance for human liver disease and metabolic dysregulation. PMID:23299886
Nagaike, Koki; Kawaguchi, Makiko; Takeda, Naoki; Fukushima, Tsuyoshi; Sawaguchi, Akira; Kohama, Kazuyo; Setoyama, Mitsuru; Kataoka, Hiroaki
2008-01-01
Hepatocyte growth factor activator inhibitor type 1 (HAI-1)/serine protease inhibitor, Kunitz type 1 (SPINT1) is a membrane-bound, serine proteinase inhibitor initially identified as an inhibitor of hepatocyte growth factor activator. It also inhibits matriptase and prostasin, both of which are membrane-bound serine proteinases that have critical roles in epidermal differentiation and function. In this study, skin and hair phenotypes of mice lacking the Hai-1/Spint1 gene were characterized. Previously, we reported that the homozygous deletion of Hai-1/Spint1 in mice resulted in embryonic lethality attributable to impaired placental development. To test the role of Hai-1/Spint1 in mice, the placental function of Hai-1/Spint1-mutant mice was rescued. Injection of Hai-1/Spint1+/+ blastocysts with Hai-1/Spint1−/− embryonic stem cells successfully generated high-chimeric Hai-1/Spint1−/− embryos (B6Hai-1−/−High) with normal placentas. These embryos were delivered without apparent developmental abnormalities, confirming that embryonic lethality of Hai-1/Spint1−/− mice was caused by placental dysfunction. However, newborn B6Hai-1−/−High mice showed growth retardation and died by 16 days. These mice developed scaly skin because of hyperkeratinization, reminiscent of ichthyosis, and abnormal hair shafts that showed loss of regular cuticular septation. The interfollicular epidermis showed acanthosis with enhanced Akt phosphorylation. Immunoblot analysis revealed altered proteolytic processing of profilaggrin in Hai-1/Spint1-deleted skin with impaired generation of filaggrin monomers. These findings indicate that Hai-1/Spint1 has critical roles in the regulated keratinization of the epidermis and hair development. PMID:18832587
Lee, Young H.; Suzuki, Yuichiro J.; Griffin, Autumn J.; Day, Regina M.
2008-01-01
Hepatocyte growth factor (HGF) is upregulated in response to lung injury and has been implicated in tissue repair through its antiapoptotic and proliferative activities. Cyclooxygenase-2 (COX-2) is an inducible enzyme in the biosynthetic pathway of prostaglandins, and its activation has been shown to play a role in cell growth. Here, we report that HGF induces gene transcription of COX-2 in human bronchial epithelial cells (HBEpC). Treatment of HBEpC with HGF resulted in phosphorylation of the HGF receptor (c-Met), activation of Akt, and upregulation of COX-2 mRNA. Adenovirus-mediated gene transfer of a dominant negative (DN) Akt mutant revealed that HGF increased COX-2 mRNA in an Akt-dependent manner. COX-2 promoter analysis in luciferase reporter constructs showed that HGF regulation required the β-catenin-responsive T cell factor-4 binding element (TBE). The HGF activation of the COX-2 gene transcription was blocked by DN mutant of β-catenin or by inhibitors that blocked activation of Akt. Inhibition of p42/p44 MAPK pathway blocked HGF-mediated activation of β-catenin gene transcription but not Akt activation, suggesting that p42/p44 MAPK acts in a parallel mechanism for β-catenin activation. We also found that inhibition of COX-2 with NS-398 blocked HGF-induced growth in HBEpC. Together, the results show that the HGF increases COX-2 gene expression via an Akt-, MAPK-, and β-catenin-dependent pathway in HBEpC. PMID:18245266
Ito, Tomoki; Yamaji, Daisuke; Kamikawa, Akihiro; Abd Eldaim, Mabrouk Attia; Okamatsu-Ogura, Yuko; Terao, Akira; Saito, Masayuki; Kimura, Kazuhiro
2017-08-30
It is well documented that estrogen is predominant inducer of hepatocyte growth factor (HGF) in a variety of cell types. However, the effect of progesterone (P) remains to be elusive. Thus, in the present study, we examined the effect of P and combined effect of P and 17β-estradiol (E2) on HGF expression and production in 3T3-L1 fibroblastic preadipocytes and mature adipocytes, as a model of stromal cells. Northern blot analysis showed that hgf mRNA expressed in preadipocytes was notably higher than that of mature adipocytes, and increased by treatment of preadipocytes with E2 or 10 nM P, but not with 1,000 nM P. The E2-induced hgf mRNA expression was enhanced by 10 nM P, but suppressed by 1,000 nM P. Western blot analysis revealed that biological active forms of HGF protein was found in the preadipocyte culture medium, while the lesser amount of HGF precursor protein was detected in the mature adipocyte culture medium. The amounts of HGF were changed dependently on the hgf mRNA expression levels. These results indicate that HGF production is intricately regulated by E2 and P at the transcriptional levels in 3T3-L1 cells, and may explain the changes in the HGF production during the mammary gland development, especially decrease in HGF expression during pregnancy when P concentration is high.
Cryopreservation and gel collagen culture of porcine hepatocytes
Liu, Hong-Ling; Wang, Ying-Jie; Guo, Hai-Tao; Wang, Yu-Ming; Liu, Jun; Yu, Yue-Cheng
2004-01-01
AIM: To study the method of cryopreserving porcine hepatocytes and gel collagen culture measure after its cryopreservation. METHODS: Hepatocytes, isolated from Chinese experimental suckling mini-pigs by two-step perfusion with collagenase using an extra corporeal perfusion apparatus, were cryopreserved with 50 mL/L to 200 mL/L DMSO in liquid nitrogen for 4 mo, then thawed and seeded in 1 or between 2 layers of gel collagen. The expression of porcine albumin message RNA, cellular morphology and content of aspartate aminotransferase (AST) and urea nitrogen (UN) were examined during culture in gel. RESULTS: Viability of 150 mL/L DMSO group thawed hepatocytes was (83 ± 4)%, but after purification, its viability was (90 ± 5)%, attachment efficiency was (86 ± 7)%, the viability of thawed hepatocytes was near to fresh cells. When the thawed hepatocytes were cultivated in gel collagen with culture medium adding epidermal growth factor, the hepatocytes grew in various administrative levels in mixed collagen gel, and bunchy in the sandwich configuration cultures. For up to 10 days’ culture, the typical cellular morphological characteristics of cultivated hepatocytes could be observed. The leakage of AST was lower during culture in gel than that in common culture. At the same time, the UN synthesized by cells cultivated in mixed gel collagen was higher than that in other groups. CONCLUSION: Storage in liquid nitrogen can long keep hepatocytes’ activities, the concentration of 150 mL/L DMSO is fit for porcine hepatocytes’ cryopreservation. Thawed hepatocytes can be cultivated with collagenous matrix, which provides an environment that more closely resembles that in vivo and maintain the expression of certain liver-specific function of hepatocytes. PMID:15052684
Takahashi, Kazuhide; Suzuki, Katsuo
2008-07-01
Lamellipodia formation necessary for epithelial cell migration and invasion is accomplished by rearrangement of the actin cytoskeleton at the leading edge through membrane transport of WAVE2. However, how WAVE2 is transported to the cell periphery where lamellipodia are formed remains to be established. We report here that hepatocyte growth factor (HGF) promoted lamellipodia formation and intracellular transport of WAVE2 to the cell periphery, depending on Rac1 activity, in MDA-MB-231 human breast cancer cells. Immunoblot analyses indicating the coimmunoprecipitation of WAVE2 with kinesin heavy chain KIF5B, one of the motor proteins, and IQGAP1 suggest that KIF5B and IQGAP1 formed a complex with WAVE2 in serum-starved cells and increased in their amount after HGF stimulation. Both downregulation of KIF5B by the small interfering RNA and depolymerization of microtubules with nocodazole abrogated the HGF-induced lamellipodia formation and WAVE2 transport. Therefore, we propose here that the promotion of lamellipodia formation by HGF in MDA-MB-231 cells is Rac1-dependent and requires KIF5B-mediated transport of WAVE2 and IQGAP1 to the cell periphery along microtubules.
Interleukin-1β induces tumor necrosis factor-α secretion from rat hepatocytes.
Yoshigai, Emi; Hara, Takafumi; Inaba, Hiroyuki; Hashimoto, Iwao; Tanaka, Yoshito; Kaibori, Masaki; Kimura, Tominori; Okumura, Tadayoshi; Kwon, A-Hon; Nishizawa, Mikio
2014-05-01
Tumor necrosis factor-α (TNF-α) is a pleiotropic cytokine involved in various inflammatory diseases. The only production of TNF-α in the liver is thought to be from hepatic macrophages known as Kupffer cells, predominantly in response to bacterial lipopolysaccharide (LPS). Primary cultured rat hepatocytes were used to analyze TNF-α expression in response to the pro-inflammatory cytokine, interleukin-1β (IL-1β). Livers of rats subjected to LPS-induced endotoxemia were analyzed. Immunocytochemistry and enzyme-linked immunosorbent assays demonstrated that IL-1β-treated rat hepatocytes secreted TNF-α, and RNA analyses indicated that TNF-α mRNA was induced specifically by IL-1β. Northern blot analysis showed that not only mRNA, but also a natural antisense transcript (asRNA), was transcribed from the rat Tnf gene in IL-1β-treated hepatocytes. TNF-α was detected in the hepatocytes of LPS-treated rats. Both TNF-α mRNA and asRNA were expressed in the hepatocytes of LPS-treated rats, human hepatocellular carcinoma and human monocyte/macrophage cells. To disrupt the interaction between TNF-α asRNA and TNF-α mRNA, sense oligonucleotides corresponding to TNF-α mRNA were introduced into rat hepatocytes resulting in significantly increased levels of TNF-α mRNA. One of these sense oligonucleotides increased a half-life of TNF-α mRNA, suggesting that the TNF-α asRNA may reduce the stability of TNF-α mRNA. IL-1β-stimulated rat hepatocytes are a newly identified source of TNF-α in the liver. TNF-α mRNA and asRNA are expressed in rats and humans, and the TNF-α asRNA reduces the stability of the TNF-α mRNA. Hepatocytes and TNF-α asRNA may be therapeutic targets to regulate levels of TNF-α mRNA. © 2013 The Japan Society of Hepatology.
Nakano, Jota; Marui, Akira; Muranaka, Hiroyuki; Masumoto, Hidetoshi; Noma, Hisashi; Tabata, Yasuhiko; Ido, Akio; Tsubouchi, Hirohito; Ikeda, Tadashi; Sakata, Ryuzo
2014-01-01
OBJECTIVES Myocarditis is considered one of the major causes of dilated cardiomyopathy. Hepatocyte growth factor (HGF) has pleiotropic activities that promote tissue regeneration and facilitate functional improvement of injured tissue. We investigated whether the epicardial sustained-release of HGF, using gelatin hydrogel sheets, improves cardiac function in a chronic myocarditis rat model. METHODS Six weeks after Lewis rats were immunized with porcine cardiac myosin to establish autoimmune myocarditis, HGF- or normal saline (NS)-incorporated gelatin hydrogel sheets were applied to the epicardium (G-HGF and G-NS, respectively). At either 2 or 4 weeks after treatment, these were compared with the Control myocarditis group. Cardiac function was evaluated by echocardiography and cardiac catheterization. Development of fibrosis was determined by histological study and expression of transforming growth factor-β1 (TGF-β1). Bax and Bcl-2 levels were measured to evaluate apoptotic activity. RESULTS At both points, fractional shortening and end-systolic elastance were higher in the G-HGF group than in the Control and G-NS groups (P < 0.01). Fractional shortening at 2 weeks of each group were as follows: 31.0 ± 0.9%, 24.8 ± 2.7% and 48.6 ± 2.6% (Control, G-NS and G-HGF, respectively). The ratio of the fibrotic area of the myocardium was lower in the G-HGF group than in the Control and G-NS groups at 2 weeks (G-HGF, 8.8 ± 0.9%; Control, 17.5 ± 0.2%; G-NS, 15.6 ± 0.7%; P < 0.01). The ratio at 4 weeks was lower in the G-HGF group than in the G-NS group (10.9 ± 1.4% vs 18.5 ± 1.3%; P < 0.01). The mRNA expression of TGF-β1 in the G-HGF group was lower than in the Control group at 2 weeks (0.6 ± 0.1 vs 1.1 ± 0.2) and lower than that in the G-NS group at 4 weeks (0.7 ± 0.1 vs 1.3 ± 0.2). The Bax-to-Bcl-2 ratios at both points were lower in the G-HGF group than in the Control group. CONCLUSIONS Sustained-released HGF markedly improves cardiac function in chronic
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rodland, Karin D.; Bollinger, Nikki; Ippolito, Danielle L.
2008-11-14
REVIEW ENTIRE DOCUMENT AT: https://pnlweb.pnl.gov/projects/bsd/ERICA%20Manuscripts%20for%20Review/KD%20Rodland%20D7E80/HMEC_transactivation_ms01_15+Figs.pdf ABSTRACT: Using a single nontransformed strain of human mammary epithelial cells, we found that the ability of multiple growth factors and cytokines to induce ERK phosphorylation was dependent on EGFR activity. These included lysophosphatidic acid (LPA), uridine triphosphate, growth hormone, vascular endothelial growth factor, insulin-like growth factor-1 (IGF-1), and tumor necrosis factoralpha. In contrast, hepatocyte growth factor could stimulate ERK phosphorylation independent of EGFR activity...
Fan, Saijun; Ma, Yong Xian; Gao, Min; Yuan, Ren-Qi; Meng, Qinghui; Goldberg, Itzhak D.; Rosen, Eliot M.
2001-01-01
Hepatocyte growth factor (scatter factor) (HGF/SF) is a pleiotrophic mediator of epithelial cell motility, morphogenesis, angiogenesis, and tumorigenesis. HGF/SF protects cells against DNA damage by a pathway from its receptor c-Met to phosphatidylinositol 3-kinase (PI3K) to c-Akt, resulting in enhanced DNA repair and decreased apoptosis. We now show that protection against the DNA-damaging agent adriamycin (ADR; topoisomerase IIα inhibitor) requires the Grb2-binding site of c-Met, and overexpression of the Grb2-associated binder Gab1 (a multisubstrate adapter required for epithelial morphogenesis) inhibits the ability of HGF/SF to protect MDCK epithelial cells against ADR. In contrast to Gab1 and its homolog Gab2, overexpression of c-Cb1, another multisubstrate adapter that associates with c-Met, did not affect protection. Gab1 blocked the ability of HGF/SF to cause the sustained activation of c-Akt and c-Akt signaling (FKHR phosphorylation). The Gab1 inhibition of sustained c-Akt activation and of cell protection did not require the Gab1 pleckstrin homology or SHP2 phosphatase-binding domain but did require the PI3K-binding domain. HGF/SF protection of parental MDCK cells was blocked by wortmannin, expression of PTEN, and dominant negative mutants of p85 (regulatory subunit of PI3K), Akt, and Pak1; the protection of cells overexpressing Gab1 was restored by wild-type or activated mutants of p85, Akt, and Pak1. These findings suggest that the adapter Gab1 may redirect c-Met signaling through PI3K away from a c-Akt/Pak1 cell survival pathway. PMID:11438654
Effect of growth factors on hyaluronan production by canine vocal fold fibroblasts.
Hirano, Shigeru; Bless, Diane M; Heisey, Dennis; Ford, Charles N
2003-07-01
Hyaluronan (HYA) is considered to be a crucial factor in scarless wound healing and in maintaining tissue viscosity of the vocal fold lamina propria. In this study focusing on the effects of growth factors, we examined how HYA is produced and controlled in canine cultured vocal fold fibroblasts. Fibroblasts were taken from the lamina propria of the vocal folds of 8 dogs and cultured with and without growth factors. The production of HYA in the supernatant culture was quantitatively examined by enzyme-linked immunosorbent assay. Hepatocyte growth factor, epidermal growth factor, basic fibroblast growth factor, and transforming growth factor beta1 all stimulated HYA synthesis from vocal fold fibroblasts. These effects differed with the concentration of growth factors and the incubation period. We also examined how frequently the growth factors had to be administered in order to maintain appropriate levels of HYA. A single administration was sufficient to maintain appropriate HYA levels for at least 7 days. The present studies have demonstrated positive effects of growth factors in stimulating HYA production. Further in vivo study is needed to clarify the usefulness of these growth factors in the management of vocal fold scarring.
Lan, H N; Hong, P; Li, R N; Shan, A S; Zheng, X
2017-10-01
The phenomenon of nuclear translocation of growth hormone receptor (GHR) in human, rat, and fish has been reported. To date, this phenomenon has not been described in a domestic animal (such as pig). In addition, the molecular mechanisms of GHR nuclear translocation have not been thoroughly elucidated. To this end, porcine hepatocytes were isolated and used as a cell model. We observed that porcine growth hormone (pGH) can induce porcine GHR's nuclear localization in porcine hepatocytes. Subsequently, the dynamics of pGH-induced pGHR's nuclear localization were analyzed and demonstrated that pGHR's nuclear localization occurs in a time-dependent manner. Next, we explored the mechanism of pGHR nuclear localization using different pGHR ligands, and we demonstrated that pGHR's nuclear translocation is GH(s)-dependent. We also observed that pGHR translocates into cell nuclei in a pGH dimerization-dependent fashion, whereas further experiments indicated that IMPα/β is involved in the nuclear translocation of the pGH-pGHR dimer. The pGH-pGHR dimer may form a pGH-GHR-JAK2 multiple complex in cell nuclei, which would suggest that similar to its function in the cell membrane, the nuclear-localized pGH-pGHR dimer might still have the ability to signal. Copyright © 2017 Elsevier Inc. All rights reserved.
Koudelkova, Petra; Costina, Victor; Weber, Gerhard; Dooley, Steven; Findeisen, Peter; Winter, Peter; Agarwal, Rahul; Schlangen, Karin; Mikulits, Wolfgang
2017-10-10
The entry of malignant hepatocytes into blood vessels is a key step in the dissemination and metastasis of hepatocellular carcinoma (HCC). The identification of molecular mechanisms involved in the transmigration of malignant hepatocytes through the endothelial barrier is of high relevance for therapeutic intervention and metastasis prevention. In this study, we employed a model of hepatocellular transmigration that mimics vascular invasion using hepatic sinusoidal endothelial cells and malignant hepatocytes evincing a mesenchymal-like, invasive phenotype by transforming growth factor (TGF)-β. Labelling of respective cell populations with various stable isotopes and subsequent mass spectrometry analyses allowed the "real-time" detection of molecular changes in both transmigrating hepatocytes and endothelial cells. Interestingly, the proteome profiling revealed 36 and 559 regulated proteins in hepatocytes and endothelial cells, respectively, indicating significant changes during active transmigration that mostly depends on cell-cell interaction rather than on TGF-β alone. Importantly, matching these in vitro findings with HCC patient data revealed a panel of common molecular alterations including peroxiredoxin-3, epoxide hydrolase, transgelin-2 and collectin 12 that are clinically relevant for the patient's survival. We conclude that hepatocellular plasticity induced by TGF-β is crucially involved in blood vessel invasion of HCC cells.
Ohkawara, Nana; Ueda, Hiroki; Shinozaki, Shohei; Kitajima, Takashi; Ito, Yoshihiro; Asaoka, Hiroshi; Kawakami, Akio; Kaneko, Eiji; Shimokado, Kentaro
2007-08-01
Hepatocyte growth factor (HGF) is known to stimulate endothelial cell proliferation. However, re-endothelialization is not enhanced when the native protein is administered to the injured artery, probably due to the short half-life of HGF at the site of injury. Therefore, the effects of an HGF fusion protein having collagen-binding activity (CBD-HGF) on re-endothelialization and neointimal formation was studied in the balloon-injured rat carotid artery. The left common carotid artery of male Sprague-Dawley rats was injured with an inflated balloon catheter, and then treated with CBD-HGF 10 microg/mL), HGF (10 micro g/mL) or saline (control) for 15 min. After 14 days, the rats were injected with Evans blue and sacrificed. The re-endothelialized area was significantly greater in the CBD-HGF- treated rats than in the control or HGF -treated rats. Neointimal formation was significantly more pronounced in the CBD-HGF treated rats than in other rat groups. Both HGF and CBD-HGF stimulated proliferation of vascular smooth muscle cells as well as endothelial cells in vitro. Consistent with this, cultured smooth muscle cells were shown to express the HGF receptor (c-Met). CBD-HGF accelerates re-endothelialization and neointimal formation in vivo. CBD fusion protein is a useful vehicle to deliver vascular growth factors to injured arteries.
HGF Secreted by Activated Kupffer Cells Induces Apoptosis of Plasmodium-Infected Hepatocytes
Gonçalves, Lígia Antunes; Rodo, Joana; Rodrigues-Duarte, Lurdes; de Moraes, Luciana Vieira; Penha-Gonçalves, Carlos
2017-01-01
Malaria liver stage infection is an obligatory parasite development step and represents a population bottleneck in Plasmodium infections, providing an advantageous target for blocking parasite cycle progression. Parasite development inside hepatocytes implies a gross cellular insult evoking innate host responses to counteract intra-hepatocytic infection. Using primary hepatocyte cultures, we investigated the role of Kupffer cell-derived hepatocyte growth factor (HGF) in malaria liver stage infection. We found that Kupffer cells from Plasmodium-infected livers produced high levels of HGF, which trigger apoptosis of infected hepatocytes through a mitochondrial-independent apoptosis pathway. HGF action in infected hepatocyte primary cultures results in a potent reduction of parasite yield by specifically sensitizing hepatocytes carrying established parasite exo-erythrocytic forms to undergo apoptosis. This apoptosis mechanism is distinct from cell death that is spontaneously induced in infected cultures and is governed by Fas signaling modulation through a mitochondrial-dependent apoptosis pathway. This work indicates that HGF and Fas signaling pathways are part of an orchestrated host apoptosis response that occurs during malaria liver stage infection, decreasing the success of infection of individual hepatocytes. Our results raise the hypothesis that paracrine signals derived from Kupffer cell activation are implicated in directing death of hepatocytes infected with the malaria parasite. PMID:28220125
HGF Secreted by Activated Kupffer Cells Induces Apoptosis of Plasmodium-Infected Hepatocytes.
Gonçalves, Lígia Antunes; Rodo, Joana; Rodrigues-Duarte, Lurdes; de Moraes, Luciana Vieira; Penha-Gonçalves, Carlos
2017-01-01
Malaria liver stage infection is an obligatory parasite development step and represents a population bottleneck in Plasmodium infections, providing an advantageous target for blocking parasite cycle progression. Parasite development inside hepatocytes implies a gross cellular insult evoking innate host responses to counteract intra-hepatocytic infection. Using primary hepatocyte cultures, we investigated the role of Kupffer cell-derived hepatocyte growth factor (HGF) in malaria liver stage infection. We found that Kupffer cells from Plasmodium -infected livers produced high levels of HGF, which trigger apoptosis of infected hepatocytes through a mitochondrial-independent apoptosis pathway. HGF action in infected hepatocyte primary cultures results in a potent reduction of parasite yield by specifically sensitizing hepatocytes carrying established parasite exo-erythrocytic forms to undergo apoptosis. This apoptosis mechanism is distinct from cell death that is spontaneously induced in infected cultures and is governed by Fas signaling modulation through a mitochondrial-dependent apoptosis pathway. This work indicates that HGF and Fas signaling pathways are part of an orchestrated host apoptosis response that occurs during malaria liver stage infection, decreasing the success of infection of individual hepatocytes. Our results raise the hypothesis that paracrine signals derived from Kupffer cell activation are implicated in directing death of hepatocytes infected with the malaria parasite.
Olsen, J; Lefebvre, O; Fritsch, C; Troelsen, J T; Orian-Rousseau, V; Kedinger, M; Simon-Assmann, P
2000-01-01
Laminin-5 is a trimer of laminin alpha3, beta3 and gamma2 chains that is found in the intestinal basement membrane. Deposition of the laminin gamma2 chain at the basement membrane is of great interest because it undergoes a developmental shift in its cellular expression. Here we study the regulatory elements that control basal and cytokine-activated transcriptional expression of the LAMC2 gene, which encodes the laminin gamma2 chain. By using transient transfection experiments we demonstrated the presence of constitutive and cytokine-responsive cis-elements. Comparison of the transcriptional activity of the LAMC2 promoter in the epithelial HT29mtx cells with that in small-intestinal fibroblastic cells (C20 cells) led us to conclude that two regions with constitutive epithelium-specific activity are present between positions -1.2 and -0.12 kb. This was further validated by transfections of primary foetal intestinal endoderm and mesenchyme. A 2.5 kb portion of the LAMC2 5' flanking region was equally responsive to PMA and hepatocyte growth factor (HGF), whereas it was less responsive to transforming growth factor beta1. A minimal promoter limited to the initial 120 bp upstream of the transcriptional start site maintained inducibility by PMA and HGF. This short promoter fragment contains two activator protein 1 (AP-1) elements and the 5'-most of these is a composite AP-1/Sp1 element. The 5'AP-1 element is crucial to the HGF-mediated activity of the promoter; analysis of interacting nuclear proteins demonstrated that AP-1 proteins containing JunD mediate the response to HGF. PMID:10749670
Drucker, Claudia; Parzefall, Wolfram; Teufelhofer, Olga; Grusch, Michael; Ellinger, Adolf; Schulte-Hermann, Rolf; Grasl-Kraupp, Bettina
2006-01-01
Hepatocellular carcinoma almost always arises in chronically inflamed livers. We developed a culture model to study the role of non-parenchymal cells (NPCs) for inflammation-driven hepatocarcinogenesis. Rats were treated with the carcinogen N-nitrosomorpholine, which induced initiated hepatocytes expressing the marker placental glutathione-S-transferase (GSTp). After 21 days two preparations of hepatocytes were made: (i) conventional ones (Hep-conv) containing NPCs and (ii) hepatocytes purified of NPCs (Hep-pur). Initiated hepatocytes, being positive for GSTp (GSTp-pos) were present in both preparations and were cultured along with normal hepatocytes, being negative for GSTp (GSTp-neg). Under any culture condition DNA synthesis was approximately 4-fold higher in GSTp-pos than in GSTp-neg hepatocytes demonstrating the inherent growth advantage of the first stages of hepatocarcinogenesis. Hepatocytes showed approximately 3-fold lower rates of DNA synthesis in Hep-pur than in Hep-conv, which was elevated above Hep-conv levels by addition of NPC or NPC-supernatant. Pretreatment of NPCs with proinflammatory lipopolysaccharide (LPS) further increased DNA synthesis. Thus, NPCs release soluble growth stimulators. Next we investigated the effect of specific cytokines produced by NPCs. Tumour necrosis factor alpha and interleukin 6 barely altered DNA synthesis, whereas hepatocyte growth factor (HGF), keratinocyte growth factor (KGF) and the heparin-binding epidermal growth factor-like growth factor (HB-EGF) were potent inducers of DNA replication in both, GSTp-neg and GSTp-pos cells. In conclusion, DNA synthesis of hepatocytes is increased by factors released from NPCs, an effect augmented by LPS-stimulation. NPC-derived cytokines, such as KGF, HGF and HB-EGF, stimulate DNA synthesis preferentially in initiated hepatocytes, presumably resulting in tumour promotion. Similar mechanisms may contribute to carcinogenesis in human inflammatory liver diseases.
Zhen, Ruixin; Yang, Jianing; Wang, Yu; Li, Yubo; Chen, Bin; Song, Youxin; Ma, Guiyun; Yang, Bo
2018-04-01
Bone regeneration is an important process associated with the treatment of osteonecrosis, which is caused by various factors. Hepatocyte growth factor (HGF) is an active biological factor that has multifunctional roles in cell biology, life sciences and clinical medicine. It has previously been suggested that bone morphogenetic protein (BMP)‑2 exerts beneficial roles in bone formation, repair and angiogenesis in the femoral head. The present study aimed to investigate the benefits and molecular mechanisms of HGF in bone regeneration. The viability of osteoblasts and osteoclasts were studied in vitro. In addition, the expression levels of tumor necrosis factor (TNF)‑α, monocyte chemotactic protein (MCP)‑1, interleukin (IL)‑1 and IL‑6 were detected in a mouse fracture model following treatment with HGF. The expression and activity of nuclear factor (NF)‑κB were also analyzed in osteocytes post‑treatment with HGF. Histological analysis was used to determine the therapeutic effects of HGF on mice with fractures. The migration and differentiation of osteoblasts and osteoclasts were investigated in HGF‑incubated cells. Furthermore, angiogenesis and BMP‑2 expression were analyzed in the mouse fracture model post‑treatment with HGF. The results indicated that HGF regulates the cell viability of osteoblasts and osteoclasts, and also balanced the ratio between osteoblasts and osteoclasts. In addition, HGF decreased the serum expression levels of TNF‑α, MCP‑1, IL‑1 and IL‑6 in experimental mice. The results of a mechanistic analysis demonstrated that HGF upregulated p65, IκB kinase‑β and IκBα expression in osteoblasts from experimental mice. In addition, the expression levels of vascular endothelial growth factor, BMP‑2 receptor, receptor activator of NF‑κB ligand and macrophage colony‑stimulating factor were upregulated by HGF, which may effectively promote blood vessel regeneration, and contribute to the formation and
Kashiwazaki, Haruhiko; Kobayashi, Narumi; Hamada, Jun‐ichi; Matsumoto, Kunio; Nakamura, Toshikazu; Takeichi, Noritoshi
1995-01-01
Using anti‐rat hepatocyte growth factor (HGF) antibody, we investigated the distribution of HGF‐positive cells in the liver tissues of LEC rats at various phases of liver diseases. During the phase of fulminant hepatitis, HGF‐positive cells increased remarkably, and many of them were localized at the portal triads; these cells were identified from their shape as non‐epithelial cells. A reduced number of HGF‐positive cells was observed during the phase of chronic hepatitis, while no HGF‐positive cells were seen in the tissue of cholangiofibrosis. During the phase of carcinoma, staining revealed that both the hepatocellular carcinoma cells and the non‐epithelial cells in cancerous liver tissue were HGF‐positive. These results suggest that, in LEC rats, HGF may play an important role in the regeneration of hepatocytes as well as in the development of hepatocellular carcinoma. PMID:7737910
Bell, Elizabeth J; Decker, Paul A; Tsai, Michael Y; Pankow, James S; Hanson, Naomi Q; Wassel, Christina L; Larson, Nicholas B; Cohoon, Kevin P; Budoff, Matthew J; Polak, Joseph F; Stein, James H; Bielinski, Suzette J
2018-05-01
Hepatocyte growth factor (HGF) has previously been associated with risk of stroke, coronary heart disease, and atherosclerosis. We hypothesized that higher circulating HGF is associated with greater progression of measures of atherosclerosis: coronary artery calcium (CAC) and carotid plaque. Participants aged 45-84 years from the prospective cohort study Multi-Ethnic Study of Atherosclerosis had HGF measured at baseline (between 2000 and 2002) and were followed for progression of atherosclerosis for up to 12 years. CAC was measured at all five exams using the Agatston method. Mixed-effects models were used to examine the association of HGF and CAC progression among 6695 participants with available data. Relative risk regression was used to assess the association between HGF and new or additional carotid plaque between exams 1 and 5 in 3400 participants with available data. All point estimates were adjusted for potential confounding variables. Each standard deviation higher HGF at baseline was associated with 2.9 Agatston units/year greater CAC progression (95% CI: 1.6-4.2, p < 0.0001), and the magnitude of this association differed by race/ethnicity (p value for interaction by race = 0.003). Each standard deviation higher HGF at baseline was associated with a 4% higher risk of new or additional carotid plaque (95% CI: 1.01-1.08, p = 0.005). Higher levels of HGF were significantly associated with greater progression of atherosclerosis in this large and diverse population. Circulating HGF continues to show promise as a potential clinical biomarker for cardiovascular disease. Copyright © 2018 Elsevier B.V. All rights reserved.
Li, Fuchuan; Nandini, Chilkunda D; Hattori, Tomohide; Bao, Xingfeng; Murayama, Daisuke; Nakamura, Toshikazu; Fukushima, Nobuhiro; Sugahara, Kazuyuki
2010-09-03
Endogenous pleiotrophin and hepatocyte growth factor (HGF) mediate the neurite outgrowth-promoting activity of chondroitin sulfate (CS)/dermatan sulfate (DS) hybrid chains isolated from embryonic pig brain. CS/DS hybrid chains isolated from shark skin have a different disaccharide composition, but also display these activities. In this study, pleiotrophin- and HGF-binding domains in shark skin CS/DS were investigated. A high affinity CS/DS fraction was isolated using a pleiotrophin-immobilized column. It showed marked neurite outgrowth-promoting activity and strong inhibitory activity against the binding of pleiotrophin to immobilized CS/DS chains from embryonic pig brain. The inhibitory activity was abolished by chondroitinase ABC or B, and partially reduced by chondroitinase AC-I. A pentasulfated hexasaccharide with a novel structure was isolated from the chondroitinase AC-I digest using pleiotrophin affinity and anion exchange chromatographies. It displayed a potent inhibitory effect on the binding of HGF to immobilized shark skin CS/DS chains, suggesting that the pleiotrophin- and HGF-binding domains at least partially overlap in the CS/DS chains involved in the neuritogenic activity. Computational chemistry using molecular modeling and calculations of the electrostatic potential of the hexasaccharide and two pleiotrophin-binding octasaccharides previously isolated from CS/DS hybrid chains of embryonic pig brain identified an electronegative zone potentially involved in the molecular recognition of the oligosaccharides by pleiotrophin. Homology modeling of pleiotrophin based on a related midkine protein structure predicted the binding pocket of pleiotrophin for the oligosaccharides and provided new insights into the molecular mechanism of the interactions between the oligosaccharides and pleiotrophin.
He, Lihong; Wang, Xianyao; Kang, Naixin; Xu, Jianwei; Dai, Nan; Xu, Xiaojing; Zhang, Huanxiang
2018-04-01
The migration of mesenchymal stem cells (MSCs) is critical for their use in cell-based therapies. Accumulating evidence suggests that microRNAs are important regulators of MSC migration. Here, we report that the expression of miR-375 was downregulated in MSCs treated with hepatocyte growth factor (HGF), which strongly stimulates the migration of these cells. Overexpression of miR-375 decreased the transfilter migration and the migration velocity of MSCs triggered by HGF. In our efforts to determine the mechanism by which miR-375 affects MSC migration, we found that miR-375 significantly inhibited the activation of Akt by downregulating its phosphorylation at T308 and S473, but had no effect on the activity of mitogen-activated protein kinases. Further, we showed that 3'phosphoinositide-dependent protein kinase-1 (PDK1), an upstream kinase necessary for full activation of Akt, was negatively regulated by miR-375 at the protein level. Moreover, miR-375 suppressed the phosphorylation of focal adhesion kinase (FAK) and paxillin, two important regulators of focal adhesion (FA) assembly and turnover, and decreased the number of FAs at cell periphery. Taken together, our results demonstrate that miR-375 inhibits HGF-elicited migration of MSCs through downregulating the expression of PDK1 and suppressing the activation of Akt, as well as influencing the tyrosine phosphorylation of FAK and paxillin and FA periphery distribution.
Rosmorduc, O; Wendum, D; Corpechot, C; Galy, B; Sebbagh, N; Raleigh, J; Housset, C; Poupon, R
1999-10-01
We tested the potential role of vascular endothelial growth factor (VEGF) and of fibroblast growth factor-2 (FGF-2) in the angiogenesis associated with experimental liver fibrogenesis induced by common bile duct ligation in Sprague-Dawley rats. In normal rats, VEGF and FGF-2 immunoreactivities were restricted to less than 3% of hepatocytes. One week after bile duct ligation, hypoxia was demonstrated by the immunodetection of pimonidazole adducts unevenly distributed throughout the lobule. After 2 weeks, hypoxia and VEGF expression were detected in >95% of hepatocytes and coexisted with an increase in periportal vascular endothelial cell proliferation, as ascertained by Ki67 immunolabeling. Subsequently, at 3 weeks the density of von Willebrand-labeled vascular section in fibrotic areas significantly increased. Semiquantitative reverse transcription polymerase chain reaction showed that VEGF(120) and VEGF(164) transcripts, that correspond to secreted isoforms, increased within 2 weeks, while VEGF(188) transcripts remained unchanged. FGF-2 mainly consisting of a 22-kd isoform, according to Western blot, was identified by immunohistochemistry in 49% and 100% of hepatocytes at 3 and 7 weeks, respectively. Our data provide evidence that in biliary-type liver fibrogenesis, angiogenesis is stimulated primarily by VEGF in response to hepatocellular hypoxia while FGF-2 likely contributes to the maintenance of angiogenesis at later stages.
Transforming Growth Factor-β Drives the Transendothelial Migration of Hepatocellular Carcinoma Cells
Koudelkova, Petra; Costina, Victor; Weber, Gerhard; Dooley, Steven; Findeisen, Peter; Winter, Peter; Agarwal, Rahul; Schlangen, Karin
2017-01-01
The entry of malignant hepatocytes into blood vessels is a key step in the dissemination and metastasis of hepatocellular carcinoma (HCC). The identification of molecular mechanisms involved in the transmigration of malignant hepatocytes through the endothelial barrier is of high relevance for therapeutic intervention and metastasis prevention. In this study, we employed a model of hepatocellular transmigration that mimics vascular invasion using hepatic sinusoidal endothelial cells and malignant hepatocytes evincing a mesenchymal-like, invasive phenotype by transforming growth factor (TGF)-β. Labelling of respective cell populations with various stable isotopes and subsequent mass spectrometry analyses allowed the “real-time” detection of molecular changes in both transmigrating hepatocytes and endothelial cells. Interestingly, the proteome profiling revealed 36 and 559 regulated proteins in hepatocytes and endothelial cells, respectively, indicating significant changes during active transmigration that mostly depends on cell–cell interaction rather than on TGF-β alone. Importantly, matching these in vitro findings with HCC patient data revealed a panel of common molecular alterations including peroxiredoxin-3, epoxide hydrolase, transgelin-2 and collectin 12 that are clinically relevant for the patient’s survival. We conclude that hepatocellular plasticity induced by TGF-β is crucially involved in blood vessel invasion of HCC cells. PMID:28994702
Ise, H; Sugihara, N; Negishi, N; Nikaido, T; Akaike, T
2001-07-13
Development of a reliable method to isolate highly proliferative potential hepatocytes will provide insight into the molecular mechanisms of liver regeneration, as well as proving crucial for the development of a biohybrid artificial liver. The aim of this study is to isolate highly proliferative, e.g., progenitor-like, hepatocytes. To this end, we fractionated hepatocytes expressing low and high levels of the asialoglycoprotein receptor (ASGP-R) based on the difference in their adhesion to poly[N-p-vinylbenzyl-O-beta-d-galactopyranosyl-(1-->4)-d-gluconamide] (PVLA), and examined the proliferative activity and gene expression of these fractionated hepatocytes. The results showed that approximately 0.5 to 1% of the total number of hepatocytes, which showed low adhesion to PVLA, expressed low levels of the ASGP-R, while the rest of hepatocyte population with high adhesion to PVLA expressed high levels of the ASGP-R. Interestingly hepatocytes with low ASGP-R expression levels had much higher DNA synthesizing activity (i.e., are much more proliferative) than those with high ASGP-R expression levels. Moreover, hepatocytes with low ASGP-R expression levels expressed higher levels of epidermal growth factor receptor (EGF-R), CD29 (beta1 integrin) and CD49f (alpha6 integrin) and lower levels of glutamine synthetase than those with high ASGP-R expression. These findings suggested that hepatocytes with low adhesion to PVLA due to their low ASGP-R expression could be potential candidates for progenitor-like hepatocytes due to their high proliferative capacity; hence, the low expression of the ASGP-R could be a unique marker for progenitor hepatocytes. The isolation of hepatocytes with different functional phenotypes using PVLA may provide a new research tool for a better understanding of the biology of hepatocytes and the mechanisms regulating their proliferation and differentiation in health and disease. Copyright 2001 Academic Press.
Fibroblast growth factor (Fgf) signaling pathway regulates liver homeostasis in zebrafish.
Tsai, Su-Mei; Liu, Da-Wei; Wang, Wen-Pin
2013-04-01
In mammals, fibroblast growth factor (FGF) signaling controls liver specification and regulates the metabolism of lipids, cholesterol, and bile acids. FGF signaling also promotes hepatocyte proliferation, and helps detoxify hepatotoxin during liver regeneration after partial hepatectomy. However, the function of Fgf in zebrafish liver is not yet well understood, specifically for postnatal homeostasis. The current study analyzed the expression of fgf receptors (fgfrs) in the liver of zebrafish. We then investigated the function of Fgf signaling in the zebrafish liver by expressing a dominant-negative Fgf receptor in hepatocytes (lfabp:dnfgfr1-egfp, lf:dnfr). Histological analysis showed that our genetic intervention resulted in a small liver size with defected medial expansion of developing livers in transgenic (Tg) larvae. Morphologically, the liver lobe of lf:dnfr adult fish was shorter than that of control. Ballooning degeneration of hepatocytes was observed in fish as young as 3 months. Further examination revealed the development of hepatic steatosis and cholestasis. In adult Tg fish, we unexpectedly observed increased liver-to-body-weight ratios, with higher percentages of proliferating hepatocytes. Considering all these findings, we concluded that as in mammals, in adult zebrafish the metabolism of lipid and bile acids in the liver are regulated by Fgf signaling. Disruption of the Fgf signal-mediated metabolism might indirectly affect hepatocyte proliferation.
Menstrual blood-derived mesenchymal stem cells differentiate into functional hepatocyte-like cells*
Mou, Xiao-zhou; Lin, Jian; Chen, Jin-yang; Li, Yi-fei; Wu, Xiao-xing; Xiang, Bing-yu; Li, Cai-yun; Ma, Ju-ming; Xiang, Charlie
2013-01-01
Orthotopic liver transplantation (OLT) is the only proven effective treatment for both end-stage and metabolic liver diseases. Hepatocyte transplantation is a promising alternative for OLT, but the lack of available donor livers has hampered its clinical application. Hepatocyte-like cells (HLCs) differentiated from many multi-potential stem cells can help repair damaged liver tissue. Yet almost suitable cells currently identified for human use are difficult to harvest and involve invasive procedures. Recently, a novel mesenchymal stem cell derived from human menstrual blood (MenSC) has been discovered and obtained easily and repeatedly. In this study, we examined whether the MenSCs are able to differentiate into functional HLCs in vitro. After three weeks of incubation in hepatogenic differentiation medium containing hepatocyte growth factor (HGF), fibroblast growth factor-4 (FGF-4), and oncostain M (OSM), cuboidal HLCs were observed, and cells also expressed hepatocyte-specific marker genes including albumin (ALB), α-fetoprotein (AFP), cytokeratin 18/19 (CK18/19), and cytochrome P450 1A1/3A4 (CYP1A1/3A4). Differentiated cells further demonstrated in vitro mature hepatocyte functions such as urea synthesis, glycogen storage, and indocyanine green (ICG) uptake. After intrasplenic transplantation into mice with 2/3 partial hepatectomy, the MenSC-derived HLCs were detected in recipient livers and expressed human ALB protein. We also showed that MenSC-derived HLC transplantation could restore the serum ALB level and significantly suppressed transaminase activity of liver injury animals. In conclusion, MenSCs may serve as an ideal, easily accessible source of material for tissue engineering and cell therapy of liver tissues. PMID:24190442
Collagen-binding vascular endothelial growth factor attenuates CCl4-induced liver fibrosis in mice
Wu, Kangkang; Huang, Rui; Wu, Hongyan; Liu, Yong; Yang, Chenchen; Cao, Shufeng; Hou, Xianglin; Chen, Bing; Dai, Jianwu; Wu, Chao
2016-01-01
Vascular endothelial growth factor (VEGF) serves an important role in promoting angiogenesis and tissue regeneration. However, the lack of an effective delivery system that can target this growth factor to the injured site reduces its therapeutic efficacy. Therefore, in the current study, collagen-binding VEGF was constructed by fusing a collagen-binding domain (CBD) to the N-terminal of native VEGF. The CBD-VEGF can specifically bind to collagen which is the major component of the extracellular matrix in fibrotic liver. The anti-fibrotic effects of this novel material were investigated by the carbon tetrachloride (CCl4)-induced liver fibrotic mouse model. Mice were injected with CCl4 intraperitoneally to induce liver fibrosis. CBD-VEGF was injected directly into the liver tissue of mice. The liver tissues were stained with hematoxylin and eosin for general observation or with Masson's trichrome staining for detection of collagen deposition. The hepatic stellate cell activation, blood vessel formation and hepatocyte proliferation were measured by immunohistochemical staining for α-smooth muscle actin, CD31 and Ki67 in the liver tissue. The fluorescent TUNEL assay was performed to evaluate the hepatocyte apoptosis. The present study identified that the CBD-VEGF injection could significantly promote vascularization of the liver tissue of fibrotic mice and attenuate liver fibrosis. Furthermore, hepatocyte apoptosis and hepatic stellate cell activation were attenuated by CBD-VEGF treatment. CBD-VEGF treatment could additionally promote hepatocyte regeneration in the liver tissue of fibrotic mice. Thus, it was suggested that CBD-VEGF may be used as a novel therapeutic intervention for liver fibrosis. PMID:27748931
Pavlova, Yelena; Viklicky, Ondrej; Slatinska, Janka; Bürgelova, Marcela; Süsal, Caner; Skibova, Jelena; Honsová, Eva; Striz, Ilja; Kolesar, Libor; Slavcev, Antonij
2011-07-01
Our retrospective study was aimed to assess the relevance of pre- and post-transplant measurements of serum concentrations of the soluble CD30 molecule (soluble CD30, sCD30) and the cytokine Hepatocyte growth factor (HGF) for prediction of the risk for development of antibody-mediated rejection (AMR) in kidney transplant patients. Evaluation of sCD30, HGF levels and the presence of HLA-specific antibodies in a cohort of 205 patients was performed before, 2weeks and 6months after transplantation. Patients were followed up for kidney graft function and survival for two years. We found a tendency of higher incidence of AMR in retransplanted patients with elevated pre-transplant sCD30 (≥100U/ml) (p=0.051), however no such correlation was observed in first-transplant patients. Kidney recipients with simultaneously high sCD30 and HLA-specific antibodies (sCD30+/Ab+) before transplantation had significantly lower AMR-free survival compared to the other patient groups (p<0.001). HGF concentrations were not associated with the incidence of AMR at any time point of measurement, nevertheless, the combined analysis HGF and sCD30 showed increased incidence of AMR in recipients with elevated pretransplant sCD30 and low HGF levels. the predictive value of pretransplant sCD30 for the development of antibody-mediated rejection after transplantation is significantly potentiated by the co-presence of HLA specific antibodies. The role of HGF as a rejection-protective factor in patients with high pretransplant HGF levels would need further investigation. Copyright © 2011 Elsevier B.V. All rights reserved.
Al-Adsani, Amani; Burke, Zoë D; Eberhard, Daniel; Lawrence, Katherine L; Shen, Chia-Ning; Rustgi, Anil K; Sakaue, Hiroshi; Farrant, J Mark; Tosh, David
2010-10-27
The pancreatic exocrine cell line AR42J-B13 can be reprogrammed to hepatocytes following treatment with dexamethasone. The question arises whether dexamethasone also has the capacity to induce ductal cells as well as hepatocytes. AR42J-B13 cells were treated with and without dexamethasone and analyzed for the expression of pancreatic exocrine, hepatocyte and ductal markers. Addition of dexamethasone inhibited pancreatic amylase expression, induced expression of the hepatocyte marker transferrin as well as markers typical of ductal cells: cytokeratin 7 and 19 and the lectin peanut agglutinin. However, the number of ductal cells was low compared to hepatocytes. The proportion of ductal cells was enhanced by culture with dexamethasone and epidermal growth factor (EGF). We established several features of the mechanism underlying the transdifferentiation of pancreatic exocrine cells to ductal cells. Using a CK19 promoter reporter, we show that a proportion of the ductal cells arise from differentiated pancreatic exocrine-like cells. We also examined whether C/EBPβ (a transcription factor important in the conversion of pancreatic cells to hepatocytes) could alter the conversion from acinar cells to a ductal phenotype. Overexpression of an activated form of C/EBPβ in dexamethasone/EGF-treated cells provoked the expression of hepatocyte markers and inhibited the expression of ductal markers. Conversely, ectopic expression of a dominant-negative form of C/EBPβ, liver inhibitory protein, inhibited hepatocyte formation in dexamethasone-treated cultures and enhanced the ductal phenotype. These results indicate that hepatocytes and ductal cells may be induced from pancreatic exocrine AR42J-B13 cells following treatment with dexamethasone. The conversion from pancreatic to hepatocyte or ductal cells is dependent upon the expression of C/EBPβ.
Lee, Woo-Ram; Kim, Kyung-Hyun; An, Hyun-Jin; Kim, Jung-Yeon; Lee, Sun-Jae; Han, Sang-Mi; Pak, Sok Cheon; Park, Kwan-kyu
2014-07-18
Apamin is an integral part of bee venom, as a peptide component. It has long been known as a highly selective block Ca(2+)-activated K(+) (SK) channels. However, the cellular mechanism and anti-fibrotic effect of apamin in TGF-β1-induced hepatocytes have not been explored. In the present study, we investigated the anti-fibrosis or anti-EMT mechanism by examining the effect of apamin on TGF-β1-induced hepatocytes. AML12 cells were seeded at ∼60% confluence in complete growth medium. Twenty-four hours later, the cells were changed to serum free medium containing the indicated concentrations of apamin. After 30 min, the cells were treated with 2 ng/ml of TGF-β1 and co-cultured for 48 h. Also, we investigated the effects of apamin on the CCl4-induced liver fibrosis animal model. Treatment of AML12 cells with 2 ng/ml of TGF-β1 resulted in loss of E-cadherin protein at the cell-cell junctions and concomitant increased expression of vimentin. In addition, phosphorylation levels of ERK1/2, Akt, Smad2/3 and Smad4 were increased by TGF-β1 stimulation. However, cells treated concurrently with TGF-β1 and apamin retained high levels of localized expression of E-cadherin and showed no increase in vimentin. Specifically, treatment with 2 μg/ml of apamin almost completely blocked the phosphorylation of ERK1/2, Akt, Smad2/3 and Smad4 in AML12 cells. In addition, apamin exhibited prevention of pathological changes in the CCl4-injected animal models. These results demonstrate the potential of apamin for the prevention of EMT progression induced by TGF-β1 in vitro and CCl4-injected in vivo. Copyright © 2014 Elsevier Inc. All rights reserved.
Shibata, Shumei; Miwa, Toru; Wu, Hsiao-Huei; Levitt, Pat
2016-01-01
The stria vascularis is a nonsensory structure that is essential for auditory hair cell function by maintaining potassium concentration of the scala media. During mouse embryonic development, a subpopulation of neural crest cell-derived melanocytes migrates and incorporates into a subregion of the cochlear epithelium, forming the intermediate cell layer of the stria vascularis. The relation of this developmental process to stria vascularis function is currently unknown. In characterizing the molecular differentiation of developing peripheral auditory structures, we discovered that hepatocyte growth factor (Hgf) is expressed in the future stria vascularis of the cochlear epithelium. Its receptor tyrosine kinase, c-Met, is expressed in the cochlear epithelium and melanocyte-derived intermediate cells in the stria vascularis. Genetic dissection of HGF signaling via c-MET reveals that the incorporation of the melanocytes into the future stria vascularis of the cochlear duct requires c-MET signaling. In addition, inactivation of either the ligand or receptor developmentally resulted in a profound hearing loss at young adult stages. These results suggest a novel connection between HGF signaling and deafness via melanocyte deficiencies. SIGNIFICANCE STATEMENT We found the roles of hepatocyte growth factor (HGF) signaling in stria vascularis development for the first time and that lack of HGF signaling in the inner ear leads to profound hearing loss in the mouse. Our findings reveal a novel mechanism that may underlie human deafness DFNB39 and DFNB97. Our findings reveal an additional example of context-dependent c-MET signaling diversity, required here for proper cellular invasion developmentally that is essential for specific aspects of auditory-related organogenesis. PMID:27488639
Fukuda, Takayuki; Takayama, Kazuo; Hirata, Mitsuhi; Liu, Yu-Jung; Yanagihara, Kana; Suga, Mika; Mizuguchi, Hiroyuki; Furue, Miho K
2017-03-15
Limited growth potential, narrow ranges of sources, and difference in variability and functions from batch to batch of primary hepatocytes cause a problem for predicting drug-induced hepatotoxicity during drug development. Human pluripotent stem cell (hPSC)-derived hepatocyte-like cells in vitro are expected as a tool for predicting drug-induced hepatotoxicity. Several studies have already reported efficient methods for differentiating hPSCs into hepatocyte-like cells, however its differentiation process is time-consuming, labor-intensive, cost-intensive, and unstable. In order to solve this problem, expansion culture for hPSC-derived hepatic progenitor cells, including hepatic stem cells and hepatoblasts which can self-renewal and differentiate into hepatocytes should be valuable as a source of hepatocytes. However, the mechanisms of the expansion of hPSC-derived hepatic progenitor cells are not yet fully understood. In this study, to isolate hPSC-derived hepatic progenitor cells, we tried to develop serum-free growth factor defined culture conditions using defined components. Our culture conditions were able to isolate and grow hPSC-derived hepatic progenitor cells which could differentiate into hepatocyte-like cells through hepatoblast-like cells. We have confirmed that the hepatocyte-like cells prepared by our methods were able to increase gene expression of cytochrome P450 enzymes upon encountering rifampicin, phenobarbital, or omeprazole. The isolation and expansion of hPSC-derived hepatic progenitor cells in defined culture conditions should have advantages in terms of detecting accurate effects of exogenous factors on hepatic lineage differentiation, understanding mechanisms underlying self-renewal ability of hepatic progenitor cells, and stably supplying functional hepatic cells. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Montesano, Roberto; Sarkoezi, Rita; Schramek, Herbert
2008-09-12
Bone morphogenetic proteins (BMPs) are multifunctional cytokines that elicit pleiotropic effects on biological processes such as cell proliferation, cell differentiation and tissue morphogenesis. With respect to cell proliferation, BMPs can exert either mitogenic or anti-mitogenic activities, depending on the target cells and their context. Here, we report that in low-density cultures of immortalized mammary epithelial cells, BMP-4 did not stimulate cell proliferation by itself. However, when added in combination with suboptimal concentrations of fibroblast growth factor (FGF)-2, FGF-7, FGF-10, epidermal growth factor (EGF) or hepatocyte growth factor (HGF), BMP-4 potently enhanced growth factor-induced cell proliferation. These results reveal a hithertomore » unsuspected interplay between BMP-4 and growth factors in the regulation of mammary epithelial cell proliferation. We suggest that the ability of BMP-4 to potentiate the mitogenic activity of multiple growth factors may contribute to mammary gland ductal morphogenesis as well as to breast cancer progression.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hinitt, C.A.M.; Wood, J.; Lee, S.S.
2010-08-01
Cell motility is important in maintaining tissue homeostasis, facilitating epithelial wound repair and in tumour formation and progression. The aim of this study was to determine whether BAG-1 isoforms regulate epidermal cell migration in in vitro models of wound healing. In the human epidermal cell line HaCaT, endogenous BAG-1 is primarily nuclear and increases with confluence. Both transient and stable p36-Bag-1 overexpression resulted in increased cellular cohesion. Stable transfection of either of the three human BAG-1 isoforms p36-Bag-1 (BAG-1S), p46-Bag-1 (BAG-1M) and p50-Bag-1 (BAG-1L) inhibited growth and wound closure in serum-containing medium. However, in response to hepatocyte growth factor (HGF)more » in serum-free medium, BAG-1S/M reduced communal motility and colony scattering, but BAG-1L did not. In the presence of HGF, p36-Bag-1 transfectants retained proliferative response to HGF with no change in ERK1/2 activation. However, the cells retained E-cadherin localisation at cell-cell junctions and exhibited pronounced cortical actin. Point mutations in the BAG domain showed that BAG-1 inhibition of motility is independent of its function as a chaperone regulator. These findings are the first to suggest that BAG-1 plays a role in regulating cell-cell adhesion and suggest an important function in epidermal cohesion.« less
Coudriet, Gina M; He, Jing; Trucco, Massimo; Mars, Wendy M; Piganelli, Jon D
2010-11-02
The generation of the pro-inflammatory cytokines IL-6, TNF-α, and IL-1β fuel the acute phase response (APR). To maintain body homeostasis, the increase of inflammatory proteins is resolved by acute phase proteins via presently unknown mechanisms. Hepatocyte growth factor (HGF) is transcribed in response to IL-6. Since IL-6 production promotes the generation of HGF and induces the APR, we posited that accumulating HGF might be a likely candidate for quelling excess inflammation under non-pathological conditions. We sought to assess the role of HGF and how it influences the regulation of inflammation utilizing a well-defined model of inflammatory activation, lipopolysaccharide (LPS)-stimulation of bone marrow derived macrophages (BMM). BMM were isolated from C57BL6 mice and were stimulated with LPS in the presence or absence of HGF. When HGF was present, there was a decrease in production of the pro-inflammatory cytokine IL-6, along with an increase in the anti-inflammatory cytokine IL-10. Altered cytokine production correlated with an increase in phosphorylated GSK3β, increased retention of the phosphorylated NFκB p65 subunit in the cytoplasm, and an enhanced interaction between CBP and phospho-CREB. These changes were a direct result of signaling through the HGF receptor, MET, as effects were reversed in the presence of a selective inhibitor of MET (SU11274) or when using BMM from macrophage-specific conditional MET knockout mice. Combined, these data provide compelling evidence that under normal circumstances, HGF acts to suppress the inflammatory response.
Hong, Zebin; De Meulemeester, Laura; Jacobi, Annemarie; Pedersen, Jan Skov; Morth, J Preben; Andreasen, Peter A; Jensen, Jan K
2016-07-01
Hepatocyte growth factor activator inhibitor-1 (HAI-1) is a type I transmembrane protein and inhibitor of several serine proteases, including hepatocyte growth factor activator and matriptase. The protein is essential for development as knock-out mice die in utero due to placental defects caused by misregulated extracellular proteolysis. HAI-1 contains two Kunitz-type inhibitor domains (Kunitz), which are generally thought of as a functionally self-contained protease inhibitor unit. This is not the case for HAI-1, where our results reveal how interdomain interactions have evolved to stimulate the inhibitory activity of an integrated Kunitz. Here we present an x-ray crystal structure of an HAI-1 fragment covering the internal domain and Kunitz-1. The structure reveals not only that the previously uncharacterized internal domain is a member of the polycystic kidney disease domain family but also how the two domains engage in interdomain interactions. Supported by solution small angle x-ray scattering and a combination of site-directed mutagenesis and functional assays, we show that interdomain interactions not only stabilize the fold of the internal domain but also stimulate the inhibitory activity of Kunitz-1. By completing our structural characterization of the previously unknown N-terminal region of HAI-1, we provide new insight into the interplay between tertiary structure and the inhibitory activity of a multidomain protease inhibitor. We propose a previously unseen mechanism by which the association of an auxiliary domain stimulates the inhibitory activity of a Kunitz-type inhibitor (i.e. the first structure of an intramolecular interaction between a Kunitz and another domain). © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Ha, Xiaoqin; Peng, Junhua; Zhao, Hongbin; Deng, Zhiyun; Dong, Juzi; Fan, Hongyan; Zhao, Yong; Li, Bing; Feng, Qiangsheng; Yang, Zhihua
2017-02-01
The present study developed an oral hepatocyte growth factor (HGF) gene therapy strategy for gastric ulcers treatment. An attenuated Salmonella typhimurium that stably expressed high HGF (named as TPH) was constructed, and the antiulcerogenic effect of TPH was evaluated in a rat model of gastric ulcers that created by acetic acid subserosal injection. From day 5 after injection, TPH (1 × 10⁹ cfu), vehicle (TP, 1 × 10⁹ cfu), or sodium bicarbonate (model control) was administered orally every alternate day for three times. Then ulcer size was measured at day 21 after ulcer induction. The ulcer area in TPH-treated group was 10.56 ± 3.30 mm², which was smaller when compared with those in the TP-treated and model control groups (43.47 ± 4.18 and 56.25 ± 6.38 mm², respectively). A higher level of reepithelialization was found in TPH-treated group and the crawling length of gastric epithelial cells was significantly longer than in the other two groups (P < 0.05). The microvessel density in the ulcer granulation tissues of the TPH-treated rats was 39.9 vessels/mm², which was greater than in the TP-treated and model control rats, with a significant statistical difference. These results suggest that TPH treatment significantly accelerates the healing of gastric ulcers via stimulating proliferation of gastric epithelial cells and enhancing angiogenesis on gastric ulcer site.
2017-01-01
The present study developed an oral hepatocyte growth factor (HGF) gene therapy strategy for gastric ulcers treatment. An attenuated Salmonella typhimurium that stably expressed high HGF (named as TPH) was constructed, and the antiulcerogenic effect of TPH was evaluated in a rat model of gastric ulcers that created by acetic acid subserosal injection. From day 5 after injection, TPH (1 × 109 cfu), vehicle (TP, 1 × 109 cfu), or sodium bicarbonate (model control) was administered orally every alternate day for three times. Then ulcer size was measured at day 21 after ulcer induction. The ulcer area in TPH-treated group was 10.56 ± 3.30 mm2, which was smaller when compared with those in the TP-treated and model control groups (43.47 ± 4.18 and 56.25 ± 6.38 mm2, respectively). A higher level of reepithelialization was found in TPH-treated group and the crawling length of gastric epithelial cells was significantly longer than in the other two groups (P < 0.05). The microvessel density in the ulcer granulation tissues of the TPH-treated rats was 39.9 vessels/mm2, which was greater than in the TP-treated and model control rats, with a significant statistical difference. These results suggest that TPH treatment significantly accelerates the healing of gastric ulcers via stimulating proliferation of gastric epithelial cells and enhancing angiogenesis on gastric ulcer site. PMID:28049228
Shih, Shou-Chuan; Ho, Tsung-Chuan; Chen, Show-Li; Tsao, Yeou-Ping
2016-01-01
Fibrogenesis is induced by repeated injury to the liver and reactive regeneration and leads eventually to liver cirrhosis. Pigment epithelium derived factor (PEDF) has been shown to prevent liver fibrosis induced by carbon tetrachloride (CCl4). A 44 amino acid domain of PEDF (44-mer) was found to have a protective effect against various insults to several cell types. In this study, we investigated the capability of synthetic 44-mer to protect against liver injury in mice and in primary cultured hepatocytes. Acute liver injury, induced by CCl4, was evident from histological changes, such as cell necrosis, inflammation and apoptosis, and a concomitant reduction of glutathione (GSH) and GSH redox enzyme activities in the liver. Intraperitoneal injection of the 44-mer into CCl4-treated mice abolished the induction of AST and ALT and markedly reduced histological signs of liver injury. The 44-mer treatment can reduce hepatic oxidative stress as evident from lower levels of lipid hydroperoxide, and higher levels of GSH. CCl4 caused a reduction of Bcl-xL, PEDF and PPARγ, which was markedly restored by the 44-mer treatment. Consequently, the 44-mer suppressed liver fibrosis induced by repeated CCl4 injury. Furthermore, our observations in primary culture of rat hepatocytes showed that PEDF and the 44-mer protected primary rat hepatocytes against apoptosis induced by serum deprivation and TGF-β1. PEDF/44-mer induced cell protective STAT3 phosphorylation. Pharmacological STAT3 inhibition prevented the antiapoptotic action of PEDF/44-mer. Among several PEDF receptor candidates that may be responsible for hepatocyte protection, we demonstrated that PNPLA2 was essential for PEDF/44-mer-mediated STAT3 phosphorylation and antiapoptotic activity by using siRNA to selectively knockdown PNPLA2. In conclusion, the PEDF 44-mer protects hepatocytes from single and repeated CCl4 injury. This protective effect may stem from strengthening the counter oxidative stress capacity and
Kindrachuk, Jason; Wahl-Jensen, Victoria; Safronetz, David; Trost, Brett; Hoenen, Thomas; Arsenault, Ryan; Feldmann, Friederike; Traynor, Dawn; Postnikova, Elena; Kusalik, Anthony; Napper, Scott; Blaney, Joseph E; Feldmann, Heinz; Jahrling, Peter B
2014-09-01
Ebola virus (EBOV) causes a severe hemorrhagic disease in humans and nonhuman primates, with a median case fatality rate of 78.4%. Although EBOV is considered a public health concern, there is a relative paucity of information regarding the modulation of the functional host response during infection. We employed temporal kinome analysis to investigate the relative early, intermediate, and late host kinome responses to EBOV infection in human hepatocytes. Pathway overrepresentation analysis and functional network analysis of kinome data revealed that transforming growth factor (TGF-β)-mediated signaling responses were temporally modulated in response to EBOV infection. Upregulation of TGF-β signaling in the kinome data sets correlated with the upregulation of TGF-β secretion from EBOV-infected cells. Kinase inhibitors targeting TGF-β signaling, or additional cell receptors and downstream signaling pathway intermediates identified from our kinome analysis, also inhibited EBOV replication. Further, the inhibition of select cell signaling intermediates identified from our kinome analysis provided partial protection in a lethal model of EBOV infection. To gain perspective on the cellular consequence of TGF-β signaling modulation during EBOV infection, we assessed cellular markers associated with upregulation of TGF-β signaling. We observed upregulation of matrix metalloproteinase 9, N-cadherin, and fibronectin expression with concomitant reductions in the expression of E-cadherin and claudin-1, responses that are standard characteristics of an epithelium-to-mesenchyme-like transition. Additionally, we identified phosphorylation events downstream of TGF-β that may contribute to this process. From these observations, we propose a model for a broader role of TGF-β-mediated signaling responses in the pathogenesis of Ebola virus disease. Ebola virus (EBOV), formerly Zaire ebolavirus, causes a severe hemorrhagic disease in humans and nonhuman primates and is the most
Wahl-Jensen, Victoria; Safronetz, David; Trost, Brett; Hoenen, Thomas; Arsenault, Ryan; Feldmann, Friederike; Traynor, Dawn; Postnikova, Elena; Kusalik, Anthony; Napper, Scott; Blaney, Joseph E.; Feldmann, Heinz; Jahrling, Peter B.
2014-01-01
ABSTRACT Ebola virus (EBOV) causes a severe hemorrhagic disease in humans and nonhuman primates, with a median case fatality rate of 78.4%. Although EBOV is considered a public health concern, there is a relative paucity of information regarding the modulation of the functional host response during infection. We employed temporal kinome analysis to investigate the relative early, intermediate, and late host kinome responses to EBOV infection in human hepatocytes. Pathway overrepresentation analysis and functional network analysis of kinome data revealed that transforming growth factor (TGF-β)-mediated signaling responses were temporally modulated in response to EBOV infection. Upregulation of TGF-β signaling in the kinome data sets correlated with the upregulation of TGF-β secretion from EBOV-infected cells. Kinase inhibitors targeting TGF-β signaling, or additional cell receptors and downstream signaling pathway intermediates identified from our kinome analysis, also inhibited EBOV replication. Further, the inhibition of select cell signaling intermediates identified from our kinome analysis provided partial protection in a lethal model of EBOV infection. To gain perspective on the cellular consequence of TGF-β signaling modulation during EBOV infection, we assessed cellular markers associated with upregulation of TGF-β signaling. We observed upregulation of matrix metalloproteinase 9, N-cadherin, and fibronectin expression with concomitant reductions in the expression of E-cadherin and claudin-1, responses that are standard characteristics of an epithelium-to-mesenchyme-like transition. Additionally, we identified phosphorylation events downstream of TGF-β that may contribute to this process. From these observations, we propose a model for a broader role of TGF-β-mediated signaling responses in the pathogenesis of Ebola virus disease. IMPORTANCE Ebola virus (EBOV), formerly Zaire ebolavirus, causes a severe hemorrhagic disease in humans and nonhuman
Chen, Tsan-Chi; Chang, Shu-Wen
2010-03-01
To investigate how mitomycin C (MMC) modulates hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) secretions in human corneal fibroblasts and regulates human corneal epithelial (HCE) cell migration. Primary human corneal fibroblasts were treated with MMC (0.05, 0.1, or 0.2 mg/mL for 5 minutes) and were cultivated with or without interleukin (IL)-1beta. Transcript and secretion of HGF and KGF were determined by quantitative real-time RT-PCR and Western blot analysis, respectively. The effect of MMC-treated fibroblasts on HCE cell migration was evaluated using a transwell migration assay. The influence of MMC on HGF expression/secretion and HCE cell migration was further confirmed by RNA interference. The number of IL-1 receptors (IL-1R) on the fibroblast surface was analyzed by flow cytometry. MMC alone did not affect endogenous HGF expression, whereas IL-1beta alone significantly upregulated HGF transcripts and secretion. By modifying IL-1R numbers, MMC further upregulated IL-1beta-related HGF expression at a concentration of 0.05 mg/mL but to a lesser extent at 0.1 and 0.2 mg/mL. KGF transcripts and intracellular expression were suppressed by MMC dose dependently in the presence or absence of IL-1beta, whereas KGF secretion was not affected. Conditioned medium from MMC-treated fibroblasts exerted a similar concentration-dependent effect on HCE cell migration, enhancing migration most significantly at 0.05 mg/mL MMC in the presence of IL-1beta. The MMC dose-dependent modulation of HCE cell migration was abolished in HGF-silenced fibroblasts. MMC differentially modulated IL-1R expression at various concentrations and regulated HGF and KGF differently. MMC alone did not alter HGF expression. In the presence of IL-1beta, MMC-treated corneal fibroblasts modified HCE cell migration through IL-1beta-induced HGF secretion.
Perge, Péter; Boros, András Mihály; Szilágyi, Szabolcs; Zima, Endre; Molnár, Levente; Gellér, László; Prohászka, Zoltán; Merkely, Béla; Széplaki, Gábor
2018-03-23
Cardiac resynchronization therapy (CRT) is beneficial for selected heart failure (HF) patients, although nonresponse to therapy is still prevalent. We investigated a set of novel biomarkers associated with various pathophysiological pathways of HF. Our purpose was to assess their ability to predict clinical outcomes after CRT. We studied 136 chronic HF patients undergoing CRT. We measured the plasma levels of fractalkine, pentraxin-3, hepatocyte growth factor (HGF), carbohydrate antigen-125, and matrix metalloproteinase-9 before and 6 months after CRT. The primary endpoint of the study was 5-year all-cause mortality, and we considered the absence of 6-month reverse remodelling (defined as at least a 15% decrease in end-systolic volume) as a secondary endpoint. Fifty-eight patients died during the 5-year follow-up period and 66 patients were categorized as nonresponders. In multivariable models, only an increased HGF was an independent predictor of both mortality (HR, 1.35; 95%CI, 1.11-1.64; P=.003; per 1 standard deviation increase) and the absence of reverse remodelling (OR, 1.83; 95%CI, 1.10-3.04; P=.01; per 1 standard deviation increase). Applying HGF to the basic multivariable model of both mortality (net reclassification improvement=0.69; 95%CI, 0.39-0.99; P<.0001; integrated discrimination improvement=0.06; 95%CI, 0.02-0.11) and reverse remodelling (net reclassification improvement=0.39; 95%CI, 0.07-0.71; P=.01; integrated discrimination improvement=0.03; 95%CI, 0.00-0.06) resulted in a statistically significant reclassification and discrimination improvement. Of the investigated biomarkers, only HGF predicted clinical outcomes following CRT independently of other parameters. Reclassification analyses showed that HGF measurements could be useful in refining patient selection. Copyright © 2018 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.
Ding, Jianqiang; Yannam, Govardhana R.; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I.; Wong, Ronald J.; Avsar, Yesim; Guha, Chandan; Perlmutter, David H.; Fox, Ira J.; Roy-Chowdhury, Jayanta
2011-01-01
α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z–expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%–98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z–expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals. PMID:21505264
Ding, Jianqiang; Yannam, Govardhana R; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I; Wong, Ronald J; Avsar, Yesim; Guha, Chandan; Perlmutter, David H; Fox, Ira J; Roy-Chowdhury, Jayanta
2011-05-01
α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z-expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%-98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z-expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals.
Xie, Zhihui; Eagleson, Kathie L.
