Science.gov

Sample records for factor nsf sorting

  1. The Neurexin/N-Ethylmaleimide-sensitive Factor (NSF) Interaction Regulates Short Term Synaptic Depression*♦

    PubMed Central

    Li, Tao; Tian, Yao; Li, Qian; Chen, Huiying; Lv, Huihui; Xie, Wei; Han, Junhai

    2015-01-01

    Although Neurexins, which are cell adhesion molecules localized predominantly to the presynaptic terminals, are known to regulate synapse formation and synaptic transmission, their roles in the regulation of synaptic vesicle release during repetitive nerve stimulation are unknown. Here, we show that nrx mutant synapses exhibit rapid short term synaptic depression upon tetanic nerve stimulation. Moreover, we demonstrate that the intracellular region of NRX is essential for synaptic vesicle release upon tetanic nerve stimulation. Using a yeast two-hybrid screen, we find that the intracellular region of NRX interacts with N-ethylmaleimide-sensitive factor (NSF), an enzyme that mediates soluble NSF attachment protein receptor (SNARE) complex disassembly and plays an important role in synaptic vesicle release. We further map the binding sites of each molecule and demonstrate that the NRX/NSF interaction is critical for both the distribution of NSF at the presynaptic terminals and SNARE complex disassembly. Our results reveal a previously unknown role of NRX in the regulation of short term synaptic depression upon tetanic nerve stimulation and provide new mechanistic insights into the role of NRX in synaptic vesicle release. PMID:25953899

  2. Processive ATP-driven Substrate Disassembly by the N-Ethylmaleimide-sensitive Factor (NSF) Molecular Machine*♦

    PubMed Central

    Cipriano, Daniel J.; Jung, Jaemyeong; Vivona, Sandro; Fenn, Timothy D.; Brunger, Axel T.; Bryant, Zev

    2013-01-01

    SNARE proteins promote membrane fusion by forming a four-stranded parallel helical bundle that brings the membranes into close proximity. Post-fusion, the complex is disassembled by an AAA+ ATPase called N-ethylmaleimide-sensitive factor (NSF). We present evidence that NSF uses a processive unwinding mechanism to disassemble SNARE proteins. Using a real-time disassembly assay based on fluorescence dequenching, we correlate NSF-driven disassembly rates with the SNARE-activated ATPase activity of NSF. Neuronal SNAREs activate the ATPase rate of NSF by ∼26-fold. One SNARE complex takes an average of ∼5 s to disassemble in a process that consumes ∼50 ATP. Investigations of substrate requirements show that NSF is capable of disassembling a truncated SNARE substrate consisting of only the core SNARE domain, but not an unrelated four-stranded coiled-coil. NSF can also disassemble an engineered double-length SNARE complex, suggesting a processive unwinding mechanism. We further investigated processivity using single-turnover experiments, which show that SNAREs can be unwound in a single encounter with NSF. We propose a processive helicase-like mechanism for NSF in which ∼1 residue is unwound for every hydrolyzed ATP molecule. PMID:23775070

  3. Tissue deposition of gadolinium and development of NSF: a convergence of factors.

    PubMed

    Perazella, Mark A

    2008-01-01

    Gadolinium-based contrast (GBC) exposure has recently been linked to the development of nephrogenic systemic fibrosis (NSF) in patients with underlying kidney disease and may in fact be the previously unrecognized trigger for the fibrosing process. As NSF is fairly rare in this patient population, a number of permissive factors are likely required for GBC exposure to initiate fibrosis. Advanced kidney disease is an absolute requirement whereas vascular injury and an inflammatory state, and a mix of co-factors including increased serum phosphate and calcium concentrations and iron overload further enhance risk. The combination of these events allows excess circulating gadolinium, which dissociates from its chelate to leak out of vessels and deposit in tissues. Free or bound tissue gadolinium, a rare earth metal of the lanthanoid series, promotes fibrosis via either direct binding to the collagen helix or, once the metal has been engulfed by macrophages, through the production of free oxygen radicals, cytokines, and other profibrotic factors that attract circulating fibrocytes to tissues. These fibrocytes then differentiate into fibroblast-like spindle cells that produce connective tissue matrix and other angiogenic and growth factors that further enhance tissue fibrosis. Direct gadolinium activation of transglutaminases on these tissue fibroblast-like cells may also promote fibrosis.

  4. NSF Commits to Supercomputers.

    ERIC Educational Resources Information Center

    Waldrop, M. Mitchell

    1985-01-01

    The National Science Foundation (NSF) has allocated at least $200 million over the next five years to support four new supercomputer centers. Issues and trends related to this NSF initiative are examined. (JN)

  5. NSF Continental Lithosphere Program

    NASA Astrophysics Data System (ADS)

    Mayhew, Michael; MacGregor, Ian

    For several months the Continental Lithosphere Program (CL) of the National Science Foundation has been subject to a major review. The process was stimulated by a series of budget setbacks over the past few years. Although Presidential budget requests have been very favorable for the Division of Earth Sciences (EAR), and there has been strong support within the National Science Foundation and Congress, actual appropriations by Congress have been disappointing.In each year the final allocation to EAR has been affected by external factors beyond the control of the Foundation. In the four fiscal years from 1986 through 1989 the factors include reductions tied to the Gramm-Rudman deficit reduction measures, congressional reaction to the October 1987 stock market crash, and two years of protection for the Ocean Sciences part of the NSF budget that was paid for from the budgets of the Atmospheric and Earth Sciences divisions.

  6. Adolescent Sex Offenders' Rankings of Therapeutic Factors Using the Yalom Card Sort

    ERIC Educational Resources Information Center

    Sribney, Christine L.; Reddon, John R.

    2008-01-01

    Following 11-98 weeks of inpatient residential treatment, 69 male adolescent sex offenders completed the 60-item, 12-factor Yalom Card Sort. The rank orders were compared to adult sex offenders and a psychiatric adult outpatient group. Relative to adult psychiatric outpatients, the adolescent sex offenders had rated Instillation of Hope three…

  7. Regulation of neurotransmitter release kinetics by NSF.

    PubMed

    Schweizer, F E; Dresbach, T; DeBello, W M; O'Connor, V; Augustine, G J; Betz, H

    1998-02-20

    NSF (N-ethylmaleimide-sensitive factor) is an adenosine triphosphatase (ATPase) that contributes to a protein complex essential for membrane fusion. The synaptic function of this protein was investigated by injecting, into the giant presynaptic terminal of squid, peptides that inhibit the ATPase activity of NSF stimulated by the soluble NSF attachment protein (SNAP). These peptides reduced the amount and slowed the kinetics of neurotransmitter release as a result of actions that required vesicle turnover and occurred at a step subsequent to vesicle docking. These results define NSF as an essential participant in synaptic vesicle exocytosis that regulates the kinetics of neurotransmitter release and, thereby, the integrative properties of synapses.

  8. NSF graduate awards

    NASA Astrophysics Data System (ADS)

    Richman, Barbara T.

    Of the 450 college students offered fellowships by the National Science Foundation (NSF) this year for graduate study in 1983-1984 in the natural and social sciences, mathematics, and engineering, 40 plan to pursue graduate studies in earth, ocean, or space sciences. None of the 50 science students awarded NSF minority graduate fellowship awards plans to study in the geophysics-related sciences.Each fellowship, awarded for 3 years of graduate study, provides a stipend of $6,900 per year for full-time graduate study. An annual cost-of-education allowance of $4,000 is provided by NSF in lieu of all tuition and fees to the institution selected by each fellow for graduate study. The fellowships may be used over 5 years to permit students to incorporate teaching or research assistantships into their education during periods in which they are not receiving their fellowship stipends.

  9. NSF Graduate Fellowships

    NASA Astrophysics Data System (ADS)

    Richman, Barbara T.

    1984-04-01

    Of the 540 college students offered fellowships by the National Science Foundation (NSF) this year for graduate study in 1984-1985 in the natural and social sciences, mathematics, and engineering, 34 plan to pursue graduate studies in the earth, ocean, or space sciences. In addition, of the 60 NSF Minority Graduate Fellowships awarded this year, 2 were offered to students who plan graduate studies in the earth, ocean, and space sciences.Each fellowship, awarded for 3 years of graduate study, provides a stipend of $8,100 per year for full-time graduate study. An annual cost-of-education allowance of $4,900 is provided by NSF in lieu of all tuition and fees to the institution selected by each fellow for graduate study. The fellowships may be used over 5 years to permit students to incorporate teaching or research assistantships into their education during periods in which they are not receiving their fellowship stipends.

  10. Protected programs at NSF

    NASA Astrophysics Data System (ADS)

    Katzoff, Judith A.

    Many scientists and science administrators say they are disturbed by the fact that Congress “protected” funding for some National Science Foundation (NSF) programs in the fiscal year (FY) 1987 budget at a cost to other NSF programs. Especially disturbing to some was the notion that the earmarking reportedly occurred as a result of special interest lobbying efforts by their fellow scientists. The favored programs, and those that were cut back to compensate for them, were mostly related to geophysics. The protection of these programs is likely to have some impact on the size and number of grants awarded in some other areas.

  11. Latent structure of the Wisconsin Card Sorting Test: a confirmatory factor analytic study.

    PubMed

    Greve, Kevin W; Stickle, Timothy R; Love, Jeffrey M; Bianchini, Kevin J; Stanford, Matthew S

    2005-05-01

    The present study represents the first large scale confirmatory factor analysis of the Wisconsin Card Sorting Test (WCST). The results generally support the three factor solutions reported in the exploratory factor analysis literature. However, only the first factor, which reflects general executive functioning, is statistically sound. The secondary factors, while likely reflecting meaningful cognitive abilities, are less stable except when all subjects complete all 128 cards. It is likely that having two discontinuation rules for the WCST has contributed to the varied factor analytic solutions reported in the literature and early discontinuation may result in some loss of useful information. Continued multivariate research will be necessary to better clarify the processes underlying WCST performance and their relationships to one another.

  12. NSF adopts new criteria

    NASA Astrophysics Data System (ADS)

    Friebele, Elaine

    Beginning in October, grant proposals submitted to the National Science Foundation will be reviewed according to new criteria. The four aspects now used by NSF reviewers to evaluate proposals will be reduced to two: intellectual merit and broader impact to society.NSF's more comprehensive strategic plan and stronger emphasis on education prompted the first change in its merit review criteria since 1981. The second new criterion—the proposed activity's impact to society—combines two present criteria regarding the relevance of the research and its effect on the infrastructure of science and engineering. The new criteria are organized in a way that, according to administrators, should make them more flexible and easier to use.

  13. NSF 1990 Plan

    NASA Astrophysics Data System (ADS)

    Jones, R.

    The National Science Foundation has released its Fiscal Year 1990 Current Plan, making expected cuts in some of the activities it supports. These cuts come on the heels of the reduction of grant and cooperative agreement increments by 2% from their originally committed amounts.NSF started with the budget request for FY 1990, subtracted the amounts cut by Congress, Gramm-Rudman-Hollings sequestration, and the across-the-board reductions for the war on drugs, and then calculated an overall funding increase of 8% over FY 1989. Funding for research and related activities was “particularly hard hit,” NSF said, and will increase by only 5%. The increase is 6% when the amount for academic research facilities is included. (That amount would have been lower had not money been reallocated into academic research facilities that was to have been used to build 10-12 new science and technology centers.)

  14. NSF announces diversity programme

    NASA Astrophysics Data System (ADS)

    Kruesi, Liz

    2016-04-01

    The US National Science Foundation (NSF) has initiated a new funding programme that will create schemes to increase diversity in science, technology, engineering and mathematics (STEM). The initiative - Inclusion across the Nation of Communities of Learners of Underrepresented Discoverers in Engineering and Science (INCLUDES) - aims to increase the participation of women, those with a low socioeconomic status, people with disabilities and those from minority racial backgrounds.

  15. A biomechanical sorting of clinical risk factors affecting osteoporotic hip fracture.

    PubMed

    Luo, Y

    2016-02-01

    Osteoporotic fracture has been found associated with many clinical risk factors, and the associations have been explored dominantly by evidence-based and case-control approaches. The major challenges emerging from the studies are the large number of the risk factors, the difficulty in quantification, the incomplete list, and the interdependence of the risk factors. A biomechanical sorting of the risk factors may shed lights on resolving the above issues. Based on the definition of load-strength ratio (LSR), we first identified the four biomechanical variables determining fracture risk, i.e., the risk of fall, impact force, bone quality, and bone geometry. Then, we explored the links between the FRAX clinical risk factors and the biomechanical variables by looking for evidences in the literature. To accurately assess fracture risk, none of the four biomechanical variables can be ignored and their values must be subject-specific. A clinical risk factor contributes to osteoporotic fracture by affecting one or more of the biomechanical variables. A biomechanical variable represents the integral effect from all the clinical risk factors linked to the variable. The clinical risk factors in FRAX mostly stand for bone quality. The other three biomechanical variables are not adequately represented by the clinical risk factors. From the biomechanical viewpoint, most clinical risk factors are interdependent to each other as they affect the same biomechanical variable(s). As biomechanical variables must be expressed in numbers before their use in calculating LSR, the numerical value of a biomechanical variable can be used as a gauge of the linked clinical risk factors to measure their integral effect on fracture risk, which may be more efficient than to study each individual risk factor.

  16. Divergent retroviral late-budding domains recruit vacuolar protein sorting factors by using alternative adaptor proteins.

    PubMed

    Martin-Serrano, Juan; Yarovoy, Anton; Perez-Caballero, David; Bieniasz, Paul D; Yaravoy, Anton

    2003-10-14

    The release of enveloped viruses from infected cells often requires a virally encoded activity, termed a late-budding domain (L domain), encoded by essential PTAP, PPXY, or YPDL sequence motifs. PTAP-type L domains recruit one of three endosomal sorting complexes required for transport (ESCRT-I). However, subsequent events in viral budding are poorly defined, and neither YPDL nor PPXY-type L domains require ESCRT-I. Here, we show that ESCRT-I and other class E vacuolar protein sorting (VPS) factors are linked by a complex series of protein-protein interactions. In particular, interactions between ESCRT-I and ESCRT-III are bridged by AIP-1/ALIX, a mammalian orthologue of the yeast class E VPS factor, Bro1. Expression of certain ESCRT-III components as fusion proteins induces a late budding defect that afflicts all three L-domain types, suggesting that ESCRT-III integrity is required in a general manner. Notably, the prototype YPDL-type L domain encoded by equine infectious anemia virus (EIAV) acts by recruiting AIP-1/ALIX and expression of a truncated form of AIP-1/ALIX or small interfering RNA-induced AIP-1/ALIX depletion specifically inhibits EIAV YPDL-type L-domain function. Overall, these findings indicate that L domains subvert a subset of class E VPS factors to mediate viral budding, some of which are required for each of the L-domain types, whereas others apparently act as adaptors to physically link specific L-domain types to the class E VPS machinery.

  17. Benefits of NSF work

    NASA Astrophysics Data System (ADS)

    Packard, Ted

    This fall I will leave my rotatorship as Associate Director for Chemical Oceanography at the National Science Foundation. I have very much enjoyed my duty and want to outline for those who may become “rotators” some of the job's benefits, since NSF is now seeking applicants to replace me. Batiza, Rea and Rumble [Eos, 69, 801, 1988] have discussed the rotator's experience; my comments supplement their points.The most important benefit in working at NSF is the breadth of vision you acquire. This is important for researchers, because it pulls you away from your narrowly focused subfield and forces you to review again, as you did as a graduate student, your entire field. For teachers, this benefit is equally important, because you will keep up with current research even while away from teaching your up-to-date balanced courses. During my stay here I have reviewed proposals to study trace metals scavenging, gas exchange, sediment traps, biochemical cycling, stable and unstable isotopes, lipid biomarkers, sediment diagenesis, anoxic redox processes, and many other exciting topics. Some research areas, such as the vent and seep studies, had not been conceived when I was a graduate student in the sixties, so my experience here has been, in fact, a real sabbatical.

  18. UBE4B protein couples ubiquitination and sorting machineries to enable epidermal growth factor receptor (EGFR) degradation.

    PubMed

    Sirisaengtaksin, Natalie; Gireud, Monica; Yan, Qing; Kubota, Yoshihisa; Meza, Denisse; Waymire, Jack C; Zage, Peter E; Bean, Andrew J

    2014-01-31

    The signaling of plasma membrane proteins is tuned by internalization and sorting in the endocytic pathway prior to recycling or degradation in lysosomes. Ubiquitin modification allows recognition and association of cargo with endosomally associated protein complexes, enabling sorting of proteins to be degraded from those to be recycled. The mechanism that provides coordination between the cellular machineries that mediate ubiquitination and endosomal sorting is unknown. We report that the ubiquitin ligase UBE4B is recruited to endosomes in response to epidermal growth factor receptor (EGFR) activation by binding to Hrs, a key component of endosomal sorting complex required for transport (ESCRT) 0. We identify the EGFR as a substrate for UBE4B, establish UBE4B as a regulator of EGFR degradation, and describe a mechanism by which UBE4B regulates endosomal sorting, affecting cellular levels of the EGFR and its downstream signaling. We propose a model in which the coordinated action of UBE4B, ESCRT-0, and the deubiquitinating enzyme USP8 enable the endosomal sorting and lysosomal degradation of the EGFR.

  19. New directions at NSF

    NASA Astrophysics Data System (ADS)

    Harvey, Albert B.

    1995-10-01

    The mission and scope of the National Science Foundation (NSF) and lightwave technology will be very briefly discussed. The focus of the presentation will be directed toward changes in research support that are taking place and the opportunities we have for aiming our research to meet the challenges and needs that face the nation. In the USA it is very clear that defense oriented research is downsizing and is being redirected into economy driven aresas, such as manufacturing, business, and industry. For those researchers who are willing to move into these areas and find a niche, the rewards may be very great. Industrial research partners should also seize these opportunities to enhance their resources in an otherwise bleak future for industrial support of basic research in lightwave technology and many other reserach disciplines. These activities of bringing together industry and academia will have the value added benefit of providing increased job opportunities for students. An outline of some of these opportunities and incentives will be presented. On the international front, there has never been a better time for the encouragement of joint research and collaboration across borders. The economic potential for involvement in Eastern Europe and Asia are enormous. Agencies like ourselves are open to help support of visiting scientist/engineer exchange, international conferences and forums and support of innovative ideas to help further enhance economic developemnt of the world and hence the quality of life. The presence of the Russian delegation here at these SPIE meetings in in part the result of NSF support. Concomitant with these changes is a growing interest in education. Academia is gradually realizing that education includes training for students to acquire jobs and hence we complete the cycle of the importance of interacting with industry. At the NSF a major new initiative is being introduced in Optical Science and Engineering (OSE). This effort has been

  20. Molecular chaperones and stress-inducible protein-sorting factors coordinate the spatiotemporal distribution of protein aggregates

    PubMed Central

    Malinovska, Liliana; Kroschwald, Sonja; Munder, Matthias C.; Richter, Doris; Alberti, Simon

    2012-01-01

    Acute stress causes a rapid redistribution of protein quality control components and aggregation-prone proteins to diverse subcellular compartments. How these remarkable changes come about is not well understood. Using a phenotypic reporter for a synthetic yeast prion, we identified two protein-sorting factors of the Hook family, termed Btn2 and Cur1, as key regulators of spatial protein quality control in Saccharomyces cerevisiae. Btn2 and Cur1 are undetectable under normal growth conditions but accumulate in stressed cells due to increased gene expression and reduced proteasomal turnover. Newly synthesized Btn2 can associate with the small heat shock protein Hsp42 to promote the sorting of misfolded proteins to a peripheral protein deposition site. Alternatively, Btn2 can bind to the chaperone Sis1 to facilitate the targeting of misfolded proteins to a juxtanuclear compartment. Protein redistribution by Btn2 is accompanied by a gradual depletion of Sis1 from the cytosol, which is mediated by the sorting factor Cur1. On the basis of these findings, we propose a dynamic model that explains the subcellular distribution of misfolded proteins as a function of the cytosolic concentrations of molecular chaperones and protein-sorting factors. Our model suggests that protein aggregation is not a haphazard process but rather an orchestrated cellular response that adjusts the flux of misfolded proteins to the capacities of the protein quality control system. PMID:22718905

  1. Molecular chaperones and stress-inducible protein-sorting factors coordinate the spatiotemporal distribution of protein aggregates.

    PubMed

    Malinovska, Liliana; Kroschwald, Sonja; Munder, Matthias C; Richter, Doris; Alberti, Simon

    2012-08-01

    Acute stress causes a rapid redistribution of protein quality control components and aggregation-prone proteins to diverse subcellular compartments. How these remarkable changes come about is not well understood. Using a phenotypic reporter for a synthetic yeast prion, we identified two protein-sorting factors of the Hook family, termed Btn2 and Cur1, as key regulators of spatial protein quality control in Saccharomyces cerevisiae. Btn2 and Cur1 are undetectable under normal growth conditions but accumulate in stressed cells due to increased gene expression and reduced proteasomal turnover. Newly synthesized Btn2 can associate with the small heat shock protein Hsp42 to promote the sorting of misfolded proteins to a peripheral protein deposition site. Alternatively, Btn2 can bind to the chaperone Sis1 to facilitate the targeting of misfolded proteins to a juxtanuclear compartment. Protein redistribution by Btn2 is accompanied by a gradual depletion of Sis1 from the cytosol, which is mediated by the sorting factor Cur1. On the basis of these findings, we propose a dynamic model that explains the subcellular distribution of misfolded proteins as a function of the cytosolic concentrations of molecular chaperones and protein-sorting factors. Our model suggests that protein aggregation is not a haphazard process but rather an orchestrated cellular response that adjusts the flux of misfolded proteins to the capacities of the protein quality control system.

  2. NSF Director Bloch Stresses Effectiveness and Efficiency.

    ERIC Educational Resources Information Center

    Lepkowski, Wil

    1985-01-01

    The text of an interview with Erich Bloch, National Science Foundation (NSF) director, is provided. Among the topics/issues explored are NSF's role in policy research, mission and goals of NSF, establishment of NSF Engineering Research Centers, and national security issues involving access to supercomputers in universities that NSF is funding. (JN)

  3. Astrophysicist nominated to head NSF

    NASA Astrophysics Data System (ADS)

    Gwynne, Peter

    2013-09-01

    US president Barack Obama has nominated astrophysicist France Córdova as the next director of the National Science Foundation (NSF) - the country's biggest funder of basic research with an annual budget of 7bn.

  4. Structural Requirements for Function of Yeast GGAs in Vacuolar Protein Sorting, α-Factor Maturation, and Interactions with Clathrin

    PubMed Central

    Mullins, Chris; Bonifacino, Juan S.

    2001-01-01

    The GGAs (Golgi-localized, gamma-ear-containing, ARF-binding proteins) are a family of multidomain adaptor proteins involved in protein sorting at the trans-Golgi network of eukaryotic cells. Here we present results from a functional characterization of the two Saccharomyces cerevisiae GGAs, Gga1p and Gga2p. We show that deletion of both GGA genes causes defects in sorting of carboxypeptidase Y (CPY) and proteinase A to the vacuole, vacuolar morphology, and maturation of α-factor. A structure-function analysis reveals a requirement of the VHS, GAT, and hinge for function, while the GAE domain is less important. We identify putative clathrin-binding motifs in the hinge domain of both yeast GGAs. These motifs are shown to mediate clathrin binding in vitro. While mutation of these motifs alone does not block function of the GGAs in vivo, combining these mutations with truncations of the hinge and GAE domains diminishes function, suggesting functional cooperation between different clathrin-binding elements. Thus, these observations demonstrate that the yeast GGAs play important roles in the CPY pathway, vacuole biogenesis, and α-factor maturation and identify structural determinants that are critical for these functions. PMID:11689690

  5. NSF visiting professorships for women

    NASA Astrophysics Data System (ADS)

    The deadline date for the National Science Foundation's Visiting Professorships for Women (VPW) program is November 15. The program enables experienced women scientists and engineers to undertake advanced research and teaching at host institutions where they can also provide guidance and encouragement to other women who want to pursue research careers. NSF is particularly interested in increasing participation in research of minority women and women with disabilities.

