Bachala, Daisy; El-Refai, Nivine; Greenfield, Edward; Aminoshariae, Anita; Mickel, Andre
2018-06-01
To date, no study has investigated the antiresorptive property of lunasin. Hence, the present study aimed to assess the ability of lunasin to inhibit the osteoclast formation using RAW 264.7 cells. We hypothesized that lunasin is able to inhibit osteoclast formation. In the present study, the murine monocytic cell line RAW 264.7 was induced to differentiate into mature osteoclasts in the presence of recombinant receptor activator of nuclear factor kappa-B ligand. Tartrate-resistant acid phosphatase, a marker of osteoclasts, was used to identify osteoclasts. Cell lines were divided into different groups and exposed to different concentrations of 50 μmol/L, 75 μmol/L, and 100 μmol/L active and inactive lunasin. The control group was RAW 264.7 cells with receptor activator of nuclear factor kappa-B ligand. Tartrate-resistant acid phosphatase-positive cells of 3 or more nuclei, indicative of mature osteoclasts, were counted by 3 observers. The mean number of the data collected was analyzed using 1-way analysis of variance and the multiple comparison post hoc Bonferroni correction. There was a significant difference in the reduction of osteoclast formation in all the active lunasin groups (P < .001) compared with the control group and the inactive lunasin group (P < .001). Considering the suppressive effect of lunasin on osteoclastogenesis, the use of lunasin as a potential antiresorptive agent can be evaluated in future studies. Copyright © 2018 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Barger, Anne M; Fan, Timothy M; de Lorimier, Louis-Philippe; Sprandel, Ian T; O'Dell-Anderson, Kristen
2007-01-01
Receptor activator of nuclear factor kappa-B (RANK), RANK-ligand (RANKL), and the soluble decoy receptor osteoprotegerin (OPG) form a key axis modulating osteoclastogenesis. In health, RANKL-expressing bone stromal cells and osteoblasts activate osteoclasts through RANK ligation, resulting in homeostatic bone resorption. Skeletal tumors of dogs and cats, whether primary or metastatic, may express RANKL and directly induce malignant osteolysis. Bone malignancies of dogs and cats may express RANKL, thereby contributing to pathologic bone resorption and pain. Furthermore, relative RANKL expression in bone tumors may correlate with radiographic characteristics of bone pathology. Forty-two dogs and 6 cats with spontaneously-occurring tumors involving bones or soft tissues were evaluated. A polyclonal anti-human RANKL antibody was validated for use in canine and feline cells by flow cytometry and immunocytochemistry. Fifty cytologic specimens were collected from bone and soft tissue tumors of 48 tumor-bearing animals and assessed for RANKL expression. In 15 canine osteosarcoma (OSA) samples, relative RANKL expression was correlated with radiographic characteristics of bone pathology. Expression of RANKL by neoplastic cells was identified in 32/44 canine and 5/6 feline tumor samples. In 15 dogs with OSA, relative RANKL expression did not correlate with either radiographic osteolysis or bone mineral density as assessed by dual energy x-ray absorptiometry. In dogs and cats, tumors classically involving bone and causing pain, often may express RANKL. Confirming RANKL expression in tumors is a necessary step toward the rational institution of novel therapies targeting malignant osteolysis via RANKL antagonism.
Zhang, Meihua; Yu, Yunzhi; Miao, Yu
2012-08-01
To investigate the expression of receptor activator of nuclear factor kappaB ligand (RANKL) and osteoprotegerin (OPG) in periapical cyst and periapical granuloma by comparison with the expression in the normal periodontal tissue as control, and to identify their functional mechanism in the bone destruction of periapical cyst and granuloma. 20 periapical cyst tissues (cyst group), 20 periapical granuloma tissues (granuloma group), and 20 normal periodontal tissues (control group) were collected respectively. Immunohistochemical technology was performed to detect the expression of RANKL and OPG in above three groups. In cyst group, granuloma group and control group, the expression of RANKL were 75.00 +/- 7.54, 68.40 +/- 6.74 and 29.40 +/- 2.46, respectively. The expression of OPG were 38.10 +/- 7.09, 47.65 +/- 13.85 and 58.60 +/- 5.88, respectively. The differences among the three groups were statistically significant (P<0.05). RANKL and OPG in cysts group were negatively correlated (r=-0.56, P=0.01) and were not correlated with granuloma and control group (P>0.05). RANKL and OPG play roles in the bone absorption of periapical disease. In periapical disease, abnormal expression of RANKL and OPG are detected, RANKL significantly increase, OPG decrease, bone absorption accelerate and osteolytic lesion are observed. In periapical cyst, the bone absorption is more active compared with periapical granuloma.
Baek, Jong Min; Kim, Ju-Young; Ahn, Sung-Jun; Cheon, Yoon-Hee; Yang, Miyoung; Oh, Jaemin; Choi, Min Kyu
2016-03-01
Dendrobium moniliforme (DM) is a well-known plant-derived extract that is widely used in Oriental medicine. DM and its chemical constituents have been reported to have a variety of pharmacological effects, including anti-oxidative, anti-inflammatory, and anti-tumor activities; however, no reports discuss the beneficial effects of DM on bone diseases such as osteoporosis. Thus, we investigated the relationship between DM and osteoclasts, cells that function in bone resorption. We found that DM significantly reduced receptor activator of nuclear factor kappa-B ligand (RANKL)-induced tartrate-resistant acid phosphatase (TRAP)-positive osteoclast formation; DM directly induced the down-regulation of c-Fos and nuclear factor of activated T cells c1 (NFATc1) without affecting other RANKL-dependent transduction pathways. In the later stages of osteoclast maturation, DM negatively regulated the organization of filamentous actin (F-actin), resulting in impaired bone-resorbing activity by the mature osteoclasts. In addition, micro-computed tomography (μ-CT) analysis of the murine model revealed that DM had a beneficial effect on lipopolysaccharide (LPS)-mediated bone erosion. Histological analysis showed that DM attenuated the degradation of trabecular bone matrix and formation of TRAP-positive osteoclasts in bone tissues. These results suggest that DM is a potential candidate for the treatment of metabolic bone disorders such as osteoporosis.
Pelle, Dominic W; Ringler, Jonathan W; Peacock, Jacqueline D; Kampfschulte, Kevin; Scholten, Donald J; Davis, Mary M; Mitchell, Deanna S; Steensma, Matthew R
2014-08-01
Aneurysmal bone cyst (ABC) is a benign tumor of bone presenting as a cystic, expansile lesion in both the axial and appendicular skeleton. Axial lesions demand special consideration, because treatment-related morbidity can be devastating. In similar lesions, such as giant cell tumor of bone (GCTB), the receptor-activator of nuclear kappaB ligand (RANKL)-receptor-activator of nuclear kappaB (RANK) signaling axis is essential to tumor progression. Although ABC and GCTB are distinct entities, they both contain abundant multinucleated giant cells and are osteolytic characteristically. We hypothesize that ABCs express both RANKL and RANK similarly in a cell-type specific manner, and that targeted RANKL therapy will mitigate ABC tumor progression. Cellular expression of RANKL and RANK was determined in freshly harvested ABC samples using laser confocal microscopy. A consistent cell-type-specific pattern was observed: fibroblastlike stromal cells expressed RANKL strongly whereas monocyte/macrophage precursor and multinucleated giant cells expressed RANK. Relative RANKL expression was determined by quantitative real-time polymerase chain reaction in ABC and GCTB tissue samples; no difference in relative expression was observed (P > 0.05). In addition, we review the case of a 5-year-old boy with a large, aggressive sacral ABC. After 3 months of targeted RANKL inhibition with denosumab, magnetic resonance imaging demonstrated tumor shrinkage, bone reconstitution, and healing of a pathologic fracture. Ambulation, and bowel and bladder function were restored at 6 months. Denosumab treatment was well tolerated. Post hoc analysis demonstrated strong RANKL expression in the pretreatment tumor sample. These findings demonstrate that RANKL-RANK signal activation is essential to ABC tumor progression. RANKL-targeted therapy may be an effective alternative to surgery in select ABC presentations. Copyright © 2014 Mosby, Inc. All rights reserved.
Baek, Jong Min; Kim, Ju-Young; Yoon, Kwon-Ha; Oh, Jaemin; Lee, Myeung Su
2016-01-01
Ebselen is a non-toxic seleno-organic drug with anti-inflammatory and antioxidant properties that is currently being examined in clinical trials to prevent and treat various diseases, including atherosclerosis, stroke, and cancer. However, no reports are available for verifying the pharmacological effects of ebselen on major metabolic bone diseases such as osteoporosis. In this study, we observed that ebselen suppressed the formation of tartrate-resistant acid phosphatase (TRAP)-positive multinucleated cells in an osteoblast/osteoclast co-culture by regulating the ratio of receptor activator of nuclear factor kappa-B ligand (RANKL)/osteoprotegerin secreted by osteoblasts. In addition, ebselen treatment in the early stage of osteoclast differentiation inhibited RANKL-dependent osteoclastogenesis by decreasing the phosphorylation of IκB, PI3K, and Akt in early signaling pathways and by subsequently inducing c-Fos and nuclear factor of activated T-cells c1. Further, ebselen induced apoptosis of osteoclasts in the late stage of osteoclast differentiation. In addition, ebselen treatment suppressed filamentous actin ring formation and bone resorption activity of mature osteoclasts. Reflecting these in vitro effects, administration of ebselen recovered bone loss and its µ-CT parameters in lipopolysaccharide-mediated mouse model. Histological analysis confirmed that ebselen prevented trabecular bone matrix degradation and osteoclast formation in the bone tissues. Finally, it was proved that the anti-osteoclastogenic action of ebselen is achieved through targeting N-methyl-D-aspartate (NMDA) receptor. These results indicate that ebselen is a potentially safe drug for treating metabolic bone diseases such as osteoporosis.
Baek, Jong Min; Kim, Ju-Young; Yoon, Kwon-Ha; Oh, Jaemin; Lee, Myeung Su
2016-01-01
Ebselen is a non-toxic seleno-organic drug with anti-inflammatory and antioxidant properties that is currently being examined in clinical trials to prevent and treat various diseases, including atherosclerosis, stroke, and cancer. However, no reports are available for verifying the pharmacological effects of ebselen on major metabolic bone diseases such as osteoporosis. In this study, we observed that ebselen suppressed the formation of tartrate-resistant acid phosphatase (TRAP)-positive multinucleated cells in an osteoblast/osteoclast co-culture by regulating the ratio of receptor activator of nuclear factor kappa-B ligand (RANKL)/osteoprotegerin secreted by osteoblasts. In addition, ebselen treatment in the early stage of osteoclast differentiation inhibited RANKL-dependent osteoclastogenesis by decreasing the phosphorylation of IκB, PI3K, and Akt in early signaling pathways and by subsequently inducing c-Fos and nuclear factor of activated T-cells c1. Further, ebselen induced apoptosis of osteoclasts in the late stage of osteoclast differentiation. In addition, ebselen treatment suppressed filamentous actin ring formation and bone resorption activity of mature osteoclasts. Reflecting these in vitro effects, administration of ebselen recovered bone loss and its µ-CT parameters in lipopolysaccharide-mediated mouse model. Histological analysis confirmed that ebselen prevented trabecular bone matrix degradation and osteoclast formation in the bone tissues. Finally, it was proved that the anti-osteoclastogenic action of ebselen is achieved through targeting N-methyl-D-aspartate (NMDA) receptor. These results indicate that ebselen is a potentially safe drug for treating metabolic bone diseases such as osteoporosis. PMID:27019631
Oakley, Fiona; Meso, Muriel; Iredale, John P; Green, Karen; Marek, Carylyn J; Zhou, Xiaoying; May, Michael J; Millward-Sadler, Harry; Wright, Matthew C; Mann, Derek A
2005-01-01
Resolution of liver fibrosis is associated with clearance of hepatic myofibroblasts by apoptosis; development of strategies that promote this process in a selective way is therefore important. The aim of this study was to determine whether the inhibitor of kappaB kinase suppressor sulfasalazine stimulates hepatic myofibroblast apoptosis and recovery from fibrosis. Hepatic myofibroblasts were generated by culture activation of rat and human hepatic stellate cells. Fibrosis was established in rat livers by chronic injury with carbon tetrachloride followed by recovery with or without sulfasalazine (150 mg/kg) treatment. Treatment of hepatic stellate cells with sulfasalazine (0.5-2.0 mmol/L) induced apoptosis of activated rat and human hepatic stellate cells. A single in vivo administration of sulfasalazine promoted accelerated recovery from fibrosis as assessed by improved fibrosis score, selective clearance of smooth muscle alpha-actin-positive myofibroblasts, reduced hepatic procollagen I and tissue inhibitor of metalloproteinase 1 messenger RNA expression, and increased matrix metalloproteinase 2 activity. Mechanistic studies showed that sulfasalazine selectively blocks nuclear factor-kappaB-dependent gene transcription, inhibits hepatic stellate cell expression of Gadd45beta, stimulates phosphorylation of Jun N-terminal kinase 2, and promotes apoptosis by a mechanism that is prevented by the Jun N-terminal kinase inhibitor SP600125. As further evidence for a survival role for the inhibitor of kappaB kinase/nuclear factor-kappaB pathway in activated hepatic stellate cells, a highly selective cell-permeable peptide inhibitor of kappaB kinase activation also stimulated hepatic stellate cell apoptosis via a Jun N-terminal kinase-dependent mechanism. Inhibition of the inhibitor of kappaB kinase/nuclear factor-kappaB pathway is sufficient to increase the rate at which activated hepatic stellate cells undergo apoptosis both in vitro and in vivo, and drugs that
Chapman, Neil R; Webster, Gill A; Gillespie, Peter J; Wilson, Brian J; Crouch, Dorothy H; Perkins, Neil D
2002-01-01
Members of both Myc and nuclear factor kappaB (NF-kappaB) families of transcription factors are found overexpressed or inappropriately activated in many forms of human cancer. Furthermore, NF-kappaB can induce c-Myc gene expression, suggesting that the activities of these factors are functionally linked. We have discovered that both c-Myc and v-Myc can induce a previously undescribed, truncated form of the RelA(p65) NF-kappaB subunit, RelA(p37). RelA(p37) encodes the N-terminal DNA binding and dimerization domain of RelA(p65) and would be expected to function as a trans-dominant negative inhibitor of NF-kappaB. Surprisingly, we found that RelA(p37) no longer binds to kappaB elements. This result is explained, however, by the observation that RelA(p37), but not RelA(p65), forms a high-molecular-mass complex with c-Myc. These results demonstrate a previously unknown functional and physical interaction between RelA and c-Myc with many significant implications for our understanding of the role that both proteins play in the molecular events underlying tumourigenesis. PMID:12027803
Evidence for activation of nuclear factor kappaB in obstructive sleep apnea.
Yamauchi, Motoo; Tamaki, Shinji; Tomoda, Koichi; Yoshikawa, Masanori; Fukuoka, Atsuhiko; Makinodan, Kiyoshi; Koyama, Noriko; Suzuki, Takahiro; Kimura, Hiroshi
2006-12-01
Obstructive sleep apnea (OSA) is a risk factor for atherosclerosis, and atherosclerosis evolves from activation of the inflammatory cascade. We propose that activation of the nuclear factor kappaB (NF-kappaB), a key transcription factor in the inflammatory cascade, occurs in OSA. Nine age-matched, nonsmoking, and non-hypertensive men with OSA symptoms and seven similar healthy subjects were recruited for standard polysomnography followed by the collection of blood samples for monocyte nuclear p65 concentrations (OSA and healthy groups). In the OSA group, p65 and of monocyte production of tumor necrosis factor alpha (TNF-alpha) were measured at the same time and after the next night of continuous positive airway pressure (CPAP). p65 Concentrations in the OSA group were significantly higher than in the control group [median, 0.037 ng/microl (interquartile range, 0.034 to 0.051) vs 0.019 ng/microl (interquartile range, 0.013 to 0.032); p = 0.008], and in the OSA group were significantly correlated with apnea-hypopnea index and time spent below an oxygen saturation of 90% (r = 0.77 and 0.88, respectively) after adjustment for age and BMI. One night of CPAP resulted in a reduction in p65 [to 0.020 ng/mul (interquartile range, 0.010 to 0.036), p = 0.04] and levels of TNF-alpha production in cultured monocytes [16.26 (interquartile range, 7.75 to 24.85) to 7.59 ng/ml (interquartile range, 5.19 to 12.95), p = 0.01]. NF-kappaB activation occurs with sleep-disordered breathing. Such activation of NF-kappaB may contribute to the pathogenesis of atherosclerosis in OSA patients.
Petegnief, V; Saura, J; de Gregorio-Rocasolano, N; Paul, S M
2001-01-01
In order to better delineate the intracellular signaling pathways underlying glial apolipoprotein E (apoE) expression and release, we have characterized an in vitro model of induction of glial apoE production induced by neuronal death. Exposure of mixed fetal cortical neuron/glia co-cultures to the neurotoxin N-methyl-D-aspartate results in increased apoE expression and release in a time- and concentration-dependent manner. Increased expression of apoE messenger RNA precedes the increase in intracellular apoE, followed by accumulation of the holoprotein in the culture medium. Neuronal injury induced by N-methyl-D-aspartate is accompanied by a reactive astrogliosis as measured by an increase in glial fibrillary acidic protein messenger RNA and protein at 48 and 72h post-lesion, respectively. A similar microgliosis was observed using the microglial marker ED-1. Neuronal injury-induced glial apoE secretion is attenuated by the nuclear factor kappaB inhibitors, aspirin, Bay 11-7082 and MG-132, suggesting that this transcription factor is involved in both constitutive and induced glial apoE expression. The present data show that up-regulation of apoE is an early event in the glial activation triggered by neurodegeneration in vitro and that activation of nuclear factor kappaB directly or indirectly mediates the increase in apoE expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baek, Jong Min; Park, Sun-Hyang; Cheon, Yoon-Hee
Esculetin exerts various biological effects on anti-oxidation, anti-tumors, and anti-inflammation. However, the involvement of esculetin in the bone metabolism process, particularly osteoclast differentiation has not yet been investigated. In the present study, we first confirmed the inhibitory effect of esculetin on receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast formation. We then revealed the relationship between esculetin and the expression of osteoclast-specific molecules to elucidate its underlying mechanisms. Esculetin interfered with the expression of c-Fos and nuclear factor of activated T cell c1 (NFATc1) both at the mRNA and protein level with no involvement in osteoclast-associated early signaling pathways, suppressingmore » the expression of various transcription factors exclusively expressed in osteoclasts such as tartrate-resistant acid phosphatase (Trap), osteoclast-associated receptor (Oscar), dendritic cell-specific transmembrane protein (Dcstamp), osteoclast stimulatory transmembrane protein (Ocstamp), cathepsin K, αvβ3 integrin, and calcitonin receptor (Ctr). Additionally, esculetin inhibited the formation of filamentous actin (F-actin) ring-positive osteoclasts during osteoclast differentiation. However, the development of F-actin structures and subsequent bone resorbing activity of mature osteoclasts, which are observed in osteoclast/osteoblast co-culture systems were not affected by esculetin. Taken together, our results indicate for the first time that esculetin inhibits RANKL-mediated osteoclastogenesis via direct suppression of c-Fos and NFATc1 expression and exerts an inhibitory effect on actin ring formation during osteoclastogenesis. - Highlights: • We first investigated the effects of esculetin on osteoclast differentiation and function. • Our data demonstrate for the first time that esculetin can suppress osteoclastogenesis in vitro. • Esculetin acts as an inhibitor of c-Fos and NFATc1 activation
Induction of nuclear factor kappaB by the CD30 receptor is mediated by TRAF1 and TRAF2.
Duckett, C S; Gedrich, R W; Gilfillan, M C; Thompson, C B
1997-01-01
CD30 is a lymphoid cell-specific surface receptor which was originally identified as an antigen expressed on Hodgkin's lymphoma cells. Activation of CD30 induces the nuclear factor kappaB (NF-kappaB) transcription factor. In this study, we define the domains in CD30 which are required for NF-kappaB activation. Two separate elements of the cytoplasmic domain which were capable of inducing NF-kappaB independently of one another were identified. The first domain (domain 1) mapped to a approximately 120-amino-acid sequence in the membrane-proximal region of the CD30 cytoplasmic tail, between residues 410 and 531. A second, more carboxy-terminal region (domain 2) was identified between residues 553 and 595. Domain 2 contains two 5- to 10-amino-acid elements which can mediate the binding of CD30 to members of the tumor necrosis factor receptor-associated factor (TRAF) family of signal transducing proteins. Coexpression of CD30 with TRAF1 or TRAF2 but not TRAF3 augmented NF-kappaB activation through domain 2 but not domain 1. NF-kappaB induction through domain 2 was inhibited by coexpression of either full-length TRAF3 or dominant negative forms of TRAF1 or TRAF2. In contrast, NF-kappaB induction by domain 1 was not affected by alterations in TRAF protein levels. Together, these data support a model in which CD30 can induce NF-kappaB by both TRAF-dependent and -independent mechanisms. TRAF-dependent induction of NF-kappaB appears to be regulated by the relative levels of individual TRAF proteins in the cell. PMID:9032281
Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P.
2016-01-01
Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes. PMID:27574114
Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P
2016-08-30
Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes.
An, N; Li, Y; Tang, Z L; Chen, X Y; Wang, D X; Gao, Q
2018-06-09
Objective: To investigate the effect of parathyroid hormone (PTH) on the bone healing of mandibular ramus osteotomy. Methods: The mandibular ramus osteotomy model was established in sixty rabbits and these rabbits were randomly divided into experimental group A, experimental group B and control group. In the experimental group A and experimental group B, the rabbits were given PTH (20 and 40 μg/kg respectively) every other day after operation. In the control group, 1 ml saline was given. The animals were sacrificed at 1 week, 2 weeks, 3 weeks and 4 weeks postoperatively. The new bone formation was observed by histology and cone bone CT. The expression of osteoprotegerin and receptor activator of nuclear factor kappa-B (RANKL) in the new bone was detected by real-time quantitative PCR. Results: The experimental groups has better osteogenesis and the bone mineral density than the control group in osteotomy area. The experimental group B showed the best osteogenesis.Osteoprotegerin mRNA expression in experimental group A (1.127±0.035, 1.742±0.049, 1.049±0.062, 1.063±0.036) was significantly higher than that in the control group in each period (0.965±0.082, 1.254±0.071, 0.793±0.061, 0.684±0.055) ( P= 0.010, P= 0.000, P= 0.001, P= 0.020), while group B (1.416±0.205, 2.648±0.168, 1.652±0.091, 1.712±0.070) was significantly higher than group A ( P= 0.000, P= 0.010, P= 0.023, P= 0.003). RANKL mRNA expression in control group (1.666±0.086, 1.058±0.105, 0.885±0.124, 0.972±0.136) was significantly higher than that of the group A (0.788±0.036, 0.585±0.017, 0.692±0.017, 0.527±0.051) ( P= 0.001, P= 0.006, P= 0.003, P= 0.028) in each period, while group A was significantly higher than group B(0.247±0.022, 0.240±0.034, 0.134±0.011, 0.103±0.050) ( P= 0.000, P= 0.001, P= 0.002, P= 0.012). Conclusions: PTH can upregulate the expression of osteoprotegerin and reduce expression of RANKL, thus promoting new bone formation. Intermittent administration of high
Factorization of the association rate coefficient in ligand rebinding to heme proteins
NASA Astrophysics Data System (ADS)
Young, Robert D.
1984-01-01
A stochastic theory of ligand migration in biomolecules is used to analyze the recombination of small ligands to heme proteins after flash photolysis. The stochastic theory is based on a generalized sequential barrier model in which a ligand binds by overcoming a series of barriers formed by the solvent protein interface, the protein matrix, and the heme distal histidine system. The stochastic theory shows that the association rate coefficient λon factorizes into three terms λon =γ12
Involvement of nuclear factor {kappa}B in platelet CD40 signaling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hachem, Ahmed; Yacoub, Daniel; Centre Hospitalier Universite de Montreal, 264 boul. Rene-Levesque est, Montreal, Quebec, Canada H2X 1P1
Highlights: Black-Right-Pointing-Pointer sCD40L induces TRAF2 association to CD40 and NF-{kappa}B activation in platelets. Black-Right-Pointing-Pointer I{kappa}B{alpha} phosphorylation downstream of CD40L/CD40 signaling is independent of p38 MAPK phosphorylation. Black-Right-Pointing-Pointer I{kappa}B{alpha} is required for sCD40L-induced platelet activation and potentiation of aggregation. -- Abstract: CD40 ligand (CD40L) is a thrombo-inflammatory molecule that predicts cardiovascular events. Platelets constitute the major source of soluble CD40L (sCD40L), which has been shown to potentiate platelet activation and aggregation, in a CD40-dependent manner, via p38 mitogen activated protein kinase (MAPK) and Rac1 signaling. In many cells, the CD40L/CD40 dyad also induces activation of nuclear factor kappa B (NF-{kappa}B). Givenmore » that platelets contain NF-{kappa}B, we hypothesized that it may be involved in platelet CD40 signaling and function. In human platelets, sCD40L induces association of CD40 with its adaptor protein the tumor necrosis factor receptor associated factor 2 and triggers phosphorylation of I{kappa}B{alpha}, which are abolished by CD40L blockade. Inhibition of I{kappa}B{alpha} phosphorylation reverses sCD40L-induced I{kappa}B{alpha} phosphorylation without affecting p38 MAPK phosphorylation. On the other hand, inhibition of p38 MAPK phosphorylation has no effect on I{kappa}B{alpha} phosphorylation, indicating a divergence in the signaling pathway originating from CD40 upon its ligation. In functional studies, inhibition of I{kappa}B{alpha} phosphorylation reverses sCD40L-induced platelet activation and potentiation of platelet aggregation in response to a sub-threshold concentration of collagen. This study demonstrates that the sCD40L/CD40 axis triggers NF-{kappa}B activation in platelets. This signaling pathway plays a critical role in platelet activation and aggregation upon sCD40L stimulation and may represent an important target against
Yun, Sumi; Kwak, Yoonjin; Nam, Soo Kyung; Seo, An Na; Oh, Heung-Kwon; Kim, Duck-Woo; Kang, Sung-Bum; Lee, Hye Seung
2018-01-17
Molecular treatments targeting epidermal growth factor receptors (EGFRs) are important strategies for advanced colorectal cancer (CRC). However, clinicopathologic implications of EGFRs and EGFR ligand signaling have not been fully evaluated. We evaluated the expression of EGFR ligands and correlation with their receptors, clinicopathologic factors, and patients' survival with CRC. The expression of EGFR ligands, including heparin binding epidermal growth factor like growth factor (HBEGF), transforming growth factor (TGF), betacellulin, and epidermal growth factor (EGF), were evaluated in 331 consecutive CRC samples using mRNA in situ hybridization (ISH). We also evaluated the expression status of EGFR, human epidermal growth factor receptor 2 (HER2), HER3, and HER4 using immunohistochemistry and/or silver ISH. Unlike low incidences of TGF (38.1%), betacellulin (7.9%), and EGF (2.1%), HBEGF expression was noted in 62.2% of CRC samples. However, the expression of each EGFR ligand did not reveal significant correlations with survival. The combined analyses of EGFR ligands and EGFR expression indicated that the ligands‒/EGFR+ group showed a significant association with the worst disease-free survival (DFS, p=0.018) and overall survival (OS, p=0.005). It was also an independent, unfavorable prognostic factor for DFS (p=0.026) and OS (p=0.007). Additionally, HER4 nuclear expression, regardless of ligand expression, was an independent, favorable prognostic factor for DFS (p=0.034) and OS (p=0.049), by multivariate analysis. Ligand-independent EGFR overexpression was suggested to have a significant prognostic impact; thus, the expression status of EGFR ligands, in addition to EGFR, might be necessary for predicting patients' outcome in CRC.
Role of RANKL in bone diseases.
Anandarajah, Allen P
2009-03-01
Bone remodeling is a tightly regulated process of osteoclast-mediated bone resorption, balanced by osteoblast-mediated bone formation. Disruption of this balance can lead to increased bone turnover, resulting in excessive bone loss or extra bone formation and consequent skeletal disease. The receptor activator of nuclear factor kappaB ligand (RANKL) (along with its receptor), the receptor activator of nuclear factor kappaB and its natural decoy receptor, osteoprotegerin, are the final effector proteins of osteoclastic bone resorption. Here, I provide an overview of recent studies that highlight the key role of RANKL in the pathophysiology of several bone diseases and discuss the novel therapeutic approaches afforded by the modulation of RANKL.
Schrevel, Marlies; Osse, E Michelle; Prins, Frans A; Trimbos, J Baptist M Z; Fleuren, Gert Jan; Gorter, Arko; Jordanova, Ekaterina S
2017-06-01
In cervical cancer, the epidermal growth factor receptor (EGFR) is overexpressed in 70-90% of the cases and has been associated with poor prognosis. EGFR-based therapy is currently being explored in cervical cancer. We investigated which EGFR ligand is primarily expressed in cervical cancer and which cell type functions as the major source of this ligand. We hypothesized that macrophages are the main source of EGFR ligands and that a paracrine loop between tumor cells and macrophages is responsible for ligand expression. mRNA expression analysis was performed on 32 cervical cancer cases to determine the expression of the EGFR ligands amphiregulin, β-cellulin, epidermal growth factor (EGF), epiregulin, heparin-binding EGF-like growth factor (HB‑EGF) and transforming growth factor α (TGFα). Subsequently, protein expression was determined immunohistochemically on 36 additional cases. To assess whether macrophages are the major source of EGFR ligands, immunohistochemical double staining was performed on four representative tissue slides. Expression of the chemokines granulocyte-macrophage colony-stimulating factor (GM-CSF) and C-C motif ligand 2 (CCL2) was determined by mRNA in situ hybridization. Of the known EGFR ligands, HB‑EGF had the highest mRNA expression and HB‑EGF and EGFR protein expression were highly correlated. Tumor specimens with high EGFR expression showed higher numbers of macrophages, and higher expression of GM-CSF and CCL2, but only a small subset (9%) of macrophages was found to be HB‑EGF-positive. Strikingly, 78% of cervical cancer specimens were found to express HB‑EGF. Standardized assessment of staining intensity, using spectral imaging analysis, showed that HB‑EGF expression was higher in the tumor compartment than in the stromal compartment. These results suggest that HB‑EGF is an important EGFR ligand in cervical cancer and that cervical cancer cells are the predominant source of HB‑EGF. Therefore, we propose an autocrine
Ligand binding and dynamics of the monomeric epidermal growth factor receptor ectodomain
Loeffler, Hannes H; Winn, Martyn D
2013-01-01
The ectodomain of the human epidermal growth factor receptor (hEGFR) controls input to several cell signalling networks via binding with extracellular growth factors. To gain insight into the dynamics and ligand binding of the ectodomain, the hEGFR monomer was subjected to molecular dynamics simulation. The monomer was found to be substantially more flexible than the ectodomain dimer studied previously. Simulations where the endogeneous ligand EGF binds to either Subdomain I or Subdomain III, or where hEGFR is unbound, show significant differences in dynamics. The molecular mechanics Poisson–Boltzmann surface area method has been used to derive relative free energies of ligand binding, and we find that the ligand is capable of binding either subdomain with a slight preference for III. Alanine-scanning calculations for the effect of selected ligand mutants on binding reproduce the trends of affinity measurements. Taken together, these results emphasize the possible role of the ectodomain monomer in the initial step of ligand binding, and add details to the static picture obtained from crystal structures. Proteins 2013; 81:1931–1943. © 2013 The Authors. Proteins published by Wiley Periodicals, Inc. PMID:23760854
Yu, Xiaochun; Sharma, Kailash D.; Takahashi, Tsuyoshi; Iwamoto, Ryo; Mekada, Eisuke
2002-01-01
Dimerization and phosphorylation of the epidermal growth factor (EGF) receptor (EGFR) are the initial and essential events of EGF-induced signal transduction. However, the mechanism by which EGFR ligands induce dimerization and phosphorylation is not fully understood. Here, we demonstrate that EGFRs can form dimers on the cell surface independent of ligand binding. However, a chimeric receptor, comprising the extracellular and transmembrane domains of EGFR and the cytoplasmic domain of the erythropoietin receptor (EpoR), did not form a dimer in the absence of ligands, suggesting that the cytoplasmic domain of EGFR is important for predimer formation. Analysis of deletion mutants of EGFR showed that the region between 835Ala and 918Asp of the EGFR cytoplasmic domain is required for EGFR predimer formation. In contrast to wild-type EGFR ligands, a mutant form of heparin-binding EGF-like growth factor (HB2) did not induce dimerization of the EGFR-EpoR chimeric receptor and therefore failed to activate the chimeric receptor. However, when the dimerization was induced by a monoclonal antibody to EGFR, HB2 could activate the chimeric receptor. These results indicate that EGFR can form a ligand-independent inactive dimer and that receptor dimerization and activation are mechanistically distinct and separable events. PMID:12134089
Henriksen, Lasse; Grandal, Michael Vibo; Knudsen, Stine Louise Jeppe; van Deurs, Bo; Grøvdal, Lene Melsæther
2013-01-01
The epidermal growth factor receptor (EGFR) regulates normal growth and differentiation, but dysregulation of the receptor or one of the EGFR ligands is involved in the pathogenesis of many cancers. There are eight ligands for EGFR, however most of the research into trafficking of the receptor after ligand activation focuses on the effect of epidermal growth factor (EGF) and transforming growth factor-α (TGF-α). For a long time it was believed that clathrin-mediated endocytosis was the major pathway for internalization of the receptor, but recent work suggests that different pathways exist. Here we show that clathrin ablation completely inhibits internalization of EGF- and TGF-α-stimulated receptor, however the inhibition of receptor internalization in cells treated with heparin-binding EGF-like growth factor (HB-EGF) or betacellulin (BTC) was only partial. In contrast, clathrin knockdown fully inhibits EGFR degradation after all ligands tested. Furthermore, inhibition of dynamin function blocked EGFR internalization after stimulation with all ligands. Knocking out a number of clathrin-independent dynamin-dependent pathways of internalization had no effect on the ligand-induced endocytosis of the EGFR. We suggest that EGF and TGF-α lead to EGFR endocytosis mainly via the clathrin-mediated pathway. Furthermore, we suggest that HB-EGF and BTC also lead to EGFR endocytosis via a clathrin-mediated pathway, but can additionally use an unidentified internalization pathway or better recruit the small amount of clathrin remaining after clathrin knockdown. PMID:23472148
Ginseng saponins and the treatment of osteoporosis: mini literature review
Siddiqi, Muhammad Hanif; Siddiqi, Muhammad Zubair; Ahn, Sungeun; Kang, Sera; Kim, Yeon-Ju; Sathishkumar, Natarajan; Yang, Dong-Uk; Yang, Deok-Chun
2013-01-01
The ginseng plant (Panax ginseng Meyer) has a large number of active ingredients including steroidal saponins with a dammarane skeleton as well as protopanaxadiol and protopanaxatriol, commonly known as ginsenosides, which have antioxidant, anticancer, antidiabetic, anti-adipocyte, and sexual enhancing effects. Though several discoveries have demonstrated that ginseng saponins (ginsenosides) as the most important therapeutic agent for the treatment of osteoporosis, yet the molecular mechanism of its active metabolites is unknown. In this review, we summarize the evidence supporting the therapeutic properties of ginsenosides both in vivo and in vitro, with an emphasis on the different molecular agents comprising receptor activator of nuclear factor kappa-B ligand, receptor activator of nuclear factor kappa-B, and matrix metallopeptidase-9, as well as the bone morphogenetic protein-2 and Smad signaling pathways. PMID:24198650
Sriwijitkamol, Apiradee; Christ-Roberts, Christine; Berria, Rachele; Eagan, Phyllis; Pratipanawatr, Thongchai; DeFronzo, Ralph A; Mandarino, Lawrence J; Musi, Nicolas
2006-03-01
Skeletal muscle insulin resistance plays a key role in the pathogenesis of type 2 diabetes. It recently has been hypothesized that excessive activity of the inhibitor of kappaB (IkappaB)/nuclear factor kappaB (NFkappaB) inflammatory pathway is a mechanism underlying skeletal muscle insulin resistance. However, it is not known whether IkappaB/NFkappaB signaling in muscle from subjects with type 2 diabetes is abnormal. We studied IkappaB/NFkappaB signaling in vastus lateralis muscle from six subjects with type 2 diabetes and eight matched control subjects. Muscle from type 2 diabetic subjects was characterized by a 60% decrease in IkappaB beta protein abundance, an indicator of increased activation of the IkappaB/NFkappaB pathway. IkappaB beta abundance directly correlated with insulin-mediated glucose disposal (Rd) during a hyperinsulinemic (40 mU x m(-2) x min(-1))-euglycemic clamp (r = 0.63, P = 0.01), indicating that increased IkappaB/NFkappaB pathway activity is associated with muscle insulin resistance. We also investigated whether reversal of this abnormality could be a mechanism by which training improves insulin sensitivity. In control subjects, 8 weeks of aerobic exercise training caused a 50% increase in both IkappaB alpha and IkappaB beta protein. In subjects with type 2 diabetes, training increased IkappaB alpha and IkappaB beta protein to levels comparable with that of control subjects, and these increments were accompanied by a 40% decrease in tumor necrosis factor alpha muscle content and a 37% increase in insulin-stimulated glucose disposal. In summary, subjects with type 2 diabetes have reduced IkappaB protein abundance in muscle, suggesting excessive activity of the IkappaB/NFkappaB pathway. Moreover, this abnormality is reversed by exercise training.
Vermes, C; Roebuck, K A; Chandrasekaran, R; Dobai, J G; Jacobs, J J; Glant, T T
2000-09-01
Particulate wear debris generated mechanically from prosthetic materials is phagocytosed by a variety of cell types within the periprosthetic space including osteoblasts, which cells with an altered function may contribute to periprosthetic osteolysis. Exposure of osteoblast-like osteosarcoma cells or bone marrow-derived primary osteoblasts to either metallic or polymeric particles of phagocytosable sizes resulted in a marked decrease in the steady-state messenger RNA (mRNA) levels of procollagen alpha1[I] and procollagen alpha1[III]. In contrast, no significant effect was observed for the osteoblast-specific genes, such as osteonectin and osteocalcin (OC). In kinetic studies, particles once phagocytosed, maintained a significant suppressive effect on collagen gene expression and type I collagen synthesis for up to five passages. Large particles of a size that cannot be phagocytosed also down-regulated collagen gene expression suggesting that an initial contact between cells and particles can generate gene responsive signals independently of the phagocytosis process. Concerning such signaling, titanium particles rapidly increased protein tyrosine phosphorylation and nuclear transcription factor kappaB (NF-kappaB) binding activity before the phagocytosis of particles. Protein tyrosine kinase (PTK) inhibitors such as genistein and the NF-kappaB inhibitor pyrrolidine dithiocarbamate (PDTC) significantly reduced the suppressive effect of titanium on collagen gene expression suggesting particles suppress collagen gene expression through the NF-kappaB signaling pathway. These results provide a mechanism by which particulate wear debris can antagonize the transcription of the procollagen alpha1[I] gene in osteoblasts, which may contribute to reduced bone formation and progressive periprosthetic osteolysis.
Capozzi, Anna; Lello, Stefano; Pontecorvi, Alfredo
2014-06-01
There is great interest in new treatments of osteoporosis owing to general ageing of population and increased risk for fragility fractures in the elderly. Current therapies show a good efficacy in improving bone quality and bone density, but, in spite of a certain reduction in fracture rate, according to each treatment, the problem of osteoporotic fractures is yet far from to be solved. Moreover, some treatments may produce different side effects. Denosumab (Dmab), a receptor activator of nuclear factor kappa-B ligand (RANKL)-inhibitor, is an agent recently introduced in clinical practice for treatment of osteoporosis of postmenopausal women. Dmab has improved bone mineral density and prevented new vertebral and non-vertebral fractures with a similar efficacy in comparison with alendronate. Many clinical studies showed Dmab produces also significant improvement versus placebo in bone quality as indicated by decreasing markers of bone turnover. Patients using Dmab reported less risk of AFF (Atypical Femoral Fractures) and ONJ (Osteonecrosis of the Jaw) with an increased number of cellulitis. Here, we review articles using Dmab for female post-menopausal osteoporosis.
Mouse glucocorticoid-induced tumor necrosis factor receptor ligand is costimulatory for T cells
Tone, Masahide; Tone, Yukiko; Adams, Elizabeth; Yates, Stephen F.; Frewin, Mark R.; Cobbold, Stephen P.; Waldmann, Herman
2003-01-01
Recently, agonist antibodies to glucocorticoid-induced tumor necrosis factor receptor (GITR) (tumor necrosis factor receptor superfamily 18) have been shown to neutralize the suppressive activity of CD4+CD25+ regulatory T cells. It was anticipated that this would be the role of the physiological ligand. We have identified and expressed the gene for mouse GITR ligand and have confirmed that its interaction with GITR reverses suppression by CD4+CD25+ T cells. It also, however, provides a costimulatory signal for the antigen-driven proliferation of naïve T cells and polarized T helper 1 and T helper 2 clones. RT-PCR and mAb staining revealed mouse GITR ligand expression in dendritic cells, macrophages, and B cells. Expression was controlled by the transcription factor NF-1 and potentially by alternative splicing of mRNA destabilization sequences. PMID:14608036
Kim, Ryungsa; Emi, Manabu; Tanabe, Kazuaki; Uchida, Yoko; Toge, Tetsuya
2004-06-01
Despite the fact that expression of Fas ligand (FasL) in cytotoxic T lymphocytes (CTLs) and in natural killer (NK) cells plays an important role in Fas-mediated tumor killing, During tumor progression FasL-expressing tumor cells are involved in counterattacking to kill tumor-infiltrating lymphocytes (TILs). Soluble FasL levels also increase with tumor progression in solid tumors, and this increase inhibits Fas-mediated tumor killing by CTLs and NK cells. The increased expression of FasL in tumor cells is associated with decreased expression of Fas; and the promoter region of the FASL gene is regulated by transcription factors, such as neuronal factor kappaB (NF-kappaB) and AP-1, in the tumor microenvironment. Although the ratio of FasL expression to Fas expression in tumor cells is not strongly related to the induction of apoptosis in TILs, increased expression of FasL is associated with decreased Fas levels in tumor cells that can escape immune surveillance and facilitate tumor progression and metastasis. Transforming growth factor beta (TGF-beta) is a potent growth inhibitor and has tumor-suppressing activity in the early phases of carcinogenesis. During subsequent tumor progression, the increased secretion of TGF-beta by both tumor cells and, in a paracrine fashion, stromal cells, is involved in the enhancement of tumor invasion and metastasis accompanied by immunosuppression. Herein, the authors review the clinical significance of FasL and TGF-beta expression patterns as features of immune privilege accompanying tumor progression in the tumor microenvironment. Potential strategies for identifying which molecules can serve as targets for effective antitumor therapy also are discussed. Copyright 2004 American Cancer Society.
Wang, Xuping; Zheng, Rongzong; Huang, Xiaowen; Mao, Zhujun; Wang, Nani; Li, Hongyu; Wen, Chengping; Shou, Dan
2018-03-25
Chronic osteomyelitis is primarily caused by infection with Staphylococcus aureus (S. aureus). Antibiotics are commonly administered; however, it is a challenge to promote bone healing. The aim of this study was to investigate the in vitro effects of alkaloids from the herbal remedy Sophora flavescens (ASF) on rat calvarial osteoblasts (ROBs) infected with S. aureus and healthy osteoclasts. Cell proliferation and alkaline phosphatase, interleukin-6, and tumour necrosis factor-α activity was measured in infected ROBs; tartrate-resistant acid phosphatase was evaluated in osteoclasts via enzyme-linked immunosorbent assay. The mRNA and protein expression levels of bone morphogenetic protein 2, runt-related transcription factor 2, osteoprotegerin, and receptor activator of nuclear factor kappa-B ligand were assessed in infected ROBs through reverse transcription-polymerase chain reaction and western blotting analysis, respectively. Results indicated that ASF increased the viability of uninfected ROBs and infected ROBs treated with vancomycin via regulation of bone morphogenetic protein 2, runt-related transcription factor, osteoprotegerin, and receptor activator of nuclear factor kappa-B ligand mRNA and protein expression levels. In addition, the secretion of the inflammatory factor tumour necrosis factor-α was decreased and alkaline phosphatase activity was increased, inhibiting the viability of osteoclasts and tartrate-resistant acid phosphatase activity. Therefore, the herbal remedy ASF has potential as a new treatment for chronic osteomyelitis. Copyright © 2018 John Wiley & Sons, Ltd.
NASA Astrophysics Data System (ADS)
Kuo, Chun-Liang; Kao, Chia-Tze; Fang, Hsin-Yuan; Huang, Tsui-Hsien; Chen, Yi-Wen; Shie, Ming-You
2015-03-01
Macrophage cells are the important effector cells in the immune reaction which are indispensable for osteoclastogenesis; their heterogeneity and plasticity renders macrophages a primer target for immune system modulation. In recent years, there have been very few studies about the effects of macrophage cells on laser treatment-regulated osteoclastogenesis. In this study, RAW 264.7 macrophage cells were treated with RANKL to regulate osteoclastogenesis. We used a CO2 laser as a model biostimulation to investigate the role of osteoclastogenic. We also evaluated cell viability, cell death and cathepsin K expression. The CO2 laser inhibited a receptor activator of the NF-ĸB ligand (RANKL)-induced formation of osteoclasts during the osteoclast differentiation process. It was also found that irradiation for two times reduced RANKL-enhanced TRAP activity in a dose-dependent manner. Furthermore, CO2 laser-treatment diminished the expression and secretion of cathepsin K elevated by RANKL and was concurrent with the inhibition of TRAF6 induction and NF-ĸB activation. The current report demonstrates that CO2 laser abrogated RANKL-induced osteoclastogenesis by retarding osteoclast differentiation. The CO2 laser can modulate every cell through dose-dependent in vitro RANKL-mediated osteoclastogenesis, such as the proliferation and fusion of preosteoclasts and the maturation of osteoclasts. Therefore, the current results serve as an improved explanation of the cellular roles of macrophage cell populations in osteoclastogenesis as well as in alveolar bone remodeling by CO2 laser-treatment.
Zhang, Li-Da; Ma, Li; Zhang, Li; Dai, Jian-Guo; Chang, Li-Gong; Huang, Pei-Lin; Tian, Xiao-Qiang
2015-01-01
Background: Hyperbaric oxygen (HBO) and Ginkgo biloba extract (e.g., EGB 761) were shown to ameliorate cognitive and memory impairment in Alzheimer's disease (AD). However, the exact mechanism remains elusive. The aim of the present study was to investigate the possible mechanisms of HBO and EGB 761 via the function of nuclear factor kappa-B (NF-κB) pathway. Methods: AD rats were induced by injecting β-amyloid 25–35 into the hippocampus. All animals were divided into six groups: Normal, sham, AD model, HBO (2 atmosphere absolute; 60 min/d), EGB 761 (20 mg·kg−1·d−1), and HBO/EGB 761 groups. Morris water maze tests were used to assess cognitive, and memory capacities of rats; TdT-mediated dUTP Nick-End Labeling staining and Western blotting were used to analyze apoptosis and NF-κB pathway-related proteins in hippocampus tissues. Results: Morris water maze tests revealed that EGB 761 and HBO significantly improved the cognitive and memory ability of AD rats. In addition, the protective effect of combinational therapy (HBO/EGB 761) was superior to either HBO or EGB 761 alone. In line, reduced apoptosis with NF-κB pathway activation was observed in hippocampus neurons treated by HBO and EGB 761. Conclusions: Our results suggested that HBO and EGB 761 improve cognitive and memory capacity in a rat model of AD. The protective effects are associated with the reduced apoptosis with NF-κB pathway activation in hippocampus neurons. PMID:26608991
Loganathan, R; Selvaduray, K R; Nesaretnam, K; Radhakrishnan, A K
2013-04-01
Tocotrienols and tocopherols are members of the vitamin E family, with similar structures; however, only tocotrienols have been reported to achieve potent anti-cancer effects. The study described here has evaluated anti-cancer activity of vitamin E to elucidate mechanisms of cell death, using human breast cancer cells. Anti-cancer activity of a tocotrienol-rich fraction (TRF) and a tocotrienol-enriched fraction (TEF) isolated from palm oil, as well as pure vitamin E analogues (α-tocopherol, α-, δ- and γ-tocotrienols) were studied using highly aggressive triple negative MDA-MB-231 cells and oestrogen-dependent MCF-7 cells, both of human breast cancer cell lines. Cell population growth was evaluated using a Coulter particle counter. Cell death mechanism, poly(ADP-ribose) polymerase cleavage and levels of NF-κB were determined using commercial ELISA kits. Tocotrienols exerted potent anti-proliferative effects on both types of cell by inducing apoptosis, the underlying mechanism of cell death being ascertained using respective IC50 concentrations of all test compounds. There was marked induction of apoptosis in both cell lines by tocotrienols compared to treatment with Paclitaxel, which was used as positive control. This activity was found to be associated with cleavage of poly(ADP-ribose) polymerase (a DNA repair protein), demonstrating involvement of the apoptotic cell death signalling pathway. Tocotrienols also inhibited expression of nuclear factor kappa-B (NF-κB), which in turn can increase sensitivity of cancer cells to apoptosis. Tocotrienols induced anti-proliferative and apoptotic effects in association with DNA fragmentation, poly(ADP-ribose) polymerase cleavage and NF-κB inhibition in the two human breast cancer cell lines. © 2013 Blackwell Publishing Ltd.
Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.
Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F
2014-10-17
The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.
EGF receptor ligands: recent advances.
Singh, Bhuminder; Carpenter, Graham; Coffey, Robert J
2016-01-01
Seven ligands bind to and activate the mammalian epidermal growth factor (EGF) receptor (EGFR/ERBB1/HER1): EGF, transforming growth factor-alpha (TGFA), heparin-binding EGF-like growth factor (HBEGF), betacellulin (BTC), amphiregulin (AREG), epiregulin (EREG), and epigen (EPGN). Of these, EGF, TGFA, HBEGF, and BTC are thought to be high-affinity ligands, whereas AREG, EREG, and EPGN constitute low-affinity ligands. This focused review is meant to highlight recent studies related to actions of the individual EGFR ligands, the interesting biology that has been uncovered, and relevant advances related to ligand interactions with the EGFR.
EGF receptor ligands: recent advances
Singh, Bhuminder; Carpenter, Graham; Coffey, Robert J.
2016-01-01
Seven ligands bind to and activate the mammalian epidermal growth factor (EGF) receptor (EGFR/ERBB1/HER1): EGF, transforming growth factor-alpha (TGFA), heparin-binding EGF-like growth factor (HBEGF), betacellulin (BTC), amphiregulin (AREG), epiregulin (EREG), and epigen (EPGN). Of these, EGF, TGFA, HBEGF, and BTC are thought to be high-affinity ligands, whereas AREG, EREG, and EPGN constitute low-affinity ligands. This focused review is meant to highlight recent studies related to actions of the individual EGFR ligands, the interesting biology that has been uncovered, and relevant advances related to ligand interactions with the EGFR. PMID:27635238
Embryonic expression of the transforming growth factor beta ligand and receptor genes in chicken.
Cooley, James R; Yatskievych, Tatiana A; Antin, Parker B
2014-03-01
Transforming growth factor-beta (TGFβ) signaling regulates a myriad of biological processes during embryogenesis, in the adult, and during the manifestation of disease. TGFβ signaling is propagated through one of three TGFβ ligands interacting with Type I and Type II receptors, and Type III co-receptors. Although TGFβ signaling is regulated partly by the combinatorial expression patterns of TGFβ receptors and ligands, a comprehensive gene expression analysis has not been published. Here we report the embryonic mRNA expression patterns in chicken embryos of the canonical TGFβ ligands (TGFB1, TGFB2, and TGFB3) and receptors (TGFBR1, TGFBR2, TGFBR3), plus the Activin A receptor, type 1 (ACVR1) and co receptor Endoglin (ENG) that also transduce TGFβ signaling. TGFB ligands and receptors show dynamic and frequently overlapping expression patterns in numerous embryonic cell layers and structures. Integrating expression information identifies combinations of ligands and receptors that are involved in specific developmental processes including somitogenesis, cardiogenesis and vasculogenesis. Copyright © 2013 Wiley Periodicals, Inc.
Lane-Serff, Harriet; MacGregor, Paula; Lowe, Edward D; Carrington, Mark; Higgins, Matthew K
2014-12-12
The haptoglobin-haemoglobin receptor (HpHbR) of African trypanosomes allows acquisition of haem and provides an uptake route for trypanolytic factor-1, a mediator of innate immunity against trypanosome infection. In this study, we report the structure of Trypanosoma brucei HpHbR in complex with human haptoglobin-haemoglobin (HpHb), revealing an elongated ligand-binding site that extends along its membrane distal half. This contacts haptoglobin and the β-subunit of haemoglobin, showing how the receptor selectively binds HpHb over individual components. Lateral mobility of the glycosylphosphatidylinositol-anchored HpHbR, and a ∼50° kink in the receptor, allows two receptors to simultaneously bind one HpHb dimer. Indeed, trypanosomes take up dimeric HpHb at significantly lower concentrations than monomeric HpHb, due to increased ligand avidity that comes from bivalent binding. The structure therefore reveals the molecular basis for ligand and innate immunity factor uptake by trypanosomes and identifies adaptations that allow efficient ligand uptake in the context of the complex trypanosome cell surface.
Artificial ligand binding within the HIF2[alpha] PAS-B domain of the HIF2 transcription factor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Scheuermann, Thomas H.; Tomchick, Diana R.; Machius, Mischa
2009-05-12
The hypoxia-inducible factor (HIF) basic helix-loop-helix Per-aryl hydrocarbon receptor nuclear translocator (ARNT)-Sim (bHLH-PAS) transcription factors are master regulators of the conserved molecular mechanism by which metazoans sense and respond to reductions in local oxygen concentrations. In humans, HIF is critically important for the sustained growth and metastasis of solid tumors. Here, we describe crystal structures of the heterodimer formed by the C-terminal PAS domains from the HIF2{alpha} and ARNT subunits of the HIF2 transcription factor, both in the absence and presence of an artificial ligand. Unexpectedly, the HIF2{alpha} PAS-B domain contains a large internal cavity that accommodates ligands identified frommore » a small-molecule screen. Binding one of these ligands to HIF2{alpha} PAS-B modulates the affinity of the HIF2{alpha}:ARNT PAS-B heterodimer in vitro. Given the essential role of PAS domains in forming active HIF heterodimers, these results suggest a presently uncharacterized ligand-mediated mechanism for regulating HIF2 activity in endogenous and clinical settings.« less
Bolkun, L; Lemancewicz, D; Jablonska, E; Szumowska, A; Bolkun-Skornicka, U; Moniuszko, M; Dzieciol, J; Kloczko, J
2015-03-01
Altered activities of ligands belonging to tumour necrosis factor (TNF) superfamily, namely B-cell activating factor (BAFF), a proliferation-inducing ligand (APRIL) and apoptosis inducing ligand (TRAIL) were demonstrated in several haematological diseases including acute lymphoblastic leukaemia (ALL). BAFF, APRIL and TRAIL provide crucial survival signals to immature, naive and activated B cells. These ligands are capable of activating a broad spectrum of intracellular signalling cascades that can either induce apoptosis or protect from programmed cell death. BAFF and APRIL, which can directly activate the NF-κB pathway, have been identified as crucial survival factors for ALL cells. Here, we have analyzed serum BAFF, APRIL and TRAIL concentrations in 48 patients with newly diagnosed ALL and 44 healthy volunteers. The levels of APRIL and BAFF were significantly higher in ALL patients as compared to healthy volunteers. In contrast, concentrations of TRAIL were significantly lower in ALL patients. Moreover, following induction, the levels of APRIL, but not BAFF or TRAIL, were significantly lower in a group of patients with complete remission (CR) as compared to non-respondent (NR) ALL patients. Furthermore, we demonstrated statistically significant differences in concentrations of APRIL between CR MRD-negative and CR, MRD-positive ALL patients. Notably detection of higher concentrations of APRIL was associated with shorter leukaemia-free survival and overall survival. Altogether, our data indicate that APRIL can play an important role in the pathogenesis of ALL and the measurement of APRIL levels can improve prognostication in ALL patients. Copyright © 2014 Elsevier Ltd. All rights reserved.
Desclozeaux, Marion; Krylova, Irina N.; Horn, Florence; Fletterick, Robert J.; Ingraham, Holly A.
2002-01-01
Steroidogenic factor 1 (SF-1) is an orphan nuclear receptor with no known ligand. We showed previously that phosphorylation at serine 203 located N′-terminal to the ligand binding domain (LBD) enhanced cofactor recruitment, analogous to the ligand-mediated recruitment in ligand-dependent receptors. In this study, results of biochemical analyses and an LBD helix assembly assay suggest that the SF-1 LBD adopts an active conformation, with helices 1 and 12 packed against the predicted alpha-helical bundle, in the apparent absence of ligand. Fine mapping of the previously defined proximal activation function in SF-1 showed that the activation function mapped fully to helix 1 of the LBD. Limited proteolyses demonstrate that phosphorylation of S203 in the hinge region mimics the stabilizing effects of ligand on the LBD. Moreover, similar effects were observed in an SF-1/thyroid hormone LBD chimera receptor, illustrating that the S203 phosphorylation effects are transferable to a heterologous ligand-dependent receptor. Our collective data suggest that the hinge together with helix 1 is an individualized specific motif, which is tightly associated with its cognate LBD. For SF-1, we find that this intramolecular association and hence receptor activity are further enhanced by mitogen-activated protein kinase phosphorylation, thus mimicking many of the ligand-induced changes observed for ligand-dependent receptors. PMID:12242296
Effects of different ligands on epidermal growth factor receptor (EGFR) nuclear translocation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Faria, Jerusa A.Q.A.; Andrade, Carolina de; Goes, Alfredo M.
The epidermal growth factor receptor (EGFR) is activated through binding to specific ligands and generates signals for proliferation, differentiation, migration, and cell survival. Recent data show the role of nuclear EGFR in tumors. Although many EGFR ligands are upregulated in cancers, little is known about their effects on EGFR nuclear translocation. We have compared the effects of six EGFR ligands (EGF, HB-EGF, TGF-α, β-Cellulin, amphiregulin, and epiregulin) on nuclear translocation of EGFR, receptor phosphorylation, migration, and proliferation. Cell fractionation and confocal immunofluorescence detected EGFR in the nucleus after EGF, HB-EGF, TGF-α and β-Cellulin stimulation in a dose-dependent manner. In contrast,more » amphiregulin and epiregulin did not generate nuclear translocation of EGFR. EGF, HB-EGF, TGF-α and β-Cellulin showed correlations between a higher rate of wound closure and increased phosphorylation of residues in the carboxy-terminus of EGFR, compared to amphiregulin and epiregulin. The data indicate that EGFR is translocated to the nucleus after stimulation with EGF, HB-EGF, TGF-α and β-Cellulin, and that these ligands are related to increased phosphorylation of EGFR tyrosine residues, inducing migration of SkHep-1 cells. - Highlights: • EGF, HB-EGF, TGF-α, β-Cellulin are involved in the EGFR nuclear translocation. • Amphiregulin and epiregulin did not promote nuclear translocation of EGFR. • EGF, HB-EGF, TGF-α and β-Cellulin have a role in SkHep-1 cells migration. • EGFR ligands associated with better prognosis don't stimulate EGFR translocation.« less
Morukov, I B; Rykova, M P; Antropova, E N; Berendeeva, T A; Ponomarev, S A; Morukov, B V
2014-01-01
The results of studying the system of osteoprotegerin/ receptor activator of nuclear factor kappa-B ligand (OPG/RANKL) in 22 cosmonauts after long-duration (124 to 199 days) ISS missions are presented. Immediately on return to 1 g, changes were observed in OPG and RANKL serum levels and the ability to produce unstimulated and stimulated PGA of peripheral blood mononuclear cells in vitro. Individual variability of these changes was noticed. Our findings suggest that the cytokine OPG/RANKL-system is involved in bone remodeling in members of long-duration space missions.
Kerpedjieva, Svetoslava S; Kim, Duk Soo; Barbeau, Dominique J; Tamama, Kenichi
2012-09-01
Cell therapy with adult bone marrow multipotential stromal cells/mesenchymal stem cells (MSCs) presents a promising approach to promote wound healing and tissue regeneration. The strong paracrine capability of various growth factors and cytokines is a key mechanism of MSC-mediated wound healing and tissue regeneration, and the goal of this study is to understand the underlying mechanism that supports the strong paracrine machineries in MSCs. Microarray database analyses revealed that early growth response-1 (EGR1) is highly expressed in MSCs. Our previous studies showed that epidermal growth factor (EGF) treatment induces growth factor production in MSCs in vitro. Since EGF strongly upregulates EGR1, we hypothesized that EGF receptor (EGFR)-EGR1 signaling plays a pivotal role in MSC paracrine activity. EGF treatment upregulated the gene expression of growth factors and cytokines, including EGFR ligands in a protein kinase C (PKC)- and/or mitogen-activated protein kinase-extracellular-signal-regulated kinase-dependent manner, and it was reversed by shRNA against EGR1. PKC activator phorbol 12-myristate 13-acetate enhanced EGFR tyrosyl phosphorylation and upregulated the gene expression of growth factors and cytokines in a heparin-binding EGF-like growth factor (HBEGF) inhibitor CRM197 sensitive manner, indicating an involvement of autocrined HBEGF in the downstream of PKC signaling. Moreover, stimulation with growth factors and cytokines induced the expression of EGFR ligands, presumably via EGR1 upregulation. These data indicate EGR1 as a convergence point of multiple signaling pathways, which in turn augments the production of multiple growth factors and cytokines by enhancing the autocrine signaling with EGFR ligands.
Targeting Nuclear Factor kappa B for the Treatment of Prostate Cancer
2005-02-01
J Immunol 163:5617-23, 1999 3. Mendonca M, Hardacre, M, Datzman, N, Comerford, K, Chin-Sinex, H, Sweeney C.: Inhibition of constitutive NFkappaB ...nuclear factor kappaB activation in 20:7342-51. PC3 cells by genistein is mediated via Akt signaling pathway. Clin 9. Huang S, DeGuzman A, Bucana CD
Kerpedjieva, Svetoslava S.; Kim, Duk Soo; Barbeau, Dominique J.
2012-01-01
Cell therapy with adult bone marrow multipotential stromal cells/mesenchymal stem cells (MSCs) presents a promising approach to promote wound healing and tissue regeneration. The strong paracrine capability of various growth factors and cytokines is a key mechanism of MSC-mediated wound healing and tissue regeneration, and the goal of this study is to understand the underlying mechanism that supports the strong paracrine machineries in MSCs. Microarray database analyses revealed that early growth response-1 (EGR1) is highly expressed in MSCs. Our previous studies showed that epidermal growth factor (EGF) treatment induces growth factor production in MSCs in vitro. Since EGF strongly upregulates EGR1, we hypothesized that EGF receptor (EGFR)–EGR1 signaling plays a pivotal role in MSC paracrine activity. EGF treatment upregulated the gene expression of growth factors and cytokines, including EGFR ligands in a protein kinase C (PKC)- and/or mitogen-activated protein kinase–extracellular-signal-regulated kinase-dependent manner, and it was reversed by shRNA against EGR1. PKC activator phorbol 12-myristate 13-acetate enhanced EGFR tyrosyl phosphorylation and upregulated the gene expression of growth factors and cytokines in a heparin-binding EGF-like growth factor (HBEGF) inhibitor CRM197 sensitive manner, indicating an involvement of autocrined HBEGF in the downstream of PKC signaling. Moreover, stimulation with growth factors and cytokines induced the expression of EGFR ligands, presumably via EGR1 upregulation. These data indicate EGR1 as a convergence point of multiple signaling pathways, which in turn augments the production of multiple growth factors and cytokines by enhancing the autocrine signaling with EGFR ligands. PMID:22316125
The nuclear-factor kappaB pathway is activated in pterygium.
Siak, Jay Jyh Kuen; Ng, See Liang; Seet, Li-Fong; Beuerman, Roger W; Tong, Louis
2011-01-05
Pterygium is a prevalent ocular surface disease with unknown pathogenesis. The authors investigated the role of nuclear factor kappa B (NF-κB) transcription factors in pterygium. Surgically excised primary pterygia were studied compared with uninvolved conjunctiva tissues. NF-κB activation was evaluated using Western blot analysis, ELISA, and DNA-binding assays. Primary pterygium fibroblasts were treated with TNF-α (20 ng/mL), and NF-κB activation was evaluated using immunocytochemistry, Western blot analysis, phospho-IκBα ELISA, and DNA-binding assays. TNF-α stimulation of NF-κB target genes RelB, NFKB2, RANTES, MCP-1, ENA-78, MMP-1, MMP-2, and MMP-3 in pterygium fibroblasts was compared with that in primary tenon fibroblasts by real-time PCR. Phosphorylation of IκBα (Ser32) was increased in pterygia tissues compared with uninvolved conjunctiva tissues, as determined by Western blot analysis and ELISA. IκBα expression was decreased, whereas nuclear RelA and p50 DNA-binding capacities were increased. Within 30 minutes of treatment with TNF-α, pterygium fibroblasts showed increased IκBα phosphorylation and nuclear translocation of RelA and p50. Treatment with TNF-α beyond 12 hours resulted in increased nuclear expression of RelB, p100, and p52. Furthermore, the upregulation of RANTES, MCP-1, ENA-78, MMP-1, MMP-2, and MMP-3 expression was more pronounced in TNF-α-treated pterygium fibroblasts than in tenon fibroblasts. The NF-κB pathway is shown for the first time to be activated in pterygia tissues compared with normal conjunctiva tissues. Stimulation by the inflammatory cytokine TNF-α can activate both canonical and noncanonical NF-κB pathways in pterygium fibroblasts with concomitant upregulation of NF-κB target genes.
Zach, Frank; Mueller, Alexandra; Gessner, André
2015-01-01
In vitro differentiation into functional osteoclasts is routinely achieved by incubation of embryonic stem cells, induced pluripotent stem cells, or primary as well as cryopreserved spleen and bone marrow-derived cells with soluble receptor activator of nuclear factor kappa-B ligand and macrophage colony-stimulating factor. Additionally, osteoclasts can be derived from co-cultures with osteoblasts or by direct administration of soluble receptor activator of nuclear factor kappa-B ligand to RAW 264.7 macrophage lineage cells. However, despite their benefits for osteoclast-associated research, these different methods have several drawbacks with respect to differentiation yields, time and animal consumption, storage life of progenitor cells or the limited potential for genetic manipulation of osteoclast precursors. In the present study, we therefore established a novel protocol for the differentiation of osteoclasts from murine ER-Hoxb8-immortalized myeloid stem cells. We isolated and immortalized bone marrow cells from wild type and genetically manipulated mouse lines, optimized protocols for osteoclast differentiation and compared these cells to osteoclasts derived from conventional sources. In vitro generated ER-Hoxb8 osteoclasts displayed typical osteoclast characteristics such as multi-nucleation, tartrate-resistant acid phosphatase staining of supernatants and cells, F-actin ring formation and bone resorption activity. Furthermore, the osteoclast differentiation time course was traced on a gene expression level. Increased expression of osteoclast-specific genes and decreased expression of stem cell marker genes during differentiation of osteoclasts from ER-Hoxb8-immortalized myeloid progenitor cells were detected by gene array and confirmed by semi-quantitative and quantitative RT-PCR approaches. In summary, we established a novel method for the quantitative production of murine bona fide osteoclasts from ER-Hoxb8 stem cells generated from wild type or
Tse, Anna Chung-Kwan; Ge, Wei
2009-05-01
Recently the roles of epidermal growth factor (EGF) family ligands in vertebrate ovaries have received increasing attention, including betacellulin (BTC), amphiregulin (AR), heparin-binding EGF-like growth factor (HB-EGF), transforming growth factor alpha (TGFalpha), epiregulin, and EGF itself. In the zebrafish (Danio rerio), four members of EGF family have been identified by either molecular cloning or genome sequencing, which are EGF, TGFalpha, BTC, and HB-EGF. Although they are mostly expressed in the oocytes in the ovary, the present study demonstrated the expression of all the four EGF family ligands (egf, btc, tgfa, and hbegf) in cultured zebrafish follicle cells albeit at very low levels. Treatment of the cultured follicle cells with EGF, BTC, and HB-EGF demonstrated differential effects of these ligands on the expression of themselves. While the expression of egf was rather non-responsive to EGF, BTC, and HB-EGF, the expression of btc was consistently down-regulated by all the three molecules. In contrast, hbegf increased its expression in response to these molecules. These results suggest that there is an EGF signaling network in the zebrafish ovarian follicle, and the functionality of this network is self-regulated by its own members.
Tanaka, Tomohiro; Zhou, Yue; Ozawa, Tatsuhiko; Okizono, Ryuya; Banba, Ayako; Yamamura, Tomohiro; Oga, Eiji; Muraguchi, Atsushi; Sakurai, Hiroaki
2018-02-16
The canonical description of transmembrane receptor function is initial binding of ligand, followed by initiation of intracellular signaling and then internalization en route to degradation or recycling to the cell surface. It is known that low concentrations of extracellular ligand lead to a higher proportion of receptor that is recycled and that non-canonical mechanisms of receptor activation, including phosphorylation by the kinase p38, can induce internalization and recycling. However, no connections have been made between these pathways; i.e. it has yet to be established what happens to unbound receptors following stimulation with ligand. Here we demonstrate that a minimal level of activation of epidermal growth factor receptor (EGFR) tyrosine kinase by low levels of ligand is sufficient to fully activate downstream mitogen-activated protein kinase (MAPK) pathways, with most of the remaining unbound EGFR molecules being efficiently phosphorylated at intracellular serine/threonine residues by activated mitogen-activated protein kinase. This non-canonical, p38-mediated phosphorylation of the C-tail of EGFR, near Ser-1015, induces the clathrin-mediated endocytosis of the unliganded EGFR monomers, which occurs slightly later than the canonical endocytosis of ligand-bound EGFR dimers via tyrosine autophosphorylation. EGFR endocytosed via the non-canonical pathway is largely recycled back to the plasma membrane as functional receptors, whereas p38-independent populations are mainly sorted for lysosomal degradation. Moreover, ligand concentrations balance these endocytic trafficking pathways. These results demonstrate that ligand-activated EGFR signaling controls unliganded receptors through feedback phosphorylation, identifying a dual-mode regulation of the endocytic trafficking dynamics of EGFR. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Effect of Irrigation Time of Antiseptic Solutions on Bone Cell Viability and Growth Factor Release.
Sawada, Kosaku; Nakahara, Ken; Haga-Tsujimura, Maiko; Fujioka-Kobayashi, Masako; Iizuka, Tateyuki; Miron, Richard J
2018-03-01
Antiseptic solutions are commonly utilized to treat local infection in the oral and maxillofacial region. However, surrounding vital bone is also exposed to antiseptic agents during irrigation and may have a potential negative impact on bone survival. The aim of the present study was therefore to investigate the effect of rinsing time with various antiseptic solutions on bone cell viability, as well as their subsequent release of growth factors important for bone regeneration. The bone samples collected from porcine mandible were rinsed in the following commonly utilized antiseptic solutions; povidone-iodine (0.5%), chlorhexidine digluconate (CHX, 0.2%), hydrogen peroxide (1%), and sodium hypochlorite (0.25%) for 1, 5, 10, 20, 30, or 60 minutes and assessed for cell viability and release of growth factors including vascular endothelial growth factor, transforming growth factor beta 1, bone morphogenetic protein 2, receptor activator of nuclear factor kappa-B ligand, and interleukin-1 beta by enzyme-linked immunosorbent assay. It was found in all the tested groups that the long exposure of any of the tested antiseptic solutions drastically promoted higher cell death. Sodium hypochlorite demonstrated the significantly highest cell death and at all time points. Interestingly, bone cell viability was highest in the CHX group post short-term rinsing of 1, 5, or 10 minutes when compared with the other 4 tested groups. A similar trend was also observed in subsequent growth factor release. The present study demonstrated that of the 4 tested antiseptic solutions, short-term CHX rinsing (ideally within 1 minute) favored bone cell viability and growth factor release. Clinical protocols should be adapted accordingly.
Matsumoto, T; Ogata, M; Koga, K; Shigematsu, A
1994-01-01
To investigate the effect of peripheral and central benzodiazepine receptor ligands on lipopolysaccharide (LPS)-induced tumor necrosis factor (TNF) activity in mouse macrophages, three types of ligands, 4'-chlorodiazepam (pure peripheral), midazolam (mixed), and clonazepam (pure central), were compared. Midazolam and 4'-chlorodiazepam significantly suppressed LPS (1-microgram/ml)-induced TNF activity in thioglycolate-elicited mouse macrophages. In every concentration examined (0.001 to 100 microM), 4'-chlorodiazepam was the most effective agent, clonazepam was the least effective agent, and midazolam had an effect intermediate between those of the other two ligands. The peripheral benzodiazepine receptor ligands had a dose-dependent suppressive effect, and the 50% inhibitory concentrations were 0.01 microM for 4'-chlorodiazepam and 5 microM for midazolam. Concomitant use of PK 11195 (10 microM), an antagonist of the peripheral benzodiazepine receptor, reversed this suppressive effect with 4'-chlorodiazepam (10 microM) or midazolam (10 microM). PK 11195 showed this antagonistic effect in a dose-dependent manner. Intravenous 4'-chlorodiazepam (5 mg/kg of body weight) significantly suppressed LPS (100-micrograms)-induced TNF activity of sera (2 h postchallenge with LPS) from thioglycolate-treated mice. The present findings suggest that the peripheral benzodiazepine receptor plays an important role in modulating LPS-induced TNF activity in mouse macrophages. PMID:8031051
LigandRNA: computational predictor of RNA–ligand interactions
Philips, Anna; Milanowska, Kaja; Łach, Grzegorz; Bujnicki, Janusz M.
2013-01-01
RNA molecules have recently become attractive as potential drug targets due to the increased awareness of their importance in key biological processes. The increase of the number of experimentally determined RNA 3D structures enabled structure-based searches for small molecules that can specifically bind to defined sites in RNA molecules, thereby blocking or otherwise modulating their function. However, as of yet, computational methods for structure-based docking of small molecule ligands to RNA molecules are not as well established as analogous methods for protein-ligand docking. This motivated us to create LigandRNA, a scoring function for the prediction of RNA–small molecule interactions. Our method employs a grid-based algorithm and a knowledge-based potential derived from ligand-binding sites in the experimentally solved RNA–ligand complexes. As an input, LigandRNA takes an RNA receptor file and a file with ligand poses. As an output, it returns a ranking of the poses according to their score. The predictive power of LigandRNA favorably compares to five other publicly available methods. We found that the combination of LigandRNA and Dock6 into a “meta-predictor” leads to further improvement in the identification of near-native ligand poses. The LigandRNA program is available free of charge as a web server at http://ligandrna.genesilico.pl. PMID:24145824
Analysis of macromolecules, ligands and macromolecule-ligand complexes
Von Dreele, Robert B [Los Alamos, NM
2008-12-23
A method for determining atomic level structures of macromolecule-ligand complexes through high-resolution powder diffraction analysis and a method for providing suitable microcrystalline powder for diffraction analysis are provided. In one embodiment, powder diffraction data is collected from samples of polycrystalline macromolecule and macromolecule-ligand complex and the refined structure of the macromolecule is used as an approximate model for a combined Rietveld and stereochemical restraint refinement of the macromolecule-ligand complex. A difference Fourier map is calculated and the ligand position and points of interaction between the atoms of the macromolecule and the atoms of the ligand can be deduced and visualized. A suitable polycrystalline sample of macromolecule-ligand complex can be produced by physically agitating a mixture of lyophilized macromolecule, ligand and a solvent.
NF-kappaB transcription factor is required for inhibitory avoidance long-term memory in mice.
Freudenthal, Ramiro; Boccia, Mariano M; Acosta, Gabriela B; Blake, Mariano G; Merlo, Emiliano; Baratti, Carlos M; Romano, Arturo
2005-05-01
Although it is generally accepted that memory consolidation requires regulation of gene expression, only a few transcription factors (TFs) have been clearly demonstrated to be specifically involved in this process. Increasing research data point to the participation of the Rel/nuclear factor-kappaB (NF-kappaB) family of TFs in memory and neural plasticity. Here we found that two independent inhibitors of NF-kappaB induced memory impairment in the one-trial step-through inhibitory avoidance paradigm in mice: post-training administration of the drug sulfasalazine and 2 h pretraining administration of a double-stranded DNA oligonucleotide containing the NF-kappaB consensus sequence (kappaB decoy). Conversely, one base mutation of the kappaB decoy (mut-kappaB decoy) injection did not affect long-term memory. Accordingly, the kappaB decoy inhibited NF-kappaB in hippocampus 2 h after injection but no inhibition was found with mut-kappaB decoy administration. A temporal course of hippocampal NF-kappaB activity after training was determined. Unexpectedly, an inhibition of NF-kappaB was found 15 min after training in shocked and unshocked groups when compared with the naïve group. Hippocampal NF-kappaB was activated 45 min after training in both shocked and unshocked groups, decreasing 1 h after training and returning to basal levels 2 and 4 h after training. On the basis of the latter results, we propose that activation of NF-kappaB in hippocampus is part of the molecular mechanism involved in the storage of contextual features that constitute the conditioned stimulus representation. The results presented here provide the first evidence to support NF-kappaB activity being regulated in hippocampus during consolidation, stressing the role of this TF as a conserved molecular mechanism for memory storage.
Ibaraki, Hisako; Kanazawa, Takanori; Takashima, Yuuki; Okada, Hiroaki; Seta, Yasuo
2018-05-05
Nucleic acid-based targeting of nuclear factor kappaB (NF-κB) is gaining attention as a treatment option for skin diseases like atopic dermatitis (AD). Transdermal administration improves patient quality of life because of non-invasive; however, siRNA delivery into the skin can be challenging owing to the barrier of tight junctions in the granular layer. Therefore, we aimed to develop a delivery system of siRNA for topical skin application using functional peptides. We previously reported that combined treatment with a cytoplasm-responsive stearylated-arginine-rich peptide (STR-CH 2 R 4 H 2 C) and a tight junction opening peptide (AT1002) showed high siRNA permeability in the skin of AD-induced and normal mice. Here, we used murine macrophage RAW264.7 cells to examine siRNA permeation and the therapeutic effect of anti-NF-κB (RelA) siRNA (siRelA) complexed with STR-CH 2 R 4 H 2 C and AT1002 for AD-induced mice. We showed that significantly higher siRNA cellular uptake occurs after this treatment as well as decreased TNF-α and IL-6 expression. Additionally, we showed that effective siRNA transdermal delivery occurs with the suppression of the tight junction protein ZO-1. Moreover, topical skin application of siRelA with STR-CH 2 R 4 H 2 C and AT1002 improved AD-like symptoms in model mice. Thus, the combined treatment of STR-CH 2 R 4 H 2 C and AT1002 could serve as an effective transdermal siRNA therapeutic system for AD. Copyright © 2018 Elsevier B.V. All rights reserved.