2016-01-01
MET, a pleiotropic receptor tyrosine kinase implicated in autism risk, influences multiple neurodevelopmental processes. There is a knowledge gap, however, in the molecular mechanism through which MET mediates developmental events related to disorder risk. In the neocortex, MET is expressed transiently during periods of peak dendritic outgrowth and synaptogenesis, with expression enriched at developing synapses, consistent with demonstrated roles in dendritic morphogenesis, modulation of spine volume, and excitatory synapse development. In a recent coimmunoprecipitation/mass spectrometry screen, β-catenin was identified as part of the MET interactome in developing neocortical synaptosomes. Here, we investigated the influence of the MET/β-catenin complex in mouse neocortical synaptogenesis. Western blot analysis confirms that MET and β-catenin coimmunoprecipitate, but N-cadherin is not associated with the MET complex. Following stimulation with hepatocyte growth factor (HGF), β-catenin is phosphorylated at tyrosine142 (Y142) and dissociates from MET, accompanied by an increase in β-catenin/N-cadherin and MET/synapsin 1 protein complexes. In neocortical neurons in vitro, proximity ligation assays confirmed the close proximity of these proteins. Moreover, in neurons transfected with synaptophysin-GFP, HGF stimulation increases the density of synaptophysin/bassoon (a presynaptic marker) and synaptophysin/PSD-95 (a postsynaptic marker) clusters. Mutation of β-catenin at Y142 disrupts the dissociation of the MET/β-catenin complex and prevents the increase in clusters in response to HGF. The data demonstrate a new mechanism for the modulation of synapse formation, whereby MET activation induces an alignment of presynaptic and postsynaptic elements that are necessary for assembly and formation of functional synapses by subsets of neocortical neurons that express MET/β-catenin complex. PMID:27595133
Li, Chuan-jiang; Yu, Li-xin; Xu, Jian; Fu, Shao-jie; Deng, Wen-feng; Du, Chuan-fu; Wang, Yi-bin
2008-02-01
To study the value of detection of both preoperative soluble CD30 (sCD30) and hepatocyte growth factor (HGF) level 5 days after transplantation in the diagnosis of acute rejection of renal allograft. Preoperative serum sCD30 levels and HGF level 5 days after transplantation were determined in 65 renal-transplant recipients using enzyme-linked immunosorbent assay. The recipients were divided according to the sCD30 levels positivity. Receiver operating characteristic (ROC) curves were used to assess the value of HGF level on day 5 posttransplantation for diagnosis of acute renal allograft rejection, and the value of combined assay of the sCD30 and HGF levels was also estimated. After transplantation, 26 recipients developed graft rejection and 39 had uneventful recovery without rejection. With the cut-off value of sCD30 of 120 U/ml, the positivity rate of sCD30 was significantly higher in recipients with graft rejection than in those without (61.5% vs 17.9%, P<0.05). Recipients with acute rejection showed also significantly higher HGF levels on day 5 posttransplantation than those without rejection (P<0.05). ROC curve analysis indicated that HGF levels on day 5 posttransplantation was a good marker for diagnosis of acute renal allograft rejection, and at the cut-off value of 90 ug/L, the diagnostic sensitivity was 84.6% and specificity 76.9%. Evaluation of both the sCD30 and HGF levels significantly enhanced the diagnostic accuracy of acute graft rejection. Combined assay of serum sCD30 and HGF levels offers a useful means for diagnosis of acute renal allograft rejection.
Three Dimensional Primary Hepatocyte Culture
NASA Technical Reports Server (NTRS)
Yoffe, Boris
1998-01-01
Our results demonstrated for the first time the feasibility of culturing PHH in microgravity bioreactors that exceeded the longest period obtained using other methods. Within the first week of culture, isolated hepatocytes started to form aggregates, which continuously increased in size (up to 1 cm) and macroscopically appeared as a multidimensional tissue-like assembly. To improve oxygenation and nutrition within the spheroids we performed experiments with the biodegradable nonwoven fiber-based polymers made from PolyGlycolic Acid (PGA). It has been shown that PGA scaffolds stimulate isolated cells to regenerate tissue with defined sizes and shapes and are currently being studied for various tissue-engineering applications. Our data demonstrated that culturing hepatocytes in the presence of PGA scaffolds resulted in more efficient cell assembly and formations of larger cell spheroids (up to 3 cm in length, see figure). The histology of cell aggregates cultured with PGA showed polymer fibers with attached hepatocytes. We initiated experiments to co-culture primary human hepatocytes with human microvascular endothelial cells in the bioreactor. The presence of endothelial cells in co-cultures were established by immunohistochemistry using anti-CD34 monoclonal Ab. Our preliminary data demonstrated that cultures of purified hepatocytes with human microvascular endothelial cells exhibited better growth and expressed higher levels of albumin MRNA for a longer period of time than cultures of ppfified, primary human hepatocytes cultured alone. We also evaluated microsomal deethylation activity of hepatocytes cultured in the presence of endothelial cells.In summary, we have established liver cell culture, which mimicked the structure and function of the parent tissue.
WANG, DONGDONG; SAGA, YASUSHI; SATO, NAOTO; NAKAMURA, TOSHIKAZU; TAKIKAWA, OSAMU; MIZUKAMI, HIROAKI; MATSUBARA, SHIGEKI; FUJIWARA, HIROYUKI
2016-01-01
Indoleamine-2,3-dioxygenase (IDO) is an immunosuppressive enzyme involved in tumor malignancy. However, the regulatory mechanism underlying its involvement remains largely uncharacterized. The present study aimed to investigate the hypothesis that NK4, an antagonist of hepatocyte growth factor (HGF), can regulate IDO and to characterize the signaling mechanism involved. Following successful transfection of the human ovarian cancer cell line SKOV-3 (which constitutively expresses IDO) with an NK4 expression vector, we observed that NK4 expression suppressed IDO expression; furthermore, NK4 expression did not suppress cancer cell growth in vitro [in the absence of natural killer (NK) cells], but did influence tumor growth in vivo. In addition, NK4 enhanced the sensitivity of cancer cells to NK cells in vitro and promoted NK cell accumulation in the tumor stroma in vivo. In an effort to clarify the mechanisms by which NK4 interacts with IDO, we performed investigations utilizing various biochemical inhibitors. The results of these investigations were as follows. First, c-Met (a receptor of HGF) tyrosine kinase inhibitor PHA-665752, and phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 both suppress IDO expression. Second, enhanced expression of PTEN (a known tumor suppressor) via negative regulation within a PI3K-AKT pathway, inhibits IDO expression. Conversely, neither the MEK1/2 inhibitor U0126 nor the STAT3 inhibitor WP1066 affects IDO expression. These results suggest that NK4 inhibits IDO expression via a c-Met-PI3K-AKT signaling pathway. PMID:27082119
Pan, XiaoPing; Wang, Yini; Yu, XiaoPeng; Li, JianZhou; Zhou, Ning; Du, WeiBo; Zhang, YanHong; Cao, HongCui; Zhu, DanHua; Chen, Yu; Li, LanJuan
2015-01-01
Background and objective. The liver-specific functions of hepatocytes are improved by co-culturing hepatocytes with primary hepatic stellate cells (HSC). However, primary HSC have a short lifespan in vitro, which is considered a major limitation for their use in various applications. This study aimed to establish immortalized human HSC using the simian virus 40 large T antigen (SV40LT) for applications in co-culturing with hepatocytes and HSC in vitro. Methods. Primary human HSC were transfected with a recombinant retrovirus containing SV40LT. The immortalized human HSC were characterized by analyzing their gene expression and functional characteristics. The liver-specific functions of hepatocytes were evaluated in a co-culture system incorporating immortalized human hepatocytes with HSC-Li cells. Results. The immortalized HSC line, HSC-Li, was obtained after infection with a recombinant retrovirus containing SV40LT. The HSC-Li cells were longitudinally spindle-like and had numerous fat droplets in their cytoplasm as shown using electron microscopy. Hepatocyte growth factor (HGF), VEGF Receptor 1(Flt-1), collagen type Iα1 and Iα2 mRNA expression levels were observed in the HSC-Li cells by RT-PCR. Immunofluorescence staining showed that the HSC-Li cells were positive for α-smooth muscle actin (α-SMA), platelet-derived growth factor receptor-beta (PDGFR-β), vimentin, and SV40LT protein expression. The HSC-Li cells produced both HGF and transforming growth factor-beta1 (TGF-β1) in a time-dependent manner. Real-time PCR showed that albumin, CYP3A5, CYP2E1, and UGT2B7 mRNA expression generally increased in the co-culture system. The enzymatic activity of CYP1A2 under the co-culture conditions also generally increased as compared to the monoculture of immortalized human hepatocytes. Conclusions. We successfully established the immortalized human HSC cell line HSC-Li. It has the specific phenotypic and functional characteristics of primary human HSC, which would be
Pan, XiaoPing; Wang, Yini; Yu, XiaoPeng; Li, JianZhou; Zhou, Ning; Du, WeiBo; Zhang, YanHong; Cao, HongCui; Zhu, DanHua; Chen, Yu; Li, LanJuan
2015-01-01
The liver-specific functions of hepatocytes are improved by co-culturing hepatocytes with primary hepatic stellate cells (HSC). However, primary HSC have a short lifespan in vitro, which is considered a major limitation for their use in various applications. This study aimed to establish immortalized human HSC using the simian virus 40 large T antigen (SV40LT) for applications in co-culturing with hepatocytes and HSC in vitro. Primary human HSC were transfected with a recombinant retrovirus containing SV40LT. The immortalized human HSC were characterized by analyzing their gene expression and functional characteristics. The liver-specific functions of hepatocytes were evaluated in a co-culture system incorporating immortalized human hepatocytes with HSC-Li cells. The immortalized HSC line, HSC-Li, was obtained after infection with a recombinant retrovirus containing SV40LT. The HSC-Li cells were longitudinally spindle-like and had numerous fat droplets in their cytoplasm as shown using electron microscopy. Hepatocyte growth factor (HGF), VEGF Receptor 1(Flt-1), collagen type Iα1 and Iα2 mRNA expression levels were observed in the HSC-Li cells by RT-PCR. Immunofluorescence staining showed that the HSC-Li cells were positive for α-smooth muscle actin (α-SMA), platelet-derived growth factor receptor-beta (PDGFR-β), vimentin, and SV40LT protein expression. The HSC-Li cells produced both HGF and transforming growth factor-beta1 (TGF-β1) in a time-dependent manner. Real-time PCR showed that albumin, CYP3A5, CYP2E1, and UGT2B7 mRNA expression generally increased in the co-culture system. The enzymatic activity of CYP1A2 under the co-culture conditions also generally increased as compared to the monoculture of immortalized human hepatocytes. We successfully established the immortalized human HSC cell line HSC-Li. It has the specific phenotypic and functional characteristics of primary human HSC, which would be a useful tool to develop anti-fibrotic therapies. Co
Visiedo, F; Bugatto, F; Carrasco-Fernández, C; Sáez-Benito, A; Mateos, R M; Cózar-Castellano, I; Bartha, J L; Perdomo, G
2015-04-01
To evaluate the impact of the pro-inflammatory cytokine hepatocyte growth factor (HGF) on the regulation of glucose and lipid placental metabolism. HGF levels were quantified in amniotic fluid and placenta from control and obese women. 2-deoxy-glucose (2-DOG) uptake, glycolysis, fatty acid oxidation (FAO), fatty acid esterification, de novo fatty acid synthesis, triglyceride levels and carnitine palmitoyltransferase activities (CPT) were measured in placental explants upon addition of pathophysiological HGF levels. In obese women, total- and -activated-HGF levels in amniotic fluid were elevated ∼24%, and placental HGF levels were ∼3-fold higher than in control women. At a similar dose to that present in amniotic fluid of obese women, HGF (30 ng/mL) increased Glut-1 levels and 2-DOG uptake by ∼25-30% in placental explants. HGF-mediated effect on 2-DOG uptake was dependent on the activation of phosphatidylinositol 3-kinase signaling pathway. In addition, HGF decreased ∼20% FAO, whereas esterification and de novo fatty acid synthesis increased ∼15% and ∼25% respectively, leading to 2-fold triglyceride accumulation in placental explants. In parallel, HGF reduced CPT-I activity ∼70%. HGF is a cytokine elevated in amniotic fluid and placental tissue of obese women, which through its ability to stimulate 2-DOG uptake and metabolism impairs FAO and enhances esterification and de novo fatty acid synthesis, leading to accumulation of placental triglycerides. Copyright © 2015 Elsevier Ltd. All rights reserved.
Chaparro, Rafael E; Izutsu, Miwa; Sasaki, Toshihiro; Sheng, Huaxin; Zheng, Yi; Sadeghian, Homa; Qin, Tao; von Bornstadt, Daniel; Herisson, Fanny; Duan, Bin; Li, Jing-Song; Jiang, Kai; Pearlstein, Molly; Pearlstein, Robert D; Smith, David E; Goldberg, Itzhak D; Ayata, Cenk; Warner, David S
2015-01-01
Hepatocyte growth factor (HGF), efficacious in preclinical models of acute central nervous system injury, is burdened by administration of full-length proteins. A multiinstitutional consortium investigated the efficacy of BB3, a small molecule with HGF-like activity that crosses the blood–brain barrier in rodent focal ischemic stroke using Stroke Therapy Academic Industry Roundtable (STAIR) and Good Laboratory Practice guidelines. In rats, BB3, begun 6 hours after temporary middle cerebral artery occlusion (tMCAO) reperfusion, or permanent middle cerebral artery occlusion (pMCAO) onset, and continued for 14 days consistently improved long-term neurologic function independent of sex, age, or laboratory. BB3 had little effect on cerebral infarct size and no effect on blood pressure. BB3 increased HGF receptor c-Met phosphorylation and synaptophysin expression in penumbral tissue consistent with a neurorestorative mechanism from HGF-like activity. In mouse tMCAO, BB3 starting 10 minutes after reperfusion and continued for 14 days improved neurologic function that persisted for 8 weeks in some, but not all measures. Study in animals with comorbidities and those exposed to common stroke drugs are the next steps to complete preclinical assessment. These data, generated in independent, masked, and rigorously controlled settings, are the first to suggest that the HGF pathway can potentially be harnessed by BB3 for neurologic benefit after ischemic stroke. PMID:25712497
Optimization of upcyte® human hepatocytes for the in vitro micronucleus assay.
Nörenberg, Astrid; Heinz, Stefan; Scheller, Katharina; Hewitt, Nicola J; Braspenning, Joris; Ott, Michael
2013-12-12
"Upcyte(®) human hepatocytes" have the unique property of combining proliferation with the expression of drug metabolising activities. In our current study, we evaluated whether these cells would be suitable for early in vitro micronucleus (MN) tests. A treatment period of 96 h without a recovery period was most reliable for detecting MN formation in upcyte(®) hepatocytes from Donor 740. The basal MN rate in upcyte(®) hepatocytes varied considerably between donors (7-28%); therefore, modifications to the assay medium were tested to determine whether they could decrease inherent MN formation. Optimal medium supplements were 10 ng/ml oncostatin M for the pre-culture and recovery periods and 25 ng/ml epidermal growth factor and 10 ng/ml oncostatin M for the treatment period. Using the optimised conditions and outcome criteria, the upcyte(®) hepatocyte MN assay could correctly identify directly acting (e.g. mitomycin C, etoposide) and metabolically activated genotoxins (e.g. benzo[a]pyrene, cyclophosphamide). "True negative" and "false positive" compounds were also correctly identified as negative. The basal %MN in upcyte(®) hepatocytes from Donor 740 treated with DMSO, cyclophosphamide or MMC, was essentially unaffected by the growth stage ranging from population doublings of 14-61, suggesting that billions of cells could be produced from a single donor for standardised drug toxicity testing. In conclusion, we have established and optimised an in vitro MN test by using upcyte(®) hepatocytes to correctly identify known direct and metabolically activated genotoxicants as well as "false positives" and true negative compounds. The almost unlimited supply of cells from a single donor and optimised test conditions increase reproducibility in early and more predictive in vitro MN tests. Copyright © 2013 Elsevier B.V. All rights reserved.
Free Fatty Acids Shift Insulin-induced Hepatocyte Proliferation towards CD95-dependent Apoptosis*
Sommerfeld, Annika; Reinehr, Roland; Häussinger, Dieter
2015-01-01
Insulin is known to induce hepatocyte swelling, which triggers via integrins and c-Src kinase an activation of the epidermal growth factor receptor (EGFR) and subsequent cell proliferation (1). Free fatty acids (FFAs) are known to induce lipoapoptosis in liver cells in a c-Jun-NH2-terminal kinase (JNK)-dependent, but death receptor-independent way (2). As non-alcoholic steatohepatitis (NASH) is associated with hyperinsulinemia and increased FFA-blood levels, the interplay between insulin and FFA was studied with regard to hepatocyte proliferation and apoptosis in isolated rat and mouse hepatocytes. Saturated long chain FFAs induced apoptosis and JNK activation in primary rat hepatocytes, but did not activate the CD95 (Fas, APO-1) system, whereas insulin triggered EGFR activation and hepatocyte proliferation. Coadministration of insulin and FFAs, however, abolished hepatocyte proliferation and triggered CD95-dependent apoptosis due to a JNK-dependent association of the activated EGFR with CD95, subsequent CD95 tyrosine phosphorylation and formation of the death-inducing signaling complex (DISC). JNK inhibition restored the proliferative insulin effect in presence of FFAs and prevented EGFR/CD95 association, CD95 tyrosine phosphorylation and DISC formation. Likewise, in presence of FFAs insulin increased apoptosis in hepatocytes from wild type but not from Alb-Cre-FASfl/fl mice, which lack functional CD95. It is concluded that FFAs can shift insulin-induced hepatocyte proliferation toward hepatocyte apoptosis by triggering a JNK signal, which allows activated EGFR to associate with CD95 and to trigger CD95-dependent apoptosis. Such phenomena may contribute to the pathogenesis of NASH. PMID:25548285
Fetal liver-derived mesenchymal stromal cells augment engraftment of transplanted hepatocytes
Joshi, Meghnad; Patil, Pradeep B.; He, Zhong; Holgersson, Jan; Olausson, Michael; Sumitran-Holgersson, Suchitra
2012-01-01
Background aims One important problem commonly encountered after hepatocyte transplantation is the low numbers of transplanted cells found in the graft. If hepatocyte transplantation is to be a viable therapeutic approach, significant liver parenchyma repopulation is required. Mesenchymal stromal cells (MSC) produce high levels of various growth factors, cytokines and metalloproteinases, and have immunomodulatory effects. We therefore hypothesized that co-transplantation of MSC with human fetal hepatocytes (hFH) could augment in vivo expansion after transplantation. We investigated the ability of human fetal liver MSC (hFLMSC) to augment expansion of phenotypically and functionally well-characterized hFH. Methods Two million hFH (passage 6) were either transplanted alone or together (1:1 ratio) with green fluorescence protein-expressing hFLMSC into the spleen of C57BL/6 nude mice with retrorsine-induced liver injury. Results After 4 weeks, engraftment of cells was detected by fluorescence in situ hybridization using a human-specific DNA probe. Significantly higher numbers of cells expressing human cytokeratin (CK)8, CK18, CK19, Cysteine-rich MNNG HOS Transforming gene (c-Met), alpha-fetoprotein (AFP), human nuclear antigen, mitochondrial antigen, hepatocyte-specific antigen and albumin (ALB) were present in the livers of recipient animals co-transplanted with hFLMSC compared with those without. Furthermore, expression of human hepatocyte nuclear factor (HNF)-4α and HNF-1β, and cytochrome P450 (CYP) 3A7 mRNA was demonstrated by reverse transcriptase-polymerase chain reaction (RT-PCR) in these animals. In addition, significantly increased amounts of human ALB were detected. Importantly, hFLMSC did not transdifferentiate into hepatocytes. Conclusions Our study reports the use of a novel strategy for enhanced liver repopulation and thereby advances this experimental procedure closer to clinical liver cell therapy. PMID:22424216
Auth, Marcus K.H.; Boost, Kim A.; Leckel, Kerstin; Beecken, Wolf-Dietrich; Engl, Tobias; Jonas, Dietger; Oppermann, Elsie; Hilgard, Philip; Markus, Bernd H.; Bechstein, Wolf-Otto; Blaheta, Roman A.
2005-01-01
AIM: Clinical application of human hepatocytes (HC) is hampered by the progressive loss of growth and differentiation in vitro. The object of the study was to evaluate the effect of a biphasic culture technique on expression and activation of growth factor receptors and differentiation of human adult HC. METHODS: Isolated HC were sequentially cultured in a hormone enriched differentiation medium (DM) containing nicotinamide, insulin, transferrin, selenium, and dexame-thasone or activation medium (AM) containing hepatocyte growth factor (HGF), epidermal growth factor (EGF), and granulocyte-macrophage colony-stimulating factor (GM-CSF). Expression, distribution and activation of the HC receptors (MET and EGFR) and the pattern of characteristic cytokeratin (CK) filaments were measured by fluorometry, confocal microscopy and Western blotting. RESULTS: In the biphasic culture system, HC underwent repeated cycles of activation (characterized by expression and activation of growth factor receptors) and re-differentiation (illustrated by distribution of typical filaments CK-18 but low or absent expression of CK-19). In AM increased expression of MET and EGFR was associated with receptor translocation into the cytoplasm and induction of atypical CK-19. In DM low expression of MET and EGFR was localized on the cell membrane and CK-19 was reduced. Receptor phosphorylation required embedding of HC in collagen type I gel. CONCLUSION: Control and reversible modulation of growth factor receptor activation of mature human HC can be accomplished in vitro, when defined signals from the extracellular matrix and sequential growth stimuli are provided. The biphasic technique helps overcome de-differentiation, which occurs during continuous stimulation by means of growth factors. PMID:15810072
Auth, Marcus-K H; Boost, Kim A; Leckel, Kerstin; Beecken, Wolf-Dietrich; Engl, Tobias; Jonas, Dietger; Oppermann, Elsie; Hilgard, Philip; Markus, Bernd H; Bechstein, Wolf-Otto; Blaheta, Roman A
2005-04-14
Clinical application of human hepatocytes (HC) is hampered by the progressive loss of growth and differentiation in vitro. The object of the study was to evaluate the effect of a biphasic culture technique on expression and activation of growth factor receptors and differentiation of human adult HC. Isolated HC were sequentially cultured in a hormone enriched differentiation medium (DM) containing nicotinamide, insulin, transferrin, selenium, and dexame-thasone or activation medium (AM) containing hepatocyte growth factor (HGF), epidermal growth factor (EGF), and granulocyte-macrophage colony-stimulating factor (GM-CSF). Expression, distribution and activation of the HC receptors (MET and EGFR) and the pattern of characteristic cytokeratin (CK) filaments were measured by fluorometry, confocal microscopy and Western blotting. In the biphasic culture system, HC underwent repeated cycles of activation (characterized by expression and activation of growth factor receptors) and re-differentiation (illustrated by distribution of typical filaments CK-18 but low or absent expression of CK-19). In AM increased expression of MET and EGFR was associated with receptor translocation into the cytoplasm and induction of atypical CK-19. In DM low expression of MET and EGFR was localized on the cell membrane and CK-19 was reduced. Receptor phosphorylation required embedding of HC in collagen type I gel. Control and reversible modulation of growth factor receptor activation of mature human HC can be accomplished in vitro, when defined signals from the extracellular matrix and sequential growth stimuli are provided. The biphasic technique helps overcome de-differentiation, which occurs during continuous stimulation by means of growth factors.
Liu, Shuyun; Zhang, Lanlan; Cheng, Jingqiu; Lu, Yanrong; Liu, Jingping
2016-01-01
Inflammatory response is a major cause of grafts dysfunction in islet transplantation. Hepatocyte growth factor (HGF) had shown anti-inflammatory activity in multiple diseases. In this study, we aim to deliver HGF by self-assembling peptide/heparin (SAP/Hep) hybrid gel to protect β-cell from inflammatory injury. The morphological and slow release properties of SAPs were analyzed. Rat INS-1 β-cell line was treated with tumor necrosis factor α in vitro and transplanted into rat kidney capsule in vivo, and the viability, apoptosis, function, and inflammation of β-cells were evaluated. Cationic KLD1R and KLD2R self-assembled to nanofiber hydrogel, which showed higher binding affinity for Hep and HGF because of electrostatic interaction. Slow release of HGF from cationic SAP/Hep gel is a two-step mechanism involving binding affinity with Hep and molecular diffusion. In vitro and in vivo results showed that HGF-loaded KLD2R/Hep gel promoted β-cell survival and insulin secretion, and inhibited cell apoptosis, cytokine release, T-cell infiltration, and activation of NFκB/p38 MAPK pathways in β-cells. This study suggested that SAP/Hep gel is a promising carrier for local delivery of bioactive proteins in islet transplantation. PMID:27729786
Ping, Jian; Chen, Hong-Yun; Yang, Zhou; Yang, Cheng; Xu, Lie-Ming
2014-03-01
To observe the effect of Yiguan Decoction (YGD) on differentiation of bone marrow mesenchymal stem cells (BMSCs) into hepatocyte-like cells in vitro. Rat BMSCs were isolated using whole bone marrow adherent method. The properties of BMSCs were identified by analyzing the expression of surface cytokines by flow cytometry. The third passage cells were differentiated into fat cells to identify their features. BMSCs were incubated with hepatocyte growth factor (HGF) plus fibroblast growth factor 4 (FGF4) or YGD containing serum YGD for 21 days. The mRNA expression of alpha-fetoprotein (alphaAFP), albumin (Alb), and hepatocyte nuclear factor 4alpha (HNF4alpha) were detected by real time PCR. Expression of AFP and cytokeratin 18 (CK18) protein was detected by cell immunofluorescence. Glycogen synthesis was observed using periodic acid-Schiff stain (PAS). CK18, Wnt 3alpha, and alphacatenin protein expressions were detected by Western blot. High expression of CD90, CD29, and CD44, and low expression of CD34 and CD11b were observed in BMSCs isolated by whole bone mar- row adherent method, and numerous lipid droplets were observed in BMSCs using oil red O staining. Both YGD containing serum and growth factor stimulated the expression levels of Alb, AFP, HNF4alpha mRNA and CK18 protein. The down-regulated expression of Wnt 3alpha and beta-catenin could be detected at 21 days after induction. The synthesized glycogen granule could be seen. Down-regulated Wnt 3alpha and beta-catenin expression could also be observed. YGD could induce the differentiation of rat BMSCs into hepatocyte-like cells, which was related to down-regulating Wnt/beta-catenin signal pathway.
Ise, Hirohiko; Nikaido, Toshio; Negishi, Naoki; Sugihara, Nobuhiro; Suzuki, Fumitaka; Akaike, Toshihiro; Ikeda, Uichi
2004-01-01
Development of a reliable method of isolating highly proliferative potential hepatocytes provides information crucial to progress in the field of hepatocyte transplantation. The aim of this study was to develop reliable hepatocyte transplantation using highly proliferative, eg, progenitor-like hepatocytes, based on asialoglycoprotein receptor (ASGPR) expression levels for hepatocyte transplantation. We have previously reported that mouse hepatocytes with low ASGPR expression levels have highly proliferative potential and can be used as progenitor-like hepatocytes. We therefore fractionated F344 male rat hepatocytes expressing low and high levels of ASGPR and determined the liver repopulation capacity of hepatocytes according to low and high ASGPR expression in the liver. Next, 2 × 105 cells of each type were transplanted into female liver regenerative model dipeptidyl peptidase-deficient rats, and we estimated the rate of liver repopulation by the transplanted hepatocytes in the host liver, as determined by recognition of the Sry gene on the Y-chromosome. At 60 days after hepatocyte transplantation, the transplanted hepatocytes occupied ∼76% of the total hepatocyte mass in the case of the transplantation of hepatocytes with low ASGPR expression, but accounted for ∼12% and 17% of the mass in the case of the transplantation of hepatocytes with high ASGPR expression and unfractionated hepatocytes, respectively. In conclusion, these findings suggest that hepatocytes with low ASGPR expression can result in normal liver function and a high repopulation capacity in vivo. These results provide insight into development of a strategy for effective liver repopulation using transplanted hepatocytes. PMID:15277224
Ise, Hirohiko; Nikaido, Toshio; Negishi, Naoki; Sugihara, Nobuhiro; Suzuki, Fumitaka; Akaike, Toshihiro; Ikeda, Uichi
2004-08-01
Development of a reliable method of isolating highly proliferative potential hepatocytes provides information crucial to progress in the field of hepatocyte transplantation. The aim of this study was to develop reliable hepatocyte transplantation using highly proliferative, eg, progenitor-like hepatocytes, based on asialoglycoprotein receptor (ASGPR) expression levels for hepatocyte transplantation. We have previously reported that mouse hepatocytes with low ASGPR expression levels have highly proliferative potential and can be used as progenitor-like hepatocytes. We therefore fractionated F344 male rat hepatocytes expressing low and high levels of ASGPR and determined the liver repopulation capacity of hepatocytes according to low and high ASGPR expression in the liver. Next, 2 x 10(5) cells of each type were transplanted into female liver regenerative model dipeptidyl peptidase-deficient rats, and we estimated the rate of liver repopulation by the transplanted hepatocytes in the host liver, as determined by recognition of the Sry gene on the Y-chromosome. At 60 days after hepatocyte transplantation, the transplanted hepatocytes occupied approximately 76% of the total hepatocyte mass in the case of the transplantation of hepatocytes with low ASGPR expression, but accounted for approximately 12% and 17% of the mass in the case of the transplantation of hepatocytes with high ASGPR expression and unfractionated hepatocytes, respectively. In conclusion, these findings suggest that hepatocytes with low ASGPR expression can result in normal liver function and a high repopulation capacity in vivo. These results provide insight into development of a strategy for effective liver repopulation using transplanted hepatocytes.
Bancks, Michael P.; Bielinski, Suzette J.; Decker, Paul A.; Hanson, Naomi Q.; Larson, Nicholas B.; Sicotte, Hugues; Wassel, Christina L.; Pankow, James S.
2016-01-01
Background Hepatocyte growth factor (HGF) is a pleotropic factor posited to have metabolic homeostatic properties. The purpose of this study is to examine whether level of HGF is associated with the development of type 2 diabetes. Methods Data from the Multi-Ethnic Study of Atherosclerosis (MESA) were used to examine the prospective association between serum level of HGF and incident diabetes. Fasting HGF was measured at Exam 1 (2000–2002) in 5395 participants free from diabetes (61.5 ± 10.2 years old) and incidence of diabetes was determined at four subsequent follow-up exams over 12 years. Hazard ratios (HR) for incident diabetes were estimated according to 1 standard deviation (SD) unit increment of HGF (1 SD =26 μg/l), before and after adjustment for age, sex, race/ethnicity, education, study center, smoking status, alcohol consumption, body mass index, waist circumference, fasting glucose and insulin, C-reactive protein, and interleukin-6 levels. Results A 1 SD increment of baseline HGF was associated with a 46% (95% CI =1.37, 1.56) increased risk of diabetes before adjustment. After adjustment, diabetes risk per 1 SD increment of HGF was attenuated but remained significantly increased (HR=1.21; 95% CI=1.12, 1.32). Men had a significantly greater HR compared to women per equivalent increase of HGF (p-value for sex interaction=0.04). There was no evidence of effect modification by race/ethnicity. Conclusions This study advances understanding from cross-sectional studies and investigation of incident insulin resistance, demonstrating higher level of HGF is associated with incident diabetes and may reflect a unique type of impaired metabolism. PMID:26892517
Bancks, Michael P; Bielinski, Suzette J; Decker, Paul A; Hanson, Naomi Q; Larson, Nicholas B; Sicotte, Hugues; Wassel, Christina L; Pankow, James S
2016-03-01
Hepatocyte growth factor (HGF) is a pleotropic factor posited to have metabolic homeostatic properties. The purpose of this study is to examine whether level of HGF is associated with the development of type 2 diabetes. Data from the Multi-Ethnic Study of Atherosclerosis (MESA) were used to examine the prospective association between serum level of HGF and incident diabetes. Fasting HGF was measured at Exam 1 (2000-2002) in 5395 participants free from diabetes (61.5±10.2 years old) and incidence of diabetes was determined at four subsequent follow-up exams over 12 years. Hazard ratios (HR) for incident diabetes were estimated according to 1 standard deviation (SD) unit increment of HGF (1 SD=26 μg/l), before and after adjustment for age, sex, race/ethnicity, education, study center, smoking status, alcohol consumption, body mass index, waist circumference, fasting glucose and insulin, C-reactive protein, and interleukin-6 levels. A 1 SD increment of baseline HGF was associated with a 46% (95% CI=1.37, 1.56) increased risk of diabetes before adjustment. After adjustment, diabetes risk per 1 SD increment of HGF was attenuated but remained significantly increased (HR=1.21; 95% CI=1.12, 1.32). Men had a significantly greater HR compared to women per equivalent increase of HGF (p-value for sex interaction=0.04). There was no evidence of effect modification by race/ethnicity. This study advances understanding from cross-sectional studies and investigation of incident insulin resistance, demonstrating higher level of HGF is associated with incident diabetes and may reflect a unique type of impaired metabolism. Copyright © 2015 Elsevier Inc. All rights reserved.
Hepatocyte polyploidization and its association with pathophysiological processes.
Wang, Min-Jun; Chen, Fei; Lau, Joseph T Y; Hu, Yi-Ping
2017-05-18
A characteristic cellular feature of the mammalian liver is the progressive polyploidization of the hepatocytes, where individual cells acquire more than two sets of chromosomes. Polyploidization results from cytokinesis failure that takes place progressively during the course of postnatal development. The proportion of polyploidy also increases with the aging process or with cellular stress such as surgical resection, toxic stimulation, metabolic overload, or oxidative damage, to involve as much as 90% of the hepatocytes in mice and 40% in humans. Hepatocyte polyploidization is generally considered an indicator of terminal differentiation and cellular senescence, and related to the dysfunction of insulin and p53/p21 signaling pathways. Interestingly, the high prevalence of hepatocyte polyploidization in the aged mouse liver can be reversed when the senescent hepatocytes are serially transplanted into young mouse livers. Here we review the current knowledge on the mechanism of hepatocytes polyploidization during postnatal growth, aging, and liver diseases. The biologic significance of polyploidization in senescent reversal, within the context of new ways to think of liver aging and liver diseases is considered.
Hepatocyte polyploidization and its association with pathophysiological processes
Wang, Min-Jun; Chen, Fei; Lau, Joseph T Y; Hu, Yi-Ping
2017-01-01
A characteristic cellular feature of the mammalian liver is the progressive polyploidization of the hepatocytes, where individual cells acquire more than two sets of chromosomes. Polyploidization results from cytokinesis failure that takes place progressively during the course of postnatal development. The proportion of polyploidy also increases with the aging process or with cellular stress such as surgical resection, toxic stimulation, metabolic overload, or oxidative damage, to involve as much as 90% of the hepatocytes in mice and 40% in humans. Hepatocyte polyploidization is generally considered an indicator of terminal differentiation and cellular senescence, and related to the dysfunction of insulin and p53/p21 signaling pathways. Interestingly, the high prevalence of hepatocyte polyploidization in the aged mouse liver can be reversed when the senescent hepatocytes are serially transplanted into young mouse livers. Here we review the current knowledge on the mechanism of hepatocytes polyploidization during postnatal growth, aging, and liver diseases. The biologic significance of polyploidization in senescent reversal, within the context of new ways to think of liver aging and liver diseases is considered. PMID:28518148
Yanagi, Satoshi; Kato, Chika; Takashima, Ryokichi; Kobayashi, Eiji; Hagiwara, Keitaro; Ochiya, Takahiro
2015-01-01
Preparing targeted cells for medical applications from human induced pluripotent stem cells (hiPSCs) using growth factors, compounds, or gene transfer has been challenging. Here, we report that human induced hepatic lineage-oriented stem cells (hiHSCs) were generated and expanded as a new type of hiPSC under non-typical coculture with feeder cells in a chemically defined hiPSC medium at a very high density. Self-renewing hiHSCs expressed markers of both human embryonic stem cells (hESCs) and hepatocytes. Those cells were highly expandable, markedly enhancing gene expression of serum hepatic proteins and cytochrome P450 enzymes with the omission of FGF-2 from an undefined hiPSC medium. The hepatic specification of hiHSCs was not attributable to the genetic and epigenetic backgrounds of the starting cells, as they were established from distinct donors and different types of cells. Approximately 90% of hiHSCs autonomously differentiated to hepatocyte-like cells, even in a defined minimum medium without any of the exogenous growth factors necessary for hepatic specification. After 12 days of this culture, the differentiated cells significantly enhanced gene expression of serum hepatic proteins (ALB, SERPINA1, TTR, TF, FABP1, FGG, AGT, RBP4, and AHSG), conjugating enzymes (UGT2B4, UGT2B7, UGT2B10, GSTA2, and GSTA5), transporters (SULT2A1, SLC13A5, and SLCO2B1), and urea cycle-related enzymes (ARG1 and CPS1). In addition, the hepatocyte-like cells performed key functions of urea synthesis, albumin secretion, glycogen storage, indocyanine green uptake, and low-density lipoprotein uptake. The autonomous hepatic specification of hiHSCs was due to their culture conditions (coculture with feeder cells in a defined hiPSC medium at a very high density) in self-renewal rather than in differentiation. These results suggest the feasibility of preparing large quantities of hepatocytes as a convenient and inexpensive hiPSC differentiation. Our study also suggests the necessity of
Chiu, Bill; Melin-Aldana, Hector; Superina, Riccardo A
2007-10-01
A 3-year-old girl developed extrahepatic portal vein obstruction (EHPVO) after a liver transplant. She had sequelae of portal hypertension that required another transplantation. The circumstances allowed for comparison of liver-dependent coagulation factor production between the second donor liver and the explanted liver with EHPVO. Liver samples from the explanted first graft and the second transplant were obtained. Fresh tissue was used to perform reverse transcription-polymerase chain reaction with primers against factors V, VII, as well as VIII, protein C, and paraffin-embedded sections for hepatocyte proliferation using Ki-67 antibody as well as for apoptosis using TUNEL assay. The transcription of factor VII and that of protein C were decreased in the explant as compared with the newly transplanted liver (factor VII, 77% of the donor; protein C, 88% of the donor). The transcription of factor V and that of factor VIII were unchanged. The explant had a greater percentage of proliferating hepatocytes than the new organ (0.85% +/- 0.75% vs 0.11% +/- 0.21%). The percentage of apoptotic cells was similar between the 2 livers (0.09% +/- 0.13% vs 0.09% +/- 0.13%). Idiopathic EHPVO is associated with a reduction in liver-dependent coagulation factor transcription and an increase in hepatocyte proliferation. Portal blood flow deprivation alters hepatic homeostasis and initiates mechanisms that attempt to restore liver-dependent coagulation factors.
Araya, Jun; Cambier, Stephanie; Morris, Alanna; Finkbeiner, Walter; Nishimura, Stephen L.
2006-01-01
Trophic interactions between pulmonary epithelial and mesenchymal cell types, known as the epithelial-mesenchymal trophic unit (EMTU), are crucial in lung development and lung disease. Transforming growth factor (TGF)-β is a key factor in mediating these interactions, but it is expressed in a latent form that requires activation to be functional. Using intact fetal tracheal tissue and primary cultures of fetal tracheal epithelial cells and fibroblasts, we demonstrate that a subset of integrins, αvβ6 and αvβ8, are responsible for almost all of the TGF-β activation in the EMTU. Both αvβ8 and αvβ6 contribute to fetal tracheal epithelial activation of TGF-β, whereas only αvβ8 contributes to fetal tracheal fibroblast activation of TGF-β. Interestingly, fetal tracheal epithelial αvβ8-mediated TGF-β activation can be enhanced by phorbol esters, likely because of the increased activity of MT1-MMP, an essential co-factor in αvβ8-mediated activation of TGF-β. Autocrine αvβ8-mediated TGF-β activation by fetal tracheal fibroblasts results in suppression of both transcription and secretion of hepatocyte growth factor, which is sufficient to affect phosphorylation of the airway epithelial hepatocyte growth factor receptor, c-Met, as well as airway epithelial proliferation in a co-culture model of the EMTU. These findings elucidate the function and complex regulation of integrin-mediated activation of TGF-β within the EMTU. PMID:16877343
Araya, Jun; Cambier, Stephanie; Morris, Alanna; Finkbeiner, Walter; Nishimura, Stephen L
2006-08-01
Trophic interactions between pulmonary epithelial and mesenchymal cell types, known as the epithelial-mesenchymal trophic unit (EMTU), are crucial in lung development and lung disease. Transforming growth factor (TGF)-beta is a key factor in mediating these interactions, but it is expressed in a latent form that requires activation to be functional. Using intact fetal tracheal tissue and primary cultures of fetal tracheal epithelial cells and fibroblasts, we demonstrate that a subset of integrins, alpha(v)beta(6) and alpha(v)beta(8), are responsible for almost all of the TGF-beta activation in the EMTU. Both alpha(v)beta(8) and alpha(v)beta(6) contribute to fetal tracheal epithelial activation of TGF-beta, whereas only alpha(v)beta(8) contributes to fetal tracheal fibroblast activation of TGF-beta. Interestingly, fetal tracheal epithelial alpha(v)beta(8)-mediated TGF-beta activation can be enhanced by phorbol esters, likely because of the increased activity of MT1-MMP, an essential co-factor in alpha(v)beta(8)-mediated activation of TGF-beta. Autocrine alpha(v)beta(8)-mediated TGF-beta activation by fetal tracheal fibroblasts results in suppression of both transcription and secretion of hepatocyte growth factor, which is sufficient to affect phosphorylation of the airway epithelial hepatocyte growth factor receptor, c-Met, as well as airway epithelial proliferation in a co-culture model of the EMTU. These findings elucidate the function and complex regulation of integrin-mediated activation of TGF-beta within the EMTU.
Hikosaka, Keisuke; Noritake, Hidenao; Kimura, Wataru; Sultana, Nishat; Sharkar, Mohammad T K; Tagawa, Yoh-Ichi; Uezato, Tadayoshi; Kobayashi, Yoshimasa; Wakita, Takaji; Miura, Naoyuki
2011-04-01
No suitable mouse model is available for studying chronic liver disease caused by hepatitis C virus (HCV). CD81, claudin-1, scavenger receptor class B type I, and occludin were recently reported to be the important factors in HCV entry into hepatocytes. We made transgenic mice (Alb-CCSO) expressing the four human proteins and examined whether HCV from a patient serum or HCV pseudoparticles (HCVpp) were capable of infecting them. HCV was not detected in the mouse serum after injecting the mice with HCV from a patient serum. We also found no indications of HCVpp entry into primary hepatocytes from Alb-CCSO mice. In addition, HCV-infectible Hep3B cells were fused with HCV-resistant primary mouse hepatocytes and the fused cells showed 35-fold lower infectivity compared to wild-type Hep3B cells, indicating that primary mouse hepatocytes have the inhibitory factor(s) in HCVpp entry. Our results suggest that the expression of the human factors does not confer susceptibility to HCV entry into the liver.
Klenkler, Bettina; Sheardown, Heather
2004-11-01
A number of growth factors and their associated receptors, including epidermal growth factor, transforming growth factor-beta, keratinocyte growth factor, hepatocyte growth factor, fibroblast growth factor and platelet-derived growth factor have been detected in the anterior segment of the eye. On binding to cellular receptors, these factors activate signalling cascades, which regulate functions including mitosis, differentiation, motility and apoptosis. Production of growth factors by corneal cells and their presence in the tear fluid and aqueous humour is essential for maintenance and renewal of normal tissue in the anterior eye and the prevention of undesirable immune or angiogenic reactions. Growth factors also play a vital role in corneal wound healing, mediating the proliferation of epithelial and stromal tissue and affecting the remodelling of the extracellular matrix (ECM). These functions depend on a complex interplay between growth factors of different types, the ECM, and regulatory mechanisms of the affected cells. Imbalances may lead to deficient wound healing and various ocular pathologies, including edema, neovascularization and glaucoma. Growth factors may be targeted in therapeutic ophthalmic applications, through exogenous application or selective inhibition, and may be used to elicit specific cellular responses to ophthalmic materials. A thorough understanding of the mechanism and function of growth factors and their actions in the complex environment of the anterior eye is required for these purposes. Growth factors, their function and mechanisms of action as well as the interplay between different growth factors based on recent in vitro and in vivo studies are presented.
Kim, Hyori; Youk, Jeonghwan; Yang, Yaewon; Kim, Tae-Yong; Min, Ahrum; Ham, Hye-Seon; Cho, Seongcheol; Lee, Kyung-Hun; Keam, Bhumsuk; Han, Sae-Won; Oh, Do-Youn; Ryu, Han Suk; Han, Wonshik; Park, In Ae; Kim, Tae-You; Noh, Dong-Young; Im, Seock-Ah
2016-03-01
In stage II/III breast cancer, neoadjuvant chemotherapy (NAC) is a standard treatment. Although several biomarkers are used to predict prognosis in breast cancer, there is no reliable predictive biomarker for NAC success. Recently, the hepatocyte growth factor (HGF) and cMet signaling pathway demonstrated to be involved in breast cancer tumor progression, and its potential as a biomarker is under active investigation. In this study, we assessed the potential of serum HGF as a prognostic biomarker for NAC efficacy. Venous blood samples were drawn from patients diagnosed with stage II/III breast cancer and treated with NAC in Seoul National University Hospital from August 2004 to November 2009. Serum HGF level was determined using an ELISA system. We reviewed the medical records of the patients and investigated the association of HGF level with patients' clinicopathologic characteristics. A total of 121 female patients (median age = 45 years old) were included. Median level of HGF was 934 pg/ml (lower quartile: 772, upper quartile: 1145 pg/ml). Patients with higher HGF level than median value were significantly more likely to have clinically detectable regional node metastasis (p = 0.017, Fisher's exact test). Patients with complete and partial response according to the American Joint Committee on Cancer 7th Edition criteria tended to have higher HGF level (p = 0.105 by t test). Patients with an HGF level higher than the upper quartile value had longer relapse-free survival than the other patients (106 vs. 85 months, p = 0.008). High serum HGF levels in breast cancer patients are associated with clinically detectable regional node metastasis and, paradoxically, with longer relapse-free survival in stage II/III breast cancer.
Takahashi, Toshiaki; Friedmacher, Florian; Zimmer, Julia; Puri, Prem
2016-10-01
Pleuroperitoneal folds (PPFs) are essential for normal diaphragmatic development, representing the only source of the diaphragm's muscle connective tissue. Hepatocyte growth factor (Hgf), which is secreted in PPFs, plays a crucial role in the formation of the muscular diaphragmatic components by regulating the migration of myogenic progenitor cells into the primordial diaphragm. Hgf is also a known downstream target of Gata4 and it has been demonstrated that the expression of Hgf was significantly downregulated in PPF cells of Gata4 knockouts with congenital diaphragmatic hernia (CDH). Furthermore, mutations in PPF-derived cells have been shown to result in CDH. We hypothesized that Hgf expression is decreased in developing diaphragms of fetal rats with nitrofen-induced CDH. Timed-pregnant rats were exposed to either nitrofen or vehicle on gestational day 9 (D9). Fetuses were harvested on selected time-points D13, D15 and D18. Dissected diaphragms (n = 72) were divided into control and nitrofen-exposed specimens (n = 12 per time-point and experimental group, respectively). Diaphragmatic gene expression of Hgf was analyzed by qRT-PCR. Immunofluorescence double staining for Hgf and the mesenchymal marker Gata4 or muscular progenitor marker Myogenin was performed to evaluate protein expression and localization in fetal diaphragms. Relative mRNA expression of Hgf was significantly downregulated in PPFs of nitrofen-exposed fetuses on D13 (3.08 ± 1.46 vs. 5.24 ± 1.93; p < 0.05), developing diaphragms of nitrofen-exposed fetuses on D15 (2.01 ± 0.79 vs. 4.10 ± 1.50; p < 0.05) and fully muscularized diaphragms of nitrofen-exposed fetuses on D18 (1.60 ± 0.78 vs. 3.21 ± 1.89; p < 0.05) compared to controls. Confocal laser scanning microscopy revealed markedly diminished diaphragmatic immunofluorescence of Hgf in nitrofen-exposed fetuses on D13, D15 and D18 compared to controls, which was associated with disruptions in muscle connective tissue
Coupling growth-factor engineering with nanotechnology for therapeutic angiogenesis.
Sinha Roy, Rituparna; Soni, Shivani; Harfouche, Rania; Vasudevan, Pooja R; Holmes, Oliver; de Jonge, Hugo; Rowe, Arthur; Paraskar, Abhimanyu; Hentschel, Dirk M; Chirgadze, Dimitri; Blundell, Tom L; Gherardi, Ermanno; Mashelkar, Raghunath A; Sengupta, Shiladitya
2010-08-03
Therapeutic angiogenesis is an emerging paradigm for the management of ischemic pathologies. Proangiogenic Therapy is limited, however, by the current inability to deliver angiogenic factors in a sustained manner at the site of pathology. In this study, we investigated a unique nonglycosylated active fragment of hepatocyte growth factor/scatter factor, 1K1, which acts as a potent angiogenic agent in vitro and in a zebrafish embryo and a murine matrigel implant model. Furthermore, we demonstrate that nanoformulating 1K1 for sustained release temporally alters downstream signaling through the mitogen activated protein kinase pathway, and amplifies the angiogenic outcome. Merging protein engineering and nanotechnology offers exciting possibilities for the treatment of ischemic disease, and furthermore allows the selective targeting of downstream signaling pathways, which translates into discrete phenotypes.
Leckel, Kerstin; Strey, Christoph; Bechstein, Wolf O; Boost, Kim A; Auth, Marcus K H; El Makhfi, Amal; Juengel, Eva; Wedel, Steffen; Jones, Jon; Jonas, Dietger; Blaheta, Roman A
2008-05-01
Isolated human hepatocytes are of great value in investigating cell transplantation, liver physiology, pathology, and drug metabolism. Though hepatocytes possess a tremendous proliferative capacity in vivo, their ability to grow in culture is severely limited. We postulated that repeated medium change, common to most in vitro systems, may prevent long-term maintenance of hepato-specific functions and growth capacity. To verify our hypotheses we compared the DNA synthesis and differentiation status of isolated human hepatocytes, cultured in medium which was renewed every day or was not changed for 3 weeks ('autocrine' setting). Daily medium change led to rapid hepatocellular de-differentiation without any signs of DNA replication. In contrast, the autocrine setting allowed hepatocytes to become highly differentiated, demonstrated by an elevated ASGPr expression level, and increased albumin and fibrinogen synthesis and release. Cytokeratin 18 filaments were stably expressed, whereas cytokeratin 19 remained undetectable. Hepatocytes growing in an autocrine fashion were activated in the presence of hepatocyte growth factor (HGF), evidenced by c-Met phosphorylation. However, HGF response was not achieved when the culture medium was renewed daily. Furthermore, the autocrine setting evoked a late but strong interleukin 6 release into the culture supernatant, reaching maximum values after a 10-day cultivation period, and intense BrdU incorporation after a further 5-day period. Our data suggest that preservation of the same medium creates environmental conditions which allow hepatocytes to control their differentiation status and DNA synthesis in an autocrine fashion. Further studies are necessary to identify the key mediators involved in autocrine communication and to design the optimal culture configuration for clinical application.
Lack of gp130 expression in hepatocytes attenuates tumor progression in the DEN model.
Hatting, M; Spannbauer, M; Peng, J; Al Masaoudi, M; Sellge, G; Nevzorova, Y A; Gassler, N; Liedtke, C; Cubero, F J; Trautwein, C
2015-03-05
Chronic liver inflammation is a crucial event in the development and growth of hepatocellular carcinoma (HCC). Compelling evidence has shown that interleukin-6 (IL-6)/gp130-dependent signaling has a fundamental role in liver carcinogenesis. Thus, in the present study we aimed to investigate the role of gp130 in hepatocytes for the initiation and progression of HCC. Hepatocyte-specific gp130 knockout mice (gp130(Δhepa)) and control animals (gp130(f/f)) were treated with diethylnitrosamine (DEN). The role of gp130 for acute injury (0-144 h post treatment), tumor initiation (24 weeks) and progression (40 weeks) was analyzed. After acute DEN-induced liver injury we observed a reduction in the inflammatory response in gp130(Δhepa) animals as reflected by decreased levels of IL-6 and oncostatin M. The loss of gp130 slightly attenuated the initiation of HCC 24 weeks after DEN treatment. In contrast, 40 weeks after DEN treatment, male and female gp130(Δhepa) mice showed smaller tumors and reduced tumor burden, indicating a role for hepatocyte-specific gp130 expression during HCC progression. Oxidative stress and DNA damage were substantially and similarly increased by DEN in both gp130(f/f) and gp130(Δhepa) animals. However, gp130(Δhepa) livers revealed aberrant STAT5 activation and decreased levels of transforming growth factor-β (TGFβ), pSMAD2/3 and SMAD2, whereas phosphorylation of STAT3 at Tyr705 and Ser727 was absent. Our results indicate that gp130 deletion in hepatocytes reduces progression, but not HCC initiation in the DEN model. Gp130 deletion resulted in STAT3 inhibition but increased STAT5 activation and diminished TGF-dependent signaling. Hence, blocking gp130 in hepatocytes might be an interesting therapeutic target to inhibit the growth of HCC.
Nakamura, Michihiko; Ono, Yoshihiro J; Kanemura, Masanori; Tanaka, Tomohito; Hayashi, Masami; Terai, Yoshito; Ohmichi, Masahide
2015-11-01
A current working model for the metastatic process of ovarian carcinoma suggests that cancer cells are shed from the ovarian tumor into the peritoneal cavity and attach to the layer of mesothelial cells that line the inner surface of the peritoneum, and several studies suggest that hepatocyte growth factor (HGF) plays an important role in the dissemination of ovarian cancer. Our objectives were to evaluate the HGF expression of ovarian cancer using clinical data and assess the effect of HGF secreted from human ovarian cancer cells to human mesothelial cells. HGF expression was immunohistochemically evaluated in 165 epithelial ovarian cancer patients arranged as tissue microarrays. HGF expression in four ovarian cancer cell lines was evaluated by using semi-quantitative polymerase chain reaction, Western blotting and enzyme-linked immunosorbent assay. The effect of ovarian cancer cell derived HGF to the human mesothelial cells was assessed by using morphologic analysis, Western blotting and cell invasion assay. The effect of HGF on ovarian cancer metastasis was assessed by using in vivo experimental model. The clinical data showed a significantly high correlation between the HGF expression and the cancer stage. The in vivo and in vitro experimental models revealed that HGF secreted by ovarian cancer cells induces the mesothelial-to-mesenchymal transition and stimulates the invasion of mesothelial cells. Furthermore, manipulating the HGF activity affected the degree of dissemination and ascite formation. We demonstrated that HGF secreted by ovarian cancer cells plays an important role in cancer peritoneal implantation. Copyright © 2015 Elsevier Inc. All rights reserved.
Kong, M; Mounier, C; Wu, J; Posner, B I
2000-11-17
In previous work we showed that the phosphatidylinositol 3-kinase (PI3-kinase), not the mitogen-activated protein kinase, pathway is necessary and sufficient to account for insulin- and epidermal growth factor (EGF)-induced DNA synthesis in rat hepatocytes. Here, using a dominant-negative p85, we confirmed the key role of EGF-induced PI3-kinase activation and sought to identify the mechanism by which this is effected. Our results show that EGF activates PI3-kinase with a time course similar to that of the association of p85 with three principal phosphotyrosine proteins (i. e. PY180, PY105, and PY52). We demonstrated that each formed a distinct p85-associated complex. PY180 and PY52 each constituted about 10% of EGF-activated PI3-kinase, whereas PY105 was responsible for 80%. PY105 associated with Grb2 and SHP-2, and although it behaved like Gab1, none of the latter was detected in rat liver. We therefore cloned a cDNA from rat liver, which was found to be 95% homologous to the mouse Grb2-associated binder 2 (Gab2) cDNA sequence. Using a specific Gab2 antibody, we demonstrated its expression in and association with p85, SHP-2, and Grb2 upon EGF treatment of rat hepatocytes. Gab2 accounted for most if not all of the PY105 species, since immunoprecipitation of Gab2 with specific antibodies demonstrated parallel immunodepletion of Gab2 and PY105 from the residual supernatants. We also found that the PI3-kinase activity associated with Gab2 was totally abolished by dominant negative p85. Thus, Gab2 appears to be the principal EGF-induced PY protein recruiting and activating PI3-kinase and mitogenesis.
Wu, Yi-Hang; Hu, Shao-Qing; Liu, Jun; Cao, Hong-Cui; Xu, Wei; Li, Yong-Jun; Li, Lan-Juan
2014-06-01
Apoptosis plays a role in the normal development of liver. However, overactivation thereof may lead to hepatocellular damage. The aim of this study was to assess D-galactosamine (D-GalN)/lipopolysaccharide (LPS)-induced hepatocyte apoptotic changes in mice and clarify the mechanisms involved in this process. DNA ladder detection was employed to determine the induction condition of hepatic apoptosis. An initial test indicated that typical hepatocyte apoptosis was observed at 6-10 h after the intraperitoneal injection of D-GalN (700 mg/kg) and LPS (10 µg/kg). Subsequently, we evaluated hepatocyte apoptosis at 8 h after administering D-GalN/LPS by histopathological analysis, terminal deoxynucleotidyl transferase-mediated dUTP nick end‑labeling (TUNEL) detection, flow cytometry and electron microscopy analysis. To clarify the apoptosis-related gene expression, the expression levels of tumor necrosis factor-α (TNF-α), transforming growth factor-β1 (TGF-β1), caspase-3, and Fas/Fas ligand (FasL) were determined by serum enzyme immunoassay, immunohistochemistry and western blot analysis. Strong apoptotic positive signals following D-GalN/LPS injection were observed from the results of the serum analysis, histopathological and immunohistochemical analyses, DNA ladder detection, TUNEL detection, flow cytometry and electron microscopy analysis. Additionally, apoptotic hepatocytes were mainly at the late stage of cell apoptosis. The expression of TNF-α, TGF-β1, caspase-3 and Fas/FasL was significantly increased. In conclusion, this study evaluated the D-GalN/LPS-induced hepatocyte apoptotic changes and clarified the apoptosis-related gene expression in mice. The hepatocyte apoptosis induced by D-GalN/LPS may be mainly regulated by the death receptor pathway. TGF-β signaling pathway may also play a vital role in this process of hepatocyte apoptosis.
Mittra, Erik S.; Fan-Minogue, Hua; Lin, Frank I.; Karamchandani, Jason; Sriram, Venkataraman; Han, May; Gambhir, Sanjiv S.
2016-01-01
Purpose Ficlatuzumab is a novel therapeutic agent targeting the hepatocyte growth factor (HGF)/c-MET pathway. We summarize extensive preclinical work using this agent in a mouse brain orthotopic model of glioblastoma. Experimental Design Sequential experiments were done using eight- to nine-week-old nude mice injected with 3 × 105 U87 MG (glioblastoma) cells into the brain. Evaluation of ficlatuzumab dose response for this brain tumor model and comparison of its response to ficlatuzumab and to temozolamide were conducted first. Subsequently, various small-animal imaging modalities, including bioluminescence imaging (BLI), positron emission tomography (PET), and MRI, were used with a U87 MG-Luc 2 stable cell line, with and without the use of ficlatuzumab, to evaluate the ability to non-invasively assess tumor growth and response to therapy. ANOVA was conducted to evaluate for significant differences in the response. Results There was a survival benefit with ficlatuzumab alone or in combination with temozolamide. BLI was more sensitive than PET in detecting tumor cells. Fluoro-D-thymidine (FLT) PET provided a better signal-to-background ratio than 2[18F]fluoro-2-deoxy-D-glucose (FDG) PET. In addition, both BLI and FLT PET showed significant changes over time in the control group as well as with response to therapy. MRI does not disclose any time-dependent change. Also, the MRI results showed a temporal delay in comparison to the BLI and FLT PET findings, showing similar results one drug cycle later. Conclusions Targeting the HGF/c-MET pathway with the novel agent ficlatuzumab appears promising for the treatment of glioblastoma. Various clinically applicable imaging modalities including FLT, PET, and MRI provide reliable ways of assessing tumor growth and response to therapy. Given the clinical applicability of these findings, future studies on patients with glioblastoma may be appropriate. PMID:23983258
Grau, M; Tebar, F; Ramírez, I; Soley, M
1996-04-01
Several laboratories report different effects of epidermal growth factor (EGF) on glycogen metabolism in hepatocytes. The discrepancies may be attributed to differences in the experimental conditions. It is therefore important to establish the actual effect of EGF in vivo. Because large physiological variations of EGF concentration in plasma occur in mice, we used this species to address this question. In freshly isolated mouse hepatocytes, EGF increased glycogen degradation in a dose-dependent manner. The maximal effect (36% increase over basal glycogenolysis) was smaller than maximal effects of classical glycogenolytic hormones like adrenaline or glucagon (more than 150% increase over basal). This is in keeping with the smaller effect of EGF on phosphorylase a activity. In contrast with these hormones, EGF did not inhibit glycolysis. Thus these effects of EGF in mouse hepatocytes are similar to those recently described by us in rat hepatocytes [Quintana, Grau, Moreno, Soler, Ramirez and Soley (1995) Biochem J 308, 889-894]. When administered to whole animals, EGF increased phosphorylase a activity, decreased the glycogen content in the liver and caused mild hyperglycaemia. Taking together the results obtained for isolated cells and for whole animals, we suggest that the glucosyl residues released from glycogen are used mostly by the liver rather than released to the circulation. This would be different from the action of the classical glycogenolytic hormones, adrenaline and glucagon.
Puszkiel, Alicja; White-Koning, Mélanie; Dupin, Nicolas; Kramkimel, Nora; Thomas-Schoemann, Audrey; Noé, Gaëlle; Chapuis, Nicolas; Vidal, Michel; Goldwasser, François; Chatelut, Etienne; Blanchet, Benoit
2016-11-01
The therapeutic response to vemurafenib, a BRAF serine-threonine kinase inhibitor, exhibits large variations between patients. Evaluation of factors predicting the clinical efficacy of vemurafenib may help to identify patients at high risk of non-response in the early phase of treatment. The aim of this study was to analyze the pharmacokinetics of vemurafenib by a population approach and to evaluate the relationship between plasma drug exposure and pre-treatment plasma hepatocyte growth factor (HGF) levels with clinical effects (progression-free survival (PFS), peripheral lymphocytes depletion) in patients with metastatic BRAF V600 mutated melanoma treated with single agent vemurafenib. Concentration-time data (n=332) obtained in 44 patients were analyzed using the NONMEM program. Pre-treatment plasma levels of HGF (n=36) were assayed by ELISA method. A Cox model was used to identify prognostic factors associated with progression-free survival (PFS), and a linear regression to identify factors contributing to the depletion of peripheral lymphocytes at day 15. Steady-state pharmacokinetics of vemurafenib was described by a one compartment model with first order absorption and first order elimination. None of the tested covariates explained the inter-patient variability in CL/F. A significant decrease in total lymphocytes count was observed within the first 15days (median ratio Day15/Day0=0.66, p<0.0001). Patients with Day15/Day0 ratio below 0.66 had longer PFS (14 vs 4 months, HR=0.41, CI95%=[0.15-0.77], p=0.0095). In the multivariate Cox model analysis, ECOG PS was the only parameter independently associated with PFS (grade 1 vs 0, HR=3.26, CI95%=[1.29-8.22], p=0.01 and grade ≥2 vs 0, HR=4.77, CI95%=[1.52-14.95], p=0.007). Plasma vemurafenib exposure (p=0.046) and pre-treatment HGF levels (p=0.003) were independently associated with the total lymphocyte ratio Day15/Day0. These findings show that plasma vemurafenib exposure and pre-treatment HGF levels are two
Assessment of Growth Factors Secreted by Human Breastmilk Mesenchymal Stem Cells.
Kaingade, Pankaj Mahipatrao; Somasundaram, Indumathi; Nikam, Amar Babaso; Sarang, Shabari Amit; Patel, Jagdish Shantilal
2016-01-01
Human breastmilk is a dynamic, multifaceted biological fluid containing nutrients, bioactive substances, and growth factors. It is effective in supporting growth and development of an infant. As breastmilk has been found to possess mesenchymal stem cells, the importance of the components of breastmilk and their physiological roles is increasing day by day. The present study was intended to identify the secretions of growth factors, mainly vascular endothelial growth factor (VEGF) and hepatocyte growth factor (HGF), from human breastmilk mesenchymal stem cells under basal conditions of in vitro cell culture using synthetic media and human cord serum. The growth factors were analyzed with the enzyme-linked immunosorbent assay technique. The cultured mesenchymal stem cells of breastmilk without serum revealed significant differences in secretions of the VEGF and HGF growth factors (8.55 ± 2.26402 pg/mL and 230.8 ± 45.9861 pg/mL, respectively) compared with mesenchymal stem cells of breastmilk with serum (21.31 ± 4.69 pg/mL and 2,404.42 ± 481.593 pg/mL, respectively). Results obtained from our study demonstrate that both VEGF and HGF are secreted in vitro by human breastmilk mesenchymal stem cells. The roles of VEGF and HGF in surfactant secretion, pulmonary maturation, and neonatal maturity have been well established. Thus, we emphasize that breastmilk-derived MSCs could be a potent therapeutic source in treating neonatal diseases. Besides, due to its immense potency, the study also emphasizes the importance of breastfeeding, which is promoted by organizations like the World Heatlh Organization and UNICEF.
Functional properties of hepatocytes in vitro are correlated with cell polarity maintenance.
Zeigerer, Anja; Wuttke, Anne; Marsico, Giovanni; Seifert, Sarah; Kalaidzidis, Yannis; Zerial, Marino
2017-01-01
Exploring the cell biology of hepatocytes in vitro could be a powerful strategy to dissect the molecular mechanisms underlying the structure and function of the liver in vivo. However, this approach relies on appropriate in vitro cell culture systems that can recapitulate the cell biological and metabolic features of the hepatocytes in the liver whilst being accessible to experimental manipulations. Here, we adapted protocols for high-resolution fluorescence microscopy and quantitative image analysis to compare two primary hepatocyte culture systems, monolayer and collagen sandwich, with respect to the distribution of two distinct populations of early endosomes (APPL1 and EEA1-positive), endocytic capacity, metabolic and signaling activities. In addition to the re-acquisition of hepatocellular polarity, primary hepatocytes grown in collagen sandwich but not in monolayer culture recapitulated the apico-basal distribution of EEA1 endosomes observed in liver tissue. We found that such distribution correlated with the organization of the actin cytoskeleton in vitro and, surprisingly, was dependent on the nutritional state in vivo. Hepatocytes in collagen sandwich also exhibited faster kinetics of low-density lipoprotein (LDL) and epidermal growth factor (EGF) internalization, showed improved insulin sensitivity and preserved their ability for glucose production, compared to hepatocytes in monolayer cultures. Although no in vitro culture system can reproduce the exquisite structural features of liver tissue, our data nevertheless highlight the ability of the collagen sandwich system to recapitulate key structural and functional properties of the hepatocytes in the liver and, therefore, support the usage of this system to study aspects of hepatocellular biology in vitro. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Choi, Yun-Hee; McNally, Brian T; Igarashi, Peter
2013-07-01
Hepatocyte nuclear factor-1β (HNF-1β) is an epithelial tissue-specific transcription factor that regulates gene expression in the kidney, liver, pancreas, intestine, and other organs. Mutations of HNF-1β in humans produce renal cysts and congenital kidney anomalies. Here, we identify the LIM-domain protein zyxin as a novel binding partner of HNF-1β in renal epithelial cells. Zyxin shuttles to the nucleus where it colocalizes with HNF-1β. Immunoprecipitation of zyxin in leptomycin B-treated cells results in coprecipitation of HNF-1β. The protein interaction requires the second LIM domain of zyxin and two distinct domains of HNF-1β. Overexpression of zyxin stimulates the transcriptional activity of HNF-1β, whereas small interfering RNA silencing of zyxin inhibits HNF-1β-dependent transcription. Epidermal growth factor (EGF) induces translocation of zyxin into the nucleus and stimulates HNF-1β-dependent promoter activity. The EGF-mediated nuclear translocation of zyxin requires activation of Akt. Expression of dominant-negative mutant HNF-1β, knockdown of zyxin, or inhibition of Akt inhibits EGF-stimulated cell migration. These findings reveal a novel pathway by which extracellular signals are transmitted to the nucleus to regulate the activity of a transcription factor that is essential for renal epithelial differentiation.
Pless-Petig, Gesine; Walter, Björn; Bienholz, Anja
2018-01-01
with subsequent energy deficiency is a key factor for the lack of attachment of cold-stored hepatocyte suspensions. PMID:29390882
Pless-Petig, Gesine; Walter, Björn; Bienholz, Anja; Rauen, Ursula
2017-12-01
with subsequent energy deficiency is a key factor for the lack of attachment of cold-stored hepatocyte suspensions.
Jeong, Jin Sook; Lee, Sang Hyeung; Jung, Kap Joong; Choi, Yong C; Park, Woong Yang; Kim, In Hoo; Kim, Sang Soon
2003-02-01
N-nitrosomorpholine (NNM) is a hepatotoxic and hepatocarcinogenic agent. This agent was administered in the form of drinking water which contained 200 mg of NNM/liter. Its time-dependent intake profile showed four phases over 20 weeks, followed by a fifth phase where only water was supplied. Most frequently, hepatocellular carcinoma appeared between the end of phase IV and the beginning of phase V. At 5 weeks of NNM administration, foci of altered hepatocytes (FAH) containing 100-1000 hepatocytes could be isolated together with free hepatocytes by the collagenase perfusion method. When these foci were grown on the William's Medium E containing hormonally defined medium, they were able to survive approximately twice as long as normal hepatocytes At 10 weeks of NNM administration, few FAH were isolated together with free hepatocytes. The hepatocytes which had been placed under extended chemical stress showed increased heat tolerance (7 to 8 h) at 43 degrees C, while normal hepatocytes could survive 3 to 4 h. At the neoplastic phase spanning the end of the 20 weeks of the NNM administration and water phase, the rats bearing hepatocellular carcinoma entered the terminal stage, where observable tumor masses could be isolated from the tumor bearing liver and tested for ex vivo growth in tissue culture. After stabilization of the isolated primary hepatoma cells through 10 passages of propagation on William's Medium E or minimal Eagle's medium containing 10% FBS, their gene expression profile was analyzed by DNA microarray and compared with the profile of normal hepatocytes. The comparison revealed that upregulation involved ribosome-dependent protein synthesis, including 40S ribosomal proteins (S4, S7, S18, S20), 60S ribosomal proteins (L6, L21, L32, L37, P1), initiation factor 4A, and elongation factor 1alpha.
MicroRNA-21 accelerates hepatocyte proliferation in vitro via PI3K/Akt signaling by targeting PTEN
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yan-nan, Bai; Department of Hepatobiliary Surgery, Fujian Provincial Hospital, Provincial Clinical College of Fujian Medical University, Fuzhou 350001, Fujian Province; Zhao-yan, Yu
2014-01-17
Highlights: •miRNAs-expression patterns of primary hepatocytes under proliferative status. •miR-21 expression level peaked at 12 h after stimulated by EGF. •miR-21 drive rapid S phase entry of primary hepatocytes. •PI3K/Akt signaling was modulated via targeting PTEN by miR-21. -- Abstract: MicroRNAs (miRNAs) are involved in controlling hepatocyte proliferation during liver regeneration. In this study, we established the miRNAs-expression patterns of primary hepatocytes in vitro under stimulation of epidermal growth factor (EGF), and found that microRNA-21 (miR-21) was appreciably up-regulated and peaked at 12 h. In addition, we further presented evidences indicating that miR-21 promotes primary hepatocyte proliferation through in vitromore » transfecting with miR-21 mimics or inhibitor. We further demonstrated that phosphatidylinositol 3′-OH kinase (PI3K)/Akt signaling was altered accordingly, it is, by targeting phosphatase and tensin homologue deleted on chromosome 10, PI3K/Akt signaling is activated by miR-21 to accelerate hepatocyte rapid S-phase entry and proliferation in vitro.« less
Quantification of growth factor signaling and pathway cross talk by live-cell imaging
Gross, Sean M.