  6. Research Funding Set for NSF, NASA, EPA.

    ERIC Educational Resources Information Center

    Chemical and Engineering News, 1982

    1982-01-01

    Funds (1983) for National Science Foundation (NSF), National Aeronautics and Space Administration (NASA), and Environmental Protection Agency (EPA) research programs include $1,092,200,000 (NSF), $5.5 billion (NASA), and $119 million (EPA). NSF's science education activities were raised to $30 million in spite of the Administration's plan to phase…

  7. Research Funding Set for NSF, NASA, EPA.

    ERIC Educational Resources Information Center

    Chemical and Engineering News, 1982

    1982-01-01

    Funds (1983) for National Science Foundation (NSF), National Aeronautics and Space Administration (NASA), and Environmental Protection Agency (EPA) research programs include $1,092,200,000 (NSF), $5.5 billion (NASA), and $119 million (EPA). NSF's science education activities were raised to $30 million in spite of the Administration's plan to phase…

  8. Sorting choanoflagellates

    NASA Astrophysics Data System (ADS)

    Marconi, Veronica I.; Miño, Gaston L.; Sparacino, Javier; Banchio, Adolfo J.; Condat, Carlos A.; Koehl, Mimi A. R.; King, Nicole; Stocker, Roman

    2015-03-01

    In freshwater environments, as well as in oceans, environmental conditions are in constant fluctuation. Some heterotrophic plankton must adapt their swimming behavior in order to survive under these conditions. In the case of the choanoflagellate, the closest animal ancestor, the ability to forage for food is given not only by its single flagellum, but also by its differentiation between fast and slow swimmers. The understanding of how these cells with different strategies to swim search for food can give us a better insight into how eukaryotes respond to different stimuli. In this work, we have designed a microfluidic device that sorts choanoflagellates by their speed. The optimal geometry was found by a numerical model using the experimentally determined motilities of each swimmer type.

  9. NSF Geosciences Draft Report Available for Comment

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2014-08-01

    The U.S. National Science Foundation's Advisory Committee for the Geosciences (NSF's AC GEO) is seeking comments from the Earth science community on a draft document issued on 7 August that outlines "imperatives and frontier areas" for NSF's Directorate for Geosciences (GEO). The report, Dynamic Earth: GEO Priorities & Frontiers 2015-2020, is an update to the directorate's 2009 report, GEO Vision.

  10. Opportunities for Funding at NSF

    NASA Astrophysics Data System (ADS)

    Kafafi, Zakya H.

    2009-03-01

    lead to a better quality of life and improved economic development for people all over the world will also be given. As science is becoming increasingly global, DMR is particularly interested in preparing students to be agile thinkers in this universal environment and in forging collaborations and cooperation among scientists and engineers around the world. Free movement of knowledge without any obstacles can only be achieved through a more coordinated approach for international collaboration. Following the presentation there will be a question-and-answer period. For additional information, visit the DMR Web page at www.nsf.gov/materials

  11. Derivation of sorting programs

    NASA Technical Reports Server (NTRS)

    Varghese, Joseph; Loganantharaj, Rasiah

    1990-01-01

    Program synthesis for critical applications has become a viable alternative to program verification. Nested resolution and its extension are used to synthesize a set of sorting programs from their first order logic specifications. A set of sorting programs, such as, naive sort, merge sort, and insertion sort, were successfully synthesized starting from the same set of specifications.

  12. Characterization of E3 ligases involved in lysosomal sorting of the HIV-1 restriction factor BST2

    PubMed Central

    Berlioz-Torrent, Clarisse

    2017-01-01

    ABSTRACT The cellular protein BST2 (also known as tetherin) acts as a major intrinsic antiviral protein that prevents the release of enveloped viruses by trapping nascent viral particles at the surface of infected cells. Viruses have evolved specific strategies to displace BST2 from viral budding sites in order to promote virus egress. In HIV-1, the accessory protein Vpu counters BST2 antiviral activity and promotes sorting of BST2 for lysosomal degradation. Vpu increases polyubiquitylation of BST2, a post-translation modification required for Vpu-induced BST2 downregulation, through recruitment of the E3 ligase complex SCF adaptors β-TrCP1 and β-TrCP2 (two isoforms encoded by BTRC and FBXW11, respectively). Herein, we further investigate the role of the ubiquitylation machinery in the lysosomal sorting of BST2. Using a small siRNA screen, we highlighted two additional regulators of BST2 constitutive ubiquitylation and sorting to the lysosomes: the E3 ubiquitin ligases NEDD4 and MARCH8. Interestingly, Vpu does not hijack the cellular machinery that is constitutively involved in BST2 ubiquitylation to sort BST2 for degradation in the lysosomes but instead promotes the recognition of BST2 by β-TrCP proteins. Altogether, our results provide further understanding of the mechanisms underlying BST2 turnover in cells. PMID:28320822

  13. The schizophrenia susceptibility factor dysbindin and its associated complex sort cargoes from cell bodies to the synapse

    PubMed Central

    Larimore, Jennifer; Tornieri, Karine; Ryder, Pearl V.; Gokhale, Avanti; Zlatic, Stephanie A.; Craige, Branch; Lee, Joshua D.; Talbot, Konrad; Pare, Jean-Francois; Smith, Yoland; Faundez, Victor

    2011-01-01

    Dysbindin assembles into the biogenesis of lysosome-related organelles complex 1 (BLOC-1), which interacts with the adaptor protein complex 3 (AP-3), mediating a common endosome-trafficking route. Deficiencies in AP-3 and BLOC-1 affect synaptic vesicle composition. However, whether AP-3-BLOC-1–dependent sorting events that control synapse membrane protein content take place in cell bodies upstream of nerve terminals remains unknown. We tested this hypothesis by analyzing the targeting of phosphatidylinositol-4-kinase type II α (PI4KIIα), a membrane protein present in presynaptic and postsynaptic compartments. PI4KIIα copurified with BLOC-1 and AP-3 in neuronal cells. These interactions translated into a decreased PI4KIIα content in the dentate gyrus of dysbindin-null BLOC-1 deficiency and AP-3–null mice. Reduction of PI4KIIα in the dentate reflects a failure to traffic from the cell body. PI4KIIα was targeted to processes in wild-type primary cultured cortical neurons and PC12 cells but failed to reach neurites in cells lacking either AP-3 or BLOC-1. Similarly, disruption of an AP-3–sorting motif in PI4KIIα impaired its sorting into processes of PC12 and primary cultured cortical neuronal cells. Our findings indicate a novel vesicle transport mechanism requiring BLOC-1 and AP-3 complexes for cargo sorting from neuronal cell bodies to neurites and nerve terminals. PMID:21998198

  14. Factors associated with fertility of nulliparous dairy heifers following a 10-day fixed-time artificial insemination program with sex-sorted and conventional semen.

    PubMed

    Noonan, E J; Kelly, J C; Beggs, D S

    2016-05-01

    To examine factors associated with fertility on dairy farms that used a common fixed-time artificial insemination (FTAI) program in yearling heifers. Records were analysed from 954 yearling heifers on 10 south-west Victorian dairy farms that used a common FTAI program, involving the insertion of a 1.9-g progesterone-releasing device for 10 days; 2 mg oestradiol benzoate at insertion; 500 µg cloprostenol on day 7; and FTAI 48 h after device removal. Weight, age, expression of oestrus, sire, semen type (frozen sex-sorted or frozen conventional) and timing of insemination were examined for their relationship with first-service conception rates. Heifers over 300 kg body weight were 1.18-fold more likely to express oestrus during the FTAI program. For every extra 1 kg, there was a 1.5% increase in the likelihood of expressing oestrus. First-service conception rates were 40.3% and 56.0% for sex-sorted and conventional semen, respectively, and were significantly higher when oestrus was expressed. The difference was greater for sex-sorted semen (3.4-fold) compared with conventional semen (1.5-fold). The interval from device removal to insemination varied between 47 and 51.4 h and had no significant effect on conception rates. However, there was a trend towards a higher conception rate for sex-sorted semen when inseminations were performed >50 h after device removal. Increased fertility was associated with larger heifers and heifers that expressed oestrus, particularly when sexed-sorted semen was used. Variation in the timing of AI with respect to device removal between 47 and 51.4 h did not adversely affect conception rates. © 2016 Australian Veterinary Association.

  15. NSF's role in Antarctic environment scrutinized

    NASA Astrophysics Data System (ADS)

    Bush, Susan

    In the last few years, the National Science Foundation has come under criticism by environmental groups for inadequate stewardship in the U.S. Antarctic Program's environmental issues. Since 1978, NSF was given full responsibility, by Executive Order, for budgeting and managing the entire U.S. national program in Antarctica, including logistics support. NSF has also been responsible for the compliance of the U.S. Antarctic Program with environmental protection measures agreed to by the Antarctic Treaty nations. Specifically under fire by environmentalists have been NSF's maintenance of a land-fill, open-air burning of solid waste, and the removal of toxic substances. According to Peter E. Wilkniss, director of the Division of Polar Programs at NSF, open burning is no longer taking place and will not be allowed in the future.

  16. Factors affecting carcass value and profitability in early-weaned Simmental steers: II. Days on feed endpoints and sorting strategies.

    PubMed

    Pyatt, N A; Berger, L L; Faulkner, D B; Walker, P M; Rodriguez-Zas, S L

    2005-12-01

    In a 4-yr study, early-weaned Simmental steers (n = 192) of known genetics were individually fed to determine EPD, performance, and carcass measurements explaining variation in carcass value and profitability across incremental days on feed (DOF) when sorted by HCW, calculated yield grade (YG), or at their highest profit endpoint (BEST). Steers were weaned at 88.0 +/- 1.1 d of age, pen-fed a high-concentrate diet for 84.5 +/- 0.4 d, individually fed for 249.7 +/- 0.7 d, and slaughtered at 423.3 +/- 1.4 d of age. Carcass weight, YG, and marbling score (MS) were predicted using real-time ultrasound throughout the finishing period to calculate carcass value and profitability at 90, 60, 30 d preslaughter and under three individual sorting strategies. Sorting strategies included marketing the 25 and 50% heaviest HCW, the highest YG at d 60 and 30, or the remaining 25% at 0-d endpoints. Independent variables were year, weaning weight EPD, yearling weight EPD, marbling EPD, DMI, ADG, HCW, YG, and MS. Profit was quadratic in response to increased DOF; the greatest economic return was noted on d 30 (pre-slaughter). Final weight, DMI, HCW, MS, and YG increased (linear; P < 0.001) with additional DOF, and ADG and G:F decreased (linear; P < 0.001). Total cost of gain was quadratic (P < 0.001), and incremental cost of gain rose at an increasing rate (quadratic; P < 0.001) with increased DOF. With increasing DOF, HCW importance decreased from 58 to 21%; MS was variable, ranging from 18 to 23%; and YG and DMI were minor contributors to profit variation. Among sorting strategies, final BW and HCW were greater for BEST, whereas other measurements were similar. Sorting individuals by HCW, YG, or at BEST increased profitability 3.70 dollars, 2.52 dollars, or 30.65 dollars over the optimal group DOF endpoint (d 30). Retrospective analyses illustrated that sorting does not need to pinpoint each animal's profit optimum to result in economic gains; rather, increasing HCW and decreasing

  17. Geochemistry of Jurassic to earliest Cretaceous deposits in the Nagato Basin, SW Japan: implication of factor analysis to sorting effects and provenance signatures

    NASA Astrophysics Data System (ADS)

    Ohta, Tohru

    2004-10-01

    One of the intractable problems in provenance analysis is the hydraulic sorting effect and resultant mineralogical heterogeneity in coarse- and fine-grained sediments which conceals provenance characteristics. The present study uses factor analysis to address geochemical responses to the sorting effect and provenance of Late Mesozoic sediments in the Nagato Basin, SW Japan. Factor analysis has proven useful for comprehending geochemical gradients between coarse- and fine-grained sediments. In the present example, compositional differences are based on varying proportions of quartz, plagioclase, chrome spinel, authigenic minerals and phyllosilicates. The contrasting behaviors of these minerals during the depositional stage resulted in the systematic fractionation of SiO 2/Al 2O 3, Na 2O/K 2O and Cr/Ba. Sandstones and mudstones exhibit an array of compositions in SiO 2/Al 2O 3-Na 2O/K 2O and SiO 2/Al 2O 3-Cr/Ba diagrams, the ranges of which reflect compositional variations due to the sorting effect. Sediments of different provenance exhibit distinctive mineral arrays and can be discriminated simply by reading the gradients of the continua. Therefore, this kind of data management concurrently quantifies the sorting effect and allows an estimation of the original source material. The SiO 2/Al 2O 3-Na 2O/K 2O diagram is particularly useful for scrutinizing igneous and mature continental provenances, while the SiO 2/Al 2O 3-Cr/Ba diagram ascertains contributions from mafic sources. This investigative approach delineates a systematic provenance transition within the Nagato Basin: a serpentinite melange provenance in the early Early Jurassic, a magmatic arc in the late Early to middle Middle Jurassic and a continental interior in the latest Jurassic to earliest Cretaceous. The provenance changed by the direct input of mature continental material into the Nagato Basin, which resulted from dissection of the volcanic arc.

  18. NSF's Career-Life Balance Initiative and the NSF Astronomy and Astrophysics Postdoctoral Fellowships

    NASA Astrophysics Data System (ADS)

    Ajhar, Edward A.

    2013-01-01

    In the fall of 2011, the National Science Foundation (NSF) began the Career-Life Balance Initiative to support graduate students, postdoctoral students, and early-career researchers in STEM fields. NSF is focusing first on its most prestigious programs for early-career scientists---the CAREER program and the postdoctoral programs, including the NSF Astronomy and Astrophysics Postdoctoral Fellowships (AAPF)---where career-life balance opportunities can help retain a significant fraction of early career talent. Subject to budget constraints, NSF plans to further integrate and enhance career-life balance opportunities over time through other programs, like the Graduate Research Fellowships Program and ADVANCE, and subsequently through the broader portfolio of NSF activities. In addition, to comply with Title IX, NSF has regulations to ensure that educational programs that receive NSF funds are free of gender discrimination and harassment. A primary goal of this presentation is to put facts about NSF into the hands of students, faculty, staff, administrators and other policy makers to benefit the advancement of career-life balance in the astronomical community. The presentation focus areas will (1) address common misconceptions about NSF rules regarding parental leave; (2) discuss benefits already available through the AAPF program, Graduate Research Fellowships, and other programs; and (3) listen to community concerns and issues to bring these back to the foundation for consideration. Did you know that NSF allows paid parental leave under many circumstances? For example, the AAPF program currently allows two months of paid parental leave during the fellow's tenure. What are the rules for NSF Graduate Research Fellowships? Come to the session and find out; the answers to such questions might surprise you.

  19. Demonstration of differential quantitative requirements for NSF among multiple vesicle fusion pathways of GLUT4 using a dominant-negative ATPase-deficient NSF

    SciTech Connect

    Chen Xiaoli; Matsumoto, Hideko; Hinck, Cynthia S.; Al-Hasani, Hadi; St-Denis, Jean-Francois; Whiteheart, Sidney W.; Cushman, Samuel W. . E-mail: sam_cushman@nih.gov

    2005-07-22

    In this study, we investigated the relative participation of N-ethylmaleimide-sensitive factor (NSF) in vivo in a complex multistep vesicle trafficking system, the translocation response of GLUT4 to insulin in rat adipose cells. Transfections of rat adipose cells demonstrate that over-expression of wild-type NSF has no effect on total, or basal and insulin-stimulated cell-surface expression of HA-tagged GLUT4. In contrast, a dominant-negative NSF (NSF-D1EQ) can be expressed at a low enough level that it has little effect on total HA-GLUT4, but does reduce both basal and insulin-stimulated cell-surface HA-GLUT4 by {approx}50% without affecting the GLUT4 fold-translocation response to insulin. However, high expression levels of NSF-D1EQ decrease total HA-GLUT4. The inhibitory effect of NSF-D1EQ on cell-surface HA-GLUT4 is reversed when endocytosis is inhibited by co-expression of a dominant-negative dynamin (dynamin-K44A). Moreover, NSF-D1EQ does not affect cell-surface levels of constitutively recycling GLUT1 and TfR, suggesting a predominant effect of low-level NSF-D1EQ on the trafficking of GLUT4 from the endocytic recycling compared to the intracellular GLUT4-specific compartment. Thus, our data demonstrate that the multiple fusion steps in GLUT4 trafficking have differential quantitative requirements for NSF activity. This indicates that the rates of plasma and intracellular membrane fusion reactions vary, leading to differential needs for the turnover of the SNARE proteins.

  20. Wakimoto to head NSF geosciences directorate

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2012-11-01

    Roger Wakimoto has been selected as the new assistant director for the U.S. National Science Foundation's (NSF) Directorate for Geosciences (GEO), the agency announced on 7 November. Wakimoto, who has been director of the NSF-sponsored National Center for Atmospheric Research (NCAR) in Boulder, Colo., since 2010, begins his NSF appointment in February 2013. His selection culminates a national search begun last year to find a successor to former GEO assistant director Tim Killeen, whose term ended in June 2012. Margaret Cavanaugh has served as acting assistant director since Killeen's departure. An AGU member, Wakimoto is a geophysicist with expertise in tornadoes, thunderstorms, and other severe weather. He previously served as associate director for NCAR's Earth Observing Laboratory and as a professor and chair of the Department of Atmospheric Science at the University of California, Los Angeles.

  1. POCA Update: An NSF PAARE Project

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, S. D.; Cash, J. L.; Hartmann, D. H.; Howell, S. B.; King, J. R.; Leising, M. D.; Mayo, E. A.; Mighell, K. J.; Smith, D. M., Jr.

    2011-01-01

    We report on the status of "A Partnership in Observational and Computational Astronomy (POCA)” under the NSF's "Partnerships in Astronomy and Astrophysics Research and Education (PAARE)" program. This partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory. We have reached the midpoint of this 5-year award and discuss the successes, challenges and obstacles encountered to date. Included is a summary of our summer REU program, the POCA graduate fellowship program, faculty research capacity building, outreach activities, increased use of NSF facilities and shared resources. Additional POCA research presentations by the authors are described elsewhere in these proceedings. Support for this work was provided by the NSF PAARE program to South Carolina State University under award AST-0750814 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory.

  2. NSF losing Earth sciences research funds

    NASA Astrophysics Data System (ADS)

    Bell, Peter M.

    The Earth Sciences Division (EAR) of the National Science Foundation (NSF) faces a diminishing financial base from which to award grants for research, while the proposal pressure increases. Robin Brett, director of the division stated, ‘Now that the Ocean Drilling Division has become a separate entity [within the Foundation] the Division of Earth Sciences has no major facility, and with the exception of COCORP, at $2.8 million per year, we are a small science division, consisting of four programs—geology, geophysics, geochemistry, and petrology.’Brett noted, however, that the field of earth sciences research, which the NSF attempts to support, has grown rapidly in the past decade. Growth (in terms of people employed in the field) is predicted to increase markedly, as the following quotation from Science and Engineering Education for the 1980s and Beyond (NSF publication, 1980) attests:

  3. A novel Sec18p/NSF-dependent complex required for Golgi-to-endosome transport in yeast.

    PubMed

    Burd, C G; Peterson, M; Cowles, C R; Emr, S D

    1997-06-01

    The vacuolar protein-sorting (VPS) pathway of Saccharomyces cerevisiae mediates localization of proteins from the trans-Golgi to the vacuole via a prevacuolar endosome compartment. Mutations in class D vacuolar protein-sorting (vps) genes affect vesicle-mediated Golgi-to-endosome transport and result in secretion of vacuolar proteins. Temperature-sensitive-for-function (tsf) and dominant negative mutations in PEP12, encoding a putative SNARE vesicle receptor on the endosome, and tsf mutations in VAC1, a gene implicated in vacuole inheritance and vacuolar protein sorting, were constructed and used to demonstrate that Pep12p and Vac1p are components of the VPS pathway. The sequence of Vac1p contains two putative zinc-binding RING motifs, a zinc finger motif, and a coiled-coil motif. Site-directed mutations in the carboxyl-terminal RING motif strongly affected vacuolar protein sorting. Vac1p was found to be tightly associated with membranes as a monomer and in a large SDS-resistant complex. By using Pep12p affinity chromatography, we found that Vac1p, Vps45p (SEC1 family member), and Sec18p (yeast N-ethyl maleimide-sensitive factor, NSF) bind Pep12p. Consistent with a functional role for this complex in vacuolar protein sorting, double pep12tsfvac1tsf and pep12tsf vps45tsf mutants exhibited synthetic Vps- phenotypes, the tsf phenotype of the vac1tsf mutant was rescued by overexpression of VPS45 or PEP12, overexpression of a dominant pep12 allele in a sec18-1 strain resulted in a severe synthetic growth defect that was rescued by deletion of PEP12 or VAC1, and subcellular fractionation of vac1 delta cells revealed a striking change in the fractionation of Pep12p and Vps21p, a rab family GTPase required for vacuolar protein sorting. The functions of Pep12p, Vps45p, and Vps21p indicate that key aspects of Golgi-to-endosome trafficking are similar to other vesicle-mediated transport steps, although the role of Vac1p suggests that there are also novel components of the VPS

  4. Assessment of Factors Influencing Preservation of Dignity at Life's End: Creation and the Cross-Cultural Validation of the Preservation of Dignity Card-Sort Tool

    PubMed Central

    Noda, Arthur M.; Chmura Kraemer, Helena

    2010-01-01

    Abstract Background Preserving patient dignity is a sentinel premise of palliative care. This study was conducted to gain a better understanding of factors influencing preservation of dignity in the last chapter of life. Methods We conducted an open-ended written survey of 100 multidisciplinary providers (69% response rate) and responses were categorized to identify 2 main themes, 5 subthemes, and 10 individual factors that were used to create the preservation of dignity card-sort tool (p-DCT). The 10-item rank order tool was administered to a cohort of community dwelling Filipino Americans (n = 140, age mean = 61.3, 45% male and 55% female). A Spearman correlation matrix was constructed for all the 10 individual factors as well as the themes and subthemes based on the data generated by the subjects. Results The individual factors were minimally correlated with each other indicating that each factor was an independent stand-alone factor. The median, 25th and 75th percentile ranks were calculated and “s/he has self-respect” (intrinsic theme, self-esteem subtheme) emerged as the most important factor (mean rank 3.0 and median rank 2.0) followed by “others treat her/him with respect” (extrinsic theme, respect subtheme) with a mean rank = 3.6 and median = 3.0. Conclusion The p-DCT is a simple, rank order card-sort tool that may help clinicians identify patients' perceptions of key factors influencing the preservation of their dignity in the last chapter of life. PMID:20420549

  5. NSF Establishes First Four National Supercomputer Centers.

    ERIC Educational Resources Information Center

    Lepkowski, Wil

    1985-01-01

    The National Science Foundation (NSF) has awarded support for supercomputer centers at Cornell University, Princeton University, University of California (San Diego), and University of Illinois. These centers are to be the nucleus of a national academic network for use by scientists and engineers throughout the United States. (DH)

  6. NSF's Response to Gulf Oil Spill

    NASA Astrophysics Data System (ADS)

    Killeen, Tim

    2010-07-01

    Under its statutory authority, the U.S. National Science Foundation (NSF) is using its Rapid Response Research (RAPID) funding mechanism to support research on the Deepwater Horizon oil spill. NSF issued a “dear colleague” letter on 27 May reminding the U.S. academic research community that RAPID awards are a special grant mechanism developed specifically by the foundation to respond to unanticipated events such as earthquakes, volcanic eruptions, hurricanes, and other natural and man-made disasters where a timely response is essential to achieving research results. To date, NSF has received more than 90 unsolicited proposals for research and related activities from scientists and engineers at U.S. academic institutions wanting to launch or continue research in the Gulf of Mexico and along its shorelines related to the Deepwater Horizon oil spill. On the basis of reviews from NSF program officer teams, the foundation has funded 46 awards so far in fiscal year 2010, totaling $4.6 million for research and $2.5 million for ship costs.