Shen, Lu; Decker, Caitlin G; Maynard, Heather D; Levine, Alex J
2016-09-01
We present here the calculation of the mean time to capture of a tethered ligand to the receptor. This calculation is then used to determine the shift in the partitioning between (1) free, (2) singly bound, and (3) doubly bound ligands in chemical equilibrium as a function of the length of the tether. These calculations are used in the research article Fibroblast Growth Factor 2 Dimer with Superagonist in vitro Activity Improves Granulation Tissue Formation During Wound Healing (Decker et al., in press [1]) to explain quantitatively how changes in polymeric linker length in the ligand dimers modifies the efficacy of these molecules relative to that of free ligands.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Veggiani, Gianluca; Ossolengo, Giuseppe; Aliprandi, Marisa
2011-05-20
Highlights: {yields} Recombinant antibodies for FGFR1 were isolated from a llama naive library in VHH format. {yields} These antibodies compete with the natural ligand FGF-2 for the same epitope on FGFR1. {yields} The antibody competition inhibits the FGF-2-dependent internalization of FGFR1. -- Abstract: Single-domain antibodies in VHH format specific for fibroblast growth factor receptor 1 (FGFR1) were isolated from a phage-display llama naive library. In particular, phage elution in the presence of the natural receptor ligand fibroblast growth factor (FGF) allowed for the identification of recombinant antibodies that compete with FGF for the same region on the receptor surface. Thesemore » antibodies posses a relatively low affinity for FGFR1 and were never identified when unspecific elution conditions favoring highly affine binders were applied to panning procedures. Two populations of competitive antibodies were identified that labeled specifically the receptor-expressing cells in immunofluorescence and recognize distinct epitopes. Antibodies from both populations effectively prevented FGF-dependent internalization and nuclear accumulation of the receptor in cultured cells. This achievement indicates that these antibodies have a capacity to modulate the receptor physiology and, therefore, constitute powerful reagents for basic research and a potential lead for therapeutic applications.« less
Shin, Jae-Min; Cho, Doo-Ho
2005-01-01
PDB-Ligand (http://www.idrtech.com/PDB-Ligand/) is a three-dimensional structure database of small molecular ligands that are bound to larger biomolecules deposited in the Protein Data Bank (PDB). It is also a database tool that allows one to browse, classify, superimpose and visualize these structures. As of May 2004, there are about 4870 types of small molecular ligands, experimentally determined as a complex with protein or DNA in the PDB. The proteins that a given ligand binds are often homologous and present the same binding structure to the ligand. However, there are also many instances wherein a given ligand binds to two or more unrelated proteins, or to the same or homologous protein in different binding environments. PDB-Ligand serves as an interactive structural analysis and clustering tool for all the ligand-binding structures in the PDB. PDB-Ligand also provides an easier way to obtain a number of different structure alignments of many related ligand-binding structures based on a simple and flexible ligand clustering method. PDB-Ligand will be a good resource for both a better interpretation of ligand-binding structures and the development of better scoring functions to be used in many drug discovery applications.
Thoh, Maikho; Kumar, Pankaj; Nagarajaram, Hampathalu A; Manna, Sunil K
2010-02-19
The role of azadirachtin, an active component of a medicinal plant Neem (Azadirachta indica), on TNF-induced cell signaling in human cell lines was investigated. Azadirachtin blocks TNF-induced activation of nuclear factor kappaB (NF-kappaB) and also expression of NF-kappaB-dependent genes such as adhesion molecules and cyclooxygenase 2. Azadirachtin inhibits the inhibitory subunit of NF-kappaB (IkappaB alpha) phosphorylation and thereby its degradation and RelA (p65) nuclear translocation. It blocks IkappaB alpha kinase (IKK) activity ex vivo, but not in vitro. Surprisingly, azadirachtin blocks NF-kappaB DNA binding activity in transfected cells with TNF receptor-associated factor (TRAF)2, TNF receptor-associated death domain (TRADD), IKK, or p65, but not with TNFR, suggesting its effect is at the TNFR level. Azadirachtin blocks binding of TNF, but not IL-1, IL-4, IL-8, or TNF-related apoptosis-inducing ligand (TRAIL) with its respective receptors. Anti-TNFR antibody or TNF protects azadirachtin-mediated down-regulation of TNFRs. Further, in silico data suggest that azadirachtin strongly binds in the TNF binding site of TNFR. Overall, our data suggest that azadirachtin modulates cell surface TNFRs thereby decreasing TNF-induced biological responses. Thus, azadirachtin exerts an anti-inflammatory response by a novel pathway, which may be beneficial for anti-inflammatory therapy.
Identification of a novel A20-binding inhibitor of nuclear factor-kappa B activation termed ABIN-2.
Van Huffel, S; Delaei, F; Heyninck, K; De Valck, D; Beyaert, R
2001-08-10
The nuclear factor kappaB (NF-kappaB) plays a central role in the regulation of genes implicated in immune responses, inflammatory processes, and apoptotic cell death. The zinc finger protein A20 is a cellular inhibitor of NF-kappaB activation by various stimuli and plays a critical role in terminating NF-kappaB responses. The underlying mechanism for NF-kappaB inhibition by A20 is still unknown. A20 has been shown to interact with several proteins including tumor necrosis factor (TNF) receptor-associated factors 2 and 6, as well as the inhibitory protein of kappaB kinase (IKK) gamma protein. Here we report the cloning and characterization of ABIN-2, a previously unknown protein that binds to the COOH-terminal zinc finger domain of A20. NF-kappaB activation induced by TNF and interleukin-1 is inhibited by overexpression of ABIN-2. The latter also inhibits NF-kappaB activation induced by overexpression of receptor-interacting protein or TNF receptor-associated factor 2. In contrast, NF-kappaB activation by overexpression of IKKbeta or direct activators of the IKK complex, such as Tax, cannot be inhibited by ABIN-2. These results indicate that ABIN-2 interferes with NF-kappaB activation upstream of the IKK complex and that it might contribute to the NF-kappaB-inhibitory function of A20.
Gao, Jian; Ulekleiv, Camilla H; Halstensen, Trond S
2016-09-26
Increased expression of epidermal growth factor receptor (EGFR) and its ligands is associated with poor prognosis and chemoresistance in many carcinoma types, but its role in head and neck squamous cell carcinoma (HNSCC) is unclear. Our aim was to clarify whether mRNA expression of EGFR-ligands was linked to prognosis and cisplatin resistance, and if so, which ligand was most important and how was the expression regulated. To examine the prognostic effect of EGFR-ligand expression, we analyzed tumorous mRNA expression in 399 HNSCC patients. The intracellular signaling pathways controlling epidermal growth factor (EGF)-induced amphiregulin (AREG) expression were examined in three oral squamous cell carcinoma (OSCC) cell lines. Effect of AREG on cisplatin resistance was examined by viability assays in four-, and by association in 11 OSCC cell lines. The patients were divided into five groups according to the median mRNA expression levels of four EGFR ligands, i.e. AREG, EGF, heparin-binding EGF-like growth factor (HBEGF) and beta-cellulin (BTC). The number of increased-expressed EGFR-ligands were progressively correlated to five-year survival, even in advanced TNM-stage IV patients, where five-year mortality increased from 26 % if tumor expressed none to one EGFR-ligand, to 45 % in three to four ligand expressing tumors. Thus, staging the tumor according to these EGFR-ligand mRNA expression pattern completely out performed TNM staging in predicting prognosis. Multivariate analysis identified AREG as the dominating predictor, and AREG was overexpressed in OSCC compared to tumors from other sites. Both EGF and HBEGF stimulation induced strong AREG increase in OSCC cell lines, which was partially mediated by the extracellular signal-regulated kinase 1/2 pathway, and negatively regulated by p38, c-Jun N-terminal kinase, and phosphoinositide-3 kinase. Although increased AREG mRNA expression predicted unfavorable prognosis in platinum treated HNSCC patients, AREG did
Murakami, Kohei; Maeda, Shingo; Yonezawa, Tomohiro; Matsuki, Naoaki
2016-12-01
Canine idiopathic polyarthritis (IPA) is characterized by increased numbers of polymorphonuclear leukocytes (PMNs) in the synovial fluid (SF). In humans, CC chemokine ligand 2 (CCL2) and CXC chemokine ligand 8 (CXCL8) recruit monocytes and neutrophils, respectively, and are involved in various inflammatory disorders. The aim of this study was to assess the roles of these chemokines in driving PMNs infiltration into the joints of dogs with IPA. SF samples were collected from dogs with IPA (n=19) and healthy controls (n=8), and the concentrations of SF CCL2 and CXCL8 were determined by ELISA. Dogs with IPA had significantly higher concentrations of CCL2 (3316±2452pg/ml, mean±SD) and CXCL8 (3668±3879pg/ml) compared with the healthy controls (235±45pg/ml and <15.6pg/ml, respectively). Then, an in vitro chemotaxis assay was performed using a modified Boyden chamber (pore size: 3μm). SF from IPA dogs had a chemoattractant activity for PMNs that purified from the peripheral blood of a healthy dog. We subsequently found that combination treatment with MK-0812 (an antagonist of CCL2 receptor) and repertaxin (an antagonist of CXCL8 receptors) significantly inhibited the migration of PMNs to SF from IPA dogs. Thus, expression of the CCL2 receptor (chemokine (CC motif) receptor 2 (CCR2)) was examined using polymerase chain reaction and immunocytochemistry. Canine peripheral blood PMNs exhibited significantly higher CCR2 mRNA expression levels than those in monocytes. In addition, we observed strong CCR2 expression on PMNs obtained from healthy controls and IPA dogs, although mononuclear cells did not express CCR2. Taken together, the data suggest that CCL2 acts as a canine PMNs chemotactic factor as well as CXCL8 and both CCL2 and CXCL8 facilitate the infiltration of PMNs into the joints of dogs with IPA. Copyright © 2016 Elsevier B.V. All rights reserved.
Bierhaus, A; Nawroth, P P
2009-11-01
The pattern recognition receptor or receptor for AGE (RAGE) is constitutionally expressed in a few cell types only. However in almost all cells studied so far it is induced by reactions known to initiate inflammation. Its biological activity seems to be mainly dependent on the presence of its various ligands, including AGE, S100-calcium binding protein/calgranulins, high-mobility group protein 1, amyloid-beta-peptides and the family of beta-sheet fibrils, all known to be elevated in chronic metabolic, malignant and inflammatory diseases. The RAGE pathway interacts with cytokine-, lipopolysaccharide-, oxidised LDL- and glucose-triggered cellular reactions by turning a short-lasting inflammatory response into a sustained change of cellular function driven by perpetuated activation of the proinflammatory transcription factor, nuclear factor kappa-B. RAGE-mediated persistent cell activation is of pivotal importance in various experimental and clinical settings, including diabetes and its complications, neurodegeneration, ageing, tumour growth, and autoimmune and infectious inflammatory disease. Due to RAGE's central role in maintaining perpetuated cell activation, various therapeutic attempts to block RAGE or its ligands are currently under investigation. Despite broad experimental evidence for the role of RAGE in chronic disease, knowledge of its physiological function is still missing, limiting predictions about safety of long-term inhibition of RAGE x ligand interaction in chronic diseases.
Ketas, Thomas J.; Kuhmann, Shawn E.; Palmer, Ashley; Zurita, Juan; He, Weijing; Ahuja, Sunil K.; Klasse, Per Johan; Moore, John P.
2007-01-01
Several CCR5 ligands, including small molecules and monoclonal antibodies (MAbs), are being developed as therapies for infection with strains of human immunodeficiency virus type 1 (HIV-1) that use CCR5 for entry (R5 viruses). The efficacy of such therapies could be influenced by inter-individual differences in host factors, such as CCR5 expression levels. To study this, we used peripheral blood mononuclear cells (PBMCs) from humans and rhesus macaques. The half-maximal inhibitory concentrations (IC50) of the small-molecule CCR5 ligands CMPD167, UK427,857 and SCH-D, and of the PRO 140 MAb, differ by >2 logs in a donor-dependent manner. We studied this variation by using flow cytometry to measure CCR5 expression on PBMCs from six of the human donors: the IC50 values of both SCH-D and PRO 140 correlated with CCR5 expression (R2 = 0.64 and 0.99, respectively). We also determined the efficacy of the CCR5 ligands against HIV-1 infection of HeLa-derived cell lines that express CD4 at the same level but vary 2-fold in CCR5 expression (JC.48 and JC.53 cells). The moderately greater CCR5 expression on the JC.53 than the JC.48 cells was associated with proportionately higher median IC50 values for all four CCR5 ligands but not for a soluble CD4-based inhibitor or a non-nucleoside reverse transcriptase inhibitor. We conclude that differences in CCR5 expression on human PBMCs, which can be affected by CCL3L1 gene dose, may influence the antiviral potency of CCR5 ligands in vitro, but other host factors are also likely to be involved. These host factors may affect the clinical activity of CCR5 inhibitors, including their use as topical microbicides to prevent HIV-1 transmission. PMID:17428518
Ligand placement based on prior structures: the guided ligand-replacement method
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klei, Herbert E.; Bristol-Myers Squibb, Princeton, NJ 08543-4000; Moriarty, Nigel W., E-mail: nwmoriarty@lbl.gov
2014-01-01
A new module, Guided Ligand Replacement (GLR), has been developed in Phenix to increase the ease and success rate of ligand placement when prior protein-ligand complexes are available. The process of iterative structure-based drug design involves the X-ray crystal structure determination of upwards of 100 ligands with the same general scaffold (i.e. chemotype) complexed with very similar, if not identical, protein targets. In conjunction with insights from computational models and assays, this collection of crystal structures is analyzed to improve potency, to achieve better selectivity and to reduce liabilities such as absorption, distribution, metabolism, excretion and toxicology. Current methods formore » modeling ligands into electron-density maps typically do not utilize information on how similar ligands bound in related structures. Even if the electron density is of sufficient quality and resolution to allow de novo placement, the process can take considerable time as the size, complexity and torsional degrees of freedom of the ligands increase. A new module, Guided Ligand Replacement (GLR), was developed in Phenix to increase the ease and success rate of ligand placement when prior protein–ligand complexes are available. At the heart of GLR is an algorithm based on graph theory that associates atoms in the target ligand with analogous atoms in the reference ligand. Based on this correspondence, a set of coordinates is generated for the target ligand. GLR is especially useful in two situations: (i) modeling a series of large, flexible, complicated or macrocyclic ligands in successive structures and (ii) modeling ligands as part of a refinement pipeline that can automatically select a reference structure. Even in those cases for which no reference structure is available, if there are multiple copies of the bound ligand per asymmetric unit GLR offers an efficient way to complete the model after the first ligand has been placed. In all of these applications
Ligand binding was acquired during evolution of nuclear receptors
Escriva, Hector; Safi, Rachid; Hänni, Catherine; Langlois, Marie-Claire; Saumitou-Laprade, Pierre; Stehelin, Dominique; Capron, André; Pierce, Raymond; Laudet, Vincent
1997-01-01
The nuclear receptor (NR) superfamily comprises, in addition to ligand-activated transcription factors, members for which no ligand has been identified to date. We demonstrate that orphan receptors are randomly distributed in the evolutionary tree and that there is no relationship between the position of a given liganded receptor in the tree and the chemical nature of its ligand. NRs are specific to metazoans, as revealed by a screen of NR-related sequences in early- and non-metazoan organisms. The analysis of the NR gene duplication pattern during the evolution of metazoans shows that the present NR diversity arose from two waves of gene duplications. Strikingly, our results suggest that the ancestral NR was an orphan receptor that acquired ligand-binding ability during subsequent evolution. PMID:9192646
Stabilization of peroxisome proliferator-activated receptor alpha by the ligand.
Hirotani, M; Tsukamoto, T; Bourdeaux, J; Sadano, H; Osumi, T
2001-10-19
Peroxisome proliferator-activated receptor (PPAR) constitutes a subfamily among a large group of ligand-activated transcription factors, the nuclear receptor superfamily. We studied the effects of ligand on the intracellular behaviors of PPARalpha. Although nuclear localization of PPARalpha was not affected by a selective ligand, Wy14643, we observed that exogenously expressed PPARalpha was rapidly degraded in HeLa cells, and the ligand significantly stabilized the protein. The stability of PPARalpha was also improved by coexpression of the heterodimer partner retinoid X receptor (RXR) alpha, and further stabilization was not observed with the ligand. These results indicate that PPARalpha is stabilized through heterodimerization with RXR, and the excess protein unpaired with RXR is rapidly turned over, if not bound by an appropriate ligand. These observations on PPARalpha are in sharp contrast to the ligand-stimulated degradation reported on PPARgamma. The ligand-dependent stabilization would have physiological significance when the synthesis of PPARalpha is elevated exceeding the available level of RXR. Copyright 2001 Academic Press.
Arslan, Muyesser Sayki; Tutal, Esra; Sahin, Mustafa; Karakose, Melia; Ucan, Bekir; Ozturk, Gulfer; Cakal, Erman; Biyikli Gencturk, Zeynep; Ozbek, Mustafa; Delibasi, Tuncay
2017-02-01
Osteoprotegerin has been shown to be increased in cardiovascular disorders and type 2 diabetes mellitus. Prediabetes represents a high risk condition for diabetes and diabetic complications. Therefore, we aimed to find the relationship between prediabetes and osteoprotegerin with nuclear factor-B ligand, carotid intima media thickness, and metabolic markers. A total of 54 participants with prediabetes including impaired fasting glucose (n = 21), impaired glucose tolerance (n = 8), impaired fasting glucose and impaired glucose tolerance (n = 25), and 60 healthy individuals as a control were admitted to the study. Metabolic and anthropometric parameters, insulin resistance variables, osteoprotegerin, and nuclear factor-B ligand markers, carotid intima media thickness were examined at baseline for all participants. To evaluate the effect of therapy we determined the same parameters after the end of the study. Measurements of waist circumference, body mass index, body fat percentage and levels of fasting blood glucose, fasting insulin, homeostatic model assessment of insulin resistance, triglyceride levels and hsCRP and carotid intima media thickness were significantly higher in patients with prediabetes (p < 0.05). We also found higher osteoprotegerin and lower nuclear factor-B ligand levels in patients than in controls however, the value was non-significant (p > 0.05). Patients with prediabetes were under lifestyle interventions with (group 1, n = 33) or without metformin (group 2, n = 21) therapy. Baseline anthropometric and metabolic characteristics were not found statistically different in group 1 and group 2. Mean follow up period of the patients were 7.9 ± 2.2 month (min-max: 6-12 months). After the follow up period we evaluated the same parameters and found significant differences between waist circumference, body mass index, body fat percentage, fasting insulin, homeostatic model assessment of insulin resistance, and
Ligand-Induced Conformational Change in the α7 Nicotinic Receptor Ligand Binding Domain
Henchman, Richard H.; Wang, Hai-Long; Sine, Steven M.; Taylor, Palmer; McCammon, J. Andrew
2005-01-01
Molecular dynamics simulations of a homology model of the ligand binding domain of the α7 nicotinic receptor are conducted with a range of bound ligands to induce different conformational states. Four simulations of 15 ns each are run with no ligand, antagonist d-tubocurarine (dTC), agonist acetylcholine (ACh), and agonist ACh with potentiator Ca2+, to give insight into the conformations of the active and inactive states of the receptor and suggest the mechanism for conformational change. The main structural factor distinguishing the active and inactive states is that a more open, symmetric arrangement of the five subunits arises for the two agonist simulations, whereas a more closed and asymmetric arrangement results for the apo and dTC cases. Most of the difference arises in the lower portion of the ligand binding domain near its connection to the adjacent transmembrane domain. The transfer of the more open state to the transmembrane domain could then promote ion flow through the channel. Variation in how subunits pack together with no ligand bound appears to give rise to asymmetry in the apo case. The presence of dTC expands the receptor but induces rotations in alternate directions in adjacent subunits that lead to an asymmetric arrangement as in the apo case. Ca2+ appears to promote a slightly greater expansion in the subunits than ACh alone by stabilizing the C-loop and ACh positions. Although the simulations are unlikely to be long enough to view the full conformational changes between open and closed states, a collection of different motions at a range of length scales are observed that are likely to participate in the conformational change. PMID:15665135
Lin, Ying-Ting
2013-04-30
A tandem technique of hard equipment is often used for the chemical analysis of a single cell to first isolate and then detect the wanted identities. The first part is the separation of wanted chemicals from the bulk of a cell; the second part is the actual detection of the important identities. To identify the key structural modifications around ligand binding, the present study aims to develop a counterpart of tandem technique for cheminformatics. A statistical regression and its outliers act as a computational technique for separation. A PPARγ (peroxisome proliferator-activated receptor gamma) agonist cellular system was subjected to such an investigation. Results show that this tandem regression-outlier analysis, or the prioritization of the context equations tagged with features of the outliers, is an effective regression technique of cheminformatics to detect key structural modifications, as well as their tendency of impact to ligand binding. The key structural modifications around ligand binding are effectively extracted or characterized out of cellular reactions. This is because molecular binding is the paramount factor in such ligand cellular system and key structural modifications around ligand binding are expected to create outliers. Therefore, such outliers can be captured by this tandem regression-outlier analysis.
Two novel mixed-ligand complexes containing organosulfonate ligands.
Li, Mingtian; Huang, Jun; Zhou, Xuan; Fang, Hua; Ding, Liyun
2008-07-01
The structures reported herein, viz. bis(4-aminonaphthalene-1-sulfonato-kappaO)bis(4,5-diazafluoren-9-one-kappa(2)N,N')copper(II), [Cu(C(10)H(8)NO(3)S)(2)(C(11)H(6)N(2)O)(2)], (I), and poly[[[diaquacadmium(II)]-bis(mu-4-aminonaphthalene-1-sulfonato)-kappa(2)O:N;kappa(2)N:O] dihydrate], {[Cd(C(10)H(8)NO(3)S)(2)(H(2)O)(2)].2H(2)O}(n), (II), are rare examples of sulfonate-containing complexes where the anion does not fulfill a passive charge-balancing role, but takes an active part in coordination as a monodentate and/or bridging ligand. Monomeric complex (I) possesses a crystallographic inversion center at the Cu(II) atom, and the asymmetric unit contains one-half of a Cu atom, one complete 4-aminonaphthalene-1-sulfonate (ans) ligand and one 4,5-diazafluoren-9-one (DAFO) ligand. The Cu(II) atom has an elongated distorted octahedral coordination geometry formed by two O atoms from two monodentate ans ligands and by four N atoms from two DAFO molecules. Complex (II) is polymeric and its crystal structure is built up by one-dimensional chains and solvent water molecules. Here also the cation (a Cd(II) atom) lies on a crystallographic inversion center and adopts a slightly distorted octahedral geometry. Each ans anion serves as a bridging ligand linking two Cd(II) atoms into one-dimensional infinite chains along the [010] direction, with each Cd(II) center coordinated by four ans ligands via O and N atoms and by two aqua ligands. In both structures, there are significant pi-pi stacking interactions between adjacent ligands and hydrogen bonds contribute to the formation of two- and three-dimensional networks.
Kelley, Brian D; Tannatt, Molly; Magnusson, Robert; Hagelberg, Sigrid; Booth, James
2004-08-05
An affinity chromatography step was developed for purification of recombinant B-Domain Deleted Factor VIII (BDDrFVIII) using a peptide ligand selected from a phage display library. The peptide library had variegated residues, contained both within a disulfide bond-constrained ring and flanking the ring. The peptide ligand binds to BDDrFVIII with a dissociation constant of approximately 1 microM both in free solution and when immobilized on a chromatographic resin. The peptide is chemically synthesized and the affinity resin is produced by coupling the peptide to an agarose matrix preactivated with N-hydroxysuccinimide. Coupling conditions were optimized to give consistent and complete ligand incorporation and validated with a robustness study that tested various combinations of processing limits. The peptide affinity chromatographic operation employs conditions very similar to an immunoaffinity chromatography step currently in use for BDDrFVIII manufacture. The process step provides excellent recovery of BDDrFVIII from a complex feed stream and reduces host cell protein and DNA by 3-4 logs. Process validation studies established resin reuse over 26 cycles without changes in product recovery or purity. A robustness study using a factorial design was performed and showed that the step was insensitive to small changes in process conditions that represent normal variation in commercial manufacturing. A scaled-down model of the process step was qualified and used for virus removal studies. A validation package addressing the safety of the leached peptide included leaching rate measurements under process conditions, testing of peptide levels in product pools, demonstration of robust removal downstream by spiking studies, end product testing, and toxicological profiling of the ligand. The peptide ligand affinity step was scaled up for cGMP production of BDDrFVIII for clinical trials.
Glukhova, Xenia A; Trizna, Julia A; Proussakova, Olga V; Gogvadze, Vladimir; Beletsky, Igor P
2018-01-22
Fas-ligand/CD178 belongs to the TNF family proteins and can induce apoptosis through death receptor Fas/CD95. The important requirement for Fas-ligand-dependent cell death induction is its localization to rafts, cholesterol- and sphingolipid-enriched micro-domains of membrane, involved in regulation of different signaling complexes. Here, we demonstrate that Fas-ligand physically associates with caveolin-1, the main protein component of rafts. Experiments with cells overexpressing Fas-ligand revealed a FasL N-terminal pre-prolin-rich region, which is essential for the association with caveolin-1. We found that the N-terminal domain of Fas-ligand bears two caveolin-binding sites. The first caveolin-binding site binds the N-terminal domain of caveolin-1, whereas the second one appears to interact with the C-terminal domain of caveolin-1. The deletion of both caveolin-binding sites in Fas-ligand impairs its distribution between cellular membranes, and attenuates a Fas-ligand-induced cytotoxicity. These results demonstrate that the interaction of Fas-ligand and caveolin-1 represents a molecular basis for Fas-ligand translocation to rafts, and the subsequent induction of Fas-ligand-dependent cell death. A possibility of a similar association between other TNF family members and caveolin-1 is discussed.
PPARγ and Its Ligands: Potential Antitumor Agents in the Digestive System.
Shu, Linjing; Huang, Renhuan; Wu, Songtao; Chen, Zhaozhao; Sun, Ke; Jiang, Yan; Cai, Xiaoxiao
2016-01-01
Peroxisome proliferator-activated receptor γ (PPARγ) is a versatile member of the ligand-activated nuclear hormone receptor superfamily of transcription factors, with expression in several different cell lines, especially in the digestive system. After being activated by its ligand, PPARγ can suppress the growth of oral, esophageal, gastric, colorectal, liver, biliary, and pancreatic tumor cells, suggesting that PPARγ ligand is a potential anticancer agent in PPARγ-expressing tumors. This review highlights key advances in understanding the effects of PPARγ ligands in the treatment of tumors in the digestive system.
Dynamic Factors Affecting Gaseous Ligand Binding in an Artificial Oxygen Transport Protein‡
Zhang, Lei; Andersen, Eskil M.E.; Khajo, Abdelahad; Magliozzo, Richard S.; Koder, Ronald L.
2013-01-01
We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7 this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime which may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when when exposed to oxygen. Compared to HP7, distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off-rate. EPR comparison of these ferric hemoproteins demonstrates that the mutation increases disorder at the heme binding site. NMR-detected deuterium exchange demonstrates that the mutation greatly increases water penetration into the protein core. The inability of the mutant protein to bind oxygen may be due to increased water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together these data underline the importance of the control of protein dynamics in the design of functional artificial proteins. PMID:23249163
Tanaka, Motonari; Nanba, Daisuke; Mori, Seiji; Shiba, Fumio; Ishiguro, Hiroshi; Yoshino, Koichiro; Matsuura, Nariaki; Higashiyama, Shigeki
2004-10-01
A disintegrin and metalloproteases (ADAMs) are implicated in the ectodomain shedding of epidermal growth factor receptor (EGFR) ligands in EGFR transactivation. However, the activation mechanisms of ADAMs remain elusive. To analyze the regulatory mechanisms of ADAM activation, we performed yeast two-hybrid screening using the cytoplasmic domain of ADAM12 as bait, and identified a protein that we designated Eve-1. Two cDNAs were cloned and characterized. They encode alternatively spliced isoforms of Eve-1, called Eve-1a and Eve-1b, that have four and five tandem Src homology 3 (SH3) domains in the carboxyl-terminal region, respectively, and seven proline-rich SH3 domain binding motifs in the amino-terminal region. The short forms of Eve-1, Eve-1c and Eve-1d, translated at Met-371 are human counterparts of mouse Sh3d19. Northern blot analysis demonstrated that Eve-1 is abundantly expressed in skeletal muscle and heart. Western blot analysis revealed the dominant production of Eve-1c in human cancer cell lines. Knockdown of Eve-1 by small interfering RNA in HT1080 cells reduced the shedding of proHB-EGF induced by angiotensin II and 12-O-tetradecanoylphorbol-13-acetate, as well as the shedding of pro-transforming growth factor-alpha, promphiregulin, and proepiregulin by 12-O-tetradecanoylphorbol-13-acetate, suggesting that Eve-1 plays a role in positively regulating the activity of ADAMs in the signaling of EGFR-ligand shedding.
Matsukura, S.; Odaka, M.; Kurokawa, M.; Kuga, H.; Homma, T.; Takeuchi, H.; Notomi, K.; Kokubu, F.; Kawaguchi, M.; Schleimer, R. P.; Johnson, M. W.; Adachi, M.
2013-01-01
Summary Background Chemokines ligands of CCR3 including eotaxin/CC chemokine ligand 11 (CCL11) may contribute to the pathogenesis of asthma. These chemokines and a growth factor (TGF-β) may be involved in the process of airway remodelling. Objective We analysed the effects of TGF-β on the expression of CCR3 ligands in human airway smooth muscle (HASM) cells and investigated the mechanisms. Methods HASM cells were cultured and treated with TGF-β and Th2 cytokines IL-4 or IL-13. Expression of mRNA was analysed by real-time PCR. Secretion of CCL11 into the culture medium was analysed by ELISA. Transcriptional regulation of CCL11 was analysed by luciferase assay using CCL11 promoter-luciferase reporter plasmids. Results IL-4 or IL-13 significantly up-regulated the expression of mRNAs for CCL11 and CCL26. TGF-β alone did not increase the expression of chemokine mRNAs, but enhanced the induction of only CCL11 by IL-4 or IL-13 among CCR3 ligands. Activity of the CCL11 promoter was stimulated by IL-4, and this activity was enhanced by TGF-β. Activation by IL-4 or IL-4 plus TGF-β was lost by mutation of the binding site for signal transducers and activators of transcription-6 (STAT6) in the promoter. Cooperative activation by IL-4 and TGF-β was inhibited by mutation of the binding site for nuclear factor-κB (NF-κB) in the promoter. Pretreatment with an inhibitor of NF-κB and glucocorticoid fluticasone propionate significantly inhibited the expression of CCL11 mRNA induced by IL-4 plus TGF-β, indicating the importance of NF-κB in the cooperative activation of CCL11 transcription by TGF-β and IL-4. Conclusion These results indicate that Th2 cytokines and TGF-β may contribute to the pathogenesis of asthma by stimulating expression of CCL11. The transcription factors STAT6 and NF-κB may play pivotal roles in this process. PMID:20214667
Matsukura, S; Odaka, M; Kurokawa, M; Kuga, H; Homma, T; Takeuchi, H; Notomi, K; Kokubu, F; Kawaguchi, M; Schleimer, R P; Johnson, M W; Adachi, M
2010-05-01
Chemokines ligands of CCR3 including eotaxin/CC chemokine ligand 11 (CCL11) may contribute to the pathogenesis of asthma. These chemokines and a growth factor (TGF-beta) may be involved in the process of airway remodelling. We analysed the effects of TGF-beta on the expression of CCR3 ligands in human airway smooth muscle (HASM) cells and investigated the mechanisms. HASM cells were cultured and treated with TGF-beta and Th2 cytokines IL-4 or IL-13. Expression of mRNA was analysed by real-time PCR. Secretion of CCL11 into the culture medium was analysed by ELISA. Transcriptional regulation of CCL11 was analysed by luciferase assay using CCL11 promoter-luciferase reporter plasmids. IL-4 or IL-13 significantly up-regulated the expression of mRNAs for CCL11 and CCL26. TGF-beta alone did not increase the expression of chemokine mRNAs, but enhanced the induction of only CCL11 by IL-4 or IL-13 among CCR3 ligands. Activity of the CCL11 promoter was stimulated by IL-4, and this activity was enhanced by TGF-beta. Activation by IL-4 or IL-4 plus TGF-beta was lost by mutation of the binding site for signal transducers and activators of transcription-6 (STAT6) in the promoter. Cooperative activation by IL-4 and TGF-beta was inhibited by mutation of the binding site for nuclear factor-kappaB (NF-kappaB) in the promoter. Pretreatment with an inhibitor of NF-kappaB and glucocorticoid fluticasone propionate significantly inhibited the expression of CCL11 mRNA induced by IL-4 plus TGF-beta, indicating the importance of NF-kappaB in the cooperative activation of CCL11 transcription by TGF-beta and IL-4. These results indicate that Th2 cytokines and TGF-beta may contribute to the pathogenesis of asthma by stimulating expression of CCL11. The transcription factors STAT6 and NF-kappaB may play pivotal roles in this process.
Ravindranath, Pradeep Anand; Sanner, Michel F.
2016-01-01
Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702
Predicting receptor-ligand pairs through kernel learning
2011-01-01
Background Regulation of cellular events is, often, initiated via extracellular signaling. Extracellular signaling occurs when a circulating ligand interacts with one or more membrane-bound receptors. Identification of receptor-ligand pairs is thus an important and specific form of PPI prediction. Results Given a set of disparate data sources (expression data, domain content, and phylogenetic profile) we seek to predict new receptor-ligand pairs. We create a combined kernel classifier and assess its performance with respect to the Database of Ligand-Receptor Partners (DLRP) 'golden standard' as well as the method proposed by Gertz et al. Among our findings, we discover that our predictions for the tgfβ family accurately reconstruct over 76% of the supported edges (0.76 recall and 0.67 precision) of the receptor-ligand bipartite graph defined by the DLRP "golden standard". In addition, for the tgfβ family, the combined kernel classifier is able to relatively improve upon the Gertz et al. work by a factor of approximately 1.5 when considering that our method has an F-measure of 0.71 while that of Gertz et al. has a value of 0.48. Conclusions The prediction of receptor-ligand pairings is a difficult and complex task. We have demonstrated that using kernel learning on multiple data sources provides a stronger alternative to the existing method in solving this task. PMID:21834994
Fully Flexible Docking of Medium Sized Ligand Libraries with RosettaLigand
DeLuca, Samuel; Khar, Karen; Meiler, Jens
2015-01-01
RosettaLigand has been successfully used to predict binding poses in protein-small molecule complexes. However, the RosettaLigand docking protocol is comparatively slow in identifying an initial starting pose for the small molecule (ligand) making it unfeasible for use in virtual High Throughput Screening (vHTS). To overcome this limitation, we developed a new sampling approach for placing the ligand in the protein binding site during the initial ‘low-resolution’ docking step. It combines the translational and rotational adjustments to the ligand pose in a single transformation step. The new algorithm is both more accurate and more time-efficient. The docking success rate is improved by 10–15% in a benchmark set of 43 protein/ligand complexes, reducing the number of models that typically need to be generated from 1000 to 150. The average time to generate a model is reduced from 50 seconds to 10 seconds. As a result we observe an effective 30-fold speed increase, making RosettaLigand appropriate for docking medium sized ligand libraries. We demonstrate that this improved initial placement of the ligand is critical for successful prediction of an accurate binding position in the ‘high-resolution’ full atom refinement step. PMID:26207742
Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that function as ligand-activated transcription factors regulating lipid metabolism and homeostasis. In addition to their ability to regulate PPAR-mediated gene transcription, PPARalpha and gamma li...
Ligand Depot: a data warehouse for ligands bound to macromolecules.
Feng, Zukang; Chen, Li; Maddula, Himabindu; Akcan, Ozgur; Oughtred, Rose; Berman, Helen M; Westbrook, John
2004-09-01
Ligand Depot is an integrated data resource for finding information about small molecules bound to proteins and nucleic acids. The initial release (version 1.0, November, 2003) focuses on providing chemical and structural information for small molecules found as part of the structures deposited in the Protein Data Bank. Ligand Depot accepts keyword-based queries and also provides a graphical interface for performing chemical substructure searches. A wide variety of web resources that contain information on small molecules may also be accessed through Ligand Depot. Ligand Depot is available at http://ligand-depot.rutgers.edu/. Version 1.0 supports multiple operating systems including Windows, Unix, Linux and the Macintosh operating system. The current drawing tool works in Internet Explorer, Netscape and Mozilla on Windows, Unix and Linux.
Lou, Meizhen; Garrett, Thomas P. J.; McKern, Neil M.; Hoyne, Peter A.; Epa, V. Chandana; Bentley, John D.; Lovrecz, George O.; Cosgrove, Leah J.; Frenkel, Maurice J.; Ward, Colin W.
2006-01-01
The insulin receptor (IR) and the type-1 insulin-like growth factor receptor (IGF1R) are homologous multidomain proteins that bind insulin and IGF with differing specificity. Here we report the crystal structure of the first three domains (L1–CR–L2) of human IR at 2.3 Å resolution and compare it with the previously determined structure of the corresponding fragment of IGF1R. The most important differences seen between the two receptors are in the two regions governing ligand specificity. The first is at the corner of the ligand-binding surface of the L1 domain, where the side chain of F39 in IR forms part of the ligand binding surface involving the second (central) β-sheet. This is very different to the location of its counterpart in IGF1R, S35, which is not involved in ligand binding. The second major difference is in the sixth module of the CR domain, where IR contains a larger loop that protrudes further into the ligand-binding pocket. This module, which governs IGF1-binding specificity, shows negligible sequence identity, significantly more α-helix, an additional disulfide bond, and opposite electrostatic potential compared to that of the IGF1R. PMID:16894147
Dynamic factors affecting gaseous ligand binding in an artificial oxygen transport protein.
Zhang, Lei; Andersen, Eskil M E; Khajo, Abdelahad; Magliozzo, Richard S; Koder, Ronald L
2013-01-22
We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7, this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities, and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime that may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when exposed to oxygen. Compared to that of HP7, the distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off rate. Electron paramagnetic resonance comparison of these ferric hemoproteins demonstrates that the mutation increases the level of disorder at the heme binding site. Nuclear magnetic resonance-detected deuterium exchange demonstrates that the mutation greatly increases the degree of penetration of water into the protein core. The inability of the mutant protein to bind oxygen may be due to an increased level of water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together, these data underline the importance of the control of protein dynamics in the design of functional artificial proteins.
Impact of protein and ligand impurities on ITC-derived protein-ligand thermodynamics.
Grüner, Stefan; Neeb, Manuel; Barandun, Luzi Jakob; Sielaff, Frank; Hohn, Christoph; Kojima, Shun; Steinmetzer, Torsten; Diederich, François; Klebe, Gerhard
2014-09-01
The thermodynamic characterization of protein-ligand interactions by isothermal titration calorimetry (ITC) is a powerful tool in drug design, giving valuable insight into the interaction driving forces. ITC is thought to require protein and ligand solutions of high quality, meaning both the absence of contaminants as well as accurately determined concentrations. Ligands synthesized to deviating purity and protein of different pureness were titrated by ITC. Data curation was attempted also considering information from analytical techniques to correct stoichiometry. We used trypsin and tRNA-guanine transglycosylase (TGT), together with high affinity ligands to investigate the effect of errors in protein concentration as well as the impact of ligand impurities on the apparent thermodynamics. We found that errors in protein concentration did not change the thermodynamic properties obtained significantly. However, most ligand impurities led to pronounced changes in binding enthalpy. If protein binding of the respective impurity is not expected, the actual ligand concentration was corrected for and the thus revised data compared to thermodynamic properties obtained with the respective pure ligand. Even in these cases, we observed differences in binding enthalpy of about 4kJ⋅mol(-1), which is considered significant. Our results indicate that ligand purity is the critical parameter to monitor if accurate thermodynamic data of a protein-ligand complex are to be recorded. Furthermore, artificially changing fitting parameters to obtain a sound interaction stoichiometry in the presence of uncharacterized ligand impurities may lead to thermodynamic parameters significantly deviating from the accurate thermodynamic signature. Copyright © 2014 Elsevier B.V. All rights reserved.
Pan, Min-Hsiung; Hsieh, Min-Chi; Hsu, Ping-Chi; Ho, Sheng-Yow; Lai, Ching-Shu; Wu, Hou; Sang, Shengmin; Ho, Chi-Tang
2008-12-01
Ginger, the rhizome of Zingiber officinale, is a traditional medicine with carminative effect, antinausea, anti-inflammatory, and anticarcinogenic properties. In this study, we investigated the inhibitory effects of 6-shogaol and a related compound, 6-gingerol, on the induction of nitric oxide synthase (NOS) and cyclooxygenase-2 (COX-2) in murine RAW 264.7 cells activated with LPS. Western blotting and reverse transcription-PCR analyses demonstrated that 6-shogaol significantly blocked protein and mRNA expression of inducible NOS (iNOS) and COX-2 in LPS-induced macrophages. The in vivo anti-inflammatory activity was evaluated by a topical 12-O-tetradecanoylphorbol 13-acetate (TPA) application to mouse skin. When applied topically onto the shaven backs of mice prior to TPA, 6-shogaol markedly inhibited the expression of iNOS and COX-2 proteins. Treatment with 6-shogaol resulted in the reduction of LPS-induced nuclear translocation of nuclear factor-kappaB (NF kappaB) subunit and the dependent transcriptional activity of NF kappaB by blocking phosphorylation of inhibitor kappaB (I kappaB)alpha and p65 and subsequent degradation of I kappaB alpha. Transient transfection experiments using NF kappaB reporter constructs indicated that 6-shogaol inhibits the transcriptional activity of NF kappaB in LPS-stimulated mouse macrophages. We found that 6-shogaol also inhibited LPS-induced activation of PI3K/Akt and extracellular signal-regulated kinase 1/2, but not p38 mitogen-activated protein kinase (MAPK). Taken together, these results show that 6-shogaol downregulates inflammatory iNOS and COX-2 gene expression in macrophages by inhibiting the activation of NF kappaB by interfering with the activation PI3K/Akt/I kappaB kinases IKK and MAPK.
Group Additivity in Ligand Binding Affinity: An Alternative Approach to Ligand Efficiency.
Reynolds, Charles H; Reynolds, Ryan C
2017-12-26
Group additivity is a concept that has been successfully applied to a variety of thermochemical and kinetic properties. This includes drug discovery, where functional group additivity is often assumed in ligand binding. Ligand efficiency can be recast as a special case of group additivity where ΔG/HA is the group equivalent (HA is the number of non-hydrogen atoms in a ligand). Analysis of a large data set of protein-ligand binding affinities (K i ) for diverse targets shows that in general ligand binding is distinctly nonlinear. It is possible to create a group equivalent scheme for ligand binding, but only in the context of closely related proteins, at least with regard to size. This finding has broad implications for drug design from both experimental and computational points of view. It also offers a path forward for a more general scheme to assess the efficiency of ligand binding.
Thompson, L M; Raffioni, S; Wasmuth, J J; Bradshaw, R A
1997-01-01
Mutations in the gene for human fibroblast growth factor receptor 3 (hFGFR3) cause a variety of skeletal dysplasias, including the most common genetic form of dwarfism, achondroplasia (ACH). Evidence indicates that these phenotypes are not due to simple haploinsufficiency of FGFR3 but are more likely related to a role in negatively regulating skeletal growth. The effects of one of these mutations on FGFR3 signaling were examined by constructing chimeric receptors composed of the extracellular domain of human platelet-derived growth factor receptor beta (hPDGFR beta) and the transmembrane and intracellular domains of hFGFR3 or of an ACH (G375C) mutant. Following stable transfection in PC12 cells, which lack platelet-derived growth factor (PDGF) receptors, all clonal cell lines, with either type of chimera, showed strong neurite outgrowth in the presence of PDGF but not in its absence. Antiphosphotyrosine immunoblots showed ligand-dependent autophosphorylation, and both receptor types stimulated strong phosphorylation of mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase, an event associated with the differentiative response of these cells. In addition, ligand-dependent phosphorylation of phospholipase Cgamma and Shc was also observed. All of these responses were comparable to those observed from ligand activation, such as by nerve growth factor, of the native PC12 cells used to prepare the stable transfectants. The cells with the chimera bearing the ACH mutation were more rapidly responsive to ligand with less sustained MAPK activation, indicative of a preactivated or primed condition and consistent with the view that these mutations weaken ligand control of FGFR3 function. However, the full effect of the mutation likely depends in part on structural features of the extracellular domain. Although FGFR3 has been suggested to act as a negative regulator of long-bone growth in chrondrocytes, it produces differentiative signals similar to
Proteome-wide covalent ligand discovery in native biological systems
Backus, Keriann M.; Correia, Bruno E.; Lum, Kenneth M.; Forli, Stefano; Horning, Benjamin D.; González-Páez, Gonzalo E.; Chatterjee, Sandip; Lanning, Bryan R.; Teijaro, John R.; Olson, Arthur J.; Wolan, Dennis W.; Cravatt, Benjamin F.
2016-01-01
Small molecules are powerful tools for investigating protein function and can serve as leads for new therapeutics. Most human proteins, however, lack small-molecule ligands, and entire protein classes are considered “undruggable” 1,2. Fragment-based ligand discovery (FBLD) can identify small-molecule probes for proteins that have proven difficult to target using high-throughput screening of complex compound libraries 1,3. Although reversibly binding ligands are commonly pursued, covalent fragments provide an alternative route to small-molecule probes 4–10, including those that can access regions of proteins that are difficult to access through binding affinity alone 5,10,11. In this manuscript, we report a quantitative analysis of cysteine-reactive small-molecule fragments screened against thousands of proteins. Covalent ligands were identified for >700 cysteines found in both druggable proteins and proteins deficient in chemical probes, including transcription factors, adaptor/scaffolding proteins, and uncharacterized proteins. Among the atypical ligand-protein interactions discovered were compounds that react preferentially with pro- (inactive) caspases. We used these ligands to distinguish extrinsic apoptosis pathways in human cell lines versus primary human T-cells, showing that the former is largely mediated by caspase-8 while the latter depends on both caspase-8 and −10. Fragment-based covalent ligand discovery provides a greatly expanded portrait of the ligandable proteome and furnishes compounds that can illuminate protein functions in native biological systems. PMID:27309814
2013-01-01
Background The human receptor tyrosine kinase MET and its ligand hepatocyte growth factor/scatter factor are essential during embryonic development and play an important role during cancer metastasis and tissue regeneration. In addition, it was found that MET is also relevant for infectious diseases and is the target of different bacteria, amongst them Listeria monocytogenes that induces bacterial uptake through the surface protein internalin B. Binding of ligand to the MET receptor is proposed to lead to receptor dimerization. However, it is also discussed whether preformed MET dimers exist on the cell membrane. Results To address these issues we used single-molecule fluorescence microscopy techniques. Our photobleaching experiments show that MET exists in dimers on the membrane of cells in the absence of ligand and that the proportion of MET dimers increases significantly upon ligand binding. Conclusions Our results indicate that partially preformed MET dimers may play a role in ligand binding or MET signaling. The addition of the bacterial ligand internalin B leads to an increase of MET dimers which is in agreement with the model of ligand-induced dimerization of receptor tyrosine kinases. PMID:23731667
Angulo, Jesús; Enríquez-Navas, Pedro M; Nieto, Pedro M
2010-07-12
The direct evaluation of dissociation constants (K(D)) from the variation of saturation transfer difference (STD) NMR spectroscopy values with the receptor-ligand ratio is not feasible due to the complex dependence of STD intensities on the spectral properties of the observed signals. Indirect evaluation, by competition experiments, allows the determination of K(D), as long as a ligand of known affinity is available for the protein under study. Herein, we present a novel protocol based on STD NMR spectroscopy for the direct measurements of receptor-ligand dissociation constants (K(D)) from single-ligand titration experiments. The influence of several experimental factors on STD values has been studied in detail, confirming the marked impact on standard determinations of protein-ligand affinities by STD NMR spectroscopy. These factors, namely, STD saturation time, ligand residence time in the complex, and the intensity of the signal, affect the accumulation of saturation in the free ligand by processes closely related to fast protein-ligand rebinding and longitudinal relaxation of the ligand signals. The proposed method avoids the dependence of the magnitudes of ligand STD signals at a given saturation time on spurious factors by constructing the binding isotherms using the initial growth rates of the STD amplification factors, in a similar way to the use of NOE growing rates to estimate cross relaxation rates for distance evaluations. Herein, it is demonstrated that the effects of these factors are cancelled out by analyzing the protein-ligand association curve using STD values at the limit of zero saturation time, when virtually no ligand rebinding or relaxation takes place. The approach is validated for two well-studied protein-ligand systems: the binding of the saccharides GlcNAc and GlcNAcbeta1,4GlcNAc (chitobiose) to the wheat germ agglutinin (WGA) lectin, and the interaction of the amino acid L-tryptophan to bovine serum albumin (BSA). In all cases, the
Pérot, Stéphanie; Regad, Leslie; Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A; Villoutreix, Bruno O; Camproux, Anne-Claude
2013-01-01
Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket
Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A.; Villoutreix, Bruno O.; Camproux, Anne-Claude
2013-01-01
Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket
Role of ligand-ligand vs. core-core interactions in gold nanoclusters.
Milowska, Karolina Z; Stolarczyk, Jacek K
2016-05-14
The controlled assembly of ligand-coated gold nanoclusters (NCs) into larger structures paves the way for new applications ranging from electronics to nanomedicine. Here, we demonstrate through rigorous density functional theory (DFT) calculations employing novel functionals accounting for van der Waals forces that the ligand-ligand interactions determine whether stable assemblies can be formed. The study of NCs with different core sizes, symmetry forms, ligand lengths, mutual crystal orientations, and in the presence of a solvent suggests that core-to-core van der Waals interactions play a lesser role in the assembly. The dominant interactions originate from combination of steric effects, augmented by ligand bundling on NC facets, and related to them changes in electronic properties induced by neighbouring NCs. We also show that, in contrast to standard colloidal theory approach, DFT correctly reproduces the surprising experimental trends in the strength of the inter-particle interaction observed when varying the length of the ligands. The results underpin the importance of understanding NC interactions in designing gold NCs for a specific function.
Li, Changqing; Tian, Mi; Yuan, Ye; Zhou, Qinxin
2008-12-01
Human peroxisome proliferator-activated receptors (hPPARs) are ligand-activated transcription factors and are the target for the treatment of many diseases. Screening of their ligands is mainly based on assays of ligand binding to the ligand binding domain (LBD) of hPPARs.However, such assays are difficult because of the preparation of hPPARs LBD. In order to yield functional hPPARs LBD for screening ligands, hPPARs LBD was fused with maltose-binding protein(MBP) using the pMAL-p2x expression system through the gene engineering technique. The radioligand binding assay showed that MBP did not affect ligand binding with hPPARs LBD in the fusion proteins, which means that MBP-hPPARs LBD can be used instead of hPPARs LBD in ligand screening work. The results show that the new strategy using MBP as a fusion tag for preparing hPPARs LBD for screening ligands is a convenient and reliable method. It may be used to easily obtain the other nuclear receptors.
Barley as a green factory for the production of functional Flt3 ligand.
Erlendsson, Lýdur S; Muench, Marcus O; Hellman, Ulf; Hrafnkelsdóttir, Soffía M; Jonsson, Anders; Balmer, Yves; Mäntylä, Einar; Orvar, Björn L
2010-02-01
Biologically active recombinant human Flt3 ligand was expressed and isolated from transgenic barley seeds. Its expression is controlled by a tissue specific promoter that confines accumulation of the recombinant protein to the endosperm tissue of the seed. The recombinant Flt3 ligand variant expressed in the seeds contains an HQ-tag for affinity purification on immobilized metal ion affinity chromatography (IMAC) resin. The tagged protein was purified from seed extracts to near homogeneity using sequential chromatography on IMAC affinity resin and cation exchange resin. We also show that the recombinant Flt3 ligand protein undergoes posttranslational modifications: it is a glycoprotein containing alpha-1,3-fucose and alpha-1,2-xylose. The HQ-tagged Flt3 ligand variant exhibits comparable biological activity to commercial Flt3 ligand. This is the first report showing expression and accumulation of recombinant human growth factor in barley seeds with a yield of active protein similar to a bacterial expression system. The present results demonstrate that plant molecular farming is a viable approach for the bioproduction of human-derived growth factors.
Ligand solvation in molecular docking.
Shoichet, B K; Leach, A R; Kuntz, I D
1999-01-01
Solvation plays an important role in ligand-protein association and has a strong impact on comparisons of binding energies for dissimilar molecules. When databases of such molecules are screened for complementarity to receptors of known structure, as often occurs in structure-based inhibitor discovery, failure to consider ligand solvation often leads to putative ligands that are too highly charged or too large. To correct for the different charge states and sizes of the ligands, we calculated electrostatic and non-polar solvation free energies for molecules in a widely used molecular database, the Available Chemicals Directory (ACD). A modified Born equation treatment was used to calculate the electrostatic component of ligand solvation. The non-polar component of ligand solvation was calculated based on the surface area of the ligand and parameters derived from the hydration energies of apolar ligands. These solvation energies were subtracted from the ligand-receptor interaction energies. We tested the usefulness of these corrections by screening the ACD for molecules that complemented three proteins of known structure, using a molecular docking program. Correcting for ligand solvation improved the rankings of known ligands and discriminated against molecules with inappropriate charge states and sizes.
Ligand interaction scan: a general method for engineering ligand-sensitive protein alleles.
Erster, Oran; Eisenstein, Miriam; Liscovitch, Mordechai
2007-05-01
The ligand interaction scan (LIScan) method is a general procedure for engineering small molecule ligand-regulated forms of a protein that is complementary to other 'reverse' genetic and chemical-genetic methods for drug-target validation. It involves insertional mutagenesis by a chemical-genetic 'switch', comprising a genetically encoded peptide module that binds with high affinity to a small-molecule ligand. We demonstrated the method with TEM-1 beta-lactamase, using a tetracysteine hexapeptide insert and a biarsenical fluorescein ligand (FlAsH).
2011-01-01
Introduction Rheumatoid arthritis (RA) is a chronic disease associated with inflammation and destruction of bone and cartilage. Although inhibition of TNFα is widely used to treat RA, a significant number of patients do not respond to TNFα blockade, and therefore there is a compelling need to continue to identify alternative therapeutic strategies for treating chronic inflammatory diseases such as RA. The anti-epidermal growth factor (anti-EGF) receptor antibody trastuzumab has revolutionised the treatment of patients with EGF receptor-positive breast cancer. Expression of EGF ligands and receptors (known as HER) has also been documented in RA. The highly unique compound RB200 is a bispecific ligand trap that is composed of full-length extracellular domains of HER1 and HER3 EGF receptors. Because of its pan-HER specificity, RB200 inhibits responses mediated by HER1, HER2 and HER3 in vitro and in vivo. The objective of this study was to assess the effect of RB200 combined with TNF blockade in a murine collagen-induced arthritis (CIA) model of RA. Methods Arthritic mice were treated with RB200 alone or in combination with the TNF receptor fusion protein etanercept. We performed immunohistochemistry to assess CD31 and in vivo fluorescent imaging using anti-E-selectin antibody labelled with fluorescent dye to elucidate the effect of RB200 on the vasculature in CIA. Results RB200 significantly abrogated CIA by reducing paw swelling and clinical scores. Importantly, low-dose RB200 combined with a suboptimal dose of etanercept led to complete abrogation of arthritis. Moreover, the combination of RB200 with etanercept abrogated the intensity of the E-selectin-targeted signal to the level seen in control animals not immunised to CIA. Conclusions The human pan-EGF receptor bispecific ligand trap RB200, when combined with low-dose etanercept, abrogates CIA, suggesting that inhibition of events downstream of EGF receptor activation, in combination with TNFα inhibitors, may
Expression of the ERBB Family of Ligands and Receptors in Gastric Cancer.
Byeon, Sun-Ju; Lee, Hye Seung; Kim, Min-A; Lee, Byung Lan; Kim, Woo Ho
2017-01-01
Gastric cancer (GC) is the second most common cancer and the third leading cause of cancer-related death in Korea. Alterations in the ERBB (homology to the erythroblastoma viral gene product, v-erbB) receptor family and ERBB-related signaling pathways are frequently observed in GC. However, the roles of the ERBB receptors and their ligands in GC are not well established. We evaluated the expression levels of various ERBB receptor ligands (i.e., heparin-binding epidermal growth factor-like growth factor [HBEGF], transforming growth factor-α [TGFA], amphiregulin [AREG], epiregulin [EREG], epidermal growth factor [EGF], and betacellulin [BTC]) and 3 ERBB family receptors (i.e., epidermal growth factor receptor [EGFR], human EGFR2 [HER2], and ERBB3) in 313 cases of GC using immunohistochemistry, fluorescence in situ hybridization, and mRNA in situ hybridization. A high expression of EGFR, HER2, and ERBB3 was observed in 30, 32, and 27 cases, respectively. A high expression of HBEGF, TGFA, AREG, EREG, EGF, and BTC was observed in 91, 97, 151, 74, 26, and 37 cases, respectively. A high expression of TGFA was associated with better survival, while a high expression of BTC was associated with worse survival. These results were confirmed using Cox proportional hazards analysis. HBEGF, TGFA, AREG, tumor-node-metastasis classification, Lauren's classification, and ERBB3 were significant survival parameters in multivariate analysis. Among the ERBB family receptors and ligands examined, 3 ligands (i.e., TGFA, HBEGF, and AREG) and ERBB3 had a prognostic impact. © 2017 S. Karger AG, Basel.
PDB ligand conformational energies calculated quantum-mechanically.
Sitzmann, Markus; Weidlich, Iwona E; Filippov, Igor V; Liao, Chenzhong; Peach, Megan L; Ihlenfeldt, Wolf-Dietrich; Karki, Rajeshri G; Borodina, Yulia V; Cachau, Raul E; Nicklaus, Marc C
2012-03-26
We present here a greatly updated version of an earlier study on the conformational energies of protein-ligand complexes in the Protein Data Bank (PDB) [Nicklaus et al. Bioorg. Med. Chem. 1995, 3, 411-428], with the goal of improving on all possible aspects such as number and selection of ligand instances, energy calculations performed, and additional analyses conducted. Starting from about 357,000 ligand instances deposited in the 2008 version of the Ligand Expo database of the experimental 3D coordinates of all small-molecule instances in the PDB, we created a "high-quality" subset of ligand instances by various filtering steps including application of crystallographic quality criteria and structural unambiguousness. Submission of 640 Gaussian 03 jobs yielded a set of about 415 successfully concluded runs. We used a stepwise optimization of internal degrees of freedom at the DFT level of theory with the B3LYP/6-31G(d) basis set and a single-point energy calculation at B3LYP/6-311++G(3df,2p) after each round of (partial) optimization to separate energy changes due to bond length stretches vs bond angle changes vs torsion changes. Even for the most "conservative" choice of all the possible conformational energies-the energy difference between the conformation in which all internal degrees of freedom except torsions have been optimized and the fully optimized conformer-significant energy values were found. The range of 0 to ~25 kcal/mol was populated quite evenly and independently of the crystallographic resolution. A smaller number of "outliers" of yet higher energies were seen only at resolutions above 1.3 Å. The energies showed some correlation with molecular size and flexibility but not with crystallographic quality metrics such as the Cruickshank diffraction-component precision index (DPI) and R(free)-R, or with the ligand instance-specific metrics such as occupancy-weighted B-factor (OWAB), real-space R factor (RSR), and real-space correlation coefficient
Arslan, Muyesser Sayki; Sahin, Mustafa; Karakose, Melia; Tutal, Esra; Topaloglu, Oya; Ucan, Bekir; Demirci, Taner; Caliskan, Mustafa; Ozdemir, Seyda; Ozbek, Mustafa; Cakal, Erman
2017-03-01
The aim of this study to was to evaluate the effect of fibroblast growth factor-23 (FGF-23), osteoprotegerin (OPG), receptor activator nuclear κB ligand (RANKL), and vitamin D hormones on bone loss in patients with hyperprolactinemia due to pituitary prolactinoma. We recruited 46 premenopausal female patients with prolactinoma and age and sex-matched healthy controls (Group 3, n = 20) for this cross-sectional study. Prolactinoma patients were divided into 2 groups as patients newly diagnosed (Group 1, n = 26) and those under cabergoline treatment (Group 2, n = 20). Anthropometric and metabolic variables; hormonal profiles; and osteocalcin, deoxypyridinoline (DOP), and bone mineral density measurements were performed for all participants. FGF-23, OPG, and RANKL levels were analyzed in all groups. FGF-23, OPG, calcium, phosphorus, and parathormone levels were similar between all groups despite significantly higher levels in the control group in terms of vitamin D and RANKL levels than in patients. Bone loss was found more in Group 2, particularly observed in Z scores of femur and spinal bone (P<.05). Correlation analysis revealed a negative correlation between FGF-23 and femur neck T score (r = -0.0433, P = .05) in patients with active prolactinoma. A positive correlation was also observed between parameters of DOP and OPG (r = 0.673, P = .02). In patients with remission there were a negative correlation between prolactin and luteinizing hormone (r = -600, P = .08). Additionally, a negative correlation was found between osteocalcin and osteoprotegerin in patients in remission (r = -0.73, P = .01). Our data indicated that FGF-23 and OPG levels do not play a critical role on the development of bone decrease in patients with hyperprolactinemia. However, further prospective studies in larger numbers of participants should be designed to clarify this issue. BFP = body fat percentage BMD = bone mineral density BMI = body mass index CV = coefficient of variation DOP
Identification of the Ah-Receptor Structural Determinants for Ligand Preferences
Xing, Yongna
2012-01-01
The aryl hydrocarbon receptor (AHR) is a transcription factor that responds to diverse ligands and plays a critical role in toxicology, immune function, and cardiovascular physiology. The structural basis of the AHR for ligand promiscuity and preferences is critical for understanding AHR function. Based on the structure of a closely related protein HIF2α, we modeled the AHR ligand binding domain (LBD) bound to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and benzo(a)pyrene (BaP) and identified residues that control ligand preferences by shape and H-bond potential. Mutations to these residues, particularly Q377 and G298, resulted in robust and opposite changes in the potency of TCDD and BaP and up to a 20-fold change in the ratio of TCDD/BaP efficacy. The model also revealed a flexible “belt” structure; molecular dynamic (MD) simulation suggested that the “belt” and several other structural elements in the AHR-LBD are more flexible than HIF2α and likely contribute to ligand promiscuity. Molecular docking of TCDD congeners to a model of human AHR-LBD ranks their binding affinity similar to experimental ranking of their toxicity. Our study reveals key structural basis for prediction of toxicity and understanding the AHR signaling through diverse ligands. PMID:22659362
Marsh, Lorraine
2015-01-01
Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.
Eun, Su-Hyeon; Woo, Je-Te; Kim, Dong-Hyun
2017-04-01
In the preliminary study, tangeretin (5,6,7,8,4'-pentamethoxy flavone), a major constituent of the pericarp of Citrus sp., inhibited TNF- α , IL-12, and IL-23 expression and nuclear factor kappa-B activation in lipopolysaccharide-stimulated dendritic cells; however, it did not affect IL-10 expression. Furthermore, tangeretin (5, 10, and 20 µM) suppressed the activation and translocation of nuclear factor kappa-B (p65) into the nuclei in vitro by inhibiting the binding of lipopolysaccharide on dendritic cells. Oral administration of tangeretin (10 and 20 mg/kg) suppressed the inflammatory responses, such as nuclear factor kappa-B and mitogen-activated protein kinase activation and myeloperoxidase activity, in the colon of mice with 2,4,6-trinitrobenzene sulfonic acid-induced colitis. Tangeretin increased 2,4,6-trinitrobenzene sulfonic acid-suppressed expression of tight junction proteins occludin, claudin-1, and ZO-1. Tangeretin also inhibited 2,4,6-trinitrobenzene sulfonic acid-induced differentiation of Th1 and Th17 cells as well as the expression of T-bet, ROR γ t, interferon- γ , IL-12, IL-17, and TNF- α . However, tangeretin increased 2,4,6-trinitrobenzene sulfonic acid-suppressed differentiation of regulatory T cells as well as the expression of Foxp3 and IL-10. These results suggest that oral administration of tangeretin may attenuate colitis by suppressing IL-12 and TNF- α expression and nuclear factor kappa-B activation through the inhibition of lipopolysaccharide binding on immune cells such as dendritic cells. Georg Thieme Verlag KG Stuttgart · New York.
Rubina, Marina; Sherrill, William M; Barkov, Alexey Yu
2014-01-01
Summary A novel class of chiral phosphanyl-oxazoline (PHOX) ligands with a conformationally rigid cyclopropyl backbone was synthesized and tested in the intermolecular asymmetric Heck reaction. Mechanistic modelling and crystallographic studies were used to predict the optimal ligand structure and helped to design a very efficient and highly selective catalytic system. Employment of the optimized ligands in the asymmetric arylation of cyclic olefins allowed for achieving high enantioselectivities and significantly suppressing product isomerization. Factors affecting the selectivity and the rate of the isomerization were identified. It was shown that the nature of this isomerization is different from that demonstrated previously using chiral diphosphine ligands. PMID:25161709
Lineage-specific co-evolution of the Egf receptor/ligand signaling system.
Laisney, Juliette A G C; Braasch, Ingo; Walter, Ronald B; Meierjohann, Svenja; Schartl, Manfred
2010-01-27
The epidermal growth factor receptor (Egfr) with its numerous ligands has fundamental roles in development, cell differentiation and physiology. Dysfunction of the receptor-ligand system contributes to many human malignancies. Consistent with such various tasks, the Egfr gene family has expanded during vertebrate evolution as a consequence of several rounds of whole genome duplication. Of particular interest is the effect of the fish-specific whole genome duplication (FSGD) on the ligand-receptor system, as it has supplied this largest group of vertebrates with additional opportunities for sub- and/or neofunctionalization in this signaling system. We identified the predicted components of the Egf receptor-ligand signaling system in teleost fishes (medaka, platyfish, stickleback, pufferfishes and zebrafish). We found two duplicated egfr genes, egfra and egfrb, in all available teleost genomes. Surprisingly only one copy for each of the seven Egfr ligands could be identified in most fishes, with zebrafish hbegf being the only exception. Special focus was put on medaka, for which we more closely investigated all Egf receptors and Egfr ligands. The different expression patterns of egfra, egfrb and their ligands in medaka tissues and embryo stages suggest differences in role and function. Preferential co-expression of different subsets of Egfr ligands corroborates the possible subfunctionalization and specialization of the two receptors in adult tissues. Bioinformatic analyses of the ligand-receptor interface between Egfr and its ligands show a very weak evolutionary conservation within this region. Using in vitro analyses of medaka Egfra, we could show that this receptor is only activated by medaka ligands, but not by human EGF. Altogether, our data suggest a lineage-specific Egfr/Egfr ligand co-evolution. Our data indicate that medaka Egfr signaling occurs via its two copies, Egfra and Egfrb, each of them being preferentially coexpressed with different subsets of Egfr
Lineage-specific co-evolution of the Egf receptor/ligand signaling system
2010-01-01
Background The epidermal growth factor receptor (Egfr) with its numerous ligands has fundamental roles in development, cell differentiation and physiology. Dysfunction of the receptor-ligand system contributes to many human malignancies. Consistent with such various tasks, the Egfr gene family has expanded during vertebrate evolution as a consequence of several rounds of whole genome duplication. Of particular interest is the effect of the fish-specific whole genome duplication (FSGD) on the ligand-receptor system, as it has supplied this largest group of vertebrates with additional opportunities for sub- and/or neofunctionalization in this signaling system. Results We identified the predicted components of the Egf receptor-ligand signaling system in teleost fishes (medaka, platyfish, stickleback, pufferfishes and zebrafish). We found two duplicated egfr genes, egfra and egfrb, in all available teleost genomes. Surprisingly only one copy for each of the seven Egfr ligands could be identified in most fishes, with zebrafish hbegf being the only exception. Special focus was put on medaka, for which we more closely investigated all Egf receptors and Egfr ligands. The different expression patterns of egfra, egfrb and their ligands in medaka tissues and embryo stages suggest differences in role and function. Preferential co-expression of different subsets of Egfr ligands corroborates the possible subfunctionalization and specialization of the two receptors in adult tissues. Bioinformatic analyses of the ligand-receptor interface between Egfr and its ligands show a very weak evolutionary conservation within this region. Using in vitro analyses of medaka Egfra, we could show that this receptor is only activated by medaka ligands, but not by human EGF. Altogether, our data suggest a lineage-specific Egfr/Egfr ligand co-evolution. Conclusions Our data indicate that medaka Egfr signaling occurs via its two copies, Egfra and Egfrb, each of them being preferentially coexpressed
Nadra, Imad; Boccaccini, Aldo R; Philippidis, Pandelis; Whelan, Linda C; McCarthy, Geraldine M; Haskard, Dorian O; Landis, R Clive
2008-01-01
Macrophages may promote a vicious cycle of inflammation and calcification in the vessel wall by ingesting neointimal calcific deposits (predominantly hydroxyapatite) and secreting tumor necrosis factor (TNF)alpha, itself a vascular calcifying agent. Here we have investigated whether particle size affects the proinflammatory potential of hydroxyapatite crystals in vitro and whether the nuclear factor (NF)-kappaB pathway plays a role in the macrophage TNFalpha response. The particle size and nano-topography of nine different crystal preparations was analyzed by X-ray diffraction, Raman spectroscopy, scanning electron microscopy and gas sorbtion analysis. Macrophage TNFalpha secretion was inversely related to hydroxyapatite particle size (P=0.011, Spearman rank correlation test) and surface pore size (P=0.014). A necessary role for the NF-kappaB pathway was demonstrated by time-dependent I kappaB alpha degradation and sensitivity to inhibitors of I kappaB alpha degradation. To test whether smaller particles were intrinsically more bioactive, their mitogenic activity on fibroblast proliferation was examined. This showed close correlation between TNFalpha secretion and crystal-induced fibroblast proliferation (P=0.007). In conclusion, the ability of hydroxyapatite crystals to stimulate macrophage TNFalpha secretion depends on NF-kappaB activation and is inversely related to particle and pore size, with crystals of 1-2 microm diameter and pore size of 10-50 A the most bioactive. Microscopic calcific deposits in early stages of atherosclerosis may therefore pose a greater inflammatory risk to the plaque than macroscopically or radiologically visible deposits in more advanced lesions.
Multiple ligand simultaneous docking: orchestrated dancing of ligands in binding sites of protein.
Li, Huameng; Li, Chenglong
2010-07-30
Present docking methodologies simulate only one single ligand at a time during docking process. In reality, the molecular recognition process always involves multiple molecular species. Typical protein-ligand interactions are, for example, substrate and cofactor in catalytic cycle; metal ion coordination together with ligand(s); and ligand binding with water molecules. To simulate the real molecular binding processes, we propose a novel multiple ligand simultaneous docking (MLSD) strategy, which can deal with all the above processes, vastly improving docking sampling and binding free energy scoring. The work also compares two search strategies: Lamarckian genetic algorithm and particle swarm optimization, which have respective advantages depending on the specific systems. The methodology proves robust through systematic testing against several diverse model systems: E. coli purine nucleoside phosphorylase (PNP) complex with two substrates, SHP2NSH2 complex with two peptides and Bcl-xL complex with ABT-737 fragments. In all cases, the final correct docking poses and relative binding free energies were obtained. In PNP case, the simulations also capture the binding intermediates and reveal the binding dynamics during the recognition processes, which are consistent with the proposed enzymatic mechanism. In the other two cases, conventional single-ligand docking fails due to energetic and dynamic coupling among ligands, whereas MLSD results in the correct binding modes. These three cases also represent potential applications in the areas of exploring enzymatic mechanism, interpreting noisy X-ray crystallographic maps, and aiding fragment-based drug design, respectively. 2010 Wiley Periodicals, Inc.
Importance of ligand reorganization free energy in protein-ligand binding-affinity prediction.
Yang, Chao-Yie; Sun, Haiying; Chen, Jianyong; Nikolovska-Coleska, Zaneta; Wang, Shaomeng
2009-09-30
Accurate prediction of the binding affinities of small-molecule ligands to their biological targets is fundamental for structure-based drug design but remains a very challenging task. In this paper, we have performed computational studies to predict the binding models of 31 small-molecule Smac (the second mitochondria-derived activator of caspase) mimetics to their target, the XIAP (X-linked inhibitor of apoptosis) protein, and their binding affinities. Our results showed that computational docking was able to reliably predict the binding models, as confirmed by experimentally determined crystal structures of some Smac mimetics complexed with XIAP. However, all the computational methods we have tested, including an empirical scoring function, two knowledge-based scoring functions, and MM-GBSA (molecular mechanics and generalized Born surface area), yield poor to modest prediction for binding affinities. The linear correlation coefficient (r(2)) value between the predicted affinities and the experimentally determined affinities was found to be between 0.21 and 0.36. Inclusion of ensemble protein-ligand conformations obtained from molecular dynamic simulations did not significantly improve the prediction. However, major improvement was achieved when the free-energy change for ligands between their free- and bound-states, or "ligand-reorganization free energy", was included in the MM-GBSA calculation, and the r(2) value increased from 0.36 to 0.66. The prediction was validated using 10 additional Smac mimetics designed and evaluated by an independent group. This study demonstrates that ligand reorganization free energy plays an important role in the overall binding free energy between Smac mimetics and XIAP. This term should be evaluated for other ligand-protein systems and included in the development of new scoring functions. To our best knowledge, this is the first computational study to demonstrate the importance of ligand reorganization free energy for the
Nickerson, Nicole K.; Mill, Christopher P.; Wu, Hsin-Jung; Riese, David J.; Foley, John
2014-01-01
Epidermal growth factor receptor (EGFR) expression has been linked to progression of basal breast cancers. Many breast cancer cells harbor the EGFR and produce its family of ligands, suggesting they may participate in autocrine and paracrine signaling with cells of the tumor microenvironment. EGFR ligand expression was profiled in the basal breast cancer cell line MDA-231 where AREG, TGF-α, and HBEGF were the three ligands most highly expressed. Autocrine signaling was modulated through silencing or overexpression of these three ligands using lentiviral constructs and the impact measured using motility, proliferation, and cytokine expression assays. Changes in receptor phosphorylation and receptor turnover were examined. Knockdown of AREG or TGF-α in vitro resulted in decreased motility (p < 0.05) and decreased expression of macrophage chemoattractants. Overexpression of TGF-α increased motility and chemoattractant expression, whereas AREG did not. HBEGF modulation had no effect on any cellular behaviors. All the cells with altered ligand production were inoculated into female athymic nude mice to form mammary fat pad tumors, followed by immunohistochemical analysis for necrosis, angiogenesis, and macrophage recruitment. In vivo, knockdown of AREG or TGF-α increased survival (p < 0.001) while decreasing angiogenesis (p < 0.001), tumor growth (p < 0.001), and macrophage attraction (p < 0.001). Overexpression of AREG appeared to elicit a greater effect than TGF-α on mammary fat pad tumor growth by increasing angiogenesis (p < 0.001) and macrophage attraction to the tumor (p < 0.01). We propose these changes in mammary tumor growth were the result of increased recruitment of macrophages to the tumor by cells with altered autocrine EGFR signaling. We conclude that AREG and TGF-α were somewhat interchangeable in their effects on EGFR signaling; however, TGF-α had a greater effect in vitro and AREG had a greater effect in vivo. PMID:23879171
Nickerson, Nicole K; Mill, Christopher P; Wu, Hsin-Jung; Riese, David J; Foley, John
2013-01-01
Epidermal growth factor receptor (EGFR) expression has been linked to progression of basal breast cancers. Many breast cancer cells harbor the EGFR and produce its family of ligands, suggesting they may participate in autocrine and paracrine signaling with cells of the tumor microenvironment. EGFR ligand expression was profiled in the basal breast cancer cell line MDA-231 where AREG, TGF-alpha, and HBEGF were the three ligands most highly expressed. Autocrine signaling was modulated through silencing or overexpression of these three ligands using lentiviral constructs and the impact measured using motility, proliferation, and cytokine expression assays. Changes in receptor phosphorylation and receptor turnover were examined. Knockdown of AREG or TGF-alpha in vitro resulted in decreased motility (p < 0.05) and decreased expression of macrophage chemoattractants. Overexpression of TGF-alpha increased motility and chemoattractant expression, whereas AREG did not. HBEGF modulation had no effect on any cellular behaviors. All the cells with altered ligand production were inoculated into female athymic nude mice to form mammary fat pad tumors, followed by immunohistochemical analysis for necrosis, angiogenesis, and macrophage recruitment. In vivo, knockdown of AREG or TGF-alpha increased survival (p < 0.001) while decreasing angiogenesis (p < 0.001), tumor growth (p < 0.001), and macrophage attraction (p < 0.001). Overexpression of AREG appeared to elicit a greater effect than TGF-alpha on mammary fat pad tumor growth by increasing angiogenesis (p < 0.001) and macrophage attraction to the tumor (p < 0.01). We propose these changes in mammary tumor growth were the result of increased recruitment of macrophages to the tumor by cells with altered autocrine EGFR signaling. We conclude that AREG and TGF-alpha were somewhat interchangeable in their effects on EGFR signaling; however, TGF-alpha had a greater effect in vitro and AREG had a greater effect in vivo.
Dahlhoff, Maik; Schäfer, Matthias; Wolf, Eckhard; Schneider, Marlon R
2013-02-15
The epidermal growth factor receptor (EGFR) is a tyrosine kinase receptor with manifold functions during development, tissue homeostasis and disease. EGFR activation, the formation of homodimers or heterodimers (with the related ERBB2-4 receptors) and downstream signaling is initiated by the binding of a family of structurally related growth factors, the EGFR ligands. Genetic deletion experiments clarified the biological function of all family members except for the last characterized ligand, epigen. We employed gene targeting in mouse embryonic stem cells to generate mice lacking epigen expression. Loss of epigen did not affect mouse development, fertility, or organ physiology. Quantitative RT-PCR analysis revealed increased expression of betacellulin and EGF in a few organs of epigen-deficient mice, suggesting a functional compensation by these ligands. In conclusion, we completed the genetic analysis of EGFR ligands and show that epigen has non-essential functions or functions that can be compensated by other EGFR ligands during growth and tissue homeostasis. Copyright © 2012 Elsevier Inc. All rights reserved.
Enhanced Ligand Sampling for Relative Protein–Ligand Binding Free Energy Calculations
2016-01-01
Free energy calculations are used to study how strongly potential drug molecules interact with their target receptors. The accuracy of these calculations depends on the accuracy of the molecular dynamics (MD) force field as well as proper sampling of the major conformations of each molecule. However, proper sampling of ligand conformations can be difficult when there are large barriers separating the major ligand conformations. An example of this is for ligands with an asymmetrically substituted phenyl ring, where the presence of protein loops hinders the proper sampling of the different ring conformations. These ring conformations become more difficult to sample when the size of the functional groups attached to the ring increases. The Adaptive Integration Method (AIM) has been developed, which adaptively changes the alchemical coupling parameter λ during the MD simulation so that conformations sampled at one λ can aid sampling at the other λ values. The Accelerated Adaptive Integration Method (AcclAIM) builds on AIM by lowering potential barriers for specific degrees of freedom at intermediate λ values. However, these methods may not work when there are very large barriers separating the major ligand conformations. In this work, we describe a modification to AIM that improves sampling of the different ring conformations, even when there is a very large barrier between them. This method combines AIM with conformational Monte Carlo sampling, giving improved convergence of ring populations and the resulting free energy. This method, called AIM/MC, is applied to study the relative binding free energy for a pair of ligands that bind to thrombin and a different pair of ligands that bind to aspartyl protease β-APP cleaving enzyme 1 (BACE1). These protein–ligand binding free energy calculations illustrate the improvements in conformational sampling and the convergence of the free energy compared to both AIM and AcclAIM. PMID:25906170
Synthesis and Characterization of PEGylated Toll Like Receptor 7 Ligands
Chan, Michael; Hayashi, Tomoko; Mathewson, Richard D.; Yao, Shiyin; Gray, Christine; Tawatao, Rommel; Kalenian, Kevin; Zhang, Yanmei; Hayashi, Yuki; Lao, Fitzgerald S.; Cottam, Howard B.; Carson, Dennis A.