2017-01-01
Peptide growth factors stimulate cellular responses through activation of their transmembrane receptors. Multiple intracellular signaling cascades are engaged following growth factor–receptor binding, leading to short- and long-term biological effects. Each receptor-activated signaling pathway does not act in isolation but rather interacts at different levels with other pathways to shape signaling networks that are distinctive for each growth factor. To gain insights into the specifics of growth factor-regulated interactions among different signaling cascades, we developed a HeLa cell line stably expressing fluorescent live-cell imaging reporters that are readouts for two major growth factor-stimulated pathways, Ras–Raf–Mek–ERK and phosphatidylinositol (PI) 3-kinase–Akt. Incubation of cells with epidermal growth factor (EGF) resulted in rapid, robust, and sustained ERK signaling but shorter-term activation of Akt. In contrast, hepatocyte growth factor induced sustained Akt signaling but weak and short-lived ERK activity, and insulin-like growth factor-I stimulated strong long-term Akt responses but negligible ERK signaling. To address potential interactions between signaling pathways, we employed specific small-molecule inhibitors. In cells incubated with EGF or platelet-derived growth factor-AA, Raf activation and the subsequent stimulation of ERK reduced Akt signaling, whereas Mek inhibition, which blocked ERK activation, enhanced Akt and turned transient effects into sustained responses. Our results reveal that individual growth factors initiate signaling cascades that vary markedly in strength and duration and demonstrate in living cells the dramatic effects of cross talk from Raf and Mek to PI 3-kinase and Akt. Our data further indicate how specific growth factors can encode distinct cellular behaviors by promoting complex interactions among signaling pathways. PMID:28100485
Hu, C; Lu, Y; Chen, X; Wu, Z; Zhang, Q
2018-05-01
Chronic post-surgical pain (CPSP) remains a major clinical problem and is often refractory to current treatments. New analgesic medications and strategies for pain relief are needed. Hepatocyte growth factor (HGF) is known to be a multi-functional growth factor and regulates various biological activities. We investigated the analgesic effect and underlying mechanism of plasmid pUDK-HGF encoding human HGF gene on CPSP induced by skin/muscle incision and retraction (SMIR) in rats. The possible changes of inflammatory factors, glial cell activation and pain sensitivity after pUDK-HGF administration were investigated by ELISA, western blot and Von Frey tests, respectively. In behavioural assays, we found that a single intramuscular or intrathecal injection of pUDK-HGF significantly attenuated mechanical hypersensitivity to von Frey stimulation of plantar ipsilateral hind paw after SMIR. Intramuscular injection of pUDK-HGF promoted blood flow and proliferation of satellite cells and inhibited inflammatory cells recruitment, collagen accumulation and expression of pronociceptive factors. Intrathecal injection of pUDK-HGF inhibited activation of spinal glial cells and production of inflammatory mediators induced by SMIR. pUDK-HGF has a strong analgesic potency and efficacy in CPSP induced by SMIR in rats. This study highlights a new strategy for the treatment of CPSP. The CPSP occurs following various surgical procedures and remains a major clinical problem due to the lack of study on the mechanisms of CPSP. Our findings provide the first evidence that pUDK-HGF attenuates SMIR-induced pain behaviuors through peripheral or central mechanisms. The peripheral analgesic effect of pUDK-HGF is associated with promoting tissue repair and inhibiting inflammatory response; furthermore, pUDK-HGF inhibits activation of spinal glial cells and overexpression of inflammatory mediators in spinal cord. Therefore, naked pUDK-HGF may be a potential therapeutic strategy for treatment of
Simpson, D L; Cawley, D B; Herschman, H R
1982-06-01
A disulfide-linked conjugate between asialofetuin (ASF) and the toxic A chain (RTA) of ricin is as potent a toxin for cultured rat hepatocytes as our previously described conjugate between ASF and fragment A of diphtheria toxin (DTA). An RTA conjugate of epidermal growth factor (EGF) was a potent toxin for 3T3 cells. In contrast, EGF-DTA was essentially nontoxic for 3T3 cells. We have now examined the toxicity of EGF-RTA and EGF-DTA on cultured hepatocytes. The EGF-DTA conjugate, nontoxic to 3T3 cells, is also a potent toxin for hepatocytes. We also observed a decrease with time of culture in the sensitivity of hepatocytes to the ASF and EGF conjugates. This decrease is not a result of a decrease in EGF or asialoglycoprotein receptors.
Baxter, Melissa; Withey, Sarah; Harrison, Sean; Segeritz, Charis-Patricia; Zhang, Fang; Atkinson-Dell, Rebecca; Rowe, Cliff; Gerrard, Dave T.; Sison-Young, Rowena; Jenkins, Roz; Henry, Joanne; Berry, Andrew A.; Mohamet, Lisa; Best, Marie; Fenwick, Stephen W.; Malik, Hassan; Kitteringham, Neil R.; Goldring, Chris E.; Piper Hanley, Karen; Vallier, Ludovic; Hanley, Neil A.
2015-01-01
Background & Aims Hepatocyte-like cells (HLCs), differentiated from pluripotent stem cells by the use of soluble factors, can model human liver function and toxicity. However, at present HLC maturity and whether any deficit represents a true fetal state or aberrant differentiation is unclear and compounded by comparison to potentially deteriorated adult hepatocytes. Therefore, we generated HLCs from multiple lineages, using two different protocols, for direct comparison with fresh fetal and adult hepatocytes. Methods Protocols were developed for robust differentiation. Multiple transcript, protein and functional analyses compared HLCs to fresh human fetal and adult hepatocytes. Results HLCs were comparable to those of other laboratories by multiple parameters. Transcriptional changes during differentiation mimicked human embryogenesis and showed more similarity to pericentral than periportal hepatocytes. Unbiased proteomics demonstrated greater proximity to liver than 30 other human organs or tissues. However, by comparison to fresh material, HLC maturity was proven by transcript, protein and function to be fetal-like and short of the adult phenotype. The expression of 81% phase 1 enzymes in HLCs was significantly upregulated and half were statistically not different from fetal hepatocytes. HLCs secreted albumin and metabolized testosterone (CYP3A) and dextrorphan (CYP2D6) like fetal hepatocytes. In seven bespoke tests, devised by principal components analysis to distinguish fetal from adult hepatocytes, HLCs from two different source laboratories consistently demonstrated fetal characteristics. Conclusions HLCs from different sources are broadly comparable with unbiased proteomic evidence for faithful differentiation down the liver lineage. This current phenotype mimics human fetal rather than adult hepatocytes. PMID:25457200
Hepatocyte transplantation for liver-based metabolic disorders.
Dhawan, Anil; Mitry, Ragai R; Hughes, Robin D
2006-01-01
Hepatocyte transplantation is being investigated as an alternative to orthotopic liver transplantation in patients with liver-based metabolic disorders. The progress made in this field to date is reviewed. Protocols have been developed using collagenase perfusion to isolate human hepatocytes from unused donor liver tissue. Hepatocytes with a high viability can often be obtained and can be cryopreserved for later use, though with loss of function on thawing. For clinical use, hepatocytes must be prepared in clean GMP conditions with cells meeting criteria of function and lack of microbial contamination before patient use. Hepatocytes are infused intraportally into the patient's liver, where a proportion of cells will engraft and replace the deficient metabolic function without the need for major surgery. Twenty patients have now received hepatocyte transplantation, including eight children at King's College Hospital. There was a range of aetiologies of liver disease: familial hypercholesterolaemia, Crigler-Najjar syndrome type 1, urea cycle defects, infantile Refsum disease, glycogen storage disease type Ia, inherited factor VII deficiency and progressive familial intrahepatic cholestasis type 2. Clinical improvement and partial correction of the metabolic abnormality was observed in most cases. Considerable progress has been made in developing the technique, but hepatocyte transplantation is limited by the available supply of liver tissue. Hepatocytes derived from stem cells could provide alternative sources of cells in the future.
Quantification of growth factor signaling and pathway cross talk by live-cell imaging.
Gross, Sean M; Rotwein, Peter
2017-03-01
Peptide growth factors stimulate cellular responses through activation of their transmembrane receptors. Multiple intracellular signaling cascades are engaged following growth factor-receptor binding, leading to short- and long-term biological effects. Each receptor-activated signaling pathway does not act in isolation but rather interacts at different levels with other pathways to shape signaling networks that are distinctive for each growth factor. To gain insights into the specifics of growth factor-regulated interactions among different signaling cascades, we developed a HeLa cell line stably expressing fluorescent live-cell imaging reporters that are readouts for two major growth factor-stimulated pathways, Ras-Raf-Mek-ERK and phosphatidylinositol (PI) 3-kinase-Akt. Incubation of cells with epidermal growth factor (EGF) resulted in rapid, robust, and sustained ERK signaling but shorter-term activation of Akt. In contrast, hepatocyte growth factor induced sustained Akt signaling but weak and short-lived ERK activity, and insulin-like growth factor-I stimulated strong long-term Akt responses but negligible ERK signaling. To address potential interactions between signaling pathways, we employed specific small-molecule inhibitors. In cells incubated with EGF or platelet-derived growth factor-AA, Raf activation and the subsequent stimulation of ERK reduced Akt signaling, whereas Mek inhibition, which blocked ERK activation, enhanced Akt and turned transient effects into sustained responses. Our results reveal that individual growth factors initiate signaling cascades that vary markedly in strength and duration and demonstrate in living cells the dramatic effects of cross talk from Raf and Mek to PI 3-kinase and Akt. Our data further indicate how specific growth factors can encode distinct cellular behaviors by promoting complex interactions among signaling pathways. Copyright © 2017 the American Physiological Society.
Role of YAP activation in nuclear receptor CAR-mediated proliferation of mouse hepatocytes.
Abe, Taiki; Amaike, Yuto; Shizu, Ryota; Takahashi, Miki; Kano, Makoto; Hosaka, Takuomi; Sasaki, Takamitsu; Kodama, Susumu; Matsuzawa, Atsushi; Yoshinari, Kouichi
2018-06-08
Constitutive androstane receptor (CAR) is a xenobiotic-responsive nuclear receptor that is highly expressed in the liver. CAR activation induces hepatocyte proliferation and hepatocarcinogenesis in rodents, but the mechanisms remain unclear. In this study, we investigated the association of CAR-dependent cell proliferation with Yes-associated protein (YAP), which is a transcriptional cofactor controlling organ size and cell growth through the interaction with various transcriptional factors including TEAD. In mouse livers, TCPOBOP (a mouse CAR activator) treatment increased the nuclear YAP accumulation and mRNA levels of YAP target genes as well as cell-cycle related genes along with liver hypertrophy and verteporfin (an inhibitor of YAP/TEAD interaction) cotreatment tended to attenuate them. Furthermore, in cell-based reporter gene assays, CAR activation enhanced the YAP/TEAD-dependent transcription. To investigate the role of YAP/TEAD activation in the CAR-dependent hepatocyte proliferation, we sought to establish an in vitro system completely reproducing CAR-dependent cell proliferation. Since CAR was only slightly expressed in cultured mouse primary hepatocytes compared to mouse livers and no proliferation was observed after treatment with TCPOBOP, we overexpressed CAR using mouse CAR expressing adenovirus (Ad-mCAR-V5) in mouse primary hepatocytes. Ad-mCAR-V5 infection and TCPOBOP treatment induced hepatocyte proliferation. Similar results were obtained with immortalized normal mouse hepatocytes as well. In the established in vitro system, CAR-dependent proliferation was strongly inhibited by Yap knockdown and completely abolished by verteporfin treatment. Our present results obtained in in vivo and in vitro experiments suggest that YAP/TEAD activation plays key roles in CAR-dependent proliferation of murine hepatocytes.
Baxter, Melissa; Withey, Sarah; Harrison, Sean; Segeritz, Charis-Patricia; Zhang, Fang; Atkinson-Dell, Rebecca; Rowe, Cliff; Gerrard, Dave T; Sison-Young, Rowena; Jenkins, Roz; Henry, Joanne; Berry, Andrew A; Mohamet, Lisa; Best, Marie; Fenwick, Stephen W; Malik, Hassan; Kitteringham, Neil R; Goldring, Chris E; Piper Hanley, Karen; Vallier, Ludovic; Hanley, Neil A
2015-03-01
Hepatocyte-like cells (HLCs), differentiated from pluripotent stem cells by the use of soluble factors, can model human liver function and toxicity. However, at present HLC maturity and whether any deficit represents a true fetal state or aberrant differentiation is unclear and compounded by comparison to potentially deteriorated adult hepatocytes. Therefore, we generated HLCs from multiple lineages, using two different protocols, for direct comparison with fresh fetal and adult hepatocytes. Protocols were developed for robust differentiation. Multiple transcript, protein and functional analyses compared HLCs to fresh human fetal and adult hepatocytes. HLCs were comparable to those of other laboratories by multiple parameters. Transcriptional changes during differentiation mimicked human embryogenesis and showed more similarity to pericentral than periportal hepatocytes. Unbiased proteomics demonstrated greater proximity to liver than 30 other human organs or tissues. However, by comparison to fresh material, HLC maturity was proven by transcript, protein and function to be fetal-like and short of the adult phenotype. The expression of 81% phase 1 enzymes in HLCs was significantly upregulated and half were statistically not different from fetal hepatocytes. HLCs secreted albumin and metabolized testosterone (CYP3A) and dextrorphan (CYP2D6) like fetal hepatocytes. In seven bespoke tests, devised by principal components analysis to distinguish fetal from adult hepatocytes, HLCs from two different source laboratories consistently demonstrated fetal characteristics. HLCs from different sources are broadly comparable with unbiased proteomic evidence for faithful differentiation down the liver lineage. This current phenotype mimics human fetal rather than adult hepatocytes. Copyright © 2014 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Generation of functional hepatocyte-like cells from human deciduous periodontal ligament stem cells.
Vasanthan, Punitha; Jayaraman, Pukana; Kunasekaran, Wijenthiran; Lawrence, Anthony; Gnanasegaran, Nareshwaran; Govindasamy, Vijayendran; Musa, Sabri; Kasim, Noor Hayaty Abu
2016-08-01
Human deciduous periodontal ligament stem cells have been introduced for as an easily accessible source of stem cells from dental origin. Although recent studies have revealed the ability of these stem cells in multipotential attribute, their efficiency of hepatic lineage differentiation has not been addressed so far. The aim of this study is to investigate hepatic lineage fate competence of periodontal ligament stem cells through direct media induction. Differentiation of periodontal ligament stem cells into hepatocyte-like cells was conducted by the exposure of two phase media induction. First phase was performed in the presence of hepatocyte growth factors to induce a definitive endoderm formation. In the subsequent phase, the cells were treated with oncostatin M and dexamethosone followed by insulin and transferrin to generate hepatocyte-like cells. Hepatic-related characters of the generated hepatocyte-like cells were determined at both mRNA and protein level followed by functional assays. Foremost changes observed in the generation of hepatocyte-like cells were the morphological features in which these cells were transformed from fibroblastic shape to polygonal shape. Temporal expression of hepatic markers ranging from early endodermal up to late markers were detected in the hepatocyte-like cells. Crucial hepatic markers such as glycogen storage, albumin, and urea secretion were also shown. These findings exhibited the ability of periodontal ligament stem cells of dental origin to be directed into hepatic lineage fate. These cells can be regarded as an alternative autologous source in the usage of stem cell-based treatment for liver diseases.
Generation of functional hepatocyte-like cells from human deciduous periodontal ligament stem cells
NASA Astrophysics Data System (ADS)
Vasanthan, Punitha; Jayaraman, Pukana; Kunasekaran, Wijenthiran; Lawrence, Anthony; Gnanasegaran, Nareshwaran; Govindasamy, Vijayendran; Musa, Sabri; Kasim, Noor Hayaty Abu
2016-08-01
Human deciduous periodontal ligament stem cells have been introduced for as an easily accessible source of stem cells from dental origin. Although recent studies have revealed the ability of these stem cells in multipotential attribute, their efficiency of hepatic lineage differentiation has not been addressed so far. The aim of this study is to investigate hepatic lineage fate competence of periodontal ligament stem cells through direct media induction. Differentiation of periodontal ligament stem cells into hepatocyte-like cells was conducted by the exposure of two phase media induction. First phase was performed in the presence of hepatocyte growth factors to induce a definitive endoderm formation. In the subsequent phase, the cells were treated with oncostatin M and dexamethosone followed by insulin and transferrin to generate hepatocyte-like cells. Hepatic-related characters of the generated hepatocyte-like cells were determined at both mRNA and protein level followed by functional assays. Foremost changes observed in the generation of hepatocyte-like cells were the morphological features in which these cells were transformed from fibroblastic shape to polygonal shape. Temporal expression of hepatic markers ranging from early endodermal up to late markers were detected in the hepatocyte-like cells. Crucial hepatic markers such as glycogen storage, albumin, and urea secretion were also shown. These findings exhibited the ability of periodontal ligament stem cells of dental origin to be directed into hepatic lineage fate. These cells can be regarded as an alternative autologous source in the usage of stem cell-based treatment for liver diseases.
Qin, Harry H; Filippi, Céline; Sun, Song; Lehec, Sharon; Dhawan, Anil; Hughes, Robin D
2015-12-01
Mesenchymal stem/stromal cells (MSCs) improve the metabolic function of co-cultured hepatocytes. The present study aimed to further enhance the trophic effects of co-culture with hepatocytes using hypoxic preconditioning (HPc) of the MSCs and also to investigate the underlying molecular mechanisms involved. Human adipose tissue-derived MSCs were subjected to hypoxia (2 % O2; HPc) or normoxia (20 % O2) for 24 h and then co-cultured with isolated human hepatocytes. Assays of metabolic function and apoptosis were performed to investigate the hepatotrophic and anti-apoptotic effects of co-culture. Indirect co-cultures and co-culture with MSC-conditioned medium investigated the role of paracrine factors in the hepatotrophic effects of co-culture. Reactive oxygen species (ROS) activity was antagonised with N-acetylcysteine to investigate whether HPc potentiated the effects of MSCs by intracellular ROS-dependent mechanisms. Tumour necrosis factor (TNF)-α, transforming growth factor (TGF)-β1, and extracellular collagen production was determined and CASP9 and BAX/BCL-2 signalling pathways analysed to investigate the role of soluble factors, extracellular matrix deposition, and apoptosis-associated gene signalling in the effects of co-culture. HPc potentiated the hepatotrophic and anti-apoptotic effects of co-culture by ROS-dependent mechanisms. There was increased MSC TGF-β1 production, and enhanced MSC deposition of extracellular collagen, with reduced synthesis of TNF-α, as well as a downregulation of the expression of pro-apoptotic CASP9, BAX, BID and BLK genes and upregulated expression of anti-apoptotic BCL-2 in hepatocytes. HPc potentiated the trophic and anti-apoptotic effects of MSCs on hepatocytes via mechanisms including intracellular ROS, autocrine TGF-β, extracellular collagen and caspase and BAX/BCL-2 signalling pathways.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Liyan; Liu, Xiaolin; Zhang, Yuelin
Poor cell survival post transplantation compromises the therapeutic benefits of mesenchymal stem cells (MSCs) in myocardial infarction (MI). Hepatocyte growth factor (HGF) is an important cytokine for angiogenesis, anti-inflammation and anti-apoptosis. This study aimed to evaluate the cardioprotective effects of MSCs overexpressing HGF in a mouse model of MI. The apoptosis of umbilical cord-derived MSCs (UC-MSCs) and HGF-UC-MSCs under normoxic and hypoxic conditions was detected. The conditioned medium (CdM) of UC-MSCs and HGF-UC-MSCs under a hypoxic condition was harvested and its protective effect on neonatal cardiomyocytes (NCMs) exposed to a hypoxic challenge was examined. UC-MSCs and HGF-UC-MSCs were transplanted intomore » the peri-infarct region in mice following MI and heart function assessed 4 weeks post transplantation. The apoptosis of HGF-UC-MSCs under hypoxic conditions was markedly decreased compared with that of UC-MSCs. NCMs treated with HGF-UC-MSC hypoxic CdM (HGF-UC-MSCs-hy-CdM) exhibited less cell apoptosis in response to hypoxic challenge than those treated with UC-MSC hypoxic CdM (UC-MSCs-hy-CdM). HGF-UC-MSCs-hy-CdM released the inhibited p-Akt and lowered the enhanced ratio of Bax/Bcl-2 induced by hypoxia in the NCMs. HGF-UC-MSCs-hy-CdM expressed higher levels of HGF, EGF, bFGF and VEGF than UC-MSCs-hy-CdM. Transplantation of HGF-UC-MSCs or UC-MSCs greatly improved heart function in the mouse model of MI. Compared with UC-MSCs, transplantation of HGF-UC-MSCs was associated with less cardiomyocyte apoptosis, enhanced angiogenesis and increased proliferation of cardiomyocytes. This study may provide a novel therapeutic strategy for MSC-based therapy in cardiovascular disease.« less
Nakanishi, Chihiro; Moriuchi, Akihiro; Ido, Akio; Numata, Masatsugu; Kim, Il-Deok; Kusumoto, Kazunori; Hasuike, Satoru; Abe, Hiroo; Nagata, Kenji; Akiyama, Yutaka; Uto, Hirofumi; Kataoka, Hiroaki; Tsubouchi, Hirohito
2006-07-01
Hepatocyte growth factor (HGF) is a promising agent for the treatment of intractable liver disease, due to its mitogenic, anti-apoptotic, and anti-fibrotic effects. We investigated the effect of recombinant human HGF (rh-HGF) on the development of both hepatocellular carcinoma (HCC) and preneoplastic nodules in rats fed a choline-deficient L-amino acid-defined (CDAA) diet, an animal model of hepatocarcinogenesis resembling human development of HCC with cirrhosis. From weeks 13 to 48 of the CDAA diet, rh-HGF (0.1 or 0.5 mg/kg/day) was administered intravenously to rats in four-week cycles, with treatment for five consecutive days of each week for two weeks, followed by a two-week washout period. Treatment with rh-HGF significantly inhibited the development of preneoplastic nodules in a dose-dependent manner at 24 weeks. Although the numbers and areas of the preneoplastic nodules in rats treated with rh-HGF were equivalent to those in mock-treated rats by 60 weeks, the incidence of HCC was reduced by HGF treatment. Although one rat treated with low-dose rh-HGF exhibited a massive HCC, which occupied almost the whole liver, and lung metastases, HGF treatment did not increase the overall frequency of HCC. Administration of high-dose rh-HGF, however, induced an increase in the urinary excretion of albumin, leading to decreased serum albumin at 60 weeks. These results indicate that long-term administration of rh-HGF does not accelerate hepatocarcinogenesis in rats fed a CDAA diet. However, these findings do not completely exclude the potential of HGF-induced hepatocarcinogenesis; this issue must be resolved before rh-HGF can be used for patients with intractable liver diseases, especially those with cirrhosis.
Tsukagawa, Eri; Adachi, Hisashi; Hirai, Yuji; Enomoto, Mika; Fukami, Ako; Ogata, Kinuka; Kasahara, Akiko; Yokoi, Kanako; Imaizumi, Tsutomu
2013-07-01
Hepatocyte growth factor (HGF) receptors form a hybrid complex with insulin receptors in the liver of mice, which lead to robust signalling to regulate glucose metabolism. Serum HGF levels are high in subjects with metabolic syndrome and/or obesity. Accordingly, we prospectively investigated the relationship between HGF and the development of insulin resistance (IR) in a general population without IR at baseline. A total of 1492 subjects received health examinations. After excluding subjects with diabetes and/or IR (n = 402) at baseline, the remaining subjects (n = 1090) were followed-up 10 years later. Complete data sets were available from 716 subjects for prospective analysis. Logistic regression was performed to determine factors associated with the development of IR after 10 years. In subjects without diabetes at baseline, serum HGF levels were higher (0·26 ± 0·10 ng/ml, n = 259) in subjects with IR than without it (0·22 ± 0·09 ng/ml, n = 1090). After deleting subjects who developed liver disease during follow-up, 188 were found to have developed IR at 10 years after the original screening. HGF (P < 0·05), age (P < 0·001), homoeostasis model assessment index (P < 0·001), HDL-c (P < 0·05; inversely) and hypertensive medication (P < 0·05) were significantly associated with the development of IR by multivariate stepwise logistic regression analysis. A significant (P < 0·05) relative risk [1·75 (95%CI: 1·01-3·12)] for the development of IR was observed in the highest (≥0·30 ng/ml) vs the lowest categories (<0·15 ng/ml) of HGF after adjustments for confounders. Our 10-year prospective study suggests that elevated serum HGF levels were significantly associated with the development of IR. © 2012 John Wiley & Sons Ltd.
Kawamura, Kazuhiro; Takano, Kazunori; Suetsugu, Shiro; Kurisu, Shusaku; Yamazaki, Daisuke; Miki, Hiroaki; Takenawa, Tadaomi; Endo, Takeshi
2004-12-24
During skeletal muscle regeneration caused by injury, muscle satellite cells proliferate and migrate toward the site of muscle injury. This migration is mainly induced by hepatocyte growth factor (HGF) secreted by intact myofibers and also released from injured muscle. However, the intracellular machinery for the satellite cell migration has not been elucidated. To examine the mechanisms of satellite cell migration, we utilized satellite cell-derived mouse C2C12 skeletal muscle cells. HGF induced reorganization of actin cytoskeleton to form lamellipodia in C2C12 myoblasts. HGF treatment facilitated both nondirectional migration of the myoblasts in phagokinetic track assay and directional chemotactic migration toward HGF in a three-dimensional migration chamber assay. Endogenous N-WASP and WAVE2 were concentrated in the lamellipodia at the leading edge of the migrating cells. Moreover, exogenous expression of wild-type N-WASP or WAVE2 promoted lamellipodial formation and migration. By contrast, expression of the dominant-negative mutant of N-WASP or WAVE2 and knockdown of N-WASP or WAVE2 expression by the RNA interference prevented the HGF-induced lamellipodial formation and migration. When the cells were treated with LY294002, an inhibitor of phosphatidylinositol 3-kinase, the HGF-induced lamellipodial formation and migration were abrogated. These results imply that both N-WASP and WAVE2, which are activated downstream of phosphati-dylinositol 3-kinase, are required for the migration through the lamellipodial formation of C2C12 cells induced by HGF.
Kong, Fanxuan; Shi, Xuefeng; Xiao, Fengjun; Yang, Yuefeng; Zhang, Xiaoyan; Wang, Li-Sheng; Wu, Chu-Tse; Wang, Hua
2018-02-01
Investigations based on mesenchymal stem cells (MSCs) for osteoporosis have attracted attention recently. MSCs can be derived from various tissues, such as bone marrow, adipose, umbilical cord, placenta, and dental pulp. Among these, dental pulp-derived MSCs (DPSCs) and hepatocyte growth factor (HGF)-modified DPSCs (DPSCs-HGF) highly express osteogenic-related genes and have stronger osteogenic differentiation capacities. DPSCs have more benefits in treating osteoporosis. The purpose of this study was to investigate the roles of HGF gene-modified DPSCs in bone regeneration using a mouse model of ovariectomy (OVX)-induced bone loss. The HGF and luciferase genes were transferred into human DPSCs using recombinant adenovirus. These transduced cells were assayed for distribution or bone regeneration assay by transplantation into an OVX-induced osteoporosis model. By using bioluminogenic imaging, it was determined that some DPSCs could survive for >1 month in vivo. The DPSCs were mainly distributed to the lung in the early stage and to the liver in the late stage of OVX osteoporosis after administration, but they were scarcely distributed to the bone. The homing efficiency of DPSCs is higher when administrated in the early stage of a mouse OVX model. Micro-computed tomography indicated that DPSCs-Null or DPSCs-HGF transplantation significantly reduces OVX-induced bone loss in the trabecular bone of the distal femur metaphysis, and DPSCs-HGF show a stronger capacity to reduce bone loss. The data suggest that systemic infusion of DPSCs-HGF is a potential therapeutic approach for OVX-induced bone loss, which might be mediated by paracrine mechanisms.
Pang, Jinke; Zhang, Geng; Lin, Yong; Xie, Zhanglian; Liu, Hongyan; Tang, Libo; Lu, Mengji; Yan, Ran; Guo, Haitao; Sun, Jian; Hou, Jinlin; Zhang, Xiaoyong
2017-01-03
Hepatitis B Virus (HBV) replication in hepatocytes is restricted by the host innate immune system and related intracellular signaling pathways. Transforming growth factor β-activated kinase 1 (TAK1) is a key mediator of toll-like receptors and pro-inflammatory cytokine signaling pathways. Here, we report that silencing or inhibition of endogenous TAK1 in hepatoma cell lines leads to an upregulation of HBV replication, transcription, and antigen expression. In contrast, overexpression of TAK1 significantly suppresses HBV replication, while an enzymatically inactive form of TAK1 exerts no effect. By screening TAK1-associated signaling pathways with inhibitors and siRNAs, we found that the MAPK-JNK pathway was involved in TAK1-mediated HBV suppression. Moreover, TAK1 knockdown or JNK pathway inhibition induced the expression of farnesoid X receptor α, a transcription factor that upregulates HBV transcription. Finally, ectopic expression of TAK1 in a HBV hydrodynamic injection mouse model resulted in lower levels of HBV DNA and antigens in both liver and serum. In conclusion, our data suggest that TAK1 inhibits HBV primarily at viral transcription level through activation of MAPK-JNK pathway, thus TAK1 represents an intrinsic host restriction factor for HBV replication in hepatocytes.
Zellmer, Sebastian; Schmidt-Heck, Wolfgang; Godoy, Patricio; Weng, Honglei; Meyer, Christoph; Lehmann, Thomas; Sparna, Titus; Schormann, Wiebke; Hammad, Seddik; Kreutz, Clemens; Timmer, Jens; von Weizsäcker, Fritz; Thürmann, Petra A; Merfort, Irmgard; Guthke, Reinhard; Dooley, Steven; Hengstler, Jan G; Gebhardt, Rolf
2010-12-01
The cellular basis of liver regeneration has been intensely investigated for many years. However, the mechanisms initiating hepatocyte "plasticity" and priming for proliferation are not yet fully clear. We investigated alterations in gene expression patterns during the first 72 hours of C57BL/6N mouse hepatocyte culture on collagen monolayers (CM), which display a high basal frequency of proliferation in the absence of cytokines. Although many metabolic genes were down-regulated, genes related to mitogen-activated protein kinase (MAPK) signaling and cell cycle were up-regulated. The latter genes showed an overrepresentation of transcription factor binding sites (TFBS) for ETF (TEA domain family member 2), E2F1 (E2F transcription factor 1), and SP-1 (Sp1 transcription factor) (P < 0.001), all depending on MAPK signaling. Time-dependent increase of ERK1/2 phosphorylation occurred during the first 48 hours (and beyond) in the absence of cytokines, accompanied by an enhanced bromodeoxyuridine labeling index of 20%. The MEK inhibitor PD98059 blunted these effects indicating MAPK signaling as major trigger for this cytokine-independent proliferative response. In line with these in vitro findings, liver tissue of mice challenged with CCl(4) displayed hepatocytes with intense p-ERK1/2 staining and nuclear SP-1 and E2F1 expression. Furthermore, differentially expressed genes in mice after partial hepatectomy contained overrepresented TFBS for ETF, E2F1, and SP-1 and displayed increased expression of E2F1. Cultivation of murine hepatocytes on CM primes cells for proliferation through cytokine-independent activation of MAPK signaling. The transcription factors ETF, E2F1, and SP-1 seem to play a pronounced role in mediating proliferation-dependent differential gene expression. Similar events, but on a shorter time-scale, occur very early after liver damage in vivo. Copyright © 2010 American Association for the Study of Liver Diseases.
Pajari, Anne-Maria; Päivärinta, Essi; Paavolainen, Lassi; Vaara, Elina; Koivumäki, Tuuli; Garg, Ritu; Heiman-Lindh, Anu; Mutanen, Marja; Marjomäki, Varpu; Ridley, Anne J.
2016-01-01
Berries have been found to inhibit colon carcinogenesis in animal models, and thus represent a potential source of compounds for prevention and treatment of colorectal cancer. The mechanistic basis for their effects is not well understood. We used human colon carcinoma cells and Min mice to investigate the effects of ellagitannin-rich cloudberry (Rubus chamaemorus) extract on cancer cell migration and underlying cell signaling. Intrinsic and hepatocyte growth factor (HGF) -induced cell motility in human HT29 and HCA7 colon carcinoma cells was assessed carrying out cell scattering and scratch wound healing assays using time-lapse microscopy. Activation of Met, AKT, and ERK in cell lines and tumors of cloudberry-fed Min mice were determined using immunoprecipitation, Western blot and immunohistochemical analyses. Cloudberry extract significantly inhibited particularly HGF-induced cancer cell migration in both cell lines. Cloudberry extract inhibited the Met receptor tyrosine phosphorylation by HGF and strongly suppressed HGF-induced AKT and ERK activation in both HT29 and HCA7 cells. Consistently, cloudberry feeding (10% w/w freeze-dried berries in diet for 10 weeks) reduced the level of active AKT and prevented phosphoMet localization at the edges in tumors of Min mice. These results indicate that cloudberry reduces tumor growth and cancer cell motility by inhibiting Met signaling and consequent activation of phosphatidylinositol 3-kinase/AKT in vitro and in tumors in vivo. As the Met receptor is recognized to be a major target in cancer treatment, our results suggest that dietary phytochemicals may have therapeutic value in reducing cancer progression and metastasis. PMID:27270323
1989-01-01
We have reported previously that the addition of dexamethasone to cultured quiescent suckling rat hepatocytes in the presence of insulin, a culture condition which does not cause growth activation, induces a selective increase in the synthesis of the 49-kD/55-kD cytokeratin (CK49/CK55) pair over a 24-h period. This increased synthesis coincides with the formation of dense filament networks reminiscent of those observed in situ at the cell periphery (Marceau, N., H. Baribault, and I. Leroux-Nicollet. 1985. Can. J. Biochem. Cell Biol. 63:448-457). We show here for the first time that when EGF is added 48 h after insulin and dexamethasone, there is an early preferential phosphorylation of the CK55 of the CK49/CK55 pair, an induced filament rearrangement from the cell periphery to the cytoplasm, and a subsequent entry into S phase and mitosis after a lag period of 8 h. Indirect immunofluorescence microscopy with monoclonal antibodies to CK49 and CK55 indicate that, while before EGF treatment the cytokeratin filaments were mainly distributed near the cell periphery, the addition of EGF resulted in their reorganization to a predominantly cytoplasmic localization within less than 3 h. Antitubulin and anti-actin antibodies showed no detectable alteration in the distribution of microtubules and microfilaments. Pulse-chase measurements with [35S]methionine showed no apparent change in the turnover of either CK49 or CK55 during the period that precedes the initiation of DNA synthesis. 32P-labeling in vivo followed by SDS-PAGE demonstrated that CK55 was phosphorylated at a much higher level than CK49 in nonstimulated hepatocytes, and that the addition of EGF resulted in a selective stimulation of 32P-CK55 labeling within less than 30 min. Comparative analyses by two-dimensional PAGE of [35S]methionine and 32P- labeled cytokeratins at various times after EGF stimulation demonstrated a rapid increase in a first phosphorylated form of CK55 and the appearance of a second
Shannon, Diane B; McKeown, Scott T W; Lundy, Fionnuala T; Irwin, Chris R
2006-01-01
Wounds of the oral mucosa heal in an accelerated fashion with reduced scarring compared with cutaneous wounds. The differences in healing outcome between oral mucosa and skin could be because of phenotypic differences between the respective fibroblast populations. This study compared paired mucosal and dermal fibroblasts in terms of collagen gel contraction, alpha-smooth muscle actin expression (alpha-SMA), and production of the epithelial growth factors: keratinocyte growth factor (KGF) and hepatocyte growth factor/scatter factor (HGF). The effects of transforming growth factor -beta1 and -beta3 on each parameter were also determined. Gel contraction in floating collagen lattices was determined over a 7-day period. alpha-SMA expression by fibroblasts was determined by Western blotting. KGF and HGF expression were determined by an enzyme-linked immunosorbent assay. Oral fibroblasts induced accelerated collagen gel contraction, yet surprisingly expressed lower levels of alpha-SMA. Oral cells also produced significantly greater levels of both KGF and HGF than their dermal counterparts. Transforming growth factor-beta1 and -beta3, over the concentration range of 0.1-10 ng/mL, had similar effects on cell function, stimulating both gel contraction and alpha-SMA production, but inhibiting KGF and HGF production by both cell types. These data indicate phenotypic differences between oral and dermal fibroblasts that may well contribute to the differences in healing outcome between these two tissues.
Human Hepatocyte Isolation: Does Portal Vein Embolization Affect the Outcome?
Kluge, Martin; Reutzel-Selke, Anja; Napierala, Hendrik; Hillebrandt, Karl Herbert; Major, Rebeka Dalma; Struecker, Benjamin; Leder, Annekatrin; Siefert, Jeffrey; Tang, Peter; Lippert, Steffen; Sallmon, Hannes; Seehofer, Daniel; Pratschke, Johann; Sauer, Igor M; Raschzok, Nathanael
2016-01-01
Primary human hepatocytes are widely used for basic research, pharmaceutical testing, and therapeutic concepts in regenerative medicine. Human hepatocytes can be isolated from resected liver tissue. Preoperative portal vein embolization (PVE) is increasingly used to decrease the risk of delayed postoperative liver regeneration by induction of selective hypertrophy of the future remnant liver tissue. The aim of this study was to investigate the effect of PVE on the outcome of hepatocyte isolation. Primary human hepatocytes were isolated from liver tissue obtained from partial hepatectomies (n = 190) using the two-step collagenase perfusion technique followed by Percoll purification. Of these hepatectomies, 27 isolations (14.2%) were performed using liver tissue obtained from patients undergoing PVE before surgery. All isolations were characterized using parameters that had been described in the literature as relevant for the outcome of hepatocyte isolation. The isolation outcomes of the PVE and the non-PVE groups were then compared before and after Percoll purification. Metabolic parameters (transaminases, urea, albumin, and vascular endothelial growth factor secretion) were measured in the supernatant of cultured hepatocytes for more than 6 days (PVE: n = 4 and non-PVE: n = 3). The PVE and non-PVE groups were similar in regard to donor parameters (sex, age, and indication for surgery), isolation parameters (liver weight and cold ischemia time), and the quality of the liver tissue. The mean initial viable cell yield did not differ between the PVE and non-PVE groups (10.16 ± 2.03 × 10(6) cells/g vs. 9.70 ± 0.73 × 10(6) cells/g, p = 0.499). The initial viability was slightly better in the PVE group (77.8% ± 2.03% vs. 74.4% ± 1.06%). The mean viable cell yield (p = 0.819) and the mean viability (p = 0.141) after Percoll purification did not differ between the groups. PVE had no effect on enzyme leakage and metabolic
Effect of brain-derived neurotrophic factor (BDNF) on hepatocyte metabolism.
Genzer, Yoni; Chapnik, Nava; Froy, Oren
2017-07-01
Brain-derived neurotrophic factor (BDNF) plays crucial roles in the development, maintenance, plasticity and homeostasis of the central and peripheral nervous systems. Perturbing BDNF signaling in mouse brain results in hyperphagia, obesity, hyperinsulinemia and hyperglycemia. Currently, little is known whether BDNF affects liver tissue directly. Our aim was to determine the metabolic signaling pathways activated after BDNF treatment in hepatocytes. Unlike its effect in the brain, BDNF did not lead to activation of the liver AKT pathway. However, AMP protein activated kinase (AMPK) was ∼3 times more active and fatty acid synthase (FAS) ∼2-fold less active, suggesting increased fatty acid oxidation and reduced fatty acid synthesis. In addition, cAMP response element binding protein (CREB) was ∼3.5-fold less active together with its output the gluconeogenic transcript phosphoenolpyruvate carboxykinase (Pepck), suggesting reduced gluconeogenesis. The levels of glycogen synthase kinase 3b (GSK3b) was ∼3-fold higher suggesting increased glycogen synthesis. In parallel, the expression levels of the clock genes Bmal1 and Cry1, whose protein products play also a metabolic role, were ∼2-fold increased and decreased, respectively. In conclusion, BDNF binding to hepatocytes leads to activation of catabolic pathways, such as fatty acid oxidation. In parallel gluconeogenesis is inhibited, while glycogen storage is triggered. This metabolic state mimics that of after breakfast, in which the liver continues to oxidize fat, stops gluconeogenesis and replenishes glycogen stores. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hayashi, Hiromitsu; Sakai, Keiko; Baba, Hideo; Sakai, Takao
2012-05-01
The matricellular protein, thrombospondin-1 (TSP-1), is prominently expressed during tissue repair. TSP-1 binds to matrix components, proteases, cytokines, and growth factors and activates intracellular signals through its multiple domains. TSP-1 converts latent transforming growth factor-beta1 (TGF-β1) complexes into their biologically active form. TGF-β plays significant roles in cell-cycle regulation, modulation of differentiation, and induction of apoptosis. Although TGF-β1 is a major inhibitor of proliferation in cultured hepatocytes, the functional requirement of TGF-β1 during liver regeneration remains to be defined in vivo. We generated a TSP-1-deficient mouse model of a partial hepatectomy (PH) and explored TSP-1 induction, progression of liver regeneration, and TGF-β-mediated signaling during the repair process after hepatectomy. We show here that TSP-1-mediated TGF-β1 activation plays an important role in suppressing hepatocyte proliferation. TSP-1 expression was induced in endothelial cells (ECs) as an immediate early gene in response to PH. TSP-1 deficiency resulted in significantly reduced TGF-β/Smad signaling and accelerated hepatocyte proliferation through down-regulation of p21 protein expression. TSP-1 induced in ECs by reactive oxygen species (ROS) modulated TGF-β/Smad signaling and proliferation in hepatocytes in vitro, suggesting that the immediately and transiently produced ROS in the regenerating liver were the responsible factor for TSP-1 induction. We have identified TSP-1 as an inhibitory element in regulating liver regeneration by TGF-β1 activation. Our work defines TSP-1 as a novel immediate early gene that could be a potential therapeutic target to accelerate liver regeneration. Copyright © 2011 American Association for the Study of Liver Diseases.
Interactions between macrophage/Kupffer cells and hepatocytes in surgical sepsis
DOE Office of Scientific and Technical Information (OSTI.GOV)
West, M.A.
Experiments were performed to investigate the role of Kupffer cell/macrophage interactions with hepatocytes in modulating liver function during infections using direct in vitro cocultivation of rat macrophages or Kupffer cells with rat hepatocytes. Protein synthesis was assayed as a sensitive indicator of integrated hepatocellular function by measuring {sup 3}H-leucine incorporation into hepatocyte protein. Septic stimuli such as lipoploysaccharide and killed bacteria were added to cocultures of hepatocytes and macrophages or Kupffer cells and the responses compared to hepatocytes alone. Information about the types of proteins synthesized by hepatocytes under various culture conditions was determined using polyacrylamide gel electrophoresis and autoradiography.more » These experiments showed that septic stimuli alter the amount and type of protein synthesized by hepatocytes and had no direct effect on hepatocytes in the absence of macrophages or Kupffer cells. The mediator(s) appears to be a heat labile, soluble monokine(s) which is distinct from interleukin-1 or tumor necrosis factor. The important role of Kupffer cells/macrophages in mediating alterations in hepatocellular function in sepsis may ultimately improve patient care.« less
Cele, S B; Odun-Ayo, F; Onyangunga, O A; Moodley, J; Naicker, T
2018-08-01
Hepatocyte Growth Factor (HGF) plays a role in the migration and morphogenesis of different cell types and tissues. Preeclampsia (PE) is associated with deficient trophoblast invasion and placental insufficiency; hence HGF production is expected to be compromised. This study therefore aimed to immunolocalize and morphometrically analyse placental HGF in normotensive versus PE pregnancies stratified by HIV status and gestational age. Normotensive (N; n = 40) and preeclamptic (PE; n = 80) women were stratified by HIV status (HIV- and HIV+), and gestational age i.e. early onset of PE (EOPE; <34 weeks) and late onset of PE (LOPE; ≥34 weeks). Placental tissues were stained using conventional immunohistochemistry, performed using mouse anti-human HGF antibody. Morphometric image analysis was performed using Zeiss Axio-Vision software. HGF was immuno-localized within the syncytiotrophoblast, cytotrophoblast, endothelial and fibroblast-like cell populations of both conducting and exchange villi. Based on pregnancy type, HGF immunoexpression within the conducting villi was significantly different between Nvs EOPE (p = 0.0372) and EOPE vs LOPE (p = 0.0006). Within the exchange villi, no significant difference of HGF immunostaining was noted between N vs EOPE and N vs LOPE. A down-regulation of HGF immuno-expression was observed in LOPE compared to other groups within both villi types, albeit non-significant. Based on HIV status, no significant difference in HGF immuno-expression was demonstrated between HIV- vs HIV + within the exchange and conducting villi. However, the expression of HGF in HIV- group was elevated in both villi types. Across the groups, a significant difference was found between N+ vs EOPE- (p = 0.0207), EOPE+ vs LOPE- (p = 0.0036) and EOPE- vs LOPE- (p = 0.0016) of the conducting villi while no significant difference was found within the exchange villi. This novel study demonstrates that HGF was two-fold higher in conducting compared to
Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L
2018-05-01
Long-term cultures of primary adult rat hepatocytes were used to study the effects of N-acetyl-2-aminofluorene (AAF) on hepatocyte proliferation during the growth cycle; on the initiation of hepatocyte DNA synthesis in quiescent cultures; and, on hepatocyte DNA replication following the initiation of DNA synthesis. Scatchard analyses were used to identify the pharmacologic properties of radiolabeled AAF metabolite binding to hepatocyte macromolecules. Two classes of growth cycle-dependent AAF metabolite binding sites-a high-affinity low-capacity site (designated Site I) and a low-affinity high-capacity site (designated Site II)-associated with two spatially distinct classes of macromolecular targets, were revealed. Based upon radiolabeled AAF metabolite binding to purified hepatocyte genomic DNA or to DNA, RNA, proteins, and lipids from isolated nuclei, Site IDAY 4 targets (KD[APPARENT] ≈ 2-4×10-6 M and BMAX[APPARENT] ≈ 6 pmol/106 cells/24 h) were consistent with genomic DNA; and with AAF metabolized by a nuclear cytochrome P450. Based upon radiolabeled AAF binding to total cellular lysates, Site IIDAY 4 targets (KD[APPARENT] ≈ 1.5×10-3 M and BMAX[APPARENT] ≈ 350 pmol/106 cells/24 h) were consistent with cytoplasmic proteins; and with AAF metabolized by cytoplasmic cytochrome P450s. DNA synthesis was not inhibited by concentrations of AAF that saturated DNA binding in the neighborhood of the Site I KD. Instead, hepatocyte DNA synthesis inhibition required higher concentrations of AAF approaching the Site II KD. These observations raise the possibility that carcinogenic DNA adducts derived from AAF metabolites form below concentrations of AAF that inhibit replicative and repair DNA synthesis.
Atabey, N; Gao, Y; Yao, Z J; Breckenridge, D; Soon, L; Soriano, J V; Burke, T R; Bottaro, D P
2001-04-27
Hepatocyte growth factor (HGF) stimulates mitogenesis, motogenesis, and morphogenesis in a wide range of cellular targets during development, homeostasis and tissue regeneration. Inappropriate HGF signaling occurs in several human cancers, and the ability of HGF to initiate a program of protease production, cell dissociation, and motility has been shown to promote cellular invasion and is strongly linked to tumor metastasis. Upon HGF binding, several tyrosines within the intracellular domain of its receptor, c-Met, become phosphorylated and mediate the binding of effector proteins, such as Grb2. Grb2 binding through its SH2 domain is thought to link c-Met with downstream mediators of cell proliferation, shape change, and motility. We analyzed the effects of Grb2 SH2 domain antagonists on HGF signaling and observed potent blockade of cell motility, matrix invasion, and branching morphogenesis, with ED(50) values of 30 nm or less, but only modest inhibition of mitogenesis. These compounds are 1000-10,000-fold more potent anti-motility agents than any previously characterized Grb2 SH2 domain antagonists. Our results suggest that SH2 domain-mediated c-Met-Grb2 interaction contributes primarily to the motogenic and morphogenic responses to HGF, and that these compounds may have therapeutic application as anti-metastatic agents for tumors where the HGF signaling pathway is active.
Yamazaki, Taisuke; Enosawa, Shin; Tokiwa, Takayoshi
2018-06-01
Previously, we reported that non-parenchymal cell (NPC) fractions from cirrhotic liver of biliary atresia (BA) may contain stem/progenitor cells, and clusters of hepatocyte-like cells appear via hepatocyte growth factor/c-Met signaling in primary cultures of NPCs. BA is a rare and serious liver disease, and procurement of BA cells is difficult. Therefore, cryopreservation of BA liver cells is an unavoidable challenge. In this study, we examined the appearance and liver function of hepatocyte-like cells in cultures of BA liver-derived NPC fractions after cryopreservation for 1 or 6 mo using a chemically defined cryopreservation solution, STEM-CELLBANKER. Although a decrease in cell viability was observed in recovered cells after 1 mo of cryopreservation, clusters of hepatocyte-like cells appeared in the culture of cells that had been cryopreserved for 1 or 6 mo, similar to non-cryopreserved cells. In addition, these hepatocyte-like cells expressed hepatocyte-related mRNAs and demonstrated albumin production and glycogen storage. The present results suggest that hepatic stem/progenitor cells in NPC fractions may be efficiently cryopreserved, as demonstrated by the appearance of hepatocyte-like cells that show various hepatic functions even after cryopreservation. This study may lead to future BA cell therapy using the patient's own cells.
Gruver, Aaron M; Liu, Ling; Vaillancourt, Peter; Yan, Sau-Chi B; Cook, Joel D; Roseberry Baker, Jessica A; Felke, Erin M; Lacy, Megan E; Marchal, Christophe C; Szpurka, Hadrian; Holzer, Timothy R; Rhoads, Emily K; Zeng, Wei; Wortinger, Mark A; Lu, Jirong; Chow, Chi-kin; Denning, Irene J; Beuerlein, Gregory; Davies, Julian; Hanson, Jeff C; Credille, Kelly M; Wijayawardana, Sameera R; Schade, Andrew E
2014-12-01
Development of novel targeted therapies directed against hepatocyte growth factor (HGF) or its receptor (MET) necessitates the availability of quality diagnostics to facilitate their safe and effective use. Limitations of some commercially available anti-MET antibodies have prompted development of the highly sensitive and specific clone A2H2-3. Here we report its analytical properties when applied by an automated immunohistochemistry method. Excellent antibody specificity was demonstrated by immunoblot, ELISA, and IHC evaluation of characterised cell lines including NIH3T3 overexpressing the related kinase MST1R (RON). Sensitivity was confirmed by measurements of MET in cell lines or characterised tissues. IHC correlated well with FISH and quantitative RT-PCR assessments of MET (P < 0.001). Good total agreement (89%) was observed with the anti-MET antibody clone SP44 using whole-tissue sections, but poor positive agreement (21-47%) was seen in tissue microarray cores. Multiple lots displayed appropriate reproducibility (R(2) > 0.9). Prevalence of MET positivity by IHC was higher in non-squamous cell NSCLC, MET or EGFR amplified cases, and in tumours harbouring abnormalities in EGFR exon 19 or 21. The anti-MET antibody clone A2H2-3 displays excellent specificity and sensitivity. These properties make it suitable for clinical trial investigations and development as a potential companion diagnostic. © 2014 The Authors. Histopathology Published by John Wiley & Sons Ltd.
Merlen, Grégory; Gentric, Géraldine; Celton-Morizur, Séverine; Foretz, Marc; Guidotti, Jacques-Emmanuel; Fauveau, Véronique; Leclerc, Jocelyne; Viollet, Benoit; Desdouets, Chantal
2014-01-01
AMP-activated protein kinase (AMPK) is an evolutionarily conserved sensor of cellular energy status that contributes to restoration of energy homeostasis by slowing down ATP-consuming pathways and activating ATP-producing pathways. Unexpectedly, in different systems, AMPK is also required for proper cell division. In the current study, we evaluated the potential effect of the AMPK catalytic subunit, AMPKα1, on hepatocyte proliferation. Hepatocyte proliferation was determined in AMPKα1 knockout and wild-type mice in vivo after two thirds partial hepatectomy, and in vitro in primary hepatocyte cultures. The activities of metabolic and cell cycle-related signaling pathways were measured. After partial hepatectomy, hepatocytes proliferated rapidly, correlating with increased AMPK phosphorylation. Deletion of AMPKα1 delayed liver regeneration by impacting on G1/S transition phase. The proliferative defect of AMPKα1-deficient hepatocytes was cell autonomous, and independent of energy balance. The priming phase, lipid droplet accumulation, protein anabolic responses and growth factor activation after partial hepatectomy occurred normally in the absence of AMPKα1 activity. By contrast, mRNA and protein expression of cyclin A2, a key driver of S phase progression, were compromised in the absence of AMPK activity. Importantly, AMPKα1 controlled cyclin A2 transcription mainly through the ATF/CREB element. Our study highlights a novel role for AMPKα1 as a positive regulator of hepatocyte division occurring independently of energy balance. Copyright © 2013 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Lamorte, Louie; Rodrigues, Sonia; Naujokas, Monica; Park, Morag
2002-10-04
Activation of the Met receptor tyrosine kinase through its ligand, hepatocyte growth factor, stimulates cell spreading, cell dispersal, and the inherent morphogenic program of various epithelial cell lines. Although both hepatocyte growth factor and epidermal growth factor (EGF) can activate downstream signaling pathways in Madin-Darby canine kidney epithelial cells, EGF fails to promote the breakdown of cell-cell junctional complexes and initiate an invasive morphogenic program. We have undertaken a strategy to identify signals that synergize with EGF in this process. We provide evidence that the overexpression of the CrkII adapter protein complements EGF-stimulated pathways to induce cell dispersal in two-dimensional cultures and cell invasion and branching morphogenesis in three-dimensional collagen gels. This finding correlates with the ability of CrkII to promote the breakdown of adherens junctions in stable cell lines and the ability of EGF to stimulate enhanced Rac activity in cells overexpressing CrkII. We have previously shown that the Gab1-docking protein is required for branching morphogenesis downstream of the Met receptor. Consistent with a role for CrkII in promoting EGF-dependent branching morphogenesis, the binding of Gab1 to CrkII is required for the branching morphogenic program downstream of Met. Together, our data support a role for the CrkII adapter protein in epithelial invasion and morphogenesis and underscores the importance of considering the synergistic actions of signaling pathways in cancer progression.
Kilic, Mustafa Kemal; Yesilkaya, Yakup; Tezcan, Kadriye; Cinar, Nese; Akin, Safak; Karakaya, Jale; Akata, Deniz; Usman, Aydan; Gurlek, Alper
2016-05-01
Hashimoto's thyroiditis (HT) is the most common etiology of hypothyroidism in regions where iodine deficiency is not a concern. To date, many clinical investigations have been conducted to elucidate its pathogenesis. Several growth factors have been shown to have a role in its development. Hepatocyte growth factor (HGF) is one of the aforementioned molecules. We aimed to demonstrate whether HGF is responsible for HT and goiter development. Also, we aimed to test the hypothesis that levo-thyroxine sodium therapy will suppress HGF levels. Sixty-one premenopausal women who were admitted to our outpatient clinic between November 2010 and September 2011 were enrolled. Three groups were determined according to their thyroid function tests (TFTs) as euthyroid Hashimoto's, control and subclinical hypothyroid Hashimoto's groups. Basal TFTs, anti-thyroid peroxidase (anti-TPO), anti-thyroglobulin (anti-tg), thyroid ultrasonography (USG) and HGF were studied and recorded. Subclinical hypothyroid HT patients received levo-thyroxine sodium replacement therapy, and were re-assessed for the same laboratory and radiologic features after a median 3.5 month follow-up. Basal HGF levels were not different between groups. In the subclinical hypothyroidism group, HGF levels (752.75 ± 144.91 pg/ml vs. 719.37 ± 128.05 pg/ml; p = 0.496) and thyroid volumes (12.51 ± 3.67 cc vs. 12.18 ± 4.26 cc; p = 0.7) before and after treatment did not change significantly. No correlations were found between HGF and other parameters. HGF levels were similar between subjects with nodular goiter and normal thyroid structure. HGF was not shown to be associated with HT and goiter development. In addition, levo-thyroxine sodium replacement therapy did not alter serum HGF levels significantly.
Treyer, Aleksandr; Müsch, Anne
2013-01-01
Hepatocytes, like other epithelia, are situated at the interface between the organism’s exterior and the underlying internal milieu and organize the vectorial exchange of macromolecules between these two spaces. To mediate this function, epithelial cells, including hepatocytes, are polarized with distinct luminal domains that are separated by tight junctions from lateral domains engaged in cell-cell adhesion and from basal domains that interact with the underlying extracellular matrix. Despite these universal principles, hepatocytes distinguish themselves from other nonstriated epithelia by their multipolar organization. Each hepatocyte participates in multiple, narrow lumina, the bile canaliculi, and has multiple basal surfaces that face the endothelial lining. Hepatocytes also differ in the mechanism of luminal protein trafficking from other epithelia studied. They lack polarized protein secretion to the luminal domain and target single-spanning and glycosylphosphatidylinositol-anchored bile canalicular membrane proteins via transcytosis from the basolateral domain. We compare this unique hepatic polarity phenotype with that of the more common columnar epithelial organization and review our current knowledge of the signaling mechanisms and the organization of polarized protein trafficking that govern the establishment and maintenance of hepatic polarity. The serine/threonine kinase LKB1, which is activated by the bile acid taurocholate and, in turn, activates adenosine monophosphate kinase-related kinases including AMPK1/2 and Par1 paralogues has emerged as a key determinant of hepatic polarity. We propose that the absence of a hepatocyte basal lamina and differences in cell-cell adhesion signaling that determine the positioning of tight junctions are two crucial determinants for the distinct hepatic and columnar polarity phenotypes. PMID:23720287
The potential of induced pluripotent stem cell derived hepatocytes.
Hannoun, Zara; Steichen, Clara; Dianat, Noushin; Weber, Anne; Dubart-Kupperschmitt, Anne
2016-07-01
Orthotopic liver transplantation remains the only curative treatment for liver disease. However, the number of patients who die while on the waiting list (15%) has increased in recent years as a result of severe organ shortages; furthermore the incidence of liver disease is increasing worldwide. Clinical trials involving hepatocyte transplantation have provided encouraging results. However, transplanted cell function appears to often decline after several months, necessitating liver transplantation. The precise aetiology of the loss of cell function is not clear, but poor engraftment and immune-mediated loss appear to be important factors. Also, primary human hepatocytes (PHH) are not readily available, de-differentiate, and die rapidly in culture. Hepatocytes are available from other sources, such as tumour-derived human hepatocyte cell lines and immortalised human hepatocyte cell lines or porcine hepatocytes. However, all these cells suffer from various limitations such as reduced or differences in functions or risk of zoonotic infections. Due to their significant potential, one possible inexhaustible source of hepatocytes is through the directed differentiation of human induced pluripotent stem cells (hiPSCs). This review will discuss the potential applications and existing limitations of hiPSC-derived hepatocytes in regenerative medicine, drug screening, in vitro disease modelling and bioartificial livers. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Low doses of TiO2-polyethylene glycol nanoparticles stimulate proliferation of hepatocyte cells
NASA Astrophysics Data System (ADS)
Sun, Qingqing; Kanehira, Koki; Taniguchi, Akiyoshi
2016-01-01
This paper describes the effect of low concentrations of 100 nm polyethylene glycol-modified TiO2 nanoparticles (TiO2-PEG NPs) on HepG2 hepatocellular carcinoma cells. Proliferation of HepG2 cells increased significantly when the cells were exposed to low doses (<100 μg ml-1) of TiO2-PEG NPs. These results were further confirmed by cell counting experiments and cell cycle assays. Cellular uptake assays were performed to determine why HepG2 cells proliferate with low-dose exposure to TiO2-PEG NPs. The results showed that exposure to lower doses of NPs led to less cellular uptake, which in turn decreased cytotoxicity. We therefore hypothesized that TiO2-PEG NPs could affect the activity of hepatocyte growth factor receptors (HGFRs), which bind to hepatocyte growth factor and stimulate cell proliferation. The localization of HGFRs on the surface of the cell membrane was detected via immunofluorescence staining and confocal microscopy. The results showed that HGFRs aggregate after exposure to TiO2-PEG NPs. In conclusion, our results indicate that TiO2-PEG NPs have the potential to promote proliferation of HepG2 cells through HGFR aggregation and suggest that NPs not only exhibit cytotoxicity but also affect cellular responses.
Naumnik, W; Naumnik, B; Niklińska, W; Ossolińska, M; Chyczewska, E
2016-01-01
Hepatocyte growth factor (HGF) is involved in tumorigenesis, interleukin-20 (IL-20) is an inhibitor of angiogenesis, and interleukin-22 (IL-22) stimulates tumor growth. The aim of this study was to determine the level of HGF, IL-20, and IL-22 in both serum and bronchoalveolar lavage fluid (BALF) of non-small cell lung cancer (NSCLC) patients before onset of chemotherapy, the nature of the interrelationships between these markers, and their prognostic significance regarding post-chemotherapy survival time. We studied 46 NSCLC patients and 15 healthy subjects as a control group. We found significantly higher serum levels of HGF and IL-22 in the NSCLC patients than those in controls [pg/ml: HGF - 1911 (693-6510) vs. 1333 (838-3667), p = 0.0004; IL-22 - 10.66 (1.44-70.34) vs. 4.69 (0.35-12.29), p = 0.0007]. In contrast, concentrations of HGF and IL-22 in BALF were lower in NSCLC patients than those in controls [pg/ml: HGF - 72 (6-561) vs. 488 (14-2003), p = 0.0002; IL-22 - 2.28 (0.70-6.52) vs. 3.72 (2.76-5.64), p = 0.002]. In the NSCLC patients, there was a negative correlation between the serum level of IL-20 and time to tumor progression (r = -0.405, p = 0.04) and between the serum level of HGF and survival time (r = -0.41, p = 0.005). In addition, a higher serum level of HGF and a higher BALF level of IL-22 in patients were linked with a shorter overall survival. We conclude that HGF, IL-20, and IL-22 in the serum and BALF of NSCLC patients before chemotherapy may be a prognostic of cancer progression.
Structural analysis of the human fibroblast growth factor receptor 4 kinase.
Lesca, E; Lammens, A; Huber, R; Augustin, M
2014-11-11
The family of fibroblast growth factor receptors (FGFRs) plays an important and well-characterized role in a variety of pathological disorders. FGFR4 is involved in myogenesis and muscle regeneration. Mutations affecting the kinase domain of FGFR4 may cause cancer, for example, breast cancer or rhabdomyosarcoma. Whereas FGFR1-FGFR3 have been structurally characterized, the structure of the FGFR4 kinase domain has not yet been reported. In this study, we present four structures of the kinase domain of FGFR4, in its apo-form and in complex with different types of small-molecule inhibitors. The two apo-FGFR4 kinase domain structures show an activation segment similar in conformation to an autoinhibitory segment observed in the hepatocyte growth factor receptor kinase but different from the known structures of other FGFR kinases. The structures of FGFR4 in complex with the type I inhibitor Dovitinib and the type II inhibitor Ponatinib reveal the molecular interactions with different types of kinase inhibitors and may assist in the design and development of FGFR4 inhibitors. Copyright © 2014 Elsevier Ltd. All rights reserved.
Sakai, Kazuko; Takeda, Masayuki; Okamoto, Isamu; Nakagawa, Kazuhiko; Nishio, Kazuto
2015-01-01
Hepatocyte growth factor (HGF) expression is a poor prognostic factor in various types of cancer. Expression levels of HGF have been reported to be regulated by shorter poly(dA) sequences in the promoter region. In the present study, the poly(dA) mononucleotide tract in various types of human cancer cell lines was examined and compared with the HGF expression levels in those cells. Short deoxyadenosine repeat sequences were detected in five of the 55 cell lines used in the present study. The H69, IM95, CCK-81, Sui73 and H28 cells exhibited a truncated poly(dA) sequence in which the number of poly(dA) repeats was reduced by ≥5 bp. Two of the cell lines exhibited high HGF expression, determined by reverse transcription quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. The CCK-81, Sui73 and H28 cells with shorter poly(dA) sequences exhibited low HGF expression. The cause of the suppression of HGF expression in the CCK-81, Sui73 and H28 cells was clarified by two approaches, suppression by methylation and single nucleotide polymorphisms in the HGF gene. Exposure to 5-Aza-dC, an inhibitor of DNA methyltransferase 1, induced an increased expression of HGF in the CCK-81 cells, but not in the other cells. Single-nucleotide polymorphism (SNP) rs72525097 in intron 1 was detected in the Sui73 and H28 cells. Taken together, it was found that the defect of poly(dA) in the HGF promoter was present in various types of cancer, including lung, stomach, colorectal, pancreas and mesothelioma. The present study proposes the negative regulation mechanisms by methylation and SNP in intron 1 of HGF for HGF expression in cancer cells with short poly(dA).
Tissue Engineering Using Transfected Growth-Factor Genes
NASA Technical Reports Server (NTRS)
Madry, Henning; Langer, Robert S.; Freed, Lisa E.; Trippel, Stephen; Vunjak-Novakovic, Gordana
2005-01-01
A method of growing bioengineered tissues includes, as a major component, the use of mammalian cells that have been transfected with genes for secretion of regulator and growth-factor substances. In a typical application, one either seeds the cells onto an artificial matrix made of a synthetic or natural biocompatible material, or else one cultures the cells until they secrete a desired amount of an extracellular matrix. If such a bioengineered tissue construct is to be used for surgical replacement of injured tissue, then the cells should preferably be the patient s own cells or, if not, at least cells matched to the patient s cells according to a human-leucocyteantigen (HLA) test. The bioengineered tissue construct is typically implanted in the patient's injured natural tissue, wherein the growth-factor genes enhance metabolic functions that promote the in vitro development of functional tissue constructs and their integration with native tissues. If the matrix is biodegradable, then one of the results of metabolism could be absorption of the matrix and replacement of the matrix with tissue formed at least partly by the transfected cells. The method was developed for articular chondrocytes but can (at least in principle) be extended to a variety of cell types and biocompatible matrix materials, including ones that have been exploited in prior tissue-engineering methods. Examples of cell types include chondrocytes, hepatocytes, islet cells, nerve cells, muscle cells, other organ cells, bone- and cartilage-forming cells, epithelial and endothelial cells, connective- tissue stem cells, mesodermal stem cells, and cells of the liver and the pancreas. Cells can be obtained from cell-line cultures, biopsies, and tissue banks. Genes, molecules, or nucleic acids that secrete factors that influence the growth of cells, the production of extracellular matrix material, and other cell functions can be inserted in cells by any of a variety of standard transfection techniques.
[Growth Factors and Interleukins in Amniotic Membrane Tissue Homogenate].
Stachon, T; Bischoff, M; Seitz, B; Huber, M; Zawada, M; Langenbucher, A; Szentmáry, N
2015-07-01
Application of amniotic membrane homogenate eye drops may be a potential treatment alternative for therapy resistant corneal epithelial defects. The purpose of this study was to determine the concentrations of epidermal growth factor (EGF), fibroblast growth factor basic (bFGF), hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), interleukin-6 (IL-6) and interleukin-8 (IL-8) in amniotic membrane homogenates. Amniotic membranes of 8 placentas were prepared and thereafter stored at - 80 °C using the standard methods of the LIONS Cornea Bank Saar-Lor-Lux, Trier/Westpfalz. Following defreezing, amniotic membranes were cut in two pieces and homogenized in liquid nitrogen. One part of the homogenate was prepared in cell-lysis buffer, the other part was prepared in PBS. The tissue homogenates were stored at - 20 °C until enzyme-linked immunosorbent assay (ELISA) analysis for EGF, bFGF, HGF, KGF, IL-6 and IL-8 concentrations. Concentrations of KGF, IL-6 and IL-8 were below the detection limit using both preparation techniques. The EGF concentration in tissue homogenates treated with cell-lysis buffer (2412 pg/g tissue) was not significantly different compared to that of tissue homogenates treated with PBS (1586 pg/g tissue, p = 0.72). bFGF release was also not significantly different using cell-lysis buffer (3606 pg/g tissue) or PBS treated tissue homogenates (4649 pg/g tissue, p = 0.35). HGF release was significantly lower using cell-lysis buffer (23,555 pg/g tissue), compared to PBS treated tissue (47,766 pg/g tissue, p = 0.007). Containing EGF, bFGF and HGF, and lacking IL-6 and IL-8, the application of amniotic membrane homogenate eye drops may be a potential treatment alternative for therapy-resistant corneal epithelial defects. Georg Thieme Verlag KG Stuttgart · New York.
Chen, Xiaoguang; Lv, Qiongxia; Ma, Jun; Liu, Yumei
2018-02-11
The PLCG2 (PLCγ2) gene is a member of PLC gene family encoding transmembrane signalling enzymes involved in various biological processes including cell proliferation and apoptosis. Our earlier study indicated that PLCγ2 may be involved in the termination of regeneration of the liver which is mainly composed of hepatocytes, but its exact biological function and molecular mechanism in liver regeneration termination remains unclear. This study aims to examine the role of PLCγ2 in the growth of hepatocytes. A recombinant adenovirus expressing PLCγ2 was used to infect primary rat hepatocytes. PLCγ2 mRNA and protein levels were detected by qRT-PCR and Western blot. The subcellular location of PLCγ2 protein was tested by an immunofluorescence assay. The proliferation of hepatocytes was measured by MTT assay. The cell cycle and apoptosis were analysed by flow cytometry. Caspase-3, -8 and -9 activities were measured by a spectrophotometry method. Phosphorylation levels of PKCD, JNK and p38 in the infected cells were detected by Western blot. The possible mechanism underlying the role of PLCγ2 in hepatocyte growth was also explored by adding a signalling pathway inhibitor. Hepatocyte proliferation was dramatically reduced, while cell apoptosis was remarkably increased. The results demonstrated that PLCγ2 increased the phosphorylation of PKCD, p38 and JNK in rat hepatocytes. After PKCD activity was inhibited by the inhibitor Go 6983, the levels of both p-p38 and p-JNK MAPKs significantly decreased, and PLCγ2-induced cell proliferation inhibition and cell apoptosis were obviously reversed. This study showed that PLCγ2 regulates hepatocyte growth through PKCD-dependently activating p38 MAPK and JNK MAPK pathways; this result was experimentally based on the further exploration of the effect of PLCγ2 on hepatocyte growth in vivo. © 2018 John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, R.M.; Garrison, J.C.
1986-05-01
EGF has been demonstrated to increase free intracellular Ca/sup 2 +/ levels in isolated hepatocytes putatively by generation of the second messenger inositol trisphosphate (IP/sub 3/). Pretreatment of cells with phorbol 12-myristate 13-acetate (PMA) inhibited the EGF (66 nM) stimulated Ca/sup 2 +/ response as measured by quin2. Inhibition by PMA was maximal within 3 min and was concentration dependent (IC/sub 50/ = 13.5 nM). Four other active phorbol ester analogues blocked the Ca/sup 2 +/ response while inactive analogues did not. EGF was unable to increase intracellular Ca/sup 2 +/ levels in hepatocytes isolated from rats treated with pertussismore » toxin for 72 hrs. Neither PMA nor toxin pretreatment was able to inhibit the Ca/sup 2 +/ response to angiotensin II (Ang II). In hepatocytes isolated 24 hrs after partial hepatectomy, the Ca/sup 2 +/ response to EGF (as measured by phosphorylase activity, EC/sub 50/ = 5 nM) was completely abolished and remained attenuated for 7 days post-hepatectomy. The Ca/sup 2 +/ response to Ang II in this model system was also blunted but required 3 days for development of the full effect and within 7 days full activity is nearly restored. The results suggest that fundamental differences exist in the transduction mechanisms used by these two Ca/sup 2 +/-linked hormones to mobilize intracellular Ca/sup 2 +/ (and putatively increase IP/sub 3/ formation).« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, R.M.; Garrison, J.C.