  7. Biogenesis of lysosome-related organelles complex-1 subunit 1 (BLOS1) interacts with sorting nexin 2 and the endosomal sorting complex required for transport-I (ESCRT-I) component TSG101 to mediate the sorting of epidermal growth factor receptor into endosomal compartments.

    PubMed

    Zhang, Aili; He, Xin; Zhang, Ling; Yang, Lin; Woodman, Philip; Li, Wei

    2014-10-17

    Biogenesis of lysosome-related organelles complex-1 (BLOC-1) is a component of the molecular machinery required for the biogenesis of specialized organelles and lysosomal targeting of cargoes via the endosomal to lysosomal trafficking pathway. BLOS1, one subunit of BLOC-1, is implicated in lysosomal trafficking of membrane proteins. We found that the degradation and trafficking of epidermal growth factor receptor (EGFR) were delayed in BLOS1 knockdown cells, which were rescued through BLOS1 overexpression. A key feature to the delayed EGFR degradation is the accumulation of endolysosomes in BLOS1 knockdown cells or BLOS1 knock-out mouse embryonic fibroblasts. BLOS1 interacted with SNX2 (a retromer subunit) and TSG101 (an endosomal sorting complex required for transport subunit-I) to mediate EGFR lysosomal trafficking. These results suggest that coordination of the endolysosomal trafficking proteins is important for proper targeting of EGFR to lysosomes.

  8. Creation and the empirical validation of the dignity card-sort tool to assess factors influencing erosion of dignity at life's end.

    PubMed

    Periyakoil, Vyjeyanthi S; Kraemer, Helena Chmura; Noda, Arthur

    2009-12-01

    Patients often experience erosion of dignity as they cope with the dying process. Preserving patient dignity is a sentinel premise of palliative care. This study was conducted to gain a better understanding of factors influencing erosion of dignity at the end of life. We conducted an open-ended written survey of 100 multidisciplinary providers (69% response rate) and responses were categorized to identify 18 themes that were used to create a card-sort tool. The initial 18-item tool was administered to nurses (n = 83), nonhospice community-dwelling subjects (n = 190) and hospice patients (n = 26) and a principal component analysis (PCA) was used to identify the 6 primary factors. The key item in each factor as identified by the PCA was used to create the final 6-item dignity card-sort tool (DCT). The DCT was also administered to physicians caring for palliative care patients (n = 21). For each of the final 6 items, the correlation between the respondents (nurses, physicians, nonterminally ill subjects, and subjects receiving hospice care) was calculated using the Spearman's correlation coefficient. The nurses were very highly positively correlated with the physicians (correlation coefficient = 0.94) and the community-dwelling nonterminally ill subjects were highly positively correlated with the subjects receiving hospice care (correlation coefficient = 0.67). More importantly, both the nurses and physicians were negatively correlated with both community dwelling nonterminally ill subjects and the subjects receiving hospice care. The health professionals in the study felt that treating a patient with disrespect and not carrying out their wishes resulted in erosion of dignity. In contrast patients thought that poor medical care and untreated pain were the most important factors leading to erosion of dignity at life's end. The DCT is a promising tool that may help clinicians identify key factors resulting in perceptions of erosion of dignity in adult palliative care

  9. Creation and the Empirical Validation of the Dignity Card-Sort Tool To Assess Factors Influencing Erosion of Dignity at Life's End

    PubMed Central

    Chmura Kraemer, Helena; Noda, Arthur

    2009-01-01

    Abstract Patients often experience erosion of dignity as they cope with the dying process. Preserving patient dignity is a sentinel premise of palliative care. This study was conducted to gain a better understanding of factors influencing erosion of dignity at the end of life. We conducted an open-ended written survey of 100 multidisciplinary providers (69% response rate) and responses were categorized to identify 18 themes that were used to create a card-sort tool. The initial 18-item tool was administered to nurses (n = 83), nonhospice community-dwelling subjects (n = 190) and hospice patients (n = 26) and a principal component analysis (PCA) was used to identify the 6 primary factors. The key item in each factor as identified by the PCA was used to create the final 6-item dignity card-sort tool (DCT). The DCT was also administered to physicians caring for palliative care patients (n = 21). For each of the final 6 items, the correlation between the respondents (nurses, physicians, nonterminally ill subjects, and subjects receiving hospice care) was calculated using the Spearman's correlation coefficient. The nurses were very highly positively correlated with the physicians (correlation coefficient = 0.94) and the community-dwelling nonterminally ill subjects were highly positively correlated with the subjects receiving hospice care (correlation coefficient = 0.67). More importantly, both the nurses and physicians were negatively correlated with both community dwelling nonterminally ill subjects and the subjects receiving hospice care. The health professionals in the study felt that treating a patient with disrespect and not carrying out their wishes resulted in erosion of dignity. In contrast patients thought that poor medical care and untreated pain were the most important factors leading to erosion of dignity at life's end. The DCT is a promising tool that may help clinicians identify key factors resulting in perceptions of erosion of

  10. Caspase-mediated proteolysis of the sorting nexin 2 disrupts retromer assembly and potentiates Met/hepatocyte growth factor receptor signaling

    PubMed Central

    Duclos, Catherine M; Champagne, Audrey; Carrier, Julie C; Saucier, Caroline; Lavoie, Christine L; Denault, Jean-Bernard

    2017-01-01

    The unfolding of apoptosis involves the cleavage of hundreds of proteins by the caspase family of cysteinyl peptidases. Among those substrates are proteins involved in intracellular vesicle trafficking with a net outcome of shutting down the crucial processes governing protein transport to organelles and to the plasma membrane. However, because of the intertwining of receptor trafficking and signaling, cleavage of specific proteins may lead to unintended consequences. Here we show that in apoptosis, sorting nexin 1 and 2 (SNX1 and SNX2), two proteins involved in endosomal sorting, are cleaved by initiator caspases and also by executioner caspase-6 in the case of SNX2. Moreover, SNX1 is cleaved at multiple sites, including following glutamate residues. Cleavage of SNX2 results in a loss of association with the endosome-to-trans-Golgi network transport protein Vps35 and in a delocalization from endosomes of its associated partner Vps26. We also demonstrate that SNX2 depletion causes an increase in hepatocyte growth factor receptor tyrosine phosphorylation and Erk1/2 signaling in cells. Finally, we show that SNX2 mRNA and protein levels are decreased in colorectal carcinoma and that lower SNX2 gene expression correlates with an increase in cancer patient mortality. Our study reveals the importance to characterize the cleavage fragments produced by caspases of specific death substrates given their potential implication in the mechanism of regulation of physiological (signaling/trafficking) pathways or in the dysfunction leading to pathogenesis. PMID:28179995

  11. Requesting use of NSF facilities for education

    NASA Astrophysics Data System (ADS)

    Meitín, J. G.; Baeuerle, B. G.

    2009-12-01

    Research in the geosciences often requires specialized facilities and instrumentation to carry out field work that is needed to understand complex, interdependent processes, covering all regions of the globe. The National Science Foundation (NSF), Lower Atmospheric Observing Facilities (LAOF) Program consists of multi-user national facilities sponsored by NSF for the geosciences community. These facilities are made available to collect large and sometimes unique data sets in support of scientific research. The LAOF are managed by the National Center for Atmospheric Research, Colorado State University, University of Wyoming, and the Center for Severe Weather Research. The NSF reserves a portion of the LAOF funding for use by educators wishing to gain access to these observational facilities for classroom instruction and hands-on learning experience. This includes requesting that a facility be deployed to a university for a short period of time. A description of the available facilities and examples of previous educational deployments will be presented. Guidelines for submitting proposals will be discussed.

  12. Prevalence of NSF following intravenous gadolinium-contrast media administration in dialysis patients with endstage renal disease.

    PubMed

    Heinz-Peer, Gertraud; Neruda, Anita; Watschinger, Bruno; Vychytil, Andreas; Geusau, Alexandra; Haumer, Markus; Weber, Michael

    2010-10-01

    To evaluate the prevalence of nephrogenic systemic fibrosis (NSF) in a patient population being at highest risk for developing this disease and to evaluate possible risk factors. The radiological records of 552 patients with ESRD being on hemodialysis (HD) or peritoneal dialysis (PD) were retrospectively reviewed to identify whether the patients underwent MR-examinations with or without intravenous administration of GBCA. In case of exposure to GBCA, the number of contrast injections, the benchmark and the cumulative doses of GBCA, and possible cofactors regarding pathogenesis of NSF were recorded. Diagnosis of NSF was confirmed either by deep skin biopsy or by review of medical and histopathological records. Data of NSF patients were compared with data of dialysis patients who did not develop NSF after MR-examinations. 146 dialysis patients underwent MRI without i.v.-administration of GBCA. No case of NSF was observed in this patient population. 195/552 patients proved to have a total number of 325 well-documented exposures to GBCA. Seven different types of GBCA were used during these MR-examinations. NSF prevalence rate was 1.6%. One patient died of NSF. Three different types of GBCA were involved in 6 NSF cases. 4/6 proved to be confounded cases. The cumulative dose of GBCA, history of thrombosis, recent surgery, and the combination of HD and PD proved to be significant cofactors for the development of NSF (p<.05). No significant difference regarding residual renal clearance (p=.898) and residual urine volume (p=.083) was found between NSF and non-NSF patients. The prevalence of NSF proved to be much lower in this high risk patient group being exposed to GBCA compared to the literature. NSF was not observed in ESRD patients undergoing MRI without administration of GBCA. Our data support a positive association between cumulative dose of GBCA and development of NSF. No positive association was found between residual renal clearance and residual urine volume and

  13. Individual cell sorting.

    PubMed

    Stovel, R T; Sweet, R G

    1979-01-01

    Current cell sorting machines do not preserve the individual identity of processed cells; after analysis, the cells are assigned to a subpopulation where they are pooled with other similar cells. This paper reports progress on a system that sorts cells individually to precise locations on a microscope slide and preserves them for further observation with a light microscope while recording flow measurement data for each cell. Various electronic and mechanical modifications to an existing sorting machine are described that increase drop placement accuracy and permit individual cell sorting.

  14. Lineage sorting in apes.

    PubMed

    Mailund, Thomas; Munch, Kasper; Schierup, Mikkel Heide

    2014-01-01

    Recombination allows different parts of the genome to have different genealogical histories. When a species splits in two, allelic lineages sort into the two descendant species, and this lineage sorting varies along the genome. If speciation events are close in time, the lineage sorting process may be incomplete at the second speciation event and lead to gene genealogies that do not match the species phylogeny. We review different recent approaches to model lineage sorting along the genome and show how it is possible to learn about population sizes, natural selection, and recombination rates in ancestral species from application of these models to genome alignments of great ape species.

  15. New visiting scientists in NSF's Earth sciences

    NASA Astrophysics Data System (ADS)

    MacGregor, Ian

    The National Science Foundation's Division of Earth Sciences has hired two new rotators to serve as program directors, as part of the ongoing visiting scientists program. The new directors are Jonathan Fink in Geochemistry and Petrology, and L. Douglas James in Hydrological Sciences.Fink has exchanged roles for 1 year with NSF's John Snyder, who is on sabbatical at Arizona State University. Fink's current research includes studies of how the Theological properties of magma govern the emplacement of volcanic domes and lava flows, and the gravitational control on their mass movements. This research extends to the mechanisms of igneous intrusion and interpretation of volcanic features in extraterrestrial and submarine environments.

  16. Solar-terrestrial news from NSF

    NASA Astrophysics Data System (ADS)

    Peacock, Dennis S.

    Tis the season to be jolly, but it is difficult, given the budgetary outlook for fiscal year (FY) 1987. The National Science Foundation (NSF) appropriation bill was signed by President Reagan on October 18, 1986. It provides $1622.9 M (M = million), which is $164.9 M or 11.3% over the post-Gramm-Rudman-Hollings (GRH) level for 1986 and $62.9 M less than the FY 1987 request. The bill includes language capping astronomy at the requested level of $85.06 M.

  17. Scalable, Multithreaded, Partially-in-Place Sorting

    SciTech Connect

    Haglin, David J.; Adolf, Robert D.; Mackey, Greg E.

    2013-05-20

    A recent trend in hardware development is producing computing systems that are stretching the number of cores and size of shared-memory beyond where most fundamental serial algorithms perform well. The expectation is that this trend will continue. So it makes sense to rethink our fundamental algorithms such as sorting. There are many situations where data that needs to be sorted will actually fit into the shared memory so applications could benefit from an efficient parallel sorting algorithm. When sorting large data (at least hundreds of Gigabytes) in a single shared memory, there are two factors that affect the algorithm choice. First, does the algorithm sort in-place? And second, does the algorithm scale well beyond tens of threads? Surprisingly, existing algorithms posses either one of these factors, but not both. We present an approach that gracefully degrades in performance as the amount of available working memory decreases relative to the size of the input.

  18. Effect of spermatozoa motility hyperactivation factors and gamete coincubation duration on in vitro bovine embryo development using flow cytometrically sorted spermatozoa.

    PubMed

    Ferré, Luis B; Bogliotti, Yanina; Chitwood, James L; Fresno, Cristóbal; Ortega, Hugo H; Kjelland, Michael E; Ross, Pablo J

    2016-02-24

    The aim of the present study was to evaluate the effects of sperm motility enhancers and different IVF times on cleavage, polyspermy, blastocyst formation, embryo quality and hatching ability. In Experiment 1, sex-sorted X chromosome-bearing Bos taurus spermatozoa were incubated for 30 min before 18 h fertilisation with hyperactivating factors, namely 10 mM caffeine (CA), 5 mM theophylline (TH), 10 mM caffeine and 5 mM theophylline (CA + TH); and untreated spermatozoa (control). In Experiment 2, matured B. taurus oocytes were fertilised using a short (8 h) or standard (18 h) fertilisation length, comparing two different fertilisation media, namely synthetic oviducal fluid (SOF) fertilisation medium (SOF-FERT) and M199 fertilisation medium (M199-FERT). Cleavage and blastocyst formation rates were significantly higher in the CA + TH group (77% and 27%, respectively) compared with the control group (71% and 21%, respectively). Cleavage rates and blastocyst formation were significantly lower for the shortest fertilisation time (8 h) in M199-FERT medium (42% and 12%, respectively). The SOF-FERT medium with an 8 h fertilisation time resulted in the highest cleavage rates and blastocyst formation (74% and 29%, respectively). The SOF-FERT medium produced the highest embryo quality (50% Grade 1) and hatching rate (66%). Motility enhancers did not affect polyspermy rates, whereas polyspermy was affected when fertilisation length was extended from 8 h (3%) to 18 h (9%) and in M199-FERT (14%) compared with SOF-FERT (6%). We conclude that adding the motility enhancers CA and TH to sex sorted spermatozoa and Tyrode's albumin lactate pyruvate (TALP)-Sperm can improve cleavage and embryo development rates without increasing polyspermy. In addition, shortening the oocyte-sperm coincubation time (8 h) resulted in similar overall embryo performance rates compared with the prolonged (18 h) interval.

  19. Educational Outreach by the NSF Polymers Program

    NASA Astrophysics Data System (ADS)

    Lovinger, Andrew J.

    2002-03-01

    Education and outreach have been NSF priority areas over the last few years. Reviewers of all proposals are explicitly asked to evaluate not only the "intellectual merit" of a research proposal but also its "broader impacts", including specifically "integration of research and education". The NSF Polymers Program has strongly emphasized these areas and has initiated and supported a wide variety of outreach activities designed to bring out the importance of polymeric materials to diverse communities and to encourage young students to develop interests in this area. Specific activities have included: Workshops and their broad dissemination through the media; press releases on important polymer-related developments; interviews to the scientific and popular press; outreach to Congress; establishment of widely publicized and broadly attended lecture series; funding and support of conferences, symposia, and workshops aimed at students and teachers from kindergarten to graduate school; support of web-based educational projects aimed at the general public and schoolchildren; participation in web-based "ask-the-experts" resources to answer science questions from children or the general public; and personal outreach to middle- and high-schools through talks and demonstrations on polymers and plastics, participation at science fairs, career days, etc.

  20. The NSF PAARE Projects at SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, Sean D.; Cash, Jennifer; Hartmann, Dieter; Hinkle, Kenneth H.; Ho, Shirley; Howell, Steve B.; King, Jeremy R.; Leising, Mark D.; Mighell, Kenneth J.; Smith, Daniel M.

    2016-01-01

    We review our progress over the past 7.5 years and the path forward under the NSF program "Partnerships in Astronomy and Astrophysics Research and Education (PAARE)". Our first project, "A Partnership in Observational and Computational Astronomy (POCA)" was a part of the 2008 PAARE cohort which we finished on September 30, 2015. We will summarize the results of those years and look at our way forward under a second PAARE award made in August 2014 (POCA II). Our partnership under the second PAARE award includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) as well as individual investigators at NASA Ames and Carnegie Mellon University. Our recent work on variable and peculiar stars, work with the Kepler Observatory and our educational products in cosmology for non-STEM majors will be presented as well as our success with undergraduate and graduate students. We will also discuss how we are sharing resources with Clemson through distance learning and undergraduate research projects. Our support includes NSF awards AST-0750814 and AST-1358913 to South Carolina State University as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under awards NNX11AB82G and NNX13AC24G. Additional details can be found at: http://physics.scsu.edu/paare/

  1. Sorting to Extremes

    ERIC Educational Resources Information Center

    Baum, Sandy; McPherson, Michael S.

    2011-01-01

    The world of higher education is a world of sorting, selecting, and ranking--on both sides of the market. Colleges select students to recruit and then to admit; students choose where to apply and which offer to accept. The sorting process that gets the most attention is in the higher reaches of the market, where it is not too much to say that…

  2. Sorting to Extremes

    ERIC Educational Resources Information Center

    Baum, Sandy; McPherson, Michael S.

    2011-01-01

    The world of higher education is a world of sorting, selecting, and ranking--on both sides of the market. Colleges select students to recruit and then to admit; students choose where to apply and which offer to accept. The sorting process that gets the most attention is in the higher reaches of the market, where it is not too much to say that…

  3. Sorting Carbon Nanotubes.

    PubMed

    Zheng, Ming

    2017-02-01

    Sorting of single-wall carbon nanotubes by their electronic and atomic structures in liquid phases is reviewed in this chapter. We first introduce the sorting problem, and then provide an overview of several sorting methodologies, following roughly the chronological order of their development over the past 15 years or so. Major methods discussed include ion-exchange chromatography, density-gradient ultracentrifugation, selective extraction in organic solvents, gel chromatography, and aqueous two-phase extraction. A main focus of the review is on the common mechanisms underlining all sorting processes. We propose that differences in solvation among different nanotube species are the ultimate driving force of sorting, and we corroborate this proposal by presenting analysis on how the differences are realized in electronic-structure-based sorting and atomic-structure-based sorting. In the end, we offer some suggestions on future directions that may grow out of carbon nanotube sorting. In particular, the prospect of expanding the function of DNA/carbon nanotube hybrid to control inter-particle interactions both inside and outside the nanotube is discussed.

  4. Raman activated cell sorting.

    PubMed

    Song, Yizhi; Yin, Huabing; Huang, Wei E

    2016-08-01

    Single cell Raman spectra (SCRS) are intrinsic biochemical profiles and 'chemical images' of single cells which can be used to characterise phenotypic changes, physiological states and functions of cells. On the base of SCRS, Raman activated cell sorting (RACS) provides a label-free cell sorting approach, which can link single cells to their chemical or phenotypic profiles. Overcoming naturally weak Raman signals, establishing Raman biomarker as sorting criteria to RACS and improving specific sorting technology are three challenges of developing RACS. Advances on Raman spectroscopy such as stimulated Raman scattering (SRS) and pre-screening helped to increase RACS sorting speed. Entire SCRS can be characterised using pattern recognition methods, and specific Raman bands can be extracted as biomarkers for RACS. Recent advances on cell sorting technologies based on microfluidic device and surface-ejection enable accurate and reliable single cell sorting from complex samples. A high throughput RACS will be achievable in near future by integrating fast Raman detection system such as SRS with microfluidic RACS and Raman activated cell ejection (RACE).

  5. NSF section remains in competitiveness bill

    NASA Astrophysics Data System (ADS)

    Lang, Valerie

    The House Space, Science and Technology Committee held mark-ups to consider amendments to HR820, the National Competitiveness Act of 1993 on April 21 and 22. Subtitle B to the bill lays out a role for the National Science Foundation that is perceived by some Earth scientists as shifting the agency's mission from supporting basic research to manufacturing technology and competitiveness (see Eos, April 13). During the mark-up, Roscoe Bartlett (R-Md.) introduced an amendment to strike the entire NSF section, saying that “manufacturing is not a proper function of basic research institutions.” He also mentioned that President Clinton did not have any money in his budget for this initiative.

  6. NSF assistant director for geosciences announces resignation

    NASA Astrophysics Data System (ADS)

    Zielinki, Sarah

    Margaret Leinen, assistant director for geosciences at the U.S. National Science Foundation, announced on 7 December that she will be leaving NSF in January 2007 to become the chief science officer and vice president of Climos, a new company based in San Francisco, Calif., that plans to develop solutions to reduce greenhouse gases. Leinen will oversee efforts to better understand the planet's carbon cycle to address global climate change issues.Leinen has managed the Directorate for Geosciences since 2000. She also served as vice chair of the U.S. Climate Change Science Program, which coordinates federal climate change research, and as co-chair of the National Science and Technology Council's Joint Committee on Ocean Science and Technology.

  7. Solar-terrestrial news from NSF

    NASA Astrophysics Data System (ADS)

    Peacock, Dennis

    This is a difficult time for solar-terrestrial (S/T) research. The loss of the shuttle Challenger has disrupted the entire short-range launch schedule at the National Aeronautics and Space Administration (NASA). The Gramm-Rudman-Hollings (GRH) Deficit Reduction Act has affected virtually all programs in fiscal year (FY) 1986 and no doubt will affect 1987 and beyond. Then again, every year has its own special problems, and even this year's difficulties could turn to our advantage. For example, GRH has demanded a serious rethinking of budgets and priorities. One outcome of this is the President's budget to Congress in 1987, which requests increases of 8.4% and 8.9% for the National Science Foundation (NSF) and NASA (research and development), respectively.

  8. NSF and IPY 2007-2008

    NASA Astrophysics Data System (ADS)

    Erb, K. A.

    2003-12-01

    International research organizations including the International Arctic Science Council, the Arctic Ocean Sciences Board, the Scientific Committee on Antarctic Research, the World Meteorological Organization and the International Council for Science have announced planning efforts toward coordinated international polar research during 2007-2008, the 50th anniversary of the International Geophysical Year and the Third International Polar Year. This activity is fueled in considerable measure by the conviction that coordinated efforts building on advances in support infrastructure and in instrumentation technology could lead to breakthrough discoveries in subjects ranging from global climate change to astrophysics, oceanography, and micro-biology, to list just a few of those we have heard discussed. The National Science Foundation's Office of Polar Programs--steward of the U.S. Antarctic Program, the U. S. Interagency Arctic Research Policy Committee, and a major source of funding for the education and training of polar scientists, their research and their field support -- has engaged in continuing discussions about the upcoming Polar Year with officials responsible for polar research in other U. S. Agencies, in other nations, with a number of international organizations, and with the U. S. planning committee leadership. We have also sought to catalyze thinking in the research community through workshops and discussions and have been monitoring the development of related scientific and educational thrusts. Our goal is to be poised to support U. S. efforts brought forward in timely fashion by researchers and educators and to be ready to facilitate their integration with related international efforts. The time is now rapidly approaching when we will need to begin planning for the support of specific research and education projects. This talk will summarize NSF activity related to planning for the 2007-2008 International Polar Year and will address ways that NSF's focus

  9. Sorting of Sperm by Morphology

    NASA Astrophysics Data System (ADS)

    Koh, James; Marcos, Marcos

    2016-11-01

    Many studies have proven that the percentage of morphologically normal sperm is a significant factor in determining the success of assisted reproduction. The velocity of sperm in a microchannel with shear flow subjected to an external field will be explored theoretically. The difference in response between morphologically normal and abnormal sperm will be computed from a statistical approach, to study the feasibility and effectiveness of sorting by an external field to remove abnormal sperm. The full name of this author is Marcos.