2011-01-01
Toll like receptor 7 (TLR7) is located in the endosomal compartment of immune cells. Signaling through TLR7, mediated by the adaptor protein MyD88, stimulates the innate immune system and shapes adaptive immune responses. Previously, we characterized TLR7 ligands conjugated to protein, lipid or polyethylene glycol (PEG). Among the TLR7 ligand conjugates, the addition of PEG chains reduced the agonistic potency. PEGs are safe in humans and widely used for improvement of pharmacokinetics in existing biologics and some low molecular weight compounds. PEGylation could be a feasible method to alter the pharmacokinetics and pharmacodynamics of TLR7 ligands. In this study, we systematically studied the influence of PEG chain length on the in vitro and in vivo properties of potent TLR7 ligands. PEGylation increased solubility of the TLR7 ligands and modulated protein binding. Adding a 6–10 length PEG to the TLR7 ligand reduced its potency toward induction of interleukin (IL)-6 by murine macrophages in vitro and IL-6 and tumor necrosis factor (TNF) in vivo. However, PEGylation with 18 or longer chain restored, and even enhanced, the agonistic activity of the drug. In human peripheral blood mononuclear cells, similar effects of PEGylation were observed for secretion of proinflammatory cytokines, IL-6, IL-12, TNF-α, IL-1β and type 1 interferon, as well for B cell proliferation. In summary, these studies demonstrate that conjugation of PEG chains to a synthetic TLR ligand can impact its potency for cytokine induction depending on the size of the PEG moiety. Thus, PEGylation may be a feasible approach to regulate the pharmacological properties of TLR7 ligands. PMID:21338093
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Dalei; Su, Xiaoyu; Potluri, Nalini
Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less
Wu, Dalei; Su, Xiaoyu; Potluri, Nalini; ...
2016-10-26
Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less
NASA Astrophysics Data System (ADS)
Li, Long; Hu, Jinglei; Xu, Guangkui; Song, Fan
2018-01-01
Cell-cell adhesion and the adhesion of cells to tissues and extracellular matrix, which are pivotal for immune response, tissue development, and cell locomotion, depend sensitively on the binding constant of receptor and ligand molecules anchored on the apposing surfaces. An important question remains of whether the immobilization of ligands affects the affinity of binding with cell adhesion receptors. We have investigated the adhesion of multicomponent membranes to a flat substrate coated with immobile ligands using Monte Carlo simulations of a statistical mesoscopic model with biologically relevant parameters. We find that the binding of the adhesion receptors to ligands immobilized on the substrate is strongly affected by the ligand distribution. In the case of ligand clusters, the receptor-ligand binding constant can be significantly enhanced due to the less translational entropy loss of lipid-raft domains in the model cell membranes upon the formation of additional complexes. For ligands randomly or uniformly immobilized on the substrate, the binding constant is rather decreased since the receptors localized in lipid-raft domains have to pay an energetic penalty in order to bind ligands. Our findings help to understand why cell-substrate adhesion experiments for measuring the impact of lipid rafts on the receptor-ligand interactions led to contradictory results.
Hwang, Janice J.; Wei, Jeffrey; Abbara, Suhny; Grinspoon, Steven K.; Lo, Janet
2013-01-01
HIV-infected individuals have an increased prevalence of coronary artery disease (CAD). Receptor activator of nuclear factor kappa β ligand (RANKL) and osteoprotegerin (OPG) have been postulated as mediators of vascular calcification. 78 HIV-infected men and 32 healthy controls without history of CAD were prospectively recruited to undergo cardiac computed tomography (CT) and CT angiography to assess coronary artery calcium and plaque burden. sRANKL was lower in HIV-infected individuals than controls (2.52 [1.08, 3.98] vs. 3.33 [2.44, 4.64] pg/ml, P=0.01, median [IQR] respectively). sRANKL was negatively associated with the number of coronary segments with plaque (Spearman ρ=−0.41, P<0.001) and Agatston calcium score (ρ=−0.30, P<0.01) in HIV-infected individuals even after adjusting for traditional cardiovascular risk factors. PMID:22842843
Engle, Keary M.; Yu, Jin-Quan
2013-01-01
Homogeneous transition metal–catalyzed reactions are indispensable to all facets of modern chemical synthesis. It is thus difficult to imagine that for much of the early 20th century, the reactivity and selectivity of all known homogeneous metal catalysts paled in comparison to their heterogeneous and biological counterparts. In the intervening decades, advances in ligand design bridged this divide, such that today some of the most demanding bond-forming events are mediated by ligand-supported homogeneous metal species. While ligand design has propelled many areas of homogeneous catalysis, in the field of Pd(II)-catalyzed C–H functionalization, suitable ligand scaffolds are lacking, which has hampered the development of broadly practical transformations based on C–H functionalization logic. In this review, we offer an account of our research employing three ligand scaffolds, mono-N-protected amino acids, 2,6-disubstituted pyridines, and 2,2′-bipyridines, to address challenges posed by several synthetically versatile substrate classes. Drawing on this work, we discuss principles of ligand design, such as the need to match a ligand to a particular substrate class, and how ligand traits such as tunability and modularity can be advantageous in reaction discovery. PMID:23565982
Macher-Goeppinger, Stephan; Aulmann, Sebastian; Tagscherer, Katrin E; Wagener, Nina; Haferkamp, Axel; Penzel, Roland; Brauckhoff, Antje; Hohenfellner, Markus; Sykora, Jaromir; Walczak, Henning; Teh, Bin T; Autschbach, Frank; Herpel, Esther; Schirmacher, Peter; Roth, Wilfried
2009-01-15
The death ligand tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and its receptors (TRAIL-R) are involved in immune surveillance and tumor development. Here, we studied a possible association between the expression of TRAIL/TRAIL-Rs and the prognosis in patients with renal cell carcinomas (RCC). A tissue microarray containing RCC tumor tissue samples and corresponding normal tissue samples from 838 patients was generated. Expression of TRAIL and TRAIL-Rs was examined by immunohistochemistry and the effect of TRAIL and TRAIL-R expression on disease-specific survival was assessed. High TRAIL-R2 expression levels were associated with high-grade RCCs (P < 0.001) and correlated negatively with disease-specific survival (P = 0.01). Similarly, high TRAIL expression was associated with a shorter disease-specific survival (P = 0.01). In contrast, low TRAIL-R4 expression was associated with high-stage RCCs (P < 0.001) as well as with the incidence of distant metastasis (P = 0.03) and correlated negatively with disease-specific survival (P = 0.02). In patients without distant metastasis, multivariate Cox regression analyses revealed that TRAIL-R2 and TRAIL are independent prognostic factors for cancer-specific survival (in addition to tumor extent, regional lymph node metastasis, grade of malignancy, and type of surgery). High TRAIL-R2, high TRAIL, and low TRAIL-R4 expression levels are associated with a worse disease-specific survival in patients with RCCs. Therefore, the assessment of TRAIL/TRAIL-R expression offers valuable prognostic information that could be used to select patients for adjuvant therapy studies. Moreover, our findings are of relevance for a potential experimental therapeutic administration of TRAIL-R agonists in patients with RCCs.
Optical and electronic properties of self-assembled nanoparticle-ligand metasurfaces
NASA Astrophysics Data System (ADS)
Fontana, Jake; Livenere, John; Caldwell, Joshua; Spillmann, Christopher; Naciri, Jawad; Rendell, Ronald; Ratna, Banahalli
2013-03-01
The optical and electronic properties of inorganic nanoparticles organized into two-dimensional lattices sensitively depend on the properties of the organic ligand shell coating the nanoparticles. We study the optical and electronic properties of these two-dimensional metasurfaces consisting of gold nanoparticles functionalized with ligands and self-assembled into macroscopic monolayers on non-templated substrates. Using these metasurfaces we demonstrate an average surface-enhanced Raman scattering (SERS) enhancement factor on the order of 108 for benzenethiol ligands and study the mechanisms that influence the enhancement. These metasurfaces may provide a platform for the development of low-power, low-cost next-generation chem/bio-sensors and new insights into the organic-inorganic interface at the nanoscale. This work was supported with funding provided from the Office of Naval Research
Ligand-biased ensemble receptor docking (LigBEnD): a hybrid ligand/receptor structure-based approach
NASA Astrophysics Data System (ADS)
Lam, Polo C.-H.; Abagyan, Ruben; Totrov, Maxim
2018-01-01
Ligand docking to flexible protein molecules can be efficiently carried out through ensemble docking to multiple protein conformations, either from experimental X-ray structures or from in silico simulations. The success of ensemble docking often requires the careful selection of complementary protein conformations, through docking and scoring of known co-crystallized ligands. False positives, in which a ligand in a wrong pose achieves a better docking score than that of native pose, arise as additional protein conformations are added. In the current study, we developed a new ligand-biased ensemble receptor docking method and composite scoring function which combine the use of ligand-based atomic property field (APF) method with receptor structure-based docking. This method helps us to correctly dock 30 out of 36 ligands presented by the D3R docking challenge. For the six mis-docked ligands, the cognate receptor structures prove to be too different from the 40 available experimental Pocketome conformations used for docking and could be identified only by receptor sampling beyond experimentally explored conformational subspace.
Tentori, Lucio; Scimeca, Manuel; Dorio, Annalisa S.; Atzori, Maria Grazia; Failla, Cristina M.; Morea, Veronica; Bonanno, Elena; D'Atri, Stefania; Lacal, Pedro M.
2016-01-01
Vascular endothelial growth factor receptor-1 (VEGFR-1) is a tyrosine kinase transmembrane receptor that has also a soluble isoform containing most of the extracellular ligand binding domain (sVEGFR-1). VEGF-A binds to both VEGFR-2 and VEGFR-1, whereas placenta growth factor (PlGF) interacts exclusively with VEGFR-1. In this study we generated an anti-VEGFR-1 mAb (D16F7) by immunizing BALB/C mice with a peptide that we had previously reported to inhibit angiogenesis and endothelial cell migration induced by PlGF. D16F7 did not affect binding of VEGF-A or PlGF to VEGFR-1, thus allowing sVEGFR-1 to act as decoy receptor for these growth factors, but it hampered receptor homodimerization and activation. D16F7 inhibited both the chemotactic response of human endothelial, myelomonocytic and melanoma cells to VEGFR-1 ligands and vasculogenic mimicry by tumor cells. Moreover, D16F7 exerted in vivo antiangiogenic effects in a matrigel plug assay. Importantly, D16F7 inhibited tumor growth and was well tolerated by B6D2F1 mice injected with syngeneic B16F10 melanoma cells. The antitumor effect was associated with melanoma cell apoptosis, vascular abnormalities and decrease of both monocyte/macrophage infiltration and myeloid progenitor mobilization. For all the above, D16F7 may be exploited in the therapy of metastatic melanoma and other tumors or pathological conditions involving VEGFR-1 activation. PMID:27655684
Modular scanning FCS quantifies receptor-ligand interactions in living multicellular organisms.
Ries, Jonas; Yu, Shuizi Rachel; Burkhardt, Markus; Brand, Michael; Schwille, Petra
2009-09-01
Analysis of receptor-ligand interactions in vivo is key to biology but poses a considerable challenge to quantitative microscopy. Here we combine static-volume, two-focus and dual-color scanning fluorescence correlation spectroscopy to solve this task at cellular resolution in complex biological environments. We quantified the mobility of fibroblast growth factor receptors Fgfr1 and Fgfr4 in cell membranes of living zebrafish embryos and determined their in vivo binding affinities to their ligand Fgf8.
Sharma, Sonia; Grandvaux, Nathalie; Mamane, Yael; Genin, Pierre; Azimi, Nazli; Waldmann, Thomas; Hiscott, John
2002-09-15
IFN regulatory factor (IRF)-4 is a lymphoid/myeloid-restricted member of the IRF transcription factor family that plays an essential role in the homeostasis and function of mature lymphocytes. IRF-4 expression is tightly regulated in resting primary T cells and is transiently induced at the mRNA and protein levels after activation by Ag-mimetic stimuli such as TCR cross-linking or treatment with phorbol ester and calcium ionophore (PMA/ionomycin). However, IRF-4 is constitutively upregulated in human T cell leukemia virus type I (HTLV-I) infected T cells as a direct gene target for the HTLV-I Tax oncoprotein. In this study we demonstrate that chronic IRF-4 expression in HTLV-I-infected T lymphocytes is associated with a leukemic phenotype, and we examine the mechanisms by which continuous production of IRF-4 is achieved in HTLV-I-transformed T cells. IRF-4 expression in HTLV-1-infected cells is driven through activation of the NF-kappaB and NF-AT pathways, resulting in the binding of p50, p65, and c-Rel to the kappaB1 element and p50, c-Rel, and NF-ATp to the CD28RE element within the -617 to -209 region of the IRF-4 promoter. Furthermore, mutation of either the kappaB1 or CD28RE sites blocks Tax-mediated transactivation of the human IRF-4 promoter in T cells. These experiments constitute the first detailed analysis of human IRF-4 transcriptional regulation within the context of HTLV-I infection and transformation of CD4(+) T lymphocytes.
NASA Astrophysics Data System (ADS)
Chau, P.-L.; Dean, P. M.
1994-10-01
Electrostatic interactions have always been considered an important factor governing ligand-receptor interactions. Previous work in this field has established the existence of electrostatic complementarity between the ligand and its receptor site. However, this property has not been treated rigorously, and the description remains largely qualitative. In this work, 34 data sets of high quality were chosen from the Brookhaven Protein Databank. The electrostatic complementarity has been calculated between the surface potentials; complementarity is absent between adjacent or neighbouring atoms of the ligand and the receptor. There is little difference between complementarities on the total ligand surface and the interfacial region. Altering the homogeneous dielectric to distance-dependent dielectrics reduces the complementarity slightly, but does not affect the pattern of complementarity.
Chau, P L; Dean, P M
1994-10-01
Electrostatic interactions have always been considered an important factor governing ligand-receptor interactions. Previous work in this field has established the existence of electrostatic complementarity between the ligand and its receptor site. However, this property has not been treated rigorously, and the description remains largely qualitative. In this work, 34 data sets of high quality were chosen from the Brookhaven Protein Databank. The electrostatic complementary has been calculated between the surface potentials; complementarity is absent between adjacent or neighbouring atoms of the ligand and the receptor. There is little difference between complementarities on the total ligand surface and the interfacial region. Altering the homogeneous dielectric to distance-dependent dielectrics reduces the complementarity slightly, but does not affect the pattern of complementarity.
Activin receptor ligand traps in chronic kidney disease.
Jelkmann, Wolfgang
2018-05-29
Sotatercept and luspatercept are recombinant soluble activin type-II receptor-IgG-Fc fusion proteins that are tested in clinical trials for the treatment of various types of anemias, including renal anemia. The mechanism of the action of the novel drugs is incompletely understood, but it seems to be based on the inactivation of soluble proteins of the transforming growth factor-ß (TGFß) family. This review considers pros and cons of the clinical use of the drugs in reference to the current therapy with recombinant erythropoiesis-stimulating agents (ESAs). One or more activin type-II receptor (ActRII) ligands appear to inhibit erythroid precursors, for example growth and differentiation factor 11. Trapping of these ligands by the recombinant ActRII fusion proteins, sotatercept and luspatercept increases red blood cell numbers and hemoglobin levels in humans. Reportedly, the novel compounds were well tolerated in trials on healthy volunteers and patients suffering from anemia due to chronic kidney disease or malignancies. On approval, the drugs may prove particularly useful in patients suffering from ineffective erythropoiesis, such as in myelodysplastic syndrome, multiple myeloma or ß-thalassemia, where ESAs are of little use. Independent of their effect on erythropoiesis, ActRII ligand traps were found to exert beneficial effects on renal tissue in experimental animals. ESAs are likely to remain standard of care in renal anemia. There is a need for a better understanding of the effects of ActRII ligand traps on TGFß-like proteins. The novel drugs have not been approved for sale as therapeutics so far. Their long-term efficacy and safety still needs to be proven, particularly with respect to immunogenicity. Antifibrotic effects may be worthy to be investigated in humans.
Zhang, Huijing; Yu, Hui; Zhao, Xi; Liu, Xiaoguang; Feng, Xianli; Huang, Xuri
2017-05-01
Takeout (To) proteins exist in a diverse range of insect species. They are involved in many important processes of insect physiology and behaviors. As the ligand carriers, To proteins can transport the small molecule to the target tissues. However, ligand release mechanism of To proteins is unclear so far. In this contribution, the process and pathway of the ligand binding and release are revealed by conventional molecular dynamics simulation, steered molecular dynamics simulation and umbrella sampling methods. Our results show that the α4-side of the protein is the unique gate for the ligand binding and release. The structural analysis confirms that the internal cavity of the protein has high rigidity, which is in accordance with the recent experimental results. By using the potential of mean force calculations in combination with residue cross correlation calculation, we concluded that the binding between the ligand and To proteins is a process of conformational selection. Furthermore, the conformational changes of To proteins and the hydrophobic interactions both are the key factors for ligand binding and release.
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Xu, Weijun; Lucke, Andrew J; Fairlie, David P
2015-04-01
Accurately predicting relative binding affinities and biological potencies for ligands that interact with proteins remains a significant challenge for computational chemists. Most evaluations of docking and scoring algorithms have focused on enhancing ligand affinity for a protein by optimizing docking poses and enrichment factors during virtual screening. However, there is still relatively limited information on the accuracy of commercially available docking and scoring software programs for correctly predicting binding affinities and biological activities of structurally related inhibitors of different enzyme classes. Presented here is a comparative evaluation of eight molecular docking programs (Autodock Vina, Fitted, FlexX, Fred, Glide, GOLD, LibDock, MolDock) using sixteen docking and scoring functions to predict the rank-order activity of different ligand series for six pharmacologically important protein and enzyme targets (Factor Xa, Cdk2 kinase, Aurora A kinase, COX-2, pla2g2a, β Estrogen receptor). Use of Fitted gave an excellent correlation (Pearson 0.86, Spearman 0.91) between predicted and experimental binding only for Cdk2 kinase inhibitors. FlexX and GOLDScore produced good correlations (Pearson>0.6) for hydrophilic targets such as Factor Xa, Cdk2 kinase and Aurora A kinase. By contrast, pla2g2a and COX-2 emerged as difficult targets for scoring functions to predict ligand activities. Although possessing a high hydrophobicity in its binding site, β Estrogen receptor produced reasonable correlations using LibDock (Pearson 0.75, Spearman 0.68). These findings can assist medicinal chemists to better match scoring functions with ligand-target systems for hit-to-lead optimization using computer-aided drug design approaches. Copyright © 2015 Elsevier Inc. All rights reserved.
Biosensors engineered from conditionally stable ligand-binding domains
Church, George M.; Feng, Justin; Mandell, Daniel J.; Baker, David; Fields, Stanley; Jester, Benjamin Ward; Tinberg, Christine Elaine
2017-09-19
Disclosed is a biosensor engineered to conditionally respond to the presence of specific small molecules, the biosensors including conditionally stable ligand-binding domains (LBDs) which respond to the presence of specific small molecules, wherein readout of binding is provided by reporter genes or transcription factors (TFs) fused to the LBDs.
NASA Astrophysics Data System (ADS)
Zhang, Yixuan; Deng, Lu; Kitova, Elena N.; Klassen, John S.
2013-10-01
The results of collision-induced dissociation (CID) experiments performed on gaseous protonated and deprotonated ions of complexes of cholera toxin B subunit homopentamer (CTB5) with the pentasaccharide (β-D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β-D-Gal p-(1→4)-β-D-Glc p (GM1)) and corresponding glycosphingolipid (β-D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β-D-Gal p-(1→4)-β-D-Glc p-Cer (GM1-Cer)) ligands, and the homotetramer streptavidin (S4) with biotin (B) and 1,2-dipalmitoyl- sn-glycero-3-phosphoethanolamine-N-(biotinyl) (Btl), are reported. The protonated (CTB5 + 5GM1)n+ ions dissociated predominantly by the loss of a single subunit, with the concomitant migration of ligand to another subunit. The simultaneous loss of ligand and subunit was observed as a minor pathway. In contrast, the deprotonated (CTB5 + 5GM1)n- ions dissociated preferentially by the loss of deprotonated ligand; the loss of ligand-bound and ligand-free subunit were minor pathways. The presence of ceramide (Cer) promoted ligand migration and the loss of subunit. The main dissociation pathway for the protonated and deprotonated (S4 + 4B)n+/- ions, as well as for deprotonated (S4 + 4Btl)n- ions, was loss of the ligand. However, subunit loss from the (S4 + 4B)n+ ions was observed as a minor pathway. The (S4 + 4Btl)n+ ions dissociated predominantly by the loss of free and ligand-bound subunit. The charge state of the complex and the collision energy were found to have little effect on the relative contribution of the different dissociation channels. Thermally-driven ligand migration between subunits was captured in the results of molecular dynamics simulations performed on protonated (CTB5 + 5GM1)15+ ions (with a range of charge configurations) at 800 K. Notably, the migration pathway was found to be highly dependent on the charge configuration of the ion. The main conclusion of this study is that the dissociation pathways of multisubunit protein-ligand
Classification of ligand molecules in PDB with graph match-based structural superposition.
Shionyu-Mitsuyama, Clara; Hijikata, Atsushi; Tsuji, Toshiyuki; Shirai, Tsuyoshi
2016-12-01
The fast heuristic graph match algorithm for small molecules, COMPLIG, was improved by adding a structural superposition process to verify the atom-atom matching. The modified method was used to classify the small molecule ligands in the Protein Data Bank (PDB) by their three-dimensional structures, and 16,660 types of ligands in the PDB were classified into 7561 clusters. In contrast, a classification by a previous method (without structure superposition) generated 3371 clusters from the same ligand set. The characteristic feature in the current classification system is the increased number of singleton clusters, which contained only one ligand molecule in a cluster. Inspections of the singletons in the current classification system but not in the previous one implied that the major factors for the isolation were differences in chirality, cyclic conformations, separation of substructures, and bond length. Comparisons between current and previous classification systems revealed that the superposition-based classification was effective in clustering functionally related ligands, such as drugs targeted to specific biological processes, owing to the strictness of the atom-atom matching.
Macdonald-Obermann, Jennifer L.; Pike, Linda J.
2014-01-01
The EGF receptor has seven different cognate ligands. Previous work has shown that these different ligands are capable of inducing different biological effects, even in the same cell. To begin to understand the molecular basis for this variation, we used luciferase fragment complementation to measure ligand-induced dimer formation and radioligand binding to study the effect of the ligands on subunit-subunit interactions in EGF receptor (EGFR) homodimers and EGFR/ErbB2 heterodimers. In luciferase fragment complementation imaging studies, amphiregulin (AREG) functioned as a partial agonist, inducing only about half as much total dimerization as the other three ligands. However, unlike the other ligands, AREG showed biphasic kinetics for dimer formation, suggesting that its path for EGF receptor activation involves binding to both monomers and preformed dimers. EGF, TGFα, and betacellulin (BTC) appear to mainly stimulate receptor activation through binding to and dimerization of receptor monomers. In radioligand binding assays, EGF and TGFα exhibited increased affinity for EGFR/ErbB2 heterodimers compared with EGFR homodimers. By contrast, BTC and AREG showed a similar affinity for both dimers. Thus, EGF and TGFα are biased agonists, whereas BTC and AREG are balanced agonists with respect to selectivity of dimer formation. These data suggest that the differences in biological response to different EGF receptor ligands may result from partial agonism for dimer formation, differences in the kinetic pathway utilized to generate activated receptor dimers, and biases in the formation of heterodimers versus homodimers. PMID:25086039
Ligand-induced Epitope Masking
Mould, A. Paul; Askari, Janet A.; Byron, Adam; Takada, Yoshikazu; Jowitt, Thomas A.; Humphries, Martin J.
2016-01-01
We previously demonstrated that Arg-Gly-Asp (RGD)-containing ligand-mimetic inhibitors of integrins are unable to dissociate pre-formed integrin-fibronectin complexes (IFCs). These observations suggested that amino acid residues involved in integrin-fibronectin binding become obscured in the ligand-occupied state. Because the epitopes of some function-blocking anti-integrin monoclonal antibodies (mAbs) lie near the ligand-binding pocket, it follows that the epitopes of these mAbs may become shielded in the ligand-occupied state. Here, we tested whether function-blocking mAbs directed against α5β1 can interact with the integrin after it forms a complex with an RGD-containing fragment of fibronectin. We showed that the anti-α5 subunit mAbs JBS5, SNAKA52, 16, and P1D6 failed to disrupt IFCs and hence appeared unable to bind to the ligand-occupied state. In contrast, the allosteric anti-β1 subunit mAbs 13, 4B4, and AIIB2 could dissociate IFCs and therefore were able to interact with the ligand-bound state. However, another class of function-blocking anti-β1 mAbs, exemplified by Lia1/2, could not disrupt IFCs. This second class of mAbs was also distinguished from 13, 4B4, and AIIB2 by their ability to induce homotypic cell aggregation. Although the epitope of Lia1/2 was closely overlapping with those of 13, 4B4, and AIIB2, it appeared to lie closer to the ligand-binding pocket. A new model of the α5β1-fibronectin complex supports our hypothesis that the epitopes of mAbs that fail to bind to the ligand-occupied state lie within, or very close to, the integrin-fibronectin interface. Importantly, our findings imply that the efficacy of some therapeutic anti-integrin mAbs could be limited by epitope masking. PMID:27484800
Ping, Zichuan; Hu, Xuanyang; Wang, Liangliang; Shi, Jiawei; Tao, Yunxia; Wu, Xiexing; Hou, Zhenyang; Guo, Xiaobin; Zhang, Wen; Yang, Huilin; Xu, Yaozeng; Wang, Zhirong; Geng, Dechun
2017-03-15
Wear debris-induced inhibition of bone regeneration and extensive bone resorption were common features in peri-prosthetic osteolysis (PPO). Here, we investigated the effect of melatonin on titanium particle-stimulated osteolysis in a murine calvariae model and mouse-mesenchymal-stem cells (mMSCs) culture system. Melatonin inhibited titanium particle-induced osteolysis and increased bone formation at osteolytic sites, confirmed by radiological and histomorphometric data. Furthermore, osteoclast numbers decreased dramatically in the low- and high-melatonin administration mice, as respectively, compared with the untreated animals. Melatonin alleviated titanium particle-induced depression of osteoblastic differentiation and mineralization in mMSCs. Mechanistically, melatonin was found to reduce the degradation of β-catenin, levels of which were decreased in presence of titanium particles both in vivo and in vitro. To further ensure whether the protective effect of melatonin was mediated by the Wnt/β-catenin signaling pathway, ICG-001, a selective β-catenin inhibitor, was added to the melatonin-treated groups and was found to attenuate the effect of melatonin on mMSC mineralization. We also demonstrated that melatonin modulated the balance between receptor activator of nuclear factor kappa-B ligand and osteoprotegerin via activation of Wnt/β-catenin signaling pathway. These findings strongly suggest that melatonin represents a promising candidate in the treatment of PPO. Peri-prosthetic osteolysis, initiated by wear debris-induced inhibition of bone regeneration and extensive bone resorption, is the leading cause for implant failure and reason for revision surgery. In the current study, we demonstrated for the first time that melatonin can induce bone regeneration and reduce bone resorption at osteolytic sites caused by titanium-particle stimulation. These effects might be mediated by activating Wnt/β-catenin signaling pathway and enhancing osteogenic
Quantum.Ligand.Dock: protein-ligand docking with quantum entanglement refinement on a GPU system.
Kantardjiev, Alexander A
2012-07-01
Quantum.Ligand.Dock (protein-ligand docking with graphic processing unit (GPU) quantum entanglement refinement on a GPU system) is an original modern method for in silico prediction of protein-ligand interactions via high-performance docking code. The main flavour of our approach is a combination of fast search with a special account for overlooked physical interactions. On the one hand, we take care of self-consistency and proton equilibria mutual effects of docking partners. On the other hand, Quantum.Ligand.Dock is the the only docking server offering such a subtle supplement to protein docking algorithms as quantum entanglement contributions. The motivation for development and proposition of the method to the community hinges upon two arguments-the fundamental importance of quantum entanglement contribution in molecular interaction and the realistic possibility to implement it by the availability of supercomputing power. The implementation of sophisticated quantum methods is made possible by parallelization at several bottlenecks on a GPU supercomputer. The high-performance implementation will be of use for large-scale virtual screening projects, structural bioinformatics, systems biology and fundamental research in understanding protein-ligand recognition. The design of the interface is focused on feasibility and ease of use. Protein and ligand molecule structures are supposed to be submitted as atomic coordinate files in PDB format. A customization section is offered for addition of user-specified charges, extra ionogenic groups with intrinsic pK(a) values or fixed ions. Final predicted complexes are ranked according to obtained scores and provided in PDB format as well as interactive visualization in a molecular viewer. Quantum.Ligand.Dock server can be accessed at http://87.116.85.141/LigandDock.html.
Duarte, Gabriel M; Braun, Jason D; Giesbrecht, Patrick K; Herbert, David E
2017-12-21
Diiminepyridines are a well-known class of "non-innocent" ligands that confer additional redox activity to coordination complexes beyond metal-centred oxidation/reduction. Here, we demonstrate that metal coordination complexes (MCCs) of diiminepyridine (DIP) ligands with iron are suitable anolytes for redox-flow battery applications, with enhanced capacitance and stability compared with bipyridine analogs, and access to storage of up to 1.6 electron equivalents. Substitution of the ligand is shown to be a key factor in the cycling stability and performance of MCCs based on DIP ligands, opening the door to further optimization.
Non-conventional Frizzled ligands and Wnt receptors.
Hendrickx, Marijke; Leyns, Luc
2008-05-01
The Wnt family of secreted signaling factors plays numerous roles in embryonic development and in stem cell biology. In the adult, Wnt signaling is involved in tissue homeostasis and mutations that lead to the overexpression of Wnt can be linked to cancer. Wnt signaling is transduced intracellularly by the Frizzled (Fzd) family of receptors. In the canonical pathway, accumulation of beta-catenin and the subsequent formation of a complex with T cell factors (TCF) or lymphoid enhancing factors (Lef) lead to target gene activation. The identification of Ryk as an alternative Wnt receptor and the discovery of the novel Fzd ligands Norrie disease protein (NDP) and R-Spondin, changed the traditional view of Wnts binding to Fzd receptors. Mouse R-Spondin cooperates with Wnt signaling and Low density lipoprotein (LDL) receptor related protein (LRP) to activate beta-catenin dependent gene expression and is involved in processes such as limb and placental development in the mouse. NDP is the product of the Norrie disease gene and controls vascular development in the retina, inner ear and in the female reproductive system during pregnancy. In this review a functional overview of the interactions of the different Wnt and non-Wnt ligands with the Fzd receptors is given as well as a survey of Wnts binding to Ryk and we discuss the biological significance of these interactions.
Eleutherakis-Papaiakovou, Evangelos; Kastritis, Efstathios; Gavriatopoulou, Maria; Christoulas, Dimitrios; Roussou, Maria; Ntanasis-Stathopoulos, Ioannis; Kanellias, Nikolaos; Papatheodorou, Athanasios; Dimopoulos, Meletios A; Terpos, Evangelos
2018-06-01
Serum receptor activator of nuclear factor κB ligand (sRANKL) and chemokine (C-C) motif ligand 3 (CCL-3) have been reported to be elevated in Waldenström macroglobulinemia (WM) patients. However, there are no published data regarding the prognostic value of these molecules in WM regarding progression-free and overall survival. To evaluate the effect of these markers of bone remodeling on survival parameters, we prospectively evaluated serum cytokines and biological markers in 55 patients with symptomatic WM before they received any kind of treatment. Serum levels of CCL-3 and bone remodeling markers were also evaluated in asymptomatic WM and IgM monoclonal gammopathy of undetermined significance. Furthermore, we assessed bone marrow biopsy samples from newly diagnosed WM patients for CCL-3 and RANKL expression. High circulating sRANKL values predicted shorter median overall survival (46 months vs. not reached, P = .025). High serum levels of CCL-3 predicted shorter median progression-free survival (27 months vs. not reached, P = .048). At bone marrow biopsy evaluation, the whole number of the neoplastic cells revealed strong cytoplasmic positivity for CCL-3, while the neoplastic clone did not express RANKL. We conclude that WM cells produce CCL-3 and possibly enhance the production of RANKL in the bone microenvironment. The correlation of sRANKL and CCL-3 with survival reveals the importance of these cytokines in disease biology and highlights the significance of the interactions between WM and stromal cells for the development of WM. Finally, these findings provide the rationale for the use of anti-RANKL and anti-CCL-3 drugs in animal models of WM before their clinical evaluation. Copyright © 2018 Elsevier Inc. All rights reserved.
Chen, Xiaojie; Tieleman, D Peter; Liang, Qing
2018-02-01
The interactions between nanoparticles and lipid bilayers are critical in applications of nanoparticles in nanomedicine, cell imaging, toxicology, and elsewhere. Here, we investigate the interactions between nanoparticles coated with neutral and/or charged ligands and phase-separated lipid bilayers using coarse-grained molecular dynamics simulation. Both penetration and adsorption processes as well as the final distribution of the nanoparticles can be readily modulated by varying the ligand density and the surface charge of the nanoparticles. Completely hydrophobic (neutral) nanoparticles with larger size initially preferentially penetrate into the liquid-disordered region of the lipid bilayer and finally transfer into the liquid-ordered region; partially hydrophilic nanoparticles with low or moderate surface charge tend to either distribute in the liquid-disordered region or be adsorbed on the surface of the lipid bilayer, while strongly hydrophilic nanoparticles with high surface charge always reside on the surface of the lipid bilayer. Interactions of the nanoparticles with the lipid bilayers are affected by the surface charge of nanoparticles, hydrophobic mismatch, bending of the ligands, and the packing state of the lipids. Insight in these factors can be used to improve the efficiency of designing nanoparticles for specific applications.
Amino acid ionic liquids as chiral ligands in ligand-exchange chiral separations.
Liu, Qian; Wu, Kangkang; Tang, Fei; Yao, Lihua; Yang, Fei; Nie, Zhou; Yao, Shouzhuo
2009-09-28
Recently, amino acid ionic liquids (AAILs) have attracted much research interest. In this paper, we present the first application of AAILs in chiral separation based on the chiral ligand exchange principle. By using 1-alkyl-3-methylimidazolium L-proline (L-Pro) as a chiral ligand coordinated with copper(II), four pairs of underivatized amino acid enantiomers-dl-phenylalanine (dl-Phe), dl-histidine (dl-His), dl-tryptophane (dl-Trp), and dl-tyrosine (dl-Tyr)-were successfully separated in two major chiral separation techniques, HPLC and capillary electrophoresis (CE), with higher enantioselectivity than conventionally used amino acid ligands (resolution (R(s))=3.26-10.81 for HPLC; R(s)=1.34-4.27 for CE). Interestingly, increasing the alkyl chain length of the AAIL cation remarkably enhanced the enantioselectivity. It was inferred that the alkylmethylimidazolium cations and L-Pro form ion pairs on the surface of the stationary phase or on the inner surface of the capillary. The ternary copper complexes with L-Pro are consequently attached to the support surface, thus inducing an ion-exchange type of retention for the dl-enantiomers. Therefore, the AAIL cation plays an essential role in the separation. This work demonstrates that AAILs are good alternatives to conventional amino acid ligands for ligand-exchange-based chiral separation. It also reveals the tremendous application potential of this new type of task-specific ILs.
Kanatli, Irem; Akkaya, Bahar; Uysal, Hilmi; Kahraman, Sevim; Sanlioglu, Ahter Dilsad
2017-02-01
Myasthenia Gravis is an autoantibody-mediated, neuromuscular junction disease, and is usually associated with thymic abnormalities presented as thymic tumors (~10%) or hyperplastic thymus (~65%). The exact role of thymus in Myasthenia Gravis development is not clear, yet many patients benefit from thymectomy. The apoptotic ligand TNF-Related Apoptosis-Inducing Ligand is thought to be involved in the regulation of thymocyte counts, although conflicting results are reported. We investigated differential expression profiles of TNF-Related Apoptosis-Inducing Ligand and its transmembrane receptors, Nuclear Factor-kB activation status, and apoptotic cell counts in healthy thymic tissue and pathological thymus from Myasthenia Gravis patients. All tissues expressed TNF-Related Apoptosis-Inducing Ligand and its receptors, with hyperplastic tissue having the highest expression levels of death receptors DR4 and DR5. No detectable Nuclear Factor-kB activation, at least via the canonical Protein Kinase A-mediated p65 Ser276 phosphorylation, was evident in any of the tissues studied. Apoptotic cell counts were higher in MG-associated tissue compared to the normal thymus. Possible use of the TNF-Related Apoptosis-Inducing Ligand within the concept of an apoptotic ligand-mediated medical thymectomy in thymoma- or thymic hyperplasia-associated Myasthenia Gravis is also discussed. Copyright © 2016 Elsevier B.V. All rights reserved.
A Guided Inquiry Activity for Teaching Ligand Field Theory
ERIC Educational Resources Information Center
Johnson, Brian J.; Graham, Kate J.
2015-01-01
This paper will describe a guided inquiry activity for teaching ligand field theory. Previous research suggests the guided inquiry approach is highly effective for student learning. This activity familiarizes students with the key concepts of molecular orbital theory applied to coordination complexes. Students will learn to identify factors that…
Size-Dependency of the Surface Ligand Density of Liposomes Prepared by Post-insertion.
Lee, Shang-Hsuan; Sato, Yusuke; Hyodo, Mamoru; Harashima, Hideyoshi
2017-01-01
In the active targeting of a drug delivery system (DDS), the density of the ligand on the functionalized liposome determines its affinity for binding to the target. To evaluate these densities on the surface of different sized liposomes, 4 liposomes with various diameters (188, 137, 70, 40 nm) were prepared and their surfaces were modified with fluorescently labeled ligand-lipid conjugates by the post-insertion method. Each liposomal mixture was fractionated into a series of fractions using size exclusion chromatography (SEC), and the resulting liposome fractions were precisely analyzed and the surface ligand densities calculated. The data collected using this methodology indicate that the density of the ligand on a particle is greatly dependent on the size of the liposome. This, in turn, indicates that smaller liposomes (75-40 nm) tend to possess higher densities. For developing active targeting systems, size and the density of the ligands are two important and independent factors that can affect the efficiency of a system as it relates to medical use.
A python-based docking program utilizing a receptor bound ligand shape: PythDock.
Chung, Jae Yoon; Cho, Seung Joo; Hah, Jung-Mi
2011-09-01
PythDock is a heuristic docking program that uses Python programming language with a simple scoring function and a population based search engine. The scoring function considers electrostatic and dispersion/repulsion terms. The search engine utilizes a particle swarm optimization algorithm. A grid potential map is generated using the shape information of a bound ligand within the active site. Therefore, the searching area is more relevant to the ligand binding. To evaluate the docking performance of PythDock, two well-known docking programs (AutoDock and DOCK) were also used with the same data. The accuracy of docked results were measured by the difference of the ligand structure between x-ray structure, and docked pose, i.e., average root mean squared deviation values of the bound ligand were compared for fourteen protein-ligand complexes. Since the number of ligands' rotational flexibility is an important factor affecting the accuracy of a docking, the data set was chosen to have various degrees of flexibility. Although PythDock has a scoring function simpler than those of other programs (AutoDock and DOCK), our results showed that PythDock predicted more accurate poses than both AutoDock4.2 and DOCK6.2. This indicates that PythDock could be a useful tool to study ligand-receptor interactions and could also be beneficial in structure based drug design.
Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors.
Beckmann, M P; Cerretti, D P; Baum, P; Vanden Bos, T; James, L; Farrah, T; Kozlosky, C; Hollingsworth, T; Shilling, H; Maraskovsky, E
1994-01-01
A family of tyrosine kinase receptors related to the product of the eph gene has been described recently. One of these receptors, elk, has been shown to be expressed only in brain and testes. Using a direct expression cloning technique, a ligand for the elk receptor has been isolated by screening a human placenta cDNA library with a fusion protein containing the extracellular domain of the receptor. This isolated cDNA encodes a transmembrane protein. While the sequence of the ligand cDNA is unique, it is related to a previously described sequence known as B61. Northern blot analysis of human tissue mRNA showed that the elk ligand's mRNA is 3.5 kb long and is found in placenta, heart, lung, liver, skeletal muscle, kidney and pancreas. Southern blot analysis showed that the gene is highly conserved in a wide variety of species. Both elk ligand and B61 mRNAs are inducible by tumour necrosis factor in human umbilical vein endothelial cells. In addition, both proteins show promiscuity in binding to the elk and the related hek receptors. Since these two ligand sequences are similar, and since elk and hek are members of a larger family of eph-related receptor molecules, we refer to these ligands as LERKs (ligands for eph-related kinases). Images PMID:8070404
NASA Astrophysics Data System (ADS)
Anokhina, Ekaterina V.
Low-dimensional and open-framework materials containing transition metals have a wide range of applications in redox catalysis, solid-state batteries, and electronic and magnetic devices. This dissertation reports on research carried out with the goal to develop a strategy for the preparation of low-dimensional and open-framework materials using octahedral metal clusters as building blocks. Our approach takes its roots from crystal engineering principles where the desired framework topologies are achieved through building block design. The key idea of this work is to induce directional bonding preferences in the cluster units using a combination of ligands with a large difference in charge density. This investigation led to the preparation and characterization of a new family of niobium oxychloride cluster compounds with original structure types exhibiting 1ow-dimensional or open-framework character. Most of these materials have framework topologies unprecedented in compounds containing octahedral clusters. Comparative analysis of their structural features indicates that the novel cluster connectivity patterns in these systems are the result of complex interplay between the effects of anisotropic ligand arrangement in the cluster unit and optimization of ligand-counterion electrostatic interactions. The important role played by these factors sets niobium oxychloride systems apart from cluster compounds with one ligand type or statistical ligand distribution where the main structure-determining factor is the total number of ligands. These results provide a blueprint for expanding the ligand combination strategy to other transition metal cluster systems and for the future rational design of cluster-based materials.
An alternate binding site for PPARγ ligands
Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.
2014-01-01
PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063
Ligand regulation of a constitutively dimeric EGF receptor
NASA Astrophysics Data System (ADS)
Freed, Daniel M.; Alvarado, Diego; Lemmon, Mark A.
2015-06-01
Ligand-induced receptor dimerization has traditionally been viewed as the key event in transmembrane signalling by epidermal growth factor receptors (EGFRs). Here we show that the Caenorhabditis elegans EGFR orthologue LET-23 is constitutively dimeric, yet responds to its ligand LIN-3 without changing oligomerization state. SAXS and mutational analyses further reveal that the preformed dimer of the LET-23 extracellular region is mediated by its domain II dimerization arm and resembles other EGFR extracellular dimers seen in structural studies. Binding of LIN-3 induces only minor structural rearrangements in the LET-23 dimer to promote signalling. Our results therefore argue that EGFR can be regulated by allosteric changes within an existing receptor dimer--resembling signalling by insulin receptor family members, which share similar extracellular domain compositions but form covalent dimers.
Yu, Yizhi; Liu, Shuxun; Wang, Wenya; Song, Wengang; Zhang, Minghui; Zhang, Weiping; Qin, Zhihai; Cao, Xuetao
2002-07-01
Dendritic cells (DC) are potent antigen-presenting cells (APC) specialized in T-cell mediated immune responses, and also play critical roles in the homeostasis of T cells for controlling immune responses. In the present study, we demonstrated that during mouse bone-marrow-derived DC activation of ovalbumin (OVA)-specific Ia-kb-restricted T hybridoma cells, MF2.2D9 and OVA257-264-specific H-2kb-restricted RF33.70 T cells, respectively, both hybridomas undergo cell death, partially mediated via apoptotic ligand-tumour necrosis factor-alpha (TNF-alpha)-related apoptosis-inducing ligand (TRAIL). Lipopolysaccharide enhanced the cytotoxic effect on the two activated T hybridoma cells, which was correlated with up-regulation of TRAIL-expression on DC to some extent. The activation of caspase-3 in activated T hybridoma cells cocultured with DC contributed to the programmed cell death pathway T cells underwent. Therefore, our results show that activation-induced cell death of T hybridoma cells can be influenced by DC, suggesting that DC may be involved in elimination of activated T cells at the end of primary immune responses.
Mix-and-match: ligand-receptor pairs in stomatal development and beyond.
Torii, Keiko U
2012-12-01
Stomata are small valves on the plant epidermis balancing gas exchange and water loss. Stomata are formed according to positional cues. In Arabidopsis, two EPIDERMAL PATTERNING FACTOR (EPF) peptides, EPF1 and EPF2, are secreted from stomatal precursors enforcing proper stomatal patterning. Here, I review recent studies revealing the ligand-receptor pairs and revising the previously predicted relations between receptors specifying stomatal patterning: ERECTA-family and TOO MANY MOUTHS (TMM). Furthermore, EPF-LIKE9 (EPFL9/Stomagen) promotes stomatal differentiation from internal tissues. Two EPFL peptides specify inflorescence architecture, a process beyond stomatal development, as ligands for ERECTA. Thus, broadly expressed receptor kinases may regulate multiple developmental processes through perceiving different peptide ligands, each with a specialized expression pattern. TMM in the epidermis may fine-tune multiple EPF/EPFL signals to prevent signal interference. Copyright © 2012 Elsevier Ltd. All rights reserved.
Bolkun, Lukasz; Lemancewicz, Dorota; Piszcz, Jaroslaw; Moniuszko, Marcin; Bolkun-Skornicka, Urszula; Szkiladz, Malgorzata; Jablonska, Ewa; Kloczko, Janusz; Dzieciol, Janusz
2015-12-01
Tumour necrosis factor-alfa (TNF-α) is an inflammatory cytokine with a wide spectrum of biological activity, including angiogenesis. Tumour necrosis factor-related apoptosis inducing ligand (TRAIL), which belongs to the TNF family of proteins, plays a role in the regulation of vascular responses, but its effect on the formation of new blood vessels (angiogenesis) is unclear. We analysed TRAIL concentrations in parallel with pro-angiogenic cytokines in serum and their expression in trephine biopsy (TB) in 56 patients with newly diagnosed IgG MM and 24 healthy volunteers. The study showed statistically higher concentrations of TRAIL and TNF-α, as well as of VEGF and its receptor, in MM patients compared to healthy volunteers and patients in advanced stages of the disease. Furthermore, we observed a significant decrease in all studied pro-angiogenic cytokines and significant increase of TRAIL concentration after anti-angiogenic therapy, with meaningful differences between responders (at least partial remission) and patients with progression during the induction treatment. It was also established that TRAIL correlated statistically and negatively with pro-angiogenic cytokines such as VEGF with its receptor and expression of VEGF and syndecan-1 in TB. In summary, our data indicate that in MM patients, both clinical course and treatment responsiveness are associated with dynamic yet corresponding changes of levels of TRAIL parallel pro-angiogenic mediators such as VEGF with its receptor and expression of VEGF and syndecan-1 in TB. Copyright © 2014 John Wiley & Sons, Ltd.
NASA Astrophysics Data System (ADS)
Hua, Xiu-Ni; Qin, Lan; Yan, Xiao-Zhi; Yu, Lei; Xie, Yi-Xin; Han, Lei
2015-12-01
Hydrothermal reactions of N-auxiliary flexible exo-bidentate ligand 1,3-bis(4-pyridyl)propane (bpp) and carboxylates ligands naphthalene-2,6-dicarboxylic acid (2,6-H2ndc) or 4,4‧-(hydroxymethylene)dibenzoic acid (H2hmdb), in the presence of cadmium(II) salts have given rise to two novel metal-organic frameworks based on flexible ligands (FL-MOFs), namely, [Cd2(2,6-ndc)2(bpp)(DMF)]·2DMF (1) and [Cd3(hmdb)3(bpp)]·2DMF·2EtOH (2) (DMF=N,N-Dimethylformamide). Single-crystal X-ray diffraction analyses revealed that compound 1 exhibits a three-dimensional self-penetrating 6-connected framework based on dinuclear cluster second building unit. Compound 2 displays an infinite three-dimensional 'Lucky Clover' shape (2,10)-connected network based on the trinuclear cluster and V-shaped organic linkers. The flexible bpp ligand displays different conformations in 1 and 2, which are successfully controlled by size-matching mixed ligands during the self-assembly process.
Wang, Yanzhao; Wang, Zhixun; Li, Yuxue; Wu, Gongde; Cao, Zheng; Zhang, Liming
2014-04-07
Most homogenous gold catalyses demand ≥ 0.5 mol% catalyst loading. Owing to the high cost of gold, these reactions are unlikely to be applicable in medium- or large-scale applications. Here we disclose a novel ligand design based on the privileged (1,1'-biphenyl)-2-ylphosphine framework that offers a potentially general approach to dramatically lowering catalyst loading. In this design, an amide group at the 3'-position of the ligand framework directs and promotes nucleophilic attack at the ligand gold complex-activated alkyne, which is unprecedented in homogenous gold catalysis considering the spatial challenge of using ligand to reach anti-approaching nucleophile in a linear P-Au-alkyne centroid structure. With such a ligand, the gold(I) complex becomes highly efficient in catalysing acid addition to alkynes, with a turnover number up to 99,000. Density functional theory calculations support the role of the amide moiety in directing the attack of carboxylic acid via hydrogen bonding.
Wang, Yanzhao; Wang, Zhixun; Li, Yuxue; Wu, Gongde; Cao, Zheng; Zhang, Liming
2014-01-01
Most homogenous gold catalyses demand ≥0.5 mol % catalyst loading. Due to the high cost of gold, these reactions are unlikely to be applicable in medium or large scale applications. Here we disclose a novel ligand design based on the privileged biphenyl-2-phosphine framework that offers a potentially general approach to dramatically lowering catalyst loading. In this design, an amide group at the 3’ position of the ligand framework directs and promotes nucleophilic attack at the ligand gold complex-activated alkyne, which is unprecedented in homogeneous gold catalysis considering the spatial challenge of using ligand to reach antiapproaching nucleophile in a linear P-Au-alkyne centroid structure. With such a ligand, the gold(I) complex becomes highly efficient in catalyzing acid addition to alkynes, with a turnover number up to 99,000. Density functional theory calculations support the role of the amide moiety in directing the attack of carboxylic acid via hydrogen bonding. PMID:24704803
Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.
Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki
2012-06-01
DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.
Guidelines for the successful generation of protein–ligand complex crystals
Müller, Ilka
2017-01-01
With continuous technical improvements at synchrotron facilities, data-collection rates have increased dramatically. This makes it possible to collect diffraction data for hundreds of protein–ligand complexes within a day, provided that a suitable crystal system is at hand. However, developing a suitable crystal system can prove challenging, exceeding the timescale of data collection by several orders of magnitude. Firstly, a useful crystallization construct of the protein of interest needs to be chosen and its expression and purification optimized, before screening for suitable crystallization and soaking conditions can start. This article reviews recent publications analysing large data sets of crystallization trials, with the aim of identifying factors that do or do not make a good crystallization construct, and gives guidance in the design of an expression construct. It provides an overview of common protein-expression systems, addresses how ligand binding can be both help and hindrance for protein purification, and describes ligand co-crystallization and soaking, with an emphasis on troubleshooting. PMID:28177304
The Chemistry of Separations Ligand Degradation by Organic Radical Cations
Mezyk, Stephen P.; Horne, Gregory P.; Mincher, Bruce J.; ...
2016-12-01
Solvent based extractions of used nuclear fuel use designer ligands in an organic phase extracting ligand complexed metal ions from an acidic aqueous phase. These extractions will be performed in highly radioactive environments, and the radiation chemistry of all these complexants and their diluents will play a major role in determining extraction efficiency, separation factors, and solvent-recycle longevity. Although there has been considerable effort in investigating ligand damage occurring in acidic water radiolysis conditions, only minimal fundamental kinetic and mechanistic data has been reported for the degradation of extraction ligands in the organic phase. Extraction solvent phases typically use normalmore » alkanes such as dodecane, TPH, and kerosene as diluents. The radiolysis of such diluents produce a mixture of radical cations (R •+), carbon-centered radicals (R •), solvated electrons, and molecular products such as hydrogen. Typically, the radical species will preferentially react with the dissolved oxygen present to produce relatively inert peroxyl radicals. This isolates the alkane radical cation species, R •+ as the major radiolytically-induced organic species that can react with, and degrade, extraction agents in this phase. Here we report on our recent studies of organic radical cation reactions with various ligands. Elucidating these parameters, and combining them with the known acidic aqueous phase chemistry, will allow a full, fundamental, understanding of the impact of radiation on solvent extraction based separation processes to be achieved.« less
The Chemistry of Separations Ligand Degradation by Organic Radical Cations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mezyk, Stephen P.; Horne, Gregory P.; Mincher, Bruce J.
Solvent based extractions of used nuclear fuel use designer ligands in an organic phase extracting ligand complexed metal ions from an acidic aqueous phase. These extractions will be performed in highly radioactive environments, and the radiation chemistry of all these complexants and their diluents will play a major role in determining extraction efficiency, separation factors, and solvent-recycle longevity. Although there has been considerable effort in investigating ligand damage occurring in acidic water radiolysis conditions, only minimal fundamental kinetic and mechanistic data has been reported for the degradation of extraction ligands in the organic phase. Extraction solvent phases typically use normalmore » alkanes such as dodecane, TPH, and kerosene as diluents. The radiolysis of such diluents produce a mixture of radical cations (R •+), carbon-centered radicals (R •), solvated electrons, and molecular products such as hydrogen. Typically, the radical species will preferentially react with the dissolved oxygen present to produce relatively inert peroxyl radicals. This isolates the alkane radical cation species, R •+ as the major radiolytically-induced organic species that can react with, and degrade, extraction agents in this phase. Here we report on our recent studies of organic radical cation reactions with various ligands. Elucidating these parameters, and combining them with the known acidic aqueous phase chemistry, will allow a full, fundamental, understanding of the impact of radiation on solvent extraction based separation processes to be achieved.« less
Kong, Xiangying; Yang, Yue; Wu, Wenbin; Wan, Hongye; Li, Xiaomin; Zhong, Michun; Su, Xiaohui; Jia, Shiwei; Lin, Na
2015-01-01
Excessive bone resorption by osteoclasts within inflamed joints is the most specific hallmark of rheumatoid arthritis. A. flaccida has long been used for the treatment of arthritis in folk medicine of China; however, the active ingredients responsible for the anti-arthritis effects of A. flaccida are still elusive. In this study, W3, a saponin isolated from the extract of A. flaccida was identified as the major active ingredient by using an osteoclast formation model induced by receptor activator of nuclear factor kappa-B ligand (RANKL). W3 dose-dependently suppressed the actin ring formation and lacunar resorption. Mechanistic investigation revealed that W3 inhibited the RANKL-induced TRAF6 expression, decreased phosphorylation of mitogen-activated protein kinases (MAPKs) and IκB-α, and suppressed NF-κB p65 DNA binding activity. Furthermore, W3 almost abrogated the expression of c-Fos and nuclear factor of activated T cells (NFATc1). Therefore, our results suggest that W3 is a potential agent for treating lytic bone diseases although further evaluation in vivo and in clinical trials is needed.
Lee, Yong-Woo; Kim, Chulsung
2012-01-01
Bench-scale soil washing studies were performed to evaluate the potential application of non-toxic, biodegradable extracted soybean-complexing ligands for the remediation of lead-contaminated soils. Results showed that, with extracted soybean-complexing ligands, lead solubility extensively increased when pH of the solution was higher than 6, and approximately 10% (500 mg/kg) of lead was removed from a rifle range soil. Two potential primary factors controlling the effectiveness of lead extraction from lead-contaminated soils with natural ligands are adsorption of extracted aqueous lead ions onto the ground soybean and the pH of the extraction solution. More complexing ligands were extracted from the ground soybean as the reaction pH increased. As a result, significantly higher lead extraction efficiency was observed under basic environments. In addition, less adsorption onto soybean was observed when the pH of the solution was higher than 7. Among two available Lewis base functional groups in the extracted soybean-complexing ligands such as carboxylate and the alpha-amino functional groups, the non-protonated alpha-amino functional groups may play an important role for the dissolution of lead from lead-contaminated soil through the formation of soluble lead--ligand complexes.
Hallenborg, Philip; Petersen, Rasmus Koefoed; Feddersen, Søren; Sundekilde, Ulrik; Hansen, Jacob B.; Blagoev, Blagoy; Madsen, Lise; Kristiansen, Karsten
2014-01-01
Adipocyte differentiation is orchestrated by the ligand-activated nuclear receptor PPARγ. Endogenous ligands comprise oxidized derivatives of arachidonic acid and structurally similar PUFAs. Although expression of PPARγ peaks in mature adipocytes, ligands are produced primarily at the onset of differentiation. Concomitant with agonist production, murine fibroblasts undergo two rounds of mitosis referred to as mitotic clonal expansion. Here we show that mouse embryonic fibroblasts deficient in either of two cell cycle inhibitors, the transcription factor p53 or its target gene encoding the cyclin-dependent kinase inhibitor p21, exhibit increased adipogenic potential. The antiadipogenic effect of p53 relied on its transcriptional activity and p21 expression but was circumvented by administration of an exogenous PPARγ agonist suggesting a linkage between cell cycling and PPARγ ligand production. Indeed, cell cycle inhibitory compounds decreased PPARγ ligand production in differentiating 3T3-L1 preadipocytes. Furthermore, these inhibitors abolished the release of arachidonic acid induced by the hormonal cocktail initiating adipogenesis. Collectively, our results suggest that murine fibroblasts require clonal expansion for PPARγ ligand production at the onset of adipocyte differentiation. PMID:25312885
Probing receptor-ligand interactions by sedimentation equilibrium
NASA Astrophysics Data System (ADS)
Philo, John S.
1997-05-01
While sedimentation equilibrium is most commonly used to characterize the molecular weight and state of association of single proteins, this technique is also a very powerful tool for probing the interactions between two or more different proteins, and can characterize both the binding stoichiometry and the equilibrium constants. To resolve the complex binding interactions that can occur in such systems, it is crucial to globally fit data from many experiments to a common binding model, including samples made with different mixing ratios and a wide range of total concentration. It is often also essential to constrain the parameters during fitting so that the fits correctly reproduce the molar ratio of proteins used in making each sample. We have applied this methodology to probe mechanisms of receptor activation for a number of hematopoietic receptors and their cognate ligands, using receptor extracellular domains expressed as soluble proteins. Such data can potentially help in the design of improved or new protein therapeutics, as well as in efforts to create small- molecular mimetics of protein hormones through structure- based drug design. Sedimentation equilibrium has shown that stem cell factor, erythropoietin, and granulocyte-colony stimulating factor can each dimerize their respective receptors in solution, but the mechanism of ligand-induced receptor dimerization for these three systems are strikingly different.
Ligand cluster-based protein network and ePlatton, a multi-target ligand finder.
Du, Yu; Shi, Tieliu
2016-01-01
Small molecules are information carriers that make cells aware of external changes and couple internal metabolic and signalling pathway systems with each other. In some specific physiological status, natural or artificial molecules are used to interact with selective biological targets to activate or inhibit their functions to achieve expected biological and physiological output. Millions of years of evolution have optimized biological processes and pathways and now the endocrine and immune system cannot work properly without some key small molecules. In the past thousands of years, the human race has managed to find many medicines against diseases by trail-and-error experience. In the recent decades, with the deepening understanding of life and the progress of molecular biology, researchers spare no effort to design molecules targeting one or two key enzymes and receptors related to corresponding diseases. But recent studies in pharmacogenomics have shown that polypharmacology may be necessary for the effects of drugs, which challenge the paradigm, 'one drug, one target, one disease'. Nowadays, cheminformatics and structural biology can help us reasonably take advantage of the polypharmacology to design next-generation promiscuous drugs and drug combination therapies. 234,591 protein-ligand interactions were extracted from ChEMBL. By the 2D structure similarity, 13,769 ligand emerged from 156,151 distinct ligands which were recognized by 1477 proteins. Ligand cluster- and sequence-based protein networks (LCBN, SBN) were constructed, compared and analysed. For assisting compound designing, exploring polypharmacology and finding possible drug combination, we integrated the pathway, disease, drug adverse reaction and the relationship of targets and ligand clusters into the web platform, ePlatton, which is available at http://www.megabionet.org/eplatton. Although there were some disagreements between the LCBN and SBN, communities in both networks were largely the same
Plant twitter: ligands under 140 amino acids enforcing stomatal patterning.
Rychel, Amanda L; Peterson, Kylee M; Torii, Keiko U
2010-05-01
Stomata are an essential land plant innovation whose patterning and density are under genetic and environmental control. Recently, several putative ligands have been discovered that influence stomatal density, and they all belong to the epidermal patterning factor-like family of secreted cysteine-rich peptides. Two of these putative ligands, EPF1 and EPF2, are expressed exclusively in the stomatal lineage cells and negatively regulate stomatal density. A third, EPFL6 or CHALLAH, is also a negative regulator of density, but is expressed subepidermally in the hypocotyl. A fourth, EPFL9 or STOMAGEN, is expressed in the mesophyll tissues and is a positive regulator of density. Genetic evidence suggests that these ligands may compete for the same receptor complex. Proper stomatal patterning is likely to be an intricate process involving ligand competition, regional specificity, and communication between tissue layers. EPFL-family genes exist in the moss Physcomitrella patens, the lycophyte Selaginella moellendorffii, and rice, Oryza sativa, and their sequence analysis yields several genes some of which are related to EPF1, EPF2, EPFL6, and EPFL9. Presence of these EPFL family members in the basal land plants suggests an exciting hypothesis that the genetic components for stomatal patterning originated early in land plant evolution.
Beyond the Matrix: The Many Non-ECM Ligands for Integrins
LaFoya, Bryce; Munroe, Jordan A.; Miyamoto, Alison; Detweiler, Michael A.; Crow, Jacob J.; Gazdik, Tana
2018-01-01
The traditional view of integrins portrays these highly conserved cell surface receptors as mediators of cellular attachment to the extracellular matrix (ECM), and to a lesser degree, as coordinators of leukocyte adhesion to the endothelium. These canonical activities are indispensable; however, there is also a wide variety of integrin functions mediated by non-ECM ligands that transcend the traditional roles of integrins. Some of these unorthodox roles involve cell-cell interactions and are engaged to support immune functions such as leukocyte transmigration, recognition of opsonization factors, and stimulation of neutrophil extracellular traps. Other cell-cell interactions mediated by integrins include hematopoietic stem cell and tumor cell homing to target tissues. Integrins also serve as cell-surface receptors for various growth factors, hormones, and small molecules. Interestingly, integrins have also been exploited by a wide variety of organisms including viruses and bacteria to support infectious activities such as cellular adhesion and/or cellular internalization. Additionally, the disruption of integrin function through the use of soluble integrin ligands is a common strategy adopted by several parasites in order to inhibit blood clotting during hematophagy, or by venomous snakes to kill prey. In this review, we strive to go beyond the matrix and summarize non-ECM ligands that interact with integrins in order to highlight these non-traditional functions of integrins. PMID:29393909
Gong, Wei; Dou, Huan; Liu, Xianqin; Sun, Lingyun; Hou, Yayi
2012-10-01
1. In the present study, we investigated the effects of technetium-99 conjugated with methylene diphosphonate ((99)Tc-MDP), an agent used in radionuclide therapy, on receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclastogenesis and explored the underlying mechanisms. 2. The murine macrophage cell line RAW264.7 and bone marrow-derived-macrophages from C57BL/6 mice (BMM) were used as models for osteoclastogenesis in vitro. The expression of some key factors in RANKL (50 ng/mL)-induced osteoclastogenesis in RAW264.7 cells was investigated by flow cytometry and real-time reverse transcription-polymerase chain reaction (RT-PCR). To detect multinucleated osteoclast formation, RAW264.7 cells were induced with RANKL for 4 days, whereas BMM were induced by 50 ng/mL RANKL and 20 ng/mL macrophage colony-stimulating factor for 7 days, before being stained with tartrate-resistant acid phosphatase. 3. Osteoclastogenesis was evaluated using the osteoclast markers CD51, matrix metalloproteinase (MMP)-9 and cathepsin K. At 0.01 μg/mL, (99)Tc-MDP significantly inhibited RANKL-induced osteoclastogenesis without any cytotoxicity. In addition, (99)Tc-MDP abolished the appearance of multinucleated osteoclasts. 4. Real-time RT-PCR analysis of transcription factor expression revealed that (99)Tc-MDP inhibited the expression of c-Fos and nuclear factor of activated T cells. In addition, (99)Tc-MDP inhibited the expression of the inflammatory factors interleukin (IL)-6, tumour necrosis factor-α and IL-1β. Finally, (99)Tc-MDP inhibited the activation of mitogen-activated protein kinases in RAW264.7 cells following RANKL stimulation. 5. In conclusion, (99)Tc-MDP possesses anti-osteoclastogenic activity against RANKL-induced osteoclast formation. © 2012 The Authors Clinical and Experimental Pharmacology and Physiology © 2012 Wiley Publishing Asia Pty Ltd.
Chemistry of Marine Ligands and Siderophores
Vraspir, Julia M.; Butler, Alison
2011-01-01
Marine microorganisms are presented with unique challenges to obtain essential metal ions required to survive and thrive in the ocean. The production of organic ligands to complex transition metal ions is one strategy to both facilitate uptake of specific metals, such as iron, and to mitigate the potential toxic effects of other metal ions, such as copper. A number of important trace metal ions are complexed by organic ligands in seawater, including iron, cobalt, nickel, copper, zinc, and cadmium, thus defining the speciation of these metal ions in the ocean. In the case of iron, siderophores have been identified and structurally characterized. Siderophores are low molecular weight iron-binding ligands produced by marine bacteria. Although progress has been made toward the identity of in situ iron-binding ligands, few compounds have been identified that coordinate the other trace metals. Deciphering the chemical structures and production stimuli of naturally produced organic ligands and the organisms they come from is fundamental to understanding metal speciation and bioavailability. The current evidence for marine ligands, with an emphasis on siderophores, and discussion of the importance and implications of metal-binding ligands in controlling metal speciation and cycling within the world’s oceans are presented. PMID:21141029
Perfluorinated Ligands in Organometallic Chemistry
1989-12-12
C49t00ooVER ,or C M’ AD"OV’~mDecember 12) 199IFinal 1/1/86 to 8/31/89C smuS. FUNOING NUMgIERS cJ Perfluorinated Ligands in Organometallic Chemistry 612...compounds, stabilized by tridentate perfluorinated ligands. Dinuclear rhodium complexes of OFCOT undergo a selective C-F bond activation reaction...hexafluorocyclooctatrieneyne ligand. Stereospecific cleavage of a fluorinated C-C bond,#-bond in perfluorocyclopropene by platinum and iridium complexes has been achieved
Erickson, Jon A; Jalaie, Mehran; Robertson, Daniel H; Lewis, Richard A; Vieth, Michal
2004-01-01
The key to success for computational tools used in structure-based drug design is the ability to accurately place or "dock" a ligand in the binding pocket of the target of interest. In this report we examine the effect of several factors on docking accuracy, including ligand and protein flexibility. To examine ligand flexibility in an unbiased fashion, a test set of 41 ligand-protein cocomplex X-ray structures were assembled that represent a diversity of size, flexibility, and polarity with respect to the ligands. Four docking algorithms, DOCK, FlexX, GOLD, and CDOCKER, were applied to the test set, and the results were examined in terms of the ability to reproduce X-ray ligand positions within 2.0A heavy atom root-mean-square deviation. Overall, each method performed well (>50% accuracy) but for all methods it was found that docking accuracy decreased substantially for ligands with eight or more rotatable bonds. Only CDOCKER was able to accurately dock most of those ligands with eight or more rotatable bonds (71% accuracy rate). A second test set of structures was gathered to examine how protein flexibility influences docking accuracy. CDOCKER was applied to X-ray structures of trypsin, thrombin, and HIV-1-protease, using protein structures bound to several ligands and also the unbound (apo) form. Docking experiments of each ligand to one "average" structure and to the apo form were carried out, and the results were compared to docking each ligand back to its originating structure. The results show that docking accuracy falls off dramatically if one uses an average or apo structure. In fact, it is shown that the drop in docking accuracy mirrors the degree to which the protein moves upon ligand binding.
Structural Analysis of Chemokine Receptor–Ligand Interactions
2017-01-01
This review focuses on the construction and application of structural chemokine receptor models for the elucidation of molecular determinants of chemokine receptor modulation and the structure-based discovery and design of chemokine receptor ligands. A comparative analysis of ligand binding pockets in chemokine receptors is presented, including a detailed description of the CXCR4, CCR2, CCR5, CCR9, and US28 X-ray structures, and their implication for modeling molecular interactions of chemokine receptors with small-molecule ligands, peptide ligands, and large antibodies and chemokines. These studies demonstrate how the integration of new structural information on chemokine receptors with extensive structure–activity relationship and site-directed mutagenesis data facilitates the prediction of the structure of chemokine receptor–ligand complexes that have not been crystallized. Finally, a review of structure-based ligand discovery and design studies based on chemokine receptor crystal structures and homology models illustrates the possibilities and challenges to find novel ligands for chemokine receptors. PMID:28165741
Postprocessing of docked protein-ligand complexes using implicit solvation models.
Lindström, Anton; Edvinsson, Lotta; Johansson, Andreas; Andersson, C David; Andersson, Ida E; Raubacher, Florian; Linusson, Anna
2011-02-28
Molecular docking plays an important role in drug discovery as a tool for the structure-based design of small organic ligands for macromolecules. Possible applications of docking are identification of the bioactive conformation of a protein-ligand complex and the ranking of different ligands with respect to their strength of binding to a particular target. We have investigated the effect of implicit water on the postprocessing of binding poses generated by molecular docking using MM-PB/GB-SA (molecular mechanics Poisson-Boltzmann and generalized Born surface area) methodology. The investigation was divided into three parts: geometry optimization, pose selection, and estimation of the relative binding energies of docked protein-ligand complexes. Appropriate geometry optimization afforded more accurate binding poses for 20% of the complexes investigated. The time required for this step was greatly reduced by minimizing the energy of the binding site using GB solvation models rather than minimizing the entire complex using the PB model. By optimizing the geometries of docking poses using the GB(HCT+SA) model then calculating their free energies of binding using the PB implicit solvent model, binding poses similar to those observed in crystal structures were obtained. Rescoring of these poses according to their calculated binding energies resulted in improved correlations with experimental binding data. These correlations could be further improved by applying the postprocessing to several of the most highly ranked poses rather than focusing exclusively on the top-scored pose. The postprocessing protocol was successfully applied to the analysis of a set of Factor Xa inhibitors and a set of glycopeptide ligands for the class II major histocompatibility complex (MHC) A(q) protein. These results indicate that the protocol for the postprocessing of docked protein-ligand complexes developed in this paper may be generally useful for structure-based design in drug discovery.
Yacoub, Daniel; Hachem, Ahmed; Théorêt, Jean-François; Gillis, Marc-Antoine; Mourad, Walid; Merhi, Yahye
2010-12-01
CD40 ligand is a thromboinflammatory molecule that predicts cardiovascular events. Platelets constitute the major source of soluble CD40 ligand (sCD40L), which has been shown to influence platelet activation, although its exact functional impact on platelets and the underlying mechanisms remain undefined. We aimed to determine the impact and the signaling mechanisms of sCD40L on platelets. sCD40L strongly enhances platelet activation and aggregation. Human platelets treated with a mutated form of sCD40L that does not bind CD40, and CD40(-/-) mouse platelets failed to elicit such responses. Furthermore, sCD40L stimulation induces the association of the tumor necrosis factor receptor-associated factor-2 with platelet CD40. Notably, sCD40L primes platelets through activation of the small GTPase Rac1 and its downstream target p38 mitogen-activated protein kinase, which leads to platelet shape change and actin polymerization. Moreover, sCD40L exacerbates thrombus formation and leukocyte infiltration in wild-type mice but not in CD40(-/-) mice. sCD40L enhances agonist-induced platelet activation and aggregation through a CD40-dependent tumor necrosis factor receptor-associated factor-2/Rac1/p38 mitogen-activated protein kinase signaling pathway. Thus, sCD40L is an important platelet primer predisposing platelets to enhanced thrombus formation in response to vascular injury. This may explain the link between circulating levels of sCD40L and cardiovascular diseases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cao, Ke-Li; Zhang, Yi-Ping; Cai, Yi-Ni
2014-07-01
To investigate the influence of hydrogen bonds and secondary ligands on the structures and properties of the resulting frameworks, five new Co(II) compounds have been synthesized by the reactions of Co(II) salts and 3,5-bis(pyridin-4-ylmethoxy)benzoic acid (HL) with four rationally selected dicarboxylic acid ligands. Without secondary ligand, we got one compound [CoL{sub 2}(H{sub 2}O){sub 2}]{sub n}·2nH{sub 2}O (1), which possesses a 1D chain structure. In the presence of ancillary ligands, namely, 1,3-adamantanedicarboxylic acid (H{sub 2}adbc), terephthalic acid (H{sub 2}tpa), thiophene-2,5-dicarboxylic acid (H{sub 2}tdc) and 1,4-benzenedithioacetic acid (H{sub 2}bdtc), four 3D structures [Co{sub 2}L{sub 2}(adbc)]{sub n}·nH{sub 2}O (2), [Co{sub 2}L{sub 2}(tpa)]{sub n}more » (3), [Co{sub 2}L{sub 2}(tdc)]{sub n} (4), [Co{sub 2}L{sub 2}(bdtc)(H{sub 2}O)]{sub n} (5) were obtained, respectively. It can be observed from the architectures of 1–5 that hydrogen bonds and secondary ligands both have great effects on the spatial connective fashions, resulting in the formation of various dimensional compounds. The XRPD, TGA data of title polymers and the magnetic properties for 2 and 5 have also been investigated. - Graphical abstract: The structural differences show that the ancillary ligands have great effects on the spatial connective fashions, resulting in the formation of various dimensional compounds. - Highlights: • Five new Co(II) coordination polymers have been synthesized by solvothermal reactions based on 3,5-bis(pyridin-4-ylmethoxy)benzoic acid (HL). • The long-flexible ligand (HL) is a good candidate to produce interpenetrating architectures. • The secondary dicarboxylic acid ligands play important roles in the spatial connective fashions and the formation of various dimensional compounds. • The magnetism studies show that both 2 and 5 exhibit antiferromagnetic interactions.« less
Decoding the Role of Water Dynamics in Ligand-Protein Unbinding: CRF1R as a Test Case.
Bortolato, Andrea; Deflorian, Francesca; Weiss, Dahlia R; Mason, Jonathan S
2015-09-28
The residence time of a ligand-protein complex is a crucial aspect in determining biological effect in vivo. Despite its importance, the prediction of ligand koff still remains challenging for modern computational chemistry. We have developed aMetaD, a fast and generally applicable computational protocol to predict ligand-protein unbinding events using a molecular dynamics (MD) method based on adiabatic-bias MD and metadynamics. This physics-based, fully flexible, and pose-dependent ligand scoring function evaluates the maximum energy (RTscore) required to move the ligand from the bound-state energy basin to the next. Unbinding trajectories are automatically analyzed and translated into atomic solvation factor (SF) values representing the water dynamics during the unbinding event. This novel computational protocol was initially tested on two M3 muscarinic receptor and two adenosine A2A receptor antagonists and then evaluated on a test set of 12 CRF1R ligands. The resulting RTscores were used successfully to classify ligands with different residence times. Additionally, the SF analysis was used to detect key differences in the degree of accessibility to water molecules during the predicted ligand unbinding events. The protocol provides actionable working hypotheses that are applicable in a drug discovery program for the rational optimization of ligand binding kinetics.
Oswal, Dhawal P.; Balanarasimha, Madhumitha; Loyer, Jeannette K.; Bedi, Shimpi; Soman, Frances L.; Rider, S. Dean; Hostetler, Heather A.
2013-01-01
Peroxisome proliferator-activated receptor α (PPARα) belongs to the family of ligand-dependent nuclear transcription factors that regulate energy metabolism. Although there exists remarkable overlap in the activities of PPARα across species, studies utilizing exogenous PPARα ligands suggest species differences in binding, activation, and physiological effects. While unsaturated long-chain fatty acids (LCFA) and their thioesters (long-chain fatty acyl-CoA; LCFA-CoA) function as ligands for recombinant mouse PPARα (mPPARα), no such studies have been conducted with full-length human PPARα (hPPARα). The objective of the current study was to determine whether LCFA and LCFA-CoA constitute high-affinity endogenous ligands for hPPARα or whether there exist species differences for ligand specificity and affinity. Both hPPARα and mPPARα bound with high affinity to LCFA-CoA; however, differences were noted in LCFA affinities. A fluorescent LCFA analog was bound strongly only by mPPARα, and naturally occurring saturated LCFA was bound more strongly by hPPARα than mPPARα. Similarly, unsaturated LCFA induced transactivation of both hPPARα and mPPARα, whereas saturated LCFA induced transactivation only in hPPARα-expressing cells. These data identified LCFA and LCFA-CoA as endogenous ligands of hPPARα, demonstrated species differences in binding specificity and activity, and may help delineate the role of PPARα as a nutrient sensor in metabolic regulation. PMID:23797899
Designing ligands to bind proteins
Whitesides, George M.; Krishnamurthy, Vijay M.
2009-01-01
The ability to design drugs (so-called ‘rational drug design’) has been one of the long-term objectives of chemistry for 50 years. It is an exceptionally difficult problem, and many of its parts lie outside the expertise of chemistry. The much more limited problem – how to design tight-binding ligands (rational ligand design) – would seem to be one that chemistry could solve, but has also proved remarkably recalcitrant. The question is ‘Why is it so difficult?’ and the answer is ‘We still don't entirely know’. This perspective discusses some of the technical issues – potential functions, protein plasticity, enthalpy/entropy compensation, and others – that contribute, and suggests areas where fundamental understanding of protein–ligand interactions falls short of what is needed. It surveys recent technological developments (in particular, isothermal titration calorimetry) that will, hopefully, make now the time for serious progress in this area. It concludes with the calorimetric examination of the association of a series of systematically varied ligands with a model protein. The counterintuitive thermodynamic results observed serve to illustrate that, even in relatively simple systems, understanding protein–ligand association is challenging. PMID:16817982
Izawa, Takashi; Hutami, Islamy Rahma; Tanaka, Eiji
2018-04-20
Temporomandibular joint osteoarthritis (TMJ-OA) is a degenerative disease that involves changes in subchondral bone and progressive degradation of cartilage. Currently, rebamipide, a gastroprotective drug, is administered to protect gastric mucosa and accelerate ulcer healing. Recent studies have shown that rebamipide also attenuates cartilage degeneration by suppressing oxidative damage and inducing homeostasis of the extracellular matrix of articular chondrocytes. Regarding the latter, reduced expression of cathepsin K, NFATc1, c-Src, and integrin β3, and increased expression of nuclear factor-kappa B, have been found to be mediated by the transcription factor, receptor activator of nuclear factor kappa-B ligand (RANKL). Treatment with rebamipide was also found to activate, mitogen-activated protein kinases such as p38, ERK, and JNK to reduce osteoclast differentiation. Taken together, these results strongly indicate that rebamipide mediates inhibitory effects on cartilage degradation and osteoclastogenesis in TMJ-OA. Here, we highlight recent evidence regarding the potential for rebamipide to affect osteoclast differentiation and TMJ-OA pathogenesis. We also discuss the potential role of rebamipide to serve as a new strategy for the treatment of TMJ-OA. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Kurciński, Mateusz; Jarończyk, Małgorzata; Lipiński, Piotr F J; Dobrowolski, Jan Cz; Sadlej, Joanna
2018-02-18
Despite considerable advances over the past years in understanding the mechanisms of action and the role of the σ₁ receptor, several questions regarding this receptor remain unanswered. This receptor has been identified as a useful target for the treatment of a diverse range of diseases, from various central nervous system disorders to cancer. The recently solved issue of the crystal structure of the σ₁ receptor has made elucidating the structure-activity relationship feasible. The interaction of seven representative opioid ligands with the crystal structure of the σ₁ receptor (PDB ID: 5HK1) was simulated for the first time using molecular dynamics (MD). Analysis of the MD trajectories has provided the receptor-ligand interaction fingerprints, combining information on the crucial receptor residues and frequency of the residue-ligand contacts. The contact frequencies and the contact maps suggest that for all studied ligands, the hydrophilic (hydrogen bonding) interactions with Glu172 are an important factor for the ligands' affinities toward the σ₁ receptor. However, the hydrophobic interactions with Tyr120, Val162, Leu105, and Ile124 also significantly contribute to the ligand-receptor interplay and, in particular, differentiate the action of the agonistic morphine from the antagonistic haloperidol.
