Science.gov

Sample records for factor nsf sorting

  1. The Neurexin/N-Ethylmaleimide-sensitive Factor (NSF) Interaction Regulates Short Term Synaptic Depression*♦

    PubMed Central

    Li, Tao; Tian, Yao; Li, Qian; Chen, Huiying; Lv, Huihui; Xie, Wei; Han, Junhai

    2015-01-01

    Although Neurexins, which are cell adhesion molecules localized predominantly to the presynaptic terminals, are known to regulate synapse formation and synaptic transmission, their roles in the regulation of synaptic vesicle release during repetitive nerve stimulation are unknown. Here, we show that nrx mutant synapses exhibit rapid short term synaptic depression upon tetanic nerve stimulation. Moreover, we demonstrate that the intracellular region of NRX is essential for synaptic vesicle release upon tetanic nerve stimulation. Using a yeast two-hybrid screen, we find that the intracellular region of NRX interacts with N-ethylmaleimide-sensitive factor (NSF), an enzyme that mediates soluble NSF attachment protein receptor (SNARE) complex disassembly and plays an important role in synaptic vesicle release. We further map the binding sites of each molecule and demonstrate that the NRX/NSF interaction is critical for both the distribution of NSF at the presynaptic terminals and SNARE complex disassembly. Our results reveal a previously unknown role of NRX in the regulation of short term synaptic depression upon tetanic nerve stimulation and provide new mechanistic insights into the role of NRX in synaptic vesicle release. PMID:25953899

  2. Tissue deposition of gadolinium and development of NSF: a convergence of factors.

    PubMed

    Perazella, Mark A

    2008-01-01

    Gadolinium-based contrast (GBC) exposure has recently been linked to the development of nephrogenic systemic fibrosis (NSF) in patients with underlying kidney disease and may in fact be the previously unrecognized trigger for the fibrosing process. As NSF is fairly rare in this patient population, a number of permissive factors are likely required for GBC exposure to initiate fibrosis. Advanced kidney disease is an absolute requirement whereas vascular injury and an inflammatory state, and a mix of co-factors including increased serum phosphate and calcium concentrations and iron overload further enhance risk. The combination of these events allows excess circulating gadolinium, which dissociates from its chelate to leak out of vessels and deposit in tissues. Free or bound tissue gadolinium, a rare earth metal of the lanthanoid series, promotes fibrosis via either direct binding to the collagen helix or, once the metal has been engulfed by macrophages, through the production of free oxygen radicals, cytokines, and other profibrotic factors that attract circulating fibrocytes to tissues. These fibrocytes then differentiate into fibroblast-like spindle cells that produce connective tissue matrix and other angiogenic and growth factors that further enhance tissue fibrosis. Direct gadolinium activation of transglutaminases on these tissue fibroblast-like cells may also promote fibrosis.

  3. Adolescent Sex Offenders' Rankings of Therapeutic Factors Using the Yalom Card Sort

    ERIC Educational Resources Information Center

    Sribney, Christine L.; Reddon, John R.

    2008-01-01

    Following 11-98 weeks of inpatient residential treatment, 69 male adolescent sex offenders completed the 60-item, 12-factor Yalom Card Sort. The rank orders were compared to adult sex offenders and a psychiatric adult outpatient group. Relative to adult psychiatric outpatients, the adolescent sex offenders had rated Instillation of Hope three…

  4. Regulation of neurotransmitter release kinetics by NSF.

    PubMed

    Schweizer, F E; Dresbach, T; DeBello, W M; O'Connor, V; Augustine, G J; Betz, H

    1998-02-20

    NSF (N-ethylmaleimide-sensitive factor) is an adenosine triphosphatase (ATPase) that contributes to a protein complex essential for membrane fusion. The synaptic function of this protein was investigated by injecting, into the giant presynaptic terminal of squid, peptides that inhibit the ATPase activity of NSF stimulated by the soluble NSF attachment protein (SNAP). These peptides reduced the amount and slowed the kinetics of neurotransmitter release as a result of actions that required vesicle turnover and occurred at a step subsequent to vesicle docking. These results define NSF as an essential participant in synaptic vesicle exocytosis that regulates the kinetics of neurotransmitter release and, thereby, the integrative properties of synapses.

  5. NSF graduate awards

    NASA Astrophysics Data System (ADS)

    Richman, Barbara T.

    Of the 450 college students offered fellowships by the National Science Foundation (NSF) this year for graduate study in 1983-1984 in the natural and social sciences, mathematics, and engineering, 40 plan to pursue graduate studies in earth, ocean, or space sciences. None of the 50 science students awarded NSF minority graduate fellowship awards plans to study in the geophysics-related sciences.Each fellowship, awarded for 3 years of graduate study, provides a stipend of $6,900 per year for full-time graduate study. An annual cost-of-education allowance of $4,000 is provided by NSF in lieu of all tuition and fees to the institution selected by each fellow for graduate study. The fellowships may be used over 5 years to permit students to incorporate teaching or research assistantships into their education during periods in which they are not receiving their fellowship stipends.

  6. NSF Graduate Fellowships

    NASA Astrophysics Data System (ADS)

    Richman, Barbara T.

    1984-04-01

    Of the 540 college students offered fellowships by the National Science Foundation (NSF) this year for graduate study in 1984-1985 in the natural and social sciences, mathematics, and engineering, 34 plan to pursue graduate studies in the earth, ocean, or space sciences. In addition, of the 60 NSF Minority Graduate Fellowships awarded this year, 2 were offered to students who plan graduate studies in the earth, ocean, and space sciences.Each fellowship, awarded for 3 years of graduate study, provides a stipend of $8,100 per year for full-time graduate study. An annual cost-of-education allowance of $4,900 is provided by NSF in lieu of all tuition and fees to the institution selected by each fellow for graduate study. The fellowships may be used over 5 years to permit students to incorporate teaching or research assistantships into their education during periods in which they are not receiving their fellowship stipends.

  7. Protected programs at NSF

    NASA Astrophysics Data System (ADS)

    Katzoff, Judith A.

    Many scientists and science administrators say they are disturbed by the fact that Congress “protected” funding for some National Science Foundation (NSF) programs in the fiscal year (FY) 1987 budget at a cost to other NSF programs. Especially disturbing to some was the notion that the earmarking reportedly occurred as a result of special interest lobbying efforts by their fellow scientists. The favored programs, and those that were cut back to compensate for them, were mostly related to geophysics. The protection of these programs is likely to have some impact on the size and number of grants awarded in some other areas.

  8. A biomechanical sorting of clinical risk factors affecting osteoporotic hip fracture.

    PubMed

    Luo, Y

    2016-02-01

    Osteoporotic fracture has been found associated with many clinical risk factors, and the associations have been explored dominantly by evidence-based and case-control approaches. The major challenges emerging from the studies are the large number of the risk factors, the difficulty in quantification, the incomplete list, and the interdependence of the risk factors. A biomechanical sorting of the risk factors may shed lights on resolving the above issues. Based on the definition of load-strength ratio (LSR), we first identified the four biomechanical variables determining fracture risk, i.e., the risk of fall, impact force, bone quality, and bone geometry. Then, we explored the links between the FRAX clinical risk factors and the biomechanical variables by looking for evidences in the literature. To accurately assess fracture risk, none of the four biomechanical variables can be ignored and their values must be subject-specific. A clinical risk factor contributes to osteoporotic fracture by affecting one or more of the biomechanical variables. A biomechanical variable represents the integral effect from all the clinical risk factors linked to the variable. The clinical risk factors in FRAX mostly stand for bone quality. The other three biomechanical variables are not adequately represented by the clinical risk factors. From the biomechanical viewpoint, most clinical risk factors are interdependent to each other as they affect the same biomechanical variable(s). As biomechanical variables must be expressed in numbers before their use in calculating LSR, the numerical value of a biomechanical variable can be used as a gauge of the linked clinical risk factors to measure their integral effect on fracture risk, which may be more efficient than to study each individual risk factor.

  9. NSF 1990 Plan

    NASA Astrophysics Data System (ADS)

    Jones, R.

    The National Science Foundation has released its Fiscal Year 1990 Current Plan, making expected cuts in some of the activities it supports. These cuts come on the heels of the reduction of grant and cooperative agreement increments by 2% from their originally committed amounts.NSF started with the budget request for FY 1990, subtracted the amounts cut by Congress, Gramm-Rudman-Hollings sequestration, and the across-the-board reductions for the war on drugs, and then calculated an overall funding increase of 8% over FY 1989. Funding for research and related activities was “particularly hard hit,” NSF said, and will increase by only 5%. The increase is 6% when the amount for academic research facilities is included. (That amount would have been lower had not money been reallocated into academic research facilities that was to have been used to build 10-12 new science and technology centers.)

  10. NSF announces diversity programme

    NASA Astrophysics Data System (ADS)

    Kruesi, Liz

    2016-04-01

    The US National Science Foundation (NSF) has initiated a new funding programme that will create schemes to increase diversity in science, technology, engineering and mathematics (STEM). The initiative - Inclusion across the Nation of Communities of Learners of Underrepresented Discoverers in Engineering and Science (INCLUDES) - aims to increase the participation of women, those with a low socioeconomic status, people with disabilities and those from minority racial backgrounds.

  11. UBE4B protein couples ubiquitination and sorting machineries to enable epidermal growth factor receptor (EGFR) degradation.

    PubMed

    Sirisaengtaksin, Natalie; Gireud, Monica; Yan, Qing; Kubota, Yoshihisa; Meza, Denisse; Waymire, Jack C; Zage, Peter E; Bean, Andrew J

    2014-01-31

    The signaling of plasma membrane proteins is tuned by internalization and sorting in the endocytic pathway prior to recycling or degradation in lysosomes. Ubiquitin modification allows recognition and association of cargo with endosomally associated protein complexes, enabling sorting of proteins to be degraded from those to be recycled. The mechanism that provides coordination between the cellular machineries that mediate ubiquitination and endosomal sorting is unknown. We report that the ubiquitin ligase UBE4B is recruited to endosomes in response to epidermal growth factor receptor (EGFR) activation by binding to Hrs, a key component of endosomal sorting complex required for transport (ESCRT) 0. We identify the EGFR as a substrate for UBE4B, establish UBE4B as a regulator of EGFR degradation, and describe a mechanism by which UBE4B regulates endosomal sorting, affecting cellular levels of the EGFR and its downstream signaling. We propose a model in which the coordinated action of UBE4B, ESCRT-0, and the deubiquitinating enzyme USP8 enable the endosomal sorting and lysosomal degradation of the EGFR.

  12. Benefits of NSF work

    NASA Astrophysics Data System (ADS)

    Packard, Ted

    This fall I will leave my rotatorship as Associate Director for Chemical Oceanography at the National Science Foundation. I have very much enjoyed my duty and want to outline for those who may become “rotators” some of the job's benefits, since NSF is now seeking applicants to replace me. Batiza, Rea and Rumble [Eos, 69, 801, 1988] have discussed the rotator's experience; my comments supplement their points.The most important benefit in working at NSF is the breadth of vision you acquire. This is important for researchers, because it pulls you away from your narrowly focused subfield and forces you to review again, as you did as a graduate student, your entire field. For teachers, this benefit is equally important, because you will keep up with current research even while away from teaching your up-to-date balanced courses. During my stay here I have reviewed proposals to study trace metals scavenging, gas exchange, sediment traps, biochemical cycling, stable and unstable isotopes, lipid biomarkers, sediment diagenesis, anoxic redox processes, and many other exciting topics. Some research areas, such as the vent and seep studies, had not been conceived when I was a graduate student in the sixties, so my experience here has been, in fact, a real sabbatical.

  13. New directions at NSF

    NASA Astrophysics Data System (ADS)

    Harvey, Albert B.

    1995-10-01

    The mission and scope of the National Science Foundation (NSF) and lightwave technology will be very briefly discussed. The focus of the presentation will be directed toward changes in research support that are taking place and the opportunities we have for aiming our research to meet the challenges and needs that face the nation. In the USA it is very clear that defense oriented research is downsizing and is being redirected into economy driven aresas, such as manufacturing, business, and industry. For those researchers who are willing to move into these areas and find a niche, the rewards may be very great. Industrial research partners should also seize these opportunities to enhance their resources in an otherwise bleak future for industrial support of basic research in lightwave technology and many other reserach disciplines. These activities of bringing together industry and academia will have the value added benefit of providing increased job opportunities for students. An outline of some of these opportunities and incentives will be presented. On the international front, there has never been a better time for the encouragement of joint research and collaboration across borders. The economic potential for involvement in Eastern Europe and Asia are enormous. Agencies like ourselves are open to help support of visiting scientist/engineer exchange, international conferences and forums and support of innovative ideas to help further enhance economic developemnt of the world and hence the quality of life. The presence of the Russian delegation here at these SPIE meetings in in part the result of NSF support. Concomitant with these changes is a growing interest in education. Academia is gradually realizing that education includes training for students to acquire jobs and hence we complete the cycle of the importance of interacting with industry. At the NSF a major new initiative is being introduced in Optical Science and Engineering (OSE). This effort has been

  14. Astrophysicist nominated to head NSF

    NASA Astrophysics Data System (ADS)

    Gwynne, Peter

    2013-09-01

    US president Barack Obama has nominated astrophysicist France Córdova as the next director of the National Science Foundation (NSF) - the country's biggest funder of basic research with an annual budget of 7bn.

  15. Structural Requirements for Function of Yeast GGAs in Vacuolar Protein Sorting, α-Factor Maturation, and Interactions with Clathrin

    PubMed Central

    Mullins, Chris; Bonifacino, Juan S.

    2001-01-01

    The GGAs (Golgi-localized, gamma-ear-containing, ARF-binding proteins) are a family of multidomain adaptor proteins involved in protein sorting at the trans-Golgi network of eukaryotic cells. Here we present results from a functional characterization of the two Saccharomyces cerevisiae GGAs, Gga1p and Gga2p. We show that deletion of both GGA genes causes defects in sorting of carboxypeptidase Y (CPY) and proteinase A to the vacuole, vacuolar morphology, and maturation of α-factor. A structure-function analysis reveals a requirement of the VHS, GAT, and hinge for function, while the GAE domain is less important. We identify putative clathrin-binding motifs in the hinge domain of both yeast GGAs. These motifs are shown to mediate clathrin binding in vitro. While mutation of these motifs alone does not block function of the GGAs in vivo, combining these mutations with truncations of the hinge and GAE domains diminishes function, suggesting functional cooperation between different clathrin-binding elements. Thus, these observations demonstrate that the yeast GGAs play important roles in the CPY pathway, vacuole biogenesis, and α-factor maturation and identify structural determinants that are critical for these functions. PMID:11689690

  16. NSF visiting professorships for women

    NASA Astrophysics Data System (ADS)

    The deadline date for the National Science Foundation's Visiting Professorships for Women (VPW) program is November 15. The program enables experienced women scientists and engineers to undertake advanced research and teaching at host institutions where they can also provide guidance and encouragement to other women who want to pursue research careers. NSF is particularly interested in increasing participation in research of minority women and women with disabilities.

  17. Research Funding Set for NSF, NASA, EPA.

    ERIC Educational Resources Information Center

    Chemical and Engineering News, 1982

    1982-01-01

    Funds (1983) for National Science Foundation (NSF), National Aeronautics and Space Administration (NASA), and Environmental Protection Agency (EPA) research programs include $1,092,200,000 (NSF), $5.5 billion (NASA), and $119 million (EPA). NSF's science education activities were raised to $30 million in spite of the Administration's plan to phase…

  18. Sorting choanoflagellates

    NASA Astrophysics Data System (ADS)

    Marconi, Veronica I.; Miño, Gaston L.; Sparacino, Javier; Banchio, Adolfo J.; Condat, Carlos A.; Koehl, Mimi A. R.; King, Nicole; Stocker, Roman

    2015-03-01

    In freshwater environments, as well as in oceans, environmental conditions are in constant fluctuation. Some heterotrophic plankton must adapt their swimming behavior in order to survive under these conditions. In the case of the choanoflagellate, the closest animal ancestor, the ability to forage for food is given not only by its single flagellum, but also by its differentiation between fast and slow swimmers. The understanding of how these cells with different strategies to swim search for food can give us a better insight into how eukaryotes respond to different stimuli. In this work, we have designed a microfluidic device that sorts choanoflagellates by their speed. The optimal geometry was found by a numerical model using the experimentally determined motilities of each swimmer type.

  19. The schizophrenia susceptibility factor dysbindin and its associated complex sort cargoes from cell bodies to the synapse

    PubMed Central

    Larimore, Jennifer; Tornieri, Karine; Ryder, Pearl V.; Gokhale, Avanti; Zlatic, Stephanie A.; Craige, Branch; Lee, Joshua D.; Talbot, Konrad; Pare, Jean-Francois; Smith, Yoland; Faundez, Victor

    2011-01-01

    Dysbindin assembles into the biogenesis of lysosome-related organelles complex 1 (BLOC-1), which interacts with the adaptor protein complex 3 (AP-3), mediating a common endosome-trafficking route. Deficiencies in AP-3 and BLOC-1 affect synaptic vesicle composition. However, whether AP-3-BLOC-1–dependent sorting events that control synapse membrane protein content take place in cell bodies upstream of nerve terminals remains unknown. We tested this hypothesis by analyzing the targeting of phosphatidylinositol-4-kinase type II α (PI4KIIα), a membrane protein present in presynaptic and postsynaptic compartments. PI4KIIα copurified with BLOC-1 and AP-3 in neuronal cells. These interactions translated into a decreased PI4KIIα content in the dentate gyrus of dysbindin-null BLOC-1 deficiency and AP-3–null mice. Reduction of PI4KIIα in the dentate reflects a failure to traffic from the cell body. PI4KIIα was targeted to processes in wild-type primary cultured cortical neurons and PC12 cells but failed to reach neurites in cells lacking either AP-3 or BLOC-1. Similarly, disruption of an AP-3–sorting motif in PI4KIIα impaired its sorting into processes of PC12 and primary cultured cortical neuronal cells. Our findings indicate a novel vesicle transport mechanism requiring BLOC-1 and AP-3 complexes for cargo sorting from neuronal cell bodies to neurites and nerve terminals. PMID:21998198

  20. Derivation of sorting programs

    NASA Technical Reports Server (NTRS)

    Varghese, Joseph; Loganantharaj, Rasiah

    1990-01-01

    Program synthesis for critical applications has become a viable alternative to program verification. Nested resolution and its extension are used to synthesize a set of sorting programs from their first order logic specifications. A set of sorting programs, such as, naive sort, merge sort, and insertion sort, were successfully synthesized starting from the same set of specifications.

  1. NSF Geosciences Draft Report Available for Comment

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2014-08-01

    The U.S. National Science Foundation's Advisory Committee for the Geosciences (NSF's AC GEO) is seeking comments from the Earth science community on a draft document issued on 7 August that outlines "imperatives and frontier areas" for NSF's Directorate for Geosciences (GEO). The report, Dynamic Earth: GEO Priorities & Frontiers 2015-2020, is an update to the directorate's 2009 report, GEO Vision.

  2. Factors affecting carcass value and profitability in early-weaned Simmental steers: II. Days on feed endpoints and sorting strategies.

    PubMed

    Pyatt, N A; Berger, L L; Faulkner, D B; Walker, P M; Rodriguez-Zas, S L

    2005-12-01

    In a 4-yr study, early-weaned Simmental steers (n = 192) of known genetics were individually fed to determine EPD, performance, and carcass measurements explaining variation in carcass value and profitability across incremental days on feed (DOF) when sorted by HCW, calculated yield grade (YG), or at their highest profit endpoint (BEST). Steers were weaned at 88.0 +/- 1.1 d of age, pen-fed a high-concentrate diet for 84.5 +/- 0.4 d, individually fed for 249.7 +/- 0.7 d, and slaughtered at 423.3 +/- 1.4 d of age. Carcass weight, YG, and marbling score (MS) were predicted using real-time ultrasound throughout the finishing period to calculate carcass value and profitability at 90, 60, 30 d preslaughter and under three individual sorting strategies. Sorting strategies included marketing the 25 and 50% heaviest HCW, the highest YG at d 60 and 30, or the remaining 25% at 0-d endpoints. Independent variables were year, weaning weight EPD, yearling weight EPD, marbling EPD, DMI, ADG, HCW, YG, and MS. Profit was quadratic in response to increased DOF; the greatest economic return was noted on d 30 (pre-slaughter). Final weight, DMI, HCW, MS, and YG increased (linear; P < 0.001) with additional DOF, and ADG and G:F decreased (linear; P < 0.001). Total cost of gain was quadratic (P < 0.001), and incremental cost of gain rose at an increasing rate (quadratic; P < 0.001) with increased DOF. With increasing DOF, HCW importance decreased from 58 to 21%; MS was variable, ranging from 18 to 23%; and YG and DMI were minor contributors to profit variation. Among sorting strategies, final BW and HCW were greater for BEST, whereas other measurements were similar. Sorting individuals by HCW, YG, or at BEST increased profitability 3.70 dollars, 2.52 dollars, or 30.65 dollars over the optimal group DOF endpoint (d 30). Retrospective analyses illustrated that sorting does not need to pinpoint each animal's profit optimum to result in economic gains; rather, increasing HCW and decreasing

  3. Geochemistry of Jurassic to earliest Cretaceous deposits in the Nagato Basin, SW Japan: implication of factor analysis to sorting effects and provenance signatures

    NASA Astrophysics Data System (ADS)

    Ohta, Tohru

    2004-10-01

    One of the intractable problems in provenance analysis is the hydraulic sorting effect and resultant mineralogical heterogeneity in coarse- and fine-grained sediments which conceals provenance characteristics. The present study uses factor analysis to address geochemical responses to the sorting effect and provenance of Late Mesozoic sediments in the Nagato Basin, SW Japan. Factor analysis has proven useful for comprehending geochemical gradients between coarse- and fine-grained sediments. In the present example, compositional differences are based on varying proportions of quartz, plagioclase, chrome spinel, authigenic minerals and phyllosilicates. The contrasting behaviors of these minerals during the depositional stage resulted in the systematic fractionation of SiO 2/Al 2O 3, Na 2O/K 2O and Cr/Ba. Sandstones and mudstones exhibit an array of compositions in SiO 2/Al 2O 3-Na 2O/K 2O and SiO 2/Al 2O 3-Cr/Ba diagrams, the ranges of which reflect compositional variations due to the sorting effect. Sediments of different provenance exhibit distinctive mineral arrays and can be discriminated simply by reading the gradients of the continua. Therefore, this kind of data management concurrently quantifies the sorting effect and allows an estimation of the original source material. The SiO 2/Al 2O 3-Na 2O/K 2O diagram is particularly useful for scrutinizing igneous and mature continental provenances, while the SiO 2/Al 2O 3-Cr/Ba diagram ascertains contributions from mafic sources. This investigative approach delineates a systematic provenance transition within the Nagato Basin: a serpentinite melange provenance in the early Early Jurassic, a magmatic arc in the late Early to middle Middle Jurassic and a continental interior in the latest Jurassic to earliest Cretaceous. The provenance changed by the direct input of mature continental material into the Nagato Basin, which resulted from dissection of the volcanic arc.

  4. Opportunities for Funding at NSF

    NASA Astrophysics Data System (ADS)

    Kafafi, Zakya H.

    2009-03-01

    lead to a better quality of life and improved economic development for people all over the world will also be given. As science is becoming increasingly global, DMR is particularly interested in preparing students to be agile thinkers in this universal environment and in forging collaborations and cooperation among scientists and engineers around the world. Free movement of knowledge without any obstacles can only be achieved through a more coordinated approach for international collaboration. Following the presentation there will be a question-and-answer period. For additional information, visit the DMR Web page at www.nsf.gov/materials

  5. NSF's role in Antarctic environment scrutinized

    NASA Astrophysics Data System (ADS)

    Bush, Susan

    In the last few years, the National Science Foundation has come under criticism by environmental groups for inadequate stewardship in the U.S. Antarctic Program's environmental issues. Since 1978, NSF was given full responsibility, by Executive Order, for budgeting and managing the entire U.S. national program in Antarctica, including logistics support. NSF has also been responsible for the compliance of the U.S. Antarctic Program with environmental protection measures agreed to by the Antarctic Treaty nations. Specifically under fire by environmentalists have been NSF's maintenance of a land-fill, open-air burning of solid waste, and the removal of toxic substances. According to Peter E. Wilkniss, director of the Division of Polar Programs at NSF, open burning is no longer taking place and will not be allowed in the future.

  6. NSF reauthorization bill sails through house

    NASA Astrophysics Data System (ADS)

    Jones, Richard M.

    The National Science Foundation (NSF) Authorization Act of 1994, HR 3254, soared through the House in early May by a vote of 396-22, but awaits further action by the House appropriators and the Senate.For fiscal year 1995, the bill authorizes $3.15 billion or an overall funding hike of 5% for NSF, which is about $50 million less than President Clinton's request.

  7. NSF's Career-Life Balance Initiative and the NSF Astronomy and Astrophysics Postdoctoral Fellowships

    NASA Astrophysics Data System (ADS)

    Ajhar, Edward A.

    2013-01-01

    In the fall of 2011, the National Science Foundation (NSF) began the Career-Life Balance Initiative to support graduate students, postdoctoral students, and early-career researchers in STEM fields. NSF is focusing first on its most prestigious programs for early-career scientists---the CAREER program and the postdoctoral programs, including the NSF Astronomy and Astrophysics Postdoctoral Fellowships (AAPF)---where career-life balance opportunities can help retain a significant fraction of early career talent. Subject to budget constraints, NSF plans to further integrate and enhance career-life balance opportunities over time through other programs, like the Graduate Research Fellowships Program and ADVANCE, and subsequently through the broader portfolio of NSF activities. In addition, to comply with Title IX, NSF has regulations to ensure that educational programs that receive NSF funds are free of gender discrimination and harassment. A primary goal of this presentation is to put facts about NSF into the hands of students, faculty, staff, administrators and other policy makers to benefit the advancement of career-life balance in the astronomical community. The presentation focus areas will (1) address common misconceptions about NSF rules regarding parental leave; (2) discuss benefits already available through the AAPF program, Graduate Research Fellowships, and other programs; and (3) listen to community concerns and issues to bring these back to the foundation for consideration. Did you know that NSF allows paid parental leave under many circumstances? For example, the AAPF program currently allows two months of paid parental leave during the fellow's tenure. What are the rules for NSF Graduate Research Fellowships? Come to the session and find out; the answers to such questions might surprise you.

  8. Demonstration of differential quantitative requirements for NSF among multiple vesicle fusion pathways of GLUT4 using a dominant-negative ATPase-deficient NSF

    SciTech Connect

    Chen Xiaoli; Matsumoto, Hideko; Hinck, Cynthia S.; Al-Hasani, Hadi; St-Denis, Jean-Francois; Whiteheart, Sidney W.; Cushman, Samuel W. . E-mail: sam_cushman@nih.gov

    2005-07-22

    In this study, we investigated the relative participation of N-ethylmaleimide-sensitive factor (NSF) in vivo in a complex multistep vesicle trafficking system, the translocation response of GLUT4 to insulin in rat adipose cells. Transfections of rat adipose cells demonstrate that over-expression of wild-type NSF has no effect on total, or basal and insulin-stimulated cell-surface expression of HA-tagged GLUT4. In contrast, a dominant-negative NSF (NSF-D1EQ) can be expressed at a low enough level that it has little effect on total HA-GLUT4, but does reduce both basal and insulin-stimulated cell-surface HA-GLUT4 by {approx}50% without affecting the GLUT4 fold-translocation response to insulin. However, high expression levels of NSF-D1EQ decrease total HA-GLUT4. The inhibitory effect of NSF-D1EQ on cell-surface HA-GLUT4 is reversed when endocytosis is inhibited by co-expression of a dominant-negative dynamin (dynamin-K44A). Moreover, NSF-D1EQ does not affect cell-surface levels of constitutively recycling GLUT1 and TfR, suggesting a predominant effect of low-level NSF-D1EQ on the trafficking of GLUT4 from the endocytic recycling compared to the intracellular GLUT4-specific compartment. Thus, our data demonstrate that the multiple fusion steps in GLUT4 trafficking have differential quantitative requirements for NSF activity. This indicates that the rates of plasma and intracellular membrane fusion reactions vary, leading to differential needs for the turnover of the SNARE proteins.

  9. Biogenesis of lysosome-related organelles complex-1 subunit 1 (BLOS1) interacts with sorting nexin 2 and the endosomal sorting complex required for transport-I (ESCRT-I) component TSG101 to mediate the sorting of epidermal growth factor receptor into endosomal compartments.

    PubMed

    Zhang, Aili; He, Xin; Zhang, Ling; Yang, Lin; Woodman, Philip; Li, Wei

    2014-10-17

    Biogenesis of lysosome-related organelles complex-1 (BLOC-1) is a component of the molecular machinery required for the biogenesis of specialized organelles and lysosomal targeting of cargoes via the endosomal to lysosomal trafficking pathway. BLOS1, one subunit of BLOC-1, is implicated in lysosomal trafficking of membrane proteins. We found that the degradation and trafficking of epidermal growth factor receptor (EGFR) were delayed in BLOS1 knockdown cells, which were rescued through BLOS1 overexpression. A key feature to the delayed EGFR degradation is the accumulation of endolysosomes in BLOS1 knockdown cells or BLOS1 knock-out mouse embryonic fibroblasts. BLOS1 interacted with SNX2 (a retromer subunit) and TSG101 (an endosomal sorting complex required for transport subunit-I) to mediate EGFR lysosomal trafficking. These results suggest that coordination of the endolysosomal trafficking proteins is important for proper targeting of EGFR to lysosomes.

  10. Wakimoto to head NSF geosciences directorate

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2012-11-01

    Roger Wakimoto has been selected as the new assistant director for the U.S. National Science Foundation's (NSF) Directorate for Geosciences (GEO), the agency announced on 7 November. Wakimoto, who has been director of the NSF-sponsored National Center for Atmospheric Research (NCAR) in Boulder, Colo., since 2010, begins his NSF appointment in February 2013. His selection culminates a national search begun last year to find a successor to former GEO assistant director Tim Killeen, whose term ended in June 2012. Margaret Cavanaugh has served as acting assistant director since Killeen's departure. An AGU member, Wakimoto is a geophysicist with expertise in tornadoes, thunderstorms, and other severe weather. He previously served as associate director for NCAR's Earth Observing Laboratory and as a professor and chair of the Department of Atmospheric Science at the University of California, Los Angeles.

  11. POCA Update: An NSF PAARE Project

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, S. D.; Cash, J. L.; Hartmann, D. H.; Howell, S. B.; King, J. R.; Leising, M. D.; Mayo, E. A.; Mighell, K. J.; Smith, D. M., Jr.

    2011-01-01

    We report on the status of "A Partnership in Observational and Computational Astronomy (POCA)” under the NSF's "Partnerships in Astronomy and Astrophysics Research and Education (PAARE)" program. This partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory. We have reached the midpoint of this 5-year award and discuss the successes, challenges and obstacles encountered to date. Included is a summary of our summer REU program, the POCA graduate fellowship program, faculty research capacity building, outreach activities, increased use of NSF facilities and shared resources. Additional POCA research presentations by the authors are described elsewhere in these proceedings. Support for this work was provided by the NSF PAARE program to South Carolina State University under award AST-0750814 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory.

  12. NSF losing Earth sciences research funds

    NASA Astrophysics Data System (ADS)

    Bell, Peter M.

    The Earth Sciences Division (EAR) of the National Science Foundation (NSF) faces a diminishing financial base from which to award grants for research, while the proposal pressure increases. Robin Brett, director of the division stated, ‘Now that the Ocean Drilling Division has become a separate entity [within the Foundation] the Division of Earth Sciences has no major facility, and with the exception of COCORP, at $2.8 million per year, we are a small science division, consisting of four programs—geology, geophysics, geochemistry, and petrology.’Brett noted, however, that the field of earth sciences research, which the NSF attempts to support, has grown rapidly in the past decade. Growth (in terms of people employed in the field) is predicted to increase markedly, as the following quotation from Science and Engineering Education for the 1980s and Beyond (NSF publication, 1980) attests:

  13. Creation and the empirical validation of the dignity card-sort tool to assess factors influencing erosion of dignity at life's end.

    PubMed

    Periyakoil, Vyjeyanthi S; Kraemer, Helena Chmura; Noda, Arthur

    2009-12-01

    Patients often experience erosion of dignity as they cope with the dying process. Preserving patient dignity is a sentinel premise of palliative care. This study was conducted to gain a better understanding of factors influencing erosion of dignity at the end of life. We conducted an open-ended written survey of 100 multidisciplinary providers (69% response rate) and responses were categorized to identify 18 themes that were used to create a card-sort tool. The initial 18-item tool was administered to nurses (n = 83), nonhospice community-dwelling subjects (n = 190) and hospice patients (n = 26) and a principal component analysis (PCA) was used to identify the 6 primary factors. The key item in each factor as identified by the PCA was used to create the final 6-item dignity card-sort tool (DCT). The DCT was also administered to physicians caring for palliative care patients (n = 21). For each of the final 6 items, the correlation between the respondents (nurses, physicians, nonterminally ill subjects, and subjects receiving hospice care) was calculated using the Spearman's correlation coefficient. The nurses were very highly positively correlated with the physicians (correlation coefficient = 0.94) and the community-dwelling nonterminally ill subjects were highly positively correlated with the subjects receiving hospice care (correlation coefficient = 0.67). More importantly, both the nurses and physicians were negatively correlated with both community dwelling nonterminally ill subjects and the subjects receiving hospice care. The health professionals in the study felt that treating a patient with disrespect and not carrying out their wishes resulted in erosion of dignity. In contrast patients thought that poor medical care and untreated pain were the most important factors leading to erosion of dignity at life's end. The DCT is a promising tool that may help clinicians identify key factors resulting in perceptions of erosion of dignity in adult palliative care

  14. A novel Sec18p/NSF-dependent complex required for Golgi-to-endosome transport in yeast.

    PubMed

    Burd, C G; Peterson, M; Cowles, C R; Emr, S D

    1997-06-01

    The vacuolar protein-sorting (VPS) pathway of Saccharomyces cerevisiae mediates localization of proteins from the trans-Golgi to the vacuole via a prevacuolar endosome compartment. Mutations in class D vacuolar protein-sorting (vps) genes affect vesicle-mediated Golgi-to-endosome transport and result in secretion of vacuolar proteins. Temperature-sensitive-for-function (tsf) and dominant negative mutations in PEP12, encoding a putative SNARE vesicle receptor on the endosome, and tsf mutations in VAC1, a gene implicated in vacuole inheritance and vacuolar protein sorting, were constructed and used to demonstrate that Pep12p and Vac1p are components of the VPS pathway. The sequence of Vac1p contains two putative zinc-binding RING motifs, a zinc finger motif, and a coiled-coil motif. Site-directed mutations in the carboxyl-terminal RING motif strongly affected vacuolar protein sorting. Vac1p was found to be tightly associated with membranes as a monomer and in a large SDS-resistant complex. By using Pep12p affinity chromatography, we found that Vac1p, Vps45p (SEC1 family member), and Sec18p (yeast N-ethyl maleimide-sensitive factor, NSF) bind Pep12p. Consistent with a functional role for this complex in vacuolar protein sorting, double pep12tsfvac1tsf and pep12tsf vps45tsf mutants exhibited synthetic Vps- phenotypes, the tsf phenotype of the vac1tsf mutant was rescued by overexpression of VPS45 or PEP12, overexpression of a dominant pep12 allele in a sec18-1 strain resulted in a severe synthetic growth defect that was rescued by deletion of PEP12 or VAC1, and subcellular fractionation of vac1 delta cells revealed a striking change in the fractionation of Pep12p and Vps21p, a rab family GTPase required for vacuolar protein sorting. The functions of Pep12p, Vps45p, and Vps21p indicate that key aspects of Golgi-to-endosome trafficking are similar to other vesicle-mediated transport steps, although the role of Vac1p suggests that there are also novel components of the VPS

  15. Caspase-mediated proteolysis of the sorting nexin 2 disrupts retromer assembly and potentiates Met/hepatocyte growth factor receptor signaling

    PubMed Central

    Duclos, Catherine M; Champagne, Audrey; Carrier, Julie C; Saucier, Caroline; Lavoie, Christine L; Denault, Jean-Bernard

    2017-01-01

    The unfolding of apoptosis involves the cleavage of hundreds of proteins by the caspase family of cysteinyl peptidases. Among those substrates are proteins involved in intracellular vesicle trafficking with a net outcome of shutting down the crucial processes governing protein transport to organelles and to the plasma membrane. However, because of the intertwining of receptor trafficking and signaling, cleavage of specific proteins may lead to unintended consequences. Here we show that in apoptosis, sorting nexin 1 and 2 (SNX1 and SNX2), two proteins involved in endosomal sorting, are cleaved by initiator caspases and also by executioner caspase-6 in the case of SNX2. Moreover, SNX1 is cleaved at multiple sites, including following glutamate residues. Cleavage of SNX2 results in a loss of association with the endosome-to-trans-Golgi network transport protein Vps35 and in a delocalization from endosomes of its associated partner Vps26. We also demonstrate that SNX2 depletion causes an increase in hepatocyte growth factor receptor tyrosine phosphorylation and Erk1/2 signaling in cells. Finally, we show that SNX2 mRNA and protein levels are decreased in colorectal carcinoma and that lower SNX2 gene expression correlates with an increase in cancer patient mortality. Our study reveals the importance to characterize the cleavage fragments produced by caspases of specific death substrates given their potential implication in the mechanism of regulation of physiological (signaling/trafficking) pathways or in the dysfunction leading to pathogenesis. PMID:28179995

  16. Clinton seeks additional funds for NSF

    NASA Astrophysics Data System (ADS)

    Bush, Susan

    A $207 million fiscal year 1993 supplemental appropriation for the National Science Foundation has been proposed by President Clinton for strategic research and core research programs. The funds would increase the agency's 1993 budget to $2.04 billion, a 14% increase over the fiscal 1992 budget. The request is part of a $16.3 billion supplemental bill awaiting action by Congress that would also create 500,000 new jobs.On February 23, NSF Director Walter E. Massey testified before the House Appropriations Subcommittee on Veterans Affairs, HUD, and Independent Agencies to support the supplement. “NSF's activities contribute to improving the nation's productivity by generating new knowledge and investing in the future by training the current and next generation of scientists and engineers,” he said.

  17. Requesting use of NSF facilities for education

    NASA Astrophysics Data System (ADS)

    Meitín, J. G.; Baeuerle, B. G.

    2009-12-01

    Research in the geosciences often requires specialized facilities and instrumentation to carry out field work that is needed to understand complex, interdependent processes, covering all regions of the globe. The National Science Foundation (NSF), Lower Atmospheric Observing Facilities (LAOF) Program consists of multi-user national facilities sponsored by NSF for the geosciences community. These facilities are made available to collect large and sometimes unique data sets in support of scientific research. The LAOF are managed by the National Center for Atmospheric Research, Colorado State University, University of Wyoming, and the Center for Severe Weather Research. The NSF reserves a portion of the LAOF funding for use by educators wishing to gain access to these observational facilities for classroom instruction and hands-on learning experience. This includes requesting that a facility be deployed to a university for a short period of time. A description of the available facilities and examples of previous educational deployments will be presented. Guidelines for submitting proposals will be discussed.

  18. Lineage sorting in apes.

    PubMed

    Mailund, Thomas; Munch, Kasper; Schierup, Mikkel Heide

    2014-01-01

    Recombination allows different parts of the genome to have different genealogical histories. When a species splits in two, allelic lineages sort into the two descendant species, and this lineage sorting varies along the genome. If speciation events are close in time, the lineage sorting process may be incomplete at the second speciation event and lead to gene genealogies that do not match the species phylogeny. We review different recent approaches to model lineage sorting along the genome and show how it is possible to learn about population sizes, natural selection, and recombination rates in ancestral species from application of these models to genome alignments of great ape species.

  19. Scalable, Multithreaded, Partially-in-Place Sorting

    SciTech Connect

    Haglin, David J.; Adolf, Robert D.; Mackey, Greg E.

    2013-05-20

    A recent trend in hardware development is producing computing systems that are stretching the number of cores and size of shared-memory beyond where most fundamental serial algorithms perform well. The expectation is that this trend will continue. So it makes sense to rethink our fundamental algorithms such as sorting. There are many situations where data that needs to be sorted will actually fit into the shared memory so applications could benefit from an efficient parallel sorting algorithm. When sorting large data (at least hundreds of Gigabytes) in a single shared memory, there are two factors that affect the algorithm choice. First, does the algorithm sort in-place? And second, does the algorithm scale well beyond tens of threads? Surprisingly, existing algorithms posses either one of these factors, but not both. We present an approach that gracefully degrades in performance as the amount of available working memory decreases relative to the size of the input.

  20. Sorting Carbon Nanotubes.

    PubMed

    Zheng, Ming

    2017-02-01

    Sorting of single-wall carbon nanotubes by their electronic and atomic structures in liquid phases is reviewed in this chapter. We first introduce the sorting problem, and then provide an overview of several sorting methodologies, following roughly the chronological order of their development over the past 15 years or so. Major methods discussed include ion-exchange chromatography, density-gradient ultracentrifugation, selective extraction in organic solvents, gel chromatography, and aqueous two-phase extraction. A main focus of the review is on the common mechanisms underlining all sorting processes. We propose that differences in solvation among different nanotube species are the ultimate driving force of sorting, and we corroborate this proposal by presenting analysis on how the differences are realized in electronic-structure-based sorting and atomic-structure-based sorting. In the end, we offer some suggestions on future directions that may grow out of carbon nanotube sorting. In particular, the prospect of expanding the function of DNA/carbon nanotube hybrid to control inter-particle interactions both inside and outside the nanotube is discussed.

  1. Sorting to Extremes

    ERIC Educational Resources Information Center

    Baum, Sandy; McPherson, Michael S.

    2011-01-01

    The world of higher education is a world of sorting, selecting, and ranking--on both sides of the market. Colleges select students to recruit and then to admit; students choose where to apply and which offer to accept. The sorting process that gets the most attention is in the higher reaches of the market, where it is not too much to say that…

  2. 48 CFR 2515.215-70 - NSF negotiation authorities.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true NSF negotiation authorities... CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Negotiation Authorities 2515.215-70 NSF negotiation authorities. (a) Authorities. Citation: 42 U.S.C. 1870(c). (b) Application. When an NSF...

  3. New visiting scientists in NSF's Earth sciences

    NASA Astrophysics Data System (ADS)

    MacGregor, Ian

    The National Science Foundation's Division of Earth Sciences has hired two new rotators to serve as program directors, as part of the ongoing visiting scientists program. The new directors are Jonathan Fink in Geochemistry and Petrology, and L. Douglas James in Hydrological Sciences.Fink has exchanged roles for 1 year with NSF's John Snyder, who is on sabbatical at Arizona State University. Fink's current research includes studies of how the Theological properties of magma govern the emplacement of volcanic domes and lava flows, and the gravitational control on their mass movements. This research extends to the mechanisms of igneous intrusion and interpretation of volcanic features in extraterrestrial and submarine environments.

  4. Solar-terrestrial news from NSF

    NASA Astrophysics Data System (ADS)

    Peacock, Dennis S.

    Tis the season to be jolly, but it is difficult, given the budgetary outlook for fiscal year (FY) 1987. The National Science Foundation (NSF) appropriation bill was signed by President Reagan on October 18, 1986. It provides $1622.9 M (M = million), which is $164.9 M or 11.3% over the post-Gramm-Rudman-Hollings (GRH) level for 1986 and $62.9 M less than the FY 1987 request. The bill includes language capping astronomy at the requested level of $85.06 M.

  5. Insulin and Insulin-like Growth Factor II Differentially Regulate Endocytic Sorting and Stability of Insulin Receptor Isoform A*

    PubMed Central

    Morcavallo, Alaide; Genua, Marco; Palummo, Angela; Kletvikova, Emilia; Jiracek, Jiri; Brzozowski, Andrzej M.; Iozzo, Renato V.; Belfiore, Antonino; Morrione, Andrea

    2012-01-01

    The insulin receptor isoform A (IR-A) binds both insulin and insulin-like growth factor (IGF)-II, although the affinity for IGF-II is 3–10-fold lower than insulin depending on a cell and tissue context. Notably, in mouse embryonic fibroblasts lacking the IGF-IR and expressing solely the IR-A (R−/IR-A), IGF-II is a more potent mitogen than insulin. As receptor endocytosis and degradation provide spatial and temporal regulation of signaling events, we hypothesized that insulin and IGF-II could affect IR-A biological responses by differentially regulating IR-A trafficking. Using R−/IR-A cells, we discovered that insulin evoked significant IR-A internalization, a process modestly affected by IGF-II. However, the differential internalization was not due to IR-A ubiquitination. Notably, prolonged stimulation of R−/IR-A cells with insulin, but not with IGF-II, targeted the receptor to a degradative pathway. Similarly, the docking protein insulin receptor substrate 1 (IRS-1) was down-regulated after prolonged insulin but not IGF-II exposure. Similar results were also obtained in experiments using [NMeTyrB26]-insulin, an insulin analog with IR-A binding affinity similar to IGF-II. Finally, we discovered that IR-A was internalized through clathrin-dependent and -independent pathways, which differentially regulated the activation of downstream effectors. Collectively, our results suggest that a lower affinity of IGF-II for the IR-A promotes lower IR-A phosphorylation and activation of early downstream effectors vis à vis insulin but may protect IR-A and IRS-1 from down-regulation thereby evoking sustained and robust mitogenic stimuli. PMID:22318726

  6. Raman activated cell sorting.

    PubMed

    Song, Yizhi; Yin, Huabing; Huang, Wei E

    2016-08-01

    Single cell Raman spectra (SCRS) are intrinsic biochemical profiles and 'chemical images' of single cells which can be used to characterise phenotypic changes, physiological states and functions of cells. On the base of SCRS, Raman activated cell sorting (RACS) provides a label-free cell sorting approach, which can link single cells to their chemical or phenotypic profiles. Overcoming naturally weak Raman signals, establishing Raman biomarker as sorting criteria to RACS and improving specific sorting technology are three challenges of developing RACS. Advances on Raman spectroscopy such as stimulated Raman scattering (SRS) and pre-screening helped to increase RACS sorting speed. Entire SCRS can be characterised using pattern recognition methods, and specific Raman bands can be extracted as biomarkers for RACS. Recent advances on cell sorting technologies based on microfluidic device and surface-ejection enable accurate and reliable single cell sorting from complex samples. A high throughput RACS will be achievable in near future by integrating fast Raman detection system such as SRS with microfluidic RACS and Raman activated cell ejection (RACE).

  7. Receptor-Mediated Uptake and Intracellular Sorting of Multivalent Lipid Nanoparticles Against the Epidermal Growth Factor Receptor (EGFR) and the Human EGFR 2 (HER2)

    NASA Astrophysics Data System (ADS)

    Tran, David Tu

    In the area of receptor-targeted lipid nanoparticles for drug delivery, efficiency has been mainly focused on cell-specificity, endocytosis, and subsequently effects on bioactivity such as cell growth inhibition. Aspects of targeted liposomal uptake and intracellular sorting are not well defined. This dissertation assessed a series of ligands as targeted functional groups against HER2 and EGFR for liposomal drug delivery. Receptor-mediated uptake, both mono-targeted and dual-targeted to multiple receptors of different ligand valence, and the intracellular sorting of lipid nanoparticles were investigated to improve the delivery of drugs to cancer cells. Lipid nanoparticles were functionalized through a new sequential micelle transfer---conjugation method, while the micelle transfer method was extended to growth factors. Through a combination of both techniques, anti-HER2 and anti-EGFR dual-targeted immunoliposomes with different combinations of ligand valence were developed for comparative studies. With the array of lipid nanoparticles, the uptake and cytotoxicity of lipid nanoparticles in relationship to ligand valence, both mono-targeting and dual-targeting, were evaluated on a small panel of breast cancer cell lines that express HER2 and EGFR of varying levels. Comparable uptake ratios of ligand to expressed receptor and apparent cooperativity were observed. For cell lines that express both receptors, additive dose-uptake effects were also observed with dual-targeted immunoliposomes, which translated to marginal improvements in cell growth inhibition with doxorubicin delivery. Colocalization analysis revealed that ligand-conjugated lipid nanoparticles settle to endosomal compartments similar to their attached ligands. Pathway transregulation and pathway saturation were also observed to affect trafficking. In the end, liposomes routed to the recycling endosomes were never observed to traffic beyond the endosomes nor to be exocytose like recycled ligands. Based on

  8. Sorting of Sperm by Morphology

    NASA Astrophysics Data System (ADS)

    Koh, James; Marcos, Marcos

    2016-11-01

    Many studies have proven that the percentage of morphologically normal sperm is a significant factor in determining the success of assisted reproduction. The velocity of sperm in a microchannel with shear flow subjected to an external field will be explored theoretically. The difference in response between morphologically normal and abnormal sperm will be computed from a statistical approach, to study the feasibility and effectiveness of sorting by an external field to remove abnormal sperm. The full name of this author is Marcos.

  9. The NSF PAARE Projects at SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, Sean D.; Cash, Jennifer; Hartmann, Dieter; Hinkle, Kenneth H.; Ho, Shirley; Howell, Steve B.; King, Jeremy R.; Leising, Mark D.; Mighell, Kenneth J.; Smith, Daniel M.

    2016-01-01

    We review our progress over the past 7.5 years and the path forward under the NSF program "Partnerships in Astronomy and Astrophysics Research and Education (PAARE)". Our first project, "A Partnership in Observational and Computational Astronomy (POCA)" was a part of the 2008 PAARE cohort which we finished on September 30, 2015. We will summarize the results of those years and look at our way forward under a second PAARE award made in August 2014 (POCA II). Our partnership under the second PAARE award includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) as well as individual investigators at NASA Ames and Carnegie Mellon University. Our recent work on variable and peculiar stars, work with the Kepler Observatory and our educational products in cosmology for non-STEM majors will be presented as well as our success with undergraduate and graduate students. We will also discuss how we are sharing resources with Clemson through distance learning and undergraduate research projects. Our support includes NSF awards AST-0750814 and AST-1358913 to South Carolina State University as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under awards NNX11AB82G and NNX13AC24G. Additional details can be found at: http://physics.scsu.edu/paare/

  10. Educational Outreach by the NSF Polymers Program

    NASA Astrophysics Data System (ADS)

    Lovinger, Andrew J.

    2002-03-01

    Education and outreach have been NSF priority areas over the last few years. Reviewers of all proposals are explicitly asked to evaluate not only the "intellectual merit" of a research proposal but also its "broader impacts", including specifically "integration of research and education". The NSF Polymers Program has strongly emphasized these areas and has initiated and supported a wide variety of outreach activities designed to bring out the importance of polymeric materials to diverse communities and to encourage young students to develop interests in this area. Specific activities have included: Workshops and their broad dissemination through the media; press releases on important polymer-related developments; interviews to the scientific and popular press; outreach to Congress; establishment of widely publicized and broadly attended lecture series; funding and support of conferences, symposia, and workshops aimed at students and teachers from kindergarten to graduate school; support of web-based educational projects aimed at the general public and schoolchildren; participation in web-based "ask-the-experts" resources to answer science questions from children or the general public; and personal outreach to middle- and high-schools through talks and demonstrations on polymers and plastics, participation at science fairs, career days, etc.

  11. NSF to receive 10% funding increase

    NASA Astrophysics Data System (ADS)

    Jones, Richard M.

    Work is almost complete on the fiscal year 1994 funding bill for the National Science Foundation. On October 1, Conference Committee Chairs Louis Stokes (D-Ohio) and Barbara Mikulski (D-Md.) and their colleagues completed work on the final version of HR2491, the VA, HUD, Independent Agencies Appropriations Bill. The House and Senate will soon give their final approval to the conference report for HR2491, after which it will lack only the president's signature. NSF's overall budget increase of 10%, raising total funding to %3,005.3 million, is the highest increase among all departments and agencies. Last year's increase in NSF funding was 6.3%.Funding for research and related activities will increase 7% to $1,986 million, a compromise between the 10% House increase and the 4% Senate figure. Last year's bill cut research funding. Education and human resources funding will increase 17% to $569.6 million. This is $13.5 million above the Clinton administration's request. Last year's increase for education and human resources was 4.7%.

  12. Sorting Out Seasonal Allergies

    MedlinePlus

    ... Contact Close ‹ Back to Healthy Living Sorting Out Seasonal Allergies Sneezing, runny nose, nasal congestion. Symptoms of the ... Georgeson. How do I know if I have seasonal allergies? According to Dr. Georgeson, the best way to ...

  13. NSF section remains in competitiveness bill

    NASA Astrophysics Data System (ADS)

    Lang, Valerie

    The House Space, Science and Technology Committee held mark-ups to consider amendments to HR820, the National Competitiveness Act of 1993 on April 21 and 22. Subtitle B to the bill lays out a role for the National Science Foundation that is perceived by some Earth scientists as shifting the agency's mission from supporting basic research to manufacturing technology and competitiveness (see Eos, April 13). During the mark-up, Roscoe Bartlett (R-Md.) introduced an amendment to strike the entire NSF section, saying that “manufacturing is not a proper function of basic research institutions.” He also mentioned that President Clinton did not have any money in his budget for this initiative.

  14. Solar-terrestrial news from NSF

    NASA Astrophysics Data System (ADS)

    Peacock, Dennis

    This is a difficult time for solar-terrestrial (S/T) research. The loss of the shuttle Challenger has disrupted the entire short-range launch schedule at the National Aeronautics and Space Administration (NASA). The Gramm-Rudman-Hollings (GRH) Deficit Reduction Act has affected virtually all programs in fiscal year (FY) 1986 and no doubt will affect 1987 and beyond. Then again, every year has its own special problems, and even this year's difficulties could turn to our advantage. For example, GRH has demanded a serious rethinking of budgets and priorities. One outcome of this is the President's budget to Congress in 1987, which requests increases of 8.4% and 8.9% for the National Science Foundation (NSF) and NASA (research and development), respectively.

  15. NSF and IPY 2007-2008

    NASA Astrophysics Data System (ADS)

    Erb, K. A.

    2003-12-01

    International research organizations including the International Arctic Science Council, the Arctic Ocean Sciences Board, the Scientific Committee on Antarctic Research, the World Meteorological Organization and the International Council for Science have announced planning efforts toward coordinated international polar research during 2007-2008, the 50th anniversary of the International Geophysical Year and the Third International Polar Year. This activity is fueled in considerable measure by the conviction that coordinated efforts building on advances in support infrastructure and in instrumentation technology could lead to breakthrough discoveries in subjects ranging from global climate change to astrophysics, oceanography, and micro-biology, to list just a few of those we have heard discussed. The National Science Foundation's Office of Polar Programs--steward of the U.S. Antarctic Program, the U. S. Interagency Arctic Research Policy Committee, and a major source of funding for the education and training of polar scientists, their research and their field support -- has engaged in continuing discussions about the upcoming Polar Year with officials responsible for polar research in other U. S. Agencies, in other nations, with a number of international organizations, and with the U. S. planning committee leadership. We have also sought to catalyze thinking in the research community through workshops and discussions and have been monitoring the development of related scientific and educational thrusts. Our goal is to be poised to support U. S. efforts brought forward in timely fashion by researchers and educators and to be ready to facilitate their integration with related international efforts. The time is now rapidly approaching when we will need to begin planning for the support of specific research and education projects. This talk will summarize NSF activity related to planning for the 2007-2008 International Polar Year and will address ways that NSF's focus

  16. Sorting by Recursive Partitioning,

    DTIC Science & Technology

    1983-12-01

    asymptotic time-complexity. This paper has the following main parts: First, a Pidgin -Algol version of the algorithm is presented and we discuss the main...those sorted subsets e) end "UsingBin*; end "AdaptSorting. 4 "Figure 1: A condensed Pidgin -Algol version of Adaptsort eiFor some conditions that we will...algorithm which have to be completed in either linear or constant times (these required critical times appear as comments in the Pidgin -Algol version

  17. The NSF Condensed Matter Physics Program

    NASA Astrophysics Data System (ADS)

    Sokol, Paul

    The Condensed Matter Physics (CMP) program in the NSF Division of Materials Research (DMR) supports experimental, as well as combined experiment and theory projects investigating the fundamental physics behind phenomena exhibited by condensed matter systems. CMP is the largest Individual Investigator Award program in DMR and supports a broad portfolio of research spanning both hard and soft condensed matter. Representative research areas include: 1) phenomena at the nano- to macro-scale including: transport, magnetic, and optical phenomena; classical and quantum phase transitions; localization; electronic, magnetic, and lattice structure or excitations; superconductivity; topological insulators; and nonlinear dynamics. 2) low-temperature physics: quantum fluids and solids; 1D & 2D electron systems. 3) soft condensed matter: partially ordered fluids, granular and colloid physics, liquid crystals, and 4) understanding the fundamental physics of new states of matter as well as the physical behavior of condensed matter under extreme conditions e.g., low temperatures, high pressures, and high magnetic fields. In this talk I will review the current CMP portfolio and discuss future funding trends for the program. I will also describe recent activities in the program aimed at addressing the challenges facing current and future principal investigators.

  18. 78 FR 69658 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-20

    .../NSF Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory... within the field of basic nuclear science research. Tentative Agenda: Agenda will include discussions...

  19. 78 FR 716 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-04

    .../NSF Nuclear Science Advisory Committee AGENCY: Office of Science, DOE. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC). DATES... on scientific priorities within the field of basic nuclear science research. Tentative Agenda:...

  20. 78 FR 62609 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-22

    ... Nuclear Science Advisory Committee AGENCY: Office of Science, Department of Energy. ACTION: Notice of... that the DOE/NSF Nuclear Science Advisory Committee (NSAC) will be renewed for a two-year period. The... within the field of basic nuclear science research. Additionally, the renewal of the DOE/NSF...

  1. 75 FR 71425 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-11-23

    .../NSF Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of Open Meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory... nuclear science research. Tentative Agenda: Agenda will include discussions of the following:...

  2. 48 CFR 2515.215-70 - NSF negotiation authorities.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false NSF negotiation... FOUNDATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Negotiation Authorities 2515.215-70 NSF negotiation authorities. (a) Authorities. Citation: 42 U.S.C. 1870(c). (b) Application....

  3. A Guide to NSF Science/Engineering Resources Data.

    ERIC Educational Resources Information Center

    National Science Foundation, Washington, DC. Directorate for Scientific, Technological and International Affairs.

    The National Science Foundation (NSF) Division of Science Resources Services designs and conducts surveys related to, and supports other data collection activities dealing with, science resources. The data from these surveys and data collection efforts are used by NSF and others to analyze various research and development (R&D) funding and…

  4. Perhaps the NSF Is a Model, but Perhaps Not ... .

    ERIC Educational Resources Information Center

    Glidden, Robert

    1990-01-01

    Responds to Charles Fowler's article, "Arts Education and the NEA: Does the National Science Foundation Point the Way?" Recommends that the National Science Foundation (NSF) and the National Endowment for the Arts (NEA) work together to promote intellectual values in schooling. Suggests that the NEA follow the NSF in its commitment to…

  5. 48 CFR 2515.215-70 - NSF negotiation authorities.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... FOUNDATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Negotiation Authorities 2515.215... an NSF contract is for scientific activities which are determined by the NSF contracting officer to... Secretary of State or Secretary of Defense, specific scientific activities in connection with...

  6. 48 CFR 2515.215-70 - NSF negotiation authorities.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... FOUNDATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Negotiation Authorities 2515.215... an NSF contract is for scientific activities which are determined by the NSF contracting officer to... Secretary of State or Secretary of Defense, specific scientific activities in connection with...

  7. Cyberinfrastructure for the NSF Ocean Observatories Initiative

    NASA Astrophysics Data System (ADS)

    Orcutt, J. A.; Vernon, F. L.; Arrott, M.; Chave, A.; Krueger, I.; Schofield, O.; Glenn, S.; Peach, C.; Nayak, A.