  10. Insulin and Insulin-like Growth Factor II Differentially Regulate Endocytic Sorting and Stability of Insulin Receptor Isoform A*

    PubMed Central

    Morcavallo, Alaide; Genua, Marco; Palummo, Angela; Kletvikova, Emilia; Jiracek, Jiri; Brzozowski, Andrzej M.; Iozzo, Renato V.; Belfiore, Antonino; Morrione, Andrea

    2012-01-01

    The insulin receptor isoform A (IR-A) binds both insulin and insulin-like growth factor (IGF)-II, although the affinity for IGF-II is 3–10-fold lower than insulin depending on a cell and tissue context. Notably, in mouse embryonic fibroblasts lacking the IGF-IR and expressing solely the IR-A (R−/IR-A), IGF-II is a more potent mitogen than insulin. As receptor endocytosis and degradation provide spatial and temporal regulation of signaling events, we hypothesized that insulin and IGF-II could affect IR-A biological responses by differentially regulating IR-A trafficking. Using R−/IR-A cells, we discovered that insulin evoked significant IR-A internalization, a process modestly affected by IGF-II. However, the differential internalization was not due to IR-A ubiquitination. Notably, prolonged stimulation of R−/IR-A cells with insulin, but not with IGF-II, targeted the receptor to a degradative pathway. Similarly, the docking protein insulin receptor substrate 1 (IRS-1) was down-regulated after prolonged insulin but not IGF-II exposure. Similar results were also obtained in experiments using [NMeTyrB26]-insulin, an insulin analog with IR-A binding affinity similar to IGF-II. Finally, we discovered that IR-A was internalized through clathrin-dependent and -independent pathways, which differentially regulated the activation of downstream effectors. Collectively, our results suggest that a lower affinity of IGF-II for the IR-A promotes lower IR-A phosphorylation and activation of early downstream effectors vis à vis insulin but may protect IR-A and IRS-1 from down-regulation thereby evoking sustained and robust mitogenic stimuli. PMID:22318726

  11. Sorting Out Seasonal Allergies

    MedlinePlus

    ... Close ‹ Back to Healthy Living Sorting Out Seasonal Allergies Sneezing, runny nose, nasal congestion. Symptoms of the ... How do I know if I have seasonal allergies? According to Dr. Georgeson, the best way to ...

  12. Receptor-Mediated Uptake and Intracellular Sorting of Multivalent Lipid Nanoparticles Against the Epidermal Growth Factor Receptor (EGFR) and the Human EGFR 2 (HER2)

    NASA Astrophysics Data System (ADS)

    Tran, David Tu

    In the area of receptor-targeted lipid nanoparticles for drug delivery, efficiency has been mainly focused on cell-specificity, endocytosis, and subsequently effects on bioactivity such as cell growth inhibition. Aspects of targeted liposomal uptake and intracellular sorting are not well defined. This dissertation assessed a series of ligands as targeted functional groups against HER2 and EGFR for liposomal drug delivery. Receptor-mediated uptake, both mono-targeted and dual-targeted to multiple receptors of different ligand valence, and the intracellular sorting of lipid nanoparticles were investigated to improve the delivery of drugs to cancer cells. Lipid nanoparticles were functionalized through a new sequential micelle transfer---conjugation method, while the micelle transfer method was extended to growth factors. Through a combination of both techniques, anti-HER2 and anti-EGFR dual-targeted immunoliposomes with different combinations of ligand valence were developed for comparative studies. With the array of lipid nanoparticles, the uptake and cytotoxicity of lipid nanoparticles in relationship to ligand valence, both mono-targeting and dual-targeting, were evaluated on a small panel of breast cancer cell lines that express HER2 and EGFR of varying levels. Comparable uptake ratios of ligand to expressed receptor and apparent cooperativity were observed. For cell lines that express both receptors, additive dose-uptake effects were also observed with dual-targeted immunoliposomes, which translated to marginal improvements in cell growth inhibition with doxorubicin delivery. Colocalization analysis revealed that ligand-conjugated lipid nanoparticles settle to endosomal compartments similar to their attached ligands. Pathway transregulation and pathway saturation were also observed to affect trafficking. In the end, liposomes routed to the recycling endosomes were never observed to traffic beyond the endosomes nor to be exocytose like recycled ligands. Based on

  13. Ciliary Neurotrophic Factor Induces Genes Associated with Inflammation and Gliosis in the Retina: A Gene Profiling Study of Flow-Sorted, Müller Cells

    PubMed Central

    Dudley, V. Joseph; Brooks, Matthew; Swaroop, Anand; Sarthy, Vijay P.

    2011-01-01

    Background Ciliary neurotrophic factor (CNTF), a member of the interleukin-6 cytokine family, has been implicated in the development, differentiation and survival of retinal neurons. The mechanisms of CNTF action as well as its cellular targets in the retina are poorly understood. It has been postulated that some of the biological effects of CNTF are mediated through its action via retinal glial cells; however, molecular changes in retinal glia induced by CNTF have not been elucidated. We have, therefore, examined gene expression dynamics of purified Müller (glial) cells exposed to CNTF in vivo. Methodology/Principal Findings Müller cells were flow-sorted from mgfap-egfp transgenic mice one or three days after intravitreal injection of CNTF. Microarray analysis using RNA from purified Müller cells showed differential expression of almost 1,000 transcripts with two- to seventeen-fold change in response to CNTF. A comparison of transcriptional profiles from Müller cells at one or three days after CNTF treatment showed an increase in the number of transcribed genes as well as a change in the expression pattern. Ingenuity Pathway Analysis showed that the differentially regulated genes belong to distinct functional types such as cytokines, growth factors, G-protein coupled receptors, transporters and ion channels. Interestingly, many genes induced by CNTF were also highly expressed in reactive Müller cells from mice with inherited or experimentally induced retinal degeneration. Further analysis of gene profiles revealed 20–30% overlap in the transcription pattern among Müller cells, astrocytes and the RPE. Conclusions/Significance Our studies provide novel molecular insights into biological functions of Müller glial cells in mediating cytokine response. We suggest that CNTF remodels the gene expression profile of Müller cells leading to induction of networks associated with transcription, cell cycle regulation and inflammatory response. CNTF also appears to

  14. Ocean sciences peer review in NSF

    NASA Astrophysics Data System (ADS)

    Wall, Robert E.

    Someone—I believe it was a German statesman—once said that there were two questions to which most people did not really want answers: What goes in to sausage? and How are government decisions made? I am sure there is some truth here. Although I'm not familiar with what has been happening in the area of sausage making, there have been many discussions and several recent studies about the use and effectiveness of peer review in federal agencies deciding what research to support.This article is precipitated by these recent studies, by the availability of quantitative peer review data in the Ocean Sciences Research Section (OSRS) of the National Science Foundation (NSF), and by continuing questions and statements concerning the peer review process that suggest some misunderstanding about what it is and how it works. My intent in this article is to describe the general process of peer review used in OSRS and to explain some of the variations in that process. Data and statistics on proposals considered for support with Fiscal Year (FY) 1981 funds help illustrate the process.

  15. The NSF Condensed Matter Physics Program

    NASA Astrophysics Data System (ADS)

    Sokol, Paul

    The Condensed Matter Physics (CMP) program in the NSF Division of Materials Research (DMR) supports experimental, as well as combined experiment and theory projects investigating the fundamental physics behind phenomena exhibited by condensed matter systems. CMP is the largest Individual Investigator Award program in DMR and supports a broad portfolio of research spanning both hard and soft condensed matter. Representative research areas include: 1) phenomena at the nano- to macro-scale including: transport, magnetic, and optical phenomena; classical and quantum phase transitions; localization; electronic, magnetic, and lattice structure or excitations; superconductivity; topological insulators; and nonlinear dynamics. 2) low-temperature physics: quantum fluids and solids; 1D & 2D electron systems. 3) soft condensed matter: partially ordered fluids, granular and colloid physics, liquid crystals, and 4) understanding the fundamental physics of new states of matter as well as the physical behavior of condensed matter under extreme conditions e.g., low temperatures, high pressures, and high magnetic fields. In this talk I will review the current CMP portfolio and discuss future funding trends for the program. I will also describe recent activities in the program aimed at addressing the challenges facing current and future principal investigators.

  16. 48 CFR 2515.215-70 - NSF negotiation authorities.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... FOUNDATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Negotiation Authorities 2515.215... an NSF contract is for scientific activities which are determined by the NSF contracting officer to... Secretary of State or Secretary of Defense, specific scientific activities in connection with matters...

  17. 48 CFR 2515.215-70 - NSF negotiation authorities.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... FOUNDATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Negotiation Authorities 2515.215... an NSF contract is for scientific activities which are determined by the NSF contracting officer to... Secretary of State or Secretary of Defense, specific scientific activities in connection with matters...

  18. 48 CFR 2515.215-70 - NSF negotiation authorities.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Negotiation Authorities 2515.215-70 NSF... is for scientific activities which are determined by the NSF contracting officer to be “necessary to... or Secretary of Defense, specific scientific activities in connection with matters relating to...

  19. 78 FR 69658 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-20

    .../NSF Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory... within the field of basic nuclear science research. Tentative Agenda: Agenda will include discussions...

  20. 78 FR 716 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-04

    .../NSF Nuclear Science Advisory Committee AGENCY: Office of Science, DOE. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC). DATES... on scientific priorities within the field of basic nuclear science research. Tentative Agenda:...

  1. A Guide to NSF Science/Engineering Resources Data.

    ERIC Educational Resources Information Center

    National Science Foundation, Washington, DC. Directorate for Scientific, Technological and International Affairs.

    The National Science Foundation (NSF) Division of Science Resources Services designs and conducts surveys related to, and supports other data collection activities dealing with, science resources. The data from these surveys and data collection efforts are used by NSF and others to analyze various research and development (R&D) funding and…

  2. 48 CFR 2515.215-70 - NSF negotiation authorities.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 6 2013-10-01 2013-10-01 false NSF negotiation... FOUNDATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Negotiation Authorities 2515.215-70 NSF negotiation authorities. (a) Authorities. Citation: 42 U.S.C. 1870(c). (b) Application. When...

  3. 48 CFR 2515.215-70 - NSF negotiation authorities.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 6 2011-10-01 2011-10-01 false NSF negotiation... FOUNDATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Negotiation Authorities 2515.215-70 NSF negotiation authorities. (a) Authorities. Citation: 42 U.S.C. 1870(c). (b) Application. When...

  4. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true NSF patent policy. 2527... CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Disposition of Rights in Inventions 2527.7002 NSF patent policy. As authorized by the National Science Board at its 230th meeting, October 15-16, 1981,...

  5. What NSF Expects in Project Evaluations for Educational Innovations.

    ERIC Educational Resources Information Center

    Hannah, Judith L.

    1996-01-01

    The National Science Foundation (NSF) sponsors a range of programs to fund innovative approaches to teaching and learning. Focuses on NSF's expectations for project evaluation beginning with a definition of evaluation and a discussion of why evaluation is needed. Also describes planning, formative, and summative evaluation stages and concludes…

  6. 78 FR 62609 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-22

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY DOE/NSF Nuclear Science Advisory Committee AGENCY: Office of Science, Department of Energy. ACTION: Notice of... within the field of basic nuclear science research. Additionally, the renewal of the DOE/NSF Nuclear...

  7. National Strike Force (NSF) Oil Spill Response Equipment Upgrade

    DTIC Science & Technology

    1991-10-01

    Current options for upgrading oil spill response equipment for the Coast Guard’s National Strike Force (NSF) were investigated. Specific systems and...design for the NSF’s skimming barrier retrieval system has been proposed. A worldwide survey of oil spill response equipment was conducted to identify

  8. Perhaps the NSF Is a Model, but Perhaps Not ... .

    ERIC Educational Resources Information Center

    Glidden, Robert

    1990-01-01

    Responds to Charles Fowler's article, "Arts Education and the NEA: Does the National Science Foundation Point the Way?" Recommends that the National Science Foundation (NSF) and the National Endowment for the Arts (NEA) work together to promote intellectual values in schooling. Suggests that the NEA follow the NSF in its commitment to…

  9. Cyberinfrastructure for the NSF Ocean Observatories Initiative

    NASA Astrophysics Data System (ADS)

    Orcutt, J. A.; Vernon, F. L.; Arrott, M.; Chave, A.; Krueger, I.; Schofield, O.; Glenn, S.; Peach, C.; Nayak, A.

    2007-12-01

    The Internet today is vastly different than the Internet that we knew even five years ago and the changes that will be evident five years from now, when the NSF Ocean Observatories Initiative (OOI) prototype has been installed, are nearly unpredictable. Much of this progress is based on the exponential growth in capabilities of consumer electronics and information technology; the reality of this exponential behavior is rarely appreciated. For example, the number of transistors on a square cm of silicon will continue to double every 18 months, the density of disk storage will double every year, and network bandwidth will double every eight months. Today's desktop 2TB RAID will be 64TB and the 10Gbps Regional Scale Network fiber optical connection will be running at 1.8Tbps. The same exponential behavior characterizes the future of genome sequencing. The first two sequences of composites of individuals' genes cost tens of millions of dollars in 2001. Dr. Craig Venter just published a more accurate complete human genome (his own) at a cost on the order of 100,000. The J. Craig Venter Institute has provided support for the X Prize for Genomics offering 10M to the first successful sequencing of a human genome for $1,000. It's anticipated that the prize will be won within five years. Major advances in technology that are broadly viewed as disruptive or revolutionary rather than evolutionary will often depend upon the exploitation of exponential expansions in capability. Applications of these ideas to the OOI will be discussed. Specifically, the agile ability to scale cyberinfrastructure commensurate with the exponential growth of sensors, networks and computational capability and demand will be described.

  10. Sorting by Recursive Partitioning,

    DTIC Science & Technology

    1983-12-01

    asymptotic time-complexity. This paper has the following main parts: First, a Pidgin -Algol version of the algorithm is presented and we discuss the main...those sorted subsets e) end "UsingBin*; end "AdaptSorting. 4 "Figure 1: A condensed Pidgin -Algol version of Adaptsort eiFor some conditions that we will...algorithm which have to be completed in either linear or constant times (these required critical times appear as comments in the Pidgin -Algol version

  11. ESO and NSF Sign Agreement on ALMA

    NASA Astrophysics Data System (ADS)

    2003-02-01

    Green Light for World's Most Powerful Radio Observatory On February 25, 2003, the European Southern Observatory (ESO) and the US National Science Foundation (NSF) are signing a historic agreement to construct and operate the world's largest and most powerful radio telescope, operating at millimeter and sub-millimeter wavelength. The Director General of ESO, Dr. Catherine Cesarsky, and the Director of the NSF, Dr. Rita Colwell, act for their respective organizations. Known as the Atacama Large Millimeter Array (ALMA), the future facility will encompass sixty-four interconnected 12-meter antennae at a unique, high-altitude site at Chajnantor in the Atacama region of northern Chile. ALMA is a joint project between Europe and North America. In Europe, ESO is leading on behalf of its ten member countries and Spain. In North America, the NSF also acts for the National Research Council of Canada and executes the project through the National Radio Astronomy Observatory (NRAO) operated by Associated Universities, Inc. (AUI). The conclusion of the ESO-NSF Agreement now gives the final green light for the ALMA project. The total cost of approximately 650 million Euro (or US Dollars) is shared equally between the two partners. Dr. Cesarsky is excited: "This agreement signifies the start of a great project of contemporary astronomy and astrophysics. Representing Europe, and in collaboration with many laboratories and institutes on this continent, we together look forward towards wonderful research projects. With ALMA we may learn how the earliest galaxies in the Universe really looked like, to mention but one of the many eagerly awaited opportunities with this marvellous facility". "With this agreement, we usher in a new age of research in astronomy" says Dr. Colwell. "By working together in this truly global partnership, the international astronomy community will be able to ensure the research capabilities needed to meet the long-term demands of our scientific enterprise, and

  12. Rubric Sorting Astronomy Essays

    NASA Astrophysics Data System (ADS)

    Len, P. M.

    2014-07-01

    Student essays on introductory astronomy exams can be consistently and efficiently graded by a single instructor, or by multiple graders for a large class. This is done by constructing a robust outcome rubric while sorting exams into separate stacks, then checking each stack for consistency. Certain online resources readily provide primary source prompts for writing astronomy exam essay questions.

  13. A Highly Polymorphic Copy Number Variant in the NSF Gene is Associated with Cocaine Dependence

    PubMed Central

    Cabana-Domínguez, Judit; Roncero, Carlos; Grau-López, Lara; Rodríguez-Cintas, Laia; Barral, Carmen; Abad, Alfonso C.; Erikson, Galina; Wineinger, Nathan E.; Torrico, Bàrbara; Arenas, Concepció; Casas, Miquel; Ribasés, Marta; Cormand, Bru; Fernàndez-Castillo, Noèlia

    2016-01-01

    Cocaine dependence is a complex psychiatric disorder involving both genetic and environmental factors. Several neurotransmitter systems mediate cocaine’s effects, dependence and relapse, being the components of the neurotransmitter release machinery good candidates for the disorder. Previously, we identified a risk haplotype for cocaine dependence in the NSF gene, encoding the protein N-Ethylmaleimide-Sensitive Factor essential for synaptic vesicle turnover. Here we examined the possible contribution to cocaine dependence of a large copy number variant (CNV) that encompasses part of the NSF gene. We performed a case-control association study in a discovery sample (359 cases and 356 controls) and identified an association between cocaine dependence and the CNV (P = 0.013), that was confirmed in the replication sample (508 cases and 569 controls, P = 7.1e-03) and in a pooled analysis (P = 1.8e-04), with an over-representation of low number of copies in cases. Subsequently, we studied the functional impact of the CNV on gene expression and found that the levels of two NSF transcripts were significantly increased in peripheral blood mononuclear cells (PBMC) along with the number of copies of the CNV. These results, together with a previous study from our group, support the role of NSF in the susceptibility to cocaine dependence. PMID:27498889

  14. A Highly Polymorphic Copy Number Variant in the NSF Gene is Associated with Cocaine Dependence.

    PubMed

    Cabana-Domínguez, Judit; Roncero, Carlos; Grau-López, Lara; Rodríguez-Cintas, Laia; Barral, Carmen; Abad, Alfonso C; Erikson, Galina; Wineinger, Nathan E; Torrico, Bàrbara; Arenas, Concepció; Casas, Miquel; Ribasés, Marta; Cormand, Bru; Fernàndez-Castillo, Noèlia

    2016-08-08

    Cocaine dependence is a complex psychiatric disorder involving both genetic and environmental factors. Several neurotransmitter systems mediate cocaine's effects, dependence and relapse, being the components of the neurotransmitter release machinery good candidates for the disorder. Previously, we identified a risk haplotype for cocaine dependence in the NSF gene, encoding the protein N-Ethylmaleimide-Sensitive Factor essential for synaptic vesicle turnover. Here we examined the possible contribution to cocaine dependence of a large copy number variant (CNV) that encompasses part of the NSF gene. We performed a case-control association study in a discovery sample (359 cases and 356 controls) and identified an association between cocaine dependence and the CNV (P = 0.013), that was confirmed in the replication sample (508 cases and 569 controls, P = 7.1e-03) and in a pooled analysis (P = 1.8e-04), with an over-representation of low number of copies in cases. Subsequently, we studied the functional impact of the CNV on gene expression and found that the levels of two NSF transcripts were significantly increased in peripheral blood mononuclear cells (PBMC) along with the number of copies of the CNV. These results, together with a previous study from our group, support the role of NSF in the susceptibility to cocaine dependence.

  15. NSF Support for Physics at the Undergraduate Level: A View from Inside

    NASA Astrophysics Data System (ADS)

    McBride, Duncan

    2015-03-01

    NSF has supported a wide range of projects in physics that involve undergraduate students. These projects include NSF research grants in which undergraduates participate; Research Experiences for Undergraduates (REU) centers and supplements; and education grants that range from upper-division labs that may include research, to curriculum development for upper- and lower-level courses and labs, to courses for non-majors, to Physics Education Research (PER). The NSF Divisions of Physics, Materials Research, and Astronomy provide most of the disciplinary research support, with some from other parts of NSF. I recently retired as the permanent physicist in NSF's Division of Undergraduate Education (DUE), which supports the education grants. I was responsible for a majority of DUE's physics grants and was involved with others overseen by a series of physics rotators. There I worked in programs entitled Instrumentation and Laboratory Improvement (ILI); Course and Curriculum Development (CCD); Course, Curriculum, and Laboratory Improvement (CCLI); Transforming Undergraduate STEM Education (TUES); and Improving Undergraduate STEM Education (IUSE). NSF support has enabled physics Principal Investigators to change and improve substantially the way physics is taught and the way students learn physics. The most important changes are increased undergraduate participation in physics research; more teaching using interactive engagement methods in classes; and growth of PER as a legitimate field of physics research as well as outcomes from PER that guide physics teaching. In turn these have led, along with other factors, to students who are better-prepared for graduate school and work, and to increases in the number of undergraduate physics majors. In addition, students in disciplines that physics directly supports, notably engineering and chemistry, and increasingly biology, are better and more broadly prepared to use their physics education in these fields. I will describe NSF

  16. Director urges NSF: Adapt “New Order”

    NASA Astrophysics Data System (ADS)

    Simarski, Lynn Teo

    The National Science Foundation must respond to dramatic changes in world affairs and science by expanding its purview, or risk losing its vitality, agency director Walter Massey recently told NSF staff.“I'm not sure we're making a difference, or the difference that the nation needs,” Massey said in a recent interview. As he sees it, the current transformation in NSF's environment is as significant as the circumstances that led to the agency's founding. “I think it is imperative that NSF determine its place in this new order,” he says.

  17. Passive droplet sorting using viscoelastic flow focusing.

    PubMed

    Hatch, Andrew C; Patel, Apurva; Beer, N Reginald; Lee, Abraham P

    2013-04-07

    We present a study of passive hydrodynamic droplet sorting in microfluidic channels based on intrinsic viscoelastic fluid properties. Sorting is achieved by tuning the droplets' intrinsic viscous and viscoelastic properties relative to the continuous oil phase to achieve a positive or negative lateral migration toward high or low shear gradients in the channel. In the presence of weakly viscoelastic fluid behavior, droplets with a viscosity ratio, κ, between 0.5-10 were found to migrate toward a high shear gradient near the channel walls. For all other κ-values, or Newtonian fluids, droplets would migrate toward a low shear gradient at the channel centerline. It was also found that for strongly viscoelastic fluids with low interfacial tension, droplets would migrate toward the edge even with κ-values lower than 0.5. The resulting bi-directional lateral droplet migration between different droplets allows size-independent sorting. Still, their sorting efficiencies are dependent on droplet size, intrinsic fluid elasticity, viscosity, droplet deformability, and overall fluid shear rates. Based on these findings, we demonstrate >200 Hz passive droplet sorting frequencies and achieve >100 fold enrichment factors without the need to actively sense and/or control active mechanisms. Using a low viscosity oil phase of 6.25 cPs, we demonstrate sorting discrimination of 1 cPs and 5 cPs aqueous droplets with κ-values of 0.2 and 0.8 respectively.