1987-05-01
The EGF-stimulated rise in intracellular Ca/sup 2 +/ (Ca/sup 2 +/)/sub i/ and Ca/sup 2 +/-dependent protein phosphorylation events in isolated hepatocytes are blocked by pertussis toxin and phorbol ester pretreatment. The present study characterized the EGF-stimulated formation of inositol 1,4,5-trisphosphate (Ins(1,4,5)P/sub 3/) and inositol 1,3,4-trisphosphate (Ins(1,3,4)P/sub 3/) in hepatocytes using HPLC methodology to separate the InsP/sub 3/ isomers. Both 66 nM EGF and 10 nM angiotensin II (ANG II) caused a rapid increase in the Ins(1,4,5)P/sub 3/ isomer although EGF-stimulated formation was smaller. At a concentration of ANG II (0.1 nM) which gave an equivalent rise in (Ca/sup 2more » +/)/sub i/ as 66 nM EGF, the kinetics and magnitude of Ins(1,4,5)P/sub 3/ formation were similar. EGF or ANG II-stimulated formation of the Ins(1,3,4)P/sub 3/ isomer was more gradual and increased beyond the level of Ins(1,4,5)P/sub 3/ after 60 sec. The initial EGF and ANG II-stimulated increase in both InsP/sub 3/ isomers was not affected by removing external Ca/sup 2 +/ with a 10-fold excess of EGTA. Pretreatment of rats with pertussis toxin for 72 hrs blocked the ability of EGF to increase Ins(1,4,5)P/sub 3/ but did not affect the increase due to ANG II. Three main pretreatment of cells with 1 ..mu..g/ml phorbol 12-myristate-13-acetate (PMA) also inhibited the EGF-stimulated Ins(1,4,5)P/sub 3/ formation. PMA slightly attenuated Ins(1,4,5)P/sub 3/ formation stimulated by 0.1 nM ANG II but not enough to affect the Ca/sup 2 +/ signal. These data suggest that the signal transduction system used by EGF receptors to increase Ins (1,4,5)P/sub 3/ in hepatocytes is somehow different from that used by ANG II receptors.« less
Choi, Tae-Young; Ninov, Nikolay; Stainier, Didier Y R; Shin, Donghun
2014-03-01
Biliary epithelial cells (BECs) are considered to be a source of regenerating hepatocytes when hepatocyte proliferation is compromised. However, there is still controversy about the extent to which BECs can contribute to the regenerating hepatocyte population, and thereby to liver recovery. To investigate this issue, we established a zebrafish model of liver regeneration in which the extent of hepatocyte ablation can be controlled. Hepatocytes were depleted by administration of metronidazole to Tg(fabp10a:CFP-NTR) animals. We traced the origin of regenerating hepatocytes using short-term lineage-tracing experiments, as well as the inducible Cre/loxP system; specifically, we utilized both a BEC tracer line Tg(Tp1:CreER(T2)) and a hepatocyte tracer line Tg(fabp10a:CreER(T2)). We also examined BEC and hepatocyte proliferation and liver marker gene expression during liver regeneration. BECs gave rise to most of the regenerating hepatocytes in larval and adult zebrafish after severe hepatocyte depletion. After hepatocyte loss, BECs proliferated as they dedifferentiated into hepatoblast-like cells; they subsequently differentiated into highly proliferative hepatocytes that restored the liver mass. This process was impaired in zebrafish wnt2bb mutants; in these animals, hepatocytes regenerated but their proliferation was greatly reduced. BECs contribute to regenerating hepatocytes after substantial hepatocyte depletion in zebrafish, thereby leading to recovery from severe liver damage. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.
Rehman, Jalees; Li, Jingling; Orschell, Christie M; March, Keith L
2003-03-04
Endothelial progenitor cells (EPCs) have been isolated from peripheral blood and can enhance angiogenesis after infusion into host animals. It is not known whether the proangiogenic effects are a result of such events as endothelial differentiation and subsequent proliferation of EPCs or secondary to secretion of angiogenic growth factors. Human EPCs were isolated as previously described, and their phenotypes were confirmed by uptake of acetylated LDL and binding of ulex-lectin. EPC proliferation and surface marker expression were analyzed by flow cytometry, and conditioned medium was assayed for growth factors. The majority of EPCs expressed monocyte/macrophage markers such as CD14 (95.7+/-0.3%), Mac-1 (57.6+/-13.5%), and CD11c (90.8+/-4.9%). A much lower percentage of cells expressed the specific endothelial marker VE-cadherin (5.2+/-0.7%) or stem/progenitor-cell markers AC133 (0.16+/-0.05%) and c-kit (1.3+/-0.7%). Compared with circulating monocytes, cultured EPCs showed upregulation of monocyte activation and macrophage differentiation markers. EPCs did not demonstrate any significant proliferation but did secrete the angiogenic growth factors vascular endothelial growth factor, hepatocyte growth factor, granulocyte colony-stimulating factor, and granulocyte-macrophage colony-stimulating factor. Our findings suggest that acetylated LDL(+)ulex-lectin(+) cells, commonly referred to as EPCs, do not proliferate but release potent proangiogenic growth factors. The majority of acetylated LDL(+)ulex-lectin(+) cells are derived from monocyte/macrophages. The findings of low proliferation and endothelial differentiation suggest that their angiogenic effects are most likely mediated by growth factor secretion. These findings may allow for development of novel angiogenic therapies relying on secreted growth factors or on recruitment of endogenous monocytes/macrophages to sites of ischemia.
Promotion of Cancer Stem-Like Cell Properties in Hepatitis C Virus-Infected Hepatocytes
Kwon, Young-Chan; Bose, Sandip K.; Steele, Robert; Meyer, Keith; Di Bisceglie, Adrian M.; Ray, Ratna B.
2015-01-01
ABSTRACT We have previously reported that hepatitis C virus (HCV) infection of primary human hepatocytes (PHH) induces the epithelial mesenchymal transition (EMT) state and extends hepatocyte life span (S. K. Bose, K. Meyer, A. M. Di Bisceglie, R. B. Ray, and R. Ray, J Virol 86:13621–13628, 2012, http://dx.doi.org/10.1128/JVI.02016-12). These hepatocytes displayed sphere formation on ultralow binding plates and survived for more than 12 weeks. The sphere-forming hepatocytes expressed a number of cancer stem-like cell (CSC) markers, including high levels of the stem cell factor receptor c-Kit. The c-Kit receptor is regarded as one of the CSC markers in hepatocellular carcinoma (HCC). Analysis of c-Kit mRNA displayed a significant increase in the liver biopsy specimens of chronically HCV-infected patients. We also found c-Kit is highly expressed in transformed human hepatocytes (THH) infected in vitro with cell culture-grown HCV genotype 2a. Further studies suggested that HCV core protein significantly upregulates c-Kit expression at the transcriptional level. HCV infection of THH led to a significant increase in the number of spheres displayed on ultralow binding plates and in enhanced EMT and CSC markers and tumor growth in immunodeficient mice. The use of imatinib or dasatinib as a c-Kit inhibitor reduced the level of sphere-forming cells in culture. The sphere-forming cells were sensitive to treatment with sorafenib, a multikinase inhibitor, that is used for HCC treatment. Further, stattic, an inhibitor of the Stat3 molecule, induced sphere-forming cell death. A combination of sorafenib and stattic had a significantly stronger effect, leading to cell death. These results suggested that HCV infection potentiates CSC generation, and selected drugs can be targeted to efficiently inhibit cell growth. IMPORTANCE HCV infection may develop into HCC as an end-stage liver disease. We focused on understanding the mechanism for the risk of HCC from chronic HCV infection
Rosales-Cruz, Patricia; Domínguez-Pérez, Mayra; Reyes-Zárate, Elizabeth; Bello-Monroy, Oscar; Enríquez-Cortina, Cristina; Miranda-Labra, Roxana; Bucio, Leticia; Gómez-Quiroz, Luis Enrique; Rojas-Del Castillo, Emilio; Gutiérrez-Ruíz, María Concepción; Souza-Arroyo, Verónica
2018-04-01
Metabolic factors are the major risk of non-alcoholic fatty liver disease, although other factors may contribute steatosis. Cadmium exposure produces histopathological and molecular changes in liver, which are consistent with steatosis. In the present study, we describe the effect of low cadmium acute treatment on hepatocytes obtained from mice fed with a high cholesterol diet. Our data suggest that hepatocytes with cholesterol overload promote an adaptive response against cadmium-induced acute toxicity by up-regulating anti-apoptotic proteins, managing ROS overproduction, increasing GSH synthesis and MT-II content to avoid protein oxidation. Cadmium treatment increases lipid content in cholesterol-fed mice hepatocytes because of an impaired autophagy process. Our data suggest an essential function of macroautophagy in the regulation of lipid storage induced by Cd on hepatocytes, that implies that alterations in this pathway may be a mechanism that aggravates hepatic steatosis. Copyright © 2018. Published by Elsevier B.V.
Okazaki, Hideto; Beppu, Hidehiko; Mizutani, Kenmei; Okamoto, Sayaka; Sonoda, Shigeru
2014-07-01
Predicting recovery from hemiparesis after stroke is important for rehabilitation. A few recent studies reported that the levels of some growth factors shortly after stroke were positively correlated with the clinical outcomes during the chronic phase. The aim of this study was to examine the relationships between the serum levels of growth factors (vascular endothelial growth factor [VEGF], insulin-like growth factor-I [IGF-I], and hepatocyte growth factor [HGF]) and improvement in hemiparesis in stroke patients who received rehabilitation in a postacute rehabilitation hospital. Subjects were 32 stroke patients (cerebral infarction: 21 and intracerebral hemorrhage [ICH]: 11). We measured serum levels of VEGF, IGF-I, and HGF and 5 items of the Stroke Impairment Assessment Set (SIAS) for hemiparesis on admission and at discharge. Age-matched healthy subjects (n=15) served as controls. Serum levels of VEGF and HGF in cerebral infarct patients on admission were higher than those in control subjects, and the serum levels of IGF-I in stroke patients were lower than those in controls. The level of HGF in ICH patients on admission was negatively correlated with gains in SIAS, and higher outliers in HGF concentration were correlated with lower gains in SIAS. Focusing on the extremely high levels of these factors may be a predictor of the low recovery from hemiparesis after stroke. Copyright © 2014 National Stroke Association. Published by Elsevier Inc. All rights reserved.
Macias-Silva, Marina; Li, Wei; Leu, Julia I; Crissey, Mary Ann S; Taub, Rebecca
2002-08-09
Transforming growth factor-beta (TGF-beta) functions as an antiproliferative factor for hepatocytes. However, for unexplained reasons, hepatocytes become resistant to TGF-beta signals and can proliferate despite the presence of TGF-beta during liver regeneration. TGF-beta is up-regulated during liver regeneration, although it is not known whether it is active or latent. TGF-beta activity may be examined by assessing Smad activation, a downstream signaling pathway. Smad pathway activation during liver regeneration induced by partial hepatectomy or CC4 injury was examined by assessing the levels of phospho-Smad2 and Smad2-Smad4 complexes. We found that Smad proteins were slightly activated in quiescent liver, but that their activation was further enhanced in regenerating liver. Interestingly, TGF-beta/Smad pathway inhibitors (SnoN and Ski) were up-regulated during regeneration, and notably, SnoN was induced mainly in hepatocytes. SnoN and Ski are transcriptional repressors that may render some cells resistant to TGF-beta via binding Smad proteins. Complexes between SnoN, Ski, and the activated Smad proteins were detected from 2 to 120 h during the major proliferative phase in regenerating liver. Inhibitory complexes decreased after liver mass restitution (5-15 days), suggesting that persistently activated Smad proteins might participate in returning the liver to a quiescent state. Our data show that active TGF-beta/Smad signals are present during regeneration and suggest that SnoN/Ski induction might explain hepatocyte resistance to TGF-beta during the proliferative phase.
Son, Bo-Ra; Marquez-Curtis, Leah A; Kucia, Magda; Wysoczynski, Marcin; Turner, A Robert; Ratajczak, Janina; Ratajczak, Mariusz Z; Janowska-Wieczorek, Anna
2006-05-01
Human mesenchymal stem cells (MSCs) are increasingly being considered in cell-based therapeutic strategies for regeneration of various organs/tissues. However, the signals required for their homing and recruitment to injured sites are not yet fully understood. Because stromal-derived factor (SDF)-1 and hepatocyte growth factor (HGF) become up-regulated during tissue/organ damage, in this study we examined whether these factors chemoattract ex vivo-expanded MSCs derived from bone marrow (BM) and umbilical cord blood (CB). Specifically, we investigated the expression by MSCs of CXCR4 and c-met, the cognate receptors of SDF-1 and HGF, and their functionality after early and late passages of MSCs. We also determined whether MSCs express matrix metalloproteinases (MMPs), including membrane type 1 (MT1)-MMP, matrix-degrading enzymes that facilitate the trafficking of hematopoietic stem cells. We maintained expanded BM- or CB-derived MSCs for up to 15-18 passages with monitoring of the expression of 1) various tissue markers (cardiac and skeletal muscle, neural, liver, and endothelial cells), 2) functional CXCR4 and c-met, and 3) MMPs. We found that for up to 15-18 passages, both BM- and CB-derived MSCs 1) express mRNA for cardiac, muscle, neural, and liver markers, as well as the vascular endothelial (VE) marker VE-cadherin; 2) express CXCR4 and c-met receptors and are strongly attracted by SDF-1 and HGF gradients; 3) express MMP-2 and MT1-MMP transcripts and proteins; and 4) are chemo-invasive across the reconstituted basement membrane Matrigel. These in vitro results suggest that the SDF-1-CXCR4 and HGF-c-met axes, along with MMPs, may be involved in recruitment of expanded MSCs to damaged tissues.
Low doses of TiO2-polyethylene glycol nanoparticles stimulate proliferation of hepatocyte cells
Sun, Qingqing; Kanehira, Koki; Taniguchi, Akiyoshi
2016-01-01
Abstract This paper describes the effect of low concentrations of 100 nm polyethylene glycol-modified TiO2 nanoparticles (TiO2-PEG NPs) on HepG2 hepatocellular carcinoma cells. Proliferation of HepG2 cells increased significantly when the cells were exposed to low doses (<100 μg ml–1) of TiO2-PEG NPs. These results were further confirmed by cell counting experiments and cell cycle assays. Cellular uptake assays were performed to determine why HepG2 cells proliferate with low-dose exposure to TiO2-PEG NPs. The results showed that exposure to lower doses of NPs led to less cellular uptake, which in turn decreased cytotoxicity. We therefore hypothesized that TiO2-PEG NPs could affect the activity of hepatocyte growth factor receptors (HGFRs), which bind to hepatocyte growth factor and stimulate cell proliferation. The localization of HGFRs on the surface of the cell membrane was detected via immunofluorescence staining and confocal microscopy. The results showed that HGFRs aggregate after exposure to TiO2-PEG NPs. In conclusion, our results indicate that TiO2-PEG NPs have the potential to promote proliferation of HepG2 cells through HGFR aggregation and suggest that NPs not only exhibit cytotoxicity but also affect cellular responses. PMID:27877913
Opgenorth, A; Nation, N; Graham, K; McFadden, G
1993-02-01
The epidermal growth factor (EGF) homologues encoded by vaccinia virus, myxoma virus, and malignant rabbit fibroma virus have been shown to contribute to the pathogenicity of virus infection upon inoculation of susceptible hosts. However, since the primary structures of these growth factors and the disease profiles induced by different poxvirus genera vary substantially, the degree to which the various EGF homologues perform similar roles in viral pathogenesis remains unclear. In order to determine whether different EGF-like growth factors can perform qualitatively similar functions in the induction of myxomatosis in rabbits, we created recombinant myxoma virus variants in which the native growth factor, myxoma growth factor (MGF), was disrupted and replaced with either vaccinia virus growth factor, Shope fibroma growth factor, or rat transforming growth factor alpha. Unlike the control virus containing an inactivated MGF gene, which caused marked attenuation of the disease syndrome and substantially less proliferation of the epithelial cell layers in the conjunctiva and respiratory tract, the recombinant myxoma virus strains expressing heterologous growth factors produced infections which were both clinically and histopathologically indistinguishable from wild-type myxomatosis. We conclude that these poxviral and cellular EGF-like growth factors, which are diverse with respect to primary structure and origin, have similar biological functions in the context of myxoma virus pathogenesis and are mitogenic for the same target cells.
miR-133b Regulation of Connective Tissue Growth Factor
Gjymishka, Altin; Pi, Liya; Oh, Seh-Hoon; Jorgensen, Marda; Liu, Chen; Protopapadakis, Yianni; Patel, Ashnee; Petersen, Bryon E.
2017-01-01
miRNAs are involved in liver regeneration, and their expression is dysregulated in hepatocellular carcinoma (HCC). Connective tissue growth factor (CTGF), a direct target of miR-133b, is crucial in the ductular reaction (DR)/oval cell (OC) response for generating new hepatocyte lineages during liver injury in the context of hepatotoxin-inhibited hepatocyte proliferation. Herein, we investigate whether miR-133b regulation of CTGF influences HCC cell proliferation and migration, and DR/OC response. We analyzed miR-133b expression and found it to be down-regulated in HCC patient samples and induced in the rat DR/OC activation model of 2-acetylaminofluorene with partial hepatectomy. Furthermore, overexpression of miR-133b via adenoviral system in vitro led to decreased CTGF expression and reduced proliferation and Transwell migration of both HepG2 HCC cells and WBF-344 rat OCs. In vivo, overexpression of miR-133b in DR/OC activation models of 2-acetylaminofluorene with partial hepatectomy in rats, and 3,5-diethoxycarbonyl-1,4-dihydrocollidine in mice, led to down-regulation of CTGF expression and OC proliferation. Collectively, these results show that miR-133b regulation of CTGF is a novel mechanism critical for the proliferation and migration of HCC cells and OC response. PMID:26945106
Crosswell, Hal E; Dasgupta, Anindya; Alvarado, Carlos S; Watt, Tanya; Christensen, James G; De, Pradip; Durden, Donald L; Findley, Harry W
2009-11-25
c-Met is a tyrosine kinase receptor for hepatocyte growth factor/scatter factor (HGF/SF), and both c-Met and its ligand are expressed in a variety of tissues. C-Met/HGF/SF signaling is essential for normal embryogenesis, organogenesis, and tissue regeneration. Abnormal c-Met/HGF/SF signaling has been demonstrated in different tumors and linked to aggressive and metastatic tumor phenotypes. In vitro and in vivo studies have demonstrated inhibition of c-Met/HGF/SF signaling by the small-molecule inhibitor PHA665752. This study investigated c-Met and HGF expression in two neuroblastoma (NBL) cell lines and tumor tissue from patients with NBL, as well as the effects of PHA665752 on growth and motility of NBL cell lines. The effect of the tumor suppressor protein PTEN on migration and proliferation of tumor cells treated with PHA665752 was also evaluated. Expression of c-Met and HGF in NBL cell lines SH-EP and SH-SY5Y and primary tumor tissue was assessed by immunohistochemistry and quantitative RT-PCR. The effect of PHA665752 on c-Met/HGF signaling involved in NBL cell proliferation and migration was evaluated in c-Met-positive cells and c-Met-transfected cells. The transwell chemotaxis assay and the MTT assay were used to measure migration and proliferation/cell-survival of tumor cells, respectively. The PPAR-gamma agonist rosiglitazone was used to assess the effect of PTEN on PHA665752-induced inhibition of NBL cell proliferation/cell-survival and migration High c-Met expression was detected in SH-EP cells and primary tumors from patients with advanced-stage disease. C-Met/HGF signaling induced both migration and proliferation of SH-EP cells. Migration and proliferation/cell-survival were inhibited by PHA665752 in a dose-dependent manner. We also found that induced overexpression of PTEN following treatment with rosiglitazone significantly enhanced the inhibitory effect of PHA665752 on NBL-cell migration and proliferation. c-Met is highly expressed in most tumors
Billion-scale production of hepatocyte-like cells from human induced pluripotent stem cells.
Yamashita, Tomoki; Takayama, Kazuo; Sakurai, Fuminori; Mizuguchi, Hiroyuki
2018-02-19
Human induced pluripotent stem (iPS) cell-derived hepatocyte-like cells are expected to be utilized in drug screening and regenerative medicine. However, hepatocyte-like cells have not been fully used in such applications because it is difficult to produce such cells on a large scale. In this study, we tried to establish a method to mass produce hepatocyte-like cells using a three-dimensional (3D) cell culture bioreactor called the Rotary Cell Culture System (RCCS). RCCS enabled us to obtain homogenous hepatocyte-like cells on a billion scale (>10 9 cells). The gene expression levels of some hepatocyte markers (alpha-1 antitrypsin, cytochrome (CYP) 1A2, CYP2D6, and hepatocyte nuclear factor 4alpha) were higher in 3D-cultured hepatocyte-like cells than in 2D-cultured hepatocyte-like cells. This result suggests that RCCS could provide more suitable conditions for hepatocyte maturation than the conventional 2D cell culture conditions. In addition, more than 90% of hepatocyte-like cells were positive for albumin and could uptake low-density lipoprotein in the culture medium. We succeeded in the large-scale production of homogenous and functional hepatocyte-like cells from human iPS cells. This technology will be useful in drug screening and regenerative medicine, which require enormous numbers of hepatocyte-like cells. Copyright © 2018 Elsevier Inc. All rights reserved.
Yang, Lujun; Zhang, Dangui; Wu, Hongjuan; Xie, Sitian; Zhang, Mingjun; Zhang, Bingna; Tang, Shijie
2018-05-30
To elucidate the possible mechanisms of how basic fibroblast growth factor (bFGF) influences epidermal homeostasis in a living skin equivalent (LSE) model. Several wound healing-related growth factors were analyzed at protein and mRNA levels for dermal fibroblasts of induced alpha-smooth muscle actin (α-SMA)-positive or α-SMA-negative phenotypes. During culturing an LSE model by seeding normal human keratinocytes on a fibroblast-populated type I collagen gel, bFGF or neutralizing antibody for keratinocyte growth factor (KGF) was added to investigate its effects on fibroblast phenotypes and, subsequently, epidermal homeostasis by histology and immunohistochemistry. The α-SMA-positive phenotype of fibroblasts induced by transforming growth factor beta-1 (TGF-β1) markedly suppressed the expression of KGF and hepatocyte growth factor (HGF), and slightly upregulated vascular endothelial growth factor (VEGF) and TGF-β1 at mRNA and protein levels, compared with α-SMA-negative fibroblasts treated with bFGF. α-SMA expression of fibroblasts at the epidermal-mesenchymal junction of the LSEs was suppressed by the addition of bFGF, and a better-differentiated epidermis was presented. The abrogation of KGF from fibroblasts by the addition of the KGF neutralizing antibody disenabled the LSE culturing system to develop an epidermis. bFGF, through affecting the phenotypes and functions of fibroblasts, especially KGF expression, influenced epidermal homeostasis in an LSE model. © 2018 S. Karger AG, Basel.
HBV life cycle is restricted in mouse hepatocytes expressing human NTCP.
Li, Hanjie; Zhuang, Qiuyu; Wang, Yuze; Zhang, Tianying; Zhao, Jinghua; Zhang, Yali; Zhang, Junfang; Lin, Yi; Yuan, Quan; Xia, Ningshao; Han, Jiahuai
2014-03-01
Recent studies have revealed that human sodium taurocholate cotransporting polypeptide (SLC10A1 or NTCP) is a functional cellular receptor for hepatitis B virus (HBV). However, whether human NTCP can support HBV infection in mouse hepatocyte cell lines has not been clarified. Because an HBV-permissible mouse model would be helpful for the study of HBV pathogenesis, it is necessary to investigate whether human NTCP supports the susceptibility of mouse hepatocyte cell lines to HBV. The results show that exogenous human NTCP expression can render non-susceptible HepG2 (human), Huh7 (human), Hepa1-6 (mouse), AML-12 (mouse) cell lines and primary mouse hepatocyte (PMH) cells susceptible to hepatitis D virus (HDV) which employs HBV envelope proteins. However, human NTCP could only introduce HBV susceptibility in human-derived HepG2 and Huh7 cells, but not in mouse-derived Hepa1-6, AML-12 or PMH cells. These data suggest that although human NTCP is a functional receptor that mediates HBV infection in human cells, it cannot support HBV infection in mouse hepatocytes. Our study indicated that the restriction of HBV in mouse hepatocytes likely occurs after viral entry but prior to viral transcription. We have excluded the role of mouse hepatocyte nuclear factors in the restriction of the HBV life cycle and showed that knockdown or inhibition of Sting, TBK1, IRF3 or IRF7, the components of the anti-viral signaling pathways, had no effect on HBV infection in mouse hepatocytes. Therefore, murine restriction factors that limit HBV infection need to be identified before a HBV-permissible mouse line can be created.
Zheng, Xing-Wu; Kudaravalli, Rama; Russell, Theresa T; DiMichele, Donna M; Gibb, Constance; Russell, J Eric; Margaritis, Paris; Pollak, Eleanor S
2011-10-01
Severe coagulant factor VII (FVII) deficiency in postpubertal dizygotic twin males results from two point mutations in the FVII gene, a promoter region T→C transition at -60 and a His-to-Arg substitution at amino acid 348; both mutations prevent persistence of plasma functional FVII. This report documents longitudinal laboratory measurements from infancy to adulthood of FVII coagulant activity (FVII:C) in the twin FVII-deficient patients; it also details specific biochemical analyses of the -60 T→C mutation. The results revealed FVII:C levels of less than 1% in infancy that remain severely decreased through puberty and into adulthood. In-vitro analyses utilizing hepatocyte nuclear factor 4α (HNF4α) co-transfection and a chromatin immunoprecipitation assay indicate that the -60 T→C mutation severely diminishes functional interaction between the FVII promoter and transcription factor HNF4α. The importance of interaction between the FVII gene and HNF4α in normal FVII expression provides an in-vivo illustration of the regulated expression of an autosomal gene encoding a coagulation protein. The constancy of FVII:C and peripubertal patient symptomatology reported here illustrates androgen-independent expression in contrast to expression with an analogous mutation in the promoter region of the gene encoding coagulation FIX.
Yang, Wei; Chen, Quanyu; Xia, Renpei; Zhang, Yujun; Shuai, Ling; Lai, Jiejuan; You, Xiaolin; Jiang, Yan; Bie, Ping; Zhang, Leida; Zhang, Hongyu; Bai, Lianhua
2018-05-28
Naïve decellularized liver scaffold (nDLS)-based tissue engineering has been impaired by the lack of a suitable extracellular matrix (ECM) to provide "active micro-environmental" support. The present study aimed to examine whether a novel, regenerative DLS (rDLS) with an active ECM improves primary hepatocyte survival and prevents thrombosis. rDLS was obtained from a 30-55% partial hepatectomy that was maintained in vivo for 3-5 days and then perfused with detergent in vitro. Compared to nDLS generated from normal livers, rDLS possesses bioactive molecules due to the regenerative period in vivo. Primary mouse hepatocyte survival was evaluated by staining for Ki-67 and Trypan blue exclusion. Thrombosis was assessed by immunohistochemistry and ex vivo diluted whole-blood perfusion. Hemocompatibility was determined by near-infrared laser-Doppler flowmetry and heterotopic transplantation. After recellularization, rDLS contained more Ki-67-positive primary hepatocytes than nDLS. rDLS had a higher oxygen saturation and blood flow velocity and a lower expression of integrin αIIb and α4 than nDLS. Tumor necrosis factor-α, hepatocyte growth factor, interleukin-10, interleukin-6 and interleukin-1β were highly expressed throughout the rDLS, whereas expression of collagen-I, collagen-IV and thrombopoietin were lower in rDLS than in nDLS. Improved blood vessel patency was observed in rDLS both in vitro and in vivo. The results in mice were confirmed in large animals (pigs). rDLS is an effective DLS with an "active microenvironment" that supports primary hepatocyte survival and promotes blood vessel patency. This is the first study to demonstrate a rDLS with a blood microvessel network that promotes hepatocyte survival and resists thrombosis. Copyright © 2018 Elsevier Ltd. All rights reserved.
Property of hepatitis B virus replication in Tupaia belangeri hepatocytes.
Sanada, Takahiro; Tsukiyama-Kohara, Kyoko; Yamamoto, Naoki; Ezzikouri, Sayeh; Benjelloun, Soumaya; Murakami, Shuko; Tanaka, Yasuhito; Tateno, Chise; Kohara, Michinori
2016-01-08
The northern treeshrew (Tupaia belangeri) has been reported to be an effective candidate for animal infection model with hepatitis B virus (HBV). The objective of our study was to analyze the growth characteristics of HBV in tupaia hepatocytes and the host response to HBV infection. We established primary tupaia hepatocytes (3-6-week old tupaia) and infected them with HBV genotypes A, B and C, and all the genotypes proliferated as well as those in human primary hepatocytes (>10(5) copies/ml in culture supernatant). We next generated a chimeric mouse with tupaia liver by transplantation of tupaia primary hepatocytes to urokinase-type plasminogen activator cDNA (cDNA-uPA)/severe combined immunodeficient (SCID) mice and the replacement ratio with tupaia hepatocytes was found to be more than 95%. Infection of chimeric mice with HBV (genotypes B, C, and D) resulted in HBV-DNA level of 10(4)-10(6) copies/ml after 8 weeks of infection, which were almost similar to that in humanized chimeric mouse. In contrast, serum HBV level in adult tupaia (1-year-old tupaia) was quite low (<10(3) copies/ml). Understanding the differences in the response to HBV infection in primary tupaia hepatocytes, chimeric mouse, and adult tupaia will contribute to elucidating the mechanism of persistent HBV infection and viral eradication. Thus, T. belangeri was found to be efficient for studying the host response to HBV infection, thereby providing novel insight into the pathogenesis of HBV. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Yu, Dongsheng; Chen, Gang; Pan, Minglin; Zhang, Jia; He, Wenping; Liu, Yang; Nian, Xue; Sheng, Liang; Xu, Bin
2018-06-01
Nonalcoholic fatty liver disease (NAFLD) is the most common form of chronic liver disease with manifestation of over-accumulation of fat in liver. Increasing evidences indicate that NAFLD may be in part caused by malfunction of very low density lipoprotein (VLDL) secretion. Hepatocyte nuclear factor 4α (HNF4α), a nuclear receptor protein, plays an important role in sustain hepatic lipid homeostasis via transcriptional regulation of genes involved in secretion of VLDL, such as apolipoprotein B (ApoB). However, the exact functional change of HNF4α in NAFLD remains to be elucidated. In the present study, we found that high fat diet (HFD) induced cytoplasmic retention of HNF4α in hepatocytes, which led to down-regulation of hepatic ApoB expression and its protein level in serum, as well as reduced secretion of VLDL. We further revealed that oxidative stress, elevated in fatty liver, was the key factor inducing the cytoplasmic retention of HNF4α in hepatocytes by activating protein kinase C (PKC)-mediated phosphorylation in HNF4α. Thus, our findings reveal a novel mechanism underlying HFD-induced fatty liver that oxidative stress impairs function of HNF4α on ApoB expression and VLDL secretion via PKC activation, eventually promoting fat accumulation in the liver. Therefore, oxidative stress/PKC/HNF4α pathway may be a novel target to treat diet-induced fatty liver. © 2017 Wiley Periodicals, Inc.
Matsuzaki, Koichi; Murata, Miki; Yoshida, Katsunori; Sekimoto, Go; Uemura, Yoshiko; Sakaida, Noriko; Kaibori, Masaki; Kamiyama, Yasuo; Nishizawa, Mikio; Fujisawa, Junichi; Okazaki, Kazuichi; Seki, Toshihito
2007-07-01
Many patients with chronic hepatitis caused by hepatitis C virus (HCV) infection develop liver fibrosis with high risk for hepatocellular carcinoma (HCC), but the mechanism underling this process is unclear. Conversely, transforming growth factor beta (TGF-beta) activates not only TGF-beta type I receptor (TbetaRI) but also c-Jun N-terminal kinase (JNK), which convert the mediator Smad3 into two distinctive phosphoisoforms: C-terminally phosphorylated Smad3 (pSmad3C) and linker-phosphorylated Smad3 (pSmad3L). Whereas the TbetaRI/pSmad3C pathway suppresses epithelial cell growth by upregulating p21(WAF1) transcription, JNK/pSmad3L-mediated signaling promotes extracellular matrix deposition, partly, by upregulating plasminogen activator inhibitor 1 (PAI-1). We studied the domain-specific Smad3 phosphorylation in biopsy specimens representing chronic hepatitis, cirrhosis, or HCC from 100 patients chronically infected with HCV, and correlated Smad3 phosphorylation with clinical course. As HCV-infected livers progressed from chronic hepatitis through cirrhosis to HCC, hepatocytic pSmad3L/PAI-1 increased with fibrotic stage and necroinflammatory grade, and pSmad3C/p21(WAF1) decreased. Of 14 patients with chronic hepatitis C with strong hepatocytic pSmad3L positivity, 8 developed HCC within 12 years; only 1 of 12 showing little pSmad3L positivity developed HCC. We further sought molecular mechanisms in vitro. JNK activation by the pro-inflammatory cytokine interleukin-1beta stimulated the pSmad3L/PAI-1 pathway in facilitating hepatocytic invasion, in the meantime reducing TGF-beta-dependent tumor-suppressive activity by the pSmad3C/p21(WAF1) pathway. These results indicate that chronic inflammation associated with HCV infection shifts hepatocytic TGF-beta signaling from tumor-suppression to fibrogenesis, accelerating liver fibrosis and increasing risk for HCC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Toyoda, Takao; Thanseem, Ismail; Kawai, Masayoshi
Autism is a pervasive neurodevelopmental disorder diagnosed in early childhood. Growth factors have been found to play a key role in the cellular differentiation and proliferation of the central and peripheral nervous systems. Epidermal growth factor (EGF) is detected in several regions of the developing and adult brain, where, it enhances the differentiation, maturation, and survival of a variety of neurons. Transforming growth factor-{beta} (TGF{beta}) isoforms play an important role in neuronal survival, and the hepatocyte growth factor (HGF) has been shown to exhibit neurotrophic activity. We examined the association of EGF, TGF{beta}1, and HGF genes with autism, in amore » trio association study, using DNA samples from families recruited to the Autism Genetic Resource Exchange; 252 trios with a male offspring scored for autism were selected for the study. Transmission disequilibrium test revealed significant haplotypic association of EGF with autism. No significant SNP or haplotypic associations were observed for TGF{beta}1 or HGF. Given the role of EGF in brain and neuronal development, we suggest a possible role of EGF in the pathogenesis of autism.« less
Pierce, Robert H.; Campbell, Jean S.; Stephenson, Alyssa B.; Franklin, Christopher C.; Chaisson, Michelle; Poot, Martin; Kavanagh, Terrance J.; Rabinovitch, Peter S.; Fausto, Nelson
2000-01-01
Tumor necrosis factor (TNF) is a mediator of the acute phase response in the liver and can initiate proliferation and cause cell death in hepatocytes. We investigated the mechanisms by which TNF causes apoptosis in hepatocytes focusing on the role of oxidative stress, antioxidant defenses, and mitochondrial damage. The studies were conducted in cultured AML12 cells, a line of differentiated murine hepatocytes. As is the case for hepatocytes in vivo, AML12 cells were not sensitive to cell death by TNF alone, but died by apoptosis when exposed to TNF and a small dose of actinomycin D (Act D). Morphological signs of apoptosis were not detected until 6 hours after the treatment and by 18 hours ∼50% of the cells had died. Exposure of the cells to TNF+Act D did not block NFκB nuclear translocation, DNA binding, or its overall transactivation capacity. Induction of apoptosis was characterized by oxidative stress indicated by the loss of NAD(P)H and glutathione followed by mitochondrial damage that included loss of mitochondrial membrane potential, inner membrane structural damage, and mitochondrial condensation. These changes coincided with cytochrome C release and the activation of caspases-8, -9, and -3. TNF-induced apoptosis was dependent on glutathione levels. In cells with decreased levels of glutathione, TNF by itself in the absence of transcriptional blocking acted as an apoptotic agent. Conversely, the antioxidant α-lipoic acid, that protected against the loss of glutathione in cells exposed to TNF+Act D completely prevented mitochondrial damage, caspase activation, cytochrome C release, and apoptosis. The results demonstrate that apoptosis induced by TNF+Act D in AML12 cells involves oxidative injury and mitochondrial damage. As injury was regulated to a larger extent by the glutathione content of the cells, we suggest that the combination of TNF+Act D causes apoptosis because Act D blocks the transcription of genes required for antioxidant defenses. PMID
Interspecies differences in metabolism of arsenic by cultured primary hepatocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Drobna, Zuzana; Walton, Felecia S.; Harmon, Anne W.
2010-05-15
Biomethylation is the major pathway for the metabolism of inorganic arsenic (iAs) in many mammalian species, including the human. However, significant interspecies differences have been reported in the rate of in vivo metabolism of iAs and in yields of iAs metabolites found in urine. Liver is considered the primary site for the methylation of iAs and arsenic (+3 oxidation state) methyltransferase (As3mt) is the key enzyme in this pathway. Thus, the As3mt-catalyzed methylation of iAs in the liver determines in part the rate and the pattern of iAs metabolism in various species. We examined kinetics and concentration-response patterns for iAsmore » methylation by cultured primary hepatocytes derived from human, rat, mice, dog, rabbit, and rhesus monkey. Hepatocytes were exposed to [{sup 73}As]arsenite (iAs{sup III}; 0.3, 0.9, 3.0, 9.0 or 30 nmol As/mg protein) for 24 h and radiolabeled metabolites were analyzed in cells and culture media. Hepatocytes from all six species methylated iAs{sup III} to methylarsenic (MAs) and dimethylarsenic (DMAs). Notably, dog, rat and monkey hepatocytes were considerably more efficient methylators of iAs{sup III} than mouse, rabbit or human hepatocytes. The low efficiency of mouse, rabbit and human hepatocytes to methylate iAs{sup III} was associated with inhibition of DMAs production by moderate concentrations of iAs{sup III} and with retention of iAs and MAs in cells. No significant correlations were found between the rate of iAs methylation and the thioredoxin reductase activity or glutathione concentration, two factors that modulate the activity of recombinant As3mt. No associations between the rates of iAs methylation and As3mt protein structures were found for the six species examined. Immunoblot analyses indicate that the superior arsenic methylation capacities of dog, rat and monkey hepatocytes examined in this study may be associated with a higher As3mt expression. However, factors other than As3mt expression may also
Vascular Endothelial Growth Factor and Angiopoietin are Required for Prostate Regeneration.
Wang, Gui-min; Kovalenko, Bruce; Huang, Yili; Moscatelli, David
2007-01-01
BACKGROUND The regulation of the prostate size by androgens may be partly the result of androgen effects on the prostatic vasculature. We examined the effect of changes in androgen levels on the expression of a variety of angiogenic factors in the mouse prostate and determined if vascular endothelial growth factor (VEGF)-A and the angiopoietins are involved in the vascular response to androgens. METHODS Expression of angiogenic factors in prostate was quantitated using real-time PCR at different times after castration and after administration of testosterone to castrated mice. Angiopoietins were localized in prostate by immunohistochemistry and in situ hybridization. The roles of VEGF and the angiopoietins in regeneration of the prostate were examined in mice inoculated with cells expressing soluble VEGF receptor-2 or soluble Tie-2. RESULTS Castration resulted in a decrease in VEGF-A, VEGF-B, VEGF-C, placenta growth factor, FGF-2, and FGF-8 expression after one day. In contrast, VEGF-D mRNA levels increased. No changes in angiopoietin-1 (Ang-1), angiopoietin-2 (Ang-2), hepatocyte growth factor, VEGF receptor-1, VEGF receptor-2 or tie-2 mRNA levels were observed. Administration of testosterone to castrated mice had the opposite effect on expression of these angiogenic factors. Ang-2 was expressed predominately in prostate epithelial cells whereas Ang-1 was expressed in epithelium and smooth muscle. Inoculation of mice with cells expressing soluble VEGF receptor-2 or Tie-2 blocked the increase in vascular density normally observed after administration of testosterone to castrated mice. The soluble receptors also blocked the increase in prostate weight and proliferation of prostatic epithelial cells. CONCLUSION VEGF-A and angiopoietins are required for the vascular response to androgens and for the ability of the prostate to regenerate in response to androgens. PMID:17221843
Curcumin attenuates insulin resistance in hepatocytes by inducing Nrf2 nuclear translocation.
Zhao, Shu-Guang; Li, Qiang; Liu, Zhen-Xiong; Wang, Jing-Jie; Wang, Xv-Xia; Qin, Ming; Wen, Qin-Sheng
2011-01-01
NF-E2-Related Factor-2 (Nrf2) is a transcription factor that plays a crucial role in the cellular protection against oxidative stress. Curcumin has been reported to induce Nrf2 nuclear translocation and upregulate the expression of numerous reactive oxygen species (ROS) detoxifying and antioxidant genes in hepatocytes. This study was designed to investigate whether curcumin-induced Nrf2 nuclear translocation could reduce ROS-mediated insulin resistance in cultured LO2 hepatocytes. Human LO2 hepatocytes were incubated with curcumine and glucose oxidase (GO) in the presence/absence of wortmannin (a phosphatidyinositol 3-kinase (PI3K) inhibitor), oxidative stress, cellular damage, Nrf2 nuclear translocation and insulin resistance were measured. GO exposure significantly increased intracellular ROS, glutathione (GSH) depletion, malondialdehyde (MDA) formation, and increased activities of cellular lactate dehydrogenase (LDH) and aspartate amino transferase (AST), as well as causing insulin resistance. Curcumin pretreatment significantly attenuated these disturbances in intracellular ROS, liver enzyme activity and significantly antagonized the lipid peroxidation, GSH depletion and insulin resistance induced by GO in LO2 hepatocytes. These effects paralleled Nrf2 nuclear translocation induced by curcumin. Wortmannin partially blocked curcumin-induced Nrf2 nuclear translocation. In addition, wortmannin prevented curcumin-induced improvements in intracellular ROS, MDA formation, GSH depletion, liver enzyme activity and insulin resistance in cultured LO2 hepatocytes. These findings suggest that curcumin could reduce ROS-mediated insulin resistance in hepatocytes, at least in part through nuclear translocation of Nrf2.
Arza, Elvira; Alvarez-Barrientos, Alberto; Fabregat, Isabel; Garcia-Bravo, Maria; Meza, Nestor W.; Segovia, Jose C.
2012-01-01
The fusion of bone marrow (BM) hematopoietic cells with hepatocytes to generate BM derived hepatocytes (BMDH) is a natural process, which is enhanced in damaged tissues. However, the reprogramming needed to generate BMDH and the identity of the resultant cells is essentially unknown. In a mouse model of chronic liver damage, here we identify a modification in the chromatin structure of the hematopoietic nucleus during BMDH formation, accompanied by the loss of the key hematopoietic transcription factor PU.1/Sfpi1 (SFFV proviral integration 1) and gain of the key hepatic transcriptional regulator HNF-1A homeobox A (HNF-1A/Hnf1a). Through genome-wide expression analysis of laser captured BMDH, a differential gene expression pattern was detected and the chromatin changes observed were confirmed at the level of chromatin regulator genes. Similarly, Tranforming Growth Factor-β1 (TGF-β1) and neurotransmitter (e.g. Prostaglandin E Receptor 4 [Ptger4]) pathway genes were over-expressed. In summary, in vivo BMDH generation is a process in which the hematopoietic cell nucleus changes its identity and acquires hepatic features. These BMDHs have their own cell identity characterized by an expression pattern different from hematopoietic cells or hepatocytes. The role of these BMDHs in the liver requires further investigation. PMID:22457803
Gray, Alana L.; Coleman, David T.; Shi, Runhua; Cardelli, James A.
2016-01-01
Tumor progression to metastatic disease contributes to the vast majority of incurable cancer. Understanding the processes leading to advanced stage cancer is important for the development of future therapeutic strategies. Here, we establish a connection between tumor cell migration, a prerequisite to metastasis, and monocarboxylate transporter 1 (MCT1). MCT1 transporter activity is known to regulate aspects of tumor progression and, as such, is a clinically relevant target for treating cancer. Knockdown of MCT1 expression caused decreased hepatocyte growth factor (HGF)-induced as well as epidermal growth factor (EGF)-induced tumor cell scattering and wound healing. Western blot analysis suggested that MCT1 knockdown (KD) hinders signaling through the HGF receptor (c-Met) but not the EGF receptor. Exogenous, membrane-permeable MCT1 substrates were not able to rescue motility in MCT1 KD cells, nor was pharmacologic inhibition of MCT1 able to recapitulate decreased cell motility as seen with MCT1 KD cells, indicating transporter activity of MCT1 was dispensable for EGF- and HGF-induced motility. These results indicate MCT1 expression, independent of transporter activity, is required for growth factor-induced tumor cell motility. The findings presented herein suggest a novel function for MCT1 in tumor progression independent of its role as a monocarboxylate transporter. PMID:27127175
The instant blood-mediated inflammatory reaction characterized in hepatocyte transplantation.
Gustafson, Elisabet K; Elgue, Graciela; Hughes, Robin D; Mitry, Ragai R; Sanchez, Javier; Haglund, Ulf; Meurling, Staffan; Dhawan, Anil; Korsgren, Olle; Nilsson, Bo
2011-03-27
Hepatocyte transplantation (HcTx) has proven to be a safe procedure, although the functional results have been unsatisfactory, probably due to insufficient engraftment or a loss of transplanted mass or function. In this study, we investigate whether hepatocytes in contact with blood induce an inflammatory reaction leading to, similar to what happens in clinical islet transplantation, an instant blood-mediated inflammatory reaction (IBMIR) resulting in an early loss of transplanted cells. By using an experimental model that mimics the portal vein blood flow, we could study different parameters reflecting the effects on the innate immunity elicited by hepatocytes in contact with ABO-matched human blood. We report that all aspects of the IBMIR such as platelet and granulocyte consumption, coagulation, and complement activation were demonstrated. Addition of various specific inhibitors of coagulation allowed us to clearly delineate the various stages of the hepatocyte-triggered IBMIR and show that the reaction was triggered by tissue factor. Analysis of a case of clinical HcTx showed that hepatocyte-induced IBMIR also occurs in vivo. Both the inflammatory and the coagulation aspects were controlled by low-molecular-weight dextran sulfate. Isolated hepatocytes in contact with blood induce the IBMIR in vitro, and there are indications that these events are also relevant in vivo. According to these findings, HcTx would benefit from controlling a wider range of signals from the innate immune system.
The Role of Growth Hormone and Insulin-Like Growth Factor-I in the Liver.
Takahashi, Yutaka
2017-07-05
Adult growth hormone deficiency (GHD) is characterized by metabolic abnormalities associated with visceral obesity, impaired quality of life, and increased mortality. Patients with adult GHD show increased prevalence of non-alcoholic fatty liver disease (NAFLD)/non-alcoholic steatohepatitis (NASH), and growth hormone (GH) replacement therapy has been shown to improve these conditions. It has also been demonstrated that a decrease in the GH insulin-like growth factor-I (IGF-I) axis is closely associated with the progression of general NAFLD, suggesting a physiological role of these hormones for the maintenance of the liver. NASH histologically demonstrates inflammation, necrosis, and fibrosis, in addition to steatosis (and is a serious disease because it can progress to liver cirrhosis and hepatocellular carcinoma in a subset of cases). While fibrosis determines the prognosis of the patient, efficacious treatment for fibrosis is crucial; however, it has not yet been established. Recent studies have clarified the essential roles of GH and IGF-I in the liver. GH profoundly reduces visceral fat, which plays an important role in the development of NAFLD. Furthermore, GH directly reduces lipogenesis in the hepatocytes. IGF-I induces cellular senescence and inactivates hepatic stellate cells, therefore ameliorating fibrosis. IGF-I treatment has been shown to improve animal models of NASH and cirrhosis, suggesting potential clinical applications of IGF-I in these conditions. In this review, I will focus on the important roles of GH and IGF-I in the liver, their underlying mechanisms, and their potential therapeutic applications.
Hepatocytes Polyploidization and Cell Cycle Control in Liver Physiopathology
Gentric, Géraldine; Desdouets, Chantal; Celton-Morizur, Séverine
2012-01-01
Most cells in mammalian tissues usually contain a diploid complement of chromosomes. However, numerous studies have demonstrated a major role of “diploid-polyploid conversion” during physiopathological processes in several tissues. In the liver parenchyma, progressive polyploidization of hepatocytes takes place during postnatal growth. Indeed, at the suckling-weaning transition, cytokinesis failure events induce the genesis of binucleated tetraploid liver cells. Insulin signalling, through regulation of the PI3K/Akt signalling pathway, is essential in the establishment of liver tetraploidization by controlling cytoskeletal organisation and consequently mitosis progression. Liver cell polyploidy is generally considered to indicate terminal differentiation and senescence, and both lead to a progressive loss of cell pluripotency associated to a markedly decreased replication capacity. Although adult liver is a quiescent organ, it retains a capacity to proliferate and to modulate its ploidy in response to various stimuli or aggression (partial hepatectomy, metabolic overload (i.e., high copper and iron hepatic levels), oxidative stress, toxic insult, and chronic hepatitis etc.). Here we review the mechanisms and functional consequences of hepatocytes polyploidization during normal and pathological liver growth. PMID:23150829
Hepatocytes polyploidization and cell cycle control in liver physiopathology.
Gentric, Géraldine; Desdouets, Chantal; Celton-Morizur, Séverine
2012-01-01
Most cells in mammalian tissues usually contain a diploid complement of chromosomes. However, numerous studies have demonstrated a major role of "diploid-polyploid conversion" during physiopathological processes in several tissues. In the liver parenchyma, progressive polyploidization of hepatocytes takes place during postnatal growth. Indeed, at the suckling-weaning transition, cytokinesis failure events induce the genesis of binucleated tetraploid liver cells. Insulin signalling, through regulation of the PI3K/Akt signalling pathway, is essential in the establishment of liver tetraploidization by controlling cytoskeletal organisation and consequently mitosis progression. Liver cell polyploidy is generally considered to indicate terminal differentiation and senescence, and both lead to a progressive loss of cell pluripotency associated to a markedly decreased replication capacity. Although adult liver is a quiescent organ, it retains a capacity to proliferate and to modulate its ploidy in response to various stimuli or aggression (partial hepatectomy, metabolic overload (i.e., high copper and iron hepatic levels), oxidative stress, toxic insult, and chronic hepatitis etc.). Here we review the mechanisms and functional consequences of hepatocytes polyploidization during normal and pathological liver growth.
Matsumoto, M; Imagawa, M; Aoki, Y
2000-07-01
Using chloramphenicol acetyltransferase assays we showed that epidermal growth factor (EGF), transforming growth factor alpha (TGF alpha), and 3,3',4,4',5-pentachlorobiphenyl (PenCB) induce class Pi glutathione S-transferase (GSTP1) in primary cultured rat liver parenchymal cells. GSTP1 enhancer I (GPEI), which is required for the stimulation of GSTP1 expression by PenCB, also mediates EGF and TGF alpha stimulation of GSTP1 gene expression. However, hepatocyte growth factor and insulin did not stimulate GPEI-mediated gene expression. On the other hand, the antioxidant reagents butylhydroxyanisole and t-butylhydroquinone, stimulated GPEI-mediated gene expression, but the level of GSTP1 mRNA was not elevated. Our observations suggest that EGF and TGF alpha induce GSTP1 by the same signal transduction pathway as PenCB. Since the sequence of GPEI is similar to that of the antioxidant responsive element (ARE), some factors which bind to ARE might play a role in GPEI-mediated gene expression.
Matsumoto, M; Imagawa, M; Aoki, Y
2000-01-01
Using chloramphenicol acetyltransferase assays we showed that epidermal growth factor (EGF), transforming growth factor alpha (TGF alpha), and 3,3',4,4',5-pentachlorobiphenyl (PenCB) induce class Pi glutathione S-transferase (GSTP1) in primary cultured rat liver parenchymal cells. GSTP1 enhancer I (GPEI), which is required for the stimulation of GSTP1 expression by PenCB, also mediates EGF and TGF alpha stimulation of GSTP1 gene expression. However, hepatocyte growth factor and insulin did not stimulate GPEI-mediated gene expression. On the other hand, the antioxidant reagents butylhydroxyanisole and t-butylhydroquinone, stimulated GPEI-mediated gene expression, but the level of GSTP1 mRNA was not elevated. Our observations suggest that EGF and TGF alpha induce GSTP1 by the same signal transduction pathway as PenCB. Since the sequence of GPEI is similar to that of the antioxidant responsive element (ARE), some factors which bind to ARE might play a role in GPEI-mediated gene expression. PMID:10861232
Oxidative stress is involved in Dasatinib-induced apoptosis in rat primary hepatocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xue, Tao; Luo, Peihua; Zhu, Hong
2012-06-15
Dasatinib, a multitargeted inhibitor of BCR–ABL and SRC kinases, exhibits antitumor activity and extends the survival of patients with chronic myeloid leukemia (CML) and Philadelphia chromosome-positive acute lymphoblastic leukemia (ALL). However, some patients suffer from hepatotoxicity, which occurs through an unknown mechanism. In the present study, we found that Dasatinib could induce hepatotoxicity both in vitro and in vivo. Dasatinib reduced the cell viability of rat primary hepatocytes, induced the release of alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) in vitro, and triggered the ballooning degeneration of hepatocytes in Sprague–Dawley rats in vivo. Apoptotic markers (chromatin condensation, cleaved caspase-3 andmore » cleaved PARP) were detected to indicate that the injury induced by Dasatinib in hepatocytes in vitro was mediated by apoptosis. This result was further validated in vivo using terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assays. Here we found that Dasatinib dramatically increased the level of reactive oxygen species (ROS) in hepatocytes, reduced the intracellular glutathione (GSH) content, attenuated the activity of superoxide dismutase (SOD), generated malondialdehyde (MDA), a product of lipid peroxidation, decreased the mitochondrial membrane potential, and activated nuclear factor erythroid 2-related factor 2 (Nrf2) and mitogen-activated protein kinases (MAPK) related to oxidative stress and survival. These results confirm that oxidative stress plays a pivotal role in Dasatinib-mediated hepatotoxicity. N-acetylcysteine (NAC), a typical antioxidant, can scavenge free radicals, attenuate oxidative stress, and protect hepatocytes against Dasatinib-induced injury. Thus, relieving oxidative stress is a viable strategy for reducing Dasatinib-induced hepatotoxicity. -- Highlights: ►Dasatinib shows potential hepatotoxicity both in vitro and in vivo. ►Apoptosis plays a vital role in
Repolarization of hepatocytes in culture.
Talamini, M A; Kappus, B; Hubbard, A
1997-01-01
We have evaluated the biochemical, morphological, and functional redevelopment of polarity in freshly isolated hepatocytes cultured using a double layer collagen gel sandwich technique. Western blot analysis showed increased cellular levels of the cell adhesion protein uvomorulin as cultured hepatocytes repolarized. Immunofluorescence studies using antibodies against domain-specific membrane proteins showed polarity as early as 48 hours, although the pattern of the polymeric Immunoglobulin-A receptor (pIgA-R) differed from in vivo liver. Electron microscopy showed developing bile canaliculi at 1 day. However, the functional presence of tight junctions was absent at 1 day, but present at 5 days. We further showed functional polarity to be present at 4 days by documenting the ability of cultured hepatocytes to metabolize and excrete fluorescein diacetate into visible bile canaliculi. We conclude that hepatocytes cultured appropriately develop morphological and functional polarity. Hepatocyte culture is therefore a useful tool for the study of mechanisms responsible for the development of polarized function.
Douros, Jonathan D; Baltzegar, David A; Mankiewicz, Jamie; Taylor, Jordan; Yamaguchi, Yoko; Lerner, Darren T; Seale, Andre P; Grau, E Gordon; Breves, Jason P; Borski, Russell J
2017-01-01
Leptin is an important cytokine for regulating energy homeostasis, however, relatively little is known about its function and control in teleost fishes or other ectotherms, particularly with regard to interactions with the growth hormone (GH)/insulin-like growth factors (IGFs) growth regulatory axis. Here we assessed the regulation of LepA, the dominant paralog in tilapia (Oreochromis mossambicus) and other teleosts under altered nutritional state, and evaluated how LepA might alter pituitary growth hormone (GH) and hepatic insulin-like growth factors (IGFs) that are known to be disparately regulated by metabolic state. Circulating LepA, and lepa and lepr gene expression increased after 3-weeks fasting and declined to control levels 10days following refeeding. This pattern of leptin regulation by metabolic state is similar to that previously observed for pituitary GH and opposite that of hepatic GHR and/or IGF dynamics in tilapia and other fishes. We therefore evaluated if LepA might differentially regulate pituitary GH, and hepatic GH receptors (GHRs) and IGFs. Recombinant tilapia LepA (rtLepA) increased hepatic gene expression of igf-1, igf-2, ghr-1, and ghr-2 from isolated hepatocytes following 24h incubation. Intraperitoneal rtLepA injection, on the other hand, stimulated hepatic igf-1, but had little effect on hepatic igf-2, ghr1, or ghr2 mRNA abundance. LepA suppressed GH accumulation and gh mRNA in pituitaries in vitro, but had no effect on GH release. We next sought to test if abolition of pituitary GH via hypophysectomy (Hx) affects the expression of hepatic lepa and lepr. Hypophysectomy significantly increases hepatic lepa mRNA abundance, while GH replacement in Hx fish restores lepa mRNA levels to that of sham controls. Leptin receptor (lepr) mRNA was unchanged by Hx. In in vitro hepatocyte incubations, GH inhibits lepa and lepr mRNA expression at low concentrations, while higher concentration stimulates lepa expression. Taken together, these findings
Kocabayoglu, Peri; Zhang, David Y; Kojima, Kensuke; Hoshida, Yujin; Friedman, Scott L
2016-06-01
Hepatic stellate cells (HSCs) activate during injury to orchestrate the liver's inflammatory and fibrogenic responses. A critical feature of HSC activation is the rapid induction of beta platelet-derived growth factor (β-PDGFR), which drives cellular fibrogenesis and proliferation; in contrast, normal liver has minimal β-PDGFR expression. While the role of β-PDGFR is well established in liver injury, its expression and contribution during liver regeneration are unknown. The aim of this study was to determine whether β-PDGFR is induced during liver regeneration following partial hepatectomy (pHx), and to define its contribution to the regenerative response. Control mice or animals with HSC-specific β-PDGFR-depletion underwent two-thirds pHx followed by assessment of hepatocyte proliferation and expression of β-PDGFR. RNA-sequencing from whole liver tissue of both groups after pHx was used to uncover pathways regulated by β-PDGFR signalling in HSCs. Beta platelet-derived growth factor expression on HSCs was up-regulated within 24 h following pHx in control mice, whereas absence of β-PDGFR blunted the expansion of HSCs. Mice lacking β-PDGFR displayed prolonged increases of transaminase levels within 72 h following pHx. Hepatocyte proliferation was impaired within the first 24 h based on Ki-67 and PCNA expression in β-PDGFR-deficient mice. This was associated with dysregulated growth in the β-PDGFR-deficient mice based on RNAseq with pathway analysis, and real-time quantitative PCR, which demonstrated reduced expression of Hgf, Igfbp1, Mapk and Il-6. Beta platelet-derived growth factor is induced in HSCs following surgical pHx and its deletion in HSCs leads to prolonged liver injury. However, there is no significant difference in liver regeneration. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Media composition: growth factors.
Hegde, Aparna; Behr, Barry
2012-01-01
Despite the fact that the fundamental principle underlying the most common method of culture media constitution is that of mimicking the natural environment of the preimplantation embryo, one major difference that remains between current embryo culture media and in vivo conditions is the absence of growth factors in vitro. Numerous growth factors are known to be present in the in vivo environment of human and nonhuman preimplantation embryos, often with peak concentrations corresponding to when fertilization and preimplantation embryo growth would occur. Although these growth factors are found in very small concentrations, they have a profound effect on tissue growth and differentiation through attachment to factor-specific receptors on cell surfaces. Receptors for many different growth factors have also been detected in human preimplantation embryos. Preimplantation embryos themselves express many growth factors. The growth factors and receptors are metabolically costly to produce, and thus their presence in the environment of the preimplantation embryo and in the embryo respectively strongly implies that embryos are designed to encounter and respond to the corresponding factors. Studies of embryo coculture also indirectly suggest that growth factors can improve in vitro development. Several animal and human studies attest to a probable beneficial effect of addition of growth factors to culture media. However, there is still ambiguity regarding the exact role of growth factors in embryonic development, the optimal dose of growth factors to be added to culture media, the combinatorial effect and endocrine of growth factors in embryonic development.
Fang, Jung-Da; Lee, Sheau-Ling
2014-07-01
Hepatocyte growth factor (HGF) is a chemoattractant and inducer for neural stem/progenitor (NS/P) cell migration. Although the type II transmembrane serine protease, matriptase (MTP) is an activator of the latent HGF, MTP is indispensable on NS/P cell motility induced by the active form of HGF. This suggests that MTP's action on NS/P cell motility involves mechanisms other than proteolytic activation of HGF. In the present study, we investigate the role of MTP in HGF-stimulated signaling events. Using specific inhibitors of phosphatidylinositol-3-kinase (PI3K), protein kinase B (Akt) or focal adhesion kinase (FAK), we demonstrated that in NS/P cells HGF-activated c-Met induces PI3k-Akt signaling which then leads to FAK activation. This signaling pathway ultimately induces MMP2 expression and NS/P cell motility. Knocking down of MTP in NS/P cells with specific siRNA impaired HGF-stimulation of c-Met, Akt and FAK activation, blocked HGF-induced production of MMP2 and inhibited HGF-stimulated NS/P cell motility. MTP-knockdown NS/P cells cultured in the presence of recombinant protein of MTP protease domain or transfected with the full-length wild-type but not the protease-defected MTP restored HGF-responsive events in NS/P cells. In addition to functioning as HGF activator, our data revealed novel function of MTP on HGF-stimulated c-Met signaling activation. Copyright © 2014. Published by Elsevier B.V.
Eto, Hitomi; Suga, Hirotaka; Aoi, Noriyuki; Kato, Harunosuke; Doi, Kentaro; Kuno, Shinichiro; Tabata, Yasuhiko; Yoshimura, Kotaro
2012-02-01
Although hypertrophic scars (HTSs) and keloids are challenging problems, their pathogenesis is not well understood, making therapy difficult. We showed that matrix metalloproteinase (MMP)-1 expression was downregulated in HTS compared with normal skin from the same patients, whereas type 1 and 3 collagen and transforming growth factor-β (TGF-β) were upregulated. These differences, however, were not seen in cultured fibroblasts, suggesting the involvement of microenvironmental factors in the pathogenesis of HTS. Fibroblast growth factor-2 (FGF-2) highly upregulated the expression of MMP-1 and hepatocyte growth factor (HGF) in both HTS-derived and control fibroblasts; the upregulation was reversed by extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) inhibitors. An animal study using human HTS tissue implanted into nude mice indicated that controlled-release FGF-2 resulted in significantly less weight and decreased hydroxyproline content in HTS. Degradation of collagen fibers in FGF-2-treated HTS was also confirmed histologically. Western blotting showed that FGF-2-treated HTS expressed significantly higher MMP-1 protein than control. Decreased MMP-1 expression may be an important transcriptional change in HTS, and its reversal as well as upregulation of HGF by FGF-2 could be a new therapeutic approach for HTS.
The differentiation of hepatocyte-like cells from monkey embryonic stem cells.
Ma, Xiaocui; Duan, Yuyou; Jung, Christine J; Wu, Jian; VandeVoort, Catherine A; Zern, Mark A
2008-12-01
Embryonic stem cells (ESC) hold great potential for the treatment of liver diseases. Here, we report the differentiation of rhesus macaque ESC along a hepatocyte lineage. The undifferentiated monkey ESC line, ORMES-6, was cultured in an optimal culture condition in an effort to differentiate them into hepatocyte-like cells in vitro. The functional efficacy of the differentiated hepatic cells was evaluated using RT-PCR for the expression of hepatocyte specific genes, and Western blot analysis and immunocytochemistry for hepatic proteins such as alpha-fetoprotein (AFP), albumin and alpha1-antitrypsin (alpha1-AT). Functional assays were performed using the periodic acid schiff (PAS) reaction and ELISA. The final yield of ESC-derived hepatocyte-like cells was measured by flow cytometry for cells that were transduced with a liver-specific lentivirus vector containing the alpha1-AT promoter driving the expression of green fluorescence protein (GFP). The treatment of monkey ESC with an optimal culture condition yielded hepatocyte-like cells that expressed albumin, alpha1-AT, AFP, hepatocyte nuclear factor 3beta, glucose-6-phophatase, and cytochrome P450 genes and proteins as determined by RT-PCR and Western blot analysis. Immunofluorescent staining showed the cells positive for albumin, AFP, and alpha1-AT. PAS staining demonstrated that the differentiated cells showed hepatocyte functional activity. Albumin could be detected in the medium after 20 days of differentiation. Flow cytometry data showed that 6.5 +/- 1.0% of the total differentiated cells were positive for GFP. These results suggest that by using a specific, empirically determined, culture condition, we were able to direct monkey ESC toward a hepatocyte lineage.
He, Fang; Ye, Bei; Chen, Jianzhen; Sun, Xiaoyan; Li, Chang
2014-01-01
To explore the effect of hepatocyte growth factor (HGF) on inducible nitric oxide synthase (iNOS), NO and interleukin-1β (IL-1β) in the cerebrum of rats subjected to cerebral ischemia/reperfusion (I/R). Sprague-Dawley rats were randomly divided into 5 groups: a sham group, an I/R group,an HGF1 group, an HGF2 group, and an HGF3 group. The latter 3 groups were respectively injected 15, 30 and 60 μg/kg HGF. The focal cerebral I/R model was established by sutureoccluded method. After 1.5 h ischemia followed by 24 h reperfusion, the iNOS activity and NO content in the ischemic cerebral tissue were assessed. The expression of iNOS mRNA and IL-1β mRNA was detected. The level of iNOS protein and IL-1β content were determined. In addition, cultured cerebral cortical neurons in vitro were exposed to I/R. Then the expression of iNOS and IL-1β protein in the neurons was detected, and NO content was assessed. The iNOS activity and NO content in the ischemic cerebral tissue were increased. The expression of iNOS mRNA and IL-1β mRNA was upregulated. The level of iNOS protein and IL- 1β content were increased. Administration of HGF decreased the iNOS activity and NO content, and downregulated the expression of iNOS mRNA, IL-1β mRNA, iNOS protein and IL-1β content in the ischemic cerebral tissue. HGF decreased the expression of IL-1β, iNOS protein and NO content in the cortical neurons exposed to I/R in vitro. HGF can inhibit the expression of IL-1β and decrease the expression of iNOS and content of NO, which is probably one of the mechanisms mediating the protection of HGF against cerebral ischemia injury.
Isolated hepatocytes--past, present and future.
Berry, M N; Grivell, A R; Grivell, M B; Phillips, J W
1997-07-01
The first technique for large-scale preparation of isolated hepatocytes was described in 1953 and involved perfusion of rat liver under pressure with a Ca(2+)-free solution containing a chelating agent. Various modifications of this technique were in use over the next ten years, until it was demonstrated that cells prepared in this manner were grossly damaged, losing most of their cytoplasmic enzymes during the preparative procedure. The successful preparation of intact isolated hepatocytes by collagenase-treatment of liver was achieved in 1967, and the widespread use of intact hepatocyte suspensions was accelerated by the development soon after of high-yield preparative techniques involving perfusion of the liver with a medium containing collagenase. The introduction of the isolated hepatocyte preparation has enabled experimental studies that otherwise would not be feasible. Important advances have been the use of cultured hepatocytes, frequently of human origin, for the investigation of the metabolism and toxicology of potential therapeutic agents. Success in this field has been achieved through the steady improvement in techniques for the maintenance in culture of differentiated hepatocytes, and in particular their cytochrome P450 complexes. Another area showing considerable promise is the employment of hepatocytes, generally from a porcine source, in temporary support systems for patients with acute liver failure. Our own studies have concentrated on the demonstration of long-range interactions between hepatocyte compartments which suggest that energy transfer between cell compartments can take place without ATP turnover.
Qian, Lichuan; Krause, Diane S.; Saltzman, W. Mark
2012-01-01
Fetal liver epithelial cells (FLEC) are valuable for liver cell therapy and tissue engineering, but methods for culture and characterization of these cells are not well developed. This work explores the influence of multiple soluble factors on FLEC, with the long-term goal of developing an optimal culture system to generate functional liver tissue. Our comparative analysis suggests hepatocyte growth factor (HGF) is required throughout the culture period. In the presence of HGF, addition of oncostatin M (OSM) at culture initiation results in concurrent growth and maturation, while constant presence of protective agents like ascorbic acid enhances cell survival. Study observations led to the development of a culture medium that provided optimal growth and hepatic differentiation conditions. FLEC expansion was observed to be ~2 fold of that under standard conditions, albumin secretion rate was 2 – 3 times greater than maximal values obtained with other media, and the highest level of glycogen accumulation among all conditions was observed with the developed medium. Our findings serve to advance culture methods for liver progenitors in cell therapy and tissue engineering applications. PMID:21922669
Itoh, Motoyuki; Yoshida, Yuichi; Nishida, Keigo; Narimatsu, Masahiro; Hibi, Masahiko; Hirano, Toshio
2000-01-01
Gab1 is a member of the Gab/DOS (Daughter of Sevenless) family of adapter molecules, which contain a pleckstrin homology (PH) domain and potential binding sites for SH2 and SH3 domains. Gab1 is tyrosine phosphorylated upon stimulation of various cytokines, growth factors, and antigen receptors in cell lines and interacts with signaling molecules, such as SHP-2 and phosphatidylinositol 3-kinase, although its biological roles have not yet been established. To reveal the functions of Gab1 in vivo, we generated mice lacking Gab1 by gene targeting. Gab1-deficient embryos died in utero and displayed developmental defects in the heart, placenta, and skin, which were similar to phenotypes observed in mice lacking signals of the hepatocyte growth factor/scatter factor, platelet-derived growth factor, and epidermal growth factor pathways. Consistent with these observations, extracellular signal-regulated kinase mitogen-activated protein (ERK MAP) kinases were activated at much lower levels in cells from Gab1-deficient embryos in response to these growth factors or to stimulation of the cytokine receptor gp130. These results indicate that Gab1 is a common player in a broad range of growth factor and cytokine signaling pathways linking ERK MAP kinase activation. PMID:10779359
Panda, Santanu; Bisht, Sonu; Malakar, Dhruba; Mohanty, Ashok K; Kaushik, Jai K
2015-01-01
In farm animals, there is no suitable cell line available to understand liver-specific functions. This has limited our understanding of liver function and metabolism in farm animals. Culturing and maintenance of functionally active hepatocytes is difficult, since they survive no more than few days. Establishing primary culture of hepatocytes can help in studying cellular metabolism, drug toxicity, hepatocyte specific gene function and regulation. Here we provide a simple in vitro method for isolation and short-term culture of functionally active buffalo hepatocytes. Buffalo hepatocytes were isolated from caudate lobes by using manual enzymatic perfusion and mechanical disruption of liver tissue. Hepatocyte yield was (5.3 ± 0.66)×107 cells per gram of liver tissue with a viability of 82.3 ± 3.5%. Freshly isolated hepatocytes were spherical with well contrasted border. After 24 hours of seeding onto fibroblast feeder layer and different extracellular matrices like dry collagen, matrigel and sandwich collagen coated plates, hepatocytes formed confluent monolayer with frequent clusters. Cultured hepatocytes exhibited typical cuboidal and polygonal shape with restored cellular polarity. Cells expressed hepatocyte-specific marker genes or proteins like albumin, hepatocyte nuclear factor 4α, glucose-6-phosphatase, tyrosine aminotransferase, cytochromes, cytokeratin and α1-antitrypsin. Hepatocytes could be immunostained with anti-cytokeratins, anti-albumin and anti α1-antitrypsin antibodies. Abundant lipid droplets were detected in the cytosol of hepatocytes using oil red stain. In vitro cultured hepatocytes could be grown for five days and maintained for up to nine days on buffalo skin fibroblast feeder layer. Cultured hepatocytes were viable for functional studies. We developed a convenient and cost effective technique for hepatocytes isolation for short-term culture that exhibited morphological and functional characteristics of active hepatocytes for studying gene
3D spheroid culture of hESC/hiPSC-derived hepatocyte-like cells for drug toxicity testing.