    2007-12-01

    The Internet today is vastly different than the Internet that we knew even five years ago and the changes that will be evident five years from now, when the NSF Ocean Observatories Initiative (OOI) prototype has been installed, are nearly unpredictable. Much of this progress is based on the exponential growth in capabilities of consumer electronics and information technology; the reality of this exponential behavior is rarely appreciated. For example, the number of transistors on a square cm of silicon will continue to double every 18 months, the density of disk storage will double every year, and network bandwidth will double every eight months. Today's desktop 2TB RAID will be 64TB and the 10Gbps Regional Scale Network fiber optical connection will be running at 1.8Tbps. The same exponential behavior characterizes the future of genome sequencing. The first two sequences of composites of individuals' genes cost tens of millions of dollars in 2001. Dr. Craig Venter just published a more accurate complete human genome (his own) at a cost on the order of 100,000. The J. Craig Venter Institute has provided support for the X Prize for Genomics offering 10M to the first successful sequencing of a human genome for $1,000. It's anticipated that the prize will be won within five years. Major advances in technology that are broadly viewed as disruptive or revolutionary rather than evolutionary will often depend upon the exploitation of exponential expansions in capability. Applications of these ideas to the OOI will be discussed. Specifically, the agile ability to scale cyberinfrastructure commensurate with the exponential growth of sensors, networks and computational capability and demand will be described.

  8. Passive droplet sorting using viscoelastic flow focusing.

    PubMed

    Hatch, Andrew C; Patel, Apurva; Beer, N Reginald; Lee, Abraham P

    2013-04-07

    We present a study of passive hydrodynamic droplet sorting in microfluidic channels based on intrinsic viscoelastic fluid properties. Sorting is achieved by tuning the droplets' intrinsic viscous and viscoelastic properties relative to the continuous oil phase to achieve a positive or negative lateral migration toward high or low shear gradients in the channel. In the presence of weakly viscoelastic fluid behavior, droplets with a viscosity ratio, κ, between 0.5-10 were found to migrate toward a high shear gradient near the channel walls. For all other κ-values, or Newtonian fluids, droplets would migrate toward a low shear gradient at the channel centerline. It was also found that for strongly viscoelastic fluids with low interfacial tension, droplets would migrate toward the edge even with κ-values lower than 0.5. The resulting bi-directional lateral droplet migration between different droplets allows size-independent sorting. Still, their sorting efficiencies are dependent on droplet size, intrinsic fluid elasticity, viscosity, droplet deformability, and overall fluid shear rates. Based on these findings, we demonstrate >200 Hz passive droplet sorting frequencies and achieve >100 fold enrichment factors without the need to actively sense and/or control active mechanisms. Using a low viscosity oil phase of 6.25 cPs, we demonstrate sorting discrimination of 1 cPs and 5 cPs aqueous droplets with κ-values of 0.2 and 0.8 respectively.

  9. ESO and NSF Sign Agreement on ALMA

    NASA Astrophysics Data System (ADS)

    2003-02-01

    Green Light for World's Most Powerful Radio Observatory On February 25, 2003, the European Southern Observatory (ESO) and the US National Science Foundation (NSF) are signing a historic agreement to construct and operate the world's largest and most powerful radio telescope, operating at millimeter and sub-millimeter wavelength. The Director General of ESO, Dr. Catherine Cesarsky, and the Director of the NSF, Dr. Rita Colwell, act for their respective organizations. Known as the Atacama Large Millimeter Array (ALMA), the future facility will encompass sixty-four interconnected 12-meter antennae at a unique, high-altitude site at Chajnantor in the Atacama region of northern Chile. ALMA is a joint project between Europe and North America. In Europe, ESO is leading on behalf of its ten member countries and Spain. In North America, the NSF also acts for the National Research Council of Canada and executes the project through the National Radio Astronomy Observatory (NRAO) operated by Associated Universities, Inc. (AUI). The conclusion of the ESO-NSF Agreement now gives the final green light for the ALMA project. The total cost of approximately 650 million Euro (or US Dollars) is shared equally between the two partners. Dr. Cesarsky is excited: "This agreement signifies the start of a great project of contemporary astronomy and astrophysics. Representing Europe, and in collaboration with many laboratories and institutes on this continent, we together look forward towards wonderful research projects. With ALMA we may learn how the earliest galaxies in the Universe really looked like, to mention but one of the many eagerly awaited opportunities with this marvellous facility". "With this agreement, we usher in a new age of research in astronomy" says Dr. Colwell. "By working together in this truly global partnership, the international astronomy community will be able to ensure the research capabilities needed to meet the long-term demands of our scientific enterprise, and

  10. Chip-based droplet sorting

    SciTech Connect

    Beer, Neil Reginald; Lee, Abraham; Hatch, Andrew

    2014-07-01

    A non-contact system for sorting monodisperse water-in-oil emulsion droplets in a microfluidic device based on the droplet's contents and their interaction with an applied electromagnetic field or by identification and sorting.

  11. Sorting quantum systems efficiently

    PubMed Central

    Ionicioiu, Radu

    2016-01-01

    Measuring the state of a quantum system is a fundamental process in quantum mechanics and plays an essential role in quantum information and quantum technologies. One method to measure a quantum observable is to sort the system in different spatial modes according to the measured value, followed by single-particle detectors on each mode. Examples of quantum sorters are polarizing beam-splitters (PBS) – which direct photons according to their polarization – and Stern-Gerlach devices. Here we propose a general scheme to sort a quantum system according to the value of any d-dimensional degree of freedom, such as spin, orbital angular momentum (OAM), wavelength etc. Our scheme is universal, works at the single-particle level and has a theoretical efficiency of 100%. As an application we design an efficient OAM sorter consisting of a single multi-path interferometer which is suitable for a photonic chip implementation. PMID:27142705

  12. A Highly Polymorphic Copy Number Variant in the NSF Gene is Associated with Cocaine Dependence

    PubMed Central

    Cabana-Domínguez, Judit; Roncero, Carlos; Grau-López, Lara; Rodríguez-Cintas, Laia; Barral, Carmen; Abad, Alfonso C.; Erikson, Galina; Wineinger, Nathan E.; Torrico, Bàrbara; Arenas, Concepció; Casas, Miquel; Ribasés, Marta; Cormand, Bru; Fernàndez-Castillo, Noèlia

    2016-01-01

    Cocaine dependence is a complex psychiatric disorder involving both genetic and environmental factors. Several neurotransmitter systems mediate cocaine’s effects, dependence and relapse, being the components of the neurotransmitter release machinery good candidates for the disorder. Previously, we identified a risk haplotype for cocaine dependence in the NSF gene, encoding the protein N-Ethylmaleimide-Sensitive Factor essential for synaptic vesicle turnover. Here we examined the possible contribution to cocaine dependence of a large copy number variant (CNV) that encompasses part of the NSF gene. We performed a case-control association study in a discovery sample (359 cases and 356 controls) and identified an association between cocaine dependence and the CNV (P = 0.013), that was confirmed in the replication sample (508 cases and 569 controls, P = 7.1e-03) and in a pooled analysis (P = 1.8e-04), with an over-representation of low number of copies in cases. Subsequently, we studied the functional impact of the CNV on gene expression and found that the levels of two NSF transcripts were significantly increased in peripheral blood mononuclear cells (PBMC) along with the number of copies of the CNV. These results, together with a previous study from our group, support the role of NSF in the susceptibility to cocaine dependence. PMID:27498889

  13. NSF Support for Physics at the Undergraduate Level: A View from Inside

    NASA Astrophysics Data System (ADS)

    McBride, Duncan

    2015-03-01

    NSF has supported a wide range of projects in physics that involve undergraduate students. These projects include NSF research grants in which undergraduates participate; Research Experiences for Undergraduates (REU) centers and supplements; and education grants that range from upper-division labs that may include research, to curriculum development for upper- and lower-level courses and labs, to courses for non-majors, to Physics Education Research (PER). The NSF Divisions of Physics, Materials Research, and Astronomy provide most of the disciplinary research support, with some from other parts of NSF. I recently retired as the permanent physicist in NSF's Division of Undergraduate Education (DUE), which supports the education grants. I was responsible for a majority of DUE's physics grants and was involved with others overseen by a series of physics rotators. There I worked in programs entitled Instrumentation and Laboratory Improvement (ILI); Course and Curriculum Development (CCD); Course, Curriculum, and Laboratory Improvement (CCLI); Transforming Undergraduate STEM Education (TUES); and Improving Undergraduate STEM Education (IUSE). NSF support has enabled physics Principal Investigators to change and improve substantially the way physics is taught and the way students learn physics. The most important changes are increased undergraduate participation in physics research; more teaching using interactive engagement methods in classes; and growth of PER as a legitimate field of physics research as well as outcomes from PER that guide physics teaching. In turn these have led, along with other factors, to students who are better-prepared for graduate school and work, and to increases in the number of undergraduate physics majors. In addition, students in disciplines that physics directly supports, notably engineering and chemistry, and increasingly biology, are better and more broadly prepared to use their physics education in these fields. I will describe NSF

  14. Sorting out Ideas about Function

    ERIC Educational Resources Information Center

    Hillen, Amy F.; Malik, LuAnn

    2013-01-01

    Card sorting has the potential to provide opportunities for exploration of a variety of topics and levels. In a card-sorting task, each participant is presented with a set of cards--each of which depicts a relationship--and is asked to sort the cards into categories that make sense to him or her. The concept of function is critical to…

  15. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  16. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  17. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  18. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  19. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  20. Committee of Visitors Advises NSF Division of Ocean Sciences

    NASA Astrophysics Data System (ADS)

    Fine, Rana; Beardsley, Robert; Bontempi, Paula; Campbell, Janet; Chotiros, Nick; Klein, Emily; North, Elizabeth; Olsen, Curtis; Robles, Carlos; Seyfried, William; Thomas, Debbie

    2010-02-01

    The U.S. National Science Foundation (NSF) relies on external Committees of Visitors (COV) convened every 3 years to assess the quality and integrity of program operations and program-level technical and managerial matters pertaining to proposal decisions. Members of COVs are chosen by program officers and division directors to represent scientific diversity, in terms of disciplines, institutions, and potential principal investigators (PIs). One such COV recently assessed NSF's Ocean Sciences (OCE) division. The COV for OCE found that the science receiving funding is highly relevant to the overarching objectives of NSF and that the OCE peer-review process is robust. Further, the COV found that program officers—NSF staff who manage programs in ocean sciences and administer proposals and grants—are conscientious and are funding projects of top quality that are well balanced across a broad spectrum.

  1. INTERACTION AND LOCALIZATION OF THE RETINITIS PIGMENTOSA PROTEIN RP2 AND NSF IN RETINAL PHOTORECEPTOR CELLS†

    PubMed Central

    Holopainen, Juha M.; Cheng, Christiana L.; Molday, Laurie L.; Johal, Gurp; Coleman, Jonathan; Dyka, Frank; Hii, Theresa; Ahn, Jinhi; Molday, Robert S.

    2010-01-01

    RP2 is a ubiquitously expressed protein encoded by a gene associated with X-linked retinitis pigmentosa (XLRP), a retinal degenerative disease that causes severe vision loss. Previous in vitro studies have shown that RP2 binds to ADP ribosylation factor-like 3 (Arl3) and activates its intrinsic GTPase activity, but the function of RP2 in the retina, and in particular photoreceptor cells, remains unclear. To begin to define the role of RP2 in the retina and XLRP, we have carried out biochemical studies to identify proteins in retinal cell extracts that interact with RP2. Here, we show that RP2 interacts with N-ethylmaleimide sensitive factor (NSF) in retinal cells as well as cultured embryonic kidney (HEK293) cells by mass spectrometry-based proteomics and biochemical analysis. This interaction is mediated by the N-terminal domain of NSF. The E138G and ΔI137 mutations of RP2 known to cause XLRP abolished the interaction of RP2 with the N-terminal domain of NSF. Immunofluorescence labeling studies further showed that RP2 co-localized with NSF in photoreceptors and other cells of the retina. Intense punctate staining of RP2 was observed close to the junction between the inner and outer segments beneath the connecting cilium, as well as within the synaptic region of rod and cone photoreceptors. Our studies indicate that RP2, in addition to serving as a regulator of Arl3, interacts with NSF and this complex may play an important role in membrane protein trafficking in photoreceptors and other cells of the retina. PMID:20669900

  2. Fluorescence activated cell sorting.

    NASA Technical Reports Server (NTRS)

    Bonner, W. A.; Hulett, H. R.; Sweet, R. G.; Herzenberg, L. A.

    1972-01-01

    An instrument has been developed for sorting biological cells. The cells are rendered differentially fluorescent and incorporated into a small liquid stream illuminated by a laser beam. The cells pass sequentially through the beam, and fluorescent light from the cells gives rise to electrical signals. The stream is broken into a series of uniform size drops downstream of the laser. The cell signals are used to give appropriate electrostatic charges to drops containing the cells. The drops then pass between two charged plates and are deflected to appropriate containers. The system has proved capable of providing fractions containing large numbers of viable cells highly enriched in a particular functional type.

  3. Multiple sort flow cytometer

    DOEpatents

    Engh, G. van den; Esposito, R.J.

    1996-01-09

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane. 8 figs.

  4. Multiple sort flow cytometer

    DOEpatents

    Van den Engh, Ger; Esposito, Richard J.

    1996-01-01

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane.

  5. Deductive sort and climbing sort: new methods for non-dominated sorting.

    PubMed

    McClymont, Kent; Keedwell, Ed

    2012-01-01

    In recent years an increasing number of real-world many-dimensional optimisation problems have been identified across the spectrum of research fields. Many popular evolutionary algorithms use non-dominance as a measure for selecting solutions for future generations. The process of sorting populations into non-dominated fronts is usually the controlling order of computational complexity and can be expensive for large populations or for a high number of objectives. This paper presents two novel methods for non-dominated sorting: deductive sort and climbing sort. The two new methods are compared to the fast non-dominated sort of NSGA-II and the non-dominated rank sort of the omni-optimizer. The results demonstrate the improved efficiencies of the deductive sort and the reductions in comparisons that can be made when applying inferred dominance relationships defined in this paper.

  6. Spin-the-bottle Sort and Annealing Sort: Oblivious Sorting via Round-robin Random Comparisons.

    PubMed

    Goodrich, Michael T

    2014-03-01

    We study sorting algorithms based on randomized round-robin comparisons. Specifically, we study Spin-the-bottle sort, where comparisons are unrestricted, and Annealing sort, where comparisons are restricted to a distance bounded by a temperature parameter. Both algorithms are simple, randomized, data-oblivious sorting algorithms, which are useful in privacy-preserving computations, but, as we show, Annealing sort is much more efficient. We show that there is an input permutation that causes Spin-the-bottle sort to require Ω(n(2) log n) expected time in order to succeed, and that in O(n(2) log n) time this algorithm succeeds with high probability for any input. We also show there is a specification of Annealing sort that runs in O(n log n) time and succeeds with very high probability.

  7. Teleoperated robotic sorting system

    DOEpatents

    Roos, Charles E.; Sommer, Edward J.; Parrish, Robert H.; Russell, James R.

    2000-01-01

    A method and apparatus are disclosed for classifying materials utilizing a computerized touch sensitive screen or other computerized pointing device for operator identification and electronic marking of spatial coordinates of materials to be extracted. An operator positioned at a computerized touch sensitive screen views electronic images of the mixture of materials to be sorted as they are conveyed past a sensor array which transmits sequences of images of the mixture either directly or through a computer to the touch sensitive display screen. The operator manually "touches" objects displayed on the screen to be extracted from the mixture thereby registering the spatial coordinates of the objects within the computer. The computer then tracks the registered objects as they are conveyed and directs automated devices including mechanical means such as air jets, robotic arms, or other mechanical diverters to extract the registered objects.

  8. Teleoperated robotic sorting system

    DOEpatents

    Roos, Charles E.; Sommer, Jr., Edward J.; Parrish, Robert H.; Russell, James R.

    2008-06-24

    A method and apparatus are disclosed for classifying materials utilizing a computerized touch sensitive screen or other computerized pointing device for operator identification and electronic marking of spatial coordinates of materials to be extracted. An operator positioned at a computerized touch sensitive screen views electronic images of the mixture of materials to be sorted as they are conveyed past a sensor array which transmits sequences of images of the mixture either directly or through a computer to the touch sensitive display screen. The operator manually "touches" objects displayed on the screen to be extracted from the mixture thereby registering the spatial coordinates of the objects within the computer. The computer then tracks the registered objects as they are conveyed and directs automated devices including mechanical means such as air jets, robotic arms, or other mechanical diverters to extract the registered objects.

  9. GPCR sorting at multivesicular endosomes.

    PubMed

    Dores, Michael Robert; Trejo, JoAnn

    2015-01-01

    The lysosomal degradation of G protein-coupled receptors (GPCRs) is essential for receptor signaling and down regulation. Once internalized, GPCRs are sorted within the endocytic pathway and packaged into intraluminal vesicles (ILVs) that bud inward to form the multivesicular endosome (MVE). The mechanisms that control GPCR sorting and ILV formation are poorly understood. Quantitative strategies are important for evaluating the function of adaptor and scaffold proteins that regulate sorting of GPCRs at MVEs. In this chapter, we outline two strategies for the quantification and visualization of GPCR sorting into the lumen of MVEs. The first protocol utilizes a biochemical approach to assay the sorting of GPCRs in a population of cells, whereas the second strategy examines GPCR sorting in individual cells using immunofluorescence confocal microscopy. Combined, these assays can be used to establish the kinetics of activated GPCR lysosomal trafficking in response to specific ligands, as well as evaluate the contribution of endosomal adaptors to GPCR sorting at MVEs. The protocols presented in this chapter can be adapted to analyze GPCR sorting in a myriad of cell types and tissues, and expanded to analyze the mechanisms that regulate MVE sorting of other cargoes.

  10. Congressional hearing reviews NSF major research and facilities projects

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2012-03-01

    An 8 March congressional hearing about the U.S. National Science Foundation's Major Research Equipment and Facilities Construction (NSF MREFC) account focused on fiscal management and accountability of projects in that account and reviewed concerns raised by NSF's Office of Inspector General (OIG). NSF established the MREFC account in 1995 to better plan and manage investments in major equipment and facilities projects, which can cost from tens of millions to hundreds of millions of dollars, and the foundation has funded 17 MREFC projects since then. The Obama administration's proposed fiscal year (FY) 2013 budget includes funding for four MREFC projects: Advanced Laser Gravitational-Wave Observatory (AdvLIGO), Advanced Technology Solar Telescope (ATST), National Ecological Observatory (NEON), and Ocean Observatories Initiative (OOI). The hearing, held by a subcommittee of the House of Representatives' Committee on Science, Space, and Technology, reviewed management oversight throughout the life cycles of MREFC projects and concerns raised in recent OIG reports about the use of budget contingency funds. NSF's February 2012 manual called "Risk management guide for large facilities" states that cost contingency is "that portion of the project budget required to cover `known unknowns,'" such as planning and estimating errors and omissions, minor labor or material price fluctuations, and design developments and changes within the project scope. Committee members acknowledged measures that NSF has made to improve the MREFC oversight process, but they also urged the agency to continue to take steps to ensure better project management.

  11. What We Learned from Josh: Sorting Out Word Sorting.

    ERIC Educational Resources Information Center

    Fresch, Mary Jo

    2000-01-01

    Describes how a researcher and an elementary school teacher added a word sorting component to help children work through the complexities of the language as they group words into categories. Describes results as fifth graders thought aloud while they sorted words. Finds a link between children's developmental knowledge of spelling and their…

  12. An NSF rotator's perspective: view from inside the hamster wheel

    NASA Astrophysics Data System (ADS)

    White, Gary

    2015-03-01

    Duncan McBride served as my unofficial mentor during my time at NSF as a ``rotator'' (or, in NSF-speak, an IPA, short for an Intergovernmental Personnel Act assignee), from fall 2012 through summer of 2013. A rotator's main job is to help keep the wheels of the grant submission process turning, shepherding individual proposal jackets through the submission cycle. While most proposals are eventually ``Declined'' it is the few that are funded that evoke the most vivid memories of my time there. I hope to relay a little bit about what that was like on a daily basis, to give one hamster's take on the machinations of the NSF machine, and testify to Duncan McBride's critical role in establishing physics as the leader in disciplinary based educational research (DBER). It was a heady experience in many ways, despite the sheer girth of proposal jackets to be processed and the uncertain footing upon which federal employees tread these days.

  13. Research Misconduct: Policy and Practice at the NSF

    NASA Astrophysics Data System (ADS)

    Manka, Aaron

    2004-03-01

    Under NSF's Office of Inspector General mandate to prevent fraud, waste, abuse, or mismanagement involving NSF's proposals and awards, our office also investigates allegations of research misconduct. I will discuss our office's handling of such matters, focusing on the ethical and legal obligations of proposal submitters and awardees and the role of the scientific community. To illustrate some other points that are of interest to the physics community, I will also discuss some of our investigative activities relevant to: duplicate funding, the accuracy of information in proposals, and collaborations.

  14. The NSF Earthscope USArray Instrumentation Network

    NASA Astrophysics Data System (ADS)

    Davis, G. A.; Vernon, F.

    2012-12-01

    Since 2004, the Transportable Array component of the USArray Instrumentation Network has collected high resolution seismic data in near real-time from over 400 geographically distributed seismic stations. The deployed footprint of the array has steadily migrated across the continental United States, starting on the west coast and gradually moving eastward. As the network footprint shifts, stations from various regional seismic networks have been incorporated into the dataset. In 2009, an infrasound and barometric sensor component was added to existing core stations and to all new deployments. The ongoing success of the project can be attributed to a number of factors, including reliable communications to each site, on-site data buffering, largely homogenous data logging hardware, and a common phase-locked time reference between all stations. Continuous data quality is ensured by thorough human and automated review of data from the primary sensors and over 24 state-of-health parameters from each station. The staff at the Array Network Facility have developed a number of tools to visualize data and troubleshoot problematic stations remotely. In the event of an emergency or maintenance on the server hardware, data acquisition can be shifted to alternate data centers through the use of virtualization technologies.

  15. To sort or not to sort: the impact of spike-sorting on neural decoding performance

    PubMed Central

    Todorova, Sonia; Sadtler, Patrick; Batista, Aaron; Chase, Steven; Ventura, Valérie

    2015-01-01

    Objective Brain-computer interfaces (BCIs) are a promising technology for restoring motor ability to paralyzed patients: spiking-based BCIs have successfully been used in clinical trials to control multi-degree-of-freedom robotic devices. Current implementations of these devices require a lengthy spike-sorting step, which is an obstacle to moving this technology from the lab to the clinic. A viable alternative is to avoid spike-sorting, treating all threshold crossings of the voltage waveform on an electrode as coming from one putative neuron. It is not known, however, how much decoding information might be lost by ignoring spike identity. Approach We present a full analysis of the effects of spike-sorting schemes on decoding performance. Specifically, we compare how well two common decoders, the optimal linear estimator and the Kalman filter, reconstruct the arm movements of non-human primates performing reaching tasks, when receiving input from various sorting schemes. The schemes we tested included: using threshold crossings without spike-sorting; expertsorting discarding the noise; expert-sorting, including the noise as if it were another neuron; and automatic spike-sorting using waveform features. We also decoded from a joint statistical model for the waveforms and tuning curves, which does not involve an explicit spike-sorting step. Main results Discarding the threshold crossings that cannot be assigned to neurons degrades decoding: no spikes should be discarded. Decoding based on spike-sorted units outperforms decoding based on electrodes voltage crossings: spike-sorting is useful. The four waveform based spike-sorting methods tested here yield similar decoding efficiencies: a fast and simple method is competitive. Decoding using the joint waveform and tuning model shows promise but is not consistently superior. Significance Our results indicate that simple automated spikesorting performs as well as computationally or manually more intensive methods, which

  16. Feed sorting in dairy cattle: Causes, consequences, and management.

    PubMed

    Miller-Cushon, E K; DeVries, T J

    2016-12-29

    Dairy cattle commonly sort total mixed rations, a behavior that influences individual nutrient intake and reduces the nutritive value of the ration left in the bunk across the day. Typical patterns of feed sorting in lactating dairy cows, against longer forage particles, result in greater intake of highly-fermentable carbohydrates and lesser intake of effective fiber than intended, and are associated with reduced rumen pH and altered milk composition. To understand the reason for this behavior and reduce it on-farm, numerous studies have explored the influences of ration characteristics, feeding strategies, and management factors on the expression of feed sorting. In mature cows and young calves, feed sorting is influenced by forage inclusion rate, particle size, and dry matter content. Feeding strategies that increase the time available to manipulate feed-including decreased feeding frequency and increased feeding level-may result in increased feed sorting. The extent of feed sorting is also influenced by a variety of herd-level factors, but variability between individuals in the extent of feed sorting suggests that this behavior may be subject to additional factors, including previous experience and internal state. The development of feed sorting in young calves has been explored in several recent studies, suggesting that early opportunities to sort feed, as provided by access to mixed diets, may encourage the early onset of this behavior and help it persist beyond weaning. Evidence also supports the role of feedback mechanisms that influence this behavior at the individual level. In calves and adult cows, selective consumption of higher-energy ration components may be linked to energy demands, as influenced by the availability of supplemental feed or changing metabolic status. Further, considerable evidence suggests that cattle will adjust patterns of feed sorting in favor of physically effective fiber to attenuate low rumen pH, providing evidence for the role

  17. Evidence-based recommendations for designing free-sorting experiments.

    PubMed

    Blanchard, Simon J; Banerji, Ishani

    2016-12-01

    The card-sorting task is a flexible research tool that is widely used across many of the subfields of psychology. Yet this same great flexibility requires researchers to make several (seemingly arbitrary) decisions in their designs, such as fixing a sufficient number of objects to sort, setting task requirements, and creating task instructions for participants. In the present research, we provide a systematic empirical investigation of the consequences of typical researcher design choices while administering sorting tasks. Specifically, we studied the effects of seven sorting task design factors by collecting data from over 1,000 online participants assigned to one of 36 sorting tasks, as part of a fractional factorial experimental design. Analyses show the effects of the various researcher decisions on the probability that participants would quit the task, the amount of time spent on the task, the number of piles made, and posttask measures such as satisfaction and depletion. Research design recommendations are provided.

  18. Standard Practice for Cell Sorting in a BSL-3 Facility

    PubMed Central

    Perfetto, Stephen P.; Ambrozak, David R.; Nguyen, Richard; Roederer, Mario; Koup, Richard A.; Holmes, Kevin L.

    2016-01-01

    Over the past decade, there has been a rapid growth in the number of BSL-3 and BSL-4 laboratories in the USA and an increase in demand for infectious cell sorting in BSL-3 laboratories. In 2007, the International Society for Advancement of Cytometry (ISAC) Biosafety Committee published standards for the sorting of unfixed cells and is an important resource for biosafety procedures when performing infectious cell sorting. Following a careful risk assessment, if it is determined that a cell sorter must be located within a BSL-3 laboratory, there are a variety of factors to be considered prior to the establishment of the laboratory. This chapter outlines procedures for infectious cell sorting in a BSL-3 environment to facilitate the establishment and safe operation of a BSL-3 cell sorting laboratory. Subjects covered include containment verification, remote operation, disinfection, personal protective equipment (PPE), and instrument-specific modifications for enhanced aerosol evacuation. PMID:21116997

  19. Multiphase ferrofluid flows for micro-particle sorting

    NASA Astrophysics Data System (ADS)

    Zhou, Ran; Wang, Cheng

    2015-11-01

    Utilizing negative magnetophoresis, ferrofluids have demonstrated great potential for sorting nonmagnetic micro-particles by size. Most of the existing techniques use single phase ferrofluids by pushing micro-particles to channel walls; the sorting speed is thus hindered. We demonstrate a novel sorting strategy by co-flowing a ferrofluid and a non-magnetic fluid in microchannels. Due to the magnetic force, the particles migrate across the ferrofluid stream at size-dependent velocities as they travel downstream. The laminar interface between the two fluids functions as a virtual boundary to accumulate particles, resulting in effective separation of particles. A stable and sharp interface is important to the success of this sorting technique. We investigate several factors that affect sorting efficiency, including magnetic field, susceptibility difference of the fluids, flow velocity, and channel geometry.

  20. To sort or not to sort: the impact of spike-sorting on neural decoding performance

    NASA Astrophysics Data System (ADS)

    Todorova, Sonia; Sadtler, Patrick; Batista, Aaron; Chase, Steven; Ventura, Valérie

    2014-10-01

    Objective. Brain-computer interfaces (BCIs) are a promising technology for restoring motor ability to paralyzed patients. Spiking-based BCIs have successfully been used in clinical trials to control multi-degree-of-freedom robotic devices. Current implementations of these devices require a lengthy spike-sorting step, which is an obstacle to moving this technology from the lab to the clinic. A viable alternative is to avoid spike-sorting, treating all threshold crossings of the voltage waveform on an electrode as coming from one putative neuron. It is not known, however, how much decoding information might be lost by ignoring spike identity. Approach. We present a full analysis of the effects of spike-sorting schemes on decoding performance. Specifically, we compare how well two common decoders, the optimal linear estimator and the Kalman filter, reconstruct the arm movements of non-human primates performing reaching tasks, when receiving input from various sorting schemes. The schemes we tested included: using threshold crossings without spike-sorting; expert-sorting discarding the noise; expert-sorting, including the noise as if it were another neuron; and automatic spike-sorting using waveform features. We also decoded from a joint statistical model for the waveforms and tuning curves, which does not involve an explicit spike-sorting step. Main results. Discarding the threshold crossings that cannot be assigned to neurons degrades decoding: no spikes should be discarded. Decoding based on spike-sorted units outperforms decoding based on electrodes voltage crossings: spike-sorting is useful. The four waveform based spike-sorting methods tested here yield similar decoding efficiencies: a fast and simple method is competitive. Decoding using the joint waveform and tuning model shows promise but is not consistently superior. Significance. Our results indicate that simple automated spike-sorting performs as well as the more computationally or manually intensive

  1. 75 FR 37783 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-30

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... nuclear science research. Tentative Agenda: Agenda will include discussions of the following: Friday,...

  2. 77 FR 51791 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-27

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... Energy and the National Science Foundation on scientific priorities within the field of basic...

  3. 76 FR 31945 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-02

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of Open Meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... Science Foundation on scientific priorities within the field of basic nuclear science research....

  4. 75 FR 6651 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-10

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... the National Science Foundation on scientific priorities within the field of basic nuclear...

  5. 76 FR 69252 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-11-08

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... Energy and the National Science Foundation on scientific priorities within the field of basic...

  6. 76 FR 8359 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-14

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... scientific priorities within the field of basic nuclear science research. Tentative Agenda: Agenda...

  7. 78 FR 56870 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-16

    ... Nuclear Science Advisory Committee AGENCY: Office of Science, Department of Energy. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory. Committee (NSAC... and the National Science Foundation on scientific priorities within the field of basic nuclear...

  8. Summary Report of the NSF/EPA WATERS Network Workshop

    EPA Science Inventory

    The National Science Foundation (NSF) and The U.S. Environmental Protection Agency (EPA) organized a workshop to support The WATer and Environmental Research Systems (WATERS) Network project. The WATERS Network is a new joint initiative of the environmental engineering and hydrol...

  9. 76 FR 62050 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-06

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of... that the DOE/NSF Nuclear Science Advisory Committee (NSAC) will be renewed for a two- year period beginning on September 30, 2011. The Committee will provide advice to the Director, Office of...

  10. 77 FR 9219 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-16

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... the National Science Foundation on scientific priorities within the field of basic nuclear...

  11. 78 FR 12044 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-21

    ... Nuclear Science Advisory Committee AGENCY: Office of Science, Department of Energy. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... advice and guidance on a continuing basis to the Department of Energy and the National Science...

  12. Wakimoto discusses role as NSF's incoming assistant director of geosciences

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2012-12-01

    Roger Wakimoto's adrenaline “is starting to pump,” the incoming assistant director for geosciences (GEO) at the U.S. National Science Foundation (NSF) told Eos during an exclusive interview at this month's AGU Fall Meeting in San Francisco. Wakimoto, whose scientific expertise is in extreme weather, is scheduled to take charge as head of the NSF directorate for geosciences starting in February 2013. During his 4-year appointment at NSF, Wakimoto, 59 and an avowed workaholic, will head up the GEO directorate, which has about an $880 million annual funding portfolio and provides about 55% of federal funding for geosciences basic research at U.S. academic institutions. The directorate currently includes the divisions of atmospheric and geospace sciences, Earth sciences, and ocean sciences. In addition, NSF's Office of Polar Programs is slated to become a GEO division under a realignment plan announced on 7 September; Wakimoto said that shift had “no bearing” on his decision to accept the position.

  13. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ....7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Disposition of Rights in Inventions 2527.7002 NSF patent policy. As authorized by the National Science Board at its 230th meeting, October 15-16, 1981,...

  14. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ....7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Disposition of Rights in Inventions 2527.7002 NSF patent policy. As authorized by the National Science Board at its 230th meeting, October 15-16, 1981,...

  15. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ....7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Disposition of Rights in Inventions 2527.7002 NSF patent policy. As authorized by the National Science Board at its 230th meeting, October 15-16, 1981,...

  16. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ....7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Disposition of Rights in Inventions 2527.7002 NSF patent policy. As authorized by the National Science Board at its 230th meeting, October 15-16, 1981,...

  17. NSF Anticipates Pushing Boundaries on Open-Access Plan

    ERIC Educational Resources Information Center

    Basken, Paul

    2013-01-01

    The National Science Foundation (NSF), in carrying out the Obama administration's new push for greater public access to research published in scientific journals, will consider exclusivity periods shorter than the 12-month standard in the White House directive, as well as trade-offs involving data-sharing and considerations of publishers'…

  18. NSF-Sponsored Biological and Chemical Oceanography Data Management Office

    NASA Astrophysics Data System (ADS)

    Allison, M. D.; Chandler, C. L.; Copley, N.; Galvarino, C.; Gegg, S. R.; Glover, D. M.; Groman, R. C.; Wiebe, P. H.; Work, T. T.; Biological; Chemical Oceanography Data Management Office

    2010-12-01

    Ocean biogeochemistry and marine ecosystem research projects are inherently interdisciplinary and benefit from improved access to well-documented data. Improved data sharing practices are important to the continued exploration of research themes that are a central focus of the ocean science community and are essential to interdisciplinary and international collaborations that address complex, global research themes. In 2006, the National Science Foundation Division of Ocean Sciences (NSF OCE) funded the Biological and Chemical Oceanography Data Management Office (BCO-DMO) to serve the data management requirements of scientific investigators funded by the National Science Foundation’s Biological and Chemical Oceanography Sections. BCO-DMO staff members work with investigators to manage marine biogeochemical, ecological, and oceanographic data and information developed in the course of scientific research. These valuable data sets are documented, stored, disseminated, and protected over short and intermediate time frames. One of the goals of the BCO-DMO is to facilitate regional, national, and international data and information exchange through improved data discovery, access, display, downloading, and interoperability. In May 2010, NSF released a statement to the effect that in October 2010, it is planning to require that all proposals include a data management plan in the form of a two-page supplementary document. The data management plan would be an element of the merit review process. NSF has long been committed to making data from NSF-funded research publicly available and the new policy will strengthen this commitment. BCO-DMO is poised to assist in creating the data management plans and in ultimately serving the data and information resulting from NSF OCE funded research. We will present an overview of the data management system capabilities including: geospatial and text-based data discovery and access systems; recent enhancements to data search tools; data

  19. NCALM: NSF Supported Center for Airborne Laser Mapping

    NASA Astrophysics Data System (ADS)

    Shrestha, R. L.; Carter, W. E.; Dietrich, W. E.

    2003-12-01

    The National Science Foundation (NSF) recently awarded a grant to create a research center to support the use of airborne laser mapping technology in the scientific community. The NSF supported Center for Airborne Laser Mapping (NCALM) will be operated jointly by the Department of Civil & Coastal Engineering, College of Engineering, University of Florida (UF) and the Department of Earth and Planetary Science, University of California-Berkeley (UCB). NCALM will use the Airborne Laser Swath Mapping (ALSM) system jointly owned by UF and Florida International University (FIU), based at the UF Geosensing Engineering and Mapping (GEM) Research Center. The state-of-the-art laser surveying instrumentation, GPS systems, which are installed in a Cessna 337 Skymaster aircraft, will collect research grade data in areas selected through the competitive NSF grant review process. The ALSM observations will be analyzed both at UF and UCB, and made available to the PI through an archiving and distribution center at UCB-building upon the Berkeley Seismological Laboratory (BSL) Northern California Earthquake Data Center system. The purpose of NCALM is to provide research grade data from ALSM technology to NSF supported research studies in geosciences. The Center will also contribute to software development that will increase the processing speed and data accuracy. This presentation will discuss NCALM operation and the process of submitting proposals to NSF. In addition, it will outline the process to request available NCALM seed project funds to help jump-start small scientific research studies. Funds are also available for travel by academic researchers and students for hands-on knowledge and experience in ALSM technology at UF and UCB.

  20. Differential roles for NSF and GRIP/ABP in AMPA receptor cycling.

    PubMed

    Braithwaite, Steven P; Xia, Houhui; Malenka, Robert C

    2002-05-14

    alpha-Amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor (AMPAR) stability and movement at synapses are important factors controlling synaptic strength. Here, we study the roles of proteins [N-ethylmaleimide-sensitive fusion protein (NSF), glutamate receptor AMPAR binding protein (ABP)-interacting protein (GRIP)/(ABP), and protein interacting with C-kinase-1 (PICK1) that interact with the GluR2 subunit in the control of the surface expression and cycling of AMPARs. Epitope-tagged GluR2 formed functional receptors that exhibited targeting to synaptic sites. Constructs in which binding to NSF, PDZ proteins (GRIP/ABP and PICK1), or GRIP/ABP alone was eliminated each exhibited normal surface targeting and constitutive cycling. The lack of NSF binding, however, resulted in receptors that were endocytosed to a greater extent than wild-type receptors in response to application of AMPA or N-methyl-d-aspartate (NMDA). Conversely, the behavior of the GluR2 mutants incapable of binding to GRIP/ABP suggests that these PDZ proteins play a role in the stabilization of an intracellular pool of AMPARs that have been internalized on stimulation, thus inhibiting their recycling to the synaptic membrane. These results provide further evidence for distinct functional roles of GluR2-interacting proteins in AMPAR trafficking.

  1. Microspherical photonics: Sorting resonant photonic atoms by using light

    SciTech Connect

    Maslov, Alexey V.; Astratov, Vasily N.

    2014-09-22

    A method of sorting microspheres by resonant light forces in vacuum, air, or liquid is proposed. Based on a two-dimensional model, it is shown that the sorting can be realized by allowing spherical particles to traverse a focused beam. Under resonance with the whispering gallery modes, the particles acquire significant velocity along the beam direction. This opens a unique way of large-volume sorting of nearly identical photonic atoms with 1/Q accuracy, where Q is the resonance quality factor. This is an enabling technology for developing super-low-loss coupled-cavity structures and devices.

  2. Engaging the Next Generation of Polar Scientists: An NSF Perspective

    NASA Astrophysics Data System (ADS)

    Crain, R.

    2008-12-01

    Sealing the leaky pipeline in science education requires new approaches. Leading up to and during the International Polar Year (2007-2009), NSF's Office of Polar Programs supported projects to engage the next generation of polar scientists. The portfolio emphasized adventure, experiential, and place-based education and included symposia and the development of web-based materials. Field experiences for teachers and university students ranged from individuals to small groups conducting research in the Arctic and Antarctic. Over 150 K12 teachers have now been on polar expeditions with NSF support. The legacy of these efforts can be observed through impacts to the participants and through materials that will be available long after IPY. Your innovative ideas are needed to attract and retain the next generation of scientists inside and outside of the polar regions.

  3. Improved Access to NSF Funded Ocean Research Data

    NASA Astrophysics Data System (ADS)

    Chandler, C. L.; Groman, R. C.; Kinkade, D.; Shepherd, A.; Rauch, S.; Allison, M. D.; Gegg, S. R.; Wiebe, P. H.; Glover, D. M.

    2015-12-01

    Data from NSF-funded, hypothesis-driven research comprise an essential part of the research results upon which we base our knowledge and improved understanding of the impacts of climate change. Initially funded in 2006, the Biological and Chemical Oceanography Data Management Office (BCO-DMO) works with marine scientists to ensure that data from NSF-funded ocean research programs are fully documented and freely available for future use. BCO-DMO works in partnership with information technology professionals, other marine data repositories and national data archive centers to ensure long-term preservation of these valuable environmental research data. Data contributed to BCO-DMO by the original investigators are enhanced with sufficient discipline-specific documentation and published in a variety of standards-compliant forms designed to enable discovery and support accurate re-use.

  4. NSF's Handling of Allegations of Misconduct in Science

    NASA Astrophysics Data System (ADS)

    Manka, Aaron

    2000-03-01

    Under NSF's Office of Inspector General mandate to prevent fraud, waste, abuse, or mismanagement involving NSF's proposals and awards, our office is unique in that it also investigates allegations of misconduct in science. I will discuss our office's handling of such matters, focusing on the ethical and legal obligations of proposal submitters and awardees and the role of the scientific community. To illustrate some of these points that are of interest to the physics community, I will discuss some of our investigative activities relevant to: duplicate funding, cost sharing, and the accuracy of information in proposals. If the OSTP policy on research misconduct has been released for public comment, I will briefly discuss this policy, which is meant to be adopted by all federal funding agencies, and what it will mean for us and the community we serve.

  5. Former NSF assistant director Killeen reflects on geosciences and society

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2012-12-01

    “This is prime time for the geosciences,” Tim Killeen, former assistant director for geosciences at the U.S. National Science Foundation (NSF GEO), told Eos during a recent exclusive interview. Killeen, who served at NSF from July 2008 until his term expired in June 2012, oversaw a number of new initiatives and an expansion of the geoscience directorate's annual funding portfolio from $752 million to about $880 million. NSF announced on 7 November that Roger Wakimoto, director of the National Center for Atmospheric Research, will start as the new geosciences assistant director in February 2013 (see related article, this page, and Eos, 93(47), 475, doi:10.1029/ 2012EO470004). During the broad-ranging interview, Killeen reflected on the importance of the geosciences and their relationship to society. Killeen has been president of the Research Foundation for the State University of New York (RFSUNY) and SUNY vice chancellor for research since 9 July. He took the helm of RFSUNY after some personnel there “took advantage of lax oversight to cheat taxpayers,” according to New York State comptroller Thomas DiNapoli. Killeen, who was AGU president from 2006 to 2008, is responsible for the supervision and operation of RFSUNY, which supports about $1 billion in research at SUNY, an institution with 64 campuses and nearly 470,000 students.

  6. Congressional geohazards showcase presented by NSF and AGU

    NASA Astrophysics Data System (ADS)

    Uhlenbrock, Kristan

    2011-10-01

    On Wednesday, 7 September 2011, two weeks after the magnitude 5.8 earthquake in Mineral, Va., and a week after Hurricane Irene struck the U.S. East Coast, AGU cosponsored a showcase of National Science Foundation (NSF)—funded hazards research in recognition of National Preparedness Month. This annual event highlights NSF—funded hazards research from all over the United States, with more than 30 exhibitors demonstrating the latest research and technology on hurricanes, earthquakes, tornadoes, volcanoes, tsunamis, and oil spills, as well as emergency and social responses to these events. The event took place at the Hart Senate Office Building, where many members of Congress and their staff could attend and discuss the importance of hazards research with the researchers and NSF staff. Sen. Bill Nelson (D-Fla.) kicked off with a panel of speakers, which included remarks by Mary Voytek, a member of the AGU Board of Directors, and Subra Suresh, director of NSF. Expert presentations were also given on hazard prediction, human safety, and social response. Following the event, Senate Majority Leader Harry Reid (D-Nev.) hosted a small event to meet directly with a few of the exhibitors to discuss the importance of investment in scientific research and development.

  7. Communicating Science Broadly: An NSF Point of View

    NASA Astrophysics Data System (ADS)

    Leinen, M. S.

    2006-12-01

    In the view of NSF, communicating about both the process of doing science and about scientific results are of paramount importance. But those of us in the agency are not the ones who do the science or generate the results. Thus, our policy is to encourage the community we fund to communicate their results as broadly as possible. Why does NSF feel so strongly about communicating scientific results? First, science only moves forward when there is free and open debate about scientific results through public mechanisms in which there is an opportunity for thorough analysis (e.g. scientific literature, professional meetings and workshops). Second, the research we support is done for the good of the public and should be communicated to the public. Third, scientific results are critical to many important decision-making processes and policy-making processes. Democracies thrive when an informed public is engaged, so communicating science broadly to the lay public is important. Why does NSF feel so strongly about communicating about the process of science? Science is a habit of mind; an orderly process for testing ideas. But many do not understand how science is done, the difference between fact and conjecture, why speculation, hypotheses and theory are critical to progress, or why the culture of constructive criticism is essential to progress. Without this context, science can be misunderstood as magic, opinion, or argument. Thus the efforts that we fund to enhance scientific education and outreach are critical to having discourse about scientific results.

  8. ALGORITHM FOR SORTING GROUPED DATA

    NASA Technical Reports Server (NTRS)

    Evans, J. D.

    1994-01-01

    It is often desirable to sort data sets in ascending or descending order. This becomes more difficult for grouped data, i.e., multiple sets of data, where each set of data involves several measurements or related elements. The sort becomes increasingly cumbersome when more than a few elements exist for each data set. In order to achieve an efficient sorting process, an algorithm has been devised in which the maximum most significant element is found, and then compared to each element in succession. The program was written to handle the daily temperature readings of the Voyager spacecraft, particularly those related to the special tracking requirements of Voyager 2. By reducing each data set to a single representative number, the sorting process becomes very easy. The first step in the process is to reduce the data set of width 'n' to a data set of width '1'. This is done by representing each data set by a polynomial of length 'n' based on the differences of the maximum and minimum elements. These single numbers are then sorted and converted back to obtain the original data sets. Required input data are the name of the data file to read and sort, and the starting and ending record numbers. The package includes a sample data file, containing 500 sets of data with 5 elements in each set. This program will perform a sort of the 500 data sets in 3 - 5 seconds on an IBM PC-AT with a hard disk; on a similarly equipped IBM PC-XT the time is under 10 seconds. This program is written in BASIC (specifically the Microsoft QuickBasic compiler) for interactive execution and has been implemented on the IBM PC computer series operating under PC-DOS with a central memory requirement of approximately 40K of 8 bit bytes. A hard disk is desirable for speed considerations, but is not required. This program was developed in 1986.

  9. Parallel mergs sort using comparison matrices. I

    SciTech Connect

    Romm, Y.E.

    1995-05-01

    The topics discussed in this paper are connected with internal merge sorting by a key (in short, M-sorting or M-sort). Originally developed by von Neumann, this is one of the first sorting methods. It still remains one of the fastest, involving Nlog{sub 2}N comparisons. The purpose of our article is to demonstrate the use of comparison matrices (CMs) for merging in M-sort. While preserving the known advantages of the sequential implementation of M-sort. CMs ensure more efficient use of main memory (one of the known weaknesses of M-sort is its large memory requirements) and effective parallelizability.

  10. Pica: sorting it out.

    PubMed

    Boyle, J S; Mackey, M C

    1999-01-01

    Pica, a culture-bound illness, has occurred for centuries. The ingestion of nonfood substances such as starch, cornstarch, clay, dirt, and other material is fairly common, although the distribution of the condition varies by cultural and socioeconomic factors. The underlying cause of pica is not known, although the condition often is associated with pregnancy. There is conflicting evidence about the association of nutrient deficiencies and pica. This article presents a clinical example of pica in a pregnant 33-year-old African American woman. Implications for culturally appropriate care are discussed.

  11. Sex-sorting sperm using flow cytometry/cell sorting.

    PubMed

    Garner, Duane L; Evans, K Michael; Seidel, George E

    2013-01-01

    The sex of mammalian offspring can be predetermined by flow sorting relatively pure living populations of X- and Y-chromosome-bearing sperm. This method is based on precise staining of the DNA of sperm with the nucleic acid-specific fluorophore, Hoechst 33342, to differentiate between the subpopulations of X- and Y-sperm. The fluorescently stained sperm are then sex-sorted using a specialized high speed sorter, MoFlo(®) SX XDP, and collected into biologically supportive media prior to reconcentration and cryopreservation in numbers adequate for use with artificial insemination for some species or for in vitro fertilization. Sperm sorting can provide subpopulations of X- or Y-bearing bovine sperm at rates in the 8,000 sperm/s range while maintaining; a purity of 90% such that it has been applied to cattle on a commercial basis. The sex of offspring has been predetermined in a wide variety of mammalian species including cattle, swine, horses, sheep, goats, dogs, cats, deer, elk, dolphins, water buffalo as well as in humans using flow cytometric sorting of X- and Y-sperm.

  12. All sorts of options for food product sorting

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Most food products undergo significant processing before arrival at the grocery store or local market. A major component of this processing includes sorting the product according to quality attributes such as size, color, sweetness, and ripeness. In addition, removal of defects or contaminants is a ...

  13. FACS Sorting Mammary Stem Cells.

    PubMed

    Iriondo, Oihana; Rábano, Miriam; Vivanco, María D M

    2015-01-01

    Fluorescent-activated cell sorting (FACS) represents one of the key techniques that have been used to isolate and characterize stem cells, including cells from the mammary gland. A combination of approaches, including recognition of cell surface antigens and different cellular activities, has facilitated the identification of stem cells from the healthy mammary gland and from breast tumors. In this chapter we describe the protocol to use FACS to separate breast cancer stem cells, but most of the general principles discussed could be applied to sort other types of cells.

  14. Automated Sorting of Transuranic Waste

    SciTech Connect

    Shurtliff, Rodney Marvin

    2001-03-01

    The HANDSS-55 Transuranic Waste Sorting Module is designed to sort out items found in 55-gallon drums of waste as determined by an operator. Innovative imaging techniques coupled with fast linear motor-based motion systems and a flexible end-effector system allow the operator to remove items from the waste stream by a touch of the finger. When all desired items are removed from the waste stream, the remaining objects are automatically moved to a repackaging port for removal from the glovebox/cell. The Transuranic Waste Sorting Module consists of 1) a high accuracy XYZ Stereo Measurement and Imaging system, 2) a vibrating/tilting sorting table, 3) an XY Deployment System, 4) a ZR Deployment System, 5) several user-selectable end-effectors, 6) a waste bag opening system, 7) control and instrumentation, 8) a noncompliant waste load-out area, and 9) a Human/Machine Interface (HMI). The system is modular in design to accommodate database management tools, additional load-out ports, and other enhancements. Manually sorting the contents of a 55-gallon drum takes about one day per drum. The HANDSS-55 Waste Sorting Module is designed to significantly increase the throughput of this sorting process by automating those functions that are strenuous and tiresome for an operator to perform. The Waste Sorting Module uses the inherent ability of an operator to identify the items that need to be segregated from the waste stream and then, under computer control, picks that item out of the waste and deposits it in the appropriate location. The operator identifies the object by locating the visual image on a large color display and touches the image on the display with his finger. The computer then determines the location of the object, and performing a highspeed image analysis determines its size and orientation, so that a robotic gripper can be deployed to pick it up. Following operator verification by voice or function key, the object is deposited into a specified location.

  15. 45 CFR 689.5 - Initial NSF handling of misconduct matters.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Initial NSF handling of misconduct matters. 689.5... FOUNDATION RESEARCH MISCONDUCT § 689.5 Initial NSF handling of misconduct matters. (a) NSF staff who learn of alleged misconduct will promptly and discreetly inform OIG or refer informants to OIG. (b) The identity...

  16. Advances in automated nut sorting

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nuts in general, and tree nuts in particular, are a high value crop in many countries. Products with defects, contamination, insects or fungal damage can cause serious losses to producers, so almost all products are subjected to some level of sorting to remove these undesirable products. This chap...

  17. Six NSF-NATO postdocs go to geoscientists

    NASA Astrophysics Data System (ADS)

    Six Earth scientists will study in the United Kingdom, Norway, and Italy on postdoctoral fellowships administered by the National Science Foundation (NSF) as part of a program sponsored by the North American Treaty Organization (NATO). In all, 57 NSF-NATO postdoctoral fellowships in science were awarded in March 1988 for study abroad for up to 12 months.The six students that received fellowships for study in geosciences are Henry N. (Spike) Berry (University of Massachusetts, Amherst, Mass.), to study geology at the University of Oslo, Norway; Marcus I. Bursik (California Institute of Technology, Pasadena, Calif.), to study geology at Cambridge University, Cambridge, U.K.; Mary S. Hubbard (Massachusetts Institute of Technology, Cambridge, Mass.), to study geology at the University of Leicester, Leicester, U. K.); Paul R. Lundgren (Northwestern University, Chicago, III.), to study geophysics at the National Institute of Geophysics, Rome; James Webster (U.S. Geological Survey, Reston, Va.), to study experiment petrology at the University of Edinburgh, U.K.; and Joseph R. Pawlik (Scripps Institution of Oceanography, La Jolla, Calif.), to study biological oceanography at the Marine Science Laboratories, Menai Bridge, U.K.

  18. ORNL/NSF elementary science leadership leadership institute

    SciTech Connect

    Lashley, T.L.

    1994-12-31

    Begun as a Teacher Enhancement Project in 1990, Oak Ridge National Laboratory (ORNL) is now hosting as annual four-week Elementary Science Leadership summer institute for twenty-five teacher/administrator participants. During 1993-95 summer institutes, the participants receive instruction in science/math content, pedagogy, leadership training, and evaluation techniques. Science topics and instruction will be selected from the best available resources at ORNL, pedagogy and evaluation techniques will be directed by the University of Tennessee`s College of Education, and leadership training will be based on established leadership training models. During the academic year component, participants will: (1) share new math/science knowledge and curriculum with their students and fellow teachers while continuing to develop additional curriculum to share with other Leadership Institute participants, (2) work with the established state-wide advisory group to contribute to systemic reform in math/science education, and (3) prepare and deliver NSF leadership Institute-related math/science presentations at local and state educational conferences. Graduate credit for summer and academic-year participation in the NSF Leadership Institute will be offered through the University of Tennessee at Knoxville.

  19. Application and commercialization of flow cytometrically sex-sorted semen.

    PubMed

    Rath, D; Johnson, L A

    2008-07-01

    The current technology to sort X and Y chromosome bearing sperm population requires individual identification and selection of spermatozoa in a modified high-speed flow cytometer. For farm animal species, the technology is capable of producing sexed sperm at greater than 90% purity. However, only in the bovine, the technology has reached a developmental level that allows its commercial application. Meanwhile, the demand for female calves has grown rapidly, which encourages the demand for sex-sorted semen from high genetic value bulls. The success of the technology will depend mainly on the fertilizing capacity of the sorted spermatozoa, as this is the most affecting and economically relevant factor. To date, fertility is still variable and is quite dependent on post-sort processing. New processing techniques are under investigation and will likely be able to improve the fertility rates after AI with sex-sorted semen. It is of great importance to select the right bulls and to test the sorted samples on a routine basis. In addition to the demand for sex-sorted semen by the cattle industry, there is also a significant demand expressed by pig farmers. However, it is still unknown if the use of sex-sorted semen through commercial pig AI will be economically feasible. For the pig, the combination of in vitro fertilization with sexed semen and non-surgical embryo transfer is an alternative that merits further scientific attention. Recent developments in ovine AI and ET will make it very likely that commercial sheep industry will adopt the sexing technology in their breeding concepts.

  20. Sorting fluorescent nanocrystals with DNA

    SciTech Connect

    Gerion, Daniele; Parak, Wolfgang J.; Williams, Shara C.; Zanchet, Daniela; Micheel, Christine M.; Alivisatos, A. Paul

    2001-12-10

    Semiconductor nanocrystals with narrow and tunable fluorescence are covalently linked to oligonucleotides. These biocompounds retain the properties of both nanocrystals and DNA. Therefore, different sequences of DNA can be coded with nanocrystals and still preserve their ability to hybridize to their complements. We report the case where four different sequences of DNA are linked to four nanocrystal samples having different colors of emission in the range of 530-640 nm. When the DNA-nanocrystal conjugates are mixed together, it is possible to sort each type of nanoparticle using hybridization on a defined micrometer -size surface containing the complementary oligonucleotide. Detection of sorting requires only a single excitation source and an epifluorescence microscope. The possibility of directing fluorescent nanocrystals towards specific biological targets and detecting them, combined with their superior photo-stability compared to organic dyes, opens the way to improved biolabeling experiments, such as gene mapping on a nanometer scale or multicolor microarray analysis.

  1. Sorted.

    PubMed

    Towers, S

    1997-04-01

    Each year in Accident and Emergency an increasing number of young people present with acute problems related to social drugs. These problems range from mild symptoms to life-threatening conditions, many of which can be extremely difficult and time consuming for staff to manage. It has become apparent that as with sex the experimental age for taking drugs is getting younger as youths are now far more 'streetwise' than their predecessors. This is one of the main reasons for this paper being written; it is imperative that staff are equipped with the appropriate knowledge to deal with the challenge and are educated about the problems associated with current drug trends. This potentially improves the quality of care and, in turn, good communication improves relationships. Ecstasy is once again becoming increasingly popular within mainstream clubs, as recently highlighted in the media, and with it reappear its problems. This article discusses the historical aspects of Ecstasy and aims to educate staff about its use and effects and provides health promotion advice for those who are involved in the care of people who take Ecstasy.

  2. Word Sorts for General Music Classes

    ERIC Educational Resources Information Center

    Cardany, Audrey Berger

    2015-01-01

    Word sorts are standard practice for aiding children in acquiring skills in English language arts. When included in the general music classroom, word sorts may aid students in acquiring a working knowledge of music vocabulary. The author shares a word sort activity drawn from vocabulary in John Lithgow's children's book "Never Play…

  3. Cargo selectivity of yeast sorting nexins.

    PubMed

    Bean, Björn D M; Davey, Michael; Conibear, Elizabeth

    2017-02-01

    Sorting nexins are PX domain-containing proteins that bind phospholipids and often act in membrane trafficking where they help to select cargo. However, the functions and cargo specificities of many sorting nexins are unknown. Here, a high-throughput imaging screen was used to identify new sorting nexin cargo in the yeast Saccharomyces cerevisiae. Deletions of 9 different sorting nexins were screened for mislocalization of a set of green fluorescent protein (GFP)-tagged membrane proteins found at the plasma membrane, Golgi or endosomes. This identified 27 proteins that require 1 or more sorting nexins for their correct localization, 23 of which represent novel sorting nexin cargo. Nine hits whose sorting was dependent on Snx4, the sorting nexin-containing retromer complex, or both retromer and Snx3, were examined in detail to search for potential sorting motifs. We identified cytosolic domains of Ear1, Ymd8 and Ymr010w that conferred retromer-dependent sorting on a chimeric reporter and identified conserved residues required for this sorting in a functional assay. This work defined a consensus sequence for retromer and Snx3-dependent sorting.

  4. Past and Future: NSF PAARE at SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, Sean D.; Cash, Jennifer; Hartmann, Dieter; Hinkle, Kenneth H.; Ho, Shirley; Howell, Steve B.; King, Jeremy R.; Leising, Mark D.; Mighell, Kenneth J.; Smith, Daniel M.

    2015-01-01

    We review our progress to date and the path forward under the NSF program 'Partnerships in Astronomy and Astrophysics Research and Education (PAARE)'. Our project 'A Partnership in Observational and Computational Astronomy (POCA)' was a part of the 2008 PAARE cohort and in August 2014 we received a second award (POCA II) to continue for another three years. Our partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory as well as individual investigators at NASA Ames and Carnegie Mellon University. We present our recent publications which include educational courseware in cosmology, a study of long-period variables using Kepler and spectroscopic variability of peculiar stars. Our graduate student successes include support for two females who have completed their Ph.Ds. in astronomy plus two additional students from underrepresented groups who have received their M.S. degrees in astronomy but are continuing their doctoral work in related fields. At SC State we have graduated 3 physics majors with the astronomy option with five more in the pipeline and review the challenges and obstacles faced along the way. We discuss our strategic plan for POCA II, which is based on lessons learned under POCA and moves us forward to the follow-on period when our efforts will be sustained by other resources.Our support includes NSF awards AST-0750814 and AST-1358913 to South Carolina State University as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under awards NNX11AB82G and NNX13AC24G. Additional details can be found at: http://physics.scsu.edu/paare/

  5. NSF ADVANCE: Institutional Transformation to Achieve Faculty Diversity

    NASA Astrophysics Data System (ADS)

    Anthony, E. Y.