  18. Committee of Visitors Advises NSF Division of Ocean Sciences

    NASA Astrophysics Data System (ADS)

    Fine, Rana; Beardsley, Robert; Bontempi, Paula; Campbell, Janet; Chotiros, Nick; Klein, Emily; North, Elizabeth; Olsen, Curtis; Robles, Carlos; Seyfried, William; Thomas, Debbie

    2010-02-01

    The U.S. National Science Foundation (NSF) relies on external Committees of Visitors (COV) convened every 3 years to assess the quality and integrity of program operations and program-level technical and managerial matters pertaining to proposal decisions. Members of COVs are chosen by program officers and division directors to represent scientific diversity, in terms of disciplines, institutions, and potential principal investigators (PIs). One such COV recently assessed NSF's Ocean Sciences (OCE) division. The COV for OCE found that the science receiving funding is highly relevant to the overarching objectives of NSF and that the OCE peer-review process is robust. Further, the COV found that program officers—NSF staff who manage programs in ocean sciences and administer proposals and grants—are conscientious and are funding projects of top quality that are well balanced across a broad spectrum.

  19. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  20. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  1. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  2. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  3. 45 CFR 674.6 - Submission of information to NSF.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... ANTARCTIC METEORITES § 674.6 Submission of information to NSF. A copy of the written procedures developed by... sufficient to ensure that the meteorites will be properly collected, handled, documented, and curated....

  4. Chip-based droplet sorting

    SciTech Connect

    Beer, Neil Reginald; Lee, Abraham; Hatch, Andrew

    2014-07-01

    A non-contact system for sorting monodisperse water-in-oil emulsion droplets in a microfluidic device based on the droplet's contents and their interaction with an applied electromagnetic field or by identification and sorting.

  5. Sorting quantum systems efficiently

    PubMed Central

    Ionicioiu, Radu

    2016-01-01

    Measuring the state of a quantum system is a fundamental process in quantum mechanics and plays an essential role in quantum information and quantum technologies. One method to measure a quantum observable is to sort the system in different spatial modes according to the measured value, followed by single-particle detectors on each mode. Examples of quantum sorters are polarizing beam-splitters (PBS) – which direct photons according to their polarization – and Stern-Gerlach devices. Here we propose a general scheme to sort a quantum system according to the value of any d-dimensional degree of freedom, such as spin, orbital angular momentum (OAM), wavelength etc. Our scheme is universal, works at the single-particle level and has a theoretical efficiency of 100%. As an application we design an efficient OAM sorter consisting of a single multi-path interferometer which is suitable for a photonic chip implementation. PMID:27142705

  6. Sorting out frontotemporal dementia?

    PubMed

    Lewis, Jada; Golde, Todd E

    2010-11-18

    Mutations within the granulin (GRN) gene that encodes progranulin (PGRN) cause the neurodegenerative disease frontotemporal lobar degeneration with ubiquitin inclusions (FTLD-U). The receptor for PGRN in the CNS has not been previously identified. In this issue of Neuron, Hu and colleagues identify Sortilin (SORT1) as a key neuronal receptor for PGRN that facilitates its endocytosis and regulates PGRN levels in vitro and in vivo. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. INTERACTION AND LOCALIZATION OF THE RETINITIS PIGMENTOSA PROTEIN RP2 AND NSF IN RETINAL PHOTORECEPTOR CELLS†

    PubMed Central

    Holopainen, Juha M.; Cheng, Christiana L.; Molday, Laurie L.; Johal, Gurp; Coleman, Jonathan; Dyka, Frank; Hii, Theresa; Ahn, Jinhi; Molday, Robert S.

    2010-01-01

    RP2 is a ubiquitously expressed protein encoded by a gene associated with X-linked retinitis pigmentosa (XLRP), a retinal degenerative disease that causes severe vision loss. Previous in vitro studies have shown that RP2 binds to ADP ribosylation factor-like 3 (Arl3) and activates its intrinsic GTPase activity, but the function of RP2 in the retina, and in particular photoreceptor cells, remains unclear. To begin to define the role of RP2 in the retina and XLRP, we have carried out biochemical studies to identify proteins in retinal cell extracts that interact with RP2. Here, we show that RP2 interacts with N-ethylmaleimide sensitive factor (NSF) in retinal cells as well as cultured embryonic kidney (HEK293) cells by mass spectrometry-based proteomics and biochemical analysis. This interaction is mediated by the N-terminal domain of NSF. The E138G and ΔI137 mutations of RP2 known to cause XLRP abolished the interaction of RP2 with the N-terminal domain of NSF. Immunofluorescence labeling studies further showed that RP2 co-localized with NSF in photoreceptors and other cells of the retina. Intense punctate staining of RP2 was observed close to the junction between the inner and outer segments beneath the connecting cilium, as well as within the synaptic region of rod and cone photoreceptors. Our studies indicate that RP2, in addition to serving as a regulator of Arl3, interacts with NSF and this complex may play an important role in membrane protein trafficking in photoreceptors and other cells of the retina. PMID:20669900

  8. Sorting out Ideas about Function

    ERIC Educational Resources Information Center

    Hillen, Amy F.; Malik, LuAnn

    2013-01-01

    Card sorting has the potential to provide opportunities for exploration of a variety of topics and levels. In a card-sorting task, each participant is presented with a set of cards--each of which depicts a relationship--and is asked to sort the cards into categories that make sense to him or her. The concept of function is critical to…

  9. Sorting out Ideas about Function

    ERIC Educational Resources Information Center

    Hillen, Amy F.; Malik, LuAnn

    2013-01-01

    Card sorting has the potential to provide opportunities for exploration of a variety of topics and levels. In a card-sorting task, each participant is presented with a set of cards--each of which depicts a relationship--and is asked to sort the cards into categories that make sense to him or her. The concept of function is critical to…

  10. Review of log sort yards

    Treesearch

    John Rusty Dramm; Gerry L. Jackson; Jenny Wong

    2002-01-01

    This report provides a general overview of current log sort yard operations in the United States, including an extensive literature review and information collected during on-site visits to several operations throughout the nation. Log sort yards provide many services in marketing wood and fiber by concentrating, merchandising, processing, sorting, and adding value to...

  11. The Evolving Evaluation Process for NSF Broader Impacts

    NASA Astrophysics Data System (ADS)

    Straub, J. A.; Lawrence, J. E.

    2016-12-01

    The National Science Foundation (NSF) supports basic research in all non-medical fields of fundamental science that benefit society. To pursue this goal, NSF uses two merit review criteria: intellectual merit and broader impacts. As defined by NSF, intellectual merit "encompasses the potential to advance knowledge," while broader impacts "encompasses the potential to benefit society and contribute to the achievement of specific, desired societal outcomes." Articulating compelling broader impacts is increasingly critical as limited available funding means that both sets of criteria will impact the final proposal outcome. Although societal relevance has been valued by NSF since the foundation was established, recent events have placed increased emphasis on its importance: the America COMPETES Act encouraged increased efforts across agencies in educating the future STEM workforce (2007); NSF prioritized broader STEM participation (2008); the Obama administration issued a memo on transparency and open government (2009); and the National Science Board revised the NSF merit review criteria to emphasize that the same five elements should be considered for both merit review criteria (2012). Principal Investigators, reviewers (including panelists), and Program Officers are being asked to justify how the broader impacts contribute significantly to the project. As broader impacts become increasingly emphasized in the merit review process, it is important to understand not only how Principal Investigators are responding, but how reviewers are evaluating this aspect of proposals. To examine how reviewers are responding to this change in NSF's evaluation policy, an assessment of broader impacts in the Division of Earth Sciences is being conducted. The data were analyzed to see how reviewers have shifted their feedback in the last ten years. Data so far suggest that policy changes to the Grant Proposal Guide in 2012 have caused a notable shift to reviewers being more evaluative

  12. Multiple sort flow cytometer

    DOEpatents

    Van den Engh, Ger; Esposito, Richard J.

    1996-01-01

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane.

  13. Multiple sort flow cytometer

    DOEpatents

    Engh, G. van den; Esposito, R.J.

    1996-01-09

    A flow cytometer utilizes multiple lasers for excitation and respective fluorescence of identified dyes bonded to specific cells or events to identify and verify multiple events to be sorted from a sheath flow and droplet stream. Once identified, verified and timed in the sheath flow, each event is independently tagged upon separation from the flow by an electrical charge of +60, +120, or +180 volts and passed through oppositely charged deflection plates with ground planes to yield a focused six way deflection of at least six events in a narrow plane. 8 figs.

  14. Fluorescence activated cell sorting.

    NASA Technical Reports Server (NTRS)

    Bonner, W. A.; Hulett, H. R.; Sweet, R. G.; Herzenberg, L. A.

    1972-01-01

    An instrument has been developed for sorting biological cells. The cells are rendered differentially fluorescent and incorporated into a small liquid stream illuminated by a laser beam. The cells pass sequentially through the beam, and fluorescent light from the cells gives rise to electrical signals. The stream is broken into a series of uniform size drops downstream of the laser. The cell signals are used to give appropriate electrostatic charges to drops containing the cells. The drops then pass between two charged plates and are deflected to appropriate containers. The system has proved capable of providing fractions containing large numbers of viable cells highly enriched in a particular functional type.

  15. Congressional hearing reviews NSF major research and facilities projects

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2012-03-01

    An 8 March congressional hearing about the U.S. National Science Foundation's Major Research Equipment and Facilities Construction (NSF MREFC) account focused on fiscal management and accountability of projects in that account and reviewed concerns raised by NSF's Office of Inspector General (OIG). NSF established the MREFC account in 1995 to better plan and manage investments in major equipment and facilities projects, which can cost from tens of millions to hundreds of millions of dollars, and the foundation has funded 17 MREFC projects since then. The Obama administration's proposed fiscal year (FY) 2013 budget includes funding for four MREFC projects: Advanced Laser Gravitational-Wave Observatory (AdvLIGO), Advanced Technology Solar Telescope (ATST), National Ecological Observatory (NEON), and Ocean Observatories Initiative (OOI). The hearing, held by a subcommittee of the House of Representatives' Committee on Science, Space, and Technology, reviewed management oversight throughout the life cycles of MREFC projects and concerns raised in recent OIG reports about the use of budget contingency funds. NSF's February 2012 manual called "Risk management guide for large facilities" states that cost contingency is "that portion of the project budget required to cover `known unknowns,'" such as planning and estimating errors and omissions, minor labor or material price fluctuations, and design developments and changes within the project scope. Committee members acknowledged measures that NSF has made to improve the MREFC oversight process, but they also urged the agency to continue to take steps to ensure better project management.

  16. Deductive sort and climbing sort: new methods for non-dominated sorting.

    PubMed

    McClymont, Kent; Keedwell, Ed

    2012-01-01

    In recent years an increasing number of real-world many-dimensional optimisation problems have been identified across the spectrum of research fields. Many popular evolutionary algorithms use non-dominance as a measure for selecting solutions for future generations. The process of sorting populations into non-dominated fronts is usually the controlling order of computational complexity and can be expensive for large populations or for a high number of objectives. This paper presents two novel methods for non-dominated sorting: deductive sort and climbing sort. The two new methods are compared to the fast non-dominated sort of NSGA-II and the non-dominated rank sort of the omni-optimizer. The results demonstrate the improved efficiencies of the deductive sort and the reductions in comparisons that can be made when applying inferred dominance relationships defined in this paper.

  17. Spin-the-bottle Sort and Annealing Sort: Oblivious Sorting via Round-robin Random Comparisons.

    PubMed

    Goodrich, Michael T

    2014-03-01

    We study sorting algorithms based on randomized round-robin comparisons. Specifically, we study Spin-the-bottle sort, where comparisons are unrestricted, and Annealing sort, where comparisons are restricted to a distance bounded by a temperature parameter. Both algorithms are simple, randomized, data-oblivious sorting algorithms, which are useful in privacy-preserving computations, but, as we show, Annealing sort is much more efficient. We show that there is an input permutation that causes Spin-the-bottle sort to require Ω(n(2) log n) expected time in order to succeed, and that in O(n(2) log n) time this algorithm succeeds with high probability for any input. We also show there is a specification of Annealing sort that runs in O(n log n) time and succeeds with very high probability.

  18. An NSF rotator's perspective: view from inside the hamster wheel

    NASA Astrophysics Data System (ADS)

    White, Gary

    2015-03-01

    Duncan McBride served as my unofficial mentor during my time at NSF as a ``rotator'' (or, in NSF-speak, an IPA, short for an Intergovernmental Personnel Act assignee), from fall 2012 through summer of 2013. A rotator's main job is to help keep the wheels of the grant submission process turning, shepherding individual proposal jackets through the submission cycle. While most proposals are eventually ``Declined'' it is the few that are funded that evoke the most vivid memories of my time there. I hope to relay a little bit about what that was like on a daily basis, to give one hamster's take on the machinations of the NSF machine, and testify to Duncan McBride's critical role in establishing physics as the leader in disciplinary based educational research (DBER). It was a heady experience in many ways, despite the sheer girth of proposal jackets to be processed and the uncertain footing upon which federal employees tread these days.

  19. Research Misconduct: Policy and Practice at the NSF

    NASA Astrophysics Data System (ADS)

    Manka, Aaron

    2004-03-01

    Under NSF's Office of Inspector General mandate to prevent fraud, waste, abuse, or mismanagement involving NSF's proposals and awards, our office also investigates allegations of research misconduct. I will discuss our office's handling of such matters, focusing on the ethical and legal obligations of proposal submitters and awardees and the role of the scientific community. To illustrate some other points that are of interest to the physics community, I will also discuss some of our investigative activities relevant to: duplicate funding, the accuracy of information in proposals, and collaborations.

  20. Teleoperated robotic sorting system

    DOEpatents

    Roos, Charles E.; Sommer, Jr., Edward J.; Parrish, Robert H.; Russell, James R.

    2008-06-24

    A method and apparatus are disclosed for classifying materials utilizing a computerized touch sensitive screen or other computerized pointing device for operator identification and electronic marking of spatial coordinates of materials to be extracted. An operator positioned at a computerized touch sensitive screen views electronic images of the mixture of materials to be sorted as they are conveyed past a sensor array which transmits sequences of images of the mixture either directly or through a computer to the touch sensitive display screen. The operator manually "touches" objects displayed on the screen to be extracted from the mixture thereby registering the spatial coordinates of the objects within the computer. The computer then tracks the registered objects as they are conveyed and directs automated devices including mechanical means such as air jets, robotic arms, or other mechanical diverters to extract the registered objects.

  1. Teleoperated robotic sorting system

    DOEpatents

    Roos, Charles E.; Sommer, Jr., Edward J.; Parrish, Robert H.; Russell, James R.

    2008-06-24

    A method and apparatus are disclosed for classifying materials utilizing a computerized touch sensitive screen or other computerized pointing device for operator identification and electronic marking of spatial coordinates of materials to be extracted. An operator positioned at a computerized touch sensitive screen views electronic images of the mixture of materials to be sorted as they are conveyed past a sensor array which transmits sequences of images of the mixture either directly or through a computer to the touch sensitive display screen. The operator manually "touches" objects displayed on the screen to be extracted from the mixture thereby registering the spatial coordinates of the objects within the computer. The computer then tracks the registered objects as they are conveyed and directs automated devices including mechanical means such as air jets, robotic arms, or other mechanical diverters to extract the registered objects.

  2. Teleoperated robotic sorting system

    DOEpatents

    Roos, Charles E.; Sommer, Edward J.; Parrish, Robert H.; Russell, James R.

    2000-01-01

    A method and apparatus are disclosed for classifying materials utilizing a computerized touch sensitive screen or other computerized pointing device for operator identification and electronic marking of spatial coordinates of materials to be extracted. An operator positioned at a computerized touch sensitive screen views electronic images of the mixture of materials to be sorted as they are conveyed past a sensor array which transmits sequences of images of the mixture either directly or through a computer to the touch sensitive display screen. The operator manually "touches" objects displayed on the screen to be extracted from the mixture thereby registering the spatial coordinates of the objects within the computer. The computer then tracks the registered objects as they are conveyed and directs automated devices including mechanical means such as air jets, robotic arms, or other mechanical diverters to extract the registered objects.

  3. Algorithm Sorts Groups Of Data

    NASA Technical Reports Server (NTRS)

    Evans, J. D.

    1987-01-01

    For efficient sorting, algorithm finds set containing minimum or maximum most significant data. Sets of data sorted as desired. Sorting process simplified by reduction of each multielement set of data to single representative number. First, each set of data expressed as polynomial with suitably chosen base, using elements of set as coefficients. Most significant element placed in term containing largest exponent. Base selected by examining range in value of data elements. Resulting series summed to yield single representative number. Numbers easily sorted, and each such number converted back to original set of data by successive division. Program written in BASIC.

  4. GPCR sorting at multivesicular endosomes.

    PubMed

    Dores, Michael Robert; Trejo, JoAnn

    2015-01-01

    The lysosomal degradation of G protein-coupled receptors (GPCRs) is essential for receptor signaling and down regulation. Once internalized, GPCRs are sorted within the endocytic pathway and packaged into intraluminal vesicles (ILVs) that bud inward to form the multivesicular endosome (MVE). The mechanisms that control GPCR sorting and ILV formation are poorly understood. Quantitative strategies are important for evaluating the function of adaptor and scaffold proteins that regulate sorting of GPCRs at MVEs. In this chapter, we outline two strategies for the quantification and visualization of GPCR sorting into the lumen of MVEs. The first protocol utilizes a biochemical approach to assay the sorting of GPCRs in a population of cells, whereas the second strategy examines GPCR sorting in individual cells using immunofluorescence confocal microscopy. Combined, these assays can be used to establish the kinetics of activated GPCR lysosomal trafficking in response to specific ligands, as well as evaluate the contribution of endosomal adaptors to GPCR sorting at MVEs. The protocols presented in this chapter can be adapted to analyze GPCR sorting in a myriad of cell types and tissues, and expanded to analyze the mechanisms that regulate MVE sorting of other cargoes.

  5. The NSF Earthscope USArray Instrumentation Network

    NASA Astrophysics Data System (ADS)

    Davis, G. A.; Vernon, F.

    2012-12-01

    Since 2004, the Transportable Array component of the USArray Instrumentation Network has collected high resolution seismic data in near real-time from over 400 geographically distributed seismic stations. The deployed footprint of the array has steadily migrated across the continental United States, starting on the west coast and gradually moving eastward. As the network footprint shifts, stations from various regional seismic networks have been incorporated into the dataset. In 2009, an infrasound and barometric sensor component was added to existing core stations and to all new deployments. The ongoing success of the project can be attributed to a number of factors, including reliable communications to each site, on-site data buffering, largely homogenous data logging hardware, and a common phase-locked time reference between all stations. Continuous data quality is ensured by thorough human and automated review of data from the primary sensors and over 24 state-of-health parameters from each station. The staff at the Array Network Facility have developed a number of tools to visualize data and troubleshoot problematic stations remotely. In the event of an emergency or maintenance on the server hardware, data acquisition can be shifted to alternate data centers through the use of virtualization technologies.

  6. What We Learned from Josh: Sorting Out Word Sorting.

    ERIC Educational Resources Information Center

    Fresch, Mary Jo

    2000-01-01

    Describes how a researcher and an elementary school teacher added a word sorting component to help children work through the complexities of the language as they group words into categories. Describes results as fifth graders thought aloud while they sorted words. Finds a link between children's developmental knowledge of spelling and their…

  7. Sorting Nexin 27 Protein Regulates Trafficking of a p21-activated Kinase (PAK) Interacting Exchange Factor (β-Pix)-G Protein-coupled Receptor Kinase Interacting Protein (GIT) Complex via a PDZ Domain Interaction*

    PubMed Central

    Valdes, Julie L.; Tang, Jingrong; McDermott, Mark I.; Kuo, Jean-Cheng; Zimmerman, Seth P.; Wincovitch, Stephen M.; Waterman, Clare M.; Milgram, Sharon L.; Playford, Martin P.

    2011-01-01

    Sorting nexin 27 (SNX27) is a 62-kDa protein localized to early endosomes and known to regulate the intracellular trafficking of ion channels and receptors. In addition to a PX domain, SNX27 is the only sorting family member that contains a PDZ domain. To identify novel SNX27-PDZ binding partners, we performed a proteomic screen in mouse principal kidney cortical collecting duct cells using a GST-SNX27 fusion construct as bait. We found that β-Pix (p21-activated kinase-interactive exchange factor), a guanine nucleotide exchange factor for the Rho family of small GTPases known to regulate cell motility directly interacted with SNX27. The association of β-Pix and SNX27 is specific for β-Pix isoforms terminating in the type-1 PDZ binding motif (ETNL). In the same screen we also identified Git1/2 as a potential SNX27 interacting protein. The interaction between SNX27 and Git1/2 is indirect and mediated by β-Pix. Furthermore, we show recruitment of the β-Pix·Git complex to endosomal sites in a SNX27-dependent manner. Finally, migration assays revealed that depletion of SNX27 from HeLa and mouse principal kidney cortical collecting duct cells significantly decreases cell motility. We propose a model by which SNX27 regulates trafficking of β-Pix to focal adhesions and thereby influences cell motility. PMID:21926430

  8. Sorting nexin 27 protein regulates trafficking of a p21-activated kinase (PAK) interacting exchange factor (β-Pix)-G protein-coupled receptor kinase interacting protein (GIT) complex via a PDZ domain interaction.

    PubMed

    Valdes, Julie L; Tang, Jingrong; McDermott, Mark I; Kuo, Jean-Cheng; Zimmerman, Seth P; Wincovitch, Stephen M; Waterman, Clare M; Milgram, Sharon L; Playford, Martin P

    2011-11-11

    Sorting nexin 27 (SNX27) is a 62-kDa protein localized to early endosomes and known to regulate the intracellular trafficking of ion channels and receptors. In addition to a PX domain, SNX27 is the only sorting family member that contains a PDZ domain. To identify novel SNX27-PDZ binding partners, we performed a proteomic screen in mouse principal kidney cortical collecting duct cells using a GST-SNX27 fusion construct as bait. We found that β-Pix (p21-activated kinase-interactive exchange factor), a guanine nucleotide exchange factor for the Rho family of small GTPases known to regulate cell motility directly interacted with SNX27. The association of β-Pix and SNX27 is specific for β-Pix isoforms terminating in the type-1 PDZ binding motif (ETNL). In the same screen we also identified Git1/2 as a potential SNX27 interacting protein. The interaction between SNX27 and Git1/2 is indirect and mediated by β-Pix. Furthermore, we show recruitment of the β-Pix·Git complex to endosomal sites in a SNX27-dependent manner. Finally, migration assays revealed that depletion of SNX27 from HeLa and mouse principal kidney cortical collecting duct cells significantly decreases cell motility. We propose a model by which SNX27 regulates trafficking of β-Pix to focal adhesions and thereby influences cell motility.

  9. 77 FR 51791 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-27

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... Energy and the National Science Foundation on scientific priorities within the field of basic...

  10. 76 FR 31945 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-06-02

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of Open Meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... Science Foundation on scientific priorities within the field of basic nuclear science research....

  11. 75 FR 6651 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-02-10

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... the National Science Foundation on scientific priorities within the field of basic nuclear...

  12. 76 FR 8359 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-14

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... scientific priorities within the field of basic nuclear science research. Tentative Agenda: Agenda...

  13. 78 FR 56870 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-16

    ... Nuclear Science Advisory Committee AGENCY: Office of Science, Department of Energy. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory. Committee (NSAC... and the National Science Foundation on scientific priorities within the field of basic nuclear...

  14. Congress: House Votes Veto Power on All NSF Research Grants

    ERIC Educational Resources Information Center

    Shapley, Deborah

    1975-01-01

    The House of Representatives voted that the National Science Foundation (NSF) must submit a list of all proposed grant awards to Congress every 30 days as well as justifications for them. The award of any grant can be vetoed by either house within 30 days. This supplants the current method of peer reviews of grant applications. (MLH)

  15. Summary Report of the NSF/EPA WATERS Network Workshop

    EPA Science Inventory

    The National Science Foundation (NSF) and The U.S. Environmental Protection Agency (EPA) organized a workshop to support The WATer and Environmental Research Systems (WATERS) Network project. The WATERS Network is a new joint initiative of the environmental engineering and hydrol...