Lima, Carlos F R A C; Taveira, Ricardo J S; Costa, José C S; Fernandes, Ana M; Melo, André; Silva, Artur M S; Santos, Luís M N B F
2016-06-28
Tris(8-hydroxyquinolinate) metallic complexes, Mq3, are one of the most important classes of organic semiconductor materials. Herein, the nature of the chemical bond in Mq3 complexes and its implications on their molecular properties were investigated by a combined experimental and computational approach. Various Mq3 complexes, resulting from the alteration of the metal and substitution of the 8-hydroxyquinoline ligand in different positions, were prepared. The mer-/fac-isomerism in Mq3 was explored by FTIR and NMR spectroscopy, evidencing that, irrespective of the substituent, mer- and fac-are the most stable molecular configurations of Al(iii) and In(iii) complexes, respectively. The relative M-ligand bond dissociation energies were evaluated experimentally by electrospray ionization tandem mass spectrometry (ESI-MS-MS), showing a non-monotonous variation along the group (Al > In > Ga). The results reveal a strong covalent character in M-ligand bonding, which allows for through-ligand electron delocalization, and explain the preferred molecular structures of Mq3 complexes as resulting from the interplay between bonding and steric factors. The mer-isomer reduces intraligand repulsions, being preferred for smaller metals, while the fac-isomer is favoured for larger metals where stronger covalent M-ligand bonds can be formed due to more extensive through-ligand conjugation mediated by metal "d" orbitals.
Crystallization of bi-functional ligand protein complexes.
Antoni, Claudia; Vera, Laura; Devel, Laurent; Catalani, Maria Pia; Czarny, Bertrand; Cassar-Lajeunesse, Evelyn; Nuti, Elisa; Rossello, Armando; Dive, Vincent; Stura, Enrico Adriano
2013-06-01
Homodimerization is important in signal transduction and can play a crucial role in many other biological systems. To obtaining structural information for the design of molecules able to control the signalization pathways, the proteins involved will have to be crystallized in complex with ligands that induce dimerization. Bi-functional drugs have been generated by linking two ligands together chemically and the relative crystallizability of complexes with mono-functional and bi-functional ligands has been evaluated. There are problems associated with crystallization with such ligands, but overall, the advantages appear to be greater than the drawbacks. The study involves two matrix metalloproteinases, MMP-12 and MMP-9. Using flexible and rigid linkers we show that it is possible to control the crystal packing and that by changing the ligand-enzyme stoichiometric ratio, one can toggle between having one bi-functional ligand binding to two enzymes and having the same ligand bound to each enzyme. The nature of linker and its point of attachment on the ligand can be varied to aid crystallization, and such variations can also provide valuable structural information about the interactions made by the linker with the protein. We report here the crystallization and structure determination of seven ligand-dimerized complexes. These results suggest that the use of bi-functional drugs can be extended beyond the realm of protein dimerization to include all drug design projects. Copyright © 2013 Elsevier Inc. All rights reserved.
Autocrine signal transmission with extracellular ligand degradation
NASA Astrophysics Data System (ADS)
Muratov, C B; Posta, F; Shvartsman, S Y
2009-03-01
Traveling waves of cell signaling in epithelial layers orchestrate a number of important processes in developing and adult tissues. These waves can be mediated by positive feedback autocrine loops, a mode of cell signaling where binding of a diffusible extracellular ligand to a cell surface receptor can lead to further ligand release. We formulate and analyze a biophysical model that accounts for ligand-induced ligand release, extracellular ligand diffusion and ligand-receptor interaction. We focus on the case when the main mode for ligand degradation is extracellular and analyze the problem with the sharp threshold positive feedback nonlinearity. We derive expressions that link the speed of propagation and other characteristics of traveling waves to the parameters of the biophysical processes, such as diffusion rates, receptor expression level, etc. Analyzing the derived expressions we found that traveling waves in such systems can exhibit a number of unusual properties, e.g. non-monotonic dependence of the speed of propagation on ligand diffusivity. Our results for the fully developed traveling fronts can be used to analyze wave initiation from localized perturbations, a scenario that frequently arises in the in vitro models of epithelial wound healing, and guide future modeling studies of cell communication in epithelial layers.
Cell-specific targeting by heterobivalent ligands.
Josan, Jatinder S; Handl, Heather L; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M; Vagner, Josef; Mash, Eugene A; Hruby, Victor J; Gillies, Robert J
2011-07-20
Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach--to specifically target combinations of cell-surface receptors using heteromultivalent ligands ("receptor combination approach"). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle(4), dPhe(7)]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20-50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH(2). Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging.
Cell-Specific Targeting by Heterobivalent Ligands
Josan, Jatinder S.; Handl, Heather L.; Sankaranarayanan, Rajesh; Xu, Liping; Lynch, Ronald M.; Vagner, Josef; Mash, Eugene A.; Hruby, Victor J.; Gillies, Robert J.
2012-01-01
Current cancer therapies exploit either differential metabolism or targeting to specific individual gene products that are overexpressed in aberrant cells. The work described herein proposes an alternative approach—to specifically target combinations of cell-surface receptors using heteromultivalent ligands (“receptor combination approach”). As a proof-of-concept that functionally unrelated receptors can be noncovalently cross-linked with high avidity and specificity, a series of heterobivalent ligands (htBVLs) were constructed from analogues of the melanocortin peptide ligand ([Nle4, DPhe7]-α-MSH) and the cholecystokinin peptide ligand (CCK-8). Binding of these ligands to cells expressing the human Melanocortin-4 receptor and the Cholecystokinin-2 receptor was analyzed. The MSH(7) and CCK(6) were tethered with linkers of varying rigidity and length, constructed from natural and/or synthetic building blocks. Modeling data suggest that a linker length of 20–50 Å is needed to simultaneously bind these two different G-protein coupled receptors (GPCRs). These ligands exhibited up to 24-fold enhancement in binding affinity to cells that expressed both (bivalent binding), compared to cells with only one (monovalent binding) of the cognate receptors. The htBVLs had up to 50-fold higher affinity than that of a monomeric CCK ligand, i.e., Ac-CCK(6)-NH2. Cell-surface targeting of these two cell types with labeled heteromultivalent ligand demonstrated high avidity and specificity, thereby validating the receptor combination approach. This ability to noncovalently cross-link heterologous receptors and target individual cells using a receptor combination approach opens up new possibilities for specific cell targeting in vivo for therapy or imaging. PMID:21639139
NASA Astrophysics Data System (ADS)
Costanzi, Stefano; Tikhonova, Irina G.; Harden, T. Kendall; Jacobson, Kenneth A.
2009-11-01
Accurate in silico models for the quantitative prediction of the activity of G protein-coupled receptor (GPCR) ligands would greatly facilitate the process of drug discovery and development. Several methodologies have been developed based on the properties of the ligands, the direct study of the receptor-ligand interactions, or a combination of both approaches. Ligand-based three-dimensional quantitative structure-activity relationships (3D-QSAR) techniques, not requiring knowledge of the receptor structure, have been historically the first to be applied to the prediction of the activity of GPCR ligands. They are generally endowed with robustness and good ranking ability; however they are highly dependent on training sets. Structure-based techniques generally do not provide the level of accuracy necessary to yield meaningful rankings when applied to GPCR homology models. However, they are essentially independent from training sets and have a sufficient level of accuracy to allow an effective discrimination between binders and nonbinders, thus qualifying as viable lead discovery tools. The combination of ligand and structure-based methodologies in the form of receptor-based 3D-QSAR and ligand and structure-based consensus models results in robust and accurate quantitative predictions. The contribution of the structure-based component to these combined approaches is expected to become more substantial and effective in the future, as more sophisticated scoring functions are developed and more detailed structural information on GPCRs is gathered.
NASA Astrophysics Data System (ADS)
Kurnikova, Maria
2009-03-01
Understanding of protein motion and energetics of conformational transitions is crucial to understanding protein function. The glutamate receptor ligand binding domain (GluR2 S1S2) is a two lobe protein, which binds ligand at the interface of two lobes and undergoes conformational transition. The cleft closure conformational transition of S1S2 has been implicated in gating of the ion channel formed by the transmembrane domain of the receptor. In this study we present a composite multi-faceted theoretical analysis of the detailed mechanism of this conformational transition based on rigid cluster decomposition of the protein structure [1] and identifying hydrogen bonds that are responsible for stabilizing the closed conformation [2]. Free energy of the protein reorganization upon ligand binding was calculated using combined Thermodynamic Integration (TI) and Umbrella Sampling (US) simulations [3]. Ligand -- protein interactions in the binding cleft were analyzed using Molecular Dynamics, continuum electrostatics and QM/MM models [4]. All model calculations compare well with corresponding experimental measurements. [4pt] [1] Protein Flexibility using Constraints from Molecular Dynamics Simulations T. Mamonova, B. Hespenheide, R. Straub, M. F. Thorpe, M. G. Kurnikova , Phys. Biol., 2, S137 (2005)[0pt] [2] Theoretical Study of the Glutamate Receptor Ligand Binding Domain Flexibility and Conformational Reorganization T. Mamonova, K. Speranskiy, and M. Kurnikova , Prot.: Struct., Func., Bioinf., 73,656 (2008)[0pt] [3] Energetics of the cleft closing transition and glutamate binding in the Glutamate Receptor ligand Binding Domain T. Mamonova, M. Yonkunas, and M. Kurnikova Biochemistry 47, 11077 (2008)[0pt] [4] On the Binding Determinants of the Glutamate Agonist with the Glutamate Receptor Ligand Binding Domain K. Speranskiy and M. Kurnikova Biochemistry 44, 11208 (2005)
Hu, Jun; Liu, Zi; Yu, Dong-Jun; Zhang, Yang
2018-02-15
Sequence-order independent structural comparison, also called structural alignment, of small ligand molecules is often needed for computer-aided virtual drug screening. Although many ligand structure alignment programs are proposed, most of them build the alignments based on rigid-body shape comparison which cannot provide atom-specific alignment information nor allow structural variation; both abilities are critical to efficient high-throughput virtual screening. We propose a novel ligand comparison algorithm, LS-align, to generate fast and accurate atom-level structural alignments of ligand molecules, through an iterative heuristic search of the target function that combines inter-atom distance with mass and chemical bond comparisons. LS-align contains two modules of Rigid-LS-align and Flexi-LS-align, designed for rigid-body and flexible alignments, respectively, where a ligand-size independent, statistics-based scoring function is developed to evaluate the similarity of ligand molecules relative to random ligand pairs. Large-scale benchmark tests are performed on prioritizing chemical ligands of 102 protein targets involving 1,415,871 candidate compounds from the DUD-E (Database of Useful Decoys: Enhanced) database, where LS-align achieves an average enrichment factor (EF) of 22.0 at the 1% cutoff and the AUC score of 0.75, which are significantly higher than other state-of-the-art methods. Detailed data analyses show that the advanced performance is mainly attributed to the design of the target function that combines structural and chemical information to enhance the sensitivity of recognizing subtle difference of ligand molecules and the introduces of structural flexibility that help capture the conformational changes induced by the ligand-receptor binding interactions. These data demonstrate a new avenue to improve the virtual screening efficiency through the development of sensitive ligand structural alignments. http
Espa, Davide; Pilia, Luca; Marchiò, Luciano; Artizzu, Flavia; Serpe, Angela; Mercuri, Maria Laura; Simão, Dulce; Almeida, Manuel; Pizzotti, Maddalena; Tessore, Francesca; Deplano, Paola
2012-03-28
The mixed-ligand dithiolene complex [Pt(Bz(2)pipdt)(dcbdt)] (1) bearing the two ligands Bz(2)pipdt = 1,4-dibenzyl-piperazine-3,2-dithione and dcbdt = dicyanobenzodithiolato, has been synthesized, characterized and studied to evaluate its second-order optical nonlinearity. The dithione/dithiolato character of the two ligands gives rise to an asymmetric distribution of the charge in the molecule. This is reflected by structural data showing that in the C(2)S(2)PtS(2)C(2) dithiolene core the four sulfur atoms define a square-planar coordination environment of the metal where the Pt-S bond distances involving the two ligands are similar, while the C-S bond distances in the C(2)S(2) units exhibit a significant difference in Bz(2)pipdt (dithione) and dcbdt (dithiolato). 1 shows a moderately strong absorption peak in the visible region, which can be related to a HOMO-LUMO transition, where the dcbdt ligand (dithiolato) contributes mostly to the HOMO, and the Bz(2)pipdt one (dithione) mostly to the LUMO. Thus this transition has ligand-to-ligand charge transfer (CT) character with some contribution of the metal and undergoes negative solvatochromism and molecular quadratic optical nonlinearity (μβ(0) = -1296 × 10(-48) esu), which was determined by the EFISH (electric-field-induced second-harmonic generation) technique and compared with the values of similar complexes on varying the dithiolato ligand (mnt = maleonitriledithiolato, dmit = 2-thioxo-1,3-dithiole-4,5-dithiolato). Theoretical calculations help to elucidate the role of the dithiolato ligands in affecting the molecular quadratic optical nonlinearity of these complexes.
Role of ligands in permanganate oxidation of organics.
Jiang, Jin; Pang, Su-Yan; Ma, Jun
2010-06-01
We previously demonstrated that several ligands such as phosphate, pyrophosphate, EDTA, and humic acid could significantly enhance permanganate oxidation of triclosan (one phenolic biocide), which was explained by the contribution of ligand-stabilized reactive manganese intermediates in situ formed upon permanganate reduction. To further understand the underlying mechanism, we comparatively investigated the influence of ligands on permanganate oxidation of bisphenol A (BPA, one phenolic endocrine-disrupting chemical), carbamazepine (CBZ, a pharmaceutical containing the olefinic group), and methyl p-tolyl sulfoxide (TMSO, a typical oxygen-atom acceptor). Selected ligands exerted oxidation enhancement for BPA but had negligible influence for CBZ and TMSO. This was mainly attributed to the effects of identified Mn(III) complexes, which would otherwise disproportionate spontaneously in the absence of ligands. The one-electron oxidant Mn(III) species exhibited no reactivity toward CBZ and TMSO for which the two-electron oxygen donation may be the primary oxidation mechanism but readily oxidized BPA. The latter case was a function of pH, the complexing ligand, and the molar [Mn(III)]:[ligand] ratio, generally consistent with the patterns of ligand-affected permanganate oxidation. Moreover, the combination of the one-electron reduction of Mn(III) (Mn(III) + e(-) -->Mn(II)) and the Mn(VII)/Mn(II) reaction in excess ligands (Mn(VII) + 4Mn(II) ----> (ligands) 5Mn(III)) suggested a catalytic role of the Mn(III)/Mn(II) pair in permanganate oxidation of some phenolics in the presence of ligands.
Bime, Christian; Pouladi, Nima; Sammani, Saad; Batai, Ken; Casanova, Nancy; Zhou, Tong; Kempf, Carrie L; Sun, Xiaoguang; Camp, Sara M; Wang, Ting; Kittles, Rick A; Lussier, Yves A; Jones, Tiffanie K; Reilly, John P; Meyer, Nuala J; Christie, Jason D; Karnes, Jason H; Gonzalez-Garay, Manuel; Christiani, David C; Yates, Charles R; Wurfel, Mark M; Meduri, Gianfranco U; Garcia, Joe G N
2018-06-01
Genetic factors are involved in acute respiratory distress syndrome (ARDS) susceptibility. Identification of novel candidate genes associated with increased risk and severity will improve our understanding of ARDS pathophysiology and enhance efforts to develop novel preventive and therapeutic approaches. To identify genetic susceptibility targets for ARDS. A genome-wide association study was performed on 232 African American patients with ARDS and 162 at-risk control subjects. The Identify Candidate Causal SNPs and Pathways platform was used to infer the association of known gene sets with the top prioritized intragenic SNPs. Preclinical validation of SELPLG (selectin P ligand gene) was performed using mouse models of LPS- and ventilator-induced lung injury. Exonic variation within SELPLG distinguishing patients with ARDS from sepsis control subjects was confirmed in an independent cohort. Pathway prioritization analysis identified a nonsynonymous coding SNP (rs2228315) within SELPLG, encoding P-selectin glycoprotein ligand 1, to be associated with increased susceptibility. In an independent cohort, two exonic SELPLG SNPs were significantly associated with ARDS susceptibility. Additional support for SELPLG as an ARDS candidate gene was derived from preclinical ARDS models where SELPLG gene expression in lung tissues was significantly increased in both ventilator-induced (twofold increase) and LPS-induced (5.7-fold increase) murine lung injury models compared with controls. Furthermore, Selplg -/- mice exhibited significantly reduced LPS-induced inflammatory lung injury compared with wild-type C57/B6 mice. Finally, an antibody that neutralizes P-selectin glycoprotein ligand 1 significantly attenuated LPS-induced lung inflammation. These findings identify SELPLG as a novel ARDS susceptibility gene among individuals of European and African descent.
Bryant, Kirsten L.; Antonyak, Marc A.; Cerione, Richard A.; Baird, Barbara; Holowka, David
2013-01-01
Deregulation of ErbB receptor-tyrosine kinases is a hallmark of many human cancers. Conserved in the ErbB family is a cluster of basic amino acid residues in the cytoplasmic juxtamembrane region. We found that charge-silencing mutagenesis within this juxtamembrane region of the epidermal growth factor receptor (EGFR) results in the generation of a mutant receptor (EGFR Mut R1-6) that spontaneously transforms NIH 3T3 cells in a ligand-independent manner. A similar mutant with one additional basic residue, EGFR Mut R1-5, fails to exhibit ligand-independent transformation. The capacity of EGFR Mut R1-6 to mediate this transformation is maintained when this mutant is retained in the endoplasmic reticulum via a single point mutation, L393H, which we describe. We show that EGFR Mut R1-6 with or without L393H exhibits enhanced basal tyrosine phosphorylation when ectopically expressed, and the ligand-independent transforming activity of EGFR Mut R1-6 is sensitive to inhibition of EGFR kinase activity and is particularly dependent on PI3K and mTOR activity. Similar to EGFR Mut R1-6/L393H in NIH 3T3 cells, EGFR variant type III, a highly oncogenic mutant form of EGFR linked to human brain cancers, confers transforming activity while it is wholly endoplasmic reticulum-retained in U87 cells. Our findings highlight the importance of the polybasic juxtamembrane sequence in regulating the oncogenic potential of EGFR signaling. PMID:24142702
NASA Technical Reports Server (NTRS)
Miskowski, Vincent M.; Houlding, Virginia H.
1989-01-01
Two types of emission behavior for Pt(II) complexes containing alpha-diimine ligands have been observed in dilute solution. If the complex also has weak field ligands such as chloride, ligand field (d-d) excited states become the lowest energy excited states. If only strong field ligands are present, a diimine 3(pi-pi/asterisk/) state becomes the lowest. In none of the cases studied did metal-to-ligand charge transfer excited state lie lowest.
Flexible ligand docking using a genetic algorithm
NASA Astrophysics Data System (ADS)
Oshiro, C. M.; Kuntz, I. D.; Dixon, J. Scott
1995-04-01
Two computational techniques have been developed to explore the orientational and conformational space of a flexible ligand within an enzyme. Both methods use the Genetic Algorithm (GA) to generate conformationally flexible ligands in conjunction with algorithms from the DOCK suite of programs to characterize the receptor site. The methods are applied to three enzyme-ligand complexes: dihydrofolate reductase-methotrexate, thymidylate synthase-phenolpthalein and HIV protease-thioketal haloperidol. Conformations and orientations close to the crystallographically determined structures are obtained, as well as alternative structures with low energy. The potential for the GA method to screen a database of compounds is also examined. A collection of ligands is evaluated simultaneously, rather than docking the ligands individually into the enzyme.
Identifying Marine Copper-Binding Ligands in Seawater
NASA Astrophysics Data System (ADS)
Whitby, H.; Hollibaugh, J. T.; Maldonado, M. T.; Ouchi, S.; van den Berg, S. M.
2016-02-01
Complexation reactions are important because they affect the bioavailability of trace metals such as copper and iron. For example, organic complexation can determine whether copper is a limiting or a toxic micronutrient at natural levels. Copper competes with iron for complexing ligands, and when iron is limiting, copper can also substitute for iron in some metabolic pathways. The speciation of copper can be measured using complexing capacity titrations, which provide the concentration of individual ligand classes (L1, L2 etc.) and the complex stabilities (log K). Using methods recently developed in our laboratory, we show that the ligands within these classes can be measured independently of titrations, thus confirming the titration method and simultaneously identifying the ligands within each class. Thiols were identified as the L1 ligand class and humic compounds as the weaker L2 class in samples from coastal Georgia, USA, collected monthly from April to December. Log K values of the ligand complexes were consistent with values expected for thiols and humic substances. Recent results from culture studies and from samples collected along Line P, a coastal - oceanic transect in the HNLC region of the NE subarctic Pacific, will be presented in comparison to the estuarine results. This comparison will help to broaden our perspective on copper complexation and the ligands responsible, furthering our understanding of ligand sources and life cycles.
PoLi: A Virtual Screening Pipeline Based On Template Pocket And Ligand Similarity
Roy, Ambrish; Srinivasan, Bharath; Skolnick, Jeffrey
2015-01-01
Often in pharmaceutical research, the goal is to identify small molecules that can interact with and appropriately modify the biological behavior of a new protein target. Unfortunately, most proteins lack both known structures and small molecule binders, prerequisites of many virtual screening, VS, approaches. For such proteins, ligand homology modeling, LHM, that copies ligands from homologous and perhaps evolutionarily distant template proteins, has been shown to be a powerful VS approach to identify possible binding ligands. However, if we want to target a specific pocket for which there is no homologous holo template protein structure, then LHM will not work. To address this issue, in a new pocket based approach, PoLi, we generalize LHM by exploiting the fact that the number of distinct small molecule ligand binding pockets in proteins is small. PoLi identifies similar ligand binding pockets in a holo-template protein library, selectively copies relevant parts of template ligands and uses them for VS. In practice, PoLi is a hybrid structure and ligand based VS algorithm that integrates 2D fingerprint-based and 3D shape-based similarity metrics for improved virtual screening performance. On standard DUD and DUD-E benchmark databases, using modeled receptor structures, PoLi achieves an average enrichment factor of 13.4 and 9.6 respectively, in the top 1% of the screened library. In contrast, traditional docking based VS using AutoDock Vina and homology-based VS using FINDSITEfilt have an average enrichment of 1.6 (3.0) and 9.0 (7.9) on the DUD (DUD-E) sets respectively. Experimental validation of PoLi predictions on dihydrofolate reductase, DHFR, using differential scanning fluorimetry, DSF, identifies multiple ligands with diverse molecular scaffolds, thus demonstrating the advantage of PoLi over current state-of-the-art VS methods. PMID:26225536
a Migration Well Model for the Binding of Ligands to Heme Proteins.
NASA Astrophysics Data System (ADS)
Beece, Daniel Kenneth
The binding of carbon monoxide and dioxygen to heme proteins can be viewed as occurring in distinct stages: diffusion in the solvent, migration through the matrix, and occupation of the pocket before the final binding step. A model is presented which can explain the dominant kinetic behavior of several different heme protein-ligand systems. The model assumes that a ligand molecule in the solvent sequentially encounters discrete energy barriers on the way to the binding site. The rate to surmount each barrier is distributed, except for the pseudofirst order rate corresponding to the step into the protein from the solvent. The migration through the matrix is equivalent to a small number of distinct jumps. Quantitative analysis of the data permit estimates of the barrier heights, preexponentials and solvent coupling factors for each rate. A migration coefficient and a matrix occupation factor are defined.
Structures of undecagold clusters: Ligand effect
NASA Astrophysics Data System (ADS)
Spivey, Kasi; Williams, Joseph I.; Wang, Lichang
2006-12-01
The most stable structure of undecagold, or Au 11, clusters was predicted from our DFT calculations to be planar [L. Xiao, L. Wang, Chem. Phys. Lett. 392 (2004) 452; L. Xiao, B. Tollberg, X. Hu, L. Wang, J. Chem. Phys. 124 (2005) 114309.]. The structures of ligand protected undecagold clusters were shown to be three-dimensional experimentally. In this work, we used DFT calculations to study the ligand effect on the structures of Au 11 clusters. Our results show that the most stable structure of Au 11 is in fact three-dimensional when SCH 3 ligands are attached. This indicates that the structures of small gold clusters are altered substantially in the presence of ligands.
Gill, Samuel C; Lim, Nathan M; Grinaway, Patrick B; Rustenburg, Ariën S; Fass, Josh; Ross, Gregory A; Chodera, John D; Mobley, David L
2018-05-31
Accurately predicting protein-ligand binding affinities and binding modes is a major goal in computational chemistry, but even the prediction of ligand binding modes in proteins poses major challenges. Here, we focus on solving the binding mode prediction problem for rigid fragments. That is, we focus on computing the dominant placement, conformation, and orientations of a relatively rigid, fragment-like ligand in a receptor, and the populations of the multiple binding modes which may be relevant. This problem is important in its own right, but is even more timely given the recent success of alchemical free energy calculations. Alchemical calculations are increasingly used to predict binding free energies of ligands to receptors. However, the accuracy of these calculations is dependent on proper sampling of the relevant ligand binding modes. Unfortunately, ligand binding modes may often be uncertain, hard to predict, and/or slow to interconvert on simulation time scales, so proper sampling with current techniques can require prohibitively long simulations. We need new methods which dramatically improve sampling of ligand binding modes. Here, we develop and apply a nonequilibrium candidate Monte Carlo (NCMC) method to improve sampling of ligand binding modes. In this technique, the ligand is rotated and subsequently allowed to relax in its new position through alchemical perturbation before accepting or rejecting the rotation and relaxation as a nonequilibrium Monte Carlo move. When applied to a T4 lysozyme model binding system, this NCMC method shows over 2 orders of magnitude improvement in binding mode sampling efficiency compared to a brute force molecular dynamics simulation. This is a first step toward applying this methodology to pharmaceutically relevant binding of fragments and, eventually, drug-like molecules. We are making this approach available via our new Binding modes of ligands using enhanced sampling (BLUES) package which is freely available on GitHub.
Assessment of automatic ligand building in ARP/wARP.
Evrard, Guillaume X; Langer, Gerrit G; Perrakis, Anastassis; Lamzin, Victor S
2007-01-01
The efficiency of the ligand-building module of ARP/wARP version 6.1 has been assessed through extensive tests on a large variety of protein-ligand complexes from the PDB, as available from the Uppsala Electron Density Server. Ligand building in ARP/wARP involves two main steps: automatic identification of the location of the ligand and the actual construction of its atomic model. The first step is most successful for large ligands. The second step, ligand construction, is more powerful with X-ray data at high resolution and ligands of small to medium size. Both steps are successful for ligands with low to moderate atomic displacement parameters. The results highlight the strengths and weaknesses of both the method of ligand building and the large-scale validation procedure and help to identify means of further improvement.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niu, Shuqiang; Ichiye, Toshiko
A central issue in understanding redox properties of iron-sulfur proteins is determining the factors that tune the reduction potentials of the Fe-S clusters. Recently, Solomon and coworkers have shown that the Fe-S bond covalency of protein analogs measured by %L, the percent ligand character of the Fe 3d orbitals, from ligand K-edge X-ray absorption spectroscopy (XAS) correlates with the electrochemical redox potentials. Also, Wang and coworkers have measured electron detachment energies for iron-sulfur clusters without environmental perturbations by gas-phase photoelectron spectroscopy (PES). Here the correlations of the ligand character with redox energy and %L character are examined in [Fe₄S₄L₄]2⁻ clustersmore » with different ligands by broken symmetry density functional theory (BS-DFT) calculations using the B3LYP functional together with PES and XAS experimental results. These gas-phase studies assess ligand effects independently of environmental perturbations and thus provide essential information for computational studies of iron-sulfur proteins. The B3LYP oxidation energies agree well with PES data, and the %L character obtained from natural bond orbital analysis correlates with XAS values, although it systematically underestimates them because of basis set effects. The results show that stronger electron-donating terminal ligands increase %Lt, the percent ligand character from terminal ligands, but decrease %Sb, the percent ligand character from the bridging sulfurs. Because the oxidized orbital has significant Fe-Lt antibonding character, the oxidation energy correlates well with %Lt. However, because the reduced orbital has varying contributions of both Fe-Lt and Fe-Sb antibonding character, the reduction energy does not correlate with either %Lt or %Sb. Overall, BSDFT calculations together with XAS and PES experiments can unravel the complex underlying factors in the redox energy and chemical bonding of the [4Fe-4S] clusters in iron
Woo, James A; Chen, Hong; Snyder, Mark A; Chai, Yiming; Frost, Russell G; Cramer, Steven M
2015-08-14
A homologous ligand library based on the commercially-available Nuvia cPrime ligand was generated to systematically explore various features of a multimodal cation-exchange ligand and to identify structural variants that had significantly altered chromatographic selectivity. Substitution of the polar amide bond with more hydrophobic chemistries was found to enhance retention while remaining hydrophobically-selective for aromatic residues. In contrast, increasing the solvent exposure of the aromatic ring was observed to strengthen the ligand affinity for both types of hydrophobic residues. An optimal linker length between the charged and hydrophobic moieties was also observed to enhance retention, balancing the steric accessibility of the hydrophobic moiety with its ability to interact independently of the charged group. The weak pKa of the carboxylate charge group was found to have a notable impact on protein retention on Nuvia cPrime at lower pH, increasing hydrophobic interactions with the protein. Substituting the charged group with a sulfonic acid allowed this strong MM ligand to retain its electrostatic-dominant character in this lower pH range. pH gradient experiments were also carried out to further elucidate this pH dependent behavior. A single QSAR model was generated using this accumulated experimental data to predict protein retention across a range of multimodal and ion exchange systems. This model could correctly predict the retention of proteins on resins that were not included in the original model and could prove quite powerful as an in silico approach toward designing more effective and differentiated multimodal ligands. Copyright © 2015. Published by Elsevier B.V.
Do, Bich Hang; Nguyen, Minh Tan; Song, Jung-A; Park, Sangsu; Yoo, Jiwon; Jang, Jaepyeong; Lee, Sunju; So, Seoungjun; Yoon, Yejin; Kim, Inki; Lee, Kyungjin; Jang, Yeon Jin; Choe, Han
2017-12-28
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is considered as an antitumor agent owing to its ability to induce apoptosis of cancer cells without imparting toxicity toward most normal cells. TRAIL is produced in poor yield because of its insoluble expression in the cytoplasm of E. coli . In this study, we achieved soluble expression of TRAIL by fusing maltose-binding protein (MBP), b'a' domain of protein disulfide isomerase (PDIb'a'), or protein disulfide isomerase at the N-terminus of TRAIL. The TRAIL was purified using subsequent immobilized metal affinity chromatography and amylose-binding chromatography, with the tag removal using tobacco etch virus protease. Approximately 4.5 mg of pure TRAIL was produced from 125 ml flask culture with a purification yield of 71.6%. The endotoxin level of the final product was 0.4 EU/μg, as measured by the Limulus amebocyte lysate endotoxin assay. The purified TRAIL was validated and shown to cause apoptosis of HeLa cells with an EC₅₀ and Hill coefficient of 0.6 ± 0.03 nM and 2.41 ± 0.15, respectively. The high level of apoptosis in HeLa cells following administration of purified TRAIL indicates the significance and novelty of this method for producing high-grade and high-yield TRAIL.
Scoring ligand similarity in structure-based virtual screening.
Zavodszky, Maria I; Rohatgi, Anjali; Van Voorst, Jeffrey R; Yan, Honggao; Kuhn, Leslie A
2009-01-01
Scoring to identify high-affinity compounds remains a challenge in virtual screening. On one hand, protein-ligand scoring focuses on weighting favorable and unfavorable interactions between the two molecules. Ligand-based scoring, on the other hand, focuses on how well the shape and chemistry of each ligand candidate overlay on a three-dimensional reference ligand. Our hypothesis is that a hybrid approach, using ligand-based scoring to rank dockings selected by protein-ligand scoring, can ensure that high-ranking molecules mimic the shape and chemistry of a known ligand while also complementing the binding site. Results from applying this approach to screen nearly 70 000 National Cancer Institute (NCI) compounds for thrombin inhibitors tend to support the hypothesis. EON ligand-based ranking of docked molecules yielded the majority (4/5) of newly discovered, low to mid-micromolar inhibitors from a panel of 27 assayed compounds, whereas ranking docked compounds by protein-ligand scoring alone resulted in one new inhibitor. Since the results depend on the choice of scoring function, an analysis of properties was performed on the top-scoring docked compounds according to five different protein-ligand scoring functions, plus EON scoring using three different reference compounds. The results indicate that the choice of scoring function, even among scoring functions measuring the same types of interactions, can have an unexpectedly large effect on which compounds are chosen from screening. Furthermore, there was almost no overlap between the top-scoring compounds from protein-ligand versus ligand-based scoring, indicating the two approaches provide complementary information. Matchprint analysis, a new addition to the SLIDE (Screening Ligands by Induced-fit Docking, Efficiently) screening toolset, facilitated comparison of docked molecules' interactions with those of known inhibitors. The majority of interactions conserved among top-scoring compounds for a given scoring
Sarlati, Fatemeh; Sattari, Mandana; Razzaghi, Shilan; Nasiri, Malihe
2012-01-01
Background: Osteoclastogenesis is coordinated by the interaction of three members of the tumor necrosis factor (TNF) superfamily: Osteoprotegerin (OPG)/receptor activator of nuclear factor kappa B ligand (RANKL)/receptor activator of nuclear factor kappa B (RANK). The aim of this study was to investigate RANKL and OPG levels, and their relative ratio in gingival crevicular fluid (GCF) of patients with chronic and aggressive periodontitis, as well as healthy controls. Materials and Methods: In this analytical study, GCF was obtained from healthy (n = 10), mild chronic periodontitis (n = 18), moderate chronic periodontitis (n = 18), severe chronic periodontitis (n = 20), and generalized aggressive periodontitis (n = 20) subjects. RANKL and OPG concentrations were measured by enzyme-linked immunosorbent assay. Statistical tests used were Kruskal–Wallis test, Mann–Whitney U rank sum test, and Spearman's rank correlation analysis. The level of statistical significance was set at P < 0.05. Results: Mean RANKL concentration showed no statistically significant differences between groups (P = 0.58). There were also no significant differences between mean OPG concentration in the five groups (P = 0.0.56). Moreover, relative RANKL/OPG ratio did not reveal a significant difference between the three study group subjects: healthy, chronic periodontitis (mild, moderate, severe), and aggressive periodontitis (P = 0.41). There was statistically significant correlation between the concentration of sRANKL and Clinical Attachment Level (CAL) in moderate chronic periodontitis patients (R = 0.48, P = 0.04). There was also negative correlation between OPG concentration and CAL in moderate chronic periodontitis patients, although not significant (R = −0.13). Conclusion: RANKL was prominent in periodontitis sites, especially in moderate periodontitis patients, whereas OPG was not detectable in some diseased sites with bleeding on probing, supporting the role of these two molecules in
Ligand structure and mechanical properties of single-nanoparticle-thick membranes.
Salerno, K Michael; Bolintineanu, Dan S; Lane, J Matthew D; Grest, Gary S
2015-06-01
The high mechanical stiffness of single-nanoparticle-thick membranes is believed to result from the local structure of ligand coatings that mediate interactions between nanoparticles. These ligand structures are not directly observable experimentally. We use molecular dynamics simulations to observe variations in ligand structure and simultaneously measure variations in membrane mechanical properties. We have shown previously that ligand end group has a large impact on ligand structure and membrane mechanical properties. Here we introduce and apply quantitative molecular structure measures to these membranes and extend analysis to multiple nanoparticle core sizes and ligand lengths. Simulations of nanoparticle membranes with a nanoparticle core diameter of 4 or 6 nm, a ligand length of 11 or 17 methylenes, and either carboxyl (COOH) or methyl (CH(3)) ligand end groups are presented. In carboxyl-terminated ligand systems, structure and interactions are dominated by an end-to-end orientation of ligands. In methyl-terminated ligand systems large ordered ligand structures form, but nanoparticle interactions are dominated by disordered, partially interdigitated ligands. Core size and ligand length also affect both ligand arrangement within the membrane and the membrane's macroscopic mechanical response, but are secondary to the role of the ligand end group. Moreover, the particular end group (COOH or CH(3)) alters the nature of how ligand length, in turn, affects the membrane properties. The effect of core size does not depend on the ligand end group, with larger cores always leading to stiffer membranes. Asymmetry in the stress and ligand density is observed in membranes during preparation at a water-vapor interface, with the stress asymmetry persisting in all membranes after drying.
Ligand structure and mechanical properties of single-nanoparticle thick membranes
Salerno, Kenneth Michael; Bolintineanu, Dan S.; Lane, J. Matthew D.; ...
2015-06-16
We believe that the high mechanical stiffness of single-nanoparticle-thick membranes is the result of the local structure of ligand coatings that mediate interactions between nanoparticles. These ligand structures are not directly observable experimentally. We use molecular dynamics simulations to observe variations in ligand structure and simultaneously measure variations in membrane mechanical properties. We have shown previously that ligand end group has a large impact on ligand structure and membrane mechanical properties. Here we introduce and apply quantitative molecular structure measures to these membranes and extend analysis to multiple nanoparticle core sizes and ligand lengths. Simulations of nanoparticle membranes with amore » nanoparticle core diameter of 4 or 6 nm, a ligand length of 11 or 17 methylenes, and either carboxyl (COOH) or methyl (CH 3) ligand end groups are presented. In carboxyl-terminated ligand systems, structure and interactions are dominated by an end-to-end orientation of ligands. In methyl-terminated ligand systems large ordered ligand structures form, but nanoparticle interactions are dominated by disordered, partially interdigitated ligands. Core size and ligand length also affect both ligand arrangement within the membrane and the membrane's macroscopic mechanical response, but are secondary to the role of the ligand end group. Additionally, the particular end group (COOH or CH 3) alters the nature of how ligand length, in turn, affects the membrane properties. The effect of core size does not depend on the ligand end group, with larger cores always leading to stiffer membranes. Asymmetry in the stress and ligand density is observed in membranes during preparation at a water-vapor interface, with the stress asymmetry persisting in all membranes after drying.« less
High-throughput screening of dye-ligands for chromatography.
Kumar, Sunil; Punekar, Narayan S
2014-01-01
Dye-ligand-based chromatography has become popular after Cibacron Blue, the first reactive textile dye, found application for protein purification. Many other textile dyes have since been successfully used to purify a number of proteins and enzymes. While the exact nature of their interaction with target proteins is often unclear, dye-ligands are thought to mimic the structural features of their corresponding substrates, cofactors, etc. The dye-ligand affinity matrices are therefore considered pseudo-affinity matrices. In addition, dye-ligands may simply bind with proteins due to electrostatic, hydrophobic, and hydrogen-bonding interactions. Because of their low cost, ready availability, and structural stability, dye-ligand affinity matrices have gained much popularity. Choice of a large number of dye structures offers a range of matrices to be prepared and tested. When presented in the high-throughput screening mode, these dye-ligand matrices provide a formidable tool for protein purification. One could pick from the list of dye-ligands already available or build a systematic library of such structures for use. A high-throughput screen may be set up to choose best dye-ligand matrix as well as ideal conditions for binding and elution, for a given protein. The mode of operation could be either manual or automated. The technology is available to test the performance of dye-ligand matrices in small volumes in an automated liquid-handling workstation. Screening a systematic library of dye-ligand structures can help establish a structure-activity relationship. While the origins of dye-ligand chromatography lay in exploiting pseudo-affinity, it is now possible to design very specific biomimetic dye structures. High-throughput screening will be of value in this endeavor as well.
Deciphering CD30 ligand biology and its role in humoral immunity
Kennedy, Mary K; Willis, Cynthia R; Armitage, Richard J
2006-01-01
Ligands and receptors in the tumour necrosis factor (TNF) and tumour necrosis factor receptor (TNFR) superfamilies have been the subject of extensive investigation over the past 10–15 years. For certain TNFR family members, such as Fas and CD40, some of the consequences of receptor ligation were predicted before the identification and cloning of their corresponding ligands through in vitro functional studies using agonistic receptor-specific antibodies. For other members of the TNFR family, including CD30, cross-linking the receptor with specific antibodies failed to yield many clues about the functional significance of the relevant ligand–receptor interactions. In many instances, the subsequent availability of TNF family ligands in the form of recombinant protein facilitated the determination of biological consequences of interactions with their relevant receptor in both in vitro and in vivo settings. In the case of CD30 ligand (CD30L; CD153), definition of its biological role remained frustratingly elusive. Early functional studies using CD30L+ cells or agonistic CD30-specific antibodies logically focused attention on cell types that had been shown to express CD30, namely certain lymphoid malignancies and subsets of activated T cells. However, it was not immediately clear how the reported activities from these in vitro studies relate to the biological activity of CD30L in the more complex whole animal setting. Recently, results from in vivo models involving CD30 or CD30L gene disruption, CD30L overexpression, or pharmacological blockade of CD30/CD30L interactions have begun to provide clues about the role played by CD30L in immunological processes. In this review we consider the reported biology of CD30L and focus on results from several recent studies that point to an important role for CD30/CD30L interactions in humoral immune responses. PMID:16771849
Pacifico, Lucia; Andreoli, Gian Marco; D'Avanzo, Miriam; De Mitri, Delia; Pierimarchi, Pasquale
2018-05-21
Concomitantly with the increase in the prevalences of overweight/obesity, nonalcoholic fatty liver disease (NAFLD) has worldwide become the main cause of chronic liver disease in both adults and children. Patients with fatty liver display features of metabolic syndrome (MetS), like insulin resistance (IR), glucose intolerance, hypertension and dyslipidemia. Recently, epidemiological studies have linked obesity, MetS, and NAFLD to decreased bone mineral density and osteoporosis, highlighting an intricate interplay among bone, adipose tissue, and liver. Osteoprotegerin (OPG), an important symbol of the receptor activator of nuclear factor-B ligand/receptor activator of nuclear factor kappa B/OPG system activation, typically considered for its role in bone metabolism, may also play critical roles in the initiation and perpetuation of obesity-related comorbidities. Clinical data have indicated that OPG concentrations are associated with hypertension, left ventricular hypertrophy, vascular calcification, endothelial dysfunction, and severity of liver damage in chronic hepatitis C. Nonetheless, the relationship between circulating OPG and IR as a key feature of MetS as well as between OPG and NAFLD remains uncertain. Thus, the aims of the present review are to provide the existent knowledge on these associations and to discuss briefly the underlying mechanisms linking OPG and NAFLD.
Huang, Xiao X; McCaughan, Geoffrey W; Shackel, Nicholas A; Gorrell, Mark D
2007-09-01
Cirrhosis can lead to hepatocellular carcinoma (HCC). Non-diseased liver and hepatitis C virus (HCV)-associated cirrhosis with or without HCC were compared. Proliferation pathway genes, immune response genes and oncogenes were analysed by a quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and immunostaining. Real-time RT-PCR showed up-regulation of genes in HCV cirrhosis including the proliferation-associated genes bone morphogenetic protein 3 (BMP3), placental growth factor 3 (PGF3), vascular endothelial growth factor receptor 1 (VEGFR1) and soluble VEGFR1, the oncogene FYN, and the immune response-associated genes toll-like receptor 9 (TLR9) and natural killer cell transcript 4 (NK4). Expressions of TLR2 and the oncogenes B-cell CLL/lymphoma 9 (BCL9) and PIM2 were decreased in HCV cirrhosis. In addition, PIM2 and TLR2 were increased in HCV cirrhosis with HCC compared with HCV cirrhosis. The ligand/receptor pair PGF and VEGFR1 was intensely expressed by the portal tract vascular endothelium. VEGFR1 was expressed in reactive biliary epithelial structures in fibrotic septum and in some stellate cells and macrophages. PGF and VEGFR1 may have an important role in the pathogenesis of the neovascular response in cirrhosis.
The effect of post-synthesis aging on the ligand exchange activity of iron oxide nanoparticles.
Davis, Kathleen; Vidmar, Michael; Khasanov, Airat; Cole, Brian; Ghelardini, Melanie; Mayer, Justin; Kitchens, Christopher; Nath, Amar; Powell, Brian A; Mefford, O Thompson
2018-02-01
Ligand exchange is a widely-used method of controlling the surface chemistry of nanomaterials. Exchange is dependent on many factors including the age of the core particle being modified. Aging of the particles can impact surface structure and composition, which in turn can affect ligand binding. To quantify the effects of aging on ligand exchange, we employed a technique to track the exchange of radiolabeled 14 C-oleic acid with unlabeled, oleic acid bound to iron oxide nanoparticles. Liquid scintillation counting (LSC) was used to determine the amount of 14 C-oleic acid adsorbing to the particles throughout the duration of the exchange for particles aged for 2days, 7days, and 30days. Results revealed an increase in the total amount of ligands exchanged with aging up to 30days. Kinetic analysis of these results revealed a significant decrease in the overall rate of ligand exchange between 2 and 30days. The change in extent of adsorption with age could suggest increased availability of free binding sites. A follow-up study comparing exchange with oxidized and unoxidized particles suggested this increase in ligand adsorption may be due to changes in the Fe 2+ /Fe 3+ ratio on the surface as the particles aged. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Abd El-Halim, Hanan F.; Mohamed, Gehad G.; Khalil, Eman A. M.
2017-10-01
A series of mixed ligand complexes were prepared from the Schiff base (L1) as a primary ligand, prepared by condensation of oxamide and furan-2-carbaldehyde, and 1,10-phenanthroline (1,10-phen) as a secondary ligand. The Schiff base ligand and its mixed ligand chelates were characterized based on elemental analysis, IR, 1H NMR, thermal analysis, UV-Visible, mass, molar conductance, magnetic moment. X-ray diffraction, solid reflectance and ESR also have been studied. The mixed ligand complexes were found to have the formulae of [M(L1) (1,10-phen)]Clm.nH2O (M = Cr(III) and Fe(III) (m = 3) (n = 0); M = Mn(II), Cu(II) and Cd(II) (m = 2) (n = 0); and M = Co(II) (m = 2) (n = 1), Ni(II) (m = 2) (n = 2) and Zn(II) (m = 2) (n = 3)) and that the geometrical structure of the complexes were octahedral. The parameters of thermodynamic using Coats-Redfern and Horowitz-Metzger equations were calculated. The synthesized Schiff base ligand, 1,10-phenanthroline ligand and Their mixed ligand complexes were also investigated for their antibacterial and antifungal activity against bacterial species (Gram-Ve bacteria: Pseudomonas aeruginosa and Escherichia coli) and (Gram + Ve bacteria: Bacillus subtilis and Streptococcus pneumonia) and fungi (Aspergillus fumigates and Candida albicans). The anticancer activity of the new compounds had been tested against breast (MFC7) and colon (HCT-116) cell lines. The results showed high activity for the synthesized compounds.
Multivalent ligands control stem cell behaviour in vitro and in vivo
NASA Astrophysics Data System (ADS)
Conway, Anthony; Vazin, Tandis; Spelke, Dawn P.; Rode, Nikhil A.; Healy, Kevin E.; Kane, Ravi S.; Schaffer, David V.
2013-11-01
There is broad interest in designing nanostructured materials that can interact with cells and regulate key downstream functions. In particular, materials with nanoscale features may enable control over multivalent interactions, which involve the simultaneous binding of multiple ligands on one entity to multiple receptors on another and are ubiquitous throughout biology. Cellular signal transduction of growth factor and morphogen cues (which have critical roles in regulating cell function and fate) often begins with such multivalent binding of ligands, either secreted or cell-surface-tethered to target cell receptors, leading to receptor clustering. Cellular mechanisms that orchestrate ligand-receptor oligomerization are complex, however, so the capacity to control multivalent interactions and thereby modulate key signalling events within living systems is currently very limited. Here, we demonstrate the design of potent multivalent conjugates that can organize stem cell receptors into nanoscale clusters and control stem cell behaviour in vitro and in vivo. The ectodomain of ephrin-B2, normally an integral membrane protein ligand, was conjugated to a soluble biopolymer to yield multivalent nanoscale conjugates that potently induce signalling in neural stem cells and promote their neuronal differentiation both in culture and within the brain. Super-resolution microscopy analysis yielded insights into the organization of the receptor-ligand clusters at the nanoscale. We also found that synthetic multivalent conjugates of ephrin-B1 strongly enhance human embryonic and induced pluripotent stem cell differentiation into functional dopaminergic neurons. Multivalent bioconjugates are therefore powerful tools and potential nanoscale therapeutics for controlling the behaviour of target stem cells in vitro and in vivo.
Shemon, Anne N; Heil, Gary L; Granovsky, Alexey E; Clark, Mathew M; McElheny, Dan; Chimon, Alexander; Rosner, Marsha R; Koide, Shohei
2010-05-05
Raf kinase inhibitory protein (RKIP), also known as phoshaptidylethanolamine binding protein (PEBP), has been shown to inhibit Raf and thereby negatively regulate growth factor signaling by the Raf/MAP kinase pathway. RKIP has also been shown to suppress metastasis. We have previously demonstrated that RKIP/Raf interaction is regulated by two mechanisms: phosphorylation of RKIP at Ser-153, and occupation of RKIP's conserved ligand binding domain with a phospholipid (2-dihexanoyl-sn-glycero-3-phosphoethanolamine; DHPE). In addition to phospholipids, other ligands have been reported to bind this domain; however their binding properties remain uncharacterized. In this study, we used high-resolution heteronuclear NMR spectroscopy to screen a chemical library and assay a number of potential RKIP ligands for binding to the protein. Surprisingly, many compounds previously postulated as RKIP ligands showed no detectable binding in near-physiological solution conditions even at millimolar concentrations. In contrast, we found three novel ligands for RKIP that specifically bind to the RKIP pocket. Interestingly, unlike the phospholipid, DHPE, these newly identified ligands did not affect RKIP binding to Raf-1 or RKIP phosphorylation. One out of the three ligands displayed off target biological effects, impairing EGF-induced MAPK and metabolic activity. This work defines the binding properties of RKIP ligands under near physiological conditions, establishing RKIP's affinity for hydrophobic ligands and the importance of bulky aliphatic chains for inhibiting its function. The common structural elements of these compounds defines a minimal requirement for RKIP binding and thus they can be used as lead compounds for future design of RKIP ligands with therapeutic potential.
PDBToSDF: Create ligand structure files from PDB file.
Muppalaneni, Naresh Babu; Rao, Allam Appa
2011-01-01
Protein Data Bank (PDB) file contains atomic data for protein and ligand in protein-ligand complexes. Structure data file (SDF) contains data for atoms, bonds, connectivity and coordinates of molecule for ligands. We describe PDBToSDF as a tool to separate the ligand data from pdb file for the calculation of ligand properties like molecular weight, number of hydrogen bond acceptors, hydrogen bond receptors easily.
Sampling protein motion and solvent effect during ligand binding
Limongelli, Vittorio; Marinelli, Luciana; Cosconati, Sandro; La Motta, Concettina; Sartini, Stefania; Mugnaini, Laura; Da Settimo, Federico; Novellino, Ettore; Parrinello, Michele
2012-01-01
An exhaustive description of the molecular recognition mechanism between a ligand and its biological target is of great value because it provides the opportunity for an exogenous control of the related process. Very often this aim can be pursued using high resolution structures of the complex in combination with inexpensive computational protocols such as docking algorithms. Unfortunately, in many other cases a number of factors, like protein flexibility or solvent effects, increase the degree of complexity of ligand/protein interaction and these standard techniques are no longer sufficient to describe the binding event. We have experienced and tested these limits in the present study in which we have developed and revealed the mechanism of binding of a new series of potent inhibitors of Adenosine Deaminase. We have first performed a large number of docking calculations, which unfortunately failed to yield reliable results due to the dynamical character of the enzyme and the complex role of the solvent. Thus, we have stepped up the computational strategy using a protocol based on metadynamics. Our approach has allowed dealing with protein motion and solvation during ligand binding and finally identifying the lowest energy binding modes of the most potent compound of the series, 4-decyl-pyrazolo[1,5-a]pyrimidin-7-one. PMID:22238423
B61 is a ligand for the ECK receptor protein-tyrosine kinase.
Bartley, T D; Hunt, R W; Welcher, A A; Boyle, W J; Parker, V P; Lindberg, R A; Lu, H S; Colombero, A M; Elliott, R L; Guthrie, B A
1994-04-07
A protein ligand for the ECK receptor protein-tyrosine kinase has been isolated by using the extracellular domain (ECK-X) of the receptor as an affinity reagent. Initially, concentrated cell culture supernatants were screened for receptor binding activity using immobilized ECK-X in a surface plasmon resonance detection system. Subsequently, supernatants from selected cell lines were fractionated directly by receptor affinity chromatography, resulting in the single-step purification of B61, a protein previously identified as the product of an early response gene induced by tumour necrosis factor-alpha. We report here that recombinant B61 induces autophosphorylation of ECK in intact cells, consistent with B61 being an authentic ligand for ECK. ECK is a member of a large orphan receptor protein-tyrosine kinase family headed by EPH, and we suggest that ligands for other members of this family will be related to B61, and can be isolated in the same way.
Guo, Yongfeng; Ni, Jun; Denver, Robert; Wang, Xiaohong; Clark, Steven E
2011-09-01
Nematodes that parasitize plant roots cause huge economic losses and have few mechanisms for control. Many parasitic nematodes infect plants by reprogramming root development to drive the formation of feeding structures. How nematodes take control of plant development is largely unknown. Here, we identify two host factors involved in the function of a receptor ligand mimic, GrCLE1, secreted by the potato cyst nematode Globodera rostochiensis. GrCLE1 is correctly processed to an active form by host plant proteases. Processed GrCLE1 peptides bind directly to the plant CLE receptors CLV2, BAM1, and BAM2. Involvement of these receptors in the ligand-mimicking process is also supported by the fact that the ability of GrCLE1 peptides to alter plant root development in Arabidopsis (Arabidopsis thaliana) is dependent on these receptors. Critically, we also demonstrate that GrCLE1 maturation can be entirely carried out by plant factors and that the availability of CLE processing activity may be essential for successful ligand mimicry.
All-inorganic Germanium nanocrystal films by cationic ligand exchange
Wheeler, Lance M.; Nichols, Asa W.; Chernomordik, Boris D.; ...
2016-01-21
In this study, we introduce a new paradigm for group IV nanocrystal surface chemistry based on room temperature surface activation that enables ionic ligand exchange. Germanium nanocrystals synthesized in a gas-phase plasma reactor are functionalized with labile, cationic alkylammonium ligands rather than with traditional covalently bound groups. We employ Fourier transform infrared and 1H nuclear magnetic resonance spectroscopies to demonstrate the alkylammonium ligands are freely exchanged on the germanium nanocrystal surface with a variety of cationic ligands, including short inorganic ligands such as ammonium and alkali metal cations. This ionic ligand exchange chemistry is used to demonstrate enhanced transport inmore » germanium nanocrystal films following ligand exchange as well as the first photovoltaic device based on an all-inorganic germanium nanocrystal absorber layer cast from solution. This new ligand chemistry should accelerate progress in utilizing germanium and other group IV nanocrystals for optoelectronic applications.« less
Denizli, A; Pişkin, E
2001-10-30
Dye-ligands have been considered as one of the important alternatives to natural counterparts for specific affinity chromatography. Dye-ligands are able to bind most types of proteins, in some cases in a remarkably specific manner. They are commercially available, inexpensive, and can easily be immobilized, especially on matrices bearing hydroxyl groups. Although dyes are all synthetic in nature, they are still classified as affinity ligands because they interact with the active sites of many proteins mimicking the structure of the substrates, cofactors, or binding agents for those proteins. A number of textile dyes, known as reactive dyes, have been used for protein purification. Most of these reactive dyes consist of a chromophore (either azo dyes, anthraquinone, or phathalocyanine), linked to a reactive group (often a mono- or dichlorotriazine ring). The interaction between the dye ligand and proteins can be by complex combination of electrostatic, hydrophobic, hydrogen bonding. Selection of the supporting matrix is the first important consideration in dye-affinity systems. There are several methods for immobilization of dye molecules onto the support matrix, in which usually several intermediate steps are followed. Both the adsorption and elution steps should carefully be optimized/designed for a successful separation. Dye-affinity systems in the form of spherical sorbents or as affinity membranes have been used in protein separation.
West, Graham M.; Willard, Francis S.; Sloop, Kyle W.; Showalter, Aaron D.; Pascal, Bruce D.; Griffin, Patrick R.
2014-01-01
Activation of the glucagon-like peptide-1 receptor (GLP-1R) in pancreatic β-cells potentiates insulin production and is a current therapeutic target for the treatment of type 2 diabetes mellitus (T2DM). Like other class B G protein-coupled receptors (GPCRs), the GLP-1R contains an N-terminal extracellular ligand binding domain. N-terminal truncations on the peptide agonist generate antagonists capable of binding to the extracellular domain, but not capable of activating full length receptor. The main objective of this study was to use Hydrogen/deuterium exchange (HDX) to identify how the amide hydrogen bonding network of peptide ligands and the extracellular domain of GLP-1R (nGLP-1R) were altered by binding interactions and to then use this platform to validate direct binding events for putative GLP-1R small molecule ligands. The HDX studies presented here for two glucagon-like peptide-1 receptor (GLP-1R) peptide ligands indicates that the antagonist exendin-4[9-39] is significantly destabilized in the presence of nonionic detergents as compared to the agonist exendin-4. Furthermore, HDX can detect stabilization of exendin-4 and exendin-4[9-39] hydrogen bonding networks at the N-terminal helix [Val19 to Lys27] upon binding to the N-terminal extracellular domain of GLP-1R (nGLP-1R). In addition we show hydrogen bonding network stabilization on nGLP-1R in response to ligand binding, and validate direct binding events with the extracellular domain of the receptor for putative GLP-1R small molecule ligands. PMID:25180755
Non-equivalence of Wnt and R-spondin ligands during Lgr5+ intestinal stem-cell self-renewal.
Yan, Kelley S; Janda, Claudia Y; Chang, Junlei; Zheng, Grace X Y; Larkin, Kathryn A; Luca, Vincent C; Chia, Luis A; Mah, Amanda T; Han, Arnold; Terry, Jessica M; Ootani, Akifumi; Roelf, Kelly; Lee, Mark; Yuan, Jenny; Li, Xiao; Bolen, Christopher R; Wilhelmy, Julie; Davies, Paige S; Ueno, Hiroo; von Furstenberg, Richard J; Belgrader, Phillip; Ziraldo, Solongo B; Ordonez, Heather; Henning, Susan J; Wong, Melissa H; Snyder, Michael P; Weissman, Irving L; Hsueh, Aaron J; Mikkelsen, Tarjei S; Garcia, K Christopher; Kuo, Calvin J
2017-05-11
between Wnt and RSPO ligands establishes a molecular precedent for regulation of mammalian stem cells by distinct priming and self-renewal factors, with broad implications for precise control of tissue regeneration.
Chelating ligands for nanocrystals' surface functionalization.
Querner, Claudia; Reiss, Peter; Bleuse, Joël; Pron, Adam
2004-09-22
A new family of ligands for the surface functionalization of CdSe nanocrystals is proposed, namely alkyl or aryl derivatives of carbodithioic acids (R-C(S)SH). The main advantages of these new ligands are as follows: they nearly quantitatively exchange the initial surface ligands (TOPO) in very mild conditions; they significantly improve the resistance of nanocrystals against photooxidation because of their ability of strong chelate-type binding to metal atoms; their relatively simple preparation via Grignard intermediates facilitates the development of new bifunctional ligands containing, in addition to the anchoring carbodithioate group, a second function, which enables the grafting of molecules or macromolecules of interest on the nanocrystal surface. To give an example of this approach, we report, for the first time, the grafting of an electroactive oligomer from the polyaniline family-aniline tetramer-on CdSe nanocrystals after their functionalization with 4-formyldithiobenzoic acid. The grafting proceeds via a condensation reaction between the aldehyde group of the ligand and the terminal primary amine group of the tetramer. The resulting organic/inorganic hybrid exhibits complete extinction of the fluorescence of its constituents, indicating efficient charge or energy transfer between the organic and the inorganic semiconductors.
Insulin-like growth factor binding protein-3 (IGFBP-3): Novel ligands mediate unexpected functions.
Baxter, Robert C
2013-08-01
In addition to its important role in the regulation of somatic growth by acting as the major circulating transport protein for the insulin-like growth factors (IGFs), IGF binding protein-3 (IGFBP-3) has a variety of intracellular ligands that point to its function within major signaling pathways. The discovery of its interaction with the retinoid X receptor has led to the elucidation of roles in regulating the function of several nuclear hormone receptors including retinoic acid receptor-α, Nur77 and vitamin D receptor. Its interaction with the nuclear hormone receptor peroxisome proliferator-activated receptor-γ is believed to be involved in regulating adipocyte differentiation, which is also modulated by IGFBP-3 through an interaction with TGFβ/Smad signaling. IGFBP-3 can induce apoptosis alone or in conjunction with other agents, and in different systems can activate caspases -8 and -9. At least two unrelated proteins (LRP1 and TMEM219) have been designated as receptors for IGFBP-3, the latter with a demonstrated role in inducing caspase-8-dependent apoptosis. In contrast, IGFBP-3 also has demonstrated roles in survival-related functions, including the repair of DNA double-strand breaks through interaction with the epidermal growth factor receptor and DNA-dependent protein kinase, and the induction of autophagy through interaction with GRP78. The ability of IGFBP-3 to modulate the balance between pro-apoptotic and pro-survival sphingolipids by regulating sphingosine kinase 1 and sphingomyelinases may be integral to its role at the crossroads between cell death and survival in response to a variety of stimuli. The pleiotropic nature of IGFBP-3 activity supports the idea that IGFBP-3 itself, or pathways with which it interacts, should be investigated as targets of therapy for a variety of diseases.
Synthesis and characterization β-ketoamine ligands
NASA Astrophysics Data System (ADS)
Zaid, Nurzati Amani Mohamed; Hassan, Nur Hasyareeda; Karim, Nurul Huda Abd
2018-04-01
β-ketoamine ligands are important members of heterodonor ligand because of their ease of preparation and modification of both steric and/or electronic effects. Complexes with β-ketoamine has received much less attention and there has been no study about this complex with β-ketoamine in ionic liquid reported. Two type of β-ketoamine ligands which are 4-amino-3-pentene-2-onato (A) and 3-amino-2-butenoic acid methyl ester (B) have been synthesized in this work. The resulting compound formed was characterized using standard spectroscopic and structural techniques which includes 1H and 13C, NMR spectroscopy and FTIR spectroscopy. The 1H and 13C NMR spectrum displayed all the expected signals with correct integration and multiplicity. And it is proved that there are some differences between two ligands as observed in NMR and FTIR spectrum.
2011-01-01
Abstract Background The combinatorial library strategy of using multiple candidate ligands in mixtures as library members is ideal in terms of cost and efficiency, but needs special screening methods to estimate the affinities of candidate ligands in such mixtures. Herein, a new method to screen candidate ligands present in unknown molar quantities in mixtures was investigated. Results The proposed method involves preparing a processed-mixture-for-screening (PMFS) with each mixture sample and an exogenous reference ligand, initiating competitive binding among ligands from the PMFS to a target immobilized on magnetic particles, recovering target-ligand complexes in equilibrium by magnetic force, extracting and concentrating bound ligands, and analyzing ligands in the PMFS and the concentrated extract by chromatography. The relative affinity of each candidate ligand to its reference ligand is estimated via an approximation equation assuming (a) the candidate ligand and its reference ligand bind to the same site(s) on the target, (b) their chromatographic peak areas are over five times their intercepts of linear response but within their linear ranges, (c) their binding ratios are below 10%. These prerequisites are met by optimizing primarily the quantity of the target used and the PMFS composition ratio. The new method was tested using the competitive binding of biotin derivatives from mixtures to streptavidin immobilized on magnetic particles as a model. Each mixture sample containing a limited number of candidate biotin derivatives with moderate differences in their molar quantities were prepared via parallel-combinatorial-synthesis (PCS) without purification, or via the pooling of individual compounds. Some purified biotin derivatives were used as reference ligands. This method showed resistance to variations in chromatographic quantification sensitivity and concentration ratios; optimized conditions to validate the approximation equation could be applied to
A 45-Amino-Acid Scaffold Mined from the PDB for High-Affinity Ligand Engineering.
Kruziki, Max A; Bhatnagar, Sumit; Woldring, Daniel R; Duong, Vandon T; Hackel, Benjamin J
2015-07-23
Small protein ligands can provide superior physiological distribution compared with antibodies, and improved stability, production, and specific conjugation. Systematic evaluation of the PDB identified a scaffold to push the limits of small size and robust evolution of stable, high-affinity ligands: 45-residue T7 phage gene 2 protein (Gp2) contains an α helix opposite a β sheet with two adjacent loops amenable to mutation. De novo ligand discovery from 10(8) mutants and directed evolution toward four targets yielded target-specific binders with affinities as strong as 200 ± 100 pM, Tms from 65 °C ± 3 °C to 80°C ± 1 °C, and retained activity after thermal denaturation. For cancer targeting, a Gp2 domain for epidermal growth factor receptor was evolved with 18 ± 8 nM affinity, receptor-specific binding, and high thermal stability with refolding. The efficiency of evolving new binding function and the size, affinity, specificity, and stability of evolved domains render Gp2 a uniquely effective ligand scaffold. Copyright © 2015 Elsevier Ltd. All rights reserved.
Clinical Use of PPARγ Ligands in Cancer
Hatton, Jennifer L.; Yee, Lisa D.
2008-01-01
The role of PPARγ in adipocyte differentiation has fueled intense interest in the function of this steroid nuclear receptor for regulation of malignant cell growth and differentiation. Given the antiproliferative and differentiating effects of PPARγ ligands on liposarcoma cells, investigation of PPARγ expression and ligand activation in other solid tumors such as breast, colon, and prostate cancers ensued. The anticancer effects of PPARγ ligands in cell culture and rodent models of a multitude of tumor types suggest broad applicability of these agents to cancer therapy. This review focuses on the clinical use of PPARγ ligands, specifically the thiazolidinediones, for the treatment and prevention of cancer. PMID:19125177
Diverse, high-quality test set for the validation of protein-ligand docking performance.
Hartshorn, Michael J; Verdonk, Marcel L; Chessari, Gianni; Brewerton, Suzanne C; Mooij, Wijnand T M; Mortenson, Paul N; Murray, Christopher W
2007-02-22
A procedure for analyzing and classifying publicly available crystal structures has been developed. It has been used to identify high-resolution protein-ligand complexes that can be assessed by reconstructing the electron density for the ligand using the deposited structure factors. The complexes have been clustered according to the protein sequences, and clusters have been discarded if they do not represent proteins thought to be of direct interest to the pharmaceutical or agrochemical industry. Rules have been used to exclude complexes containing non-drug-like ligands. One complex from each cluster has been selected where a structure of sufficient quality was available. The final Astex diverse set contains 85 diverse, relevant protein-ligand complexes, which have been prepared in a format suitable for docking and are to be made freely available to the entire research community (http://www.ccdc.cam.ac.uk). The performance of the docking program GOLD against the new set is assessed using a variety of protocols. Relatively unbiased protocols give success rates of approximately 80% for redocking into native structures, but it is possible to get success rates of over 90% with some protocols.
Ligand Activation of TAM Family Receptors-Implications for Tumor Biology and Therapeutic Response.
Davra, Viralkumar; Kimani, Stanley G; Calianese, David; Birge, Raymond B
2016-11-29
The TAM family of receptors (i.e., Tyro3, Axl, and Mertk), and their ligands Growth arrest specific factor 6 (Gas6) and Protein S (Pros1) contribute to several oncogenic processes, such as cell survival, invasion, migration, chemo-resistance, and metastasis, whereby expression often correlates with poor clinical outcomes. In recent years, there has been great interest in the study of TAM receptors in cancer, stemming both from their roles as oncogenic signaling receptors, as well as their roles in tumor immunology. As a result, several classes of TAM inhibitors that include small molecule tyrosine kinase inhibitors, monoclonal antibodies, decoy receptors, as well as novel strategies to target TAM ligands are being developed. This paper will review the biology of TAM receptors and their ligands with a focus on cancer, as well as evidence-based data for the continued pursuit of TAM/Gas6 inhibitors in clinical practice.
Richardson, Jaime Stella Moses; Aminudin, Norhaniza; Abd Malek, Sri Nurestri
2017-10-01
transducer and activation of transcription 3, and extrinsic apoptotic pathway and also its ability to arrest cell cycle in S phase. This compound was from the leaves of Ruta angustifolia L. Pers. It provides new insight on the ability of this plant in suppressing certain cancers, especially the nonsmall cell lung carcinoma according to this study. Abbreviations used: °C: Degree Celsius, ANOVA: Analysis of variance, ATCC: American Type Culture Collection, BCL-2: B-Cell CLL/Lymphoma 2, Bcl-xL: B-cell lymphoma extra-large, BH3: Bcl-2 homology 3, BID: BH3-interacting domain death agonist, BIR: Baculovirus inhibitor of apoptosis protein repeat, Caspases: Cysteinyl aspartate-specific proteases, CDK: Cyclin-dependent kinase, CO 2 : Carbon dioxide, CST: Cell signaling technologies, DISC: Death-inducing signaling complex, DMSO: Dimethyl sulfoxide, DNA: Deoxyribonucleic acid, DR4: Death receptor 4, DR5: Death receptor 5, E1a: Adenovirus early region 1A, ECL: Enhanced chemiluminescence, EDTA: Ethylenediaminetetraacetic acid, ELISA: Enzyme-linked immunosorbent assay, etc.: Etcetera, FADD: Fas-associated protein with death domain, FBS: Fetal bovine serum, FITC: Fluorescein isothiocyanate, G1: Gap 1, G2: Gap 2, HPLC: High-performance liquid chromatography, HRP: Horseradish peroxidase, IAPs: Inhibitor of apoptosis proteins, IC50: Inhibitory concentration at half maximal inhibitory, IKK-α: Inhibitor of nuclear factor kappa-B kinase subunit alpha, IKK-β: Inhibitor of nuclear factor kappa-B kinase subunit beta, IKK-γ: Inhibitor of nuclear factor kappa-B kinase subunit gamma, IKK: IκB kinase, IkBα: Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha, m: Meter, M: Mitotic, mm: Millimeter, mRNA: Messenger ribonucleic acid, NaCl: Sodium chloride, NaVO4: Sodium orthovanadate, NEMO: NF-Kappa-B essential modulator, NF-κB: Nuclear factor kappa-light chain-enhancer of activated B cells, NSCLC: Nonsmall cell lung carcinoma, PBS: Phosphate buffered saline, PGE2
Role of B61, the Ligand for the Eck Receptor Tyrosine Kinase, in TNF- α-Induced Angiogenesis
NASA Astrophysics Data System (ADS)
Pandey, Akhilesh; Shao, Haining; Marks, Rory M.; Polverini, Peter J.; Dixit, Vishva M.
1995-04-01
B61, a cytokine-inducible endothelial gene product, is the ligand for the Eck receptor protein tyrosine kinase (RPTK). Expression of a B61-immunoglobulin chimera showed that B61 could act as an angiogenic factor in vivo and a chemoattractant for endothelial cells in vitro. The Eck RPTK was activated by tumor necrosis factor-α (TNF-α) through induction of B61, and an antibody to B61 attenuated angiogenesis induced by TNF-α but not by basic fibroblast growth factor. This finding suggests the existence of an autocrine or paracrine loop involving activation of the Eck RPTK by its inducible ligand B61 after an inflammatory stimulus, the net effect of which would be to promote angiogenesis, a hallmark of chronic inflammation.
Role of B61, the ligand for the Eck receptor tyrosine kinase, in TNF-alpha-induced angiogenesis.
Pandey, A; Shao, H; Marks, R M; Polverini, P J; Dixit, V M
1995-04-28
B61, a cytokine-inducible endothelial gene product, is the ligand for the Eck receptor protein tyrosine kinase (RPTK). Expression of a B61-immunoglobulin chimera showed that B61 could act as an angiogenic factor in vivo and a chemoattractant for endothelial cells in vitro. The Eck RPTK was activated by tumor necrosis factor-alpha (TNF-alpha) through induction of B61, and an antibody to B61 attenuated angiogenesis induced by TNF-alpha but not by basic fibroblast growth factor. This finding suggests the existence of an autocrine or paracrine loop involving activation of the Eck RPTK by its inducible ligand B61 after an inflammatory stimulus, the net effect of which would be to promote angiogenesis, a hallmark of chronic inflammation.
Granovsky, Alexey E.; Clark, Mathew M.; McElheny, Dan; Chimon, Alexander; Rosner, Marsha R.; Koide, Shohei
2010-01-01
Background Raf kinase inhibitory protein (RKIP), also known as phoshaptidylethanolamine binding protein (PEBP), has been shown to inhibit Raf and thereby negatively regulate growth factor signaling by the Raf/MAP kinase pathway. RKIP has also been shown to suppress metastasis. We have previously demonstrated that RKIP/Raf interaction is regulated by two mechanisms: phosphorylation of RKIP at Ser-153, and occupation of RKIP's conserved ligand binding domain with a phospholipid (2-dihexanoyl-sn-glycero-3-phosphoethanolamine; DHPE). In addition to phospholipids, other ligands have been reported to bind this domain; however their binding properties remain uncharacterized. Methods/Findings In this study, we used high-resolution heteronuclear NMR spectroscopy to screen a chemical library and assay a number of potential RKIP ligands for binding to the protein. Surprisingly, many compounds previously postulated as RKIP ligands showed no detectable binding in near-physiological solution conditions even at millimolar concentrations. In contrast, we found three novel ligands for RKIP that specifically bind to the RKIP pocket. Interestingly, unlike the phospholipid, DHPE, these newly identified ligands did not affect RKIP binding to Raf-1 or RKIP phosphorylation. One out of the three ligands displayed off target biological effects, impairing EGF-induced MAPK and metabolic activity. Conclusions/Significance This work defines the binding properties of RKIP ligands under near physiological conditions, establishing RKIP's affinity for hydrophobic ligands and the importance of bulky aliphatic chains for inhibiting its function. The common structural elements of these compounds defines a minimal requirement for RKIP binding and thus they can be used as lead compounds for future design of RKIP ligands with therapeutic potential. PMID:20463977
NASA Astrophysics Data System (ADS)
Kalinovskaya, I. V.
2014-09-01
The luminescence spectral characteristics of mixed-ligand compounds of ytterbium(III) with cinnamic acid and neutral phosphorus-containing ligands were studied by luminescence spectroscopy. The intensity of luminescence of the compounds was determined. The highest intensity of luminescence was found for the ytterbium(III) compound with triphenylphosphine oxide.
Decatur, S M; DePillis, G D; Boxer, S G
1996-04-02
A variety of heterocyclic ligands can be exchanged into the proximal cavity of sperm whale myoglobin mutant H93G, providing a simple method for introduction of the equivalent of unnatural amino acid side chains into a functionally critical location in this protein. These modified proteins bind CO on the distal side. 1H NMR data on H93G(Im)CO, where Im is imidazole, demonstrate that the structure of the distal heme pocket in H93G(Im)CO is very similar to that of wild type; thus, the effects of the proximal ligand's properties on CO binding can be studied with minimal perturbation of distal pocket structure. The exogenous proximal ligands used in this study include imidazole (Im), 4-methylimidazole (4-MeIm), 4-bromoimidazole (4-BrIm), N-methylimidazole (N-MeIm), pyridine (Pyr), and 3-fluoropyridine (3-FPyr). Substitution of the proximal ligand is found to produce substantial changes in the CO on and off rates, the equilibrium binding constant, and the vibrational stretch frequency of CO. Many of the changes are as large as those reported for distal pocket mutants prepared by site-directed mutagenesis. The ability to systematically vary the nature of the proximal ligand is exploited to test the effects of particular properties of the proximal ligand on CO binding. For example, 4-MeIm and 4-BrIm are similar in size and shape but differ significantly in pKa. The same relationship is true for Pyr and 3-FPyr. By comparison of the IR spectra and CO recombination kinetics of these complexes, the effects of proximal ligand pKa on the CO binding are assessed. Likewise, N-MeIm and 4-MeIm are similar in size and pKa but differ in their ability to hydrogen bond to amino acid residues in the proximal cavity. Comparisons of IR spectra and CO binding kinetics in these complexes reveal that proximal ligand conformation and hydrogen bonding affect the kinetics of CO binding. The mechanism of proximal ligand exchange between solution and the proximal cavity in CO complexes was
da Costa, Leonardo Moreira; de Mesquita Carneiro, José Walkimar; Paes, Lilian Weitzel Coelho
2011-08-01
DFT (B3LYP/6-31+G(d)) calculations of Mg(2+) affinities for a set of phosphoryl ligands were performed. Two types of ligands were studied: a set of trivalent [O = P(R)] and a set of pentavalent phosphoryl ligands [O = P(R)(3)] (R = H, F, Cl, Br, OH, OCH(3), CH(3), CN, NH(2) and NO(2)), with R either bound directly to the phosphorus atom or to the para position of a phenyl ring. The affinity of the Mg(2+) cation for the ligands was quantified by means of the enthalpy for the substitution of one water molecule in the [Mg(H(2)O)(6)](2+) complex for a ligand. The enthalpy of substitution was correlated with electronic and geometric parameters. Electron-donor groups increase the interaction between the cation and the ligand, while electron-acceptor groups decrease the interaction enthalpy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsai, M.; Takeishi, Takashi; Geissler, E.N.
1991-07-15
The authors investigated the effects of a newly recognized multifunctional growth factor, the c-kit ligand stem cell factor (SCF), on mouse mast cell proliferation and phenotype. Recombinant rat SCF{sup 164} (rrSCF{sup 164}) induced the development of large numbers of dermal mast cells in normal mice in vivo. Many of these mast cells had features of connective tissue-type mast cells (CTMC), in that they were reactive both with the heparin-binding fluorescent dye berberine sulfate and with safranin. In vitro, rrSCF{sup 164} induced the proliferation of cloned interleukin 3 (IL-3)-dependent mouse mast cells and primary populations of IL-3-dependent, bone marrow-derived cultured mastmore » cells (BMCMC), which represent immature mast cells, and purified peritoneal mast cells, which represent a type of mature CTMC> BMCMC maintained in rrSCF{sup 164} not only proliferated but also matured. These findings identify SCF as a single cytokine that can induce immature, IL-3-dependent mast cells to mature and to acquire multiple characteristics of CTMC. These findings also directly demonstrate that SCF can regulate the development of a cellular lineage expressing c-kit through effects on both proliferation and maturation.« less
Semiconductor Quantum Dots with Photoresponsive Ligands.
Sansalone, Lorenzo; Tang, Sicheng; Zhang, Yang; Thapaliya, Ek Raj; Raymo, Françisco M; Garcia-Amorós, Jaume
2016-10-01
Photochromic or photocaged ligands can be anchored to the outer shell of semiconductor quantum dots in order to control the photophysical properties of these inorganic nanocrystals with optical stimulations. One of the two interconvertible states of the photoresponsive ligands can be designed to accept either an electron or energy from the excited quantum dots and quench their luminescence. Under these conditions, the reversible transformations of photochromic ligands or the irreversible cleavage of photocaged counterparts translates into the possibility to switch luminescence with external control. As an alternative to regulating the photophysics of a quantum dot via the photochemistry of its ligands, the photochemistry of the latter can be controlled by relying on the photophysics of the former. The transfer of excitation energy from a quantum dot to a photocaged ligand populates the excited state of the species adsorbed on the nanocrystal to induce a photochemical reaction. This mechanism, in conjunction with the large two-photon absorption cross section of quantum dots, can be exploited to release nitric oxide or to generate singlet oxygen under near-infrared irradiation. Thus, the combination of semiconductor quantum dots and photoresponsive ligands offers the opportunity to assemble nanostructured constructs with specific functions on the basis of electron or energy transfer processes. The photoswitchable luminescence and ability to photoinduce the release of reactive chemicals, associated with the resulting systems, can be particularly valuable in biomedical research and can, ultimately, lead to the realization of imaging probes for diagnostic applications as well as to therapeutic agents for the treatment of cancer.