    2004-12-01

    The NSF ADVANCE initiative is designed to enhance gender equity in academic science and engineering faculty. One of its components - Institutional Transformation - has the goal of establishing strategies and policies that will revolutionize institutional climate so that diverse faculty flourish. The University of Texas at El Paso is one of 19 institutions to currently hold a 5-year grant under the Institutional Transformation program. This poster presentation highlights practices from the participating institutions. Two general aspects of the program are: 1) co-principal investigators are a blend of administrators and active researchers. This blend ensures a bottom-up, top-down approach to presenting gender equity to faculty. 2) Many of the investigators have diversity as their research focus, which is intended to result in rigorous, peer-reviewed dissemination of institutional results. Specific effors for all institutions relate to recruitment, retention, and advancement of female faculty and, by establishing equitable conditions, to improvement of the workplace for all faculty. To aid recruitment, institutions have committed faculty involved in the search process, including training of search committees in diversity strategies and interaction with candidates. A close working relationship with the campus EO officer is essential. Retention strategies center on mentoring, monetary support for research, and policy implementation. Policies focus on work-family balance. Advancement of females to important administrative and non-administrative leadership roles is the third focus. Workshops and seminars on leadership skills are common in the various institutions. Finally, a central theme of the program is that, in addition to specific strategies, institutions must articulate diversity as a core value and reflect on the means to actualize this value. More information on the NSF ADVANCE program, including links to the Institutional Transformation grantees, may be found on

  6. Geoscience Workforce Development at UNAVCO: Leveraging the NSF GAGE Facility

    NASA Astrophysics Data System (ADS)

    Morris, A. R.; Charlevoix, D. J.; Miller, M.

    2013-12-01

    Global economic development demands that the United States remain competitive in the STEM fields, and developing a forward-looking and well-trained geoscience workforce is imperative. According to the Bureau of Labor Statistics, the geosciences will experience a growth of 19% by 2016. Fifty percent of the current geoscience workforce is within 10-15 years of retirement, and as a result, the U.S. is facing a gap between the supply of prepared geoscientists and the demand for well-trained labor. Barring aggressive intervention, the imbalance in the geoscience workforce will continue to grow, leaving the increased demand unmet. UNAVCO, Inc. is well situated to prepare undergraduate students for placement in geoscience technical positions and advanced graduate study. UNAVCO is a university-governed consortium facilitating research and education in the geosciences and in addition UNAVCO manages the NSF Geodesy Advancing Geosciences and EarthScope (GAGE) facility. The GAGE facility supports many facets of geoscience research including instrumentation and infrastructure, data analysis, cyberinfrastructure, and broader impacts. UNAVCO supports the Research Experiences in the Solid Earth Sciences for Students (RESESS), an NSF-funded multiyear geoscience research internship, community support, and professional development program. The primary goal of the RESESS program is to increase the number of historically underrepresented students entering graduate school in the geosciences. RESESS has met with high success in the first 9 years of the program, as more than 75% of RESESS alumni are currently in Master's and PhD programs across the U.S. Building upon the successes of RESESS, UNAVCO is launching a comprehensive workforce development program that will network underrepresented groups in the geosciences to research and opportunities throughout the geosciences. This presentation will focus on the successes of the RESESS program and plans to expand on this success with broader

  7. Update on the NSF PAARE Program at SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Ajello, Marco; Brittain, Sean D.; Cash, Jennifer; Hartmann, Dieter; Ho, Shirley; Howell, Steve B.; King, Jeremy R.; Leising, Mark D.; Smith, Daniel M.

    2017-01-01

    We report on results from our NSF PAARE program during Year 2 of the project. Our partnership under this PAARE award includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) as well as individual investigators at NASA Ames and Carnegie Mellon University. Our recent work on variable and peculiar stars, work with the Kepler Observatory and our educational products in cosmology for non-STEM majors will be presented. We have successfully piloted sharing our teaching resources by offering an upper-level astrophysics course taught at Clemson via video conferencing , allowing a graduating senior from SC State to take a course not available through his home institution. Additionally, we are working on a memorandum of agreement between the two institutions that will allow for the seamless transfer of an undergraduate from SC State to Clemson’s graduate program in physics and astronomy. Our curriculum work includes new web-based cosmology activities and laboratory experiments. SC State undergraduates are reporting at this conference on their work with the light curves of semiregular variables using Kepler data. Additionally, we are heavily involved in the Citizen CATE Experiment. A PAARE scholarship student from SC State and the PAARE PI traveled to Indonesia for the March 2016 solar eclipse. Their results are also being presented elsewhere at this conference (see Myles McKay’s poster). Support for this work includes our NSF PAARE award AST-1358913 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Additional support has been provided by the South Carolina Space Grant Consortium and from NASA to SC State under awards NNX11AB82G and NNX13AC24G. CATE work has been supported by NASA SMD award NNX16AB92A to the National Solar Observatory. Additional details can be found at: http://physics.scsu.edu

  8. Viability and DNA fragmentation in differently sorted boar spermatozoa.

    PubMed

    De Ambrogi, M; Spinaci, M; Galeati, G; Tamanini, C

    2006-11-01

    Sperm cell defense against DNA damage relies on two factors: the tight packaging of chromatin, based on condensation and substitution of histones with protamines, and the antioxidant agents present in seminal plasma. These defenses are extremely important as mature sperm is unable to repair DNA damage and even if a successful fertilization occurs, embryo undergoes apoptosis at the time of genomic activation. Sex-sorting exposes spermatozoa to stress sources such as high pressure, laser beam and electrical charge. The aim of this work was to determine how sorting procedures affect viability and DNA integrity in boar spermatozoa, by using the newly developed Sperm-Sus-Halomax. Four sperm populations were considered: CONTROL (no treatment), REAL (sex-sorted semen), BULK (semen sorted without sex separation) and NO LASER (semen only exposed to the high pressure, but including also cells normally discarded from sex-sorting). A significantly (P=0.019) lower viability in NO LASER (64.71%) than in CONTROL (78.6%) and REAL (80.5%) groups was found; this was accompanied by a significantly (P=0.001) higher DNA fragmentation index (DFI) in NO LASER group (6.86%) respect to CONTROL (3.30%) and REAL (3.42%) groups. BULK group did not show any difference in viability or DFI as compared to the other groups. In conclusion, we may believe that sex-sorting procedure as a whole does not affect either viability or DFI and that shear mechanical forces are a relevant source of DNA damage for sorted semen.

  9. NRAO Response to NSF Senior Review of Astronomy Facilities

    NASA Astrophysics Data System (ADS)

    2006-11-01

    The National Science Foundation's (NSF) Astronomy Senior Review Committee report (pdf file), released today, made major recommendations for restructuring the NSF's ground-based astronomy efforts, including significant changes for the National Radio Astronomy Observatory (NRAO). The committee's report urged that leadership in radio astronomy, including millimeter- and submillimeter-wave observatories, "remain centered at NRAO as it is, by far, the largest radio astronomy organization in the world." The report praised the record of management of NRAO and the scientific capabilities of the Atacama Large Millimeter/submillimeter Array (ALMA), the Expanded Very Large Array (EVLA), the Robert C. Byrd Green Bank Telescope (GBT), and the Very Long Baseline Array (VLBA). However, the report also recommended that some reductions and changes occur at the NRAO by 2011. Specifically, the report recommended that: (a) VLBA operations make a transition to a significant reliance on international funding or risk closure; (b) GBT operations costs be reduced; and (c) NRAO scientific staff costs be reduced. "The Senior Review Committee had the very difficult task of reconciling the needs of current facilities and funding new facilities for the future of astronomy. We appreciate their efforts and look forward to working with the NSF to ensure that the valuable and unique research capabilities of our NRAO telescopes continue to serve the astronomical community," said Dr. Fred K.Y. Lo, NRAO Director. The VLBA provides the greatest angular resolution, or ability to see fine detail, of any telescope in the world, greatly exceeding the capabilities of the Hubble Space Telescope and the future Square Kilometre Array. The committee recognized that, "if the VLBA is closed, a unique capability would likely be lost for decades." "The VLBA is used by scientists from around the world because of its unique capabilities. It has produced landmark research milestones and the committee recognized in its

  10. Neonatal Intensive-Care Unit Graduates Show Persistent Difficulties in an Intradimensional Shift Card Sort

    ERIC Educational Resources Information Center

    Kittler, Phyllis M.; Brooks, Patricia J.; Rossi, Vanessa; Karmel, Bernard Z.; Gardner, Judith M.; Flory, Michael J.

    2013-01-01

    Neonatal intensive-care unit (NICU) graduates, a group at risk for attention problems and attention-deficit hyperactivity disorder, performed an intradimensional shift card sort at 34, 42, 51, and 60 months to assess executive function and to examine effects of individual risk factors. In the "silly" game, children sorted cards…

  11. Viable cell sorting of dinoflagellates by multi-parametric flow cytometry.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Electronic cell sorting for isolation and culture of dinoflagellates and other marine eukaryotic phytoplankton was compared to the traditional method of manually picking of cells using a micropipette. Trauma to electronically sorted cells was not a limiting factor as fragile dinoflagellates, such a...

  12. Geosciences at the NSF: Opportunities, Approaches, Partnerships, and Plans

    NASA Astrophysics Data System (ADS)

    Killeen, T. L.

    2008-12-01

    The National Science Foundation's Geosciences Directorate (GEO) has worked with community leaders over the past year to develop and refine a new strategic vision for the next decade - GEOVision 2008. GEO's three scientific divisions (EAR, OCE and ATM), together with a family of complementary education and outreach programs, map extremely well into the scientific and educational interests of the AGU's membership. NSF/GEO plays a special role for the AGU community through its long-term commitment to the many programs that support basic disciplinary and interdisciplinary research and education in the geosciences. The Directorate also plays a leading role in the development of strong inter-agency, intra-agency, and international partnerships that further support geoscience research. During the next ten years, significant new facilities and capabilities will be realized that will help transform the field and many scientific breakthroughs and discoveries will undoubtedly be made through the mechanism of peer-reviewed basic research. This presentation will highlight both the opportunities and mandates that are in the new plan and will place GEOVision 2008 in the context of exciting ongoing research and important demographic and other trends.

  13. NSF nanomanufacturing program and its implications for measurement and control

    NASA Astrophysics Data System (ADS)

    Cooper, Khershed P.

    2013-09-01

    The NSF Nanomanufacturing Program supports fundamental research in novel methods and techniques for batch and continuous processes, and top-down and bottom-up processes leading to the formation of complex nanostructures, nanodevices and nanosystems. The program leverages advances in the understanding of nano-scale phenomena and processes, nanomaterials discovery, novel nanostructure architectures, innovative nanodevice and nanosystem design. It seeks to address issues such as quality, efficiency, scalability, reliability, safety and affordability. The program encourages research in the development of new nano-scale processes and production systems based on computation, modeling and simulation and use of process sensing, monitoring, and control. Research in instrumentation and metrology is an integral part of the program. Additionally, the program supports education of the next generation of researchers, and encourages building a workforce trained in nanotechnology and nanomanufacturing systems. It is also interested in understanding long-term societal implications of large-scale production and use of nano-scale materials. For this, it encourages the development of standards. This paper will describe the program philosophy.

  14. Application of visible spectroscopy in waste sorting

    NASA Astrophysics Data System (ADS)

    Spiga, Philippe; Bourely, Antoine

    2011-10-01

    Today, waste recycling, (bottles, papers...), is a mechanical operation: the waste are crushed, fused and agglomerated in order to obtain new manufactured products (e.g. new bottles, clothes ...). The plastics recycling is the main application in the color sorting process. The colorless plastics recovered are more valuable than the colored plastics. Other emergent applications are in the paper sorting, where the main goal is to sort dyed paper from white papers. Up to now, Pellenc Selective Technologies has manufactured color sorting machines based on RGB cameras. Three dimensions (red, green and blue) are no longer sufficient to detect low quantities of dye in the considered waste. In order to increase the efficiency of the color detection, a new sorting machine, based on visible spectroscopy, has been developed. This paper presents the principles of the two approaches and their difference in terms of sorting performance, making visible spectroscopy a clear winner.

  15. Curriculum Reform and the NSF Engineering Education Coalitions: A Case Study.

    ERIC Educational Resources Information Center

    Serow, Robert C.; And Others

    This paper presents the findings from an evaluation of SUCCEED (Southwestern University and College Coalition for Engineering Education), a National Science Foundation (NSF) coalition. The presentation is made in several stages: (1) a review of the background and goals of the NSF coalitions, SUCCEED in particular; (2) a discussion of the methods…

  16. 45 CFR 650.14 - Request for conveyance of title to NSF.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 45 Public Welfare 3 2011-10-01 2011-10-01 false Request for conveyance of title to NSF. 650.14 Section 650.14 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION PATENTS § 650.14 Request for conveyance of title to NSF. (a) The procedures established by...

  17. 75 FR 63450 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-15

    .../NSF High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory... CONTACT: John Kogut, Executive Secretary; High Energy Physics Advisory Panel; U.S. Department of...

  18. National Science Foundation Fiscal Year 1986 Awards (by State and NSF Directorate).

    ERIC Educational Resources Information Center

    National Science Foundation, Washington, DC.

    Provided is a listing of National Science Foundation (NSF) program grants and contracts awarded in Fiscal Year 1986. Data, current as of Feburary 13, 1987, are arranged as follows: (1) by state, with totals for each state (foreign countries are alphabetized with states); (2) by NSF Directorate, with award and dollar totals for each NSF…

  19. 45 CFR 689.5 - Initial NSF handling of misconduct matters.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... FOUNDATION RESEARCH MISCONDUCT § 689.5 Initial NSF handling of misconduct matters. (a) NSF staff who learn of... time proceed with its own inquiry. (e) If OIG proceeds with its own inquiry it will normally complete the inquiry no more than 90 days after initiating it. (f) On the basis of what it learns from...

  20. 45 CFR 650.14 - Request for conveyance of title to NSF.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 45 Public Welfare 3 2012-10-01 2012-10-01 false Request for conveyance of title to NSF. 650.14 Section 650.14 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION PATENTS § 650.14 Request for conveyance of title to NSF. (a) The procedures established by...

  1. 45 CFR 650.14 - Request for conveyance of title to NSF.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 45 Public Welfare 3 2014-10-01 2014-10-01 false Request for conveyance of title to NSF. 650.14 Section 650.14 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION PATENTS § 650.14 Request for conveyance of title to NSF. (a) The procedures established by...

  2. NSF Internships in Public Science Education: Sensing the Radio Sky

    NASA Astrophysics Data System (ADS)

    Hund, L.; Boltuch, D.; Fultz, C.; Buck, S.; Smith, T.; Harris, R.; Moffett, D.; LaFratta, M.; Walsh, L.; Castelaz, M. W.

    2005-12-01

    The intent of the "Sensing the Radio Sky" project is to teach high school students the concepts and relevance of radio astronomy through presentations in STARLAB portable planetariums. The two year project began in the summer of 2004. A total of twelve interns and four faculty mentors from Furman University and UNCA have participated at the Pisgah Astronomical Research Institute to develop the Radio Sky project. The project united physics and multimedia majors and allowed these students to apply their knowledge of different disciplines to a common goal. One component of the project is the development and production of a cylinder to be displayed in portable STARLAB planetariums. The cylinder gives a thorough view of the Milky Way and of several other celestial sources in radio wavelengths, yet these images are difficult to perceive without prior knowledge of radio astronomy. Consequently, the Radio Sky team created a multimedia presentation to accompany the cylinder. This multimedia component contains six informative lessons on radio astronomy assembled by the physics interns and numerous illustrations and animations created by the multimedia interns. The cylinder and multimedia components complement each other and provide a unique, thorough, and highly intelligible perspective on radio astronomy. The project is near completion and the final draft will be sent to Learning Technologies, Inc., for marketing to owners of STARLAB planetariums throughout the world. The development of the Radio Sky project has also provided a template for potential similar projects that examine our universe in different wavelengths, such as gamma ray, x-ray, and infrared. We acknowledge support from the NSF Internship in Public Science Education Program grant number 0324729.

  3. NSF scientific and funding priorities in Earth sciences

    NASA Astrophysics Data System (ADS)

    Speidel, David H.; MacGregor, Ian D.

    The Earth Science Division (EAR) of the National Science Foundation provides about two-thirds of the funding for basic geological scientific research at academic institutions in the United States. This funding is provided through three budget units: Earth Science Project Support, which funds individual researchers; Instrumentation and Facilities, for the support of research equipment for individual investigators and larger facilities for shared use; and Continental Lithosphere, for the support of large multidisciplinary and multiinstitutional studies of the continental lithosphere.The latter two programs, established in 1984, open opportunities for new styles of research not previously available through the programs for individual investigators. From 1980 to 1988, the EAR budget increased from $25.98 million to $51.29 million, allowing the number of awards per year during that period to double. Over the same period, applications more than doubled, leading to a decline in the success rate from over 40% to less than 30%. Similarly, average award size increased but at a rate less than inflation. Congressional appropriations for EAR have been significantly less than the amounts requested in the President's budget r8—Hi-⅞ for NSF in the last 4 fiscal years, thus stalling the ability of the division to increase both the success rate and the amounts of individual grants and to move forward with a fully diversified research agenda. In 1986 the Advisory Committee for Earth Sciences (ACES), the official external advisor to the EAR scientific staff, reexamined this diversified agenda and began to develop a set of long-range scientific and fiscal priorities.

  4. CAISE: A NSF Resource Center for Informal Science Education

    NASA Astrophysics Data System (ADS)

    Dickow, Benjamin

    2012-01-01

    Informal science education (ISE) is playing an increasingly important role in how and where the public engages with science. A growing body of research is showing that people learn the majority of their science knowledge outside of school (Falk & Dierking, 2010). The ISE field includes a wide variety of sources, including the internet, TV programs, magazines, hobby clubs and museums. These experiences touch large numbers of people throughout their lifetimes. If you would like to share your research with the public, ISE can be an effective conduit for meaningful science communication. However, because the ISE field is so diverse, it can be overwhelming with its multiple entry points. If you already are part of an ISE initiative, knowing how to access the most useful resources easily can also be daunting. CAISE, the Center for Advancement of Informal Science Education, is a resource center for the ISE field funded by the National Science Foundation (NSF). CAISE can help connect you to the knowledge and people of ISE, through its website, products and in-person convenings. The proposed CAISE presentation will outline the diversity of the field and concisely present data that will make the case for the impact of ISE. We will focus on examples of successful programs that connect science with the public and that bring together AAS's science research community with practitioners and researchers within ISE. Pathways to various ISE resources in the form of current CAISE initiatives will be described as well. The presentation will include an interview section in which a CAISE staff member will ask questions of a scientist involved in an ISE initiative in order to detail one example of how ISE can be a valuable tool for engaging the public in science. Time for audience Q&A also will be included in the session.

  5. Flotillins bind to the dileucine sorting motif of β-site amyloid precursor protein-cleaving enzyme 1 and influence its endosomal sorting.

    PubMed

    John, Bincy A; Meister, Melanie; Banning, Antje; Tikkanen, Ritva

    2014-04-01

    The β-site amyloid precursor protein-cleaving enzyme 1 (BACE1) is a protease that participates in the amyloidogenic cleavage of the Alzheimer amyloid precursor protein. Trafficking of BACE1 has been shown to be largely mediated by an acidic cluster dileucine motif in its cytoplasmic tail. This sorting signal functions both in endocytosis and endosomal sorting/recycling of BACE1 by providing a binding site for various sorting factors, such as the Golgi-localizing γ-ear containing ADP ribosylation factor binding (GGA) proteins that mediate BACE1 sorting within endosomes. Because flotillin-1 has been suggested to bind to BACE1 cytoplasmic tail, we analyzed the role of flotillins in BACE1 sorting. We show that flotillin-1 directly binds to the dileucine motif in the cytoplasmic tail of BACE1, whereas flotillin-2 binding is mainly mediated by its interaction with flotillin-1. Depletion of flotillins results in altered subcellular localization of BACE1 in endosomes and stabilization of BACE1 protein. Furthermore, amyloidogenic processing of Alzheimer amyloid precursor protein is increased. Flotillins compete with GGA proteins for binding to the dileucine motif in the BACE1 tail, suggesting that they play an important role in endosomal sorting of BACE1. The present study shows for the first time that flotillins are involved in endosomal sorting of BACE1. Because the endosomal localization of BACE1 affects its function as the β-secretase by increasing amyloidogenic processing of the amyloid precursor protein, flotillins may play a novel role in Alzheimer's disease. The present study is the first to show that flotillins bind to a canonical sorting signal and influence the binding of endosomal sorting factors onto cargo tails.

  6. Brokering technologies to realize the hydrology scenario in NSF BCube

    NASA Astrophysics Data System (ADS)

    Boldrini, Enrico; Easton, Zachary; Fuka, Daniel; Pearlman, Jay; Nativi, Stefano

    2015-04-01

    In the National Science Foundation (NSF) BCube project an international team composed of cyber infrastructure experts, geoscientists, social scientists and educators are working together to explore the use of brokering technologies, initially focusing on four domains: hydrology, oceans, polar, and weather. In the hydrology domain, environmental models are fundamental to understand the behaviour of hydrological systems. A specific model usually requires datasets coming from different disciplines for its initialization (e.g. elevation models from Earth observation, weather data from Atmospheric sciences, etc.). Scientific datasets are usually available on heterogeneous publishing services, such as inventory and access services (e.g. OGC Web Coverage Service, THREDDS Data Server, etc.). Indeed, datasets are published according to different protocols, moreover they usually come in different formats, resolutions, Coordinate Reference Systems (CRSs): in short different grid environments depending on the original data and the publishing service processing capabilities. Scientists can thus be impeded by the burden of discovery, access and normalize the desired datasets to the grid environment required by the model. These technological tasks of course divert scientists from their main, scientific goals. The use of GI-axe brokering framework has been experimented in a hydrology scenario where scientists needed to compare a particular hydrological model with two different input datasets (digital elevation models): - the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) dataset, v.2. - the Shuttle Radar Topography Mission (SRTM) dataset, v.3. These datasets were published by means of Hyrax Server technology, which can provide NetCDF files at their original resolution and CRS. Scientists had their model running on ArcGIS, so the main goal was to import the datasets using the available ArcPy library and have EPSG:4326 with the same resolution grid as the

  7. The NSF-RCN Urban Heat Island Network

    NASA Astrophysics Data System (ADS)

    Twine, T. E.; Snyder, P. K.; Hamilton, P.; Shepherd, M.; Stone, B., Jr.

    2015-12-01

    In much of the world cities are warming at twice the rate of outlying rural areas. The frequency of urban heat waves is projected to increase with climate change through the 21st century. Addressing the economic, environmental, and human costs of urban heat islands requires a better understanding of their behavior from many disciplinary perspectives. The goal of this four-year Urban Heat Island Network is to (1) bring together scientists studying the causes and impacts of urban warming, (2) advance multidisciplinary understanding of urban heat islands, (3) examine how they can be ameliorated through engineering and design practices, and (4) share these new insights with a wide array of stakeholders responsible for managing urban warming to reduce their health, economic, and environmental impacts. The NSF-RCN Urban Heat Island Network involves atmospheric scientists, engineers, architects, landscape designers, urban planners, public health experts, and education and outreach experts, who will share knowledge, evaluate research directions, and communicate knowledge and research recommendations to the larger research community as well as stakeholders engaged in developing strategies to adapt to and mitigate urban warming. The first Urban Climate Institute was held in Saint Paul, MN in July 2013 and focused on the characteristics of urban heat islands. Scientists engaged with local practitioners to improve communication pathways surrounding issues of understanding, adapting to, and mitigating urban warming. The second Urban Climate Institute was held in Atlanta, Georgia in July 2014 and focused on urban warming and public health. The third Urban Climate Institute was held in Athens, GA in July 2015 and focused on urban warming and the role of the built environment. Scientists and practitioners discussed strategies for mitigation and adaptation. Evaluation experts at the Science Museum of Minnesota have extensively evaluated the Institutes to inform other research

  8. Data parallel sorting for particle simulation

    NASA Technical Reports Server (NTRS)

    Dagum, Leonardo

    1992-01-01

    Sorting on a parallel architecture is a communications intensive event which can incur a high penalty in applications where it is required. In the case of particle simulation, only integer sorting is necessary, and sequential implementations easily attain the minimum performance bound of O (N) for N particles. Parallel implementations, however, have to cope with the parallel sorting problem which, in addition to incurring a heavy communications cost, can make the minimun performance bound difficult to attain. This paper demonstrates how the sorting problem in a particle simulation can be reduced to a merging problem, and describes an efficient data parallel algorithm to solve this merging problem in a particle simulation. The new algorithm is shown to be optimal under conditions usual for particle simulation, and its fieldwise implementation on the Connection Machine is analyzed in detail. The new algorithm is about four times faster than a fieldwise implementation of radix sort on the Connection Machine.

  9. Active droplet sorting in microfluidics: a review.

    PubMed

    Xi, Heng-Dong; Zheng, Hao; Guo, Wei; Gañán-Calvo, Alfonso M; Ai, Ye; Tsao, Chia-Wen; Zhou, Jun; Li, Weihua; Huang, Yanyi; Nguyen, Nam-Trung; Tan, Say Hwa

    2017-02-28

    The ability to manipulate and sort droplets is a fundamental issue in droplet-based microfluidics. Various lab-on-a-chip applications can only be realized if droplets are systematically categorized and sorted. These micron-sized droplets act as ideal reactors which compartmentalize different biological and chemical reagents. Array processing of these droplets hinges on the competence of the sorting and integration into the fluidic system. Recent technological advances only allow droplets to be actively sorted at the rate of kilohertz or less. In this review, we present state-of-the-art technologies which are implemented to efficiently sort droplets. We classify the concepts according to the type of energy implemented into the system. We also discuss various key issues and provide insights into various systems.

  10. Sorting by reciprocal translocations via reversals theory.

    PubMed

    Ozery-Flato, Michal; Shamir, Ron

    2007-05-01

    The understanding of genome rearrangements is an important endeavor in comparative genomics. A major computational problem in this field is finding a shortest sequence of genome rearrangements that transforms, or sorts, one genome into another. In this paper we focus on sorting a multi-chromosomal genome by translocations. We reveal new relationships between this problem and the well studied problem of sorting by reversals. Based on these relationships, we develop two new algorithms for sorting by reciprocal translocations, which mimic known algorithms for sorting by reversals: a score-based method building on Bergeron's algorithm, and a recursive procedure similar to the Berman-Hannenhalli method. Though their proofs are more involved, our procedures for reciprocal translocations match the complexities of the original ones for reversals.

  11. A hybrid dielectrophoretic and hydrophoretic microchip for particle sorting using integrated prefocusing and sorting steps.

    PubMed

    Yan, Sheng; Zhang, Jun; Yuan, Yuan; Lovrecz, George; Alici, Gursel; Du, Haiping; Zhu, Yonggang; Li, Weihua

    2015-01-01

    This work explores dielectrophoresis (DEP)-active hydrophoresis in sorting particles and cells. The device consists of prefocusing region and sorting region with great potential to be integrated into advanced lab-on-a-chip bioanalysis devices. Particles or cells can be focused in the prefocusing region and then sorted in the sorting region. The DEP-active hydrophoretic sorting is not only based on size but also on dielectric properties of the particles or cells of interest without any labelling. A mixture of 3 and 10 μm particles were sorted and collected from corresponding outlets with high separation efficiency. According to the different dielectric properties of viable and nonviable Chinese Hamster Ovary (CHO) cells at the medium conductivity of 0.03 S/m, the viable CHO cells were focused well and sorted from cell sample with a high purity.

  12. Battling the GPA Bias: Selecting NSF-REU Participants for Transformative Research Experiences

    NASA Astrophysics Data System (ADS)

    Smith, M.; Kim, C. S.; Osborn, J.

    2014-12-01

    Student grade point average (GPA) is one of the most common metrics used to select REU participants, with >85% of NSF-funded research participants nationally having an average GPA at or above 3.0 (Russell, 2004). Yet, as efforts are made to expand and diversify the pool of undergraduates participating in research experiences, privileging candidates with GPAs above 3.0 may exclude promising STEM students who can most benefit from a research experience, including community college students and recent transfer students from community colleges. Myriad factors that impinge on student GPAs are salient in the literature, including (1) early academic failure related to pre-college under-preparation (Feldman, 1993); (2) transfer shock (Molinaro, 2014; Diaz, 1992); (3) employment (DeSimone, 2008); (4) limited social support for academic pursuits (Cheng, Ickes, & Verhofstadt, 2012); (5) food insecurity (Maroto, 2013); and inadequate advising (Pascarella & Terenzini, 2005). A discussion of these factors with examples from student transcripts and an overview of a scoring rubric that minimizes GPA bias and can assist PIs with an alternate approach to participant selection will be included in this session.

  13. Automated multi-parametric sorting of micron-sized particles via multi-trap laser tweezers

    NASA Astrophysics Data System (ADS)

    Kaputa, Daniel S.

    The capabilities of laser tweezers have rapidly expanded since the first demonstration by Ashkin and co-workers in 1970 of the ability to trap particles using optical energy. Laser tweezers have been used to measure piconewton forces in many biological and material science application, sort bacteria, measure DNA bond strength, and even perform microsurgery. The laser tweezers system developed for this dissertation foreshadows the next generation of laser tweezer systems that provide automated particle sorted based upon multiple criteria. Many laser tweezer sorting applications today entail the operator sorting cells from a bulk sample, one by one. This dissertation demonstrates the technologies of pattern recognition and image processing that allow for an entire microscope slide to be sorted without any operator intervention. We already live in an automated world where the cars we drive are built by machines instead of humans. The technology is there, and the only factors limiting the advancements of fully automated biological instrumentation is the lack of developers with the appropriate knowledge sets. This dissertation introduces the concept of sorting particles via a multi-parametric approach where several parameters such as size, fluorescence, and Raman spectra are used as sorting criteria. Since the advent of laser tweezers, several groups have demonstrated the ability to sort cells and other particle by size, or by fluorescence, or by any other parameter, but to our knowledge there does not exist a laser tweezer sorting system that can sort particles based upon multiple parameters. Sorting via a single parameter can be a severe limitation as the method lacks the robustness and class specificity that exists when sorting based upon multiple parameters. Simply put, it makes more sense to determine the worth of a baseball card by considering it's condition as well as it's age, rather then solely upon its condition. By adding another parameter such as the name of

  14. An Unsupervised Online Spike-Sorting Framework.

    PubMed

    Knieling, Simeon; Sridharan, Kousik S; Belardinelli, Paolo; Naros, Georgios; Weiss, Daniel; Mormann, Florian; Gharabaghi, Alireza

    2016-08-01

    Extracellular neuronal microelectrode recordings can include action potentials from multiple neurons. To separate spikes from different neurons, they can be sorted according to their shape, a procedure referred to as spike-sorting. Several algorithms have been reported to solve this task. However, when clustering outcomes are unsatisfactory, most of them are difficult to adjust to achieve the desired results. We present an online spike-sorting framework that uses feature normalization and weighting to maximize the distinctiveness between different spike shapes. Furthermore, multiple criteria are applied to either facilitate or prevent cluster fusion, thereby enabling experimenters to fine-tune the sorting process. We compare our method to established unsupervised offline (Wave_Clus (WC)) and online (OSort (OS)) algorithms by examining their performance in sorting various test datasets using two different scoring systems (AMI and the Adamos metric). Furthermore, we evaluate sorting capabilities on intra-operative recordings using established quality metrics. Compared to WC and OS, our algorithm achieved comparable or higher scores on average and produced more convincing sorting results for intra-operative datasets. Thus, the presented framework is suitable for both online and offline analysis and could substantially improve the quality of microelectrode-based data evaluation for research and clinical application.

  15. Colloidal sorting in dynamic optical lattices

    NASA Astrophysics Data System (ADS)

    Smith, Ryan L.; Spalding, G. C.; Dholakia, K.; MacDonald, M. P.

    2007-08-01

    Passive microfluidic sorting techniques based upon the interaction of particles with an optically defined potential energy landscape have possible advantages over active sorting techniques such as microfluorescence activated cell sorting (FACS), including ease of integration into lab-on-a-chip systems, reconfigurability, and scalability. Rather than analysing and deflecting a single-file stream of particles one by one, a passive approach intrinsically aimed at parallel processing may, ultimately, offer greater potential for high throughput. However attempts to sort many particles simultaneously in high density suspensions are inevitably limited by particle particle interactions, which lead to a reduction in the efficiency of the sorting. In this paper we describe two different approaches aimed at reducing colloidal traffic flow problems. We find that continuous translation of the sorting lattice helps to reduce nearest neighbour particle spacing, providing promise for efficiency improvements in future high throughput applications, and that a flashing lattice yields a reduction in unwanted pile-up and spillover effects which otherwise limit the efficiency of sorting.

  16. Manual sorting to eliminate aflatoxin from peanuts.

    PubMed

    Galvez, F C F; Francisco, M L D L; Villarino, B J; Lustre, A O; Resurreccion, A V A

    2003-10-01

    A manual sorting procedure was developed to eliminate aflatoxin contamination from peanuts. The efficiency of the sorting process in eliminating aflatoxin-contaminated kernels from lots of raw peanuts was verified. The blanching of 20 kg of peanuts at 140 degrees C for 25 min in preheated roasters facilitated the manual sorting of aflatoxin-contaminated kernels after deskinning. The manual sorting of raw materials with initially high aflatoxin contents (300 ppb) resulted in aflatoxin-free peanuts (i.e., peanuts in which no aflatoxin was detected). Verification procedures showed that the sorted sound peanuts contained no aflatoxin or contained low levels (<15 ppb) of aflatoxin. The results obtained confirmed that the sorting process was effective in separating contaminated peanuts whether or nor contamination was extensive. At the commercial level, when roasters were not preheated, the dry blanching of 50 kg of peanuts for 45 to 55 min facilitated the proper deskinning and subsequent manual sorting of aflatoxin-contaminated peanut kernels from sound kernels.

  17. Improved quality of sex-sorted sperm: a prerequisite for wider commercial application.

    PubMed

    Rath, D; Moench-Tegeder, G; Taylor, U; Johnson, L A

    2009-01-01

    To date the only successful method to sort sperm into X- and Y-chromosome-bearing populations is the Beltsville Sperm Sexing Technology. Fertility results continue to be variable even though the technology has been used in a commercial setting for nearly a decade. This is at least partly due to the reduced lifespan of sperm after sorting and freezing. Several technical and biological factors are responsible for this problem. Furthermore, to meet economic demands, only 10-15% of the number of sperm (compared to unsexed semen) are loaded in each straw, further limiting the chances for fertilization. A new protocol for preservation of bull sperm, utilizing Sexcess shows promise in extending the lifespan of sorted bull sperm. Motility and acrosome integrity are significantly increased using Sexcess. Conception rates achieved with heifers for those bulls tested with Sexcess and using a standard AI regime give results that do not differ from results achieved using regular AI. In addition to the improvements of the sorting technology itself, we recommend a thorough pre-selection of bulls. A reliable prediction method to determine whether a bull is suitable for a sex-sorting program still does not exist. Such a test is needed, especially for "custom sorting" programs. Currently, test sorts are the only means of obtaining information about the sorting efficiency of semen from a particular bull.

  18. Administration's Proposed NSF Budget Includes a 5.5% Increase for Geosciences

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2013-04-01

    The fiscal year (FY) 2014 proposed federal budget for the U.S. National Science Foundation (NSF) is $7.63 billion, 7.3% above the FY 2012 actual amount. NSF acting director Cora Marrett said the budget reflects the administration's recognition of NSF and the importance of funding basic research. "We are pleased about where we stand and hope that Congress will be just as pleased with the budget proposal and will help move things forward," she said during a meeting of the NSF Advisory Committee for Geosciences on 11 April. Budget comparisons are to FY 2012 because the 2013 appropriations were enacted at the end of March, less than 2 weeks before President Barack Obama sent the proposed budget to Congress.

  19. The Q sort theory and technique.

    PubMed

    Nyatanga, L

    1989-10-01

    This paper is based on the author's experience of using the Q sort technique with BA Social Sciences (BASS) students, and the community psychiatric nursing (CPN, ENB No 811 course). The paper focuses on two main issues: 1. The theoretical assumptions underpinning the Q Sort technique. Carl Rogers' self theory and some of the values of humanistic psychology are summarised. 2. The actual technique procedure and meaning of results are highlighted. As the Q Sort technique is potentially useful in a variety of sittings some of which are listed in this paper, the emphasis has deliberately been placed in understanding the theoretical underpinning and the operationalisation (sensitive interpretation) of the theory to practice.

  20. An improved infrared technique for sorting pecans

    NASA Astrophysics Data System (ADS)

    Graeve, Thorsten; Dereniak, Eustace L.; Lamonica, John A., Jr.

    1991-10-01

    This paper presents the results of a study of pecan spectral reflectances. It describes an experiment for measuring the contrast between several components of raw pecan product to be sorted. An analysis of the experimental data reveals high contrast ratios in the infrared spectrum, suggesting a potential improvement in sorting efficiency when separating pecan meat from shells. It is believed that this technique has the potential to dramatically improve the efficiency of current sorting machinery, and to reduce the cost of processing pecans for the consumer market.

  1. 13. SANDSORTING BUILDING, THIRD FLOOR, VIBRATING SCREENS FOR SAND SORTING, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. SAND-SORTING BUILDING, THIRD FLOOR, VIBRATING SCREENS FOR SAND SORTING, LOOKING SOUTHWEST - Mill "C" Complex, Sand-Sorting Building, South of Dee Bennet Road, near Illinois River, Ottawa, La Salle County, IL

  2. Intuitive, Image-Based Cell Sorting Using Opto-fluidic Cell Sorting

    PubMed Central

    Kovac, J. R.; Voldman, J.

    2008-01-01

    We present a microfluidic cell sorting device which augments microscopy with the capability to perform facile image-based cell sorting. This combination enables intuitive, complex phenotype sorting based on spatio-temporal fluorescence or cell morphology. The microfluidic device contains a microwell array that can be passively loaded with mammalian cells via sedimentation and can be subsequently inspected with microscopy. After inspection, we use the scattering force from a focused infrared laser to levitate cells of interest from their wells into a flow field for collection. First, we demonstrate image-based sorting predicated on whole-cell fluorescence, which could enable sorting based on temporal whole-cell fluorescence behavior. Second, we demonstrate image-based sorting predicated on fluorescence localization (nuclear vs. whole-cell fluorescence), highlighting the capability of our approach to sort based on imaged sub-cellular events, such as localized protein expression or translocation events. We achieve post-sort purities up to 89%, and up to 155-fold enrichment of target cells. Optical manipulation literature and a direct cell viability assay suggest that cells remain viable after using our technique. The architecture is highly scalable and supports over 10,000 individually addressable trap sites. Our approach enables sorting of significant populations based on sub-cellular spatio-temporal information, which is difficult or impossible with existing widespread sorting technologies. PMID:18004819

  3. Card Sorts, State Tests, and Meaningful Mathematics

    ERIC Educational Resources Information Center

    Chauvot, Jennifer B.; Benson, Sharon L. D.

    2008-01-01

    This article shares card-sorting activities that involve state-mandated test items to use with prospective and practicing mathematics teachers to teach about accountability measures while exploring reform-minded mathematics instruction recommendations. (Contains 2 figures.)

  4. Visual ergonomics interventions in mail sorting facilities.

    PubMed

    Hemphälä, H; Hansson, G-Å; Dahlqvist, C; Eklund, J

    2012-01-01

    This study was performed between 2004 and 2011 at mail sorting facilities in Sweden. During this time, different interventions were performed. The first was a lighting intervention that had a positive impact on the postal workers, especially those with eyestrain. A new lighting system also improved the illuminance and gave better light distribution. The second intervention involved new personal spectacles for the postal workers who needed them and this had a positive effect on eyestrain. The third intervention involved a specific type of sorting spectacles for the postal workers who already used progressive lenses privately. The reading distances that the postal workers had while sorting the mail was inverted to the distances in their regular progressive lenses. The new sorting spectacles had a positive effect on head postures and on muscular activity.

  5. Sorting it out: regulation of exosome loading.

    PubMed

    Villarroya-Beltri, Carolina; Baixauli, Francesc; Gutiérrez-Vázquez, Cristina; Sánchez-Madrid, Francisco; Mittelbrunn, María

    2014-10-01

    Extracellular vesicles (EVs), a term that includes both exosomes of endocytic origin and vesicles derived from plasma membranes, are continuously secreted by cells to the extracellular environment, and represent a novel vehicle for cell-cell communication. Exosomes contain specific repertoires of proteins and RNAs, indicating the existence of mechanisms that control the sorting of molecules into them. Although the molecular mechanisms that regulate the loading of proteins into exosomes have been studied for years, the sorting of RNA has been elusive until recently. Here we review the molecular mechanisms that control the sorting of molecules into exosomes, with special attention to the sorting of RNA. We also discuss how the cellular context affects the composition of exosomes, and thus the outcome of the communication between the exosome-producer and recipient cells, with particular focus on the communication between tumor cells and with cells of the tumor microenvironment.

  6. Filter-less submicron hydrodynamic size sorting.

    PubMed

    Fouet, M; Mader, M-A; Iraïn, S; Yanha, Z; Naillon, A; Cargou, S; Gué, A-M; Joseph, P

    2016-02-21

    We propose a simple microfluidic device able to separate submicron particles (critical size ∼0.1 μm) from a complex sample with no filter (minimum channel dimension being 5 μm) by hydrodynamic filtration. A model taking into account the actual velocity profile and hydrodynamic resistances enables prediction of the chip sorting properties for any geometry. Two design families are studied to obtain (i) small sizes within minutes (low-aspect ratio, two-level chip) and (ii) micron-sized sorting with a μL flow rate (3D architecture based on lamination). We obtain quantitative agreement of sorting performances both with experiments and with numerical solving, and determine the limits of the approach. We therefore demonstrate a passive, filter-less sub-micron size sorting with a simple, robust, and easy to fabricate design.

  7. Flow Analysis and Sorting of Plant Chromosomes.

    PubMed

    Vrána, Jan; Cápal, Petr; Šimková, Hana; Karafiátová, Miroslava; Čížková, Jana; Doležel, Jaroslav

    2016-10-10

    Analysis and sorting of plant chromosomes (plant flow cytogenetics) is a special application of flow cytometry in plant genomics and its success depends critically on sample quality. This unit describes the methodology in a stepwise manner, starting with the induction of cell cycle synchrony and accumulation of dividing cells in mitotic metaphase, and continues with the preparation of suspensions of intact mitotic chromosomes, flow analysis and sorting of chromosomes, and finally processing of the sorted chromosomes. Each step of the protocol is described in detail as some procedures have not been used widely. Supporting histograms are presented as well as hints on dealing with plant material; the utility of sorted chromosomes for plant genomics is also discussed. © 2016 by John Wiley & Sons, Inc.

  8. Glycosaminoglycans: Sorting determinants in intracellular protein traffic.

    PubMed

    Mihov, Deyan; Spiess, Martin

    2015-11-01

    Intracellular transport of proteins to their appropriate destinations is crucial for the maintenance of cellular integrity and function. Sorting information is contained either directly in the amino acid sequence or in a protein's post-translational modifications. Glycosaminoglycans (GAGs) are characteristic modifications of proteoglycans. GAGs are long unbranched polysaccharide chains with unique structural and functional properties also contributing to protein sorting in various ways. By deletion or insertion of GAG attachment sites it has been shown that GAGs affect polarized sorting in epithelial cells, targeting to and storage in secretory granules, and endocytosis. Most recently, the role of GAGs as signals for rapid trans-Golgi-to-cell surface transport, dominant over the cytosolic sorting motifs in the core protein, was demonstrated. Here, we provide an overview on existing data on the roles of GAGs on protein and proteoglycan trafficking.

  9. Protein sorting at the trans-Golgi network.

    PubMed

    Guo, Yusong; Sirkis, Daniel W; Schekman, Randy

    2014-01-01

    The trans-Golgi network (TGN) is an important cargo sorting station within the cell where newly synthesized proteins are packaged into distinct transport carriers that are targeted to various destinations. To maintain the fidelity of protein transport, elaborate protein sorting machinery is employed to mediate sorting of specific cargo proteins into distinct transport carriers. Protein sorting requires assembly of the cytosolic sorting machinery onto the TGN membrane and capture of cargo proteins. We review the cytosolic and transmembrane sorting machinery that function at the TGN and describe molecular interactions and regulatory mechanisms that enable accurate protein sorting. In addition, we highlight the importance of TGN sorting in physiology and disease.

  10. Microscale synthesis and characterization of polystyrene: NSF-POLYED scholars project

    NASA Technical Reports Server (NTRS)

    Quaal, Karen S.; Wu, Chang-Ning

    1994-01-01

    Polystyrene is a familiar polymer with many commercial uses. Its applications range from the clear, high index of refraction, brittle plastic used to form audio cassette and CD cases to the foamed material used in insulated drink cups and packaging material. Polystyrene constitutes 11 percent of the plastics used in packaging with only High Density Polyethylene (HDPE) and Low Density Polyethylene (LDPE) contributing a larger share: so much polystyrene is used today, it is one of six common plastics that manufacturers have assigned an identification code. The code helps recycling efforts. Polystyrene's code is (PS code 6). During the summer and fall of 1992 several new polymeric experiments were developed by the NSF POLYED Scholars for introduction into the chemistry core curriculum. In this presentation, one such project will be discussed. This laboratory project is recommended for a first or second year laboratory course allowing the introduction of polymeric science to undergraduates at the earliest opportunity. The reliability of the experiments which make up this project and the recognition factor of polystyrene, a material we come in contact with everyday, makes the synthesis and characterization of polystyrene a good choice for the introduction of polymerization to undergraduates. This laboratory project appeals to the varied interests of students enrolled in the typical first year chemistry course and becomes an ideal way to introduce polymers to a wide variety of science and engineering students.

  11. Vertical sorting and the morphodynamics of bed-form-dominated rivers: An equilibrium sorting model

    NASA Astrophysics Data System (ADS)

    Blom, Astrid; Parker, Gary; Ribberink, Jan S.; de Vriend, Huib J.

    2006-02-01

    A modeling framework is developed for taking into account the effects of sediment sorting in the morphodynamic modeling of bed-form-dominated rivers for the case of equilibrium or stationary conditions dominated by bed load transport. To this end, the Blom and Parker (2004) framework for sediment continuity is reduced to an equilibrium sorting model. The predicted equilibrium sorting profile is mainly determined by the probability density function (PDF) of bed form trough elevations and by a lee sorting function. The PDF of trough elevations needs to be known from either model predictions or measurements. A simple formulation for the lee sorting function is suggested, yet data on the avalanche mechanism down lee faces of dunes is required so as to improve the function and make it generic. The equilibrium sorting model is calibrated and verified using data from flume experiments. The agreement between the predicted and measured equilibrium sorting profiles is reasonable, although the model does not reproduce an observed coarse top layer. In a hydraulic-morphodynamic model this equilibrium sorting model may be applied instantaneously if the timescale of large-scale morphological changes is much larger than the ones of changes in vertical sorting and dune dimensions.

  12. Effect of Wildfire on Sediment Sorting in a Steep Channel

    NASA Astrophysics Data System (ADS)

    Florsheim, J. L.; Chin, A.; O'Hirok, L.; Storesund, R.

    2014-12-01

    Wildfire is an external forcing factor in the landscape. In chaparral environments, wildfire initiates transport of well-sorted fine sediment through dry-ravel processes on hillslopes and facilitates delivery of sediment to stream channels. In turn, this periodic post-fire sediment influx governs sorting of channel-bed material during subsequent floods that mobilize and transport the sediment downstream. We investigated the effects of the May 2013 Springs Wildfire in the Santa Monica Mountains in semi-arid southern California with field measurements and terrestrial LiDAR scanning. Before the fire, sediment sorting within the heterogeneous bed material present in Big Sycamore Creek was controlled by organized step-pool bedforms. Boulders formed steps with relatively finer cobbles, gravel, and sand filling the pools. Before the fire, the grain size distribution present in the substrate between boulder steps was relatively coarse (D84 = 250 mm), in contrast to that in the influx of sediment contributed by post-fire dry-ravel processes deposited at channel margins (D84 = 8 mm). Flow shear stress during one small flood in 2014 (post-fire) was adequate to mobilize fine dry ravel- related sediment. Transport capacity was sufficient to mobilize and transport this sediment within a study reach; however, it was not adequate to flush the fine material downstream. Shear stress required to mobilize sediment contributed by dry ravel was substantially less than that required to transport the substrate material present before the wildfire. The small flood deposited fine sediment (D84 = 16 mm) as flow lost capacity. Resulting deposition buried bedforms, changing the step-pool profile to a plane bed. The relatively poorly sorted, coarse, rough bed changed to a well sorted, fine, smooth, bed. These changes have implications for sediment transport dynamics and aquatic ecology. In steep, semi-arid, chaparral fluvial systems, sediment derived from dry-ravel processes influences the

  13. Extracellular vesicle sorting of α-Synuclein is regulated by sumoylation.

    PubMed

    Kunadt, Marcel; Eckermann, Katrin; Stuendl, Anne; Gong, Jing; Russo, Belisa; Strauss, Katrin; Rai, Surya; Kügler, Sebastian; Falomir Lockhart, Lisandro; Schwalbe, Martin; Krumova, Petranka; Oliveira, Luis M A; Bähr, Mathias; Möbius, Wiebke; Levin, Johannes; Giese, Armin; Kruse, Niels; Mollenhauer, Brit; Geiss-Friedlander, Ruth; Ludolph, Albert C; Freischmidt, Axel; Feiler, Marisa S; Danzer, Karin M; Zweckstetter, Markus; Jovin, Thomas M; Simons, Mikael; Weishaupt, Jochen H; Schneider, Anja

    2015-05-01

    Extracellular α-Synuclein has been implicated in interneuronal propagation of disease pathology in Parkinson's Disease. How α-Synuclein is released into the extracellular space is still unclear. Here, we show that α-Synuclein is present in extracellular vesicles in the central nervous system. We find that sorting of α-Synuclein in extracellular vesicles is regulated by sumoylation and that sumoylation acts as a sorting factor for targeting of both, cytosolic and transmembrane proteins, to extracellular vesicles. We provide evidence that the SUMO-dependent sorting utilizes the endosomal sorting complex required for transport (ESCRT) by interaction with phosphoinositols. Ubiquitination of cargo proteins is so far the only known determinant for ESCRT-dependent sorting into the extracellular vesicle pathway. Our study reveals a function of SUMO protein modification as a Ubiquitin-independent ESCRT sorting signal, regulating the extracellular vesicle release of α-Synuclein. We deciphered in detail the molecular mechanism which directs α-Synuclein into extracellular vesicles which is of highest relevance for the understanding of Parkinson's disease pathogenesis and progression at the molecular level. We furthermore propose that sumo-dependent sorting constitutes a mechanism with more general implications for cell biology.

  14. Occu-Sort: Development and Evaluation of an Occupational Card Sort System.

    ERIC Educational Resources Information Center

    Jones, Lawrence K.

    1979-01-01

    Development of the Occu-Sort system, occupational card sorts, self-guided booklet, record sheet, and manual is discussed. Field testing using the cards with the self-guided booklet is reported. There is a moderate relationship between O-S and VPI codes. Thus O-S shows promise as an effective vocational counseling and career development tool.…

  15. Forces driving cell sorting in the amphibian embryo.

    PubMed

    Winklbauer, Rudolf; Parent, Serge E

    2017-04-01

    Adhesion differences are the main driver of cell sorting and related processes such as boundary formation or tissue positioning. In the early amphibian embryo, graded variations in cadherin density and localized expression of adhesion-modulating factors are associated with regional differences in adhesive properties including overall adhesion strength. The role of these differences in embryonic boundary formation has not been studied extensively, but available evidence suggests that adhesion strength differentials are not essential. On the other hand, the inside-out positioning of the germ layers is correlated with adhesion strength, although the biological significance of this effect is unclear. By contrast, the positioning of dorsal mesoderm tissues along the anterior-posterior body axis is essential for axis elongation, but the underlying sorting mechanism is not correlated with adhesion strength, and may rely on specific cell adhesion. Formation of the ectoderm-mesoderm boundary is the best understood sorting related process in the frog embryo. It relies on contact-induced cell repulsion at the tissue interface, driven by Eph-ephrin signaling and paraxial protocadherin-dependent self/non-self recognition.

  16. The NSF/RANN FY 1975 program for geothermal resources research and technology

    NASA Technical Reports Server (NTRS)

    Kruger, P.

    1974-01-01

    The specific goal of the NSF geothermal program is the rapid development by industry of the nation's geothermal resources that can be demonstrated to be commercially, environmentally and socially acceptable as alternate energy sources. NSF, as the lead agency for the federal geothermal energy research program, is expediting a program which encompasses the objectives necessary for significant utilization. These include: acceleration of exploration and assessment methods to identify commercial geothermal resources; development of innovative and improved technology to achieve economic feasibility; evaluation of policy options to resolve environmental, legal, and institutional problems; and support of experimental research facilities for each type of geothermal resource. Specific projects in each of these four objective areas are part of the NSF program for fiscal year 1975.

  17. Fruit Sorting Using Fuzzy Logic Techniques

    NASA Astrophysics Data System (ADS)

    Elamvazuthi, Irraivan; Sinnadurai, Rajendran; Aftab Ahmed Khan, Mohamed Khan; Vasant, Pandian

    2009-08-01

    Fruit and vegetables market is getting highly selective, requiring their suppliers to distribute the goods according to very strict standards of quality and presentation. In the last years, a number of fruit sorting and grading systems have appeared to fulfill the needs of the fruit processing industry. However, most of them are overly complex and too costly for the small and medium scale industry (SMIs) in Malaysia. In order to address these shortcomings, a prototype machine was developed by integrating the fruit sorting, labeling and packing processes. To realise the prototype, many design issues were dealt with. Special attention is paid to the electronic weighing sub-system for measuring weight, and the opto-electronic sub-system for determining the height and width of the fruits. Specifically, this paper discusses the application of fuzzy logic techniques in the sorting process.

  18. Order-Sorted Parameterization and Induction

    NASA Astrophysics Data System (ADS)

    Meseguer, José

    Parameterization is one of the most powerful features to make specifications and declarative programs modular and reusable, and our best hope for scaling up formal verification efforts. This paper studies order-sorted parameterization at three different levels: (i) its mathematical semantics; (ii) its operational semantics by term rewriting; and (iii) the inductive reasoning principles that can soundly be used to prove properties about such specifications. It shows that achieving the desired properties at each of these three levels is a considerably subtler matter than for many-sorted specifications, but that such properties can be attained under reasonable conditions.

  19. Retromer-mediated endosomal protein sorting: The role of unstructured domains.

    PubMed

    Mukadam, Aamir S; Seaman, Matthew N J

    2015-09-14

    The retromer complex is a key element of the endosomal protein sorting machinery that is conserved through evolution and has been shown to play a role in diseases such as Alzheimer's disease and Parkinson's disease. Through sorting various membrane proteins (cargo), the function of retromer complex has been linked to physiological processes such as lysosome biogenesis, autophagy, down regulation of signalling receptors and cell spreading. The cargo-selective trimer of retromer recognises membrane proteins and sorts them into two distinct pathways; endosome-to-Golgi retrieval and endosome-to-cell surface recycling and additionally the cargo-selective trimer functions as a hub to recruit accessory proteins to endosomes where they may regulate and/or facilitate retromer-mediated endosomal proteins sorting. Unstructured domains present in cargo proteins or accessory factors play key roles in both these aspects of retromer function and will be discussed in this review.

  20. Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

    PubMed

    Xi, Zhiqin; Deng, Wanni; Wang, Liang; Xiao, Fei; Li, Jie; Wang, Zhihua; Wang, Xin; Mi, Xiujuan; Wang, Na; Wang, Xuefeng

    2015-11-01

    Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

  1. Institutional transformation: An analysis of change initiatives at NSF ADVANCE institutions

    NASA Astrophysics Data System (ADS)

    Plummer, Ellen W.

    The purpose of this study was to examine how institutional culture promoted or impeded the implementation of round one and two NSF ADVANCE initiatives designed to improve academic climates for women in science and engineering. This study was conducted in two phases. In phase one, 35 participants from 18 institutions were interviewed to answer three research questions. Participants identified a policy, process, or program designed to improve academic cultures for women in science and engineering fields. Participants also identified strategies that promoted the implementation of these efforts, and discussed factors that impeded these efforts. In phase two, site visits were conducted at two institutions to answer a fourth research question. How did institutional culture shape the design and implementation of faculty search processes? Policies, processes, and programs were implemented by participants at the institutional, departmental, and individual levels and included family friendly and dual career policies at the institutional level, improved departmental faculty search and climate improvement processes, and mentoring programs and training for department heads at the individual level. Communication and leadership strategies were key to the successful implementation of policies, processes, and programs designed to achieve institutional transformation. Communication strategies involved shaping change messages to reach varied audiences often with the argument that change efforts would improve the climate for everyone not just women faculty members. Administrative and faculty leaders from multiple levels proved important to change efforts. Institutional Transformation Institutional culture shaped initiatives to improve faculty search processes. Faculty leaders in both settings used data to persuade faculty members of the need for change. At one site, data that included national availability information was critical to advancing the change agenda. At the other site

  2. Sorting of fungal-damaged white sorghum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A high-speed, color image-based sorting machine was modified to separate white sorghum with symptoms of fungal damage. Most of the sorghum tested was typically white, but over 27% of the bulk contained grains with fungal damage of various degrees, from severe to very slight. Grains with slight fun...

  3. A multispectral sorting device for wheat kernels

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A low-cost multispectral sorting device was constructed using three visible and three near-infrared light-emitting diodes (LED) with peak emission wavelengths of 470 nm (blue), 527 nm (green), 624 nm (red), 850 nm, 940 nm, and 1070 nm. The multispectral data were collected by rapidly (~12 kHz) blin...

  4. Credit Scores, Race, and Residential Sorting

    ERIC Educational Resources Information Center

    Nelson, Ashlyn Aiko

    2010-01-01

    Credit scores have a profound impact on home purchasing power and mortgage pricing, yet little is known about how credit scores influence households' residential location decisions. This study estimates the effects of credit scores on residential sorting behavior using a novel mortgage industry data set combining household demographic, credit, and…

  5. Microwave Conductivity of Sorted CNT Assemblies

    PubMed Central

    Bulmer, John S.; Martens, Jon; Kurzepa, Lukasz; Gizewski, Tomasz; Egilmez, M.; Blamire, M. G.; Yahya, Noorhana; Koziol, Krzysztof K. K.

    2014-01-01

    Recent progress with tailored growth and post-process sorting enables carbon nanotube (CNT) assemblies with predominantly metallic or semi-conducting concentrations. Cryogenic and microwave measurements performed here show transport dimensionality and overall order increasing with increasing metallic concentration, even in atmospheric doping conditions. By 120 GHz, the conductivity of predominantly semi-conducting assemblies grew to 400% its DC value at an increasing growth rate, while other concentrations a growth rate that tapered off. A generalized Drude model fits to the different frequency dependent behaviors and yields useful quality control parameters such as plasma frequency, mean free path, and degree of localization. As one of the first demonstrations of waveguides fabricated from this material, sorted CNTs from both as-made and post-process sources were inserted into sections of practical micro-strip. With both sources, sorted CNT micro-strip increasingly outperformed the unsorted with increasing frequency-- illustrating that sorted CNT assemblies will be important for high frequency applications. PMID:24446019

  6. Systematic Sorting: Teacher Characteristics and Class Assignments

    ERIC Educational Resources Information Center

    Kalogrides, Demetra; Loeb, Susanna; Beteille, Tara

    2013-01-01

    Although prior research has documented differences in the distribution of teacher characteristics across schools serving different student populations, few studies have examined the extent to which teacher sorting occurs within schools. This study uses data from one large urban school district and compares the class assignments of teachers who…

  7. Fuzzy logic-based spike sorting system.

    PubMed

    Balasubramanian, Karthikeyan; Obeid, Iyad

    2011-05-15

    We present a new method for autonomous real-time spike sorting using a fuzzy logic inference engine. The engine assigns each detected event a 'spikiness index' from zero to one that quantifies the extent to which the detected event is like an ideal spike. Spikes can then be sorted by simply clustering the spikiness indices. The sorter is defined in terms of natural language rules that, once defined, are static and thus require no user intervention or calibration. The sorter was tested using extracellular recordings from three animals: a macaque, an owl monkey and a rat. Simulation results show that the fuzzy sorter performed equal to or better than the benchmark principal component analysis (PCA) based sorter. Importantly, there was no degradation in fuzzy sorter performance when the spikes were not temporally aligned prior to sorting. In contrast, PCA sorter performance dropped by 27% when sorting unaligned spikes. Since the fuzzy sorter is computationally trivial and requires no spike alignment, it is suitable for scaling into large numbers of parallel channels where computational overhead and the need for operator intervention would preclude other spike sorters.