  16. NSF Anticipates Pushing Boundaries on Open-Access Plan

    ERIC Educational Resources Information Center

    Basken, Paul

    2013-01-01

    The National Science Foundation (NSF), in carrying out the Obama administration's new push for greater public access to research published in scientific journals, will consider exclusivity periods shorter than the 12-month standard in the White House directive, as well as trade-offs involving data-sharing and considerations of publishers'…

  17. Wakimoto discusses role as NSF's incoming assistant director of geosciences

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2012-12-01

    Roger Wakimoto's adrenaline “is starting to pump,” the incoming assistant director for geosciences (GEO) at the U.S. National Science Foundation (NSF) told Eos during an exclusive interview at this month's AGU Fall Meeting in San Francisco. Wakimoto, whose scientific expertise is in extreme weather, is scheduled to take charge as head of the NSF directorate for geosciences starting in February 2013. During his 4-year appointment at NSF, Wakimoto, 59 and an avowed workaholic, will head up the GEO directorate, which has about an $880 million annual funding portfolio and provides about 55% of federal funding for geosciences basic research at U.S. academic institutions. The directorate currently includes the divisions of atmospheric and geospace sciences, Earth sciences, and ocean sciences. In addition, NSF's Office of Polar Programs is slated to become a GEO division under a realignment plan announced on 7 September; Wakimoto said that shift had “no bearing” on his decision to accept the position.

  18. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ....7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Disposition of Rights in Inventions 2527.7002 NSF patent policy. As authorized by the National Science Board at its 230th meeting, October 15-16, 1981,...

  19. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ....7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Disposition of Rights in Inventions 2527.7002 NSF patent policy. As authorized by the National Science Board at its 230th meeting, October 15-16, 1981,...

  20. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ....7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Disposition of Rights in Inventions 2527.7002 NSF patent policy. As authorized by the National Science Board at its 230th meeting, October 15-16, 1981,...

  1. 48 CFR 2527.7002 - NSF patent policy.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ....7002 Section 2527.7002 Federal Acquisition Regulations System NATIONAL SCIENCE FOUNDATION GENERAL CONTRACTING REQUIREMENTS PATENTS, DATA, AND COPYRIGHTS Disposition of Rights in Inventions 2527.7002 NSF patent policy. As authorized by the National Science Board at its 230th meeting, October 15-16, 1981,...

  2. Summary Report of the NSF/EPA WATERS Network Workshop

    EPA Science Inventory

    The National Science Foundation (NSF) and The U.S. Environmental Protection Agency (EPA) organized a workshop to support The WATer and Environmental Research Systems (WATERS) Network project. The WATERS Network is a new joint initiative of the environmental engineering and hydrol...

  3. 78 FR 12044 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-21

    ... Nuclear Science Advisory Committee AGENCY: Office of Science, Department of Energy. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... advice and guidance on a continuing basis to the Department of Energy and the National Science Foundation...

  4. 76 FR 62050 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-06

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of... that the DOE/NSF Nuclear Science Advisory Committee (NSAC) will be renewed for a two- year period beginning on September 30, 2011. The Committee will provide advice to the Director, Office of Science...

  5. 77 FR 9219 - DOE/NSF Nuclear Science Advisory Committee

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-16

    ... Nuclear Science Advisory Committee AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF Nuclear Science Advisory Committee (NSAC... the National Science Foundation on scientific priorities within the field of basic nuclear science...

  6. NSF Anticipates Pushing Boundaries on Open-Access Plan

    ERIC Educational Resources Information Center

    Basken, Paul

    2013-01-01

    The National Science Foundation (NSF), in carrying out the Obama administration's new push for greater public access to research published in scientific journals, will consider exclusivity periods shorter than the 12-month standard in the White House directive, as well as trade-offs involving data-sharing and considerations of publishers'…

  7. NSF-Sponsored Biological and Chemical Oceanography Data Management Office

    NASA Astrophysics Data System (ADS)

    Allison, M. D.; Chandler, C. L.; Copley, N.; Galvarino, C.; Gegg, S. R.; Glover, D. M.; Groman, R. C.; Wiebe, P. H.; Work, T. T.; Biological; Chemical Oceanography Data Management Office

    2010-12-01

    Ocean biogeochemistry and marine ecosystem research projects are inherently interdisciplinary and benefit from improved access to well-documented data. Improved data sharing practices are important to the continued exploration of research themes that are a central focus of the ocean science community and are essential to interdisciplinary and international collaborations that address complex, global research themes. In 2006, the National Science Foundation Division of Ocean Sciences (NSF OCE) funded the Biological and Chemical Oceanography Data Management Office (BCO-DMO) to serve the data management requirements of scientific investigators funded by the National Science Foundation’s Biological and Chemical Oceanography Sections. BCO-DMO staff members work with investigators to manage marine biogeochemical, ecological, and oceanographic data and information developed in the course of scientific research. These valuable data sets are documented, stored, disseminated, and protected over short and intermediate time frames. One of the goals of the BCO-DMO is to facilitate regional, national, and international data and information exchange through improved data discovery, access, display, downloading, and interoperability. In May 2010, NSF released a statement to the effect that in October 2010, it is planning to require that all proposals include a data management plan in the form of a two-page supplementary document. The data management plan would be an element of the merit review process. NSF has long been committed to making data from NSF-funded research publicly available and the new policy will strengthen this commitment. BCO-DMO is poised to assist in creating the data management plans and in ultimately serving the data and information resulting from NSF OCE funded research. We will present an overview of the data management system capabilities including: geospatial and text-based data discovery and access systems; recent enhancements to data search tools; data

  8. NCALM: NSF Supported Center for Airborne Laser Mapping

    NASA Astrophysics Data System (ADS)

    Shrestha, R. L.; Carter, W. E.; Dietrich, W. E.

    2003-12-01

    The National Science Foundation (NSF) recently awarded a grant to create a research center to support the use of airborne laser mapping technology in the scientific community. The NSF supported Center for Airborne Laser Mapping (NCALM) will be operated jointly by the Department of Civil & Coastal Engineering, College of Engineering, University of Florida (UF) and the Department of Earth and Planetary Science, University of California-Berkeley (UCB). NCALM will use the Airborne Laser Swath Mapping (ALSM) system jointly owned by UF and Florida International University (FIU), based at the UF Geosensing Engineering and Mapping (GEM) Research Center. The state-of-the-art laser surveying instrumentation, GPS systems, which are installed in a Cessna 337 Skymaster aircraft, will collect research grade data in areas selected through the competitive NSF grant review process. The ALSM observations will be analyzed both at UF and UCB, and made available to the PI through an archiving and distribution center at UCB-building upon the Berkeley Seismological Laboratory (BSL) Northern California Earthquake Data Center system. The purpose of NCALM is to provide research grade data from ALSM technology to NSF supported research studies in geosciences. The Center will also contribute to software development that will increase the processing speed and data accuracy. This presentation will discuss NCALM operation and the process of submitting proposals to NSF. In addition, it will outline the process to request available NCALM seed project funds to help jump-start small scientific research studies. Funds are also available for travel by academic researchers and students for hands-on knowledge and experience in ALSM technology at UF and UCB.

  9. To sort or not to sort: the impact of spike-sorting on neural decoding performance

    PubMed Central

    Todorova, Sonia; Sadtler, Patrick; Batista, Aaron; Chase, Steven; Ventura, Valérie

    2015-01-01

    Objective Brain-computer interfaces (BCIs) are a promising technology for restoring motor ability to paralyzed patients: spiking-based BCIs have successfully been used in clinical trials to control multi-degree-of-freedom robotic devices. Current implementations of these devices require a lengthy spike-sorting step, which is an obstacle to moving this technology from the lab to the clinic. A viable alternative is to avoid spike-sorting, treating all threshold crossings of the voltage waveform on an electrode as coming from one putative neuron. It is not known, however, how much decoding information might be lost by ignoring spike identity. Approach We present a full analysis of the effects of spike-sorting schemes on decoding performance. Specifically, we compare how well two common decoders, the optimal linear estimator and the Kalman filter, reconstruct the arm movements of non-human primates performing reaching tasks, when receiving input from various sorting schemes. The schemes we tested included: using threshold crossings without spike-sorting; expertsorting discarding the noise; expert-sorting, including the noise as if it were another neuron; and automatic spike-sorting using waveform features. We also decoded from a joint statistical model for the waveforms and tuning curves, which does not involve an explicit spike-sorting step. Main results Discarding the threshold crossings that cannot be assigned to neurons degrades decoding: no spikes should be discarded. Decoding based on spike-sorted units outperforms decoding based on electrodes voltage crossings: spike-sorting is useful. The four waveform based spike-sorting methods tested here yield similar decoding efficiencies: a fast and simple method is competitive. Decoding using the joint waveform and tuning model shows promise but is not consistently superior. Significance Our results indicate that simple automated spikesorting performs as well as computationally or manually more intensive methods, which

  10. Feed sorting in dairy cattle: Causes, consequences, and management.

    PubMed

    Miller-Cushon, E K; DeVries, T J

    2016-12-29

    Dairy cattle commonly sort total mixed rations, a behavior that influences individual nutrient intake and reduces the nutritive value of the ration left in the bunk across the day. Typical patterns of feed sorting in lactating dairy cows, against longer forage particles, result in greater intake of highly-fermentable carbohydrates and lesser intake of effective fiber than intended, and are associated with reduced rumen pH and altered milk composition. To understand the reason for this behavior and reduce it on-farm, numerous studies have explored the influences of ration characteristics, feeding strategies, and management factors on the expression of feed sorting. In mature cows and young calves, feed sorting is influenced by forage inclusion rate, particle size, and dry matter content. Feeding strategies that increase the time available to manipulate feed-including decreased feeding frequency and increased feeding level-may result in increased feed sorting. The extent of feed sorting is also influenced by a variety of herd-level factors, but variability between individuals in the extent of feed sorting suggests that this behavior may be subject to additional factors, including previous experience and internal state. The development of feed sorting in young calves has been explored in several recent studies, suggesting that early opportunities to sort feed, as provided by access to mixed diets, may encourage the early onset of this behavior and help it persist beyond weaning. Evidence also supports the role of feedback mechanisms that influence this behavior at the individual level. In calves and adult cows, selective consumption of higher-energy ration components may be linked to energy demands, as influenced by the availability of supplemental feed or changing metabolic status. Further, considerable evidence suggests that cattle will adjust patterns of feed sorting in favor of physically effective fiber to attenuate low rumen pH, providing evidence for the role

  11. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) protein-induced lysosomal translocation of proapoptotic effectors is mediated by phosphofurin acidic cluster sorting protein-2 (PACS-2).

    PubMed

    Werneburg, Nathan W; Bronk, Steve F; Guicciardi, Maria Eugenia; Thomas, Laurel; Dikeakos, Jimmy D; Thomas, Gary; Gores, Gregory J

    2012-07-13

    Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis of liver cancer cell lines requires death receptor-5 (DR5)-dependent permeabilization of lysosomal membranes. Ligated DR5 triggers recruitment of the proapoptotic proteins Bim and Bax to lysosomes, releasing cathepsin B into the cytosol where it mediates mitochondria membrane permeabilization and activation of executioner caspases. Despite the requirement for lysosome membrane permeabilization during TRAIL-induced apoptosis, little is known about the mechanism that controls recruitment of Bim and Bax to lysosomal membranes. Here we report that TRAIL induces recruitment of the multifunctional sorting protein phosphofurin acidic cluster sorting protein-2 (PACS-2) to DR5-positive endosomes in Huh-7 cells where it forms an immunoprecipitatable complex with Bim and Bax on lysosomal membranes. shRNA-targeted knockdown of PACS-2 prevents recruitment of Bim or Bax to lysosomes, blunting the TRAIL-induced lysosome membrane permeabilization. Consistent with the reduced lysosome membrane permeabilization, shRNA knockdown of PACS-2 in Huh-7 cells reduced TRAIL-induced apoptosis and increased clonogenic cell survival. The determination that recombinant PACS-2 bound Bim but not Bax in vitro and that shRNA knockdown of Bim blocked Bax recruitment to lysosomes suggests that TRAIL/DR5 triggers endosomal PACS-2 to recruit Bim and Bax to lysosomes to release cathepsin B and induce apoptosis. Together, these findings provide insight into the lysosomal pathway of apoptosis.

  12. To sort or not to sort: the impact of spike-sorting on neural decoding performance

    NASA Astrophysics Data System (ADS)

    Todorova, Sonia; Sadtler, Patrick; Batista, Aaron; Chase, Steven; Ventura, Valérie

    2014-10-01

    Objective. Brain-computer interfaces (BCIs) are a promising technology for restoring motor ability to paralyzed patients. Spiking-based BCIs have successfully been used in clinical trials to control multi-degree-of-freedom robotic devices. Current implementations of these devices require a lengthy spike-sorting step, which is an obstacle to moving this technology from the lab to the clinic. A viable alternative is to avoid spike-sorting, treating all threshold crossings of the voltage waveform on an electrode as coming from one putative neuron. It is not known, however, how much decoding information might be lost by ignoring spike identity. Approach. We present a full analysis of the effects of spike-sorting schemes on decoding performance. Specifically, we compare how well two common decoders, the optimal linear estimator and the Kalman filter, reconstruct the arm movements of non-human primates performing reaching tasks, when receiving input from various sorting schemes. The schemes we tested included: using threshold crossings without spike-sorting; expert-sorting discarding the noise; expert-sorting, including the noise as if it were another neuron; and automatic spike-sorting using waveform features. We also decoded from a joint statistical model for the waveforms and tuning curves, which does not involve an explicit spike-sorting step. Main results. Discarding the threshold crossings that cannot be assigned to neurons degrades decoding: no spikes should be discarded. Decoding based on spike-sorted units outperforms decoding based on electrodes voltage crossings: spike-sorting is useful. The four waveform based spike-sorting methods tested here yield similar decoding efficiencies: a fast and simple method is competitive. Decoding using the joint waveform and tuning model shows promise but is not consistently superior. Significance. Our results indicate that simple automated spike-sorting performs as well as the more computationally or manually intensive

  13. Multiphase ferrofluid flows for micro-particle sorting

    NASA Astrophysics Data System (ADS)

    Zhou, Ran; Wang, Cheng

    2015-11-01

    Utilizing negative magnetophoresis, ferrofluids have demonstrated great potential for sorting nonmagnetic micro-particles by size. Most of the existing techniques use single phase ferrofluids by pushing micro-particles to channel walls; the sorting speed is thus hindered. We demonstrate a novel sorting strategy by co-flowing a ferrofluid and a non-magnetic fluid in microchannels. Due to the magnetic force, the particles migrate across the ferrofluid stream at size-dependent velocities as they travel downstream. The laminar interface between the two fluids functions as a virtual boundary to accumulate particles, resulting in effective separation of particles. A stable and sharp interface is important to the success of this sorting technique. We investigate several factors that affect sorting efficiency, including magnetic field, susceptibility difference of the fluids, flow velocity, and channel geometry.

  14. Standard Practice for Cell Sorting in a BSL-3 Facility

    PubMed Central

    Perfetto, Stephen P.; Ambrozak, David R.; Nguyen, Richard; Roederer, Mario; Koup, Richard A.; Holmes, Kevin L.

    2016-01-01

    Over the past decade, there has been a rapid growth in the number of BSL-3 and BSL-4 laboratories in the USA and an increase in demand for infectious cell sorting in BSL-3 laboratories. In 2007, the International Society for Advancement of Cytometry (ISAC) Biosafety Committee published standards for the sorting of unfixed cells and is an important resource for biosafety procedures when performing infectious cell sorting. Following a careful risk assessment, if it is determined that a cell sorter must be located within a BSL-3 laboratory, there are a variety of factors to be considered prior to the establishment of the laboratory. This chapter outlines procedures for infectious cell sorting in a BSL-3 environment to facilitate the establishment and safe operation of a BSL-3 cell sorting laboratory. Subjects covered include containment verification, remote operation, disinfection, personal protective equipment (PPE), and instrument-specific modifications for enhanced aerosol evacuation. PMID:21116997

  15. Evidence-based recommendations for designing free-sorting experiments.

    PubMed

    Blanchard, Simon J; Banerji, Ishani

    2016-12-01

    The card-sorting task is a flexible research tool that is widely used across many of the subfields of psychology. Yet this same great flexibility requires researchers to make several (seemingly arbitrary) decisions in their designs, such as fixing a sufficient number of objects to sort, setting task requirements, and creating task instructions for participants. In the present research, we provide a systematic empirical investigation of the consequences of typical researcher design choices while administering sorting tasks. Specifically, we studied the effects of seven sorting task design factors by collecting data from over 1,000 online participants assigned to one of 36 sorting tasks, as part of a fractional factorial experimental design. Analyses show the effects of the various researcher decisions on the probability that participants would quit the task, the amount of time spent on the task, the number of piles made, and posttask measures such as satisfaction and depletion. Research design recommendations are provided.

  16. NSF's Handling of Allegations of Misconduct in Science

    NASA Astrophysics Data System (ADS)

    Manka, Aaron

    2000-03-01

    Under NSF's Office of Inspector General mandate to prevent fraud, waste, abuse, or mismanagement involving NSF's proposals and awards, our office is unique in that it also investigates allegations of misconduct in science. I will discuss our office's handling of such matters, focusing on the ethical and legal obligations of proposal submitters and awardees and the role of the scientific community. To illustrate some of these points that are of interest to the physics community, I will discuss some of our investigative activities relevant to: duplicate funding, cost sharing, and the accuracy of information in proposals. If the OSTP policy on research misconduct has been released for public comment, I will briefly discuss this policy, which is meant to be adopted by all federal funding agencies, and what it will mean for us and the community we serve.

  17. Engaging the Next Generation of Polar Scientists: An NSF Perspective

    NASA Astrophysics Data System (ADS)

    Crain, R.

    2008-12-01

    Sealing the leaky pipeline in science education requires new approaches. Leading up to and during the International Polar Year (2007-2009), NSF's Office of Polar Programs supported projects to engage the next generation of polar scientists. The portfolio emphasized adventure, experiential, and place-based education and included symposia and the development of web-based materials. Field experiences for teachers and university students ranged from individuals to small groups conducting research in the Arctic and Antarctic. Over 150 K12 teachers have now been on polar expeditions with NSF support. The legacy of these efforts can be observed through impacts to the participants and through materials that will be available long after IPY. Your innovative ideas are needed to attract and retain the next generation of scientists inside and outside of the polar regions.

  18. Improved Access to NSF Funded Ocean Research Data

    NASA Astrophysics Data System (ADS)

    Chandler, C. L.; Groman, R. C.; Kinkade, D.; Shepherd, A.; Rauch, S.; Allison, M. D.; Gegg, S. R.; Wiebe, P. H.; Glover, D. M.

    2015-12-01

    Data from NSF-funded, hypothesis-driven research comprise an essential part of the research results upon which we base our knowledge and improved understanding of the impacts of climate change. Initially funded in 2006, the Biological and Chemical Oceanography Data Management Office (BCO-DMO) works with marine scientists to ensure that data from NSF-funded ocean research programs are fully documented and freely available for future use. BCO-DMO works in partnership with information technology professionals, other marine data repositories and national data archive centers to ensure long-term preservation of these valuable environmental research data. Data contributed to BCO-DMO by the original investigators are enhanced with sufficient discipline-specific documentation and published in a variety of standards-compliant forms designed to enable discovery and support accurate re-use.

  19. Report: NSF Instrumentation and Laboratory Improvement Grants in Chemistry

    NASA Astrophysics Data System (ADS)

    1997-01-01

    The 1996 awards in chemistry under the Instrumentation and Laboratory Improvement Program (ILI) of the Division of Undergraduate Education (DUE) have been announced and are listed below. The ILI program provides matching funds in the range of 5,000 to 100,000 for purchasing equipment for laboratory improvement. Since the recipient institution must provide matching funds equaling or exceeding the NSF award, the supported projects range in cost from 10,000 to over 200,000. The 311 chemistry proposals requesting 13 million constituted 21% of the total number of proposals submitted to the ILI program. A total of 3.9 million was awarded in support of 110 projects in chemistry. The instruments requested most frequently were high field NMRs, GC/MS instruments, computers for data analysis, and FT-IRs; next most commonly requested were UV-vis spectrophotometers, followed by HPLCs, lasers, computers for molecular modeling, AAs, and GCs. In addition, one award was made this year in chemistry within the Leadership in Laboratory Development category. The next deadline for submission of ILI proposals is November 14, 1997. Guidelines for the preparation of proposals are found in the DUE Program Announcement (NSF 96-10), which may be obtained by calling (703) 306-1666 or by e-mail: undergrad@nsf.gov. Other information about DUE programs and activities and abstracts of the funded proposals can be found on the DUE Home Page at http://www.ehr.nsf.gov/EHR/DUE/start.htm. We thank Sandra D. Nelson, Science Education Analyst in DUE, for assistance in data gathering.

  20. Former NSF assistant director Killeen reflects on geosciences and society

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2012-12-01

    “This is prime time for the geosciences,” Tim Killeen, former assistant director for geosciences at the U.S. National Science Foundation (NSF GEO), told Eos during a recent exclusive interview. Killeen, who served at NSF from July 2008 until his term expired in June 2012, oversaw a number of new initiatives and an expansion of the geoscience directorate's annual funding portfolio from $752 million to about $880 million. NSF announced on 7 November that Roger Wakimoto, director of the National Center for Atmospheric Research, will start as the new geosciences assistant director in February 2013 (see related article, this page, and Eos, 93(47), 475, doi:10.1029/ 2012EO470004). During the broad-ranging interview, Killeen reflected on the importance of the geosciences and their relationship to society. Killeen has been president of the Research Foundation for the State University of New York (RFSUNY) and SUNY vice chancellor for research since 9 July. He took the helm of RFSUNY after some personnel there “took advantage of lax oversight to cheat taxpayers,” according to New York State comptroller Thomas DiNapoli. Killeen, who was AGU president from 2006 to 2008, is responsible for the supervision and operation of RFSUNY, which supports about $1 billion in research at SUNY, an institution with 64 campuses and nearly 470,000 students.

  1. Communicating Science Broadly: An NSF Point of View

    NASA Astrophysics Data System (ADS)

    Leinen, M. S.

    2006-12-01

    In the view of NSF, communicating about both the process of doing science and about scientific results are of paramount importance. But those of us in the agency are not the ones who do the science or generate the results. Thus, our policy is to encourage the community we fund to communicate their results as broadly as possible. Why does NSF feel so strongly about communicating scientific results? First, science only moves forward when there is free and open debate about scientific results through public mechanisms in which there is an opportunity for thorough analysis (e.g. scientific literature, professional meetings and workshops). Second, the research we support is done for the good of the public and should be communicated to the public. Third, scientific results are critical to many important decision-making processes and policy-making processes. Democracies thrive when an informed public is engaged, so communicating science broadly to the lay public is important. Why does NSF feel so strongly about communicating about the process of science? Science is a habit of mind; an orderly process for testing ideas. But many do not understand how science is done, the difference between fact and conjecture, why speculation, hypotheses and theory are critical to progress, or why the culture of constructive criticism is essential to progress. Without this context, science can be misunderstood as magic, opinion, or argument. Thus the efforts that we fund to enhance scientific education and outreach are critical to having discourse about scientific results.