Lee, Shang-Hsuan; Sato, Yusuke; Hyodo, Mamoru; Harashima, Hideyoshi
2016-01-01
The surface topology of ligands on liposomes is an important factor in active targeting in drug delivery systems. Accurately evaluating the density of anchors and bioactive functional ligands on a liposomal surface is critical for ensuring the efficient delivery of liposomes. For evaluating surface ligand density, it is necessary to clarify that on the ligand-modified liposomal surfaces, some anchors are attached to ligands but some are not. To distinguish between these situations, a key parameter, surface anchor density, was introduced to specify amount of total anchors on the liposomal surface. Second, the parameter reaction yield was introduced to identify the amount of ligand-attached anchors among total anchors, since the conjugation efficiency is not always the same nor 100%. Combining these independent parameters, we derived: incorporation ratio=surface anchor density×reaction yield. The term incorporation ratio defines the surface ligand density. Since the surface anchor density represents the density of polyethylene glycol (PEG) on the surfaces in most cases, it also determines liposomal function. It is possible to accurately characterize various PEG and ligand densities and to define the surface topologies. In conclusion, this quantitative methodology can standardize the liposome preparation process and qualify the modified liposomal surfaces.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakaeda, Yoshiichi; Hiroi, Miki; Shimojima, Takahiro
Sulindac, a non-steroidal anti-inflammatory drug, has been shown to exert an anti-tumor effect on several types of cancer. To determine the effect of sulindac on intracellular signaling pathways in host immune cells such as macrophages, we investigated the effect of the drug on interferon gamma (IFN{gamma})-induced expression of signal transducer and activator of transcription 1 (STAT1) and other genes in mouse macrophage-like cell line RAW264.7 cells. Sulindac, but not aspirin or sodium salicylate, inhibited IFN{gamma}-induced expression of the CXC ligand 9 (CXCL9) mRNA, a chemokine for activated T cells, whereas the interferon-induced expression of CXCL10 or IFN regulatory factor-1 wasmore » not affected by sulindac. Luciferase reporter assay demonstrated that sulindac inhibited IFN{gamma}-induced promoter activity of the CXCL9 gene. Surprisingly, sulindac had no inhibitory effect on IFN{gamma}-induced STAT1 activation; however, constitutive nuclear factor {kappa}B activity was suppressed by the drug. These results indicate that sulindac selectively inhibited IFN{gamma}-inducible gene expression without inhibiting STAT1 activation.« less
Doern, Adam; Cao, Xianjun; Sereno, Arlene; Reyes, Christopher L; Altshuler, Angelina; Huang, Flora; Hession, Cathy; Flavier, Albert; Favis, Michael; Tran, Hon; Ailor, Eric; Levesque, Melissa; Murphy, Tracey; Berquist, Lisa; Tamraz, Susan; Snipas, Tracey; Garber, Ellen; Shestowsky, William S; Rennard, Rachel; Graff, Christilyn P; Wu, Xiufeng; Snyder, William; Cole, Lindsay; Gregson, David; Shields, Michael; Ho, Steffan N; Reff, Mitchell E; Glaser, Scott M; Dong, Jianying; Demarest, Stephen J; Hariharan, Kandasamy
2009-04-10
Therapeutic antibodies directed against the type 1 insulin-like growth factor receptor (IGF-1R) have recently gained significant momentum in the clinic because of preliminary data generated in human patients with cancer. These antibodies inhibit ligand-mediated activation of IGF-1R and the resulting down-stream signaling cascade. Here we generated a panel of antibodies against IGF-1R and screened them for their ability to block the binding of both IGF-1 and IGF-2 at escalating ligand concentrations (>1 microm) to investigate allosteric versus competitive blocking mechanisms. Four distinct inhibitory classes were found as follows: 1) allosteric IGF-1 blockers, 2) allosteric IGF-2 blockers, 3) allosteric IGF-1 and IGF-2 blockers, and 4) competitive IGF-1 and IGF-2 blockers. The epitopes of representative antibodies from each of these classes were mapped using a purified IGF-1R library containing 64 mutations. Most of these antibodies bound overlapping surfaces on the cysteine-rich repeat and L2 domains. One class of allosteric IGF-1 and IGF-2 blocker was identified that bound a separate epitope on the outer surface of the FnIII-1 domain. Using various biophysical techniques, we show that the dual IGF blockers inhibit ligand binding using a spectrum of mechanisms ranging from highly allosteric to purely competitive. Binding of IGF-1 or the inhibitory antibodies was associated with conformational changes in IGF-1R, linked to the ordering of dynamic or unstructured regions of the receptor. These results suggest IGF-1R uses disorder/order within its polypeptide sequence to regulate its activity. Interestingly, the activity of representative allosteric and competitive inhibitors on H322M tumor cell growth in vitro was reflective of their individual ligand-blocking properties. Many of the antibodies in the clinic likely adopt one of the inhibitory mechanisms described here, and the outcome of future clinical studies may reveal whether a particular inhibitory mechanism
Hong, Suntaek; Kim, Hye-Youn; Kim, Jooyoung; Ha, Huyen Trang; Kim, Young-Mi; Bae, Eunjin; Kim, Tae Hyung; Lee, Kang Choon; Kim, Seong-Jin
2013-01-01
Smad7 has been known as a negative regulator for the transforming growth factor-β (TGF-β) signaling pathway through feedback regulation. However, Smad7 has been suspected to have other biological roles through the regulation of gene transcription. By screening differentially regulated genes, we found that the caspase 8 gene was highly up-regulated in Smad7-expressing cells. Smad7 was able to activate the caspase 8 promoter through recruitment of the interferon regulatory factor 1 (IRF1) transcription factor to the interferon-stimulated response element (ISRE) site. Interaction of Smad7 on the caspase 8 promoter was confirmed with electrophoretic mobility shift assay and chromatin immunoprecipitation experiment. Interestingly, Smad7 did not directly interact with the ISRE site, but it increased the binding activity of IRF1 with ISRE. These results support that Smad7 recruits IRF1 protein on the caspase 8 promoter and functions as a transcriptional coactivator. To confirm the biological significance of caspase 8 up-regulation, we tested tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL)-mediated cell death assay in breast cancer cells. Smad7 in apoptosis-resistant MCF7 cells markedly sensitized the cells to TRAIL-induced cell death by restoring the caspase cascade. Furthermore, restoration of caspase 8-mediated apoptosis pathway repressed the tumor growth in the xenograft model. In conclusion, we suggest a novel role for Smad7 as a transcriptional coactivator for caspase 8 through the interaction with IRF1 in regulation of the cell death pathway. PMID:23255602
Forier, Cynthia; Boschetti, Egisto; Ouhammouch, Mohamed; Cibiel, Agnès; Ducongé, Frédéric; Nogré, Michel; Tellier, Michel; Bataille, Damien; Bihoreau, Nicolas; Santambien, Patrick; Chtourou, Sami; Perret, Gérald
2017-03-17
Nucleic acid aptamers are promising ligands for analytical and preparative-scale affinity chromatography applications. However, a full industrial exploitation requires that aptamer-grafted chromatography media provide a number of high technical standards that remained largely untested. Ideally, they should exhibit relatively high binding capacity associated to a very high degree of specificity. In addition, they must be highly resistant to harsh cleaning/sanitization conditions, as well as to prolonged and repeated exposure to biological environment. Here, we present practical examples of aptamer affinity chromatography for the purification of three human therapeutic proteins from various sources: Factor VII, Factor H and Factor IX. In a single chromatographic step, three DNA aptamer ligands enabled the efficient purification of their target protein, with an unprecedented degree of selectivity (from 0.5% to 98% of purity in one step). Furthermore, these aptamers demonstrated a high stability under harsh sanitization conditions (100h soaking in 1M NaOH). These results pave the way toward a wider adoption of aptamer-based affinity ligands in the industrial-scale purification of not only plasma-derived proteins but also of any other protein in general. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Shedding Light on Anesthetic Mechanisms: Application of Photoaffinity Ligands
Woll, Kellie A.; Dailey, William P.; Brannigan, Grace; Eckenhoff, Roderic G.
2016-01-01
Anesthetic photoaffinity ligands have had an increasing presence within anesthesiology research. These ligands mimic parent general anesthetics, and allow investigators to study anesthetic interactions with receptors and enzymes; identify novel targets; and determine distribution within biological systems. To date nearly all general anesthetics used in medicine have a corresponding photoaffinity ligand represented in the literature. In this review we examine all aspects of the current methodologies, including ligand design, characterization and deployment. Finally we offer points of consideration and highlight the future outlook as more photoaffinity ligands emerge within the field. PMID:27464974
Shedding Light on Anesthetic Mechanisms: Application of Photoaffinity Ligands.
Woll, Kellie A; Dailey, William P; Brannigan, Grace; Eckenhoff, Roderic G
2016-11-01
Anesthetic photoaffinity ligands have had an increasing presence within anesthesiology research. These ligands mimic parent general anesthetics and allow investigators to study anesthetic interactions with receptors and enzymes; identify novel targets; and determine distribution within biological systems. To date, nearly all general anesthetics used in medicine have a corresponding photoaffinity ligand represented in the literature. In this review, we examine all aspects of the current methodologies, including ligand design, characterization, and deployment. Finally we offer points of consideration and highlight the future outlook as more photoaffinity ligands emerge within the field.
Uehara, Shota; Tanaka, Shigenori
2016-11-23
Water plays a significant role in the binding process between protein and ligand. However, the thermodynamics of water molecules are often underestimated, or even ignored, in protein-ligand docking. Usually, the free energies of active-site water molecules are substantially different from those of waters in the bulk region. The binding of a ligand to a protein causes a displacement of these waters from an active site to bulk, and this displacement process substantially contributes to the free energy change of protein-ligand binding. The free energy of active-site water molecules can be calculated by grid inhomogeneous solvation theory (GIST), using molecular dynamics (MD) and the trajectory of a target protein and water molecules. Here, we show a case study of the combination of GIST and a docking program and discuss the effectiveness of the displacing gain of unfavorable water in protein-ligand docking. We combined the GIST-based desolvation function with the scoring function of AutoDock4, which is called AutoDock-GIST. The proposed scoring function was assessed employing 51 ligands of coagulation factor Xa (FXa), and results showed that both scoring accuracy and docking success rate were improved. We also evaluated virtual screening performance of AutoDock-GIST using FXa ligands in the directory of useful decoys-enhanced (DUD-E), thus finding that the displacing gain of unfavorable water is effective for a successful docking campaign.
Sensing multiple ligands with single receptor
NASA Astrophysics Data System (ADS)
Singh, Vijay; Nemenman, Ilya
2015-03-01
Cells use surface receptors to measure concentrations of external ligand molecules. Limits on the accuracy of such sensing are well-known for the scenario where concentration of one molecular species is being determined by one receptor [Endres]. However, in more realistic scenarios, a cognate (high-affinity) ligand competes with many non-cognate (low-affinity) ligands for binding to the receptor. We analyze effects of this competition on the accuracy of sensing. We show that maximum-likelihood statistical inference allows determination of concentrations of multiple ligands, cognate and non-cognate, by the same receptor concurrently. While it is unclear if traditional biochemical circuitry downstream of the receptor can implement such inference exactly, we show that an approximate inference can be performed by coupling the receptor to a kinetic proofreading cascade. We characterize the accuracy of such kinetic proofreading sensing in comparison to the exact maximum-likelihood approach. We acknowledge the support from the James S. McDonnell Foundation and the Human Frontier Science Program.
The LIM-homeodomain transcription factor LMX1B regulates expression of NF-kappa B target genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rascle, Anne; Neumann, Tanja; Raschta, Anne-Sarah
2009-01-01
LMX1B is a LIM-homeodomain transcription factor essential for development. Putative LMX1B target genes have been identified through mouse gene targeting studies, but their identity as direct LMX1B targets remains hypothetical. We describe here the first molecular characterization of LMX1B target gene regulation. Microarray analysis using a tetracycline-inducible LMX1B expression system in HeLa cells revealed that a subset of NF-{kappa}B target genes, including IL-6 and IL-8, are upregulated in LMX1B-expressing cells. Inhibition of NF-{kappa}B activity by short interfering RNA-mediated knock-down of p65 impairs, while activation of NF-{kappa}B activity by TNF-{alpha} synergizes induction of NF-{kappa}B target genes by LMX1B. Chromatin immunoprecipitation demonstratedmore » that LMX1B binds to the proximal promoter of IL-6 and IL-8 in vivo, in the vicinity of the characterized {kappa}B site, and that LMX1B recruitment correlates with increased NF-{kappa}B DNA association. IL-6 promoter-reporter assays showed that the {kappa}B site and an adjacent putative LMX1B binding motif are both involved in LMX1B-mediated transcription. Expression of NF-{kappa}B target genes is affected in the kidney of Lmx1b{sup -/-} knock-out mice, thus supporting the biological relevance of our findings. Together, these data demonstrate for the first time that LMX1B directly regulates transcription of a subset of NF-{kappa}B target genes in cooperation with nuclear p50/p65 NF-{kappa}B.« less
Eichmann, Anne; Corbel, Catherine; Nataf, Valérie; Vaigot, Pierre; Bréant, Christiane; Le Douarin, Nicole M.
1997-01-01
The existence of a common precursor for endothelial and hemopoietic cells, termed the hemangioblast, has been postulated since the beginning of the century. Recently, deletion of the endothelial-specific vascular endothelial growth factor receptor 2 (VEGFR2) by gene targeting has shown that both endothelial and hemopoietic cells are absent in homozygous null mice. This observation suggested that VEGFR2 could be expressed by the hemangioblast and essential for its further differentiation along both lineages. However, it was not possible to exclude the hypothesis that hemopoietic failure was a secondary effect resulting from the absence of an endothelial cell microenvironment. To distinguish between these two hypotheses, we have produced a mAb directed against the extracellular domain of avian VEGFR2 and isolated VEGFR2+ cells from the mesoderm of chicken embryos at the gastrulation stage. We have found that in clonal cultures, a VEGFR2+ cell gives rise to either a hemopoietic or an endothelial cell colony. The developmental decision appears to be regulated by the binding of two different VEGFR2 ligands. Thus, endothelial differentiation requires VEGF, whereas hemopoietic differentiation occurs in the absence of VEGF and is significantly reduced by soluble VEGFR2, showing that this process could be mediated by a second, yet unidentified, VEGFR2 ligand. These observations thus suggest strongly that in the absence of the VEGFR2 gene product, the precursors of both hemopoietic and vascular endothelial lineages cannot survive. These cells therefore might be the initial targets of the VEGFR2 null mutation. PMID:9144204
Seitz, Michael; Do, King; Ingram, Andrew J.; Moore, Evan G.; Muller, Gilles; Raymond, Kenneth N.
2009-01-01
Abstract: Circulaly polarized luminescence from terbium(III) complexed and excited by chiral antenna ligands gives strong emission The modular synthesis of three new octadentate, enantiopure ligands are reported - one with the bidentate chelating unit 2-hydroxyisophthalamide (IAM) and two with 1-hydroxy-2-pyridinone (1,2-HOPO) units. A new design principle is introduced for the chiral, non-racemic hexamines which constitute the central backbones for the presented class of ligands. The terbium(III) complex of the IAM ligand, as well as the europium(III) complexes of the 1,2-HOPO ligands are synthesized and characterized by various techniques (NMR, UV, CD, luminescence spectroscopy). All species exhibit excellent stability and moderate to high luminescence efficiency (quantum yields ΦEu = 0.05–0.08 and ΦTb = 0.30–0.57) in aqueous solution at physiological pH. Special focus is put onto the properties of the complexes in regard to circularly polarized luminescence (CPL). The maximum luminescence dissymmetry factors (glum) in aqueous solution are high with |glum|max = 0.08 – 0.40. Together with the very favorable general properties (good stability, high quantum yields, long lifetimes), the presented lanthanide complexes can be considered as good candidates for analytical probes based on CPL in biologically relevant environments. PMID:19639983
Visualizing ligand molecules in Twilight electron density.
Weichenberger, Christian X; Pozharski, Edwin; Rupp, Bernhard
2013-02-01
Three-dimensional models of protein structures determined by X-ray crystallography are based on the interpretation of experimentally derived electron-density maps. The real-space correlation coefficient (RSCC) provides an easily comprehensible, objective measure of the residue-based fit of atom coordinates to electron density. Among protein structure models, protein-ligand complexes are of special interest, given their contribution to understanding the molecular underpinnings of biological activity and to drug design. For consumers of such models, it is not trivial to determine the degree to which ligand-structure modelling is biased by subjective electron-density interpretation. A standalone script, Twilight, is presented for the analysis, visualization and annotation of a pre-filtered set of 2815 protein-ligand complexes deposited with the PDB as of 15 January 2012 with ligand RSCC values that are below a threshold of 0.6. It also provides simplified access to the visualization of any protein-ligand complex available from the PDB and annotated by the Uppsala Electron Density Server. The script runs on various platforms and is available for download at http://www.ruppweb.org/twilight/.
Engineering death receptor ligands for cancer therapy.
Wajant, Harald; Gerspach, Jeannette; Pfizenmaier, Klaus
2013-05-28
CD95, TNFR1, TRAILR1 and TRAILR2 belong to a subgroup of TNF receptors which is characterized by a conserved cell death-inducing protein domain that connects these receptors to the apoptotic machinery of the cell. Activation of death receptors in malignant cells attracts increasing attention as a principle to fight cancer. Besides agonistic antibodies the major way to stimulate death receptors is the use of their naturally occurring "death ligands" CD95L, TNF and TRAIL. However, dependent from the concept followed to develop a death ligand-based therapy various limiting aspects have to be taken into consideration on the way to a "bedside" usable drug. Problems arise in particular from the cell associated transmembrane nature of the death ligands, the poor serum half life of the soluble fragments derived from the transmembrane ligands, the ubiquitous expression of the death receptors and the existence of additional non-death receptors of the death ligands. Here, we summarize strategies how these limitations can be overcome by genetic engineering. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Receptor-ligand binding sites and virtual screening.
Hattotuwagama, Channa K; Davies, Matthew N; Flower, Darren R
2006-01-01
Within the pharmaceutical industry, the ultimate source of continuing profitability is the unremitting process of drug discovery. To be profitable, drugs must be marketable: legally novel, safe and relatively free of side effects, efficacious, and ideally inexpensive to produce. While drug discovery was once typified by a haphazard and empirical process, it is now increasingly driven by both knowledge of the receptor-mediated basis of disease and how drug molecules interact with receptors and the wider physiome. Medicinal chemistry postulates that to understand a congeneric ligand series, or set thereof, is to understand the nature and requirements of a ligand binding site. Likewise, structural molecular biology posits that to understand a binding site is to understand the nature of ligands bound therein. Reality sits somewhere between these extremes, yet subsumes them both. Complementary to rules of ligand design, arising through decades of medicinal chemistry, structural biology and computational chemistry are able to elucidate the nature of binding site-ligand interactions, facilitating, at both pragmatic and conceptual levels, the drug discovery process.
Thermometric titration studies of mixed ligand complexes of thorium.
Kugler, G C; Carey, G H
1970-10-01
Mixed-ligand chelates consisting of two different multidentate ligands linked to a central thorium(IV) ion have been prepared in aqueous solution and their heats of formation studied thermo metrically. Pyrocatechol, tiron, chromotropic acid, potassium hydrogen phthalate, 8-hydroxyquinoline-S-sulphonic acid, iminodiacetic acid, 5-sulphosalicylic acid and salicylic acid were used as the secondary ligands, while ethylenediaminetetra-acetate and 1, 2-diaminocyclohexane-N,N,N',N'-tetra-acetate were used as primary ligands. DeltaH values for the overall reactions are given, and where possible, the DeltaH and DeltaS values for the specific secondary ligand addition were calculated. The overall stability of the mixed-ligand chelates and the enhanced stability of EDTA mixed chelates relative to the analogous DCTA chelates were found to be due to entropy rather than enthalpy effects.
Kim, Hiyoung; Kim, Kwang-Jin; Yeon, Jeong-Tae; Kim, Seong Hwan; Won, Dong Hwan; Choi, Hyukjae; Nam, Sang-Jip; Son, Young-Jin; Kang, Heonjoong
2014-01-01
A new inhibitor, placotylene A (1), of the receptor activator of nuclear factor-κB ligand (RANKL)-induced osteoclast differentiation, and a regioisomer of placotylene A, placotylene B (2), were isolated from a Korean marine sponge Placospongia sp. The chemical structures of placotylenes A and B were elucidated on the basis of 1D and 2D NMR, along with MS spectral analysis and revealed as an iodinated polyacetylene class of natural products. Placotylene A (1) displayed inhibitory activity against RANKL-induced osteoclast differentiation at 10 μM while placotylene B (2) did not show any significant activity up to 100 μM, respectively. PMID:24705502
Lagarde, Nathalie; Zagury, Jean-François; Montes, Matthieu
2014-10-27
The evaluation of virtual ligand screening methods is of major importance to ensure their reliability. Taking into account the agonist/antagonist pharmacological profile should improve the quality of the benchmarking data sets since ligand binding can induce conformational changes in the nuclear receptor structure and such changes may vary according to the agonist/antagonist ligand profile. We indeed found that splitting the agonist and antagonist ligands into two separate data sets for a given nuclear receptor target significantly enhances the quality of the evaluation. The pharmacological profile of the ligand bound in the binding site of the target structure was also found to be an additional critical parameter. We also illustrate that active compound data sets for a given pharmacological activity can be used as a set of experimentally validated decoy ligands for another pharmacological activity to ensure a reliable and challenging evaluation of virtual screening methods.
Design of a Hole Trapping Ligand
La Croix, Andrew D.; O’Hara, Andrew; Reid, Kemar R.; ...
2017-01-18
A new ligand that covalently attaches to the surface of colloidal CdSe/ CdS nanorods and can simultaneously chelate a molecular metal center is described. The dithiocarbamate$-$bipyridine ligand system facilitates hole transfer through energetic overlap at the inorganic$-$organic interface and conjugation through the organic ligand to a chelated metal center. Density functional theory calculations show that the coordination of the free ligand to a CdS surface causes the formation of two hybridized molecular states that lie in the band gap of CdS. The further chelation of Fe(II) to the bipyridine moiety causes the presence of seven midgap states. Hole transfer frommore » the CdS valence band to the midgap states is dipole allowed and occurs at a faster rate than what is experimentally known for the CdSe/CdS band-edge radiative recombination. In the case of the ligand bound with iron, a two-step process emerges that places the hole on the iron, again at rates much faster than band gap recombination. The system was experimentally assembled and characterized via UV$-$vis absorbance spectroscopy, fluorescence spectroscopy, time-resolved photoluminescence spectroscopy, and energy dispersive X-ray spectroscopy. Lastly, theoretically predicted red shifts in absorbance were observed experimentally, as well as the expected quench in photoluminescence and lifetimes in time-resolved photoluminescence« less
Design of a Hole Trapping Ligand
DOE Office of Scientific and Technical Information (OSTI.GOV)
La Croix, Andrew D.; O’Hara, Andrew; Reid, Kemar R.
A new ligand that covalently attaches to the surface of colloidal CdSe/ CdS nanorods and can simultaneously chelate a molecular metal center is described. The dithiocarbamate$-$bipyridine ligand system facilitates hole transfer through energetic overlap at the inorganic$-$organic interface and conjugation through the organic ligand to a chelated metal center. Density functional theory calculations show that the coordination of the free ligand to a CdS surface causes the formation of two hybridized molecular states that lie in the band gap of CdS. The further chelation of Fe(II) to the bipyridine moiety causes the presence of seven midgap states. Hole transfer frommore » the CdS valence band to the midgap states is dipole allowed and occurs at a faster rate than what is experimentally known for the CdSe/CdS band-edge radiative recombination. In the case of the ligand bound with iron, a two-step process emerges that places the hole on the iron, again at rates much faster than band gap recombination. The system was experimentally assembled and characterized via UV$-$vis absorbance spectroscopy, fluorescence spectroscopy, time-resolved photoluminescence spectroscopy, and energy dispersive X-ray spectroscopy. Lastly, theoretically predicted red shifts in absorbance were observed experimentally, as well as the expected quench in photoluminescence and lifetimes in time-resolved photoluminescence« less
Umemoto, Tomoe; Fujiki, Yukio
2012-07-01
Peroxisome proliferator-activated receptors (PPARs) play important roles in diverse biological processes including metabolisms of sugars and lipids and differentiation of cells such as adipocytes. PPARs are transcription factors belonging to the ligand-dependent hormone receptor group. To function as transcription factors, PPARs translocate into nucleus where they associate with transcription apparatus. However, mechanisms underlying nuclear transport of PPARs remain enigmatic. We show here that PPARα and PPARγ dynamically shuttle between nucleus and cytoplasm, although they constitutively and predominantly appear in nucleus. With a series of truncation mutants, we identify that PPAR nuclear transport is mediated by at least two nuclear localization signals (NLSs) in DNA-binding domain (DBD)-hinge and activation function 1 (AF1) regions and their respective receptors including importinα/β, importin 7, and an unidentified receptor. PPARs also harbor two nuclear export signals in DBD and ligand-binding domain regions that are recognized by distinct export receptors, calreticulin and CRM1. Moreover, we show that nuclear-cytoplasmic shuttling of PPARs is regulated by respective PPAR ligands and Ca2+ concentration. Taken together, we suggest that the multiple pathways for the nuclear-cytoplasmic transport of PPARs regulate the biological functions of PPARs in response to external signals. © 2012 The Authors Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Implicit ligand theory for relative binding free energies
NASA Astrophysics Data System (ADS)
Nguyen, Trung Hai; Minh, David D. L.
2018-03-01
Implicit ligand theory enables noncovalent binding free energies to be calculated based on an exponential average of the binding potential of mean force (BPMF)—the binding free energy between a flexible ligand and rigid receptor—over a precomputed ensemble of receptor configurations. In the original formalism, receptor configurations were drawn from or reweighted to the apo ensemble. Here we show that BPMFs averaged over a holo ensemble yield binding free energies relative to the reference ligand that specifies the ensemble. When using receptor snapshots from an alchemical simulation with a single ligand, the new statistical estimator outperforms the original.
Engineering cofactor and ligand binding in an artificial neuroglobin
NASA Astrophysics Data System (ADS)
Zhang, Lei
HP-7 is one artificial mutated oxygen transport protein, which operates via a mechanism akin to human neuroglobin and cytoglobin. This protein destabilizes one of two heme-ligating histidine residues by coupling histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Replacement of these glutamate residues with alanine, which has a neutral hydrophobicity, slows gaseous ligand binding 22-fold, increases the affinity of the distal histidine ligand by a factor of thirteen, and decreases the binding affinity of carbon monoxide, a nonreactive oxygen analogue, three-fold. Paradoxically, it also decreases heme binding affinity by a factor of three in the reduced state and six in the oxidized state. Application of a two-state binding model, in which an initial pentacoordinate binding event is followed by a protein conformational change to hexacoordinate, provides insight into the mechanism of this seemingly counterintuitive result: the initial pentacoordinate encounter complex is significantly destabilized by the loss of the glutamate side chains, and the increased affinity for the distal histidine only partially compensates. These results point to the importance of considering each oxidation and conformational state in the design of functional artificial proteins. We have also examined the effects these mutations have on function. The K d of the nonnreactive oxygen analogue carbon monoxide (CO) is only decreased three-fold, despite the large increase in distal histidine affinity engendered by the 22-fold decrease in the histidine ligand off-rate. This is a result of the four-fold increase in affinity for CO binding to the pentacoordinate state. Oxygen binds to HP7 with a Kd of 117 µM, while the mutant rapidly oxidizes when exposed to oxygen. EPR analysis of both ferric hemoproteins demonstrates that the mutation increases disorder at the heme binding site. NMR-detected deuterium exchange demonstrates that the mutation causes a
Superior serum half life of albumin tagged TNF ligands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mueller, Nicole; Schneider, Britta; Pfizenmaier, Klaus
2010-06-11
Due to their immune stimulating and apoptosis inducing properties, ligands of the TNF family attract increasing interest as therapeutic proteins. A general limitation of in vivo applications of recombinant soluble TNF ligands is their notoriously rapid clearance from circulation. To improve the serum half life of the TNF family members TNF, TWEAK and TRAIL, we genetically fused soluble variants of these molecules to human serum albumin (HSA). The serum albumin-TNF ligand fusion proteins were found to be of similar bioactivity as the corresponding HSA-less counterparts. Upon intravenous injection (i.v.), serum half life of HSA-TNF ligand fusion proteins, as determined bymore » ELISA, was around 15 h as compared to approximately 1 h for all of the recombinant control TNF ligands without HSA domain. Moreover, serum samples collected 6 or 24 h after i.v. injection still contained high TNF ligand bioactivity, demonstrating that there is only limited degradation/inactivation of circulating HSA-TNF ligand fusion proteins in vivo. In a xenotransplantation model, significantly less of the HSA-TRAIL fusion protein compared to the respective control TRAIL protein was required to achieve inhibition of tumor growth indicating that the increased half life of HSA-TNF ligand fusion proteins translates into better therapeutic action in vivo. In conclusion, our data suggest that genetic fusion to serum albumin is a powerful and generally applicable mean to improve bioavailability and in vivo activity of TNF ligands.« less
Effects of electrostatic interactions on ligand dissociation kinetics
NASA Astrophysics Data System (ADS)
Erbaş, Aykut; de la Cruz, Monica Olvera; Marko, John F.
2018-02-01
We study unbinding of multivalent cationic ligands from oppositely charged polymeric binding sites sparsely grafted on a flat neutral substrate. Our molecular dynamics simulations are suggested by single-molecule studies of protein-DNA interactions. We consider univalent salt concentrations spanning roughly a 1000-fold range, together with various concentrations of excess ligands in solution. To reveal the ionic effects on unbinding kinetics of spontaneous and facilitated dissociation mechanisms, we treat electrostatic interactions both at a Debye-Hückel (DH) (or implicit ions, i.e., use of an electrostatic potential with a prescribed decay length) level and by the more precise approach of considering all ionic species explicitly in the simulations. We find that the DH approach systematically overestimates unbinding rates, relative to the calculations where all ion pairs are present explicitly in solution, although many aspects of the two types of calculation are qualitatively similar. For facilitated dissociation (FD) (acceleration of unbinding by free ligands in solution) explicit-ion simulations lead to unbinding at lower free-ligand concentrations. Our simulations predict a variety of FD regimes as a function of free-ligand and ion concentrations; a particularly interesting regime is at intermediate concentrations of ligands where nonelectrostatic binding strength controls FD. We conclude that explicit-ion electrostatic modeling is an essential component to quantitatively tackle problems in molecular ligand dissociation, including nucleic-acid-binding proteins.
[Supercomputer investigation of the protein-ligand system low-energy minima].
Oferkin, I V; Sulimov, A V; Katkova, E V; Kutov, D K; Grigoriev, F V; Kondakova, O A; Sulimov, V B
2015-01-01
The accuracy of the protein-ligand binding energy calculations and ligand positioning is strongly influenced by the choice of the docking target function. This work demonstrates the evaluation of the five different target functions used in docking: functions based on MMFF94 force field and functions based on PM7 quantum-chemical method accounting or without accounting the implicit solvent model (PCM, COSMO or SGB). For these purposes the ligand positions corresponding to the minima of the target function and the experimentally known ligand positions in the protein active site (crystal ligand positions) were compared. Each function was examined on the same test-set of 16 protein-ligand complexes. The new parallelized docking program FLM based on Monte Carlo search algorithm was developed to perform the comprehensive low-energy minima search and to calculate the protein-ligand binding energy. This study demonstrates that the docking target function based on the MMFF94 force field can be used to detect the crystal or near crystal positions of the ligand by the finding the low-energy local minima spectrum of the target function. The importance of solvent accounting in the docking process for the accurate ligand positioning is also shown. The accuracy of the ligand positioning as well as the correlation between the calculated and experimentally determined protein-ligand binding energies are improved when the MMFF94 force field is substituted by the new PM7 method with implicit solvent accounting.
Critical ligand binding reagent preparation/selection: when specificity depends on reagents.
Rup, Bonita; O'Hara, Denise
2007-05-11
Throughout the life cycle of biopharmaceutical products, bioanalytical support is provided using ligand binding assays to measure the drug product for pharmacokinetic, pharmacodynamic, and immunogenicity studies. The specificity and selectivity of these ligand binding assays are highly dependent on the ligand binding reagents. Thus the selection, characterization, and management processes for ligand binding reagents are crucial to successful assay development and application. This report describes process considerations for selection and characterization of ligand binding reagents that are integral parts of the different phases of assay development. Changes in expression, purification, modification, and storage of the ligand binding reagents may have a profound effect on the ligand binding assay performance. Thus long-term management of the critical ligand binding assay reagents is addressed including suggested characterization criteria that allow ligand binding reagents to be used in as consistent a manner as possible. Examples of challenges related to the selection, modification, and characterization of ligand binding reagents are included.
Szewczuk, M
2017-02-01
As a member of the somatotropic axis, insulin-like growth factor I receptor (IGF1R) seems to be a promising candidate gene. Two silent polymorphisms, identified by MspI and TaqI restriction enzymes, were selected within exon 2, encoding the majority of the putative ligand binding pocket. A total of 1169 cows of four pure breeds (Polish Holstein Friesian, Montbeliarde, Jersey and Holstein Friesian) were genotyped. The T (IGF1R/e2/MspI) and G (IGF1R/e2/TaqI) alleles were found to be prevalent. Three combinations of genotypes (TT/GG, TT/AG and CT/GG) were associated with the highest productivity (milk, protein and fat yields) among all breeds under study, as opposed to individuals carrying the worst CC/AA combination. In view of the specific structure of the ligand binding pocket and the significance of insulin-like growth factor I signalling promoting the development and differentiation in a variety of tissues (not only limited to mammary gland), the existence of missense mutation is unlikely. Potential mutations are likely limited to mRNA transcription and further post-transcriptional modifications. Further investigations should follow searching for the most useful IGF1R haplotypes, associated with higher milk production traits, exerting at the same time positive or neutral impact on health and welfare of individuals. © 2016 Blackwell Verlag GmbH.
Vikse, Krista; Khairallah, George N; McIndoe, J Scott; O'Hair, Richard A J
2013-05-14
A combination of multistage mass spectrometry experiments and density functional theory (DFT) calculations were used to examine the decarboxylation reactions of a series of metal carboxylate complexes bearing a fixed-charge phosphine ligand, [(O3SC6H4)(C6H5)2PM(I)O2CR](-) (M = Cu, Ag, Au; R = Me, Et, benzyl, Ph). Collision-induced dissociation (CID) of these complexes using an LTQ linear ion mass spectrometer results in three main classes of reactions being observed: (1) decarboxylation; (2) loss of the phosphine ligand; (3) loss of carboxylic acid. The gas-phase unimolecular chemistry of the resultant decarboxylated organometallic ions, [(O3SC6H4)(C6H5)2PM(I)R](-), were also explored using CID experiments, and fragment primarily via loss of the phosphine ligand. Energy-resolved CID experiments on [(O3SC6H4)(C6H5)2PM(I)O2CR](-) (M = Cu, Ag, Au; R = Me, Et, benzyl, Ph) using a Q-TOF mass spectrometer were performed to gain a more detailed understanding of the factors influencing coinage metal-catalyzed decarboxylation and DFT calculations on the major fragmentation pathways aided in interpretation of the experimental results. Key findings are that: (1) the energy required for loss of the phosphine ligand follows the order Ag < Cu < Au; (2) the ease of decarboxylation of the coordinated RCO2 groups follows the order of R: Ph < PhCH2 < Me < Et; (3) in general, copper is best at facilitating decarboxylation, followed by gold then silver. The one exception to this trend is when R = Ph and M = Au which has the highest overall propensity for decarboxylation. The influence of the phosphine ligand on decarboxylation is also considered in comparison with previous studies on metal carboxylates that do not contain a phosphine ligand.
Weber, Alfred; Engelmaier, Andrea; Hainzelmayer, Sandra; Minibeck, Eva; Anderle, Heinz; Schwarz, Hans Peter; Turecek, Peter L
2015-10-21
BAX 855 is a PEGylated recombinant factor VIII preparation that showed prolonged circulatory half-life in nonclinical and clinical studies. This paper describes the development, validation, and application of a novel ligand-binding assay (LBA) to selectively measure BAX 855 in plasma. The LBA is based on PEG-specific capture of BAX 855, followed by immunological factor VIII (FVIII)-specific detection of the antibody-bound BAX 855. This assay principle enabled sensitive measurement of BAX 855 down to the low nanomolar range without interference from non-PEGylated FVIII as demonstrated by validation data for plasma from animals typically used for nonclinical characterization of FVIII. The selectivity of an in-house-developed anti-PEG and a commercially available preparation, shown by competition studies to primarily target the terminating methoxy group of PEG, also allowed assessment of the intactness of the attached PEG chains. Altogether, this new LBA adds to the group of methods to selectively, accurately, and precisely measure a PEGylated drug in complex biological matrices. The feasibility and convenience of using this method was demonstrated during extensive nonclinical characterization of BAX 855.
Ligand.Info small-molecule Meta-Database.
von Grotthuss, Marcin; Koczyk, Grzegorz; Pas, Jakub; Wyrwicz, Lucjan S; Rychlewski, Leszek
2004-12-01
Ligand.Info is a compilation of various publicly available databases of small molecules. The total size of the Meta-Database is over 1 million entries. The compound records contain calculated three-dimensional coordinates and sometimes information about biological activity. Some molecules have information about FDA drug approving status or about anti-HIV activity. Meta-Database can be downloaded from the http://Ligand.Info web page. The database can also be screened using a Java-based tool. The tool can interactively cluster sets of molecules on the user side and automatically download similar molecules from the server. The application requires the Java Runtime Environment 1.4 or higher, which can be automatically downloaded from Sun Microsystems or Apple Computer and installed during the first use of Ligand.Info on desktop systems, which support Java (Ms Windows, Mac OS, Solaris, and Linux). The Ligand.Info Meta-Database can be used for virtual high-throughput screening of new potential drugs. Presented examples showed that using a known antiviral drug as query the system was able to find others antiviral drugs and inhibitors.
[Functional selectivity of opioid receptors ligands].
Audet, Nicolas; Archer-Lahlou, Elodie; Richard-Lalonde, Mélissa; Piñeyro-Filpo, Graciela
2010-01-01
Opiates are the most effective analgesics available for the treatment of severe pain. However, their clinical use is restricted by unwanted side effects such as tolerance, physical dependence and respiratory depression. The strategy to develop new opiates with reduced side effects has mainly focused on the study and production of ligands that specifically bind to different opiate receptors subtypes. However, this strategy has not allowed the production of novel therapeutic ligands with a better side effects profile. Thus, other research strategies need to be explored. One which is receiving increasing attention is the possibility of exploiting ligand ability to stabilize different receptor conformations with distinct signalling profiles. This newly described property, termed functional selectivity, provides a potential means of directing the stimulus generated by an activated receptor towards a specific cellular response. Here we summarize evidence supporting the existence of ligand-specific active conformations for two opioid receptors subtypes (delta and mu), and analyze how functional selectivity may contribute in the production of longer lasting, better tolerated opiate analgesics. double dagger.
Rational Ligand Design for U(VI) and Pu(IV)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Szigethy, Geza
2009-08-12
Nuclear power is an attractive alternative to hydrocarbon-based energy production at a time when moving away from carbon-producing processes is widely accepted as a significant developmental need. Hence, the radioactive actinide power sources for this industry are necessarily becoming more widespread, which is accompanied by the increased risk of exposure to both biological and environmental systems. This, in turn, requires the development of technology designed to remove such radioactive threats efficiently and selectively from contaminated material, whether that be contained nuclear waste streams or the human body. Raymond and coworkers (University of California, Berkeley) have for decades investigated the interactionmore » of biologically-inspired, hard Lewis-base ligands with high-valent, early-actinide cations. It has been established that such ligands bind strongly to the hard Lewis-acidic early actinides, and many poly-bidentate ligands have been developed and shown to be effective chelators of actinide contaminants in vivo. Work reported herein explores the effect of ligand geometry on the linear U(IV) dioxo dication (uranyl, UO 2 2+). The goal is to utilize rational ligand design to develop ligands that exhibit shape selectivity towards linear dioxo cations and provides thermodynamically favorable binding interactions. The uranyl complexes with a series of tetradentate 3-hydroxy-pyridin-2-one (3,2-HOPO) ligands were studied in both the crystalline state as well as in solution. Despite significant geometric differences, the uranyl affinities of these ligands vary only slightly but are better than DTPA, the only FDA-approved chelation therapy for actinide contamination. The terepthalamide (TAM) moiety was combined into tris-beidentate ligands with 1,2- and 3,2-HOPO moieties were combined into hexadentate ligands whose structural preferences and solution thermodynamics were measured with the uranyl cation. In addition to achieving coordinative saturation
Ligand- and receptor-based docking with LiBELa
NASA Astrophysics Data System (ADS)
dos Santos Muniz, Heloisa; Nascimento, Alessandro S.
2015-08-01
Methodologies on molecular docking are constantly improving. The problem consists on finding an optimal interplay between the computational cost and a satisfactory physical description of ligand-receptor interaction. In pursuit of an advance in current methods we developed a mixed docking approach combining ligand- and receptor-based strategies in a docking engine, where tridimensional descriptors for shape and charge distribution of a reference ligand guide the initial placement of the docking molecule and an interaction energy-based global minimization follows. This hybrid docking was evaluated with soft-core and force field potentials taking into account ligand pose and scoring. Our approach was found to be competitive to a purely receptor-based dock resulting in improved logAUC values when evaluated with DUD and DUD-E. Furthermore, the smoothed potential as evaluated here, was not advantageous when ligand binding poses were compared to experimentally determined conformations. In conclusion we show that a combination of ligand- and receptor-based strategy docking with a force field energy model results in good reproduction of binding poses and enrichment of active molecules against decoys. This strategy is implemented in our tool, LiBELa, available to the scientific community.
Mapping of ligand-binding cavities in proteins.
Andersson, C David; Chen, Brian Y; Linusson, Anna
2010-05-01
The complex interactions between proteins and small organic molecules (ligands) are intensively studied because they play key roles in biological processes and drug activities. Here, we present a novel approach to characterize and map the ligand-binding cavities of proteins without direct geometric comparison of structures, based on Principal Component Analysis of cavity properties (related mainly to size, polarity, and charge). This approach can provide valuable information on the similarities and dissimilarities, of binding cavities due to mutations, between-species differences and flexibility upon ligand-binding. The presented results show that information on ligand-binding cavity variations can complement information on protein similarity obtained from sequence comparisons. The predictive aspect of the method is exemplified by successful predictions of serine proteases that were not included in the model construction. The presented strategy to compare ligand-binding cavities of related and unrelated proteins has many potential applications within protein and medicinal chemistry, for example in the characterization and mapping of "orphan structures", selection of protein structures for docking studies in structure-based design, and identification of proteins for selectivity screens in drug design programs. 2009 Wiley-Liss, Inc.
Mapping of Ligand-Binding Cavities in Proteins
Andersson, C. David; Chen, Brian Y.; Linusson, Anna
2010-01-01
The complex interactions between proteins and small organic molecules (ligands) are intensively studied because they play key roles in biological processes and drug activities. Here, we present a novel approach to characterise and map the ligand-binding cavities of proteins without direct geometric comparison of structures, based on Principal Component Analysis of cavity properties (related mainly to size, polarity and charge). This approach can provide valuable information on the similarities, and dissimilarities, of binding cavities due to mutations, between-species differences and flexibility upon ligand-binding. The presented results show that information on ligand-binding cavity variations can complement information on protein similarity obtained from sequence comparisons. The predictive aspect of the method is exemplified by successful predictions of serine proteases that were not included in the model construction. The presented strategy to compare ligand-binding cavities of related and unrelated proteins has many potential applications within protein and medicinal chemistry, for example in the characterisation and mapping of “orphan structures”, selection of protein structures for docking studies in structure-based design and identification of proteins for selectivity screens in drug design programs. PMID:20034113
Visualizing ligand molecules in twilight electron density
Weichenberger, Christian X.; Pozharski, Edwin; Rupp, Bernhard
2013-01-01
Three-dimensional models of protein structures determined by X-ray crystallography are based on the interpretation of experimentally derived electron-density maps. The real-space correlation coefficient (RSCC) provides an easily comprehensible, objective measure of the residue-based fit of atom coordinates to electron density. Among protein structure models, protein–ligand complexes are of special interest, given their contribution to understanding the molecular underpinnings of biological activity and to drug design. For consumers of such models, it is not trivial to determine the degree to which ligand-structure modelling is biased by subjective electron-density interpretation. A standalone script, Twilight, is presented for the analysis, visualization and annotation of a pre-filtered set of 2815 protein–ligand complexes deposited with the PDB as of 15 January 2012 with ligand RSCC values that are below a threshold of 0.6. It also provides simplified access to the visualization of any protein–ligand complex available from the PDB and annotated by the Uppsala Electron Density Server. The script runs on various platforms and is available for download at http://www.ruppweb.org/twilight/. PMID:23385767
Modification of the 5' terminus of oligodeoxyribonucleotides for conjugation with ligands.
Asseline, U; Thuong, N T
2001-08-01
Ligands can be introduced at the 5' terminus of an oligonucleotide by adding a linker to the ligand and modifying the 5' terminus of the oligonucleotide. These are then reacted to give the ligand-oligonucleotide conjugate. This unit describes the addition of carboxylated and aminoalkylated linkers, and phosphorothioate, phosphate, and masked thiol groups to the 5' terminus of an oligonucleotide. The addition of linkers to ligands and the final reaction that produces the ligand-conjugated oligonucleotide are described elsewhere in the series. This approach is particularly useful when there is a limited amount of ligand available, when the ligand is sensitive to chemical conditions required for oligonucleotide deprotection, or when the ligand is weakly soluble in solvents required for phosphoramidite- or H-phosphonate-mediated oligonucleotide synthesis.
Ligand-independent activation of the oestrogen receptor by mutation of a conserved tyrosine.
White, R; Sjöberg, M; Kalkhoven, E; Parker, M G
1997-01-01
The oestrogen receptor is a member of the nuclear receptor family of transcription factors which, on binding the steroid hormone 17beta-oestradiol, interacts with co-activator proteins and stimulates gene expression. Replacement of a single tyrosine in the hormone-binding domain generated activated forms of the receptor which stimulated transcription in the absence of hormone. This increased activation is related to a decrease in hydrophobicity and a reduction in size of the side chain of the amino acid with which the tyrosine is replaced. Ligand-independent, in common with ligand-dependent transcriptional activation, requires an amphipathic alpha-helix at the C-terminus of the ligand-binding domain which is essential for the interaction of the receptor with a number of potential co-activator proteins. In contrast to the wild-type protein, constitutively active receptors were able to bind both the receptor-interacting protein RIP-140 and the steroid receptor co-activator SRC-1 in a ligand-independent manner, although in the case of SRC-1 this was only evident when the receptors were prebound to DNA. We propose, therefore, that this tyrosine is required to maintain the receptor in a transcriptionally inactive state in the absence of hormone. Modification of this residue may generate a conformational change in the ligand-binding domain of the receptor to form an interacting surface which allows the recruitment of co-activators independent of hormone binding. This suggests that this tyrosine may be a target for a different signalling pathway which forms an alternative mechanism of activating oestrogen receptor-mediated transcription. PMID:9135157
Staehle, Robert; Tong, Lianpeng; Wang, Lei; Duan, Lele; Fischer, Andreas; Ahlquist, Mårten S G; Sun, Licheng; Rau, Sven
2014-02-03
A new water oxidation catalyst [Ru(III)(bda)(mmi)(OH2)](CF3SO3) (2, H2bda = 2,2'-bipyridine-6,6'-dicarboxylic acid; mmi = 1,3-dimethylimidazolium-2-ylidene) containing an axial N-heterocyclic carbene ligand and one aqua ligand was synthesized and fully characterized. The kinetics of catalytic water oxidation by 2 were measured using stopped-flow technique, and key intermediates in the catalytic cycle were probed by density functional theory calculations. While analogous Ru-bda water oxidation catalysts [Ru(bda)L2] (L = pyridyl ligands) are supposed to catalyze water oxidation through a bimolecular coupling pathway, our study points out that 2, surprisingly, undergoes a single-site water nucleophilic attack (acid-base) pathway. The diversion of catalytic mechanisms is mainly ascribed to the different ligand environments, from nonaqua ligands to an aqua ligand. Findings in this work provide some critical proof for our previous hypothesis about how alternation of ancillary ligands of water oxidation catalysts influences their catalytic efficiency.
Transient Ligand Docking Sites in Cerebratulus lacteus Mini-Hemoglobin
Deng, Pengchi; Nienhaus, Karin; Palladino, Pasquale; Olson, John S.; Blouin, George; Moens, Luc; Dewilde, Sylvia; Geuens, Eva; Nienhaus, G. Ulrich
2007-01-01
The monomeric hemoglobin of the nemertean worm Cerebratulus lacteus functions as an oxygen storage protein to maintain neural activity under hypoxic conditions. It shares a large, apolar matrix tunnel with other small hemoglobins, which has been implicated as a potential ligand migration pathway. Here we explore ligand migration and binding within the distal heme pocket, to which the tunnel provides access to ligands from the outside. FTIR/TDS experiments performed at cryogenic temperatures reveal the presence of three transient ligand docking sites within the distal pocket, the primary docking site B on top of pyrrole C and secondary sites C and D. Site C is assigned to a cavity adjacent to the distal portion of the heme pocket, surrounded by the B and E helices. It has an opening to the apolar tunnel and is expected to be on the pathway for ligand entry and exit, whereas site D, circumscribed by TyrB10, GlnE7, and the CD corner, most likely is located on a side pathway of ligand migration. Flash photolysis experiments at ambient temperatures indicate that the rate-limiting step for ligand binding to CerHb is migration through the apolar channel to site C. Movement from C to B and iron-ligand bond formation involve low energy barriers and thus are very rapid processes in the wt protein. PMID:17531406
Architecture effects on multivalent interactions by polypeptide-based multivalent ligands
NASA Astrophysics Data System (ADS)
Liu, Shuang
Multivalent interactions are characterized by the simultaneous binding between multiple ligands and multiple binding sites, either in solutions or at interfaces. In biological systems, most multivalent interactions occur between protein receptors and carbohydrate ligands through hydrogen-bonding and hydrophobic interactions. Compared with weak affinity binding between one ligand and one binding site, i.e. monovalent interaction, multivalent interactioins provide greater avidity and specificity, and therefore play unique roles in a broad range of biological activities. Moreover, the studies of multivalent interactions are also essential for producing effective inhibitors and effectors of biological processes that could have important therapeutic applications. Synthetic multivalent ligands have been designed to mimic the biological functions of natural multivalent interactions, and various types of scaffolds have been used to display multiple ligands, including small molecules, linear polymers, dendrimers, nanoparticle surfaces, monolayer surfaces and liposomes. Studies have shown that multivalent interactions can be highly affected by various architectural parameters of these multivalent ligands, including ligand identities, valencies, spacing, ligand densities, nature of linker arms, scaffold length and scaffold conformation. Most of these multivalent ligands are chemically synthesized and have limitations of controlling over sequence and conformation, which is a barrier for mimicking ordered and controlled natural biological systems. Therefore, multivalent ligands with precisely controlled architecture are required for improved structure-function relationship studies. Protein engineering methods with subsequent chemical coupling of ligands provide significant advantages of controlling over backbone conformation and functional group placement, and therefore have been used to synthesize recombinant protein-based materials with desired properties similar to natural
Janero, David R; Korde, Anisha; Makriyannis, Alexandros
2017-01-01
Detailed characterization of the ligand-binding motifs and structure-function correlates of the principal GPCRs of the endocannabinoid-signaling system, the cannabinoid 1 (CB1R) and cannabinoid 2 (CB2R) receptors, is essential to inform the rational design of drugs that modulate CB1R- and CB2R-dependent biosignaling for therapeutic gain. We discuss herein an experimental paradigm termed "ligand-assisted protein structure" (LAPS) that affords a means of characterizing, at the amino acid level, CB1R and CB2R structural features key to ligand engagement and receptor-dependent information transmission. For this purpose, LAPS integrates three key disciplines and methodologies: (a) medicinal chemistry: design and synthesis of high-affinity, pharmacologically active probes as reporters capable of reacting irreversibly with particular amino acids at (or in the immediate vicinity of) the ligand-binding domain of the functionally active receptor; (b) molecular and cellular biology: introduction of discrete, conservative point mutations into the target GPCR and determination of their effect on probe binding and pharmacological activity; (c) analytical chemistry: identification of the site(s) of probe-GPCR interaction through focused, bottom-up, amino acid-level proteomic identification of the probe-receptor complex using liquid chromatography tandem mass spectrometry. Subsequent in silico methods including ligand docking and computational modeling provide supplementary data on the probe-receptor interaction as defined by LAPS. Examples of LAPS as applied to human CB2R orthosteric binding site characterization for a biarylpyrazole antagonist/inverse agonist and a classical cannabinoid agonist belonging to distinct chemical classes of cannabinergic compounds are given as paradigms for further application of this methodology to other therapeutic protein targets. LAPS is well positioned to complement other experimental and in silico methods in contemporary structural biology such
Le, Hai Van; Kim, Jae Young
2016-06-01
Toll-like receptor 10 (TLR10) is the only orphan receptor whose natural ligand and function are unknown among the 10 human TLRs. In this study, to test whether TLR10 recognizes some known TLR ligands, we established a stable TLR10 knockdown human monocytic cell line THP-1 using TLR10 short hairpin RNA lentiviral particle and puromycin selection. Among 60 TLR10 knockdown clones that were derived from each single transduced cell, six clones were randomly selected, and then one of those clones, named E7, was chosen for the functional study. E7 exhibited approximately 50% inhibition of TLR10 mRNA and protein expression. Of all the TLRs, only the expression of TLR10 changed significantly in this cell line. Additionally, phorbol 12-myristate 13-acetate-induced macrophage differentiation of TLR10 knockdown cells was not affected in the knockdown cells. When exposed to TLR ligands, such as synthetic diacylated lipoprotein (FSL-1), lipopolysaccharide (LPS), and flagellin, significant induction of proinflammatory cytokine gene expression including Interleukin-8 (IL-8), Interleukin-1 beta (IL-1β), Tumor necrosis factor-alpha (TNF-α) and Chemokine (C-C Motif) Ligand 20 (CCL20) expression, was found in the control THP-1 cells, whereas the TLR10 knockdown cells exhibited a significant reduction in the expression of IL-8, IL-1β, and CCL20. TNF-α was the only cytokine for which the expression did not decrease in the TLR10 knockdown cells from that measured in the control cells. Analysis of putative binding sites for transcription factors using a binding-site-prediction program revealed that the TNF-α promoter does not have putative binding sites for AP-1 or c-Jun, comprising a major transcription factor along with NF-κB for TLR signaling. Our results suggest that TLR10 is involved in the recognition of FSL-1, LPS, and flagellin and TLR-ligand-induced expression of TNF-α does not depend on TLR10.
Takegahara, Noriko; Kim, Hyunsoo; Mizuno, Hiroki; Sakaue-Sawano, Asako; Miyawaki, Atsushi; Tomura, Michio; Kanagawa, Osami; Ishii, Masaru; Choi, Yongwon
2016-01-01
Osteoclasts are specialized polyploid cells that resorb bone. Upon stimulation with receptor activator of nuclear factor-κB ligand (RANKL), myeloid precursors commit to becoming polyploid, largely via cell fusion. Polyploidization of osteoclasts is necessary for their bone-resorbing activity, but the mechanisms by which polyploidization is controlled remain to be determined. Here, we demonstrated that in addition to cell fusion, incomplete cytokinesis also plays a role in osteoclast polyploidization. In in vitro cultured osteoclasts derived from mice expressing the fluorescent ubiquitin-based cell cycle indicator (Fucci), RANKL induced polyploidy by incomplete cytokinesis as well as cell fusion. Polyploid cells generated by incomplete cytokinesis had the potential to subsequently undergo cell fusion. Nuclear polyploidy was also observed in osteoclasts in vivo, suggesting the involvement of incomplete cytokinesis in physiological polyploidization. Furthermore, RANKL-induced incomplete cytokinesis was reduced by inhibition of Akt, resulting in impaired multinucleated osteoclast formation. Taken together, these results reveal that RANKL-induced incomplete cytokinesis contributes to polyploidization of osteoclasts via Akt activation. PMID:26670608
Optical Absorbance Enhancement in PbS QD/Cinnamate Ligand Complexes.
Kroupa, Daniel M; Vörös, Márton; Brawand, Nicholas P; Bronstein, Noah; McNichols, Brett W; Castaneda, Chloe V; Nozik, Arthur J; Sellinger, Alan; Galli, Giulia; Beard, Matthew C
2018-06-08
We studied the optical absorption enhancement in colloidal suspensions of PbS quantum dots (QD) upon ligand exchange from oleate to a series of cinnamate ligands. By combining experiments and ab initio simulations, we elucidate physical parameters that govern the optical absorption enhancement. We find that, within the cinnamate/PbS QD system, the optical absorption enhancement scales linearly with the electronic gap of the ligand, indicating that the ligand/QD coupling occurs equally efficient between the QD and ligand HOMO and their respective LUMO levels. Disruption of the conjugation that connects the aromatic ring and its substituents to the QD core causes a reduction of the electronic coupling. Our results further support the notion that the ligand/QD complex should be considered as a distinct chemical system with emergent behavior rather than a QD core with ligands whose sole purpose is to passivate surface dangling bonds and prevent agglomeration.
New synthetic routes toward enantiopure nitrogen donor ligands.
Sala, Xavier; Rodríguez, Anna M; Rodríguez, Montserrat; Romero, Isabel; Parella, Teodor; von Zelewsky, Alexander; Llobet, Antoni; Benet-Buchholz, Jordi
2006-12-08
New polypyridylic chiral ligands, having either C3 or lower symmetry, have been prepared via a de novo construction of the pyridine nucleus by means of Kröhnke methodology in the key step. The chiral moieties of these ligands originate from the monoterpen chiral pool, namely (-)-alpha-pinene ((-)-14, (-)-15) and (-)-myrtenal ((-)-9, (-)-10). Extension of the above-mentioned asymmetric synthesis procedure to the preparation of enantiopure derivatives of some commonly used polypyridylic ligands has been achieved through a new aldehyde building block ((-)-16). As an example, the synthesis of a chiral derivative of N,N-bis(2-pyridylmethyl)ethylamine (bpea) ligand, (-)-19, has been performed to illustrate the viability of the method. The coordinative ability of the ligands has been tested through the synthesis and characterization of complexes [Mn((-)-19)Br2], (-)-20, and [RuCl((-)-10)(bpy)](BF4), (-)-21. Some preliminary results related to the enantioselective catalytic epoxidation of styrene with the ruthenium complex are also presented.
Thiophene-Core Estrogen Receptor Ligands Having Superagonist Activity
Min, Jian; Wang, Pengcheng; Srinivasan, Sathish; Nwachukwu, Jerome C.; Guo, Pu; Huang, Minjian; Carlson, Kathryn E.; Katzenellenbogen, John A.; Nettles, Kendall W.; Zhou, Hai-Bing
2013-01-01
To probe the importance of the heterocyclic core of estrogen receptor (ER) ligands, we prepared a series of thiophene-core ligands by Suzuki cross-coupling of aryl boronic acids with bromo-thiophenes, and we assessed their receptor binding and cell biological activities. The disposition of the phenol substituents on the thiophene core, at alternate or adjacent sites, and the nature of substituents on these phenols all contribute to binding affinity and subtype selectivity. Most of the bis(hydroxyphenyl)-thiophenes were ERβ selective, whereas the tris(hydroxyphenyl)-thiophenes were ERα selective; analogous furan-core compounds generally have lower affinity and less selectivity. Some diarylthiophenes show distinct superagonist activity in reporter gene assays, giving maximal activities 2–3 times that of estradiol, and modeling suggests that these ligands have a different interaction with a hydrogen-bonding residue in helix-11. Ligand-core modification may be a new strategy for developing ER ligands whose selectivity is based on having transcriptional activity greater than that of estradiol. PMID:23586645
Cloud computing for protein-ligand binding site comparison.
Hung, Che-Lun; Hua, Guan-Jie
2013-01-01
The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery.
Rohloff, John C; Gelinas, Amy D; Jarvis, Thale C; Ochsner, Urs A; Schneider, Daniel J; Gold, Larry; Janjic, Nebojsa
2014-01-01
Limited chemical diversity of nucleic acid libraries has long been suspected to be a major constraining factor in the overall success of SELEX (Systematic Evolution of Ligands by EXponential enrichment). Despite this constraint, SELEX has enjoyed considerable success over the past quarter of a century as a result of the enormous size of starting libraries and conformational richness of nucleic acids. With judicious introduction of functional groups absent in natural nucleic acids, the “diversity gap” between nucleic acid–based ligands and protein-based ligands can be substantially bridged, to generate a new class of ligands that represent the best of both worlds. We have explored the effect of various functional groups at the 5-position of uracil and found that hydrophobic aromatic side chains have the most profound influence on the success rate of SELEX and allow the identification of ligands with very low dissociation rate constants (named Slow Off-rate Modified Aptamers or SOMAmers). Such modified nucleotides create unique intramolecular motifs and make direct contacts with proteins. Importantly, SOMAmers engage their protein targets with surfaces that have significantly more hydrophobic character compared with conventional aptamers, thereby increasing the range of epitopes that are available for binding. These improvements have enabled us to build a collection of SOMAmers to over 3,000 human proteins encompassing major families such as growth factors, cytokines, enzymes, hormones, and receptors, with additional SOMAmers aimed at pathogen and rodent proteins. Such a large and growing collection of exquisite affinity reagents expands the scope of possible applications in diagnostics and therapeutics. PMID:25291143
Ligand binding by repeat proteins: natural and designed
Grove, Tijana Z; Cortajarena, Aitziber L; Regan, Lynne
2012-01-01
Repeat proteins contain tandem arrays of small structural motifs. As a consequence of this architecture, they adopt non-globular, extended structures that present large, highly specific surfaces for ligand binding. Here we discuss recent advances toward understanding the functional role of this unique modular architecture. We showcase specific examples of natural repeat proteins interacting with diverse ligands and also present examples of designed repeat protein–ligand interactions. PMID:18602006
How to Compute Labile Metal-Ligand Equilibria
ERIC Educational Resources Information Center
de Levie, Robert
2007-01-01
The different methods used for computing labile metal-ligand complexes, which are suitable for an iterative computer solution, are illustrated. The ligand function has allowed students to relegate otherwise tedious iterations to a computer, while retaining complete control over what is calculated.
Conformational Transitions upon Ligand Binding: Holo-Structure Prediction from Apo Conformations
Seeliger, Daniel; de Groot, Bert L.
2010-01-01
Biological function of proteins is frequently associated with the formation of complexes with small-molecule ligands. Experimental structure determination of such complexes at atomic resolution, however, can be time-consuming and costly. Computational methods for structure prediction of protein/ligand complexes, particularly docking, are as yet restricted by their limited consideration of receptor flexibility, rendering them not applicable for predicting protein/ligand complexes if large conformational changes of the receptor upon ligand binding are involved. Accurate receptor models in the ligand-bound state (holo structures), however, are a prerequisite for successful structure-based drug design. Hence, if only an unbound (apo) structure is available distinct from the ligand-bound conformation, structure-based drug design is severely limited. We present a method to predict the structure of protein/ligand complexes based solely on the apo structure, the ligand and the radius of gyration of the holo structure. The method is applied to ten cases in which proteins undergo structural rearrangements of up to 7.1 Å backbone RMSD upon ligand binding. In all cases, receptor models within 1.6 Å backbone RMSD to the target were predicted and close-to-native ligand binding poses were obtained for 8 of 10 cases in the top-ranked complex models. A protocol is presented that is expected to enable structure modeling of protein/ligand complexes and structure-based drug design for cases where crystal structures of ligand-bound conformations are not available. PMID:20066034
Macromolecular Modelling and Docking Simulations for the Discovery of Selective GPER Ligands.
Rosano, Camillo; Ponassi, Marco; Santolla, Maria Francesca; Pisano, Assunta; Felli, Lamberto; Vivacqua, Adele; Maggiolini, Marcello; Lappano, Rosamaria
2016-01-01
Estrogens influence multiple physiological processes and are implicated in many diseases as well. Cellular responses to estrogens are mainly mediated by the estrogen receptors (ER)α and ERβ, which act as ligand-activated transcription factors. Recently, a member of the G protein-coupled receptor (GPCR) superfamily, namely GPER/GPR30, has been identified as a further mediator of estrogen signalling in different pathophysiological conditions, including cancer. Today, computational methods are commonly used in all areas of health science research. Among these methods, virtual ligand screening has become an established technique for hit discovery and optimization. The absence of an established three-dimensional structure of GPER promoted studies of structure-based drug design in order to build reliable molecular models of this receptor. Here, we discuss the results obtained through the structure-based virtual ligand screening for GPER, which allowed the identification and synthesis of different selective agonist and antagonist moieties. These compounds led significant advances in our understanding of the GPER function at the cellular, tissue, and organismal levels. In particular, selective GPER ligands were critical toward the evaluation of the role elicited by this receptor in several pathophysiological conditions, including cancer. Considering that structure-based approaches are fundamental in drug discovery, future research breakthroughs with the aid of computer-aided molecular design and chemo-bioinformatics could generate a new class of drugs that, acting through GPER, would be useful in a variety of diseases as well as in innovative anticancer strategies.
Solution structure of the chick TGFbeta type II receptor ligand-binding domain.
Marlow, Michael S; Brown, Christopher B; Barnett, Joey V; Krezel, Andrzej M
2003-02-28
The transforming growth factor beta (TGFbeta) signaling pathway influences cell proliferation, immune responses, and extracellular matrix reorganization throughout the vertebrate life cycle. The signaling cascade is initiated by ligand-binding to its cognate type II receptor. Here, we present the structure of the chick type II TGFbeta receptor determined by solution NMR methods. Distance and angular constraints were derived from 15N and 13C edited NMR experiments. Torsion angle dynamics was used throughout the structure calculations and refinement. The 20 final structures were energy minimized using the generalized Born solvent model. For these 20 structures, the average backbone root-mean-square distance from the average structure is below 0.6A. The overall fold of this 109-residue domain is conserved within the superfamily of these receptors. Chick receptors fully recognize and respond to human TGFbeta ligands despite only 60% identity at the sequence level. Comparison with the human TGFbeta receptor determined by X-ray crystallography reveals different conformations in several regions. Sequence divergence and crystal packing interactions under low pH conditions are likely causes. This solution structure identifies regions were structural changes, however subtle, may occur upon ligand-binding. We also identified two very well conserved molecular surfaces. One was found to bind ligand in the crystallized human TGFbeta3:TGFbeta type II receptor complex. The other, newly identified area can be the interaction site with type I and/or type III receptors of the TGFbeta signaling complex.
Fenwick, Michael K.; Oswald, Robert E.
2008-01-01
Glutamate receptors mediate neuronal intercommunication in the central nervous system by coupling extracellular neurotransmitter-receptor interactions to ion channel conductivity. To gain insight into structural and dynamical factors that underlie this coupling, solution NMR experiments were performed on the bi-lobed ligand-binding core of glutamate receptor 2 in complexes with a set of willardiine partial agonists. These agonists are valuable for studying structure-function relationships because their 5-position substituent size is correlated with ligand efficacy and extent of receptor desensitization whereas the substituent electronegativity is correlated with ligand potency. NMR results show that the protein backbone amide chemical shift deviations correlate mainly with efficacy and extent of desensitization. Pronounced deviations occur at specific residues in the ligand-binding site and in the two helical segments that join the lobes by a disulfide bond. Experiments detecting conformational exchange show that micro- to millisecond timescale motions also occur near the disulfide bond and vary largely with efficacy and extent of desensitization. These results thus identify regions displaying structural and dynamical dissimilarity arising from differences in ligand-protein interactions and lobe closure which may play a critical role in receptor response. Furthermore, measures of line broadening and conformational exchange for a portion of the ligand-binding site correlate with ligand EC50 data. These results do not have any correlate in the currently available crystal structures and thus provide a novel view of ligand-binding events that may be associated with agonist potency differences. PMID:18387631
da Costa, Leonardo Moreira; Carneiro, José Walkimar de Mesquita; Romeiro, Gilberto Alves; Paes, Lilian Weitzel Coelho
2011-02-01
The affinity of the Ca(2+) ion for a set of substituted carbonyl ligands was analyzed with both the DFT (B3LYP/6-31+G(d)) and semi-empirical (PM6) methods. Two types of ligands were studied: a set of monosubstituted [O=CH(R)] and a set of disubstituted ligands [O=C(R)(2)] (R=H, F, Cl, Br, OH, OCH(3), CH(3), CN, NH(2) and NO(2)), with R either directly bound to the carbonyl carbon atom or to the para position of a phenyl ring. The interaction energy was calculated to quantify the affinity of the Ca(2+) cation for the ligands. Geometric and electronic parameters were correlated with the intensity of the metal-ligand interaction. The electronic nature of the substituent is the main parameter that determines the interaction energy. Donor groups make the interaction energy more negative (stabilizing the complex formed), while acceptor groups make the interaction energy less negative (destabilizing the complex formed).
Models of protein–ligand crystal structures: trust, but verify
Deller, Marc C.
2015-01-01
X-ray crystallography provides the most accurate models of protein–ligand structures. These models serve as the foundation of many computational methods including structure prediction, molecular modelling, and structure-based drug design. The success of these computational methods ultimately depends on the quality of the underlying protein–ligand models. X-ray crystallography offers the unparalleled advantage of a clear mathematical formalism relating the experimental data to the protein–ligand model. In the case of X-ray crystallography, the primary experimental evidence is the electron density of the molecules forming the crystal. The first step in the generation of an accurate and precise crystallographic model is the interpretation of the electron density of the crystal, typically carried out by construction of an atomic model. The atomic model must then be validated for fit to the experimental electron density and also for agreement with prior expectations of stereochemistry. Stringent validation of protein–ligand models has become possible as a result of the mandatory deposition of primary diffraction data, and many computational tools are now available to aid in the validation process. Validation of protein–ligand complexes has revealed some instances of overenthusiastic interpretation of ligand density. Fundamental concepts and metrics of protein–ligand quality validation are discussed and we highlight software tools to assist in this process. It is essential that end users select high quality protein–ligand models for their computational and biological studies, and we provide an overview of how this can be achieved. PMID:25665575
Models of protein-ligand crystal structures: trust, but verify.
Deller, Marc C; Rupp, Bernhard
2015-09-01
X-ray crystallography provides the most accurate models of protein-ligand structures. These models serve as the foundation of many computational methods including structure prediction, molecular modelling, and structure-based drug design. The success of these computational methods ultimately depends on the quality of the underlying protein-ligand models. X-ray crystallography offers the unparalleled advantage of a clear mathematical formalism relating the experimental data to the protein-ligand model. In the case of X-ray crystallography, the primary experimental evidence is the electron density of the molecules forming the crystal. The first step in the generation of an accurate and precise crystallographic model is the interpretation of the electron density of the crystal, typically carried out by construction of an atomic model. The atomic model must then be validated for fit to the experimental electron density and also for agreement with prior expectations of stereochemistry. Stringent validation of protein-ligand models has become possible as a result of the mandatory deposition of primary diffraction data, and many computational tools are now available to aid in the validation process. Validation of protein-ligand complexes has revealed some instances of overenthusiastic interpretation of ligand density. Fundamental concepts and metrics of protein-ligand quality validation are discussed and we highlight software tools to assist in this process. It is essential that end users select high quality protein-ligand models for their computational and biological studies, and we provide an overview of how this can be achieved.
Quantitative analysis of protein-ligand interactions by NMR.
Furukawa, Ayako; Konuma, Tsuyoshi; Yanaka, Saeko; Sugase, Kenji
2016-08-01
Protein-ligand interactions have been commonly studied through static structures of the protein-ligand complex. Recently, however, there has been increasing interest in investigating the dynamics of protein-ligand interactions both for fundamental understanding of the underlying mechanisms and for drug development. NMR is a versatile and powerful tool, especially because it provides site-specific quantitative information. NMR has widely been used to determine the dissociation constant (KD), in particular, for relatively weak interactions. The simplest NMR method is a chemical-shift titration experiment, in which the chemical-shift changes of a protein in response to ligand titration are measured. There are other quantitative NMR methods, but they mostly apply only to interactions in the fast-exchange regime. These methods derive the dissociation constant from population-averaged NMR quantities of the free and bound states of a protein or ligand. In contrast, the recent advent of new relaxation-based experiments, including R2 relaxation dispersion and ZZ-exchange, has enabled us to obtain kinetic information on protein-ligand interactions in the intermediate- and slow-exchange regimes. Based on R2 dispersion or ZZ-exchange, methods that can determine the association rate, kon, dissociation rate, koff, and KD have been developed. In these approaches, R2 dispersion or ZZ-exchange curves are measured for multiple samples with different protein and/or ligand concentration ratios, and the relaxation data are fitted to theoretical kinetic models. It is critical to choose an appropriate kinetic model, such as the two- or three-state exchange model, to derive the correct kinetic information. The R2 dispersion and ZZ-exchange methods are suitable for the analysis of protein-ligand interactions with a micromolar or sub-micromolar dissociation constant but not for very weak interactions, which are typical in very fast exchange. This contrasts with the NMR methods that are used
The Cytokine Flt3-Ligand in Normal and Malignant Hematopoiesis.
Tsapogas, Panagiotis; Mooney, Ciaran James; Brown, Geoffrey; Rolink, Antonius
2017-05-24
The cytokine Fms-like tyrosine kinase 3 ligand (FL) is an important regulator of hematopoiesis. Its receptor, Flt3, is expressed on myeloid, lymphoid and dendritic cell progenitors and is considered an important growth and differentiation factor for several hematopoietic lineages. Activating mutations of Flt3 are frequently found in acute myeloid leukemia (AML) patients and associated with a poor clinical prognosis. In the present review we provide an overview of our current knowledge on the role of FL in the generation of blood cell lineages. We examine recent studies on Flt3 expression by hematopoietic stem cells and its potential instructive action at early stages of hematopoiesis. In addition, we review current findings on the role of mutated FLT3 in leukemia and the development of FLT3 inhibitors for therapeutic use to treat AML. The importance of mouse models in elucidating the role of Flt3-ligand in normal and malignant hematopoiesis is discussed.
PLIP: fully automated protein-ligand interaction profiler.
Salentin, Sebastian; Schreiber, Sven; Haupt, V Joachim; Adasme, Melissa F; Schroeder, Michael
2015-07-01
The characterization of interactions in protein-ligand complexes is essential for research in structural bioinformatics, drug discovery and biology. However, comprehensive tools are not freely available to the research community. Here, we present the protein-ligand interaction profiler (PLIP), a novel web service for fully automated detection and visualization of relevant non-covalent protein-ligand contacts in 3D structures, freely available at projects.biotec.tu-dresden.de/plip-web. The input is either a Protein Data Bank structure, a protein or ligand name, or a custom protein-ligand complex (e.g. from docking). In contrast to other tools, the rule-based PLIP algorithm does not require any structure preparation. It returns a list of detected interactions on single atom level, covering seven interaction types (hydrogen bonds, hydrophobic contacts, pi-stacking, pi-cation interactions, salt bridges, water bridges and halogen bonds). PLIP stands out by offering publication-ready images, PyMOL session files to generate custom images and parsable result files to facilitate successive data processing. The full python source code is available for download on the website. PLIP's command-line mode allows for high-throughput interaction profiling. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ligand-based virtual screening under partial shape constraints.
von Behren, Mathias M; Rarey, Matthias
2017-04-01
Ligand-based virtual screening has proven to be a viable technology during the search for new lead structures in drug discovery. Despite the rapidly increasing number of published methods, meaningful shape matching as well as ligand and target flexibility still remain open challenges. In this work, we analyze the influence of knowledge-based sterical constraints on the performance of the recently published ligand-based virtual screening method mRAISE. We introduce the concept of partial shape matching enabling a more differentiated view on chemical structure. The new method is integrated into the LBVS tool mRAISE providing multiple options for such constraints. The applied constraints can either be derived automatically from a protein-ligand complex structure or by manual selection of ligand atoms. In this way, the descriptor directly encodes the fit of a ligand into the binding site. Furthermore, the conservation of close contacts between the binding site surface and the query ligand can be enforced. We validated our new method on the DUD and DUD-E datasets. Although the statistical performance remains on the same level, detailed analysis reveal that for certain and especially very flexible targets a significant improvement can be achieved. This is further highlighted looking at the quality of calculated molecular alignments using the recently introduced mRAISE dataset. The new partial shape constraints improved the overall quality of molecular alignments especially for difficult targets with highly flexible or different sized molecules. The software tool mRAISE is freely available on Linux operating systems for evaluation purposes and academic use (see http://www.zbh.uni-hamburg.de/raise ).
Ligand-based virtual screening under partial shape constraints
NASA Astrophysics Data System (ADS)
von Behren, Mathias M.; Rarey, Matthias
2017-04-01
Ligand-based virtual screening has proven to be a viable technology during the search for new lead structures in drug discovery. Despite the rapidly increasing number of published methods, meaningful shape matching as well as ligand and target flexibility still remain open challenges. In this work, we analyze the influence of knowledge-based sterical constraints on the performance of the recently published ligand-based virtual screening method mRAISE. We introduce the concept of partial shape matching enabling a more differentiated view on chemical structure. The new method is integrated into the LBVS tool mRAISE providing multiple options for such constraints. The applied constraints can either be derived automatically from a protein-ligand complex structure or by manual selection of ligand atoms. In this way, the descriptor directly encodes the fit of a ligand into the binding site. Furthermore, the conservation of close contacts between the binding site surface and the query ligand can be enforced. We validated our new method on the DUD and DUD-E datasets. Although the statistical performance remains on the same level, detailed analysis reveal that for certain and especially very flexible targets a significant improvement can be achieved. This is further highlighted looking at the quality of calculated molecular alignments using the recently introduced mRAISE dataset. The new partial shape constraints improved the overall quality of molecular alignments especially for difficult targets with highly flexible or different sized molecules. The software tool mRAISE is freely available on Linux operating systems for evaluation purposes and academic use (see http://www.zbh.uni-hamburg.de/raise).
Ligand diffusion in proteins via enhanced sampling in molecular dynamics.
Rydzewski, J; Nowak, W
2017-12-01
Computational simulations in biophysics describe the dynamics and functions of biological macromolecules at the atomic level. Among motions particularly important for life are the transport processes in heterogeneous media. The process of ligand diffusion inside proteins is an example of a complex rare event that can be modeled using molecular dynamics simulations. The study of physical interactions between a ligand and its biological target is of paramount importance for the design of novel drugs and enzymes. Unfortunately, the process of ligand diffusion is difficult to study experimentally. The need for identifying the ligand egress pathways and understanding how ligands migrate through protein tunnels has spurred the development of several methodological approaches to this problem. The complex topology of protein channels and the transient nature of the ligand passage pose difficulties in the modeling of the ligand entry/escape pathways by canonical molecular dynamics simulations. In this review, we report a methodology involving a reconstruction of the ligand diffusion reaction coordinates and the free-energy profiles along these reaction coordinates using enhanced sampling of conformational space. We illustrate the above methods on several ligand-protein systems, including cytochromes and G-protein-coupled receptors. The methods are general and may be adopted to other transport processes in living matter. Copyright © 2017 Elsevier B.V. All rights reserved.
Translating in vitro ligand bias into in vivo efficacy.
Luttrell, Louis M; Maudsley, Stuart; Gesty-Palmer, Diane
2018-01-01
It is increasingly apparent that ligand structure influences both the efficiency with which G protein-coupled receptors (GPCRs) engage their downstream effectors and the manner in which they are activated. Thus, 'biased' agonists, synthetic ligands whose intrinsic efficacy differs from the native ligand, afford a strategy for manipulating GPCR signaling in ways that promote beneficial signals while blocking potentially deleterious ones. Still, there are significant challenges in relating in vitro ligand efficacy, which is typically measured in heterologous expression systems, to the biological response in vivo, where the ligand is acting on natively expressed receptors and in the presence of the endogenous ligand. This is particularly true of arrestin pathway-selective 'biased' agonists. The type 1 parathyroid hormone receptor (PTH 1 R) is a case in point. Parathyroid hormone (PTH) is the principal physiological regulator of calcium homeostasis, and PTH 1 R expressed on cells of the osteoblast lineage are an established therapeutic target in osteoporosis. In vitro, PTH 1 R signaling is highly sensitive to ligand structure, and PTH analogs that affect the selectivity/kinetics of G protein coupling or that engage arrestin-dependent signaling mechanisms without activating heterotrimeric G proteins have been identified. In vivo, intermittent administration of conventional PTH analogs accelerates the rate of osteoblastic bone formation, largely through known cAMP-dependent mechanisms. Paradoxically, both intermittent and continuous administration of an arrestin pathway-selective PTH analog, which in vivo would be expected to antagonize endogenous PTH 1 R-cAMP signaling, also increases bone mass. Transcriptomic analysis of tissue from treated animals suggests that conventional and arrestin pathway-selective PTH1R ligands act in largely different ways, with the latter principally affecting pathways involved in the regulation of cell cycle, survival, and migration
NASA Astrophysics Data System (ADS)
Kajita, Masashi K.; Aihara, Kazuyuki; Kobayashi, Tetsuya J.