  8. Sorting cells by their dynamical properties

    NASA Astrophysics Data System (ADS)

    Henry, Ewan; Holm, Stefan H.; Zhang, Zunmin; Beech, Jason P.; Tegenfeldt, Jonas O.; Fedosov, Dmitry A.; Gompper, Gerhard

    2016-10-01

    Recent advances in cell sorting aim at the development of novel methods that are sensitive to various mechanical properties of cells. Microfluidic technologies have a great potential for cell sorting; however, the design of many micro-devices is based on theories developed for rigid spherical particles with size as a separation parameter. Clearly, most bioparticles are non-spherical and deformable and therefore exhibit a much more intricate behavior in fluid flow than rigid spheres. Here, we demonstrate the use of cells’ mechanical and dynamical properties as biomarkers for separation by employing a combination of mesoscale hydrodynamic simulations and microfluidic experiments. The dynamic behavior of red blood cells (RBCs) within deterministic lateral displacement (DLD) devices is investigated for different device geometries and viscosity contrasts between the intra-cellular fluid and suspending medium. We find that the viscosity contrast and associated cell dynamics clearly determine the RBC trajectory through a DLD device. Simulation results compare well to experiments and provide new insights into the physical mechanisms which govern the sorting of non-spherical and deformable cells in DLD devices. Finally, we discuss the implications of cell dynamics for sorting schemes based on properties other than cell size, such as mechanics and morphology.

  9. Sorting cells by their dynamical properties

    PubMed Central

    Henry, Ewan; Holm, Stefan H.; Zhang, Zunmin; Beech, Jason P.; Tegenfeldt, Jonas O.; Fedosov, Dmitry A.; Gompper, Gerhard

    2016-01-01

    Recent advances in cell sorting aim at the development of novel methods that are sensitive to various mechanical properties of cells. Microfluidic technologies have a great potential for cell sorting; however, the design of many micro-devices is based on theories developed for rigid spherical particles with size as a separation parameter. Clearly, most bioparticles are non-spherical and deformable and therefore exhibit a much more intricate behavior in fluid flow than rigid spheres. Here, we demonstrate the use of cells’ mechanical and dynamical properties as biomarkers for separation by employing a combination of mesoscale hydrodynamic simulations and microfluidic experiments. The dynamic behavior of red blood cells (RBCs) within deterministic lateral displacement (DLD) devices is investigated for different device geometries and viscosity contrasts between the intra-cellular fluid and suspending medium. We find that the viscosity contrast and associated cell dynamics clearly determine the RBC trajectory through a DLD device. Simulation results compare well to experiments and provide new insights into the physical mechanisms which govern the sorting of non-spherical and deformable cells in DLD devices. Finally, we discuss the implications of cell dynamics for sorting schemes based on properties other than cell size, such as mechanics and morphology. PMID:27708337

  10. Integration through a Card-Sort Activity

    ERIC Educational Resources Information Center

    Green, Kris; Ricca, Bernard P.

    2015-01-01

    Learning to compute integrals via the various techniques of integration (e.g., integration by parts, partial fractions, etc.) is difficult for many students. Here, we look at how students in a college level Calculus II course develop the ability to categorize integrals and the difficulties they encounter using a card sort-resort activity. Analysis…

  11. Physiology and pathology of endosome-to-Golgi retrograde sorting.

    PubMed

    Burd, Christopher G

    2011-08-01

    Bidirectional traffic between the Golgi apparatus and the endosomal system sustains the functions of the trans-Golgi network (TGN) in secretion and organelle biogenesis. Export of cargo from the TGN via anterograde trafficking pathways depletes the organelle of sorting receptors, processing proteases, SNARE molecules, and other factors, and these are subsequently retrieved from endosomes via the retrograde pathway. Recent studies indicate that retrograde trafficking is vital to early metazoan development, nutrient homeostasis, and for processes that protect against Alzheimer's and other neurological diseases.

  12. 77 FR 64799 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-23

    ... Elementary Particle Physics Program Reports on and Discussions of Topics of General Interest in High Energy... High Energy Physics Advisory Panel AGENCY: Department of Energy. ACTION: Notice of open Meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory Panel...

  13. 77 FR 33449 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-06

    ... Foundation Elementary Particle Physics Program. Reports on and Discussions of Topics of General Interest in... High Energy Physics Advisory Panel AGENCY: Office of Science, Department of Energy. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics...

  14. 76 FR 8358 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-14

    ... Particle Physics Program Reports on and Discussions of Topics of General Interest in High Energy Physics... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics...

  15. 78 FR 69839 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-21

    ... Elementary Particle Physics Program Reports on and Discussions of Topics of General Interest in High Energy... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of Open Meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics...

  16. 77 FR 4027 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-26

    ... Energy High Energy Physics Program Discussion of National Science Foundation Elementary Particle Physics... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics...

  17. 78 FR 12043 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-21

    ... Foundation Elementary Particle Physics Program. ] Reports on and Discussions of Topics of General Interest in... High Energy Physics Advisory Panel AGENCY: Office of Science, Department of Energy. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics...

  18. 76 FR 41234 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-13

    ... Elementary Particle Physics Program. Reports on and Discussions of Topics of General Interest in High Energy... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics...

  19. 75 FR 57463 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-21

    ... Energy High Energy Physics Program. Discussion of National Science Foundation Elementary Particle Physics... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics...

  20. 76 FR 19986 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-11

    .... Discussion of National Science Foundation Elementary Particle Physics Program. Reports on and Discussion of... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics...

  1. 45 CFR 650.14 - Request for conveyance of title to NSF.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... § 650.4(a) to request conveyance of title to a subject invention if certain conditions exist. (b) The... designee title in one or more countries to any invention to which the awardee has elected not to retain title. The NSF Patent Assistant may request immediate conveyance of title to a subject invention if...

  2. The 1983-1984 NSF Chautauqua-Type Short Course Program.

    ERIC Educational Resources Information Center

    Zeitler, William R.; Ogletree, Owen, Jr.

    1984-01-01

    National Science Foundation (NSF) Chautauqua-type short courses offer undergraduate science teachers the opportunity to absorbe new ideas from highly respected scholars. A complete list of courses, course directors, locations, dates, and registration fees for the 1983-84 program is provided. Subject areas include: instructional composting, cells…

  3. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 5 Administrative Personnel 3 2011-01-01 2011-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  4. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... SCIENCE FOUNDATION NATIONAL SCIENCE FOUNDATION RULES OF PRACTICE Rules of Practice for the National Science Foundation § 680.11 Staff involvement with NSF proposals and awards. (a)(1) Many scientists... field of science, engineering, or education, notwithstanding that the focus of the work may change...

  5. 45 CFR 680.12 - One-year NSF post-employment restrictions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Section 680.12 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION NATIONAL SCIENCE FOUNDATION RULES OF PRACTICE AND STATUTORY CONFLICT-OF-INTEREST EXEMPTIONS Rules of Practice for the National Science Foundation § 680.12 One-year NSF post-employment...

  6. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... SCIENCE FOUNDATION NATIONAL SCIENCE FOUNDATION RULES OF PRACTICE AND STATUTORY CONFLICT-OF-INTEREST EXEMPTIONS Rules of Practice for the National Science Foundation § 680.11 Staff involvement with NSF... investigator and his or her laboratory or group (if any) in the same general field of science, engineering,...

  7. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  8. Development of a Consensus Standard for School Equipment: NSF/NSSEA 380

    ERIC Educational Resources Information Center

    Breitner, Ashlee

    2011-01-01

    For many years, the school supplies and equipment industry has investigated methods to ensure product safety and compliance across all its product categories. In early 2010, NSF International and the National School Supply and Equipment Association (NSSEA) came together to develop quality standards for products and equipment designed for use in…

  9. 78 FR 14087 - DOE/NSF High Energy Physics Advisory Panel: Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-04

    ... High Energy Physics Advisory Panel: Correction AGENCY: Office of Science, Department of Energy. ACTION...) published a notice of open meeting for the DOE/NSF High Energy Physics Advisory Panel to be held on March 11... Kogut, Executive Secretary; High Energy Physics Advisory Panel; U.S. Department of Energy;...

  10. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... support the work of the same investigator and his or her laboratory or group (if any) in the same general... current NSF employee would be a senior investigator or equivalent, unless it is a proposal for continuation or extension of support for work on which the employee served in that capacity before coming...

  11. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... support the work of the same investigator and his or her laboratory or group (if any) in the same general... current NSF employee would be a senior investigator or equivalent, unless it is a proposal for continuation or extension of support for work on which the employee served in that capacity before coming...

  12. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... support the work of the same investigator and his or her laboratory or group (if any) in the same general... current NSF employee would be a senior investigator or equivalent, unless it is a proposal for continuation or extension of support for work on which the employee served in that capacity before coming...

  13. Position Paper. Cutting the NSF-OSIS Budget: Potential Disaster for Information Science and Technology

    ERIC Educational Resources Information Center

    Smith, Joshua I.

    1974-01-01

    A statement submitted on behalf of ASIS to the Subcommitte on Science Research and Development of the Committee on Science and Astronautics of the U.S. House of Representatives on the NSF Authorization Act 1975, HR 12816. (Author/JB)

  14. NSF's Experimental Program to Stimulate Competitive Research (EPSCoR): Subsidizing Academic Research or State Budgets?

    ERIC Educational Resources Information Center

    Wu, Yonghong

    2009-01-01

    This cross-state empirical study focuses on the National Science Foundation's (NSF) Experimental Program to Stimulate Competitive Research (EPSCoR) and examines its impact on the academic research and development (R&D) expenditures financed by state governments. Based on a panel of 50 states during 1979-2006, the empirical results indicate that…

  15. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 5 Administrative Personnel 3 2012-01-01 2012-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  16. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 5 Administrative Personnel 3 2014-01-01 2014-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  17. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 5 Administrative Personnel 3 2013-01-01 2013-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  18. 78 FR 46330 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-31

    ..., 4201 Wilson Blvd., Arlington, VA 22230. FOR FURTHER INFORMATION CONTACT: John Kogut, Executive... contact John Kogut, (301) 903-1298 or by email at: John.Kogut@science.doe.gov . You must make your request... Mills at: lmills@nsf.gov , no later than September 3, 2013, so a visitor pass can be prepared....

  19. NSF/DARPA/NASA Digital Libraries Initiative: A Program Manager's Perspective.

    ERIC Educational Resources Information Center

    Griffin, Stephen M.

    1998-01-01

    Discusses the National Science Foundation (NSF)/United States Defense Advanced Research Projects Agency (DARPA)/National Aeronautics and Space Agency (NASA) Research in Digital Libraries Initiative (DLI). Highlights include benefits of digital libraries; the Federal High Performance Computing and Communications Program (HPCC); and program…

  20. 45 CFR 689.5 - Initial NSF handling of misconduct matters.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 45 Public Welfare 3 2014-10-01 2014-10-01 false Initial NSF handling of misconduct matters. 689.5 Section 689.5 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE... the inquiry no more than 90 days after initiating it. (f) On the basis of what it learns from...

  1. Innovating and Evaluating Science Education: NSF Evaluation Forums 1992-94.

    ERIC Educational Resources Information Center

    Westat, Inc., Rockville, MD.

    This document contains papers from a series of Evaluation Forums of the National Science Foundation. The titles are: "Education Program Evaluation at NSF: What Difference Does It Make?" (D. E. Chubin); "Interagency Efforts to Review and Evaluate Science, Mathematics, and Engineering Programs Through the Federal Coordinating Council…

  2. Evaluation of NSF's International Research Fellowship Program: Final Report

    ERIC Educational Resources Information Center

    Martinez, Alina; Epstein, Carter; Parsad, Amanda; Whittaker, Karla

    2012-01-01

    Among the National Science Foundation's (NSF) postdoctoral programs, the International Research Fellowship Program (IRFP) is unique in its emphasis on providing postdoctoral fellows with international research experiences. Established in 1992, IRFP provides financial support to postdoctoral scientists for a research experience abroad lasting…

  3. Differences in Math and Science Understanding between NSF GK-12 Participant Groups: A Year Long Study

    ERIC Educational Resources Information Center

    Wilhelm, Jennifer; She, Xiaobo; Morrison, Darrellee Clem

    2011-01-01

    In this study, interdisciplinary environments were created in NSF institutes and classrooms with graduate fellows and teachers. Using a mixed methodology, we examined how experiential learning influenced participants' mathematical/scientific actions and compared differences in mathematics/science efficacy and content understanding between…

  4. Linking the GLOBE Program With NASA and NSF Large-Scale Experiments

    NASA Astrophysics Data System (ADS)

    Filmer, P. E.

    2005-12-01

    NASA and the NSF, the sponsoring Federal agencies for the GLOBE Program, are seeking the participation of science teams who are working at the cutting edge of Earth systems science in large integrated Earth systems science programs. Connecting the GLOBE concept and structure with NASA and NSF's leading Earth systems science programs will give GLOBE schools and students access to top scientists, and expose them to programs that have been designated as scientific priorities. Students, teachers, parents, and their communities will be able to see how scientists of many disciplines work together to learn about the Earth system. The GLOBE solicitation released by the NSF targets partnerships between GLOBE and NSF/NASA-funded integrated Earth systems science programs. This presentation will focus on the goals and requirements of the NSF solicitation. Proponents will be expected to provide ways for the GLOBE community to interact with a group of scientists from their science programs as part of a wider joint Earth systems science educational strategy (the sponsoring agencies', GLOBE's, and the proposing programs'). Teams proposing to this solicitation must demonstrate: - A focus on direct connections with major NSF Geosciences and/or Polar Programs and/or NASA Earth-Sun research programs that are related to Earth systems science; - A demonstrable benefit to GLOBE and to NSF Geosciences and/or Polar Programs or NASA Earth-Sun education goals (providing access to program researchers and data, working with GLOBE in setting up campaigns where possible, using tested GLOBE or non-GLOBE protocols to the greatest extent possible, actively participating in the wider GLOBE community including schools, among other goals); - An international component; - How the existing educational efforts of the large science program will coordinate with GLOBE; - An Earth systems science education focus, rather than a GLOBE protocol-support focus; - A rigorous evaluation and assessment component

  5. PhySortR: a fast, flexible tool for sorting phylogenetic trees in R

    PubMed Central

    Stephens, Timothy G.; Bhattacharya, Debashish; Ragan, Mark A.

    2016-01-01

    A frequent bottleneck in interpreting phylogenomic output is the need to screen often thousands of trees for features of interest, particularly robust clades of specific taxa, as evidence of monophyletic relationship and/or reticulated evolution. Here we present PhySortR, a fast, flexible R package for classifying phylogenetic trees. Unlike existing utilities, PhySortR allows for identification of both exclusive and non-exclusive clades uniting the target taxa based on tip labels (i.e., leaves) on a tree, with customisable options to assess clades within the context of the whole tree. Using simulated and empirical datasets, we demonstrate the potential and scalability of PhySortR in analysis of thousands of phylogenetic trees without a priori assumption of tree-rooting, and in yielding readily interpretable trees that unambiguously satisfy the query. PhySortR is a command-line tool that is freely available and easily automatable. PMID:27190724

  6. Global nanotechnology development from 1991 to 2012: patents, scientific publications, and effect of NSF funding

    NASA Astrophysics Data System (ADS)

    Chen, Hsinchun; Roco, Mihail C.; Son, Jaebong; Jiang, Shan; Larson, Catherine A.; Gao, Qiang

    2013-09-01

    In a relatively short interval for an emerging technology, nanotechnology has made a significant economic impact in numerous sectors including semiconductor manufacturing, catalysts, medicine, agriculture, and energy production. A part of the United States (US) government investment in basic research has been realized in the last two decades through the National Science Foundation (NSF), beginning with the nanoparticle research initiative in 1991 and continuing with support from the National Nanotechnology Initiative after fiscal year 2001. This paper has two main goals: (a) present a longitudinal analysis of the global nanotechnology development as reflected in the United States Patent and Trade Office (USPTO) patents and Web of Science (WoS) publications in nanoscale science and engineering (NSE) for the interval 1991-2012; and (b) identify the effect of basic research funded by NSF on both indicators. The interval has been separated into three parts for comparison purposes: 1991-2000, 2001-2010, and 2011-2012. The global trends of patents and scientific publications are presented. Bibliometric analysis, topic analysis, and citation network analysis methods are used to rank countries, institutions, technology subfields, and inventors contributing to nanotechnology development. We then, examined how these entities were affected by NSF funding and how they evolved over the past two decades. Results show that dedicated NSF funding used to support nanotechnology R&D was followed by an increased number of relevant patents and scientific publications, a greater diversity of technology topics, and a significant increase of citations. The NSF played important roles in the inventor community and served as a major contributor to numerous nanotechnology subfields.

  7. Differential expression of axon-sorting molecules in mouse olfactory sensory neurons.

    PubMed

    Ihara, Naoki; Nakashima, Ai; Hoshina, Naosuke; Ikegaya, Yuji; Takeuchi, Haruki

    2016-08-01

    In the mouse olfactory system, the axons of olfactory sensory neurons that express the same type of odorant receptor (OR) converge to a specific set of glomeruli in the olfactory bulb (OB). It is widely accepted that expressed OR molecules instruct glomerular segregation by regulating the expression of axon-sorting molecules. Although the relationship between the expression of axon-sorting molecules and OR types has been analyzed in detail, those between the expressions of axon-sorting molecules remain to be elucidated. Here we collected the expression profiles of four axon-sorting molecules from a large number of glomeruli in the OB. These molecules demonstrated position-independent mosaic expressions, but their patterns were not identical in the OB. Comparing their expressions identified positive and negative correlations between several pairs of genes even though they showed various expressions. Furthermore, the principal component analysis revealed that the factor loadings in the principal component 1, which explain the largest amount of variation, were most likely to reflect the degree of the cyclic nucleotide-gated (CNG) channel dependence on the expression of axon-sorting molecules. Thus, neural activity generated through the CNG channel is a major component in the generation of a wide variety of expressions of axon-sorting molecules in glomerular segregation.

  8. Endosomal type Iγ PIP 5-kinase controls EGF receptor lysosomal sorting.

    PubMed

    Sun, Yue; Hedman, Andrew C; Tan, Xiaojun; Schill, Nicholas J; Anderson, Richard A

    2013-04-29

    Endosomal trafficking and degradation of epidermal growth factor receptor (EGFR) play an essential role in the control of its signaling. Phosphatidylinositol-4,5-bisphosphate (PtdIns4,5P(2)) is an established regulator of endocytosis, whereas PtdIns3P modulates endosomal trafficking. However, we demonstrate here that type I gamma phosphatidylinositol phosphate 5-kinase i5 (PIPKIγi5), an enzyme that synthesizes PtdIns4,5P(2), controls endosome-to-lysosome sorting of EGFR. In this pathway, PIPKIγi5 interacts with sorting nexin 5 (SNX5), a protein that binds PtdIns4,5P(2) and other phosphoinositides. PIPKIγi5 and SNX5 localize to endosomes, and loss of either protein blocks EGFR sorting into intraluminal vesicles (ILVs) of the multivesicular body. Loss of ILV sorting greatly enhances and prolongs EGFR signaling. PIPKIγi5 and SNX5 prevent Hrs ubiquitination, and this facilitates the Hrs association with EGFR that is required for ILV sorting. These findings reveal that PIPKIγi5 and SNX5 form a signaling nexus that controls EGFR endosomal sorting, degradation, and signaling.

  9. The sorting of proglucagon to secretory granules is mediated by carboxypeptidase E and intrinsic sorting signals.

    PubMed

    McGirr, Rebecca; Guizzetti, Leonardo; Dhanvantari, Savita

    2013-05-01

    Proglucagon is expressed in pancreatic alpha cells, intestinal L cells and brainstem neurons. Tissue-specific processing of proglucagon yields the peptide hormones glucagon in the alpha cell and glucagon-like peptide (GLP)-1 and GLP-2 in L cells. Both glucagon and GLP-1 are secreted in response to nutritional status and are critical for regulating glycaemia. The sorting of proglucagon to the dense-core secretory granules of the regulated secretory pathway is essential for the appropriate secretion of glucagon and GLP-1. We examined the roles of carboxypeptidase E (CPE), a prohormone sorting receptor, the processing enzymes PC1/3 and PC2 and putative intrinsic sorting signals in proglucagon sorting. In Neuro 2a cells that lacked CPE, PC1/3 and PC2, proglucagon co-localised with the Golgi marker p115 as determined by quantitative immunofluorescence microscopy. Expression of CPE, but not of PC1/3 or PC2, enhanced proglucagon sorting to granules. siRNA-mediated knockdown of CPE disrupted regulated secretion of glucagon from pancreatic-derived alphaTC1-6 cells, but not of GLP-1 from intestinal cell-derived GLUTag cells. Mutation of the PC cleavage site K70R71, the dibasic R17R18 site within glucagon or the alpha-helix of glucagon, all significantly affected the sub-cellular localisation of proglucagon. Protein modelling revealed that alpha helices corresponding to glucagon, GLP-1 and GLP-2, are arranged within a disordered structure, suggesting some flexibility in the sorting mechanism. We conclude that there are multiple mechanisms for sorting proglucagon to the regulated secretory pathway, including a role for CPE in pancreatic alpha cells, initial cleavage at K70R71 and multiple sorting signals.

  10. Molecular requirements for sorting of the chemokine interleukin-8/CXCL8 to endothelial Weibel-Palade bodies.

    PubMed

    Hol, Johanna; Küchler, Axel M; Johansen, Finn-Eirik; Dalhus, Bjørn; Haraldsen, Guttorm; Oynebråten, Inger

    2009-08-28

    Sorting of proteins to Weibel-Palade bodies (WPB) of endothelial cells allows rapid regulated secretion of leukocyte-recruiting P-selectin and chemokines as well as procoagulant von Willebrand factor (VWF). Here we show by domain swap studies that the exposed aspartic acid in loop 2 (Ser(44)-Asp(45)-Gly(46)) of the CXC chemokine interleukin (IL)-8 is crucial for targeting to WPB. Loop 2 also governs sorting of chemokines to alpha-granules of platelets, but the fingerprint of the loop 2 of these chemokines differs from that of IL-8. On the other hand, loop 2 of IL-8 closely resembles a surface-exposed sequence of the VWF propeptide, the region of VWF that directs sorting of the protein to WPB. We conclude that loop 2 of IL-8 constitutes a critical signal for sorting to WPB and propose a general role for this loop in the sorting of chemokines to compartments of regulated secretion.

  11. A Study of NSF Teacher Enhancement Program (TEP) Participants and Principal Investigators: 1984-1989. Volume II: Technical Report.

    ERIC Educational Resources Information Center

    Abt Associates, Inc., Cambridge, MA.

    This study documents the effects of participation in the Teacher Enhancement Program (TEP) of the National Science Foundation (NSF). The NSF awarded more than 600 grants to scientists, mathematicians, and educators to develop and operate inservice teacher training programs between 1984 and 1989. The present study focuses specifically upon the…

  12. Parallel integer sorting with medium and fine-scale parallelism

    NASA Technical Reports Server (NTRS)

    Dagum, Leonardo

    1993-01-01

    Two new parallel integer sorting algorithms, queue-sort and barrel-sort, are presented and analyzed in detail. These algorithms do not have optimal parallel complexity, yet they show very good performance in practice. Queue-sort designed for fine-scale parallel architectures which allow the queueing of multiple messages to the same destination. Barrel-sort is designed for medium-scale parallel architectures with a high message passing overhead. The performance results from the implementation of queue-sort on a Connection Machine CM-2 and barrel-sort on a 128 processor iPSC/860 are given. The two implementations are found to be comparable in performance but not as good as a fully vectorized bucket sort on the Cray YMP.

  13. A mower detector to judge soil sorting

    SciTech Connect

    Bramlitt, E.T.; Johnson, N.R.

    1995-12-31

    Thermo Nuclear Services (TNS) has developed a mower detector as an inexpensive and fast means for deciding potential value of soil sorting for cleanup. It is a shielded detector box on wheels pushed over the ground (as a person mows grass) at 30 ft/min with gamma-ray counts recorded every 0.25 sec. It mirror images detection by the TNS transportable sorter system which conveys soil at 30 ft/min and toggles a gate to send soil on separate paths based on counts. The mower detector shows if contamination is variable and suitable for sorting, and by unique calibration sources, it indicates detection sensitivity. The mower detector has been used to characterize some soil at Department of Energy sites in New Jersey and South Carolina.

  14. Information sharing and sorting in a community

    NASA Astrophysics Data System (ADS)

    Bhattacherjee, Biplab; Manna, S. S.; Mukherjee, Animesh

    2013-06-01

    We present the results of a detailed numerical study of a model for the sharing and sorting of information in a community consisting of a large number of agents. The information gathering takes place in a sequence of mutual bipartite interactions where randomly selected pairs of agents communicate with each other to enhance their knowledge and sort out the common information. Although our model is less restricted compared to the well-established naming game, the numerical results strongly indicate that the whole set of exponents characterizing this model are different from those of the naming game and they assume nontrivial values. Finally, it appears that in analogy to the emergence of clusters in the phenomenon of percolation, one can define clusters of agents here having the same information. We have studied in detail the growth of the largest cluster in this article and performed its finite-size scaling analysis.

  15. Efficient Sorting on the Tilera Manycore Architecture

    SciTech Connect

    Morari, Alessandro; Tumeo, Antonino; Villa, Oreste; Secchi, Simone; Valero, Mateo

    2012-10-24

    e present an efficient implementation of the radix sort algo- rithm for the Tilera TILEPro64 processor. The TILEPro64 is one of the first successful commercial manycore processors. It is com- posed of 64 tiles interconnected through multiple fast Networks- on-chip and features a fully coherent, shared distributed cache. The architecture has a large degree of flexibility, and allows various optimization strategies. We describe how we mapped the algorithm to this architecture. We present an in-depth analysis of the optimizations for each phase of the algorithm with respect to the processor’s sustained performance. We discuss the overall throughput reached by our radix sort implementation (up to 132 MK/s) and show that it provides comparable or better performance-per-watt with respect to state-of-the art implemen- tations on x86 processors and graphic processing units.

  16. Population Enrichment and Isolation with Magnetic Sorting

    DTIC Science & Technology

    2011-09-01

    diposable, microfluidic cartridges. Along with magnetic sorting methods, we detail flow cytometry analysis techniques to quantify cell population...panel. The red signal in each plot is the background cell fluorescence measured in the PE emission channel . Either a histogram of PE-H vs. count or...Recently, the U.S. Army Research Laboratory (ARL) transitioned a microfluidic magnetic sorter (MMS) from Cynvenio Biosystems during an ICB 6.2

  17. How Schwann Cells Sort Axons: New Concepts.

    PubMed

    Feltri, M Laura; Poitelon, Yannick; Previtali, Stefano Carlo

    2016-06-01

    Peripheral nerves contain large myelinated and small unmyelinated (Remak) fibers that perform different functions. The choice to myelinate or not is dictated to Schwann cells by the axon itself, based on the amount of neuregulin I-type III exposed on its membrane. Peripheral axons are more important in determining the final myelination fate than central axons, and the implications for this difference in Schwann cells and oligodendrocytes are discussed. Interestingly, this choice is reversible during pathology, accounting for the remarkable plasticity of Schwann cells, and contributing to the regenerative potential of the peripheral nervous system. Radial sorting is the process by which Schwann cells choose larger axons to myelinate during development. This crucial morphogenetic step is a prerequisite for myelination and for differentiation of Remak fibers, and is arrested in human diseases due to mutations in genes coding for extracellular matrix and linkage molecules. In this review we will summarize progresses made in the last years by a flurry of reverse genetic experiments in mice and fish. This work revealed novel molecules that control radial sorting, and contributed unexpected ideas to our understanding of the cellular and molecular mechanisms that control radial sorting of axons.

  18. Generalized sorting profile of alluvial fans

    NASA Astrophysics Data System (ADS)

    Miller, Kimberly Litwin; Reitz, Meredith D.; Jerolmack, Douglas J.

    2014-10-01

    Alluvial rivers often exhibit self-similar gravel size distributions and abrupt gravel-sand transitions. Experiments suggest that these sorting patterns are established rapidly, but how—and how fast—this convergence occurs in the field is unknown. We examine the establishment of downstream sorting patterns in a kilometer-scale alluvial fan. The sharp transition from canyon to unconfined, channelized fan provides a well-defined boundary condition. The channel changes from deep and entrenched at the fan apex to shallow and depositional over a short distance, exhibiting nonequilibrium behavior. The resulting gravel-fining profile is not self-similar; the particle size distribution narrows until approximate equal mobility is achieved. Downfan, the gravel-sand transition appears to exhibit a self-similar form; field and laboratory data collapse when downstream distance is normalized by the location of the transition. Results suggest a generalized sorting profile for alluvial fans as a consequence of the threshold of motion and nonequilibrium channels.

  19. Gender Sorting across K-12 Schools in the United States

    ERIC Educational Resources Information Center

    Long, Mark C.; Conger, Dylan

    2013-01-01

    This article documents evidence of nonrandom gender sorting across K-12 schools in the United States. The sorting exists among coed schools and at all grade levels, and it is highest in the secondary school grades. We observe some gender sorting across school sectors and types: for instance, males are slightly underrepresented in private schools…

  20. Categorizing Variations of Student-Implemented Sorting Algorithms

    ERIC Educational Resources Information Center

    Taherkhani, Ahmad; Korhonen, Ari; Malmi, Lauri

    2012-01-01

    In this study, we examined freshmen students' sorting algorithm implementations in data structures and algorithms' course in two phases: at the beginning of the course before the students received any instruction on sorting algorithms, and after taking a lecture on sorting algorithms. The analysis revealed that many students have insufficient…

  1. My eSorts and Digital Extensions of Word Study

    ERIC Educational Resources Information Center

    Zucker, Tricia A.; Invernizzi, Marcia

    2008-01-01

    "My eSorts" is a strategy for helping children learn to read and spell in a socially motivated context. It is based on developmental spelling research and the word study approach to teaching phonics and spelling. "eSorting" employs digital desktop publishing tools that allow children to author their own electronic word sorts and then share these…

  2. Optical design of the NASA-NSF extreme precision Doppler spectrograph concept "WISDOM"

    NASA Astrophysics Data System (ADS)

    Barnes, Stuart I.; Fżrész, Gábor; Simcoe, Robert A.; Shectman, Stephen A.; Woods, Deborah F.

    2016-08-01

    The WISDOM instrument concept was developed at MIT as part of a NASA-NSF funded study to equip the 3.5m WIYN telescope with an extremely precise radial velocity spectrometer. The spectrograph employs an asymmetric white pupil optical design, where the instrument is split into two nearly identical "Short" (380 to 750 nm) and "Long"" (750 to 1300 nm) wavelength channels. The echelle grating and beam sizes are R3.75/125mm and R6/80mm in the short and long channels respectively. Together with the pupil slicer, and octagonal to rectangular fibre coupling, this permits resolving powers over R = 120k with a 1.2" diameter fibre on the sky. A factor of two reduction in the focal length between the main collimator OAP and the transfer collimator ensures a very compact instrument, with a small white pupil footprint, thereby enabling small cross-dispersing and camera elements. A dichroic is used near the white pupil to split each of the long and short channels into two, so that the final spectrograph has 4 channels; namely "Blue," "Green," "Red" and "NIR." Each of these channels has an anamorphic VPH grism for cross-dispersion, and a fully dioptric all-spherical camera objective. The spectral footprints cover 4k×4k and 6k×6k CCDs with 15 µm pixels in the short "Blue" and "Green" wavelength channels, respectively. A 4k×4k CCD with 15 μm pixels is used in the long "Red" channel, with a HgCdTe 1.7 μm cutoff 4k×4k detector with 10um pixels is to be used in the long "NIR" channel. The white pupil relay includes a Mangin mirror very close to the intermediate focus to correct the white pupil relay Petzval curvature before it is swept into a cylinder by the cross-dispersers. This design decision allows each of the dioptric cameras to be fully optimised and tested independently of the rest of the spectrograph. The baseline design for the cameras also ensures that the highest possible (diffraction limited) image quality is achieved across all wavelengths, while also ensuring

  3. Better Accountability Procedures Needed in NSF and NIH Research Grant Systems.

    DTIC Science & Technology

    1981-09-30

    research at colleges and universities. Peer review (expert advice of selected researchers) is the primary component of the research grant scientific...and found that the peer review and internal review systems are working reasonably well. Although the systems are basically the same at the two...agencies, the procedures differ. GAO found that some of the NIH peer review procedures have advantages over those at NSF, but believes that changes are

  4. US Global Change Research Program Distributed Cost Budget Interagency Funds Transfer from DOE to NSF

    SciTech Connect

    Uhle, Maria

    2016-09-22

    These funds were transferred from DOE to NSF as DOE's contribution to the U.S. Global Change Research Program in support of 4 internationalnactivities/programs as approved by the U.S. Global Change Research Program on 14 March 2014. The programs are the International Geosphere-Biosphere Programme, the DIVERSITAS programme, and the World Climate Research Program. All program awards ended as of 09-23-2015.

  5. Advancing Capabilities for Understanding the Earth System Through Intelligent Systems, the NSF Perspective

    NASA Astrophysics Data System (ADS)

    Gil, Y.; Zanzerkia, E. E.; Munoz-Avila, H.

    2015-12-01

    The National Science Foundation (NSF) Directorate for Geosciences (GEO) and Directorate for Computer and Information Science (CISE) acknowledge the significant scientific challenges required to understand the fundamental processes of the Earth system, within the atmospheric and geospace, Earth, ocean and polar sciences, and across those boundaries. A broad view of the opportunities and directions for GEO are described in the report "Dynamic Earth: GEO imperative and Frontiers 2015-2020." Many of the aspects of geosciences research, highlighted both in this document and other community grand challenges, pose novel problems for researchers in intelligent systems. Geosciences research will require solutions for data-intensive science, advanced computational capabilities, and transformative concepts for visualizing, using, analyzing and understanding geo phenomena and data. Opportunities for the scientific community to engage in addressing these challenges are available and being developed through NSF's portfolio of investments and activities. The NSF-wide initiative, Cyberinfrastructure Framework for 21st Century Science and Engineering (CIF21), looks to accelerate research and education through new capabilities in data, computation, software and other aspects of cyberinfrastructure. EarthCube, a joint program between GEO and the Advanced Cyberinfrastructure Division, aims to create a well-connected and facile environment to share data and knowledge in an open, transparent, and inclusive manner, thus accelerating our ability to understand and predict the Earth system. EarthCube's mission opens an opportunity for collaborative research on novel information systems enhancing and supporting geosciences research efforts. NSF encourages true, collaborative partnerships between scientists in computer sciences and the geosciences to meet these challenges.

  6. Córdova to Be Nominated as New Head of NSF

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2013-08-01

    President Barack Obama announced on 31 July that he intends to nominate France Anne Córdova to become the next director of the National Science Foundation (NSF). Córdova was president of Purdue University from 2007 to 2012 and has been a professor of physics and astronomy there. Previously, Córdova was chancellor of the University of California, Riverside from 1996 to 2002.

  7. Airborne microorganisms associated with packaging glass sorting facilities.

    PubMed

    Pinto, Marta Jorge de Vasconcelos; Veiga, José Miguel; Fernandes, Paulo; Ramos, Carla; Gonçalves, Sérgio; Velho, Maria Manuela Lemos Vaz; Guerreiro, Joana Santos

    2015-01-01

    In recent years, efforts have been undertaken to reduce the volume of residual waste through sorting and recycling. The waste management and recycling sector is thriving and the number of workers there is increasing. In this context, prior knowledge of the risks to which workers may be exposed is of crucial importance, and preventive measures need to be put in place to accurately identify and quantify those risks. This study aimed to assess occupational risk of exposure to biological agents (viable bacteria and fungi) in a Portuguese waste packaging glass sorting plant. Air samples were collected from selected locations in waste sorting cabins (critical area, CA), administrative services (noncritical area, NCA) and outdoors (control point, CP). Duplicate air samples were collected through an impaction method. The investigation was carried out over an 8-mo period with two collection periods, autumn/winter (AW) and spring/summer (SS), in order to access the influence of any seasonal variation. In the 36 air samples collected, 319 bacterial and 196 mold identifications were performed. Air samples revealed existence of high environmental contamination by bacteria (1.6 × 10(4) colony forming units [cfu]/m(3)) and fungi (1.5 × 10(4) cfu/m(3)). The predominant bacterial genus was Staphylococcus (coagulase negative) with values ranging from 29.6 to 60% of the total count of bacteria. Genera Bacillus, Micrococcus, and Staphylococcus (coagulase negative) were also present at all sampling sites, regardless of the season. However, the counts of these genera, in the CA, were higher in warmer seasons. The genus Penicillium was the most frequent genus present with an approximate value of 95% of total fungal count in the CA. Seasonal variation was a significant factor for total bacteria and fungi, except for NCA versus CP. Overall, the highest levels of bacterial and fungal species (10(4) cfu/m(3)) were found in the waste sorting cabin (CA). These results highlight the

  8. Study of Sort Stories: Leveled Reading Supplement to Words Their Way: Word Sorts for Letter Name-Alphabet Spellers

    ERIC Educational Resources Information Center

    Zugel, Kevin

    2005-01-01

    "Sort Stories: Leveled Reading Supplement to Words Their Way: Word Sorts for Letter Name-Alphabet Spellers" effectiveness was tested using five English language learner (ELL) students in the fifth and sixth grade. "Sort Stories" uses the word lists and accompanying clip-art from "Words Their Way" in developmental, grade-level specific, short read…

  9. HydroShare: Applying professional software engineering to a new NSF-funded large software project

    NASA Astrophysics Data System (ADS)

    Idaszak, R.; Tarboton, D. G.; Ames, D.; Saleem Arrigo, J. A.; Band, L. E.; Bedig, A.; Castronova, A. M.; Christopherson, L.; Coposky, J.; Couch, A.; Dash, P.; Gan, T.; Goodall, J.; Gustafson, K.; Heard, J.; Hooper, R. P.; Horsburgh, J. S.; Jackson, S.; Johnson, H.; Maidment, D. R.; Mbewe, P.; Merwade, V.; Miles, B.; Reeder, S.; Russell, T.; Song, C.; Taylor, A.; Thakur, S.; Valentine, D. W.; Whiteaker, T. L.

    2013-12-01

    HydroShare is an online, collaborative system being developed for sharing hydrologic data and models as part of the NSF's Software Infrastructure for Sustained Innovation (SI2) program (NSF collaborative award numbers 1148453 and 1148090). HydroShare involves a large software development effort requiring cooperative research and distributed software development between domain scientists, professional software engineers (here 'professional' denotes previous commercial experience in the application of modern software engineering), and university software developers. HydroShare expands upon the data sharing capabilities of the Hydrologic Information System of the Consortium of Universities for the Advancement of Hydrologic Sciences, Inc. (CUAHSI) by broadening the classes of data accommodated, expanding capability to include the sharing of models and model components, and taking advantage of emerging social media functionality to enhance information about and collaboration around hydrologic data and models. With a goal of enabling better science concomitant with improved sustainable software practices, we will describe our approach, experiences, and lessons learned thus-far in applying professional software engineering to a large NSF-funded software project from the project's onset.

  10. NSF's solar-terrestrial research program and RISE. [RISE (Radiative Inputs of the Sun to Earth)

    SciTech Connect

    Schatten, K.H.

    1992-01-01

    SunRISE has become a top priority proposed initiative for solar terrestrial science at NSF. NSF's priorities include People, Education, Infrastructure, and Competitiveness in Science. Within NSF's Atmospheric Division, the Solar Terrestrial (ST) Program considers the Sun as the principle driver of dynamic phenomena in the atmospheric and geospace environments. The ST [open quotes]Core[close quotes] program will place increased emphasis on the nature of solar variability and the resultant terrestrial responses. Solar variability, emphasized dramatically by flares is not well understood, particularly below the atmosphere. Yet in all its forms, outstanding problems exist from the base of the convection zone, through the photosphere, chromosphere, and corona, and into the solar wind, where interactions with the Earth system occur. Areas of increased emphasis will be to answer the following questions. How does solar variability manifest itself in terrestrial atmospheric effects What is the nature of solar activity and how does it change in its transit from deep within the Sun to the Earth How does the Sun's variable radiative emission, flares, and corpuscular radiation affect the Earth's atmosphere The impact the Sun has upon the Earth's climate through its radiative drivers is the focus for the new initiative [open quotes]SunRISE[close quotes] (Radiative Inputs of the Sun to Earth). At present, there are large uncertainties in the contribution of solar irradiance variations to global change. Properly subtracting out, the contribution of solar variability from the climate record is critical for determining human-induced changes during the present epoch.

  11. A Neuroprotective Function of NSF1 Sustains Autophagy and Lysosomal Trafficking in Drosophila

    PubMed Central

    Babcock, Daniel T.; Shen, Wei; Ganetzky, Barry

    2015-01-01

    A common feature of many neurodegenerative diseases is the accumulation of toxic proteins that disrupt vital cellular functions. Degradative pathways such as autophagy play an important protective role in breaking down misfolded and long-lived proteins. Neurons are particularly vulnerable to defects in these pathways, but many of the details regarding the link between autophagy and neurodegeneration remain unclear. We previously found that temperature-sensitive paralytic mutants in Drosophila are enriched for those exhibiting age-dependent neurodegeneration. Here we show that one of these mutants, comatose (comt), in addition to locomotor defects, displays shortened lifespan and progressive neurodegeneration, including loss of dopaminerigic (DA) neurons. comt encodes N-ethyl-maleimide sensitive fusion protein (NSF1), which has a well-documented role in synaptic transmission. However, the neurodegenerative phenotypes we observe in comt mutants do not appear to depend on defects in synaptic transmission, but rather from their inability to sustain autophagy under stress, due at least in part to a defect in trafficking of lysosomal proteases such as cathepsin-L. Conversely, overexpression of NSF1 rescues α-synuclein-induced toxicity of DA neurons in a model of Parkinson’s disease. Our results demonstrate a neuroprotective role for NSF1 that involves mediation of fusion events crucial for degradative pathways such as autophagy, providing greater understanding of cellular dysfunctions common to several neurodegenerative diseases. PMID:25519897

  12. An Analysis of NSF Research Experience for Undergraduate Site Programs from 2009 through 2014

    NASA Astrophysics Data System (ADS)

    Vargas, R.; Patino, L. C.; Rom, E. L.; Adams, A. S.

    2015-12-01

    The Research Experience for Undergraduate (REU) Program at the U.S. National Science Foundation (NSF) supports U.S. institutions so that they can provide undergraduate students from any college or university the opportunity to conduct research at many different institutions. Participants also gain a better understanding of pathways for research careers. In 2013 a new system for annual report data collection was implemented by the National Science Foundation for all awards, including REU Sites. As a result, REU Site Directors must ask students to self-report data using the NSF Fastlane system. NSF has been collecting this data for several years and information is now available about the effectiveness of this new data collection system. Information on the GEO REU Site student demographics from 2014 will be presented and compared to data from previous years. Results show low participation rates by REU students in the data submission process. Many students who do participate skip questions or chose not to provide answers to the questions. Methods for increasing student participation in the data collection process will be discussed and suggestions for other ways to improve data collection as a community will be presented. Accurate information on student demographics for GEO REU Site programs are important because these students often go on to graduate programs and are the future role models for a diverse workforce.

  13. Building Bridges Between EPO Professionals Across Scientific Disciplines: Partnerships with NSF Centers (First Steps)

    NASA Astrophysics Data System (ADS)

    Steinberg, D.; Black, K.; Schultz, S.

    2010-08-01

    NASA, NSF and other funding organizations support science education and outreach to achieve their broader impact goals. Organizations like ASP and the NSF Research Centers Educators Network (NRCEN) are building networks of education and public outreach (EPO) professionals to enhance programmatic success in reaching these goals. As the professionals who provide these programs to the various scientific communities, we are often the key connectors between investigators at cutting-edge research centers, the education world and the public. However, our profession does not have strong ties for sharing best practices across the different scientific disciplines. To develop those ties, we need to identify our common interests and build on them by sharing lessons learned and best practices. We will use the technique of concept mapping to develop a schematic of how each of us addresses our broader impact goals and discuss the common and divergent features. We will also present the education and outreach logic model that was recently developed by the 27 Education Directors of NSF-funded Materials Research Science and Engineering Centers (MRSEC). Building on this information, we will collaboratively develop a list of key areas of similar interest between ASP and NRCEN EPO professionals.

  14. Thermal conductivity of chirality-sorted carbon nanotube networks

    NASA Astrophysics Data System (ADS)

    Lian, Feifei; Llinas, Juan P.; Li, Zuanyi; Estrada, David; Pop, Eric

    2016-03-01

    The thermal properties of single-walled carbon nanotubes (SWNTs) are of significant interest, yet their dependence on SWNT chirality has been, until now, not explored experimentally. Here, we used electrical heating and infrared thermal imaging to simultaneously study thermal and electrical transport in chirality-sorted SWNT networks. We examined solution processed 90% semiconducting, 90% metallic, purified unsorted (66% semiconducting), and as-grown HiPco SWNT films. The thermal conductivities of these films range from 80 to 370 W m-1 K-1 but are not controlled by chirality, instead being dependent on the morphology (i.e., mass and junction density, quasi-alignment) of the networks. The upper range of the thermal conductivities measured is comparable to that of the best metals (Cu and Ag), but with over an order of magnitude lower mass density. This study reveals important factors controlling the thermal properties of light-weight chirality-sorted SWNT films, for potential thermal and thermoelectric applications.

  15. An integrated optofluidic platform for Raman-activated cell sorting.

    PubMed

    Lau, Adrian Y; Lee, Luke P; Chan, James W

    2008-07-01

    We report on integrated optofluidic Raman-activated cell sorting (RACS) platforms that combine multichannel microfluidic devices and laser tweezers Raman spectroscopy (LTRS) for delivery, identification, and simultaneous sorting of individual cells. The system allows label-free cell identification based on Raman spectroscopy and automated continuous cell sorting. Two optofluidic designs using hydrodynamic focusing and pinch-flow fractionation are evaluated based on their sorting design and flow velocity effect on the laser trapping efficiency at different laser power levels. A proof-of-principle demonstration of the integrated optofluidic LTRS system for the identification and sorting of two leukemia cell lines is presented. This functional prototype lays the foundation for the development of a label-free cell sorting platform based on intrinsic Raman markers for automated sampling and sorting of a large number of individual cells in solution.

  16. Online sorting of recovered wood waste by automated XRF-technology: part II. Sorting efficiencies.

    PubMed

    Hasan, A Rasem; Solo-Gabriele, Helena; Townsend, Timothy

    2011-04-01

    Sorting of waste wood is an important process practiced at recycling facilities in order to detect and divert contaminants from recycled wood products. Contaminants of concern include arsenic, chromium and copper found in chemically preserved wood. The objective of this research was to evaluate the sorting efficiencies of both treated and untreated parts of the wood waste stream, and metal (As, Cr and Cu) mass recoveries by the use of automated X-ray fluorescence (XRF) systems. A full-scale system was used for experimentation. This unit consisted of an XRF-detection chamber mounted on the top of a conveyor and a pneumatic slide-way diverter which sorted wood into presumed treated and presumed untreated piles. A randomized block design was used to evaluate the operational conveyance parameters of the system, including wood feed rate and conveyor belt speed. Results indicated that online sorting efficiencies of waste wood by XRF technology were high based on number and weight of pieces (70-87% and 75-92% for treated wood and 66-97% and 68-96% for untreated wood, respectively). These sorting efficiencies achieved mass recovery for metals of 81-99% for As, 75-95% for Cu and 82-99% of Cr. The incorrect sorting of wood was attributed almost equally to deficiencies in the detection and conveyance/diversion systems. Even with its deficiencies, the system was capable of producing a recyclable portion that met residential soil quality levels established for Florida, for an infeed that contained 5% of treated wood.

  17. ALG-2 activates the MVB sorting function of ALIX through relieving its intramolecular interaction.

    PubMed

    Sun, Sheng; Zhou, Xi; Corvera, Joe; Gallick, Gary E; Lin, Sue-Hwa; Kuang, Jian

    2015-01-01

    The modular adaptor protein ALIX is critically involved in endosomal sorting complexes required for transport (ESCRT)-mediated multivesicular body (MVB) sorting of activated epidermal growth factor receptor (EGFR); however, ALIX contains a default intramolecular interaction that renders ALIX unable to perform this ESCRT function. The ALIX partner protein ALG-2 is a calcium-binding protein that belongs to the calmodulin superfamily. Prompted by a defined biological function of calmodulin, we determined the role of ALG-2 in regulating ALIX involvement in MVB sorting of activated EGFR. Our results show that calcium-dependent ALG-2 interaction with ALIX completely relieves the intramolecular interaction of ALIX and promotes CHMP4-dependent ALIX association with the membrane. EGFR activation induces increased ALG-2 interaction with ALIX, and this increased interaction is responsible for increased ALIX association with the membrane. Functionally, inhibition of ALIX activation by ALG-2 inhibits MVB sorting of activated EGFR as effectively as inhibition of ALIX interaction with CHMP4 does; however, inhibition of ALIX activation by ALG-2 does not affect cytokinetic abscission or equine infectious anemia virus (EIAV) budding. These findings indicate that calcium-dependent ALG-2 interaction with ALIX is specifically responsible for generating functional ALIX that supports MVB sorting of ubiquitinated membrane receptors.

  18. A common assembly module in injectisome and flagellar type III secretion sorting platforms

    NASA Astrophysics Data System (ADS)

    Notti, Ryan Q.; Bhattacharya, Shibani; Lilic, Mirjana; Stebbins, C. Erec

    2015-05-01

    Translocating proteins across the double membrane of Gram-negative bacteria, type III secretion systems (T3SS) occur in two evolutionarily related forms: injectisomes, delivering virulence factors into host cells, and the flagellar system, secreting the polymeric filament used for motility. While both systems share related elements of a cytoplasmic sorting platform that facilitates the hierarchical secretion of protein substrates, its assembly and regulation remain unclear. Here we describe a module mediating the assembly of the sorting platform in both secretion systems, and elucidate the structural basis for segregation of homologous components among these divergent T3SS subtypes sharing a common cytoplasmic milieu. These results provide a foundation for the subtype-specific assembly of T3SS sorting platforms and will support further mechanistic analysis and anti-virulence drug design.

  19. Problem-solving deficits in alcoholics: evidence from the California Card Sorting Test.

    PubMed

    Beatty, W W; Katzung, V M; Nixon, S J; Moreland, V J

    1993-11-01

    In an attempt to clarify the nature of the problem-solving deficits exhibited by chronic alcoholics, the California Card Sorting Test (CCST) and other measures of abstraction and problem solving were administered to 23 alcoholics and 16 nonalcoholic controls, equated for age, education and vocabulary. On the CCST, the alcoholics exhibited three types of deficits which appeared to be relatively independent. First, the alcoholics generated and identified fewer correct concepts than controls, although they executed concepts normally when cued by the examiner. Second, the alcoholics made more perseverative sorting responses and perseverative verbal explanations for their sorting behavior than did controls. Third, alcoholics provided less complete verbal explanations of the concepts that they correctly generated or identified. The differential importance of these factors on various measures of problem solving may help to explain the varied patterns of inefficient problem solving exhibited by alcoholics.

  20. Small Peptide Recognition Sequence for Intracellular Sorting

    PubMed Central

    Pandey, Kailash N.

    2010-01-01

    Increasing evidence indicate that complex arrays of short signals and recognition peptide sequence ensure accurate trafficking and distribution of transmembrane receptors and/or proteins and their ligands into intracellular compartments. Internalization and subsequent trafficking of cell-surface receptors into the cell interior is mediated by specific short-sequence peptide signals within the cytoplasmic domains of these receptor proteins. The short signals usually consist of small linear amino acid sequences, which are recognized by adaptor coat proteins along the endocytic and sorting pathways. In recent years, much has been learned about the function and mechanisms of endocytic pathways responsible for the trafficking and molecular sorting of membrane receptors and their ligands into intracellular compartments, however, the significance and scope of the short sequence motifs in these cellular events is not well understood. Here a particular emphasis has been given to the functions of short-sequence signal motifs responsible for the itinerary and destination of membrane receptors and proteins moving into subcellular compartments. PMID:20817434

  1. Developing Automated Methods of Waste Sorting

    SciTech Connect

    Shurtliff, Rodney Marvin

    2002-08-01

    The U.S. Department of Energy (DOE) analyzed the need complex-wide for remote and automated technologies as they relate to the treatment and disposal of mixed wastes. This analysis revealed that several DOE sites need the capability to open drums containing waste, visually inspect and sort the contents, and finally repackage the containers that are acceptable at a waste disposal facility such as the Waste Isolation Pilot Plant (WIPP) in New Mexico. Conditioning contaminated waste so that it is compatible with the WIPP criteria for storage is an arduous task whether the waste is contact handled (waste having radioactivity levels below 200 mrem/hr) or remote handled. Currently, WIPP non-compliant items are removed from the waste stream manually, at a rate of about one 55-gallon drum per day. Issues relating to contamination-based health hazards as well as repetitive motion health hazards are steering industry towards a more user-friendly, method of conditioning or sorting waste.

  2. ImmuSort, a database on gene plasticity and electronic sorting for immune cells

    PubMed Central

    Wang, Pingzhang; Yang, Yehong; Han, Wenling; Ma, Dalong

    2015-01-01

    Gene expression is highly dynamic and plastic. We present a new immunological database, ImmuSort. Unlike other gene expression databases, ImmuSort provides a convenient way to view global differential gene expression data across thousands of experimental conditions in immune cells. It enables electronic sorting, which is a bioinformatics process to retrieve cell states associated with specific experimental conditions that are mainly based on gene expression intensity. A comparison of gene expression profiles reveals other applications, such as the evaluation of immune cell biomarkers and cell subsets, identification of cell specific and/or disease-associated genes or transcripts, comparison of gene expression in different transcript variants and probe set quality evaluation. A plasticity score is introduced to measure gene plasticity. Average rank and marker evaluation scores are used to evaluate biomarkers. The current version includes 31 human and 17 mouse immune cell groups, comprising 10,422 and 3,929 microarrays derived from public databases, respectively. A total of 20,283 human and 20,963 mouse genes are available to query in the database. Examples show the distinct advantages of the database. The database URL is http://202.85.212.211/Account/ImmuSort.html. PMID:25988315

  3. A cell sorting protocol for selecting high-producing sub-populations of Sf9 and High Five™ cells.

    PubMed

    Vidigal, João; Dias, Mafalda M; Fernandes, Fabiana; Patrone, Marco; Bispo, Cláudia; Andrade, Cláudia; Gardner, Rui; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P

    2013-12-01

    Insect cell lines such as Sf9 and High Five™ have been widely used to produce recombinant proteins mostly by the lytic baculovirus vector system. We have recently established an expression platform in Sf9 cells using a fluorescence-based recombinase mediated cassette exchange (RMCE) strategy which has similar development timelines but avoids baculovirus infection. To expedite cell engineering efforts, a robust fluorescence-activated cell sorting (FACS) protocol optimized for insect cells was developed here. The standard sorting conditions used for mammalian cells proved to be unsuitable, resulting in post-sorting viabilities below 10% for both cell lines. We found that the extreme sensitivity to the shear stress displayed by Sf9 and High Five™ cells was the limiting factor, and using Pluronic F-68 in the cell suspension could increase post-sorting viabilities in a dose dependent manner. The newly developed protocol was then used to sort stable populations of both cell lines tagged with a DsRed-expressing cassette. Before sorting, the average fluorescence intensity of the Sf9 cell population was 3-fold higher than that of the High Five™ cell population. By enriching with the 10% strongest DsRed-fluorescent cells, the productivity of both cell populations could be successfully improved. The established sorting protocol potentiates the use of RMCE technology for recombinant protein production in insect cells.

  4. Unravelling the pivotal role of Alix in MVB sorting and silencing of the activated EGFR.

    PubMed

    Sun, Sheng; Zhou, Xi; Zhang, Wei; Gallick, Gary E; Kuang, Jian

    2015-03-15

    Endosomal sorting complex required for transport (ESCRT)-III-mediated membrane invagination and scission are a critical step in multivesicular body (MVB) sorting of ubiquitinated membrane receptors, and generally thought to be required for degradation of these receptors in lysosomes. The adaptor protein Alix is critically involved in multiple ESCRT-III-mediated, membrane-remodelling processes in mammalian cells. However, Alix knockdown does not inhibit degradation of the activated epidermal growth factor receptor (EGFR) in mammalian cell lines, leading to a widely held notion that Alix is not critically involved in MVB sorting of ubiquitinated membrane receptors in mammalian cells. In the present study, we demonstrate that, despite its non-essential role in degradation of the activated EGFR, Alix plays a critical role in its MVB sorting and silencing Epidermal growth factor (EGF) stimulation of mammalian cell lines induces Alix's interaction with the ubiquitinated EGFR via the Alix V domain, and increases Alix's association with membrane-bound charged multivesicular body protein 4 (CHMP4) via the Alix Bro1 domain. Under both continuous and pulse-chase EGF stimulation conditions, inhibition of Alix's interaction with membrane-bound CHMP4, inhibition of Alix dimerization through the V domain or Alix knockdown dramatically inhibits MVB sorting of the activated EGFR and promotes sustained activation of extracellular-signal regulated kinase (ERK)1/2. Under the continuous EGF stimulation conditions, these cell treatments also retard degradation of the activated EGFR. These findings indicate that Alix is critically involved in MVB sorting of ubiquitinated membrane receptors in mammalian cells.

  5. Optical Science and Engineering. New Directions and Opportunities in Research and Education. NSF Workshop (Arlington, VA, May 23-24, 1994).

    ERIC Educational Resources Information Center

    National Science Foundation, Arlington, VA.

    The National Science Foundation (NSF) workshop on Optical Science and Engineering was organized to examine approaches NSF could use to identify opportunities in optical science, engineering, and education that meet both the mission of NSF and its broader national goals. The workshop participants identified opportunities where optical science and…

  6. Cargo-dependent degradation of ESCRT-I as a feedback mechanism to modulate endosomal sorting.

    PubMed

    Malerød, Lene; Pedersen, Nina Marie; Sem Wegner, Catherine Elisabeth; Lobert, Viola Hélène; Leithe, Edward; Brech, Andreas; Rivedal, Edgar; Liestøl, Knut; Stenmark, Harald

    2011-09-01

    Ligand-mediated lysosomal degradation of growth factor receptors, mediated by the endosomal sorting complex required for transport (ESCRT) machinery, is a mechanism that attenuates the cellular response to growth factors. In this article, we present a novel regulatory mechanism that involves ligand-mediated degradation of a key component of the sorting machinery itself. We have investigated the endosomal localization of subunits of the four ESCRTs-Hrs (ESCRT-0), Tsg101 (ESCRT-I), EAP30/Vps22 (ESCRT-II) and charged multivesicular body protein 3/Vps24 (ESCRT-III). All the components were detected on the limiting membrane of multivesicular endosomes (MVEs). Surprisingly, however, Tsg101 and other ESCRT-I subunits were also detected within intraluminal vesicles (ILVs) of MVEs. Tsg101 was sequestered along with cargo during endosomal sorting into ILVs and further degraded in lysosomes. Importantly, ESCRT-mediated downregulation of two distinct cargoes, epidermal growth factor receptor (EGFR) and connexin43, mutually made cells refractory to degradation of the other cargo. Our observations indicate that the degradation of a key ESCRT component along with cargo represents a novel feedback control of endosomal sorting by preventing collateral degradation of cell surface receptors following stimulation of one specific pathway.

  7. Extension of the sorting instructions for household plastic packaging and changes in exposure to bioaerosols at materials recovery facilities.