  2. Congressional geohazards showcase presented by NSF and AGU

    NASA Astrophysics Data System (ADS)

    Uhlenbrock, Kristan

    2011-10-01

    On Wednesday, 7 September 2011, two weeks after the magnitude 5.8 earthquake in Mineral, Va., and a week after Hurricane Irene struck the U.S. East Coast, AGU cosponsored a showcase of National Science Foundation (NSF)—funded hazards research in recognition of National Preparedness Month. This annual event highlights NSF—funded hazards research from all over the United States, with more than 30 exhibitors demonstrating the latest research and technology on hurricanes, earthquakes, tornadoes, volcanoes, tsunamis, and oil spills, as well as emergency and social responses to these events. The event took place at the Hart Senate Office Building, where many members of Congress and their staff could attend and discuss the importance of hazards research with the researchers and NSF staff. Sen. Bill Nelson (D-Fla.) kicked off with a panel of speakers, which included remarks by Mary Voytek, a member of the AGU Board of Directors, and Subra Suresh, director of NSF. Expert presentations were also given on hazard prediction, human safety, and social response. Following the event, Senate Majority Leader Harry Reid (D-Nev.) hosted a small event to meet directly with a few of the exhibitors to discuss the importance of investment in scientific research and development.

  3. Integrating Research and Education in NSF's Office of Polar Programs

    NASA Astrophysics Data System (ADS)

    Wharton, R. A.; Crain, R. D.

    2003-12-01

    The National Science Foundation invests in activities that integrate research and education, and that develop reward systems to support teaching, mentoring and outreach. Effective integration of research and education at all levels can infuse learning with the excitement of discovery. It can also ensure that the findings and methods of research are quickly and effectively communicated in a broader context and to a larger audience. This strategy is vital to the accomplishment of NSF's strategic goals of ensuring a world-class science and engineering workforce, new knowledge across the frontiers of science and engineering, and the tools to get the job done efficiently and effectively. The NSF's Office of Polar Programs sponsors educational projects at all levels of learning, making full use of the variety of disciplinary and interdisciplinary studies in the polar regions to attract and invigorate students. An array of efforts from the Arctic and Antarctic scientific communities link research activities with education. There has been an advance from the beneficial but isolated impacts of individual researcher visits to K-12 classrooms to large-scale developments, such as field research experiences for teachers and undergraduate students, online sharing of polar field experiences with rural classrooms, the institution of interdisciplinary graduate research programs through NSF initiatives, and opportunities for minority and underrepresented groups in polar sciences. The NSF's criterion for evaluating proposals based upon the broader impacts of the research activity has strengthened efforts to link research and education, resulting in partnerships and innovations that infuse research into education from kindergarten through postdoctoral studies and reaching out to the general public. In addition, the Office of Polar Programs partners with other directorates at NSF to broaden OPP's efforts and benefit from resources and experience in the Education and Human Resources

  4. Microspherical photonics: Sorting resonant photonic atoms by using light

    SciTech Connect

    Maslov, Alexey V.; Astratov, Vasily N.

    2014-09-22

    A method of sorting microspheres by resonant light forces in vacuum, air, or liquid is proposed. Based on a two-dimensional model, it is shown that the sorting can be realized by allowing spherical particles to traverse a focused beam. Under resonance with the whispering gallery modes, the particles acquire significant velocity along the beam direction. This opens a unique way of large-volume sorting of nearly identical photonic atoms with 1/Q accuracy, where Q is the resonance quality factor. This is an enabling technology for developing super-low-loss coupled-cavity structures and devices.

  5. ALGORITHM FOR SORTING GROUPED DATA

    NASA Technical Reports Server (NTRS)

    Evans, J. D.

    1994-01-01

    It is often desirable to sort data sets in ascending or descending order. This becomes more difficult for grouped data, i.e., multiple sets of data, where each set of data involves several measurements or related elements. The sort becomes increasingly cumbersome when more than a few elements exist for each data set. In order to achieve an efficient sorting process, an algorithm has been devised in which the maximum most significant element is found, and then compared to each element in succession. The program was written to handle the daily temperature readings of the Voyager spacecraft, particularly those related to the special tracking requirements of Voyager 2. By reducing each data set to a single representative number, the sorting process becomes very easy. The first step in the process is to reduce the data set of width 'n' to a data set of width '1'. This is done by representing each data set by a polynomial of length 'n' based on the differences of the maximum and minimum elements. These single numbers are then sorted and converted back to obtain the original data sets. Required input data are the name of the data file to read and sort, and the starting and ending record numbers. The package includes a sample data file, containing 500 sets of data with 5 elements in each set. This program will perform a sort of the 500 data sets in 3 - 5 seconds on an IBM PC-AT with a hard disk; on a similarly equipped IBM PC-XT the time is under 10 seconds. This program is written in BASIC (specifically the Microsoft QuickBasic compiler) for interactive execution and has been implemented on the IBM PC computer series operating under PC-DOS with a central memory requirement of approximately 40K of 8 bit bytes. A hard disk is desirable for speed considerations, but is not required. This program was developed in 1986.

  6. ALGORITHM FOR SORTING GROUPED DATA

    NASA Technical Reports Server (NTRS)

    Evans, J. D.

    1994-01-01

    It is often desirable to sort data sets in ascending or descending order. This becomes more difficult for grouped data, i.e., multiple sets of data, where each set of data involves several measurements or related elements. The sort becomes increasingly cumbersome when more than a few elements exist for each data set. In order to achieve an efficient sorting process, an algorithm has been devised in which the maximum most significant element is found, and then compared to each element in succession. The program was written to handle the daily temperature readings of the Voyager spacecraft, particularly those related to the special tracking requirements of Voyager 2. By reducing each data set to a single representative number, the sorting process becomes very easy. The first step in the process is to reduce the data set of width 'n' to a data set of width '1'. This is done by representing each data set by a polynomial of length 'n' based on the differences of the maximum and minimum elements. These single numbers are then sorted and converted back to obtain the original data sets. Required input data are the name of the data file to read and sort, and the starting and ending record numbers. The package includes a sample data file, containing 500 sets of data with 5 elements in each set. This program will perform a sort of the 500 data sets in 3 - 5 seconds on an IBM PC-AT with a hard disk; on a similarly equipped IBM PC-XT the time is under 10 seconds. This program is written in BASIC (specifically the Microsoft QuickBasic compiler) for interactive execution and has been implemented on the IBM PC computer series operating under PC-DOS with a central memory requirement of approximately 40K of 8 bit bytes. A hard disk is desirable for speed considerations, but is not required. This program was developed in 1986.

  7. 45 CFR 689.5 - Initial NSF handling of misconduct matters.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Initial NSF handling of misconduct matters. 689.5... FOUNDATION RESEARCH MISCONDUCT § 689.5 Initial NSF handling of misconduct matters. (a) NSF staff who learn of alleged misconduct will promptly and discreetly inform OIG or refer informants to OIG. (b) The identity...

  8. Parallel mergs sort using comparison matrices. I

    SciTech Connect

    Romm, Y.E.

    1995-05-01

    The topics discussed in this paper are connected with internal merge sorting by a key (in short, M-sorting or M-sort). Originally developed by von Neumann, this is one of the first sorting methods. It still remains one of the fastest, involving Nlog{sub 2}N comparisons. The purpose of our article is to demonstrate the use of comparison matrices (CMs) for merging in M-sort. While preserving the known advantages of the sequential implementation of M-sort. CMs ensure more efficient use of main memory (one of the known weaknesses of M-sort is its large memory requirements) and effective parallelizability.

  9. Sorting waves and associated eigenvalues

    NASA Astrophysics Data System (ADS)

    Carbonari, Costanza; Colombini, Marco; Solari, Luca

    2017-04-01

    The presence of mixed sediment always characterizes gravel bed rivers. Sorting processes take place during bed load transport of heterogeneous sediment mixtures. The two main elements necessary to the occurrence of sorting are the heterogeneous character of sediments and the presence of an active sediment transport. When these two key ingredients are simultaneously present, the segregation of bed material is consistently detected both in the field [7] and in laboratory [3] observations. In heterogeneous sediment transport, bed altimetric variations and sorting always coexist and both mechanisms are independently capable of driving the formation of morphological patterns. Indeed, consistent patterns of longitudinal and transverse sorting are identified almost ubiquitously. In some cases, such as bar formation [2] and channel bends [5], sorting acts as a stabilizing effect and therefore the dominant mechanism driving pattern formation is associated with bed altimetric variations. In other cases, such as longitudinal streaks, sorting enhances system instability and can therefore be considered the prevailing mechanism. Bedload sheets, first observed by Khunle and Southard [1], represent another classic example of a morphological pattern essentially triggered by sorting, as theoretical [4] and experimental [3] results suggested. These sorting waves cause strong spatial and temporal fluctuations of bedload transport rate typical observed in gravel bed rivers. The problem of bed load transport of a sediment mixture is formulated in the framework of a 1D linear stability analysis. The base state consists of a uniform flow in an infinitely wide channel with active bed load transport. The behaviour of the eigenvalues associated with fluid motion, bed evolution and sorting processes in the space of the significant flow and sediment parameters is analysed. A comparison is attempted with the results of the theoretical analysis of Seminara Colombini and Parker [4] and Stecca

  10. Hybrid optical and acoustic force based sorting

    NASA Astrophysics Data System (ADS)

    O'Mahoney, Paul; Brodie, Graham W.; Wang, Han; Demore, Christine E. M.; Cochran, Sandy; Spalding, Gabriel C.; MacDonald, Michael P.

    2014-09-01

    We report the combined use of optical sorting and acoustic levitation to give particle sorting. Differing sizes of microparticles are sorted optically both with and without the aid of acoustic levitation, and the results compared to show that the use of acoustic trapping can increase sorting efficiency. The use of a transparent ultrasonic transducer is also shown to streamline the integration of optics and acoustics. We also demonstrate the balance of optical radiation pressure and acoustic levitation to achieve vertical sorting.

  11. Pica: sorting it out.

    PubMed

    Boyle, J S; Mackey, M C

    1999-01-01

    Pica, a culture-bound illness, has occurred for centuries. The ingestion of nonfood substances such as starch, cornstarch, clay, dirt, and other material is fairly common, although the distribution of the condition varies by cultural and socioeconomic factors. The underlying cause of pica is not known, although the condition often is associated with pregnancy. There is conflicting evidence about the association of nutrient deficiencies and pica. This article presents a clinical example of pica in a pregnant 33-year-old African American woman. Implications for culturally appropriate care are discussed.

  12. Sex-sorting sperm using flow cytometry/cell sorting.

    PubMed

    Garner, Duane L; Evans, K Michael; Seidel, George E

    2013-01-01

    The sex of mammalian offspring can be predetermined by flow sorting relatively pure living populations of X- and Y-chromosome-bearing sperm. This method is based on precise staining of the DNA of sperm with the nucleic acid-specific fluorophore, Hoechst 33342, to differentiate between the subpopulations of X- and Y-sperm. The fluorescently stained sperm are then sex-sorted using a specialized high speed sorter, MoFlo(®) SX XDP, and collected into biologically supportive media prior to reconcentration and cryopreservation in numbers adequate for use with artificial insemination for some species or for in vitro fertilization. Sperm sorting can provide subpopulations of X- or Y-bearing bovine sperm at rates in the 8,000 sperm/s range while maintaining; a purity of 90% such that it has been applied to cattle on a commercial basis. The sex of offspring has been predetermined in a wide variety of mammalian species including cattle, swine, horses, sheep, goats, dogs, cats, deer, elk, dolphins, water buffalo as well as in humans using flow cytometric sorting of X- and Y-sperm.

  13. All sorts of options for food product sorting

    USDA-ARS?s Scientific Manuscript database

    Most food products undergo significant processing before arrival at the grocery store or local market. A major component of this processing includes sorting the product according to quality attributes such as size, color, sweetness, and ripeness. In addition, removal of defects or contaminants is a ...

  14. FACS Sorting Mammary Stem Cells.

    PubMed

    Iriondo, Oihana; Rábano, Miriam; Vivanco, María D M

    2015-01-01

    Fluorescent-activated cell sorting (FACS) represents one of the key techniques that have been used to isolate and characterize stem cells, including cells from the mammary gland. A combination of approaches, including recognition of cell surface antigens and different cellular activities, has facilitated the identification of stem cells from the healthy mammary gland and from breast tumors. In this chapter we describe the protocol to use FACS to separate breast cancer stem cells, but most of the general principles discussed could be applied to sort other types of cells.

  15. Automated Sorting of Transuranic Waste

    SciTech Connect

    Shurtliff, Rodney Marvin

    2001-03-01

    The HANDSS-55 Transuranic Waste Sorting Module is designed to sort out items found in 55-gallon drums of waste as determined by an operator. Innovative imaging techniques coupled with fast linear motor-based motion systems and a flexible end-effector system allow the operator to remove items from the waste stream by a touch of the finger. When all desired items are removed from the waste stream, the remaining objects are automatically moved to a repackaging port for removal from the glovebox/cell. The Transuranic Waste Sorting Module consists of 1) a high accuracy XYZ Stereo Measurement and Imaging system, 2) a vibrating/tilting sorting table, 3) an XY Deployment System, 4) a ZR Deployment System, 5) several user-selectable end-effectors, 6) a waste bag opening system, 7) control and instrumentation, 8) a noncompliant waste load-out area, and 9) a Human/Machine Interface (HMI). The system is modular in design to accommodate database management tools, additional load-out ports, and other enhancements. Manually sorting the contents of a 55-gallon drum takes about one day per drum. The HANDSS-55 Waste Sorting Module is designed to significantly increase the throughput of this sorting process by automating those functions that are strenuous and tiresome for an operator to perform. The Waste Sorting Module uses the inherent ability of an operator to identify the items that need to be segregated from the waste stream and then, under computer control, picks that item out of the waste and deposits it in the appropriate location. The operator identifies the object by locating the visual image on a large color display and touches the image on the display with his finger. The computer then determines the location of the object, and performing a highspeed image analysis determines its size and orientation, so that a robotic gripper can be deployed to pick it up. Following operator verification by voice or function key, the object is deposited into a specified location.

  16. Analyses of prognosis-related factors of intracranial solitary fibrous tumors and hemangiopericytomas help understand the relationship between the two sorts of tumors.

    PubMed

    Zeng, Lingcheng; Wang, Yan; Wang, Yu; Han, Lin; Niu, Hongquan; Zhang, Mengxian; Ke, Changshu; Chen, Jian; Lei, Ting

    2017-01-01

    Increasing evidence has suggested a close relationship between solitary fibrous tumors (SFTs) and hemangiopericytomas (HPCs) in the central nervous system (CNS). However, CNS SFTs differentiate from HPCs in their clinical behavior and patient prognoses. Analyses of prognosis-related factors can help clarify the relationship between SFT and HPC. The intracranial SFT and HPC cases treated in our departments from January 2002 to December 2012 were retrospectively reviewed. The SFT and HPC cases were also combined into an SFT/HPC group. The factors associated with patient progression-free survival (PFS) and overall survival (OS) were statistically analyzed using uni- and multivariate analyses. Fifty-eight intracranial SFT/HPC patients including 38 SFT patients and 20 HPC patients were treated during this period. The "Marseille grading" evaluated upon the histological aggressive phenotypes was applied in this study. The grading reflected a malignant progression ranging from "conventional" SFTs (grade I) to WHO III HPCs (grade III), and grade was negatively correlated with the PFS and OS of the SFT, HPC and SFT/HPC patients (P < 0.05).The multivariate analyses revealed that gross total resection (GTR) was significantly positively correlated with PFS and OS in the SFT, HPC and SFT/HPC patients and that radiotherapy was significantly positively correlated with PFS in the HPC and SFT/HPC patients (P < 0.05). In conclusion, the intracranial SFTs and HPCs share common prognostic factors including extent of surgery and pathology, moreover, the histological grading of the aggressive phenotypes supports the unifying of the CNS SFT and HPC into one tumor entity of SFT/HPC.

  17. Sorting the nuclear proteome

    PubMed Central

    Bauer, Denis C.; Willadsen, Kai; Buske, Fabian A.; Lê Cao, Kim-Anh; Bailey, Timothy L.; Dellaire, Graham; Bodén, Mikael

    2011-01-01

    Motivation: Quantitative experimental analyses of the nuclear interior reveal a morphologically structured yet dynamic mix of membraneless compartments. Major nuclear events depend on the functional integrity and timely assembly of these intra-nuclear compartments. Yet, unknown drivers of protein mobility ensure that they are in the right place at the time when they are needed. Results: This study investigates determinants of associations between eight intra-nuclear compartments and their proteins in heterogeneous genome-wide data. We develop a model based on a range of candidate determinants, capable of mapping the intra-nuclear organization of proteins. The model integrates protein interactions, protein domains, post-translational modification sites and protein sequence data. The predictions of our model are accurate with a mean AUC (over all compartments) of 0.71. We present a complete map of the association of 3567 mouse nuclear proteins with intra-nuclear compartments. Each decision is explained in terms of essential interactions and domains, and qualified with a false discovery assessment. Using this resource, we uncover the collective role of transcription factors in each of the compartments. We create diagrams illustrating the outcomes of a Gene Ontology enrichment analysis. Associated with an extensive range of transcription factors, the analysis suggests that PML bodies coordinate regulatory immune responses. Contact: m.boden@uq.edu.au Supplementary information: Supplementary data are available at Bioinformatics online. PMID:21685104

  18. Six NSF-NATO postdocs go to geoscientists

    NASA Astrophysics Data System (ADS)

    Six Earth scientists will study in the United Kingdom, Norway, and Italy on postdoctoral fellowships administered by the National Science Foundation (NSF) as part of a program sponsored by the North American Treaty Organization (NATO). In all, 57 NSF-NATO postdoctoral fellowships in science were awarded in March 1988 for study abroad for up to 12 months.The six students that received fellowships for study in geosciences are Henry N. (Spike) Berry (University of Massachusetts, Amherst, Mass.), to study geology at the University of Oslo, Norway; Marcus I. Bursik (California Institute of Technology, Pasadena, Calif.), to study geology at Cambridge University, Cambridge, U.K.; Mary S. Hubbard (Massachusetts Institute of Technology, Cambridge, Mass.), to study geology at the University of Leicester, Leicester, U. K.); Paul R. Lundgren (Northwestern University, Chicago, III.), to study geophysics at the National Institute of Geophysics, Rome; James Webster (U.S. Geological Survey, Reston, Va.), to study experiment petrology at the University of Edinburgh, U.K.; and Joseph R. Pawlik (Scripps Institution of Oceanography, La Jolla, Calif.), to study biological oceanography at the Marine Science Laboratories, Menai Bridge, U.K.

  19. ORNL/NSF elementary science leadership leadership institute

    SciTech Connect

    Lashley, T.L.

    1994-12-31

    Begun as a Teacher Enhancement Project in 1990, Oak Ridge National Laboratory (ORNL) is now hosting as annual four-week Elementary Science Leadership summer institute for twenty-five teacher/administrator participants. During 1993-95 summer institutes, the participants receive instruction in science/math content, pedagogy, leadership training, and evaluation techniques. Science topics and instruction will be selected from the best available resources at ORNL, pedagogy and evaluation techniques will be directed by the University of Tennessee`s College of Education, and leadership training will be based on established leadership training models. During the academic year component, participants will: (1) share new math/science knowledge and curriculum with their students and fellow teachers while continuing to develop additional curriculum to share with other Leadership Institute participants, (2) work with the established state-wide advisory group to contribute to systemic reform in math/science education, and (3) prepare and deliver NSF leadership Institute-related math/science presentations at local and state educational conferences. Graduate credit for summer and academic-year participation in the NSF Leadership Institute will be offered through the University of Tennessee at Knoxville.

  20. NSF Geosciences Initiatives and Plans Reviewed at Advisory Committee Meeting

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2010-10-01

    In its semiannual meeting on 6-7 October, the U.S. National Science Foundation's (NSF) Advisory Committee for Geosciences (GEO) reviewed GEO initiatives, programs, and plans, including the GEO directorate's fast and significant response to support research related to various aspects of the Deepwater Horizon oil spill in the Gulf of Mexico through Rapid Response Research (RAPID) awards and other measures. An undercurrent during the meeting was concern about workload stress among GEO staff. Assistant director of geosciences Tim Killeen noted that the proposed budget for fiscal year (FY) 2011, which began on 1 October, would increase directorate funding 7.4% over FY 2010, if the budget is approved by Congress. A continuing resolution in Congress maintains FY 2010 funding levels until at least 3 December. Killeen said NSF's budget request for FY 2012 has been submitted to the White House Office of Management and Budget, adding that although he cannot discuss details of that budget yet, GEO Vision, a long­range strategy document for the directorate released in October 2009, “is reflected in our thinking going forward.”

  1. Deformability-based capsule sorting

    NASA Astrophysics Data System (ADS)

    Le Goff, Anne; Munier, Nadege; Maire, Pauline; Edwards-Levy, Florence; Salsac, Anne-Virginie

    2015-11-01

    Many microfluidic devices have been developed for cancer diagnosis applications, most of which relying on costly antibodies. Since some cancer cells display abnormal mechanical properties, new sorting tools based on mechanical sensing are of particular interest. We present a simple, passive pinched flow microfluidic system for capsule sorting. The device consists of a straight microchannel containing a cylindrical obstacle. Thanks to a flow-focusing module placed at the channel entrance, capsules arrive well-centered in the vicinity of the obstacle. Pure size-sorting can be achieved at low shear rate. When increasing the shear rate, capsules are deformed in the narrow space between the pillar and the wall. The softer the capsule, the more tightly it wraps around the obstacle. After the obstacle, streamlines diverge, allowing for the separation between soft capsules, that follow central streamlines, and stiff capsules, that drift away from the obstacle with a wider angle. This proves that we have developed a flexible multipurpose sorting microsystem based on a simple design.

  2. Advances in automated nut sorting

    USDA-ARS?s Scientific Manuscript database

    Nuts in general, and tree nuts in particular, are a high value crop in many countries. Products with defects, contamination, insects or fungal damage can cause serious losses to producers, so almost all products are subjected to some level of sorting to remove these undesirable products. This chap...

  3. What Predicts an Advanced-Stage Diagnosis of Breast Cancer? Sorting Out the Influence of Method of Detection, Access to Care, and Biologic Factors.

    PubMed

    Lipscomb, Joseph; Fleming, Steven T; Trentham-Dietz, Amy; Kimmick, Gretchen; Wu, Xiao-Cheng; Morris, Cyllene R; Zhang, Kun; Smith, Robert A; Anderson, Roger T; Sabatino, Susan A

    2016-04-01

    Multiple studies have yielded important findings regarding the determinants of an advanced-stage diagnosis of breast cancer. We seek to advance this line of inquiry through a broadened conceptual framework and accompanying statistical modeling strategy that recognize the dual importance of access-to-care and biologic factors on stage. The Centers for Disease Control and Prevention-sponsored Breast and Prostate Cancer Data Quality and Patterns of Care Study yielded a seven-state, cancer registry-derived population-based sample of 9,142 women diagnosed with a first primary in situ or invasive breast cancer in 2004. The likelihood of advanced-stage cancer (American Joint Committee on Cancer IIIB, IIIC, or IV) was investigated through multivariable regression modeling, with base-case analyses using the method of instrumental variables (IV) to detect and correct for possible selection bias. The robustness of base-case findings was examined through extensive sensitivity analyses. Advanced-stage disease was negatively associated with detection by mammography (P < 0.001) and with age < 50 (P < 0.001), and positively related to black race (P = 0.07), not being privately insured [Medicaid (P = 0.01), Medicare (P = 0.04), uninsured (P = 0.07)], being single (P = 0.06), body mass index > 40 (P = 0.001), a HER2 type tumor (P < 0.001), and tumor grade not well differentiated (P < 0.001). This IV model detected and adjusted for significant selection effects associated with method of detection (P = 0.02). Sensitivity analyses generally supported these base-case results. Through our comprehensive modeling strategy and sensitivity analyses, we provide new estimates of the magnitude and robustness of the determinants of advanced-stage breast cancer. Statistical approaches frequently used to address observational data biases in treatment-outcome studies can be applied similarly in analyses of the determinants of stage at diagnosis. Cancer Epidemiol Biomarkers Prev; 25(4); 613-23.

  4. NSF ADVANCE: Institutional Transformation to Achieve Faculty Diversity

    NASA Astrophysics Data System (ADS)

    Anthony, E. Y.