Takayama, Kazuo; Kawabata, Kenji; Nagamoto, Yasuhito; Kishimoto, Keisuke; Tashiro, Katsuhisa; Sakurai, Fuminori; Tachibana, Masashi; Kanda, Katsuhiro; Hayakawa, Takao; Furue, Miho Kusuda; Mizuguchi, Hiroyuki
2013-02-01
Although it is expected that hepatocyte-like cells differentiated from human embryonic stem (ES) cells or induced pluripotent stem (iPS) cells will be utilized in drug toxicity testing, the actual applicability of hepatocyte-like cells in this context has not been well examined so far. To generate mature hepatocyte-like cells that would be applicable for drug toxicity testing, we established a hepatocyte differentiation method that employs not only stage-specific transient overexpression of hepatocyte-related transcription factors but also a three-dimensional spheroid culture system using a Nanopillar Plate. We succeeded in establishing protocol that could generate more matured hepatocyte-like cells than our previous protocol. In addition, our hepatocyte-like cells could sensitively predict drug-induced hepatotoxicity, including reactive metabolite-mediated toxicity. In conclusion, our hepatocyte-like cells differentiated from human ES cells or iPS cells have potential to be applied in drug toxicity testing. Copyright © 2012 Elsevier Ltd. All rights reserved.
Paulk, Nicole K; Wursthorn, Karsten; Haft, Annelise; Pelz, Carl; Clarke, Gregory; Newell, Amy H; Olson, Susan B; Harding, Cary O; Finegold, Milton J; Bateman, Raymond L; Witte, John F; McClard, Ronald; Grompe, Markus
2012-01-01
Genetic fumarylacetoacetate hydrolase (Fah) deficiency is unique in that healthy gene-corrected hepatocytes have a strong growth advantage and can repopulate the diseased liver. Unfortunately, similar positive selection of gene-corrected cells is absent in most inborn errors of liver metabolism and it is difficult to reach the cell replacement index required for therapeutic benefit. Therefore, methods to transiently create a growth advantage for genetically modified hepatocytes in any genetic background would be advantageous. To mimic the selective pressure of Fah deficiency in normal animals, an efficient in vivo small molecule inhibitor of FAH, 4-[(2-carboxyethyl)-hydroxyphosphinyl]-3-oxobutyrate (CEHPOBA) was developed. Microarray analysis demonstrated that pharmacological inhibition of FAH produced highly similar gene expression changes to genetic deficiency. As proof of principle, hepatocytes lacking homogentisic acid dioxygenase (Hgd) and hence resistant to FAH inhibition were transplanted into sex-mismatched wild-type recipients. Time course analyses of 4–6 weeks of CEHPOBA administration after transplantation showed a linear relationship between treatment length and replacement index. Compared to controls, recipients treated with the FAH-inhibitor had 20–100-fold increases in liver repopulation. We conclude that pharmacological inhibition of FAH is a promising approach to in vivo selection of hepatocytes. PMID:22871666
van der Flier, Arjan; Liu, Zhan; Tan, Siyuan; Chen, Kai; Drager, Douglas; Liu, Tongyao; Patarroyo-White, Susannah; Jiang, Haiyan; Light, David R.
2015-01-01
We recently developed a longer lasting recombinant factor VIII-Fc fusion protein, rFVIIIFc, to extend the half-life of replacement FVIII for the treatment of people with hemophilia A. In order to elucidate the biological mechanism for the elongated half-life of rFVIIIFc at a cellular level we delineated the roles of VWF and the tissue-specific expression of the neonatal Fc receptor (FcRn) in the biodistribution, clearance and cycling of rFVIIIFc. We find the tissue biodistribution is similar for rFVIIIFc and rFVIII and that liver is the major clearance organ for both molecules. VWF reduces the clearance and the initial liver uptake of rFVIIIFc. Pharmacokinetic studies in FcRn chimeric mice show that FcRn expressed in somatic cells (hepatocytes or liver sinusoidal endothelial cells) mediates the decreased clearance of rFVIIIFc, but FcRn in hematopoietic cells (Kupffer cells) does not affect clearance. Immunohistochemical studies show that when rFVIII or rFVIIIFc is in dynamic equilibrium binding with VWF, they mostly co localize with VWF in Kupffer cells and macrophages, confirming a major role for liver macrophages in the internalization and clearance of the VWF-FVIII complex. In the absence of VWF a clear difference in cellular localization of VWF-free rFVIII and rFVIIIFc is observed and neither molecule is detected in Kupffer cells. Instead, rFVIII is observed in hepatocytes, indicating that free rFVIII is cleared by hepatocytes, while rFVIIIFc is observed as a diffuse liver sinusoidal staining, suggesting recycling of free-rFVIIIFc out of hepatocytes. These studies reveal two parallel linked clearance pathways, with a dominant pathway in which both rFVIIIFc and rFVIII complexed with VWF are cleared mainly by Kupffer cells without FcRn cycling. In contrast, the free fraction of rFVIII or rFVIIIFc unbound by VWF enters hepatocytes, where FcRn reduces the degradation and clearance of rFVIIIFc relative to rFVIII by cycling rFVIIIFc back to the liver sinusoid and
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
Jalkanen, Juho; Hautero, Olli; Maksimow, Mikael; Jalkanen, Sirpa; Hakovirta, Harri
2018-04-21
The aim of the present study was to assess the circulating levels of vascular endothelial growth factor (VEGF) and other suggested therapeutic growth factors with the degree of ischemia in patients with different clinical manifestations of peripheral arterial disease (PAD) according to the Rutherford grades. The study cohort consists of 226 consecutive patients admitted to a Department of Vascular Surgery for elective invasive procedures. PAD patients were grouped according to the Rutherford grades after a clinical assessment. Ankle-brachial pressure indices (ABI) and absolute toe pressure (TP) values were measured. Serum levels of circulating VEGF, hepatocyte growth factor (HGF), basic fibroblast growth factor (bFGF), and platelet derived growth factor (PDGF) were measured from serum and analysed against Rutherford grades and peripheral hemodynamic measurements. The levels of VEGF (P = 0.009) and HGF (P < 0.001) increased significantly as the ischaemic burden became more severe according to the Rutherford grades. PDGF behaved in opposite manner and declined along increasing Rutherford grades (P = 0.004). A significant, inverse correlations between Rutherford grades was detected as follows; VEGF (Pearson's correlation = 0.183, P = 0.004), HGF (Pearson's correlation = 0.253, P < 0.001), bFGF (Pearson's correlation = 0.169, P = 0.008) and PDGF (Pearson's correlation = 0.296, P < 0.001). In addition, VEGF had a clear direct negative correlation with ABI (Pearson's correlation -0.19, P = 0.009) and TP (Pearson's correlation -0.20, P = 0.005) measurements. Our present observations show that the circulating levels of VEGF and other suggested therapeutic growth factors are significantly increased along with increasing ischemia. These findings present a new perspective to anticipated positive effects of gene therapies utilizing VEGF, HGF, and bFGF, because the levels of these growth factors are endogenously high in end
Feng, Cong; Wu, Bo; Fan, Hongxia; Li, Changfei; Meng, Songdong
2014-10-04
To investigate the mechanism of gp96 raised during hepatitis B virus (HBV) infection and the pathological mechanism. The mechanism of NF-KB activating gp96 expression was determined by bioinformatics analysis, luciferase reporter assay, real-time PCR and Western blot. The effect of over-expression and knockdown gp96 expression by transfection or RNA interference on hepatocyte proliferation, apoptosis and cell cycle was examined by CCK-8 and flow cytometry. The role of gp96 for HCC development was determined by epithelial-mesenchymal transition (EMT) and colony formation assay. NF-kB significantly increased the gp96 expression by binding to the NF-kappaB binding site. Over-expression and knockdown studies both show that gp96 promoted hepatocyte proliferation, inhibited apoptosis, and induced G0/G1 to S phase cell cycle progression. Moreover, gp96 induced epithelial-mesenchymal transition and increased colony formation ability of hepatocytes. Our results therefore provide insights in chronic HBV infection-induced gp96 expression, and indicate that elevated gp96 may contribute to HCC development during chronic inflammation.
Guo, Xinyue; Li, Weihong; Ma, Minghui; Lu, Xin; Zhang, Haiyan
2017-11-01
The extracellular matrix (ECM) microenvironment is involved in the regulation of hepatocyte phenotype and function. Recently, the cell-derived extracellular matrix has been proposed to represent the bioactive and biocompatible materials of the native ECM. Here, we show that the endothelial cell-derived matrix (EC matrix) promotes the metabolic maturation of human adipose stem cell-derived hepatocyte-like cells (hASC-HLCs) through the activation of the transcription factor forkhead box protein A2 (FOXA2) and the nuclear receptors hepatocyte nuclear factor 4 alpha (HNF4α) and pregnane X receptor (PXR). Reducing the fibronectin content in the EC matrix or silencing the expression of α5 integrin in the hASC-HLCs inhibited the effect of the EC matrix on Src phosphorylation and hepatocyte maturation. The inhibition of Src phosphorylation using the inhibitor PP2 or silencing the expression of Src in hASC-HLCs also attenuated the up-regulation of the metabolic function of hASC-HLCs in a nuclear receptor-dependent manner. These data elucidate integrin-Src signalling linking the extrinsic EC matrix signals and metabolic functional maturation of hepatocyte. This study provides a model for studying the interaction between hepatocytes and non-parenchymal cell-derived matrix. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Frémin, Christophe; Bessard, Anne; Ezan, Frédéric; Gailhouste, Luc; Régeard, Morgane; Le Seyec, Jacques; Gilot, David; Pagès, Gilles; Pouysségur, Jacques; Langouët, Sophie; Baffet, Georges
2009-03-01
We investigated the specific role of the mitogen-activated protein kinase (MAPK) extracellular signal-regulated kinase 1 (ERK1)/ERK2 pathway in the regulation of multiple cell cycles and long-term survival of normal hepatocytes. An early and sustained epidermal growth factor (EGF)-dependent MAPK activation greatly improved the potential of cell proliferation. In this condition, almost 100% of the hepatocytes proliferated, and targeting ERK1 or ERK2 via RNA interference revealed the specific involvement of ERK2 in this regulation. However, once their first cell cycle was performed, hepatocytes failed to undergo a second round of replication and stayed blocked in G1 phase. We demonstrated that sustained EGF-dependent activation of the MAPK/ERK kinase (MEK)/ERK pathway was involved in this blockage as specific transient inhibition of the cascade repotentiated hepatocytes to perform a new wave of replication and multiple cell cycles. We identified this mechanism by showing that this blockage was in part supported by ERK2-dependent p21 expression. Moreover, continuous MEK inhibition was associated with a lower apoptotic engagement, leading to an improvement of survival up to 3 weeks. Using RNA interference and ERK1 knockout mice, we extended these results by showing that this improved survival was due to the specific inhibition of ERK1 expression/phosphorylation and did not involve ERK2. Our results emphasize that transient MAPK inhibition allows multiple cell cycles in primary cultures of hepatocytes and that ERK2 has a key role in the regulation of S phase entry. Moreover, we revealed a major and distinct role of ERK1 in the regulation of hepatocyte survival. Taken together, our results represent an important advance in understanding long-term survival and cell cycle regulation of hepatocytes.
Cryopreservation of Hepatocyte Microbeads for Clinical Transplantation
Jitraruch, Suttiruk; Hughes, Robin D.; Filippi, Celine; Lehec, Sharon C.; Glover, Leanne; Mitry, Ragai R.
2017-01-01
Intraperitoneal transplantation of hepatocyte microbeads is an attractive option for the management of acute liver failure. Encapsulation of hepatocytes in alginate microbeads supports their function and prevents immune attack of the cells. Establishment of banked cryopreserved hepatocyte microbeads is important for emergency use. The aim of this study was to develop an optimized protocol for cryopreservation of hepatocyte microbeads for clinical transplantation using modified freezing solutions. Four freezing solutions with potential for clinical application were investigated. Human and rat hepatocytes cryopreserved with University of Wisconsin (UW)/10% dimethyl sulfoxide (DMSO)/5% (300 mM) glucose and CryoStor CS10 showed better postthawing cell viability, attachment, and hepatocyte functions than with histidine–tryptophan–ketoglutarate/10% DMSO/5% glucose and Bambanker. The 2 freezing solutions that gave better results were studied with human and rat hepatocytes microbeads. Similar effects on cryopreserved microbead morphology (external and ultrastructural), viability, and hepatocyte-functions post thawing were observed over 7 d in culture. UW/DMSO/glucose, as a basal freezing medium, was used to investigate the additional effects of cytoprotectants: a pan-caspase inhibitor (benzyloxycarbonyl-Val-Ala-dl-Asp-fluoromethylketone [ZVAD]), an antioxidant (desferoxamine [DFO]), and a buffering and mechanical protectant (human serum albumin [HSA]) on RMBs. ZVAD (60 µM) had a beneficial effect on cell viability that was greater than with DFO (1 mM), HSA (2%), and basal freezing medium alone. Improvements in the ultrastructure of encapsulated hepatocytes and a lower degree of cell apoptosis were observed with all 3 cytoprotectants, with ZVAD tending to provide the greatest effect. Cytochrome P450 activity was significantly higher in the 3 cytoprotectant groups than with fresh microbeads. In conclusion, developing an optimized cryopreservation protocol by adding
Lian, Gewei; Wang, Chengyan; Teng, Chunbo; Zhang, Cong; Du, Liying; Zhong, Qian; Miao, Chenglin; Ding, Mingxiao; Deng, Hongkui
2006-03-01
Whether bone marrow (BM) hematopoietic stem/progenitor cells can directly differentiate into nonhematopoietic cells remains controversial. The aim of this study is to further investigate the potentiality of BM hematopoietic progenitor cells to convert into hepatocytes in vitro. Different subsets of BM cells from C57/BL6 mice were isolated using markers of hematopoietic stem cells by magnetic cell sorting and by flow cytometry. These cells were induced to transdifferentiate to hepatocytes in vitro in the presence of various cytokines or of hepatocytes (or tissue) from damaged liver, which have been reported to stimulate the conversion. Hepatic gene markers in freshly isolated or cultured BM cells were determined by reverse transcriptase polymerase chain reaction and immunofluorescence. Freshly isolated hematopoietic progenitor cells (HPC) expressed a low level of messenger RNAs of hepatic cell-specific markers including albumin and alpha-fetoprotein (AFP), but did not significantly upregulate expression of these markers, even in the presence of cytokines or cocultured hepatocytes (or tissue). HPCs induced in vitro did not express the message of alpha-anti-trypsin-a mature hepatocyte marker. At protein level, the specific staining of AFP was not detected in the HPCs, either freshly isolated or in vitro induced. Albumin protein was detected in freshly isolated albumin mRNA-positive and -negative BM cell subpopulations. Albumin-stained BM cells disappeared after being induced for 5 days, but restained if mouse serum was supplemented in medium for a 24-hour extended culture, suggesting that albumin was absorbed by BM cells instead of de novo expression. HPCs expressed mRNAs of hepatic cell markers, but could not efficiently convert into hepatocytes in vitro under our experimental conditions. Our observation raises a cautionary note in determining whether in vitro transdifferentiation of BM cells to hepatocytes can actually take place.
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation
Gaviglio, Angela L.; Knelson, Erik H.; Blobe, Gerard C.
2017-01-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor–like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.—Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. PMID:28174207
Band, Arja M.; Björklund, Mia; Laiho, Marikki
2009-01-01
Ski is an oncoprotein that negatively regulates transforming growth factor (TGF)-β signaling. It acts as a transcriptional co-repressor by binding to TGF-β signaling molecules, Smads. Efficient TGF-β signaling is facilitated by rapid proteasome-mediated degradation of Ski by TGF-β. Here we report that Ski is phosphorylated by Akt/PKB kinase. Akt phosphorylates Ski on a highly conserved Akt motif at threonine 458 both in vitro and in vivo. The phosphorylation of Ski at threonine 458 is induced by Akt pathway activators including insulin, insulin-like growth factor-1, and hepatocyte growth factor. The phosphorylation of Ski causes its destabilization and reduces Ski-mediated inhibition of expression of another negative regulator of TGF-β, Smad7. Induction of Smad7 levels leads to inactivation of TGF-β receptors and TGF-β signaling cascade, as indicated by reduced induction of TGF-β target p15. Therefore, Akt modulates TGF-β signaling by temporarily adjusting the levels of two TGF-β pathway negative regulators, Ski and Smad7. These novel findings demonstrate that Akt pathway activation directly impacts TGF-β pathway. PMID:19875456
Purushotham, Aparna; Xu, Qing; Lu, Jing; Foley, Julie F.; Yan, Xingjian; Kim, Dong-Hyun; Kemper, Jongsook Kim
2012-01-01
SIRT1, a highly conserved NAD+-dependent protein deacetylase, is a key metabolic sensor that directly links nutrient signals to animal metabolic homeostasis. Although SIRT1 has been implicated in a number of hepatic metabolic processes, the mechanisms by which hepatic SIRT1 modulates bile acid metabolism are still not well understood. Here we report that deletion of hepatic SIRT1 reduces the expression of farnesoid X receptor (FXR), a nuclear receptor that regulates bile acid homeostasis. We provide evidence that SIRT1 regulates the expression of FXR through hepatocyte nuclear factor 1α (HNF1α). SIRT1 deficiency in hepatocytes leads to decreased binding of HNF1α to the FXR promoter. Furthermore, we show that hepatocyte-specific deletion of SIRT1 leads to derangements in bile acid metabolism, predisposing the mice to development of cholesterol gallstones on a lithogenic diet. Taken together, our findings indicate that SIRT1 plays a vital role in the regulation of hepatic bile acid homeostasis through the HNF1α/FXR signaling pathway. PMID:22290433
Thompson, Michael D.; Wickline, Emily D.; Bowen, William B.; Lu, Amy; Singh, Sucha; Misse, Amalea; Monga, Satdarshan P. S.
2011-01-01
Prolonged exposure of mice to diet containing 0.1% 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) results in hepatobiliary injury, atypical ductular proliferation, oval cell appearance and limited fibrosis. Previously, we reported that short-term ingestion of DDC diet by hepatocyte-specific β-catenin conditional knockout (KO) mice, led to fewer A6-positive oval cells than wild-type (WT) littermates. To examine the role of β-catenin in chronic hepatic injury and repair, we exposed WT and KO mice to DDC for 80 and 150 days. Paradoxically, long-term DDC exposure led to significantly more A6-positive cells indicating greater atypical ductular proliferation in KO, which coincided with increased fibrosis and cholestasis. Surprisingly, at 80 and 150 days in KO, we observed a significant amelioration of hepatocyte injury. This coincided with extensive repopulation of β-catenin null livers with β-catenin-positive hepatocytes at 150 days, which was preceded by appearance of β-catenin-positive hepatocyte clusters at 80 days and a few β-catenin-positive hepatocytes at earlier times. Intriguingly, occasional β-catenin-positive hepatocytes that were negative for progenitor markers were also observed at baseline in the KO livers suggesting spontaneous escape from cre-mediated recombination. These cells with hepatocyte morphology expressed mature hepatocyte markers but lacked markers of hepatic progenitors. The gradual repopulation of KO livers with β-catenin-positive hepatocytes occurred only following DDC injury and coincided with a progressive loss of hepatic cre-recombinase expression. A few β-catenin-positive cholangiocytes were observed albeit only after long-term DDC-exposure and trailed the appearance of β-catenin-positive hepatocytes. In conclusion, in a chronic liver injury model, β-catenin-positive hepatocytes exhibit growth and survival advantages and repopulate KO livers eventually limiting hepatic injury and dysfunction despite increased fibrosis and
Litwin, Monika; Radwańska, Agata; Paprocka, Maria; Kieda, Claudine; Dobosz, Tadeusz; Witkiewicz, Wojciech; Baczyńska, Dagmara
2015-12-01
In recent years, special attention has been paid to finding new pro-angiogenic factors which could be used in gene therapy of vascular diseases such as critical limb ischaemia (CLI). Angiogenesis, the formation of new blood vessels, is a complex process dependent on different cytokines, matrix proteins, growth factors and other pro- or anti-angiogenic stimuli. Numerous lines of evidence suggest that key mediators of angiogenesis, vascular endothelial growth factor (VEGF) and hepatocyte growth factor (HGF) together with fibroblast growth factor2 (FGF2) are involved in regulation of the normal and pathological process of angiogenesis. However, less information is available on the complex interactions between these and other angiogenic factors. The aim of this study was to characterise the effect of fibroblast growth factor2 on biological properties of human endothelial progenitor cells with respect to the expression level of other regulatory cytokines. Ectopic expression of FGF2 in EP cells stimulates their pro-angiogenic behaviour, leading to increased proliferation, migration and tube formation abilities. Moreover, we show that the expression profile of VEGF and other pro-angiogenic cytokines, such as HGF, MCP2, and interleukins, is affected differently by FGF2 in EPC. In conclusion, we provide evidence that FGF2 directly affects not only the biological properties of EP cells but also the expression pattern and secretion of numerous chemocytokines. Our results suggest that FGF2 could be applied in therapeutic approaches for CLI and other ischaemic diseases of the vascular system in vivo.
Chen, Bing; Yan, Hongbin; Zhao, Yannan; Lou, Zhongzi; Li, Jianqiu; Fu, Baoquan; Zhu, Xingquan; McManus, Donald P.; Dai, Jianwu; Jia, Wanzhong
2018-01-01
Background Hepatocyte-based metacestode culture is an attractive method to study alveolar echinococcosis (AE), but it is limited by the relatively short lifespan of cultured hepatocytes in maintaining their normal function. Methodology/principal findings We describe a three-dimensional (3D) hepatic culture system developed from co-cultured hepatocytes and mesenchymal stem cells using a collagen scaffold to study the development of Echinococcus multilocularis larvae. This 3D culture system preserved the function of hepatocytes for a longer period of time than their monolayer counterparts, with albumin secretion, 7-ethoxyresorufin O-deethylation activity, urea synthesis, CYP3A4 and CYP2D6 activity being highly preserved for 21–28 days. The expression levels of hepatocyte-specific genes including CLDN-3, Bsep, AFP, G6P, A1AT, CYP3A4 and NR1I3 were significantly higher in the 3D cultured system compared with their monolayer counterparts after 14-days in culture. Additionally, in the presence of 3D cultured hepatocytes, 81.2% of E. multilocularis protoscoleces rapidly de-differentiated into infective vesicles within eight weeks. Transcriptomic analyses revealed 807 differentially expressed genes between cultured vesicles and protoscoleces, including 119 genes uniquely expressed in protoscoleces, and 242 genes uniquely expressed in vesicles. These differentially expressed genes were mainly involved in parasite growth relating to the G-protein coupled receptor activity pathway, substrate-specific transmembrane transporter activity, cell-cell adhesion process, and potentially with neuroactive ligand-receptor interaction. Conclusions/significance This culture system provides a valuable advance in prolonging hepatocyte functionality, a foundation for future in-depth analysis of the host-parasite interaction in AE, and a useful model to evaluate potential therapeutic strategies to treat AE. PMID:29538424
Boisvert, William A; Yu, Miri; Choi, Youngbin; Jeong, Gi Hee; Zhang, Yi-Lin; Cho, Sunghun; Choi, Changsun; Lee, Sanghyun; Lee, Bog-Hieu
2017-02-13
Geranium sibiricum L. has been used as a medicinal plant to treat diarrhea, bacterial infection, and cancer in Bulgaria, Peru, and Korea. However, its hair growth-promoting effect was not investigated so far. This study examined the effects of Geranium sibiricum L. extract (GSE) on hair growth, using in vitro and in vivo models. Antioxidant, proliferation and migration assay of GSE was performed with human dermal papilla cells (hDPCs). Hair-growth promoting effect was measured in animal model. Relative expression of interleukin-1, vascular endothelial growth factor, hepatocyte growth factor, and transforming growth factor beta 1 was determined by real time RT-PCR. Expression of Ki-67 and stem cell factor were analyzed by immunohistochemistry. GSE treatment proliferated and migrated human dermal papilla cells (hDPCs) more than treatment of 10 μM minoxidil. GSE significantly stimulated the expression of Ki-67 protein and the mRNA levels of hepatocyte growth factor and vascular endothelial growth factor in hDPCs. Topical application of 1,000 ppm GSE for 3 weeks promoted more significant hair growth on shaved C57BL/6 mice than did 5% minoxidil. The histological morphology of hair follicles demonstrated an active anagen phase with the induction of stem cell factor. GSE treatment significantly reduced the number of mast cells and the expression of transforming growth factor beta 1 in mouse skin tissues. These results demonstrated that GSE promotes hair growth in vitro and in vivo by regulating growth factors and the cellular response.
Richert, Lysiane; Lamboley, Christelle; Viollon-Abadie, Catherine; Grass, Peter; Hartmann, Nicole; Laurent, Stephane; Heyd, Bruno; Mantion, Georges; Chibout, Salah-Dine; Staedtler, Frank
2003-09-01
The mRNA expression profile in control and clofibric acid (CLO)-treated mouse, rat, and human hepatocytes was analyzed using species-specific oligonucleotide DNA microarrays (Affymetrix). A statistical empirical Bayes procedure was applied in order to select the significantly differentially expressed genes. Treatment with the peroxisome proliferator CLO induced up-regulation of genes involved in peroxisome proliferation and in cell proliferation as well as down-regulation of genes involved in apoptosis in hepatocytes of rodent but not of human origin. CLO treatment induced up-regulation of microsomal cytochrome P450 4a genes in rodent hepatocytes and in two of six human hepatocyte cultures. In addition, genes encoding phenobarbital-inducible cytochrome P450s were also up-regulated by CLO in rodent and human hepatocyte cultures. Up-regulation of phenobarbital-inducible UDP-glucuronosyl-transferase genes by CLO was observed in both rat and human but not in mouse hepatocytes. CLO treatment induced up-regulation of L-fatty acid binding protein (L-FABP) gene in hepatocytes of both rodent and human origin. However, while genes of the cytosolic, microsomal, and mitochondrial pathways involved in fatty acid transport and metabolism were up-regulated by CLO in both rodent and human hepatocyte cultures, genes of the peroxisomal pathway of lipid metabolism were up-regulated in rodents only. An up-regulation of hepatocyte nuclear factor 1alpha (HNF1alpha) by CLO was observed only in human hepatocyte cultures, suggesting that this trans-activating factor may play a key role in the regulation of fatty acid metabolism in human liver as well as in the nonresponsiveness of human liver to CLO-induced regulation of cell proliferation and apoptosis.
Asquith, Mark; Pasala, Sumana; Engelmann, Flora; Haberthur, Kristen; Meyer, Christine; Park, Byung; Grant, Kathleen A; Messaoudi, Ilhem
2014-04-01
Chronic alcohol consumption has been associated with enhanced susceptibility to both systemic and mucosal infections. However, the exact mechanisms underlying this enhanced susceptibility remain incompletely understood. Using a nonhuman primate model of ethanol (EtOH) self-administration, we examined the impact of chronic alcohol exposure on immune homeostasis, cytokine, and growth factor production in peripheral blood, lung, and intestinal mucosa following 12 months of chronic EtOH exposure. EtOH exposure inhibited activation-induced production of growth factors hepatocyte growth factor (HGF), granulocyte colony-stimulating factor (G-CSF), and vascular-endothelial growth factor (VEGF) by peripheral blood mononuclear cells (PBMC). Moreover, EtOH significantly reduced the frequency of colonic Th1 and Th17 cells in a dose-dependent manner. In contrast, we did not observe differences in lymphocyte frequency or soluble factor production in the lung of EtOH-consuming animals. To uncover mechanisms underlying reduced growth factor and Th1/Th17 cytokine production, we compared expression levels of microRNAs in PBMC and intestinal mucosa. Our analysis revealed EtOH-dependent up-regulation of distinct microRNAs in affected tissues (miR-181a and miR-221 in PBMC; miR-155 in colon). Moreover, we were able to detect reduced expression of the transcription factors STAT3 and ARNT, which regulate expression of VEGF, G-CSF, and HGF and contain targets for these microRNAs. To confirm and extend these observations, PBMC were transfected with either mimics or antagomirs of miR-181 and miR-221, and protein levels of the transcription factors and growth factors were determined. Transfection of microRNA mimics led to a reduction in both STAT3/ARNT as well as VEGF/HGF/G-CSF levels. The opposite outcome was observed when microRNA antagomirs were transfected. Chronic EtOH consumption significantly disrupts both peripheral and mucosal immune homeostasis, and this dysregulation may be
Mesenchyme-derived factors enhance preneoplastic growth by non-genotoxic carcinogens in rat liver.
Nejabat, Marzieh; Riegler, Teresa; Reitinger, Tabea; Subosits, Sandra; Römer, Michael; Eichner, Johannes; Bilban, Martin; Zell, Andreas; Huber, Wolfgang W; Schulte-Hermann, Rolf; Grasl-Kraupp, Bettina
2018-02-01
Many frequently prescribed drugs are non-genotoxic carcinogens (NGC) in rodent liver. Their mode of action and health risks for humans remain to be elucidated. Here, we investigated the impact of two model NGC, the anti-epileptic drug phenobarbital (PB) and the contraceptive cyproterone acetate (CPA), on intrahepatic epithelial-mesenchymal crosstalk and on growth of first stages of hepatocarcinogenesis. Unaltered hepatocytes (HC) and preneoplastic HC (HC PREN ) were isolated from rat liver for primary culture. DNA replication of HC and HC PREN was increased by in vitro treatment with 10 µM CPA, but not 1 mM PB. Next, mesenchymal cells (MC) obtained from liver of rats treated with either PB (50 mg/kg bw/day) or CPA (100 mg/kg bw/day), were cultured. Supernatants from both types of MC raised DNA synthesis of HC and HC PREN . This indicates that PB induces replication of HC and HC PREN only indirectly, via growth factors secreted by MC. CPA, however, acts on HC and HC PREN directly as well as indirectly via mesenchymal factors. Transcriptomics and bio-informatics revealed that PB and CPA induce extensive changes in the expression profile of MC affecting many growth factors and pathways. MC from PB-treated rats produced and secreted enhanced levels of HBEGF and GDF15, factors found to suppress apoptosis and/or induce DNA synthesis in cultured HC and HC PREN . MC from CPA-treated animals showed enhanced expression and secretion of HGF, which strongly raised DNA replication of HC and HC PREN . In conclusion, our findings reveal profound effects of two prototypical NGC on the hepatic mesenchyme. The resulting release of factors, which suppress apoptosis and/or enhance cell replication preferentially in cancer prestages, appears to be crucial for tumor promotion by NGC in the liver.
Lim, Jung Hwa; Jung, Cho-Rok; Lee, Chan-Hee; Im, Dong-Soo
2008-11-01
E2-EPF ubiquitin carrier protein (UCP) has been shown to be highly expressed in common human cancers and target von Hippel-Lindau (VHL) for proteosomal degradation in cells, thereby stabilizing hypoxia-inducible factor (HIF)-1alpha. Here, we investigated cellular factors that regulate the expression of UCP gene. Promoter deletion assay identified binding sites for early growth response-1 (Egr-1) and serum response factor (SRF) in the UCP promoter. Hepatocyte or epidermal growth factor (EGF), or phorbol 12-myristate 13-acetate induced UCP expression following early induction of Egr-1 expression in HeLa cells. Serum increased mRNA and protein levels of SRF and UCP in the cell. By electrophoretic mobility shift and chromatin immunoprecipitation assays, sequence-specific DNA-binding of Egr-1 and SRF to the UCP promoter was detected in nuclear extracts from HeLa cells treated with EGF and serum, respectively. Overexpression of Egr-1 or SRF increased UCP expression. RNA interference-mediated depletion of endogenous Egr-1 or SRF impaired EGF- or serum-mediated induction of UCP expression, which was required for cancer cell proliferation. Systemic delivery of EGF into mice also increased UCP expression following early induction of Egr-1 expression in mouse liver. The induced UCP expression by the growth factors or serum increased HIF-1alpha protein level under non-hypoxic conditions, suggesting that the Egr-1/SRF-UCP-VHL pathway is in part responsible for the increased HIF-1alpha protein level in vitro and in vivo. Thus, growth factors and serum induce expression of Egr-1 and SRF, respectively, which in turn induces UCP expression that positively regulates cancer cell growth.
Epigallocatechin-3-gallate ameliorates insulin resistance in hepatocytes.
Ma, Shan-Bo; Zhang, Rui; Miao, Shan; Gao, Bin; Lu, Yang; Hui, Sen; Li, Long; Shi, Xiao-Peng; Wen, Ai-Dong
2017-06-01
Hyperglycemia is a typical pathogenic factor in a series of complications among patients with type II diabetes. Epigallocatechin-3-gallate (EGCG) is the major polyphenol extracted from green tea and is reported to be an antioxidant. The aim of the present study was to examine the effect of EGCG on insulin resistance in human HepG2 cells pretreated with high concentrations of glucose. The protein kinase B (AKT)/glycogen synthase kinase (GSK) pathways were analyzed using western blot analysis in HepG2 cells and primary mouse hepatocytes treated with high glucose and/or EGCG. Cellular glycogen content was determined using a glycogen assay kit. Reactive oxygen species (ROS) production was determined using dihydroethidium staining and flow cytometry. c‑JUN N‑terminal kinase (JNK)/insulin receptor substrate 1 (IRS1)/AKT/GSK signaling was explored using western blot analysis in HepG2 cells treated with high glucose and/or EGCG or N-acetyl-cysteine. High glucose significantly decreased the levels of phosphorylated AKT and GSK in HepG2 cells and mouse primary hepatocytes. Pretreatment with EGCG significantly restored the activation of AKT and GSK in HepG2 cells and primary hepatocytes exposed to high glucose. In HepG2 cells and primary hepatocytes, glycogen synthesis was improved by EGCG treatment in a dose‑dependent manner. High glucose significantly stimulated the production of ROS while EGCG protected high glucose‑induced ROS production. ROS is known to serve a major role in high glucose induced‑insulin resistance by increasing JNK and IRS1 serine phosphorylation. In the present study, EGCG was observed to enhance the insulin‑signaling pathway. EGCG ameliorated high glucose‑induced insulin resistance in the hepatocytes by potentially decreasing ROS‑induced JNK/IRS1/AKT/GSK signaling.
Energy determinants GAPDH and NDPK act as genetic modifiers for hepatocyte inclusion formation
Weerasinghe, Sujith V.W.; Singla, Amika; Leonard, Jessica M.; Hanada, Shinichiro; Andrews, Philip C.; Lok, Anna S.; Omary, M. Bishr
2011-01-01
Genetic factors impact liver injury susceptibility and disease progression. Prominent histological features of some chronic human liver diseases are hepatocyte ballooning and Mallory-Denk bodies. In mice, these features are induced by 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) in a strain-dependent manner, with the C57BL and C3H strains showing high and low susceptibility, respectively. To identify modifiers of DDC-induced liver injury, we compared C57BL and C3H mice using proteomic, biochemical, and cell biological tools. DDC elevated reactive oxygen species (ROS) and oxidative stress enzymes preferentially in C57BL livers and isolated hepatocytes. C57BL livers and hepatocytes also manifested significant down-regulation, aggregation, and nuclear translocation of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). GAPDH knockdown depleted bioenergetic and antioxidant enzymes and elevated hepatocyte ROS, whereas GAPDH overexpression decreased hepatocyte ROS. On the other hand, C3H livers had higher expression and activity of the energy-generating nucleoside-diphosphate kinase (NDPK), and knockdown of hepatocyte NDPK augmented DDC-induced ROS formation. Consistent with these findings, cirrhotic, but not normal, human livers contained GAPDH aggregates and NDPK complexes. We propose that GAPDH and NDPK are genetic modifiers of murine DDC-induced liver injury and potentially human liver disease. PMID:22006949
Lipopolysaccharide Stimulates p62-Dependent Autophagy-Like Aggregate Clearance in Hepatocytes
Deng, Meihong; Sun, Qian; Loughran, Patricia; Billiar, Timothy R.; Scott, Melanie J.
2014-01-01
Impairment of autophagy has been associated with liver injury. TLR4-stimulation by LPS upregulates autophagy in hepatocytes, although the signaling pathways involved remain elusive. The objective of this study was to determine the signaling pathway leading to LPS-stimulated autophagy in hepatocytes. Cell lysates from livers of wild type (WT; C57BL/6) mice given LPS (5 mg/kg-IP) and hepatocytes from WT, TLR4ko, and MyD88ko mice treated with LPS (100 ng/mL) up to 24 h were collected. LC3II, p62/SQSTM1, Nrf2, and beclin1 levels were determined by immunoblot, immunofluorescence, and qPCR. Autophagy-like activation was measured by GFP-LC3-puncta formation and LC3II-expression. Beclin1, Nrf2, p62, MyD88, and TIRAP were knocked-down using siRNA. LC3II-expression increased in both liver and hepatocytes after LPS and was dependent on TLR4. Beclin1 expression did not increase after LPS in hepatocytes and beclin1-knockdown did not affect LC3II levels. In hepatocytes given LPS, expression of p62 increased and p62 colocalized with LC3. p62-knockdown prevented LC3II puncta formation. LPS-induced LC3II/p62-puncta also required MyD88/TIRAP signaling and localization of both Nrf2 and NFκB transcription factors to the nucleus to upregulate p62-expression. Therefore, TLR4-activation by LPS in hepatocytes induces a p62-mediated, not beclin1-mediated, autophagy-like clearance pathway that is hepatoprotective by clearing aggregate-prone or misfolded proteins from the cytosol and preserving energy homeostasis under stress. PMID:24683544
Lipopolysaccharide stimulates p62-dependent autophagy-like aggregate clearance in hepatocytes.
Chen, Christine; Deng, Meihong; Sun, Qian; Loughran, Patricia; Billiar, Timothy R; Scott, Melanie J
2014-01-01
Impairment of autophagy has been associated with liver injury. TLR4-stimulation by LPS upregulates autophagy in hepatocytes, although the signaling pathways involved remain elusive. The objective of this study was to determine the signaling pathway leading to LPS-stimulated autophagy in hepatocytes. Cell lysates from livers of wild type (WT; C57BL/6) mice given LPS (5 mg/kg-IP) and hepatocytes from WT, TLR4ko, and MyD88ko mice treated with LPS (100 ng/mL) up to 24 h were collected. LC3II, p62/SQSTM1, Nrf2, and beclin1 levels were determined by immunoblot, immunofluorescence, and qPCR. Autophagy-like activation was measured by GFP-LC3-puncta formation and LC3II-expression. Beclin1, Nrf2, p62, MyD88, and TIRAP were knocked-down using siRNA. LC3II-expression increased in both liver and hepatocytes after LPS and was dependent on TLR4. Beclin1 expression did not increase after LPS in hepatocytes and beclin1-knockdown did not affect LC3II levels. In hepatocytes given LPS, expression of p62 increased and p62 colocalized with LC3. p62-knockdown prevented LC3II puncta formation. LPS-induced LC3II/p62-puncta also required MyD88/TIRAP signaling and localization of both Nrf2 and NF κ B transcription factors to the nucleus to upregulate p62-expression. Therefore, TLR4-activation by LPS in hepatocytes induces a p62-mediated, not beclin1-mediated, autophagy-like clearance pathway that is hepatoprotective by clearing aggregate-prone or misfolded proteins from the cytosol and preserving energy homeostasis under stress.
Hepatocyte nuclear factor-4alpha is a central transactivator of the mouse Ntcp gene.
Geier, Andreas; Martin, Ina V; Dietrich, Christoph G; Balasubramaniyan, Natarajan; Strauch, Sonja; Suchy, Frederick J; Gartung, Carsten; Trautwein, Christian; Ananthanarayanan, Meenakshisundaram
2008-08-01
Sodium taurocholate cotransporting polypeptide (Ntcp) is the major uptake system for conjugated bile acids. Deletions of hepatocyte nuclear factor (HNF)-1alpha and retinoid X receptor-alpha:retinoic acid receptor-alpha binding sites in the mouse 5'-flanking region corresponding to putatively central regulatory elements of rat Ntcp do not significantly reduce promoter activity. We hypothesized that HNF-4alpha, which is increasingly recognized as a central regulator of hepatocyte function, may directly transactivate mouse (mNtcp). A 1.1-kb 5'-upstream region including the mouse Ntcp promoter was cloned and compared with the rat promoter. In contrast to a moderate 3.5-fold activation of mNtcp by HNF-1alpha, HNF-4alpha cotransfection led to a robust 20-fold activation. Deletion analysis of mouse and rat Ntcp promoters mapped a conserved HNF-4alpha consensus site at -345/-326 and -335/-316 bp, respectively. p-475bpmNtcpLUC is not transactivated by HNF-1alpha but shows a 50-fold enhanced activity upon cotransfection with HNF-4alpha. Gel mobility shift assays demonstrated a complex of the HNF-4alpha-element formed with liver nuclear extracts that was blocked by an HNF-4alpha specific antibody. HNF-4alpha binding was confirmed by chromatin immunoprecipitation. Using Hepa 1-6 cells, HNF-4alpha-knockdown resulted in a significant 95% reduction in NTCP mRNA. In conclusion, mouse Ntcp is regulated by HNF-4alpha via a conserved distal cis-element independently of HNF-1alpha.
Chen, Xiaochuan; Rozance, Paul J; Hay, William W; Limesand, Sean W
2012-05-01
Placental insufficiency results in intrauterine growth restriction (IUGR), impaired fetal insulin secretion and less fetal pancreatic β-cell mass, partly due to lower β-cell proliferation rates. Insulin-like growth factors (IGFs) and fibroblast growth factors (FGFs) regulate fetal β-cell proliferation and pancreas development, along with transcription factors, such as pancreatic and duodenal homeobox 1 (PDX-1). We determined expression levels for these growth factors, their receptors and IGF binding proteins in ovine fetal pancreas and isolated islets. In the IUGR pancreas, relative mRNA expression levels of IGF-I, PDX-1, FGF7 and FGFR2IIIb were 64% (P < 0.01), 76% (P < 0.05), 76% (P < 0.05) and 52% (P < 0.01) lower, respectively, compared with control fetuses. Conversely, insulin-like growth factor binding protein 2 (IGFBP-2) mRNA and protein concentrations were 2.25- and 1.2-fold greater (P < 0.05) in the IUGR pancreas compared with controls. In isolated islets from IUGR fetuses, IGF-II and IGFBP-2 mRNA concentrations were 1.5- and 3.7-fold greater (P < 0.05), and insulin mRNA was 56% less (P < 0.05) than control islets. The growth factor expression profiles for IGF and FGF signaling pathways indicate that declines in β-cell mass are due to decreased growth factor signals for both pancreatic progenitor epithelial cell and mature β-cell replication.
Dong, Yewei; Wang, Shuqi; Chen, Junliang; Zhang, Qinghao; Liu, Yang; You, Cuihong; Monroig, Óscar; Tocher, Douglas R.; Li, Yuanyou
2016-01-01
Rabbitfish Siganus canaliculatus was the first marine teleost demonstrated to have the capability of biosynthesizing long-chain polyunsaturated fatty acids (LC-PUFA) from C18 precursors, and to possess a Δ4 fatty acyl desaturase (Δ4 Fad) which was the first report in vertebrates, and is a good model for studying the regulatory mechanisms of LC-PUFA biosynthesis in teleosts. In order to understand regulatory mechanisms of transcription of Δ4 Fad, the gene promoter was cloned and characterized in the present study. An upstream sequence of 1859 bp from the initiation codon ATG was cloned as the promoter candidate. On the basis of bioinformatic analysis, several binding sites of transcription factors (TF) including GATA binding protein 2 (GATA-2), CCAAT enhancer binding protein (C/EBP), nuclear factor 1 (NF-1), nuclear factor Y (NF-Y), hepatocyte nuclear factor 4α (HNF4α) and sterol regulatory element (SRE), were identified in the promoter by site-directed mutation and functional assays. HNF4α and NF-1 were confirmed to interact with the core promoter of Δ4 Fad by gel shift assay and mass spectrometry. Moreover, over-expression of HNF4α increased promoter activity in HEK 293T cells and mRNA level of Δ4 Fad in rabbitfish primary hepatocytes, respectively. The results indicated that HNF4α is a TF of rabbitfish Δ4 Fad. To our knowledge, this is the first report on promoter structure of a Δ4 Fad, and also the first demonstration of HNF4α as a TF of vertebrate Fad gene involved in transcription regulation of LC-PUFA biosynthesis. PMID:27472219
Rapid generation of functional hepatocyte-like cells from human adipose-derived stem cells.
Fu, Yanli; Deng, Jie; Jiang, Qingyuan; Wang, Yuan; Zhang, Yujing; Yao, Yunqi; Cheng, Fuyi; Chen, Xiaolei; Xu, Fen; Huang, Meijuan; Yang, Yang; Zhang, Shuang; Yu, Dechao; Zhao, Robert Chunhua; Wei, Yuquan; Deng, Hongxin
2016-08-05
Liver disease is a major cause of death worldwide. Orthotropic liver transplantation (OLT) represents the only effective treatment for patients with liver failure, but the increasing demand for organs is unfortunately so great that its application is limited. Hepatocyte transplantation is a promising alternative to OLT for the treatment of some liver-based metabolic disorders or acute liver failure. Unfortunately, the lack of donor livers also makes it difficult to obtain enough viable hepatocytes for hepatocyte-based therapies. Currently, a fundamental solution to this key problem is still lacking. Here we show a novel non-transgenic protocol that facilitates the rapid generation of functional induced hepatocytes (iHeps) from human adipose-derived stem cells (hADSCs), providing a source of available cells for autologous hepatocytes to treat liver disease. We used collagenase digestion to isolate hADSCs. The surface marker was detected by flow cytometry. The multipotential differentiation potency was detected by induction into adipocytes, osteocytes, and chondrocytes. Passage 3-7 hADSCs were induced into iHeps using an induction culture system composed of small molecule compounds and cell factors. Primary cultured hADSCs presented a fusiform or polygon appearance that became fibroblast-like after passage 3. More than 95 % of the cells expressed the mesenchymal cell markers CD29, CD44, CD166, CD105, and CD90. hADSCs possessed multipotential differentiation towards adipocytes, osteocytes, and chondrocytes. We rapidly induced hADSCs into iHeps within 10 days in vitro; the cellular morphology changed from fusiform to close-connected cubiform, which was similar to hepatocytes. After induction, most of the iHeps co-expressed albumin and alpha-1 antitrypsin; they also expressed mature hepatocyte special genes and achieved the basic functions of hepatocyte. Moreover, iHep transplantation could improve the liver function of acute liver-injured NPG mice and prolong life. We
Oxidative stress triggers cytokinesis failure in hepatocytes upon isolation.
Tormos, A M; Taléns-Visconti, R; Bonora-Centelles, A; Pérez, S; Sastre, J
2015-01-01
Primary hepatocytes are highly differentiated cells and proliferatively quiescent. However, the stress produced during liver digestion seems to activate cell cycle entry by proliferative/dedifferentiation programs that still remain unclear. The aim of this work was to assess whether the oxidative stress associated with hepatocyte isolation affects cell cycle and particularly cytokinesis, the final step of mitosis. Hepatocytes were isolated from C57BL/6 mice by collagenase perfusion in the absence and presence of N-acetyl cysteine (NAC). Polyploidy, cell cycle, and reactive oxygen species (ROS) were studied by flow cytometry (DNA, phospho-histone 3, and CellROX(®) Deep Red) and Western blotting (cyclins B1 and D1, and proliferating cell nuclear antigen). mRNA expression of cyclins A1, B1, B2, D1, and F by reverse transcription (RT)-PCR was also assessed. Glutathione levels were measured by mass spectrometry. Here we show that hepatocyte isolation enhanced cell cycle entry, increased hepatocyte binucleation, and caused marked glutathione oxidation. Addition of 5 mM NAC to the hepatocyte isolation media prevented glutathione depletion, partially blocked ROS production and cell cycle entry of hepatocytes, and avoided the blockade of mitosis progression, abrogating defective cytokinesis and diminishing the formation of binucleated hepatocytes during isolation. Therefore, addition of NAC to the isolation media decreased the generation of polyploid hepatocytes confirming that oxidative stress occurs during hepatocyte isolation and it is responsible, at least in part, for cytokinesis failure and hepatocyte binucleation.
Janani, G; Nandi, Samit K; Mandal, Biman B
2018-02-01
The creation of in vitro functional hepatic tissue simulating micro-environmental niche of native liver is a keen area of research due to its demand in bioartificial liver (BAL) and cell-based tissue engineering. Here, we investigated the potential of novel blend (BA) silk scaffold fabricated by blending mulberry (Bombyx mori, BM) silk fibroin with cell adhesion motif (RGD) rich non-mulberry (Antheraea assamensis, AA) silk fibroin, in generating a functional liver construct. Three-dimensional (3D) porous silk scaffolds (BM, AA and BA) were physico-chemically characterized and functionally evaluated using human hepatocarcinoma cells (HepG2) and primary neonatal rat hepatocytes. The growth and distribution of hepatocytes within the scaffolds were tracked by FESEM, alamar blue proliferation assay and live/dead staining. Hemocompatible BA scaffolds supported the formation of high density hepatocyte clusters, facilitating cell-matrix and cell-cell interactions. Blend scaffolds evinced enhanced liver-specific functions of cultured hepatocytes in terms of albumin synthesis, urea synthesis and cytochrome P450 enzyme activity over 21 days. Subcutaneous implantation of scaffolds demonstrated minimal macrophage infiltration in blend scaffolds. These findings substantiate that the integral property of blend (BA) scaffold offers a befitting environment by influencing spheroidal growth of hepatocytes with enhanced biological activity. Collectively, the present study provides a new 3D bio-matrix niche for growing functional liver cells that would have future prospects in BAL as well as regenerative medicine. An end stage liver disease called cirrhosis perturbs the self-healing ability and physiological functions of liver. Due to the scarcity of healthy donors, a functional in vitro hepatic construct retaining the liver-specific functions is in great demand for its prospects in bioartificial liver (BAL) and cell-based tissue engineering. Physicochemical attributes of a matrix
Scheving, Lawrence A; Zhang, Xiuqi; Garcia, Oscar A; Wang, Rebecca F; Stevenson, Mary C; Threadgill, David W; Russell, William E
2014-03-01
Dsk5 mice have a gain of function in the epidermal growth factor receptor (EGFR), caused by a point mutation in the kinase domain. We analyzed the effect of this mutation on liver size, histology, and composition. We found that the livers of 12-wk-old male Dsk5 heterozygotes (+/Dsk5) were 62% heavier compared with those of wild-type controls (+/+). The livers of the +/Dsk5 mice compared with +/+ mice had larger hepatocytes with prominent, polyploid nuclei and showed modestly increased cell proliferation indices in both hepatocytes and nonparenchymal cells. An analysis of total protein, DNA, and RNA (expressed relative to liver weight) revealed no differences between the mutant and wild-type mice. However, the livers of the +/Dsk5 mice had more cholesterol but less phospholipid and fatty acid. Circulating cholesterol levels were twice as high in adult male +/Dsk5 mice but not in postweaned young male or female mice. The elevated total plasma cholesterol resulted mainly from an increase in low-density lipoprotein (LDL). The +/Dsk5 adult mouse liver expressed markedly reduced protein levels of LDL receptor, no change in proprotein convertase subtilisin/kexin type 9, and a markedly increased fatty acid synthase and 3-hydroxy-3-methyl-glutaryl-CoA reductase. Increased expression of transcription factors associated with enhanced cholesterol synthesis was also observed. Together, these findings suggest that the EGFR may play a regulatory role in hepatocyte proliferation and lipid metabolism in adult male mice, explaining why elevated levels of EGF or EGF-like peptides have been positively correlated to increased cholesterol levels in human studies.
Yan, Zhaoyong; Qu, Kai; Zhang, Jing; Huang, Qichao; Qu, Ping; Xu, Xinsen; Yuan, Peng; Huang, Xiaojun; Shao, Yongping; Liu, Chang; Zhang, Hongxin; Xing, Jinliang
2015-10-01
Although previous evidence indicates close involvement of CD147 in the pathogenesis of liver fibrosis, the underlying molecular mechanisms and its therapeutic value remain largely unknown. In the present study, we investigated the biological roles of CD147 in liver fibrosis and assessed its therapeutic value as a target molecule in the CCl4-induced liver fibrosis mouse model. We found that CD147 was highly expressed in both hepatocytes and SECs (sinusoidal endothelial cells) in fibrotic liver tissues. Additionally, it was significantly associated with the fibrosis stage. TGF-β1 (transforming growth factor β1) was found to be mainly responsible for the up-regulation of CD147. Bioinformatic and experimental data suggest a functional link between CD147 expression and VEGF-A (vascular endothelial growth factor A)/VEGR-2 (VEGF receptor 2) signalling-mediated angiogenesis in fibrotic liver tissues. Furthermore, we observed that the CD147-induced activation of the PI3K (phosphoinositide 3-kinase)/Akt signalling pathway promotes the production of VEGF-A in hepatocytes and expression of VEGFR-2 in SECs, which was found to enhance the angiogenic capability of SECs. Finally, our data indicate that blocking of CD147 using an mAb (monoclonal antibody) attenuated liver fibrosis progression via inhibition of VEGF-A/VEGFR-2 signalling and subsequent amelioration of microvascular abnormality in the CCl4-induced mouse model. Our findings suggest a novel functional mechanism that CD147 may promote liver fibrosis progression via inducing the VEGF-A/VEGFR-2 signalling pathway-mediated cross-talk between hepatocytes and SECs. New strategies based on the intervention of CD147 can be expected for prevention of liver fibrosis. © 2015 Authors; published by Portland Press Limited.
Hirata, Marina; Ishigami, Masatoshi; Matsushita, Yoshihiro; Ito, Takanori; Hattori, Hisashi; Hibi, Hideharu; Goto, Hidemi; Ueda, Minoru; Yamamoto, Akihito
2016-10-01
: Chronic liver injury from various causes often results in liver fibrosis (LF). Although the liver possesses endogenous tissue-repairing activities, these can be overcome by sustained inflammation and excessive fibrotic scar formation. Advanced LF leads to irreversible cirrhosis and subsequent liver failure and/or hepatic cancer. Here, using the mouse carbon tetrachloride (CCl 4 )-induced LF model, we showed that a single intravenous administration of stem cells derived from human exfoliated deciduous teeth (SHEDs) or of SHED-derived serum-free conditioned medium (SHED-CM) resulted in fibrotic scar resolution. SHED-CM suppressed the gene expression of proinflammatory mediators, such as TNF-α, IL-1β, and iNOS, and eliminated activated hepatic stellate cells by inducing their apoptosis, but protected parenchymal hepatocytes from undergoing apoptosis. In addition, SHED-CM induced tissue-repairing macrophages that expressed high levels of the profibrinolytic factor, matrix metalloproteinase 13. Furthermore, SHED-CM suppressed the CCl 4 -induced apoptosis of primary cultured hepatocytes. SHED-CM contained a high level of hepatocyte growth factor (HGF). Notably, HGF-depleted SHED-CM (dHGF-CM) did not suppress the proinflammatory response or resolve fibrotic scarring. Furthermore, SHED-CM, but not dHGF-CM, inhibited CCl 4 -induced hepatocyte apoptosis. These results suggest that HGF plays a central role in the SHED-CM-mediated resolution of LF. Taken together, our findings suggest that SHED-CM provides multifaceted therapeutic benefits for the treatment of LF. This study demonstrated that a single intravenous administration of stem cells from human exfoliated deciduous teeth (SHEDs) or of the serum-free conditioned medium (CM) derived from SHEDs markedly improved mouse liver fibrosis (LF). SHED-CM suppressed chronic inflammation, eliminated activated hepatic stellate cells by inducing their apoptosis, protected hepatocytes from undergoing apoptosis, and induced
Methamphetamine enhances Hepatitis C virus replication in human hepatocytes
Ye, L.; Peng, J. S.; Wang, X.; Wang, Y. J.; Luo, G. X.; Ho, W. Z.
2009-01-01
SUMMARY Very little is known about the interactions between hepatitis C virus (HCV) and methamphetamine, which is a highly abused psychostimulant and a known risk factor for human immunodeficiency virus (HIV)/HCV infection. This study examined whether methamphetamine has the ability to inhibit innate immunity in the host cells, facilitating HCV replication in human hepatocytes. Methamphetamine inhibited intracellular interferon alpha expression in human hepatocytes, which was associated with the increase in HCV replication. In addition, methamphetamine also compromised the anti-HCV effect of recombinant interferon alpha. Further investigation of mechanism(s) responsible for the methamphetamine action revealed that methamphetamine was able to inhibit the expression of the signal transducer and activator of transcription 1, a key modulator in interferon-mediated immune and biological responses. Methamphetamine also down-regulated the expression of interferon regulatory factor-5, a crucial transcriptional factor that activates the interferon pathway. These in vitro findings that methamphetamine compromises interferon alpha-mediated innate immunity against HCV infection indicate that methamphetamine may have a cofactor role in the immunopathogenesis of HCV disease. PMID:18307590
Kroy, Daniela C; Schumacher, Fabienne; Ramadori, Pierluigi; Hatting, Maximilian; Bergheim, Ina; Gassler, Nikolaus; Boekschoten, Mark V; Müller, Michael; Streetz, Konrad L; Trautwein, Christian
2014-10-01
Non-alcoholic-fatty-liver disease (NAFLD) is part of the metabolic syndrome. The spectrum of NAFLD includes NASH (non-alcoholic steatohepatitis), which is characterised by progressive inflammation associated with oxidative stress and apoptosis, finally triggering liver cirrhosis and hepatocellular carcinoma. HGF (hepatocyte growth factor)/mesenchymal-epithelial transition factor (c-Met) receptor signalling is known to activate distinct intracellular pathways mediating among others anti-apoptotic properties to hepatocytes. Therefore, the aim was to characterise the role of c-Met during NASH development. Hepatocyte specific c-Met knockout mice (c-MetΔ(hepa)) using the cre-loxP system and wild type controls (c-Met(loxP/loxP)) were fed a methionine-choline deficient (MCD) diet. MCD feeding triggered massive steatosis, decreased survival and higher transaminases in c-MetΔ(hepa) livers compared to c-Met(loxP/loxP). Gene array analysis demonstrated that genes involved in fatty acid metabolism were strongly upregulated in c-MetΔ(hepa) livers correlating with higher amounts of hepatic free fatty acids. Consequently, c-MetΔ(hepa) mice showed significantly more TUNEL positive cells and more superoxide anion production than c-Met(loxPloxP) animals. Additionally, c-MetΔ(hepa) livers showed significantly larger fractions of infiltrating neutrophils, macrophages, and cytotoxic T cells. These changes correlated with an enhanced progression of liver fibrosis as evidenced by higher collagen deposition in c-MetΔ(hepa) livers. As increased apoptosis was a prominent feature in c-MetΔ(hepa) livers, we generated c-Met/Casp8Δ(hepa) double knockout mice. In these animals compared to c-MetΔ(hepa) animals the increase in apoptosis could be reverted. c-Met deletion in hepatocytes triggers NASH progression. A prominent mechanism is higher fatty acid accumulation and increased apoptosis, which in part can be reverted by blocking caspase 8. Copyright © 2014 European Association for the
Murata, Miki; Matsuzaki, Koichi; Yoshida, Katsunori; Sekimoto, Go; Tahashi, Yoshiya; Mori, Shigeo; Uemura, Yoshiko; Sakaida, Noriko; Fujisawa, Junichi; Seki, Toshihito; Kobayashi, Kazuki; Yokote, Koutaro; Koike, Kazuhiko; Okazaki, Kazuichi
2009-04-01
Hepatitis B virus X (HBx) protein is suspected to participate in oncogenesis during chronic hepatitis B progression. Transforming growth factor beta (TGF-beta) signaling involves both tumor suppression and oncogenesis. TGF-beta activates TGF-beta type I receptor (TbetaRI) and c-Jun N-terminal kinase (JNK), which differentially phosphorylate the mediator Smad3 to become C-terminally phosphorylated Smad3 (pSmad3C) and linker-phosphorylated Smad3 (pSmad3L). Reversible shifting of Smad3-mediated signaling between tumor suppression and oncogenesis in HBx-expressing hepatocytes indicated that TbetaRI-dependent pSmad3C transmitted a tumor-suppressive TGF-beta signal, while JNK-dependent pSmad3L promoted cell growth. We used immunostaining, immunoblotting, and in vitro kinase assay to compare pSmad3L- and pSmad3C-mediated signaling in biopsy specimens representing chronic hepatitis, cirrhosis, or hepatocellular carcinoma (HCC) from 90 patients chronically infected with hepatitis B virus (HBV) with signaling in liver specimens from HBx transgenic mice. In proportion to plasma HBV DNA levels, early chronic hepatitis B specimens showed prominence of pSmad3L in hepatocytic nuclei. HBx-activated JNK/pSmad3L/c-Myc oncogenic pathway was enhanced, while the TbetaRI/pSmad3C/p21(WAF1) tumor-suppressive pathway was impaired as human and mouse HBx-associated hepatocarcinogenesis progressed. Of 28 patients with chronic hepatitis B who showed strong oncogenic pSmad3L signaling, six developed HCC within 12 years; only one of 32 patients showing little pSmad3L developed HCC. In contrast, seven of 30 patients with little Smad3C phosphorylation developed HCC, while no patient who retained hepatocytic tumor-suppressive pSmad3C developed HCC within 12 years. HBx shifts hepatocytic TGF-beta signaling from the tumor-suppressive pSmad3C pathway to the oncogenic pSmad3L pathway in early carcinogenic process. Hepatocytic pSmad3L and pSmad3C assessment in HBV-infected liver specimens should prove
Cao, Yu; Liu, Zhenhai; Xie, Yilin; Hu, Jingchao; Wang, Hua; Fan, Zhipeng; Zhang, Chunmei; Wang, Jingsong; Wu, Chu-Tse; Wang, Songlin
2015-12-15
Periodontitis is one of the most widespread infectious diseases in humans. We previously promoted significant periodontal tissue regeneration in swine models with the transplantation of autologous periodontal ligament stem cells (PDLSCs) and PDLSC sheet. We also promoted periodontal tissue regeneration in a rat model with a local injection of allogeneic bone marrow mesenchymal stem cells. The purpose of the present study is to investigate the roles of the hepatocyte growth factor (HGF) and human dental pulp stem cells (DPSCs) in periodontal tissue regeneration in swine. In the present study, we transferred an adenovirus that carried HGF gene into human DPSCs (HGF-hDPSCs) under good manufacturing practice (GMP) conditions. These cells were then transplanted into a swine model for periodontal regeneration. Twenty miniature pigs were used to generate periodontitis with bone defect of 5 mm in width, 7 mm in length, and 3 mm in depth. After 12 weeks, clinical, radiological, quantitative and histological assessment of regenerated periodontal tissues was performed to compare periodontal regeneration in swine treated with cell implantation. Our study showed that injecting HGF-hDPSCs into this large animal model could significantly improve periodontal bone regeneration and soft tissue healing. A hDPSC or HGF-hDPSC sheet showed superior periodontal tissue regeneration compared to the injection of dissociated cells. However, the sheets required surgical placement; thus, they were suitable for surgically-managed periodontitis treatments. The adenovirus-mediated transfer of the HGF gene markedly decreased hDPSC apoptosis in a hypoxic environment or in serum-free medium, and it increased blood vessel regeneration. This study indicated that HGF-hDPSCs produced under GMP conditions significantly improved periodontal bone regeneration in swine; thus, this method represents a potential clinical application for periodontal regeneration.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buckley, A.R.; Buckley, D.J.
1991-01-01
The trophic effects of prolactin (PRL) in rat liver have been linked to activation of protein kinase C (PKC). Since alterations in PKC activity imply its activation by 1,2-diacylglycerol (DAG), we tested whether PRL treatment stimulated DAG generation coupled to induction of a growth response in primary hepatocytes. Addition of PRL to hepatocyte cultures significantly increased ({sup 3}H)-glycerol incorporation into DAG within 5 minutes which was followed by a loss of cytosolic PKC activity by 10 minutes. Prolactin also significantly enhanced radiolabel incorporation into triacylglycerol and phospholipids within 10 minutes and induced ODC activity at 6 hours. Therefore, prolactin-stimulated alterationsmore » in PKC activity are preceded by enhanced DAG generation. Moreover, these events appear to be coupled to PRL-stimulated entry of hepatocytes into cell cycle.« less
Terada, Maiko; Horisawa, Kenichi; Miura, Shizuka; Takashima, Yasuo; Ohkawa, Yasuyuki; Sekiya, Sayaka; Matsuda-Ito, Kanae; Suzuki, Atsushi
2016-01-01
Intrahepatic cholangiocarcinoma (ICC) is a malignant epithelial neoplasm composed of cells resembling cholangiocytes that line the intrahepatic bile ducts in portal areas of the hepatic lobule. Although ICC has been defined as a tumor arising from cholangiocyte transformation, recent evidence from genetic lineage-tracing experiments has indicated that hepatocytes can be a cellular origin of ICC by directly changing their fate to that of biliary lineage cells. Notch signaling has been identified as an essential factor for hepatocyte conversion into biliary lineage cells at the onset of ICC. However, the mechanisms underlying Notch signal activation in hepatocytes remain unclear. Here, using a mouse model of ICC, we found that hepatic macrophages called Kupffer cells transiently congregate around the central veins in the liver and express the Notch ligand Jagged-1 coincident with Notch activation in pericentral hepatocytes. Depletion of Kupffer cells prevents the Notch-mediated cell-fate conversion of hepatocytes to biliary lineage cells, inducing hepatocyte apoptosis and increasing mortality in mice. These findings will be useful for uncovering the pathogenic mechanism of ICC and developing prevenient and therapeutic strategies for this refractory disease. PMID:27698452
Generation of functional hepatocytes from human spermatogonial stem cells.
Chen, Zheng; Sun, Min; Yuan, Qingqing; Niu, Minghui; Yao, Chencheng; Hou, Jingmei; Wang, Hong; Wen, Liping; Liu, Yun; Li, Zheng; He, Zuping
2016-02-23
To generate functional human hepatocytes from stem cells and/or extra-hepatic tissues could provide an important source of cells for treating liver diseases. Spermatogonial stem cells (SSCs) have an unlimited plasticity since they can dedifferentiate and transdifferentiate to other cell lineages. However, generation of mature and functional hepatocytes from human SSCs has not yet been achieved. Here we have for the first time reported direct transdifferentiation of human SSCs to mature and functional hepatocytes by three-step induction using the defined condition medium. Human SSCs were first transdifferentiated to hepatic stem cells, as evidenced by their morphology and biopotential nature of co-expressing hepatocyte and cholangiocyte markers but not hallmarks for embryonic stem cells. Hepatic stem cells were further induced to differentiate into mature hepatocytes identified by their morphological traits and strong expression of CK8, CK18, ALB, AAT, TF, TAT, and cytochrome enzymes rather than CK7 or CK19. Significantly, mature hepatocytes derived from human SSCs assumed functional attributes of human hepatocytes, because they could produce albumin, remove ammonia, and uptake and release indocyanine green. Moreover, expression of β-CATENIN, HNF4A, FOXA1 and GATA4 was upregulated during the transdifferentiation of human SSCs to mature hepatocytes. Collectively, human SSCs could directly transdifferentiate to mature and functional hepatocytes. This study could offer an invaluable source of human hepatocytes for curing liver disorders and drug toxicology screening and provide novel insights into mechanisms underlying human liver regeneration.
Generation of functional hepatocytes from human spermatogonial stem cells
Chen, Zheng; Sun, Min; Yuan, Qingqing; Niu, Minghui; Yao, Chencheng; Hou, Jingmei; Wang, Hong; Wen, Liping; Liu, Yun; Li, Zheng; He, Zuping
2016-01-01
To generate functional human hepatocytes from stem cells and/or extra-hepatic tissues could provide an important source of cells for treating liver diseases. Spermatogonial stem cells (SSCs) have an unlimited plasticity since they can dedifferentiate and transdifferentiate to other cell lineages. However, generation of mature and functional hepatocytes from human SSCs has not yet been achieved. Here we have for the first time reported direct transdifferentiation of human SSCs to mature and functional hepatocytes by three-step induction using the defined condition medium. Human SSCs were first transdifferentiated to hepatic stem cells, as evidenced by their morphology and biopotential nature of co-expressing hepatocyte and cholangiocyte markers but not hallmarks for embryonic stem cells. Hepatic stem cells were further induced to differentiate into mature hepatocytes identified by their morphological traits and strong expression of CK8, CK18, ALB, AAT, TF, TAT, and cytochrome enzymes rather than CK7 or CK19. Significantly, mature hepatocytes derived from human SSCs assumed functional attributes of human hepatocytes, because they could produce albumin, remove ammonia, and uptake and release indocyanine green. Moreover, expression of β-CATENIN, HNF4A, FOXA1 and GATA4 was upregulated during the transdifferentiation of human SSCs to mature hepatocytes. Collectively, human SSCs could directly transdifferentiate to mature and functional hepatocytes. This study could offer an invaluable source of human hepatocytes for curing liver disorders and drug toxicology screening and provide novel insights into mechanisms underlying human liver regeneration. PMID:26840458
Mu, Xueru; Pradere, Jean-Philippe; Affò, Silvia; Dapito, Dianne H; Friedman, Richard; Lefkovitch, Jay H; Schwabe, Robert F
2016-03-01
Transforming growth factor-β (TGFβ) exerts key functions in fibrogenic cells, promoting fibrosis development in the liver and other organs. In contrast, the functions of TGFβ in liver epithelial cells are not well understood, despite their high level of responsiveness to TGFβ. We sought to determine the contribution of epithelial TGFβ signaling to hepatic fibrogenesis and carcinogenesis. TGFβ signaling in liver epithelial cells was inhibited by albumin-Cre-, K19-CreERT-, Prom1-CreERT2-, or AAV8-TBG-Cre-mediated deletion of the floxed TGFβ receptor II gene (Tgfbr2). Liver fibrosis was induced by carbon tetrachloride, bile duct ligation, or disruption of the multidrug-resistance transporter 2 gene (Mdr2). Hepatocarcinogenesis was induced by diethylnitrosamine or hepatic deletion of PTEN. Deletion of Tgfbr2 from liver epithelial cells did not alter liver injury, toxin-induced or biliary fibrosis, or diethylnitrosamine-induced hepatocarcinogenesis. In contrast, epithelial deletion of Tgfbr2 promoted tumorigenesis and reduced survival of mice with concomitant hepatic deletion of Pten, accompanied by an increase in tumor number and a shift from hepatocellular carcinoma to cholangiocarcinoma. Surprisingly, both hepatocyte- and cholangiocyte-specific deletion of Pten and Tgfbr2 promoted the development of cholangiocarcinoma, but with different latencies. The prolonged latency and the presence of hepatocyte-derived cholangiocytes after AAV8-TBG-Cre-mediated deletion of Tgfbr2 and Pten indicated that cholangiocarcinoma might arise from hepatocyte-derived cholangiocytes in this model. Pten deletion resulted in up-regulation of Tgfbr2, and deletion of Tgfbr2 increased cholangiocyte but not hepatocyte proliferation, indicating that the main function of epithelial TGFBR2 is to restrict cholangiocyte proliferation. Epithelial TGFβ signaling does not contribute to the development of liver fibrosis or formation of hepatocellular carcinomas in mice, but restricts
Tutau, Federico; Rodríguez-Ortigosa, Carlos; Puche, Juan Enrique; Juanarena, Nerea; Monreal, Iñigo; García Fernández, María; Clavijo, Encarna; Castilla, Alberto; Castilla-Cortázar, Inma
2009-01-01
Cirrhosis is a diffuse process of hepatic fibrosis and regenerative nodule formation. The liver is the major source of circulating insulin-like growth factor-I (IGF-I) whose plasma levels are diminished in cirrhosis. IGF-I supplementation has been shown to induce beneficial effects in cirrhosis, including antifibrogenic and hepatoprotective effects. On other hand, interferon-alpha (IFN-alpha) therapy seems to suppress the progression of hepatic fibrosis. The aim of this study was to investigate the effect of the co-administration of IGF-I+IFN-alpha to Wistar rats with CCl(4)-induced cirrhosis, exploring liver function tests, hepatic lipid peroxidation and histopathology. The mechanisms underlying the effects of these agents were studied by reverse transcription-polymerase chain reaction, determining the expression of some factors [hepatocyte growth factor (HGF), transforming growth factor-beta (TGF-beta), alpha-smooth muscle actin, collagen, tissular inhibitor of metalloproteinases-1 and pregnane X receptor (PXR)] involved in fibrogenesis, fibrolysis and/or hepatoprotection. Both IGF-I and IFN-alpha exerted significant effects on fibrogenesis. IGF-I significantly increased serum albumin and HGF whereas IFN-alpha-therapy did not. The inhibition of TGF-beta expression was only observed by the effect of IFN-alpha-therapy. In addition, only the co-administration of IGF-I and IFN-alpha was able to increase the PXR. The combined therapy with both factors improved liver function tests, hepatic lipid peroxidation and reduced fibrosis, inducing a relevant histological improvement, reducing fibrosis and recovering hepatic architecture. The co-administration IGF-I+IFN enhanced all the beneficial effects observed with each factor separately, showing an additive action on histopathology and PXR expression, which is involved in the inhibition of fibrogenesis.