    PubMed

    Schlosser, O; Déportes, I Z; Facon, B; Fromont, E

    2015-12-01

    The aim of this study was to assess how extending the sorting instructions for plastic packaging would affect the exposure of workers working at materials recovery facility (MRF) to dust, endotoxins, fungi and bacteria, taking into consideration other factors that could have an influence on this exposure. Personal sampling was carried out at four MRFs during six sampling campaigns at each facility, both in sorting rooms and when the workers were involved in "mobile tasks" away from the rooms. The data was analysed by describing the extension of sorting instructions both using a qualitative variable (after vs before) and using data for the pots and trays recycling stream, including or excluding plastic film. Overall, before the extension of the sorting guidelines, the geometric mean of personal exposure levels in sorting rooms was 0.3mg/m(3) for dust, 27.7 EU/m(3) for endotoxins, 13,000 CFU/m(3) for fungi and 1800 CFU/m(3) for bacteria. When workers were involved in mobile tasks away from the rooms, these averages were 0.5mg/m(3), 25.7 EU/m(3), 28,000 CFU/m(3) and 5100 CFU/m(3) respectively.The application by households of instructions to include pots, trays and film with other recyclable plastic packaging led to an increase in exposure to endotoxins, fungi and bacteria at MRFs. For an increase of 0.5 kg per inhabitant per year in the pots, trays and film recycling stream, exposure in sorting rooms rose by a factor of 1.4-2.2, depending on the biological agent. Exposure during mobile tasks increased by a factor of 3.0-3.6. The age of the waste amplified the effect of the extension of sorting instructions on exposure to fungi, bacteria and endotoxins. Factors that had a significant influence on the exposure of workers to dust and/or bioaerosols included the presence of paper, newspapers and magazines in the sorted waste, the order in which incoming waste was treated and the quality of the ventilation system in the sorting rooms. The levels of exposure observed in

  8. NSF Lower Atmospheric Observing Facilities (LAOF) in support of science and education

    NASA Astrophysics Data System (ADS)

    Baeuerle, B.; Rockwell, A.

    2012-12-01

    Researchers, students and teachers who want to understand and describe the Earth System require high quality observations of the atmosphere, ocean, and biosphere. Making these observations requires state-of-the-art instruments and systems, often carried on highly capable research platforms. To support this need of the geosciences community, the National Science Foundation's (NSF) Division of Atmospheric and Geospace Sciences (AGS) provides multi-user national facilities through its Lower Atmospheric Observing Facilities (LAOF) Program at no cost to the investigator. These facilities, which include research aircraft, radars, lidars, and surface and sounding systems, receive NSF financial support and are eligible for deployment funding. The facilities are managed and operated by five LAOF partner organizations: the National Center for Atmospheric Research (NCAR); Colorado State University (CSU); the University of Wyoming (UWY); the Center for Severe Weather Research (CSWR); and the Center for Interdisciplinary Remotely-Piloted Aircraft Studies (CIRPAS). These observational facilities are available on a competitive basis to all qualified researchers from US universities, requiring the platforms and associated services to carry out various research objectives. The deployment of all facilities is driven by scientific merit, capabilities of a specific facility to carry out the proposed observations, and scheduling for the requested time. The process for considering requests and setting priorities is determined on the basis of the complexity of a field campaign. The poster will describe available observing facilities and associated services, and explain the request process researchers have to follow to secure access to these platforms for scientific as well as educational deployments. NSF/NCAR GV Aircraft

  9. Proceedings of the Fifth NASA/NSF/DOD Workshop on Aerospace Computational Control

    NASA Technical Reports Server (NTRS)

    Wette, M. (Editor); Man, G. K. (Editor)

    1993-01-01

    The Fifth Annual Workshop on Aerospace Computational Control was one in a series of workshops sponsored by NASA, NSF, and the DOD. The purpose of these workshops is to address computational issues in the analysis, design, and testing of flexible multibody control systems for aerospace applications. The intention in holding these workshops is to bring together users, researchers, and developers of computational tools in aerospace systems (spacecraft, space robotics, aerospace transportation vehicles, etc.) for the purpose of exchanging ideas on the state of the art in computational tools and techniques.

  10. Molecular shape sorting using molecular organic cages.

    PubMed

    Mitra, Tamoghna; Jelfs, Kim E; Schmidtmann, Marc; Ahmed, Adham; Chong, Samantha Y; Adams, Dave J; Cooper, Andrew I

    2013-04-01

    The energy-efficient separation of chemical feedstocks is a major sustainability challenge. Porous extended frameworks such as zeolites or metal-organic frameworks are one potential solution to this problem. Here, we show that organic molecules, rather than frameworks, can separate other organic molecules by size and shape. A molecular organic cage is shown to separate a common aromatic feedstock (mesitylene) from its structural isomer (4-ethyltoluene) with an unprecedented perfect specificity for the latter. This specificity stems from the structure of the intrinsically porous cage molecule, which is itself synthesized from a derivative of mesitylene. In other words, crystalline organic molecules are used to separate other organic molecules. The specificity is defined by the cage structure alone, so this solid-state 'shape sorting' is, uniquely, mirrored for cage molecules in solution. The behaviour can be understood from a combination of atomistic simulations for individual cage molecules and solid-state molecular dynamics simulations.

  11. Passive chip-based droplet sorting

    SciTech Connect

    Beer, Neil Reginald; Lee, Abraham P; Hatch, Andrew C; Fisher, Jeffrey S

    2015-11-05

    An apparatus for passive sorting of microdroplets including a main flow channel, a flow stream of microdroplets in the main flow channel wherein the microdroplets have substantially the same diameter and wherein the flow stream of microdroplets includes first microdroplets having a first degree of stiffness and second microdroplets having a second degree of stiffness wherein the second degree of stiffness is different than the first degree of stiffness. A second flow channel is connected to the main flow channel for the second microdroplets having a second degree of stiffness. A separator separates the second microdroplets having a second degree of stiffness from the first microdroplets and directs the second microdroplets having a second degree of stiffness into the second flow channel.

  12. Passive chip-based droplet sorting

    DOEpatents

    Beer, Neil Reginald; Lee, Abraham P; Hatch, Andrew C; Fisher, Jeffrey S

    2015-03-03

    An apparatus for passive sorting of microdroplets including a main flow channel, a flow stream of microdroplets in the main flow channel wherein the microdroplets have substantially the same diameter and wherein the flow stream of microdroplets includes first microdroplets having a first degree of stiffness and second microdroplets having a second degree of stiffness wherein the second degree of stiffness is different than the first degree of stiffness. A second flow channel is connected to the main flow channel for the second microdroplets having a second degree of stiffness. A separator separates the second microdroplets having a second degree of stiffness from the first microdroplets and directs the second microdroplets having a second degree of stiffness into the second flow channel.

  13. Phase sorting wave-particle correlator

    NASA Astrophysics Data System (ADS)

    Kletzing, C. A.; LaBelle, J.; Bounds, S. R.; Dolan, J.; Kaeppler, S. R.; Dombrowski, M.

    2017-02-01

    Wave-particle correlations, particularly of Langmuir waves and electrons, have been the subject of significant interest extending back to the 1970s. Often, these correlations have been simply observing modulation of the electrons at the plasma frequency with no phase resolution. The first phase-resolving correlators were developed at UC Berkeley in the late 1980s and reported by Ergun in the early 1990s. A design is presented which further improves on phase resolution in correlations of Langmuir waves and electrons with phase resolution of 22.5°. In this technique, a phase-locked loop (PLL) is used to lock onto the wave and subdivide the phase. Electrons are sorted on-the-fly as they arrive into the phase bins. Discussed are details of accurate timing, testing, and calibration of this system as well as results from rocket flights in which statistically significant phase correlations have been observed.

  14. Learning sorting algorithms through visualization construction

    NASA Astrophysics Data System (ADS)

    Cetin, Ibrahim; Andrews-Larson, Christine

    2016-01-01

    Recent increased interest in computational thinking poses an important question to researchers: What are the best ways to teach fundamental computing concepts to students? Visualization is suggested as one way of supporting student learning. This mixed-method study aimed to (i) examine the effect of instruction in which students constructed visualizations on students' programming achievement and students' attitudes toward computer programming, and (ii) explore how this kind of instruction supports students' learning according to their self-reported experiences in the course. The study was conducted with 58 pre-service teachers who were enrolled in their second programming class. They expect to teach information technology and computing-related courses at the primary and secondary levels. An embedded experimental model was utilized as a research design. Students in the experimental group were given instruction that required students to construct visualizations related to sorting, whereas students in the control group viewed pre-made visualizations. After the instructional intervention, eight students from each group were selected for semi-structured interviews. The results showed that the intervention based on visualization construction resulted in significantly better acquisition of sorting concepts. However, there was no significant difference between the groups with respect to students' attitudes toward computer programming. Qualitative data analysis indicated that students in the experimental group constructed necessary abstractions through their engagement in visualization construction activities. The authors of this study argue that the students' active engagement in the visualization construction activities explains only one side of students' success. The other side can be explained through the instructional approach, constructionism in this case, used to design instruction. The conclusions and implications of this study can be used by researchers and

  15. 17. VIEW LOOKING NORTHEAST, SHOWING SORTING AND SHIPPING SHED WITH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. VIEW LOOKING NORTHEAST, SHOWING SORTING AND SHIPPING SHED WITH SAWMILL BEHIND - Ichabod T. Williams & Sons Sawmill & Veneer Plant, Roosevelt Avenue at Carteret Avenue, Carteret, Middlesex County, NJ

  16. Pattern matching based active optical sorting of colloids/cells

    NASA Astrophysics Data System (ADS)

    Verma, R. S.; Dasgupta, R.; Ahlawat, S.; Kumar, N.; Uppal, A.; Gupta, P. K.

    2013-08-01

    We report active optical sorting of colloids/cells by employing a cross correlation based pattern matching technique for selection of the desired objects and thereafter sorting using dynamically controllable holographic optical traps. The problem of possible collision between the different sets of objects during sorting was avoided by raising one set of particles to a different plane. We also present the results obtained on using this approach for some representative applications such as sorting of silica particles of two different sizes, of closely packed colloids and of white blood cells and red blood cells from a mixture of the two.

  17. 34. VIEW OF VIVIANNA WORKS ORE SORTING AND CRUSHING PLATFORM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. VIEW OF VIVIANNA WORKS ORE SORTING AND CRUSHING PLATFORM LOOKING EAST, NORTHEAST. NOTICE RAIL TIES EMBEDDED IN CONCRETE. - Mariscal Quicksilver Mine & Reduction Works, Terlingua, Brewster County, TX

  18. VIP21/caveolin, glycosphingolipid clusters and the sorting of glycosylphosphatidylinositol-anchored proteins in epithelial cells.

    PubMed Central

    Zurzolo, C; van't Hof, W; van Meer, G; Rodriguez-Boulan, E

    1994-01-01

    We studied the role of the association between glycosylphosphatidylinositol (GPI)-anchored proteins and glycosphingolipid (GSL) clusters in apical targeting using gD1-DAF, a GPI-anchored protein that is differentially sorted by three epithelial cell lines. Differently from MDCK cells, where both gD1-DAF and glucosylceramide (GlcCer) are sorted to the apical membrane, in MDCK Concanavalin A-resistant cells (MDCK-ConAr) gD1-DAF was mis-sorted to both surfaces, but GlcCer was still targeted to the apical surface. In both MDCK and MDCK-ConAr cells, gD1-DAF became associated with TX-100-insoluble GSL clusters during transport to the cell surface. In dramatic contrast with MDCK cells, the Fischer rat thyroid (FRT) cell line targeted both gD1-DAF and GlcCer basolaterally. The targeting differences for GSLs in FRT and MDCK cells cannot be accounted for by a differential ability to form clusters because, in spite of major differences in the GSL composition, both cell lines assembled GSLs into TX-100-insoluble complexes with identical isopycnic densities. Surprisingly, in FRT cells, gD1-DAF did not form clusters with GSLs and, therefore, remained completely soluble. This clustering defect in FRT cells correlated with the lack of expression of VIP21/caveolin, a protein localized to both the plasma membrane caveolae and the trans Golgi network. This suggests that VIP21/caveolin may have an important role in recruiting GPI-anchored proteins into GSL complexes necessary for their apical sorting. However, since MDCK-ConAr cells expressed caveolin and clustered GPI-anchored proteins normally, yet mis-sorted them, our results also indicate that clustering and caveolin are not sufficient for apical targeting, and that additional factors are required for the accurate apical sorting of GPI-anchored proteins. Images PMID:8306971

  19. Cold Weather Wind Turbines: A Joint NASA/NSF/DOE Effort in Technology Transfer and Commercialization

    NASA Technical Reports Server (NTRS)

    Flynn, Michael; Bubenheim, David; Chiang, Erick; Goldman, Peter; Kohout, Lisa; Norton, Gary; Kliss, Mark (Technical Monitor)

    1997-01-01

    Renewable energy sources and their integration with other power sources to support remote communities is of interest for Mars applications as well as Earth communities. The National Science Foundation (NSF), NASA, and the Department of Energy (DOE) have been jointly supporting development of a 100 kW cold weather wind turbine through grants and SBIRs independently managed by each agency but coordinated by NASA. The NSF grant addressed issues associated with the South Pole application and a 3 kW direct drive unit is being tested there in anticipation of the 100 kW unit operation. The DOE-NREL contract focused on development of the 100 kW direct drive generator. The NASA SBIR focused on the development of the 100 kW direct drive wind turbine. The success of this effort has required coordination and team involvement of federal agencies and the industrial partners. Designs of the wind turbine and component performance testing results will be presented. Plans for field testing of wind turbines, based on this design, in village energy systems in Alaska and in energy production at the South Pole Station will be discussed. Also included will be a discussion of terrestrial and space use of hybrid energy systems, including renewable energy sources, such as the wind turbine, to support remote communities.

  20. The NSF CubeSat Program: The Promise of Scientific Projects (Invited)

    NASA Astrophysics Data System (ADS)

    Moretto, T.

    2009-12-01

    Working in the cubesat regime of space missions imposes obvious limitations on the complexity and scope of experiments that can be accomplished. However, these very small satellite projects also offer substantial advantages. In comparison to the traditional large satellite missions they provide a means to fast, near immediate, implementation of scientific ideas; to narrowly focused science investigations; to extended multi-point measurements; and to try out creative new, but high-risk, experimental approaches. Relatively simple but well-chosen measurements from CubeSat missions can complement observations from ground or large spacecraft missions to observe phenomena of interest over different geographic locations, at higher or lower altitudes, an at different local times. They can also provide crucial information on the small-scale structure of phenomena or help provide a global view. The powerful utility of all of these features is verified in the rich collection of scientific ideas emerging in response to the newly established NSF CubeSat program. The assortment of scientific investigations being proposed spans all across solar, magnetospheric, ionospheric, upper-atmospheric, and space weather research. Based on examples from current projects and potential future directions for the NSF CubeSat program, the presentation will explore the prolific scientific promise of the program.

  1. Building a research group of Space Physics at UAHuntsville -- the impact of an NSF career award

    NASA Astrophysics Data System (ADS)

    Li, G.

    2011-12-01

    G. Li (1,2) (1) Department of Physics, University of Alabama in Huntsville Huntsville, AL, 35899 (2) CSPAR, University of Alabama in Huntsville Huntsville, AL, 35899 The author joined the faculty of the department of Physics at University of Alabama in Huntsville in August 2008. He was awarded the NSF Career award ATM-0847719 in 2009. To date, the Career award has provided partial supports to one postdoc, two graduate students and three undergraduate students for a variety of periods. Three publications came out as a result of the award (one of which is first authored by one undergraduate). Another two publications are in preparation. The award also helped the PI to be further recognized by the field of space plasma physics and cosmic ray physics. For example, in July 2009, the PI was awarded the Young Scientist Medal by the International Union of Pure and Applied Physics (IUPAP); in April 2010, the PI won an Oak Ridge Associated Universities (ORAU) 2010 Ralph E. Powe Junior Faculty Enhancement Award. In short, the NSF CAREER has helped the PI to start his career at a level without which, will be impossible.

  2. Limiting Index Sort: A New Non-Dominated Sorting Algorithm and its Comparison to the State-of-the-Art

    DTIC Science & Technology

    2010-05-01

    Skyline Algorithm ( SaLSa ), and the Divide-and-Conquer (D&C) approach. LIS outperformed SaLSa in all tests, and it outperformed D&C when sorting...dominé de pointe, le Sort and Limit Skyline Algorithm ( SaLSa ) et l’algorithme Divide-and-Conquer (D&C). LIS a surclassé SaLSa dans tous les tests...art non-dominated sorting algorithms, the Sort and Limit Skyline Algorithm ( SaLSa ), and the Divide-and-Conquer (D&C) approach. LIS outperformed

  3. Seminal plasma affects sperm sex sorting in boars.

    PubMed

    Alkmin, Diego V; Parrilla, Inmaculada; Tarantini, Tatiana; Del Olmo, David; Vazquez, Juan M; Martinez, Emilio A; Roca, Jordi

    2016-04-01

    Two experiments were conducted in boar semen samples to evaluate how both holding time (24h) and the presence of seminal plasma (SP) before sorting affect sperm sortability and the ability of sex-sorted spermatozoa to tolerate liquid storage. Whole ejaculate samples were divided into three aliquots immediately after collection: one was diluted (1:1, v/v) in Beltsville thawing solution (BTS; 50% SP); the SP of the other two aliquots was removed and the sperm pellets were diluted with BTS + 10% of their own SP (10% SP) or BTS alone (0% SP). The three aliquots of each ejaculate were divided into two portions, one that was processed immediately for sorting and a second that was sorted after 24h storage at 15-17°C. In the first experiment, the ability to exhibit well-defined X- and Y-chromosome-bearing sperm peaks (split) in the cytometry histogram and the subsequent sorting efficiency were assessed (20 ejaculates). In contrast with holding time, the SP proportion influenced the parameters examined, as evidenced by the higher number of ejaculates exhibiting split and better sorting efficiency (P<0.05) in semen samples with 0-10% SP compared with those with 50% SP. In a second experiment, the quality (viability, total and progressive motility) and functionality (plasma membrane fluidity and intracellular generation of reactive oxygen species) of sex-sorted spermatozoa were evaluated after 0, 72 and 120h storage at 15-17°C (10 ejaculates). Holding time and SP proportion did not influence the quality or functionality of stored sex-sorted spermatozoa. In conclusion, a holding time as long as 24h before sorting did not negatively affect sex sorting efficiency or the ability of sorted boar spermatozoa to tolerate long-term liquid storage. A high proportion of SP (50%) in the semen samples before sorting reduced the number of ejaculates to be sorted and negatively influenced the sorting efficiency, but did not affect the ability of sex-sorted spermatozoa to tolerate liquid

  4. Processes of Overall Similarity Sorting in Free Classification

    ERIC Educational Resources Information Center

    Milton, Fraser; Longmore, Christopher A.; Wills, A. J.

    2008-01-01

    The processes of overall similarity sorting were investigated in 5 free classification experiments. Experiments 1 and 2 demonstrated that increasing time pressure can reduce the likelihood of overall similarity categorization. Experiment 3 showed that a concurrent load also reduced overall similarity sorting. These findings suggest that overall…

  5. Surface free energy activated high-throughput cell sorting.

    PubMed

    Zhang, Xinru; Zhang, Qian; Yan, Tao; Jiang, Zeyi; Zhang, Xinxin; Zuo, Yi Y

    2014-09-16

    Cell sorting is an important screening process in microbiology, biotechnology, and clinical research. Existing methods are mainly based on single-cell analysis as in flow cytometric and microfluidic cell sorters. Here we report a label-free bulk method for sorting cells by differentiating their characteristic surface free energies (SFEs). We demonstrated the feasibility of this method by sorting model binary cell mixtures of various bacterial species, including Pseudomonas putida KT2440, Enterococcus faecalis ATCC 29212, Salmonella Typhimurium ATCC 14028, and Escherichia coli DH5α. This method can effectively separate 10(10) bacterial cells within 30 min. Individual bacterial species can be sorted with up to 96% efficiency, and the cell viability ratio can be as high as 99%. In addition to its capacity of sorting evenly mixed bacterial cells, we demonstrated the feasibility of this method in selecting and enriching cells of minor populations in the mixture (presenting at only 1% in quantity) to a purity as high as 99%. This SFE-activated method may be used as a stand-alone method for quickly sorting a large quantity of bacterial cells or as a prescreening tool for microbial discrimination. Given its advantages of label-free, high-throughput, low cost, and simplicity, this SFE-activated cell sorting method has potential in various applications of sorting cells and abiotic particles.

  6. Disentangling Dimensions in the Dimensional Change Card-Sorting Task

    ERIC Educational Resources Information Center

    Kloo, Daniela; Perner, Josef

    2005-01-01

    The dimensional change card-sorting task (DCCS task) is frequently used to assess young children's executive abilities. However, the source of children's difficulty with this task is still under debate. In the standard DCCS task, children have to sort, for example, test cards with a red cherry or a blue banana into two boxes marked with target…

  7. Sorting: Groups and Graphs. Used Numbers. Grades 2-3.

    ERIC Educational Resources Information Center

    Russell, Susan Jo; Corwin, Rebecca B.

    A unit of study that introduces sorting and classification as a way of organizing data is presented. Suitable for students in grades 2 and 3, it provides a foundation for further work in statistics and data analysis. The investigations may extend from one to five class sessions and are grouped into three parts: "Introduction to Sorting"; "Sorting…

  8. Cloning of Plasmodium falciparum by single-cell sorting.

    PubMed

    Miao, Jun; Li, Xiaolian; Cui, Liwang

    2010-10-01

    Malaria parasite cloning is traditionally carried out mainly by using the limiting dilution method, which is laborious, imprecise, and unable to distinguish multiply-infected RBCs. In this study, we used a parasite engineered to express green fluorescent protein (GFP) to evaluate a single-cell sorting method for rapidly cloning Plasmodium falciparum. By dividing a two-dimensional scattergram from a cell sorter into 17 gates, we determined the parameters for isolating singly-infected erythrocytes and sorted them into individual cultures. Pre-gating of the engineered parasites for GFP allowed the isolation of almost 100% GFP-positive clones. Compared with the limiting dilution method, the number of parasite clones obtained by single-cell sorting was much higher. Molecular analyses showed that parasite isolates obtained by single-cell sorting were highly homogenous. This highly efficient single-cell sorting method should prove very useful for cloning both P. falciparum laboratory populations from genetic manipulation experiments and clinical samples.

  9. ArfGAPs: key regulators for receptor sorting

    PubMed Central

    Shiba, Yoko; Randazzo, Paul A.

    2015-01-01

    Mammalian cells have many membranous organelles that require proper composition of proteins and lipids. Cargo sorting is a process required for transporting specific proteins and lipids to appropriate organelles, and if this process is disrupted, organelle function as well as cell function is disrupted. ArfGAP family proteins have been found to be critical for receptor sorting. In this review, we summarize our recent knowledge about the mechanism of cargo sorting that require function of ArfGAPs in promoting the formation of transport vesicles, and discuss the involvement of specific ArfGAPs for the sorting of a variety of receptors, such as MPR, EGFR, TfR, Glut4, TRAIL-R1/DR4, M5-muscarinic receptor, c-KIT, rhodopsin and β1-integrin. Given the importance of many of these receptors to human disease, the studies of ArfGAPs may provide novel therapeutic strategies in addition to providing mechanistic insight of receptor sorting. PMID:26046097

  10. Chromosome photoinactivation, a new method for high speed chromosome sorting

    SciTech Connect

    Martin, J.C.; Park, M.; Han, K.T.; Cram, L.S. )

    1993-01-01

    A new optical high-speed chromosome sorting concept is under development which relies on chromosome inactivation rather than droplet sorting to meet the demands of large volume sorting for cloning into large insert vectors. Inactivation can be achieved by photosensitizing and cross-linking metaphase chromosomes. By eliminating the need to create droplets, sorting rates 50 to 100 times faster than the sorting rates of commercial sorters will be achieved. Preliminary experiments using 8-methoxy psoralen in combination with UV doses of about 20 kJ/m2 have shown that: (1) DNA is cross-linked and remains double stranded even under denaturing conditions, (2) the ability of psoralen treated plasmid DNA to transect E. coli XL1-Blue cells is totally blocked following UV exposure, and (3) an average of one interstrand cross-link per 6 kb is produced with these UV doses.

  11. Regular expression order-sorted unification and matching

    PubMed Central

    Kutsia, Temur; Marin, Mircea

    2015-01-01

    We extend order-sorted unification by permitting regular expression sorts for variables and in the domains of function symbols. The obtained signature corresponds to a finite bottom-up unranked tree automaton. We prove that regular expression order-sorted (REOS) unification is of type infinitary and decidable. The unification problem presented by us generalizes some known problems, such as, e.g., order-sorted unification for ranked terms, sequence unification, and word unification with regular constraints. Decidability of REOS unification implies that sequence unification with regular hedge language constraints is decidable, generalizing the decidability result of word unification with regular constraints to terms. A sort weakening algorithm helps to construct a minimal complete set of REOS unifiers from the solutions of sequence unification problems. Moreover, we design a complete algorithm for REOS matching, and show that this problem is NP-complete and the corresponding counting problem is #P-complete. PMID:26523088

  12. Cell sorting using efficient light shaping approaches

    NASA Astrophysics Data System (ADS)

    Bañas, Andrew; Palima, Darwin; Villangca, Mark; Glückstad, Jesper

    2016-03-01

    Early detection of diseases can save lives. Hence, there is emphasis in sorting rare disease-indicating cells within small dilute quantities such as in the confines of lab-on-a-chip devices. In our work, we use optical forces to isolate red blood cells detected by machine vision. This approach is gentler, less invasive and more economical compared to conventional FACS systems. As cells are less responsive to plastic or glass beads commonly used in the optical manipulation literature, and since laser safety would be an issue in clinical use, we develop efficient approaches in utilizing lasers and light modulation devices. The Generalized Phase Contrast (GPC) method that can be used for efficiently illuminating spatial light modulators or creating well-defined contiguous optical traps is supplemented by diffractive techniques capable of integrating the available light and creating 2D or 3D beam distributions aimed at the positions of the detected cells. Furthermore, the beam shaping freedom provided by GPC can allow optimizations in the beam's propagation and its interaction with the catapulted cells.

  13. Nanoplasmonic lenses for bacteria sorting (Presentation Recording)

    NASA Astrophysics Data System (ADS)

    Zhu, Xiangchao; Yanik, Ahmet A.

    2015-08-01

    We demonstrate that patches of two dimensional arrays of circular plasmonic nanoholes patterned on gold-titanium thin film enables subwavelength focusing of visible light in far field region. Efficient coupling of the light with the excited surface plasmon at metal dielectric interface results in strong light transmission. As a result, surface plasmon plays an important role in the far field focusing behavior of the nanohole-aperture patches device. Furthermore, the focal length of the focused beam was found to be predominantly dependent on the overall size of the patch, which is in good agreement with that calculated by Rayleigh-Sommerfield integral formula. The focused light beam can be utilized to separate bio-particles in the dynamic range from 0.1 μm to 1 μm through mainly overcoming the drag force induced by fluid flow. In our proposed model, focused light generated by our plasmonic lenses will push the larger bio-particles in size back to the source of fluid flow and allow the smaller particles to move towards the central aperture of the patch. Such a new kind of plasmonic lenses open up possibility of sorting bacterium-like particles with plasmonic nanolenses, and also represent a promising tool in the field of virology.

  14. Microfluidic-chip platform for cell sorting

    NASA Astrophysics Data System (ADS)

    Malik, Sarul; Balyan, Prerna; Akhtar, J.; Agarwal, Ajay

    2016-04-01

    Cell sorting and separation are considered to be very crucial preparatory steps for numerous clinical diagnostics and therapeutics applications in cell biology research arena. Label free cell separation techniques acceptance rate has been increased to multifold by various research groups. Size based cell separation method focuses on the intrinsic properties of the cell which not only avoids clogging issues associated with mechanical and centrifugation filtration methods but also reduces the overall cost for the process. Consequentially flow based cell separation method for continuous flow has attracted the attention of millions. Due to the realization of structures close to particle size in micro dimensions, the microfluidic devices offer precise and rapid particle manipulation which ultimately leads to an extraordinary cell separation results. The proposed microfluidic device is fabricated to separate polystyrene beads of size 1 µm, 5 µm, 10 µm and 20 µm. The actual dimensions of blood corpuscles were kept in mind while deciding the particle size of polystyrene beads which are used as a model particles for study.

  15. An investigation of the effect of membrane curvature on transmembrane-domain dependent protein sorting in lipid bilayers

    PubMed Central

    Fossati, Matteo; Goud, Bruno; Borgese, Nica; Manneville, Jean-Baptiste

    2014-01-01

    Sorting of membrane proteins within the secretory pathway of eukaryotic cells is a complex process involving discrete sorting signals as well as physico-chemical properties of the transmembrane domain (TMD). Previous work demonstrated that tail-anchored (TA) protein sorting at the interface between the Endoplasmic Reticulum (ER) and the Golgi complex is exquisitely dependent on the length and hydrophobicity of the transmembrane domain, and suggested that an imbalance between TMD length and bilayer thickness (hydrophobic mismatch) could drive long TMD-containing proteins into curved membrane domains, including ER exit sites, with consequent export of the mismatched protein out of the ER. Here, we tested a possible role of curvature in TMD-dependent sorting in a model system consisting of Giant Unilamellar Vesicles (GUVs) from which narrow membrane tubes were pulled by micromanipulation. Fluorescent TA proteins differing in TMD length were incorporated into GUVs of uniform lipid composition or made of total ER lipids, and TMD-dependent sorting and diffusion, as well as the bending rigidity of bilayers made of microsomal lipids, were investigated. Long and short TMD-containing constructs were inserted with similar orientation, diffused equally rapidly in GUVs and in tubes pulled from GUVs, and no difference in their final distribution between planar and curved regions was detected. These results indicate that curvature alone is not sufficient to drive TMD-dependent sorting at the ER-Golgi interface, and set the basis for the investigation of the additional factors that must be required. PMID:25210649

  16. Spatial Sorting Drives Morphological Variation in the Invasive Bird, Acridotheris tristis

    PubMed Central

    Berthouly-Salazar, Cécile; van Rensburg, Berndt J.; Le Roux, Johannes J.; van Vuuren, Bettine J.; Hui, Cang

    2012-01-01

    The speed of range expansion in many invasive species is often accelerating because individuals with stronger dispersal abilities are more likely to be found at the range front. This ‘spatial sorting’ of strong dispersers will drive the acceleration of range expansion. In this study, we test whether the process of spatial sorting is at work in an invasive bird population (Common myna, Acridotheris tristis) in South Africa. Specifically, we sampled individuals across its invasive range and compared morphometric measurements relevant and non-relevant to the dispersal ability. Besides testing for signals of spatial sorting, we further examined the effect of environmental factors on morphological variations. Our results showed that dispersal-relevant traits are significantly correlated with distance from the range core, with strong sexual dimorphism, indicative of sex-biased dispersal. Morphological variations were significant in wing and head traits of females, suggesting females as the primary dispersing sex. In contrast, traits not related to dispersal such as those associated with foraging showed no signs of spatial sorting but were significantly affected by environmental variables such as the vegetation and the intensity of urbanisation. When taken together, our results support the role of spatial sorting in facilitating the expansion of Common myna in South Africa despite its low propensity to disperse in the native range. PMID:22693591

  17. Crossing Borders to Advance the Frontier: NSF's Role in International Outreach

    NASA Astrophysics Data System (ADS)

    Bement, Arden

    2006-04-01

    The globalization of today's science and engineering is unprecedented. Ideas and discoveries emerge around the world and are transmitted instantaneously. Skills and capabilities are moving to new venues. We can view this free flow of investment and intellectual capital not only as a challenge, but also as an opportunity to form partnerships that integrate our strengths with those of other cultures and economies. As a nation, we can seek additional ways to become a valued partner in the global arena. We can train scientists and engineers that are not only technically competent but also skilled in cross-disciplinary, multi-cultural collaborations. NSF is committed to building bridges across borders to pursue these goals and collaboratively advance the frontiers of science and engineering.

  18. Proceedings: Joint DOE/NSF Workshop on flow of particulates and fluids

    SciTech Connect

    Not Available

    1993-12-31

    These proceedings are the result of the Fifth DOR-NSF Workshop on fundamental research in the area of particulate two-phase flow and granular flow. The present collection of twenty contributions from universities and national laboratories is based on research projects sponsored by either the Department of Energy or the National Science Foundation. These papers illustrate some of the latest advances in theory, simulations, and experiments. The papers from the Workshop held September 29--October 1, 1993 have been separated into three basic areas: experiments, theory, and numerical simulations. A list of attendees at the workshop is included at the end of the proceedings. Selected papers have been indexed separately for inclusion in the Energy Science and Technology Database.

  19. Improving Science Teacher Preparation through the APS PhysTEC and NSF Noyce Programs

    NASA Astrophysics Data System (ADS)

    Williams, Tasha; Tyler, Micheal; van Duzor, Andrea; Sabella, Mel

    2013-03-01

    Central to the recruitment of students into science teaching at a school like CSU, is a focus on the professional nature of teaching. The purpose of this focus is twofold: it serves to change student perceptions about teaching and it prepares students to become teachers who value continued professional development and value the science education research literature. The Noyce and PhysTEC programs at CSU place the professional nature of teaching front and center by involving students in education research projects, paid internships, attendance at conferences, and participation in a new Teacher Immersion Institute and a Science Education Journal Reading Class. This poster will focus on specific components of our teacher preparation program that were developed through these two programs. In addition we will describe how these new components provide students with diverse experiences in the teaching of science to students in the urban school district. Supported by the NSF Noyce Program (0833251) and the APS PhysTEC Program.

  20. Structural analysis of wind turbine rotors for NSF-NASA Mod-0 wind power system

    NASA Technical Reports Server (NTRS)

    Spera, D. A.

    1976-01-01

    Preliminary estimates are presented of vibratory loads and stresses in hingeless and teetering rotors for the proposed NSF-NASA Mod-0 wind power system. Preliminary blade design utilizes a tapered tubular aluminum spar which supports nonstructural aluminum ribs and skin and is joined to the rotor hub by a steel shank tube. Stresses in the shank of the blade are calculated for static, rated, and overload operating conditions. Blade vibrations were limited to the fundamental flapping modes, which were elastic cantilever bending for hingeless rotor blades and rigid-body rotation for teetering rotor blades. The MOSTAB-C computer code was used to calculate aerodynamic and mechanical loads. The teetering rotor has substantial advantages over the hingeless rotor with respect to shank stresses, fatigue life, and tower loading. The hingeless rotor analyzed does not appear to be structurally stable during overloads.

  1. A Five Year Summary of the NSF PAARE Project at SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, S. D.; Cash, J.; Hartmann, D.; Howell, S. B.; King, J. R.; Leising, M. D.; Mighell, K. J.; Smith, D. M.

    2013-01-01

    We summarize the progress made over five years of “A Partnership in Observational and Computational Astronomy (POCA)”. This NSF-funded project is part of the “Partnerships in Astronomy and Astrophysics Research and Education (PAARE)" program. Our partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory. Graduate fellowships provided by POCA as well as recruitment efforts on the national level have resulted in enrolling a total of four underrepresented minorities into the Ph.D. program in astronomy at Clemson. One of these has completed her M.S. in astronomy, while the others continue on toward the doctorate. We summarize the success and challenges of recruiting students into the undergraduate physics major with astronomy option at SC State and the support POCA has provided for nearly two dozen of them. Our summer REU program under POCA includes underrepresented students from across the country conducting research at each of our three institutions. Their work can be found elsewhere at this conference (Hernandez et al., Kurgatt et al. and Pugh et al.) Examples are given of our inquiry-based, laboratory exercises and web- based activities related to cosmology that have been developed with PAARE funding. We discuss our ground-based photometric and spectroscopic study of RV Tauri and Semiregular variables as well as our successful Kepler Cycle 2 and Cycle 4 study of a dozen of these objects . Support for the POCA project is provided by the NSF PAARE program to South Carolina State University under award AST-0750814 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under award NNX11AB82G. Additional details can be found at: http://physics.scsu.edu/paare/

  2. Update on the NSF PAARE Project at South Carolina State University

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, S. D.; Cash, J.; Hartmann, D.; Hinkle, K. H.; Howell, S. B.; King, J. R.; Leising, M. D.; Mighell, K. J.; Smith, D. M.

    2014-01-01

    We summarize the progress made over the past six years of “A Partnership in Observational and Computational Astronomy (POCA)”. This NSF-funded project is part of the “Partnerships in Astronomy and Astrophysics Research and Education (PAARE)" program. Our partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory. We summarize the results to date of our ongoing ground and space-based study of RV Tauri and Semiregular variables. We also examine our work on two unusual stars, R Coronae Borealis and XX Oph. The research on our Kepler objects is nearing completion and includes new international collaborators. We have developed 2 new cosmology labs and 5 new web simulations in the past year. These are being used in the science classes at South Carolina State University and are available to the community at our website listed below. Our success and the challenge of recruiting and retaining underrepresented students into the field as physics majors at South Carolina State University is reviewed. We recently graduated from Clemson a POCA student with a M.S. in astronomy who has since continued on for a Ph.D. in a related field, while another underrepresented student continues toward her Ph.D. in astronomy. Support for the POCA project is provided by the NSF PAARE program to South Carolina State University under award AST-0750814 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under awards NNX11AB82G and NNX13AC24G. Additional details can be found at: http://physics.scsu.edu/paare/

  3. Year 4 Of The NSF-funded PAARE Project At SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, S. D.; Cash, J. L.; Hartmann, D. H.; Howell, S. B.; King, J. R.; Leising, M. D.; Mayo, E. A.; Mighell, K. J.; Smith, D. M.

    2012-01-01

    We summarize the progress made through Year 4 of "A Partnership in Observational and Computational Astronomy (POCA)". This NSF-funded project is part of the "Partnerships in Astronomy and Astrophysics Research and Education (PAARE)" program. Our partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory. Fellowships provided by POCA as well as recruitment efforts on the national level have resulted in enrolling a total of four underrepresented minorities into the Ph.D. program in astronomy at Clemson. We report on the success and challenges to recruiting students into the undergraduate physics major with astronomy option at SC State. Our summer REU program under POCA includes underrepresented students from across the country conducting research at each of our three institutions. Examples are given of our inquiry-based, laboratory exercises and web- based activities related to cosmology that have been developed with PAARE funding. We discuss our ground-based photometric and spectroscopic study of RV Tauri and Semi-Regular variables which has been expanded to include successful Cycle 2 Kepler observations of a dozen of these objects reported elsewhere at this conference (see D.K. Walter, et.al.). Support for the POCA project is provided by the NSF PAARE program to South Carolina State University under award AST-0750814 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under award NNX11AB82G.

  4. Geoscience Education Programs in the NSF Division of Undergraduate Education: Different Acronyms with Similar Intent

    NASA Astrophysics Data System (ADS)

    Singer, J.; Ryan, J. G.

    2014-12-01

    For the past three decades, the National Science Foundation's (NSF) Division of Undergraduate Education (DUE) has administered a succession of programs intended to improve undergraduate STEM education for all students. The IUSE (Improving Undergraduate STEM Education) program is the latest program in this succession, and reflects an expanded, NSF-wide effort to make sustainable improvements in STEM education on a national scale. The origins and thinking behind IUSE can be in part traced back to precursor programs including: ILI (Instrumentation and Laboratory Improvement), CCD (Course and Curriculum Development), UFE (Undergraduate Faculty Enhancement), CCLI (Course, Curriculum and Laboratory Improvement), and TUES (Transforming Undergraduate Education in STEM), all of which sought to support faculty efforts to investigate and improve curriculum and instructional practice in undergraduate STEM education, and to disseminate effective STEM educational practices for broad adoption. IUSE, like its predecessor programs, is open to all STEM fields, and as such is intended to support improvements in geoscience education, spanning the atmospheric, ocean, and Earth sciences, as well as in environmental science, GIS science, climate change and sustainability/resilience. An emphasis on discipline-based research on learning that had origins in the CCLI and TUES programs is a new priority area in IUSE, with the ambition that projects will take advantage of the integrated expertise of domain scientists, educational practioners, and experts in learning science. We trace and describe the history of undergraduate education efforts with an emphasis placed on the recently introduced IUSE program. Understanding the origin of DUE's IUSE program can provide insights for faculty interested in developing proposals for submission and gain a greater appreciation of trends and priorities within the division.

  5. Microfluidic EmbryoSort technology: towards in flow analysis, sorting and dispensing of individual vertebrate embryos

    NASA Astrophysics Data System (ADS)

    Fuad, Nurul M.; Wlodkowic, Donald

    2013-12-01

    The demand to reduce the numbers of laboratory animals has facilitated the emergence of surrogate models such as tests performed on zebrafish (Danio rerio) or African clawed frog's (Xenopus levis) eggs, embryos and larvae. Those two model organisms are becoming increasingly popular replacements to current adult animal testing in toxicology, ecotoxicology and also in drug discovery. Zebrafish eggs and embryos are particularly attractive for toxicological analysis due their size (diameter 1.6 mm), optical transparency, large numbers generated per fish and very straightforward husbandry. The current bottleneck in using zebrafish embryos for screening purposes is, however, a tedious manual evaluation to confirm the fertilization status and subsequent dispensing of single developing embryos to multitier plates to perform toxicity analysis. Manual procedures associated with sorting hundreds of embryos are very monotonous and as such prone to significant analytical errors due to operator's fatigue. In this work, we present a proofof- concept design of a continuous flow embryo sorter capable of analyzing, sorting and dispensing objects ranging in size from 1.5 - 2.5 mm. The prototypes were fabricated in polymethyl methacrylate (PMMA) transparent thermoplastic using infrared laser micromachining. The application of additive manufacturing processes to prototype Lab-on-a-Chip sorters using both fused deposition manufacturing (FDM) and stereolithography (SLA) were also explored. The operation of the device was based on a revolving receptacle capable of receiving, holding and positioning single fish embryos for both interrogation and subsequent sorting. The actuation of the revolving receptacle was performed using a DC motor and/or microservo motor. The system was designed to separate between fertilized (LIVE) and non-fertilized (DEAD) eggs, based on optical transparency using infrared (IR) emitters and receivers.

  6. Label-free density difference amplification-based cell sorting.

    PubMed

    Song, Jihwan; Song, Minsun; Kang, Taewook; Kim, Dongchoul; Lee, Luke P

    2014-11-01

    The selective cell separation is a critical step in fundamental life sciences, translational medicine, biotechnology, and energy harvesting. Conventional cell separation methods are fluorescent activated cell sorting and magnetic-activated cell sorting based on fluorescent probes and magnetic particles on cell surfaces. Label-free cell separation methods such as Raman-activated cell sorting, electro-physiologically activated cell sorting, dielectric-activated cell sorting, or inertial microfluidic cell sorting are, however, limited when separating cells of the same kind or cells with similar sizes and dielectric properties, as well as similar electrophysiological phenotypes. Here we report a label-free density difference amplification-based cell sorting (dDACS) without using any external optical, magnetic, electrical forces, or fluidic activations. The conceptual microfluidic design consists of an inlet, hydraulic jump cavity, and multiple outlets. Incoming particles experience gravity, buoyancy, and drag forces in the separation chamber. The height and distance that each particle can reach in the chamber are different and depend on its density, thus allowing for the separation of particles into multiple outlets. The separation behavior of the particles, based on the ratio of the channel heights of the inlet and chamber and Reynolds number has been systematically studied. Numerical simulation reveals that the difference between the heights of only lighter particles with densities close to that of water increases with increasing the ratio of the channel heights, while decreasing Reynolds number can amplify the difference in the heights between the particles considered irrespective of their densities.

  7. Flow virometric sorting and analysis of HIV quasispecies from plasma

    PubMed Central

    Jones, Jennifer C.; Keele, Brandon F.; Jenkins, Lisa M. Miller; Demberg, Thorsten

    2017-01-01

    Flow cytometry is utilized extensively for cellular analysis, but technical limitations have prevented its routine application for characterizing virus. The recent introduction of nanoscale fluorescence-activated cytometric cell sorting now allows analysis of individual virions. Here, we demonstrate staining and sorting of infectious HIV. Fluorescent antibodies specific for cellular molecules found on budding virions were used to label CCR5-tropic Bal HIV and CXCR4-tropic NL4.3 HIV Env-expressing pseudovirions made in THP-1 cells (monocyte/macrophage) and H9 cells (T cells), respectively. Using a flow cytometer, we resolved the stained virus beyond isotype staining and demonstrated purity and infectivity of sorted virus populations on cells with the appropriate coreceptors. We subsequently sorted infectious simian/human immunodeficiency virus from archived plasma. Recovery was approximately 0.5%, but virus present in plasma was already bound to viral-specific IgG generated in vivo, likely contributing to the low yield. Importantly, using two broadly neutralizing HIV antibodies, PG9 and VRC01, we also sorted virus from archived human plasma and analyzed the sorted populations genetically and by proteomics, identifying the quasispecies present. The ability to sort infectious HIV from clinically relevant samples provides material for detailed molecular, genetic, and proteomic analyses applicable to future design of vaccine antigens and potential development of personalized treatment regimens. PMID:28239654

  8. Sortilin regulates sorting and secretion of Sonic hedgehog.

    PubMed

    Campbell, Charles; Beug, Shawn; Nickerson, Philip E B; Peng, Jimmy; Mazerolle, Chantal; Bassett, Erin A; Ringuette, Randy; Jama, Fadumo A; Morales, Carlos; Christ, Annabel; Wallace, Valerie A

    2016-10-15

    Sonic Hedgehog (Shh) is a secreted morphogen that is an essential regulator of patterning and growth. The Shh full-length protein undergoes autocleavage in the endoplasmic reticulum to generate the biologically active N-terminal fragment (ShhN), which is destined for secretion. We identified sortilin (Sort1), a member of the VPS10P-domain receptor family, as a new Shh trafficking receptor. We demonstrate that Sort-Shh interact by performing coimmunoprecipitation and proximity ligation assays in transfected cells and that they colocalize at the Golgi. Sort1 overexpression causes re-distribution of ShhN and, to a lesser extent, of full-length Shh to the Golgi and reduces Shh secretion. We show loss of Sort1 can partially rescue Hedgehog-associated patterning defects in a mouse model that is deficient in Shh processing, and we show that Sort1 levels negatively regulate anterograde Shh transport in axons in vitro and Hedgehog-dependent axon-glial interactions in vivo Taken together, we conclude that Shh and Sort1 can interact at the level of the Golgi and that Sort1 directs Shh away from the pathways that promote its secretion.

  9. Microfluidic droplet sorting using integrated bilayer micro-valves

    NASA Astrophysics Data System (ADS)

    Chen, Yuncong; Tian, Yang; Xu, Zhen; Wang, Xinran; Yu, Sicong; Dong, Liang

    2016-10-01

    This paper reports on a microfluidic device capable of sorting microfluidic droplets utilizing conventional bilayer pneumatic micro-valves as sorting controllers. The device consists of two micro-valves placed symmetrically on two sides of a sorting area, each on top of a branching channel at an inclined angle with respect to the main channel. Changes in transmitted light intensity, induced by varying light absorbance by each droplet, are used to divert the droplet from the sorting area into one of the three outlet channels. When no valve is activated, the droplet flows into the outlet channel in the direction of the main channel. When one of the valves is triggered, the flexible membrane of valve will first be deflected. Once the droplet leaves the detection point, the deflected membrane will immediately return to its default flattened position, thereby exerting a drawing pressure on the droplet and deviating it from its original streamline to the outlet on the same side as the valve. This sorting method will be particularly suitable for numerous large-scale integrated microfluidic systems, where pneumatic micro-valves are already used. Only few structural modifications are needed to achieve droplet sorting capabilities in these systems. Due to the mechanical nature of diverting energy applied to droplets, the proposed sorting method may induce only minimal interference to biological species or microorganisms encapsulated inside the droplets that may accompany electrical, optical and magnetic-based techniques.

  10. Patterns of mitochondrial sorting in yeast zygotes.

    PubMed Central

    Azpiroz, R; Butow, R A

    1993-01-01

    Inheritance of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae is usually biparental. Pedigree studies of zygotic first buds indicate limited mixing of wild-type (p+) parental mtDNAs: end buds are frequently homoplasmic for one parental mtDNA, while heteroplasmic and recombinant progeny usually arise from medial buds. In crosses involving certain petites, however, mitochondrial inheritance can be uniparental. In this study we show that mitochondrial sorting can be influenced by the parental mtDNAs and have identified intermediates in the process. In crosses where mtDNA mixing is limited and one parent is prelabeled with the matrix enzyme citrate synthase 1 (CS1), the protein freely equilibrates throughout the zygote before the first bud has matured. Furthermore, if one parent is p0 (lacking mtDNA), mtDNA from the p+ parent can also equilibrate; intracellular movement of mtDNA is unhindered in this case. Surprisingly, in zygotes from a p0 CS1+ x p+ CS1- cross, CS1 is quantitatively translocated to the p+ end of the zygote before mtDNA movement; subsequently, both components equilibrate throughout the cell. This initial vectorial transfer does not require respiratory function in the p+ parent, although it does not occur if that parent is p-. Mouse dihydrofolate reductase (DHFR) present in the mitochondrial matrix can also be vectorially translocated, indicating that the process is general. Our data suggest that in zygotes mtDNA movement may be separately controlled from the movement of bulk matrix constituents. Images PMID:8443407

  11. Efficient sorting of free electron orbital angular momentum

    NASA Astrophysics Data System (ADS)

    McMorran, Benjamin J.; Harvey, Tyler R.; Lavery, Martin P. J.

    2017-02-01

    We propose a method for sorting electrons by orbital angular momentum (OAM). Several methods now exist to prepare electron wavefunctions in OAM states, but no technique has been developed for efficient, parallel measurement of pure and mixed electron OAM states. The proposed technique draws inspiration from the recent demonstration of the sorting of OAM through modal transformation. We show that the same transformation can be performed on electrons with electrostatic optical elements. Specifically, we show that a charged needle and an array of electrodes perform the transformation and phase correction necessary to sort OAM states. This device may enable the analysis of the spatial mode distribution of inelastically scattered electrons.

  12. A Critical Role for Toxoplasma gondii Vacuolar Protein Sorting VPS9 in Secretory Organelle Biogenesis and Host Infection

    PubMed Central

    Sakura, Takaya; Sindikubwabo, Fabien; Oesterlin, Lena K.; Bousquet, Hugo; Slomianny, Christian; Hakimi, Mohamed-Ali; Langsley, Gordon; Tomavo, Stanislas

    2016-01-01

    Accurate sorting of proteins to the three types of parasite-specific secretory organelles namely rhoptry, microneme and dense granule in Toxoplasma gondii is crucial for successful host cell invasion by this obligate intracellular parasite. Despite its tiny body architecture and limited trafficking machinery, T. gondii relies heavily on transport of vesicles containing proteins, lipids and important virulence-like factors that are delivered to these secretory organelles. However, our understanding on how trafficking of vesicles operates in the parasite is still limited. Here, we show that the T. gondii vacuolar protein sorting 9 (TgVps9), has guanine nucleotide exchange factor (GEF) activity towards Rab5a and is crucial for sorting of proteins destined to secretory organelles. Our results illuminate features of TgVps9 protein as a key trafficking facilitator that regulates protein maturation, secretory organelle formation and secretion, thereby ensuring a primary role in host infection by T. gondii. PMID:27966671

  13. Exploring student preferences with a Q-sort: the development of an individualized renal physiology curriculum.

    PubMed

    Roberts, John K; Hargett, Charles W; Nagler, Alisa; Jakoi, Emma; Lehrich, Ruediger W

    2015-09-01

    Medical education reform is underway, but the optimal course for change has yet to be seen. While planning for the redesign of a renal physiology course at the Duke School of Medicine, the authors used a Q-sort survey to assess students' attitudes and learning preferences to inform curricular change. The authors invited first-year medical students at the Duke School of Medicine to take a Q-sort survey on the first day of renal physiology. Students prioritized statements related to their understanding of renal physiology, learning preferences, preferred course characteristics, perceived clinical relevance of renal physiology, and interest in nephrology as a career. By-person factor analysis was performed using the centroid method. Three dominant factors were strongly defined by learning preferences: "readers" prefer using notes, a textbook, and avoid lectures; "social-auditory learners" prefer attending lectures, interactivity, and working with peers; and "visual learners" prefer studying images, diagrams, and viewing materials online. A smaller, fourth factor represented a small group of students with a strong predisposition against renal physiology and nephrology. In conclusion, the Q-sort survey identified and then described in detail the dominant viewpoints of our students. Learning style preferences better classified first-year students rather than any of the other domains. A more individualized curriculum would simultaneously cater to the different types of learners in the classroom.

  14. Solid- and gas-phase structures and spectroscopic and chemical properties of tris(pentafluorosulfanyl)amine, N(SF5)3, and bis(pentafluorosufanyl)aminyl radical, rad N(SF5)2

    NASA Astrophysics Data System (ADS)

    Nielsen, Jon B.; Zylka, Petra; Kronberg, Marc; Zeng, Xiaoqing; Robinson, Kerry D.; Bott, Simon G.; Zhang, Hongming; Atwood, Jerry L.; Oberhammer, Heinz; Willner, Helge; Thrasher, Joseph S.

    2017-03-01

    Tris(pentafluorosulfanyl)amine, N(SF5)3, and the bis(pentafluorosulfanyl)aminyl radical, rad N(SF5)2, have been synthesized and characterized by gas electron diffraction, single crystal XRD, NMR, EPR, FT-IR, Raman, and UV-vis spectroscopy, and by their thermal decompositions. The amine possesses a planar molecular structure of D3 symmetry with an unusually long Nsbnd S bond of 1.829(6) Å. The long Nsbnd S bonds are in accordance with the small Arrhenius activation barrier for the decay into rad N(SF5)2 and rad SF5 radicals of 6.9 kcal mol-1, and its half-life at room temperature is only 50 min. The aminyl radical possesses C2 symmetry with Nsbnd S = 1.692(4) Å and Ssbnd Nsbnd S = 135.1(5)°, and its structure is similar to that of FN(SF5)2. This radical is much more stable than the amine (half-life at room temperature is 130 min). Dimerization and formation of the corresponding hydrazine, (SF5)2NN(SF5)2, was not observed, nor was the nitrene:NSF5 or its isomer FNdbnd SF4.

  15. Undergraduate Research as a Process for STEM Teaching and Learning Systemic Change: Lessons Learned from the Council on Undergraduate Research NSF CCLI and TUES Projects

    NASA Astrophysics Data System (ADS)

    Ambos, E. L.; Havholm, K. G.; Malachowski, M.; Osborn, J.; Karukstis, K.

    2013-12-01

    concerted efforts to affect policy, workload, tenure and promotion and resource issues, which are often core factors in any STEM education change process. Several systems are now connecting individual campus-based undergraduate research efforts more effectively, and tying undergraduate research to regional workforce and economic development programs. Many campus teams are moving their department and colleges toward curricular innovations that emphasize scaffolding undergraduate research throughout the undergraduate curriculum. An NSF EAGER/WIDER supplement to the CUR CCLI III award was received in October 2012 and expanded the scope of the project to include deeper study of the changes processes underway at each of the six systems and to tease out the factors that can either promote or retard expansion of undergraduate research as a teaching and learning paradigm. Lessons learned from one of the six systems, the University of Wisconsin, will be highlighted.

  16. The EARP Complex and Its Interactor EIPR-1 Are Required for Cargo Sorting to Dense-Core Vesicles

    PubMed Central

    Topalidou, Irini; Cattin-Ortolá, Jérôme; MacCoss, Michael J.

    2016-01-01

    The dense-core vesicle is a secretory organelle that mediates the regulated release of peptide hormones, growth factors, and biogenic amines. Dense-core vesicles originate from the trans-Golgi of neurons and neuroendocrine cells, but it is unclear how this specialized organelle is formed and acquires its specific cargos. To identify proteins that act in dense-core vesicle biogenesis, we performed a forward genetic screen in Caenorhabditis elegans for mutants defective in dense-core vesicle function. We previously reported the identification of two conserved proteins that interact with the small GTPase RAB-2 to control normal dense-core vesicle cargo-sorting. Here we identify several additional conserved factors important for dense-core vesicle cargo sorting: the WD40 domain protein EIPR-1 and the endosome-associated recycling protein (EARP) complex. By assaying behavior and the trafficking of dense-core vesicle cargos, we show that mutants that lack EIPR-1 or EARP have defects in dense-core vesicle cargo-sorting similar to those of mutants in the RAB-2 pathway. Genetic epistasis data indicate that RAB-2, EIPR-1 and EARP function in a common pathway. In addition, using a proteomic approach in rat insulinoma cells, we show that EIPR-1 physically interacts with the EARP complex. Our data suggest that EIPR-1 is a new interactor of the EARP complex and that dense-core vesicle cargo sorting depends on the EARP-dependent trafficking of cargo through an endosomal sorting compartment. PMID:27191843

  17. Discrete and continuous models of protein sorting in the Golgi

    NASA Astrophysics Data System (ADS)

    Gong, Haijun; Schwartz, Russell

    2009-03-01

    The Golgi apparatus plays an important role in processing and sorting proteins and lipids. Golgi compartments constantly exchange material with each other and with other cellular components, allowing them to maintain and reform distinct identities despite dramatic changes in structure and size during cell division, development and osmotic stress. We have developed two minimal models of membrane and protein exchange in the Golgi --- a discrete, stochastic model [1] and a continuous ordinary differential equation (ODE) model --- both based on two fundamental mechanisms: vesicle-coat-mediated selective concentration of soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins during vesicle formation and SNARE-mediated selective fusion of vesicles. Both show similar ability to establish and maintain distinct identities over broad parameter ranges, but they diverge in extreme conditions where Golgi collapse and reassembly may be observed. By exploring where the models differ, we hope to better identify those features essential to minimal models of various Golgi behaviors. [1] H. Gong, D. Sengupta, A. D. Linstedt, R. Schwartz. Biophys J. 95: 1674-1688, 2008.

  18. Magnetophoretic cell sorting is a function of antibody binding capacity.

    PubMed

    McCloskey, Kara E; Moore, Lee R; Hoyos, Mauricio; Rodriguez, Alex; Chalmers, Jeffrey J; Zborowski, Maciej

    2003-01-01

    Antibody binding capacity (ABC) is a term representing a cell's ability to bind antibodies, correlating with the number of specific cellular antigens expressed on that cell. ABC allows magnetically conjugated antibodies to bind to the targeted cells, imparting a magnetophoretic mobility on each targeted cell. This enables sorting based on differences in the cell magnetophoretic mobility and, potentially, a magnetic separation based on the differences in the cell ABC values. A cell's ABC value is a particularly important factor in continuous magnetic cell separation. This work investigates the relationship between ABC and magnetic cell separation efficiency by injection of a suspension of immunomagnetically labeled quantum simply cellular calibration microbeads of known ABC values into fluid flowing through a quadrupole magnetic sorter. The elution profiles of the outlet streams were evaluated using UV detectors. Optimal separation flow rate was shown to correlate with the ABC of these microbeads. Comparing experimental and theoretical results, the theory correctly predicted maximum separation flow rates but overestimated the separation fractional recoveries.

  19. Brazil Nuts on Eros: Size-Sorting of Asteroid Regolith

    NASA Technical Reports Server (NTRS)

    Asphaug, E.; King, P. J.; Swift, M. R.; Merrifield, M. R.

    2001-01-01

    We consider the hypothesis that frequent cratering produces size- or compositionally-sorted asteroid regolith, affecting the structure, texture, and in extreme cases the shape of asteroids. Additional information is contained in the original extended abstract.