2017-07-01
Specific interactions between receptors and their target ligands in the presence of nontarget ligands are crucial for biological processes such as T cell ligand discrimination. To discriminate between the target and nontarget ligands, cells have to increase specificity to the target ligands by amplifying the small differences in affinity among ligands. In addition, sensitivity to the ligand concentration and quick discrimination are also important to detect low amounts of target ligands and facilitate fast cellular decision making after ligand recognition. In this work we propose a mechanism for nonlinear specificity amplification (ultraspecificity) based on zero-order saturating reactions, which was originally proposed to explain nonlinear sensitivity amplification (ultrasensitivity) to the ligand concentration. In contrast to the previously proposed proofreading mechanisms that amplify the specificity by a multistep reaction, our model can produce an optimal balance of specificity, sensitivity, and quick discrimination. Furthermore, we show that a model for insensitivity to a large number of nontarget ligands can be naturally derived from a model with the zero-order ultraspecificity. The zero-order ultraspecificity, therefore, may provide an alternative way to understand ligand discrimination from the viewpoint of nonlinear properties in biochemical reactions.
Guo, Yongfeng; Ni, Jun; Denver, Robert; Wang, Xiaohong; Clark, Steven E.
2011-01-01
Nematodes that parasitize plant roots cause huge economic losses and have few mechanisms for control. Many parasitic nematodes infect plants by reprogramming root development to drive the formation of feeding structures. How nematodes take control of plant development is largely unknown. Here, we identify two host factors involved in the function of a receptor ligand mimic, GrCLE1, secreted by the potato cyst nematode Globodera rostochiensis. GrCLE1 is correctly processed to an active form by host plant proteases. Processed GrCLE1 peptides bind directly to the plant CLE receptors CLV2, BAM1, and BAM2. Involvement of these receptors in the ligand-mimicking process is also supported by the fact that the ability of GrCLE1 peptides to alter plant root development in Arabidopsis (Arabidopsis thaliana) is dependent on these receptors. Critically, we also demonstrate that GrCLE1 maturation can be entirely carried out by plant factors and that the availability of CLE processing activity may be essential for successful ligand mimicry. PMID:21750229
The Retinoid X Receptors and Their Ligands
Dawson, Marcia I.; Xia, Zebin
2014-01-01
This chapter presents an overview of the current status of studies on the structural and molecular biology of the retinoid X receptor subtypes α, β, and γ (RXRs, NR2B1–3), their nuclear and cytoplasmic functions, post-transcriptional processing, and recently reported ligands. Points of interest are the different changes in the ligand-binding pocket induced by variously shaped agonists, the communication of the ligand–bound pocket with the coactivator binding surface and the heterodimerization interface, and recently identified ligands that are natural products, those that function as environmental toxins or drugs that had been originally designed to interact with other targets, as well as those that were deliberately designed as RXR-selective transcriptional agonists, synergists, or antagonists. Of these synthetic ligands, the general trend in design appears to be away from fully aromatic rigid structures to those containing partial elements of the flexible tetraene side chain of 9-cis-retinoic acid. PMID:22020178
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kroupa, Daniel M.; Arias, Dylan H.; Blackburn, Jeffrey L.
We have prepared a series of samples with the ligand 6,13-bistri(iso-propyl)silylethynyl tetracene 2-carboxylic acid (TIPS-Tc-COOH) attached to PbS quantum dot (QD) samples of three different sizes in order to monitor and control the extent and time scales of energy flow after photoexcitation. Fast energy transfer (~1 ps) to the PbS QD occurs upon direct excitation of the ligand for all samples. The largest size QD maintains the microsecond exciton lifetime characteristic of the as-prepared oleate terminated PbS QDs. However, two smaller QD sizes with lowest exciton energies similar to or larger than the TIPS-Tc-COO- triplet energy undergo energy transfer betweenmore » QD core and ligand triplet on nanosecond to microsecond timescales. For the intermediate size QDs in particular, energy can be recycled many times between ligand and core, but the triplet remains the dominant excited species at long times, living for ~3 us for fully exchanged QDs and up to 30 us for partial ligand exchange, which is revealed as a method for controlling the triplet lifetime. A unique upconverted luminescence spectrum is observed that results from annihilation of triplets after exclusive excitation of the QD core.« less
Kroupa, Daniel M.; Arias, Dylan H.; Blackburn, Jeffrey L.; ...
2018-01-24
We have prepared a series of samples with the ligand 6,13-bistri(iso-propyl)silylethynyl tetracene 2-carboxylic acid (TIPS-Tc-COOH) attached to PbS quantum dot (QD) samples of three different sizes in order to monitor and control the extent and time scales of energy flow after photoexcitation. Fast energy transfer (~1 ps) to the PbS QD occurs upon direct excitation of the ligand for all samples. The largest size QD maintains the microsecond exciton lifetime characteristic of the as-prepared oleate terminated PbS QDs. However, two smaller QD sizes with lowest exciton energies similar to or larger than the TIPS-Tc-COO- triplet energy undergo energy transfer betweenmore » QD core and ligand triplet on nanosecond to microsecond timescales. For the intermediate size QDs in particular, energy can be recycled many times between ligand and core, but the triplet remains the dominant excited species at long times, living for ~3 us for fully exchanged QDs and up to 30 us for partial ligand exchange, which is revealed as a method for controlling the triplet lifetime. A unique upconverted luminescence spectrum is observed that results from annihilation of triplets after exclusive excitation of the QD core.« less
Differential hydrogen/deuterium exchange mass spectrometry analysis of protein–ligand interactions
Chalmers, Michael J; Busby, Scott A; Pascal, Bruce D; West, Graham M; Griffin, Patrick R
2011-01-01
Functional regulation of ligand-activated receptors is driven by alterations in the conformational dynamics of the protein upon ligand binding. Differential hydrogen/deuterium exchange (HDX) coupled with mass spectrometry has emerged as a rapid and sensitive approach for characterization of perturbations in conformational dynamics of proteins following ligand binding. While this technique is sensitive to detecting ligand interactions and alterations in receptor dynamics, it also can provide important mechanistic insights into ligand regulation. For example, HDX has been used to determine a novel mechanism of ligand activation of the nuclear receptor peroxisome proliferator activated receptor-γ, perform detailed analyses of binding modes of ligands within the ligand-binding pocket of two estrogen receptor isoforms, providing insight into selectivity, and helped classify different types of estrogen receptor-α ligands by correlating their pharmacology with the way they interact with the receptor based solely on hierarchical clustering of receptor HDX signatures. Beyond small-molecule–receptor interactions, this technique has also been applied to study protein–protein complexes, such as mapping antibody–antigen interactions. In this article, we summarize the current state of the differential HDX approaches and the future outlook. We summarize how HDX analysis of protein–ligand interactions has had an impact on biology and drug discovery. PMID:21329427
Mutual control of axial and equatorial ligands: model studies with [Ni]-bacteriochlorophyll-a.
Yerushalmi, Roie; Noy, Dror; Baldridge, Kim K; Scherz, Avigdor
2002-07-17
) computationally, we found that a reduction of [Ni]-BChl*imidazole results in a weaker metal-axial ligand bond. Yet, it remains weakly bound in the gas phase. The experimentally observed ligand dissociation is accounted for computationally when solvation is considered. On the basis of the experimental observations and QM calculations, we propose a mechanism whereby alterations in the equatorial pi system and modulation of sigma bonding between the axial ligands and the metal core are mutually correlated. Such a mechanism highlights the dynamic role of axial ligands in regulating the activity of metal centers such as factor F430 (F430), a nickel-based coenzyme that is essential in methanogenic archea.
A grand unified model for liganded gold clusters
NASA Astrophysics Data System (ADS)
Xu, Wen Wu; Zhu, Beien; Zeng, Xiao Cheng; Gao, Yi
2016-12-01
A grand unified model (GUM) is developed to achieve fundamental understanding of rich structures of all 71 liganded gold clusters reported to date. Inspired by the quark model by which composite particles (for example, protons and neutrons) are formed by combining three quarks (or flavours), here gold atoms are assigned three `flavours' (namely, bottom, middle and top) to represent three possible valence states. The `composite particles' in GUM are categorized into two groups: variants of triangular elementary block Au3(2e) and tetrahedral elementary block Au4(2e), all satisfying the duet rule (2e) of the valence shell, akin to the octet rule in general chemistry. The elementary blocks, when packed together, form the cores of liganded gold clusters. With the GUM, structures of 71 liganded gold clusters and their growth mechanism can be deciphered altogether. Although GUM is a predictive heuristic and may not be necessarily reflective of the actual electronic structure, several highly stable liganded gold clusters are predicted, thereby offering GUM-guided synthesis of liganded gold clusters by design.
Cloud Computing for Protein-Ligand Binding Site Comparison
2013-01-01
The proteome-wide analysis of protein-ligand binding sites and their interactions with ligands is important in structure-based drug design and in understanding ligand cross reactivity and toxicity. The well-known and commonly used software, SMAP, has been designed for 3D ligand binding site comparison and similarity searching of a structural proteome. SMAP can also predict drug side effects and reassign existing drugs to new indications. However, the computing scale of SMAP is limited. We have developed a high availability, high performance system that expands the comparison scale of SMAP. This cloud computing service, called Cloud-PLBS, combines the SMAP and Hadoop frameworks and is deployed on a virtual cloud computing platform. To handle the vast amount of experimental data on protein-ligand binding site pairs, Cloud-PLBS exploits the MapReduce paradigm as a management and parallelizing tool. Cloud-PLBS provides a web portal and scalability through which biologists can address a wide range of computer-intensive questions in biology and drug discovery. PMID:23762824
A grand unified model for liganded gold clusters
Xu, Wen Wu; Zhu, Beien; Zeng, Xiao Cheng; Gao, Yi
2016-01-01
A grand unified model (GUM) is developed to achieve fundamental understanding of rich structures of all 71 liganded gold clusters reported to date. Inspired by the quark model by which composite particles (for example, protons and neutrons) are formed by combining three quarks (or flavours), here gold atoms are assigned three ‘flavours' (namely, bottom, middle and top) to represent three possible valence states. The ‘composite particles' in GUM are categorized into two groups: variants of triangular elementary block Au3(2e) and tetrahedral elementary block Au4(2e), all satisfying the duet rule (2e) of the valence shell, akin to the octet rule in general chemistry. The elementary blocks, when packed together, form the cores of liganded gold clusters. With the GUM, structures of 71 liganded gold clusters and their growth mechanism can be deciphered altogether. Although GUM is a predictive heuristic and may not be necessarily reflective of the actual electronic structure, several highly stable liganded gold clusters are predicted, thereby offering GUM-guided synthesis of liganded gold clusters by design. PMID:27910848
Dual genetically encoded phage-displayed ligands.
Mohan, Kritika; Weiss, Gregory A
2014-05-15
M13 bacteriophage display presents polypeptides as fusions to phage coat proteins. Such phage-displayed ligands offer useful reagents for biosensors. Here, we report a modified phage propagation protocol for the consistent and robust display of two different genetically encoded ligands on the major coat protein, P8. The results demonstrate that the phage surface reaches a saturation point for maximum peptide display. Copyright © 2014 Elsevier Inc. All rights reserved.
Spatiotemporal Targeting of a Dual-Ligand Nanoparticle to Cancer Metastasis.
Doolittle, Elizabeth; Peiris, Pubudu M; Doron, Gilad; Goldberg, Amy; Tucci, Samantha; Rao, Swetha; Shah, Shruti; Sylvestre, Meilyn; Govender, Priya; Turan, Oguz; Lee, Zhenghong; Schiemann, William P; Karathanasis, Efstathios
2015-08-25
Various targeting strategies and ligands have been employed to direct nanoparticles to tumors that upregulate specific cell-surface molecules. However, tumors display a dynamic, heterogeneous microenvironment, which undergoes spatiotemporal changes including the expression of targetable cell-surface biomarkers. Here, we investigated a dual-ligand nanoparticle to effectively target two receptors overexpressed in aggressive tumors. By using two different chemical specificities, the dual-ligand strategy considered the spatiotemporal alterations in the expression patterns of the receptors in cancer sites. As a case study, we used two mouse models of metastasis of triple-negative breast cancer using the MDA-MB-231 and 4T1 cells. The dual-ligand system utilized two peptides targeting P-selectin and αvβ3 integrin, which are functionally linked to different stages of the development of metastatic disease at a distal site. Using in vivo multimodal imaging and post mortem histological analyses, this study shows that the dual-ligand nanoparticle effectively targeted metastatic disease that was otherwise missed by single-ligand strategies. The dual-ligand nanoparticle was capable of capturing different metastatic sites within the same animal that overexpressed either receptor or both of them. Furthermore, the highly efficient targeting resulted in 22% of the injected dual-ligand nanoparticles being deposited in early-stage metastases within 2 h after injection.
The role of ligands in coinage-metal nanoparticles for electronics
Kanelidis, Ioannis
2017-01-01
Coinage-metal nanoparticles are key components of many printable electronic inks. They can be combined with polymers to form conductive composites and have been used as the basis of molecular electronic devices. This review summarizes the multidimensional role of surface ligands that cover their metal cores. Ligands not only passivate crystal facets and determine growth rates and shapes; they also affect size and colloidal stability. Particle shapes can be tuned via the ligand choice while ligand length, size, ω-functionalities, and chemical nature influence shelf-life and stability of nanoparticles in dispersions. When particles are deposited, ligands affect the electrical properties of the resulting film, the morphology of particle films, and the nature of the interfaces. The effects of the ligands on sintering, cross-linking, and self-assembly of particles in electronic materials are discussed. PMID:29259877
Phosphine-alkene ligands as mechanistic probes in the Pauson-Khand reaction.
Ferrer, Catalina; Benet-Buchholz, Jordi; Riera, Antoni; Verdaguer, Xavier
2010-07-26
An alkyne tetracarbonyl dicobalt complex with a chelated phosphine-alkene ligand, in which the phosphorus atom and the alkene from the ligand are attached to the same cobalt atom has been prepared, isolated, and characterized by X-ray crystallography. The complex serves as a mechanistic model for an intermediate of the Pauson-Khand (PK) reaction. Although the alkene fragment is located in an equatorial coordination site with an appropriate orientation, and, therefore, should undergo insertion, it failed to give the PK product upon either thermal or N-methylmorpholine N-oxide activation. However, a phosphine-alkene complex that contains a terminal alkene readily provided the corresponding PK product. We attribute this change in reactivity to the different ability of each olefin to undergo 1,2-insertion. These results provide further insights into the factors that govern a crucial step in the PK reaction, the olefin insertion.
The ligand effect on the hydrolytic reactivity of Zn(II) complexes toward phosphate diesters.
Bonfá, Lodovico; Gatos, Maddalena; Mancin, Fabrizio; Tecilla, Paolo; Tonellato, Umberto
2003-06-16
The catalytic effects of the Zn(II) complexes of a series of poliaminic ligands in the hydrolysis of the activated phosphodiesters bis-p-nitrophenyl phosphate (BNP) and 2-hydroxypropyl-p-nitrophenyl phosphate (HPNP) have been investigated. The reactions show first-order rate dependency on both substrate and metal ion complex and a pH dependence which is diagnostic of the acid dissociation of the reactive species. The mechanism of the metal catalyzed transesterification of HPNP has been assessed by solvent isotopic kinetic effect studies and involves the intramolecular nucleophilic attack of the substrate alcoholic group, activated by metal ion coordination. The intrinsic reactivity of the different complexes is controlled by the nature and structure of the ligand: complexes of tridentate ligands, particularly if characterized by a facial coordination mode, are more reactive than those of tetradentate ligands which can hardly allow binding sites for the substrate. In the case of tridentate ligands that form complexes with a facial coordination mode, a linear Brønsted correlation between the reaction rate (log k) and the pK(a) of the active nucleophile is obtained. The beta(nuc) values are 0.75 for the HPNP transesterification and 0.20 for the BNP hydrolysis. These values are indicated as the result of the combination of two opposite Lewis acid effects of the Zn(II) ion: the activation of the substrate and the efficiency of the metal coordinated nucleophile. The latter factor apparently prevails in determining the intrinsic reactivity of the Zn(II) complexes.
Polymerization catalysts containing electron-withdrawing amide ligands
Watkin, John G.; Click, Damon R.
2002-01-01
The present invention describes methods of making a series of amine-containing organic compounds which are used as ligands for group 3-10 and lanthanide metal compounds. The ligands have electron-withdrawing groups bonded to them. The metal compounds, when combined with a cocatalyst, are catalysts for the polymerization of olefins.
Molecualr-scale multicoordinating ligands for coating luminescent QDs and gold nanoparticles
NASA Astrophysics Data System (ADS)
Zhan, Naiqian
Colloidal semiconductor quantum dots (QDs) are inorganic nanocrystals that possess several unique photophysical properties, including tunable narrow emission and remarkable photo- and chemical stability. They have large surface area, and thus can be decorated with large numbers and a variety of molecular vectors. These properties combined offer a potentially superior alternative to traditional organic fluorophore for advanced applications in bio-imaging and bio-sensing. Herein, our effort has centered on developing a series of metal coordinating ligands with controllable structures to modify the QD surfaces and construct biocompatible nanocrystals. The ligand architecture accounts for several factors: (i) variable coordination number, (ii) nature of the hydrophilic moiety, polyethylene glycol (PEG) or zwitterion, and (iii) versatility of end-reactive groups including amine, azide, carboxylic acid and aldehyde. The ligand design is combined with a newly developed photoligation strategy to promote the dispersion of luminescent QDs in buffer media. The dissertation is organized in six chapters: In chapter 1, we provide a brief introduction of the basic photophysical properties of QDs and the synthesis history for growing high quality semiconductor nanocrystals. We also present some of the most effective methods reported to date to prepare aqueous QD dispersions, discuss the effective chemical coupling strategies for conjugating biomolecules, and review the recent literatures that have used QD-bioconjugates for imaging and sensing purposes. In Chapter 2, we describe a novel photoligation strategy to promote the transfer of luminescent QDs from hydrophobic to hydrophilic media using lipic acid (LA)-based ligands. We also discusse the experimental conditions, mechanismfor in-situ ligand exchange and the generosity of the method towards the diverse functionality while maintaining the optical properties of the nanocrystals. In chapter 3, we present the design and synthesis
Selectivity in ligand recognition of G-quadruplex loops.
Campbell, Nancy H; Patel, Manisha; Tofa, Amina B; Ghosh, Ragina; Parkinson, Gary N; Neidle, Stephen
2009-03-03
A series of disubstituted acridine ligands have been cocrystallized with a bimolecular DNA G-quadruplex. The ligands have a range of cyclic amino end groups of varying size. The crystal structures show that the diagonal loop in this quadruplex results in a large cavity for these groups, in contrast to the steric constraints imposed by propeller loops in human telomeric quadruplexes. We conclude that the nature of the loop has a significant influence on ligand selectivity for particular quadruplex folds.
Sigma Receptor (σR) Ligands with Antiproliferative and Anticancer Activity.
Georgiadis, Markos-Orestis; Karoutzou, Olga; Foscolos, Angeliki-Sofia; Papanastasiou, Ioannis
2017-08-25
Sigma receptor (σR) ligands have proven to be useful as cancer diagnostics and anticancer therapeutics and their ligands have been developed as molecular probes in oncology. Moreover, various σR ligands generate cancer cell death in vitro and in vivo. These σR ligands have exhibited promising results against numerous human and rodent cancers and are investigated under preclinical and clinical study trials, indicating a new category of drugs in cancer therapy.
Ligand Entry and Exit Pathways in the β2-adrenergic Receptor
Wang, Ting; Duan, Yong
2009-01-01
The recently determined crystal structure of the human β2-adrenergic (β2AR) G-protein coupled receptor provides an excellent structural basis for exploring β2AR -ligand binding and dissociation process. Based on this crystal structure, we simulated ligand exit from the β2AR receptor by applying the random acceleration molecular dynamics (RAMD) simulation method. The simulation results showed that the extracellular opening on the receptor surface was the most frequently observed egress point (referred to as pathway A) and a few other pathways through inter-helical clefts were also observed with significantly lower frequencies. In the egress trajectories along pathway A, the D192-K305 salt bridge between the extracellular loop 2 (ECL2) and the apex of the transmembrane helix 7 (TM7) was exclusively broken. The spatial occupancy maps of the ligand computed from the 100 RAMD simulation trajectories indicated that the receptor-ligand interactions that restrained the ligand in the binding pocket were the major resistance encountered by the ligand during exit and no second barrier was notable. We next performed RAMD simulations by using a putative ligand-free conformation of the receptor as input structure. This conformation was obtained in a standard MD simulation in the absence of the ligand and it differed from the ligand-bound conformation in a hydrophobic patch bridging ECL2 and TM7 due to the rotation of F193 of ECL2. Results from the RAMD simulations with this putative ligand-free conformation suggest that the cleft formed by the hydrophobic bridge, TM2, TM3 and TM7 on the extracellular surface likely serves as a more specific ligand-entry site and the ECL2-TM7 hydrophobic junction can be partially interrupted upon the entry of ligand that pushes F193 to rotate, resulting in a conformation as observed in the ligand-bound crystal structure. These results may help design β2AR-targeting drugs with improved efficacy as well as understand the receptor subtype
New ligands for melanocortin receptors.
Kaelin, C B; Candille, S I; Yu, B; Jackson, P; Thompson, D A; Nix, M A; Binkley, J; Millhauser, G L; Barsh, G S
2008-12-01
Named originally for their effects on peripheral end organs, the melanocortin system controls a diverse set of physiological processes through a series of five G-protein-coupled receptors and several sets of small peptide ligands. The central melanocortin system plays an essential role in homeostatic regulation of body weight, in which two alternative ligands, alpha-melanocyte-stimulating hormone and agouti-related protein, stimulate and inhibit receptor signaling in several key brain regions that ultimately affect food intake and energy expenditure. Much of what we know about the relationship between central melanocortin signaling and body weight regulation stems from genetic studies. Comparative genomic studies indicate that melanocortin receptors used for controlling pigmentation and body weight regulation existed more than 500 million years ago in primitive vertebrates, but that fine-grained control of melanocortin receptors through neuropeptides and endogenous antagonists developed more recently. Recent studies based on dog coat-color genetics revealed a new class of melanocortin ligands, the beta-defensins, which reveal the potential for cross talk between the melanocortin and the immune systems.
Mote, Nilesh R; Patel, Ketan; Shinde, Dinesh R; Gaikwad, Shahaji R; Koshti, Vijay S; Gonnade, Rajesh G; Chikkali, Samir H
2017-10-16
Self-assembly of two neutral ligands on a metal to mimic bidentate ligand coordination has been frequently encountered in the recent past, but self-assembly of an anionic ligand on a metal template alongside a neutral ligand remains an elusive target. Such a self-assembly is hampered by additional complexity, wherein a highly negatively charged anion can form intermolecular hydrogen bonding with the supramolecular motif, leaving no scope for self-assembly with neutral ligand. Presented here is the self-association of anionic ligand 3-ureidobenzoic acid (2a) and neutral ligand 1-(3-(diphenylphosphanyl)phenyl)urea (1a) on a metal template to yield metal complex [{COOC 6 H 4 NH(CO)NH 2 }{Ph 2 PC 6 H 4 NH(CO)NH 2 }PdMeDMSO] (4a). The identity of 4a was established by NMR and mass spectroscopy. Along the same lines, 3-(3-phenylureido)benzoic acid (2b) and 1-(3-(diphenylphosphanyl)phenyl)-3-phenylurea (1b) self-assemble on a metal template to produce palladium complex [{COOC 6 H 4 NH(CO)NHPh}{Ph 2 PC 6 H 4 NH(CO)NHPh}PdMePy] (5c). The existence of 5c was confirmed by Job plot, 1-2D NMR spectroscopy, deuterium labeling, IR spectroscopy, UV-vis spectroscopy, model complex synthesis, and DFT calculations. These solution and gas phase investigations authenticated the presence of intramolecular hydrogen bonding between hydrogen's of 1b and carbonyl oxygen of 2b. The generality of the supramolecular approach has been validated by preparing six complexes from four monodentate ligands, and their synthetic utility was demonstrated in ethylene polymerization. Complex 4a was found to be the most active, leading to the production of highly branched polyethylene with a molecular weight of 55700 g/mol and melting temperature of 112 °C.
Harada, Takashi; Tsumatori, Hiroyuki; Nishiyama, Katsura; Yuasa, Junpei; Hasegawa, Yasuchika; Kawai, Tsuyoshi
2012-06-18
Circularly polarized luminescence (CPL) of chiral Eu(III) complexes with nona- and octa-coordinated structures, [Eu(R/S-iPr-Pybox)(D-facam)(3)] (1-R/1-S; R/S-iPr-Pybox, 2,6-bis(4R/4S-isopropyl-2-oxazolin-2-yl)pyridine; D-facam, 3-trifluoroacetyl-d-camphor), [Eu(S,S-Me-Ph-Pybox)(D-facam)(3)] (2-SS; S,S-Me-Ph-Pybox, 2,6-bis(4S-methyl-5S-phenyl-2-oxazolin-2-yl)pyridine), and [Eu(Phen)(D-facam)(3)] (3; Phen, 1,10-phenanthroline) are reported, and their structural features are discussed on the basis of X-ray crystallographic analyses. These chiral Eu(III) complexes showed relatively intense photoluminescence due to their (5)D(0) → (7)F(1) (magnetic-dipole) and (5)D(0) → (7)F(2) (electric-dipole) transition. The dissymmetry factors of CPL (g(CPL)) at the former band of 1-R and 1-S were as large as -1.0 and -0.8, respectively, while the g(CPL) of 3 at the (5)D(0) → (7)F(1) transition was relatively small (g(CPL) = -0.46). X-ray crystallographic data indicated specific ligand-ligand hydrogen bonding in these compounds which was expected to stabilize their chiral structures even in solution phase. CPL properties of 1-R and 1-S were discussed in terms of transition nature of lanthanide luminescence.
Belfiore, Lisa; Spenkelink, Lisanne M; Ranson, Marie; van Oijen, Antoine M; Vine, Kara L
2018-05-28
Despite the longstanding existence of liposome technology in drug delivery applications, there have been no ligand-directed liposome formulations approved for clinical use to date. This lack of translation is due to several factors, one of which is the absence of molecular tools for the robust quantification of ligand density on the surface of liposomes. We report here for the first time the quantification of proteins attached to the surface of small unilamellar liposomes using single-molecule fluorescence imaging. Liposomes were surface-functionalized with fluorescently labeled human proteins previously validated to target the cancer cell surface biomarkers plasminogen activator inhibitor-2 (PAI-2) and trastuzumab (TZ, Herceptin®). These protein-conjugated liposomes were visualized using a custom-built wide-field fluorescence microscope with single-molecule sensitivity. By counting the photobleaching steps of the fluorescently labeled proteins, we calculated the number of attached proteins per liposome, which was 11 ± 4 proteins for single-ligand liposomes. Imaging of dual-ligand liposomes revealed stoichiometries of the two attached proteins in accordance with the molar ratios of protein added during preparation. Preparation of PAI-2/TZ dual-ligand liposomes via two different methods revealed that the post-insertion method generated liposomes with a more equal representation of the two differently sized proteins, demonstrating the ability of this preparation method to enable better control of liposome protein densities. We conclude that the single-molecule imaging method presented here is an accurate and reliable quantification tool for determining ligand density and stoichiometry on the surface of liposomes. This method has the potential to allow for comprehensive characterization of novel ligand-directed liposomes that should facilitate the translation of these nanotherapies through to the clinic. Copyright © 2018 Elsevier B.V. All rights reserved.
Free-energy relationships in ion channels activated by voltage and ligand
Chowdhury, Sandipan
2013-01-01
Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866
Kim, A-Ram; Kim, Hyuk Soon; Lee, Jeong Min; Choi, Jung Ho; Kim, Se Na; Kim, Do Kyun; Kim, Ji Hyung; Mun, Se Hwan; Kim, Jie Wan; Jeon, Hyun Soo; Kim, Young Mi; Choi, Wahn Soo
2012-05-05
Osteoclasts, multinucleated bone-resorbing cells, are closely associated with bone diseases such as rheumatoid arthritis and osteoporosis. Osteoclasts are derived from hematopoietic precursor cells, and their differentiation is mediated by two cytokines, including macrophage colony stimulating factor and receptor activator of nuclear factor κB ligand (RANKL). Previous studies have shown that arctigenin exhibits an anti-inflammatory effect. However, the effect of arctigenin on osteoclast differentiation is yet to be elucidated. In this study, we found that arctigenin inhibited RANKL-mediated osteoclast differentiation in bone marrow macrophages in a dose-dependent manner and suppressed RANKL-mediated bone resorption. Additionally, the expression of typical marker proteins, such as NFATc1, c-Fos, TRAF6, c-Src, and cathepsin K, were significantly inhibited. Arctigenin inhibited the phosphorylation of Erk1/2, but not p38 and JNK, in a dose-dependent manner. Arctigenin also dramatically suppressed immunoreceptor tyrosine-based activation motif-mediated costimulatory signaling molecules, including Syk and PLCγ2, and Gab2. Notably, arctigenin inhibited the activation of Syk through RANKL stimulation. Furthermore, arctigenin prevented osteoclast differentiation in the calvarial bone of mice following stimulation with lipopolysaccharide. Our results show that arctigenin inhibits osteoclast differentiation in vitro and in vivo. Therefore, arctigenin may be useful for treating rheumatoid arthritis and osteoporosis. Copyright © 2012 Elsevier B.V. All rights reserved.
Bernardes, Amanda; Souza, Paulo C T; Muniz, João R C; Ricci, Clarisse G; Ayers, Stephen D; Parekh, Nili M; Godoy, André S; Trivella, Daniela B B; Reinach, Peter; Webb, Paul; Skaf, Munir S; Polikarpov, Igor
2013-08-23
Peroxisome proliferator-activated receptors (PPARs) are members of a superfamily of nuclear transcription factors. They are involved in mediating numerous physiological effects in humans, including glucose and lipid metabolism. PPARα ligands effectively treat dyslipidemia and have significant antiinflammatory and anti-atherosclerotic activities. These effects and their ligand-dependent activity make nuclear receptors obvious targets for drug design. Here, we present the structure of the human PPARα in complex with WY14643, a member of fibrate class of drug, and a widely used PPAR activator. The crystal structure of this complex suggests that WY14643 induces activation of PPARα in an unusual bipartite mechanism involving conventional direct helix 12 stabilization and an alternative mode that involves a second ligand in the pocket. We present structural observations, molecular dynamics and activity assays that support the importance of the second site in WY14643 action. The unique binding mode of WY14643 reveals a new pattern of nuclear receptor ligand recognition and suggests a novel basis for ligand design, offering clues for improving the binding affinity and selectivity of ligand. We show that binding of WY14643 to PPARα was associated with antiinflammatory disease in a human corneal cell model, suggesting possible applications for PPARα ligands. Copyright © 2013 Elsevier Ltd. All rights reserved.
Identification and characterization of PPARα ligands in the hippocampus
Roy, Avik; Kundu, Madhuchhanda; Jana, Malabendu; Mishra, Rama K.; Yung, Yeni; Luan, Chi-Hao; Gonzalez, Frank J.; Pahan, Kalipada
2016-01-01
Peroxisome proliferator-activated receptor alpha (PPARα) regulates hepatic fatty acid catabolism and mediates the metabolic response to starvation. Recently, we have found that PPARα is constitutively activated in nuclei of hippocampal neurons and controls plasticity via direct transcriptional activation of CREB. Here, three endogenous ligands of PPARα, 3-hydroxy-(2,2)-dimethyl butyrate, hexadecanamide, and 9-octadecenamide were discovered in mouse brain hippocampus. Mass spectrometric detection of these compounds in mouse hippocampal nuclear extracts, in silico interaction studies, time-resolved FRET analyses, and thermal shift assay clearly indicated that these three compounds served as ligands of PPARα. Site-directed mutagenesis studies further revealed that PPARα Tyr 464 and Tyr 314 were involved in binding these hippocampal ligands. Moreover, these ligands activated PPARα and upregulated synaptic function of hippocampal neurons. These results highlight the discovery of hippocampal ligands of PPARα capable of modulating synaptic functions. PMID:27748752
Identification and characterization of PPARα ligands in the hippocampus.
Roy, Avik; Kundu, Madhuchhanda; Jana, Malabendu; Mishra, Rama K; Yung, Yeni; Luan, Chi-Hao; Gonzalez, Frank J; Pahan, Kalipada
2016-12-01
Peroxisome proliferator-activated receptor-α (PPARα) regulates hepatic fatty acid catabolism and mediates the metabolic response to starvation. Recently we found that PPARα is constitutively activated in nuclei of hippocampal neurons and controls plasticity via direct transcriptional activation of CREB. Here we report the discovery of three endogenous PPARα ligands-3-hydroxy-(2,2)-dimethyl butyrate, hexadecanamide, and 9-octadecenamide-in mouse brain hippocampus. Mass spectrometric detection of these compounds in mouse hippocampal nuclear extracts, in silico interaction studies, time-resolved FRET analyses, and thermal shift assay results clearly indicated that these three compounds served as ligands of PPARα. Site-directed mutagenesis studies further revealed that PPARα Y464 and Y314 are involved in binding these hippocampal ligands. Moreover, these ligands activated PPARα and upregulated the synaptic function of hippocampal neurons. These results highlight the discovery of hippocampal ligands of PPARα capable of modulating synaptic functions.
Ligand-protein docking using a quantum stochastic tunneling optimization method.
Mancera, Ricardo L; Källblad, Per; Todorov, Nikolay P
2004-04-30
A novel hybrid optimization method called quantum stochastic tunneling has been recently introduced. Here, we report its implementation within a new docking program called EasyDock and a validation with the CCDC/Astex data set of ligand-protein complexes using the PLP score to represent the ligand-protein potential energy surface and ScreenScore to score the ligand-protein binding energies. When taking the top energy-ranked ligand binding mode pose, we were able to predict the correct crystallographic ligand binding mode in up to 75% of the cases. By using this novel optimization method run times for typical docking simulations are significantly shortened. Copyright 2004 Wiley Periodicals, Inc. J Comput Chem 25: 858-864, 2004
Spatiotemporal Targeting of a Dual-Ligand Nanoparticle to Cancer Metastasis
Doolittle, Elizabeth; Peiris, Pubudu M.; Doron, Gilad; Goldberg, Amy; Tucci, Samantha; Rao, Swetha; Shah, Shruti; Sylvestre, Meilyn; Govender, Priya; Turan, Oguz; Lee, Zhenghong; Schiemann, William P.; Karathanasis, Efstathios
2015-01-01
Various targeting strategies and ligands have been employed to direct nanoparticles to tumors that upregulate specific cell-surface molecules. However, tumors display a dynamic, heterogeneous microenvironment, which undergoes spatiotemporal changes including the expression of targetable cell-surface biomarkers. Here, we investigated a dual-ligand nanoparticle to effectively target two receptors overexpressed in aggressive tumors. By using two different chemical specificities, the dual-ligand strategy considered the spatiotemporal alterations in the expression patterns of the receptors in cancer sites. As a case study, we used two mouse models of metastasis of triple-negative breast cancer using the MDA-MB-231 and 4T1 cells. The dual-ligand system utilized two peptides targeting P-selectin and αvβ3 integrin, which are functionally linked to different stages of the development of metastatic disease at a distal site. Using in vivo multimodal imaging and post mortem histological analyses, this study shows that the dual-ligand nanoparticle effectively targeted metastatic disease that was otherwise missed by single-ligand strategies. The dual-ligand nanoparticle was capable of capturing different metastatic sites within the same animal that overexpressed either receptor or both of them. Furthermore, the highly efficient targeting resulted in 22% of the injected dual-ligand nanoparticles being deposited in early-stage metastases within 2 h after injection. PMID:26203676
Improved ligand geometries in crystallographic refinement using AFITT in PHENIX
Janowski, Pawel A.; Moriarty, Nigel W.; Kelley, Brian P.; ...
2016-08-31
Modern crystal structure refinement programs rely on geometry restraints to overcome the challenge of a low data-to-parameter ratio. While the classical Engh and Huber restraints work well for standard amino-acid residues, the chemical complexity of small-molecule ligands presents a particular challenge. Most current approaches either limit ligand restraints to those that can be readily described in the Crystallographic Information File (CIF) format, thus sacrificing chemical flexibility and energetic accuracy, or they employ protocols that substantially lengthen the refinement time, potentially hindering rapid automated refinement workflows.PHENIX–AFITTrefinement uses a full molecular-mechanics force field for user-selected small-molecule ligands during refinement, eliminating the potentiallymore » difficult problem of finding or generating high-quality geometry restraints. It is fully integrated with a standard refinement protocol and requires practically no additional steps from the user, making it ideal for high-throughput workflows.PHENIX–AFITTrefinements also handle multiple ligands in a single model, alternate conformations and covalently bound ligands. Here, the results of combiningAFITTand thePHENIXsoftware suite on a data set of 189 protein–ligand PDB structures are presented. Refinements usingPHENIX–AFITTsignificantly reduce ligand conformational energy and lead to improved geometries without detriment to the fit to the experimental data. Finally, for the data presented,PHENIX–AFITTrefinements result in more chemically accurate models for small-molecule ligands.« less
Wilkes, Mark C.; Repellin, Claire E.; Kang, Jeong-Han; Andrianifahanana, Mahefatiana; Yin, Xueqian; Leof, Edward B.
2015-01-01
Transforming growth factor β (TGFβ) is a pleiotropic protein secreted from essentially all cell types and primary tissues. While TGFβ’s actions reflect the activity of a number of signaling networks, the primary mediator of TGFβ responses are the Smad proteins. Following receptor activation, these cytoplasmic proteins form hetero-oligomeric complexes that translocate to the nucleus and affect gene transcription. Here, through biological, biochemical, and immunofluorescence approaches, sorting nexin 9 (SNX9) is identified as being required for Smad3-dependent responses. SNX9 interacts with phosphorylated (p) Smad3 independent of Smad2 or Smad4 and promotes more rapid nuclear delivery than that observed independent of ligand. Although SNX9 does not bind nucleoporins Nup153 or Nup214 or some β importins (Imp7 or Impβ), it mediates the association of pSmad3 with Imp8 and the nuclear membrane. This facilitates nuclear translocation of pSmad3 but not SNX9. PMID:26337383
NASA Astrophysics Data System (ADS)
Kurkcuoglu, Zeynep; Koukos, Panagiotis I.; Citro, Nevia; Trellet, Mikael E.; Rodrigues, J. P. G. L. M.; Moreira, Irina S.; Roel-Touris, Jorge; Melquiond, Adrien S. J.; Geng, Cunliang; Schaarschmidt, Jörg; Xue, Li C.; Vangone, Anna; Bonvin, A. M. J. J.
2018-01-01
We present the performance of HADDOCK, our information-driven docking software, in the second edition of the D3R Grand Challenge. In this blind experiment, participants were requested to predict the structures and binding affinities of complexes between the Farnesoid X nuclear receptor and 102 different ligands. The models obtained in Stage1 with HADDOCK and ligand-specific protocol show an average ligand RMSD of 5.1 Å from the crystal structure. Only 6/35 targets were within 2.5 Å RMSD from the reference, which prompted us to investigate the limiting factors and revise our protocol for Stage2. The choice of the receptor conformation appeared to have the strongest influence on the results. Our Stage2 models were of higher quality (13 out of 35 were within 2.5 Å), with an average RMSD of 4.1 Å. The docking protocol was applied to all 102 ligands to generate poses for binding affinity prediction. We developed a modified version of our contact-based binding affinity predictor PRODIGY, using the number of interatomic contacts classified by their type and the intermolecular electrostatic energy. This simple structure-based binding affinity predictor shows a Kendall's Tau correlation of 0.37 in ranking the ligands (7th best out of 77 methods, 5th/25 groups). Those results were obtained from the average prediction over the top10 poses, irrespective of their similarity/correctness, underscoring the robustness of our simple predictor. This results in an enrichment factor of 2.5 compared to a random predictor for ranking ligands within the top 25%, making it a promising approach to identify lead compounds in virtual screening.
Aza-macrocyclic Triphenylamine Ligands for G-Quadruplex Recognition.
García-España, Enrique Victor; Pont, Isabel; González-García, Jorge; Inclán, Mario; Reynolds, Matthew; Delgado-Pinar, Estefanía; Albelda, M Teresa; Vilar, Ramon
2018-05-16
A new series of triphenylamine-based ligands with one (TPA1PY), two (TPA2PY) or three pending aza-macrocycle(s) (TPA3PY) have been synthesised and studied by means of pH-metric titrations, UV/Vis spectroscopy and fluorescence experiments. The affinity of these ligands for G-quadruplex (G4) DNA and its selectivity over duplex DNA were investigated by FRET melting assays, fluorimetric titrations and circular dichroism (CD) spectroscopy. Interestingly, the interaction of the bi- and specially the tri-branched ligand with G4 leads to a very intense red-shifted fluorescence emission band which may be associated with intermolecular aggregation between the molecule and the DNA. This light-up effect allows the application of the ligands as fluorescence probes to selectivity detect G4. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ligand migration in the truncated hemoglobin of Mycobacterium tuberculosis.
Heroux, Maxime S; Mohan, Anne D; Olsen, Kenneth W
2011-03-01
The truncated hemoglobin of Mycobacterium tuberculosis (Mt-trHbO) is a small heme protein belonging to the hemoglobin superfamily. Truncated hemoglobins (trHbs) are believed to have functional roles such as terminal oxidases and oxygen sensors involved in the response to oxidative and nitrosative stress, nitric oxide (NO) detoxification, O₂/NO chemistry, O₂ delivery under hypoxic conditions, and long-term ligand storage. Based on sequence similarities, they are classified into three groups. Experimental studies revealed that all trHbs display a 2-on-2 α-helical sandwich fold rather than the 3-on-3 α-helical sandwich fold of the classical hemoglobin fold. Using locally enhanced sampling (LESMD) molecular dynamics, the ligand-binding escape pathways from the distal heme binding cavity of Mt-trHbO were determined to better understand how this protein functions. The importance of specific residues, such as the group II and III invariant W(G8) residue, can be seen in terms of ligand diffusion pathways and ligand dynamics. LESMD simulations show that the wild-type Mt-trHbO has three diffusion pathways while the W(G8)F Mt-trHbO mutant has only two. The W(G8) residue plays a critical role in ligand binding and stabilization and helps regulate the rate of ligand escape from the distal heme pocket. Thus, this invariant residue is important in creating ligand diffusion pathways and possibly in the enzymatic functions of this protein. Copyright © 2011 Wiley Periodicals, Inc.
In vitro evaluation of biodegradable microspheres with surface-bound ligands.
Keegan, Mark E; Royce, Sara M; Fahmy, Tarek; Saltzman, W Mark
2006-02-21
Protein ligands were conjugated to the surface of biodegradable microspheres. These microsphere-ligand conjugates were then used in two in vitro model systems to evaluate the effect of conjugated ligands on microsphere behavior. Microsphere retention in agarose columns was increased by ligands on the microsphere surface specific for receptors on the agarose matrix. In another experiment, conjugating the lectin Ulex europaeus agglutinin 1 to the microsphere surface increased microsphere adhesion to Caco-2 monolayers compared to control microspheres. This increase in microsphere adhesion was negated by co-administration of l-fucose, indicating that the increase in adhesion is due to specific interaction of the ligand with carbohydrate receptors on the cell surface. These results demonstrate that the ligands conjugated to the microspheres maintain their receptor binding activity and are present on the microsphere surface at a density sufficient to target the microspheres to both monolayers and three-dimensional matrices bearing complementary receptors.
Distinct Iron-binding Ligands in the Upper Water Column at Station ALOHA
NASA Astrophysics Data System (ADS)
Bundy, R.; Boiteau, R.; Repeta, D.
2016-02-01
The distribution and chemical properties of iron-binding organic ligands at station ALOHA were examined using a combination of solid phase extraction (SPE) followed by high pressure liquid chromatography-inductively coupled plasma mass spectrometry (HPLC-ICPMS). HPLC-ICPMS ligand measurements were complemented by competitive ligand exchange adsorptive cathodic stripping voltammetry (CLE-ACSV) analysis using salicylaldoxime as the added ligand. By HPLC-ICPMS, we find enhanced concentrations of distinct naturally-occurring polar iron-binding ligands present at the surface and in the chlorophyll maximum. Lower concentrations were found in the subsurface, where a suite of non-polar ligands was detected. Siderophores were present at the deepest depths sampled at station ALOHA, down to 400m. Incubation studies provided evidence for the production of iron-binding ligands associated with nutrient amended phytoplankton growth in surface waters, and as a result of microbial particle remineralization in the subsurface water column. Ligands classes identified via SPE were then compared to CLE-ACSV ligand measurements, as well as the conditional stability constants measured from model polar and non-polar siderophores, yielding insight to the sources of iron-binding ligands throughout the water column at station ALOHA.
Coreceptors and Their Ligands in Epithelial γδ T Cell Biology
Witherden, Deborah A.; Johnson, Margarete D.; Havran, Wendy L.
2018-01-01
Epithelial tissues line the body providing a protective barrier from the external environment. Maintenance of these epithelial barrier tissues critically relies on the presence of a functional resident T cell population. In some tissues, the resident T cell population is exclusively comprised of γδ T cells, while in others γδ T cells are found together with αβ T cells and other lymphocyte populations. Epithelial-resident γδ T cells function not only in the maintenance of the epithelium, but are also central to the repair process following damage from environmental and pathogenic insults. Key to their function is the crosstalk between γδ T cells and neighboring epithelial cells. This crosstalk relies on multiple receptor–ligand interactions through both the T cell receptor and accessory molecules leading to temporal and spatial regulation of cytokine, chemokine, growth factor, and extracellular matrix protein production. As antigens that activate epithelial γδ T cells are largely unknown and many classical costimulatory molecules and coreceptors are not used by these cells, efforts have focused on identification of novel coreceptors and ligands that mediate pivotal interactions between γδ T cells and their neighbors. In this review, we discuss recent advances in the understanding of functions for these coreceptors and their ligands in epithelial maintenance and repair processes. PMID:29686687
Resolving DNA-ligand intercalation in the entropic stretching regime
NASA Astrophysics Data System (ADS)
Almaqwashi, Ali A.
Single molecule studies of DNA intercalation are typically conducted by applying stretching forces to obtain force-dependent DNA elongation measurements. The zero-force properties of DNA intercalation are determined by equilibrium and kinetic force-analysis. However, the applied stretching forces that are above the entropic regime (>5 pN) prevent DNA-DNA contact which may eliminate competitive DNA-ligand interactions. In particular, it is noted that cationic mono-intercalators investigated by single molecule force spectroscopy are mostly found to intercalate DNA with single rate, while bulk studies reported additional slower rates. Here, a proposed framework quantifies DNA intercalation by cationic ligands in competition with relatively rapid kinetic DNA-ligand aggregation. At a constant applied force in the entropic stretching regime, the analysis illustrates that DNA intercalation would be measurably optimized only within a narrow range of low ligand concentrations. As DNA intercalators are considered for potential DNA-targeted therapeutics, this analysis provides insights in tuning ligand concertation to maximize therapeutics efficiency.
Lipinski, Christopher A
2016-06-01
The rule of five (Ro5), based on physicochemical profiles of phase II drugs, is consistent with structural limitations in protein targets and the drug target ligands. Three of four parameters in Ro5 are fundamental to the structure of both target and drug binding sites. The chemical structure of the drug ligand depends on the ligand chemistry and design philosophy. Two extremes of chemical structure and design philosophy exist; ligands constructed in the medicinal chemistry synthesis laboratory without input from natural selection and natural product (NP) metabolites biosynthesized based on evolutionary selection. Exceptions to Ro5 are found mostly among NPs. Chemistry chameleon-like behavior of some NPs due to intra-molecular hydrogen bonding as exemplified by cyclosporine A is a strong contributor to NP Ro5 outliers. The fragment derived, drug Navitoclax is an example of the extensive expertise, resources, time and key decisions required for the rare discovery of a non-NP Ro5 outlier. Copyright © 2016 Elsevier B.V. All rights reserved.
Gas adsorption and gas mixture separations using mixed-ligand MOF material
Hupp, Joseph T [Northfield, IL; Mulfort, Karen L [Chicago, IL; Snurr, Randall Q [Evanston, IL; Bae, Youn-Sang [Evanston, IL
2011-01-04
A method of separating a mixture of carbon dioxiode and hydrocarbon gas using a mixed-ligand, metal-organic framework (MOF) material having metal ions coordinated to carboxylate ligands and pyridyl ligands.
Dissecting Orthosteric Contacts for a Reverse-Fragment-Based Ligand Design.
Chandramohan, Arun; Tulsian, Nikhil K; Anand, Ganesh S
2017-08-01
Orthosteric sites on proteins are formed typically from noncontiguous interacting sites in three-dimensional space where the composite binding interaction of a biological ligand is mediated by multiple synergistic interactions of its constituent functional groups. Through these multiple interactions, ligands stabilize both the ligand binding site and the local secondary structure. However, relative energetic contributions of the individual contacts in these protein-ligand interactions are difficult to resolve. Deconvolution of the contributions of these various functional groups in natural inhibitors/ligand would greatly aid in iterative fragment-based drug discovery (FBDD). In this study, we describe an approach of progressive unfolding of a target protein using a gradient of denaturant urea to reveal the individual energetic contributions of various ligand-functional groups to the affinity of the entire ligand. Through calibrated unfolding of two protein-ligand systems: cAMP-bound regulatory subunit of Protein Kinase A (RIα) and IBMX-bound phosphodiesterase8 (PDE8), monitored by amide hydrogen-deuterium exchange mass spectrometry, we show progressive disruption of individual orthosteric contacts in the ligand binding sites, allowing us to rank the energetic contributions of these individual interactions. In the two cAMP-binding sites of RIα, exocyclic phosphate oxygens of cAMP were identified to mediate stronger interactions than ribose 2'-OH in both the RIα-cAMP binding interfaces. Further, we have also ranked the relative contributions of the different functional groups of IBMX based on their interactions with the orthosteric residues of PDE8. This strategy for deconstruction of individual binding sites and identification of the strongest functional group interaction in enzyme orthosteric sites offers a rational starting point for FBDD.
Takegahara, Noriko; Kim, Hyunsoo; Mizuno, Hiroki; Sakaue-Sawano, Asako; Miyawaki, Atsushi; Tomura, Michio; Kanagawa, Osami; Ishii, Masaru; Choi, Yongwon
2016-02-12
Osteoclasts are specialized polyploid cells that resorb bone. Upon stimulation with receptor activator of nuclear factor-κB ligand (RANKL), myeloid precursors commit to becoming polyploid, largely via cell fusion. Polyploidization of osteoclasts is necessary for their bone-resorbing activity, but the mechanisms by which polyploidization is controlled remain to be determined. Here, we demonstrated that in addition to cell fusion, incomplete cytokinesis also plays a role in osteoclast polyploidization. In in vitro cultured osteoclasts derived from mice expressing the fluorescent ubiquitin-based cell cycle indicator (Fucci), RANKL induced polyploidy by incomplete cytokinesis as well as cell fusion. Polyploid cells generated by incomplete cytokinesis had the potential to subsequently undergo cell fusion. Nuclear polyploidy was also observed in osteoclasts in vivo, suggesting the involvement of incomplete cytokinesis in physiological polyploidization. Furthermore, RANKL-induced incomplete cytokinesis was reduced by inhibition of Akt, resulting in impaired multinucleated osteoclast formation. Taken together, these results reveal that RANKL-induced incomplete cytokinesis contributes to polyploidization of osteoclasts via Akt activation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Real-Time Ligand Binding Pocket Database Search Using Local Surface Descriptors
Chikhi, Rayan; Sael, Lee; Kihara, Daisuke
2010-01-01
Due to the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of a particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two dimensional pseudo-Zernike moments or the 3D Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark study employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed. PMID:20455259
Real-time ligand binding pocket database search using local surface descriptors.
Chikhi, Rayan; Sael, Lee; Kihara, Daisuke
2010-07-01
Because of the increasing number of structures of unknown function accumulated by ongoing structural genomics projects, there is an urgent need for computational methods for characterizing protein tertiary structures. As functions of many of these proteins are not easily predicted by conventional sequence database searches, a legitimate strategy is to utilize structure information in function characterization. Of particular interest is prediction of ligand binding to a protein, as ligand molecule recognition is a major part of molecular function of proteins. Predicting whether a ligand molecule binds a protein is a complex problem due to the physical nature of protein-ligand interactions and the flexibility of both binding sites and ligand molecules. However, geometric and physicochemical complementarity is observed between the ligand and its binding site in many cases. Therefore, ligand molecules which bind to a local surface site in a protein can be predicted by finding similar local pockets of known binding ligands in the structure database. Here, we present two representations of ligand binding pockets and utilize them for ligand binding prediction by pocket shape comparison. These representations are based on mapping of surface properties of binding pockets, which are compactly described either by the two-dimensional pseudo-Zernike moments or the three-dimensional Zernike descriptors. These compact representations allow a fast real-time pocket searching against a database. Thorough benchmark studies employing two different datasets show that our representations are competitive with the other existing methods. Limitations and potentials of the shape-based methods as well as possible improvements are discussed.
Ligand binding analysis and screening by chemical denaturation shift.
Schön, Arne; Brown, Richard K; Hutchins, Burleigh M; Freire, Ernesto
2013-12-01
The identification of small molecule ligands is an important first step in drug development, especially drugs that target proteins with no intrinsic activity. Toward this goal, it is important to have access to technologies that are able to measure binding affinities for a large number of potential ligands in a fast and accurate way. Because ligand binding stabilizes the protein structure in a manner dependent on concentration and binding affinity, the magnitude of the protein stabilization effect elicited by binding can be used to identify and characterize ligands. For example, the shift in protein denaturation temperature (Tm shift) has become a popular approach to identify potential ligands. However, Tm shifts cannot be readily transformed into binding affinities, and the ligand rank order obtained at denaturation temperatures (≥60°C) does not necessarily coincide with the rank order at physiological temperature. An alternative approach is the use of chemical denaturation, which can be implemented at any temperature. Chemical denaturation shifts allow accurate determination of binding affinities with a surprisingly wide dynamic range (high micromolar to sub nanomolar) and in situations where binding changes the cooperativity of the unfolding transition. In this article, we develop the basic analytical equations and provide several experimental examples. Copyright © 2013 Elsevier Inc. All rights reserved.
Ligand Binding Analysis and Screening by Chemical Denaturation Shift
Sch n, Arne; Brown, Richard K.; Hutchins, Burleigh M.; Freire, Ernesto
2013-01-01
The identification of small molecule ligands is an important first step in drug development, especially drugs that target proteins with no intrinsic activity. Towards this goal, it is important to have access to technologies that are able to measure binding affinities for a large number of potential ligands in a fast and accurate way. Since ligand binding stabilizes the protein structure in a manner dependent on concentration and binding affinity, the magnitude of the protein stabilization effect elicited by binding can be used to identify and characterize ligands. For example, the shift in protein denaturation temperature (Tm shift) has become a popular approach to identify potential ligands. However, Tm shifts cannot be readily transformed into binding affinities and the ligand rank order obtained at denaturation temperatures (60°C or higher) does not necessarily coincide with the rank order at physiological temperature. An alternative approach is the use of chemical denaturation, which can be implemented at any temperature. Chemical denaturation shifts allow accurate determination of binding affinities with a surprisingly wide dynamic range (high micromolar to sub nanomolar) and in situations in which binding changes the cooperativity of the unfolding transition. In this paper we develop the basic analytical equations and provide several experimental examples. PMID:23994566
Association of growth factors, HIF-1 and NF-κB expression with proteasomes in endometrial cancer.
Spirina, Ludmila V; Yunusova, Nataliya V; Kondakova, Irina V; Kolomiets, Larisa A; Koval, Valeriya D; Chernyshova, Alena L; Shpileva, Olga V
2012-09-01
Insulin-like growth factors (IGFs), vascular endothelial growth factor (VEGF), hypoxia-inducible factor-1 (HIF-1), and nuclear factor kappa-B (NF-κB) are known to play an important role in endometrial cancer pathogenesis. However, the proteolytic regulation of these factors is still poorly understood. We studied the correlation between chymotrypsin-like activity of proteasomes and IGF-I, IGF-II, VEGF, HIF-1, and NF-κB levels in endometrial cancer tissues. It was shown that the total activity of proteasomes and the activity of the 20S and 26S proteasomes in malignant tumors were significantly higher than those observed in the normal endometrium. Negative relationships between the proteasome activity and IGF-I, HIF-1, and NF-κB p50 expressions were found. High 20S proteasome activity was associated with increase of HIF-1 level. Positive relationships between IGF-I expression and two classic forms of NF-κB p50 and p65 in endometrial cancer were revealed. The data obtained indicate the possible proteasomal regulation of growth and transcription factors. The major pool of IGF-I is located in the extracellular space, and it is likely that extracellular proteasomes also take part in the regulation of the IGF-I content. The present data show the evidence of proteasome regulation of growth and nuclear factors that can play an important role in cancer pathogenesis.
Methyl group reorientation under ligand binding probed by pseudocontact shifts.
Lescanne, Mathilde; Ahuja, Puneet; Blok, Anneloes; Timmer, Monika; Akerud, Tomas; Ubbink, Marcellus
2018-06-02
Liquid-state NMR spectroscopy is a powerful technique to elucidate binding properties of ligands on proteins. Ligands binding in hydrophobic pockets are often in close proximity to methyl groups and binding can lead to subtle displacements of methyl containing side chains to accommodate the ligand. To establish whether pseudocontact shifts can be used to characterize ligand binding and the effects on methyl groups, the N-terminal domain of HSP90 was tagged with caged lanthanoid NMR probe 5 at three positions and titrated with a ligand. Binding was monitored using the resonances of leucine and valine methyl groups. The pseudocontact shifts (PCS) caused by ytterbium result in enhanced dispersion of the methyl spectrum, allowing more resonances to be observed. The effects of tag attachment on the spectrum and ligand binding are small. Significant changes in PCS were observed upon ligand binding, indicating displacements of several methyl groups. By determining the cross-section of PCS iso-surfaces generated by two or three paramagnetic centers, the new position of a methyl group can be estimated, showing displacements in the range of 1-3 Å for methyl groups in the binding site. The information about such subtle but significant changes may be used to improve docking studies and can find application in fragment-based drug discovery.
Photochemically stable fluorescent heteroditopic ligands for zinc ion.
Zhang, Lu; Zhu, Lei
2008-11-07
Photochemically stable fluorescent heteroditopic ligands (9 and 10) for zinc ion were prepared and studied. Two independent metal coordination-driven photophysical processes, chelation-enhanced fluorescence (CHEF) and internal (or intramolecular) charge transfer (ICT), were designed into our heteroditopic ligand framework. This strategy successfully relates three coordination states of a ligand, non-, mono-, and dicoordinated, to three fluorescence states, fluorescence OFF, ON at one wavelength, and ON at another wavelength. This ligand platform has provided chemical foundation for applications such as the quantification of zinc concentration over broad ranges (Zhang, L.; Clark, R. J.; Zhu, L. Chem.-Eur. J. 2008, 14, 2894-2903) and molecular logic functions (Zhang, L.; Whitfield, W. A.; Zhu, L. Chem. Commun. 2008, 1880-1882). The binding stoichiometries of dipicolylamino and 2,2'-bipyridyl, the two binding sites featured in heteroditopic ligands 7-10, were studied in acetonitrile using both Job's method of continuous variation and isothermal titration calorimetry (ITC). The fluorescence enhancement of 7-10 upon the formation of monozinc complexes (defined as the fluorescence quantum yield ratio of monozinc complex and free ligand) is qualitatively related to the highest occupied molecular orbital (HOMO) energy levels of their fluorophores. This is consistent with our hypothesis on the thermodynamics of the coordination-driven photophysical processes embodied in the designed heteroditopic system, which was supported by cyclic voltammetry studies. In conclusion, compounds 9 and 10 not only possess better photochemical stability but also display a higher degree of fluorescence turn-on upon formation of monozinc complexes than their vinyl counterparts 7 and 8.
Testing inhomogeneous solvation theory in structure-based ligand discovery.
Balius, Trent E; Fischer, Marcus; Stein, Reed M; Adler, Thomas B; Nguyen, Crystal N; Cruz, Anthony; Gilson, Michael K; Kurtzman, Tom; Shoichet, Brian K
2017-08-15
Binding-site water is often displaced upon ligand recognition, but is commonly neglected in structure-based ligand discovery. Inhomogeneous solvation theory (IST) has become popular for treating this effect, but it has not been tested in controlled experiments at atomic resolution. To do so, we turned to a grid-based version of this method, GIST, readily implemented in molecular docking. Whereas the term only improves docking modestly in retrospective ligand enrichment, it could be added without disrupting performance. We thus turned to prospective docking of large libraries to investigate GIST's impact on ligand discovery, geometry, and water structure in a model cavity site well-suited to exploring these terms. Although top-ranked docked molecules with and without the GIST term often overlapped, many ligands were meaningfully prioritized or deprioritized; some of these were selected for testing. Experimentally, 13/14 molecules prioritized by GIST did bind, whereas none of the molecules that it deprioritized were observed to bind. Nine crystal complexes were determined. In six, the ligand geometry corresponded to that predicted by GIST, for one of these the pose without the GIST term was wrong, and three crystallographic poses differed from both predictions. Notably, in one structure, an ordered water molecule with a high GIST displacement penalty was observed to stay in place. Inclusion of this water-displacement term can substantially improve the hit rates and ligand geometries from docking screens, although the magnitude of its effects can be small and its impact in drug binding sites merits further controlled studies.
Ardestani, Masoud M; van Straalen, Nico M; van Gestel, Cornelis A M
2015-10-01
The biotic ligand model (BLM) approach is used to assess metal toxicity, taking into account the competition of other cations with the free metal ions for binding to the biotic ligand sites of aquatic and soil organisms. The bioavailable fraction of metals, represented by the free metal ion, is a better measure than the total concentration for assessing their potential risk to the environment. Because BLMs are relating toxicity to the fraction of biotic ligands occupied by the metal, they can be useful for investigating factors affecting metal bioaccumulation and toxicity. In the present review, the effects of major cations on the toxicity of metals to soil and aquatic organisms were comprehensively studied by performing a meta-analysis of BLM literature data. Interactions at the binding sites were shown to be species- and metal-specific. The main factors affecting the relationships between toxicity and conditional binding constants for metal binding at the biotic ligand appeared to be Ca(2+) , Mg(2+) , and protons. Other important characteristics of the exposure medium, such as levels of dissolved organic carbon and concentrations of other cations, should also be considered to obtain a proper assessment of metal toxicity to soil and aquatic organisms. © 2015 SETAC.
Jiang, Yi-Zhou; Dai, Cai-Feng; Patankar, Manish S.; Song, Jia-Sheng; Zheng, Jing
2013-01-01
The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor mediates many biological processes. Herein, we investigated if 2-(1′H-indole-3′-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE, an endogenous AhR ligand) regulated proliferation and migration of human ovarian cancer cells via AhR. We found that AhR was widely present in many histotypes of ovarian cancer tissues. ITE suppressed OVCAR-3 cell proliferation and SKOV-3 cell migration in vitro, which were blocked by AhR knockdown. ITE also suppressed OVCAR-3 cell growth in mice. These data suggest that the ITE might potentially be used for therapeutic intervention for at least a subset of human ovarian cancer. PMID:23851185
Dynamic biochemical tissue analysis detects functional L-selectin ligands on colon cancer tissues
Carlson, Grady E.; Martin, Eric W.; Shirure, Venktesh S.; Malgor, Ramiro; Resto, Vicente A.; Goetz, Douglas J.; Burdick, Monica M.
2017-01-01
A growing body of evidence suggests that L-selectin ligands presented on circulating tumor cells facilitate metastasis by binding L-selectin presented on leukocytes. Commonly used methods for detecting L-selectin ligands on tissues, e.g., immunostaining, are performed under static, no-flow conditions. However, such analysis does not assay for functional L-selectin ligands, specifically those ligands that promote adhesion under shear flow conditions. Recently our lab developed a method, termed dynamic biochemical tissue analysis (DBTA), to detect functional selectin ligands in situ by probing tissues with L-selectin-coated microspheres under hemodynamic flow conditions. In this investigation, DBTA was used to probe human colon tissues for L-selectin ligand activity. The detection of L-selectin ligands using DBTA was highly specific. Furthermore, DBTA reproducibly detected functional L-selectin ligands on diseased, e.g., cancerous or inflamed, tissues but not on noncancerous tissues. In addition, DBTA revealed a heterogeneous distribution of functional L-selectin ligands on colon cancer tissues. Most notably, detection of L-selectin ligands by immunostaining using HECA-452 antibody only partially correlated with functional L-selectin ligands detected by DBTA. In summation, the results of this study demonstrate that DBTA detects functional selectin ligands to provide a unique characterization of pathological tissue. PMID:28282455
Dynamic biochemical tissue analysis detects functional L-selectin ligands on colon cancer tissues.
Carlson, Grady E; Martin, Eric W; Shirure, Venktesh S; Malgor, Ramiro; Resto, Vicente A; Goetz, Douglas J; Burdick, Monica M
2017-01-01
A growing body of evidence suggests that L-selectin ligands presented on circulating tumor cells facilitate metastasis by binding L-selectin presented on leukocytes. Commonly used methods for detecting L-selectin ligands on tissues, e.g., immunostaining, are performed under static, no-flow conditions. However, such analysis does not assay for functional L-selectin ligands, specifically those ligands that promote adhesion under shear flow conditions. Recently our lab developed a method, termed dynamic biochemical tissue analysis (DBTA), to detect functional selectin ligands in situ by probing tissues with L-selectin-coated microspheres under hemodynamic flow conditions. In this investigation, DBTA was used to probe human colon tissues for L-selectin ligand activity. The detection of L-selectin ligands using DBTA was highly specific. Furthermore, DBTA reproducibly detected functional L-selectin ligands on diseased, e.g., cancerous or inflamed, tissues but not on noncancerous tissues. In addition, DBTA revealed a heterogeneous distribution of functional L-selectin ligands on colon cancer tissues. Most notably, detection of L-selectin ligands by immunostaining using HECA-452 antibody only partially correlated with functional L-selectin ligands detected by DBTA. In summation, the results of this study demonstrate that DBTA detects functional selectin ligands to provide a unique characterization of pathological tissue.
PyPLIF: Python-based Protein-Ligand Interaction Fingerprinting.
Radifar, Muhammad; Yuniarti, Nunung; Istyastono, Enade Perdana
2013-01-01
Structure-based virtual screening (SBVS) methods often rely on docking score. The docking score is an over-simplification of the actual ligand-target binding. Its capability to model and predict the actual binding reality is limited. Recently, interaction fingerprinting (IFP) has come and offered us an alternative way to model reality. IFP provides us an alternate way to examine protein-ligand interactions. The docking score indicates the approximate affinity and IFP shows the interaction specificity. IFP is a method to convert three dimensional (3D) protein-ligand interactions into one dimensional (1D) bitstrings. The bitstrings are subsequently employed to compare the protein-ligand interaction predicted by the docking tool against the reference ligand. These comparisons produce scores that can be used to enhance the quality of SBVS campaigns. However, some IFP tools are either proprietary or using a proprietary library, which limits the access to the tools and the development of customized IFP algorithm. Therefore, we have developed PyPLIF, a Python-based open source tool to analyze IFP. In this article, we describe PyPLIF and its application to enhance the quality of SBVS in order to identify antagonists for estrogen α receptor (ERα). PyPLIF is freely available at http://code.google.com/p/pyplif.
A web server for analysis, comparison and prediction of protein ligand binding sites.
Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S
2016-03-25
One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .
High affinity ligands from in vitro selection: Complex targets
Morris, Kevin N.; Jensen, Kirk B.; Julin, Carol M.; Weil, Michael; Gold, Larry
1998-01-01
Human red blood cell membranes were used as a model system to determine if the systematic evolution of ligands by exponential enrichment (SELEX) methodology, an in vitro protocol for isolating high-affinity oligonucleotides that bind specifically to virtually any single protein, could be used with a complex mixture of potential targets. Ligands to multiple targets were generated simultaneously during the selection process, and the binding affinities of these ligands for their targets are comparable to those found in similar experiments against pure targets. A secondary selection scheme, deconvolution-SELEX, facilitates rapid isolation of the ligands to targets of special interest within the mixture. SELEX provides high-affinity compounds for multiple targets in a mixture and might allow a means for dissecting complex biological systems. PMID:9501188
DOE Office of Scientific and Technical Information (OSTI.GOV)
Richter, M.M.; Bard, A.J.
The electrochemistry and electrogenerated chemiluminescence (ECL) of a series of europium chelates, cryptates, and mixed-ligand chelate/cryptand complexes were studied. The complexes were of the following general forms: EuL{sub 4}{sup -}, where L = {beta}-diketonate, a bis-chelating ligand (such as dibenzoylmethide), added as salts (A)EuL{sub 4}, where A= tetrabutylammonium ion or piperidinium ion (pipH{sup +}); Eu(crypt){sup 3+}, where crypt = a cryptand ligand, e.g., 4,7,13,16,21-pentaoxa-1,10-diazabicyclo[8,8,5]-tricosa ne; and Eu(crypt)(L){sup 2+} for the mixed-ligand systems. ECL was obtained for the chelates and mixed-ligand systems by reducing the complexes at a Pt electrode in the presence of peroxydisulfate in acetonitrile solutions and was attributedmore » to the electron-transfer reaction between the reduced bound ligands and SO{sub 4}{sup .-}, followed by intramolecular excitation transfer from the excited ligand orbitals to the metal-centered 4f states. No ECL was observed under the same conditions for the europium complexes incorporating only the cryptand ligands in aqueous solution. The ECL spectra matched the photoluminescence spectra with a narrow emission band observed at 612 nm, corresponding to a metal-centered 4f-4f transition. The ECL efficiencies for the ECL-active species were low, about 10{sup -1}-10{sup -4}% of that of the Ru-(bpy){sub 3}{sup 2+}/S{sub 2}O{sub 8}{sup 2-} system under similar conditions. 38 refs., 6 figs., 2 tabs.« less
Shin, Woong-Hee; Kihara, Daisuke
2018-01-01
Virtual screening is a computational technique for predicting a potent binding compound for a receptor protein from a ligand library. It has been a widely used in the drug discovery field to reduce the efforts of medicinal chemists to find hit compounds by experiments.Here, we introduce our novel structure-based virtual screening program, PL-PatchSurfer, which uses molecular surface representation with the three-dimensional Zernike descriptors, which is an effective mathematical representation for identifying physicochemical complementarities between local surfaces of a target protein and a ligand. The advantage of the surface-patch description is its tolerance on a receptor and compound structure variation. PL-PatchSurfer2 achieves higher accuracy on apo form and computationally modeled receptor structures than conventional structure-based virtual screening programs. Thus, PL-PatchSurfer2 opens up an opportunity for targets that do not have their crystal structures. The program is provided as a stand-alone program at http://kiharalab.org/plps2 . We also provide files for two ligand libraries, ChEMBL and ZINC Drug-like.
Comitani, Federico; Melis, Claudio; Molteni, Carla
2015-04-01
Pentameric ligand-gated ion channels (pLGICs) are important biomolecules that mediate fast synaptic transmission. Their malfunctions are linked to serious neuronal disorders and they are major pharmaceutical targets; in invertebrates, they are involved in insecticide resistance. The complexity of pLGICs and the limited crystallographic information available prevent a detailed understanding of how they function. State-of-the-art computational techniques are therefore crucial to build an accurate picture at the atomic level of the mechanisms which drive the activation of pLGICs, complementing the available experimental data. We have used a series of simulation methods, including homology modelling, ligand-protein docking, density functional theory, molecular dynamics and metadynamics, a powerful scheme for accelerating rare events, with the guidance of mutagenesis electrophysiology experiments, to explore ligand-binding mechanisms, the effects of mutations and the potential role of a proline molecular switch for the gating of the ion channels. Results for the insect RDL receptor, the GABAC receptor, the 5-HT3 receptor and the nicotinic acetylcholine receptor will be reviewed.
Analysis of ligand-protein exchange by Clustering of Ligand Diffusion Coefficient Pairs (CoLD-CoP)
NASA Astrophysics Data System (ADS)
Snyder, David A.; Chantova, Mihaela; Chaudhry, Saadia
2015-06-01
NMR spectroscopy is a powerful tool in describing protein structures and protein activity for pharmaceutical and biochemical development. This study describes a method to determine weak binding ligands in biological systems by using hierarchic diffusion coefficient clustering of multidimensional data obtained with a 400 MHz Bruker NMR. Comparison of DOSY spectrums of ligands of the chemical library in the presence and absence of target proteins show translational diffusion rates for small molecules upon interaction with macromolecules. For weak binders such as compounds found in fragment libraries, changes in diffusion rates upon macromolecular binding are on the order of the precision of DOSY diffusion measurements, and identifying such subtle shifts in diffusion requires careful statistical analysis. The "CoLD-CoP" (Clustering of Ligand Diffusion Coefficient Pairs) method presented here uses SAHN clustering to identify protein-binders in a chemical library or even a not fully characterized metabolite mixture. We will show how DOSY NMR and the "CoLD-CoP" method complement each other in identifying the most suitable candidates for lysozyme and wheat germ acid phosphatase.
Baum, Bernhard; Muley, Laveena; Smolinski, Michael; Heine, Andreas; Hangauer, David; Klebe, Gerhard
2010-04-09
Additivity of functional group contributions to protein-ligand binding is a very popular concept in medicinal chemistry as the basis of rational design and optimized lead structures. Most of the currently applied scoring functions for docking build on such additivity models. Even though the limitation of this concept is well known, case studies examining in detail why additivity fails at the molecular level are still very scarce. The present study shows, by use of crystal structure analysis and isothermal titration calorimetry for a congeneric series of thrombin inhibitors, that extensive cooperative effects between hydrophobic contacts and hydrogen bond formation are intimately coupled via dynamic properties of the formed complexes. The formation of optimal lipophilic contacts with the surface of the thrombin S3 pocket and the full desolvation of this pocket can conflict with the formation of an optimal hydrogen bond between ligand and protein. The mutual contributions of the competing interactions depend on the size of the ligand hydrophobic substituent and influence the residual mobility of ligand portions at the binding site. Analysis of the individual crystal structures and factorizing the free energy into enthalpy and entropy demonstrates that binding affinity of the ligands results from a mixture of enthalpic contributions from hydrogen bonding and hydrophobic contacts, and entropic considerations involving an increasing loss of residual mobility of the bound ligands. This complex picture of mutually competing and partially compensating enthalpic and entropic effects determines the non-additivity of free energy contributions to ligand binding at the molecular level. (c) 2010 Elsevier Ltd. All rights reserved.
Ligand-regulated peptide aptamers.
Miller, Russell A
2009-01-01
The peptide aptamer approach employs high-throughput selection to identify members of a randomized peptide library displayed from a scaffold protein by virtue of their interaction with a target molecule. Extending this approach, we have developed a peptide aptamer scaffold protein that can impart small-molecule control over the aptamer-target interaction. This ligand-regulated peptide (LiRP) scaffold, consisting of the protein domains FKBP12, FRB, and GST, binds to the cell-permeable small-molecule rapamycin and the binding of this molecule can prevent the interaction of the randomizable linker region connecting FKBP12 with FRB. Here we present a detailed protocol for the creation of a peptide aptamer plasmid library, selection of peptide aptamers using the LiRP scaffold in a yeast two-hybrid system, and the screening of those peptide aptamers for a ligand-regulated interaction.
Essential role of conformational selection in ligand binding.
Vogt, Austin D; Pozzi, Nicola; Chen, Zhiwei; Di Cera, Enrico
2014-02-01
Two competing and mutually exclusive mechanisms of ligand recognition - conformational selection and induced fit - have dominated our interpretation of ligand binding in biological macromolecules for almost six decades. Conformational selection posits the pre-existence of multiple conformations of the macromolecule from which the ligand selects the optimal one. Induced fit, on the other hand, postulates the existence of conformational rearrangements of the original conformation into an optimal one that are induced by binding of the ligand. In the former case, conformational transitions precede the binding event; in the latter, conformational changes follow the binding step. Kineticists have used a facile criterion to distinguish between the two mechanisms based on the dependence of the rate of relaxation to equilibrium, kobs, on the ligand concentration, [L]. A value of kobs decreasing hyperbolically with [L] has been seen as diagnostic of conformational selection, while a value of kobs increasing hyperbolically with [L] has been considered diagnostic of induced fit. However, this simple conclusion is only valid under the rather unrealistic assumption of conformational transitions being much slower than binding and dissociation events. In general, induced fit only produces values of kobs that increase with [L] but conformational selection is more versatile and is associated with values of kobs that increase with, decrease with or are independent of [L]. The richer repertoire of kinetic properties of conformational selection applies to kinetic mechanisms with single or multiple saturable relaxations and explains the behavior of nearly all experimental systems reported in the literature thus far. Conformational selection is always sufficient and often necessary to account for the relaxation kinetics of ligand binding to a biological macromolecule and is therefore an essential component of any binding mechanism. On the other hand, induced fit is never necessary and
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oh, Se Jeong; Gu, Dong Ryun; Center for Metabolic Function Regulation
2016-06-17
Cytosolic malate dehydrogenase (malate dehydrogenase 1, MDH1) plays pivotal roles in the malate/aspartate shuttle that might modulate metabolism between the cytosol and mitochondria. In this study, we investigated the role of MDH1 in osteoclast differentiation and formation. MDH1 expression was induced by receptor activator of nuclear factor kappa-B ligand (RANKL) treatment. Knockdown of MDH1 by infection with retrovirus containing MDH1-specific shRNA (shMDH1) reduced mature osteoclast formation and bone resorption activity. Moreover, the expression of marker genes associated with osteoclast differentiation was downregulated by shMDH1 treatment, suggesting a role of MDH1 in osteoclast differentiation. In addition, intracellular ATP production was reducedmore » following the activation of adenosine 5′ monophosphate-activated protein kinase (AMPK), a cellular energy sensor and negative regulator of RANKL-induced osteoclast differentiation, in shMDH1-infected osteoclasts compared to control cells. In addition, the expression of c-Fos and nuclear factor of activated T-cells, cytoplasmic 1 (NFATc1), a critical transcription factor of osteoclastogenesis, was decreased with MDH1 knockdown during RANKL-mediated osteoclast differentiation. These findings provide strong evidence that MDH1 plays a critical role in osteoclast differentiation and function via modulation of the intracellular energy status, which might affect AMPK activity and NFATc1 expression.« less
Insights into Protein–Ligand Interactions: Mechanisms, Models, and Methods
Du, Xing; Li, Yi; Xia, Yuan-Ling; Ai, Shi-Meng; Liang, Jing; Sang, Peng; Ji, Xing-Lai; Liu, Shu-Qun
2016-01-01
Molecular recognition, which is the process of biological macromolecules interacting with each other or various small molecules with a high specificity and affinity to form a specific complex, constitutes the basis of all processes in living organisms. Proteins, an important class of biological macromolecules, realize their functions through binding to themselves or other molecules. A detailed understanding of the protein–ligand interactions is therefore central to understanding biology at the molecular level. Moreover, knowledge of the mechanisms responsible for the protein-ligand recognition and binding will also facilitate the discovery, design, and development of drugs. In the present review, first, the physicochemical mechanisms underlying protein–ligand binding, including the binding kinetics, thermodynamic concepts and relationships, and binding driving forces, are introduced and rationalized. Next, three currently existing protein-ligand binding models—the “lock-and-key”, “induced fit”, and “conformational selection”—are described and their underlying thermodynamic mechanisms are discussed. Finally, the methods available for investigating protein–ligand binding affinity, including experimental and theoretical/computational approaches, are introduced, and their advantages, disadvantages, and challenges are discussed. PMID:26821017
Pandurangan, Komala; Kitchen, Jonathan A; Blasco, Salvador; Boyle, Elaine M; Fitzpatrick, Bella; Feeney, Martin; Kruger, Paul E; Gunnlaugsson, Thorfinnur
2015-04-07
The design and synthesis of tripodal ligands 1-3 based upon the N-methyl-1,3,5-benzenetricarboxamide platform appended with three aryl urea arms is reported. This ligand platform gives rise to highly preorganized structures and is ideally suited for binding SO4 (2-) and H2 PO4 (-) ions through multiple hydrogen-bonding interactions. The solid-state crystal structures of 1-3 with SO4 (2-) show the encapsulation of a single anion within a cage structure, whereas the crystal structure of 1 with H2 PO4 (-) showed that two anions are encapsulated. We further demonstrate that ligand 4, based on the same platform but consisting of two bis-urea moieties and a single ammonium moiety, also recognizes SO4 (2-) to form a self-assembled capsule with [4:4] SO4 (2-) :4 stoichiometry in which the anions are clustered within a cavity formed by the four ligands. This is the first example of a self-sorting self-assembled capsule where four tetrahedrally arranged SO4 (2-) ions are embedded within a hydrophobic cavity. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Metallosupramolecular Architectures Obtained from Poly-N-heterocyclic Carbene Ligands.