Reversal of hepatocyte senescence after continuous in vivo cell proliferation.
Wang, Min-Jun; Chen, Fei; Li, Jian-Xiu; Liu, Chang-Cheng; Zhang, Hai-Bin; Xia, Yong; Yu, Bing; You, Pu; Xiang, Dao; Lu, Lian; Yao, Hao; Borjigin, Uyunbilig; Yang, Guang-Shun; Wangensteen, Kirk J; He, Zhi-Ying; Wang, Xin; Hu, Yi-Ping
2014-07-01
A better understanding of hepatocyte senescence could be used to treat age-dependent disease processes of the liver. Whether continuously proliferating hepatocytes could avoid or reverse senescence has not yet been fully elucidated. We confirmed that the livers of aged mice accumulated senescent and polyploid hepatocytes, which is associated with accumulation of DNA damage and activation of p53-p21 and p16(ink4a)-pRB pathways. Induction of multiple rounds continuous cell division is hard to apply in any animal model. Taking advantage of serial hepatocyte transplantation assays in the fumarylacetoacetate hydrolase-deficient (Fah(-/-)) mouse, we studied the senescence of hepatocytes that had undergone continuous cell proliferation over a long time period, up to 12 rounds of serial transplantations. We demonstrated that the continuously proliferating hepatocytes avoided senescence and always maintained a youthful state. The reactivation of telomerase in hepatocytes after serial transplantation correlated with reversal of senescence. Moreover, senescent hepatocytes harvested from aged mice became rejuvenated upon serial transplantation, with full restoration of proliferative capacity. The same findings were also true for human hepatocytes. After serial transplantation, the high initial proportion of octoploid hepatocytes decreased to match the low level of youthful liver. These findings suggest that the hepatocyte "ploidy conveyer" is regulated differently during aging and regeneration. The findings of reversal of hepatocyte senescence could enable future studies on liver aging and cell therapy. © 2014 by the American Association for the Study of Liver Diseases.
Kaushansky, Alexis; Austin, Laura S.; Mikolajczak, Sebastian A.; Lo, Fang Y.; Miller, Jessica L.; Douglass, Alyse N.; Arang, Nadia; Vaughan, Ashley M.; Gardner, Malcolm J.
2014-01-01
After transmission by Anopheles mosquitoes, Plasmodium sporozoites travel to the liver, infect hepatocytes, and rapidly develop as intrahepatocytic liver stages (LS). Rodent models of malaria exhibit large differences in the magnitude of liver infection, both between parasite species and between strains of mice. This has been mainly attributed to differences in innate immune responses and parasite infectivity. Here, we report that BALB/cByJ mice are more susceptible to Plasmodium yoelii preerythrocytic infection than BALB/cJ mice. This difference occurs at the level of early hepatocyte infection, but expression levels of reported host factors that are involved in infection do not correlate with susceptibility. Interestingly, BALB/cByJ hepatocytes are more frequently polyploid; thus, their susceptibility converges on the previously observed preference of sporozoites to infect polyploid hepatocytes. Gene expression analysis demonstrates hepatocyte-specific differences in mRNA abundance for numerous genes between BALB/cByJ and BALB/cJ mice, some of which encode hepatocyte surface molecules. These data suggest that a yet-unknown receptor for sporozoite infection, present at elevated levels on BALB/cByJ hepatocytes and also polyploid hepatocytes, might facilitate Plasmodium liver infection. PMID:25312960
Selective insulin resistance in hepatocyte senescence
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aravinthan, Aloysious; Challis, Benjamin; Shannon, Nicholas
Insulin resistance has been described in association with chronic liver disease for decades. Hepatocyte senescence has been demonstrated in chronic liver disease and as many as 80% of hepatocytes show a senescent phenotype in advanced liver disease. The aim of this study was to understand the role of hepatocyte senescence in the development of insulin resistance. Senescence was induced in HepG2 cells via oxidative stress. The insulin metabolic pathway was studied in control and senescent cells following insulin stimulation. GLUT2 and GLUT4 expressions were studied in HepG2 cells and human liver tissue. Further, GLUT2 and GLUT4 expressions were studied inmore » three independent chronic liver disease cohorts. Signalling impairment distal to Akt in phosphorylation of AS160 and FoxO1 was evident in senescent HepG2 cells. Persistent nuclear localisation of FoxO1 was demonstrated in senescent cells despite insulin stimulation. Increased GLUT4 and decreased GLUT2 expressions were evident in senescent cells, human cirrhotic liver tissue and publically available liver disease datasets. Changes in GLUT expressions were associated with a poor clinical prognosis. In conclusion, selective insulin resistance is evident in senescent HepG2 cells and changes in GLUT expressions can be used as surrogate markers of hepatocyte senescence. - Highlights: • Senescent hepatocytes demonstrate selective insulin resistance. • GLUT changes act as markers of hepatocyte senescence and have prognostic value. • Study offers insight into long noticed intimacy of cirrhosis and insulin resistance.« less
Stathmin Mediates Hepatocyte Resistance to Death from Oxidative Stress by down Regulating JNK
Zhao, Enpeng; Amir, Muhammad; Lin, Yu; Czaja, Mark J.
2014-01-01
Stathmin 1 performs a critical function in cell proliferation by regulating microtubule polymerization. This proliferative function is thought to explain the frequent overexpression of stathmin in human cancer and its correlation with a bad prognosis. Whether stathmin also functions in cell death pathways is unclear. Stathmin regulates microtubules in part by binding free tubulin, a process inhibited by stathmin phosphorylation from kinases including c-Jun N-terminal kinase (JNK). The involvement of JNK activation both in stathmin phosphorylation, and in hepatocellular resistance to oxidative stress, led to an examination of the role of stathmin/JNK crosstalk in oxidant-induced hepatocyte death. Oxidative stress from menadione-generated superoxide induced JNK-dependent stathmin phosphorylation at Ser-16, Ser-25 and Ser-38 in hepatocytes. A stathmin knockdown sensitized hepatocytes to both apoptotic and necrotic cell death from menadione without altering levels of oxidant generation. The absence of stathmin during oxidative stress led to JNK overactivation that was the mechanism of cell death as a concomitant knockdown of JNK1 or JNK2 blocked death. Hepatocyte death from JNK overactivation was mediated by the effects of JNK on mitochondria. Mitochondrial outer membrane permeabilization occurred in stathmin knockdown cells at low concentrations of menadione that triggered apoptosis, whereas mitochondrial β-oxidation and ATP homeostasis were compromised at higher, necrotic menadione concentrations. Stathmin therefore mediates hepatocyte resistance to death from oxidative stress by down regulating JNK and maintaining mitochondrial integrity. These findings demonstrate a new mechanism by which stathmin promotes cell survival and potentially tumor growth. PMID:25285524
Won, Eugene T; Douros, Jonathan D; Hurt, David A; Borski, Russell J
2016-04-01
Leptin is an anorexigenic peptide hormone that circulates as an indicator of adiposity in mammals, and functions to maintain energy homeostasis by balancing feeding and energy expenditure. In fish, leptin tends to be predominantly expressed in the liver, another important energy storing tissue, rather than in fat depots as it is in mammals. The liver also produces the majority of circulating insulin-like growth factors (IGFs), which comprise the mitogenic component of the growth hormone (GH)-IGF endocrine growth axis. Based on similar regulatory patterns of leptin and IGFs that we have documented in previous studies on hybrid striped bass (HSB: Morone saxatilis×Morone chrysops), and considering the co-localization of these peptides in the liver, we hypothesized that leptin might regulate the endocrine growth axis in a manner that helps coordinate somatic growth with energy availability. Using a HSB hepatocyte culture system to simulate autocrine or paracrine exposure that might occur within the liver, this study examines the potential for leptin to modulate metabolism and growth through regulation of IGF gene expression directly, or indirectly through the regulation of GH receptors (GHR), which mediate GH-induced IGF expression. First, we verified that GH (50nM) has a classical stimulatory effect on IGF-1 and additionally show it stimulates IGF-2 transcription in hepatocytes. Leptin (5 and/or 50nM) directly stimulated in vitro GHR2 gene expression within 8h of exposure, and both GHR1 and GHR2 as well as IGF-1 and IGF-2 gene expression after 24h. Cells were then co-incubated with submaximal concentrations of leptin and GH (25nM each) to test if they had a synergistic effect on IGF gene expression, possibly through increased GH sensitivity following GHR upregulation by leptin. In combination, however, the treatments only had an additive effect on stimulating IGF-1 mRNA despite their capacity to increase GHR mRNA abundance. This suggests that leptin's stimulatory
Transversal inducing differentiation of human amniotic epithelial cells into hepatocyte-like cells.
Luo, Hongwu; Huang, Xiangjun; Huang, Feizhou; Liu, Xunyang
2011-06-01
To evaluate the in vitro differentiation of human amniotic epithelial cells (hAECs ) into hepatocyte-like cells. Combined approach of dexamethasone, HGF, IGF and other cytokines were used to induce the differentiation of hAECs into hepatocyte-like cells. The induction lasted 2 weeks. During the induction, the expression of albumin ALB, CYP1A1, CYP1A2, IGFR, c-met and key functional genes related to liver cells as well as transcription factors HNF3, HNF4 and C/EBPa were monitored by RT-PCR. Time dependent changes of the surface marker colony ALB, AFP and CK18 were analyzed by cell flow cytometry. After the 2 week induction, the expressions of liver hepatocyte-like cell functional genes such as albumin, CYP1A1, CYP1A2, c-met, and transcription factors such as HNF3, HNF4, C/EBPa and HNF1 were observed. Six days after the induction, hAECs mainly were stained AFP+, and the positive rate was (15.1 ± 2.1)%. While 10 days after the induction, part of the hAECs showed AFP+/ALB+ (6.5 ± 1.4)%; and on 14th day, hAECs only showed ALB+, and the rate was (13.9 ± 2.3)%. ALB+ cell increase indicated a gradual functional maturation from the hAECs to hepatocyte-like cells. Similaritly, the number of CK18+ cells in the whole population was also increased: On 10th day, the rate was (16.1 ± 1.2)%; on 14th day, that was (21.3 ± 4.6)%, which proved the above hypothesis of the trandifferentiation. By extending the induction time, the expression of functional genes increased gradually, and a maturing process of hAECs was detected by cell surface markers. The differentiation of hAECs induced in vitro has the characteristics of hepatocyte-like cells.
Heslop, James A; Kia, Richard; Pridgeon, Christopher S; Sison-Young, Rowena L; Liloglou, Triantafillos; Elmasry, Mohamed; Fenwick, Stephen W; Mills, John S; Kitteringham, Neil R; Goldring, Chris E; Park, Bong K
2017-05-01
Drug-induced liver injury is the greatest cause of post-marketing drug withdrawal; therefore, substantial resources are directed toward triaging potentially dangerous new compounds at all stages of drug development. One of the major factors preventing effective screening of new compounds is the lack of a predictive in vitro model of hepatotoxicity. Primary human hepatocytes offer a metabolically relevant model for which the molecular initiating events of hepatotoxicity can be examined; however, these cells vary greatly between donors and dedifferentiate rapidly in culture. Induced pluripotent stem cell (iPSC)-derived hepatocyte-like cells (HLCs) offer a reproducible, physiologically relevant and genotypically normal model cell; however, current differentiation protocols produce HLCs with a relatively immature phenotype. During the reprogramming of somatic cells, the epigenome undergoes dramatic changes; however, this "resetting" is a gradual process, resulting in an altered differentiation propensity, skewed toward the lineage of origin, particularly in early passage cultures. We, therefore, performed a comparison of human hepatocyte- and dermal fibroblast-derived iPSCs, assessing the impact of epigenetic memory at all stages of HLC differentiation. These results provide the first isogenic assessment of the starting cell type in human iPSC-derived HLCs. Despite a trend toward improvement in hepatic phenotype in albumin secretion and gene expression, few significant differences in hepatic differentiation capacity were found between hepatocyte and fibroblast-derived iPSCs. We conclude that the donor and inter-clonal differences have a greater influence on the hepatocyte phenotypic maturity than the starting cell type. Therefore, it is not necessary to use human hepatocytes for generating iPSC-derived HLCs. Stem Cells Translational Medicine 2017;6:1321-1331. © 2017 The Authors Stem Cells Translational Medicine published by Wiley Periodicals, Inc. on behalf of Alpha
Wood, Marnie J; Gadd, Victoria L; Powell, Lawrie W; Ramm, Grant A; Clouston, Andrew D
2014-03-01
The development of portal fibrosis following the iron loading of hepatocytes is the first stage of fibrogenesis in hereditary hemochromatosis. In other chronic liver diseases it has been shown that a ductular reaction (DR) appears early, correlates with fibrosis progression, and is a consequence of activation of an alternative pathway of hepatocyte replication. This study was designed to investigate the presence of the DR in hemochromatosis and describe its associations. Liver biopsies from 63 C282Y homozygous patients were assessed for hepatic iron concentration (HIC) and graded for iron loading, fibrosis stage, steatosis, and inflammation. Immunostaining allowed quantification of the DR, hepatocyte senescence and proliferation, and analysis incorporated clinical data. Hepatocyte senescence was positively correlated with HIC, serum ferritin, and oxidative stress. A DR was demonstrated and occurred prior to histological fibrosis. HIC, age, hepatocyte senescence and proliferation, portal inflammation, and excessive alcohol consumption all had significant associations with the extent of the DR. In multivariate analysis, iron loading, hepatocyte replicative arrest, and portal inflammation remained independently and significantly associated with the DR. Of factors associated with fibrosis progression, the DR (odds ratio [OR] 10.86 P<0.0001) and the presence of portal inflammation (OR 4.31, P=0.028) remained significant after adjustment for cofactors. The extent of the DR regressed following therapeutic venesection. Iron loading of hepatocytes leads to impaired replication, stimulating the development of the DR in hemochromatosis and this correlates strongly with hepatic fibrosis. Portal inflammation occurs in hemochromatosis and is independently associated with the DR and fibrosis, and thus its role in this disease should be evaluated further. © 2014 by the American Association for the Study of Liver Diseases.
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
Parent Perspectives on Decisions to Participate in a Phase I Hepatocyte Transplant Trial
Dreyzin, Alexandra; Barnato, Amber; Soltys, Kyle; Farris, Coreen; Sada, Rachel; Haberman, Kimberly; Fox, Ira
2013-01-01
We examined factors that affect decision-making for families presented with a phase I clinical trial of hepatocyte transplant as a potential alternative to liver transplant for their children among two groups: 1) families who were actually offered enrollment in the hepatocyte trial and; 2) families whose children had liver transplants before the trial was available. We conducted semi-structured interviews about actual and hypothetical decision-making regarding trial participation and used grounded theory analysis to identify common themes. The most common motivator for participation was decline in the child's health. The most common deterrent was lack of data from prior hepatocyte transplants, particularly compared to data available about liver transplant. Interviewees' point of comparison for evaluating relative benefits and risks of hepatocyte transplant oscillated between the alternative of doing nothing while waiting for a liver (the relevant alternative) versus the alternative of getting a liver. These results suggest that families' reluctance to participate may result from misconceptions about severity of the child's disease, underestimating risks of liver transplant, or confusion about the role of hepatocyte transplant in the treatment pathway. Clarification of available treatment alternatives and associated risks as part of informed consent may improve the quality of decision-making regarding trial enrollment. PMID:24251638
Mesenchymal stem cells support hepatocyte function in engineered liver grafts.
Kadota, Yoshie; Yagi, Hiroshi; Inomata, Kenta; Matsubara, Kentaro; Hibi, Taizo; Abe, Yuta; Kitago, Minoru; Shinoda, Masahiro; Obara, Hideaki; Itano, Osamu; Kitagawa, Yuko
2014-01-01
Recent studies suggest that organ decellularization is a promising approach to facilitate the clinical application of regenerative therapy by providing a platform for organ engineering. This unique strategy uses native matrices to act as a reservoir for the functional cells which may show therapeutic potential when implanted into the body. Appropriate cell sources for artificial livers have been debated for some time. The desired cell type in artificial livers is primary hepatocytes, but in addition, other supportive cells may facilitate this stem cell technology. In this context, the use of mesenchymal stem cells (MSC) is an option meeting the criteria for therapeutic organ engineering. Ideally, supportive cells are required to (1) reduce the hepatic cell mass needed in an engineered liver by enhancing hepatocyte function, (2) modulate hepatic regeneration in a paracrine fashion or by direct contact, and (3) enhance the preservability of parenchymal cells during storage. Here, we describe enhanced hepatic function achieved using a strategy of sequential infusion of cells and illustrate the advantages of co-cultivating bone marrow-derived MSCs with primary hepatocytes in the engineered whole-liver scaffold. These co-recellularized liver scaffolds colonized by MSCs and hepatocytes were transplanted into live animals. After blood flow was established, we show that expression of adhesion molecules and proangiogenic factors was upregulated in the graft.
Heslop, James A; Rowe, Cliff; Walsh, Joanne; Sison-Young, Rowena; Jenkins, Roz; Kamalian, Laleh; Kia, Richard; Hay, David; Jones, Robert P; Malik, Hassan Z; Fenwick, Stephen; Chadwick, Amy E; Mills, John; Kitteringham, Neil R; Goldring, Chris E P; Kevin Park, B
2017-01-01
The application of primary human hepatocytes following isolation from human tissue is well accepted to be compromised by the process of dedifferentiation. This phenomenon reduces many unique hepatocyte functions, limiting their use in drug disposition and toxicity assessment. The aetiology of dedifferentiation has not been well defined, and further understanding of the process would allow the development of novel strategies for sustaining the hepatocyte phenotype in culture or for improving protocols for maturation of hepatocytes generated from stem cells. We have therefore carried out the first proteomic comparison of primary human hepatocyte differentiation. Cells were cultured for 0, 24, 72 and 168 h as a monolayer in order to permit unrestricted hepatocyte dedifferentiation, so as to reveal the causative signalling pathways and factors in this process, by pathway analysis. A total of 3430 proteins were identified with a false detection rate of <1 %, of which 1117 were quantified at every time point. Increasing numbers of significantly differentially expressed proteins compared with the freshly isolated cells were observed at 24 h (40 proteins), 72 h (118 proteins) and 168 h (272 proteins) (p < 0.05). In particular, cytochromes P450 and mitochondrial proteins underwent major changes, confirmed by functional studies and investigated by pathway analysis. We report the key factors and pathways which underlie the loss of hepatic phenotype in vitro, particularly those driving the large-scale and selective remodelling of the mitochondrial and metabolic proteomes. In summary, these findings expand the current understanding of dedifferentiation should facilitate further development of simple and complex hepatic culture systems.
Yamazaki, Taisuke; Wakai, Mariko; Enosawa, Shin; Tokiwa, Takayoshi
2017-06-01
Biliary atresia (BA) is a rare and serious liver disease in newborn infants. Previously, we reported that non-parenchymal cell (NPC) fractions from cirrhotic liver of BA may contain hepatic stem/progenitor cells in primary culture of NPC fractions. In this study, NPC fractions were subjected to primary or passage culture and found that clusters of hepatocyte-like cells appear even without adding hepatocyte growth factor (HGF) to the culture medium, but not in their passage culture used as a control. Based on these findings, conditioned media (CMs) were collected and soluble factors in the CMs were analyzed in order to elucidate the mechanism of the appearance of hepatocyte-like cells or their clusters. A large amount of active HGF consisting of α and β chains was detected in CMs derived from primary culture, but not in CMs from passage culture, as determined by western blot analysis, bone morphogenetic protein (BMP)-4, oncostatin M (OSM), and transforming growth factor (TGF)-β1 were not detected in any of the CMs. The number of hepatocyte-like cells in primary culture tended to decrease following treatment with the HGF receptor c-Met inhibitor, SU11274 in a dose-dependent manner. Furthermore, the clusters of hepatocyte-like cells tended to increase in size and number when freshly isolated NPC fractions were cultured in the presence of 10% of CMs collected after 3-4 wk of primary culture. In conclusion, these findings indicate that CMs derived from primary culture of NPC fractions of BA liver contain a large amount of active HGF, which may activate hepatic stem/progenitor cells and promote the appearance of hepatocyte-like cells or their clusters through HGF/c-Met signaling. The present study would lead to cell therapy using the patient's own cells for the treatment of BA.
Tanigawa, T; Ahluwalia, A; Watanabe, T; Arakawa, T; Tarnawski, A S
2015-08-01
A previous study has demonstrated that locally administered growth factors such as epidermal growth factor, basic fibroblast growth factor and hepatocyte growth factor can accelerate healing of experimental gastric ulcers in rats. That study indicates that locally administered growth factors can exert potent biological effects resulting in enhanced gastric ulcers healing. However, the fate of injected growth factors, their retention and localization to specific cellular compartments have not been examined. In our preliminary study, we demonstrated that local injection of nerve growth factor to the base of experimental gastric ulcers dramatically accelerates ulcer healing, increases angiogenesis - new blood vessel formation, and improves the quality of vascular and epithelial regeneration. Before embarking on larger, definitive and time sequence studies, we wished to determine whether locally injected nerve growth factor is retained in gastric ulcer's tissues and taken up by specific cells during gastric ulcer healing. Gastric ulcers were induced in anesthetized rats by local application of acetic acid using standard methods; and, 60 min later fluorescein isothiocyanate-labeled nerve growth factor was injected locally to the ulcer base. Rats were euthanized 2, 5 and 10 days later. Gastric specimens were obtained and processed for histology. Unstained paraffin sections were examined under a fluorescence microscope, and the incorporation of fluorescein isothiocyanate-labeled nerve growth factor into various gastric tissue cells was determined and quantified. In addition, we performed immunostaining for S100β protein that is expressed in neural components. Five and ten days after ulcer induction labeled nerve growth factor (injected to the gastric ulcer base) was incorporated into endothelial cells of blood vessels, neuronal, glial and epithelial cells, myofibroblasts and muscle cells. This study demonstrates for the first time that during gastric ulcer healing
Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M
1996-03-01
Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.
Gómez-Lechón, María José; Lahoz, Agustín; Jiménez, Nuria; Bonora, Ana; Castell, José V; Donato, María Teresa
2008-01-01
Hepatocyte transplantation has been proposed as a method to support patients with liver insufficiency. Key factors for clinical cell transplantation to progress is to prevent hepatocyte damage, loss of viability and cell functionality, factors that depend on the nature of the tissue used for isolation to a large extent. The main sources of tissue for hepatocyte isolation are marginal livers that are unsuitable for transplantation, and segments from reduced cadaveric grafts. Hepatocellular transplantation requires infusing human hepatocytes in suspension over a period of minutes to hours. The beneficial effect of hypothermic preservation of hepatocytes in infusion medium has been reported, but how critical issues towards the success of cell transplantation, such as the composition of infusion medium and duration of hepatocyte storage will affect hepatocyte quality for clinical cell infusion has not been systematically investigated. Infusion media composition is phosphate-buffered saline containing anticoagulants and human serum albumin. The supplementation of infusion media with glucose or N-acetyl-cystein, or with both components at the same time, has been investigated. After isolation, hepatocytes were suspended in each infusion medium and a sample at the 0 time point was harvested for cell viability and functional assessment. Thereafter, cells were incubated in different infusion media agitated on a rocker platform to simulate the clinical infusion technique. The time course of hepatocyte viability, funtionality (drug-metabolizing enzymes, ureogenic capability, ATP, glycogen, and GSH levels), apoptosis (caspase-3 activation), and attachment and monolayer formation were analyzed. The optimal preservation of cell viability, attaching capacity, and functionality, particularly GSH and glycogen levels, as well as drug-metabolizing cytochrome P450 enzymes, was found in infusion media supplemented with 2 mM N-acetyl-cystein and 15 mM glucose.
Xu, Jiesi; Xu, Yang; Li, Yuanyuan; Jadhav, Kavita; You, Min; Yin, Liya; Zhang, Yanqiao
2016-04-14
The liver is a major organ that controls hepatic and systemic homeostasis. Dysregulation of liver metabolism may cause liver injury. Previous studies have demonstrated that carboxylesterase 1 (CES1) regulates hepatic triglyceride metabolism and protects against liver steatosis. In the present study, we investigated whether CES1 played a role in the development of alcoholic liver disease (ALD) and methionine and choline-deficient (MCD) diet-induced liver injury. Both hepatocyte nuclear factor 4α (HNF4α) and CES1 were markedly reduced in patients with alcoholic steatohepatitis. Alcohol repressed both HNF4α and CES1 expression in primary hepatocytes. HNF4α regulated CES1 expression by directly binding to the proximal promoter of CES1. Global inactivation of CES1 aggravated alcohol- or MCD diet-induced liver inflammation and liver injury, likely as a result of increased production of acetaldehyde and reactive oxygen species and mitochondrial dysfunctions. Knockdown of hepatic CES1 exacerbated ethanol-induced steatohepatitis. These data indicate that CES1 plays a crucial role in protection against alcohol- or MCD diet-induced liver injury.
Glycyrrhetinic acid suppressed NF-κB activation in TNF-α-induced hepatocytes.
Chen, Hong-Jhang; Kang, Shih-Pei; Lee, I-Jung; Lin, Yun-Lian
2014-01-22
Tumor necrosis factor-alpha (TNF-α) is a crucial inflammatory cytokine when hepatocytes are damaged. Glycyrrhiza uralensis Fisch. (Chinese licorice) has been widely used in Chinese herbal prescriptions for the treatment of liver diseases and as a food additive. Nuclear factor-kappa B (NF-κB) reporter gene assay in TNF-α-induced HepG2 was used as a screening platform. IκBα phosphorylation and p65 translocation were measured by Western blotting, and nitric oxide (NO) production and inducible nitric oxide synthase (iNOS) gene expression were further confirmed in rat primary hepatocytes. Results showed that TNF-α enhanced NF-κB activity was significantly attenuated by glycyrrhetinic acid in a concentration-dependent manner in the NF-κB reporter gene assay. Glycyrrhetinic acid decreased the gene expression of iNOS through inhibited IκBα phosphorylation and p65 translocation in protein level. Furthermore, NO production and iNOS expression were reduced by glycyrrhetinic acid in TNF-α-induced rat primary hepatocytes. These results suggest that glycyrrhetinic acid may provide hepatoprotection against chronic liver inflammation through attenuating NF-κB activation to alleviate the inflammation.
Wang, Zhijun; Song, Yuhu; Tu, Wei; He, Xingxing; Lin, Jusheng; Liu, Fang
2012-08-01
Transforming growth factor (TGF) β signalling pathway plays a crucial role in liver regeneration following partial hepatectomy in mice. Evidence demonstrated that β-2 Spectrin is involved in TGFβ/Smad signalling pathway as a Smad3/4 adaptor protein. The aim of this study was to explore the role of β-2 Spectrin in hepatocyte proliferation. β-2 Spectrin expression was evaluated in mice receiving partial hepatectomy. The effect of siRNA against β-2 Spectrin on hepatocyte proliferation was determined. The interaction between TGFβ/Smad and PI3K/Akt signalling was investigated. Hepatic β-2 Spectrin decreased dramatically 2 days after 70% hepatectomy in mice. In AML-12 cells, hepatocyte proliferation was inhibited after the stimulation of TGF β1 and a reduction in β-2 Spectrin mediated by siRNA resulted in increase in proliferative response. Confocal results revealed that β-2 Spectrin represented a key regulator in TGFβ/Smad signalling through controlling Smad3/4 subcellular localization. Moreover, Alternation of Akt phosphorylation led to the change in subcellular localization of Smad2, 3, 4 and β-2 Spectrin, A reduction in Smad2, 3 and 4 mediated by siRNA resulted in the induction of pAkt expression. These findings reveal that β-2 Spectrin plays a crucial role in hepatocyte proliferation, which contributes to liver regeneration following hepatectomy in mice. In addition, PI3K/Akt is involved in TGFβ/Smad signalling pathway through the interaction with Smad proteins and β-2 Spectrin. © 2012 John Wiley & Sons A/S.
The molecular functions of hepatocyte nuclear factors - In and beyond the liver.
Lau, Hwee Hui; Ng, Natasha Hui Jin; Loo, Larry Sai Weng; Jasmen, Joanita Binte; Teo, Adrian Kee Keong
2018-05-01
The hepatocyte nuclear factors (HNFs) namely HNF1α/β, FOXA1/2/3, HNF4α/γ and ONECUT1/2 are expressed in a variety of tissues and organs, including the liver, pancreas and kidney. The spatial and temporal manner of HNF expression regulates embryonic development and subsequently the development of multiple tissues during adulthood. Though the HNFs were initially identified individually based on their roles in the liver, numerous studies have now revealed that the HNFs cross-regulate one another and exhibit synergistic relationships in the regulation of tissue development and function. The complex HNF transcriptional regulatory networks have largely been elucidated in rodent models, but less so in human biological systems. Several heterozygous mutations in these HNFs were found to cause diseases in humans but not in rodents, suggesting clear species-specific differences in mutational mechanisms that remain to be uncovered. In this review, we compare and contrast the expression patterns of the HNFs, the HNF cross-regulatory networks and how these liver-enriched transcription factors serve multiple functions in the liver and beyond, extending our focus to the pancreas and kidney. We also summarise the insights gained from both human and rodent studies of mutations in several HNFs that are known to lead to different disease conditions. Copyright © 2017 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Kaushansky, Alexis; Austin, Laura S; Mikolajczak, Sebastian A; Lo, Fang Y; Miller, Jessica L; Douglass, Alyse N; Arang, Nadia; Vaughan, Ashley M; Gardner, Malcolm J; Kappe, Stefan H I
2015-01-01
After transmission by Anopheles mosquitoes, Plasmodium sporozoites travel to the liver, infect hepatocytes, and rapidly develop as intrahepatocytic liver stages (LS). Rodent models of malaria exhibit large differences in the magnitude of liver infection, both between parasite species and between strains of mice. This has been mainly attributed to differences in innate immune responses and parasite infectivity. Here, we report that BALB/cByJ mice are more susceptible to Plasmodium yoelii preerythrocytic infection than BALB/cJ mice. This difference occurs at the level of early hepatocyte infection, but expression levels of reported host factors that are involved in infection do not correlate with susceptibility. Interestingly, BALB/cByJ hepatocytes are more frequently polyploid; thus, their susceptibility converges on the previously observed preference of sporozoites to infect polyploid hepatocytes. Gene expression analysis demonstrates hepatocyte-specific differences in mRNA abundance for numerous genes between BALB/cByJ and BALB/cJ mice, some of which encode hepatocyte surface molecules. These data suggest that a yet-unknown receptor for sporozoite infection, present at elevated levels on BALB/cByJ hepatocytes and also polyploid hepatocytes, might facilitate Plasmodium liver infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Bhogal, Ricky H; Weston, Christopher J; Curbishley, Stuart M; Adams, David H; Afford, Simon C
2012-01-01
Hypoxia and hypoxia-reoxygenation (H-R) are pathogenic factors in many liver diseases that lead to hepatocyte death as a result of reactive oxygen species (ROS) accumulation. The tumor necrosis factor super-family member CD154 can also induce hepatocyte apoptosis via activation of its receptor CD40 and induction of autocrine/paracrine Fas Ligand/CD178 but the relationship between CD40 activation, ROS generation and apoptosis is poorly understood. We hypothesised that CD40 activation and ROS accumulation act synergistically to drive human hepatocyte apoptosis. Human hepatocytes were isolated from liver tissue and exposed to an in vitro model of hypoxia and H-R in the presence or absence of CD154 and/or various inhibitors. Hepatocyte ROS production, apoptosis and necrosis were determined by labelling cells with 2',7'-dichlorofluorescin, Annexin-V and 7-AAD respectively in a three-colour reporter flow cytometry assay. Exposure of human hepatocytes to recombinant CD154 or platelet-derived soluble CD154 augments ROS accumulation during H-R resulting in NADPH oxidase-dependent apoptosis and necrosis. The inhibition of c-Jun N-terminal Kinase and p38 attenuated CD154-mediated apoptosis but not necrosis. CD154-mediated apoptosis of hepatocytes involves ROS generation that is amplified during hypoxia-reoxygenation. This finding provides a molecular mechanism to explain the role of platelets in hepatocyte death during ischemia-reperfusion injury.
Zhang, Fang; Sodroski, Catherine; Cha, Helen; Li, Qisheng; Liang, T Jake
2017-01-01
The signaling molecule and transcriptional regulator SMAD6, which inhibits the transforming growth factor β signaling pathway, is required for infection of hepatocytes by hepatitis C virus (HCV). We investigated the mechanisms by which SMAD6 and another inhibitory SMAD (SMAD7) promote HCV infection in human hepatoma cells and hepatocytes. We infected Huh7 and Huh7.5.1 cells and primary human hepatocytes with Japanese fulminant hepatitis-1 (JFH1) HCV cell culture system (HCVcc). We then measured HCV binding, intracellular levels of HCV RNA, and expression of target genes. We examined HCV entry in HepG2/microRNA (miR) 122/CD81 cells, which support entry and replication of HCV, were transfected these cells with small interfering RNAs targeting inhibitory SMADs to analyze gene expression profiles. Uptake of labeled low-density lipoprotein (LDL) and cholesterol was measured. Cell surface proteins were quantified by flow cytometry. We obtained liver biopsy samples from 69 patients with chronic HCV infection and 19 uninfected individuals (controls) and measured levels of syndecan 1 (SDC1), SMAD7, and SMAD6 messenger RNAs (mRNAs). Small interfering RNA knockdown of SMAD6 blocked the binding and infection of hepatoma cell lines and primary human hepatocytes by HCV, whereas SMAD6 overexpression increased HCV infection. We found levels of mRNAs encoding heparan sulfate proteoglycans (HSPGs), particularly SDC1 mRNA, and cell surface levels of heparan sulfate to be reduced in cells after SMAD6 knockdown. SMAD6 knockdown also reduced transcription of genes encoding lipoprotein and cholesterol uptake receptors, including the LDL receptor (LDLR), the very LDLR, and the scavenger receptor class B member 1 in hepatocytes; knockdown of SMAD6 also inhibited cell uptake of cholesterol and lipoprotein. Overexpression of SMAD6 increased the expression of these genes. Similar effects were observed with knockdown and overexpression of SMAD7. In addition, HCV infection of cells increased
Snykers, Sarah; Vanhaecke, Tamara; De Becker, Ann; Papeleu, Peggy; Vinken, Mathieu; Van Riet, Ivan; Rogiers, Vera
2007-01-01
Background The capability of human mesenchymal stem cells (hMSC) derived of adult bone marrow to undergo in vitro hepatic differentiation was investigated. Results Exposure of hMSC to a cocktail of hepatogenic factors [(fibroblast growth factor-4 (FGF-4), hepatocyte growth factor (HGF), insulin-transferrin-sodium-selenite (ITS) and dexamethasone)] failed to induce hepatic differentiation. Sequential exposure to these factors (FGF-4, followed by HGF, followed by HGF+ITS+dexamethasone), however, resembling the order of secretion during liver embryogenesis, induced both glycogen-storage and cytokeratin (CK)18 expression. Additional exposure of the cells to trichostatin A (TSA) considerably improved endodermal differentiation, as evidenced by acquisition of an epithelial morphology, chronological expression of hepatic proteins, including hepatocyte-nuclear factor (HNF)-3β, alpha-fetoprotein (AFP), CK18, albumin (ALB), HNF1α, multidrug resistance-associated protein (MRP)2 and CCAAT-enhancer binding protein (C/EBP)α, and functional maturation, i.e. upregulated ALB secretion, urea production and inducible cytochrome P450 (CYP)-dependent activity. Conclusion hMSC are able to undergo mesenchymal-to-epithelial transition. TSA is hereby essential to promote differentiation of hMSC towards functional hepatocyte-like cells. PMID:17407549
Stuart, William D.; Kulkarni, Rishikesh M.; Gray, Jerilyn K.; Vasiliauskas, Juozas; Leonis, Mike A.; Waltz, Susan E.
2011-01-01
Previous studies demonstrated that targeted deletion of the Ron receptor tyrosine kinase (TK) domain in mice leads to marked hepatocyte protection in a well-characterized model of lipopolysaccharide (LPS)-induced acute liver failure in D-galactosamine (GalN)-sensitized mice. Hepatocyte protection in TK−/− mice was observed despite paradoxically elevated serum levels of tumor necrosis factor alpha (TNFα). To understand the role of Ron in the liver, purified populations of Kupffer cells and hepatocytes from wild-type (TK+/+) and TK−/− mice were studied. Utilizing quantitative RT-PCR, we demonstrated that Ron is expressed in these cell-types. Moreover, we also recapitulated the protected hepatocyte phenotype and exaggerated cytokine production observed in the TK−/− mice in vivo through the use of purified cultured cells ex vivo. We show that isolated TK−/− Kupffer cells produce increased levels of TNFα and select cytokines compared to TK+/+ cells following LPS stimulation. We also show that conditioned media from LPS-treated TK−/− Kupffer cells was more toxic to hepatocytes than control media, suggesting the exaggerated levels of cytokines produced from the TK−/− Kupffer cells are detrimental to wild type hepatocytes. In addition, we observed that TK−/− hepatocytes were more resistant to cell death compared to TK+/+ hepatocytes, suggesting that Ron functions in both the epithelial and inflammatory cell compartments to regulate acute liver injury. These findings were confirmed in vivo in mice with hepatocyte and macrophage cell-type-specific conditional Ron deletions. Mice with Ron loss selectively in hepatocytes exhibited less liver damage and increased survival compared to mice with Ron loss in macrophages. In conclusion, we have dissected cell-type-specific roles for Ron such that this receptor modulates cytokine production from Kupffer cells and inhibits hepatocyte survival in response to injury. PMID:21520175
Kim, Teayoun; Nason, Shelly; Holleman, Cassie; Pepin, Mark; Wilson, Landon; Berryhill, Taylor F; Wende, Adam R; Steele, Chad; Young, Martin E; Barnes, Stephen; Drucker, Daniel J; Finan, Brian; DiMarchi, Richard; Perez-Tilve, Diego; Tschoep, Matthias; Habegger, Kirk M
2018-06-20
Glucagon, an essential regulator of glucose and lipid metabolism, also promotes weight loss, in part through potentiation of fibroblast-growth factor 21 (FGF21) secretion. However, FGF21 is only a partial mediator of metabolic actions ensuing from GcgR-activation, prompting us to search for additional pathways. Intriguingly, chronic GcgR agonism increases plasma bile acid levels. We hypothesized that GcgR agonism regulates energy metabolism, at least in part, through farnesoid X receptor (FXR). To test this hypothesis, we studied whole body and liver-specific FXR knockout ( Fxr ∆liver ) mice. Chronic GcgR agonist (IUB288) administration in diet-induced obese (DIO) Gcgr , Fgf21 and Fxr whole body or liver-specific knockout ( ∆liver ) mice failed to reduce body weight (BW) when compared to wildtype (WT) mice. IUB288 increased energy expenditure and respiration in DIO WT mice, but not FXR ∆liver mice. GcgR agonism increased [ 14 C]-palmitate oxidation in hepatocytes isolated from WT mice in a dose-dependent manner, an effect blunted in hepatocytes from Fxr ∆liver mice. Our data clearly demonstrate that control of whole body energy expenditure by GcgR agonism requires intact FXR signaling in the liver. This heretofore-unappreciated aspect of glucagon biology has implications for the use of GcgR agonism in the therapy of metabolic disorders. © 2018 by the American Diabetes Association.
Yovchev, Mladen; Jaber, Fadi L.; Lu, Zhonglei; Patel, Shachi; Locker, Joseph; Rogler, Leslie E.; Murray, John W.; Sudol, Marius; Dabeva, Mariana D.; Zhu, Liang; Shafritz, David A.
2016-01-01
Liver repopulation by transplanted hepatocytes has not been achieved previously in a normal liver microenvironment. Here we report that adult rat hepatocytes transduced ex vivo with a lentivirus expressing a human YapERT2 fusion protein (hYapERT2) under control of the hepatocyte-specific transthyretin (TTR) promoter repopulate normal rat liver in a tamoxifen-dependent manner. Transplanted hepatocytes expand very slowly but progressively to produce 10% repopulation at 6 months, showing clusters of mature hepatocytes that are fully integrated into hepatic parenchyma, with no evidence for dedifferentiation, dysplasia or malignant transformation. Thus, we have developed the first vector designed to regulate the growth control properties of Yap that renders it capable of producing effective cell therapy. The level of liver repopulation achieved has significant translational implications, as it is 2-3x the level required to cure many monogenic disorders of liver function that have no underlying hepatic pathology and is potentially applicable to diseases of other tissues and organs. PMID:26763940
Growth factor involvement in tension-induced skeletal muscle growth
NASA Technical Reports Server (NTRS)
Vandenburgh, Herman H.
1993-01-01
Long-term manned space travel will require a better understanding of skeletal muscle atrophy which results from microgravity. Astronaut strength and dexterity must be maintained for normal mission operations and for emergency situations. Although exercise in space slows the rate of muscle loss, it does not prevent it. A biochemical understanding of how gravity/tension/exercise help to maintain muscle size by altering protein synthesis and/or degradation rate should ultimately allow pharmacological intervention to prevent muscle atrophy in microgravity. The overall objective is to examine some of the basic biochemical processes involved in tension-induced muscle growth. With an experimental in vitro system, the role of exogenous and endogenous muscle growth factors in mechanically stimulated muscle growth are examined. Differentiated avian skeletal myofibers can be 'exercised' in tissue culture using a newly developed dynamic mechanical cell stimulator device which simulates different muscle activity patterns. Patterns of mechanical activity which significantly affect muscle growth and metabolic characteristics were found. Both exogenous and endogenous growth factors are essential for tension-induced muscle growth. Exogenous growth factors found in serum, such as insulin, insulin-like growth factors, and steroids, are important regulators of muscle protein turnover rates and mechanically-induced muscle growth. Endogenous growth factors are synthesized and released into the culture medium when muscle cells are mechanically stimulated. At least one family of mechanically induced endogenous factors, the prostaglandins, help to regulate the rates of protein turnover in muscle cells. Endogenously synthesized IGF-1 is another. The interaction of muscle mechanical activity and these growth factors in the regulation of muscle protein turnover rates with our in vitro model system is studied.
Reactive oxygen species mediate human hepatocyte injury during hypoxia/reoxygenation.
Bhogal, Ricky Harminder; Curbishley, Stuart M; Weston, Christopher J; Adams, David H; Afford, Simon C
2010-11-01
Increasing evidence shows that reactive oxygen species (ROS) may be critical mediators of liver damage during the relative hypoxia of ischemia/reperfusion injury (IRI) associated with transplant surgery or of the tissue microenvironment created as a result of chronic hepatic inflammation or infection. Much work has been focused on Kupffer cells or liver resident macrophages with respect to the generation of ROS during IRI. However, little is known about the contribution of endogenous hepatocyte ROS production or its potential impact on the parenchymal cell death associated with IRI and chronic hepatic inflammation. For the first time, we show that human hepatocytes isolated from nondiseased liver tissue and human hepatocytes isolated from diseased liver tissue exhibit marked differences in ROS production in response to hypoxia/reoxygenation (H-R). Furthermore, several different antioxidants are able to abrogate hepatocyte ROS-induced cell death during hypoxia and H-R. These data provide clear evidence that endogenous ROS production by mitochondria and nicotinamide adenine dinucleotide phosphate oxidase drives human hepatocyte apoptosis and necrosis during hypoxia and H-R and may therefore play an important role in any hepatic diseases characterized by a relatively hypoxic liver microenvironment. In conclusion, these data strongly suggest that hepatocytes and hepatocyte-derived ROS are active participants driving hepatic inflammation. These novel findings highlight important functional/metabolic differences between hepatocytes isolated from normal donor livers, hepatocytes isolated from normal resected tissue obtained during surgery for malignant neoplasms, and hepatocytes isolated from livers with end-stage disease. Furthermore, the targeting of hepatocyte ROS generation with antioxidants may offer therapeutic potential for the adjunctive treatment of IRI and chronic inflammatory liver diseases. © 2010 AASLD.
Metabolism of para-aminophenol by rat hepatocytes.
Yan, Z; Nikelly, J G; Killmer, L; Tarloff, J B
2000-08-01
Autoxidation of para-aminophenol (PAP) has been proposed to account for the selective nephrotoxicity of this compound. However, other studies suggest that hepatic metabolites of PAP rather than the parent compound may be responsible for renal damage. These studies were designed to investigate PAP metabolism in isolated hepatocytes. We synthesized several proposed metabolites for analysis by HPLC/mass spectrometry and compared those results with HPLC/mass spectrometric analyses of metabolites found after incubating hepatocytes with PAP. Hepatocytes prepared from male Sprague-Dawley rats were incubated in Krebs-Henseleit buffer at 37 degrees C for 5 h with 2.3 mM PAP under an atmosphere of 5% CO2/95% O2. Aliquots were withdrawn at 0.1 h of incubation and then hourly through 5 h of incubation. Reactions were terminated by the addition of acetonitrile. Hepatocyte viability was unaltered with PAP present in the incubation medium. We found that hepatocytes converted PAP to two major metabolites (PAP-GSH conjugates and PAP-N-acetylcysteine conjugates) and several minor metabolites [PAP-O-glucuronide, acetaminophen (APAP), APAP-O-glucuronide, APAP-GSH conjugates, and 4-hydroxyformanilide]. Preincubating hepatoyctes with 1-aminobenzotriazole, an inhibitor of cytochromes P450, did not alter the pattern of PAP metabolism. In conclusion, we found that PAP was metabolized in hepatocytes predominantly to PAP-GSH conjugates and PAP-N-acetylcysteine conjugates in sufficient quantities to account for the nephrotoxicity of PAP.
Price, Eric W; Carnazza, Kathryn E; Carlin, Sean D; Cho, Andrew; Edwards, Kimberly J; Sevak, Kuntal K; Glaser, Jonathan M; de Stanchina, Elisa; Janjigian, Yelena Y; Lewis, Jason S
2017-09-01
The hepatocyte growth factor (HGF) binding antibody rilotumumab (AMG102) was modified for use as a 89 Zr-based immuno-PET imaging agent to noninvasively determine the local levels of HGF protein in tumors. Because recent clinical trials of HGF-targeting therapies have been largely unsuccessful in several different cancers (e.g., gastric, brain, lung), we have synthesized and validated 89 Zr-DFO-AMG102 as a companion diagnostic for improved identification and selection of patients having high local levels of HGF in tumors. To date, patient selection has not been performed using the local levels of HGF protein in tumors. Methods: The chelator p -SCN-Bn-DFO was conjugated to AMG102, radiolabeling with 89 Zr was performed in high radiochemical yields and purity (>99%), and binding affinity of the modified antibody was confirmed using an enzyme-linked immunosorbent assay (ELISA)-type binding assay. PET imaging, biodistribution, autoradiography and immunohistochemistry, and ex vivo HGF ELISA experiments were performed on murine xenografts of U87MG (HGF-positive, MET-positive) and MKN45 (HGF-negative, MET-positive) and 4 patient-derived xenografts (MET-positive, HGF unknown). Results: Tumor uptake of 89 Zr-DFO-AMG102 at 120 h after injection in U87MG xenografts (HGF-positive) was high (36.8 ± 7.8 percentage injected dose per gram [%ID/g]), whereas uptake in MKN45 xenografts (HGF-negative) was 5.0 ± 1.3 %ID/g and a control of nonspecific human IgG 89 Zr-DFO-IgG in U87MG tumors was 11.5 ± 3.3 %ID/g, demonstrating selective uptake in HGF-positive tumors. Similar experiments performed in 4 different gastric cancer patient-derived xenograft models showed low uptake of 89 Zr-DFO-AMG102 (∼4-7 %ID/g), which corresponded with low HGF levels in these tumors (ex vivo ELISA). Autoradiography, immunohistochemical staining, and HGF ELISA assays confirmed that elevated levels of HGF protein were present only in U87MG tumors and that 89 Zr-DFO-AMG102 uptake was closely correlated
Hepatocyte nuclear factor-4 alpha in noise-induced cochlear neuropathy.
Groth, Jane Bjerg; Kao, Shyan-Yuan; Briët, Martijn C; Stankovic, Konstantina M
2016-12-01
Noise-induced hearing loss (NIHL) is a problem of profound clinical significance and growing magnitude. Alarmingly, even moderate noise levels, previously assumed to cause only temporary shifts in auditory thresholds ("temporary" NIHL), are now known to cause cochlear synaptopathy and subsequent neuropathy. To uncover molecular mechanisms of this neuropathy, a network analysis of genes reported to have significantly altered expression after temporary threshold shift-inducing noise exposure was performed. The transcription factor Hepatocyte Nuclear Factor-4 alpha (HNF4α), which had not previously been studied in the context of cochlear response to noise, was identified as a hub of a top-ranking network. Hnf4α expression and localization using quantitative RT-PCR and in situ hybridization, respectively, were described in adolescent and adult mice exposed to neuropathic noise levels in adolescence. Isoforms α3 and α12 in the cochlea were also identified. At every age examined, Hnf4α mRNA expression in the cochlear apex was similar to expression in the base. Hnf4α expression was evident in select cochlear cells, including spiral ganglion neurons (SGNs) and hair cells, and was significantly upregulated from 6 to 70 weeks of age, especially in SGNs. This age-related Hnf4α upregulation was inhibited by neuropathic noise exposure in adolescence. Hnf4α silencing with shRNA transfection into auditory neuroblast cells (VOT-33) reduced cell viability, as measured with the MTT assay, suggesting that Hnf4α may be involved in SGN survival. Our results motivate future studies of HNF4α in cochlear pathophysiology, especially because HNF4α mutations and polymorphisms are associated with human diseases that may include hearing loss. © 2016 Wiley Periodicals, Inc. Develop Neurobiol 76: 1374-1386, 2016. © 2016 Wiley Periodicals, Inc.
Javed, M Shahid; Yaqoob, Naeem; Iwamuro, Masaya; Kobayashi, Naoya; Fujiwara, Toshiyoshi
2014-02-01
To generate a homogeneous population of patient-specific hepatocyte-like cells (HLCs) from human iPS cells those show the morphologic and phenotypic properties of primary human hepatocytes. An experimental study. Department of Surgery, Okayama University, Graduate School of Medicine, Japan, from April to December 2011. Human iPS cells were generated and maintained on ES qualified matrigel coated plates supplemented with mTeSR medium or alternatively on mitotically inactivated MEF feeder layer in DMEM/F12 medium containing 20% KOSR, 4ng/ml bFGF-2, 1 x 10-4 M 2-mercaptoethanol, 1 mmol/L NEAA, 2mM L-glutamine and 1% penicillin-streptomycin. iPS cells were differentiated to HLCs by sequential culture using a four step differentiation protocol: (I) Generation of embryoid bodies (EBs) in suspension culture; (II) Induction of definitive endoderm (DE) from 2 days old EBs by growth in human activin-A (100 ng/ml) and basic fibroblasts growth factor (bFGF2) (100 ng/ml) on matrigel coated plates; (III) Induction of hepatic progenitors by co-culture with non-parenchymal human hepatic stellate cell line (TWNT-1); and (IV) Maturation by culture in dexamethasone. Characterization was performed by RT-PCR and functional assays. The generated HLCs showed microscopically morphological phenotype of human hepatocytes, expressed liver-specific genes (ASGPR, Albumin, AFP, Sox17, Fox A2), secreted human liver-specific proteins such as albumin, synthesized urea and metabolized ammonia. Functional HLCs were generated from human iPS cells, which could be used for autologus hepatocyte transplantation for liver failure and as in vitro model for determining the metabolic and toxicological properties of drug compounds.
Afford, S C; Randhawa, S; Eliopoulos, A G; Hubscher, S G; Young, L S; Adams, D H
1999-01-18
We propose that a novel mechanism of hepatocyte apoptosis, involving a cooperative interaction between CD40 and Fas, is involved in the hepatocyte loss of chronic liver allograft rejection. We detected increased hepatocyte expression of Fas, Fas ligand (FasL), and CD40 associated with dropout of centrilobular (acinar zone 3) hepatocytes in chronic allograft rejection. Expression of CD40 ligand (CD40L) was also increased but was largely restricted to CD68(+) macrophages. A functional role for CD40 and Fas in hepatocyte apoptosis was demonstrated in vitro using primary human hepatocytes and the HepG2 cell line in both of which apoptosis was induced, not only by cross-linking Fas directly but also via CD40 activation. Our data suggest that CD40 activation induces apoptosis via Fas because (a) ligation of CD40 upregulated hepatocyte FasL expression, and (b) apoptosis induced via activation of CD40 was prevented by a neutralizing monoclonal antibody to FasL. Thus, CD40 engagement triggers apoptosis of human hepatocytes and might amplify Fas-dependent hepatocyte apoptosis in chronic rejection and other inflammatory liver diseases in which Fas-mediated apoptosis is involved.
TRANSPLANTATION OF HEPATOCYTES FROM GENETICALLY-ENGINEERED PIGS IN BABOONS
Iwase, Hayato; Liu, Hong; Schmelzer, Eva; Ezzelarab, Mohamed; Wijkstrom, Martin; Hara, Hidetaka; Lee, Whayoung; Singh, Jagjit; Long, Cassandra; Lagasse, Eric; Gerlach, Jörg C.; Cooper, David K.C.; Gridelli, Bruno
2017-01-01
Background Some patients with acute or acute-on-chronic hepatic failure die before a suitable human liver allograft becomes available. Encouraging results have been achieved in such patients by the transplantation of human hepatocyte progenitor cells from fetal liver tissue. The aim of the study was to explore survival of hepatocytes from genetically-engineered pigs after direct injection into the spleen and other selected sites in immunosuppressed baboons to monitor the immune response and the metabolic function and survival of the transplanted hepatocytes. Methods Baboons (n=3) were recipients of GTKO/hCD46 pig hepatocytes. All three baboons received anti-thymocyte globulin (ATG) induction and tapering methylprednisolone. Baboon 1 received maintenance immunosuppressive therapy with tacrolimus and rapamycin. Baboons 2 and 3 received an anti-CD40mAb/rapamycin-based regimen that prevents sensitization to pig solid organ grafts. The baboons were euthanized 4 or 5 weeks after hepatocyte transplantation. The baboon immune response was monitored by measurement of anti-nonGal IgM and IgG antibodies (by flow cytometry) and CFSE-mixed lymphocyte reaction. Monitoring for hepatocyte survival and function was by (i) real-time PCR detection of porcine DNA, (ii) real-time PCR for porcine gene expression, and (iii) pig serum albumin levels (by ELISA). The sites of hepatocyte injection were examined microscopically. Results Detection of porcine DNA and porcine gene expression was minimal at all sites of hepatocyte injection. Serum levels of porcine albumen were very low – 500–1,000-fold lower than in baboons with orthotopic pig liver grafts, and approximately 5,000-fold lower than in healthy pigs. No hepatocytes or infiltrating immune cells were seen at any of the injection sites. Two baboons (Baboons 1 and 3) demonstrated a significant increase in anti-pig IgM and an even greater increase in IgG, indicating sensitization to pig antigens. Discussion and Conclusions As a
Intertissue Flow of Glutathione (GSH) as a Tumor Growth-promoting Mechanism
Obrador, Elena; Benlloch, María; Pellicer, José A.; Asensi, Miguel; Estrela, José M.
2011-01-01
B16 melanoma F10 (B16-F10) cells with high glutathione (GSH) content show high metastatic activity in vivo. An intertissue flow of GSH, where the liver is the main reservoir, can increase GSH content in metastatic cells and promote their growth. We have studied here possible tumor-derived molecular signals that could activate GSH release from hepatocytes. GSH efflux increases in hepatocytes isolated from mice bearing liver or lung metastases, thus suggesting a systemic mechanism. Fractionation of serum-free conditioned medium from cultured B16-F10 cells and monoclonal antibody-induced neutralization techniques facilitated identification of interleukin (IL)-6 as a tumor-derived molecule promoting GSH efflux in hepatocytes. IL-6 activates GSH release through a methionine-sensitive/organic anion transporter polypeptide 1- and multidrug resistance protein 1-independent channel located on the sinusoidal site of hepatocytes. Specific siRNAs were used to knock down key factors in the main signaling pathways activated by IL-6, which revealed a STAT3-dependent mechanism. Our results show that IL-6 (mainly of tumor origin in B16-F10-bearing mice) may facilitate GSH release from hepatocytes and its interorgan transport to metastatic growing foci. PMID:21393247
Xu, Zhiyun; He, Tianrui; Li, Encheng; Guo, Zhe; Liu, Fen; Jiang, Chunmeng; Wang, Qi
2015-01-01
Tumor stroma and growth factors provide a survival environment to tumor cells and can modulate their chemoresistance by dysregulating several signal pathways. In this study, we fabricated a three-dimensional (3D) microfluidic chip using polydimethylsiloxane (PDMS) to investigate the impact of hepatocyte growth factor (HGF) from cancer-associated fibroblasts (CAF) on the Met/PI3K/AKT activation, glucose regulatory protein (GRP78) expression and the paclitaxel-induced A549 cell apoptosis. With a concentration gradient generator, the assembled chip was able to reconstruct a tumor microenvironment in vitro. We found high levels of HGF in the supernatants of CAF and the CAF matrix from the supernatants of activated HFL1 fibroblasts or HGF enhanced the levels of Met, PI3K and AKT phosphorylation and GRP78 expression in A549 cells cultured in a 3D cell chamber, which was abrogated by anti-HGF. Inhibition of Met attenuated the CAF matrix-enhanced PI3K/AKT phosphorylation and GRP78 expression while inhibition of PI3K reduced GRP78 expression, but not Met phosphorylation in A549 cells. Inhibition of GRP78 failed to modulate the CAF matrix-enhanced Met/PI3K/AKT phosphorylation in A549 cells. Furthermore, inhibition of PI3K or GRP78 enhanced spontaneous and paclitaxel-induced A549 cell apoptosis. Moreover, treatment with the CAF matrix inhibited spontaneous and medium or high dose of paclitaxel-induced A549 cell apoptosis. Inhibition of PI3K or GRP78 attenuated the CAF matrix-mediated inhibition on paclitaxel-induced A549 cell apoptosis. Our data indicated that HGF in the CAF matrix activated the Met/PI3K/AKT and up-regulated GRP78 expression, promoting chemoresistance to paclitaxel-mediated apoptosis in A549 cells. Our findings suggest that the microfluidic system may represent an ideal platform for signaling research and drug screening. PMID:26115510
Nrf2 Knockdown Disrupts the Protective Effect of Curcumin on Alcohol-Induced Hepatocyte Necroptosis.
Lu, Chunfeng; Xu, Wenxuan; Zhang, Feng; Shao, Jiangjuan; Zheng, Shizhong
2016-12-05
It has emerged that hepatocyte necroptosis plays a critical role in chronic alcoholic liver disease (ALD). Our previous study has identified that the beneficial therapeutic effect of curcumin on alcohol-caused liver injury might be attributed to activation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2), whereas the role of curcumin in regulating necroptosis and the underlying mechanism remain to be determined. We first found that chronic alcohol consumption triggered obvious hepatocyte necroptosis, leading to increased expression of receptor-interacting protein 1, receptor-interacting protein 3, high-mobility group box 1, and phosphorylated mixed lineage kinase domain-like in murine livers. Curcumin dose-dependently ameliorated hepatocyte necroptosis and alleviated alcohol-caused decrease in hepatic Nrf2 expression in alcoholic mice. Then Nrf2 shRNA lentivirus was introduced to generate Nrf2-knockdown mice. Our results indicated that Nrf2 knockdown aggravated the effects of alcohol on liver injury and necroptosis and even abrogated the inhibitory effect of curcumin on necroptosis. Further, activated Nrf2 by curcumin inhibited p53 expression in both livers and cultured hepatocytes under alcohol stimulation. The next in vitro experiments, similar to in vivo ones, revealed that although Nrf2 knockdown abolished the suppression of curcumin on necroptosis of hepatocytes exposed to ethanol, p53 siRNA could clearly rescued the relative effect of curcumin. In summary, for the first time, we concluded that curcumin attenuated alcohol-induced hepatocyte necroptosis in a Nrf2/p53-dependent mechanism. These findings make curcumin an excellent candidate for ALD treatment and advance the understanding of ALD mechanisms associated with hepatocyte necroptosis.
Hepatocyte heterogeneity in the metabolism of carbohydrates.
Jungermann, K; Thurman, R G
1992-01-01
Periportal and perivenous hepatocytes possess different amounts and activities of the rate-generating enzymes of carbohydrate and oxidative energy metabolism and thus different metabolic capacities. This is the basis of the model of metabolic zonation, according to which periportal cells catalyze predominantly the oxidative catabolism of fatty and amino acids as well as glucose release and glycogen formation via gluconeogenesis, and perivenous cells carry out preferentially glucose uptake for glycogen synthesis and glycolysis coupled to liponeogenesis. The input of humoral and nervous signals into the periportal and perivenous zones is different; gradients of oxygen, substrates and products, hormones and mediators and nerve densities exist which are important not only for the short-term regulation of carbohydrate metabolism but also for the long-term regulation of zonal gene expression. The specialization of periportal and perivenous hepatocytes in carbohydrate metabolism has been well characterized. In vivo evidence is provided by the complex metabolic situation termed the 'glucose paradox' and by zonal flux differences calculated on the basis of the distribution of enzymes and metabolites. In vitro evidence is given by the different flux rates determined with classical invasive techniques, e.g. in periportal-like and perivenous-like hepatocytes in cell culture, in periportal- and perivenous-enriched hepatocyte populations and in perfused livers during orthograde and retrograde flow, as well as with noninvasive techniques using miniature oxygen electrodes, e.g. in livers perfused in either direction. Differences of opinion in the interpretation of studies with invasive and noninvasive techniques by the authors are discussed. The declining gradient in oxygen concentrations, the decreasing glucagon/insulin ratio and the different innervation could be important factors in the zonal expression of the genes of carbohydrate-metabolizing enzymes. While it is clear that
Ma, Jihong; Zou, Chunbin; Guo, Lida; Seneviratne, Danushka S.; Tan, Xinping; Kwon, Yong-Kook; An, Jiyan; Bowser, Robert; DeFrances, Marie C.; Zarnegar, Reza
2013-01-01
Met, the transmembrane tyrosine kinase receptor for hepatocyte growth factor (HGF) is known to function as a potent anti-apoptotic mediator in normal and neoplastic cells. Herein we report that intracellular cytoplasmic tail of Met has evolved to harbor a tandem pair of Caspase-3 cleavage sites, which bait, trap and disable the active site of Caspase-3, thereby blocking the execution of apoptosis. We call this Caspase-3 cleavage motif the ‘Death Defying Domain’ (DDD). This site consists of the following sequence: DNAD-DEVD-T (where the hyphens denote caspase cleavage sites). Through functional and mechanistic studies, we show that upon DDD cleavage by Caspase-3, the resulting DEVD-T peptide acts as a competitive inhibitor and entraps the active site of Caspase-3 akin to DEVD-CHO, which is a potent, synthetic inhibitor of Caspase-3 activity. By gain and loss-of-function studies using restoration of DDD expression in DDD deficient hepatocytic cells, we found that both Caspase-3 sites in DDD are necessary for inhibition of Caspase-3 and promotion of cell survival. Employing mutagenesis studies, we show that DDD could operate independently of Met’s enzymatic activity as determined by using kinase-dead human Met mutant constructs. Studies of both human liver cancer tissues and cell lines uncovered that DDD cleavage and entrapment of Caspase-3 by DDD occur in vivo, further proving that this site has physiological and pathophysiological relevance. Conclusion Our findings show that Met can directly inhibit Caspase-3 via a novel mechanism and promote hepato-cyte survival. Results presented here will further our understanding of the mechanisms that control not only normal tissue homeostasis but also abnormal tissue growth such as cancer and degenerative diseases in which apoptotic caspases are at play. PMID:24122846
Gómez-Lechón, María José; Tolosa, Laia
2016-09-01
Drug-induced liver injury (DILI) is a frequent cause of failure in both clinical and post-approval stages of drug development, and poses a key challenge to the pharmaceutical industry. Current animal models offer poor prediction of human DILI. Although several human cell-based models have been proposed for the detection of human DILI, human primary hepatocytes remain the gold standard for preclinical toxicological screening. However, their use is hindered by their limited availability, variability and phenotypic instability. In contrast, pluripotent stem cells, which include embryonic and induced pluripotent stem cells (iPSCs), proliferate extensively in vitro and can be differentiated into hepatocytes by the addition of soluble factors. This provides a stable source of hepatocytes for multiple applications, including early preclinical hepatotoxicity screening. In addition, iPSCs also have the potential to establish genotype-specific cells from different individuals, which would increase the predictivity of toxicity assays allowing more successful clinical trials. Therefore, the generation of human hepatocyte-like cells derived from pluripotent stem cells seems to be promising for overcoming limitations of hepatocyte preparations, and it is expected to have a substantial repercussion in preclinical hepatotoxicity risk assessment in early drug development stages.
Kuroyanagi, Misato; Yamamoto, Akiko; Shimizu, Nahoko; Toi, Ayako; Inomata, Tomonori; Takeda, Akira; Kuroyanagi, Yoshimitsu
2014-01-01
Anti-adhesive products need to be designed while considering the concept of wound healing. Two main events must proceed simultaneously: facilitating wound healing in surgically excised tissue, as well as preventing injured tissue from adhering to the surrounding tissue. The present study aimed to develop an anti-adhesive spongy sheet composed of hyaluronic acid and collagen (Col) containing epidermal growth factor, and to investigate the potential of this spongy sheet using an in vitro wound surface model (placing a spongy sheet on a fibroblast-incorporating Col gel sheet) and an in vitro inter-tissue model (placing a spongy sheet between two fibroblast-incorporating Col gel sheets). These in vitro experiments demonstrated that this spongy sheet effectively stimulates fibroblasts to release an increased amount of vascular endothelial growth factor and hepatocyte growth factor, which are essential for wound healing to proceed succesfully. In addition, anti-adhesive performance of this spongy sheet was evaluated in animal experiments using Sprague Dawley rats. Under anesthesia, a 1 cm × 2 cm segment of peritoneum was superficially excised from walls, and the cecum was then abraded by scraping with a scalpel blade over a 1 cm × 2 cm area. A piece of spongy sheet was placed on the peritoneal defect. Both defects were placed in contact, and the incision was closed by suturing. Peritoneal condition was evaluated after one week. This spongy sheet was capable of facilitating the wound healing of surgically excised tissue and preventing surgically excised tissue from adhering to surrounding tissues.
[State of hepatocyte transplantation: a risk or a chance?].
Leckel, K; Blaheta, R A; Markus, B H
2003-04-01
Over the past few years, hepatocyte transplantation has been considered as an alternative method for orthotopic liver transplantation for the treatment of various liver diseases. Beside curative approach for genetic metabolic deficiencies (familial hypercholesterolemia, hemophilia, etc.), it could be a useful tool for bridging the waiting period until an appropriate donor organ is obtained. In preclinical animal studies, hepatocytes injected intraperitoneally, intraportally or into the spleen settle down in the diseased liver. This enables genetic modification to correct inborn metabolic deficiencies and improves survival in acute liver failure. In 1992, the first clinical transplantation of isolated hepatocytes in 10 patients was performed. In 1998, Fox and coworkers described the successful transplantation of allogeneic liver cells in a child with Crigler-Najjar syndrome. Accomplished studies of Strom et al. resp. Bilir et al. of the same year proved the effectiveness of liver cell transplantation for transient treatment of acute liver failure. Prerequisite of this cell-based therapeutic strategy is a sufficient amount of highly differentiated hepatocytes, hence, a well established in-vitro cell-culture technique is necessary to yield a reproducible number of proliferating hepatocytes and to preserve the physiological cell function. This review discusses the different experimental approaches regarding the cultivation of human hepatocytes and also the use of alternative cell sources (like animal hepatocytes, immortalized cells of human origin, progenitor cells from fetal human liver/liver stem cells) for hepatocyte transplantation.
Prill, Jan-Michael; Espenlaub, Sigrid; Samen, Ulrike; Engler, Tatjana; Schmidt, Erika; Vetrini, Francesco; Rosewell, Amanda; Grove, Nathan; Palmer, Donna; Ng, Philip; Kochanek, Stefan; Kreppel, Florian
2011-01-01
In vivo gene transfer with adenovirus vectors would significantly benefit from a tight control of the adenovirus-inherent liver tropism. For efficient hepatocyte transduction, adenovirus vectors need to evade from Kupffer cell scavenging while delivery to peripheral tissues or tumors could be improved if both scavenging by Kupffer cells and uptake by hepatocytes were blocked. Here, we provide evidence that a single point mutation in the hexon capsomere designed to enable defined chemical capsid modifications may permit both detargeting from and targeting to hepatocytes with evasion from Kupffer cell scavenging. Vector particles modified with small polyethylene glycol (PEG) moieties specifically on hexon exhibited decreased transduction of hepatocytes by shielding from blood coagulation factor binding. Vector particles modified with transferrin or, surprisingly, 5,000 Da PEG or dextran increased hepatocyte transduction up to 18-fold independent of the presence of Kupffer cells. We further show that our strategy can be used to target high-capacity adenovirus vectors to hepatocytes emphasizing the potential for therapeutic liver-directed gene transfer. Our approach may lead to a detailed understanding of the interactions between adenovirus vectors and Kupffer cells, one of the most important barriers for adenovirus-mediated gene delivery.
Hepatocyte Growth Factor and Interleukin-6 in Prostate Cancer Bone Metastasis
2006-06-01
Wif1 Wnt inhibitory factor 1 ## ## ## ## Cxcl4 Chemokine (C-X-C motif) ligand 4 ## ## ## ## Cxcl12 Chemokine (C-X-C motif) ligand 12...CGGCTGAAGAACAACAACAG GGCGTCTGACTCACACCTCT Clu CAGCTGGCTAACCTCACACA AACAGCTTCACCACCACCTC Cxcl4 AGTCCTGAGCTGCTGCTTCT CCCAGAGGAGATGGTCTTCA Col1A1 GAGAGCATGACCGATGGATT
Kolychev, A P; Ternovskaya, E E; Arsenieva, A V; Shapkina, E V
2013-01-01
Insulin and IGF-I are two related peptides performing in the mammalian body functionally different roles of the metabolic and growth hormones, respectively. Internalization of the insulin-receptor complex (IRC) is the most important chain of mechanism of the action of hormone. To elucidate differences in the main stages of internalization of the two related hormones, the internalization dynamics of 125I-insulin and 125I-IGF-I was traced in isolated rat hepatocytes at 37 and 12 degrees C. There were established marked differences in the process of internalization of labeled hormones, which is stimulated by insulin and IGF-I. At 37 degrees C the insulin-stimulated internalization, unlike the process initiated by IGF-I, did not reach the maximal level for 1 h of incubation. However, essential differences in the internalization course of these two related peptide were obvious at the temperature of 12 degrees C. The internalization level of insulin receptors at 12 degrees C decreased by one third in spite of a significant increase of the insulin receptor binding on the hepatocytes plasma membrane. At 12 degrees C a slight decrease of the proportion of intracellular 125I-IGF-I correlated with a decrease in the 125I-IGF-I binding to receptors on the cell membrane. Internalization of IGF-I receptors was not affected by low temperature, as neither its level, nor the rate changed at 12 degrees C. The paradoxical decrease of the insulin-stimulated internalization at low temperature seems to represent a peculiar "inhibition mechanism" of immersion of IRC into the cell, which leads to accumulation of the complexes on the cell surface and possibly to a readjustment of the insulin biological activity. The resistance of internalization of the IGF-I receptor to cold seems to be related to the more ancient origin of this mechanism in the poikilothermal vertebrates.