  20. 63. THIRD FLOOR, SHIPPING COURT, CONVEYORS FROM SORTING AREA TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    63. THIRD FLOOR, SHIPPING COURT, CONVEYORS FROM SORTING AREA TO PACKAGE HANDLING AND WRAPPING - Sears Roebuck & Company Mail Order Plant, Merchandise Building, 924 South Homan Avenue, Chicago, Cook County, IL

  1. 23. LOWER END OF HIDE CHUTE, BASEMENT LEVEL; NOTE SORTING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. LOWER END OF HIDE CHUTE, BASEMENT LEVEL; NOTE SORTING TABLE AND HANDCART FOR MOVING HIDES - Rath Packing Company, Beef Killing Building, Sycamore Street between Elm & Eighteenth Streets, Waterloo, Black Hawk County, IA

  2. 14. VIEW OF SPOUTS ON THIRD FLOOR THAT SORT GRAIN ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. VIEW OF SPOUTS ON THIRD FLOOR THAT SORT GRAIN INTO VARIOUS HOPPER BINS BELOW. Photographer: Jet T. Lowe, 1985 - Alexander's Grist Mill, Lock 37 on Ohio & Erie Canal, South of Cleveland, Valley View, Cuyahoga County, OH

  3. Sorting on STAR. [CDC computer algorithm timing comparison

    NASA Technical Reports Server (NTRS)

    Stone, H. S.

    1978-01-01

    Timing comparisons are given for three sorting algorithms written for the CDC STAR computer. One algorithm is Hoare's (1962) Quicksort, which is the fastest or nearly the fastest sorting algorithm for most computers. A second algorithm is a vector version of Quicksort that takes advantage of the STAR's vector operations. The third algorithm is an adaptation of Batcher's (1968) sorting algorithm, which makes especially good use of vector operations but has a complexity of N(log N)-squared as compared with a complexity of N log N for the Quicksort algorithms. In spite of its worse complexity, Batcher's sorting algorithm is competitive with the serial version of Quicksort for vectors up to the largest that can be treated by STAR. Vector Quicksort outperforms the other two algorithms and is generally preferred. These results indicate that unusual instruction sets can introduce biases in program execution time that counter results predicted by worst-case asymptotic complexity analysis.

  4. Reflection-Impulsivity and Color-Form Sorting

    ERIC Educational Resources Information Center

    Katz, Judith Milstein

    1971-01-01

    A study to determine whether the differential development of conceptual tempo can predict preferences. Conceptual tempo predicted preferences in color-form sorting among 67 children ranging in age from 44 to 65 months. (WY)

  5. Natural Selection Is a Sorting Process: What Does that Mean?

    ERIC Educational Resources Information Center

    Price, Rebecca M.

    2013-01-01

    To learn why natural selection acts only on existing variation, students categorize processes as either creative or sorting. This activity helps students confront the misconception that adaptations evolve because species need them.

  6. Recent progress in multi-electrode spike sorting methods.

    PubMed

    Lefebvre, Baptiste; Yger, Pierre; Marre, Olivier

    2017-03-02

    In recent years, arrays of extracellular electrodes have been developed and manufactured to record simultaneously from hundreds of electrodes packed with a high density. These recordings should allow neuroscientists to reconstruct the individual activity of the neurons spiking in the vicinity of these electrodes, with the help of signal processing algorithms. Algorithms need to solve a source separation problem, also known as spike sorting. However, these new devices challenge the classical way to do spike sorting. Here we review different methods that have been developed to sort spikes from these large-scale recordings. We describe the common properties of these algorithms, as well as their main differences. Finally, we outline the issues that remain to be solved by future spike sorting algorithms.

  7. Regulation of endocytic sorting by ESCRT-DUB-mediated deubiquitination.

    PubMed

    Wright, Michelle H; Berlin, Ilana; Nash, Piers D

    2011-06-01

    Endocytosis of cell surface receptors mediates cellular homeostasis by coordinating receptor distribution with downstream signal transduction and attenuation. Post-translational modification with ubiquitin of these receptors, as well as the proteins that comprise the endocytic machinery, modulates cargo progression along the endocytic pathway. The interplay between ubiquitination states of cargo and sorting proteins drives trafficking outcomes by directing endocytosed material toward either lysosomal degradation or recycling. Deubiquitination by specific proteinases creates a reversible system that promotes spatial and temporal organization of endosomal sorting complexes required for transport (ESCRTs) and supports regulated cargo trafficking. Two dubiquitinating enzymes--ubiquitin-specific protease 8 (USP8/Ubpy) and associated molecule with the SH3 domain of STAM (AMSH)--interact with ESCRT components to modulate the ubiquitination status of receptors and relevant sorting proteins. In doing so, these ESCRT-DUBs control receptor fate and sorting complex function through a variety of mechanisms described herein.

  8. Using Sorting Networks for Skill Building and Reasoning

    ERIC Educational Resources Information Center

    Andre, Robert; Wiest, Lynda R.

    2007-01-01

    Sorting networks, used in graph theory, have instructional value as a skill- building tool as well as an interesting exploration in discrete mathematics. Students can practice mathematics facts and develop reasoning and logic skills with this topic. (Contains 4 figures.)

  9. Acoustic bubble sorting for ultrasound contrast agent enrichment.

    PubMed

    Segers, Tim; Versluis, Michel

    2014-05-21

    An ultrasound contrast agent (UCA) suspension contains encapsulated microbubbles with a wide size distribution, with radii ranging from 1 to 10 μm. Medical transducers typically operate at a single frequency, therefore only a small selection of bubbles will resonate to the driving ultrasound pulse. Thus, the sensitivity can be improved by narrowing down the size distribution. Here, we present a simple lab-on-a-chip method to sort the population of microbubbles on-chip using a traveling ultrasound wave. First, we explore the physical parameter space of acoustic bubble sorting using well-defined bubble sizes formed in a flow-focusing device, then we demonstrate successful acoustic sorting of a commercial UCA. This novel sorting strategy may lead to an overall improvement of the sensitivity of contrast ultrasound by more than 10 dB.

  10. An Analysis of NSF Geosciences Research Experience for Undergraduate Site Programs from 2009 through 2011

    NASA Astrophysics Data System (ADS)

    Rom, E. L.; Patino, L. C.; Weiler, S.; Sanchez, S. C.; Colon, Y.; Antell, L.

    2011-12-01

    The Research Experience for Undergraduate (REU) Program at the U.S. National Science Foundation (NSF) provides U.S. undergraduate students from any college or university the opportunity to conduct research at a different institution and gain a better understanding of research career pathways. The Geosciences REU Sites foster research opportunities in areas closely aligned with geoscience programs, particularly those related to earth, atmospheric and ocean sciences. The aim of this paper is to provide an overview of the Geosciences REU Site programs run in 2009 through 2011. A survey requesting information on recruitment methods, student demographics, enrichment activities, and fields of research was sent to the Principal Investigators of each of the active REU Sites. Over 70% of the surveys were returned with the requested information from about 50 to 60 sites each year. The internet is the most widely used mechanism to recruit participants, with personal communication as the second most important recruiting tool. The admissions rate for REU Sites in Geosciences varies from less than 10% to 50%, with the majority of participants being rising seniors and juniors. Many of the participants come from non-PhD granting institutions. Among the participants, gender distribution varies by discipline, with ocean sciences having a large majority of women and earth sciences having a majority of men. Regarding ethnic diversity, the REU Sites reflect the difficulty of attracting diverse students into Geosciences as a discipline; a large majority of participants are Caucasian and Asian students. Furthermore, participants from minority-serving institutions and community colleges constitute a small percentage of those taking part in these research experiences. The enrichment activities are very similar across the REU Sites, and mimic activities common to the scientific community, including intellectual exchange of ideas (lab meetings, seminars, and professional meetings

  11. The U.S. NSF Ocean Observatories Initiative: A Modern Virtual Observatory

    NASA Astrophysics Data System (ADS)

    Orcutt, John; Vernon, Frank; Peach, Cheryl; Arrott, Matthew; Graybeal, John; Farcas, Claudiu; Farcas, Emilia; Krueger, Ingolf; Meisinger, Michael; Chave, Alan

    2010-05-01

    The NSF Ocean Observatories Initiative (OOI) began a five-year construction period in October 2009. The Consortium on Ocean Leadership (COL) manages the overall program with Implementing Organizations for Coastal/Global Scale Nodes (CGSN) at Woods Hole, Oregon State and Scripps; the Regional Cabled Network (RCN) at U of Washington and Cyberinfrastructure (CI) at UCSD and more than ten subcontractors. The NSF has made a commitment to support the observatory operations and maintenance for a 30-year period; a minimal period of time to measure physical, chemical and biological data over a length of time possibly sufficient to measure secular changes associated with climate and geodesy. The CI component is a substantial departure from previous approaches to data distribution and management. These innovations include the availability of data in near-real-time with latencies of seconds, open access to all data, analysis of the data stream for detection and modeling, use of the derived knowledge to modify the network with minimal or no human interaction and maintenance of data provenance through time as new versions of the data are created through QA/QC processes. The network architecture is designed to be scalable so that addition of new sensors is straightforward and inexpensive with costs increasing linearly at worst. Rather than building new computer infrastructure (disk farms and computer clusters), we are presently exploiting Amazon's Extensible Computing Cloud (EC2) and Simple Storage System (S3) to reduce long-term commitments to hardware and maintenance in order to minimize operations and maintenance costs. The OOI CI is actively partnering with other organizations (e.g. NOAA's IOOS) to integrate existing data systems using many of the same technologies to improve broad access to existing and planned observing systems, including those that provide critical climate data. Because seasonal and annual variability of most measureable parameters is so large, the

  12. An Analysis of NSF Geosciences 2009 Research Experience for Undergraduate Site Programs

    NASA Astrophysics Data System (ADS)

    Sanchez, S. C.; Patino, L. C.; Rom, E. L.; Weiler, S. C.

    2009-12-01

    The Research Experience for Undergraduate (REU) Program at the U.S. National Science Foundation (NSF) provides undergraduate students the opportunity to conduct research at different institutions and in areas that may not be available in their home campuses. The Geosciences REU Sites foster research opportunities in areas closely aligned with undergraduate majors and facilitates discovery of the multidisciplinary nature of the Geosciences. The aim of this paper is to provide an overview of the Geosciences REU Site programs run in 2009. A survey requesting information on recruitment methods, student demographics, enrichment activities, and fields of research was sent to the Principal Investigators of each of the 50 active REU Sites; over 70% of the surveys were returned with the requested information. The internet is the most widely used mechanism to recruit participants, but the survey did not distinguish among different tools like websites, emails, social networks, etc. The admissions rate for REU Sites in Geosciences varies from less than 10% to 50%, with the majority of participants being rising seniors and juniors. A few Sites include rising sophomores. At least 40% of the participants come from non-PhD granting institutions. Among the participants, gender distribution is balanced, with a slightly larger number of female participants. Regarding ethnic diversity, the REU Sites reflect the difficulty of attracting diverse students into Geosciences as a discipline; more than 75% of the participants are Caucasian and Asian students. Furthermore, participants from minority-serving institutions constitute a small percentage of those taking part in these research experiences. The enrichment activities are very similar across the REU Sites, and mimic well activities common to the scientific community, including intellectual exchange of ideas (lab meetings, seminars, and professional meetings), networking and social activities. There are some clear similarities among

  13. Sorting and hardware assisted rendering for volume visualization

    SciTech Connect

    Stein, C.; Becker, B.; Max, N.

    1994-03-01

    We present some techniques for volume rendering unstructured data. Interpolation between vertex colors and opacities is performed using hardware assisted texture mapping, and color is integrated for use with a volume rendering system. We also present an O(n{sup 2}) method for sorting n arbitrarily shaped convex polyhedra prior to visualization. It generalizes the Newell, Newell and Sancha sort for polygons to 3-D volume elements.

  14. Increasing Access for Economically Disadvantaged Students: The NSF/CSEM & S-STEM Programs at Louisiana State University

    ERIC Educational Resources Information Center

    Wilson, Zakiya S.; Iyengar, Sitharama S.; Pang, Su-Seng; Warner, Isiah M.; Luces, Candace A.

    2012-01-01

    Increasing college degree attainment for students from disadvantaged backgrounds is a prominent component of numerous state and federal legislation focused on higher education. In 1999, the National Science Foundation (NSF) instituted the "Computer Science, Engineering, and Mathematics Scholarships" (CSEMS) program; this initiative was designed to…

  15. 77 FR 30330 - Notice of Intent To Seek Approval To Establish an Information Collection for the NSF Graduate...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-22

    ... From the Federal Register Online via the Government Publishing Office NATIONAL SCIENCE FOUNDATION Notice of Intent To Seek Approval To Establish an Information Collection for the NSF Graduate Research... of Approval: Not applicable. Type of Request: Intent to seek approval to establish an...

  16. A Study of NSF Teacher Enhancement Program (TEP) Participants and Principal Investigators: 1984-1989. Volume I: Summary Report.

    ERIC Educational Resources Information Center

    Abt Associates, Inc., Cambridge, MA.

    The National Science Foundation (NSF) supported more than 600 inservice teacher training programs between 1984 and 1989 under its Teacher Enhancement Program (TEP). Two studies were undertaken of TEP: the first was a survey of the 600 Principal Investigators (PIs) who had operated inservice teacher enhancement projects and the second, a survey of…

  17. Exploration of NSF-ATE Projects Approaches in the Integration of Technology and Engineering Education at the K-12 Levels

    ERIC Educational Resources Information Center

    Strobel, Johannes; Mendoza Díaz, Noemi V.

    2012-01-01

    Access to post-secondary education, specifically in the technical, two-year institution area, is a topic of growing interest in the country. Funding agencies, such as NSF, via the Advanced Technological Education Program (ATE), are supporting initiatives and research aimed at increasing the number of technicians and engineers and improving…

  18. Master Teachers in Residence: Bringing a Classroom Perspective to Course Reform for NSF's Oklahoma Teacher Education Collaborative (O-TEC).

    ERIC Educational Resources Information Center

    Ramsey, Sarah; Neathery, Faye; Fholer, Gwen; Weger, Elayne; Voth, Bonnie; Townsend, Joyce; Campbell, DeAnn; Boedecker, Martha

    Master teachers can be influential in course revision. The Oklahoma Teacher Education Collaborative (O-TEC) teacher reform effort is a consortium of nine higher education institutions working with the National Science Foundation's (NSF's) reform effort to produce teachers better equipped for teaching science and mathematics. The reform emphasizes…

  19. Year-Long Peer Mentoring Activity to Enhance the Retention of Freshmen STEM Students in a NSF Scholarship Program

    ERIC Educational Resources Information Center

    Cutright, Teresa J.; Evans, Edward

    2016-01-01

    The last year of a National Science Foundation (NSF) funded scholarship program was used to provide pseudo-formal peer mentoring activities to engineering, mathematics, and science undergraduates. A one-credit class was used to afford time for peer mentors and mentees to interact. During the fall semester, seniors augmented each week's topics with…

  20. Annual Report of the National Science Foundation on Contract NSF-C414 Task III July 1966 through June 1967.

    ERIC Educational Resources Information Center

    American Chemical Society, Columbus, OH. Chemical Abstracts Service.

    This Annual Report describes in detail the work performed during the first year of Task III of Contract NSF-C414 and the present status of Task III work. The programs and achievements described constitute the first significant efforts to develop a user-oriented, cooperative program between major secondary scientific and technical information…

  1. QED: Final Report on the NSF Grant to the Science Academy of Austin, 1994. Publication Number 94.04.

    ERIC Educational Resources Information Center

    Turner, Jeannine

    The Science Academy of Austin, part of the Austin Independent School District (Texas), was given a 4-year National Science Foundation (NSF) grant beginning in 1990-91 to link public and private sectors to create a "thinking curriculum." This evaluation report covers the fourth, and last, year of the grant's implementation. The new…

  2. Molecular characterization of flow-sorted mammalian centromeres

    SciTech Connect

    Hamkalo, B.A.; Henschen, A.; Parseghian, M.H.

    1998-12-31

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The project involved experiments directed towards developing a molecular characterization of the centromere region of mammalian chromosomes. Attempts to purify this essential chromosomal locus by conventional methods have thus far been unsuccessful. However, preliminary data obtained in collaboration with the National Flow Cytometry Resource (NFCR) showed that it is possible to purify a chromosome fragment that is present in certain cultured mouse cell lines and has all the properties expected of an intact centromere region. To begin sorting this minichromosome for the identification of proteins preferentially associated with centromere regions, standard buffers utilized in chromosome sorting were evaluated for potential effects on maintenance of chromosomal proteins during sorting. The data indicate that the presence of several buffer constituents results in the extraction of all but a few chromosomal proteins. The subsequent use of a magnesium sulfate buffer resulted in the sorting of mouse chromosomes that do not suffer a significant loss of proteins. Several DNA stains were also evaluated for causing protein dissociation, but no significant losses were observed. Although flow-sorted chromosomes have been used extensively for DNA analysis and cloning, this is a pioneering effort by the NFCR, and its collaborators, to exploit chromosome sorting capabilities for the analysis of chromosomal proteins.

  3. Random walk models of worker sorting in ant colonies.

    PubMed

    Sendova-Franks, Ana B; Van Lent, Jan

    2002-07-21

    Sorting can be an important mechanism for the transfer of information from one level of biological organization to another. Here we study the algorithm underlying worker sorting in Leptothorax ant colonies. Worker sorting is related to task allocation and therefore to the adaptive advantages associated with an efficient system for the division of labour in ant colonies. We considered four spatially explicit individual-based models founded on two-dimensional correlated random walk. Our aim was to establish whether sorting at the level of the worker population could occur with minimal assumptions about the behavioural algorithm of individual workers. The behaviour of an individual worker in the models could be summarized by the rule "move if you can, turn always". We assume that the turning angle of a worker is individually specific and negatively dependent on the magnitude of an internal parameter micro which could be regarded as a measure of individual experience or task specialization. All four models attained a level of worker sortedness that was compatible with results from experiments onLeptothorax ant colonies. We found that the presence of a sorting pivot, such as the nest wall or an attraction force towards the centre of the worker population, was crucial for sorting. We make a distinction between such pivots and templates and discuss the biological implications of their difference.

  4. Particle shape-controlled sorting and transport behaviour of mixed siliciclastic/bioclastic sediments in a mesotidal lagoon, South Africa

    NASA Astrophysics Data System (ADS)

    Flemming, Burghard W.

    2016-07-01

    This study investigates the effect of particle shape on the transport and deposition of mixed siliciclastic-bioclastic sediments in the lower mesotidal Langebaan Lagoon along the South Atlantic coast of South Africa. As the two sediment components have undergone mutual sorting for the last 7 ka, they can be expected to have reached a highest possible degree of hydraulic equivalence. A comparison of sieve and settling tube data shows that, with progressive coarsening of the size fractions, the mean diameters of individual sediment components increasingly depart from the spherical quartz standard, the experimental data demonstrating the hydraulic incompatibility of the sieve data. Overall, the spatial distribution patterns of textural parameters (mean settling diameter, sorting and skewness) of the siliciclastic and bioclastic sediment components are very similar. Bivariate plots between them reveal linear trends when averaged over small intervals. A systematic deviation is observed in sorting, the trend ranging from uniformity at poorer sorting levels to a progressively increasing lag of the bioclastic component relative to the siliciclastic one as overall sorting improves. The deviation amounts to 0.8 relative sorting units at the optimal sorting level. The small textural differences between the two components are considered to reflect the influence of particle shape, which prevents the bioclastic fraction from achieving complete textural equivalence with the siliciclastic one. This is also reflected in the inferred transport behaviour of the two shape components, the bioclastic fraction moving closer to the bed than the siliciclastic one because of the higher drag experienced by low shape factor particles. As a consequence, the bed-phase development of bioclastic sediments departs significantly from that of siliciclastic sediments. Systematic flume experiments, however, are currently still lacking.

  5. Bringing Geoscientific Practices to Schools Through Guided Inquiry and the NSF-MSP-funded RITES Project

    NASA Astrophysics Data System (ADS)

    Cardace, D.; Schifman, L. A.; Kortz, K. M.; Saul, K.; Veeger, A. I.; Murray, D. P.

    2012-12-01

    The Rhode Island Technology Enhanced Science (RITES) Project is in its fifth of five years of funding from the NSF Math Science Partnership Program. At this stage, RITES has exceptional engagement of school districts across Rhode Island and growing momentum with partners in schools (covering the demographic spectrum present in Rhode Island) to enhance science education state-wide. One RITES product that will endure is the wide use by teachers of a Rock Cycle focused guided inquiry module, of constructivist design, that corresponds well to both the Rhode Island Grade Span Expectations (GSE) and the Next Generation Science Standards (with probable nationwide implementation) released in May 2012. The Rock Cycle teaching module has been piloted and edited following use in middle and high school classrooms. In this presentation, we evaluate the implementation fidelity of this curricular module, integrating commentary by the design team (Kortz and Saul) with data from teacher interviews, teacher reports on class use, and focus groups during which teachers discuss successes and challenges pertinent to the Rock Cycle from classroom experiences. In this presentation, we pay particular attention to the skills developed through the Rock Cycle module that resonate with research-supported approaches, such as observation, evidence-based hypothesis resolution, diverse science communication strategies, etc., all of which are also necessary scientific research skills.

  6. Engineering and Technical Configuration Aspects of HIAPER, the new NSF/NCAR Research Aircraft

    NASA Astrophysics Data System (ADS)

    Friesen, R.; Laursen, K.

    2002-12-01

    The High-performance Instrumented Airborne Platform for Environmental Research, or HIAPER, is the new research aircraft presently being developed at the National Center for Atmospheric Research (NCAR) to serve the environmental research needs of the National Science Foundation (NSF) for the next several decades. The basic aircraft -- a Gulfstream V (G-V) business jet -- has been completed and will shortly undergo extensive modification to prepare it for future deployments in support of a variety of geosciences research missions. This presentation will focus on the many design and engineering considerations that have been made and are yet to come in converting a "green" business jet into a versatile research aircraft to serve the environmental research community. The project teams composed of engineers and scientists from NCAR and the scientific community at large are faced with trade offs involving costs of modifications, airframe structural integrity, aircraft performance (e.g. weight, drag), cabin environment, locations of inlet and sampling ports and FAA certification requirements. Many of the specific engineering specifications and modifications that have been made to date will be presented by way of engineering drawings, graphical depictions and actual photographs of the aircraft structure. Additionally, projected performance data of the modified-for-research aircraft will be presented along with some of the analyses performed to arrive at critical decisions (e.g. CFD airflow analysis). Finally, some of the details of the aircraft "infrastructure" such as signal and power wiring, generic cabin layout and data acquisition will be discussed.

  7. Calibration and intercomparison of water vapor instrumentation used on the NSF/NCAR HIAPER aircraft

    NASA Astrophysics Data System (ADS)

    Kraemer, D.; Campos, T.; Flocke, F.; Jensen, J.; Wang, J.; Cole, H.; Korn, E.; Lauritsen, D.; Kraemer, M.

    2007-12-01

    Subject of the study is the characterization of a Kahn DCS-80 water vapor calibration system and the calibration of two water vapor sensors used on research aircraft, namely a Buck Instruments B-1001 chilled mirror sensor and a MayComm Tunable Diode Laser Absorption Hygrometer. A series of Vaisala drop sondes were also characterized and compared to the aircraft instruments. In an effort to assess the precision of the water vapor sensors that are being used on board the NSF/NACR GV aircraft (HIAPER), the instruments were tested at ambient pressure (800 mbar) inside an environmental chamber to simulate temperature conditions during flight. Tested dewpoints ranged from -70 to +20 degrees Celsius. The TDL - hygrometer was calibrated in preparation for an international water vapor measurement intercomparison campaign at the Forschungszentrum Karlsruhe, Germany. We will present the detailed calibration and characterization procedure, the laboratory setup for the different sensors, results from the calibrations of all instruments, assess their precision and useful operating range, and present some preliminary results from the international intercomparison campaign.

  8. NSF RET in Southern Africa: community and research experiences in soil science

    NASA Astrophysics Data System (ADS)

    Mladenov, N.; Pollard, A.; Wellbeloved-Stone, R.; Riffel, H.; Chavarro, D.; D'Odorico, P.

    2010-12-01

    Collaborative research on belowground carbon storage in the Kalahari Desert has provided opportunities for international research experience for US middle and high school teachers, funded by the National Science Foundation Research Experience for Teachers (RET) Program. This presentation will highlight the field research experiences, international high school visit, relationships fostered with Botswana high school teachers, and new soil science curricula developed by three US environmental science teachers. New lesson plans and activities on carbon sequestration, fine and coarse root mapping, and soil organic carbon cycling and other learning tools have been incorporated into the existing Underground Safari webpage (instaar.colorado.edu/undergroundsafari) (Figure 1). An interactive blog, undergroundsafari.edublogs.org, has been developed to allow dynamic discourse between students, teachers and researchers on this project. Lessons learned from classroom trials of curriculum and use of other RET experience-motivated activities in the classroom will be discussed. Figure 1. Screen capture of the "Videos" page from the Underground Safari website for NSF DEB project, "Collaborative Research: Distribution and dynamics of belowground carbon in savannas."

  9. Perspectives from the NSF-sponsored workshop on Grand Challenges in Nanomaterials

    NASA Astrophysics Data System (ADS)

    Hull, Robert

    2004-03-01

    At an NSF-sponsored workshop in June 2003, about seventy research leaders in the field of nanomaterials met to discuss, explore and identify future new directions and critical needs ("Grand Challenges") for the next decade and beyond. The key pervasive theme that was identified was the need to develop techniques for assembly of nanoscaled materials over multiple lengths scales, at the levels of efficiency, economy, and precision necessary to realize broad new classes of applications in such diverse technologies as electronics, computation, telecommunications, data storage, energy storage / transmission / generation, health care, transportation, civil infrastructure, military applications, national security, and the environment. Elements of this strategy include development of new self-assembly and lithographic techniques; biologically-mediated synthesis; three-dimensional atomic-scale measurement of structure, properties and chemistry; harnessing of the sub-atomic properties of materials such as electron spin and quantum interactions; new computational methods that span all relevant length- and time- scales; a fundamental understanding of acceptable / achievable "fault tolerance" at the nanoscale; and methods for real-time and distributed sensing of nanoscale assembly. A parallel theme was the need to provide education concerning the potential, applications, and benefits of nanomaterials to all components of society and all levels of the educational spectrum. This talk will summarize the conclusions and recommendations from this workshop, and illustrate the future potential of this field through presentation of selected break-through results provided by workshop participants.

  10. Beyond Earth: Weaving Science and Indigenous Culture - A 1-year NSF Planning Grant

    NASA Astrophysics Data System (ADS)

    Young, Timothy; Guy, M.; Baker Big-Back, C.; Froelich, K.

    2011-01-01

    We present results of a 1-year NSF planning grant called Beyond Earth. The project is designed to engage Native American, urban, and rural families in science learning while piloting curriculum development and implementation that incorporates both Native and Western epistemologies. Physical, earth, and space science content is juxtaposed with indigenous culture, stories, language and epistemology in after-school programs and teacher training. Project partners include the Dakota Science Center, Fort Berthold Community College, and Sitting Bull College. The Native American tribes represented in this initiative illustrate partnerships between the Dakota, Lakota, Nakota, Hidatsa, Mandan, and Arikara. Over the past year the primary project deliverables include a culturally responsive curriculum Beyond Earth Moon Module, teacher training workshops, a project website. The curriculum module introduces students to the moon's appearance, phases, and positions in the sky using the Night Sky Planetarium Experience Station to explore core concepts underlying moon phases and eclipses using the interactive Nature Experience Station before engaging in the culminating Mission Challenge in which they apply their knowledge to problem solving situations and projects. The Native Science and Western Science activities developed, planetarium explorations created, and website toolkit utilizations are presented.

  11. Sorting Out the Video Game Controversy.

    ERIC Educational Resources Information Center

    Crespi, Pam

    1983-01-01

    This article looks at the controversy over video games; arguments for and against them are offered, along with a list of regulations in force around the country and nine important factors agencies should consider before leasing the machines. (JM)

  12. A comparison between amplitude sorting and phase-angle sorting using external respiratory measurement for 4D CT

    SciTech Connect

    Lu Wei; Parikh, Parag J.; Hubenschmidt, James P.; Bradley, Jeffrey D.; Low, Daniel A.

    2006-08-15

    Respiratory motion can cause significant dose delivery errors in conformal radiation therapy for thoracic and upper abdominal tumors. Four-dimensional computed tomography (4D CT) has been proposed to provide the image data necessary to model tumor motion and consequently reduce these errors. The purpose of this work was to compare 4D CT reconstruction methods using amplitude sorting and phase angle sorting. A 16-slice CT scanner was operated in cine mode to acquire 25 scans consecutively at each couch position through the thorax. The patient underwent synchronized external respiratory measurements. The scans were sorted into 12 phases based, respectively, on the amplitude and direction (inhalation or exhalation) or on the phase angle (0-360 deg.) of the external respiratory signal. With the assumption that lung motion is largely proportional to the measured respiratory amplitude, the variation in amplitude corresponds to the variation in motion for each phase. A smaller variation in amplitude would associate with an improved reconstructed image. Air content, defined as the amount of air within the lungs, bronchi, and trachea in a 16-slice CT segment and used by our group as a surrogate for internal motion, was correlated to the respiratory amplitude and phase angle throughout the lungs. For the 35 patients who underwent quiet breathing, images (similar to those used for treatment planning) and animations (used to display respiratory motion) generated using amplitude sorting displayed fewer reconstruction artifacts than those generated using phase angle sorting. The variations in respiratory amplitude were significantly smaller (P<0.001) with amplitude sorting than those with phase angle sorting. The subdivision of the breathing cycle into more (finer) phases improved the consistency in respiratory amplitude for amplitude sorting, but not for phase angle sorting. For 33 of the 35 patients, the air content showed significantly improved (P<0.001) correlation with the

  13. Microfluidic train station: highly robust and multiplexable sorting of droplets on electric rails.

    PubMed

    Frenzel, Daniel; Merten, Christoph A

    2017-03-14

    Fluorescence-activated droplet sorting (FADS) has become a widely used technique for high-throughput screening applications. However, existing methods are very sensitive to fluctuating flow rates at the sorting junction, which can be caused by the pulsing effects of mechanical pumps, droplet aggregates or the accumulation of precipitates during lengthy biological screening applications. Furthermore, existing sorting devices allow only 2-way sorting. We present here a dielectrophoretic sorting system in which the droplets are sorted along multiple electrode pairs that run parallel to the channels. This enables highly reliable sorting (no errors were detected for more than 2000 sorting events) even when inverting the relative flow rates at a 2-way sorting junction from 80 : 20 to 20 : 80. Furthermore, our toolbox is scalable: we demonstrate on the example of a triple-colour sorting experiment with a total of four decoupled electrodes that multi-way sorting is feasible.

  14. Trade-Off between Effectiveness and Equity? An Analysis of Social Sorting between Classrooms and between Schools

    ERIC Educational Resources Information Center

    Ferrer-Esteban, Gerard

    2016-01-01

    This article analyzes whether school social segregation, derived from policies and practices of both between-school student allocation and within-school streaming, is related to the effectiveness of the Italian education system. Hierarchical regression models are used to set out territorially aggregated factors of social sorting influencing…

  15. Quantitative assessment of distance to collection point and improved sorting information on source separation of household waste.

    PubMed

    Rousta, Kamran; Bolton, Kim; Lundin, Magnus; Dahlén, Lisa

    2015-06-01

    The present study measures the participation of households in a source separation scheme and, in particular, if the household's application of the scheme improved after two interventions: (a) shorter distance to the drop-off point and (b) easy access to correct sorting information. The effect of these interventions was quantified and, as far as possible, isolated from other factors that can influence the recycling behaviour. The study was based on households located in an urban residential area in Sweden, where waste composition studies were performed before and after the interventions by manual sorting (pick analysis). Statistical analyses of the results indicated a significant decrease (28%) of packaging and newsprint in the residual waste after establishing a property close collection system (intervention (a)), as well as significant decrease (70%) of the miss-sorted fraction in bags intended for food waste after new information stickers were introduced (intervention (b)). Providing a property close collection system to collect more waste fractions as well as finding new communication channels for information about sorting can be used as tools to increase the source separation ratio. This contribution also highlights the need to evaluate the effects of different types of information and communication concerning sorting instructions in a property close collection system.

  16. A sorting system with automated gates permits individual operant experiments with mice from a social home cage.

    PubMed

    Winter, York; Schaefers, Andrea T U

    2011-03-30

    Behavioral experiments based on operant procedures can be time-consuming for small amounts of data. While individual testing and handling of animals can influence attention, emotion, and behavior, and interfere with experimental outcome, many operant protocols require individual testing. We developed an RFID-technology- and transponder-based sorting system that allows removing the human factor for longer-term experiments. Identity detectors and automated gates route mice individually from their social home cage to an adjacent operant compartment with 24/7 operation. CD1-mice learnt quickly to individually pass through the sorting system. At no time did more than a single mouse enter the operant compartment. After 3 days of adjusting to the sorting system, groups of 4 mice completed about 50 experimental trials per day in the operant compartment without experimenter intervention. The automated sorting system eliminates handling, isolation, and disturbance of the animals, eliminates experimenter-induced variability, saves experimenter time, and is financially economical. It makes possible a new approach for high-throughput experimentation, and is a viable tool for increasing quality and efficiency of many behavioral and neurobiological investigations. It can connect a social home cage, through individual sorting automation, to diverse setups including classical operant chambers, mazes, or arenas with video-based behavior classification. Such highly automated systems will permit efficient high-throughput screening even for transgenic animals with only subtle neurological or psychiatric symptoms where elaborate or longer-term protocols are required for behavioral diagnosis.

  17. Toward label-free Raman-activated cell sorting of cardiomyocytes derived from human embryonic stem cells

    NASA Astrophysics Data System (ADS)

    Pascut, Flavius C.; Goh, Huey T.; George, Vinoj; Denning, Chris; Notingher, Ioan

    2011-04-01

    Raman micro-spectroscopy (RMS) has been recently proposed for label-free phenotypic identification of human embryonic stem cells (hESC)-derived cardiomyocytes. However, the methods used for measuring the Raman spectra led to acquisition times of minutes per cell, which is prohibitive for rapid cell sorting applications. In this study we evaluated two measurement strategies that could reduce the measurement time by a factor of more than 100. We show that sampling individual cells with a laser beam focused to a line could eliminate the need of cell raster scanning and achieve high prediction accuracies (>95% specificity and >96% sensitivity) with acquisition times ~5 seconds per cell. However, the use of commercially-available higher power lasers could potentially lead to sorting speeds of ~10 cells per s. This would start to progress RMS to the field of cell sorting for applications such as enrichment and purification of hESC-derived cardiomyocytes.

  18. Spike sorting for polytrodes: a divide and conquer approach

    PubMed Central

    Swindale, Nicholas V.; Spacek, Martin A.

    2014-01-01

    In order to determine patterns of neural activity, spike signals recorded by extracellular electrodes have to be clustered (sorted) with the aim of ensuring that each cluster represents all the spikes generated by an individual neuron. Many methods for spike sorting have been proposed but few are easily applicable to recordings from polytrodes which may have 16 or more recording sites. As with tetrodes, these are spaced sufficiently closely that signals from single neurons will usually be recorded on several adjacent sites. Although this offers a better chance of distinguishing neurons with similarly shaped spikes, sorting is difficult in such cases because of the high dimensionality of the space in which the signals must be classified. This report details a method for spike sorting based on a divide and conquer approach. Clusters are initially formed by assigning each event to the channel on which it is largest. Each channel-based cluster is then sub-divided into as many distinct clusters as possible. These are then recombined on the basis of pairwise tests into a final set of clusters. Pairwise tests are also performed to establish how distinct each cluster is from the others. A modified gradient ascent clustering (GAC) algorithm is used to do the clustering. The method can sort spikes with minimal user input in times comparable to real time for recordings lasting up to 45 min. Our results illustrate some of the difficulties inherent in spike sorting, including changes in spike shape over time. We show that some physiologically distinct units may have very similar spike shapes. We show that RMS measures of spike shape similarity are not sensitive enough to discriminate clusters that can otherwise be separated by principal components analysis (PCA). Hence spike sorting based on least-squares matching to templates may be unreliable. Our methods should be applicable to tetrodes and scalable to larger multi-electrode arrays (MEAs). PMID:24574979

  19. From the NSF: The National Science Foundation's Investments in Broadening Participation in Science, Technology, Engineering, and Mathematics Education through Research and Capacity Building

    ERIC Educational Resources Information Center

    James, Sylvia M.; Singer, Susan R.

    2016-01-01

    The National Science Foundation (NSF) has a long history of investment in broadening participation (BP) in science, technology, engineering, and mathematics (STEM) education. A review of past NSF BP efforts provides insights into how the portfolio of programs and activities has evolved and the broad array of innovative strategies that has been…

  20. Defining linkages between the GSC and NSF's LTER program: how the Ecological Metadata Language (EML) relates to GCDML and other outcomes.

    PubMed

    Gil, Inigo San; Sheldon, Wade; Schmidt, Tom; Servilla, Mark; Aguilar, Raul; Gries, Corinna; Gray, Tanya; Field, Dawn; Cole, James; Pan, Jerry Yun; Palanisamy, Giri; Henshaw, Donald; O'Brien, Margaret; Kinkel, Linda; McMahon, Katherine; Kottmann, Renzo; Amaral-Zettler, Linda; Hobbie, John; Goldstein, Philip; Guralnick, Robert P; Brunt, James; Michener, William K

    2008-06-01

    The Genomic Standards Consortium (GSC) invited a representative of the Long-Term Ecological Research (LTER) to its fifth workshop to present the Ecological Metadata Language (EML) metadata standard and its relationship to the Minimum Information about a Genome/Metagenome Sequence (MIGS/MIMS) and its implementation, the Genomic Contextual Data Markup Language (GCDML). The LTER is one of the top National Science Foundation (NSF) programs in biology since 1980, representing diverse ecosystems and creating long-term, interdisciplinary research, synthesis of information, and theory. The adoption of EML as the LTER network standard has been key to build network synthesis architectures based on high-quality standardized metadata. EML is the NSF-recognized metadata standard for LTER, and EML is a criteria used to review the LTER program progress. At the workshop, a potential crosswalk between the GCDML and EML was explored. Also, collaboration between the LTER and GSC developers was proposed to join efforts toward a common metadata cataloging designer's tool. The community adoption success of a metadata standard depends, among other factors, on the tools and trainings developed to use the standard. LTER's experience in embracing EML may help GSC to achieve similar success. A possible collaboration between LTER and GSC to provide training opportunities for GCDML and the associated tools is being explored. Finally, LTER is investigating EML enhancements to better accommodate genomics data, possibly integrating the GCDML schema into EML. All these action items have been accepted by the LTER contingent, and further collaboration between the GSC and LTER is expected.

  1. Defining linkages between the GSC and NSF's LTER program: How the Ecological Metadata Language (EML) relates to GCDML and other outcomes

    SciTech Connect

    Inigo, Gil San; Servilla, Mark; Brunt, James; Michener, William; Sheldon, Wade; Schmidt, Tom; Cole, James; Aguilar, Raul; Gries, Corinna; Gray, Tanya; Field, Dawn; Pan, Jerry Yun; Palanisamy, Giri; Henshaw, Donald; O'Brien, Margaret

    2008-06-01

    The Genomic Standards Consortium (GSC) invited a representative of the Long-Term Ecological Research (LTER) to its fifth workshop to present the Ecological Metadata Language (EML) metadata standard and its relationship to the Minimum Information about a Genome/Metagenome Sequence (MIGS/MIMS) and its implementation, the Genomic Contextual Data Markup Language (GCDML). The LTER is one of the top National Science Foundation (NSF) programs in biology since 1980, representing diverse ecosystems and creating long-term, interdisciplinary research, synthesis of information, and theory. The adoption of EML as the LTER network standard has been key to build network synthesis architectures based on high-quality standardized metadata. EML is the NSF-recognized metadata standard for LTER, and EML is a criteria used to review the LTER program progress. At the workshop, a potential crosswalk between the GCDML and EML was explored. Also, collaboration between the LTER and GSC developers was proposed to join efforts toward a common metadata cataloging designer's tool. The community adoption success of a metadata standard depends, among other factors, on the tools and trainings developed to use the standard. LTER's experience in embracing EML may help GSC to achieve similar success. A possible collaboration between LTER and GSC to provide training opportunities for GCDML and the associated tools is being explored. Finally, LTER is investigating EML enhancements to better accommodate genomics data, possibly integrating the GCDML schema into EML. All these action items have been accepted by the LTER contingent, and further collaboration between the GSC and LTER is expected.

  2. ALIX binds a YPX(3)L motif of the GPCR PAR1 and mediates ubiquitin-independent ESCRT-III/MVB sorting.

    PubMed

    Dores, Michael R; Chen, Buxin; Lin, Huilan; Soh, Unice J K; Paing, May M; Montagne, William A; Meerloo, Timo; Trejo, JoAnn

    2012-04-30

    The sorting of signaling receptors to lysosomes is an essential regulatory process in mammalian cells. During degradation, receptors are modified with ubiquitin and sorted by endosomal sorting complex required for transport (ESCRT)-0, -I, -II, and -III complexes into intraluminal vesicles (ILVs) of multivesicular bodies (MVBs). However, it remains unclear whether a single universal mechanism mediates MVB sorting of all receptors. We previously showed that protease-activated receptor 1 (PAR1), a G protein-coupled receptor (GPCR) for thrombin, is internalized after activation and sorted to lysosomes independent of ubiquitination and the ubiquitin-binding ESCRT components hepatocyte growth factor-regulated tyrosine kinase substrate and Tsg101. In this paper, we report that PAR1 sorted to ILVs of MVBs through an ESCRT-III-dependent pathway independent of ubiquitination. We further demonstrate that ALIX, a charged MVB protein 4-ESCRT-III interacting protein, bound to a YPX(3)L motif of PAR1 via its central V domain to mediate lysosomal degradation. This study reveals a novel MVB/lysosomal sorting pathway for signaling receptors that bypasses the requirement for ubiquitination and ubiquitin-binding ESCRTs and may be applicable to a subset of GPCRs containing YPX(n)L motifs.

  3. First Applications of DoD Iridium RUDICS in the NSF Polar Programs

    NASA Astrophysics Data System (ADS)

    Valentic, T.; Stehle, R.

    2008-12-01

    be deployed that better exploit the characteristics of the Iridium channel. In addition, the setup naturally scales to handle hundreds of remote devices, an important aspect for larger sensor networks. As part of the NSF's Arctic Research Support and Logistics Services, we have deployed RUDICS systems with three different research projects. These are the first NSF RUDICS deployments for projects using the Department of Defense Iridium gateway, which allows for unlimited connection time at a flat monthly rate for US government users. The first project is O-Buoy, an IPY-OASIS project for self-contained, autonomous observations of atmospheric chemical species in the polar marine boundary layer. The second project is collection of low-power instrument towers on Alaska's North Slope at Imnavait Creek, part of the Arctic Observation Network (AON). Lastly, the autonomous instrument platform at Ivotuk, Alaska, uses RUDICS to provide telemetry about the renewable energy systems. A set of real-time web displays allow researchers for each project to monitor their remote sites and access real-time data.

  4. Sustaining professional development gains after the NSF-CCLI grant ends

    NASA Astrophysics Data System (ADS)

    Grove, K.; Dekens, P. S.; Dempsey, D. P.

    2012-12-01

    At San Francisco State University we aimed to transform our freshman-level courses in geology, oceanography, and meteorology using funding from a NSF-CCLI grant—"Creating an academic community to foster curiosity and discovery in introductory Geoscience classes" (2010-2012). In addition to creating a new laboratory space and new laboratory materials, we focused on the professional development of graduate teaching assistants (GTAs) and other departmental instructors. Previously, GTAs were given little support to gain teaching skills and present interesting labs, and there was little communication among the various instructors of the introductory courses. We aimed to change the tenor of the department by infusing discussions about effective teaching practices into the daily academic lives of faculty and GTAs and by creating institutional structures to ensure that innovations continued beyond the life of the NSF grant. We entitled this function of the department a Teaching and Learning Community (TLC). An essential element of the TLC, and the institutionalization of project activities, was to create a new graduate seminar course—"Our Dynamic Classroom"—that is offered every semester. This course was created to provide a mechanism for instructors to meet each week to discuss aspects of teaching pedagogy and to share classroom experiences. Each week a GTA or faculty member leads the discussion. Typical weekly topics include: what is inquiry-based learning, understanding students' misconceptions, teaching quantitative skills, what is the affective domain, improving students' writing skills. In response to participant feedback, the course now focuses more on the needs of specific instructors teaching specific courses. For example, in Spring 2012, seminar participants identified several issues GTAs were encountering, such as students failing to read instructions for labs before executing them, and some members of small collaborative groups not actively participating

  5. Sex-sorted canine sperm cryopreservation: limits and procedural considerations.

    PubMed

    Merlo, Barbara; Zambelli, Daniele; Cunto, Marco; Iacono, Eleonora; Nasi, Ludovica; Giaretta, Elisa; Galeati, Giovanna; Bucci, Diego; Spinaci, Marcella

    2015-04-15

    The aim of this study was to define a protocol to store dog sperm before and after sorting to obtain an insemination dose sufficient to allow the conception by artificial insemination. Experiment 1 and 2 were performed to evaluate the more appropriate extender for preserving at room temperature dog sperm before and after sorting. Four extenders were tested: (1) Tris-fructose-citrate (TFC), (2) Tris-glucose-citrate (TGC), (3) modified Tyrode's albumin lactate pyruvate medium (mTALP), and (4) third fraction of the ejaculate (after centrifugation at 5000× g for 10 minutes; III FRAC). Experiment 3 and 4 were performed to evaluate the ability of dog semen to withstand sex sorting and freezing/thawing. Modified Tyrode's albumin lactate pyruvate medium was the best extender for canine sperm storage at room temperature (20 °C-25 °C) before (total motility: TFC, 8.3 ± 1.7; TGC, 50.0 ± 11.5; mTALP, 70.0 ± 0.1; III FRAC, 25.0 ± 1 0.4; P < 0.05) and after sorting (total motility: TFC, 7.3 ± 1.5; TGC, 10.3 ± 1.5; mTALP, 33.3 ± 6.7; III FRAC, 8.7 ± 5.8; P < 0.05), even if at 24-hour sorted sperm quality was impaired in all extenders tested herein. Sperm quality decreased after sorting (total motility: control, 92.5 ± 0.9; sorted, 52.9 ± 6.0; P < 0.05) and, especially, after freezing/thawing (total motility: frozen control, 25.7 ± 4.1; frozen sorted, 2.4 ± 1.2; P < 0.05). In conclusion, mTALP is an appropriate medium for canine sperm storage before and soon after sorting (hours), but a long storage period of sexed sperm at room temperature is not adequate. Cryopreservation greatly impaired sperm quality, and further studies are needed to optimize the freezing protocol for sexed dog sperm.

  6. Transforming Research in Oceanography through Education, Ethnography and Rapidly Evolving Technologies: An NSF-INSPIRE project.

    NASA Astrophysics Data System (ADS)

    German, C. R.; Croff Bell, K. L.; Pallant, A.; Mirmalek, Z.; Jasanoff, S.; Rajan, K.

    2014-12-01

    This paper will discuss a new NSF-INSPIRE project that brings together research conducted in the fields of Ocean Sciences, Education & Human Resources and Computer and Information Science & Engineering. Specifically, our objective is to investigate new methods by which telepresence can be used to conduct cutting edge research and provide authentic educational experiences to undergraduate students, remotely. We choose to conduct this research in an Oceanographic context for two reasons: first with the move toward smaller research ships in the national Oceanographic research fleet, we anticipate that access to berth space at sea will continue to be at a premium. Any component of traditional oceanographic research that can be ported to shore without loss of effectiveness would be of immediate benefit to the Ocean Sciences. Equally, however, we argue that any improvements to work place and/or education practices that we can identify while delivering research and education from the bottom of the deep ocean should be readily mappable to any other scientific or engineering activities that seek to make use of telepresence in less extreme remote environments. Work on our TREET project, to-date, has included recruitment of 6 early career scientists keen to take advantage of the research opportunity provided, together with two senior science mentors with experience using Telepresence and a cohort of undergraduate students at three of the ECS partner Universities, spanning 4 time zones across the continental US. Following a 12-week synchronous on-line seminar series taught in Spring-Summer 2014, the entire team joined together at the Inner Space Center in Sept-Oct 2014 to participate, virtually, in a cruise of research and exploration to the Kick'Em Jenny underwater volcano and adjacent cold seep sites, conducted by the Ocean Exploration Trust's ROV Hercules aboard the Exploration Vessel Nautilus. Our presentation will include preliminary results from that cruise.

  7. The ASM-NSF Biology Scholars Program: An Evidence-Based Model for Faculty Development

    PubMed Central

    Chang, Amy L.; Pribbenow, Christine M.

    2016-01-01

    The American Society for Microbiology (ASM) established its ASM-NSF (National Science Foundation) Biology Scholars Program (BSP) to promote undergraduate education reform by 1) supporting biologists to implement evidence-based teaching practices, 2) engaging life science professional societies to facilitate biologists’ leadership in scholarly teaching within the discipline, and 3) participating in a teaching community that fosters disciplinary-level science, technology, engineering, and mathematics (STEM) reform. Since 2005, the program has utilized year-long residency training to provide a continuum of learning and practice centered on principles from the scholarship of teaching and learning (SoTL) to more than 270 participants (“scholars”) from biology and multiple other disciplines. Additionally, the program has recruited 11 life science professional societies to support faculty development in SoTL and discipline-based education research (DBER). To identify the BSP’s long-term outcomes and impacts, ASM engaged an external evaluator to conduct a study of the program’s 2010–2014 scholars (n = 127) and society partners. The study methods included online surveys, focus groups, participant observation, and analysis of various documents. Study participants indicate that the program achieved its proposed goals relative to scholarship, professional society impact, leadership, community, and faculty professional development. Although participants also identified barriers that hindered elements of their BSP participation, findings suggest that the program was essential to their development as faculty and provides evidence of the BSP as a model for other societies seeking to advance undergraduate science education reform. The BSP is the longest-standing faculty development program sponsored by a collective group of life science societies. This collaboration promotes success across a fragmented system of more than 80 societies representing the life sciences and

  8. The ASM-NSF Biology Scholars Program: An Evidence-Based Model for Faculty Development.

    PubMed

    Chang, Amy L; Pribbenow, Christine M

    2016-05-01

    The American Society for Microbiology (ASM) established its ASM-NSF (National Science Foundation) Biology Scholars Program (BSP) to promote undergraduate education reform by 1) supporting biologists to implement evidence-based teaching practices, 2) engaging life science professional societies to facilitate biologists' leadership in scholarly teaching within the discipline, and 3) participating in a teaching community that fosters disciplinary-level science, technology, engineering, and mathematics (STEM) reform. Since 2005, the program has utilized year-long residency training to provide a continuum of learning and practice centered on principles from the scholarship of teaching and learning (SoTL) to more than 270 participants ("scholars") from biology and multiple other disciplines. Additionally, the program has recruited 11 life science professional societies to support faculty development in SoTL and discipline-based education research (DBER). To identify the BSP's long-term outcomes and impacts, ASM engaged an external evaluator to conduct a study of the program's 2010-2014 scholars (n = 127) and society partners. The study methods included online surveys, focus groups, participant observation, and analysis of various documents. Study participants indicate that the program achieved its proposed goals relative to scholarship, professional society impact, leadership, community, and faculty professional development. Although participants also identified barriers that hindered elements of their BSP participation, findings suggest that the program was essential to their development as faculty and provides evidence of the BSP as a model for other societies seeking to advance undergraduate science education reform. The BSP is the longest-standing faculty development program sponsored by a collective group of life science societies. This collaboration promotes success across a fragmented system of more than 80 societies representing the life sciences and helps

  9. Key Concepts in Geomorphology - NSF supports community-based creation of a new style of textbook

    NASA Astrophysics Data System (ADS)

    Bierman, P. R.; Montgomery, D. R.; Massey, C. A.

    2013-12-01

    Using support from the National Science Foundation, we have created an all new textbook that differs from existing books and serves as a model for extensive community involvement and vetting at all stages from initial outlining through chapter development and revision to final review. The new textbook is designed to serve undergraduate students in first year courses about Earth Surface Processes, Physical Geography, and Quaternary Geology. The approach we employed to create this book could easily be adapted to creating books in other disciplines. The new textbook differs from existing books because it is shorter and focuses on the key concepts of the discipline rather than on specific derivations or place-based examples. A series of >200 electronic resources developed by community members as part of this project (http://serc.carleton.edu/vignettes) provide more detail and geographically specific case-studies that faculty and students need for place-or content-based teaching and learning. NSF support provided for extensive review to ensure accuracy and completeness. Each chapter was reviewed at least twice by two experts in the chapter's content area. Every chapter was also vetted by 8 to 10 generalist reviewers before extensive copyediting. The entire textbook was edited by two senior geomorphologists and a technical editor with expertise in geomorphology. The textbook has 14 chapters organized into four sections. Each chapter includes between 10 and 14 newly drafted, full-color figures designed specifically for novice learners. Between 20 and 30 annotated color photographs illustrate each of the chapters. At the end of each chapter, the Digging Deeper section presents an in depth look at the development of scientific thought on a problem relevant to the chapter along with a worked problem and a series of questions that allow students to test their mastery of the material.

  10. The Perkins Telescope in the 21st Century: An NSF PREST Project

    NASA Astrophysics Data System (ADS)

    Janes, K. A.; Buie, M. W.; Bosh, A. S.; Clemens, D. P.; Jackson, J. M.

    2005-12-01

    With the help of a grant under the NSF "Program for Research and Education with Small Telescopes (PREST)," Boston University and Lowell Observatory are engaged in a project to improve the performance of the 1.83-meter Perkins Telescope on Anderson Mesa near Flagstaff, Arizona. Our goal is to bring the Perkins Telescope into the 21st century, to create effective resources in support of the scientific and educational missions of our two institutions and the larger community. Over the past several years we have re-instrumented the telescope; two facility-class instruments, Mimir, a wide-field infrared imager, polarimeter and spectrometer and PRISM, an optical counterpart, are now in operation at the Perkins Telescope. The new instrumentation at the Perkins will give our partnership and visiting observers access to an important niche in "observation space" not readily available elsewhere. Wide-field polarimetry and imaging and multi-object low-resolution spectroscopy are now possible across the spectrum from the near uv to the thermal IR. We are well-placed for surveys and synoptic studies, ranging from monitoring polarization variations in blazars to mapping the galactic magnetic field to tracking Kuiper-belt objects. Our PREST project includes four components: Thermal management to improve the seeing at the telescope, upgrades to the instrumentation, productivity enhancements to the facility, and integration of the Boston University access to the telescope into our graduate and undergraduate educational programs. In the first year of the PREST grant we have set up a visitor program (see www.lowell.edu/VisitingObservers/), established a graduate-student-in-residence program, installed fans and ductwork around the telescope and dome to improve seeing, and completed a student-led project to construct an innovative grism for optical spectroscopy based on a volume-phase holographic grating.

  11. Internships and UNAVCO: Training the Future Geoscience Workforce Through the NSF GAGE Facility

    NASA Astrophysics Data System (ADS)

    Morris, A. R.; MacPherson-Krutsky, C. C.; Charlevoix, D. J.; Bartel, B. A.

    2015-12-01

    Facilities are uniquely positioned to both serve a broad, national audience and provide unique workforce experience to students and recent graduates. Intentional efforts dedicated to broadening participation in the future geoscience workforce at the NSF GAGE (Geodesy Advancing Geosciences and EarthScope) Facility operated by UNAVCO, are designed to meet the needs of the next generation of students and professionals. As a university-governed consortium facilitating research and education in the geosciences, UNAVCO is well-situated to both prepare students for geoscience technical careers and advanced research positions. Since 1998, UNAVCO has offered over 165 student assistant or intern positions including engineering, data services, education and outreach, and business support. UNAVCO offers three formal programs: the UNAVCO Student Internship Program (USIP), Research Experiences in Solid Earth Science for Students (RESESS), and the Geo-Launchpad (GLP) internship program. Interns range from community college students up through graduate students and recent Masters graduates. USIP interns gain real-world work experience in a professional setting, collaborate with teams toward a common mission, and contribute their knowledge, skills, and abilities to the UNAVCO community. RESESS interns conduct authentic research with a scientist in the Front Range area as well as participate in a structured professional development series. GLP students are in their first 2 years of higher education and work alongside UNAVCO technical staff gaining valuable work experience and insight into the logistics of supporting scientific research. UNAVCO's efforts in preparing the next generation of scientists largely focuses on increasing diversity in the geosciences, whether continuing academic studies or moving into the workforce. To date, well over half of our interns and student assistants come from backgrounds historically underrepresented in the geosciences. Over 80% of former interns

  12. NSF-Sponsored Summit on the Future of Undergraduate Geoscience Education: outcomes

    NASA Astrophysics Data System (ADS)

    Mosher, S.

    2014-12-01

    The NSF-sponsored Summit on the Future of Undergraduate Geoscience Education made major progress toward developing a collective community vision for the geosciences. A broad spectrum of the geoscience education community, ~200 educators from research universities/four and two year colleges, focused on preparation of undergraduates for graduate school and future geoscience careers, pedagogy, use of technology, broadening participation/retention of underrepresented groups, and preparation of K-12 science teachers. Participants agreed that key concepts, competencies and skills learned throughout the curriculum were more important than specific courses. Concepts included understanding Earth as complex, dynamic system, deep time, evolution of life, natural resources, energy, hazards, hydrogeology, surface processes, Earth materials and structure, and climate change. Skills/competencies included ability to think spatially and temporally, reason inductively and deductively, make and use indirect observations, engage in complex open, coupled systems thinking, and work with uncertainty, non-uniqueness, and incompleteness, as well as critical thinking, problem solving, communication, and ability to think like a scientist and continue to learn. Successful ways of developing these include collaborative, integrative projects involving teams, interdisciplinary projects, fieldwork and research experiences, as well as flipped classrooms and integration and interactive use of technology, including visualization, simulation, modeling and analysis of real data. Wider adoption of proven, effective best practices is our communities' main pedagogical challenge, and we focused on identifying implementation barriers. Preparation of future teachers in introductory and general geoscience courses by incorporating Next Generation Science Standards and using other sciences/math to solve real world geoscience problems should help increase diversity and number of future geoscientists and

  13. Computer simulations of cell sorting due to differential adhesion.

    PubMed

    Zhang, Ying; Thomas, Gilberto L; Swat, Maciej; Shirinifard, Abbas; Glazier, James A

    2011-01-01

    The actions of cell adhesion molecules, in particular, cadherins during embryonic development and morphogenesis more generally, regulate many aspects of cellular interactions, regulation and signaling. Often, a gradient of cadherin expression levels drives collective and relative cell motions generating macroscopic cell sorting. Computer simulations of cell sorting have focused on the interactions of cells with only a few discrete adhesion levels between cells, ignoring biologically observed continuous variations in expression levels and possible nonlinearities in molecular binding. In this paper, we present three models relating the surface density of cadherins to the net intercellular adhesion and interfacial tension for both discrete and continuous levels of cadherin expression. We then use then the Glazier-Graner-Hogeweg (GGH) model to investigate how variations in the distribution of the number of cadherins per cell and in the choice of binding model affect cell sorting. We find that an aggregate with a continuous variation in the level of a single type of cadherin molecule sorts more slowly than one with two levels. The rate of sorting increases strongly with the interfacial tension, which depends both on the maximum difference in number of cadherins per cell and on the binding model. Our approach helps connect signaling at the molecular level to tissue-level morphogenesis.

  14. A statistical approach for distinguishing hybridization and incomplete lineage sorting.

    PubMed

    Joly, Simon; McLenachan, Patricia A; Lockhart, Peter J

    2009-08-01

    The extent and evolutionary significance of hybridization is difficult to evaluate because of the difficulty in distinguishing hybridization from incomplete lineage sorting. Here we present a novel parametric approach for statistically distinguishing hybridization from incomplete lineage sorting based on minimum genetic distances of a nonrecombining locus. It is based on the idea that the expected minimum genetic distance between sequences from two species is smaller for some hybridization events than for incomplete lineage sorting scenarios. When applied to empirical data sets, distributions can be generated for the minimum interspecies distances expected under incomplete lineage sorting using coalescent simulations. If the observed distance between sequences from two species is smaller than its predicted distribution, incomplete lineage sorting can be rejected and hybridization inferred. We demonstrate the power of the method using simulations and illustrate its application on New Zealand alpine buttercups (Ranunculus). The method is robust and complements existing approaches. Thus it should allow biologists to assess with greater accuracy the importance of hybridization in evolution.