Sinha, Narayan; Hahn, F Ekkehardt
2017-09-19
Over the past two decades, self-assembly of supramolecular architectures has become a field of intensive research due to the wide range of applications for the resulting assemblies in various fields such as molecular encapsulation, supramolecular catalysis, drug delivery, metallopharmaceuticals, chemical and photochemical sensing, and light-emitting materials. For these purposes, a large number of coordination-driven metallacycles and metallacages featuring different sizes and shapes have been prepared and investigated. Almost all of these are Werner-type coordination compounds where metal centers are coordinated by nitrogen and/or oxygen donors of polydentate ligands. With the evolving interest in the coordination chemistry of N-heterocyclic carbenes (NHCs), discrete supramolecular complexes held together by M-C NHC bonds have recently become of interest. The construction of such metallosupramolecular assemblies requires the synthesis of suitable poly-NHC ligands where the NHC donors form labile bonds with metal centers thus enabling the formation of the thermodynamically most stable reaction product. In organometallic chemistry, these conditions are uniquely met by the combination of poly-NHCs and silver(I) ions where the resulting assemblies also offer the possibility to generate new structures by transmetalation of the poly-NHC ligands to additional metal centers forming more stable C NHC -M bonds. Stable metallosupramolecular assemblies obtained from poly-NHC ligands feature special properties such as good solubility in many less polar organic solvents and the presence of the often catalyticlly active {M(NHC) n } moiety as building block. In this Account, we review recent developments in organometallic supramolecular architectures derived from poly-NHC ligands. We describe dinuclear (M = Ag I , Au I , Cu I ) tetracarbene complexes obtained from bis-NHC ligands with an internal olefin or two external coumarin pendants and their postsynthetic modification via a
Ligand exchange in quaternary alloyed nanocrystals--a spectroscopic study.
Gabka, Grzegorz; Bujak, Piotr; Giedyk, Kamila; Kotwica, Kamil; Ostrowski, Andrzej; Malinowska, Karolina; Lisowski, Wojciech; Sobczak, Janusz W; Pron, Adam
2014-11-14
Exchange of initial, predominantly stearate ligands for pyridine in the first step and butylamine (BA) or 11-mercaptoundecanoic acid (MUA) in the second one was studied for alloyed quaternary Cu-In-Zn-S nanocrystals. The NMR results enabled us to demonstrate, for the first time, direct binding of the pyridine labile ligand to the nanocrystal surface as evidenced by paramagnetic shifts of the three signals attributed to its protons to 7.58, 7.95 and 8.75 ppm. XPS investigations indicated, in turn, a significant change in the composition of the nanocrystal surface upon the exchange of initial ligands for pyridine, which being enriched in indium in the 'as prepared' form became enriched in zinc after pyridine binding. This finding indicated that the first step of ligand exchange had to involve the removal of the surface layer enriched in indium with simultaneous exposure of a new, zinc-enriched layer. In the second ligand exchange step (replacement of pyridine with BA or MUA) the changes in the nanocrystal surface compositions were much less significant. The presence of zinc in the nanocrystal surface layer turned out necessary for effective binding of pyridine as shown by a comparative study of ligand exchange in Cu-In-Zn-S, Ag-In-Zn-S and CuInS2, carried out by complementary XPS and NMR investigations.
Ligand and receptor dynamics contribute to the mechanism of graded PPARγ agonism
Hughes, Travis S.; Chalmers, Michael J.; Novick, Scott; Kuruvilla, Dana S.; Chang, Mi Ra; Kamenecka, Theodore M.; Rance, Mark; Johnson, Bruce A.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.
2011-01-01
SUMMARY Ligand binding to proteins is not a static process, but rather involves a number of complex dynamic transitions. A flexible ligand can change conformation upon binding its target. The conformation and dynamics of a protein can change to facilitate ligand binding. The conformation of the ligand, however, is generally presumed to have one primary binding mode, shifting the protein conformational ensemble from one state to another. We report solution NMR studies that reveal peroxisome proliferator-activated receptor γ (PPARγ) modulators can sample multiple binding modes manifesting in multiple receptor conformations in slow conformational exchange. Our NMR, hydrogen/deuterium exchange and docking studies reveal that ligand-induced receptor stabilization and binding mode occupancy correlate with the graded agonist response of the ligand. Our results suggest that ligand and receptor dynamics affect the graded transcriptional output of PPARγ modulators. PMID:22244763
NASA Astrophysics Data System (ADS)
Mavromatis, Vasileios; Immenhauser, Adrian; Buhl, Dieter; Purgstaller, Bettina; Baldermann, Andre; Dietzel, Martin
2016-04-01
Calcite growth experiments have been performed at 25 oC and 1 bar pCO2 in the presence of aqueous Mg and six organic ligands in the concentration range from 10-5 to 10-3 M. These experiments were performed in order to quantify the effect of distinct organic ligands on the Mg partitioning and Mg stable isotope fractionation during its incorporation in calcite at similar growth rates normalized to total surface area. The organic ligands used in this study comprise of (i) acetate acid, (ii) citrate, (iii) glutamate, (iv) salicylate, (v) glycine and (vi) ethylenediaminetetraacetic acid (EDTA), containing carboxyl- and amino-groups. These fuctional groups are required for bacterial activity and growth as well as related to biotic and abiotic mineralization processes occurring in sedimentary and earliest diagenetic aquatic environments (e.g. soil, cave, lacustrine, marine). The results obtained in this study indicate that the presence of organic ligands promotes an increase in the partition coefficient of Mg in calcite (DMg = (Mg/Ca)calcite (Mg/Ca)fluid). This behaviour can be explained by the temporal formation of aqueous Mg-ligand complexes that are subsequently adsorbed on the calcite surfaces and thereby reducing the active growth sites of calcite. The increase of DMg values as a function of the supersaturation degree of calcite in the fluid phase can be described by the linear equation LogDMg =0.3694 (±0.0329)×SIcalcite - 1.9066 (±0.0147); R2=0.92 In contrast, the presence of organic ligands, with exception of citrate, does not significantly affect the Mg isotope fractionation factor between calcite and reactive fluid (Δ26Mgcalcite-fluid = -2.5 ±0.1). Citrate likely exhibits larger fractionation between the Mg-ligand complexes and free aqueous Mg2+, compared to the other organic ligands studied in this work, as evidenced by the smaller Δ26Mgcalcite-fluid values. These results indicate that in Earth's surface calcite precipitating environments that are
Synergistic effect of reductive and ligand-promoted dissolution of goethite.
Wang, Zimeng; Schenkeveld, Walter D C; Kraemer, Stephan M; Giammar, Daniel E
2015-06-16
Ligand-promoted dissolution and reductive dissolution of iron (hydr)oxide minerals control the bioavailability of iron in many environmental systems and have been recognized as biological iron acquisition strategies. This study investigated the potential synergism between ligands (desferrioxamine B (DFOB) or N,N'-Di(2-hydroxybenzyl)ethylenediamine-N,N'-diacetic acid (HBED)) and a reductant (ascorbate) in goethite dissolution. Batch experiments were performed at pH 6 with ligand or reductant alone and in combination, and under both oxic and anoxic conditions. Goethite dissolution in the presence of reductant or ligand alone followed classic surface-controlled dissolution kinetics. Ascorbate alone does not promote goethite dissolution under oxic conditions due to rapid reoxidation of Fe(II). The rate coefficients for goethite dissolution by ligands are closely correlated with the stability constants of the aqueous Fe(III)-ligand complexes. A synergistic effect of DFOB and ascorbate on the rate of goethite dissolution was observed (total rates greater than the sum of the individual rates), and this effect was most pronounced under oxic conditions. For HBED, macroscopically the synergistic effect was hidden due to the inhibitory effect of ascorbate on HBED adsorption. After accounting for the concentrations of adsorbed ascorbate and HBED, a synergistic effect could still be identified. The potential synergism between ligand and reductant for iron (hydr)oxide dissolution may have important implications for iron bioavailability in soil environments.
On the role of thermal backbone fluctuations in myoglobin ligand gate dynamics.
Krokhotin, Andrey; Niemi, Antti J; Peng, Xubiao
2013-05-07
We construct an energy function that describes the crystallographic structure of sperm whale myoglobin backbone. As a model in our construction, we use the Protein Data Bank entry 1ABS that has been measured at liquid helium temperature. Consequently, the thermal B-factor fluctuations are very small, which is an advantage in our construction. The energy function that we utilize resembles that of the discrete nonlinear Schrödinger equation. Likewise, ours supports topological solitons as local minimum energy configurations. We describe the 1ABS backbone in terms of topological solitons with a precision that deviates from 1ABS by an average root-mean-square distance, which is less than the experimentally observed Debye-Waller B-factor fluctuation distance. We then subject the topological multi-soliton solution to extensive numerical heating and cooling experiments, over a very wide range of temperatures. We concentrate in particular to temperatures above 300 K and below the Θ-point unfolding temperature, which is around 348 K. We confirm that the behavior of the topological multi-soliton is fully consistent with Anfinsen's thermodynamic principle, up to very high temperatures. We observe that the structure responds to an increase of temperature consistently in a very similar manner. This enables us to characterize the onset of thermally induced conformational changes in terms of three distinct backbone ligand gates. One of the gates is made of the helix F and the helix E. The two other gates are chosen similarly, when open they provide a direct access route for a ligand to reach the heme. We find that out of the three gates we investigate, the one which is formed by helices B and G is the most sensitive to thermally induced conformational changes. Our approach provides a novel perspective to the important problem of ligand entry and exit.
On the role of thermal backbone fluctuations in myoglobin ligand gate dynamics
NASA Astrophysics Data System (ADS)
Krokhotin, Andrey; Niemi, Antti J.; Peng, Xubiao
2013-05-01
We construct an energy function that describes the crystallographic structure of sperm whale myoglobin backbone. As a model in our construction, we use the Protein Data Bank entry 1ABS that has been measured at liquid helium temperature. Consequently, the thermal B-factor fluctuations are very small, which is an advantage in our construction. The energy function that we utilize resembles that of the discrete nonlinear Schrödinger equation. Likewise, ours supports topological solitons as local minimum energy configurations. We describe the 1ABS backbone in terms of topological solitons with a precision that deviates from 1ABS by an average root-mean-square distance, which is less than the experimentally observed Debye-Waller B-factor fluctuation distance. We then subject the topological multi-soliton solution to extensive numerical heating and cooling experiments, over a very wide range of temperatures. We concentrate in particular to temperatures above 300 K and below the Θ-point unfolding temperature, which is around 348 K. We confirm that the behavior of the topological multi-soliton is fully consistent with Anfinsen's thermodynamic principle, up to very high temperatures. We observe that the structure responds to an increase of temperature consistently in a very similar manner. This enables us to characterize the onset of thermally induced conformational changes in terms of three distinct backbone ligand gates. One of the gates is made of the helix F and the helix E. The two other gates are chosen similarly, when open they provide a direct access route for a ligand to reach the heme. We find that out of the three gates we investigate, the one which is formed by helices B and G is the most sensitive to thermally induced conformational changes. Our approach provides a novel perspective to the important problem of ligand entry and exit.
Protein-ligand docking with multiple flexible side chains
NASA Astrophysics Data System (ADS)
Zhao, Yong; Sanner, Michel F.
2008-09-01
In this work, we validate and analyze the results of previously published cross docking experiments and classify failed dockings based on the conformational changes observed in the receptors. We show that a majority of failed experiments (i.e. 25 out of 33, involving four different receptors: cAPK, CDK2, Ricin and HIVp) are due to conformational changes in side chains near the active site. For these cases, we identify the side chains to be made flexible during docking calculation by superimposing receptors and analyzing steric overlap between various ligands and receptor side chains. We demonstrate that allowing these side chains to assume rotameric conformations enables the successful cross docking of 19 complexes (ligand all atom RMSD < 2.0 Å) using our docking software FLIPDock. The number of side receptor side chains interacting with a ligand can vary according to the ligand's size and shape. Hence, when starting from a complex with a particular ligand one might have to extend the region of potential interacting side chains beyond the ones interacting with the known ligand. We discuss distance-based methods for selecting additional side chains in the neighborhood of the known active site. We show that while using the molecular surface to grow the neighborhood is more efficient than Euclidian-distance selection, the number of side chains selected by these methods often remains too large and additional methods for reducing their count are needed. Despite these difficulties, using geometric constraints obtained from the network of bonded and non-bonded interactions to rank residues and allowing the top ranked side chains to be flexible during docking makes 22 out of 25 complexes successful.
Ligand-based receptor tyrosine kinase partial agonists: New paradigm for cancer drug discovery?
Riese, David J
2011-02-01
INTRODUCTION: Receptor tyrosine kinases (RTKs) are validated targets for oncology drug discovery and several RTK antagonists have been approved for the treatment of human malignancies. Nonetheless, the discovery and development of RTK antagonists has lagged behind the discovery and development of agents that target G-protein coupled receptors. In part, this is because it has been difficult to discover analogs of naturally-occurring RTK agonists that function as antagonists. AREAS COVERED: Here we describe ligands of ErbB receptors that function as partial agonists for these receptors, thereby enabling these ligands to antagonize the activity of full agonists for these receptors. We provide insights into the mechanisms by which these ligands function as antagonists. We discuss how information concerning these mechanisms can be translated into screens for novel small molecule- and antibody-based antagonists of ErbB receptors and how such antagonists hold great potential as targeted cancer chemotherapeutics. EXPERT OPINION: While there have been a number of important key findings into this field, the identification of the structural basis of ligand functional specificity is still of the greatest importance. While it is true that, with some notable exceptions, peptide hormones and growth factors have not proven to be good platforms for oncology drug discovery; addressing the fundamental issues of antagonistic partial agonists for receptor tyrosine kinases has the potential to steer oncology drug discovery in new directions. Mechanism based approaches are now emerging to enable the discovery of RTK partial agonists that may antagonize both agonist-dependent and -independent RTK signaling and may hold tremendous promise as targeted cancer chemotherapeutics.
Improved Evolutionary Hybrids for Flexible Ligand Docking in Autodock
DOE Office of Scientific and Technical Information (OSTI.GOV)
Belew, R.K.; Hart, W.E.; Morris, G.M.
1999-01-27
In this paper we evaluate the design of the hybrid evolutionary algorithms (EAs) that are currently used to perform flexible ligand binding in the Autodock docking software. Hybrid EAs incorporate specialized operators that exploit domain-specific features to accelerate an EA's search. We consider hybrid EAs that use an integrated local search operator to reline individuals within each iteration of the search. We evaluate several factors that impact the efficacy of a hybrid EA, and we propose new hybrid EAs that provide more robust convergence to low-energy docking configurations than the methods currently available in Autodock.
Force loading explains spatial sensing of ligands by cells
NASA Astrophysics Data System (ADS)
Oria, Roger; Wiegand, Tina; Escribano, Jorge; Elosegui-Artola, Alberto; Uriarte, Juan Jose; Moreno-Pulido, Cristian; Platzman, Ilia; Delcanale, Pietro; Albertazzi, Lorenzo; Navajas, Daniel; Trepat, Xavier; García-Aznar, José Manuel; Cavalcanti-Adam, Elisabetta Ada; Roca-Cusachs, Pere
2017-12-01
Cells can sense the density and distribution of extracellular matrix (ECM) molecules by means of individual integrin proteins and larger, integrin-containing adhesion complexes within the cell membrane. This spatial sensing drives cellular activity in a variety of normal and pathological contexts. Previous studies of cells on rigid glass surfaces have shown that spatial sensing of ECM ligands takes place at the nanometre scale, with integrin clustering and subsequent formation of focal adhesions impaired when single integrin-ligand bonds are separated by more than a few tens of nanometres. It has thus been suggested that a crosslinking ‘adaptor’ protein of this size might connect integrins to the actin cytoskeleton, acting as a molecular ruler that senses ligand spacing directly. Here, we develop gels whose rigidity and nanometre-scale distribution of ECM ligands can be controlled and altered. We find that increasing the spacing between ligands promotes the growth of focal adhesions on low-rigidity substrates, but leads to adhesion collapse on more-rigid substrates. Furthermore, disordering the ligand distribution drastically increases adhesion growth, but reduces the rigidity threshold for adhesion collapse. The growth and collapse of focal adhesions are mirrored by, respectively, the nuclear or cytosolic localization of the transcriptional regulator protein YAP. We explain these findings not through direct sensing of ligand spacing, but by using an expanded computational molecular-clutch model, in which individual integrin-ECM bonds—the molecular clutches—respond to force loading by recruiting extra integrins, up to a maximum value. This generates more clutches, redistributing the overall force among them, and reducing the force loading per clutch. At high rigidity and high ligand spacing, maximum recruitment is reached, preventing further force redistribution and leading to adhesion collapse. Measurements of cellular traction forces and actin flow speeds
Gui, Ling-Li; Zhang, Chuan-Han; Liu, Zhi-Heng; Chen, Zhao-Jun; Zhu, Chang
2008-04-01
To investigate the effects of different nuclear factor (NF)-KB dimers on the survival of immortalized neural progenitor cells (INPCs). The control vector RC/CMV, containing the promoter of cytomegalovirus (CMV), and the expression vectors, RcCMV-p50 and RcCMV-p65, containing the coding regions of NF-KB subunits p50 and p65 genes, were transfected into the INPCs by liposome respectively. Stably transfected clones were screened out following G418 selection. Subsequently, the plasmid RcCMV-p50 was transiently transfected into the INPCs which had been stably transfected with the plasmid RcCMV-p65. The expression of p50 or p65 gene was detected in each cell strain by Western blotting. And the NF-KB DNA binding activity in the cell nuclear extracts was measured by electrophoresis mobility shift assay (EMSA). The expression of IkappaBalpha in the cytoplasm was detected by Western blotting. After oxygen and glucose deprivation for 13 h, the cell survival rate was measured by MTT assay. After gene transfection, five different cell strains were obtained: INPC, INPC/CMV, INPC/p50, INPC/p65, and INPC/p50p65. p50 or p65 gene was translated correctly and efficiently in the cell strains which had been transfected with the corresponding plasmids. EMSA showed that the INPC/p50, INPC/p65, and INPC/p50p65 cells all gave rise to NF-kappaB specific bands, which were composed of p50 homodimer, p65 homodimer, and p50 p65 heterodimer and p50 homodimer respectively. The expression of IkappaBbeta was increased significantly in the cytoplasm of the INPC/p65 and INPC/p50p65 cells. Games-Howell test showed that after oxygen and glucose deprivation for 13 h, the survival rates of the NPC/p65 and INPC/p50p65 cells were (6.0 +/- 1.0)% and (4.6 +/- 0.6)% respectively, both significantly lower than those of the INPC, INPC/CMV, and INPC/p50 cells [(72.5 +/- 6.2)%, (70.1 +/- 4.3)%, and (70.4 +/- 7.3)% respectively, all P < 0.05]. Overexpression of p50 gene and p65 gene directly enhance the DNA
Emerging Roles for CSF-1 Receptor and its Ligands in the Nervous System
Chitu, Violeta; Gokhan, Solen; Nandi, Sayan; Mehler, Mark F.; Stanley, E. Richard
2016-01-01
The colony stimulating factor-1 receptor (CSF-1R) kinase regulates tissue macrophage homeostasis, osteoclastogenesis, and Paneth cell development. However, recent studies in mice have revealed that CSF-1R signaling directly controls the development and maintenance of microglia, and cell autonomously regulates neuronal differentiation and survival. While the CSF-1R-cognate ligands, CSF-1 and interleukin-34 (IL-34), compete for binding to the CSF-1R, they are expressed in a largely non-overlapping manner by mature neurons. The recent identification of a dominantly inherited, adult-onset, progressive dementia associated with inactivating mutations in the CSF-1R highlights the importance of CSF-1R signaling in the brain. We review the roles of the CSF-1R and its ligands in microglial and neural development and function, and their relevance to our understanding of neurodegenerative disease. PMID:27083478
A mixed valence zinc dithiolene system with spectator metal and reactor ligands.
Ratvasky, Stephen C; Mogesa, Benjamin; van Stipdonk, Michael J; Basu, Partha
2016-08-16
Neutral complexes of zinc with N,N'-diisopropylpiperazine-2,3-dithione ( i Pr 2 Dt 0 ) and N,N'-dimethylpiperazine-2,3-dithione (Me 2 Dt 0 ) with chloride or maleonitriledithiolate (mnt 2- ) as coligands have been synthesized and characterized. The molecular structures of these zinc complexes have been determined using single crystal X-ray diffractometry. Complexes recrystallize in monoclinic P type systems with zinc adopting a distorted tetrahedral geometry. Two zinc complexes with mixed-valent dithiolene ligands exhibit ligand-to-ligand charge transfer bands. Optimized geometries, molecular vibrations and electronic structures of charge-transfer complexes were calculated using density functional theory (B3LYP/6-311G+(d,p) level). Redox orbitals are shown to be almost exclusively ligand in nature, with a HOMO based heavily on the electron-rich maleonitriledithiolate ligand, and a LUMO comprised mostly of the electron-deficient dithione ligand. Charge transfer is thus believed to proceed from dithiolate HOMO to dithione LUMO, showing ligand-to-ligand redox interplay across a d 10 metal.
Characterization of Colloidal Quantum Dot Ligand Exchange by X-ray Photoelectron Spectroscopy
NASA Astrophysics Data System (ADS)
Atewologun, Ayomide; Ge, Wangyao; Stiff-Roberts, Adrienne D.
2013-05-01
Colloidal quantum dots (CQDs) are chemically synthesized semiconductor nanoparticles with size-dependent wavelength tunability. Chemical synthesis of CQDs involves the attachment of long organic surface ligands to prevent aggregation; however, these ligands also impede charge transport. Therefore, it is beneficial to exchange longer surface ligands for shorter ones for optoelectronic devices. Typical characterization techniques used to analyze surface ligand exchange include Fourier-transform infrared spectroscopy, x-ray diffraction, transmission electron microscopy, and nuclear magnetic resonance spectroscopy, yet these techniques do not provide a simultaneously direct, quantitative, and sensitive method for evaluating surface ligands on CQDs. In contrast, x-ray photoelectron spectroscopy (XPS) can provide nanoscale sensitivity for quantitative analysis of CQD surface ligand exchange. A unique aspect of this work is that a fingerprint is identified for shorter surface ligands by resolving the regional XPS spectrum corresponding to different types of carbon bonds. In addition, a deposition technique known as resonant infrared matrix-assisted pulsed laser evaporation is used to improve the CQD film uniformity such that stronger XPS signals are obtained, enabling more accurate analysis of the ligand exchange process.
NKG2D and its ligands in cancer.
Dhar, Payal; Wu, Jennifer D
2018-04-01
NKG2D is an activating immune receptor expressed by NK and effector T cells. Induced expression of NKG2D ligand on tumor cell surface during oncogenic insults renders cancer cells susceptible to immune destruction. In advanced human cancers, tumor cells shed NKG2D ligand to produce an immune soluble form as a means of immune evasion. Soluble NKG2D ligands have been associated with poor clinical prognosis in cancer patients. Harnessing NKG2D pathway is considered a viable avenue in cancer immunotherapy over recent years. In this review, we will discuss the progress and perspectives. Copyright © 2018. Published by Elsevier Ltd.
Park, Se Won; Ham, Ho Wan; Kim, Young Sik
2012-04-01
In the paper, we describe new Ir complexes for achieving efficient blue phosphorescence. New blue-emitting mixed-ligand Ir complexes comprising one cyclometalating, two phosphines trans to each other such as Ir(dppz)(PPh3)2(H)(L) (Ll= Cl, NCMe+, CN), [dppz = 3,5-Diphenylpyrazole] were synthesized and studied to tune the phosphorescence wavelength to the deep blue region and to enhance the luminescence efficiencies. To gain insight into the factors responsible for the emission color change and the variation of luminescence efficiency, we investigate the electron-withdrawing capabilities of ancillary ligands using DFT and TD-DFT calculations on the ground and excited states of the complexes. To achieve deep blue emission and increase the emission efficiency, (1) we substitute the phenyl group on the 3-position of the pyrazole ring that lowers the triplet energy enough that the quenching channel is not thermally accessible and (2) change the ancillary ligands coordinated to iridium atom to phosphine and cyano groups known as very strong field ligands. Their inclusion in the coordination sphere can increase the HOMO-LUMO gap to achieve the hypsochromic shift in emission color and lower the HOMO and LUMO energy level, which causes a large d-orbital energy splitting and avoids the quenching effect to improve the luminescence efficiency. The maximum emission spectra of Ir(dppz)(PPh3)2(H)(CI) and Ir(dppz)(PPh3)2(H)(CN) were in the ranges of 439, 432 nm, respectively.
Inhibitory Effects of PPARγ Ligands on TGF-β1–Induced Corneal Myofibroblast Transformation
Jeon, Kye-Im; Kulkarni, Ajit; Woeller, Collynn F.; Phipps, Richard P.; Sime, Patricia J.; Hindman, Holly B.; Huxlin, Krystel R.
2015-01-01
Corneal scarring, whether caused by trauma, laser refractive surgery, or infection, remains a significant problem for humans. Certain ligands for peroxisome proliferator-activated receptor gamma (PPARγ) have shown promise as antiscarring agents in a variety of body tissues. In the cornea, their relative effectiveness and mechanisms of action are still poorly understood. Here, we contrasted the antifibrotic effects of three different PPARγ ligands (15-deoxy-Δ12,14-prostaglandin J2, troglitazone, and rosiglitazone) in cat corneal fibroblasts. Western blot analyses revealed that all three compounds reduced transforming growth factor (TGF)-β1–driven myofibroblast differentiation and up-regulation of α-smooth muscle actin, type I collagen, and fibronectin expression. Because these effects were independent of PPARγ, we ascertained whether they occurred by altering phosphorylation of Smads 2/3, p38 mitogen–activated protein kinase, stress-activated protein kinase, protein kinase B, extracellular signal-regulated kinase, and/or myosin light chain 2. Only p38 mitogen–activated protein kinase phosphorylation was significantly inhibited by all three PPARγ ligands. Finally, we tested the antifibrotic potential of troglitazone in a cat model of photorefractive keratectomy–induced corneal injury. Topical application of troglitazone significantly reduced α-smooth muscle actin expression and haze in the stromal ablation zone. Thus, the PPARγ ligands tested here showed great promise as antifibrotics, both in vitro and in vivo. Our results also provided new evidence for the signaling pathways that may underlie these antifibrotic actions in corneal fibroblasts. PMID:24650561
Vancomycin: ligand recognition, dimerization and super-complex formation.
Jia, ZhiGuang; O'Mara, Megan L; Zuegg, Johannes; Cooper, Matthew A; Mark, Alan E
2013-03-01
The antibiotic vancomycin targets lipid II, blocking cell wall synthesis in Gram-positive bacteria. Despite extensive study, questions remain regarding how it recognizes its primary ligand and what is the most biologically relevant form of vancomycin. In this study, molecular dynamics simulation techniques have been used to examine the process of ligand binding and dimerization of vancomycin. Starting from one or more vancomycin monomers in solution, together with different peptide ligands derived from lipid II, the simulations predict the structures of the ligated monomeric and dimeric complexes to within 0.1 nm rmsd of the structures determined experimentally. The simulations reproduce the conformation transitions observed by NMR and suggest that proposed differences between the crystal structure and the solution structure are an artifact of the way the NMR data has been interpreted in terms of a structural model. The spontaneous formation of both back-to-back and face-to-face dimers was observed in the simulations. This has allowed a detailed analysis of the origin of the cooperatively between ligand binding and dimerization and suggests that the formation of face-to-face dimers could be functionally significant. The work also highlights the possible role of structural water in stabilizing the vancomycin ligand complex and its role in the manifestation of vancomycin resistance. © 2013 The Authors Journal compilation © 2013 FEBS.
Knowledge-Guided Docking of WW Domain Proteins and Flexible Ligands
NASA Astrophysics Data System (ADS)
Lu, Haiyun; Li, Hao; Banu Bte Sm Rashid, Shamima; Leow, Wee Kheng; Liou, Yih-Cherng
Studies of interactions between protein domains and ligands are important in many aspects such as cellular signaling. We present a knowledge-guided approach for docking protein domains and flexible ligands. The approach is applied to the WW domain, a small protein module mediating signaling complexes which have been implicated in diseases such as muscular dystrophy and Liddle’s syndrome. The first stage of the approach employs a substring search for two binding grooves of WW domains and possible binding motifs of peptide ligands based on known features. The second stage aligns the ligand’s peptide backbone to the two binding grooves using a quasi-Newton constrained optimization algorithm. The backbone-aligned ligands produced serve as good starting points to the third stage which uses any flexible docking algorithm to perform the docking. The experimental results demonstrate that the backbone alignment method in the second stage performs better than conventional rigid superposition given two binding constraints. It is also shown that using the backbone-aligned ligands as initial configurations improves the flexible docking in the third stage. The presented approach can also be applied to other protein domains that involve binding of flexible ligand to two or more binding sites.
Hepatocyte Growth Factor and Interleukin-6 in Prostate Cancer Bone Metastasis
2006-06-01
Wif1 Wnt inhibitory factor 1 ## ## ## ## Cxcl4 Chemokine (C-X-C motif) ligand 4 ## ## ## ## Cxcl12 Chemokine (C-X-C motif) ligand 12...CGGCTGAAGAACAACAACAG GGCGTCTGACTCACACCTCT Clu CAGCTGGCTAACCTCACACA AACAGCTTCACCACCACCTC Cxcl4 AGTCCTGAGCTGCTGCTTCT CCCAGAGGAGATGGTCTTCA Col1A1 GAGAGCATGACCGATGGATT
QSAR modeling of GPCR ligands: methodologies and examples of applications.
Tropsha, A; Wang, S X
2006-01-01
GPCR ligands represent not only one of the major classes of current drugs but the major continuing source of novel potent pharmaceutical agents. Because 3D structures of GPCRs as determined by experimental techniques are still unavailable, ligand-based drug discovery methods remain the major computational molecular modeling approaches to the analysis of growing data sets of tested GPCR ligands. This paper presents an overview of modern Quantitative Structure Activity Relationship (QSAR) modeling. We discuss the critical issue of model validation and the strategy for applying the successfully validated QSAR models to virtual screening of available chemical databases. We present several examples of applications of validated QSAR modeling approaches to GPCR ligands. We conclude with the comments on exciting developments in the QSAR modeling of GPCR ligands that focus on the study of emerging data sets of compounds with dual or even multiple activities against two or more of GPCRs.
Dutta, Dipankar J.; Zameer, Andleeb; Mariani, John N.; Zhang, Jingya; Asp, Linnea; Huynh, Jimmy; Mahase, Sean; Laitman, Benjamin M.; Argaw, Azeb Tadesse; Mitiku, Nesanet; Urbanski, Mateusz; Melendez-Vasquez, Carmen V.; Casaccia, Patrizia; Hayot, Fernand; Bottinger, Erwin P.; Brown, Chester W.; John, Gareth R.
2014-01-01
In the embryonic CNS, development of myelin-forming oligodendrocytes is limited by bone morphogenetic proteins, which constitute one arm of the transforming growth factor-β (Tgfβ) family and signal canonically via Smads 1/5/8. Tgfβ ligands and Activins comprise the other arm and signal via Smads 2/3, but their roles in oligodendrocyte development are incompletely characterized. Here, we report that Tgfβ ligands and activin B (ActB) act in concert in the mammalian spinal cord to promote oligodendrocyte generation and myelination. In mouse neural tube, newly specified oligodendrocyte progenitors (OLPs) are first exposed to Tgfβ ligands in isolation, then later in combination with ActB during maturation. In primary OLP cultures, Tgfβ1 and ActB differentially activate canonical Smad3 and non-canonical MAP kinase signaling. Both ligands enhance viability, and Tgfβ1 promotes proliferation while ActB supports maturation. Importantly, co-treatment strongly activates both signaling pathways, producing an additive effect on viability and enhancing both proliferation and differentiation such that mature oligodendrocyte numbers are substantially increased. Co-treatment promotes myelination in OLP-neuron co-cultures, and maturing oligodendrocytes in spinal cord white matter display strong Smad3 and MAP kinase activation. In spinal cords of ActB-deficient Inhbb−/− embryos, apoptosis in the oligodendrocyte lineage is increased and OLP numbers transiently reduced, but numbers, maturation and myelination recover during the first postnatal week. Smad3−/− mice display a more severe phenotype, including diminished viability and proliferation, persistently reduced mature and immature cell numbers, and delayed myelination. Collectively, these findings suggest that, in mammalian spinal cord, Tgfβ ligands and ActB together support oligodendrocyte development and myelin formation. PMID:24917498
Dutta, Dipankar J; Zameer, Andleeb; Mariani, John N; Zhang, Jingya; Asp, Linnea; Huynh, Jimmy; Mahase, Sean; Laitman, Benjamin M; Argaw, Azeb Tadesse; Mitiku, Nesanet; Urbanski, Mateusz; Melendez-Vasquez, Carmen V; Casaccia, Patrizia; Hayot, Fernand; Bottinger, Erwin P; Brown, Chester W; John, Gareth R
2014-06-01
In the embryonic CNS, development of myelin-forming oligodendrocytes is limited by bone morphogenetic proteins, which constitute one arm of the transforming growth factor-β (Tgfβ) family and signal canonically via Smads 1/5/8. Tgfβ ligands and Activins comprise the other arm and signal via Smads 2/3, but their roles in oligodendrocyte development are incompletely characterized. Here, we report that Tgfβ ligands and activin B (ActB) act in concert in the mammalian spinal cord to promote oligodendrocyte generation and myelination. In mouse neural tube, newly specified oligodendrocyte progenitors (OLPs) are first exposed to Tgfβ ligands in isolation, then later in combination with ActB during maturation. In primary OLP cultures, Tgfβ1 and ActB differentially activate canonical Smad3 and non-canonical MAP kinase signaling. Both ligands enhance viability, and Tgfβ1 promotes proliferation while ActB supports maturation. Importantly, co-treatment strongly activates both signaling pathways, producing an additive effect on viability and enhancing both proliferation and differentiation such that mature oligodendrocyte numbers are substantially increased. Co-treatment promotes myelination in OLP-neuron co-cultures, and maturing oligodendrocytes in spinal cord white matter display strong Smad3 and MAP kinase activation. In spinal cords of ActB-deficient Inhbb(-/-) embryos, apoptosis in the oligodendrocyte lineage is increased and OLP numbers transiently reduced, but numbers, maturation and myelination recover during the first postnatal week. Smad3(-/-) mice display a more severe phenotype, including diminished viability and proliferation, persistently reduced mature and immature cell numbers, and delayed myelination. Collectively, these findings suggest that, in mammalian spinal cord, Tgfβ ligands and ActB together support oligodendrocyte development and myelin formation. © 2014. Published by The Company of Biologists Ltd.
Parimal, Siddharth; Garde, Shekhar; Cramer, Steven M
2015-07-14
Fundamental understanding of protein-ligand interactions is important to the development of efficient bioseparations in multimodal chromatography. Here we employ molecular dynamics (MD) simulations to investigate the interactions of three different proteins--ubiquitin, cytochrome C, and α-chymotrypsinogen A, sampling a range of charge from +1e to +9e--with two multimodal chromatographic ligands containing similar chemical moieties--aromatic, carboxyl, and amide--in different structural arrangements. We use a spherical harmonic expansion to analyze ligand and individual moiety density profiles around the proteins. We find that the Capto MMC ligand, which contains an additional aliphatic group, displays stronger interactions than Nuvia CPrime ligand with all three proteins. Studying the ligand densities at the moiety level suggests that hydrophobic interactions play a major role in determining the locations of high ligand densities. Finally, the greater structural flexibility of the Capto MMC ligand compared to that of the Nuvia cPrime ligand allows for stronger structural complementarity and enables stronger hydrophobic interactions. These subtle and not-so-subtle differences in binding affinities and modalities for multimodal ligands can result in significantly different binding behavior towards proteins with important implications for bioprocessing.
A new test set for validating predictions of protein-ligand interaction.
Nissink, J Willem M; Murray, Chris; Hartshorn, Mike; Verdonk, Marcel L; Cole, Jason C; Taylor, Robin
2002-12-01
We present a large test set of protein-ligand complexes for the purpose of validating algorithms that rely on the prediction of protein-ligand interactions. The set consists of 305 complexes with protonation states assigned by manual inspection. The following checks have been carried out to identify unsuitable entries in this set: (1) assessing the involvement of crystallographically related protein units in ligand binding; (2) identification of bad clashes between protein side chains and ligand; and (3) assessment of structural errors, and/or inconsistency of ligand placement with crystal structure electron density. In addition, the set has been pruned to assure diversity in terms of protein-ligand structures, and subsets are supplied for different protein-structure resolution ranges. A classification of the set by protein type is available. As an illustration, validation results are shown for GOLD and SuperStar. GOLD is a program that performs flexible protein-ligand docking, and SuperStar is used for the prediction of favorable interaction sites in proteins. The new CCDC/Astex test set is freely available to the scientific community (http://www.ccdc.cam.ac.uk). Copyright 2002 Wiley-Liss, Inc.
Miyake, Ryosuke; Shionoya, Mitsuhiko
2014-06-02
To understand reversible structural switching in crystalline materials, we studied the mechanism of reversible crystal-to-crystal transformation of a tetranuclear Ni(II) macrocycle consisting of artificial β-dipeptides. On the basis of detailed structural analyses and thermodynamic measurements made in a comparison of pseudo-isostructural crystals (NO3 and BF4 salts), we herein discuss how ligand-exchange reactions take place in the crystal due to changes in water content and temperature. Observations of the structural transformation of NO3 salt indicated that a pseudo crystalline phase transformation takes place through concerted ligand-exchange reactions at the four Ni(II) centers of the macrocycle with hydrogen bond switching. A mechanism for this ligand exchange was supported by IR spectroscopy. Thermodynamic measurements suggested that the favorable compensation relationship of the enthalpy changes due to water uptake and structural changes are keys to the reversible structural transformation. On the basis of a comparison with the pseudo-isostructural crystals, it is apparent that the crystal packing structure and the types of counter anions are important factors for facilitating reversible ligand exchange with single crystallinity.
Messai, Yosra; Gad, Sophie; Noman, Muhammad Zaeem; Le Teuff, Gwenael; Couve, Sophie; Janji, Bassam; Kammerer, Solenne Florence; Rioux-Leclerc, Nathalie; Hasmim, Meriem; Ferlicot, Sophie; Baud, Véronique; Mejean, Arnaud; Mole, David Robert; Richard, Stéphane; Eggermont, Alexander M M; Albiges, Laurence; Mami-Chouaib, Fathia; Escudier, Bernard; Chouaib, Salem
2016-10-01
Clear cell renal cell carcinomas (ccRCC) frequently display a loss of function of the von Hippel-Lindau (VHL) gene. To elucidate the putative relationship between VHL mutation status and immune checkpoint ligand programmed death-ligand 1 (PD-L1) expression. A series of 32 renal tumors composed of 11 VHL tumor-associated and 21 sporadic RCCs were used to evaluate PD-L1 expression levels after sequencing of the three exons and exon-intron junctions of the VHL gene. The 786-O, A498, and RCC4 cell lines were used to investigate the mechanisms of PD-L1 regulation. Fisher's exact test was used for VHL mutation and Kruskal-Wallis test for PD-L1 expression. If no covariate accounted for the association of VHL and PD-L1, then a Kruskal-Wallis test was used; otherwise Cochran-Mantel-Haenzsel test was used. We also used the Fligner-Policello test to compare two medians when the distributions had different dispersions. We demonstrated that tumors from ccRCC patients with VHL biallelic inactivation (ie, loss of function) display a significant increase in PD-L1 expression compared with ccRCC tumors carrying one VHL wild-type allele. Using the inducible VHL 786-O-derived cell lines with varying hypoxia-inducible factor-2 alpha (HIF-2α) stabilization levels, we showed that PD-L1 expression levels positively correlate with VHL mutation and HIF-2α expression. Targeting HIF-2α decreased PD-L1, while HIF-2α overexpression increased PD-L1 mRNA and protein levels in ccRCC cells. Interestingly, chromatin immunoprecipitation and luciferase assays revealed a direct binding of HIF-2α to a transcriptionally active hypoxia-response element in the human PD-L1 proximal promoter in 786-O cells. Our work provides the first evidence that VHL mutations positively correlate with PD-L1 expression in ccRCC and may influence the response to ccRCC anti-PD-L1/PD-1 immunotherapy. We investigated the relationship between von Hippel-Lindau mutations and programmed death-ligand 1 expression. We
Ligand Exchange Kinetics of Environmentally Relevant Metals
DOE Office of Scientific and Technical Information (OSTI.GOV)
Panasci, Adele Frances
2014-07-15
The interactions of ground water with minerals and contaminants are of broad interest for geochemists but are not well understood. Experiments on the molecular scale can determine reaction parameters (i.e. rates of ligand exchange, activation entropy, activation entropy, and activation volume) that can be used in computations to gain insight into reactions that occur in natural groundwaters. Experiments to determine the rate of isotopic ligand exchange for three environmentally relevant metals, rhodium (Rh), iron (Fe), and neptunium (Np), are described. Many environmental transformations of metals (e.g. reduction) in soil occur at trivalent centers, Fe(III) in particular. Contaminant ions absorb tomore » mineral surfaces via ligand exchange, and the reversal of this reaction can be dangerous, releasing contaminants into the environment. Ferric iron is difficult to study spectroscopically because most of its complexes are paramagnetic and are generally reactive toward ligand exchange; therefore, Rh(III), which is diamagnetic and less reactive, was used to study substitution reactions that are analogous to those that occur on mineral oxide surfaces. Studies on both Np(V) and Np(VI) are important in their own right, as 237Np is a radioactive transuranic element with a half-life of 2 million years.« less
Comparative analysis of inner cavities and ligand migration in non-symbiotic AHb1 and AHb2.
Spyrakis, Francesca; Lucas, Fátima; Bidon-Chanal, Axel; Viappiani, Cristiano; Guallar, Victor; Luque, F Javier
2013-09-01
This study reports a comparative analysis of the topological properties of inner cavities and the intrinsic dynamics of non-symbiotic hemoglobins AHb1 and AHb2 from Arabidopsis thaliana. The two proteins belong to the 3/3 globin fold and have a sequence identity of about 60%. However, it is widely assumed that they have distinct physiological roles. In order to investigate the structure-function relationships in these proteins, we have examined the bis-histidyl and ligand-bound hexacoordinated states by atomistic simulations using in silico structural models. The results allow us to identify two main pathways to the distal cavity in the bis-histidyl hexacoordinated proteins. Nevertheless, a larger accessibility to small gaseous molecules is found in AHb2. This effect can be attributed to three factors: the mutation Leu35(AHb1)→Phe32(AHb2), the enhanced flexibility of helix B, and the more favorable energetic profile for ligand migration to the distal cavity. The net effect of these factors would be to facilitate the access of ligands, thus compensating the preference for the fully hexacoordination of AHb2, in contrast to the equilibrium between hexa- and pentacoordinated species in AHb1. On the other hand, binding of the exogenous ligand introduces distinct structural changes in the two proteins. A well-defined tunnel is formed in AHb1, which might be relevant to accomplish the proposed NO detoxification reaction. In contrast, no similar tunnel is found in AHb2, which can be ascribed to the reduced flexibility of helix E imposed by the larger number of salt bridges compared to AHb1. This feature would thus support the storage and transport functions proposed for AHb2. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins. Copyright © 2013 Elsevier B.V. All rights reserved.
Iron-based magnetic superhalogens with pseudohalogens as ligands: An unbiased structure search
Ping Ding, Li; Shao, Peng; Lu, Cheng; Hui Zhang, Fang; Wang, Li Ya
2017-01-01
We have performed an unbiased structure search for a series of neutral and anionic FeL4 (L = BO2, CN, NO2, NO3, OH, CH3, NH2, BH4 and Li2H3) clusters using the CALYPSO (Crystal structure Analysis by Particle Swarm Optimization) structure search method. To probe the superhalogen properties of neutral and anionic FeL4 clusters, we used density-functional theory with the B3LYP functional to examine three factors, including distribution of extra electron, pattern of bonding and the nature of the ligands. Theoretical results show that Fe(BO2)4, Fe(NO3)4 and Fe(NO2)4 can be classified as magnetic superhalogen due to that their electron affinities even exceed those of the constituent ligands. The magnetic moment of Fe atom is almost entirly maintained when it is decorated with various ligands except for neutral and anionic (Li2H3)4. Moreover, the current work is also extended to the salt moieties formed by hyperhalogen/superhalogen anion and Na+ ion. It is found that these salts against dissociation into Na + FeL4 are thermodynamic stable except for Na[Fe(OH)4]. These results provides a wealth of electronic structure information about FeL4 magnetic superhalogens and offer insights into the synthesis mechanisms. PMID:28327547
Pedziwiatr, Jakub; Ghiviriga, Ion; Abboud, Khalil A; Veige, Adam S
2017-02-01
This report describes a synthetic protocols and the crystal structures involving a novel pincer-type H 3 [NNN] ligand, namely di-μ-bromido-μ-{2-(2,2-di-methylpropanimido-yl)- N -[2-(2,2-di-methyl-propanimido-yl)-4-methyl-phen-yl]-4-methylaniline}-bis-[(diethyl ether)lithium], [Li 2 Br 2 (C 24 H 33 N 3 )(C 4 H 10 O) 2 ] ( 1 ) and a dinuclear metal complex, namely di-μ-bromido-2:3κ 4 Br : Br -bis-{2-(2,2-di-methylpropanimido-yl)- N -[2-(2,2-di-methyl-propanimido-yl)-4-methyl-phen-yl]-4-methylaniline}-1κ 3 N , N ', N '';4κ 3 N , N ', N ''-tetra-μ-iso-propano-lato-1:2κ 4 O : O ;3:4κ 4 O : O -diiso-propano-lato-1κ O ,4κ O -2,3-dilithium-1,4-dititanium, [Li 2 Ti 2 Br 2 (C 24 H 32 N 3 ) 2 (C 3 H 7 O) 6 ] or {[NHNNH]Ti(O i Pr) 3 (LiBr) 2 } 2 ( 2 ). Complex 1 , which sits on a twofold rotation axis, is a rare example of a pincer-type ligand which bears ketimine side arms. A unique feature of complex 1 is that the ketimine N atoms have an LiBr(Et 2 O) fragment bonded to them, with the Li atom adopting a distorted tetra-hedral geometry. This particular fragment creates an LiBr bridge between the two ketimine sidearms, which leads to a cage-type appearance of the ligand. Complex 2 consists of the previously described ligand and a Ti IV metal atom in an octa-hedral environment, and is located on an inversion center. Complex 2 crystallizes as a dinuclear species with the metal atoms being bridged by an LiBr entity [the Br atoms are disordered and refined in two positions with their site occupation factors refining to 0.674 (12)/0.372 (12)], and the Li cation being bonded to the isopropoxide O atoms (Li having a tetra-hedral coordination as in 1 ). The organic ligand of compound 2 exhibits disorder in its periphery groups; isopropyl and tert -butyl groups (occupation factors fixed at 0.6/0.4). The novel [NNN]H 3 pincer-type ligand was characterized by multinuclear and multidimensional NMR, HRMS and X-ray crystallography. The dinuclear metal complex 2 was
de Visser, Sam P; Tahsini, Laleh; Nam, Wonwoo
2009-01-01
The catalytic activity of high-valent iron-oxo active species of heme enzymes is known to be dependent on the nature of the axial ligand trans to the iron-oxo group. In a similar fashion, experimental studies on iron-oxo porphyrin biomimetic systems have shown a significant axial ligand effect on ethylbenzene hydroxylation, with an axial acetonitrile ligand leading to phenyl hydroxylation products and an axial chloride anion giving predominantly benzyl hydroxylation products. To elucidate the fundamental factors that distinguish this regioselectivity reversal in iron-oxo porphyrin catalysis, we have performed a series of density functional theory calculations on the hydroxylation of ethylbenzene by [Fe(IV)=O(Por(+.))L] (Por = porphyrin; L = NCCH(3) or Cl(-)), which affords 1-phenylethanol and p-ethylphenol products. The calculations confirm the experimentally determined product distributions. Furthermore, a detailed analysis of the electronic differences between the two oxidants shows that their reversed regioselectivity is a result of differences in orbital interactions between the axial ligand and iron-oxo porphyrin system. In particular, three high-lying orbitals (pi*(xz), pi*(yz) and a(2u)), which are singly occupied in the reactant complex, are stabilised with an anionic ligand such as Cl(-), which leads to enhanced HOMO-LUMO energy gaps. As a consequence, reactions leading to cationic intermediates through the two-electron reduction of the metal centre are disfavoured. The aliphatic hydroxylation mechanism, in contrast, is a radical process in which only one electron is transferred in the rate-determining transition state, which means that the effect of the axial ligand on this mechanism is much smaller.
Quintana, Francisco J.; Murugaiyan, Gopal; Farez, Mauricio F.; Mitsdoerffer, Meike; Tukpah, Ann-Marcia; Burns, Evan J.; Weiner, Howard L.
2010-01-01
The ligand-activated transcription factor aryl hydrocarbon receptor (AHR) participates in the differentiation of FoxP3+ Treg, Tr1 cells, and IL-17–producing T cells (Th17). Most of our understanding on the role of AHR on the FoxP3+ Treg compartment results from studies using the toxic synthetic chemical 2,3,7,8-tetrachlorodibenzo-p-dioxin. Thus, the physiological relevance of AHR signaling on FoxP3+ Treg in vivo is unclear. We studied mice that carry a GFP reporter in the endogenous foxp3 locus and a mutated AHR protein with reduced affinity for its ligands, and found that AHR signaling participates in the differentiation of FoxP3+ Treg in vivo. Moreover, we found that treatment with the endogenous AHR ligand 2-(1′H-indole-3′-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE) given parenterally or orally induces FoxP3+ Treg that suppress experimental autoimmune encephalomyelitis. ITE acts not only on T cells, but also directly on dendritic cells to induce tolerogenic dendritic cells that support FoxP3+ Treg differentiation in a retinoic acid-dependent manner. Thus, our work demonstrates that the endogenous AHR ligand ITE promotes the induction of active immunologic tolerance by direct effects on dendritic and T cells, and identifies nontoxic endogenous AHR ligands as potential unique compounds for the treatment of autoimmune disorders. PMID:21068375
Copper chalcogenide clusters stabilized with ferrocene-based diphosphine ligands.
Khadka, Chhatra B; Najafabadi, Bahareh Khalili; Hesari, Mahdi; Workentin, Mark S; Corrigan, John F
2013-06-17
The redox-active diphosphine ligand 1,1'-bis(diphenylphosphino)ferrocene (dppf) has been used to stabilize the copper(I) chalcogenide clusters [Cu12(μ4-S)6(μ-dppf)4] (1), [Cu8(μ4-Se)4(μ-dppf)3] (2), [Cu4(μ4-Te)(μ4-η(2)-Te2)(μ-dppf)2] (3), and [Cu12(μ5-Te)4(μ8-η(2)-Te2)2(μ-dppf)4] (4), prepared by the reaction of the copper(I) acetate coordination complex (dppf)CuOAc (5) with 0.5 equiv of E(SiMe3)2 (E = S, Se, Te). Single-crystal X-ray analyses of complexes 1-4 confirm the presence of {Cu(2x)E(x)} cores stabilized by dppf ligands on their surfaces, where the bidentate ligands adopt bridging coordination modes. The redox chemistry of cluster 1 was examined using cyclic voltammetry and compared to the electrochemistry of the free ligand dppf and the corresponding copper(I) acetate coordination complex 5. Cluster 1 shows the expected consecutive oxidations of the ferrocene moieties, Cu(I) centers, and phosphine of the dppf ligand.
Abdullah, Hani'ah; Brankin, Brenda; Brady, Clare; Cosby, Sara Louise
2013-07-01
Small numbers of brain endothelial cells (BECs) are infected in children with neurologic complications of measles virus (MV) infection. This may provide a mechanism for virus entry into the central nervous system, but the mechanisms are unclear. Both in vitro culture systems and animal models are required to elucidate events in the endothelium. We compared the ability of wild-type (WT), vaccine, and rodent-adapted MV strains to infect, replicate, and induce apoptosis in human and murine brain endothelial cells (HBECs and MBECs, respectively). Mice also were infected intracerebrally. All MV stains productively infected HBECs and induced the MV receptor PVRL4. Efficient WT MV production also occurred in MBECs. Extensive monolayer destruction associated with activated caspase 3 staining was observed in HBECs and MBECs, most markedly with WT MV. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), but not Fas ligand, was induced by MV infection. Treatment of MBECs with supernatants from MV-infected MBEC cultures with an anti-TRAIL antibody blocked caspase 3 expression and monolayer destruction. TRAIL was also expressed in the endothelium and other cell types in infected murine brains. This is the first demonstration that infection of low numbers of BECs with WT MV allows efficient virus production, induction of TRAIL, and subsequent widespread apoptosis.
Wang, Kai; Li, Yan; Jiang, Yi-Zhou; Dai, Cai-Feng; Patankar, Manish S; Song, Jia-Sheng; Zheng, Jing
2013-10-28
The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor mediates many biological processes. Herein, we investigated if 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE, an endogenous AhR ligand) regulated proliferation and migration of human ovarian cancer cells via AhR. We found that AhR was widely present in many histotypes of ovarian cancer tissues. ITE suppressed OVCAR-3 cell proliferation and SKOV-3 cell migration in vitro, which were blocked by AhR knockdown. ITE also suppressed OVCAR-3 cell growth in mice. These data suggest that the ITE might potentially be used for therapeutic intervention for at least a subset of human ovarian cancer. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Polycatenar Ligand Control of the Synthesis and Self-Assembly of Colloidal Nanocrystals.
Diroll, Benjamin T; Jishkariani, Davit; Cargnello, Matteo; Murray, Christopher B; Donnio, Bertrand
2016-08-24
Hydrophobic colloidal nanocrystals are typically synthesized and manipulated with commercially available ligands, and surface functionalization is therefore typically limited to a small number of molecules. Here, we report the use of polycatenar ligands derived from polyalkylbenzoates for the direct synthesis of metallic, chalcogenide, pnictide, and oxide nanocrystals. Polycatenar molecules, branched structures bearing diverging chains in which the terminal substitution pattern, functionality, and binding group can be independently modified, offer a modular platform for the development of ligands with targeted properties. Not only are these ligands used for the direct synthesis of monodisperse nanocrystals, but nanocrystals coated with polycatenar ligands self-assemble into softer bcc superlattices that deviate from conventional harder close-packed structures (fcc or hcp) formed by the same nanocrystals coated with commercial ligands. Self-assembly experiments demonstrate that the molecular structure of polycatenar ligands encodes interparticle spacings and attractions, engineering self-assembly, which is tunable from hard sphere to soft sphere behavior.
Ghosh, Arun K.; Parham, Garth L.; Martyr, Cuthbert D.; Nyalapatla, Prasanth R.; Osswald, Heather L.; Agniswamy, Johnson; Wang, Yuan-Fang; Amano, Masayuki; Weber, Irene T.; Mitsuya, Hiroaki
2013-01-01
The design, synthesis, and biological evaluation of a series of HIV-1 protease inhibitors incorporating stereochemically defined fused tricyclic P2-ligands are described. Various substituent effects were investigated in order to maximize the ligand-binding site interactions in the protease active site. Inhibitors 16a and 16f showed excellent enzyme inhibitory and antiviral activity while incorporation of sulfone functionality resulted in a decrease in potency. Both inhibitors 16a and 16f have maintained activity against a panel of multidrug resistant HIV-1 variants. A high-resolution X-ray crystal structure of 16a-bound HIV-1 protease revealed important molecular insights into the ligand-binding site interactions which may account for the inhibitor’s potent antiviral activity and excellent resistance profiles. PMID:23947685
Ramasamy, Thilagavathi; Selvam, Chelliah
2015-10-15
Virtual screening has become an important tool in drug discovery process. Structure based and ligand based approaches are generally used in virtual screening process. To date, several benchmark sets for evaluating the performance of the virtual screening tool are available. In this study, our aim is to compare the performance of both structure based and ligand based virtual screening methods. Ten anti-cancer targets and their corresponding benchmark sets from 'Demanding Evaluation Kits for Objective In silico Screening' (DEKOIS) library were selected. X-ray crystal structures of protein-ligand complexes were selected based on their resolution. Openeye tools such as FRED, vROCS were used and the results were carefully analyzed. At EF1%, vROCS produced better results but at EF5% and EF10%, both FRED and ROCS produced almost similar results. It was noticed that the enrichment factor values were decreased while going from EF1% to EF5% and EF10% in many cases. Published by Elsevier Ltd.
Ardestani, Masoud M; van Straalen, Nico M; van Gestel, Cornelis A M
2014-12-01
The biotic ligand model (BLM) is a theoretical, potentially mechanistic approach to assess metal bioavailability in soil and aquatic systems. In a BLM, toxicity is linked to the fraction of biotic ligand occupied, which in turn, depends on the various components of the solution, including activity of the metal. Bioavailability is a key factor in determining toxicity and uptake of metals in organisms. In this study, the present status of BLM development for soil and aquatic organisms is summarized. For all species and all metals, toxicity was correlated with the conditional biotic ligand binding constants. For almost all organisms, values for Ag, Cu, and Cd were higher than those for Zn and Ni. The constants derived for aquatic systems seem to be equally valid for soil organisms, but in the case of soils, bioavailability from the soil solution is greatly influenced by the presence of the soil solid phase. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ligand lability and chirality inversion in yb heterobimetallic catalysts.
Di Bari, Lorenzo; Lelli, Moreno; Salvadori, Piero
2004-09-20
We have investigated the exchange dynamics between the free and bound ligand in K3[Yb[(R)-binol]3], the most active heterobimetallic lanthanoid catalyst for cyclic imine hydrophosphonylation; we found that the Yb-binol bond is labile. The rate constant for this exchange was determined through NMR saturation transfer experiments. Upon addition of (S)-binaphthol, ligand exchange leads to the formation of a small quantity of heterochiral complexes and, in the presence of a molar excess of (S)-binaphthol, to chirality inversion of the whole complex. This demonstrates that, in contrast to other analogous systems, K3[Yb(binol)3] displays a strong chiral discrimination, with the overwhelming preference for ligands of the same configuration. The lability of Yb-binol bond in THF may suggest a ligand-to-substrate exchange as a key step in the catalytic process.
Cloud computing approaches for prediction of ligand binding poses and pathways.
Lawrenz, Morgan; Shukla, Diwakar; Pande, Vijay S
2015-01-22
We describe an innovative protocol for ab initio prediction of ligand crystallographic binding poses and highly effective analysis of large datasets generated for protein-ligand dynamics. We include a procedure for setup and performance of distributed molecular dynamics simulations on cloud computing architectures, a model for efficient analysis of simulation data, and a metric for evaluation of model convergence. We give accurate binding pose predictions for five ligands ranging in affinity from 7 nM to > 200 μM for the immunophilin protein FKBP12, for expedited results in cases where experimental structures are difficult to produce. Our approach goes beyond single, low energy ligand poses to give quantitative kinetic information that can inform protein engineering and ligand design.
Dynamic control of chirality in phosphine ligands for enantioselective catalysis
Zhao, Depeng; Neubauer, Thomas M.; Feringa, Ben L.
2015-01-01
Chirality plays a fundamental role in biology and chemistry and the precise control of chirality in a catalytic conversion is a key to modern synthesis most prominently seen in the production of pharmaceuticals. In enantioselective metal-based catalysis, access to each product enantiomer is commonly achieved through ligand design with chiral bisphosphines being widely applied as privileged ligands. Switchable phosphine ligands, in which chirality is modulated through an external trigger signal, might offer attractive possibilities to change enantioselectivity in a catalytic process in a non-invasive manner avoiding renewed ligand synthesis. Here we demonstrate that a photoswitchable chiral bisphosphine based on a unidirectional light-driven molecular motor, can be used to invert the stereoselectivity of a palladium-catalysed asymmetric transformation. It is shown that light-induced changes in geometry and helicity of the switchable ligand enable excellent selectivity towards the racemic or individual enantiomers of the product in a Pd-catalysed desymmetrization reaction. PMID:25806856
Differential TAM receptor-ligand-phospholipid interactions delimit differential TAM bioactivities.
Lew, Erin D; Oh, Jennifer; Burrola, Patrick G; Lax, Irit; Zagórska, Anna; Través, Paqui G; Schlessinger, Joseph; Lemke, Greg
2014-09-29
The TAM receptor tyrosine kinases Tyro3, Axl, and Mer regulate key features of cellular physiology, yet the differential activities of the TAM ligands Gas6 and Protein S are poorly understood. We have used biochemical and genetic analyses to delineate the rules for TAM receptor-ligand engagement and find that the TAMs segregate into two groups based on ligand specificity, regulation by phosphatidylserine, and function. Tyro3 and Mer are activated by both ligands but only Gas6 activates Axl. Optimal TAM signaling requires coincident TAM ligand engagement of both its receptor and the phospholipid phosphatidylserine (PtdSer): Gas6 lacking its PtdSer-binding 'Gla domain' is significantly weakened as a Tyro3/Mer agonist and is inert as an Axl agonist, even though it binds to Axl with wild-type affinity. In two settings of TAM-dependent homeostatic phagocytosis, Mer plays a predominant role while Axl is dispensable, and activation of Mer by Protein S is sufficient to drive phagocytosis.
Chemodynamics of aquatic metal complexes: from small ligands to colloids.
Van Leeuwen, Herman P; Buffle, Jacques
2009-10-01
Recent progress in understanding the formation/dissociation kinetics of aquatic metal complexes with complexants in different size ranges is evaluated and put in perspective, with suggestions for further studies. The elementary steps in the Eigen mechanism, i.e., diffusion and dehydration of the metal ion, are reviewed and further developed. The (de)protonation of both the ligand and the coordinating metal ion is reconsidered in terms of the consequences for dehydration rates and stabilities of the various outer-sphere complexes. In the nanoparticulate size range, special attention is given to the case of fulvic ligands, for which the impact of electrostatic interactions is especially large. In complexation with colloidal ligands (hard, soft, and combination thereof) the diffusive transport of metal ions is generally a slower step than in the case of complexation with small ligands in a homogeneous solution. The ensuing consequences for the chemodynamics of colloidal complexes are discussed in detail and placed in a generic framework, encompassing the complete range of ligand sizes.
Ligand-independent pathway that controls stability of interferon alpha receptor
Liu, Jianghuai; Plotnikov, Alexander; Banerjee, Anamika; Kumar, K.G. Suresh; Ragimbeau, Josiane; Marijanovic, Zrinka; Baker, Darren P.; Pellegrini, Sandra; Fuchs, Serge Y.
2008-01-01
SUMMARY Ligand-specific negative regulation of cytokine-induced signaling relies on down regulation of the cytokine receptors. Down regulation of the IFNAR1 sub-unit of the Type I interferon (IFN) receptor proceeds via lysosomal receptor proteolysis, which is triggered by ubiquitination that depends on IFNAR1 serine phosphorylation. While IFN-inducible phosphorylation, ubiquitination and degradation requires the catalytic activity of the Tyk2 Janus kinase, here we found the ligand- and Tyk2-independent pathway that promotes IFNAR1 phosphorylation, ubiquitination, and degradation when IFNAR1 is expressed at high levels. A major cellular kinase activity that is responsible for IFNAR1 phosphorylation in vitro does not depend on either ligand or Tyk2 activity. Inhibition of ligand-independent IFNAR1 degradation suppresses cell proliferation. We discuss the signaling events that might lead to ubiquitination and degradation of IFNAR1 via ligand-dependent and independent pathways and their potential physiologic significance. PMID:18166147
Ligand Electron Density Shape Recognition Using 3D Zernike Descriptors
NASA Astrophysics Data System (ADS)
Gunasekaran, Prasad; Grandison, Scott; Cowtan, Kevin; Mak, Lora; Lawson, David M.; Morris, Richard J.
We present a novel approach to crystallographic ligand density interpretation based on Zernike shape descriptors. Electron density for a bound ligand is expanded in an orthogonal polynomial series (3D Zernike polynomials) and the coefficients from this expansion are employed to construct rotation-invariant descriptors. These descriptors can be compared highly efficiently against large databases of descriptors computed from other molecules. In this manuscript we describe this process and show initial results from an electron density interpretation study on a dataset containing over a hundred OMIT maps. We could identify the correct ligand as the first hit in about 30 % of the cases, within the top five in a further 30 % of the cases, and giving rise to an 80 % probability of getting the correct ligand within the top ten matches. In all but a few examples, the top hit was highly similar to the correct ligand in both shape and chemistry. Further extensions and intrinsic limitations of the method are discussed.
Pharmacokinetics and Pharmacodynamics of Nonsteroidal Androgen Receptor Ligands
Gao, Wenqing; Kim, Juhyun; Dalton, James T.
2007-01-01
Testosterone and structurally related anabolic steroids have been used to treat hypogonadism, muscle wasting, osteoporosis, male contraception, cancer cachexia, anemia, and hormone replacement therapy in aging men or age-related frailty; while antiandrogens may be useful for treatment of conditions like acne, alopecia (male-pattern baldness), hirsutism, benign prostatic hyperplasia (BPH) and prostate cancer. However, the undesirable physicochemical and pharmacokinetic properties of steroidal androgen receptor (AR) ligands limited their clinical use. Nonsteroidal AR ligands with improved pharmacological and pharmacokinetic properties have been developed to overcome these problems. This review focuses on the pharmacokinetics, metabolism, and pharmacology of clinically used and emerging nonsteroidal AR ligands, including antagonists, agonists, and selective androgen receptor modulators. PMID:16841196
Comparison of the Efficiency of the LIE and MM/GBSA Methods to Calculate Ligand-Binding Energies.
Genheden, Samuel; Ryde, Ulf
2011-11-08
We have evaluated the efficiency of two popular end-point methods to calculate ligand-binding free energies, LIE (linear interaction energy) and MM/GBSA (molecular mechanics with generalized Born surface-area solvation), i.e. the computational effort needed to obtain estimates of a similar precision. As a test case, we use the binding of seven biotin analogues to avidin. The energy terms used by MM/GBSA and LIE exhibit a similar correlation time (∼5 ps), and the equilibration time seems also to be similar, although it varies much between the various ligands. The results show that the LIE method is more effective than MM/GBSA, by a factor of 2-7 for a truncated spherical system with a radius of 26 Å and by a factor of 1.0-2.4 for the full avidin tetramer (radius 47 Å). The reason for this is the cost for the MM/GBSA entropy calculations, which more than compensates for the extra simulation of the free ligand in LIE. On the other hand, LIE requires that the protein is neutralized, whereas MM/GBSA has no such requirements. Our results indicate that both the truncation and neutralization of the proteins may slow the convergence and emphasize small differences in the calculations, e.g., differences between the four subunits in avidin. Moreover, LIE cannot take advantage of the fact that avidin is a tetramer. For this test case, LIE gives poor results with the standard parametrization, but after optimizing the scaling factor of the van der Waals terms, reasonable binding affinities can be obtained, although MM/GBSA still gives a significantly better predictive index and correlation to the experimental affinities.
Analysis of ligand-protein exchange by Clustering of Ligand Diffusion Coefficient Pairs (CoLD-CoP).
Snyder, David A; Chantova, Mihaela; Chaudhry, Saadia
2015-06-01
NMR spectroscopy is a powerful tool in describing protein structures and protein activity for pharmaceutical and biochemical development. This study describes a method to determine weak binding ligands in biological systems by using hierarchic diffusion coefficient clustering of multidimensional data obtained with a 400 MHz Bruker NMR. Comparison of DOSY spectrums of ligands of the chemical library in the presence and absence of target proteins show translational diffusion rates for small molecules upon interaction with macromolecules. For weak binders such as compounds found in fragment libraries, changes in diffusion rates upon macromolecular binding are on the order of the precision of DOSY diffusion measurements, and identifying such subtle shifts in diffusion requires careful statistical analysis. The "CoLD-CoP" (Clustering of Ligand Diffusion Coefficient Pairs) method presented here uses SAHN clustering to identify protein-binders in a chemical library or even a not fully characterized metabolite mixture. We will show how DOSY NMR and the "CoLD-CoP" method complement each other in identifying the most suitable candidates for lysozyme and wheat germ acid phosphatase. Copyright © 2015 Elsevier Inc. All rights reserved.
Selective high-affinity polydentate ligands and methods of making such
DOE Office of Scientific and Technical Information (OSTI.GOV)
Denardo, Sally J.; Denardo, Gerald L.; Balhorn, Rodney L.
This invention provides novel polydentate selective high affinity ligands (SHALs) that can be used in a variety of applications in a manner analogous to the use of antibodies. SHALs typically comprise a multiplicity of ligands that each bind different region son the target molecule. The ligands are joined directly or through a linker thereby forming a polydentate moiety that typically binds the target molecule with high selectivity and avidity.
Selective high-affinity polydentate ligands and methods of making such
DeNardo, Sally; DeNardo, Gerald; Balhorn, Rodney
2013-09-17
This invention provides polydentate selective high affinity ligands (SHALs) that can be used in a variety of applications in a manner analogous to the use of antibodies. SHALs typically comprise a multiplicity of ligands that each binds different regions on the target molecule. The ligands are joined directly or through a linker thereby forming a polydentate moiety that typically binds the target molecule with high selectivity and avidity.
Selective high affinity polydentate ligands and methods of making such
DeNardo, Sally; DeNardo, Gerald; Balhorn, Rodney
2010-02-16
This invention provides novel polydentate selective high affinity ligands (SHALs) that can be used in a variety of applications in a manner analogous to the use of antibodies. SHALs typically comprise a multiplicity of ligands that each bind different region son the target molecule. The ligands are joined directly or through a linker thereby forming a polydentate moiety that typically binds the target molecule with high selectivity and avidity.
Reaction chemistry and ligand exchange at cadmium selenide nanocrystal surfaces
DOE Office of Scientific and Technical Information (OSTI.GOV)
Owen, Jonathan; Park, Jungwon; Trudeau, Paul-Emile
Chemical modification of nanocrystal surfaces is fundamentally important to their assembly, their implementation in biology and medicine, and greatly impacts their electrical and optical properties. However, it remains a major challenge owing to a lack of analytical tools to directly determine nanoparticle surface structure. Early nuclear magnetic resonance (NMR) and X-ray photoelectron spectroscopy (XPS) studies of CdSe nanocrystals prepared in tri-n-octylphosphine oxide (1) and tri-n-octylphosphine (2), suggested these coordinating solvents are datively bound to the particle surface. However, assigning the broad NMR resonances of surface-bound ligands is complicated by significant concentrations of phosphorus-containing impurities in commercial sources of 1, andmore » XPS provides only limited information about the nature of the phosphorus containing molecules in the sample. More recent reports have shown the surface ligands of CdSe nanocrystals prepared in technical grade 1, and in the presence of alkylphosphonic acids, include phosphonic and phosphinic acids. These studies do not, however, distinguish whether these ligands are bound datively, as neutral, L-type ligands, or by X-type interaction of an anionic phosphonate/phosphinate moiety with a surface Cd{sup 2+} ion. Answering this question would help clarify why ligand exchange with such particles does not proceed generally as expected based on a L-type ligand model. By using reagents with reactive silicon-chalcogen and silicon-chlorine bonds to cleave the ligands from the nanocrystal surface, we show that our CdSe and CdSe/ZnS core-shell nanocrystal surfaces are likely terminated by X-type binding of alkylphosphonate ligands to a layer of Cd{sup 2+}/Zn{sup 2+} ions, rather than by dative interactions. Further, we provide spectroscopic evidence that 1 and 2 are not coordinated to our purified nanocrystals.« less
Ye, Yang; Miao, Shuhan; Wang, Yan; Zhou, Jianwei; Lu, Rongzhu
2015-05-01
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) specifically kills cancer cells without destroying the majority of healthy cells. However, numerous types of cancer cell, including gastric cancer cells, tend to be resistant to TRAIL. The bioactive product 3,3'-diindolylmethane (DIM), which is derived from cruciferous vegetables, is also currently recognized as a candidate anticancer agent. In the present study, a Cell Counting Kit 8 cell growth assay and an Annexin V-fluorescein isothiocyanate apoptosis assay were performed to investigate the potentiating effect of DIM on TRAIL-induced apoptosis in gastric cancer cells, and the possible mechanisms of this potentiation. The results obtained demonstrated that, compared with TRAIL or DIM treatment alone, co-treatment with TRAIL (25 or 50 ng/ml) and DIM (10 µmol/l) induced cytotoxic and apoptotic effects in BGC-823 and SGC-7901 gastric cancer cells. Furthermore, western blot analysis revealed that the protein expression levels of death receptor 5 (DR5), CCAAT/enhancer binding protein homologous protein (CHOP) and glucose-regulated protein 78 (GRP78) were upregulated in the co-treated gastric cancer cells. To the best of our knowledge, the present study is the first to provide evidence that DIM sensitizes TRAIL-induced inhibition of proliferation and apoptosis in gastric cancer cells, accompanied by the upregulated expression of DR5, CHOP and GRP78 proteins, which may be involved in endoplasmic reticulum stress mechanisms.
Reshetnyak, Andrey V; Murray, Phillip B; Shi, Xiarong; Mo, Elizabeth S; Mohanty, Jyotidarsini; Tome, Francisco; Bai, Hanwen; Gunel, Murat; Lax, Irit; Schlessinger, Joseph
2015-12-29
Receptor tyrosine kinases (RTKs) are a class of cell surface receptors that, upon ligand binding, stimulate a variety of critical cellular functions. The orphan receptor anaplastic lymphoma kinase (ALK) is one of very few RTKs that remain without a firmly established protein ligand. Here we present a novel cytokine, FAM150B, which we propose naming augmentor-α (AUG-α), as a ligand for ALK. AUG-α binds ALK with high affinity and activates ALK in cells with subnanomolar potency. Detailed binding experiments using cells expressing ALK or the related receptor leukocyte tyrosine kinase (LTK) demonstrate that AUG-α binds and robustly activates both ALK and LTK. We show that the previously established LTK ligand FAM150A (AUG-β) is specific for LTK and only weakly binds to ALK. Furthermore, expression of AUG-α stimulates transformation of NIH/3T3 cells expressing ALK, induces IL-3 independent growth of Ba/F3 cells expressing ALK, and is expressed in neuroblastoma, a cancer partly driven by ALK. These experiments reveal the hierarchy and specificity of two cytokines as ligands for ALK and LTK and set the stage for elucidating their roles in development and disease states.
NASA Technical Reports Server (NTRS)
Childs-Disney, Jessica L. (Inventor); Disney, Matthew D. (Inventor)
2017-01-01
Disclosed are methods for identifying a nucleic acid (e.g., RNA, DNA, etc.) motif which interacts with a ligand. The method includes providing a plurality of ligands immobilized on a support, wherein each particular ligand is immobilized at a discrete location on the support; contacting the plurality of immobilized ligands with a nucleic acid motif library under conditions effective for one or more members of the nucleic acid motif library to bind with the immobilized ligands; and identifying members of the nucleic acid motif library that are bound to a particular immobilized ligand. Also disclosed are methods for selecting, from a plurality of candidate ligands, one or more ligands that have increased likelihood of binding to a nucleic acid molecule comprising a particular nucleic acid motif, as well as methods for identifying a nucleic acid which interacts with a ligand.
Interleukin-29 induces epithelial production of CXCR3A ligands and T-cell infiltration.
Witte, Ellen; Kokolakis, Georgios; Witte, Katrin; Warszawska, Katarzyna; Friedrich, Markus; Christou, Demetrios; Kirsch, Stefan; Sterry, Wolfram; Volk, Hans-Dieter; Sabat, Robert; Wolk, Kerstin
2016-04-01
Psoriasis is considered as a model for chronic immune-mediated disorders. Th17-cells are pivotal players in those diseases. Recently, we demonstrated that Th17-cells produce interleukin (IL)-29 and that IL-29 is highly present in psoriatic lesions. Whether IL-29, with its action on epithelial cells and melanocytes, contributes to psoriasis pathogenesis, was unknown so far. Analysis of IL-29-treated human keratinocytes revealed induction of the chemokines CXCL10, CXCL11, and, to a much lesser extent, CXCL9. Unlike these CXCR3A ligands, known to attract Th1-, CD8(+), NK-, and Th1/Th17 transient cells, no influence was found on chemokines attracting other immune cell populations or on molecules modulating the CXCR3A/CXCR3A ligand interaction. CXCR3A ligand expression was also induced by IL-29 in melanocytes and in epidermis models and explanted skin. Regarding other psoriasis-relevant cytokines, interferon-γ and, less potently, tumor necrosis factor-α and IL-1β shared and strengthened IL-29's capacity. Murine IL-29 counterpart injected into mouse skin provoked local CXCL10 and CXCL11 expression, T-cell infiltration, and, in consequence, skin swelling. The elevated IL-29 expression in psoriatic lesions was associated with upregulation of CXCR3A ligands compared to non-lesional skin of these patients and to the skin of healthy donors and atopic dermatitis patients, which lack IL-29 production. Importantly, neutralization of IL-29 reduced CXCR3A ligand levels in explant cultures of psoriatic lesions. Finally, elevated blood CXCL11 levels were found in psoriasis that might be useful for monitoring lesional activity of the IL-29 axis. In summary, the Th17-cytokine IL-29 induces specific chemokines and, in consequence, provokes skin infiltration of potentially pathogenic T-cells. IL-29 selectively induces CXCR3A-binding chemokines (CXCL9, CXCL10, CXCL11) in skin cells. Murine IL-29 counterpart induces skin T-cell infiltration and inflammation in mice. CXCR3A ligands are
Growth of fluorescence gold clusters using photo-chemically activated ligands
NASA Astrophysics Data System (ADS)
Mishra, Dinesh; Aldeek, Fadi; Michael, Serge; Palui, Goutam; Mattoussi, Hedi
2016-03-01
Ligands made of lipoic acid (LA) appended with a polyethylene glycol (PEG) chain have been used in the aqueous phase growth of luminescent gold clusters with distinct emission from yellow to near-IR, using two different routes. In the first route, the gold-ligand complex was chemically reduced using sodium borohydride in alkaline medium, which gave near- IR luminescent gold clusters with maximum emission around 745 nm. In the second method, LA-PEG ligand was photochemically modified to a mixture of thiols, oligomers and oxygenated species under UV-irradiation, which was then used as both reducing agent and stabilizing ligand. By adjusting the pH, temperature, and time of the reaction, we were able to obtain clusters with two distinct emission properties. Refluxing the gold-ligand complex in alkaline medium in the presence of excess ligand gave yellow emission within the first two hours and the emission shifted to red after overnight reaction. Mass spectrometry and chemical assay were used to understand the photo-chemical transformation of Lipoic Acid (LA). Mass spectroscopic studies showed the photo-irradiated product contains thiols, oligomers (dimers, trimers and tetramers) as well as oxygenated species. The amount of thiol formed under different conditions of irradiation was estimated using Ellman's assay.