Shintani, Terumichi; Kusuhara, Yoshito; Daizumoto, Kei; Dondoo, Tsogt-Ochir; Yamamoto, Hiroki; Mori, Hidehisa; Fukawa, Tomoya; Nakatsuji, Hiroyoshi; Fukumori, Tomoharu; Takahashi, Masayuki; Kanayama, Hiroomi
2017-03-01
To clarify the invasive mechanisms of muscle-invasive bladder cancer (BCa) would be useful for the determination of appropriate treatment strategies. We previously showed that hepatocyte growth factor (HGF)-MET signaling is correlated with invasiveness of BCa cells. Here, we investigated the effects of the MET inhibitor, cabozantinib (XL184), on BCa cells. We first conducted Western blot analysis to investigate MET expression in BCa cell lines. Next, we examined the effect of cabozantinib on their proliferation and invasive abilities using MTT and Matrigel invasion assays, respectively. Invasion assays were performed using the xCELLigence system. Additionally, to investigate the biological function of HGF-MET signaling, we analyzed gene expression profiles and performed real-time polymerase chain reaction analyses of 5637 cells that were cultivated with or without HGF stimulation, with or without cabozantinib. MET was highly expressed in 4 of 5 BCa cell lines, and 5637 and T24 cells showed especially high protein expression of MET. Cabozantinib suppressed cell proliferation and invasion (cell index; mock, 1.49 vs HGF, 2.26 vs HGF + XL184, 1.47, P < .05). Gene expression profile analysis indicated that matrix metalloproteinase 1 (MMP1) was significantly elevated at the mRNA level with addition of HGF. Moreover, cabozantinib suppressed HGF-induced MMP1 expression in 5637 T24 cells. These data indicate that cabozantinib suppressed MMP1 expression by blocking HGF-MET signaling and that HGF-MET-MMP1 signaling is involved in the invasiveness and proliferation of BCa cells. These results suggest that cabozantinib might prove useful for future treatment of muscle-invasive BCa. Copyright © 2016 Elsevier Inc. All rights reserved.
Bhogal, Ricky H.; Weston, Christopher J.; Curbishley, Stuart M.; Adams, David H.; Afford, Simon C.
2012-01-01
Background Hypoxia and hypoxia-reoxygenation (H-R) are pathogenic factors in many liver diseases that lead to hepatocyte death as a result of reactive oxygen species (ROS) accumulation. The tumor necrosis factor super-family member CD154 can also induce hepatocyte apoptosis via activation of its receptor CD40 and induction of autocrine/paracrine Fas Ligand/CD178 but the relationship between CD40 activation, ROS generation and apoptosis is poorly understood. We hypothesised that CD40 activation and ROS accumulation act synergistically to drive human hepatocyte apoptosis. Methods Human hepatocytes were isolated from liver tissue and exposed to an in vitro model of hypoxia and H-R in the presence or absence of CD154 and/or various inhibitors. Hepatocyte ROS production, apoptosis and necrosis were determined by labelling cells with 2′,7′-dichlorofluorescin, Annexin-V and 7-AAD respectively in a three-colour reporter flow cytometry assay. Results Exposure of human hepatocytes to recombinant CD154 or platelet-derived soluble CD154 augments ROS accumulation during H-R resulting in NADPH oxidase-dependent apoptosis and necrosis. The inhibition of c-Jun N-terminal Kinase and p38 attenuated CD154-mediated apoptosis but not necrosis. Conclusions CD154-mediated apoptosis of hepatocytes involves ROS generation that is amplified during hypoxia-reoxygenation. This finding provides a molecular mechanism to explain the role of platelets in hepatocyte death during ischemia-reperfusion injury. PMID:22295117
Mfsd2a+ hepatocytes repopulate the liver during injury and regeneration
Pu, Wenjuan; Zhang, Hui; Huang, Xiuzhen; Tian, Xueying; He, Lingjuan; Wang, Yue; Zhang, Libo; Liu, Qiaozhen; Li, Yan; Li, Yi; Zhao, Huan; Liu, Kuo; Lu, Jie; Zhou, Yingqun; Huang, Pengyu; Nie, Yu; Yan, Yan; Hui, Lijian; Lui, Kathy O.; Zhou, Bin
2016-01-01
Hepatocytes are functionally heterogeneous and are divided into two distinct populations based on their metabolic zonation: the periportal and pericentral hepatocytes. During liver injury and regeneration, the cellular dynamics of these two distinct populations remain largely elusive. Here we show that major facilitator super family domain containing 2a (Mfsd2a), previously known to maintain blood–brain barrier function, is a periportal zonation marker. By genetic lineage tracing of Mfsd2a+ periportal hepatocytes, we show that Mfsd2a+ population decreases during liver homeostasis. Nevertheless, liver regeneration induced by partial hepatectomy significantly stimulates expansion of the Mfsd2a+ periportal hepatocytes. Similarly, during chronic liver injury, the Mfsd2a+ hepatocyte population expands and completely replaces the pericentral hepatocyte population throughout the whole liver. After injury recovery, the adult liver re-establishes the metabolic zonation by reprogramming the Mfsd2a+-derived hepatocytes into pericentral hepatocytes. The evidence of entire zonation replacement during injury increases our understanding of liver biology and disease. PMID:27857132
Bipotential adult liver progenitors are derived from chronically injured mature hepatocytes
Tarlow, Branden D.; Pelz, Carl; Naugler, Willscott E.; Wakefield, Leslie; Wilson, Elizabeth M.; Finegold, Milton J.; Grompe, Markus
2014-01-01
Summary Adult liver progenitor cells are biliary-like epithelial cells that emerge only under injury conditions in the periportal region of the liver. They exhibit phenotypes of both hepatocytes and bile ducts. However, their origin and their significance to injury repair remain unclear. Here, we used a chimeric lineage tracing system to demonstrate that hepatocytes contribute to the progenitor pool. RNA-sequencing, ultrastructural analysis, and in vitro progenitor assays revealed that hepatocyte-derived progenitors were distinct from their biliary-derived counterparts. In vivo lineage tracing and serial transplantation assays showed that hepatocyte-derived proliferative ducts retained a memory of their origin and differentiated back into hepatocytes upon cessation of injury. Similarly, human hepatocytes in chimeric mice also gave rise to biliary progenitors in vivo. We conclude that human and mouse hepatocytes can undergo reversible ductal metaplasia in response to injury, expand as ducts and subsequently contribute to restoration of the hepatocyte mass. PMID:25312494
DeTemple, Daphne E; Oldhafer, Felix; Falk, Christine S; Chen-Wacker, Chen; Figueiredo, Constanca; Kleine, Moritz; Ramackers, Wolf; Timrott, Kai; Lehner, Frank; Klempnauer, Juergen; Bock, Michael; Vondran, Florian W R
2018-03-01
Hepatocyte transplantation is a promising therapeutic approach for various liver diseases. Despite the liver's tolerogenic potential, early immune-mediated loss of transplanted cells is observed, and longterm acceptance has not been achieved yet. Patients deemed tolerant after liver transplantation presented an increased frequency of regulatory T cells (Tregs), which therefore also might enable reduction of posttransplant cell loss and enhance longterm allograft acceptance. We hence characterized hepatocyte-induced immune reactions and evaluated the immunomodulatory potential of Tregs applying mixed lymphocyte cultures and mixed lymphocyte hepatocyte cultures. These were set up using peripheral blood mononuclear cells and primary human hepatocytes, respectively. Polyclonally expanded CD4 + CD25 high CD127 low Tregs were added to cocultures in single-/trans-well setups with/without supplementation of anti-interferon γ (IFNγ) antibodies. Hepatocyte-induced alloresponses were then analyzed by multicolor flow cytometry. Measurements indicated that T cell response upon stimulation was associated with IFNγ-induced major histocompatibility complex (MHC) class II up-regulation on hepatocytes and mediated by CD4 + T cells. An indirect route of antigen presentation could be ruled out by use of fragmented hepatocytes and culture supernatants of hepatocytes. Allospecific proliferation was accompanied by inflammatory cytokine secretion. CD8 + T cells showed early up-regulation of CD69 despite lack of cell proliferation in the course of coculture. Supplementation of Tregs effectively abrogated hepatocyte-induced alloresponses and was primarily cell contact dependent. In conclusion, human hepatocytes induce a CD4 + T cell alloresponse in vitro, which is associated with MHC class II up-regulation on hepatocytes and is susceptible to suppression by Tregs. Liver Transplantation 24 407-419 2018 AASLD. © 2018 The Authors. Liver Transplantation published by Wiley Periodicals, Inc
Transplantation of hepatocytes from genetically engineered pigs into baboons.
Iwase, Hayato; Liu, Hong; Schmelzer, Eva; Ezzelarab, Mohamed; Wijkstrom, Martin; Hara, Hidetaka; Lee, Whayoung; Singh, Jagjit; Long, Cassandra; Lagasse, Eric; Gerlach, Jörg C; Cooper, David K C; Gridelli, Bruno
2017-03-01
Some patients with acute or acute-on-chronic hepatic failure die before a suitable human liver allograft becomes available. Encouraging results have been achieved in such patients by the transplantation of human hepatocyte progenitor cells from fetal liver tissue. The aim of the study was to explore survival of hepatocytes from genetically engineered pigs after direct injection into the spleen and other selected sites in immunosuppressed baboons to monitor the immune response and the metabolic function and survival of the transplanted hepatocytes. Baboons (n=3) were recipients of GTKO/hCD46 pig hepatocytes. All three baboons received anti-thymocyte globulin (ATG) induction and tapering methylprednisolone. Baboon 1 received maintenance immunosuppressive therapy with tacrolimus and rapamycin. Baboons 2 and 3 received an anti-CD40mAb/rapamycin-based regimen that prevents sensitization to pig solid organ grafts. The baboons were euthanized 4 or 5 weeks after hepatocyte transplantation. The baboon immune response was monitored by the measurement of anti-non-Gal IgM and IgG antibodies (by flow cytometry) and CFSE-mixed lymphocyte reaction. Monitoring for hepatocyte survival and function was by (i) real-time PCR detection of porcine DNA, (ii) real-time PCR for porcine gene expression, and (iii) pig serum albumin levels (by ELISA). The sites of hepatocyte injection were examined microscopically. Detection of porcine DNA and porcine gene expression was minimal at all sites of hepatocyte injection. Serum levels of porcine albumen were very low-500-1000-fold lower than in baboons with orthotopic pig liver grafts, and approximately 5000-fold lower than in healthy pigs. No hepatocytes or infiltrating immune cells were seen at any of the injection sites. Two baboons (Baboons 1 and 3) demonstrated a significant increase in anti-pig IgM and an even greater increase in IgG, indicating sensitization to pig antigens. As a result of this disappointing experience, the following points
Lara, Matthew S.; Holland, William S.; Chinn, Danielle; Burich, Rebekah A.; Lara, Primo N.; Gandara, David R.; Kelly, Karen; Mack, Philip C.
2018-01-01
The MET inhibitor INC-280 restored sensitivity to erlotinib and promoted apoptosis in non–small-cell lung cancer models rendered resistant to erlotinib by hepatocyte growth factor. Background Although the epidermal growth factor receptor (EGFR) inhibitor erlotinib is initially effective in non–small-cell lung cancer (NSCLC) patients with tumors harboring activating mutations of EGFR, most subsequently develop acquired resistance. One recognized resistance mechanism occurs through activation of bypass signaling via the hepatocyte growth factor (HGF)-MET pathway. INC-280 is a small molecule kinase inhibitor of MET. We sought to demonstrate the activity of INC-280 on select NSCLC cell lines both as a single agent and in combination with erlotinib using exogenous HGF to simulate MET up-regulation. Methods Four NSCLC cell lines (HCC827, PC9, H1666, and H358) were treated with either single-agent INC-280 or in combination with erlotinib with or without HGF. The activity of the drug treatments was measured by cell viability assays. Immunoblotting was used to monitor expression of EGFR/pEGFR, MET/pMET, GAB1/pGAB1, AKT/pAKT, and ERK/pERK as well as markers of apoptosis (PARP and capase-3 cleavage) in H1666, HCC827, and PC9. Results As a single agent, INC-280 showed minimal cytotoxicity despite potent inhibition of MET kinase activity at concentrations as low as 10 nM. Addition of HGF prevented erlotinib-induced cell death. The addition of INC280 to HGF-mediated erlotinib-resistant models restored erlotinib sensitivity for all cell lines tested, associated with cleavage of both PARP and caspase-3. In these models, INC-280 treatment was sufficient to restore erlotinib-induced inhibition of MET, GAB1, AKT, and ERK in the presence of HGF. Conclusion Although the MET inhibitor INC-280 alone had no discernible effect on cell growth, it was able to restore sensitivity to erlotinib and promote apoptosis in NSCLC models rendered erlotinib resistant by HGF. These data provide a
Lakshmanan, J; Landel, C P
1986-07-01
We examined long-term effects of neonatal hyperthyroidism on salivary secretions of nerve growth factor and epidermal growth factor in male and female mice at the age of 31 days. Hyperthyroidism was induced by thyroxine (T4) injections (0.4 microgram/g body weight/day) during days 0-6. Littermate control mice were treated with vehicle. T4 treatment did not alter the amounts of protein secreted into saliva but hormone administration induced alteration in the types of protein secreted. T4 treatment decreased the contents of both nerve growth factor and epidermal growth factor secreted into the saliva. A Sephadex G-200 column chromatographic profile revealed the presence of two distinct nerve growth factor immunoreactive peaks, while epidermal growth factor immunoreactivity predominantly eluted as a single low molecular weight form. T4 treatment did not alter the molecular nature of their secretion, but the treatment decreased their contents. These results indicate an impairment in salivary secretion of nerve growth factor and epidermal growth factor long after T4 treatment has been discontinued.
Whole-body γ-irradiation decelerates rat hepatocyte polyploidization.
Ikhtiar, Adnan M
2015-07-01
To characterize hepatocyte polyploidization induced by intermediate dose of γ-ray. Male Wistar strain rats were whole-body irradiated (WBI) with 2 Gy of γ-ray at the age of 1 month, and 5-6 rats were sacrificed monthly at 0-25 months after irradiation. The nuclear DNA content of individual hepatocytes was measured by flow cytometry, then hepatocytes were classified into various ploidy classes. Survival percentage, after exposure up to the end of the study, did not indicate any differences between the irradiated groups and controls. The degree of polyploidization in hepatocytes of irradiated rats, was significantly lower than that for the control after 1 month of exposure, and it continued to be lower after up to 8 months. Thereafter, the degree of polyploidization in the irradiated group slowly returned to the control level when the irradiated rats reached the age of 10 months. Intermediate dose of ionizing radiation, in contrast to high doses, decelerate hepatocyte polyploidization, which may coincides with the hypothesis of the beneficial effects of low doses of ionizing radiation.
Fibroblast growth factor receptors in breast cancer.
Wang, Shuwei; Ding, Zhongyang
2017-05-01
Fibroblast growth factor receptors are growth factor receptor tyrosine kinases, exerting their roles in embryogenesis, tissue homeostasis, and development of breast cancer. Recent genetic studies have identified some subtypes of fibroblast growth factor receptors as strong genetic loci associated with breast cancer. In this article, we review the recent epidemiological findings and experiment results of fibroblast growth factor receptors in breast cancer. First, we summarized the structure and physiological function of fibroblast growth factor receptors in humans. Then, we discussed the common genetic variations in fibroblast growth factor receptors that affect breast cancer risk. In addition, we also introduced the potential roles of each fibroblast growth factor receptors isoform in breast cancer. Finally, we explored the potential therapeutics targeting fibroblast growth factor receptors for breast cancer. Based on the biological mechanisms of fibroblast growth factor receptors leading to the pathogenesis in breast cancer, targeting fibroblast growth factor receptors may provide new opportunities for breast cancer therapeutic strategies.
Pereira, Clifford T; Herndon, David N; Rocker, Roland; Jeschke, Marc G
2007-05-15
Growth factors affect the complex cascade of wound healing; however, interaction between different growth factors during dermal and epidermal regeneration are still not entirely defined. In the present study, we thought to determine the interaction between keratinocyte growth factor (KGF) administered as liposomal cDNA with other dermal and epidermal growth factors and collagen synthesis in an acute wound. Rats received an acute wound and were divided into two groups to receive weekly subcutaneous injections of liposomes plus the Lac-Z gene (0.22 microg, vehicle), or liposomes plus the KGF cDNA (2.2 microg) and Lac-Z gene (0.22 microg). Histological and immunohistochemical techniques were used to determine growth factor, collagen expression, and dermal and epidermal structure. KGF cDNA increased insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3 (IGFBP-3), and fibroblast growth factor (FGF), decreased transforming growth factor-beta (TGF-beta), while it had no effect on platelet-derived growth factor (PDGF) levels in the wound. KGF cDNA significantly increased collagen Type IV at both the wound edge as well as the wound bed, while it had no effect on collagen Type I and III. KGF cDNA increased re-epithelialization, improved dermal regeneration, and increased neovascularization. Exogenous administered KGF cDNA causes increases in IGF-I, IGF-BP3, FGF, and collagen IV and decreases TGF-beta concentration. KGF gene transfer accelerates wound healing without causing an increase in collagen I or III.
Defective insulin secretion in hepatocyte nuclear factor 1alpha-deficient mice.
Pontoglio, M; Sreenan, S; Roe, M; Pugh, W; Ostrega, D; Doyen, A; Pick, A J; Baldwin, A; Velho, G; Froguel, P; Levisetti, M; Bonner-Weir, S; Bell, G I; Yaniv, M; Polonsky, K S
1998-01-01
Mutations in the gene for the transcription factor hepatocyte nuclear factor (HNF) 1alpha cause maturity-onset diabetes of the young (MODY) 3, a form of diabetes that results from defects in insulin secretion. Since the nature of these defects has not been defined, we compared insulin secretory function in heterozygous [HNF-1alpha (+/-)] or homozygous [HNF-1alpha (-/-)] mice with null mutations in the HNF-1alpha gene with their wild-type littermates [HNF-1alpha (+/+)]. Blood glucose concentrations were similar in HNF-1alpha (+/+) and (+/-) mice (7.8+/-0.2 and 7.9+/-0.3 mM), but were significantly higher in the HNF-1alpha (-/-) mice (13.1+/-0.7 mM, P < 0.001). Insulin secretory responses to glucose and arginine in the perfused pancreas and perifused islets from HNF-1alpha (-/-) mice were < 15% of the values in the other two groups and were associated with similar reductions in intracellular Ca2+ responses. These defects were not due to a decrease in glucokinase or insulin gene transcription. beta cell mass adjusted for body weight was not reduced in the (-/-) animals, although pancreatic insulin content adjusted for pancreas weight was slightly lower (0.06+/-0.01 vs. 0.10+/-0.01 microg/mg, P < 0.01) than in the (+/+) animals. In summary, a null mutation in the HNF-1alpha gene in homozygous mice leads to diabetes due to alterations in the pathways that regulate beta cell responses to secretagogues including glucose and arginine. These results provide further evidence in support of a key role for HNF-1alpha in the maintenance of normal beta cell function. PMID:9593777
Non-viral FoxM1 gene delivery to hepatocytes enhances liver repopulation
Xiang, D; Liu, C-C; Wang, M-J; Li, J-X; Chen, F; Yao, H; Yu, B; Lu, L; Borjigin, U; Chen, Y-X; Zhong, L; Wangensteen, K J; He, Z-Y; Wang, X; Hu, Y-P
2014-01-01
Hepatocyte transplantation as a substitute strategy of orthotopic liver transplantation is being studied for treating end-stage liver diseases. Several technical hurdles must be overcome in order to achieve the therapeutic liver repopulation, such as the problem of insufficient expansion of the transplanted hepatocytes in recipient livers. In this study, we analyzed the application of FoxM1, a cell-cycle regulator, to enhance the proliferation capacity of hepatocytes. The non-viral sleeping beauty (SB) transposon vector carrying FoxM1 gene was constructed for delivering FoxM1 into the hepatocytes. The proliferation capacities of hepatocytes with FoxM1 expression were examined both in vivo and in vitro. Results indicated that the hepatocytes with FoxM1 expression had a higher proliferation rate than wild-type (WT) hepatocytes in vitro. In comparison with WT hepatocytes, the hepatocytes with FoxM1 expression had an enhanced level of liver repopulation in the recipient livers at both sub-acute injury (fumaryl acetoacetate hydrolase (Fah)–/– mice model) and acute injury (2/3 partial hepatectomy mice model). Importantly, there was no increased risk of tumorigenicity with FoxM1 expression in recipients even after serial transplantation. In conclusion, expression of FoxM1 in hepatocytes enhanced the capacity of liver repopulation without inducing tumorigenesis. FoxM1 gene delivered by non-viral SB vector into hepatocytes may be a viable approach to promote therapeutic repopulation after hepatocyte transplantation. PMID:24853430
Arai, Kenichi; Yoshida, Toshiko; Okabe, Motonori; Goto, Mitsuaki; Mir, Tanveer Ahmad; Soko, Chika; Tsukamoto, Yoshinari; Akaike, Toshihiro; Nikaido, Toshio; Zhou, Kaixuan; Nakamura, Makoto
2017-06-01
The development of new three-dimensional (3D) cell culture system that maintains the physiologically relevant signals of hepatocytes is essential in drug discovery and tissue engineering research. Conventional two-dimensional (2D) culture yields cell growth, proliferation, and differentiation. However, gene expression and signaling profiles can be different from in vivo environment. Here, we report the fabrication of a 3D culture system using an artificial scaffold and our custom-made inkjet 3D bioprinter as a new strategy for studying liver-specific functions of hepatocytes. We built a 3D culture platform for hepatocytes-attachment and formation of cell monolayer by interacting the galactose chain of galactosylated alginate gel (GA-gel) with asialoglycoprotein receptor (ASGPR) of hepatocytes. The 3D geometrical arrangement of cells was controlled by using 3D bioprinter, and cell polarity was controlled with the galactosylated hydrogels. The fabricated GA-gel was able to successfully promote adhesion of hepatocytes. To observe liver-specific functions and to mimic hepatic cord, an additional parallel layer of hepatocytes was generated using two gel sheets. These results indicated that GA-gel biomimetic matrices can be used as a 3D culture system that could be effective for the engineering of liver tissues. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 1583-1592, 2017. © 2017 Wiley Periodicals, Inc.
Russo, Anthony J
2015-01-01
Dysregulation of the PI3K/AKT/mammalian target of rapamycin (mTOR) pathway could contribute to the pathogenesis of autism spectrum disorders. In this study, phosphorylated Akt concentration was measured in 37 autistic children and 12, gender and age similar neurotypical, controls using an enzyme-linked immunosorbent assay. Akt levels were compared to biomarkers known to be associated with epidermal growth factor receptor (EGFR) and c-Met (hepatocyte growth factor (HGF) receptor) pathways and severity levels of 19 autism-related symptoms. We found phosphorylated Akt levels significantly lower in autistic children and low Akt levels correlated with high EGFR and HGF and low gamma-aminobutyric acid, but not other biomarkers. Low Akt levels also correlated significantly with increased severity of receptive language, conversational language, hypotonia, rocking and pacing, and stimming, These results suggest a relationship between decreased phosphorylated Akt and selected symptom severity in autistic children and support the suggestion that the AKT pathways may be associated with the etiology of autism.
NASA Technical Reports Server (NTRS)
Bok, S. H.; Casida, L. E., Jr.
1977-01-01
A screening procedure was used to isolate from soil a Penicillium sp., two bacterial isolates, and a Streptomyces sp. that produced a previously unknown microbial growth factor. This factor was an absolute growth requirement for three soil bacteria. The Penicillium sp. and one of the bacteria requiring the factor, an Arthrobacter sp., were selected for more extensive study concerning the production and characteristics of the growth factor. It did not seem to be related to the siderochromes. It was not present in soil extract, rumen fluid, or any other medium component tested. It appears to be a glycoprotein of high molecular weight and has high specific activity. When added to the diets for a meadow-vole mammalian test system, it caused an increased consumption of diet without a concurrent increase in rate of weight gain.
Haines, Corinne; Elcombe, Barbara M; Chatham, Lynsey R; Vardy, Audrey; Higgins, Larry G; Elcombe, Clifford R; Lake, Brian G
2018-03-01
Phenobarbital (PB), a constitutive androstane receptor (CAR) activator, produces liver tumours in rodents by a mitogenic mode of action involving CAR activation. In this study, the hepatic effects of sodium phenobarbital (NaPB) were compared in male C57BL/6J wild type (WT) mice and in humanized mice, where both the mouse CAR and pregnane X receptor (PXR) have been replaced by their human counterparts (hCAR/hPXR mice). Investigations were also performed in cultured male C57BL/6J and CD-1 mouse, male Sprague-Dawley rat and male and female human hepatocytes. The treatment of WT and hCAR/hPXR mice with 186-984 ppm NaPB in the diet for 7 days resulted in increased relative liver weight, hypertrophy and induction of cytochrome P450 (CYP) enzyme activities. Treatment with NaPB also produced dose-dependent increases in hepatocyte replicative DNA synthesis (RDS), with the effect being more marked in WT than in hCAR/hPXR mice. While the treatment of cultured C57BL/6J and CD-1 mouse, Sprague-Dawley rat and human hepatocytes with 100 and/or 1000 μM NaPB for 4 days induced CYP enzyme activities, increased RDS was only observed in mouse and rat hepatocytes. However, as a positive control, epidermal growth factor increased RDS in hepatocytes from all three species. In summary, although human hepatocytes are refractory to the mitogenic effects of NaPB, treatment with NaPB induced RDS in vivo in hCAR/hPXR mice, which is presumably due to the human CAR and PXR receptors operating in a mouse hepatocyte regulatory environment. As the response of the hCAR/hPXR mouse to the CAR activator NaPB differs markedly from that of human hepatocytes, the hCAR/hPXR mouse is thus not a suitable animal model for studies on the hepatic effects of nongenotoxic rodent CAR activators. Copyright © 2018 Elsevier B.V. All rights reserved.
Mir-24 regulates hepatocyte apoptosis via BIM during acute liver failure.
Feng, Zhiwen; Li, Zhi; Zhu, Deming; Ling, Wei; Zheng, Lei; Pu, Liyong; Kong, Lianbao
2017-01-01
Acuteliver failure (ALF) has a high mortality rate and is characterized by massive hepatocyte destruction. Although microRNAs (miRNAs) play an important role in manyliver diseases, the role of miRNAs in ALF development is unknown. In this study, the murine ALF model was induced by intraperitoneal injection of D-galactosamine/lipopolysaccharide (D-GalN/LPS). Compared with saline-treated mice, miR-24 was distinctly down-regulated post D-GalN/LPS challenge in vivo and D-galactosamine/tumor necrosis factor (D-GalN/TNF) challenge in vitro , which was confirmed by quantitative real-time polymerase chain reaction. Meanwhile, the mRNA and protein levels of the BH3-only-domain-containing protein BIM were upregulated after challenge both in vivo and in vitro . Previous studies have demonstrated that hepatocyte apoptosis is a distinguishing feature of D-GalN/LPS-associated liver failure. In this study, D-GalN/LPS-challenged mice showed higher alanine aminotransferase and aspartate aminotransferase levels, more severe liver damage, increased numbers of apoptotic hepatocytes and higher levels of caspase-3 compared with saline-treated mice. In D-GalN/TNF-treated BNLCL2 cells, miR-24 overexpression attenuated apoptosis.Furthermore, miR-24 overexpression reduced BIM mRNA and protein levels in vitro . Taken together, these findings demonstrate that miR-24 regulates hepatocyte apoptosis via BIM during ALF development, suggesting that miR-24 is a novel onco-miRNA that may provide potential therapeutic targets for ALF.
Targeted transplantation of mitochondria to hepatocytes
Gupta, Nidhi; Wu, Catherine H; Wu, George Y
2016-01-01
Background Mitochondrial defects in hepatocytes can result in liver dysfunction and death. Hepatocytes have cell-surface asialoglycoprotein receptors (AsGRs) which internalize AsGs within endosomes. The aim of this study was to determine whether mitochondria could be targeted to hepatocytes by AsGR-mediated endocytosis. Materials and methods An AsG, AsOR, was linked to polylysine to create a conjugate, AsOR-PL, and complexed with healthy and functional mitochondria (defined by normal morphology, cytochrome c assays, and oxygen-consumption rates). Huh7 (AsGR+) and SK Hep1 (AsGR−) cells were treated with a mitochondrial toxin to form Huh7-Mito− and SK Hep1-Mito− cells, lacking detectable mitochondrial DNA. An endosomolytic peptide, LLO, was coupled to AsOR to form AsOR-LLO. A lysosomal inhibitor, amantadine, was used in mitochondria-uptake studies as a control for nonspecific endosomal release. Results Coincubation of complexed mitochondria and AsOR-LLO with Huh7-Mito− cells increased mitochondrial DNA to >9,700-fold over control at 7 days (P<0.001), and increased mitochondrial oxygen-consumption rates to >90% of control by 10 days. Conclusion Rescue of mitochondria-damaged hepatocytes can be achieved by targeted uptake of normal mitochondria through receptor-mediated endocytosis. PMID:27942238
MicroRNAs control hepatocyte proliferation during liver regeneration.
Song, Guisheng; Sharma, Amar Deep; Roll, Garrett R; Ng, Raymond; Lee, Andrew Y; Blelloch, Robert H; Frandsen, Niels M; Willenbring, Holger
2010-05-01
MicroRNAs (miRNAs) constitute a new class of regulators of gene expression. Among other actions, miRNAs have been shown to control cell proliferation in development and cancer. However, whether miRNAs regulate hepatocyte proliferation during liver regeneration is unknown. We addressed this question by performing 2/3 partial hepatectomy (2/3 PH) on mice with hepatocyte-specific inactivation of DiGeorge syndrome critical region gene 8 (DGCR8), an essential component of the miRNA processing pathway. Hepatocytes of these mice were miRNA-deficient and exhibited a delay in cell cycle progression involving the G(1) to S phase transition. Examination of livers of wildtype mice after 2/3 PH revealed differential expression of a subset of miRNAs, notably an induction of miR-21 and repression of miR-378. We further discovered that miR-21 directly inhibits Btg2, a cell cycle inhibitor that prevents activation of forkhead box M1 (FoxM1), which is essential for DNA synthesis in hepatocytes after 2/3 PH. In addition, we found that miR-378 directly inhibits ornithine decarboxylase (Odc1), which is known to promote DNA synthesis in hepatocytes after 2/3 PH. Our results show that miRNAs are critical regulators of hepatocyte proliferation during liver regeneration. Because these miRNAs and target gene interactions are conserved, our findings may also be relevant to human liver regeneration.
[Study on the hepatocytic cell targetability of liposomes].
Hou, Xin-pu; Wang, Li; Wang, Xiang-tao; Li, Sha
2003-02-01
To target for hepatocytic cell, liposomes was modified by special ligand. Sterically stabilized liposomes (SSL) was conjugated with asialofeticin (AF), the ligand of asialoglycoprotein receptor (ASGP-R) of hepatocyte. ASGP-R-BLM is the ASGP-R reconstructed on bilayer lipid membrane (BLM). The recognition reaction between AF-SSL and ASGP-R-BLM can be monitored by the varieties of membrane electrical parameters. The targetability of AF-SSL mediated to hepatocyte was detected by radioisotopic labeled in vitro and in vivo. The therapeutic effect of antihepatocarcinoma was observed also. The lifetime of ASGP-R-BLM decreased with the added amount of AF-SSL. It was demonstrated that there was recognition reaction between AF-SSL and ASGP-R-BLM. The combination of AF-SSL with hepatocyte was significantly higher than that of SSL without AF-modified in vitro and in vivo. The survival time of rat for AF-SSL carriered ADM (adriamycin) group was much longer and the toxicities on heart, kidney and lung were lower than those SSL carried ADM group. It is possible to actively target the cell with specific receptor by ligand modified liposomes. The result prvide scientific basis of hepatocyte targeted liposomes.
Achtzehn, Silvia; Schmitz, Theresa; Bloch, Wilhelm; Mester, Joachim; Werner, Nikos
2014-01-01
Aims Endothelial microparticles (EMP) are complex vesicular structures shed from activated or apoptotic endothelial cells. As endurance exercise affects the endothelium, the objective of the study was to examine levels of EMP and angiogenic growth factors following different endurance exercise protocols. Methods 12 subjects performed 3 different endurance exercise protocols: 1. High volume training (HVT; 130 min at 55% peak power output (PPO); 2. 4×4 min at 95% PPO; 3. 4×30 sec all-out. EMPs were quantified using flow cytometry after staining platelet-poor-plasma. Events positive for Annexin-V and CD31, and negative for CD42b, were classified as EMPs. Vascular endothelial growth factor (VEGF), migratory inhibiting factor (MIF) and hepatocyte growth factor (HGF) were determined by ELISA technique. For all these measurements venous blood samples were taken pre, 0′, 30′, 60′ and 180′ after each intervention. Furthermore, in vitro experiments were performed to explore the effect of collected sera on target endothelial functions and MP uptake capacities. Results VEGF and HGF significantly increased after HIT interventions. All three interventions caused a significant decrease in EMP levels post exercise compared to pre values. The sera taken after exercise increased the uptake of EMP in target endothelial cells compared to sera taken under resting conditions, which was shown to be phosphatidylserin-dependent. Increased EMP uptake was associated with an improved protection of target cells against apoptosis. Sera taken prior and after exercise promoted target endothelial cell migration, which was abrogated after inhibition of VEGF. Conclusion Physical exercise leads to decreased EMP levels and promotes a phosphatidylserin-dependent uptake of EMP into target endothelial cells, which is associated with a protection of target cells against apoptosis. PMID:24770423
Factors That Influence Language Growth.
ERIC Educational Resources Information Center
McCarthy, Dorothea, Ed.; And Others
This booklet contains four articles that discuss factors influencing language growth. The first, "The Child's Equipment for Language Growth" by Charlotte Wells, examines what the child needs for language learning, how the child uses his equipment for language growth, and what school factors facilitate the child's use of his equipment for language…
NAKAMURA, Toshikazu; MIZUNO, Shinya
2010-01-01
It has been more than 25 years since HGF was discovered as a mitogen of hepatocytes. HGF is produced by stromal cells, and stimulates epithelial cell proliferation, motility, morphogenesis and angiogenesis in various organs via tyrosine phosphorylation of its receptor, c-Met. In fetal stages, HGF-neutralization, or c-Met gene destruction, leads to hypoplasia of many organs, indicating that HGF signals are essential for organ development. Endogenous HGF is required for self-repair of injured livers, kidneys, lungs and so on. In addition, HGF exerts protective effects on epithelial and non-epithelial organs (including the heart and brain) via anti-apoptotic and anti-inflammatory signals. During organ diseases, plasma HGF levels significantly increased, while anti-HGF antibody infusion accelerated tissue destruction in rodents. Thus, endogenous HGF is required for minimization of diseases, while insufficient production of HGF leads to organ failure. This is the reason why HGF supplementation produces therapeutic outcomes under pathological conditions. Moreover, emerging studies delineated key roles of HGF during tumor metastasis, while HGF-antagonism leads to anti-tumor outcomes. Taken together, HGF-based molecules, including HGF-variants, HGF-fragments and c-Met-binders are available as regenerative or anti-tumor drugs. Molecular analysis of the HGF-c-Met system could provide bridges between basic biology and clinical medicine. PMID:20551596
Branches of NF-κb signaling pathway regulate hepatocyte proliferation in rat liver regeneration.
Chang, C F; Zhao, W M; Mei, J X; Zhou, Y; Pan, C Y; Xu, T T; Xu, C S
2015-07-13
Previous studies have demonstrated that the nuclear factor κB (NF-κB) pathway is involved in promoting cell proliferation. To further explore the regulatory branches and their sequence in the NF-κB pathway in the promotion of hepatocyte proliferation at the transcriptional level during rat liver regeneration, Rat Genome 230 2.0 array was used to detect the expression changes of the isolated hepatocytes. We found that many genes involved in the NF-κB pathway (including 73 known genes and 19 homologous genes) and cell proliferation (including 484 genes and 104 homologous genes) were associated with liver regeneration. Expression profile function (Ep) was used to analyze the biological processes. It was revealed that the NF-κB pathway promoted hepatocyte proliferation through three branches. Several methods of integrated statistics were applied to extract and screen key genes in liver regeneration, and it indicated that eight genes may play a vital role in rat liver regeneration. To confirm the above predicted results, Ccnd1, Jun and Myc were analyzed using qRT-PCR, and the results were generally consistent with that of microarray data. It is concluded that 3 branches and 8 key genes involved in the NF-κB pathway regulate hepatocyte proliferation during rat liver regeneration.
Experience of microbiological screening of human hepatocytes for clinical transplantation.
Lehec, Sharon C; Hughes, Robin D; Mitry, Ragai R; Graver, Michelle A; Verma, Anita; Wade, Jim J; Dhawan, Anil
2009-01-01
Hepatocyte transplantation is being used in patients with liver-based metabolic disorders and acute liver failure. Hepatocytes are isolated from unused donor liver tissue under GMP conditions. Cells must be free of microbiological contamination to be safe for human use. The experience of microbiological screening during 72 hepatocyte isolation procedures at one center is reported. Samples were taken at different stages of the process and tested using a blood culture bottle system and Gram stain. Bacterial contamination was detected in 37.5% of the UW organ preservative solutions used to transport the liver tissue to the Cell Isolation Unit. After tissue processing the contamination was reduced to 7% overall in the final hepatocyte product, irrespective of the presence of initial contamination of the transport solution. The most common organisms recovered were coagulase-negative staphylococci, a skin commensal. A total of 41 preparations of fresh or cryopreserved hepatocytes were used for cell transplantation in children with liver-based metabolic disorders without any evidence of sepsis due to infusion of hepatocytes. In conclusion, the incidence of bacterial contamination of the final product was low, confirming the suitability of the organs used, hepatocyte isolation procedure, and the environmental conditions of the clean room.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jawan, Bruno; Kao, Y.-H.; Department of Biological Sciences, National Sun Yat-Sen University, 70 Lien-Hai Road, Kaohsiung 804, Taiwan
Propofol (PPF), a widely used intravenous anesthetic for induction and maintenance of anesthesia during surgeries, was found to possess suppressive effect on host immunity. This study aimed at investigating whether PPF plays a modulatory role in the lipopolysaccharide (LPS)-induced inflammatory cytokine expression in a cell line of rat hepatocytes. Morphological observation and viability assay showed that PPF exhibits no cytotoxicity at concentrations up to 300 {mu}M after 48 h incubation. Pretreatment with 100 {mu}M PPF for 24 h prior to LPS stimulation was performed to investigate the modulatory effect on LPS-induced inflammatory gene production. The results of semi-quantitative RT-PCR demonstratedmore » that PPF pretreatment significantly suppressed the LPS-induced toll-like receptor (TLR)-4, CD14, tumor necrosis factor (TNF)-{alpha}, and granulocyte-macrophage colony-stimulating factor (GM-CSF) gene expression. Western blotting analysis showed that PPF pretreatment potentiated the LPS-induced TLR-4 downregulation. Flow cytometrical analysis revealed that PPF pretreatment showed no modulatory effect on the LPS-upregulated CD14 expression on hepatocytes. In addition, PPF pretreatment attenuated the phosphorylation of mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) and I{kappa}B{alpha}, as well as the nuclear translocation of NF-{kappa}B primed by LPS. Moreover, addition of PD98059, a MAPK kinase inhibitor, significantly suppressed the LPS-induced NF-{kappa}B nuclear translocation and GM-CSF production, suggesting that the PPF-attenuated GM-CSF production in hepatocytes may be attributed to its suppressive effect on MAPK/ERK signaling pathway. In conclusion, PPF as an anesthetic may clinically benefit those patients who are vulnerable to sepsis by alleviating sepsis-related inflammatory response in livers.« less
Functional assessment of hepatocytes after transplantation into rat spleen
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woods, R.J.; Fuller, B.J.; Attenburrow, V.D.
1982-02-01
The retention of structural integrity and metabolic function by isolated hepatocytes after ectopic transplantation has been investigated in autografted rats. Rats were partially hepatectomized and isolated hepatocytes prepared from the excised liver lobes were implanted into their spleens. Histological examination of the spleens 7 or more weeks after implantation revealed aggregates of hepatocytes in the red pulp. Two tests of biochemical function were applied to the hepatocytes after tranplantation. In the first the hepatobiliary imaging agent technetium-99m N-(N'-(2,6-dimethylphenyl)carbamoylmethyl)iminodiacetic acid (/sup 99//sup m/Tc HIDA), which was shown to be avidly taken up by isolated hepatocytes in vitro, was infused into themore » tail veins of autograft and control rats. Radioactivity accumulating in the spleens of autografted rats was markedly greater than that in controls implanted with lethally damaged cells or in nontransplanted rats. In the second the presence of bilirubin metabolites was sought in autograft spleens after intravenous infusion of bilirubin. Both mono- and diglucuronides of bilirubin were recovered from the spleens of autograft rats but no conjugates were recovered from the spleens of unoperated controls. We conclude that after autotransplantation isolated hepatocytes retain their morphology and at least some of their functional activities.« less
Functional assessment of hepatocytes after transplantation into rat spleen
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woods, R.J.; Fuller, B.J.; Attenburrow, V.D.
1982-02-01
The retention of structural integrity and metabolic function by isolated hepatocytes after ectopic transplantation has been investigated in autografted rats. Rats were partially hepatectomized and isolated hepatocytes prepared from the excised liver lobes were implanted into their spleens. Histological examination of the spleens 7 or more weeks after implantation revealed aggregates of hepatocytes in the red pulp. Two tests of biochemical function were applied to the hepatocytes after transplantation. In the first the hepatobiliary imaging agent technetium-99m N-(N'-(2, 6-dimethylphenyl)carbamoylmethyl)iminodiacetic acid (99mTc HIDA), which was shown to be avidly taken up by isolated hepatocytes in vitro, was infused into the tailmore » veins of autograft and control rats. Radioactivity accumulating in the spleens of autografted rats was markedly greater than that in controls implanted with lethally damaged cells or in nontransplanted rats. In the second the presence of bilirubin metabolites was sought in autograft spleens after intravenous infusion of bilirubin. Both mono- and diglucuronides of bilirubin were recovered from the spleens of autograft rats but no conjugates were recovered from the spleens of unoperated controls. We conclude that after autotransplantation isolated hepatocytes retain their morphology and at least some of their functional activities.« less
Insulin-like growth factor 1: common mediator of multiple enterotrophic hormones and growth factors.
Bortvedt, Sarah F; Lund, P Kay
2012-03-01
To summarize the recent evidence that insulin-like growth factor 1 (IGF1) mediates growth effects of multiple trophic factors and discuss clinical relevance. Recent reviews and original reports indicate benefits of growth hormone (GH) and long-acting glucagon-like peptide 2 (GLP2) analogs in short bowel syndrome and Crohn's disease. This review highlights the evidence that biomarkers of sustained small intestinal growth or mucosal healing and evaluation of intestinal epithelial stem cell biomarkers may improve clinical measures of intestinal growth or response to trophic hormones. Compelling evidence that IGF1 mediates growth effects of GH and GLP2 on intestine or linear growth in preclinical models of resection or Crohn's disease is presented, along with a concept that these hormones or IGF1 may enhance sustained growth if given early after bowel resection. Evidence that suppressor of cytokine signaling protein induction by GH or GLP2 in normal or inflamed intestine may limit IGF1-induced growth, but protect against risk of dysplasia or fibrosis, is reviewed. Whether IGF1 receptor mediates IGF1 action and potential roles of insulin receptors are addressed. IGF1 has a central role in mediating trophic hormone action in small intestine. Better understanding of benefits and risks of IGF1, receptors that mediate IGF1 action, and factors that limit undesirable growth are needed.
Zamora, Paul O [Gaithersburg, MD; Pena, Louis A [Poquott, NY; Lin, Xinhua [Plainview, NY; Takahashi, Kazuyuki [Germantown, MD
2012-07-24
The present invention provides a fibroblast growth factor heparin-binding analog of the formula: ##STR00001## where R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, X, Y and Z are as defined, pharmaceutical compositions, coating compositions and medical devices including the fibroblast growth factor heparin-binding analog of the foregoing formula, and methods and uses thereof.
Danilenko, D. M.; Ring, B. D.; Tarpley, J. E.; Morris, B.; Van, G. Y.; Morawiecki, A.; Callahan, W.; Goldenberg, M.; Hershenson, S.; Pierce, G. F.
1995-01-01
The topical application of recombinant growth factors such as epidermal growth factor, platelet-derived growth factor-BB homodimer (rPDGF-BB), keratinocyte growth factor (rKGF), and neu differentiation factor has resulted in significant acceleration of healing in several animal models of wound repair. In this study, we established highly reproducible and quantifiable full and deep partial thickness porcine burn models in which burns were escharectomized 4 or 5 days postburn and covered with an occlusive dressing to replicate the standard treatment in human burn patients. We then applied these growth factors to assess their efficacy on several parameters of wound repair: extracellular matrix and granulation tissue production, percent reepithelialization, and new epithelial area. In full thickness burns, only rPDGF-BB and the combination of rPDGF-BB and rKGF induced significant changes in burn repair. rPDGF-BB induced marked extracellular matrix and granulation tissue production (P = 0.013) such that the burn defect was filled within several days of escharectomy, but had no effect on new epithelial area or reepithelialization. The combination of rPDGF-BB and rKGF in full thickness burns resulted in a highly significant increase in extracellular matrix and granulation tissue area (P = 0.0009) and a significant increase in new epithelial area (P = 0.007), but had no effect on reepithelialization. In deep partial thickness burns, rKGF induced the most consistent changes. Daily application of rKGF induced a highly significant increase in new epithelial area (P < 0.0001) but induced only a modest increase in reepithelialization (83.7% rKGF-treated versus 70.2% control; P = 0.016) 12 days postburn. rKGF also doubled the number of fully reepithelialized burns (P = 0.02) at 13 days postburn, at least partially because of marked stimulation of both epidermal and follicular proliferation as assessed by proliferating cell nuclear antigen expression. In situ hybridization for
Choi, Jaehoon; Lee, Eun Hee; Park, Sang Woo; Chang, Hak
2015-01-01
Hypertrophic scars and keloids are associated with abnormal levels of growth factors. Silicone gel sheets are effective in treating and preventing hypertrophic scars and keloids. There has been no report on the change in growth factors in the scar tissue following the use of silicone gel sheeting for scar prevention. A prospective controlled trial was performed to evaluate whether growth factors are altered by the application of a silicone gel sheet on a fresh surgical scar. Four of seven enrolled patients completed the study. Transforming growth factor (TGF)-β1, platelet-derived growth factor (PDGF), and basic fibroblast growth factor (bFGF) were investigated immunohistochemically in biopsies taken from five scars at 4 months following surgery. In both the epidermis and the dermis, the expression of TGF-β1 (P=0.042 and P=0.042) and PDGF (P=0.043 and P=0.042) was significantly lower in the case of silicone gel sheet-treated scars than in the case of untreated scars. The expression of bFGF in the dermis was significantly higher in the case of silicone gel sheet-treated scars than in the case of untreated scars (P=0.042), but in the epidermis, the expression of bFGF showed no significant difference between the groups (P=0.655). The levels of TGF-β1, PDGF, and bFGF are altered by the silicone gel sheet treatment, which might be one of the mechanisms of action in scar prevention.
Genetic abolishment of hepatocyte proliferation activates hepatic stem cells.
Endo, Yoko; Zhang, Mingjun; Yamaji, Sachie; Cang, Yong
2012-01-01
Quiescent hepatic stem cells (HSCs) can be activated when hepatocyte proliferation is compromised. Chemical injury rodent models have been widely used to study the localization, biomarkers, and signaling pathways in HSCs, but these models usually exhibit severe promiscuous toxicity and fail to distinguish damaged and non-damaged cells. Our goal is to establish new animal models to overcome these limitations, thereby providing new insights into HSC biology and application. We generated mutant mice with constitutive or inducible deletion of Damaged DNA Binding protein 1 (DDB1), an E3 ubiquitin ligase, in hepatocytes. We characterized the molecular mechanism underlying the compensatory activation and the properties of oval cells (OCs) by methods of mouse genetics, immuno-staining, cell transplantation and gene expression profiling. We show that deletion of DDB1 abolishes self-renewal capacity of mouse hepatocytes in vivo, leading to compensatory activation and proliferation of DDB1-expressing OCs. Partially restoring proliferation of DDB1-deficient hepatocytes by ablation of p21, a substrate of DDB1 E3 ligase, alleviates OC proliferation. Purified OCs express both hepatocyte and cholangiocyte markers, form colonies in vitro, and differentiate to hepatocytes after transplantation. Importantly, the DDB1 mutant mice exhibit very minor liver damage, compared to a chemical injury model. Microarray analysis reveals several previously unrecognized markers, including Reelin, enriched in oval cells. Here we report a genetic model in which irreversible inhibition of hepatocyte duplication results in HSC-driven liver regeneration. The DDB1 mutant mice can be broadly applied to studies of HSC differentiation, HSC niche and HSCs as origin of liver cancer.
Growth factors, nutrient signaling, and cardiovascular aging.
Fontana, Luigi; Vinciguerra, Manlio; Longo, Valter D
2012-04-13
Growth factors regulated by specific macronutrients have been shown to promote aging and accelerate mortality in the majority of the organisms studied. In particular, the enzymes activated by growth hormone, insulin, and insulin-like growth factor-1 in mammals and their orthologs in simple model organisms represent perhaps the best-understood proteins involved in the aging process. Dietary restriction, which reduces the level of insulin-like growth factor-1 and of other growth factors, has been associated with protection from diabetes, cancer, and cardiovascular diseases, and deficiencies in growth hormone signaling and insulin-like growth factor-1 are strongly associated with protection from cancer and diabetes in both mice and humans; however, their role in cardiac function and cardiovascular diseases is controversial. Here, we review the link between growth factors, cardiac function, and heart disease with focus on the cardioprotective and sensitizing effect of growth factors in both model organisms and humans.
Monitoring liver damage using hepatocyte-specific methylation markers in cell-free circulating DNA.
Lehmann-Werman, Roni; Magenheim, Judith; Moss, Joshua; Neiman, Daniel; Abraham, Ofri; Piyanzin, Sheina; Zemmour, Hai; Fox, Ilana; Dor, Talya; Grompe, Markus; Landesberg, Giora; Loza, Bao-Li; Shaked, Abraham; Olthoff, Kim; Glaser, Benjamin; Shemer, Ruth; Dor, Yuval
2018-06-21
Liver damage is typically inferred from serum measurements of cytoplasmic liver enzymes. DNA molecules released from dying hepatocytes are an alternative biomarker, unexplored so far, potentially allowing for quantitative assessment of liver cell death. Here we describe a method for detecting acute hepatocyte death, based on quantification of circulating, cell-free DNA (cfDNA) fragments carrying hepatocyte-specific methylation patterns. We identified 3 genomic loci that are unmethylated specifically in hepatocytes, and used bisulfite conversion, PCR, and massively parallel sequencing to quantify the concentration of hepatocyte-derived DNA in mixed samples. Healthy donors had, on average, 30 hepatocyte genomes/ml plasma, reflective of basal cell turnover in the liver. We identified elevations of hepatocyte cfDNA in patients shortly after liver transplantation, during acute rejection of an established liver transplant, and also in healthy individuals after partial hepatectomy. Furthermore, patients with sepsis had high levels of hepatocyte cfDNA, which correlated with levels of liver enzymes aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Duchenne muscular dystrophy patients, in which elevated AST and ALT derive from damaged muscle rather than liver, did not have elevated hepatocyte cfDNA. We conclude that measurements of hepatocyte-derived cfDNA can provide specific and sensitive information on hepatocyte death, for monitoring human liver dynamics, disease, and toxicity.
Wang, Jianjun; Zhao, Ping; Wan, Zhihong; Jin, Xueyuan; Cheng, Yongqian; Yan, Tao; Qing, Song; Ding, Ning; Xin, Shaojie
2016-10-01
The aim of this study was to investigate the differentiation potential of induced pluripotent stem cells (iPSCs) derived from human foreskin fibroblasts (HFFs) into hepatocyte-like cells (HLCs). The iPSCs were firstly induced by transduction of OCT4, SOX2, KLF4, and c-MYC into HFFs using retrovirus. Afterwards, expressions of pluripotency factors were identified by semiquantitative reverse transcription-polymerase chain reaction and immunofluorescence staining, and karyotype, embryoid, and teratoma were observed by microscope. Then, iPSCs were gradually differentiated into endoderm cells, hepatic progenitor cells, and mature HLCs by special culture medium. During this process, differentiation efficiency into each kind of cells was evaluated by detecting SOX17, HNF4a, and ALB using flow cytometry, respectively. Besides, enzyme-linked immunosorbent assay was conducted to detect the secretion of ALB in iPSC-induced HLCs and quantitative reverse transcription-polymerase chain reaction was performed to detect the expression levels of hepatocyte-specific genes. The iPSCs were successfully induced by HFFs, which exhibited typical embryonic stem cells morphology, positive alkaline phosphatase staining, normal diploid karyotype, and positive expression of various pluripotency factors. Meanwhile, spherical embryoid and teratoma with 3 germ layers were formed by iPSCs. The iPSCs were consecutively induced into endoderm cells, hepatic progenitor cells and mature HLCs, and the differentiation efficiency was 55.7 ± 2.9%, 45.7 ± 4.8%, and 35.0 ± 3.9%, respectively. Besides, the secretion of ALB and expression of various hepatocyte-specific genes was highly detected in iPSC-induced HLCs. The iPSCs were successfully derived from HFFs and then differentiated into HLCs, which proved a new source for hepatocyte transplantation. HFFs were successfully induced into iPSCs by transduction of OCT4, SOX2, KLF4, and c-MYC. Positive expressions of various pluripotency factors were
Harbrecht, B G; Taylor, B S; Xu, Z; Ramalakshmi, S; Ganster, R W; Geller, D A
2001-08-01
The inducible nitric oxide synthase (iNOS) is strongly expressed following inflammatory stimuli. Adenosine 3',5'-cyclic monophosphate (cAMP) increases iNOS expression and activity in a number of cell types but decreases cytokine-stimulated iNOS expression in hepatocytes. The mechanisms for this effect are unknown. Rat hepatocytes were stimulated with cytokines to induce iNOS and cultured with cAMP agonists dibutyryl-cAMP (dbcAMP), 8-bromo-cAMP, and forskolin (FSK). Nitric oxide synthesis was assessed by supernatant nitrite levels and iNOS expression was measured by Northern and Western blot analyses. Nuclear factor kappaB binding was assessed by electromobility shift assay. Cyclic AMP dose dependently decreased NO synthesis in response to a combination of proinflammatory cytokines or interleukin-1beta (IL-1beta) alone. The adenylate cyclase inhibitor SQ 22,536 increased cytokine- or IL-1beta-stimulated NO synthesis. dbcAMP decreased iNOS mRNA expression and iNOS protein expression. Both dbcAMP and glucagon decreased iNOS promoter activity in rat hepatocytes transfected with the murine iNOS promoter and decreased DNA binding of the transcription factor NF-kappaB. These data suggest that cAMP is important in hepatocyte iNOS expression and agents that alter cAMP levels may profoundly alter the response of hepatocytes to inflammatory stimuli through effects onthe iNOS promoter region and NF-kappaB. Copyright 2001 Academic Press.
Effects of silver nanoparticles on the liver and hepatocytes in vitro.
Gaiser, Birgit K; Hirn, Stephanie; Kermanizadeh, Ali; Kanase, Nilesh; Fytianos, Kleanthis; Wenk, Alexander; Haberl, Nadine; Brunelli, Andrea; Kreyling, Wolfgang G; Stone, Vicki
2013-02-01
With the increasing use and incorporation of nanoparticles (NPs) into consumer products, screening for potential toxicity is necessary to ensure customer safety. NPs have been shown to translocate to the bloodstream following inhalation and ingestion, and such studies demonstrate that the liver is an important organ for accumulation. Silver (Ag) NPs are highly relevant for human exposure due to their use in food contact materials, dietary supplements, and antibacterial wound treatments. Due to the large number of different NPs already used in various products and being developed for new applications, it is essential that relevant, quick, and cheap methods of in vitro risk assessment suitable for these new materials are established. Therefore, this study used a simple hepatocytes model combined with an in vivo injection model to simulate the passage of a small amount of NPs into the bloodstream following exposure, e.g., via ingestion or inhalation, and examined the potential of Ag NPs of 20 nm diameter to cause toxicity, inflammation, and oxidative stress in the liver following in vivo exposures of female Wistar rats via iv injection to 50 μg of NPs and in vitro exposures using the human hepatocyte cell line C3A. We found that Ag NPs were highly cytotoxic to hepatocytes (LC(50) lactate dehydrogenase: 2.5 μg/cm(2)) and affected hepatocyte homeostasis by reducing albumin release. At sublethal concentrations with normal cell or tissue morphology, Ag NPs were detected in cytoplasm and nuclei of hepatocytes. We observed similar effects of Ag NPs on inflammatory mediator expression in vitro and in vivo with increase of interleukin-8 (IL-8)/macrophage inflammatory protein 2, IL-1RI, and tumor necrosis factor-α expression in both models and increased IL-8 protein release in vitro. This article presents evidence of the potential toxicity and inflammogenic potential of Ag NPs in the liver following ingestion. In addition, the similarities between in vitro and in vivo
Lee, Kyong Joo; Jang, Yoon Ok; Cha, Seung-Kuy; Kim, Moon Young; Park, Kyu-Sang; Eom, Young Woo; Baik, Soon Koo
2018-04-27
Fibroblast growth factor (FGF) 21 is associated with hepatic inflammation and fibrosis. However, little is known regarding the effects of inflammation and fibrosis on the β-Klotho and FGF21 pathway in the liver. Enrolled patients had biopsy-confirmed viral or alcoholic hepatitis. FGF19, FGF21 and β-Klotho levels were evaluated using enzyme-linked immunosorbent assay, real-time polymerase chain reaction, and Western blotting. Furthermore, we explored the underlying mechanisms for this process by evaluating nuclear factor-κB (NF-κB) and c-Jun N-terminal kinase (JNK) pathway involvement in Huh-7 cells. We observed that the FGF19 and FGF21 serum and mRNA levels in the biopsied liver tissue gradually increased and were correlated with fibrosis stage. Inflammatory markers (interleukin 1β [IL-1β], IL-6, and tumor necrosis factor-α) were positively correlated, while β-Klotho expression was negatively correlated with the degree of fibrosis. In Huh-7 cells, IL-1β increased FGF21 levels and decreased β-Klotho levels. NF-κB and JNK inhibitors abolished the effect of IL-1β on both FGF21 and β-Klotho expression. FGF21 protected IL-1β-induced growth retardation in Huh-7 cells. These results indicate that the inflammatory response during fibrogenesis increases FGF21 levels and suppresses β-Klotho via the NF-κB and JNK pathway. In addition, FGF21 likely protects hepatocytes from hepatic inflammation and fibrosis.
Development of scaffold architectures and heterotypic cell systems for hepatocyte transplantation
NASA Astrophysics Data System (ADS)
Alzebdeh, Dalia Abdelrahim
In vitro assembly of functional liver tissue is needed to enable the transplantation of tissue-engineered livers. In addition, there is an increasing demand for in vitro models that replicate complex events occurring in the liver. However, tissue engineering of sizable implantable liver systems is currently limited by the difficulty of assembling three dimensional hepatocyte cultures of a useful size, while maintaining full cell viability, an issue which is closely related to the high metabolic rate of hepatocytes. In this study, we first compared two designs of highly porous chitosan-heparin scaffolds seeded with hepatocytes in dynamic perfusion bioreactor systems. The aim was to promote cell seeding efficiency by effectively entrapping 100 million hepatocytes at high density. We found that scaffolds with radially tapering pore architecture had highly efficient cell entrapment that maximized donor hepatocyte utilization, compared to alternate pore structures. Hepatocytes showed higher seeding efficiency and metabolic function when seeded as single cell suspensions as opposed to pre-formed, 100microm aggregates. Seeding efficiency was found to increase with flow rate, with single cell and aggregate suspension exhibiting different optimal flow rates. However, metabolic performance results indicated significant shear damage to cells at high efficiency flow rates. To better maintain hepatocyte basement membrane and cell polarity, spheroid co-cultures with mesenchymal stem cells (MSC) were investigated. Hepatocytes and MSCs were seeded in three different architectures in an effort to optimize the spatial arrangement of the two cell types. MSC co-culture greatly enhanced hepatocyte metabolic function in agitated cultures. Interestingly, the effects of diffusion limitations in spheroid culture, coupled with shear damage and subsequent removal of outer hepatocyte layers produced a defined oscillation of urea production rates in certain co-culture arrangements. A
Growth/differentiation factor-11: an evolutionary conserved growth factor in vertebrates.
Funkenstein, Bruria; Olekh, Elena
2010-11-01
Growth and differentiation factor-11 (GDF-11) is a member of the transforming growth factor-β superfamily and is thought to be derived together with myostatin (known also as GDF-8) from an ancestral gene. In the present study, we report the isolation and characterization of GDF-11 homolog from a marine teleost, the gilthead sea bream Sparus aurata, and show that this growth factor is highly conserved throughout vertebrates. Using bioinformatics, we identified GDF-11 in Tetraodon, Takifugu, medaka, and stickleback and found that they are highly conserved at the amino acid sequence as well as gene organization. Moreover, we found conservation of syntenic relationships among vertebrates in the GDF-11 locus. Transcripts for GDF-11 can be found in eggs and early embryos, albeit at low levels, while in post-hatching larvae expression levels are high and decreases as development progresses, suggesting that GDF-11 might have a role during early development of fish as found in tetrapods and zebrafish. Finally, GDF-11 is expressed in various tissues in the adult fish including muscle, brain, and eye.
Wang, Bo; Jakus, Adam E.; Baptista, Pedro M.; Soker, Shay; Soto-Gutierrez, Alejandro; Abecassis, Michael M.; Shah, Ramille N.
2016-01-01
Induced pluripotent stem cells (iPSCs) are new diagnostic and potentially therapeutic tools to model disease and assess the toxicity of pharmaceutical medications. A common limitation of cell lineages derived from iPSCs is a blunted phenotype compared with fully developed, endogenous cells. We examined the influence of novel three-dimensional bioartificial microenvironments on function and maturation of hepatocyte-like cells differentiated from iPSCs and grown within an acellular, liver-derived extracellular matrix (ECM) scaffold. In parallel, we also compared a bioplotted poly-l-lactic acid (PLLA) scaffold that allows for cell growth in three dimensions and formation of cell-cell contacts but is infused with type I collagen (PLLA-collagen scaffold) alone as a “deconstructed” control scaffold with narrowed biological diversity. iPSC-derived hepatocytes cultured within both scaffolds remained viable, became polarized, and formed bile canaliculi-like structures; however, cells grown within ECM scaffolds had significantly higher P450 (CYP2C9, CYP3A4, CYP1A2) mRNA levels and metabolic enzyme activity compared with iPSC hepatocytes grown in either bioplotted PLLA collagen or Matrigel sandwich control culture. Additionally, the rate of albumin synthesis approached the level of primary cryopreserved hepatocytes with lower transcription of fetal-specific genes, α-fetoprotein and CYP3A7, compared with either PLLA-collagen scaffolds or sandwich culture. These studies show that two acellular, three-dimensional culture systems increase the function of iPSC-derived hepatocytes. However, scaffolds derived from ECM alone induced further hepatocyte maturation compared with bioplotted PLLA-collagen scaffolds. This effect is likely mediated by the complex composition of ECM scaffolds in contrast to bioplotted scaffolds, suggesting their utility for in vitro hepatocyte assays or drug discovery. Significance Through the use of novel technology to develop three-dimensional (3D
Rat hepatocytes transport water mainly via a non-channel-mediated pathway.
Yano, M; Marinelli, R A; Roberts, S K; Balan, V; Pham, L; Tarara, J E; de Groen, P C; LaRusso, N F
1996-03-22
During bile formation by the liver, large volumes of water are transported across two epithelial barriers consisting of hepatocytes and cholangiocytes (i.e. intrahepatic bile duct epithelial cells). We recently reported that a water channel, aquaporin-channel-forming integral protein of 28 kDa, is present in cholangiocytes and suggested that it plays a major role in water transport by these cells. Since the mechanisms of water transport across hepatocytes remain obscure, we performed physiological, molecular, and biochemical studies on hepatocytes to determine if they also contain water channels. Water permeability was studied by exposing isolated rat hepatocytes to buffers of different osmolarity and measuring cell volume by quantitative phase contrast, fluorescence and laser scanning confocal microscopy. Using this method, hepatocytes exposed to hypotonic buffers at 23 degrees C increased their cell volume in a time and osmolarity-dependent manner with an osmotic water permeability coefficient of 66.4 x 10(-4) cm/s. In studies done at 10 degrees C, the osmotic water permeability coefficient decreased by 55% (p < 0.001, at 23 degrees C; t test). The derived activation energy from these studies was 12.8 kcal/mol. After incubation of hepatocytes with amphotericin B at 10 degrees C, the osmotic water permeability coefficient increased by 198% (p < 0.001) and the activation energy value decreased to 3.6 kcal/mol, consistent with the insertion of artificial water channels into the hepatocyte plasma membrane. Reverse transcriptase polymerase chain reaction with hepatocyte RNA as template did not produce cDNAs for three of the known water channels. Both the cholesterol content and the cholesterol/phospholipid ratio of hepatocyte plasma membranes were significantly (p < 0.005) less than those of cholangiocytes; membrane fluidity of hepatocytes estimated by measuring steady-state anisotropy was higher than that of cholangiocytes. Our data suggests that the osmotic flow of
Anitua, Eduardo; Zalduendo, Mari Mar; Alkhraisat, Mohammad Hamdan; Orive, Gorka
2013-10-01
Many studies have evaluated the biological effects of platelet rich plasma reporting the final outcomes on cell and tissues. However, few studies have dealt with the kinetics of growth factor delivery by plasma rich in growth factors. Venous blood was obtained from three healthy volunteers and processed with PRGF-Endoret technology to prepare autologous plasma rich in growth factors. The gel-like fibrin scaffolds were then incubated in triplicate, in a cell culture medium to monitor the release of PDGF-AB, VEGF, HGF and IGF-I during 8 days of incubation. A leukocyte-platelet rich plasma was prepared employing the same technology and the concentrations of growth factors and interleukin-1β were determined after 24h of incubation. After each period, the medium was collected, fibrin clot was destroyed and the supernatants were stored at -80°C until analysis. The growth factor delivery is diffusion controlled with a rapid initial release by 30% of the bioactive content after 1h of incubation and a steady state release when almost 70% of the growth factor content has been delivered. Autologous fibrin matrix retained almost 30% of the amount of the growth factors after 8 days of incubation. The addition of leukocytes to the formula of platelet rich plasma did not increase the concentration of the growth factors, while it drastically increased the presence of pro-inflammatory IL-1β. Further studies employing an in vitro inflammatory model would be interesting to study the difference in growth factors and pro-inflammatory cytokines between leukocyte-free and leukocyte-rich platelet rich plasma. Copyright © 2013 Elsevier GmbH. All rights reserved.
Barbon, Elena; Pignani, Silvia; Branchini, Alessio; Bernardi, Francesco; Pinotti, Mirko; Bovolenta, Matteo
2016-06-24
Tailored approaches to restore defective transcription responsible for severe diseases have been poorly explored. We tested transcription activator-like effectors fused to an activation domain (TALE-TFs) in a coagulation factor VII (FVII) deficiency model. In this model, the deficiency is caused by the -94C > G or -61T > G mutation, which abrogate the binding of Sp1 or HNF-4 transcription factors. Reporter assays in hepatoma HepG2 cells naturally expressing FVII identified a single TALE-TF (TF4) that, by targeting the region between mutations, specifically trans-activated both the variant (>100-fold) and wild-type (20-40-fold) F7 promoters. Importantly, in the genomic context of transfected HepG2 and transduced primary hepatocytes, TF4 increased F7 mRNA and protein levels (2- to 3-fold) without detectable off-target effects, even for the homologous F10 gene. The ectopic F7 expression in renal HEK293 cells was modestly affected by TF4 or by TALE-TF combinations. These results provide experimental evidence for TALE-TFs as gene-specific tools useful to counteract disease-causing promoter mutations.
Park, Ji-hyun; Yoon, Jaewoo
2015-04-01
The transforming growth factor (TGF)-β1 plays a crucial role in the induction of the epithelial-to-mesenchymal transition (EMT) in hepatocytes, which contributes to the pathogenesis of liver fibrosis. The inhibition of the TGF-β1 cascade suppresses EMT and the resultant fibrosis. Schizandrin (Sch) has various therapeutic effects on a range of medical conditions such as anti-asthmatic, anti-cancer, and anti-inflammatory effects. However, the effect of Sch on TGF-β1-stimulated hepatic fibrosis and EMT is still unknown. In the present investigation, we evaluated the anti-fibrotic and anti-EMT properties of Sch and its underlying mechanisms in murine hepatocyte AML12 cells. Overall, we found that Sch inhibited the pro-fibrotic activity of TGF-β1 in AML12 cells; thus, it suppressed the accumulation of ECM proteins. Also, Sch inhibited the EMT as assessed by reduced expression of vimentin and fibronectin, and increased E-cadherin and ZO-1 in TGF-β1 induced AML12 cells. Sch reduced TGF-β1-mediated phosphorylation of Smad2/3 and Smad3/4 DNA binding activity. On the other hand, Sch reduced TGF-β1-induced ERK1/2 and PI3K/Akt phosphorylation in the non-Smad pathway. In conclusion, Sch can antagonize TGF-β1-mediated fibrosis and EMT in AML12 cells. Sch may possess potential as an anti-fibrotic molecule in the treatment of liver fibrosis. Copyright © 2015 Elsevier B.V. All rights reserved.