  15. Mechanically robust microfluidics and bulk wave acoustics to sort microparticles

    NASA Astrophysics Data System (ADS)

    Dauson, Erin R.; Gregory, Kelvin B.; Greve, David W.; Healy, Gregory P.; Oppenheim, Irving J.

    2016-04-01

    Sorting microparticles (or cells, or bacteria) is significant for scientific, medical and industrial purposes. Research groups have used lithium niobate SAW devices to produce standing waves, and then to align microparticles at the node lines in polydimethylsiloxane (PDMS, silicone) microfluidic channels. The "tilted angle" (skewed) configuration is a recent breakthrough producing particle trajectories that cross multiple node lines, making it practical to sort particles. However, lithium niobate wafers and PDMS microfluidic channels are not mechanically robust. We demonstrate "tilted angle" microparticle sorting in novel devices that are robust, rapidly prototyped, and manufacturable. We form our microfluidic system in a rigid polymethyl methacrylate (PMMA, acrylic) prism, sandwiched by lead-zirconium-titanate (PZT) wafers, operating in through-thickness mode with inertial backing, that produce standing bulk waves. The overall configuration is compact and mechanically robust, and actuating PZT wafers in through-thickness mode is highly efficient. Moving to this novel configuration introduced new acoustics questions involving internal reflections, but we show experimental images confirming the intended nodal geometry. Microparticles in "tilted angle" devices display undulating trajectories, where deviation from the straight path increases with particle diameter and with excitation voltage to create the mechanism by which particles are sorted. We show a simplified analytical model by which a "phase space" is constructed to characterize effective particle sorting, and we compare our experimental data to the predictions from that simplified model; precise correlation is not expected and is not observed, but the important physical trends from the model are paralleled in the measured particle trajectories.

  16. Marker-specific sorting of rare cells using dielectrophoresis

    PubMed Central

    Hu, Xiaoyuan; Bessette, Paul H.; Qian, Jiangrong; Meinhart, Carl D.; Daugherty, Patrick S.; Soh, Hyongsok T.

    2005-01-01

    Current techniques in high-speed cell sorting are limited by the inherent coupling among three competing parameters of performance: throughput, purity, and rare cell recovery. Microfluidics provides an alternate strategy to decouple these parameters through the use of arrayed devices that operate in parallel. To efficiently isolate rare cells from complex mixtures, an electrokinetic sorting methodology was developed that exploits dielectrophoresis (DEP) in microfluidic channels. In this approach, the dielectrophoretic amplitude response of rare target cells is modulated by labeling cells with particles that differ in polarization response. Cell mixtures were interrogated in the DEP-activated cell sorter in a continuous-flow manner, wherein the electric fields were engineered to achieve efficient separation between the dielectrophoretically labeled and unlabeled cells. To demonstrate the efficiency of marker-specific cell separation, DEP-activated cell sorting (DACS) was applied for affinity-based enrichment of rare bacteria expressing a specific surface marker from an excess of nontarget bacteria that do not express this marker. Rare target cells were enriched by >200-fold in a single round of sorting at a single-channel throughput of 10,000 cells per second. DACS offers the potential for automated, surface marker-specific cell sorting in a disposable format that is capable of simultaneously achieving high throughput, purity, and rare cell recovery. PMID:16236724

  17. Flow Cytometric Analysis and Sorting of Heterodera glycines Eggs

    PubMed Central

    Tylka, G. L.; Niblack, T. L.; Walk, T. C.; Harkins, K. R.; Barnett, L.; Baker, N. K.

    1993-01-01

    A nondestructive technique was developed to characterize and separate eggs of soybean cyst nematode, Heterodera glycines, by developmental stage using flow cytometry. Eggs from cysts cultured on susceptible soybean roots were suspended in 0.1% xanthan gum or 59% sucrose and loaded into either a Coulter EPICS 752 or EPICS 753 flow cytometer. Eggs were analyzed and sorted according to forward angle and 90° light scatter, flow cytometric parameters that are relative measures of object size and granularity, respectively. Mature eggs containing vermiform juveniles were less granular and slightly larger than eggs in earlier stages of embryogeny, allowing for separation of mature eggs from immature eggs. The effectiveness of flow cytometric sorting was evaluated by comparing the developmental stages of subpopulations of unsorted and sorted eggs. Of a subpopulation of unsorted eggs, 62% contained vermiform juveniles, whereas 85 to 95% of sorted subpopulations of larger, less granular eggs contained vermiform juveniles. Suspending H. glycines eggs in 0.1% xanthan gum or 59% sucrose for flow cytometric analysis had no effect on subsequent egg hatch in vitro. This technique is an efficient and effective means to collect large, relatively homogeneous quantities of H. glycines eggs in early or late embryogeny, and would likely be useful for analyzing and sorting eggs of other nematode species for use in developmental, genetic, or physiological research, or for identification and collection of parasitized eggs. PMID:19279815

  18. Sorting centimetre-long single-walled carbon nanotubes

    PubMed Central

    Yu, Woo Jong; Chae, Sang Hoon; Vu, Quoc An; Lee, Young Hee

    2016-01-01

    While several approaches have been developed for sorting metallic (m) or semiconducting (s) single-walled carbon nanotubes (SWCNTs), the length of SWCNTs is limited within a micrometer, which restricts excellent electrical performances of SWCNTs for macro-scale applications. Here, we demonstrate a simple sorting method of centimetre-long aligned m- and s-SWCNTs. Ni particles were selectively and uniformly coated along the 1-cm-long m-SWCNTs by applying positive gate bias during electrochemical deposition with continuous electrolyte injection. To sort s-SWCNTs, the Ni coating was oxidized to form insulator outer for blocking of current flow through inner m-SWCNTs. Sorting of m-SWCNTs were demonstrated by selective etching of s-SWCNTs via oxygen plasma, while the protected m-SWCNTs by Ni coating remained intact. The series of source-drain pairs were patterned along the 1-cm-long sorted SWCNTs, which confirmed high on/off ratio of 104–108 for s-SWCNTs and nearly 1 for m-SWCNTs. PMID:27476909

  19. Sorting centimetre-long single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Yu, Woo Jong; Chae, Sang Hoon; Vu, Quoc An; Lee, Young Hee

    2016-08-01

    While several approaches have been developed for sorting metallic (m) or semiconducting (s) single-walled carbon nanotubes (SWCNTs), the length of SWCNTs is limited within a micrometer, which restricts excellent electrical performances of SWCNTs for macro-scale applications. Here, we demonstrate a simple sorting method of centimetre-long aligned m- and s-SWCNTs. Ni particles were selectively and uniformly coated along the 1-cm-long m-SWCNTs by applying positive gate bias during electrochemical deposition with continuous electrolyte injection. To sort s-SWCNTs, the Ni coating was oxidized to form insulator outer for blocking of current flow through inner m-SWCNTs. Sorting of m-SWCNTs were demonstrated by selective etching of s-SWCNTs via oxygen plasma, while the protected m-SWCNTs by Ni coating remained intact. The series of source-drain pairs were patterned along the 1-cm-long sorted SWCNTs, which confirmed high on/off ratio of 104–108 for s-SWCNTs and nearly 1 for m-SWCNTs.

  20. The Method of Sorting as a Data-Gathering Procedure in Multivariate Research

    ERIC Educational Resources Information Center

    Rosenberg, Seymour; Kim, Moonja Park

    1975-01-01

    Compares two basic variants of the sorting method: single-sort and multiple sort. The nature of individual differences in sorting, as well as sex differences, were also investigated. Stimulus materials were the 15 mutually exclusive kinship terms selected by Wallace and Atkins (1960). (RC)

  1. A novel pathway for sorting to intralumenal vesicles of multivesicular endosomes involved in organelle morphogenesis

    PubMed Central

    Theos, Alexander C.; Truschel, Steven T.; Tenza, Danielle; Hurbain, Ilse; Harper, Dawn C.; Berson, Joanne F.; Thomas, Penelope C.; Raposo, Graça; Marks, Michael S.

    2006-01-01

    SUMMARY Cargo partitioning into intralumenal vesicles (ILVs) of multivesicular endosomes underlies such cellular processes as growth factor down-regulation, viral budding, and biogenesis of lysosome-related organelles including melanosomes. Here we show that the melanosomal protein, Pmel17, is sorted into ILVs by a novel mechanism that is conserved in non-pigment cells and is dependent upon lumenal determinants. ILV targeting of Pmel17 is unaffected by mutagenesis of cytoplasmic lysine and cysteine residues or replacement of the cytoplasmic domain, indicating independence of ubiquitylation, and unlike ILV targeting of ubiquitylated cargo, is insensitive to functional inhibition of Hrs and ESCRT complexes. Chimeric protein and deletion analyses indicate that two N-terminal lumenal sub-domains are necessary and sufficient for ILV targeting. Pmel17 fibril formation, which occurs during melanosome maturation in melanocytes, requires a third lumenal sub-domain and proteolytic processing that itself requires ILV localization. These results establish a novel Hrs- and perhaps ESCRT-independent pathway of ILV sorting by lumenal determinants and a requirement for ILV sorting in fibril formation. PMID:16516837

  2. The importance of species sorting differs between habitat generalists and specialists in bacterial communities.

    PubMed

    Székely, Anna J; Langenheder, Silke

    2014-01-01

    Recent studies have shown that the spatial turnover of bacterial communities, that is, beta-diversity, is determined by a combination of different assembly mechanisms, such as species sorting, that is, environmental filtering, and dispersal-related mechanisms. However, it is currently unclear to what extent the importance of the different mechanisms depends on community traits. Here, we implemented a study using a rock pool metacommunity to test whether habitat specialization of bacterial taxa and groups or their phylogenetic identity influenced by which mechanisms communities were assembled. In general, our results show that species sorting was the most important assembly mechanism. However, we found that a larger fraction of the variation in bacterial community composition between pools could be explained by environmental factors in case of habitat generalists, that is, taxa that were widespread and abundant in the metacommunity, compared with habitat specialists, that is, taxa that had a more restricted distribution range and tended to be rare. Differences in assembly mechanisms were observed between different major phyla and classes. However, also here, a larger fraction of the variation in community composition among pools could be explained for taxonomic groups that contained on average more habitat generalists. In summary, our results show that species sorting is stronger for the most common taxa, indicating that beta-diversity along environmental gradients can be adequately described without considering rare taxa.

  3. Building Global Capacity for Conducting Operational Research Using the SORT IT Model: Where and Who?

    PubMed Central

    Zachariah, Rony; Rust, Stefanie; Berger, Selma Dar; Guillerm, Nathalie; Bissell, Karen; Delaunois, Paul; Reid, Anthony J.; Kumar, Ajay M. V.; Olliaro, Piero L.; Reeder, John C.; Harries, Anthony D.; Ramsay, Andrew

    2016-01-01

    Setting Research capacity is weakest in low and middle-income countries (LMICs) where operational research is highly relevant and needed. Structured Operational Research and Training Initiative (SORT IT) courses have been developed to train participants to conduct and publish operational research and influence policy and practice. Twenty courses were completed in Asia, Africa, Europe and the South Pacific between 2009 and 2014. Objectives In the 20 completed SORT IT courses, to assess where the research was conducted, who was trained, who became facilitators in subsequent courses and course outcomes. Design A cohort study of completed SORT IT courses Results There were 236 participants (41% female) including 64 nationalities who conducted research in 59 countries, mostly from Asia and Africa (mean course duration = 9.7 months). Most participants (68%) were from government health programs and non-governmental agencies. A total of 213(90%) participants completed all milestones successfully with 41(19%) becoming subsequent course facilitators, 88% of whom were from LMICs. Of 228 manuscripts submitted to scientific journals, 197(86%) were either published or in press; in 86%, the principal investigator (first author) was a LMIC national. Papers were published in 23 scientific journals (impact factor 0.5–4.4) and covered 21 disease categories (median publication time = 5.7 months). Published papers (186) had 94,794 cumulative article views/downloads. Article views/downloads for immediate open access articles were double those from closed access journals. Conclusion The SORT IT model has been effective in training personnel to produce relevant operational research in LMICs. It merits continued commitment and support for further scale-up and development. PMID:27505253

  4. Sorting ring polymers by knot type with modulated nanochannels.

    PubMed

    Marenda, Mattia; Orlandini, Enzo; Micheletti, Cristian

    2017-01-25

    In this theoretical study we discuss a novel method for sorting ring polymers according to their topological, knotted state. The proposed approach harnesses the rich dynamical behaviour of polymers confined inside spatially-modulated nanochannels. The longitudinal mobility of the rings is shown to have two key properties that are ideally suited for knot sorting. First, at fixed topology, the mobility has an intriguing oscillatory dependence on chain length. Second, the mobility ranking of different knot types is inverted upon increasing the chain length. We show that this complex interplay of channel geometry, chain length and topology can be rationalised within a simple theoretical framework based on Fick-Jacobs's diffusive theory. The results and the interpretative scheme ought to be useful for designing microfluidic devices with optimal topological sorting capabilities.

  5. Efficient searching and sorting applications using an associative array processor

    NASA Technical Reports Server (NTRS)

    Pace, W.; Quinn, M. J.

    1978-01-01

    The purpose of this paper is to describe a method of searching and sorting data by using some of the unique capabilities of an associative array processor. To understand the application, the associative array processor is described in detail. In particular, the content addressable memory and flip network are discussed because these two unique elements give the associative array processor the power to rapidly sort and search. A simple alphanumeric sorting example is explained in hardware and software terms. The hardware used to explain the application is the STARAN (Goodyear Aerospace Corporation) associative array processor. The software used is the APPLE (Array Processor Programming Language) programming language. Some applications of the array processor are discussed. This summary tries to differentiate between the techniques of the sequential machine and the associative array processor.

  6. Amplitude sorting of oscillatory burst signals by sampling

    DOEpatents

    Davis, Thomas J.

    1977-01-01

    A method and apparatus for amplitude sorting of oscillatory burst signals is described in which the burst signal is detected to produce a burst envelope signal and an intermediate or midportion of such envelope signal is sampled to provide a sample pulse output. The height of the sample pulse is proportional to the amplitude of the envelope signal and to the maximum burst signal amplitude. The sample pulses are fed to a pulse height analyzer for sorting. The present invention is used in an acoustic emission testing system to convert the amplitude of the acoustic emission burst signals into sample pulse heights which are measured by a pulse height analyzer for sorting the pulses in groups according to their height in order to identify the material anomalies in the test material which emit the acoustic signals.

  7. Lawrence Berkeley Laboratory magnetic-moment sorting system

    NASA Astrophysics Data System (ADS)

    Nelson, D. H.; Barale, P. J.; Green, M. I.; Vandyke, D. A.

    1985-07-01

    The Magnetic Measurements Engineering Group at Lawrence Berkeley Laboratory (LBL) has designed and built, and is currently using, a Magnetic-moment Measurement and Sorting System (MMSS). The MMSS measures magnetic moments of permanent-magnet material and sorts the material according to selected criteria. The MMSS represents the latest application of the LBL General Purpose Magnetic Measurement Data Acquisition System reported on a MT-8. We describe the theoretical basis for the MMSS, the analog and digital components, and a unique method of calibrating the MMSS using only measured electrical quantities. We also discuss the measurement and sorting of permanent-magnet material to be incorporated in beam-line elements (dipoles and quadrupoles) in the Lawrence Livermore National Laboratory Advanced Test Accelerator Beam Director.

  8. Optical sorting and cultivation of denitrifying anaerobic methane oxidation archaea

    PubMed Central

    Qi, Xiaoqiong; Carberry, David M.; Cai, Chen; Hu, Shihu; Yuan, Zhiguo; Dunlop, Halin Rubinsztein; Guo, Jianhua

    2017-01-01

    Denitrifying anaerobic methane oxidizing (DAMO) microorganisms play an important role in the global carbon and nitrogen cycles as they are able to mediate methane oxidation using nitrite/nitrate under anoxic conditions. However, the physiological properties of DAMO microorganisms remain poorly understood, partially since the organisms are difficult to isolate or cultivate in pure culture and partially because of their long cultivation time. In this study, DAMO cell sorting has been conducted by integrating optical tweezers within enclosed microfluidic chips. This integrated cell sorting method has high purity, low infection rates, and causes no discernable harm to cell viability. The purity of the sorted cells was controlled by the microfluidic chip structure design and operation, while the cell viability was verified by imaging the cultured DAMO archaea after 420 days. PMID:28270994

  9. Particle migration and sorting in microbubble streaming flows

    PubMed Central

    Thameem, Raqeeb; Hilgenfeldt, Sascha

    2016-01-01

    Ultrasonic driving of semicylindrical microbubbles generates strong streaming flows that are robust over a wide range of driving frequencies. We show that in microchannels, these streaming flow patterns can be combined with Poiseuille flows to achieve two distinctive, highly tunable methods for size-sensitive sorting and trapping of particles much smaller than the bubble itself. This method allows higher throughput than typical passive sorting techniques, since it does not require the inclusion of device features on the order of the particle size. We propose a simple mechanism, based on channel and flow geometry, which reliably describes and predicts the sorting behavior observed in experiment. It is also shown that an asymptotic theory that incorporates the device geometry and superimposed channel flow accurately models key flow features such as peak speeds and particle trajectories, provided it is appropriately modified to account for 3D effects caused by the axial confinement of the bubble. PMID:26958103

  10. REAL-WORLD SORTING OF RHIC SUPERCONDUCTING MAGNETS.

    SciTech Connect

    WEI,J.; GUPTA,R.; HARRISON,M.; JAIN,A.; PEGGS,S.; THOMPSON,P.; TRBOJEVIC,D.; WANDERER,P.

    1999-03-29

    During the seven-year construction of the Relativistic Heavy Ion Collider (RHIC), more than 1700 superconducting dipoles, quadrupoles, sextupoles, and multi-layer correctors have been constructed and installed. These magnets have been sorted at several production stages to optimize their performance and reliability. For arc magnets, priorities have been put first on quench performance and operational risk minimization, second on field transfer function and other first-order quantities, and finally on nonlinear field errors which were painstakingly optimized at design. For Interaction-Region (IR) magnets, sorting is applied to select the best possible combination of magnets for the low-{beta}* interaction points (IP). This paper summarizes the history of this real-world sorting process.

  11. "Clothed in triple blues": sorting out the Italian blues.

    PubMed

    Bimler, David; Uusküla, Mari

    2014-04-01

    Cross-cultural comparisons of color perception and cognition often feature versions of the "similarity sorting" procedure. By interpreting the assignment of two color samples to different groups as an indication that the dissimilarity between them exceeds some threshold, sorting data can be regarded as low-resolution similarity judgments. Here we analyze sorting data from speakers of Italian, Russian, and English, applying multidimensional scaling to delineate the boundaries between perceptual categories while highlighting differences between the three populations. Stimuli were 55 color swatches, predominantly from the blue region. Results suggest that at least two Italian words for "blue" are basic, a similar situation to Russian, in contrast to English where a single "blue" term is basic.

  12. Image-based fluidic sorting system for automated Zebrafish egg sorting into multiwell plates.

    PubMed

    Graf, Siegfried F; Hötzel, Sebastian; Liebel, Urban; Stemmer, Andreas; Knapp, Helmut F

    2011-04-01

    The global demand for the reduction of animal testing has led to the emergence of Zebrafish eggs/larvae as model organisms to replace current adult animal testing in, for example, toxicity testing. Because of the egg size (diameter 1.6mm) and the relatively easy maintenance of Zebrafish farms the eggs also offer high-throughput screening (HTS). However, the current bottleneck for HTS is the cost-efficient placing of individual organisms into single wells of a multiwell plate (MWP). The system presented here is capable of storing, sorting, and placing individual organisms in a highly reproducible manner. In about 11 min a complete 96-MWP is filled, which corresponds to about 8 sec per egg. The survival rate of fertilized transgenic and wild-type eggs was comparable to the one of the control (control 6.7%, system 7.6%). Furthermore, it was also possible to place dechorionated eggs into individual wells. The results demonstrate that the cost efficient system works gentle and reliable enough to disburden scientists from the exhausting and monotonous job of placing single eggs into single wells, such that they can concentrate on the scientific aspects of their experiments and create results with a higher statistical relevance.

  13. New coke-sorting system at OAO Koks

    SciTech Connect

    B.Kh. Bulaevskii; V.S. Shved; Yu.V. Kalimin; S.D. Filippov

    2009-05-15

    A new coke-sorting system has been introduced at OAO Koks. It differs from the existing system in that it has no bunkers for all-purpose coke but only bunkers for commercial coke. In using this system with coke from battery 4, the crushing of the coke on conveyer belts, at roller screens, and in the commercial-coke bunkers is studied. After installing braking elements in the coke path, their effectiveness in reducing coke disintegration and improving coke screening is investigated. The granulometric composition and strength of the commercial coke from coke battery 3, with the new coke-sorting system, is evaluated.

  14. New designs in the reconstruction of coke-sorting systems

    SciTech Connect

    A.S. Larin; V.V. Demenko; V.L. Voitanik

    2009-07-15

    In recent Giprokoks designs for the reconstruction of coke-sorting systems, high-productivity vibrational-inertial screens have been employed. This permits single-stage screening and reduction in capital and especially operating expenditures, without loss of coke quality. In two-stage screening, >80 mm coke (for foundry needs) is additionally separated, with significant improvement in quality of the metallurgical coke (25-80 mm). New designs for the reconstruction of coke-sorting systems employ mechanical treatment of the coke outside the furnace, which offers new scope for stabilization of coke quality and permits considerable improvement in mechanical strength and granulometric composition of the coke by mechanical crushing.

  15. Entropy Driven Excitation Energy Sorting in Superfluid Fission Dynamics

    SciTech Connect

    Schmidt, Karl-Heinz; Jurado, Beatriz

    2010-05-28

    It is shown that the constant-temperature behavior of nuclei in the superfluid regime leads to an energy-sorting process if two nuclei are in thermal contact, as is the case in the fission process. This effect explains why an increase of the initial excitation energy leads an increase of the number of emitted neutrons from the heavy fission fragment, only. The observed essentially complete energy sorting may be seen as a new counterintuitive manifestation of quantum-mechanical properties of microscopic systems.

  16. Characterization of color texture: color texture based sorting of tiles

    NASA Astrophysics Data System (ADS)

    Bourada, Y.; Lafon, Dominique; Eterradossi, O.

    1998-09-01

    Many materials used by the building industry show a color texture which affects the product commercial value. This texture can be seen as the spatial arrangement of regions of acceptable color differences. This work describes an appearance based automated sorting via color texture analysis, using ceramic tiles as example. Textural analysis of the tiles digital images expressed in CIEL*a*b* color system is performed through the analysis of intrinsic features of each region and relationships between regions. Results obtained through the automated process are compared to a visual sorting which leads to calculation of application dependant color and texture tolerances.

  17. Cell sorting is analogous to phase ordering in fluids

    PubMed Central

    Beysens, D. A.; Forgacs, G.; Glazier, J. A.

    2000-01-01

    Morphogenetic processes, like sorting or spreading of tissues, characterize early embryonic development. An analogy between viscoelastic fluids and certain properties of embryonic tissues helps interpret these phenomena. The values of tissue-specific surface tensions are consistent with the equilibrium configurations that the Differential Adhesion Hypothesis predicts such tissues reach after sorting and spreading. Here we extend the fluid analogy to cellular kinetics. The same formalism applies to recent experiments on the kinetics of phase ordering in two-phase fluids. Our results provide biologically relevant information on the strength of binding between cell adhesion molecules under near-physiological conditions. PMID:10944216

  18. 4D CT sorting based on patient internal anatomy

    NASA Astrophysics Data System (ADS)

    Li, Ruijiang; Lewis, John H.; Cerviño, Laura I.; Jiang, Steve B.

    2009-08-01

    Respiratory motion during free-breathing computed tomography (CT) scan may cause significant errors in target definition for tumors in the thorax and upper abdomen. A four-dimensional (4D) CT technique has been widely used for treatment simulation of thoracic and abdominal cancer radiotherapy. The current 4D CT techniques require retrospective sorting of the reconstructed CT slices oversampled at the same couch position. Most sorting methods depend on external surrogates of respiratory motion recorded by extra instruments. However, respiratory signals obtained from these external surrogates may not always accurately represent the internal target motion, especially when irregular breathing patterns occur. We have proposed a new sorting method based on multiple internal anatomical features for multi-slice CT scan acquired in the cine mode. Four features are analyzed in this study, including the air content, lung area, lung density and body area. We use a measure called spatial coherence to select the optimal internal feature at each couch position and to generate the respiratory signals for 4D CT sorting. The proposed method has been evaluated for ten cancer patients (eight with thoracic cancer and two with abdominal cancer). For nine patients, the respiratory signals generated from the combined internal features are well correlated to those from external surrogates recorded by the real-time position management (RPM) system (average correlation: 0.95 ± 0.02), which is better than any individual internal measures at 95% confidence level. For these nine patients, the 4D CT images sorted by the combined internal features are almost identical to those sorted by the RPM signal. For one patient with an irregular breathing pattern, the respiratory signals given by the combined internal features do not correlate well with those from RPM (correlation: 0.68 ± 0.42). In this case, the 4D CT image sorted by our method presents fewer artifacts than that from the RPM signal. Our

  19. NSF Workshop Report: Discovering General Principles of Nervous System Organization by Comparing Brain Maps across Species

    PubMed Central

    Striedter, Georg F.; Belgard, T. Grant; Chen, Chun-Chun; Davis, Fred P.; Finlay, Barbara L.; Güntürkün, Onur; Hale, Melina E.; Harris, Julie A.; Hecht, Erin E.; Hof, Patrick R.; Hofmann, Hans A.; Holland, Linda Z.; Iwaniuk, Andrew N.; Jarvis, Erich D.; Karten, Harvey J.; Katz, Paul S.; Kristan, William B.; Macagno, Eduardo R.; Mitra, Partha P.; Moroz, Leonid L.; Preuss, Todd M.; Ragsdale, Clifton W.; Sherwood, Chet C.; Stevens, Charles F.; Stüttgen, Maik C.; Tsumoto, Tadaharu; Wilczynski, Walter

    2014-01-01

    supported, at least in part, through existing mechanisms at NSF, NIH, and other agencies. It will also be important to develop new integrated software and database systems for cross-species data analyses. Multidisciplinary efforts to develop such analytical tools should be supported financially. Finally, training opportunities should be created to stimulate multidisciplinary, integrative research into brain structure, function, and evolution. PMID:24603302

  20. An Analysis of NSF Geosciences Research Experience for Undergraduate Site Programs from 2009 to 2012

    NASA Astrophysics Data System (ADS)

    Rom, E. L.; Patino, L. C.; Gonzales, J.; Weiler, C. S.; Antell, L.; Colon, Y.; Sanchez, S. C.

    2012-12-01

    The Research Experience for Undergraduate (REU) Program at the U.S. National Science Foundation (NSF) provides undergraduate students from across the nation the opportunity to conduct research at a different institution and in an area that may not be available at their home campus. REU Sites funded by the Directorate of Geosciences provide student research opportunities in earth, ocean, atmospheric and geospace research. This paper provides an overview of the Geosciences REU Site programs run from 2009 to 2012. Information was gathered from over 45 REU sites each year on recruitment methods, student demographics, enrichment activities, and fields of research. The internet is the most widely used mechanism to recruit participants. The admissions rate for REU Sites in Geosciences varies by discipline but averages between 6% to 18% each year, with the majority of participants being rising seniors and juniors. A few Sites include rising sophomores and freshmen. Most students attend PhD granting institutions. Among the participants, gender distribution depends on discipline, with atmospheric and geospace sciences having more male than female participants, but ocean and earth sciences having a majority of female participants. Regarding ethnic diversity, the REU Sites reflect the difficulty of attracting diverse students into Geosciences as a discipline; a large majority of the participants are Caucasian or Asian students. Furthermore, participants from minority-serving institutions or community colleges constitute a small percentage of those taking part in these research experiences. The enrichment activities are very similar across the REU Sites, and mimic well activities common to the scientific community, including intellectual exchange of ideas (lab meetings, seminars, and professional meetings), networking and social activities. Results from this study will be used to examine strengths in the REU Sites in the Geosciences and opportunities for improvement in the

  1. NSF GK-12 Fellows as Mentors for K-12 Teachers Participating in Field Research Experiences

    NASA Astrophysics Data System (ADS)

    Ellins, K.; Perry, E.

    2005-12-01

    by the GK-12 Fellows was important in helping teachers transfer components of a challenging field research experience to their students. Participating research scientists were able to convey the importance of their science to a wider audience. NSF GK-12 Fellows gained valuable experience in communicating scientific knowledge and field skills to K-12 teachers and students, became more knowledgeable about K-12 science education and were exposed to advances in pedagogy.

  2. NSF workshop report: discovering general principles of nervous system organization by comparing brain maps across species.

    PubMed

    Striedter, Georg F; Belgard, T Grant; Chen, Chun-Chun; Davis, Fred P; Finlay, Barbara L; Güntürkün, Onur; Hale, Melina E; Harris, Julie A; Hecht, Erin E; Hof, Patrick R; Hofmann, Hans A; Holland, Linda Z; Iwaniuk, Andrew N; Jarvis, Erich D; Karten, Harvey J; Katz, Paul S; Kristan, William B; Macagno, Eduardo R; Mitra, Partha P; Moroz, Leonid L; Preuss, Todd M; Ragsdale, Clifton W; Sherwood, Chet C; Stevens, Charles F; Stüttgen, Maik C; Tsumoto, Tadaharu; Wilczynski, Walter

    2014-01-01

    , at least in part, through existing mechanisms at NSF, NIH, and other agencies. It will also be important to develop new integrated software and database systems for cross-species data analyses. Multidisciplinary efforts to develop such analytical tools should be supported financially. Finally, training opportunities should be created to stimulate multidisciplinary, integrative research into brain structure, function, and evolution.

  3. NSF workshop report: discovering general principles of nervous system organization by comparing brain maps across species.

    PubMed

    Striedter, Georg F; Belgard, T Grant; Chen, Chun-Chun; Davis, Fred P; Finlay, Barbara L; Güntürkün, Onur; Hale, Melina E; Harris, Julie A; Hecht, Erin E; Hof, Patrick R; Hofmann, Hans A; Holland, Linda Z; Iwaniuk, Andrew N; Jarvis, Erich D; Karten, Harvey J; Katz, Paul S; Kristan, William B; Macagno, Eduardo R; Mitra, Partha P; Moroz, Leonid L; Preuss, Todd M; Ragsdale, Clifton W; Sherwood, Chet C; Stevens, Charles F; Stüttgen, Maik C; Tsumoto, Tadaharu; Wilczynski, Walter

    2014-05-01

    , at least in part, through existing mechanisms at NSF, NIH, and other agencies. It will also be important to develop new integrated software and database systems for cross-species data analyses. Multidisciplinary efforts to develop such analytical tools should be supported financially. Finally, training opportunities should be created to stimulate multidisciplinary, integrative research into brain structure, function, and evolution.

  4. Topographic control of sorted circle morphology on Svalbard

    NASA Astrophysics Data System (ADS)

    Voigt, Joana; Hauber, Ernst; Reiss, Dennis; Hiesinger, Harald; Johnsson, Andreas; van Gasselt, Stephan; Balme, Matt; Head, Jim; de Verra, Jean-Pierre; Steinbrügge, Gregor; Jaumann, Ralf

    2015-04-01

    Patterned ground is a typical phenomenon in polar, subpolar and alpine regions [1]. As it is commonly (but not necessarily!) related to freeze-thaw cycles, its presence on Mars could possibly point to locations and periods where and when liquid water existed in the recent past [2]. Sorted circles are a class of patterned ground that was tentatively identified in Elysium Planitia (Mars) [3], but this interpretation has been challenged on the basis of physical considerations [4]. Without direct access to potential patterned ground on Mars, the analysis of terrestrial analogues can inform the interpretation of Martian landforms. Svalbard (Norway) offers a wide variety of permafrost features that are morphologically analogous to Martian cold-climate landforms [5]. It hosts some of the best examples of sorted circles on Earth, which are located on the westernmost tip of Brøgger peninsula, on a broad strand flat that is characterized by a series of postglacial beach ridges [6]. Here we report on our analysis of sorted circle morphology (especially their plan-view shape, i.e. their "roundness" or ellipticity) and its correlation with local topography (slopes, curvature). Sorted circle morphology was determined from HRSC-AX images (for details on the flight campaign and image properties see ref [5]) and through field work. Topographic information comes from a 50 cm gridded DEM derived from HRSC-AX stereo images. We measured sorted circle morphology (ellipticity, azimuth of major axis) along a WNW-ESE traverse that runs from the inland towards the sea and is oriented perpendicular to the local beach ridge trend. Selected areas with homogeneous sorted circle appearance were visually mapped, and compared to the average slope, aspect, and the calculated topographic wetness index (TWI). Furthermore the whole traverse was classified into four different morphologies of the sorted patterned ground (sorted circles, sorted "ellipses", sorted nets and areas without patterned ground

  5. Development of a novel cell sorting method that samples population diversity in flow cytometry.

    PubMed

    Osborne, Geoffrey W; Andersen, Stacey B; Battye, Francis L

    2015-11-01

    Flow cytometry based electrostatic cell sorting is an important tool in the separation of cell populations. Existing instruments can sort single cells into multi-well collection plates, and keep track of cell of origin and sorted well location. However currently single sorted cell results reflect the population distribution and fail to capture the population diversity. Software was designed that implements a novel sorting approach, "Slice and Dice Sorting," that links a graphical representation of a multi-well plate to logic that ensures that single cells are sampled and sorted from all areas defined by the sort region/s. Therefore the diversity of the total population is captured, and the more frequently occurring or rarer cell types are all sampled. The sorting approach was tested computationally, and using functional cell based assays. Computationally we demonstrate that conventional single cell sorting can sample as little as 50% of the population diversity dependant on the population distribution, and that Slice and Dice sorting samples much more of the variety present within a cell population. We then show by sorting single cells into wells using the Slice and Dice sorting method that there are cells sorted using this method that would be either rarely sorted, or not sorted at all using conventional single cell sorting approaches. The present study demonstrates a novel single cell sorting method that samples much more of the population diversity than current methods. It has implications in clonal selection, stem cell sorting, single cell sequencing and any areas where population heterogeneity is of importance.

  6. The Arctic Cooperative Data and Information System: Data Management Support for the NSF Arctic Research Program (Invited)

    NASA Astrophysics Data System (ADS)

    Moore, J.; Serreze, M. C.; Middleton, D.; Ramamurthy, M. K.; Yarmey, L.

    2013-12-01

    The NSF funds the Advanced Cooperative Arctic Data and Information System (ACADIS), url: (http://www.aoncadis.org/). It serves the growing and increasingly diverse data management needs of NSF's arctic research community. The ACADIS investigator team combines experienced data managers, curators and software engineers from the NSIDC, UCAR and NCAR. ACADIS fosters scientific synthesis and discovery by providing a secure long-term data archive to NSF investigators. The system provides discovery and access to arctic related data from this and other archives. This paper updates the technical components of ACADIS, the implementation of best practices, the value of ACADIS to the community and the major challenges facing this archive for the future in handling the diverse data coming from NSF Arctic investigators. ACADIS provides sustainable data management, data stewardship services and leadership for the NSF Arctic research community through open data sharing, adherence to best practices and standards, capitalizing on appropriate evolving technologies, community support and engagement. ACADIS leverages other pertinent projects, capitalizing on appropriate emerging technologies and participating in emerging cyberinfrastructure initiatives. The key elements of ACADIS user services to the NSF Arctic community include: data and metadata upload; support for datasets with special requirements; metadata and documentation generation; interoperability and initiatives with other archives; and science support to investigators and the community. Providing a self-service data publishing platform requiring minimal curation oversight while maintaining rich metadata for discovery, access and preservation is challenging. Implementing metadata standards are a first step towards consistent content. The ACADIS Gateway and ADE offer users choices for data discovery and access with the clear objective of increasing discovery and use of all Arctic data especially for analysis activities

  7. Tunable Superomniphobic Surfaces for Sorting Droplets by Surface Tension

    NASA Astrophysics Data System (ADS)

    Movafaghi, Sanli; Wang, Wei; Metzger, Ari; Williams, Desiree; Williams, John; Kota, Arun

    2016-11-01

    Manipulation of liquid droplets on super-repellent surfaces (i.e., surfaces that are extremely repellent to liquids) has been widely studied because droplets exhibit high mobility on these surfaces due to the ultra-low adhesion, which leads to minimal sample loss and contamination. Although droplet manipulation has been demonstrated using electric fields, magnetic fields, guiding tracks and wettability gradients, to the best of our knowledge, there are no reports of droplet manipulation methods that can sort droplets by surface tension on super-repellent surfaces. In this work, we utilized tunable superomniphobic surfaces (i.e., surfaces that are extremely repellent to virtually all liquids) to develop a simple device with precisely tailored solid surface energy domains that, for the first time, can sort droplets by surface tension. Droplet sorting occurs on our device entirely due to a balance between the work done by gravity and the work expended due to adhesion, without the need for any external energy input. Our device can be fabricated easily in a short time and is particularly useful for in-the-field and on-the-go operations, where complex analysis equipment is unavailable. We envision that our methodology for droplet sorting will enable inexpensive and energy-efficient analytical devices for personalized point-of-care diagnostic platforms and lab-on-a-chip systems.

  8. G Protein–Coupled Receptor Sorting to Endosomes and Lysosomes

    PubMed Central

    Marchese, Adriano; Paing, May M.; Temple, Brenda R.S.; Trejo, JoAnn

    2010-01-01

    The heptahelical G protein–coupled receptors (GPCRs) belong to the largest family of cell surface signaling receptors encoded in the human genome. GPCRs signal to diverse extracellular stimuli and control a vast number of physiological responses, making this receptor class the target of nearly half the drugs currently in use. In addition to rapid desensitization, receptor trafficking is crucial for the temporal and spatial control of GPCR signaling. Sorting signals present in the intracytosolic domains of GPCRs regulate trafficking through the endosomal-lysosomal system. GPCR internalization is mediated by serine and threonine phosphorylation and arrestin binding. Short, linear peptide sequences including tyrosine- and dileucine-based motifs, and PDZ ligands that are recognized by distinct endocytic adaptor proteins also mediate internalization and endosomal sorting of GPCRs. We present new data from bioinformatic searches that reveal the presence of these types of sorting signals in the cytoplasmic tails of many known GPCRs. Several recent studies also indicate that the covalent modification of GPCRs with ubiquitin serves as a signal for internalization and lysosomal sorting, expanding the diversity of mechanisms that control trafficking of mammalian GPCRs. PMID:17995450

  9. 30. William E. Barrett, Photographer, August 1975. SAWMILL SORTING DOCK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    30. William E. Barrett, Photographer, August 1975. SAWMILL SORTING DOCK SHOWING THREE TRACKS OF MOVING CHAIN CONVEYOR. LUMBER WAS UNLOADED ON BOTH SIDES AND PLACED ON CARTS WHOSE RAILS MAY BE SEEN AT LEFT. - Meadow River Lumber Company, Highway 60, Rainelle, Greenbrier County, WV

  10. 31. William E. Barrett, Photographer, August 1975. SORTING DOCK LOOKING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. William E. Barrett, Photographer, August 1975. SORTING DOCK LOOKING EAST TOWARD LUMBERYARD. NOTE RAILS FOR LUMBER CARTS. CARTS WERE UNLOADED AT EDGE OF DOCK AND LUMBER WAS PLACED ON FLATCARS TO BE TAKEN TO YARD. - Meadow River Lumber Company, Highway 60, Rainelle, Greenbrier County, WV

  11. Empirical Approach to Interpreting Card-Sorting Data

    ERIC Educational Resources Information Center

    Wolf, Steven F.; Dougherty, Daniel P.; Kortemeyer, Gerd

    2012-01-01

    Since it was first published 30 years ago, the seminal paper of Chi "et al." on expert and novice categorization of introductory problems led to a plethora of follow-up studies within and outside of the area of physics [Cogn. Sci. 5 121 (1981)]. These studies frequently encompass "card-sorting" exercises whereby the…

  12. Personal Wellness Card Sort: A Strategy for Promoting Relational Healing

    ERIC Educational Resources Information Center

    Lenz, A. Stephen; Roscoe, Lauren J.

    2011-01-01

    The Personal Wellness Card Sort task is presented as a practical tool for mediating a therapeutic impasse when working with clients who have experienced a traumatic event. The authors describe how this activity can assist clients with viewing themselves in a holistic way, regaining disowned aspects of self and initiating movement toward connecting…

  13. Getting a "Decent Sort": Key Considerations when Planning for AMH

    ERIC Educational Resources Information Center

    Canty, Adrienne Brown

    2010-01-01

    In 2008 and 2009, the Edmonton Public Library (EPL), where the author works as an information professional, completed a $6 million CDN (about $5.7 million) RFID conversion project with the installation of automated check-in and sorting equipment at six of its 17 service points. The sorters currently handle about 55% of EPL's system's total…

  14. Autism and Attachment: The Attachment Q-Sort

    ERIC Educational Resources Information Center

    Rutgers, Anna H.; Van Ijzendoorn, Marinus H.; Bakermans-Kranenburg, Marian J.; Swinkels, Sophie H. N.

    2007-01-01

    Children with autism are able to show secure attachment behaviours to their parents/caregivers. Most studies on attachment in children with autism used a (modified) Strange Situation Procedure (SSP) to examine attachment security. An advantage of the Attachment Q-Sort (AQS) over the SSP is that it can be attuned to the secure-base behaviour of…

  15. On Possibility of Sorting of Electromagnetic Undulators HU256

    SciTech Connect

    Churkin, I.; Steshov, A.

    2007-01-19

    It is known that the magnetic parameters of the permanent and hybrid magnet undulators may be improved by sorting on basis of the magnetic measurements of individual magnetic blocks and applying of the optimization criteria. The procedure of sorting for the electromagnetic undulators HU256 is described in the article. The magnetic calculations of the individual dipoles and dipoles in ''undulator environment'' executed by means of Mermaid 3D Code and the magnetic measurements of the representative dipoles confirmed these magnetic calculations, and it allows us to get the main dependencies of the magnetic parameters of all dipoles from the mechanical characteristics (pole gap, yoke width, coil position). The criteria of optimization were conditions of weak influence of the insertion device on electron beam in the Storage Ring and high quality of undulator radiation. The 1st integral of the magnetic field and phase error have been minimized for sorting of the dipoles in undulators. The limitation of sorting connected with accuracy of mechanical measurements of individual dipoles is discussed.

  16. A Kinetic Self‐Sorting Approach to Heterocircuit [3]Rotaxanes

    PubMed Central

    Neal, Edward A.

    2016-01-01

    Abstract In this proof‐of‐concept study, an active‐template coupling is used to demonstrate a novel kinetic self‐sorting process. This process iteratively increases the yield of the target heterocircuit [3]rotaxane product at the expense of other threaded species. PMID:27600208

  17. Sort-First, Distributed Memory Parallel Visualization and Rendering

    SciTech Connect

    Bethel, E. Wes; Humphreys, Greg; Paul, Brian; Brederson, J. Dean

    2003-07-15

    While commodity computing and graphics hardware has increased in capacity and dropped in cost, it is still quite difficult to make effective use of such systems for general-purpose parallel visualization and graphics. We describe the results of a recent project that provides a software infrastructure suitable for general-purpose use by parallel visualization and graphics applications. Our work combines and extends two technologies: Chromium, a stream-oriented framework that implements the OpenGL programming interface; and OpenRM Scene Graph, a pipelined-parallel scene graph interface for graphics data management. Using this combination, we implement a sort-first, distributed memory, parallel volume rendering application. We describe the performance characteristics in terms of bandwidth requirements and highlight key algorithmic considerations needed to implement the sort-first system. We characterize system performance using a distributed memory parallel volume rendering application, a nd present performance gains realized by using scene specific knowledge to accelerate rendering through reduced network bandwidth. The contribution of this work is an exploration of general-purpose, sort-first architecture performance characteristics as applied to distributed memory, commodity hardware, along with a description of the algorithmic support needed to realize parallel, sort-first implementations.

  18. Development of the Arab Heritage Activity Card Sort

    ERIC Educational Resources Information Center

    Hamed, Razan; AlHeresh, Rawan; Dahab, Sana Abu; Collins, Brittany; Fryer, Jasmine; Holm, Margo B.

    2011-01-01

    Participation is an indicator of healthy functioning and well-being, as emphasized by the International Classification of Functioning, Disability, and Health (World Health Organization, 2001). The Activity Card Sort (ACS) is a valid and reliable assessment tool that measures participation. This study describes the process of developing the Arab…

  19. Sorting Recycled Trash: An Activity for Earth Day 2007

    ERIC Educational Resources Information Center

    Harris, Mary E.; Harris, Harold H.

    2007-01-01

    Middle or high school students celebrate Earth Day on April 22, 2007 by participating in the activity to separate commingled recyclable trash to simulate sorting in a recycling center. Students would gain an appreciation for recyclable trash, after it is taken to a recycling center and learn about properties of recyclables.

  20. Real-time implementation of a color sorting system

    NASA Astrophysics Data System (ADS)

    Srikanteswara, Srikathyanyani; Lu, Qiang O.; King, William; Drayer, Thomas H.; Conners, Richard W.; Kline, D. Earl; Araman, Philip A.

    1997-09-01

    Wood edge glued panels are used extensively in the furniture and cabinetry industries. They are used to make doors, tops, and sides of solid wood furniture and cabinets. Since lightly stained furniture and cabinets are gaining in popularity, there is an increasing demand to color sort the parts used to make these edge glued panels. The goal of the sorting processing is to create panels that are uniform in both color and intensity across their visible surface. If performed manually, the color sorting of edge-glued panel parts is very labor intensive and prone to error. This paper describes a complete machine vision system for performing this sort. This system uses two color line scan cameras for image input and a specially designed custom computing machine to allow real-time implementation. Users define the number of color classes that are to be used. An 'out' class is provided to handle unusually colored parts. The system removes areas of character mark, e.g., knots, mineral streak, etc., from consideration when assigning a color class to a part. The system also includes a better face algorithm for determining which part face would be the better to put on the side of the panel that will show. The throughput is two linear feet per second. Only a four inch between part spacing is required. This system has undergone extensive in plant testing and will be commercially available in the very near future. The results of this testing will be presented.

  1. Spike sorting of synchronous spikes from local neuron ensembles

    PubMed Central

    Pröpper, Robert; Alle, Henrik; Meier, Philipp; Geiger, Jörg R. P.; Obermayer, Klaus; Munk, Matthias H. J.

    2015-01-01

    Synchronous spike discharge of cortical neurons is thought to be a fingerprint of neuronal cooperativity. Because neighboring neurons are more densely connected to one another than neurons that are located further apart, near-synchronous spike discharge can be expected to be prevalent and it might provide an important basis for cortical computations. Using microelectrodes to record local groups of neurons does not allow for the reliable separation of synchronous spikes from different cells, because available spike sorting algorithms cannot correctly resolve the temporally overlapping waveforms. We show that high spike sorting performance of in vivo recordings, including overlapping spikes, can be achieved with a recently developed filter-based template matching procedure. Using tetrodes with a three-dimensional structure, we demonstrate with simulated data and ground truth in vitro data, obtained by dual intracellular recording of two neurons located next to a tetrode, that the spike sorting of synchronous spikes can be as successful as the spike sorting of nonoverlapping spikes and that the spatial information provided by multielectrodes greatly reduces the error rates. We apply the method to tetrode recordings from the prefrontal cortex of behaving primates, and we show that overlapping spikes can be identified and assigned to individual neurons to study synchronous activity in local groups of neurons. PMID:26289473

  2. Experimental investigation of gravity effects on sediment sorting on Mars

    NASA Astrophysics Data System (ADS)

    Kuhn, Nikolaus J.; Kuhn, Brigitte; Gartmann, Andres

    2014-05-01

    Sorting of sedimentary rocks is a proxy for the environmental conditions at the time of deposition, in particular the runoff that moved and deposited the material forming the rocks. Settling of sediment is strongly influenced by the gravity of a planetary body. As a consequence, sorting of a sedimentary rock varies with gravity for a given depth and velocity of surface runoff. Theoretical considerations for spheres indicate that sorting is more uniform on Mars than on Earth for runoff of identical depth. In reality, such considerations have to be applied with great caution because the shape of a particle strongly influences drag. Drag itself can only be calculated directly for an irregularly shaped particle with great computational effort, if at all. Therefore, even for terrestrial applications, sediment settling velocities are often determined directly, e.g. by measurements using settling tubes. In this study the results of settling tube tests conducted under reduced gravity during three experimental flights conducted in November 2012 and 2013 are presented. Nine types of sediment, ranging in size, shape and density were tested in custom-designed settling tubes during parabolas of Martian gravity lasting 20 to 25 seconds. Based on the observed settling velocities, the applicability of empirical relationships developed on Earth to assess particle settling on Mars are discussed. In addition, the potential effects of reduced gravity on the sorting of sedimentary rocks and their use as a proxy for runoff and thus environmental conditions on Mars are examined.

  3. Prediction of N-terminal protein sorting signals.

    PubMed

    Claros, M G; Brunak, S; von Heijne, G

    1997-06-01

    Recently, neural networks have been applied to a widening range of problems in molecular biology. An area particularly suited to neural-network methods is the identification of protein sorting signals and the prediction of their cleavage sites, as these functional units are encoded by local, linear sequences of amino acids rather than global 3D structures.

  4. Parallel sort with a ranged, partitioned key-value store in a high perfomance computing environment

    DOEpatents

    Bent, John M.; Faibish, Sorin; Grider, Gary; Torres, Aaron; Poole, Stephen W.

    2016-01-26

    Improved sorting techniques are provided that perform a parallel sort using a ranged, partitioned key-value store in a high performance computing (HPC) environment. A plurality of input data files comprising unsorted key-value data in a partitioned key-value store are sorted. The partitioned key-value store comprises a range server for each of a plurality of ranges. Each input data file has an associated reader thread. Each reader thread reads the unsorted key-value data in the corresponding input data file and performs a local sort of the unsorted key-value data to generate sorted key-value data. A plurality of sorted, ranged subsets of each of the sorted key-value data are generated based on the plurality of ranges. Each sorted, ranged subset corresponds to a given one of the ranges and is provided to one of the range servers corresponding to the range of the sorted, ranged subset. Each range server sorts the received sorted, ranged subsets and provides a sorted range. A plurality of the sorted ranges are concatenated to obtain a globally sorted result.

  5. Check-All-That-Apply (CATA), Sorting, and Polarized Sensory Positioning (PSP) with Astringent Stimuli

    PubMed Central

    Fleming, Erin E.; Ziegler, Gregory R.; Hayes, John E.

    2015-01-01

    Multiple rapid sensory profiling techniques have been developed as more efficient alternatives to traditional sensory descriptive analysis. Here, we compare the results of three rapid sensory profiling techniques – check-all-that-apply (CATA), sorting, and polarized sensory positioning (PSP) – using a diverse range of astringent stimuli. These rapid methods differ in their theoretical basis, implementation, and data analyses, and the relative advantages and limitations are largely unexplored. Additionally, we were interested in using these methods to compare varied astringent stimuli, as these compounds are difficult to characterize using traditional descriptive analysis due to high fatigue and potential carry-over. In the CATA experiment, subjects (n=41) were asked to rate the overall intensity of each stimulus as well as to endorse any relevant terms (from a list of 13) which characterized the sample. In the sorting experiment, subjects (n=30) assigned intensity-matched stimuli into groups 1-on-1 with the experimenter. In the PSP experiment, (n=41) subjects first sampled and took notes on three blind references (‘poles’) before rating each stimulus for its similarity to each of the 3 poles. Two-dimensional perceptual maps from correspondence analysis (CATA), multidimensional scaling (sorting), and multiple factor analysis (PSP) were remarkably similar, with normalized RV coefficients indicating significantly similar plots, regardless of method. Agglomerative hierarchical clustering of all data sets using Ward’s minimum variance as the linkage criteria showed the clusters of astringent stimuli were approximately based on the respective class of astringent agent. Based on the descriptive CATA data, it appears these differences may be due to the presence of side tastes such as bitterness and sourness, rather than astringent sub-qualities per se. Although all three methods are considered ‘rapid,’ our prior experience with sorting suggests it is best

  6. Check-All-That-Apply (CATA), Sorting, and Polarized Sensory Positioning (PSP) with Astringent Stimuli.

    PubMed

    Fleming, Erin E; Ziegler, Gregory R; Hayes, John E

    2015-10-01

    Multiple rapid sensory profiling techniques have been developed as more efficient alternatives to traditional sensory descriptive analysis. Here, we compare the results of three rapid sensory profiling techniques - check-all-that-apply (CATA), sorting, and polarized sensory positioning (PSP) - using a diverse range of astringent stimuli. These rapid methods differ in their theoretical basis, implementation, and data analyses, and the relative advantages and limitations are largely unexplored. Additionally, we were interested in using these methods to compare varied astringent stimuli, as these compounds are difficult to characterize using traditional descriptive analysis due to high fatigue and potential carry-over. In the CATA experiment, subjects (n=41) were asked to rate the overall intensity of each stimulus as well as to endorse any relevant terms (from a list of 13) which characterized the sample. In the sorting experiment, subjects (n=30) assigned intensity-matched stimuli into groups 1-on-1 with the experimenter. In the PSP experiment, (n=41) subjects first sampled and took notes on three blind references ('poles') before rating each stimulus for its similarity to each of the 3 poles. Two-dimensional perceptual maps from correspondence analysis (CATA), multidimensional scaling (sorting), and multiple factor analysis (PSP) were remarkably similar, with normalized RV coefficients indicating significantly similar plots, regardless of method. Agglomerative hierarchical clustering of all data sets using Ward's minimum variance as the linkage criteria showed the clusters of astringent stimuli were approximately based on the respective class of astringent agent. Based on the descriptive CATA data, it appears these differences may be due to the presence of side tastes such as bitterness and sourness, rather than astringent sub-qualities per se. Although all three methods are considered 'rapid,' our prior experience with sorting suggests it is best performed 1

  7. Genetic mapping of paternal sorting of mitochondria in cucumber.

    PubMed

    Calderon, Claudia I; Yandell, Brian S; Havey, Michael J

    2012-06-01

    Mitochondria are organelles that have their own DNA; serve as the powerhouses of eukaryotic cells; play important roles in stress responses, programmed cell death, and ageing; and in the vast majority of eukaryotes, are maternally transmitted. Strict maternal transmission of mitochondria makes it difficult to select for better-performing mitochondria, or against deleterious mutations in the mitochondrial DNA. Cucumber is a useful plant for organellar genetics because its mitochondria are paternally transmitted and it possesses one of the largest mitochondrial genomes among all eukaryotes. Recombination among repetitive motifs in the cucumber mitochondrial DNA produces rearrangements associated with strongly mosaic (MSC) phenotypes. We previously reported nuclear control of sorting among paternally transmitted mitochondrial DNAs. The goal of this project was to map paternal sorting of mitochondria as a step towards its eventual cloning. We crossed single plants from plant introduction (PI) 401734 and Cucumis sativus var. hardwickii and produced an F(2) family. A total of 425 F(2) plants were genotyped for molecular markers and testcrossed as the female with MSC16. Testcross families were scored for frequencies of wild-type versus MSC progenies. Discrete segregations for percent wild-type progenies were not observed and paternal sorting of mitochondria was therefore analyzed as a quantitative trait. A major quantitative trait locus (QTL; LOD >23) was mapped between two simple sequence repeats encompassing a 459-kb region on chromosome 3. Nuclear genes previously shown to affect the prevalence of mitochondrial DNAs (MSH1, OSB1, and RECA homologs) were not located near this major QTL on chromosome 3. Sequencing of this region from PI 401734, together with improved annotation of the cucumber genome, should result in the eventual cloning of paternal sorting of mitochondria and provide insights about nuclear control of organellar-DNA sorting.

  8. Management and Stewardship of Airborne Observational Data for the NSF/NCAR HIAPER (GV) and NSF/NCAR C-130 at the National Center for Atmospheric Research (NCAR) Earth Observing Laboratory (EOL)

    NASA Astrophysics Data System (ADS)

    Aquino, J.

    2014-12-01

    The National Science Foundation (NSF) provides the National Center for Atmospheric Research (NCAR) Earth Observing Laboratory (EOL) funding for the operation, maintenance and upgrade of two research aircraft: the NSF/NCAR High-performance Instrumented Airborne Platform for Environmental Research (HIAPER) Gulfstream V and the NSF/NCAR Hercules C-130. A suite of in-situ and remote sensing airborne instruments housed at the EOL Research Aviation Facility (RAF) provide a basic set of measurements that are typically deployed on most airborne field campaigns. In addition, instruments to address more specific research requirements are provided by collaborating participants from universities, industry, NASA, NOAA or other agencies. The data collected are an important legacy of these field campaigns. A comprehensive metadata database and integrated cyber-infrastructure, along with a robust data workflow that begins during the field phase and extends to long-term archival (current aircraft data holdings go back to 1967), assures that: all data and associated software are safeguarded throughout the data handling process; community standards of practice for data stewardship and software version control are followed; simple and timely community access to collected data and associated software tools are provided; and the quality of the collected data is preserved, with the ultimate goal of supporting research and the reproducibility of published results. The components of this data system to be presented include: robust, searchable web access to data holdings; reliable, redundant data storage; web-based tools and scripts for efficient creation, maintenance and update of data holdings; access to supplemental data and documentation; storage of data in standardized data formats; comprehensive metadata collection; mature version control; human-discernable storage practices; and procedures to inform users of changes. In addition, lessons learned, shortcomings, and desired upgrades

  9. A sorting nexin 17-binding domain within the LRP1 cytoplasmic tail mediates receptor recycling through the basolateral sorting endosome.

    PubMed

    Farfán, Pamela; Lee, Jiyeon; Larios, Jorge; Sotelo, Pablo; Bu, Guojun; Marzolo, María-Paz

    2013-07-01

    Sorting nexin 17 (SNX17) is an adaptor protein present in early endosomal antigen 1 (EEA1)-positive sorting endosomes that promotes the efficient recycling of low-density lipoprotein receptor-related protein 1 (LRP1) to the plasma membrane through recognition of the first NPxY motif in the cytoplasmic tail of this receptor. The interaction of LRP1 with SNX17 also regulates the basolateral recycling of the receptor from the basolateral sorting endosome (BSE). In contrast, megalin, which is apically distributed in polarized epithelial cells and localizes poorly to EEA1-positive sorting endosomes, does not interact with SNX17, despite containing three NPxY motifs, indicating that this motif is not sufficient for receptor recognition by SNX17. Here, we identified a cluster of 32 amino acids within the cytoplasmic domain of LRP1 that is both necessary and sufficient for SNX17 binding. To delineate the function of this SNX17-binding domain, we generated chimeric proteins in which the SNX17-binding domain was inserted into the cytoplasmic tail of megalin. This insertion mediated the binding of megalin to SNX17 and modified the cell surface expression and recycling of megalin in non-polarized cells. However, the polarized localization of chimeric megalin was not modified in polarized Madin-Darby canine kidney cells. These results provide evidence regarding the molecular and cellular mechanisms underlying the specificity of SNX17-binding receptors and the restricted function of SNX17 in the BSE.