Bystander protein protects potential vaccine-targeting ligands against intestinal proteolysis.
Reuter, Fabian; Bade, Steffen; Hirst, Timothy R; Frey, Andreas
2009-07-20
Endowing mucosal vaccines with ligands that target antigen to mucosal lymphoid tissues may improve immunization efficacy provided that the ligands withstand the proteolytic environment of the gastro-intestinal tract until they reach their destination. Our aim was to investigate whether and how three renowned ligands - Ulex europaeus agglutinin I and the B subunits of cholera toxin and E. coli heat-labile enterotoxin - master this challenge. We assessed the digestive power of natural murine intestinal fluid (natIF) using assays for trypsin, chymotrypsin and pancreatic elastase along with a test for nonspecific proteolysis. The natIF was compared with simulated murine intestinal fluid (simIF) that resembled the trypsin, chymotrypsin and elastase activities of its natural counterpart but lacked or contained albumins as additional protease substrates. The ligands were exposed to the digestive fluids and degradation was determined. The studies revealed that (i) the three pancreatic endoproteases constitute only one third of the total protease activity of natIF and (ii) the ligands resist proteolysis in natIF and protein-enriched simIF over 3 h but (iii) are partially destroyed in simIF that lacks additional protease substrate. We assume that the proteins of natIF are preferred substrates for the intestinal proteases and thus can protect vaccine-targeting ligands from destruction.
Validation of ligands in macromolecular structures determined by X-ray crystallography
Horský, Vladimír; Svobodová Vařeková, Radka; Bendová, Veronika
2018-01-01
Crystallographic studies of ligands bound to biological macromolecules (proteins and nucleic acids) play a crucial role in structure-guided drug discovery and design, and also provide atomic level insights into the physical chemistry of complex formation between macromolecules and ligands. The quality with which small-molecule ligands have been modelled in Protein Data Bank (PDB) entries has been, and continues to be, a matter of concern for many investigators. Correctly interpreting whether electron density found in a binding site is compatible with the soaked or co-crystallized ligand or represents water or buffer molecules is often far from trivial. The Worldwide PDB validation report (VR) provides a mechanism to highlight any major issues concerning the quality of the data and the model at the time of deposition and annotation, so the depositors can fix issues, resulting in improved data quality. The ligand-validation methods used in the generation of the current VRs are described in detail, including an examination of the metrics to assess both geometry and electron-density fit. It is found that the LLDF score currently used to identify ligand electron-density fit outliers can give misleading results and that better ligand-validation metrics are required. PMID:29533230
Coordination- and Redox-Noninnocent Behavior of Ambiphilic Ligands Containing Antimony.
Jones, J Stuart; Gabbaï, François P
2016-05-17
Stimulated by applications in catalysis, the chemistry of ambiphilic ligands featuring both donor and acceptor functionalities has experienced substantial growth in the past several years. The unique opportunities in catalysis offered by ambiphilic ligands stem from the ability of their acceptor functionalities to play key roles via metal-ligand cooperation or modulation of the reactivity of the metal center. Ligands featuring group 13 centers, most notably boranes, as their acceptor functionalities have undoubtedly spearheaded these developments, with remarkable results having been achieved in catalytic hydrogenation and hydrosilylation. Motivated by these developments as well as by our fundamental interest in the chemistry of heavy group 15 elements, we became fascinated by the possibility of employing antimony centers as Lewis acids within ambiphilic ligands. The chemistry of antimony-based ligands, most often encountered as trivalent stibines, has historically been considered to mirror that of their lighter phosphorus-based congeners. There is growing evidence, however, that antimony-based ligands may display unique coordination behavior and reactivity. Additionally, despite the diverse Lewis acid and redox chemistry that antimony exhibits, there have been only limited efforts to explore this chemistry within the coordination sphere of a transition metal. By incorporation of antimony into the framework of polydentate ligands in order to enforce the main group metal-transition metal interaction, the effect of redox and coordination events at the antimony center on the structure, electronics, and reactivity of the metal complex may be investigated. This Account describes our group's continuing efforts to probe the coordination behavior, reactivity, and application of ambiphilic ligands incorporating antimony centers. Structural and theoretical studies have established that both Sb(III) and Sb(V) centers in polydentate ligands may act as Z-type ligands toward late
2015-01-01
The objective of this study was to assess the effects of oral ingestion of β-glucans isolated from Saccharomyces cereviseae on the metabolic profile, expression of gingival inflammatory markers and amount of alveolar bone loss in diabetic rats with periodontal disease. Diabetes mellitus was induced in 48 Wistar rats by intraperitoneal injection of streptozotocin (80 mg/kg). After confirming the diabetes diagnosis, the animals were treated with β-glucans (by gavage) for 28 days. On the 14th day of this period, periodontal disease was induced using a ligature protocol. β-glucans reduced the amount of alveolar bone loss in animals with periodontal disease in both the diabetic and non-diabetic groups (p < 0.05). β-glucans reduced blood glucose, cholesterol and triacylglycerol levels in diabetic animals, both with and without periodontal disease (p < 0.05). Furthermore, treatment with β-glucans reduced the expression of cyclooxygenase-2 and receptor activator of nuclear factor kappa-B ligand and increased osteoprotegerin expression in animals with diabetes and periodontal disease (p < 0.05). It was concluded that treatment with β-glucans has beneficial metabolic and periodontal effects in diabetic rats with periodontal disease. PMID:26291983
Self-assembled molecular films incorporating a ligand
Bednarski, M.D.; Wilson, T.E.; Mastandra, M.S.
1996-04-23
Functionalized monomers are presented which can be used in the fabrication of molecular films for controlling adhesion, detection of receptor-ligand binding and enzymatic reactions; new coatings for lithography; and for semiconductor materials. The monomers are a combination of a ligand, a linker, optionally including a polymerizable group, and a surface attachment group. The processes and an apparatus for making films from these monomers, as well as methods of using the films are also provided. 7 figs.
Affinity Electrophoresis Using Ligands Attached To Polymers
NASA Technical Reports Server (NTRS)
Van Alstine, James M.; Snyder, Robert S.; Harris, J. M.; Brooks, D. E.
1990-01-01
In new technique, reduction of electrophoretic mobilities by addition of polyethylene glycol to ligands increases electrophoretic separabilities. In immuno-affinity electrophoresis, modification of ligands extends specificity of electrophoretic separation to particles having surface electric-charge structures otherwise making them electrophoretically inseparable. Modification of antibodies by polyethylene glycol greatly reduces ability to aggregate while enhancing ability to affect electrophoretic mobilities of cells. In hydrophobic-affinity electrophoresis, addition of polyethylene glycol reduces tendency toward aggregation of cells or macromolecules.
Quantification of Protein-Ligand Interactions by Laser Electrospray Mass Spectrometry
NASA Astrophysics Data System (ADS)
Archer, Jieutonne J.; Karki, Santosh; Shi, Fengjian; Sistani, Habiballah; Levis, Robert J.
2018-04-01
Laser electrospray mass spectrometry (LEMS) measurement of the dissociation constant (Kd) for hen egg white lysozyme (HEWL) and N,N',N″-triacetylchitotriose (NAG3) revealed an apparent Kd value of 313.2 ± 25.9 μM for the ligand titration method. Similar measurements for N,N',N″,N″'-tetraacetylchitotetraose (NAG4) revealed an apparent Kd of 249.3 ± 13.6 μM. An electrospray ionization mass spectrometry (ESI-MS) experiment determined a Kd value of 9.8 ± 0.6 μM. In a second LEMS approach, a calibrated measurement was used to determine a Kd value of 6.8 ± 1.5 μM for NAG3. The capture efficiency of LEMS was measured to be 3.6 ± 1.8% and is defined as the fraction of LEMS sample detected after merging with the ESI plume. When the dilution is factored into the ligand titration measurement, the adjusted Kd value was 11.3 μM for NAG3 and 9.0 μM for NAG4. The calibration method for measuring Kd developed in this study can be applied to solutions containing unknown analyte concentrations. [Figure not available: see fulltext.
Water as a complex system: its role in ligand diffusion, general anesthesia, and sleep.
Kier, Lemont B
2007-10-01
The work and inspiration of Robert Rosen is stated and expressed in personal tones. The concept of passages through water (H2O) near protein surfaces is reviewed in terms of its influence on ligand diffusion to an effector. This is offered as a target for interference by a non-specific general anesthetic agent. In view of the similarities between this anesthetic state and sleep, this mechanism is proposed to be operative for the sleep/wake states. Based on this mechanism and other factors, nitrogen (N2) is proposed as an exogenous sleep factor.
Adsorption of hairy particles with mobile ligands: Molecular dynamics and density functional study
NASA Astrophysics Data System (ADS)
Borówko, M.; Sokołowski, S.; Staszewski, T.; Pizio, O.
2018-01-01
We study models of hairy nanoparticles in contact with a hard wall. Each particle is built of a spherical core with a number of ligands attached to it and each ligand is composed of several spherical, tangentially jointed segments. The number of segments is the same for all ligands. Particular models differ by the numbers of ligands and of segments per ligand, but the total number of segments is constant. Moreover, our model assumes that the ligands are tethered to the core in such a manner that they can "slide" over the core surface. Using molecular dynamics simulations we investigate the differences in the structure of a system close to the wall. In order to characterize the distribution of the ligands around the core, we have calculated the end-to-end distances of the ligands and the lengths and orientation of the mass dipoles. Additionally, we also employed a density functional approach to obtain the density profiles. We have found that if the number of ligands is not too high, the proposed version of the theory is capable to predict the structure of the system with a reasonable accuracy.
Heinecke, Christine L; Ni, Thomas W; Malola, Sami; Mäkinen, Ville; Wong, O Andrea; Häkkinen, Hannu; Ackerson, Christopher J
2012-08-15
Ligand exchange reactions are widely used for imparting new functionality on or integrating nanoparticles into devices. Thiolate-for-thiolate ligand exchange in monolayer protected gold nanoclusters has been used for over a decade; however, a firm structural basis of this reaction has been lacking. Herein, we present the first single-crystal X-ray structure of a partially exchanged Au(102)(p-MBA)(40)(p-BBT)(4) (p-MBA = para-mercaptobenzoic acid, p-BBT = para-bromobenzene thiol) with p-BBT as the incoming ligand. The crystal structure shows that 2 of the 22 symmetry-unique p-MBA ligand sites are partially exchanged to p-BBT under the initial fast kinetics in a 5 min timescale exchange reaction. Each of these ligand-binding sites is bonded to a different solvent-exposed Au atom, suggesting an associative mechanism for the initial ligand exchange. Density functional theory calculations modeling both thiol and thiolate incoming ligands postulate a mechanistic pathway for thiol-based ligand exchange. The discrete modification of a small set of ligand binding sites suggests Au(102)(p-MBA)(44) as a powerful platform for surface chemical engineering.
Ligand-Asymmetric Janus Quantum Dots for Efficient Blue-Quantum Dot Light-Emitting Diodes.
Cho, Ikjun; Jung, Heeyoung; Jeong, Byeong Guk; Hahm, Donghyo; Chang, Jun Hyuk; Lee, Taesoo; Char, Kookheon; Lee, Doh C; Lim, Jaehoon; Lee, Changhee; Cho, Jinhan; Bae, Wan Ki
2018-06-19
We present ligand-asymmetric Janus quantum dots (QDs) to improve the device performance of quantum dot light-emitting diodes (QLEDs). Specifically, we devise blue QLEDs incorporating blue QDs with asymmetrically modified ligands, in which the bottom ligand of QDs in contact with ZnO electron-transport layer serves as a robust adhesive layer and an effective electron-blocking layer and the top ligand ensures uniform deposition of organic hole transport layers with enhanced hole injection properties. Suppressed electron overflow by the bottom ligand and stimulated hole injection enabled by the top ligand contribute synergistically to boost the balance of charge injection in blue QDs and therefore the device performance of blue QLEDs. As an ultimate achievement, the blue QLED adopting ligand-asymmetric QDs displays 2-fold enhancement in peak external quantum efficiency (EQE = 3.23%) compared to the case of QDs with native ligands (oleic acid) (peak EQE = 1.49%). The present study demonstrates an integrated strategy to control over the charge injection properties into QDs via ligand engineering that enables enhancement of the device performance of blue QLEDs and thus promises successful realization of white light-emitting devices using QDs.
NALDB: nucleic acid ligand database for small molecules targeting nucleic acid.
Kumar Mishra, Subodh; Kumar, Amit
2016-01-01
Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular formula, molecular weight, net-formal charge, AlogP, number of rings, number of hydrogen bond donor and acceptor, potential energy along with their Ki, Kd, IC50 values. All these details at single platform would be helpful for the development and betterment of novel ligands targeting nucleic acids that could serve as a potential target in different diseases including cancers and neurological disorders. With maximum 255 conformers for each ligand entry, our database is a multi-conformer database and can facilitate the virtual screening process. NALDB provides powerful web-based search tools that make database searching efficient and simplified using option for text as well as for structure query. NALDB also provides multi-dimensional advanced search tool which can screen the database molecules on the basis of molecular properties of ligand provided by database users. A 3D structure visualization tool has also been included for 3D structure representation of ligands. NALDB offers an inclusive pharmacological information and the structurally flexible set of small molecules with their three-dimensional conformers that can accelerate the virtual screening and other modeling processes and eventually complement the nucleic acid-based drug discovery research. NALDB can be routinely updated and freely available on bsbe.iiti.ac.in/bsbe/naldb/HOME.php. Database URL: http://bsbe.iiti.ac.in/bsbe/naldb/HOME.php. © The Author(s) 2016. Published by Oxford University Press.
NALDB: nucleic acid ligand database for small molecules targeting nucleic acid
Kumar Mishra, Subodh; Kumar, Amit
2016-01-01
Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular formula, molecular weight, net-formal charge, AlogP, number of rings, number of hydrogen bond donor and acceptor, potential energy along with their Ki, Kd, IC50 values. All these details at single platform would be helpful for the development and betterment of novel ligands targeting nucleic acids that could serve as a potential target in different diseases including cancers and neurological disorders. With maximum 255 conformers for each ligand entry, our database is a multi-conformer database and can facilitate the virtual screening process. NALDB provides powerful web-based search tools that make database searching efficient and simplified using option for text as well as for structure query. NALDB also provides multi-dimensional advanced search tool which can screen the database molecules on the basis of molecular properties of ligand provided by database users. A 3D structure visualization tool has also been included for 3D structure representation of ligands. NALDB offers an inclusive pharmacological information and the structurally flexible set of small molecules with their three-dimensional conformers that can accelerate the virtual screening and other modeling processes and eventually complement the nucleic acid-based drug discovery research. NALDB can be routinely updated and freely available on bsbe.iiti.ac.in/bsbe/naldb/HOME.php. Database URL: http://bsbe.iiti.ac.in/bsbe/naldb/HOME.php PMID:26896846
Feng, Wei; Liu, Hongrui; Luo, Tingting; Liu, Di; Du, Juan; Sun, Jing; Wang, Wei; Han, Xiuchun; Yang, Kaiyun; Guo, Jie; Amizuka, Norio; Li, Minqi
2017-01-27
Interleukin (IL)-6 is known to indirectly enhance osteoclast formation by promoting receptor activator of nuclear factor kappa-B ligand (RANKL) production by osteoblastic/stromal cells. However, little is known about the direct effect of IL-6 on osteoclastogenesis. Here, we determined the direct effects of IL-6 and its soluble receptor (sIL-6R) on RANKL-induced osteoclast formation by osteoclast precursors in vitro. We found IL-6/sIL-6R significantly promoted and suppressed osteoclast differentiation induced by low- (10 ng/ml) and high-level (50 ng/ml) RANKL, respectively. Using a bone resorption pit formation assay, expression of osteoclastic marker genes and transcription factors confirmed differential regulation of RANKL-induced osteoclastogenesis by IL-6/sIL-6R. Intracellular signaling transduction analysis revealed IL-6/sIL-6R specifically upregulated and downregulated the phosphorylation of NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells), ERK (extracellular signal-regulated kinase) and JNK (c-Jun N-terminal kinase) induced by low- and high level RANKL, respectively. Taken together, our findings demonstrate that IL-6/sIL-6R differentially regulate RANKL-induced osteoclast differentiation and activity through modulation of NF-κB, ERK and JNK signaling pathways. Thus, IL-6 likely plays a dual role in osteoclastogenesis either as a pro-resorption factor or as a protector of bone, depending on the level of RANKL within the local microenvironment.
Luteolin, a flavonoid, inhibits CD40 ligand expression by activated human basophils.
Hirano, Toru; Arimitsu, Junsuke; Higa, Shinji; Naka, Tetsuji; Ogata, Atsushi; Shima, Yoshihito; Fujimoto, Minoru; Yamadori, Tomoki; Ohkawara, Tomoharu; Kuwabara, Yusuke; Kawai, Mari; Kawase, Ichiro; Tanaka, Toshio
2006-01-01
We have previously shown that flavonoids such as luteolin, apigenin and fisetin inhibit interleukin 4 and interleukin 13 production. In this study, we investigated whether luteolin can suppress CD40 ligand expression by basophils. A human basophilic cell line, KU812, was stimulated with A23187 and phorbol myristate acetate (PMA) with or without various concentrations of luteolin or other flavonoids for 12 h, and CD40 ligand expression was analyzed by FACS. The effect of luteolin on CD40 ligand mRNA expression was studied by semiquantitative reverse transcription PCR analysis. In addition, CD40 ligand expression was also measured in purified basophils that had been stimulated for 12 h with A23187 plus PMA with or without various concentrations of luteolin. CD40 ligand expression by KU812 cells was enhanced noticeably in response to A23187 and even more strikingly augmented by A23187 plus PMA. The expression was significantly suppressed by 10 or 30 microM of luteolin, whereas myricetin failed to inhibit. Reverse transcription PCR analyses demonstrated that luteolin inhibited CD40 ligand mRNA expression by stimulated KU812 cells. Of the six flavonoids examined, luteolin, apigenin, fisetin and quercetin at 30 microM showed a significant inhibitory effect on CD40 ligand expression. The incubation of purified basophils with A23187 plus PMA significantly enhanced CD40 ligand expression, and the presence of luteolin again had an inhibitory effect. Luteolin inhibits CD40 ligand expression by activated basophils.
Force spectroscopy studies on protein-ligand interactions: a single protein mechanics perspective.
Hu, Xiaotang; Li, Hongbin
2014-10-01
Protein-ligand interactions are ubiquitous and play important roles in almost every biological process. The direct elucidation of the thermodynamic, structural and functional consequences of protein-ligand interactions is thus of critical importance to decipher the mechanism underlying these biological processes. A toolbox containing a variety of powerful techniques has been developed to quantitatively study protein-ligand interactions in vitro as well as in living systems. The development of atomic force microscopy-based single molecule force spectroscopy techniques has expanded this toolbox and made it possible to directly probe the mechanical consequence of ligand binding on proteins. Many recent experiments have revealed how ligand binding affects the mechanical stability and mechanical unfolding dynamics of proteins, and provided mechanistic understanding on these effects. The enhancement effect of mechanical stability by ligand binding has been used to help tune the mechanical stability of proteins in a rational manner and develop novel functional binding assays for protein-ligand interactions. Single molecule force spectroscopy studies have started to shed new lights on the structural and functional consequence of ligand binding on proteins that bear force under their biological settings. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
An infrastructure to mine molecular descriptors for ligand selection on virtual screening.
Seus, Vinicius Rosa; Perazzo, Giovanni Xavier; Winck, Ana T; Werhli, Adriano V; Machado, Karina S
2014-01-01
The receptor-ligand interaction evaluation is one important step in rational drug design. The databases that provide the structures of the ligands are growing on a daily basis. This makes it impossible to test all the ligands for a target receptor. Hence, a ligand selection before testing the ligands is needed. One possible approach is to evaluate a set of molecular descriptors. With the aim of describing the characteristics of promising compounds for a specific receptor we introduce a data warehouse-based infrastructure to mine molecular descriptors for virtual screening (VS). We performed experiments that consider as target the receptor HIV-1 protease and different compounds for this protein. A set of 9 molecular descriptors are taken as the predictive attributes and the free energy of binding is taken as a target attribute. By applying the J48 algorithm over the data we obtain decision tree models that achieved up to 84% of accuracy. The models indicate which molecular descriptors and their respective values are relevant to influence good FEB results. Using their rules we performed ligand selection on ZINC database. Our results show important reduction in ligands selection to be applied in VS experiments; for instance, the best selection model picked only 0.21% of the total amount of drug-like ligands.
Increased Accuracy of Ligand Sensing by Receptor Internalization and Lateral Receptor Diffusion
NASA Astrophysics Data System (ADS)
Aquino, Gerardo; Endres, Robert
2010-03-01
Many types of cells can sense external ligand concentrations with cell-surface receptors at extremely high accuracy. Interestingly, ligand-bound receptors are often internalized, a process also known as receptor-mediated endocytosis. While internalization is involved in a vast number of important functions for the life of a cell, it was recently also suggested to increase the accuracy of sensing ligand as overcounting of the same ligand molecules is reduced. A similar role may be played by receptor diffusion om the cell membrane. Fast, lateral receptor diffusion is known to be relevant in neurotransmission initiated by release of neurotransmitter glutamate in the synaptic cleft between neurons. By binding ligand and removal by diffusion from the region of release of the neurotransmitter, diffusing receptors can be reasonably expected to reduce the local overcounting of the same ligand molecules in the region of signaling. By extending simple ligand-receptor models to out-of-equilibrium thermodynamics, we show that both receptor internalization and lateral diffusion increase the accuracy with which cells can measure ligand concentrations in the external environment. We confirm this with our model and give quantitative predictions for experimental parameters values. We give quantitative predictions, which compare favorably to experimental data of real receptors.
Wang, Shiyan; Tian, Linwei; Zeng, Zhirong; Zhang, Mingdong; Wu, Kaichun; Chen, Minhu; Fan, Daiming; Hu, Pinjin; Sung, Joseph J Y; Yu, Jun
2010-02-05
Nuclear factor of kappa B inhibitor alpha (I kappaB alpha) protein is implicated in regulating a variety of cellular process from inflammation to tumorigenesis. The objective of this study was to investigate the susceptibility of rs2233408 T/C genotype in the promoter region of I kappaB alpha to gastric cancer and the association of this polymorphism with clinicopathologic variables in gastric cancer patients. A population-based case-control study was conducted between 1999 and 2006 in Guangdong Province, China. A total of 564 gastric cancer patients and 566 healthy controls were enrolled in this study. rs2233408 genotypes in I kappaB alpha were analyzed by TaqMan SNP genotyping assay. Both rs2233408 T homozygote (TT) and T heterozygotes (TC and TT) had significantly reduced gastric cancer risk (TT: OR = 0.250, 95% CI = 0.069-0.909, P = 0.035; TC and TT: OR = 0.721, 95% CI = 0.530-0.981, P = 0.037), compared with rs2233408 C homozygote (CC). rs2233408 T heterozygotes were significantly associated with reduced risk of intestinal-type gastric cancer with ORs of 0.648 (95% CI = 0.459-0.916, P = 0.014), but not with the diffuse or mix type of gastric cancer. The association between rs2233408 T heterozygotes and gastric cancer appeared more apparent in the older patients (age>40) (OR = 0.674, 95% CI = 0.484-0.939, P = 0.02). rs2233408 T heterozygotes was associated with non-cardiac gastric cancer (OR = 0.594, 95% CI = 0.411-0.859, P = 0.006), but not with cardiac gastric cancer. However, rs2233408 polymorphism was not associated with the prognosis of gastric cancer patients. I kappaB alpha rs2233408 T heterozygotes were associated with reduced risk of gastric cancer, especially for the development of certain subtypes of gastric cancer in Chinese population.
Differential expression of VEGF ligands and receptors in prostate cancer.
Woollard, David J; Opeskin, Kenneth; Coso, Sanja; Wu, Di; Baldwin, Megan E; Williams, Elizabeth D
2013-05-01
Prostate cancer disseminates to regional lymph nodes, however the molecular mechanisms responsible for lymph node metastasis are poorly understood. The vascular endothelial growth factor (VEGF) ligand and receptor family have been implicated in the growth and spread of prostate cancer via activation of the blood vasculature and lymphatic systems. The purpose of this study was to comprehensively examine the expression pattern of VEGF ligands and receptors in the glandular epithelium, stroma, lymphatic vasculature and blood vessels in prostate cancer. The localization of VEGF-A, VEGF-C, VEGF-D, VEGF receptor (VEGFR)-1, VEGFR-2, and VEGFR-3 was examined in cancerous and adjacent benign prostate tissue from 52 subjects representing various grades of prostate cancer. Except for VEGFR-2, extensive staining was observed for all ligands and receptors in the prostate specimens. In epithelial cells, VEGF-A and VEGFR-1 expression was higher in tumor tissue compared to benign tissue. VEGF-D and VEGFR-3 expression was significantly higher in benign tissue compared to tumor in the stroma and the endothelium of lymphatic and blood vessels. In addition, the frequency of lymphatic vessels, but not blood vessels, was lower in tumor tissue compared with benign tissue. These results suggest that activation of VEGFR-1 by VEGF-A within the carcinoma, and activation of lymphatic endothelial cell VEGFR-3 by VEGF-D within the adjacent benign stroma may be important signaling mechanisms involved in the progression and subsequent metastatic spread of prostate cancer. Thus inhibition of these pathways may contribute to therapeutic strategies for the management of prostate cancer. Copyright © 2012 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bassner, S.L.; Morrison, E.D.; Geoffroy, G.L.
1986-08-20
Free ketene is a valuable organic synthetic reagent, but its utility is somewhat limited by its high reactivity and tendency to dimerize to yield diketene. The ketene ligand is obviously stabilized by metal coordination in a variety of bonding modes, but it is not yet known how coordination influences the chemistry of this important molecule. The authors have studied the reactivity of the coordinated ketene ligand of type II found in the anionic cluster compound (PPN)(Os/sub 3/(CO)/sub 10/(..mu..-I)(..mu..-CH/sub 2/CO)) (1) (PPN/sup +/ = (Ph/sub 3/P)/sub 2/N/sup +/) and herein show that this ligand is readily converted into eta-enolate ligands uponmore » reaction with simple nucleophiles and into vinyl and acetyl ligands upon reaction with electrophiles.« less
Ligand induced ferromagnetism in ZnO nanostructures.
Wang, Qian; Sun, Qiang; Jena, P
2008-10-28
Complementary to the experimental finding that ZnO nanoparticles become ferromagnetic when coated with N and S containing ligands such as dodecylamine and dodecanethiol [Garcia et al., Nano Lett. 7, 1489 (2007)], we provide the first theoretical understanding of the origin of magnetism in ligated ZnO nanoparticles as well as the structural properties of the ligated systems by using density functional theory and generalized gradient approximation for exchange and correlation, and a cluster model for the nanoparticles. We show that N or S atoms of the ligand bind to the Zn sites. The accompanying changes in the Zn-O bond length, hybridization between Zn 4s orbitals with N 2p or S 3p orbitals, and consequently the redistribution of charges between Zn and O atoms result in a magnetic system where the 2p electrons in O and N, and 3p electrons in S sites are spin polarized. Furthermore, the sites nearest to the Zn atom attached to the ligand carry bulk of the magnetic moment. Studies, as a function of cluster size, also illustrate that magnetism resides only on the surface. Our results confirm that the use of ligands can pave a new way for introducing magnetism in ZnO nanostructures, which can be used to develop magnetic sensors to detect N and S containing molecules.
The use of supramolecular structures as protein ligands.
Stopa, Barbara; Jagusiak, Anna; Konieczny, Leszek; Piekarska, Barbara; Rybarska, Janina; Zemanek, Grzegorz; Król, Marcin; Piwowar, Piotr; Roterman, Irena
2013-11-01
Congo red dye as well as other eagerly self-assembling organic molecules which form rod-like or ribbon-like supramolecular structures in water solutions, appears to represent a new class of protein ligands with possible wide-ranging medical applications. Such molecules associate with proteins as integral clusters and preferentially penetrate into areas of low molecular stability. Abnormal, partly unfolded proteins are the main binding target for such ligands, while well packed molecules are generally inaccessible. Of particular interest is the observation that local susceptibility for binding supramolecular ligands may be promoted in some proteins as a consequence of function-derived structural changes, and that such complexation may alter the activity profile of target proteins. Examples are presented in this paper.
Ambler, Brett R; Peddi, Santosh; Altman, Ryan A
2015-05-15
"Cu-CF3" species have been used historically for a broad spectrum of nucleophilic trifluoromethylation reactions. Although recent advancements have employed ligands to stabilize and harness the reactivity of this key organometallic intermediate, the ability of a ligand to differentiate a regiochemical outcome of a Cu-CF3-mediated or -catalyzed reaction has not been previously reported. Herein, we report the first example of a Cu-catalyzed trifluoromethylation reaction in which a ligand controls the regiochemical outcome. More specifically, we demonstrate the ability of bipyridyl-derived ligands to control the regioselectivity of the Cu-catalyzed nucleophilic trifluoromethylation reactions of propargyl electrophiles to generate (trifluoromethyl)allenes. This method provides a variety of di-, tri-, and tetrasubstituted (trifluoromethyl)allenes, which can be further modified to generate complex fluorinated substructures.
Silvaroli, Josie A; Arne, Jason M; Chelstowska, Sylwia; Kiser, Philip D; Banerjee, Surajit; Golczak, Marcin
2016-04-15
Important in regulating the uptake, storage, and metabolism of retinoids, cellular retinol-binding protein 1 (CRBP1) is essential for trafficking vitamin A through the cytoplasm. However, the molecular details of ligand uptake and targeted release by CRBP1 remain unclear. Here we report the first structure of CRBP1 in a ligand-free form as well as ultra-high resolution structures of this protein bound to either all-trans-retinol or retinylamine, the latter a therapeutic retinoid that prevents light-induced retinal degeneration. Superpositioning of human apo- and holo-CRBP1 revealed major differences within segments surrounding the entrance to the retinoid-binding site. These included α-helix II and hairpin turns between β-strands βC-βD and βE-βF as well as several side chains, such as Phe-57, Tyr-60, and Ile-77, that change their orientations to accommodate the ligand. Additionally, we mapped hydrogen bond networks inside the retinoid-binding cavity and demonstrated their significance for the ligand affinity. Analyses of the crystallographic B-factors indicated several regions with higher backbone mobility in the apoprotein that became more rigid upon retinoid binding. This conformational flexibility of human apo-CRBP1 facilitates interaction with the ligands, whereas the more rigid holoprotein structure protects the labile retinoid moiety during vitamin A transport. These findings suggest a mechanism of induced fit upon ligand binding by mammalian cellular retinol-binding proteins. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Role of water and steric constraints in the kinetics of cavity-ligand unbinding.
Tiwary, Pratyush; Mondal, Jagannath; Morrone, Joseph A; Berne, B J
2015-09-29
A key factor influencing a drug's efficacy is its residence time in the binding pocket of the host protein. Using atomistic computer simulation to predict this residence time and the associated dissociation process is a desirable but extremely difficult task due to the long timescales involved. This gets further complicated by the presence of biophysical factors such as steric and solvation effects. In this work, we perform molecular dynamics (MD) simulations of the unbinding of a popular prototypical hydrophobic cavity-ligand system using a metadynamics-based approach that allows direct assessment of kinetic pathways and parameters. When constrained to move in an axial manner, the unbinding time is found to be on the order of 4,000 s. In accordance with previous studies, we find that the cavity must pass through a region of sharp wetting transition manifested by sudden and high fluctuations in solvent density. When we remove the steric constraints on ligand, the unbinding happens predominantly by an alternate pathway, where the unbinding becomes 20 times faster, and the sharp wetting transition instead becomes continuous. We validate the unbinding timescales from metadynamics through a Poisson analysis, and by comparison through detailed balance to binding timescale estimates from unbiased MD. This work demonstrates that enhanced sampling can be used to perform explicit solvent MD studies at timescales previously unattainable, to our knowledge, obtaining direct and reliable pictures of the underlying physiochemical factors including free energies and rate constants.
Role of water and steric constraints in the kinetics of cavity–ligand unbinding
Tiwary, Pratyush; Mondal, Jagannath; Morrone, Joseph A.; Berne, B. J.
2015-01-01
A key factor influencing a drug’s efficacy is its residence time in the binding pocket of the host protein. Using atomistic computer simulation to predict this residence time and the associated dissociation process is a desirable but extremely difficult task due to the long timescales involved. This gets further complicated by the presence of biophysical factors such as steric and solvation effects. In this work, we perform molecular dynamics (MD) simulations of the unbinding of a popular prototypical hydrophobic cavity–ligand system using a metadynamics-based approach that allows direct assessment of kinetic pathways and parameters. When constrained to move in an axial manner, the unbinding time is found to be on the order of 4,000 s. In accordance with previous studies, we find that the cavity must pass through a region of sharp wetting transition manifested by sudden and high fluctuations in solvent density. When we remove the steric constraints on ligand, the unbinding happens predominantly by an alternate pathway, where the unbinding becomes 20 times faster, and the sharp wetting transition instead becomes continuous. We validate the unbinding timescales from metadynamics through a Poisson analysis, and by comparison through detailed balance to binding timescale estimates from unbiased MD. This work demonstrates that enhanced sampling can be used to perform explicit solvent MD studies at timescales previously unattainable, to our knowledge, obtaining direct and reliable pictures of the underlying physiochemical factors including free energies and rate constants. PMID:26371312
Ehrlich, Allison K; Pennington, Jamie M; Bisson, William H; Kolluri, Siva K; Kerkvliet, Nancy I
2018-02-01
FICZ and TCDD, two high-affinity AhR ligands, are reported to have opposite effects on T cell differentiation with TCDD inducing regulatory T cells and FICZ inducing Th17 cells. This dichotomy has been attributed to ligand-intrinsic differences in AhR activation, although differences in sensitivity to metabolism complicate the issue. TCDD is resistant to AhR-induced metabolism and produces sustained AhR activation following a single dose in the μg/kg range, whereas FICZ is rapidly metabolized and AhR activation is transient. Nonetheless, prior studies comparing FICZ with TCDD have generally used the same 10-50 μg/kg dose range, and thus the two ligands would not equivalently activate AhR. We hypothesized that high-affinity AhR ligands can promote CD4+ T cell differentiation into both Th17 cells and Tregs, with fate depending on the extent and duration of AhR activation. We compared the immunosuppressive effects of TCDD and FICZ, along with two other rapidly metabolized ligands (ITE and 11-Cl-BBQ) in an acute alloresponse mouse model. The dose and timing of administration of each ligand was optimized for TCDD-equivalent Cyp1a1 induction. When optimized, all of the ligands suppressed the alloresponse in conjunction with the induction of Foxp3- Tr1 cells on day 2 and the expansion of natural Foxp3+ Tregs on day 10. In contrast, a low dose of FICZ induced transient expression of Cyp1a1 and did not induce Tregs or suppress the alloresponse but enhanced IL-17 production. Interestingly, low doses of the other ligands, including TCDD, also increased IL-17 production on day 10. These findings support the conclusion that the dose and the duration of AhR activation by high-affinity AhR ligands are the primary factors driving the fate of T cell differentiation. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Sulfate Separation by Selective Crystallization with a Bis-iminoguanidinium Ligand.
Seipp, Charles A; Williams, Neil J; Custelcean, Radu
2016-09-08
A simple and effective method for selective sulfate separation from aqueous solutions by crystallization with a bis-guanidinium ligand, 1,4-benzene-bis(iminoguanidinium) (BBIG), is demonstrated. The ligand is synthesized as the chloride salt (BBIG-Cl) by in situ imine condensation of terephthalaldehyde with aminoguanidinium chloride in water, followed by crystallization as the sulfate salt (BBIG-SO4). Alternatively, BBIG-Cl is synthesized ex situ in larger scale from ethanol. The sulfate separation ability of the BBIG ligand is demonstrated by selective and quantitative crystallization of sulfate from seawater. The ligand can be recycled by neutralization of BBIG-SO4 with aqueous NaOH and crystallization of the neutral bis-iminoguanidine, which can be converted back into BBIG-Cl with aqueous HCl and reused in another separation cycle. Finally, (35)S-labeled sulfate and β liquid scintillation counting are employed for monitoring the sulfate concentration in solution. Overall, this protocol will instruct the user in the necessary skills to synthesize a ligand, employ it in the selective crystallization of sulfate from aqueous solutions, and quantify the separation efficiency.
Crowther, Gregory J.; Napuli, Alberto J.; Thomas, Andrew P.; Chung, Diana J.; Kovzun, Kuzma V.; Leibly, David J.; Castaneda, Lisa J.; Bhandari, Janhavi; Damman, Christopher J.; Hui, Raymond; Hol, Wim G. J.; Buckner, Frederick S.; Verlinde, Christophe L. M. J.; Zhang, Zhongsheng; Fan, Erkang; Van Voorhis, Wesley C.
2010-01-01
In the last decade, thermal melt/thermal shift assays have become a common tool for identifying ligands and other factors that stabilize specific proteins. Increased stability is indicated by an increase in the protein's melting temperature (Tm). In optimizing the assays for subsequent screening of compound libraries, it is important to minimize the variability of Tm measurements so as to maximize the assay's ability to detect potential ligands. Here we present an investigation of Tm variability in recombinant proteins from Plasmodium parasites. Ligands of Plasmodium proteins are particularly interesting as potential starting points for drugs for malaria, and new drugs are urgently needed. A single standard buffer (100 mM HEPES, pH 7.5, 150 mM NaCl) permitted estimation of Tm for 58 of 61 Plasmodium proteins tested. However, with several proteins, Tm could not be measured with a consistency suitable for high-throughput screening unless alternative protein-specific buffers were employed. We conclude that buffer optimization to minimize variability in Tm measurements increases the success of thermal melt screens involving proteins for which a standard buffer is suboptimal. PMID:19470714
NASA Astrophysics Data System (ADS)
Pi, Fengmei; Binzel, Daniel W.; Lee, Tae Jin; Li, Zhefeng; Sun, Meiyan; Rychahou, Piotr; Li, Hui; Haque, Farzin; Wang, Shaoying; Croce, Carlo M.; Guo, Bin; Evers, B. Mark; Guo, Peixuan
2018-01-01
Nanotechnology offers many benefits, and here we report an advantage of applying RNA nanotechnology for directional control. The orientation of arrow-shaped RNA was altered to control ligand display on extracellular vesicle membranes for specific cell targeting, or to regulate intracellular trafficking of small interfering RNA (siRNA) or microRNA (miRNA). Placing membrane-anchoring cholesterol at the tail of the arrow results in display of RNA aptamer or folate on the outer surface of the extracellular vesicle. In contrast, placing the cholesterol at the arrowhead results in partial loading of RNA nanoparticles into the extracellular vesicles. Taking advantage of the RNA ligand for specific targeting and extracellular vesicles for efficient membrane fusion, the resulting ligand-displaying extracellular vesicles were capable of specific delivery of siRNA to cells, and efficiently blocked tumour growth in three cancer models. Extracellular vesicles displaying an aptamer that binds to prostate-specific membrane antigen, and loaded with survivin siRNA, inhibited prostate cancer xenograft. The same extracellular vesicle instead displaying epidermal growth-factor receptor aptamer inhibited orthotopic breast cancer models. Likewise, survivin siRNA-loaded and folate-displaying extracellular vesicles inhibited patient-derived colorectal cancer xenograft.
Alternative Affinity Ligands for Immunoglobulins.
Kruljec, Nika; Bratkovič, Tomaž
2017-08-16
The demand for recombinant therapeutic antibodies and Fc-fusion proteins is expected to increase in the years to come. Hence, extensive efforts are concentrated on improving the downstream processing. In particular, the development of better-affinity chromatography matrices, supporting robust time- and cost-effective antibody purification, is warranted. With the advances in molecular design and high-throughput screening approaches from chemical and biological combinatorial libraries, novel affinity ligands representing alternatives to bacterial immunoglobulin (Ig)-binding proteins have entered the scene. Here, we review the design, development, and properties of diverse classes of alternative antibody-binding ligands, ranging from engineered versions of Ig-binding proteins, to artificial binding proteins, peptides, aptamers, and synthetic small-molecular-weight compounds. We also provide examples of applications for the novel affinity matrices in chromatography and beyond.
[Mechanisms of action of voltage-gated sodium channel ligands].
Tikhonov, D B
2007-05-01
The voltage-gated sodium channels play a key role in the generation of action potential in excitable cells. Sodium channels are targeted by a number of modulating ligands. Despite numerous studies, the mechanisms of action of many ligands are still unknown. The main cause of the problem is the absence of the channel structure. Sodium channels belong to the superfamily of P-loop channels that also the data abowt includes potassium and calcium channels and the channels of ionotropic glutamate receptors. Crystallization of several potassium channels has opened a possibility to analyze the structure of other members of the superfamily using the homology modeling approach. The present study summarizes the results of several recent modelling studies of such sodium channel ligands as tetrodotoxin, batrachotoxin and local anesthetics. Comparison of available experimental data with X-ray structures of potassium channels has provided a new level of understanding of the mechanisms of action of sodium channel ligands and has allowed proposing several testable hypotheses.
NASA Astrophysics Data System (ADS)
Li, Jin-Feng; Sun, Yin-Yin; Bai, Hongcun; Li, Miao-Miao; Li, Jian-Li; Yin, Bing
2015-06-01
The superhalogen properties of polynuclear structures without halogen ligand are theoretically explored here for several [M2(CN)5]-1 (M = Ca, Be) clusters. At CCSD(T) level, these clusters have been confirmed to be superhalogens due to their high vertical electron detachment energies (VDE). The largest one is 9.70 eV for [Ca2(CN)5]-1 which is even higher than those of corresponding traditional structures based on fluorine or chlorine ligands. Therefore the superhalogens stronger than the traditional halogen-based structures could be realized by ligands other than halogen atoms. Compared with CCSD(T), outer valence Green's function (OVGF) method either overestimates or underestimates the VDEs for different structures while MP2 results are generally consistent in the aspect of relative values. The extra electrons of the highest VDE anions here aggregate on the bridging CN units with non-negligible distribution occurring on other CN units too. These two features lower both the potential and kinetic energies of the extra electron respectively and thus lead to high VDE. Besides superhalogen properties, the structures, relative stabilities and thermodynamic stabilities with respect to the detachment of cyanide ligand were also investigated. The sum of these results identifies the potential of polynuclear structures with pseudohalogen ligand as suitable candidates with enhanced superhalogens properties.
Molecular Determinants of Epidermal Growth Factor Binding: A Molecular Dynamics Study
Sanders, Jeffrey M.; Wampole, Matthew E.; Thakur, Mathew L.; Wickstrom, Eric
2013-01-01
The epidermal growth factor receptor (EGFR) is a member of the receptor tyrosine kinase family that plays a role in multiple cellular processes. Activation of EGFR requires binding of a ligand on the extracellular domain to promote conformational changes leading to dimerization and transphosphorylation of intracellular kinase domains. Seven ligands are known to bind EGFR with affinities ranging from sub-nanomolar to near micromolar dissociation constants. In the case of EGFR, distinct conformational states assumed upon binding a ligand is thought to be a determining factor in activation of a downstream signaling network. Previous biochemical studies suggest the existence of both low affinity and high affinity EGFR ligands. While these studies have identified functional effects of ligand binding, high-resolution structural data are lacking. To gain a better understanding of the molecular basis of EGFR binding affinities, we docked each EGFR ligand to the putative active state extracellular domain dimer and 25.0 ns molecular dynamics simulations were performed. MM-PBSA/GBSA are efficient computational approaches to approximate free energies of protein-protein interactions and decompose the free energy at the amino acid level. We applied these methods to the last 6.0 ns of each ligand-receptor simulation. MM-PBSA calculations were able to successfully rank all seven of the EGFR ligands based on the two affinity classes: EGF>HB-EGF>TGF-α>BTC>EPR>EPG>AR. Results from energy decomposition identified several interactions that are common among binding ligands. These findings reveal that while several residues are conserved among the EGFR ligand family, no single set of residues determines the affinity class. Instead we found heterogeneous sets of interactions that were driven primarily by electrostatic and Van der Waals forces. These results not only illustrate the complexity of EGFR dynamics but also pave the way for structure-based design of therapeutics targeting EGF
Nanoparticle Superlattices: The Roles of Soft Ligands
Si, Kae Jye; Chen, Yi; Shi, Qianqian
2017-01-01
Abstract Nanoparticle superlattices are periodic arrays of nanoscale inorganic building blocks including metal nanoparticles, quantum dots and magnetic nanoparticles. Such assemblies can exhibit exciting new collective properties different from those of individual nanoparticle or corresponding bulk materials. However, fabrication of nanoparticle superlattices is nontrivial because nanoparticles are notoriously difficult to manipulate due to complex nanoscale forces among them. An effective way to manipulate these nanoscale forces is to use soft ligands, which can prevent nanoparticles from disordered aggregation, fine‐tune the interparticle potential as well as program lattice structures and interparticle distances – the two key parameters governing superlattice properties. This article aims to review the up‐to‐date advances of superlattices from the viewpoint of soft ligands. We first describe the theories and design principles of soft‐ligand‐based approach and then thoroughly cover experimental techniques developed from soft ligands such as molecules, polymer and DNA. Finally, we discuss the remaining challenges and future perspectives in nanoparticle superlattices. PMID:29375958
Analysis of ligand-receptor cross-linked fragments by mass spectrometry
DOE Office of Scientific and Technical Information (OSTI.GOV)
Son, C.D.; Sargsyan, H.; Hurst, Gregory
G-protein coupled receptors (GPCRs) are a class of integral membrane receptor proteins that are characterized by a signature seven-transmembrane (7-TM) configuration. The a-factor receptor (Ste2p) from Saccharomyces cerevisiae is a GPCR that, upon binding of a peptide ligand, transduces a signal to initiate a cascade of events leading to the mating of haploid yeast cells. This study summarizes the application of affinity purification and of matrix-assisted laser-desorption ionization time-of-flight (MALDI-TOF) experiments using biotinylated photoactivatable a-factor analogs. Affinity purification and enrichment of biotinylated peptides by monomeric avidin beads resulted in mass spectrometric detection of specific signals corresponding to crosslinked fragments ofmore » Ste2p. Data obtained from cyanogen bromide (CNBr) fragments of receptor cross-linked to an a-factor analog with the photoaffinity group p-benzoyl-L-phenylalanine on position 1 were in agreement with the previous results reported by our laboratory suggesting the cross-linking between position 1 of a-factor and a region of Ste2p covering residues 251 294.« less
mRAISE: an alternative algorithmic approach to ligand-based virtual screening
NASA Astrophysics Data System (ADS)
von Behren, Mathias M.; Bietz, Stefan; Nittinger, Eva; Rarey, Matthias
2016-08-01
Ligand-based virtual screening is a well established method to find new lead molecules in todays drug discovery process. In order to be applicable in day to day practice, such methods have to face multiple challenges. The most important part is the reliability of the results, which can be shown and compared in retrospective studies. Furthermore, in the case of 3D methods, they need to provide biologically relevant molecular alignments of the ligands, that can be further investigated by a medicinal chemist. Last but not least, they have to be able to screen large databases in reasonable time. Many algorithms for ligand-based virtual screening have been proposed in the past, most of them based on pairwise comparisons. Here, a new method is introduced called mRAISE. Based on structural alignments, it uses a descriptor-based bitmap search engine (RAISE) to achieve efficiency. Alignments created on the fly by the search engine get evaluated with an independent shape-based scoring function also used for ranking of compounds. The correct ranking as well as the alignment quality of the method are evaluated and compared to other state of the art methods. On the commonly used Directory of Useful Decoys dataset mRAISE achieves an average area under the ROC curve of 0.76, an average enrichment factor at 1 % of 20.2 and an average hit rate at 1 % of 55.5. With these results, mRAISE is always among the top performing methods with available data for comparison. To access the quality of the alignments calculated by ligand-based virtual screening methods, we introduce a new dataset containing 180 prealigned ligands for 11 diverse targets. Within the top ten ranked conformations, the alignment closest to X-ray structure calculated with mRAISE has a root-mean-square deviation of less than 2.0 Å for 80.8 % of alignment pairs and achieves a median of less than 2.0 Å for eight of the 11 cases. The dataset used to rate the quality of the calculated alignments is freely available at
Urate is a ligand for the transcriptional regulator PecS.
Perera, Inoka C; Grove, Anne
2010-09-24
PecS is a member of the MarR (multiple antibiotic resistance regulator) family, which has been shown in Erwinia to regulate the expression of virulence genes. MarR homologs typically bind a small molecule ligand, resulting in attenuated DNA binding. For PecS, the natural ligand has not been identified. We have previously shown that urate is a ligand for the Deinococcus radiodurans-encoded MarR homolog HucR (hypothetical uricase regulator) and identified residues responsible for ligand binding. We show here that all four residues involved in urate binding and propagation of conformational changes to DNA recognition helices are conserved in PecS homologs, suggesting that urate is the ligand for PecS. Consistent with this prediction, Agrobacterium tumefaciens PecS specifically binds urate, and urate attenuates DNA binding in vitro. PecS binds two operator sites in the intergenic region between the divergent pecS gene and pecM genes, one of which features two partially overlapping repeats to which PecS binds as a dimer on opposite faces of the duplex. Notably, urate dissociates PecS from cognate DNA, allowing transcription of both genes in vivo. Taken together, our data show that urate is a ligand for PecS and suggest that urate serves a novel function in signaling the colonization of a host plant. Copyright © 2010 Elsevier Ltd. All rights reserved.
Regulation of expression of the ligand for CD40 on T helper lymphocytes.
Castle, B E; Kishimoto, K; Stearns, C; Brown, M L; Kehry, M R
1993-08-15
Activated Th cells deliver contact-dependent signals to resting B lymphocytes that initiate and drive B cell proliferation. Recently, a ligand for the B lymphocyte membrane protein, CD40, has been identified that delivers contact-dependent Th cell signals to B cells. A dimeric soluble form of CD40 was produced and used to further characterize the regulation of expression of the CD40 ligand. Expression of the CD40 ligand was rapidly induced after Th lymphocyte activation, and its stability depended upon whether Th cells were activated with soluble or plastic-bound stimuli. Th cells activated with soluble stimuli rapidly turned over cell-surface CD40 ligand whereas Th cells activated with plastic-bound stimuli exhibited more stable CD40 ligand expression for up to 48 h. Removal of activated Th cells from the plastic-bound stimulus resulted in a rapid turnover of CD40 ligand, suggesting that continuous stimulation could maintain CD40 ligand expression. Ligation by soluble CD40 could also stabilize expression of CD40 ligand on the Th cell surface. Both CD40 ligand and IL-2 were transiently synthesized from 1 to 12 h after Th cell activation and had similar kinetics of synthesis. In Con A-activated Th cells newly synthesized CD40 ligand exhibited an initial high turnover (1.5 h t1/2) and after 5 h of Th cell activation became more stable (10-h t1/2). In Th cells activated with plastic-bound anti-CD3, CD40 ligand exhibited a similar biphasic turnover except that the rapid turnover phase began significantly later. This delay could allow more time for newly synthesized CD40 ligand to assemble or associate with other molecules and thus become stabilized on the cell surface. Newly synthesized CD40 ligand in Con A-activated Th cells appeared to not be efficient in delivering Th cell-dependent contact signals to resting B cells, implying the need for assembly or accessory proteins. Regulation of CD40 ligand expression was consistent with all the characteristics of Th cell
Rühmann, Eggert H; Rupp, Melinda; Betz, Michael; Heine, Andreas; Klebe, Gerhard
2016-02-04
Structural preorganization to fix bioactive conformations at protein binding sites is a popular strategy to enhance binding affinity during late-stage optimization. The rationale for this enhancement relates to entropic advantages assigned to rigidified versus flexible ligands. We analyzed a narrow series of peptidomimetics binding to thrombin. The individual ligands exhibit at P2 a conformationally flexible glycine, more restricted alanine, N-methylglycine, N-methylhomoalanine, and largely rigidified proline moiety. Overall, affinity was found to increase by a factor of 1000, explained partly by an entropic advantage. All ligands adopt the same binding mode with small deviations. The residual mobility of the bound ligands is decreased across the series, and a protein side chain differs in its order/disorder behavior along with changes in the surface-water network pattern established across the newly generated protein-ligand surfaces. The enthalpy/entropy inventory displays a rather complex picture and emphasizes that thermodynamics can only be compared in terms of relative differences within a structurally similar ligand series. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Phosphorus-supported ligands for the assembly of multimetal architectures.
Chandrasekhar, Vadapalli; Murugesapandian, Balasubramanian
2009-08-18
Modeled after boron-based scorpionate ligands, acyclic and cyclic phosphorus-containing compounds possessing reactive groups can serve as excellent precursors for the assembly of novel phosphorus-supported ligands that can coordinate multiple sites. In such ligands, the phosphorus atom does not have any role in coordination but is used as a structural support to assemble one or more coordination platforms. In this Account, we describe the utility of inorganic heterocyclic rings such as cyclophosphazenes and carbophosphazenes as well as acyclic phosphorus-containing compounds such as (S)PCl(3), RP(O)Cl(2), and R(2)P(O)Cl for building such multisite coordination platforms. We can modulate the number and orientation of such coordination platforms through the choice of the phosphorus-containing precursor. This methodology is quite general and modular and allows the creation of well-defined libraries of multisite coordination ligands. Phosphorus-supported pyrazolyl ligands are quite useful for building multimetallic architectures. Some of these ligands are prone to P-N bond hydrolysis upon metalation, but we have exploited the P-N bond sensitivity to generate hydrolyzed ligands in situ, which are useful to build multimetal assemblies. In addition, the intimate relationship between small molecule cyclophosphazenes and the corresponding pendant cyclophosphazene-containing polymer systems facilitated our design of polymer-supported catalysts for phosphate ester hydrolysis, plasmid DNA modification, and C-C bond formation reactions. Phosphorus hydrazides containing reactive amine groups are ideal precursors for integration into more complex ligand systems. The ligand (S)P[N(Me)N=CH-C(6)H(4)-2-OH](3) (LH(3)) contains six coordination sites, and its coordination response depends upon the oxidation state of the metal ion employed. LH(3) reacts with divalent transition metal ions to afford neutral trimetallic derivatives L(2)M(3), where the three metal ions are arranged in a
Sawaguchi, Shogo; Varshney, Shweta; Ogawa, Mitsutaka; Sakaidani, Yuta; Yagi, Hirokazu; Takeshita, Kyosuke; Murohara, Toyoaki; Kato, Koichi; Sundaram, Subha; Stanley, Pamela; Okajima, Tetsuya
2017-04-11
The glycosyltransferase EOGT transfers O-GlcNAc to a consensus site in epidermal growth factor-like (EGF) repeats of a limited number of secreted and membrane proteins, including Notch receptors. In EOGT-deficient cells, the binding of DLL1 and DLL4, but not JAG1, canonical Notch ligands was reduced, and ligand-induced Notch signaling was impaired. Mutagenesis of O-GlcNAc sites on NOTCH1 also resulted in decreased binding of DLL4. EOGT functions were investigated in retinal angiogenesis that depends on Notch signaling. Global or endothelial cell-specific deletion of Eogt resulted in defective retinal angiogenesis, with a mild phenotype similar to that caused by reduced Notch signaling in retina. Combined deficiency of different Notch1 mutant alleles exacerbated the abnormalities in Eogt -/- retina, and Notch target gene expression was decreased in Eogt -/- endothelial cells. Thus, O-GlcNAc on EGF repeats of Notch receptors mediates ligand-induced Notch signaling required in endothelial cells for optimal vascular development.
Structural and Electrochemical Consequences of [Cp*] Ligand Protonation.
Peng, Yun; Ramos-Garcés, Mario V; Lionetti, Davide; Blakemore, James D
2017-09-05
There are few examples of the isolation of analogous metal complexes bearing [η 5 -Cp*] and [η 4 -Cp*H] (Cp* = pentamethylcyclopentadienyl) complexes within the same metal/ligand framework, despite the relevance of such structures to catalytic applications. Recently, protonation of Cp*Rh(bpy) (bpy = 2,2'-bipyridyl) has been shown to yield a complex bearing the uncommon [η 4 -Cp*H] ligand, rather than generating a [Rh III -H] complex. We now report the purification and isolation of this protonated species, as well as characterization of analogous complexes of 1,10-phenanthroline (phen). Specifically, reaction of Cp*Rh(bpy) or Cp*Rh(phen) with 1 equiv of Et 3 NH + Br - affords rhodium compounds bearing endo-η 4 -pentamethylcyclopentadiene (η 4 -Cp*H) as a ligand. NMR spectroscopy and single-crystal X-ray diffraction studies confirm protonation of the Cp* ligand, rather than formation of metal hydride complexes. Analysis of new structural data and electronic spectra suggests that phen is significantly reduced in Cp*Rh(phen), similar to the case of Cp*Rh(bpy). Backbonding interactions with olefinic motifs are activated by formation of [η 4 -Cp*H]; protonation of [Cp*] stabilizes the low-valent metal center and results in loss of reduced character on the diimine ligands. In accord with these changes in electronic structure, electrochemical studies reveal a distinct manifold of redox processes that are accessible in the [Cp*H] complexes in comparison with their [Cp*] analogues; these processes suggest new applications in catalysis for the complexes bearing endo-η 4 -Cp*H.
Nag, Angshuman; Kovalenko, Maksym V; Lee, Jong-Soo; Liu, Wenyong; Spokoyny, Boris; Talapin, Dmitri V
2011-07-13
All-inorganic colloidal nanocrystals were synthesized by replacing organic capping ligands on chemically synthesized nanocrystals with metal-free inorganic ions such as S(2-), HS(-), Se(2-), HSe(-), Te(2-), HTe(-), TeS(3)(2-), OH(-) and NH(2)(-). These simple ligands adhered to the NC surface and provided colloidal stability in polar solvents. The versatility of such ligand exchange has been demonstrated for various semiconductor and metal nanocrystals of different size and shape. We showed that the key aspects of Pearson's hard and soft acids and bases (HSAB) principle, originally developed for metal coordination compounds, can be applied to the bonding of molecular species to the nanocrystal surface. The use of small inorganic ligands instead of traditional ligands with long hydrocarbon tails facilitated the charge transport between individual nanocrystals and opened up interesting opportunities for device integration of colloidal nanostructures.
Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Maturana, Andrés D; Kuroda, Shun'ichi
2016-06-01
Mammalian receptors are recognized as target molecules for drug discovery, and chemical libraries have been screened for both potential antagonists and agonists mainly by ligand-binding assays using immobilized receptors. A bio-nanocapsule (BNC) of approximately 30 nm that displays a tandem form of the protein A-derived immunoglobulin G (IgG) Fc-binding Z domains (denoted as ZZ-BNC) has been developed for both clustering and oriented immobilization of IgGs on the solid phase of immunosensors. In this study, human IgG1 Fc-fused vascular endothelial growth factor (VEGF) receptor was immobilized through ZZ-BNC on the sensor chip of quartz crystal microbalance (ZZ-BNC-coating). When compared with direct adsorption and protein A-coating, the sensor chip showed higher sensitivity (∽46- and ∽165-fold, respectively) and larger ligand-binding capacity (∽4- and ∽18-fold, respectively). Furthermore, the number of VEGF molecules bound to its receptor increased from 0.20 (direct adsorption) to 2.06 by ZZ-BNC-coating, strongly suggesting that ZZ-BNC reduced the steric hindrance near ligand recognition sites through oriented immobilization. Similarly, the sensitivity and ligand-binding capacity of leptin and prolactin receptors were both enhanced at a level comparable to that observed for the VEGF receptor. Thus, the combination of ZZ-BNC and Fc-fused receptors could significantly improve the function of ligand-binding assays. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Expression of osteoprotegerin and its ligands, RANKL and TRAIL, in rheumatoid arthritis
Remuzgo-Martínez, Sara; Genre, Fernanda; López-Mejías, Raquel; Ubilla, Begoña; Mijares, Verónica; Pina, Trinitario; Corrales, Alfonso; Blanco, Ricardo; Martín, Javier; Llorca, Javier; González-Gay, Miguel A.
2016-01-01
Osteoprotegerin (OPG), receptor activator of nuclear factor-ΚB ligand (RANKL) and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) have been involved in rheumatoid arthritis (RA) pathophysiology. In this study, we assessed messenger RNA (mRNA) expression of these molecules by qPCR in peripheral blood from 26 patients with RA (12 of them with ischemic heart disease –IHD) and 10 healthy controls. Correlation coefficients between OPG, RANKL and TRAIL expression levels in RA patients and their clinical and demographic characteristics were also evaluated. Whereas OPG and OPG/TRAIL ratio expression were significantly increased in RA patients compared to controls (fold change = 1.79, p = 0.013 and 2.07, p = 0.030, respectively), RANKL/OPG ratio was significantly decreased (fold change = 0.50, p = 0.020). No significant differences were found between patients and controls in RANKL and TRAIL expression. Interestingly, TRAIL expression was significantly higher in RA patients with IHD compared to those without IHD (fold change = 1.46, p = 0.033). Moreover, biologic disease-modifying antirheumatic drugs (DMARDs) significantly decreased RANKL expression in RA patients (p = 0.016). Our study supports an important role of OPG and TRAIL in RA. Furthermore, it highlights an effect of biologic DMARDs in the modulation of RANKL. PMID:27403809
istar: a web platform for large-scale protein-ligand docking.
Li, Hongjian; Leung, Kwong-Sak; Ballester, Pedro J; Wong, Man-Hon
2014-01-01
Protein-ligand docking is a key computational method in the design of starting points for the drug discovery process. We are motivated by the desire to automate large-scale docking using our popular docking engine idock and thus have developed a publicly-accessible web platform called istar. Without tedious software installation, users can submit jobs using our website. Our istar website supports 1) filtering ligands by desired molecular properties and previewing the number of ligands to dock, 2) monitoring job progress in real time, and 3) visualizing ligand conformations and outputting free energy and ligand efficiency predicted by idock, binding affinity predicted by RF-Score, putative hydrogen bonds, and supplier information for easy purchase, three useful features commonly lacked on other online docking platforms like DOCK Blaster or iScreen. We have collected 17,224,424 ligands from the All Clean subset of the ZINC database, and revamped our docking engine idock to version 2.0, further improving docking speed and accuracy, and integrating RF-Score as an alternative rescoring function. To compare idock 2.0 with the state-of-the-art AutoDock Vina 1.1.2, we have carried out a rescoring benchmark and a redocking benchmark on the 2,897 and 343 protein-ligand complexes of PDBbind v2012 refined set and CSAR NRC HiQ Set 24Sept2010 respectively, and an execution time benchmark on 12 diverse proteins and 3,000 ligands of different molecular weight. Results show that, under various scenarios, idock achieves comparable success rates while outperforming AutoDock Vina in terms of docking speed by at least 8.69 times and at most 37.51 times. When evaluated on the PDBbind v2012 core set, our istar platform combining with RF-Score manages to reproduce Pearson's correlation coefficient and Spearman's correlation coefficient of as high as 0.855 and 0.859 respectively between the experimental binding affinity and the predicted binding affinity of the docked conformation. istar
Technetium radiodiagnostic fatty acids derived from bisamide bisthiol ligands
Jones, Alun G.; Lister-James, John; Davison, Alan
1988-05-24
A bisamide-bisthiol ligand containing fatty acid substituted thiol useful for producing Tc-labelled radiodiagnostic imaging agents is described. The ligand forms a complex with the radionuclide .sup.99m Tc suitable for administration as a radiopharmaceutical to obtain images of the heart for diagnosis of myocardial disfunction.
AFAL: a web service for profiling amino acids surrounding ligands in proteins
NASA Astrophysics Data System (ADS)
Arenas-Salinas, Mauricio; Ortega-Salazar, Samuel; Gonzales-Nilo, Fernando; Pohl, Ehmke; Holmes, David S.; Quatrini, Raquel
2014-11-01
With advancements in crystallographic technology and the increasing wealth of information populating structural databases, there is an increasing need for prediction tools based on spatial information that will support the characterization of proteins and protein-ligand interactions. Herein, a new web service is presented termed amino acid frequency around ligand (AFAL) for determining amino acids type and frequencies surrounding ligands within proteins deposited in the Protein Data Bank and for assessing the atoms and atom-ligand distances involved in each interaction (availability: http://structuralbio.utalca.cl/AFAL/index.html). AFAL allows the user to define a wide variety of filtering criteria (protein family, source organism, resolution, sequence redundancy and distance) in order to uncover trends and evolutionary differences in amino acid preferences that define interactions with particular ligands. Results obtained from AFAL provide valuable statistical information about amino acids that may be responsible for establishing particular ligand-protein interactions. The analysis will enable investigators to compare ligand-binding sites of different proteins and to uncover general as well as specific interaction patterns from existing data. Such patterns can be used subsequently to predict ligand binding in proteins that currently have no structural information and to refine the interpretation of existing protein models. The application of AFAL is illustrated by the analysis of proteins interacting with adenosine-5'-triphosphate.
AFAL: a web service for profiling amino acids surrounding ligands in proteins.
Arenas-Salinas, Mauricio; Ortega-Salazar, Samuel; Gonzales-Nilo, Fernando; Pohl, Ehmke; Holmes, David S; Quatrini, Raquel
2014-11-01
With advancements in crystallographic technology and the increasing wealth of information populating structural databases, there is an increasing need for prediction tools based on spatial information that will support the characterization of proteins and protein-ligand interactions. Herein, a new web service is presented termed amino acid frequency around ligand (AFAL) for determining amino acids type and frequencies surrounding ligands within proteins deposited in the Protein Data Bank and for assessing the atoms and atom-ligand distances involved in each interaction (availability: http://structuralbio.utalca.cl/AFAL/index.html ). AFAL allows the user to define a wide variety of filtering criteria (protein family, source organism, resolution, sequence redundancy and distance) in order to uncover trends and evolutionary differences in amino acid preferences that define interactions with particular ligands. Results obtained from AFAL provide valuable statistical information about amino acids that may be responsible for establishing particular ligand-protein interactions. The analysis will enable investigators to compare ligand-binding sites of different proteins and to uncover general as well as specific interaction patterns from existing data. Such patterns can be used subsequently to predict ligand binding in proteins that currently have no structural information and to refine the interpretation of existing protein models. The application of AFAL is illustrated by the analysis of proteins interacting with adenosine-5'-triphosphate.
Turner, Katherine A; Manouchehri, Jasmine M; Kalafatis, Michael
2018-03-28
Malignant melanoma is the most commonly diagnosed skin cancer associated with a high rate of metastasis. Low-stage melanoma is easily treated, but metastatic malignant melanoma is an extremely treatment-resistant malignancy with low survival rates. The application of recombinant human tumor necrosis factor-related apoptosis-inducing ligand (rhTRAIL) for the treatment of metastatic malignant melanoma holds considerable promise because of its selective proapoptotic activity towards cancer cells and not nontransformed cells. Unfortunately, the clinical utilization of rhTRAIL has been terminated due to the resistance of many cancer cells to undergo apoptosis in response to rhTRAIL. However, rhTRAIL-resistance can be abrogated through the cotreatment with compounds derived from 'Mother Nature' such as quercetin that can modulate cellular components responsible for rhTRAIL-resistance. Here, we show that rhTRAIL-resistant malignant melanomas are sensitized by quercetin. Quercetin action is manifested by the upregulation of rhTRAIL-binding receptors DR4 and DR5 on the surface of cancer cells and by increased rate of the proteasome-mediated degradation of the antiapoptotic protein FLIP. Our data provide for a new efficient and nontoxic treatment of malignant melanoma.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal. http://creativecommons.org/licenses/by-nc-nd/4.0/.
Rahaman, Obaidur; Estrada, Trilce P.; Doren, Douglas J.; Taufer, Michela; Brooks, Charles L.; Armen, Roger S.
2011-01-01
The performance of several two-step scoring approaches for molecular docking were assessed for their ability to predict binding geometries and free energies. Two new scoring functions designed for “step 2 discrimination” were proposed and compared to our CHARMM implementation of the linear interaction energy (LIE) approach using the Generalized-Born with Molecular Volume (GBMV) implicit solvation model. A scoring function S1 was proposed by considering only “interacting” ligand atoms as the “effective size” of the ligand, and extended to an empirical regression-based pair potential S2. The S1 and S2 scoring schemes were trained and five-fold cross validated on a diverse set of 259 protein-ligand complexes from the Ligand Protein Database (LPDB). The regression-based parameters for S1 and S2 also demonstrated reasonable transferability in the CSARdock 2010 benchmark using a new dataset (NRC HiQ) of diverse protein-ligand complexes. The ability of the scoring functions to accurately predict ligand geometry was evaluated by calculating the discriminative power (DP) of the scoring functions to identify native poses. The parameters for the LIE scoring function with the optimal discriminative power (DP) for geometry (step 1 discrimination) were found to be very similar to the best-fit parameters for binding free energy over a large number of protein-ligand complexes (step 2 discrimination). Reasonable performance of the scoring functions in enrichment of active compounds in four different protein target classes established that the parameters for S1 and S2 provided reasonable accuracy and transferability. Additional analysis was performed to definitively separate scoring function performance from molecular weight effects. This analysis included the prediction of ligand binding efficiencies for a subset of the CSARdock NRC HiQ dataset where the number of ligand heavy atoms ranged from 17 to 35. This range of ligand heavy atoms is where improved accuracy of
Rahaman, Obaidur; Estrada, Trilce P; Doren, Douglas J; Taufer, Michela; Brooks, Charles L; Armen, Roger S
2011-09-26
The performances of several two-step scoring approaches for molecular docking were assessed for their ability to predict binding geometries and free energies. Two new scoring functions designed for "step 2 discrimination" were proposed and compared to our CHARMM implementation of the linear interaction energy (LIE) approach using the Generalized-Born with Molecular Volume (GBMV) implicit solvation model. A scoring function S1 was proposed by considering only "interacting" ligand atoms as the "effective size" of the ligand and extended to an empirical regression-based pair potential S2. The S1 and S2 scoring schemes were trained and 5-fold cross-validated on a diverse set of 259 protein-ligand complexes from the Ligand Protein Database (LPDB). The regression-based parameters for S1 and S2 also demonstrated reasonable transferability in the CSARdock 2010 benchmark using a new data set (NRC HiQ) of diverse protein-ligand complexes. The ability of the scoring functions to accurately predict ligand geometry was evaluated by calculating the discriminative power (DP) of the scoring functions to identify native poses. The parameters for the LIE scoring function with the optimal discriminative power (DP) for geometry (step 1 discrimination) were found to be very similar to the best-fit parameters for binding free energy over a large number of protein-ligand complexes (step 2 discrimination). Reasonable performance of the scoring functions in enrichment of active compounds in four different protein target classes established that the parameters for S1 and S2 provided reasonable accuracy and transferability. Additional analysis was performed to definitively separate scoring function performance from molecular weight effects. This analysis included the prediction of ligand binding efficiencies for a subset of the CSARdock NRC HiQ data set where the number of ligand heavy atoms ranged from 17 to 35. This range of ligand heavy atoms is where improved accuracy of predicted ligand
Outcome of the First wwPDB/CCDC/D3R Ligand Validation Workshop
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adams, Paul D.; Aertgeerts, Kathleen; Bauer, Cary
Crystallographic studies of ligands bound to biological macromolecules (proteins and nucleic acids) represent an important source of information concerning drug-target interactions, providing atomic level insights into the physical chemistry of complex formation between macromolecules and ligands. Of the more than 115,000 entries extant in the Protein Data Bank archive, ~75% include at least one non-polymeric ligand. Ligand geometrical and stereochemical quality, the suitability of ligand models for in silico drug discovery/design, and the goodness-of-fit of ligand models to electron density maps vary widely across the archive. We describe the proceedings and conclusions from the first Worldwide Protein Data Bank/Cambridge Crystallographicmore » Data Centre/Drug Design Data Resource (wwPDB/CCDC/D3R) Ligand Validation Workshop held at the Research Collaboratory for Structural Bioinformatics at Rutgers University on July 30-31, 2015. Experts in protein crystallography from academe and industry came together with non-profit and for-profit software providers for crystallography and with experts in computational chemistry and data archiving to discuss and make recommendations on best practices, as framed by a series of questions central to structural studies of macromolecule-ligand complexes. What data concerning bound ligands should be archived in the Protein Data Bank? How should the ligands be best represented? How should structural models of macromolecule-ligand complexes be validated? What supplementary information should accompany publications of structural studies of biological macromolecules? Consensus recommendations on best practices developed in response to each of these questions are provided, together with some details regarding implementation. Important issues addressed but not resolved at the workshop are also enumerated.« less
Outcome of the First wwPDB/CCDC/D3R Ligand Validation Workshop
Adams, Paul D.; Aertgeerts, Kathleen; Bauer, Cary; ...
2016-04-05
Crystallographic studies of ligands bound to biological macromolecules (proteins and nucleic acids) represent an important source of information concerning drug-target interactions, providing atomic level insights into the physical chemistry of complex formation between macromolecules and ligands. Of the more than 115,000 entries extant in the Protein Data Bank archive, ~75% include at least one non-polymeric ligand. Ligand geometrical and stereochemical quality, the suitability of ligand models for in silico drug discovery/design, and the goodness-of-fit of ligand models to electron density maps vary widely across the archive. We describe the proceedings and conclusions from the first Worldwide Protein Data Bank/Cambridge Crystallographicmore » Data Centre/Drug Design Data Resource (wwPDB/CCDC/D3R) Ligand Validation Workshop held at the Research Collaboratory for Structural Bioinformatics at Rutgers University on July 30-31, 2015. Experts in protein crystallography from academe and industry came together with non-profit and for-profit software providers for crystallography and with experts in computational chemistry and data archiving to discuss and make recommendations on best practices, as framed by a series of questions central to structural studies of macromolecule-ligand complexes. What data concerning bound ligands should be archived in the Protein Data Bank? How should the ligands be best represented? How should structural models of macromolecule-ligand complexes be validated? What supplementary information should accompany publications of structural studies of biological macromolecules? Consensus recommendations on best practices developed in response to each of these questions are provided, together with some details regarding implementation. Important issues addressed but not resolved at the workshop are also enumerated.« less
Outcome of the First wwPDB/CCDC/D3R Ligand Validation Workshop.
Adams, Paul D; Aertgeerts, Kathleen; Bauer, Cary; Bell, Jeffrey A; Berman, Helen M; Bhat, Talapady N; Blaney, Jeff M; Bolton, Evan; Bricogne, Gerard; Brown, David; Burley, Stephen K; Case, David A; Clark, Kirk L; Darden, Tom; Emsley, Paul; Feher, Victoria A; Feng, Zukang; Groom, Colin R; Harris, Seth F; Hendle, Jorg; Holder, Thomas; Joachimiak, Andrzej; Kleywegt, Gerard J; Krojer, Tobias; Marcotrigiano, Joseph; Mark, Alan E; Markley, John L; Miller, Matthew; Minor, Wladek; Montelione, Gaetano T; Murshudov, Garib; Nakagawa, Atsushi; Nakamura, Haruki; Nicholls, Anthony; Nicklaus, Marc; Nolte, Robert T; Padyana, Anil K; Peishoff, Catherine E; Pieniazek, Susan; Read, Randy J; Shao, Chenghua; Sheriff, Steven; Smart, Oliver; Soisson, Stephen; Spurlino, John; Stouch, Terry; Svobodova, Radka; Tempel, Wolfram; Terwilliger, Thomas C; Tronrud, Dale; Velankar, Sameer; Ward, Suzanna C; Warren, Gregory L; Westbrook, John D; Williams, Pamela; Yang, Huanwang; Young, Jasmine
2016-04-05
Crystallographic studies of ligands bound to biological macromolecules (proteins and nucleic acids) represent an important source of information concerning drug-target interactions, providing atomic level insights into the physical chemistry of complex formation between macromolecules and ligands. Of the more than 115,000 entries extant in the Protein Data Bank (PDB) archive, ∼75% include at least one non-polymeric ligand. Ligand geometrical and stereochemical quality, the suitability of ligand models for in silico drug discovery and design, and the goodness-of-fit of ligand models to electron-density maps vary widely across the archive. We describe the proceedings and conclusions from the first Worldwide PDB/Cambridge Crystallographic Data Center/Drug Design Data Resource (wwPDB/CCDC/D3R) Ligand Validation Workshop held at the Research Collaboratory for Structural Bioinformatics at Rutgers University on July 30-31, 2015. Experts in protein crystallography from academe and industry came together with non-profit and for-profit software providers for crystallography and with experts in computational chemistry and data archiving to discuss and make recommendations on best practices, as framed by a series of questions central to structural studies of macromolecule-ligand complexes. What data concerning bound ligands should be archived in the PDB? How should the ligands be best represented? How should structural models of macromolecule-ligand complexes be validated? What supplementary information should accompany publications of structural studies of biological macromolecules? Consensus recommendations on best practices developed in response to each of these questions are provided, together with some details regarding implementation. Important issues addressed but not resolved at the workshop are also enumerated. Copyright © 2016 Elsevier Ltd. All rights reserved.
Outcome of the first wwPDB/CCDC/D3R Ligand Validation Workshop
Adams, Paul D.; Aertgeerts, Kathleen; Bauer, Cary; Bell, Jeffrey A.; Berman, Helen M.; Bhat, Talapady N.; Blaney, Jeff; Bolton, Evan; Bricogne, Gerard; Brown, David; Burley, Stephen K.; Case, David A.; Clark, Kirk L.; Darden, Tom; Emsley, Paul; Feher, Victoria A.; Feng, Zukang; Groom, Colin R.; Harris, Seth F.; Hendle, Jorg; Holder, Thomas; Joachimiak, Andrzej; Kleywegt, Gerard J.; Krojer, Tobias; Marcotrigiano, Joseph; Mark, Alan E.; Markley, John L.; Miller, Matthew; Minor, Wladek; Montelione, Gaetano T.; Murshudov, Garib; Nakagawa, Atsushi; Nakamura, Haruki; Nicholls, Anthony; Nicklaus, Marc; Nolte, Robert T.; Padyana, Anil K.; Peishoff, Catherine E.; Pieniazek, Susan; Read, Randy J.; Shao, Chenghua; Sheriff, Steven; Smart, Oliver; Soisson, Stephen; Spurlino, John; Stouch, Terry; Svobodova, Radka; Tempel, Wolfram; Terwilliger, Thomas C.; Tronrud, Dale; Velankar, Sameer; Ward, Suzanna; Warren, Gregory L.; Westbrook, John D.; Williams, Pamela; Yang, Huanwang; Young, Jasmine
2016-01-01
Summary Crystallographic studies of ligands bound to biological macromolecules (proteins and nucleic acids) represent an important source of information concerning drug-target interactions, providing atomic level insights into the physical chemistry of complex formation between macromolecules and ligands. Of the more than 115,000 entries extant in the Protein Data Bank archive, ~75% include at least one non-polymeric ligand. Ligand geometrical and stereochemical quality, the suitability of ligand models for in silico drug discovery/design, and the goodness-of-fit of ligand models to electron density maps vary widely across the archive. We describe the proceedings and conclusions from the first Worldwide Protein Data Bank/Cambridge Crystallographic Data Centre/Drug Design Data Resource (wwPDB/CCDC/D3R) Ligand Validation Workshop held at the Research Collaboratory for Structural Bioinformatics at Rutgers University on July 30–31, 2015. Experts in protein crystallography from academe and industry came together with non-profit and for-profit software providers for crystallography and with experts in computational chemistry and data archiving to discuss and make recommendations on best practices, as framed by a series of questions central to structural studies of macromolecule-ligand complexes. What data concerning bound ligands should be archived in the Protein Data Bank? How should the ligands be best represented? How should structural models of macromolecule-ligand complexes be validated? What supplementary information should accompany publications of structural studies of biological macromolecules? Consensus recommendations on best practices developed in response to each of these questions are provided, together with some details regarding implementation. Important issues addressed but not resolved at the workshop are also enumerated. PMID:27050687