Genetic Abolishment of Hepatocyte Proliferation Activates Hepatic Stem Cells
Endo, Yoko; Zhang, Mingjun; Yamaji, Sachie; Cang, Yong
2012-01-01
Quiescent hepatic stem cells (HSCs) can be activated when hepatocyte proliferation is compromised. Chemical injury rodent models have been widely used to study the localization, biomarkers, and signaling pathways in HSCs, but these models usually exhibit severe promiscuous toxicity and fail to distinguish damaged and non-damaged cells. Our goal is to establish new animal models to overcome these limitations, thereby providing new insights into HSC biology and application. We generated mutant mice with constitutive or inducible deletion of Damaged DNA Binding protein 1 (DDB1), an E3 ubiquitin ligase, in hepatocytes. We characterized the molecular mechanism underlying the compensatory activation and the properties of oval cells (OCs) by methods of mouse genetics, immuno-staining, cell transplantation and gene expression profiling. We show that deletion of DDB1 abolishes self-renewal capacity of mouse hepatocytes in vivo, leading to compensatory activation and proliferation of DDB1-expressing OCs. Partially restoring proliferation of DDB1-deficient hepatocytes by ablation of p21, a substrate of DDB1 E3 ligase, alleviates OC proliferation. Purified OCs express both hepatocyte and cholangiocyte markers, form colonies in vitro, and differentiate to hepatocytes after transplantation. Importantly, the DDB1 mutant mice exhibit very minor liver damage, compared to a chemical injury model. Microarray analysis reveals several previously unrecognized markers, including Reelin, enriched in oval cells. Here we report a genetic model in which irreversible inhibition of hepatocyte duplication results in HSC-driven liver regeneration. The DDB1 mutant mice can be broadly applied to studies of HSC differentiation, HSC niche and HSCs as origin of liver cancer. PMID:22384083
Fox, I J; Chowdhury, N R; Gupta, S; Kondapalli, R; Schilsky, M L; Stockert, R J; Chowdhury, J R
1995-03-01
Viral vectors and protein carriers utilizing asialoglycoprotein receptor (ASGR)-mediated endocytosis are being developed to transfer genes for the correction of bilirubin-UDP-glucuronosyltransferase (bilirubin-UGT) deficiency. Ex vivo evaluation of these gene transfer vectors would be facilitated by a cell system that lacks bilirubin-UGT, but expresses differentiated liver functions, including ASGR. We immortalized primary Gunn rat hepatocytes by transduction with a recombinant Moloney murine leukemia virus expressing a thermolabile mutant SV40 large T antigen (tsA58). At 33 degrees C, the immortalized hepatocyte clones expressed SV40 large T antigen, synthesized DNA, and doubled in number every 2 to 3 days. At this temperature, differentiated hepatocyte markers, e.g., albumin, ASGR, and androsterone-UGT, were expressed at 5% to 10% of the levels found in primary hepatocytes maintained in culture for 24 hours. Glutathione-S-transferase Yp (GST-Yp), an oncofetal protein, was expressed in these cells at 33 degrees C, but was undetectable in primary hepatocytes. In contrast, when the cells were cultured at 39 degrees C or 37 degrees C, the large T antigen was degraded, DNA synthesis and cell growth stopped, and morphologic characteristics of differentiated hepatocytes were observed. The expression of albumin, ASGR, and androsterone-UGT, and their corresponding mRNAs, increased to 25% to 40% of the level in primary hepatocytes, whereas GST-Yp expression decreased. Functionality of ASGR was demonstrated by internalization of Texas red-labeled asialoorosomucoid, and binding and degradation of 125I-asialoorosomucoid. After liposome-mediated transfer of a plasmid containing the coding region of human bilirubin-UGT1, driven by the SV40 large T promoter, active human bilirubin-UGT1 was expressed in these cells. The immortalized cells were not tumorigenic after transplantation into severe combined immunodeficiency mice. These conditionally immortalized cells will be useful
Hepatocyte attachment to laminin is mediated through multiple receptors
1990-01-01
The interaction of hepatocytes with the basement membrane glycoprotein laminin was studied using synthetic peptides derived from laminin sequences. Rat hepatocytes bind to laminin and three different sites within the A and B1 chains of laminin were identified. Active laminin peptides include the PA22-2 peptide (close to the carboxyl end of the long arm in the A chain), the RGD-containing peptide, PA21 (in the short arm of the A chain) and the pentapeptide YIGSR (in the short arm of the B1 chain). PA22-2 was the most potent peptide, whereas the other two peptides had somewhat lower activity. Furthermore, hepatocyte attachment to laminin was inhibited by the three peptides, with PA22-2 being the most active. Various proteins from isolated membranes of cell- surface iodinated hepatocytes bound to a laminin affinity column including three immunologically related binding proteins : Mr = 67,000, 45,000, and 32,000. Several proteins--Mr = 80,000, 55,000, and 38,000- 36,000--with a lower affinity for laminin were also identified. Affinity chromatography on peptide columns revealed that the PA22-2 peptide specifically bound the Mr = 80,000, 67,000, 45,000, and 32,000 proteins, the PA21 peptide bound the Mr = 45,000 and 38,000-36,000 proteins and the YIGSR peptide column bound the 38,000-36,000 protein. Antisera to a bacterial fusion protein of the 32-kD laminin-binding protein (LBP-32) reacted strongly with the three laminin-binding proteins, Mr = 67,000, 45,000, and 32,000, showing that they are immunologically related. Immunoperoxidase microscopy studies confirmed that these proteins are present within the plasma membrane of the hepatocyte. The antisera inhibited the adhesion of hepatocytes to hepatocytes to laminin by 30%, supporting the finding that these receptors and others mediate the attachment of hepatocytes to several regions of laminin. PMID:2136861
Berdiaki, Aikaterini; Tzardi, Maria
2015-01-01
Breast cancer is the most common type of cancer for women worldwide with a lifetime risk amounting to a staggering total of 10%. It is well established that the endogenous synthesis of insulin-like growth factor (IGF) and epidermal growth factor (EGF) polypeptide growth factors are closely correlated to malignant transformation and all the steps of the breast cancer metastatic cascade. Numerous studies have demonstrated that both estrogens and growth factors stimulate the proliferation of steroid-dependent tumor cells, and that the interaction between these signaling pathways occurs at several levels. Importantly, the majority of breast cancer cases are estrogen receptor- (ER-) positive which have a more favorable prognosis and pattern of recurrence with endocrine therapy being the backbone of treatment. Unfortunately, the majority of patients progress to endocrine therapy resistant disease (acquired resistance) whereas a proportion of patients may fail to respond to initial therapy (de novo resistance). The IGF-I and EGF downstream signaling pathways are closely involved in the process of progression to therapy resistant disease. Modifications in the bioavailability of these growth factors contribute critically to disease progression. In the present review therefore, we will discuss in depth how IGF and EGF signaling participate in breast cancer pathogenesis and progression to endocrine resistant disease. PMID:26258011
Schlegel, Werner; Raimann, Adalbert; Halbauer, Daniel; Scharmer, Daniela; Sagmeister, Susanne; Wessner, Barbara; Helmreich, Magdalena; Haeusler, Gabriele; Egerbacher, Monika
2013-01-01
Human insulin-like growth factor 1 Ec (IGF-1Ec), also called mechano growth factor (MGF), is a splice variant of insulin-like growth factor 1 (IGF-1), which has been shown in vitro as well as in vivo to induce growth and hypertrophy in mechanically stimulated or damaged muscle. Growth, hypertrophy and responses to mechanical stimulation are important reactions of cartilaginous tissues, especially those in growth plates. Therefore, we wanted to ascertain if MGF is expressed in growth plate cartilage and if it influences proliferation of chondrocytes, as it does in musculoskeletal tissues. MGF expression was analyzed in growth plate and control tissue samples from piglets aged 3 to 6 weeks. Furthermore, growth plate chondrocyte cell culture was used to evaluate the effects of the MGF peptide on proliferation. We showed that MGF is expressed in considerable amounts in the tissues evaluated. We found the MGF peptide to be primarily located in the cytoplasm, and in some instances, it was also found in the nucleus of the cells. Addition of MGF peptides was not associated with growth plate chondrocyte proliferation.
High Efficient Differentiation of Functional Hepatocytes from Porcine Induced Pluripotent Stem Cells
Ao, Ying; Mich-Basso, Jocelyn Danielle; Lin, Bo; Yang, Lei
2014-01-01
Hepatocyte transplantation is considered to be a promising therapy for patients with liver diseases. Induced pluripotent stem cells (iPSCs) provide an unlimited source for the generation of functional hepatocytes. In this study, we generated iPSCs from porcine ear fibroblasts (PEFs) by overexpressing Sox2, Klf4, Oct4, and c-Myc (SKOM), and developed a novel strategy for the efficient differentiation of hepatocyte-like cells from porcine iPSCs by following the processes of early liver development. The differentiated cells displayed the phenotypes of hepatocytes, exhibited classic hepatocyte-associated bio-functions, such as LDL uptake, glycogen storage and urea secretion, as well as possessed the metabolic activities of cytochrome P-450 (CYP) 3A and 2C. Furthermore, we compared the hepatocyte differentiation efficacy of our protocol with another published method, and the results demonstrated that our differentiation strategy could significantly improve the generation of morphological and functional hepatocyte-like cells from porcine iPSCs. In conclusion, this study establishes an efficient method for in vitro generation of functional hepatocytes from porcine iPSCs, which could represent a promising cell source for preclinical testing of cell-based therapeutics for liver failure and for pharmacological applications. PMID:24949734
De Santis Puzzonia, Marco; Cozzolino, Angela Maria; Grassi, Germana; Bisceglia, Francesca; Strippoli, Raffaele; Guarguaglini, Giulia; Citarella, Franca; Sacchetti, Benedetto; Tripodi, Marco; Marchetti, Alessandra; Amicone, Laura
2016-01-01
In all mammals, the adult liver shows binucleated as well as mononucleated polyploid hepatocytes. The hepatic polyploidization starts after birth with an extensive hepatocyte binucleation and generates hepatocytes of several ploidy classes. While the functional significance of hepatocyte polyploidy is becoming clearer, how it is triggered and maintained needs to be clarified. Aim of this study was to identify a major inducer of hepatocyte binucleation/polyploidization and the cellular and molecular mechanisms involved. We found that, among several cytokines analyzed, known to be involved in early liver development and/or mass control, TGFbeta1 was capable to induce, together with the expected morphological changes, binucleation in hepatocytes in culture. Most importantly, the pharmacological inhibition of TGFbeta signaling in healthy mice during weaning, when the physiological binucleation occurs, induced a significant decrease of hepatocyte binucleation rate, without affecting cell proliferation and hepatic index. The TGFbeta-induced hepatocyte binucleation resulted from a cytokinesis failure, as assessed by video microscopy, and is associated with a delocalization of the cytokinesis regulator RhoA-GTPase from the mid-body of dividing cells. The use of specific chemical inhibitors demonstrated that the observed events are Src-dependent. Finally, the restoration of a fully epithelial phenotype by TGFbeta withdrawal gave rise to a cell progeny capable to maintain the polyploid state. In conclusion, we identified TGFbeta as a major inducer of hepatocyte binucleation both in vitro and in vivo, thus ascribing a novel role to this pleiotropic cytokine. The production of binucleated/tetraploid hepatocytes is due to a cytokinesis failure controlled by the molecular axis TGFbeta/Src/RhoA.
Growth factors for nanobacteria
NASA Astrophysics Data System (ADS)
Ciftcioglu, Neva; Kajander, E. Olavi
1999-12-01
Nanobacteria are novel microorganisms recently isolated from fetal bovine serum and blood of cows and humans. These coccoid, gram negative bacteria in alpha-2 subgroup of Proteobacteria grow slowly under mammalian cell culture conditions but not in common media for microbes. Now we have found two different kinds of culture supplement preparations that improve their growth and make them culturable in the classical sense. These are supernatant fractions of conditioned media obtained from 1 - 3 months old nanobacteria cultures and from about a 2 weeks old Bacillus species culture. Both improved multiplication and particle yields and the latter increased their resistance to gentamicin. Nanobacteria cultured with any of the methods shared similar immunological property, structure and protein pattern. The growth supporting factors were heat-stabile and nondialyzable, and dialysis improved the growth promoting action. Nanobacteria formed stony colonies in a bacteriological medium supplemented with the growth factors. This is an implication that nanobacterial growth is influenced by pre-existing bacterial flora.
Lange, K; Brandt, U; Gartzke, J; Bergmann, J
1998-02-25
In previous studies we have shown that the insulin-responding glucose transporter isoform of 3T3-L1 adipocytes, GluT4, is almost completely located on microvilli. Furthermore, insulin caused the integration of these microvilli into the plasma membrane, suggesting that insulin-induced stimulation of glucose uptake may be due to the destruction of the cytoskeletal diffusion barrier formed by the actin filament bundle of the microvillar shaft regions [Lange et al. (1990) FEBS Lett. 261, 459-463; Lange et al. (1990) FEBS Lett. 276, 39-41]. Similar shape changes in microvilli were observed when the transport rates of adipocytes were modulated by glucose feeding or starvation. Here we demonstrate that the action of insulin on the surface morphology of hepatocytes is identical to that on 3T3L1 adipocytes; small and narrow microvilli on the surface of unstimulated hepatocytes were rapidly shortened and dilated on top of large domed surface areas. The aspect and mechanism of this effect are closely related to "membrane ruffling" induced by insulin and other growth factors. Pretreatment of hepatocytes with the PI 3-kinase inhibitor wortmannin (100 nM), which completely prevents transport stimulation by insulin in adipocytes and other cell types, also inhibited insulin-induced shape changes in microvilli on the hepatocyte surface. In contrast, vasopressin-induced microvillar shape changes in hepatocytes [Lange et al. (1997) Exp. Cell Res. 234, 486-497] were insensitive to wortmannin pretreatment. These findings indicate that PI 3-kinase products are necessary for stimulation of submembrane microfilament dynamics and that cytoskeletal reorganization is critically involved in insulin stimulation of transport processes. The mechanism of the insulin-induced cytoskeletal reorganization can be explained on the basis of the recent finding of Lu et al. [Biochemistry 35(1996) 14027-14034] that PI 3-kinase products exhibit much higher affinity for the profilin-actin complex than the
Yoshida, Katsunori; Matsuzaki, Koichi; Mori, Shigeo; Tahashi, Yoshiya; Yamagata, Hideo; Furukawa, Fukiko; Seki, Toshihito; Nishizawa, Mikio; Fujisawa, Junichi; Okazaki, Kazuichi
2005-04-01
After liver injury, transforming growth factor-beta (TGF-beta) and platelet-derived growth factor (PDGF) regulate the activation of hepatic stellate cells (HSCs) and tissue remodeling. Mechanisms of PDGF signaling in the TGF-beta-triggered cascade are not completely understood. TGF-beta signaling involves phosphorylation of Smad2 and Smad3 at linker and C-terminal regions. Using antibodies to distinguish Smad2/3 phosphorylated at linker regions from those phosphorylated at C-terminal regions, we investigated Smad2/3-mediated signaling in rat liver injured by CCl(4) administration and in cultured HSCs. In acute liver injury, Smad2/3 were transiently phosphorylated at both regions. Although linker-phosphorylated Smad2 remained in the cytoplasm of alpha-smooth muscle actin-immunoreactive mesenchymal cells adjacent to necrotic hepatocytes in centrilobular areas, linker-phosphorylated Smad3 accumulated in the nuclei. c-Jun N-terminal kinase (JNK) in the activated HSCs directly phosphorylated Smad2/3 at linker regions. Co-treatment of primary cultured HSCs with TGF-beta and PDGF activated the JNK pathway, subsequently inducing endogenous linker phosphorylation of Smad2/3. The JNK pathway may be involved in migration of resident HSCs within the space of Disse to the sites of tissue damage because the JNK inhibitor SP600125 inhibited HSC migration induced by TGF-beta and PDGF signals. Moreover, treatment of HSCs with both TGF-beta and PDGF increased transcriptional activity of plasminogen activator inhibitor-1 through linker phosphorylation of Smad3. In conclusion, TGF-beta and PDGF activate HSCs by transmitting their signals through JNK-mediated Smad2/3 phosphorylation at linker regions, both in vivo and in vitro.
Human but Not Mouse Hepatocytes Respond to Interferon-Lambda In Vivo
Hermant, Pascale; Demarez, Céline; Mahlakõiv, Tanel; Staeheli, Peter; Meuleman, Philip; Michiels, Thomas
2014-01-01
The type III interferon (IFN) receptor is preferentially expressed by epithelial cells. It is made of two subunits: IFNLR1, which is specific to IFN-lambda (IFN-λ) and IL10RB, which is shared by other cytokine receptors. Human hepatocytes express IFNLR1 and respond to IFN-λ. In contrast, the IFN-λ response of the mouse liver is very weak and IFNLR1 expression is hardly detectable in this organ. Here we investigated the IFN-λ response at the cellular level in the mouse liver and we tested whether human and mouse hepatocytes truly differ in responsiveness to IFN-λ. When monitoring expression of the IFN-responsive Mx genes by immunohistofluorescence, we observed that the IFN-λ response in mouse livers was restricted to cholangiocytes, which form the bile ducts, and that mouse hepatocytes were indeed not responsive to IFN-λ. The lack of mouse hepatocyte response to IFN-λ was observed in different experimental settings, including the infection with a hepatotropic strain of influenza A virus which triggered a strong local production of IFN-λ. With the help of chimeric mice containing transplanted human hepatocytes, we show that hepatocytes of human origin readily responded to IFN-λ in a murine environment. Thus, our data suggest that human but not mouse hepatocytes are responsive to IFN-λ in vivo. The non-responsiveness is an intrinsic property of mouse hepatocytes and is not due to the mouse liver micro-environment. PMID:24498220
Avior, Yishai; Levy, Gahl; Zimerman, Michal; Kitsberg, Daniel; Schwartz, Robert; Sadeh, Ronen; Moussaieff, Arieh; Cohen, Merav; Itskovitz-Eldor, Joseph; Nahmias, Yaakov
2015-07-01
The liver is the main organ responsible for the modification, clearance, and transformational toxicity of most xenobiotics owing to its abundance in cytochrome P450 (CYP450) enzymes. However, the scarcity and variability of primary hepatocytes currently limits their utility. Human pluripotent stem cells (hPSCs) represent an excellent source of differentiated hepatocytes; however, current protocols still produce fetal-like hepatocytes with limited mature function. Interestingly, fetal hepatocytes acquire mature CYP450 expression only postpartum, suggesting that nutritional cues may drive hepatic maturation. We show that vitamin K2 and lithocholic acid, a by-product of intestinal flora, activate pregnane X receptor (PXR) and subsequent CYP3A4 and CYP2C9 expression in hPSC-derived and isolated fetal hepatocytes. Differentiated cells produce albumin and apolipoprotein B100 at levels equivalent to primary human hepatocytes, while demonstrating an 8-fold induction of CYP450 activity in response to aryl hydrocarbon receptor (AhR) agonist omeprazole and a 10-fold induction in response to PXR agonist rifampicin. Flow cytometry showed that over 83% of cells were albumin and hepatocyte nuclear factor 4 alpha (HNF4α) positive, permitting high-content screening in a 96-well plate format. Analysis of 12 compounds showed an R(2) correlation of 0.94 between TC50 values obtained in stem cell-derived hepatocytes and primary cells, compared to 0.62 for HepG2 cells. Finally, stem cell-derived hepatocytes demonstrate all toxicological endpoints examined, including steatosis, apoptosis, and cholestasis, when exposed to nine known hepatotoxins. Our work provides fresh insights into liver development, suggesting that microbial-derived cues may drive the maturation of CYP450 enzymes postpartum. Addition of these cues results in the first functional, inducible, hPSC-derived hepatocyte for predictive toxicology. © 2015 by the American Association for the Study of Liver Diseases.
Research on growth factors in periodontology.
Smith, Patricio C; Martínez, Constanza; Cáceres, Mónica; Martínez, Jorge
2015-02-01
Growth factors play critical roles in periodontal repair through the regulation of cell behavior. Many of the cell responses regulated by these proteins include cell adhesion, migration, proliferation and differentiation. Periodontal regeneration involves an organized response of different cells, tissues and growth factors implicated in the coordination of these events. However, periodontal tissue reconstruction is an extremely difficult task. Multiple studies have been performed to understand the specific role of growth factors in periodontal wound healing. In the present review we analyze the evidence that supports the roles of growth factors in periodontal wound healing and regeneration. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Effects of edaravone, a radical scavenger, on hepatocyte transplantation.
Hayashi, Chihiro; Ito, Masahiro; Ito, Ryoutaro; Murakumo, Akiko; Yamamoto, Naoki; Hiramatsu, Noriko; Fox, Ira J; Horiguchi, Akihiko
2014-12-01
Hepatocyte transplantation (HTx) has yielded significant improvements in liver function and survival in experimentally induced acute liver failure and liver-based metabolic disease. However, transplantation is inefficient, and it is thought that transplanted hepatocytes have a shortened lifespan because of inflammation involving excess nitric oxide (NO). The present study aimed to clarify whether edaravone, a free radical scavenger used to treat ischemic stroke, could reduce ischemic changes in hepatocyte-transplanted livers. Edaravone (3 mg/kg) was administered intravenously 24 h before HTx to Nagase analbuminemic rats (NARs). Hepatocytes were isolated, and 30 × 10(6) cells were injected in a 1.0-ml volume directly into the spleens of NARs. All experimental groups studied received FK506 to control rejection. Animals in Group A received medium-only; Group B received HTx only; and Group C received HTx and edaravone. Forty-eight hours after transplantation, the hepatocytes from animals were isolated and analyzed for staining with propidium iodide- and annexin-V using flow cytometry. Liver sections were also studied by immunostaining for albumin, and TUNEL. Peripheral blood serum albumin levels were measured on post-transplant days 0, 3, 5, 7, 10 and 14 using ELISA. The edaravone-treated animals demonstrated an increased number of engrafted donor hepatocytes in the liver. The edaravone-treated liver sections also contained fewer TUNEL-positive cells and animals that received edaravone had higher serum albumin levels post-transplantation. Hepatocytes were also found to have increased in numbers 2 weeks following treatment with edaravone. Edaravone administration during HTx can suppress apoptosis near the transplanted cells, increasing engraftment. These studies indicate its potential usefulness for future clinical application. © 2014 Japanese Society of Hepato-Biliary-Pancreatic Surgery.
Synthetic heparin-binding growth factor analogs
Pena, Louis A.; Zamora, Paul; Lin, Xinhua; Glass, John D.
2007-01-23
The invention provides synthetic heparin-binding growth factor analogs having at least one peptide chain that binds a heparin-binding growth factor receptor, covalently bound to a hydrophobic linker, which is in turn covalently bound to a non-signaling peptide that includes a heparin-binding domain. The synthetic heparin-binding growth factor analogs are useful as soluble biologics or as surface coatings for medical devices.
Ververis, J; Ku, L; Delafontaine, P
1994-02-01
Insulin-like growth factor I is an important mitogen for vascular smooth muscle cells, and its effects are regulated by several binding proteins. Western ligand blotting of conditioned medium from rat aortic smooth muscle cells detected a 24 kDa binding protein and a 28 kDa glycosylated variant of this protein, consistent with insulin-like growth factor binding protein-4 by size. Low amounts of a glycosylated 38 to 42 kDa doublet (consistent with binding protein-3) and a 31 kDa non-glycosylated protein also were present. Basic fibroblast growth factor markedly increased secretion of the 24 kDa binding protein and its 28 kDa glycosylated variant. This effect was dose- and time-dependent and was inhibited by co-incubation with cycloheximide. Crosslinking of [125I]-insulin-like growth factor I to cell monolayers revealed no surface-associated binding proteins, either basally or after agonist treatment. Induction of binding protein production by fibroblast growth factor at sites of vascular injury may be important in vascular proliferative responses in vivo.
Susceptibility to Plasmodium liver stage infection is altered by hepatocyte polyploidy.
Austin, Laura S; Kaushansky, Alexis; Kappe, Stefan H I
2014-05-01
Plasmodium parasites infect hepatocytes of their mammalian hosts and undergo obligate liver stage development. The specific host cell attributes that are important for liver infection remain largely unknown. Several host signalling pathways are perturbed in infected hepatocytes, some of which are important in the generation of hepatocyte polyploidy. To test the functional consequence of polyploidy on liver infection, we infected hepatocytes with the rodent malaria parasite Plasmodium yoelii both in vitro and in vivo and examined the ploidy of infected and uninfected hepatocytes by flow cytometry. In both hepatoma cell lines and in the mouse liver, the fraction of polyploid cells was higher in the infected cell population than in the uninfected cell population. When the data were reanalysed by comparing the extent of Plasmodium infection within each ploidy subset, we found that infection rates were elevated in more highly polyploid cells and lower in diploid cells. Furthermore, we found that the parasite's preference for host cells with high ploidy is conserved among rodent malaria species and the human malaria parasite Plasmodium falciparum. This parasite preference for host cells of high ploidy cannot be explained by differences in hepatocyte size or DNA replication. We conclude that Plasmodium preferentially infects and develops in polyploid hepatocytes. © 2014 John Wiley & Sons Ltd.
Susceptibility to Plasmodium liver stage infection is altered by hepatocyte polyploidy
Austin, Laura S.; Kaushansky, Alexis; Kappe, Stefan H.I.
2014-01-01
Summary Plasmodium parasites infect hepatocytes of their mammalian hosts and within undergo obligate liver stage development. The specific host cell attributes that are important for liver infection remain largely unknown. Several host signaling pathways are perturbed in infected hepatocytes, some of which are important in the generation of hepatocyte polyploidy. To test the functional consequence of polyploidy in liver infection, we infected hepatocytes with the rodent malaria parasite Plasmodium yoelii both in vitro and in vivo and examined the ploidy of infected and uninfected hepatocytes by flow cytometry. In both hepatoma cell lines and in the mouse liver, the fraction of polyploid cells was higher in the infected cell population than in the uninfected cell population. When the data were reanalyzed by comparing the extent of Plasmodium infection within each ploidy subset, we found that infection rates were elevated in more highly polyploid cells and lower in diploid cells. Furthermore, we found that the parasite’s preference for host cells with high ploidy is conserved among rodent malaria species and the human malaria parasite Plasmodium falciparum. This parasite preference for host cells of high ploidy cannot be explained by differences in hepatocyte size or DNA replication. We conclude that Plasmodium preferentially infects and develops in polyploid hepatocytes. PMID:24612025
Rubiolo, Juan Andrés; Mithieux, Gilles; Vega, Félix Victor
2008-09-04
Oxidative stress is recognized as an important factor in the development of liver pathologies. The reactive oxygen species endogenously generated or as a consequence of xenobiotic metabolism are eliminated by enzymatic and nonenzymatic cellular systems. Besides endogen defences, the antioxidant consumption in the diet has an important role in the protection against the development of diseases product of oxidative damage. Resveratrol is a naturally occurring compound which is part of the human diet. This molecule has been shown to have many biological properties, including antioxidant activity. We decided to test if resveratrol could protect primary hepatocytes in culture from oxidative stress damage and if so, to determine if this compound affects the cellular detoxifying systems and their regulation through the Nrf2 transcription factor that regulates the expression of antioxidant and phase II detoxifying enzymes. Cell death by necrosis was detected by measuring the activity of lactate dehydrogenase liberated to the medium. The activities of antioxidant and phase II enzymes were measured using previously described methods. Activation of the Nrf2 transcription factor was studied by confocal microscopy and the Nrf2 and its coding mRNA levels were determined by western blot and quantitative PCR respectively. Resveratrol pre-treatment effectively protected hepatocytes in culture exposed to oxidative stress, increasing the activities of catalase, superoxide dismutase, glutathione peroxidase, NADPH quinone oxidoreductase and glutathione-S-transferase. Resveratrol increases the level of Nrf2 and induces its translocation to the nucleus. Also, it increases the concentration of the coding mRNA for Nrf2. In this work we show that resveratrol could be a useful drug for the protection of liver cells from oxidative stress induced damage.
Mason, Roger M
2013-01-01
Connective tissue growth factor (CTGF, CCN2) is a member of the CCN family of matricellular proteins. It interacts with many other proteins, including plasma membrane proteins, modulating cell function. It is expressed at low levels in normal adult kidney cells but is increased in kidney diseases, playing important roles in inflammation and in the development of glomerular and interstitial fibrosis in chronic disease. This review reports the evidence for its expression in human and animal models of chronic kidney disease and summarizes data showing that anti-CTGF therapy can successfully attenuate fibrotic changes in several such models, suggesting that therapies targeting CTGF and events downstream of it in renal cells may be useful for the treatment of human kidney fibrosis. Connective tissue growth factor stimulates the development of fibrosis in the kidney in many ways including activating cells to increase extracellular matrix synthesis, inducing cell cycle arrest and hypertrophy, and prolonging survival of activated cells. The relationship between CTGF and the pro-fibrotic factor TGFβ is examined and mechanisms by which CTGF promotes signalling by the latter are discussed. No specific cellular receptors for CTGF have been discovered but it interacts with and activates several plasma membrane proteins including low-density lipoprotein receptor-related protein (LRP)-1, LRP-6, tropomyosin-related kinase A, integrins and heparan sulphate proteoglycans. Intracellular signalling and downstream events triggered by such interactions are reviewed. Finally, the relationships between CTGF and several anti-fibrotic factors, such as bone morphogenetic factor-4 (BMP4), BMP7, hepatocyte growth factor, CCN3 and Oncostatin M, are discussed. These may determine whether injured tissue heals or progresses to fibrosis. PMID:23110747
Grassi, Germana; Bisceglia, Francesca; Strippoli, Raffaele; Guarguaglini, Giulia; Citarella, Franca; Sacchetti, Benedetto; Tripodi, Marco; Amicone, Laura
2016-01-01
In all mammals, the adult liver shows binucleated as well as mononucleated polyploid hepatocytes. The hepatic polyploidization starts after birth with an extensive hepatocyte binucleation and generates hepatocytes of several ploidy classes. While the functional significance of hepatocyte polyploidy is becoming clearer, how it is triggered and maintained needs to be clarified. Aim of this study was to identify a major inducer of hepatocyte binucleation/polyploidization and the cellular and molecular mechanisms involved. We found that, among several cytokines analyzed, known to be involved in early liver development and/or mass control, TGFbeta1 was capable to induce, together with the expected morphological changes, binucleation in hepatocytes in culture. Most importantly, the pharmacological inhibition of TGFbeta signaling in healthy mice during weaning, when the physiological binucleation occurs, induced a significant decrease of hepatocyte binucleation rate, without affecting cell proliferation and hepatic index. The TGFbeta-induced hepatocyte binucleation resulted from a cytokinesis failure, as assessed by video microscopy, and is associated with a delocalization of the cytokinesis regulator RhoA-GTPase from the mid-body of dividing cells. The use of specific chemical inhibitors demonstrated that the observed events are Src-dependent. Finally, the restoration of a fully epithelial phenotype by TGFbeta withdrawal gave rise to a cell progeny capable to maintain the polyploid state. In conclusion, we identified TGFbeta as a major inducer of hepatocyte binucleation both in vitro and in vivo, thus ascribing a novel role to this pleiotropic cytokine. The production of binucleated/tetraploid hepatocytes is due to a cytokinesis failure controlled by the molecular axis TGFbeta/Src/RhoA. PMID:27893804
HCV core protein promotes hepatocyte proliferation and chemoresistance by inhibiting NR4A1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tan, Yongsheng, E-mail: yongshengtanwhu@126.com; Li, Yan, E-mail: liyansd2@163.com
This study investigated the effect of HCV core protein on the proliferation of hepatocytes and hepatocellular carcinoma cells (HCC), the influence of HCV core protein on HCC apoptosis induced by the chemotherapeutic agent cisplatin, and the mechanism through which HCV core protein acts as a potential oncoprotein in HCV-related HCC by measuring the levels of NR4A1 and Runt-related transcription factor 3 (RUNX3), which are associated with tumor suppression and chemotherapy resistance. In the present study, PcDNA3.1-core and RUNX3 siRNA were transfected into LO2 and HepG2 cells using Lipofectamine 2000. LO2-core, HepG2-core, LO2-RUNX3 {sup low} and control cells were treated withmore » different concentrations of cisplatin for 72 h, and cell proliferation and apoptosis were assayed using the CellTiter 96{sup ®}Aqueous Non-Radioactive Cell Proliferation Assay Kit. Western blot and real time PCR analyses were used to detect NR4A1, RUNX3, smad7, Cyclin D1 and BAX. Confocal microscopy was used to determine the levels of NR4A1 in HepG2 and HepG2-core cells. The growth rate of HepG2-core cells was considerably greater than that of HepG2 cells. HCV core protein increased the expression of cyclin D1 and decreased the expressions of NR4A1 and RUNX3. In LO2 – RUNX3 {sup low}, the rate of cell proliferation and the level of cisplatin resistance were the same as in the LO2 -core. These results suggest that HCV core protein decreases the sensitivity of hepatocytes to cisplatin by inhibiting the expression of NR4A1 and promoting the expression of smad7, which negatively regulates the TGF-β pathway. This effect results in down regulation of RUNX3, a target of the TGF-β pathway. Taken together, these findings indicate that in hepatocytes, HCV core protein increases drug resistance and inhibits cell apoptosis by inhibiting the expressions of NR4A1 and RUNX3. - Highlights: • HCV core protein inhibits HepG2 cell sensitivity to cisplatin. • Core expression in HepG2 decreases
Yamada, Tomoya; Okuda, Yu; Kushida, Masahiko; Sumida, Kayo; Takeuchi, Hayato; Nagahori, Hirohisa; Fukuda, Takako; Lake, Brian G; Cohen, Samuel M; Kawamura, Satoshi
2014-11-01
High doses of sodium phenobarbital (NaPB), a constitutive androstane receptor (CAR) activator, have been shown to produce hepatocellular tumors in rodents by a mitogenic mode of action (MOA) involving CAR activation. The effect of 1-week dietary treatment with NaPB on liver weight and histopathology, hepatic CYP2B enzyme activity and CYP2B/3A mRNA expression, replicative DNA synthesis and selected genes related to cell proliferation, and functional transcriptomic and metabolomic analyses was studied in male CD-1 mice, Wistar Hannover (WH) rats, and chimeric mice with human hepatocytes. The treatment of chimeric mice with 1000-1500-ppm NaPB resulted in plasma levels around 3-5-fold higher than those observed in human subjects given therapeutic doses of NaPB. NaPB produced dose-dependent increases in hepatic CYP2B activity and CYP2B/3A mRNA levels in all animal models. Integrated functional metabolomic and transcriptomic analyses demonstrated that the responses to NaPB in the human liver were clearly different from those in rodents. Although NaPB produced a dose-dependent increase in hepatocyte replicative DNA synthesis in CD-1 mice and WH rats, no increase in replicative DNA synthesis was observed in human hepatocyte-originated areas of chimeric mice. In addition, treatment with NaPB had no effect on Ki-67, PCNA, GADD45β, and MDM2 mRNA expression in chimeric mice, whereas significant increases were observed in CD-1 mice and/or WH rats. However, increases in hepatocyte replicative DNA synthesis were observed in chimeric mice both in vivo and in vitro after treatment epidermal growth factor. Thus, although NaPB could activate CAR in both rodent and human hepatocytes, NaPB did not increase replicative DNA synthesis in human hepatocytes of chimeric mice, whereas it was mitogenic to rat and mouse hepatocytes. As human hepatocytes are refractory to the mitogenic effects of NaPB, the MOA for NaPB-induced rodent liver tumor formation is thus not relevant for humans. © The
Maximising the use of freshly isolated human hepatocytes.
Evans, Peter J
2016-01-01
Freshly isolated human hepatocytes are the best model for predicting adverse drug reactions. However, their preparation and use present the investigator with many variables that are beyond their control. These include operation continuity and timing, size and number of cut surfaces on liver tissue and the prior history of the patient. To exploit the potential of freshly isolated human hepatocytes a method is required to preserve the cells in their initial in vivo like state. This experimental pausing allows experiments to be prioritised at convenient times of the day. A novel approach for selecting viable human hepatocytes by functional attachment to a gelatin gel is described rather than relying on their physical characteristics. The cells are preserved as a monolayer on the semi-solid support at 10°C as single spherical entities. The hepatocytes can be released into suspension, when required, by a temperature transition to 37°C for 20min. The cells can be used in suspension or as a monolayer. The length of preservation depends upon the source tissue. Hepatocytes from normal liver can be maintained for at least 4days and demonstrated to have the same level of CYP3A4 and the enzymes involved in glucuronidation and sulphation as freshly isolated cells. Cells from fatty liver, attached to gelatin, vary in their preservation time but it is at least 24h and so confluent monolayers, that survive at 37°C can be generated the following day. The technique enables freshly isolated human hepatocytes to be used more effectively. They can be preserved in times of plenty so more experimentation is possible. Alternatively, with poorer fatty cells the initial attachment on gelatin enables confluent monolayers of lipid rich cells to be studied. Copyright © 2015 Elsevier Inc. All rights reserved.
[Endoplasmic reticulum stress mediates lipopolysaccharide-induced apoptosis in rat hepatocyte].
Ji, Ying-Lei; Yan, Jun; Wang, Yan-Sha; Liu, Yi-Chang; Gu, Zhen-Yong
2014-02-01
To investigate the role of endoplasmic reticulum stress (ERS) in lipopolysaccharide (LPS)-induced hepatocyte apoptosis. Cells of the rat hepatocyte line BRL were cultured. The hepatocytes were treated with LPS, ERS inducer thapsigargin (TG), and ERS inhibitor 4-phenylbutyric acid (4-PBA), respectively or in their different combination. The cell viability was measured by MTT assay. The cyto-nuclear morphological changes of apoptosis cells were detected by the fluorescent dye Hoechst 33258. The apoptosis rate was assessed by flow cytometry with Annexin V-FITC/PI double-staining. Expressions of GRP78 as ERS marker protein, CHOP, caspase-12 and cleaved-caspase-3 as ERS related protein were detected by Western blotting. LPS could cause a decrease in cell viability and an increase in apoptosis rate in a dose- and time-dependent manner. The expression of GRP78, CHOP, caspase-12 and cleaved-caspase-3 proteins were significantly increased with LPS treatment. TG led to a marked decrease in cell viability and an increase in apoptosis rate, which aggravated the hepatocyte injury induced by LPS; whereas 4-PBA alleviated LPS-induced apoptosis. ERS mediates LPS-induced hepatocyte injuries, indicating that ERS may play a vital role in the pathogenesis of LPS-induced hepatocyte injuries.
2004-01-01
OLIGODENDROCYTE DEVELOPMENT AND REMYELINATION 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e...Z39-18 ABSTRACT Title: THE INFLUENCE OF PLATELET-DERIVED GROWTH FACTOR AND FIBROBLAST GROWTH FACTOR 2 ON OLIGODENDROCYTE DEVELOPMENT AND...GROWTH FACTOR 2 ON OLIGODENDROCYTE DEVELOPMENT AND REMYELINATION by Joshua C. Murtie Thesis/dissertation submitted to the
Hemodynamic flow improves rat hepatocyte morphology, function, and metabolic activity in vitro.
Dash, A; Simmers, M B; Deering, T G; Berry, D J; Feaver, R E; Hastings, N E; Pruett, T L; LeCluyse, E L; Blackman, B R; Wamhoff, B R
2013-06-01
In vitro primary hepatocyte systems typically elicit drug induction and toxicity responses at concentrations much higher than corresponding in vivo or clinical plasma C(max) levels, contributing to poor in vitro-in vivo correlations. This may be partly due to the absence of physiological parameters that maintain metabolic phenotype in vivo. We hypothesized that restoring hemodynamics and media transport would improve hepatocyte architecture and metabolic function in vitro compared with nonflow cultures. Rat hepatocytes were cultured for 2 wk either in nonflow collagen gel sandwiches with 48-h media changes or under controlled hemodynamics mimicking sinusoidal circulation within a perfused Transwell device. Phenotypic, functional, and metabolic parameters were assessed at multiple times. Hepatocytes in the devices exhibited polarized morphology, retention of differentiation markers [E-cadherin and hepatocyte nuclear factor-4α (HNF-4α)], the canalicular transporter [multidrug-resistant protein-2 (Mrp-2)], and significantly higher levels of liver function compared with nonflow cultures over 2 wk (albumin ~4-fold and urea ~5-fold). Gene expression of cytochrome P450 (CYP) enzymes was significantly higher (fold increase over nonflow: CYP1A1: 53.5 ± 10.3; CYP1A2: 64.0 ± 15.1; CYP2B1: 15.2 ± 2.9; CYP2B2: 2.7 ± 0.8; CYP3A2: 4.0 ± 1.4) and translated to significantly higher basal enzyme activity (device vs. nonflow: CYP1A: 6.26 ± 2.41 vs. 0.42 ± 0.015; CYP1B: 3.47 ± 1.66 vs. 0.4 ± 0.09; CYP3A: 11.65 ± 4.70 vs. 2.43 ± 0.56) while retaining inducibility by 3-methylcholanthrene and dexamethasone (fold increase over DMSO: CYP1A = 27.33 and CYP3A = 4.94). These responses were observed at concentrations closer to plasma levels documented in vivo in rats. The retention of in vivo-like hepatocyte phenotype and metabolic function coupled with drug response at more physiological concentrations emphasizes the importance of restoring in vivo physiological transport
Meier, Anja; Mehrle, Stefan; Weiss, Thomas S; Mier, Walter; Urban, Stephan
2013-07-01
Chronic infection with the human hepatitis B virus (HBV) is a global health problem and a main cause of progressive liver diseases. HBV exhibits a narrow host range, replicating primarily in hepatocytes. Both host and hepatocyte specificity presumably involve specific receptor interactions on the target cell; however, direct evidence for this hypothesis is missing. Following the observation that HBV entry is specifically blocked by L-protein-derived preS1-lipopeptides, we visualized specific HBV receptor/ligand complexes on hepatic cells and quantified the turnover kinetics. Using fluorescein isothiocyanate-labeled, myristoylated HBV preS1-peptides we demonstrate (1) the presence of a highly specific HBV receptor on the plasma membrane of HBV-susceptible primary human and tupaia hepatocytes and HepaRG cells but also on hepatocytes from the nonsusceptible species mouse, rat, rabbit and dog; (2) the requirement of a differentiated state of the hepatocyte for specific preS1-binding; (3) the lack of detectable amounts of the receptor on HepG2 and HuH7 cells; (4) a slow receptor turnover at the hepatocyte membrane; and (5) an association of the receptor with actin microfilaments. The presence of the preS1-receptor in primary hepatocytes from some non-HBV-susceptible species indicates that the lack of susceptibility of these cells is owed to a postbinding step. These findings suggest that HBV hepatotropism is mediated by the highly selective expression of a yet unknown receptor* on differentiated hepatocytes, while species specificity of the HBV infection requires selective downstream events, e.g., the presence of host dependency or the absence of host restriction factors. The criteria defined here will allow narrowing down reasonable receptor candidates and provide a binding assay for HBV-receptor expression screens in hepatic cells. Copyright © 2012 American Association for the Study of Liver Diseases.
Hainan, Lan; Huilin, Liu; Khan, Mahamad; Xin, Zheng; YuJiang, Yang; Hui, Zhang; Naiquan, Yao
2018-06-08
Traditional views suggest that growth hormone and the growth hormone receptor (GH/GHR complex) exert their functions only on the plasma membrane. This paradigm, however, has been challenged by recent new findings that the GH/GHR complex could translocate into cell nuclei where they could still exhibit important physiological functions. We also reported the nuclear localization of porcine GH/GHR and their potential functions in porcine hepatocytes. However, the basic path of pGH/GHR's nuclear translocation remains unclear. Combining previous research results and our current findings, we proposed two basic routes of pGH/GHR's nuclear transportation as follows: 1) after pGH binding to GHR, pGH/GHR enters into the cytoplasm though clathrin- or caveolin-mediated endocytosis, then the pGH/GHR complex enters into early endosomes (Rab5-positive), and the endosome carries the GH/GHR complex to the endoplasmic reticulum (ER). After endosome docking on the ER, the endosome starts fission, and the pGH/GHR complex enters into the ER lumen. Then the pGH/GHR complex transports into the cytoplasm, possibly by the ERAD pathway. Subsequently, the pGH/GHR complex interacts with IMPα/β, which, in turn, mediates GH/GHR nuclear localization; 2) pGH binds with the GHR on the cell membrane and, subsequently, pGH/GHR internalizes into the cell and enters into the endosome (this endosome may belong to a class of endosomes called envelope-associated endosomes (NAE)). Then, the endosome carries the pGH/GHR to the nuclear membrane. After docking on the nuclear membrane, the pGH/GHR complex fuses with the nuclear membrane and then enters into the cell nucleus. Copyright © 2018 Elsevier Inc. All rights reserved.
Gleich, Alexander; Kaiser, Bastian; Schumann, Julia; Fuhrmann, Herbert
2016-06-01
Due to lack of in vitro models for bovine hepatocytes apart from primary cells, there is demand for a bovine hepatocyte-derived cell line. Transduction of bovine foetal hepatocytes with SV40 large T-antigen was performed using the vector pRetro-E2 SV40. Phase contrast microscopy was carried out to evaluate morphology. Immunofluorescence staining was conducted to study expression of keratins, tight junction proteins zona occludens-1 and claudin-1, glucose transporter-2 and P-glycoprotein as well as phosphoenolpyruvate carboxykinase. Urea and triglyceride production was quantified photometrically. Histochemical staining of glycogen by Periodic acid-Schiff stain and of lipids with Oil red O was performed after 24 h incubation with 20 mM glucose and 85 μM palmitic acid, respectively. Gene expression analysis of hepatocyte-typical genes was conducted by reverse transcription PCR. We obtained a SV40LTAg-transduced extended passage cell line, referred to as BFH12. Polygonal growth, keratins, tight junction proteins zona occludens-1 and claudin-1 and glucose transporter-2 as well as P-glycoprotein and phosphoenolpyruvate carboxykinase were attested positively. Urea production calculated as cell-specific rate was 14.2 ± 2.0 fmol/h (early passage) and 17.6 ± 3.7 fmol/h (late passage). Cell-specific triglyceride production was 1.6 ± 0.5 fmol/h (early passage) and 2.1 ± 0.3 fmol/h (late passage). Additionally, cells were positive for glycogen and lipid storage and showed a gene expression pattern resembling foetal hepatocytes. With the properties described here, the novel cell line BFH12 is a hepatocyte-derived cell line which can be used as an in vitro whole cell model.
Scott, Melanie J.; Chen, Christine; Sun, Qian; Billiar, Timothy R.
2010-01-01
Background & Aims NOD-like receptors are recently described cytosolic pattern recognition receptors. NOD1 and NOD2 are members of this family that recognize bacterial cell wall components, diaminopimelic acid and muramyl dipeptide, respectively. Both NOD1 and NOD2 have been associated with many inflammatory diseases, although their role in liver inflammation and infection has not been well studied. Materials and Methods We investigated the role of NOD receptors in mouse liver by assessing expression and activation of NOD1 and NOD2 in liver and primary isolated hepatocytes from C57BL/6 mice. Results Both NOD1 and NOD2 mRNA and protein were highly expressed in hepatocytes and liver. RIP2, the main signaling partner for NODs, was also expressed. Stimulation of hepatocytes with NOD1 ligand (C12-iEDAP) induced NFκB activation, activation of MAP kinases and expression of chemokines CCL5 (RANTES) and CXCL1 (KC). C12-iEDAP also synergized with interferon (IFN)γ to increase iNOS expression and production of nitric oxide. Despite activating NFκB, NOD1 ligand did not upregulate hepatocyte production of the acute phase proteins lipopolysaccharide binding protein, serum amyloid A, or soluble CD14 in cell culture supernatants, or upregulate mRNA expression of lipopolysaccharide binding protein, serum amyloid A, C-reactive protein, or serum amyloid P. NOD2 ligand (MDP) did not activate hepatocytes when given alone, but did synergize with Toll-like receptor ligands, lipopolysaccharide (LPS), and polyI:C to activate NFκB and MAPK. Conclusions All together these data suggest an important role for hepatocyte NOD1 in attracting leukocytes to the liver during infection and for hepatic NLRs to augment innate immune responses to pathogens. PMID:20615568
Schlegel, Werner; Raimann, Adalbert; Halbauer, Daniel; Scharmer, Daniela; Sagmeister, Susanne; Wessner, Barbara; Helmreich, Magdalena; Haeusler, Gabriele; Egerbacher, Monika
2013-01-01
Human insulin-like growth factor 1 Ec (IGF-1Ec), also called mechano growth factor (MGF), is a splice variant of insulin-like growth factor 1 (IGF-1), which has been shown in vitro as well as in vivo to induce growth and hypertrophy in mechanically stimulated or damaged muscle. Growth, hypertrophy and responses to mechanical stimulation are important reactions of cartilaginous tissues, especially those in growth plates. Therefore, we wanted to ascertain if MGF is expressed in growth plate cartilage and if it influences proliferation of chondrocytes, as it does in musculoskeletal tissues. MGF expression was analyzed in growth plate and control tissue samples from piglets aged 3 to 6 weeks. Furthermore, growth plate chondrocyte cell culture was used to evaluate the effects of the MGF peptide on proliferation. We showed that MGF is expressed in considerable amounts in the tissues evaluated. We found the MGF peptide to be primarily located in the cytoplasm, and in some instances, it was also found in the nucleus of the cells. Addition of MGF peptides was not associated with growth plate chondrocyte proliferation. PMID:24146828
Increased hepatocyte fas expression and apoptosis in HIV and hepatitis C virus coinfection.
Macias, Juan; Japón, Miguel A; Sáez, Carmen; Palacios, Rosa B; Mira, José A; García-García, José A; Merchante, Nicolás; Vergara, Salvador; Lozano, Fernando; Gómez-Mateos, Jesús; Pineda, Juan A
2005-11-01
Chronic hepatitis C disease (CHC) follows an accelerated course in human immunodeficiency virus (HIV) coinfection. The reasons for this are unclear. Fas-mediated hepatocyte apoptosis is involved in the pathogenesis of hepatitis C virus (HCV) infection. We sought to compare the expression of Fas on hepatocytes and irreversible apoptosis of hepatocytes among patients with CHC with and without HCV/HIV coinfection. Fas-immunostained hepatocytes were semiquantified, and apoptotic hepatocytes were detected by staining caspase-cleaved cytokeratin 18 filaments and counted across the entire section of liver-biopsy specimens from HCV-infected patients with and without HCV/HIV coinfection. One hundred thirty-four HCV/HIV-coinfected and 100 HCV-infected patients were included. HCV/HIV coinfection was associated with both diffuse distribution of Fas-stained hepatocytes (adjusted odds ratio [AOR], 7.4 [95% confidence interval {CI}, 3.8-14.4]) and with apoptotic hepatocyte counts greater than the median (AOR, 2.5 [95% CI, 1.5-4.5]). In HCV/HIV-coinfected patients, CD4+ cell nadir<200 cells/mL was associated with both Fas expression (AOR, 2.9 [95% CI, 1.3-6.8]) and hepatocyte apoptosis (AOR, 2.3 [95% CI, 1.1-4.9]). HCV/HIV-coinfected patients show higher levels of hepatocytes expressing Fas and undergoing irreversible apoptosis than do HCV-infected patients. However, low CD4+ cell nadirs in coinfected patients are associated with hepatocyte Fas expression and apoptosis.
Hepatocyte Produced Matrix Metalloproteinases Are Regulated by CD147 in Liver Fibrogenesis
Morgan, Alison J.; Tu, Thomas; Wen, Victoria W.; Yee, Christine; Mridha, Auvro; Lee, Maggie; d'Avigdor, William; Locarnini, Stephen A.; McCaughan, Geoffrey W.; Warner, Fiona J.; McLennan, Susan V.; Shackel, Nicholas A.
2014-01-01
Background The classical paradigm of liver injury asserts that hepatic stellate cells (HSC) produce, remodel and turnover the abnormal extracellular matrix (ECM) of fibrosis via matrix metalloproteinases (MMPs). In extrahepatic tissues MMP production is regulated by a number of mechanisms including expression of the glycoprotein CD147. Previously, we have shown that CD147 is expressed on hepatocytes but not within the fibrotic septa in cirrhosis [1]. Therefore, we investigated if hepatocytes produce MMPs, regulated by CD147, which are capable of remodelling fibrotic ECM independent of the HSC. Methods Non-diseased, fibrotic and cirrhotic livers were examined for MMP activity and markers of fibrosis in humans and mice. CD147 expression and MMP activity were co-localised by in-situ zymography. The role of CD147 was studied in-vitro with siRNA to CD147 in hepatocytes and in-vivo in mice with CCl4 induced liver injury using ãCD147 antibody intervention. Results In liver fibrosis in both human and mouse tissue MMP expression and activity (MMP-2, -9, -13 and -14) increased with progressive injury and localised to hepatocytes. Additionally, as expected, MMPs were abundantly expressed by activated HSC. Further, with progressive fibrosis there was expression of CD147, which localised to hepatocytes but not to HSC. Functionally significant in-vitro regulation of hepatocyte MMP production by CD147 was demonstrated using siRNA to CD147 that decreased hepatocyte MMP-2 and -9 expression/activity. Further, in-vivo α-CD147 antibody intervention decreased liver MMP-2, -9, -13, -14, TGF-β and α-SMA expression in CCl4 treated mice compared to controls. Conclusion We have shown that hepatocytes produce active MMPs and that the glycoprotein CD147 regulates hepatocyte MMP expression. Targeting CD147 regulates hepatocyte MMP production both in-vitro and in-vivo, with the net result being reduced fibrotic matrix turnover in-vivo. Therefore, CD147 regulation of hepatocyte MMP is a
Hepatocyte produced matrix metalloproteinases are regulated by CD147 in liver fibrogenesis.
Calabro, Sarah R; Maczurek, Annette E; Morgan, Alison J; Tu, Thomas; Wen, Victoria W; Yee, Christine; Mridha, Auvro; Lee, Maggie; d'Avigdor, William; Locarnini, Stephen A; McCaughan, Geoffrey W; Warner, Fiona J; McLennan, Susan V; Shackel, Nicholas A
2014-01-01
The classical paradigm of liver injury asserts that hepatic stellate cells (HSC) produce, remodel and turnover the abnormal extracellular matrix (ECM) of fibrosis via matrix metalloproteinases (MMPs). In extrahepatic tissues MMP production is regulated by a number of mechanisms including expression of the glycoprotein CD147. Previously, we have shown that CD147 is expressed on hepatocytes but not within the fibrotic septa in cirrhosis [1]. Therefore, we investigated if hepatocytes produce MMPs, regulated by CD147, which are capable of remodelling fibrotic ECM independent of the HSC. Non-diseased, fibrotic and cirrhotic livers were examined for MMP activity and markers of fibrosis in humans and mice. CD147 expression and MMP activity were co-localised by in-situ zymography. The role of CD147 was studied in-vitro with siRNA to CD147 in hepatocytes and in-vivo in mice with CCl4 induced liver injury using ãCD147 antibody intervention. In liver fibrosis in both human and mouse tissue MMP expression and activity (MMP-2, -9, -13 and -14) increased with progressive injury and localised to hepatocytes. Additionally, as expected, MMPs were abundantly expressed by activated HSC. Further, with progressive fibrosis there was expression of CD147, which localised to hepatocytes but not to HSC. Functionally significant in-vitro regulation of hepatocyte MMP production by CD147 was demonstrated using siRNA to CD147 that decreased hepatocyte MMP-2 and -9 expression/activity. Further, in-vivo α-CD147 antibody intervention decreased liver MMP-2, -9, -13, -14, TGF-β and α-SMA expression in CCl4 treated mice compared to controls. We have shown that hepatocytes produce active MMPs and that the glycoprotein CD147 regulates hepatocyte MMP expression. Targeting CD147 regulates hepatocyte MMP production both in-vitro and in-vivo, with the net result being reduced fibrotic matrix turnover in-vivo. Therefore, CD147 regulation of hepatocyte MMP is a novel pathway that could be targeted by
Ni, Hong-Min; McGill, Mitchell R; Chao, Xiaojuan; Woolbright, Benjamin L; Jaeschke, Hartmut; Ding, Wen-Xing
2016-10-01
How different cell death modes and cell survival pathways cross talk remains elusive. We determined the interrelation of apoptosis, necrosis, and autophagy in tumor necrosis factor (TNF)-α/actinomycin D (ActD) and lipopolysaccharide/D-galactosamine (GalN)-induced hepatotoxicity in vitro and in vivo. We found that TNF-α/ActD-induced apoptosis was completely blocked by a general caspase inhibitor ZVAD-fmk at 24 hours but hepatocytes still died by necrosis at 48 hours. Inhibition of caspases also protected mice against lipopolysaccharide/GalN-induced apoptosis and liver injury at the early time point, but this protection was diminished after prolonged treatment by switching apoptosis to necrosis. Inhibition of receptor-interacting protein kinase (RIP)1 by necrostatin 1 partially inhibited TNF-α/ZVAD-induced necrosis in primary hepatocytes. Pharmacologic inhibition of autophagy or genetic deletion of Atg5 in hepatocytes did not protect against TNF-α/ActD/ZVAD-induced necrosis. Moreover, pharmacologic inhibition of RIP1 or genetic deletion of RIP3 failed to protect and even exacerbated liver injury after mice were treated with lipopolysaccharide/GalN and a pan-caspase inhibitor. In conclusion, our results suggest that different cell death mode and cell survival pathways are closely integrated during TNF-α-induced liver injury when both caspases and NF-κB are blocked. Moreover, results from our study also raised concerns about the safety of currently ongoing clinical trials that use caspase inhibitors. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Wree, Alexander; Eguchi, Akiko; McGeough, Matthew D; Pena, Carla A; Johnson, Casey D; Canbay, Ali; Hoffman, Hal M; Feldstein, Ariel E
2014-03-01
Inflammasome activation plays a central role in the development of drug-induced and obesity-associated liver disease. However, the sources and mechanisms of inflammasome-mediated liver damage remain poorly understood. Our aim was to investigate the effect of NLRP3 inflammasome activation on the liver using novel mouse models. We generated global and myeloid cell-specific conditional mutant Nlrp3 knock-in mice expressing the D301N Nlrp3 mutation (ortholog of D303N in human NLRP3), resulting in a hyperactive NLRP3. To study the presence and significance of NLRP3-initiated pyroptotic cell death, we separated hepatocytes from nonparenchymal cells and developed a novel flow-cytometry-based (fluorescence-activated cell sorting; FACS) strategy to detect and quantify pyroptosis in vivo based on detection of active caspase 1 (Casp1)- and propidium iodide (PI)-positive cells. Liver inflammation was quantified histologically by FACS and gene expression analysis. Liver fibrosis was assessed by Sirius Red staining and quantitative polymerase chain reaction for markers of hepatic stellate cell (HSC) activation. NLRP3 activation resulted in shortened survival, poor growth, and severe liver inflammation; characterized by neutrophilic infiltration and HSC activation with collagen deposition in the liver. These changes were partially attenuated by treatment with anakinra, an interleukin-1 receptor antagonist. Notably, hepatocytes from global Nlrp3-mutant mice showed marked hepatocyte pyroptotic cell death, with more than a 5-fold increase in active Casp1/PI double-positive cells. Myeloid cell-restricted mutant NLRP3 activation resulted in a less-severe liver phenotype in the absence of detectable pyroptotic hepatocyte cell death. Our data demonstrate that global and, to a lesser extent, myeloid-specific NLRP3 inflammasome activation results in severe liver inflammation and fibrosis while identifying hepatocyte pyroptotic cell death as a novel mechanism of NLRP3-mediated liver damage
LIVER REGENERATION STUDIES WITH RAT HEPATOCYTES IN PRIMARY CULTURE
Adult rat parenchymal hepatocytes in primary culture can be induced to enter into DNA synthesis and mitosis. The optimal conditions for hepatocyte replication are low plating density (less than 10,000 cells/sq cm) and 50% serum from two-thirds partially hepatectomized rats (48 hr...
Growth factor transgenes interactively regulate articular chondrocytes.
Shi, Shuiliang; Mercer, Scott; Eckert, George J; Trippel, Stephen B
2013-04-01
Adult articular chondrocytes lack an effective repair response to correct damage from injury or osteoarthritis. Polypeptide growth factors that stimulate articular chondrocyte proliferation and cartilage matrix synthesis may augment this response. Gene transfer is a promising approach to delivering such factors. Multiple growth factor genes regulate these cell functions, but multiple growth factor gene transfer remains unexplored. We tested the hypothesis that multiple growth factor gene transfer selectively modulates articular chondrocyte proliferation and matrix synthesis. We tested the hypothesis by delivering combinations of the transgenes encoding insulin-like growth factor I (IGF-I), fibroblast growth factor-2 (FGF-2), transforming growth factor beta1 (TGF-β1), bone morphogenetic protein-2 (BMP-2), and bone morphogenetic protien-7 (BMP-7) to articular chondrocytes and measured changes in the production of DNA, glycosaminoglycan, and collagen. The transgenes differentially regulated all these chondrocyte activities. In concert, the transgenes interacted to generate widely divergent responses from the cells. These interactions ranged from inhibitory to synergistic. The transgene pair encoding IGF-I and FGF-2 maximized cell proliferation. The three-transgene group encoding IGF-I, BMP-2, and BMP-7 maximized matrix production and also optimized the balance between cell proliferation and matrix production. These data demonstrate an approach to articular chondrocyte regulation that may be tailored to stimulate specific cell functions, and suggest that certain growth factor gene combinations have potential value for cell-based articular cartilage repair. Copyright © 2012 Wiley Periodicals, Inc.
Takayama, Kazuo; Inamura, Mitsuru; Kawabata, Kenji; Katayama, Kazufumi; Higuchi, Maiko; Tashiro, Katsuhisa; Nonaka, Aki; Sakurai, Fuminori; Hayakawa, Takao; Kusuda Furue, Miho; Mizuguchi, Hiroyuki
2012-01-01
Hepatocyte-like cells from human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) are expected to be a useful source of cells drug discovery. Although we recently reported that hepatic commitment is promoted by transduction of SOX17 and HEX into human ESC- and iPSC-derived cells, these hepatocyte-like cells were not sufficiently mature for drug screening. To promote hepatic maturation, we utilized transduction of the hepatocyte nuclear factor 4α (HNF4α) gene, which is known as a master regulator of liver-specific gene expression. Adenovirus vector-mediated overexpression of HNF4α in hepatoblasts induced by SOX17 and HEX transduction led to upregulation of epithelial and mature hepatic markers such as cytochrome P450 (CYP) enzymes, and promoted hepatic maturation by activating the mesenchymal-to-epithelial transition (MET). Thus HNF4α might play an important role in the hepatic differentiation from human ESC-derived hepatoblasts by activating the MET. Furthermore, the hepatocyte like-cells could catalyze the toxication of several compounds. Our method would be a valuable tool for the efficient generation of functional hepatocytes derived from human ESCs and iPSCs, and the hepatocyte-like cells could be used for predicting drug toxicity. PMID:22068426
Effect of Immunosuppressive Agents on Hepatocyte Apoptosis Post-Liver Transplantation
Lim, Eu Jin; Chin, Ruth; Nachbur, Ueli; Silke, John; Jia, Zhiyuan; Angus, Peter W.; Torresi, Joseph
2015-01-01
Introduction Immunosuppressants are used ubiquitously post-liver transplantation to prevent allograft rejection. However their effects on hepatocytes are unknown. Experimental data from non-liver cells indicate that immunosuppressants may promote cell death thereby driving an inflammatory response that promotes fibrosis and raises concerns that a similar effect may occur within the liver. We evaluated apoptosis within the liver tissue of post-liver transplant patients and correlated these findings with in vitro experiments investigating the effects of immunosuppressants on apoptosis in primary hepatocytes. Methods Hepatocyte apoptosis was assessed using immunohistochemistry for M30 CytoDEATH and cleaved PARP in human liver tissue. Primary mouse hepatocytes were treated with various combinations of cyclosporine, tacrolimus, sirolimus, or MMF. Cell viability and apoptosis were evaluated using crystal violet assays and Western immunoblots probed for cleaved PARP and cleaved caspase 3. Results Post-liver transplant patients had a 4.9-fold and 1.7-fold increase in M30 CytoDEATH and cleaved PARP compared to normal subjects. Cyclosporine and tacrolimus at therapeutic concentrations did not affect hepatocyte apoptosis, however when they were combined with MMF, cell death was significantly enhanced. Cell viability was reduced by 46% and 41%, cleaved PARP was increased 2.6-fold and 2.2-fold, and cleaved caspase 3 increased 2.2-fold and 1.8-fold following treatment with Cyclosporine/MMF and Tacrolimus/MMF respectively. By contrast, the sirolimus/MMF combination did not significantly reduce hepatocyte viability or promote apoptosis. Conclusion Commonly used immunosuppressive drug regimens employed after liver transplantation enhance hepatocyte cell death and may thus contribute to the increased liver fibrosis that occurs in a proportion of liver transplant recipients. PMID:26390404
DNA damage in lead-exposed hepatocytes: coexistence of apoptosis and necrosis?
Narayana, Kilarkaje; Raghupathy, Raj
2012-04-01
The aim of the present study was to investigate the coexistence of oxidative DNA damage and apoptosis- and necrosis-related DNA damage, and to correlate with ultrastructural changes in hepatocyte nuclei in the lead-nitrate-exposed liver. Adult male Wistar rats were exposed to 0, 0.5, and 1% lead nitrate for 60 days, and the livers were sampled the next day. Ultrastructurally, hepatocyte nuclei showed no apoptosis-related morphological changes, but showed necrotic changes. Competitive enzyme-linked immunosorbent assay showed no change in 8-oxo-dG activity (P > 0.05), but immunohistochemistry showed its localization in hepatocytes, Kupffer cells, endothelium, and bile ductule epithelium. TUNEL-labeled DNA breaks presenting 3'-OH ends increased in hepatocytes in all functional zones of the portal acini and bile ductule epithelium (zones I>III>II). In situ oligo ligation revealed the existence of DNA breaks bearing duplex 3' overhangs and 5' P-blunt ends in hepatocytes of all functional zones and bile ductule epithelium. In conclusion, both apoptosis- and necrosis-related DNA damage coexist without significant oxidative DNA damage. Hepatocytes display changes related to necrosis, but not those related to apoptosis.
Miranda, Joana P; Rodrigues, Armanda; Tostões, Rui M; Leite, Sofia; Zimmerman, Heiko; Carrondo, Manuel J T; Alves, Paula M
2010-12-01
The maintenance of differentiated hepatocyte phenotype in vitro depends on several factors-in particular, on extracellular matrix interactions, for example, with three-dimensional (3D) matrices. Alginate hydrogel provides the cells with a good extracellular matrix due to the formation of a massive capsule with semi-permeable properties that allows for diffusion of the medium components into the cells as well as efficient waste product elimination. Simultaneously, alginate protects the cells from shear stress caused by the hydrodynamics when cultured in stirred systems such as bioreactors. We have previously developed a hepatocyte aggregate 3D culture system in a bioreactor where improved hepatocyte functionality could be maintained over longer periods (21 days). In this work, ultra-high-viscosity alginate was used for hepatocyte aggregates entrapment. Hepatocyte biotransformation (phase I and II enzymes), CYP450 inducibility, and secretory capacity (albumin and urea production) were monitored. The analyses were performed in both spinner vessels and bioreactors to test the effect of the pO(2) control, unavailable in the spinners. Performance of alginate-encapsulated hepatocyte aggregates in culture was compared with nonencapsulated aggregate cultures in both bioreactor (controlled environment) and spinner vessels. For both culture systems, hepatocytes' metabolic and biotransformation capacities were maintained for up to 1 month, and encapsulated cells in bioreactors showed the best performance. In particular, albumin production rate increased 2- and 1.5-fold in encapsulated aggregates compared with nonencapsulated aggregates in bioreactor and spinner vessels, respectively. Urea production rate increased twofold in encapsulated cultures compared with nonencapsulated cells, in both bioreactor and spinner vessels. Similarly, in both the bioreactor and the spinner system, cell encapsulation resulted in a 1.5- and 2.8-fold improvement of hepatocyte 7-ethoxycoumarin and
Deegan, Daniel B; Zimmerman, Cynthia; Skardal, Aleksander; Atala, Anthony; Shupe, Thomas D
2015-03-01
Tissue engineering and cell based liver therapies have utilized primary hepatocytes with limited success due to the failure of hepatocytes to maintain their phenotype in vitro. In order to overcome this challenge, hyaluronic acid (HA) cell culture substrates were formulated to closely mimic the composition and stiffness of the normal liver cellular microenvironment. The stiffness of the substrate was modulated by adjusting HA hydrogel crosslinking. Additionally, the repertoire of bioactive molecules within the HA substrate was bolstered by supplementation with normal liver extracellular matrix (ECM). Primary human hepatocyte viability and phenotype were determined over a narrow physiologically relevant range of substrate stiffnesses from 600 to 4600Pa in both the presence and absence of liver ECM. Cell attachment, viability, and organization of the actin cytoskeleton improved with increased stiffness up to 4600Pa. These differences were not evident in earlier time points or substrates containing only HA. However, gene expression for the hepatocyte markers hepatocyte nuclear factor 4 alpha (HNF4α) and albumin significantly decreased on the 4600Pa stiffness at day 7 indicating that cells may not have maintained their phenotype long-term at this stiffness. Function, as measured by albumin secretion, varied with both stiffness and time in culture and peaked at day 7 at the 1200Pa stiffness, slightly below the stiffness of normal liver ECM at 3000Pa. Overall, gel stiffness affected primary human hepatocyte cell adhesion, functional marker expression, and morphological characteristics dependent on both the presence of liver ECM in gel substrates and time in culture. Copyright © 2015 Elsevier Ltd. All rights reserved.
Reduced growth factor requirement of keloid-derived fibroblasts may account for tumor growth
DOE Office of Scientific and Technical Information (OSTI.GOV)
Russell, S.B.; Trupin, K.M.; Rodriguez-Eaton, S.
Keloids are benign dermal tumors that form during an abnormal wound-healing process is genetically susceptible individuals. Although growth of normal and keloid cells did not differ in medium containing 10% (vol/vol) fetal bovine serum, keloid culture grew to significantly higher densities than normal cells in medium containing 5% (vol/vol) fetal bovine serum, keloid cultures grew to significantly higher densities than normal cells in medium containing 5% (vol/vol) plasma or 1% fetal bovine serum. Conditioned medium from keloid cultures did not stimulate growth of normal cells in plasma nor did it contain detectable platelet-derived growth factor or epidermal growth factor. Keloidmore » fibroblasts responded differently than normal adult fibroblasts to transforming growth factor ..beta... Whereas transforming growth factor ..beta.. reduced growth stimulation by epidermal growth factor in cells from normal adult skin or scars, it enhanced the activity of epidermal growth factor in cells from normal adult skin or scars, it enhanced the activity of epidermal growth factor in cells from keloids. Normal and keloid fibroblasts also responded differently to hydrocortisone: growth was stimulated in normal adult cells and unaffected or inhibited in keloid cells. Fetal fibroblasts resembled keloid cells in their ability to grow in plasma and in their response to hydrocortisone. The ability of keloid fibroblasts to grow to higher cell densities in low-serum medium than cells from normal adult skin or from normal early or mature scars suggests that a reduced dependence on serum growth factors may account for their prolonged growth in vivo. Similarities between keloid and fetal cells suggest that keloids may result from the untimely expression of growth-control mechanism that is developmentally regulated.« less
Fuzheng Huayu recipe alleviates hepatic fibrosis via inhibiting TNF-α induced hepatocyte apoptosis.
Tao, Yan-yan; Yan, Xiu-chuan; Zhou, Tao; Shen, Li; Liu, Zu-long; Liu, Cheng-hai
2014-11-18
What was the relationship of Fuzheng Huayu recipe (FZHY) inhibiting hepatocyte apoptosis and HSC activation at different stage of liver fibrosis? In order to answer this question, the study was carried out to dynamically observe FZHY's effect on hepatocyte apoptosis and HSC activation and further explored underling mechanism of FZHY against hepatocyte apoptosis. Mice were randomly divided into four groups: normal, model, FZHY, and N-acetylcystein (NAC) groups. Acute hepatic injury and liver fibrosis in mice were induced by CCl4. Three days before the first CCl4 injection, treatment with FZHY powder or NAC respectively was started. In vitro, primary hepatocytes were pretreated with FZHY medicated serum or Z-VAD-FMK and then incubated with ActD and TNF-α. Primary HSCs were treated with DNA from apoptotic hepatocytes incubated by Act D/TNF-α or FZHY medicated. Liver sections were analyzed for HE staining and immunohistochemical evaluation of apoptosis. Serum ALT and AST, Alb content and TNF-α expression in liver tissue were detected. Hyp content was assayed and collagen deposition was visualized. Expressions of α-SMA and type I collagen were analyzed by immunofluorescence and immunoblotting. Flow cytometry, immunofluorescence, and DNA ladder for hepatocyte apoptosis and immunoblotting for TNF-R1, Bcl-2 and Bax were also analyzed. Mice showed characteristic features of massive hepatocytes apoptosis in early stage of liver injury and developed severe hepatic fibrosis in later phase. FZHY treatment significantly alleviated acute liver injury and hepatocyte apoptosis, and inhibited liver fibrosis by decreasing α-SMA expression and hepatic Hyp content. In vitro, primary hepatocytes were induced by TNF-α and Act D. The anti-apoptotic effect of FZHY was generated by reducing TNFR1 expression and balancing the expressions of Bcl-2 and Bax. Meanwhile, the nuclear DNA from apoptotic hepatocytes stimulated HSC activation in a dose dependent manner, and the DNA from
Lamontagne, Jason; Mell, Joshua C; Bouchard, Michael J
2016-02-01
Globally, a chronic hepatitis B virus (HBV) infection remains the leading cause of primary liver cancer. The mechanisms leading to the development of HBV-associated liver cancer remain incompletely understood. In part, this is because studies have been limited by the lack of effective model systems that are both readily available and mimic the cellular environment of a normal hepatocyte. Additionally, many studies have focused on single, specific factors or pathways that may be affected by HBV, without addressing cell physiology as a whole. Here, we apply RNA-seq technology to investigate transcriptome-wide, HBV-mediated changes in gene expression to identify single factors and pathways as well as networks of genes and pathways that are affected in the context of HBV replication. Importantly, these studies were conducted in an ex vivo model of cultured primary hepatocytes, allowing for the transcriptomic characterization of this model system and an investigation of early HBV-mediated effects in a biologically relevant context. We analyzed differential gene expression within the context of time-mediated gene-expression changes and show that in the context of HBV replication a number of genes and cellular pathways are altered, including those associated with metabolism, cell cycle regulation, and lipid biosynthesis. Multiple analysis pipelines, as well as qRT-PCR and an independent, replicate RNA-seq analysis, were used to identify and confirm differentially expressed genes. HBV-mediated alterations to the transcriptome that we identified likely represent early changes to hepatocytes following an HBV infection, suggesting potential targets for early therapeutic intervention. Overall, these studies have produced a valuable resource that can be used to expand our understanding of the complex network of host-virus interactions and the impact of HBV-mediated changes to normal hepatocyte physiology on viral replication.