  10. A sorting nexin 17-binding domain within the LRP1 cytoplasmic tail mediates receptor recycling through the basolateral sorting endosome

    PubMed Central

    Farfán, Pamela; Lee, Jiyeon; Larios, Jorge; Sotelo, Pablo; Bu, Guojun; Marzolo, María-Paz

    2013-01-01

    Sorting nexin 17 (SNX17) is an adaptor protein present in EEA1-positive sorting endosomes that promotes the efficient recycling of low-density lipoprotein receptor-related protein 1 (LRP1) to the plasma membrane through recognition of the first NPxY motif in the cytoplasmic tail of this receptor. The interaction of LRP1 with SNX17 also regulates the basolateral recycling of the receptor from the basolateral sorting endosome (BSE). In contrast, megalin, which is apically distributed in polarized epithelial cells and localizes poorly to EEA1-positive sorting endosomes, does not interact with SNX17, despite containing three NPxY motifs, indicating that this motif is not sufficient for receptor recognition by SNX17. Here, we identified a cluster of 32 amino acids within the cytoplasmic domain of LRP1 that is both necessary and sufficient for SNX17 binding. To delineate the function of this SNX17-binding domain, we generated chimeric proteins in which the SNX17-binding domain was inserted into the cytoplasmic tail of megalin. This insertion mediated the binding of megalin to SNX17 and modified the cell surface expression and recycling of megalin in non-polarized cells. However, the polarized localization of chimeric megalin was not modified in polarized MDCK cells. These results provide evidence regarding the molecular and cellular mechanisms underlying the specificity of SNX17-binding receptors and the restricted function of SNX17 in the BSE. PMID:23593972

  11. Microfluidic sorting of protein nanocrystals by size for X-ray free-electron laser diffraction

    SciTech Connect

    Abdallah, Bahige G.; Zatsepin, Nadia A.; Roy-Chowdhury, Shatabdi; Coe, Jesse; Conrad, Chelsie E.; Dörner, Katerina; Sierra, Raymond G.; Stevenson, Hilary P.; Camacho-Alanis, Fernanda; Grant, Thomas D.; Nelson, Garrett; James, Daniel; Calero, Guillermo; Wachter, Rebekka M.; Spence, John C. H.; Weierstall, Uwe; Fromme, Petra; Ros, Alexandra

    2015-08-19

    We report that the advent and application of the X-ray free-electron laser (XFEL) has uncovered the structures of proteins that could not previously be solved using traditional crystallography. While this new technology is powerful, optimization of the process is still needed to improve data quality and analysis efficiency. One area is sample heterogeneity, where variations in crystal size (among other factors) lead to the requirement of large data sets (and thus 10–100 mg of protein) for determining accurate structure factors. To decrease sample dispersity, we developed a high-throughput microfluidic sorter operating on the principle of dielectrophoresis, whereby polydisperse particles can be transported into various fluid streams for size fractionation. Using this microsorter, we isolated several milliliters of photosystem I nanocrystal fractions ranging from 200 to 600 nm in size as characterized by dynamic light scattering, nanoparticle tracking, and electron microscopy. Sorted nanocrystals were delivered in a liquid jet via the gas dynamic virtual nozzle into the path of the XFEL at the Linac Coherent Light Source. We obtained diffraction to ~4 Å resolution, indicating that the small crystals were not damaged by the sorting process. We also observed the shape transforms of photosystem I nanocrystals, demonstrating that our device can optimize data collection for the shape transform-based phasing method. Using simulations, we show that narrow crystal size distributions can significantly improve merged data quality in serial crystallography. From this proof-of-concept work, we expect that the automated size-sorting of protein crystals will become an important step for sample production by reducing the amount of protein needed for a high quality final structure and the development of novel phasing methods that exploit inter-Bragg reflection intensities or use variations in beam intensity for radiation damage-induced phasing. Ultimately, this method will also

  12. Analysis of articulation between clathrin and retromer in retrograde sorting on early endosomes.

    PubMed

    Popoff, Vincent; Mardones, Gonzalo A; Bai, Siau-Kun; Chambon, Valérie; Tenza, Danièle; Burgos, Patricia V; Shi, Anbing; Benaroch, Philippe; Urbé, Sylvie; Lamaze, Christophe; Grant, Barth D; Raposo, Graça; Johannes, Ludger

    2009-12-01

    Clathrin and retromer have key functions for retrograde trafficking between early endosomes and the trans-Golgi network (TGN). Previous studies on Shiga toxin suggested that these two coat complexes operate in a sequential manner. Here, we show that the curvature recognition subunit component sorting nexin 1 (SNX1) of retromer interacts with receptor-mediated endocytosis-8 (RME-8) protein, and that RME-8 and SNX1 colocalize on early endosomes together with a model cargo of the retrograde route, the receptor-binding B-subunit of Shiga toxin (STxB). RME-8 has previously been found to bind to the clathrin uncoating adenosine triphosphatase (ATPase) Hsc70, and we now report that depletion of RME-8 or Hsc70 affects retrograde trafficking at the early endosomes-TGN interface of STxB and the cation-independent mannose 6-phosphate receptor, an endogenous retrograde cargo protein. We also provide evidence that retromer interacts with the clathrin-binding protein hepatocyte growth factor-regulated tyrosine kinase substrate (Hrs) not only via SNX1, as previously published (Chin Raynor MC, Wei X, Chen HQ, Li L. Hrs interacts with sorting nexin 1 and regulates degradation of epidermal growth factor receptor. J Biol Chem 2001;276:7069-7078), but also via the core complex component Vps35. Hrs codistributes at the ultrastructural level with STxB on early endosomes, and interfering with Hrs function using antibodies or mild overexpression inhibits retrograde transport. Our combined data suggest a model according to which the functions in retrograde sorting on early endosomes of SNX1/retromer and clathrin are articulated by RME-8, and possibly also by Hrs.

  13. Microfluidic sorting of protein nanocrystals by size for X-ray free-electron laser diffraction

    DOE PAGES

    Abdallah, Bahige G.; Zatsepin, Nadia A.; Roy-Chowdhury, Shatabdi; ...

    2015-08-19

    We report that the advent and application of the X-ray free-electron laser (XFEL) has uncovered the structures of proteins that could not previously be solved using traditional crystallography. While this new technology is powerful, optimization of the process is still needed to improve data quality and analysis efficiency. One area is sample heterogeneity, where variations in crystal size (among other factors) lead to the requirement of large data sets (and thus 10–100 mg of protein) for determining accurate structure factors. To decrease sample dispersity, we developed a high-throughput microfluidic sorter operating on the principle of dielectrophoresis, whereby polydisperse particles canmore » be transported into various fluid streams for size fractionation. Using this microsorter, we isolated several milliliters of photosystem I nanocrystal fractions ranging from 200 to 600 nm in size as characterized by dynamic light scattering, nanoparticle tracking, and electron microscopy. Sorted nanocrystals were delivered in a liquid jet via the gas dynamic virtual nozzle into the path of the XFEL at the Linac Coherent Light Source. We obtained diffraction to ~4 Å resolution, indicating that the small crystals were not damaged by the sorting process. We also observed the shape transforms of photosystem I nanocrystals, demonstrating that our device can optimize data collection for the shape transform-based phasing method. Using simulations, we show that narrow crystal size distributions can significantly improve merged data quality in serial crystallography. From this proof-of-concept work, we expect that the automated size-sorting of protein crystals will become an important step for sample production by reducing the amount of protein needed for a high quality final structure and the development of novel phasing methods that exploit inter-Bragg reflection intensities or use variations in beam intensity for radiation damage-induced phasing. Ultimately, this method

  14. Microfluidic sorting of protein nanocrystals by size for X-ray free-electron laser diffraction

    PubMed Central

    Abdallah, Bahige G.; Zatsepin, Nadia A.; Roy-Chowdhury, Shatabdi; Coe, Jesse; Conrad, Chelsie E.; Dörner, Katerina; Sierra, Raymond G.; Stevenson, Hilary P.; Camacho-Alanis, Fernanda; Grant, Thomas D.; Nelson, Garrett; James, Daniel; Calero, Guillermo; Wachter, Rebekka M.; Spence, John C. H.; Weierstall, Uwe; Fromme, Petra; Ros, Alexandra

    2015-01-01

    The advent and application of the X-ray free-electron laser (XFEL) has uncovered the structures of proteins that could not previously be solved using traditional crystallography. While this new technology is powerful, optimization of the process is still needed to improve data quality and analysis efficiency. One area is sample heterogeneity, where variations in crystal size (among other factors) lead to the requirement of large data sets (and thus 10–100 mg of protein) for determining accurate structure factors. To decrease sample dispersity, we developed a high-throughput microfluidic sorter operating on the principle of dielectrophoresis, whereby polydisperse particles can be transported into various fluid streams for size fractionation. Using this microsorter, we isolated several milliliters of photosystem I nanocrystal fractions ranging from 200 to 600 nm in size as characterized by dynamic light scattering, nanoparticle tracking, and electron microscopy. Sorted nanocrystals were delivered in a liquid jet via the gas dynamic virtual nozzle into the path of the XFEL at the Linac Coherent Light Source. We obtained diffraction to ∼4 Å resolution, indicating that the small crystals were not damaged by the sorting process. We also observed the shape transforms of photosystem I nanocrystals, demonstrating that our device can optimize data collection for the shape transform-based phasing method. Using simulations, we show that narrow crystal size distributions can significantly improve merged data quality in serial crystallography. From this proof-of-concept work, we expect that the automated size-sorting of protein crystals will become an important step for sample production by reducing the amount of protein needed for a high quality final structure and the development of novel phasing methods that exploit inter-Bragg reflection intensities or use variations in beam intensity for radiation damage-induced phasing. This method will also permit an analysis

  15. Sperm sorting procedure induces a redistribution of Hsp70 but not Hsp60 and Hsp90 in boar spermatozoa.

    PubMed

    Spinaci, Marcella; Volpe, Sara; Bernardini, Chiara; de Ambrogi, Marco; Tamanini, Carlo; Seren, Eraldo; Galeati, Giovanna

    2006-01-01

    Heat shock proteins, besides their protective function against stresses, have been recently indicated as key factors for sperm fertilizing ability. Since sexing sperm by high-speed flow-cytometry subjects them to different physical, mechanical, and chemical stresses, the present study was designed to verify, by immunofluorescence and Western blot, whether the sorting procedure induces any modification in the amount and cellular distribution of heat shock proteins 60, 70, and 90 (Hsp60, Hsp70, Hsp90). Immunolocalization and Western blot quantification of both Hsp60 and Hsp90 did not reveal differences between unsorted and sorted semen. On the contrary, a redistribution of Hsp70 immunoreactivity from the equatorial subsegment toward the equator of sperm cells was recorded after sorting; this relocation suggests capacitation-like changes of sperm membrane. This modification seems to be caused mainly by incubation with Hoechst 33342, while both passage of sperm through flow cytometer and laser beam represent only minor stimuli. A further Hsp70 redistribution seems to be due to the final steps of sperm sorting, charging, and deflection of drops, and to the dilution during collection. On the other hand, staining procedure and mechanical stress seem to be the factors most injurious to sperm viability. Moreover, Hsp70 relocation was deeply influenced by the storage method. In fact, storing sexed spermatozoa, after centrifugation, in a small volume in presence of seminal plasma induced a reversion of Hsp70 redistribution, while storage in the diluted catch fluid of collection tubes caused Hsp70 relocation in most sorted spermatozoa.

  16. Removing seminal plasma improves bovine sperm sex-sorting.

    PubMed

    Steinhauser, C B; Graham, J K; Lenz, R W; Seidel, G E

    2016-11-01

    Bull ejaculates with sperm concentrations of less than 1 billion sperm sort poorly for sex chromosomes, but whether this is because of the sperm concentration or the concomitant seminal plasma content has not been elucidated. Experiments were conducted to determine why ejaculates with lower sperm concentrations sort poorly and develop a protocol to increase sorting efficiency. In Experiment I, spermatozoa at 160 or 240 × 10(6) sperm/mL were stained at 49, 65 or 81 μm Hoechst 33342 with 0 or 10% seminal plasma and then sex-sorted. In Experiment II, seminal plasma was adjusted to create samples with sperm concentrations of 0.7, 1.4 and 2.1 × 10(9) sperm/mL, prior to sex-sorting. In Experiment III, spermatozoa were diluted to 0.7, 1.4 and 2.1 × 10(9) sperm/mL using TALP containing 0 or 10% seminal plasma prior to sex-sorting and cryopreservation. In Experiment I, the optimal staining combination was 160 × 10(6) sperm/mL stained with 65 μm Hoechst 33342 and no seminal plasma. In Experiment II, the percentages of membrane-impaired sperm were lower for sample concentrations of 2.1 × 10(9) sperm/mL (15%) than for samples at 1.4 × 10(9) (17%) or 0.7 × 10(9) sperm/mL (18%; p < 0.01). The X sort rate was slower for samples stored at 0.7 × 10(9) sperm/mL (3.45 × 10(3) sperm/sec) than for samples stored at 1.4 × 10(9) and 2.1 × 10(9) sperm/mL (3.85 and 3.94 × 10(3) sperm/sec, respectively; p < 0.05). In Experiment III, samples containing 0% seminal plasma had higher percentages of live-oriented cells (54 vs. 50%; p < 0.05), fewer dead sperm (19 vs. 22%; p < 0.01) and higher post-thaw motility (41 vs. 35%; p < 0.05) than samples containing 10% seminal plasma. Ejaculates with high sperm concentrations result in superior sorting because these samples have less seminal plasma during staining than ejaculates with lower initial sperm concentrations as all samples are diluted to 160 × 10(6) sperm/mL for staining. Therefore, sorting

  17. Cell adhesion and sorting in embryoid bodies derived from N- or E-cadherin deficient murine embryonic stem cells

    PubMed Central

    Moore, Robert; Tao, Wensi; Meng, Yue; Smith, Elizabeth R.; Xu, Xiang-Xi

    2014-01-01

    Summary The primitive endoderm epithelial structure in mouse blastocysts forms following cell differentiation and subsequent sorting, and this two-step process can be reproduced in vitro using an embryoid body model. We found that in the chimeric embryoid bodies consisting of paired wildtype and E-cadherin null ES cells, the wildtype sorted to the center and were enveloped by the less adhesive E-cadherin null cells, in accord with Steinberg's hypothesis. However, wildtype and N-cadherin null ES cells intermixed and did not segregate, a situation that may be explained by Albert Harris' modified principle, which incorporates the unique properties of living cells. Furthermore, in chimeric embryoid bodies composed of N-cadherin and E-cadherin null ES cells, the two weakly interacting cell types segregated but did not envelop one another. Lastly, the most consistent and striking observation was that differentiated cells sorted to the surface and formed an enveloping layer, regardless of the relative cell adhesive affinity of any cell combination, supporting the hypothesis that the ability of the differentiated cells to establish apical polarity is the determining factor in surface sorting and positioning. PMID:24414205

  18. Human mammalian cell sorting using a highly integrated micro-fabricated fluorescence-activated cell sorter (microFACS).

    PubMed

    Cho, Sung Hwan; Chen, Chun H; Tsai, Frank S; Godin, Jessica M; Lo, Yu-Hwa

    2010-06-21

    We demonstrate a high performance microfabricated FACS system with highly integrated microfluidics, optics, acoustics, and electronics. Single cell manipulation at a high speed is made possible by the fast response time (approximately 0.1 ms) of the integrated PZT actuator and the nozzle structure at the sorting junction. A Teflon AF-coated optofluidic waveguide along the microfluidic channel guides the illumination light, enabling multi-spot detection, while a novel space-time coding technology enhances the detection sensitivity of the microFACS system. The real-time control loop system is implemented using a field-programmable-gate-array (FPGA) for automated and accurate sorting. The microFACS achieves a high purification enrichment factor: up to approximately 230 fold for both polystyrene microbeads and suspended human mammalian cells (K562) at a high throughput (>1000 cells s(-1)). The sorting mechanism is independent of cell properties such as size, density, and shape, thus the presented system can be applied to sort out any pure sub-populations. This new lab-on-a-chip FACS system, therefore, holds promise to revolutionize microfluidic cytometers to meet cost, size, and performance goals.

  19. Cell adhesion and sorting in embryoid bodies derived from N- or E-cadherin deficient murine embryonic stem cells.

    PubMed

    Moore, Robert; Tao, Wensi; Meng, Yue; Smith, Elizabeth R; Xu, Xiang-Xi

    2014-02-15

    The primitive endoderm epithelial structure in mouse blastocysts forms following cell differentiation and subsequent sorting, and this two-step process can be reproduced in vitro using an embryoid body model. We found that in the chimeric embryoid bodies consisting of paired wildtype and E-cadherin null ES cells, the wildtype sorted to the center and were enveloped by the less adhesive E-cadherin null cells, in accord with Steinberg's hypothesis. However, wildtype and N-cadherin null ES cells intermixed and did not segregate, a situation that may be explained by Albert Harris' modified principle, which incorporates the unique properties of living cells. Furthermore, in chimeric embryoid bodies composed of N-cadherin and E-cadherin null ES cells, the two weakly interacting cell types segregated but did not envelop one another. Lastly, the most consistent and striking observation was that differentiated cells sorted to the surface and formed an enveloping layer, regardless of the relative cell adhesive affinity of any cell combination, supporting the hypothesis that the ability of the differentiated cells to establish apical polarity is the determining factor in surface sorting and positioning.

  20. Buoyancy-activated cell sorting using targeted biotinylated albumin microbubbles.

    PubMed

    Liou, Yu-Ren; Wang, Yu-Hsin; Lee, Chia-Ying; Li, Pai-Chi

    2015-01-01

    Cell analysis often requires the isolation of certain cell types. Various isolation methods have been applied to cell sorting, including fluorescence-activated cell sorting and magnetic-activated cell sorting. However, these conventional approaches involve exerting mechanical forces on the cells, thus risking cell damage. In this study we applied a novel isolation method called buoyancy-activated cell sorting, which involves using biotinylated albumin microbubbles (biotin-MBs) conjugated with antibodies (i.e., targeted biotin-MBs). Albumin MBs are widely used as contrast agents in ultrasound imaging due to their good biocompatibility and stability. For conjugating antibodies, biotin is conjugated onto the albumin MB shell via covalent bonds and the biotinylated antibodies are conjugated using an avidin-biotin system. The albumin microbubbles had a mean diameter of 2 μm with a polydispersity index of 0.16. For cell separation, the MDA-MB-231 cells are incubated with the targeted biotin-MBs conjugated with anti-CD44 for 10 min, centrifuged at 10 g for 1 min, and then allowed 1 hour at 4 °C for separation. The results indicate that targeted biotin-MBs conjugated with anti-CD44 antibodies can be used to separate MDA-MB-231 breast cancer cells; more than 90% of the cells were collected in the MB layer when the ratio of the MBs to cells was higher than 70:1. Furthermore, we found that the separating efficiency was higher for targeted biotin-MBs than for targeted avidin-incorporated albumin MBs (avidin-MBs), which is the most common way to make targeted albumin MBs. We also demonstrated that the recovery rate of targeted biotin-MBs was up to 88% and the sorting purity was higher than 84% for a a heterogenous cell population containing MDA-MB-231 cells (CD44(+)) and MDA-MB-453 cells (CD44-), which are classified as basal-like breast cancer cells and luminal breast cancer cells, respectively. Knowing that the CD44(+) is a commonly used cancer-stem-cell biomarker, our

  1. Anatomy of the Berkeley Sensor & Actuator Center (BSAC): The NSF Industry/University Cooperative Research Center on MEMS

    DTIC Science & Technology

    2013-04-08

    graduate student researchers, UC Berkeley College of Engineering, UC Davis College of Engineering, the UC Berkeley Microlab, DARPA , the administrative staffs...typically from the Defense Advanced Projects Agency ( DARPA ), NSF,  National  Institute of Health, Army Research Lab, the California Energy Commission...Federal research agencies ( DARPA , DOE, NIH, NASA, DOC, etc) set aside some of their operating budgets  to fund promising Innovation Research through

  2. NSF- and SNARE-mediated membrane fusion is required for nuclear envelope formation and completion of nuclear pore complex assembly in Xenopus laevis egg extracts.

    PubMed

    Baur, Tina; Ramadan, Kristijan; Schlundt, Andreas; Kartenbeck, Jürgen; Meyer, Hemmo H

    2007-08-15

    Despite the progress in understanding nuclear envelope (NE) reformation after mitosis, it has remained unclear what drives the required membrane fusion and how exactly this is coordinated with nuclear pore complex (NPC) assembly. Here, we show that, like other intracellular fusion reactions, NE fusion in Xenopus laevis egg extracts is mediated by SNARE proteins that require activation by NSF. Antibodies against Xenopus NSF, depletion of NSF or the dominant-negative NSF(E329Q) variant specifically inhibited NE formation. Staging experiments further revealed that NSF was required until sealing of the envelope was completed. Moreover, excess exogenous alpha-SNAP that blocks SNARE function prevented membrane fusion and caused accumulation of non-flattened vesicles on the chromatin surface. Under these conditions, the nucleoporins Nup107 and gp210 were fully recruited, whereas assembly of FxFG-repeat-containing nucleoporins was blocked. Together, we define NSF- and SNARE-mediated membrane fusion events as essential steps during NE formation downstream of Nup107 recruitment, and upstream of membrane flattening and completion of NPC assembly.

  3. Gravity effects on sediment sorting: limitations of models developed on Earth for Mars

    NASA Astrophysics Data System (ADS)

    Kuhn, Nikolaus J.; Kuhn, Brigitte; Gartmann, Andres

    2015-04-01

    Most studies on surface processes on planetary bodies assume that the use of empirical models developed for Earth is possible if the mathematical equations include all the relevant factors, such as gravity, viscosity and the density of water and sediment. However, most models for sediment transport on Earth are at least semi-empirical, using coefficients to link observed sediment movement to controlling factors such as flow velocity, slope and channel dimensions. However, using roughness and drag coefficients, as well as parameters describing incipient motion of particles, observed on Earth on another planet, violates, strictly speaking, the boundary conditions set for their application by fluid dynamics because the coefficienst describe a flow condition, not a particle property. Reduced gravity affects the flow around a settling partcile or over the bed of a watercourse, therefore data and models from Earth do not apply to another planet. Comparing observations from reduced gravity experiments and model results obtained on Earth confirm the significance of this error, e.g. by underestimating settling velocities of sandy particles by 10 to 50% for Mars when using models from Earth. In this study, the relevance of this error is examined by simulating the sorting of sediment deposited from water flowing on Mars. The results indicate that sorting on Mars is less pronounced than models calibrated on Earth suggest. This has implications for the selection of landing sites and, more importantly, the identification of strata potentially bearing traces of past life during rover missions on Mars.

  4. Gravity effects on sediment sorting: limitations of models developed on Earth for Mars

    NASA Astrophysics Data System (ADS)

    Kuhn, N. J.; Kuhn, B.; Gartmann, A.

    2015-10-01

    Most studies on surface processes on planetary bodies assume that the use of empirical models developed for Earth is possible if the mathematical equations include all the relevant factors, such as gravity, viscosity and the density of water and sediment. However, most models for sediment transport on Earth are at least semi-empirical, using coefficients to link observed sediment movement to controlling factors such as flow velocity, slope and channel dimensions. However, using roughness and drag coefficients, as well as parameters describing incipient motion of particles, observed on Earth on another planet, violates, strictly speaking, the boundary conditions set for their application by fluid dynamics because the coefficienst describe a flow condition, not a particle property. Reduced gravity affects the flow around a settling partcile or over the bed of a watercourse, therefore data and models from Earth do not apply to another planet. Comparing observations from reduced gravity experiments and model results obtained on Earth confirm the significance of this error, e.g. by underestimating settling velocities of sandy particles by 10 to 50% for Mars when using models from Earth. In this study, the relevance of this error is examined by simulating the sorting of sediment deposited from water flowing on Mars. The results indicate that sorting on Mars is less pronounced than models calibrated on Earth suggest. This has implications for the selection of landing sites and,more importantly, the identification of strata potentially bearing traces of past life during rover missions on Mars. try, 2001

  5. Design of monitoring system for mail-sorting based on the Profibus S7 series PLC

    NASA Astrophysics Data System (ADS)

    Zhang, W.; Jia, S. H.; Wang, Y. H.; Liu, H.; Tang, G. C.

    2017-01-01

    With the rapid development of the postal express, the workload of mail sorting is increasing, but the automatic technology of mail sorting is not mature enough. In view of this, the system uses Siemens S7-300 PLC as the main station controller, PLC of Siemens S7-200/400 is from the station controller, through the man-machine interface configuration software MCGS, PROFIBUS-DP communication, RFID technology and mechanical sorting hand achieve mail classification sorting monitoring. Among them, distinguish mail-sorting by scanning RFID posted in the mail electronic bar code (fixed code), the system uses the corresponding controller on the acquisition of information processing, the processed information transmit to the sorting manipulator by PROFIBUS-DP. The system can realize accurate and efficient mail sorting, which will promote the development of mail sorting technology.

  6. Reticulate evolution and incomplete lineage sorting among the ponderosa pines.

    PubMed

    Willyard, Ann; Cronn, Richard; Liston, Aaron

    2009-08-01

    Interspecific gene flow via hybridization may play a major role in evolution by creating reticulate rather than hierarchical lineages in plant species. Occasional diploid pine hybrids indicate the potential for introgression, but reticulation is hard to detect because ancestral polymorphism is still shared across many groups of pine species. Nucleotide sequences for 53 accessions from 17 species in subsection Ponderosae (Pinus) provide evidence for reticulate evolution. Two discordant patterns among independent low-copy nuclear gene trees and a chloroplast haplotype are better explained by introgression than incomplete lineage sorting or other causes of incongruence. Conflicting resolution of three monophyletic Pinus coulteri accessions is best explained by ancient introgression followed by a genetic bottleneck. More recent hybridization transferred a chloroplast from P. jeffreyi to a sympatric P. washoensis individual. We conclude that incomplete lineage sorting could account for other examples of non-monophyly, and caution against any analysis based on single-accession or single-locus sampling in Pinus.

  7. Method and apparatus for electrostatically sorting biological cells

    DOEpatents

    Merrill, John T.

    1982-01-01

    An improved method of sorting biological cells in a conventional cell sorter apparatus includes generating a fluid jet containing cells to be sorted, measuring the distance between the centers of adjacent droplets in a zone thereof defined at the point where the fluid jet separates into descrete droplets, setting the distance between the center of a droplet in said separation zone and the position along said fluid jet at which the cell is optically sensed for specific characteristics to be an integral multiple of said center-to-center distance, and disabling a charger from electrically charging a specific droplet if a cell is detected by the optical sensor in a position wherein it will be in the neck area between droplets during droplet formation rather than within a predetermined distance from the droplet center.

  8. New optical configuration for flow cytometric sorting of aspherical cells

    NASA Astrophysics Data System (ADS)

    Sharpe, John C.; Schaare, Peter N.; Kuennemeyer, Rainer

    1997-05-01

    The orthogonal axes of illumination, flow, and detection in conventional sorting flow cytometers can limit accuracy or throughput when making fluorescence measurements on a spherical cells. A new radially symmetric optical configuration has been designed to overcome these problems. Both illumination and fluorescence collection are performed by a single optical element which encircles the sample stream flow axis. Unlike existing epi-illumination flow cytometer designs, these optics are compatible with electrostatic sorting. The resolution of this system is currently being evaluated for DNA chromosome content measurement with an ultimate goal of separation of X- and Y- chromosome-bearing mammalian spermatozoa. We describe the new optical configuration and present preliminary results of instrument performance. Comparison with a conventional orthogonal optical geometry is made using fluorescent microspheres, chicken red blood cells and chinchilla sperm.

  9. Sorting and Manipulation of Magnetic Droplets in Continuous Flow

    NASA Astrophysics Data System (ADS)

    Al-Hetlani, Entesar; Hatt, Oliver J.; Vojtíšek, Martin; Tarn, Mark D.; Iles, Alexander; Pamme, Nicole

    2010-12-01

    We report the rapid on-chip generation and subsequent manipulation of magnetic droplets in continuous flow. Magnetic droplets were formed using aqueous-based ferrofluid as the dispersed phase and fluorocarbon oil as the continuous phase. Droplet manipulation was demonstrated with simple permanent magnets using two microfluidic platforms: (i) flow focusing droplet generation followed by their splitting into daughter droplets containing different amounts of magnetic nanoparticles, and (ii) droplet generation at a T-junction and their downstream deflection across a chamber for sorting based on the applied magnetic field and magnetite loading of the droplet. Both systems show great potential for performing a wide range of high throughput continuous flow processes including sample dilution, cell sorting and screening, and microparticle fabrication.

  10. Expansion and Polarity Sorting in Microtubule-Dynein Bundles

    NASA Astrophysics Data System (ADS)

    Zemel, A.; Mogilner, A.

    Interactions of multiple molecular motors with dynamicpolymers, such as actin and microtubules, form the basis for many processes in the cell cytoskeleton. One example is the active `sorting' of microtubule bundles by dynein molecular motors into aster-like arrays of microtubules; in these bundles dynein motors cross-link and slide neighboring microtubules apart. A number of models have been suggested to quantify the active dynamics of cross-linked bundles of polar filaments. In the case of densely packed bundles, however, a major complication arises from the fact that each microtubule interacts with multiple neighboring filaments. To explicitly take these interactions into account we performed detailed computer simulations in which the equations of motion for all microtubules in the bundle were iteratively solved. Our simulations demonstrate the phenomenon of polarity sorting and reveal the variable-rate of the concurrent bundle expansion and its dependence on the nature of the microtubule-motor interactions.

  11. Image coding based on energy-sorted wavelet packets

    NASA Astrophysics Data System (ADS)

    Kong, Lin-Wen; Lay, Kuen-Tsair

    1995-04-01

    The discrete wavelet transform performs multiresolution analysis, which effectively decomposes a digital image into components with different degrees of details. In practice, it is usually implemented in the form of filter banks. If the filter banks are cascaded and both the low-pass and the high-pass components are further decomposed, a wavelet packet is obtained. The coefficients of the wavelet packet effectively represent subimages in different resolution levels. In the energy-sorted wavelet- packet decomposition, all subimages in the packet are then sorted according to their energies. The most important subimages, as measured by the energy, are preserved and coded. By investigating the histogram of each subimage, it is found that the pixel values are well modelled by the Laplacian distribution. Therefore, the Laplacian quantization is applied to quantized the subimages. Experimental results show that the image coding scheme based on wavelet packets achieves high compression ratio while preserving satisfactory image quality.

  12. Self-organized sorting limits behavioral variability in swarms

    PubMed Central

    Copenhagen, Katherine; Quint, David A.; Gopinathan, Ajay

    2016-01-01

    Swarming is a phenomenon where collective motion arises from simple local interactions between typically identical individuals. Here, we investigate the effects of variability in behavior among the agents in finite swarms with both alignment and cohesive interactions. We show that swarming is abolished above a critical fraction of non-aligners who do not participate in alignment. In certain regimes, however, swarms above the critical threshold can dynamically reorganize and sort out excess non-aligners to maintain the average fraction close to the critical value. This persists even in swarms with a distribution of alignment interactions, suggesting a simple, robust and efficient mechanism that allows heterogeneously mixed populations to naturally regulate their composition and remain in a collective swarming state or even differentiate among behavioral phenotypes. We show that, for evolving swarms, this self-organized sorting behavior can couple to the evolutionary dynamics leading to new evolutionarily stable equilibrium populations set by the physical swarm parameters. PMID:27550316

  13. Particle sorting using a porous membrane in a microfluidic device.

    PubMed

    Wei, Huibin; Chueh, Bor-han; Wu, Huiling; Hall, Eric W; Li, Cheuk-wing; Schirhagl, Romana; Lin, Jin-Ming; Zare, Richard N

    2011-01-21

    Porous membranes have been fabricated based on the development of the perforated membrane mold [Y. Luo and R. N. Zare, Lab Chip, 2008, 8, 1688-1694] to create a single filter that contains multiple pore sizes ranging from 6.4 to 16.6 µm inside a monolithic three-dimensional poly(dimethylsiloxane) microfluidic structure. By overlapping two filters we are able to achieve smaller pore size openings (2.5 to 3.3 µm). This filter operates without any detectable irreversible clogging, which is achieved using a cross-flow placed in front of each filtration section. The utility of a particle-sorting device that contains this filter is demonstrated by separating polystyrene beads of different diameters with an efficiency greater than 99.9%. Additionally, we demonstrate the effectiveness of this particle-sorting device by separating whole blood samples into white blood cells and red blood cells with platelets.

  14. Armoring and vertical sorting in aeolian dune fields

    NASA Astrophysics Data System (ADS)

    Gao, Xin; Narteau, Clément; Rozier, Olivier

    2016-04-01

    Unlike ripples, there are only few numerical studies on grain-size segregation at the scale of dunes in aeolian environments. Here we use a cellular automaton model to analyze vertical sorting in granular mixtures under steady unidirectional flow conditions. We investigate the feedbacks between dune growth and the segregation mechanisms by varying the size of coarse grains and their proportion within the bed. We systematically observe the development of a horizontal layer of coarse grains at the top of which sorted bed forms may grow by amalgamation. The formation of such an armor layer controls the overall sediment transport and availability. The emergence of dunes and the transition from barchan to transverse dune fields depend only on the grain size distribution of the initial sediment layer. As confirmed by observation, this result indicates that armor layers should be present in most arid deserts, where they are likely to control dune morphodynamics.

  15. Spatial sorting promotes the spread of maladaptive hybridization

    USGS Publications Warehouse

    Lowe, Winsor H.; Muhlfeld, Clint C.; Allendorf, Fred W.

    2015-01-01

    Invasive hybridization is causing loss of biodiversity worldwide. The spread of such introgression can occur even when hybrids have reduced Darwinian fitness, which decreases the frequency of hybrids due to low survival or reproduction through time. This paradox can be partially explained by spatial sorting, where genotypes associated with dispersal increase in frequency at the edge of expansion, fueling further expansion and allowing invasive hybrids to increase in frequency through space rather than time. Furthermore, because all progeny of a hybrid will be hybrids (i.e., will possess genes from both parental taxa), nonnative admixture in invaded populations can increase even when most hybrid progeny do not survive. Broader understanding of spatial sorting is needed to protect native biodiversity.

  16. Control of a brain-computer interface without spike sorting

    NASA Astrophysics Data System (ADS)

    Fraser, George W.; Chase, Steven M.; Whitford, Andrew; Schwartz, Andrew B.

    2009-10-01

    Two rhesus monkeys were trained to move a cursor using neural activity recorded with silicon arrays of 96 microelectrodes implanted in the primary motor cortex. We have developed a method to extract movement information from the recorded single and multi-unit activity in the absence of spike sorting. By setting a single threshold across all channels and fitting the resultant events with a spline tuning function, a control signal was extracted from this population using a Bayesian particle-filter extraction algorithm. The animals achieved high-quality control comparable to the performance of decoding schemes based on sorted spikes. Our results suggest that even the simplest signal processing is sufficient for high-quality neuroprosthetic control.

  17. What about inhibition in the Wisconsin Card Sorting Test?

    PubMed

    Steinmetz, Jean-Paul; Houssemand, Claude

    2011-05-01

    The commercially available Wisconsin Card Sorting Test (WCST) is one of the most commonly used tests for assessing executive functions within clinical settings. Importantly, however, it remains relatively unclear exactly what processes are assessed by the test. Conceptually, increased perseverative errors in sorting cards are usually related to deficient inhibition processes. Empirically, evidence supporting this conclusion is limited. In a sample of 38 healthy adults we addressed the question to what extent inhibition mechanisms assessed by the go/no-go and the stop-signal paradigm are related to WCST performances. Inhibition-related scores were found to predict non-perseverative errors better than perseverative errors. Consequently we conclude that the non-perseverative errors score reflects processes that are partly dependent on inhibition functions.

  18. Osteogenic potential of sorted equine mesenchymal stem cell subpopulations.

    PubMed

    Radtke, Catherine L; Nino-Fong, Rodolfo; Rodriguez-Lecompte, Juan Carlos; Esparza Gonzalez, Blanca P; Stryhn, Henrik; McDuffee, Laurie A

    2015-04-01

    The objectives of this study were to use non-equilibrium gravitational field-flow fractionation (GrFFF), an immunotag-less method of sorting mesenchymal stem cells (MSCs), to sort equine muscle tissue-derived mesenchymal stem cells (MMSCs) and bone marrow-derived mesenchymal stem cells (BMSC) into subpopulations and to carry out assays in order to compare their osteogenic capabilities. Cells from 1 young adult horse were isolated from left semitendinosus muscle tissue and from bone marrow aspirates of the fourth and fifth sternebrae. Aliquots of 800 × 10(3) MSCs from each tissue source were sorted into 5 fractions using non-equilibrium GrFFF (GrFFF proprietary system). Pooled fractions were cultured and expanded for use in osteogenic assays, including flow cytometry, histochemistry, bone nodule assays, and real-time quantitative polymerase chain reaction (qPCR) for gene expression of osteocalcin (OCN), RUNX2, and osterix. Equine MMSCs and BMSCs were consistently sorted into 5 fractions that remained viable for use in further osteogenic assays. Statistical analysis confirmed strongly significant upregulation of OCN, RUNX2, and osterix for the BMSC fraction 4 with P < 0.00001. Flow cytometry revealed different cell size and granularity for BMSC fraction 4 and MMSC fraction 2 compared to unsorted controls and other fractions. Histochemisty and bone nodule assays revealed positive staining nodules without differences in average nodule area, perimeter, or stain intensity between tissues or fractions. As there are different subpopulations of MSCs with different osteogenic capacities within equine muscle- and bone marrow-derived sources, these differences must be taken into account when using equine stem cell therapy to induce bone healing in veterinary medicine.

  19. Sorting via injection of particle streams into an optical lattice

    NASA Astrophysics Data System (ADS)

    MacDonald, Michael P.; Neale, Steven L.; Smith, Ryan L.; Spalding, Gabriel C.; Dholakia, Kishan

    2005-08-01

    The growth of research into microfluidics, especially towards micro-Total Analysis Systems (μTAS), is leading to a demand for highly efficient and accurate methods for analyte delivery, sorting, mixing and analysis. Optical techniques, due to their non-invasive, non-contact properties are ideally suited to integration in to microfluidic systems. One of the key abilities in a μTAS device is the ability to sort microscopic matter. When done optically this typically involves fluorescence detection, management of the information detected and subsequent action such as the actuation of an electric field or electro-mechanical valve. We present here a method whereby the detection of a micro-particle's properties is done passively, with simultaneous separation of those particles. To do this particle streams are injected into a three-dimensional crystal-like lattice of optical intensity maxima. A particle's response to the three-dimensional optical potential landscape formed by the lattice depends on its polarisability. This leads to a sensitivity to size, refractive index and shape. More strongly interacting particles are deflected away from the main flow whilst those that interact weakly are washed straight through the lattice without little or no net deflection. We present analysis of both injection and subsequent re-routing/sorting of particle streams, using body-centred tetragonal and three-dimensional "log-pile" optical lattices to separate both inert colloid and blood cells by refractive index or size. Sorting with an efficiency as high as 96% has been achieved with particle deflections in excess of 45 degrees.

  20. Ion pump sorting in polarized renal epithelial cells.

    PubMed

    Caplan, M J

    2001-08-01

    The plasma membranes of renal epithelial cells are divided into distinct apical and basolateral domains, which contain different inventories of ion transport proteins. Without this polarity vectorial ion and fluid transport would not be possible. Little is known of the signals and mechanisms that renal epithelial cells use to establish and maintain polarized distributions of their ion transport proteins. Analysis of ion pump sorting reveals that multiple complex signals participate in determining and regulating these proteins' subcellular localizations.

  1. DNA manipulation, sorting, and mapping in nanofluidic systems.

    PubMed

    Levy, Stephen L; Craighead, Harold G

    2010-03-01

    Fluidic systems with nanometre length scales enable sensitive analysis of DNA molecules. Nanofluidic systems have been used to probe conformational, dynamic, and entropic properties of DNA molecules, to rapidly sort DNA molecules based on length dependent interactions with their confining environment, and for determining the spatial location of genetic information along long DNA molecules. In this critical review, recent experiments utilizing fluidic systems comprised of nanochannels, nanoslits, nanopores, and zero-mode waveguides for DNA analysis are reviewed (161 references).

  2. Colloidal Iron, Aluminum, and DOC/DON in Surface Waters of the Northwest Pacific: Results from the 2002 NSF/IOC Cruise

    NASA Astrophysics Data System (ADS)

    Sonke, J.; Landing, W. M.

    2002-12-01

    Over 70 surface seawater samples were collected on the 2002 NSF/IOC cruise between Japan and Hawaii using a towed "fish" peristaltic pump trace-metals clean sampling system. Samples for total dissolved Fe and AL were filtered using 0.2 um cartridge filters. Colloidal Fe and Al were isolated using a Millipore PrepScale 1 kDa regenerated cellulose tangential flow ultrafiltration device. Concentration factors were 8-10. Aluminum concentrations were measured using the lumogallion fluorometric technique; Fe concentrations were measured by Fe-57 isotope dilution with a Finnegan Element high-resolution magnetic sector ICPMS. Total dissolved Fe concentrations ranged from 0.2 to 0.6 nM and were weakly correlated with atmospheric Fe deposition (calculated from aerosol Fe concentrations). Colloidal Fe ranged from 10-60 percent of the total dissolved Fe and appeared to be related to atmospheric input and biological activity. We will discuss the relationships between the concentrations of particulate, dissolved and colloidal Fe, Al, and DOC/DON and the intertwined effects of atmospheric input, complexation by natural ligands, and physical dilution into the mixed layer.

  3. Structural determinants allowing endolysosomal sorting and degradation of endosomal GTPases.

    PubMed

    Valero, Ruth A; Oeste, Clara L; Stamatakis, Konstantinos; Ramos, Irene; Herrera, Mónica; Boya, Patricia; Pérez-Sala, Dolores

    2010-09-01

    Rapid control of protein degradation is usually achieved through the ubiquitin-proteasome pathway. We recently found that the short-lived GTPase RhoB is degraded in lysosomes. Moreover, the fusion of the RhoB C-terminal sequence CINCCKVL, containing the isoprenylation and palmitoylation sites, to other proteins directs their sorting into multivesicular bodies (MVBs) and rapid lysosomal degradation. Here, we show that this process is highly specific for RhoB. Alteration of late endosome lipid dynamics produced the accumulation of RhoB, but not of other endosomal GTPases, including Rab5, Rab7, Rab9 or Rab11, into enlarged MVB. Other isoprenylated and bipalmitoylated GTPases, such as H-Ras, Rap2A, Rap2B and TC10, were not accumulated into MVB and were stable. Remarkably, although TC10, which is highly homologous to RhoB, was stable, a sequence derived from its C-terminus (CINCCLIT) elicited MVB sorting and degradation of a green fluorescent protein (GFP)-chimeric protein. This led us to identify a cluster of basic amino acids (KKH) in the TC10 hypervariable region, constituting a secondary signal potentially involved in electrostatic interactions with membrane lipids. Mutation of this cluster allowed TC10 MVB sorting and degradation, whereas inserting it into RhoB hypervariable region rescued this protein from its lysosomal degradation pathway. These findings define a highly specific structural module for entering the MVB pathway and rapid lysosomal degradation.

  4. GRAIN SORTING IN COMETARY DUST FROM THE OUTER SOLAR NEBULA

    SciTech Connect

    Wozniakiewicz, P. J.; Bradley, J. P.; Ishii, H. A.; Brownlee, D. E.; Kearsley, A. T.; Burchell, M. J.; Price, M. C.

    2012-12-01

    Most young stars are surrounded by a disk of gas and dust. Close to the hot stars, amorphous dust grains from the parent molecular cloud are reprocessed into crystals that are then distributed throughout the accretion disk. In some disks, there is a reduction in crystalline grain size with heliocentric distance from the star. We investigated crystalline grain size distributions in chondritic porous (CP) interplanetary dust particles (IDPs) believed to be from small, icy bodies that accreted in outer regions of the solar nebula. The grains are Mg-rich silicates and Fe-rich sulfides, the two most abundant minerals in CP IDPs. We find that they are predominantly <0.25 {mu}m in radius with a mean grain size that varies from one CP IDP to another. We report a size-density relationship between the silicates and sulfides. A similar size-density relationship between much larger silicate and sulfide grains in meteorites from the asteroid belt is ascribed to aerodynamic sorting. Since the silicate and sulfide grains in CP IDPs are theoretically too small for aerodynamic sorting, their size-density relationship may be due to another process capable of sorting small grains.

  5. Cell sorting analysis of geographically separated hypersaline environments.

    PubMed

    Zhaxybayeva, Olga; Stepanauskas, Ramunas; Mohan, Nikhil Ram; Papke, R Thane

    2013-03-01

    Biogeography of microbial populations remains to be poorly understood, and a novel technique of single cell sorting promises a new level of resolution for microbial diversity studies. Using single cell sorting, we compared saturated NaCl brine environments (32-35 %) of the South Bay Salt Works in Chula Vista in California (USA) and Santa Pola saltern near Alicante (Spain). Although some overlap in community composition was detected, both samples were significantly different and included previously undiscovered 16S rRNA sequences. The community from Chula Vista saltern had a large bacterial fraction, which consisted of diverse Bacteroidetes and Proteobacteria. In contrast, Archaea dominated Santa Pola's community and its bacterial fraction consisted of the previously known Salinibacter lineages. The recently reported group of halophilic Archaea, Nanohaloarchaea, was detected at both sites. We demonstrate that cell sorting is a useful technique for analysis of halophilic microbial communities, and is capable of identifying yet unknown or divergent lineages. Furthermore, we argue that observed differences in community composition reflect restricted dispersal between sites, a likely mechanism for diversification of halophilic microorganisms.

  6. Efficient Architecture for Spike Sorting in Reconfigurable Hardware

    PubMed Central

    Hwang, Wen-Jyi; Lee, Wei-Hao; Lin, Shiow-Jyu; Lai, Sheng-Ying

    2013-01-01

    This paper presents a novel hardware architecture for fast spike sorting. The architecture is able to perform both the feature extraction and clustering in hardware. The generalized Hebbian algorithm (GHA) and fuzzy C-means (FCM) algorithm are used for feature extraction and clustering, respectively. The employment of GHA allows efficient computation of principal components for subsequent clustering operations. The FCM is able to achieve near optimal clustering for spike sorting. Its performance is insensitive to the selection of initial cluster centers. The hardware implementations of GHA and FCM feature low area costs and high throughput. In the GHA architecture, the computation of different weight vectors share the same circuit for lowering the area costs. Moreover, in the FCM hardware implementation, the usual iterative operations for updating the membership matrix and cluster centroid are merged into one single updating process to evade the large storage requirement. To show the effectiveness of the circuit, the proposed architecture is physically implemented by field programmable gate array (FPGA). It is embedded in a System-on-Chip (SOC) platform for performance measurement. Experimental results show that the proposed architecture is an efficient spike sorting design for attaining high classification correct rate and high speed computation. PMID:24189331

  7. Thermochemical Pretreatment for Anaerobic Digestion of Sorted Waste

    NASA Astrophysics Data System (ADS)

    Hao, W.; Hongtao, W.

    2008-02-01

    The effect of alkaline hydrothermal pre-treatment for anaerobic digestion of mechanically-sorted municipal solid waste (MSW) and source-sorted waste was studied. Waste was hydrothermally pre-treated in dilute alkali solution. Hydrolysis product was incubated in 500 ml saline bottle to determine methane potential (MP) under mesospheric anaerobic conditions. Optimum reaction condition obtained in the study is 170 °C at the dose of 4 g NaOH/100 g solid for one hour. Soluble COD was 13936 mg/L and methane yield was 164 ml/g VS for 6 days incubation at optimum conditions. More than 50% biogas increase was achieved over the control, and methane conversion ratio on carbon basis was enhanced to 30.6%. The digestion period was less than 6 days when pre-treatment temperature was above 130 °C. The organic part of sorted waste is mainly constituted of kitchen garbage and leaf. Model kitchen garbage was completely liquidized at 130 °C for one hour and the methane yield was 276 ml/g VS. Addition of alkali enhance hydroxylation rate and methane yield slightly. The biogas potential of leaf could be observed by pre-treatment above 150 °C under alkaline condition.

  8. Quadrupole Magnetic Sorting of Porcine Islets of Langerhans

    PubMed Central

    Shenkman, Rustin M.; Chalmers, Jeffrey J.; Hering, Bernhard J.; Kirchhof, Nicole

    2009-01-01

    Islet transplantation is emerging as a treatment option for selected patients with type 1 diabetes. Inconsistent isolation, purification, and recovery of large numbers of high-quality islets remain substantial impediments to progress in the field. Removing islets as soon as they are liberated from the pancreas during digestion and circumventing the need for density gradient purification is likely to result in substantially increased viable islet yields by minimizing exposure to proteolytic enzymes, reactive oxygen intermediates, and mechanical stress associated with centrifugation. This study capitalized on the hypervascularity of islets compared with acinar tissue to explore their preferential enrichment with magnetic beads to enable immediate separation in a magnetic field utilizing a quadrupole magnetic sorting. The results demonstrate that (1) preferential enrichment of porcine islets is achievable, but homogeneous bead distribution within the pancreas is difficult to achieve with current protocols; (2) greater than 70% of islets in the dissociated pancreatic tissue were recovered by quadrupole magnetic sorting, but their purity was low; and (3) infused islets purified by density gradients and subsequently passed through quadrupole magnetic sorting had similar potency as uninfused islets. These results demonstrate proof of concept and define the steps for implementation of this technology in pig and human islet isolation. PMID:19505179

  9. Sort-Mid tasks scheduling algorithm in grid computing.

    PubMed

    Reda, Naglaa M; Tawfik, A; Marzok, Mohamed A; Khamis, Soheir M

    2015-11-01

    Scheduling tasks on heterogeneous resources distributed over a grid computing system is an NP-complete problem. The main aim for several researchers is to develop variant scheduling algorithms for achieving optimality, and they have shown a good performance for tasks scheduling regarding resources selection. However, using of the full power of resources is still a challenge. In this paper, a new heuristic algorithm called Sort-Mid is proposed. It aims to maximizing the utilization and minimizing the makespan. The new strategy of Sort-Mid algorithm is to find appropriate resources. The base step is to get the average value via sorting list of completion time of each task. Then, the maximum average is obtained. Finally, the task has the maximum average is allocated to the machine that has the minimum completion time. The allocated task is deleted and then, these steps are repeated until all tasks are allocated. Experimental tests show that the proposed algorithm outperforms almost other algorithms in terms of resources utilization and makespan.

  10. Microfluidic: an innovative tool for efficient cell sorting.

    PubMed

    Autebert, Julien; Coudert, Benoit; Bidard, François-Clément; Pierga, Jean-Yves; Descroix, Stéphanie; Malaquin, Laurent; Viovy, Jean-Louis

    2012-07-01

    At first mostly dedicated to molecular analysis, microfluidic systems are rapidly expanding their range of applications towards cell biology, thanks to their ability to control the mechanical, biological and fluidic environment at the scale of the cells. A number of new concepts based on microfluidics were indeed proposed in the last ten years for cell sorting. For many of these concepts, progress remains to be done regarding automation, standardization, or throughput, but it is now clear that microfluidics will have a major contribution to the field, from fundamental research to point-of-care diagnosis. We present here an overview of cells sorting in microfluidics, with an emphasis on circulating tumor cells. Sorting principles are classified in two main categories, methods based on physical properties of the cells, such as size, deformability, electric or optical properties, and methods based on biomolecular properties, notably specific surface antigens. We document potential applications, discuss the main advantages and limitations of different approaches, and tentatively outline the main remaining challenges in this fast evolving field.

  11. Liver 4DMRI: A retrospective image-based sorting method

    SciTech Connect

    Paganelli, Chiara; Summers, Paul; Bellomi, Massimo; Baroni, Guido; Riboldi, Marco

    2015-08-15

    Purpose: Four-dimensional magnetic resonance imaging (4DMRI) is an emerging technique in radiotherapy treatment planning for organ motion quantification. In this paper, the authors present a novel 4DMRI retrospective image-based sorting method, providing reduced motion artifacts than using a standard monodimensional external respiratory surrogate. Methods: Serial interleaved 2D multislice MRI data were acquired from 24 liver cases (6 volunteers + 18 patients) to test the proposed 4DMRI sorting. Image similarity based on mutual information was applied to automatically identify a stable reference phase and sort the image sequence retrospectively, without the use of additional image or surrogate data to describe breathing motion. Results: The image-based 4DMRI provided a smoother liver profile than that obtained from standard resorting based on an external surrogate. Reduced motion artifacts were observed in image-based 4DMRI datasets with a fitting error of the liver profile measuring 1.2 ± 0.9 mm (median ± interquartile range) vs 2.1 ± 1.7 mm of the standard method. Conclusions: The authors present a novel methodology to derive a patient-specific 4DMRI model to describe organ motion due to breathing, with improved image quality in 4D reconstruction.

  12. Association Sorting Algorithm Design for Error Searching System

    NASA Astrophysics Data System (ADS)

    Yang, Fan; Dong, Zhenghong; Li, Mengwei

    2017-02-01

    For the searching results of error searching system for Integrated Decision Information System (IDIS), this paper proposed a method to carry out association sorting according to degree of association of searched results by keywords, which can priorily recommend user interested searching results. Errors of IDIS platform are occurred very often. Because those errors belong to different stages like setup, configuration, and operation, or those errors may occurred in different services, applications, or IP ports, or may be happened in different system software, different version of software, and those errors are also can be classified into different types. As there will be many error information are searched out, it is required to sort them according to degree of association, and provide user interested results. This paper proposed a method to carry out association sorting for the searching results according to the times of searched repeated results by keywords, which effectively put results with high degree of association in the front and increase the searching efficiency.

  13. Scalable orbital-angular-momentum sorting without destroying photon states

    NASA Astrophysics Data System (ADS)

    Wang, Fang-Xiang; Chen, Wei; Yin, Zhen-Qiang; Wang, Shuang; Guo, Guang-Can; Han, Zheng-Fu

    2016-09-01

    Single photons with orbital angular momentum (OAM) have attracted substantial attention from researchers. A single photon can carry infinite OAM values theoretically. Thus, OAM photon states have been widely used in quantum information and fundamental quantum mechanics. Although there have been many methods for sorting quantum states with different OAM values, the nondestructive and efficient sorter of high-dimensional OAM remains a fundamental challenge. Here, we propose a scalable OAM sorter which can categorize different OAM states simultaneously, meanwhile, preserving both OAM and spin angular momentum. Fundamental elements of the sorter are composed of symmetric multiport beam splitters (BSs) and Dove prisms with cascading structure, which in principle can be flexibly and effectively combined to sort arbitrarily high-dimensional OAM photons. The scalable structures proposed here greatly reduce the number of BSs required for sorting high-dimensional OAM states. In view of the nondestructive and extensible features, the sorters can be used as fundamental devices not only for high-dimensional quantum information processing, but also for traditional optics.

  14. Preliminary X-ray analysis of the binding domain of the soybean vacuolar sorting receptor complexed with a sorting determinant of a seed storage protein.

    PubMed

    Maruyama, Nobuyuki; Goshi, Tomohiro; Sugiyama, Shigeru; Niiyama, Mayumi; Adachi, Hiroaki; Takano, Kazufumi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Matsumura, Hiroyoshi; Mikami, Bunzo

    2015-02-01

    β-Conglycinin is a major seed storage protein in soybeans, which are an important source of protein. The major subunits (α, α' and β) of β-conglycinin are sorted to protein-storage vacuoles in seed cells. Vacuolar sorting receptor (VSR) is an integral membrane protein that recognizes the sorting determinant of vacuolar proteins, including β-conglycinin, and regulates their sorting process. Vacuolar sorting determinants of the α' and β subunits of β-conglycinin exist in their C-terminal peptides. Here, the preliminary X-ray diffraction analysis of the binding domain of soybean VSR crystallized with the peptide responsible for the sorting determinant in β-conglycinin is reported. X-ray diffraction data were collected to a resolution of 3.5 Å. The crystals belonged to space group P3121, with unit-cell parameters a = b = 116.4, c = 86.1 Å.

  15. Increasing Access for Economically Disadvantaged Students: The NSF/CSEM & S-STEM Programs at Louisiana State University

    NASA Astrophysics Data System (ADS)

    Wilson, Zakiya S.; Iyengar, Sitharama S.; Pang, Su-Seng; Warner, Isiah M.; Luces, Candace A.

    2012-10-01

    Increasing college degree attainment for students from disadvantaged backgrounds is a prominent component of numerous state and federal legislation focused on higher education. In 1999, the National Science Foundation (NSF) instituted the "Computer Science, Engineering, and Mathematics Scholarships" (CSEMS) program; this initiative was designed to provide greater access and support to academically talented students from economically disadvantaged backgrounds. Originally intended to provide financial support to lower income students, this NSF program also advocated that additional professional development and advising would be strategies to increase undergraduate persistence to graduation. This innovative program for economically disadvantaged students was extended in 2004 to include students from other disciplines including the physical and life sciences as well as the technology fields, and the new name of the program was Scholarships for Science, Technology, Engineering and Mathematics (S-STEM). The implementation of these two programs in Louisiana State University (LSU) has shown significant and measurable success since 2000, making LSU a Model University in providing support to economically disadvantaged students within the STEM disciplines. The achievement of these programs is evidenced by the graduation rates of its participants. This report provides details on the educational model employed through the CSEMS/S-STEM projects at LSU and provides a path to success for increasing student retention rates in STEM disciplines. While the LSU's experience is presented as a case study, the potential relevance of this innovative mentoring program in conjunction with the financial support system is discussed in detail.

  16. Enhancing the Executive Functions of 3-Year-Olds in the Dimensional Change Card Sort Task

    ERIC Educational Resources Information Center

    Perone, Sammy; Molitor, Stephen J.; Buss, Aaron T.; Spencer, John P.; Samuelson, Larissa K.

    2015-01-01

    Executive functions enable flexible thinking, something young children are notoriously bad at. For instance, in the dimensional change card sort (DCCS) task, 3-year-olds can sort cards by one dimension (shape), but continue to sort by this dimension when asked to switch (to color). This study tests a prediction of a dynamic neural field model that…

  17. Perspective Taking and Cognitive Flexibility in the Dimensional Change Card Sorting (DCCS) Task

    ERIC Educational Resources Information Center

    Kloo, Daniela; Perner, Josef; Aichhorn, Markus; Schmidhuber, Nicola

    2010-01-01

    In a study with 79 3-year-olds, we confirm earlier findings that separating the sorting dimensions improve children's performance on the Dimensional Change Card Sorting (DCCS) task. We also demonstrate that the central reason for this facilitation is that the two sorting dimensions are not integral features of a single object. Spatial separation…

  18. Community Readiness Survey: Norm Development Using a Q-Sort Process

    ERIC Educational Resources Information Center

    Sharma, Anu; Botzet, Andria M.; Sechrist, Rebecca A. J.; Arthur, Nikki; Winters, Ken C.

    2006-01-01

    This study reports on norms developed for the Minnesota Institute of Public Health's (1999) Community Readiness Survey. Prevention experts from ten states and the Red Lake Nation sorted data from 50 communities into high and low readiness groups using a Q-sort process. High inter-rater agreement was achieved on communities sorted. Tests of…

  19. COST EVALUATION OF AUTOMATED AND MANUAL POST- CONSUMER PLASTIC BOTTLE SORTING SYSTEMS

    EPA Science Inventory

    This project evaluates, on the basis of performance and cost, two Automated BottleSort® sorting systems for post-consumer commingled plastic containers developed by Magnetic Separation Systems. This study compares the costs to sort mixed bales of post-consumer plastic at these t...

  20. Experimental investigation of gravity effects on sediment sorting on Mars

    NASA Astrophysics Data System (ADS)

    Kuhn, Nikolaus J.; Kuhn, Brigitte; Gartmann, Andres

    2016-04-01

    Introduction: Sorting of sedimentary rocks is a proxy for the environmental conditions at the time of deposition, in particular the runoff that moved and deposited the material forming the rocks. Settling of sediment in water is strongly influenced by the gravity of a planetary body. As a consequence, sorting of a sedimentary rock varies with gravity for a given depth and velocity of surface runoff. Theoretical considerations for spheres indicate that sorting is more uniform on Mars than on Earth for runoff of identical depth. In reality, such considerations have to be applied with great caution because the shape of a particle strongly influences drag. Drag itself can only be calculated directly for an irregularly shaped particle with great computational effort, if at all. Therefore, even for terrestrial applications, sediment settling velocities are often determined directly, e.g. by measurements using settling tubes. Experiments: In this study the results of settling tube tests conducted under reduced gravity during three Mars Sedimentation Experiment (MarsSedEx I, II and III) flights, conducted between 2012 and 2015, are presented. Ten types of sediment, ranging in size, shape and density were tested in custom-designed settling tubes during parabolas of Martian gravity lasting 20 to 25 seconds. Results: The experiments conducted during the MarsSedEx reduced gravity experiments showed that the violation of fluid dynamics caused by using empirical models and parameter values developed for sediment transport on Earth lead to significant miscalculations for Mars, specifically an underetsimation of settling velcoity because of an overestimation of turbulant drag. The error is caused by the flawed representation of particle drag on Mars. Drag coefficients are not a property of a sediment particle, but a property of the flow around the particle, and thus strongly affected by gravity. Conlcusions: The observed errors in settling velocity when using terrestrial models