    2004-12-01

    The NSF ADVANCE initiative is designed to enhance gender equity in academic science and engineering faculty. One of its components - Institutional Transformation - has the goal of establishing strategies and policies that will revolutionize institutional climate so that diverse faculty flourish. The University of Texas at El Paso is one of 19 institutions to currently hold a 5-year grant under the Institutional Transformation program. This poster presentation highlights practices from the participating institutions. Two general aspects of the program are: 1) co-principal investigators are a blend of administrators and active researchers. This blend ensures a bottom-up, top-down approach to presenting gender equity to faculty. 2) Many of the investigators have diversity as their research focus, which is intended to result in rigorous, peer-reviewed dissemination of institutional results. Specific effors for all institutions relate to recruitment, retention, and advancement of female faculty and, by establishing equitable conditions, to improvement of the workplace for all faculty. To aid recruitment, institutions have committed faculty involved in the search process, including training of search committees in diversity strategies and interaction with candidates. A close working relationship with the campus EO officer is essential. Retention strategies center on mentoring, monetary support for research, and policy implementation. Policies focus on work-family balance. Advancement of females to important administrative and non-administrative leadership roles is the third focus. Workshops and seminars on leadership skills are common in the various institutions. Finally, a central theme of the program is that, in addition to specific strategies, institutions must articulate diversity as a core value and reflect on the means to actualize this value. More information on the NSF ADVANCE program, including links to the Institutional Transformation grantees, may be found on

  5. Update on the NSF PAARE Program at SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Ajello, Marco; Brittain, Sean D.; Cash, Jennifer; Hartmann, Dieter; Ho, Shirley; Howell, Steve B.; King, Jeremy R.; Leising, Mark D.; Smith, Daniel M.

    2017-01-01

    We report on results from our NSF PAARE program during Year 2 of the project. Our partnership under this PAARE award includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) as well as individual investigators at NASA Ames and Carnegie Mellon University. Our recent work on variable and peculiar stars, work with the Kepler Observatory and our educational products in cosmology for non-STEM majors will be presented. We have successfully piloted sharing our teaching resources by offering an upper-level astrophysics course taught at Clemson via video conferencing , allowing a graduating senior from SC State to take a course not available through his home institution. Additionally, we are working on a memorandum of agreement between the two institutions that will allow for the seamless transfer of an undergraduate from SC State to Clemson’s graduate program in physics and astronomy. Our curriculum work includes new web-based cosmology activities and laboratory experiments. SC State undergraduates are reporting at this conference on their work with the light curves of semiregular variables using Kepler data. Additionally, we are heavily involved in the Citizen CATE Experiment. A PAARE scholarship student from SC State and the PAARE PI traveled to Indonesia for the March 2016 solar eclipse. Their results are also being presented elsewhere at this conference (see Myles McKay’s poster). Support for this work includes our NSF PAARE award AST-1358913 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Additional support has been provided by the South Carolina Space Grant Consortium and from NASA to SC State under awards NNX11AB82G and NNX13AC24G. CATE work has been supported by NASA SMD award NNX16AB92A to the National Solar Observatory. Additional details can be found at: http://physics.scsu.edu

  6. Past and Future: NSF PAARE at SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, Sean D.; Cash, Jennifer; Hartmann, Dieter; Hinkle, Kenneth H.; Ho, Shirley; Howell, Steve B.; King, Jeremy R.; Leising, Mark D.; Mighell, Kenneth J.; Smith, Daniel M.

    2015-01-01

    We review our progress to date and the path forward under the NSF program 'Partnerships in Astronomy and Astrophysics Research and Education (PAARE)'. Our project 'A Partnership in Observational and Computational Astronomy (POCA)' was a part of the 2008 PAARE cohort and in August 2014 we received a second award (POCA II) to continue for another three years. Our partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory as well as individual investigators at NASA Ames and Carnegie Mellon University. We present our recent publications which include educational courseware in cosmology, a study of long-period variables using Kepler and spectroscopic variability of peculiar stars. Our graduate student successes include support for two females who have completed their Ph.Ds. in astronomy plus two additional students from underrepresented groups who have received their M.S. degrees in astronomy but are continuing their doctoral work in related fields. At SC State we have graduated 3 physics majors with the astronomy option with five more in the pipeline and review the challenges and obstacles faced along the way. We discuss our strategic plan for POCA II, which is based on lessons learned under POCA and moves us forward to the follow-on period when our efforts will be sustained by other resources.Our support includes NSF awards AST-0750814 and AST-1358913 to South Carolina State University as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under awards NNX11AB82G and NNX13AC24G. Additional details can be found at: http://physics.scsu.edu/paare/

  7. Geoscience Workforce Development at UNAVCO: Leveraging the NSF GAGE Facility

    NASA Astrophysics Data System (ADS)

    Morris, A. R.; Charlevoix, D. J.; Miller, M.

    2013-12-01

    Global economic development demands that the United States remain competitive in the STEM fields, and developing a forward-looking and well-trained geoscience workforce is imperative. According to the Bureau of Labor Statistics, the geosciences will experience a growth of 19% by 2016. Fifty percent of the current geoscience workforce is within 10-15 years of retirement, and as a result, the U.S. is facing a gap between the supply of prepared geoscientists and the demand for well-trained labor. Barring aggressive intervention, the imbalance in the geoscience workforce will continue to grow, leaving the increased demand unmet. UNAVCO, Inc. is well situated to prepare undergraduate students for placement in geoscience technical positions and advanced graduate study. UNAVCO is a university-governed consortium facilitating research and education in the geosciences and in addition UNAVCO manages the NSF Geodesy Advancing Geosciences and EarthScope (GAGE) facility. The GAGE facility supports many facets of geoscience research including instrumentation and infrastructure, data analysis, cyberinfrastructure, and broader impacts. UNAVCO supports the Research Experiences in the Solid Earth Sciences for Students (RESESS), an NSF-funded multiyear geoscience research internship, community support, and professional development program. The primary goal of the RESESS program is to increase the number of historically underrepresented students entering graduate school in the geosciences. RESESS has met with high success in the first 9 years of the program, as more than 75% of RESESS alumni are currently in Master's and PhD programs across the U.S. Building upon the successes of RESESS, UNAVCO is launching a comprehensive workforce development program that will network underrepresented groups in the geosciences to research and opportunities throughout the geosciences. This presentation will focus on the successes of the RESESS program and plans to expand on this success with broader

  8. Application and commercialization of flow cytometrically sex-sorted semen.

    PubMed

    Rath, D; Johnson, L A

    2008-07-01

    The current technology to sort X and Y chromosome bearing sperm population requires individual identification and selection of spermatozoa in a modified high-speed flow cytometer. For farm animal species, the technology is capable of producing sexed sperm at greater than 90% purity. However, only in the bovine, the technology has reached a developmental level that allows its commercial application. Meanwhile, the demand for female calves has grown rapidly, which encourages the demand for sex-sorted semen from high genetic value bulls. The success of the technology will depend mainly on the fertilizing capacity of the sorted spermatozoa, as this is the most affecting and economically relevant factor. To date, fertility is still variable and is quite dependent on post-sort processing. New processing techniques are under investigation and will likely be able to improve the fertility rates after AI with sex-sorted semen. It is of great importance to select the right bulls and to test the sorted samples on a routine basis. In addition to the demand for sex-sorted semen by the cattle industry, there is also a significant demand expressed by pig farmers. However, it is still unknown if the use of sex-sorted semen through commercial pig AI will be economically feasible. For the pig, the combination of in vitro fertilization with sexed semen and non-surgical embryo transfer is an alternative that merits further scientific attention. Recent developments in ovine AI and ET will make it very likely that commercial sheep industry will adopt the sexing technology in their breeding concepts.

  9. Sorting cells by their density.

    PubMed

    Norouzi, Nazila; Bhakta, Heran C; Grover, William H

    2017-01-01

    Sorting cells by their type is an important capability in biological research and medical diagnostics. However, most cell sorting techniques rely on labels or tags, which may have limited availability and specificity. Sorting different cell types by their different physical properties is an attractive alternative to labels because all cells intrinsically have these physical properties. But some physical properties, like cell size, vary significantly from cell to cell within a cell type; this makes it difficult to identify and sort cells based on their sizes alone. In this work we continuously sort different cells types by their density, a physical property with much lower cell-to-cell variation within a cell type (and therefore greater potential to discriminate different cell types) than other physical properties. We accomplish this using a 3D-printed microfluidic chip containing a horizontal flowing micron-scale density gradient. As cells flow through the chip, Earth's gravity makes each cell move vertically to the point where the cell's density matches the surrounding fluid's density. When the horizontal channel then splits, cells with different densities are routed to different outlets. As a proof of concept, we use our density sorter chip to sort polymer microbeads by their material (polyethylene and polystyrene) and blood cells by their type (white blood cells and red blood cells). The chip enriches the fraction of white blood cells in a blood sample from 0.1% (in whole blood) to nearly 98% (in the output of the chip), a 1000x enrichment. Any researcher with access to a 3D printer can easily replicate our density sorter chip and use it in their own research using the design files provided as online Supporting Information. Additionally, researchers can simulate the performance of a density sorter chip in their own applications using the Python-based simulation software that accompanies this work. The simplicity, resolution, and throughput of this technique make

  10. Sorting cells by their density

    PubMed Central

    Norouzi, Nazila; Bhakta, Heran C.

    2017-01-01

    Sorting cells by their type is an important capability in biological research and medical diagnostics. However, most cell sorting techniques rely on labels or tags, which may have limited availability and specificity. Sorting different cell types by their different physical properties is an attractive alternative to labels because all cells intrinsically have these physical properties. But some physical properties, like cell size, vary significantly from cell to cell within a cell type; this makes it difficult to identify and sort cells based on their sizes alone. In this work we continuously sort different cells types by their density, a physical property with much lower cell-to-cell variation within a cell type (and therefore greater potential to discriminate different cell types) than other physical properties. We accomplish this using a 3D-printed microfluidic chip containing a horizontal flowing micron-scale density gradient. As cells flow through the chip, Earth’s gravity makes each cell move vertically to the point where the cell’s density matches the surrounding fluid’s density. When the horizontal channel then splits, cells with different densities are routed to different outlets. As a proof of concept, we use our density sorter chip to sort polymer microbeads by their material (polyethylene and polystyrene) and blood cells by their type (white blood cells and red blood cells). The chip enriches the fraction of white blood cells in a blood sample from 0.1% (in whole blood) to nearly 98% (in the output of the chip), a 1000x enrichment. Any researcher with access to a 3D printer can easily replicate our density sorter chip and use it in their own research using the design files provided as online Supporting Information. Additionally, researchers can simulate the performance of a density sorter chip in their own applications using the Python-based simulation software that accompanies this work. The simplicity, resolution, and throughput of this

  11. Sorting fluorescent nanocrystals with DNA

    SciTech Connect

    Gerion, Daniele; Parak, Wolfgang J.; Williams, Shara C.; Zanchet, Daniela; Micheel, Christine M.; Alivisatos, A. Paul

    2001-12-10

    Semiconductor nanocrystals with narrow and tunable fluorescence are covalently linked to oligonucleotides. These biocompounds retain the properties of both nanocrystals and DNA. Therefore, different sequences of DNA can be coded with nanocrystals and still preserve their ability to hybridize to their complements. We report the case where four different sequences of DNA are linked to four nanocrystal samples having different colors of emission in the range of 530-640 nm. When the DNA-nanocrystal conjugates are mixed together, it is possible to sort each type of nanoparticle using hybridization on a defined micrometer -size surface containing the complementary oligonucleotide. Detection of sorting requires only a single excitation source and an epifluorescence microscope. The possibility of directing fluorescent nanocrystals towards specific biological targets and detecting them, combined with their superior photo-stability compared to organic dyes, opens the way to improved biolabeling experiments, such as gene mapping on a nanometer scale or multicolor microarray analysis.

  12. Sorted.

    PubMed

    Towers, S

    1997-04-01

    Each year in Accident and Emergency an increasing number of young people present with acute problems related to social drugs. These problems range from mild symptoms to life-threatening conditions, many of which can be extremely difficult and time consuming for staff to manage. It has become apparent that as with sex the experimental age for taking drugs is getting younger as youths are now far more 'streetwise' than their predecessors. This is one of the main reasons for this paper being written; it is imperative that staff are equipped with the appropriate knowledge to deal with the challenge and are educated about the problems associated with current drug trends. This potentially improves the quality of care and, in turn, good communication improves relationships. Ecstasy is once again becoming increasingly popular within mainstream clubs, as recently highlighted in the media, and with it reappear its problems. This article discusses the historical aspects of Ecstasy and aims to educate staff about its use and effects and provides health promotion advice for those who are involved in the care of people who take Ecstasy.

  13. NRAO Response to NSF Senior Review of Astronomy Facilities

    NASA Astrophysics Data System (ADS)

    2006-11-01

    The National Science Foundation's (NSF) Astronomy Senior Review Committee report (pdf file), released today, made major recommendations for restructuring the NSF's ground-based astronomy efforts, including significant changes for the National Radio Astronomy Observatory (NRAO). The committee's report urged that leadership in radio astronomy, including millimeter- and submillimeter-wave observatories, "remain centered at NRAO as it is, by far, the largest radio astronomy organization in the world." The report praised the record of management of NRAO and the scientific capabilities of the Atacama Large Millimeter/submillimeter Array (ALMA), the Expanded Very Large Array (EVLA), the Robert C. Byrd Green Bank Telescope (GBT), and the Very Long Baseline Array (VLBA). However, the report also recommended that some reductions and changes occur at the NRAO by 2011. Specifically, the report recommended that: (a) VLBA operations make a transition to a significant reliance on international funding or risk closure; (b) GBT operations costs be reduced; and (c) NRAO scientific staff costs be reduced. "The Senior Review Committee had the very difficult task of reconciling the needs of current facilities and funding new facilities for the future of astronomy. We appreciate their efforts and look forward to working with the NSF to ensure that the valuable and unique research capabilities of our NRAO telescopes continue to serve the astronomical community," said Dr. Fred K.Y. Lo, NRAO Director. The VLBA provides the greatest angular resolution, or ability to see fine detail, of any telescope in the world, greatly exceeding the capabilities of the Hubble Space Telescope and the future Square Kilometre Array. The committee recognized that, "if the VLBA is closed, a unique capability would likely be lost for decades." "The VLBA is used by scientists from around the world because of its unique capabilities. It has produced landmark research milestones and the committee recognized in its

  14. Word Sorts for General Music Classes

    ERIC Educational Resources Information Center

    Cardany, Audrey Berger

    2015-01-01

    Word sorts are standard practice for aiding children in acquiring skills in English language arts. When included in the general music classroom, word sorts may aid students in acquiring a working knowledge of music vocabulary. The author shares a word sort activity drawn from vocabulary in John Lithgow's children's book "Never Play…

  15. Cargo selectivity of yeast sorting nexins.

    PubMed

    Bean, Björn D M; Davey, Michael; Conibear, Elizabeth

    2017-02-01

    Sorting nexins are PX domain-containing proteins that bind phospholipids and often act in membrane trafficking where they help to select cargo. However, the functions and cargo specificities of many sorting nexins are unknown. Here, a high-throughput imaging screen was used to identify new sorting nexin cargo in the yeast Saccharomyces cerevisiae. Deletions of 9 different sorting nexins were screened for mislocalization of a set of green fluorescent protein (GFP)-tagged membrane proteins found at the plasma membrane, Golgi or endosomes. This identified 27 proteins that require 1 or more sorting nexins for their correct localization, 23 of which represent novel sorting nexin cargo. Nine hits whose sorting was dependent on Snx4, the sorting nexin-containing retromer complex, or both retromer and Snx3, were examined in detail to search for potential sorting motifs. We identified cytosolic domains of Ear1, Ymd8 and Ymr010w that conferred retromer-dependent sorting on a chimeric reporter and identified conserved residues required for this sorting in a functional assay. This work defined a consensus sequence for retromer and Snx3-dependent sorting.

  16. Dissimilarity Measures for Unconstrained Sorting Data

    ERIC Educational Resources Information Center

    Burton, Michael L.

    1975-01-01

    Three dissimilarity measures for the unconstrained sorting task are investigated. All three are metrics, but differ in the kind of compensation which they make for differences in the sizes of cells within sortings. Empirical tests of the measures are done with sorting data for occupations names and the names of behaviors, using multidimensional…

  17. Word Sorts for General Music Classes

    ERIC Educational Resources Information Center

    Cardany, Audrey Berger

    2015-01-01

    Word sorts are standard practice for aiding children in acquiring skills in English language arts. When included in the general music classroom, word sorts may aid students in acquiring a working knowledge of music vocabulary. The author shares a word sort activity drawn from vocabulary in John Lithgow's children's book "Never Play…

  18. NSF nanomanufacturing program and its implications for measurement and control

    NASA Astrophysics Data System (ADS)

    Cooper, Khershed P.

    2013-09-01

    The NSF Nanomanufacturing Program supports fundamental research in novel methods and techniques for batch and continuous processes, and top-down and bottom-up processes leading to the formation of complex nanostructures, nanodevices and nanosystems. The program leverages advances in the understanding of nano-scale phenomena and processes, nanomaterials discovery, novel nanostructure architectures, innovative nanodevice and nanosystem design. It seeks to address issues such as quality, efficiency, scalability, reliability, safety and affordability. The program encourages research in the development of new nano-scale processes and production systems based on computation, modeling and simulation and use of process sensing, monitoring, and control. Research in instrumentation and metrology is an integral part of the program. Additionally, the program supports education of the next generation of researchers, and encourages building a workforce trained in nanotechnology and nanomanufacturing systems. It is also interested in understanding long-term societal implications of large-scale production and use of nano-scale materials. For this, it encourages the development of standards. This paper will describe the program philosophy.

  19. Federal role in science will grow, NSF Director predicts

    NASA Astrophysics Data System (ADS)

    Simarski, Lynn Teo

    1992-01-01

    Walter Massey, director of the National Science Foundation, recently called for a fundamental reassessment of the relationship between the federal government and research institutions. On January 15, Massey, now in his ninth month at NSF, described great changes in the government-university “partnership” since the “golden age” of the 1960s. Speaking in Washington, D.C. at a seminar of George Washington University's Center for International Science and Technology Policy, he predicted that his own term at the foundation would not be “business as usual.”Science and technology have shifted from being a peripheral concern of the government to a central policy issue, Massey said. The United States now sees science as too important to leave its agenda for scientists to set themselves. In response, the federal government is launching the initiatives of the Federal Coordinating Council for Science, Engineering, and Technology. Some of last year's FCCSET budget initiatives, spanning a number of federal agencies, dealt with math and science education, global change, and high-performance computing. Such programs “are research agenda put forth from the federal side—they are not things put forth from the [research] community,” Massey pointed out.

  20. Science enabled by ocean observatory acoustics: The NSF ORION program

    NASA Astrophysics Data System (ADS)

    Howe, Bruce M.; Miller, James H.

    2004-05-01

    The National Science Foundation (NSF) has started the Ocean Research Interactive Observatories Network (ORION) program for research-driven sustained observations. The core infrastructure will consist of: (1) a coarse global array of buoys, (2) a regional cabled observatory in the northeast Pacific (with Canada already funded for the northern portion), and (3) coastal observatories. Seafloor junction boxes providing power and communications are a common enabling feature. The ORION Workshop (Puerto Rico, 4-8 January 2004) developed science themes that can be addressed utilizing this infrastructure. Acoustics enable much of the science. The use of acoustics to sense the synoptic 3-D/volumetric ocean environment was found to be ubiquitous through most ORION working groups. One reason for this is the relative transparency of the ocean to sound and the opaqueness to electromagnetic radiation. Participants at the workshop formed an Acoustics Working Group. Based on its report, we review the science and technical drivers for acoustics and educational opportunities. Themes include inherent volumetric, near instantaneous sampling, robust transducers, imaging at many scales, navigation, communications, and using sound in the sea as a major education and outreach mechanism. Recommendations include the formation of a standing ORION committee on acoustics and a workshop. See http://www.orionprogram.org and http://www.oce.uri.edu/ao/AOWEBPAGE.

  1. Geosciences at the NSF: Opportunities, Approaches, Partnerships, and Plans

    NASA Astrophysics Data System (ADS)

    Killeen, T. L.

    2008-12-01

    The National Science Foundation's Geosciences Directorate (GEO) has worked with community leaders over the past year to develop and refine a new strategic vision for the next decade - GEOVision 2008. GEO's three scientific divisions (EAR, OCE and ATM), together with a family of complementary education and outreach programs, map extremely well into the scientific and educational interests of the AGU's membership. NSF/GEO plays a special role for the AGU community through its long-term commitment to the many programs that support basic disciplinary and interdisciplinary research and education in the geosciences. The Directorate also plays a leading role in the development of strong inter-agency, intra-agency, and international partnerships that further support geoscience research. During the next ten years, significant new facilities and capabilities will be realized that will help transform the field and many scientific breakthroughs and discoveries will undoubtedly be made through the mechanism of peer-reviewed basic research. This presentation will highlight both the opportunities and mandates that are in the new plan and will place GEOVision 2008 in the context of exciting ongoing research and important demographic and other trends.

  2. Viability and DNA fragmentation in differently sorted boar spermatozoa.

    PubMed

    De Ambrogi, M; Spinaci, M; Galeati, G; Tamanini, C

    2006-11-01

    Sperm cell defense against DNA damage relies on two factors: the tight packaging of chromatin, based on condensation and substitution of histones with protamines, and the antioxidant agents present in seminal plasma. These defenses are extremely important as mature sperm is unable to repair DNA damage and even if a successful fertilization occurs, embryo undergoes apoptosis at the time of genomic activation. Sex-sorting exposes spermatozoa to stress sources such as high pressure, laser beam and electrical charge. The aim of this work was to determine how sorting procedures affect viability and DNA integrity in boar spermatozoa, by using the newly developed Sperm-Sus-Halomax. Four sperm populations were considered: CONTROL (no treatment), REAL (sex-sorted semen), BULK (semen sorted without sex separation) and NO LASER (semen only exposed to the high pressure, but including also cells normally discarded from sex-sorting). A significantly (P=0.019) lower viability in NO LASER (64.71%) than in CONTROL (78.6%) and REAL (80.5%) groups was found; this was accompanied by a significantly (P=0.001) higher DNA fragmentation index (DFI) in NO LASER group (6.86%) respect to CONTROL (3.30%) and REAL (3.42%) groups. BULK group did not show any difference in viability or DFI as compared to the other groups. In conclusion, we may believe that sex-sorting procedure as a whole does not affect either viability or DFI and that shear mechanical forces are a relevant source of DNA damage for sorted semen.

  3. 45 CFR 689.5 - Initial NSF handling of misconduct matters.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... FOUNDATION RESEARCH MISCONDUCT § 689.5 Initial NSF handling of misconduct matters. (a) NSF staff who learn of... time proceed with its own inquiry. (e) If OIG proceeds with its own inquiry it will normally complete the inquiry no more than 90 days after initiating it. (f) On the basis of what it learns from...

  4. National Science Foundation Fiscal Year 1986 Awards (by State and NSF Directorate).

    ERIC Educational Resources Information Center

    National Science Foundation, Washington, DC.

    Provided is a listing of National Science Foundation (NSF) program grants and contracts awarded in Fiscal Year 1986. Data, current as of Feburary 13, 1987, are arranged as follows: (1) by state, with totals for each state (foreign countries are alphabetized with states); (2) by NSF Directorate, with award and dollar totals for each NSF…

  5. 45 CFR 650.14 - Request for conveyance of title to NSF.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 45 Public Welfare 3 2012-10-01 2012-10-01 false Request for conveyance of title to NSF. 650.14 Section 650.14 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION PATENTS § 650.14 Request for conveyance of title to NSF. (a) The procedures established by...

  6. 45 CFR 650.14 - Request for conveyance of title to NSF.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 45 Public Welfare 3 2014-10-01 2014-10-01 false Request for conveyance of title to NSF. 650.14 Section 650.14 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION PATENTS § 650.14 Request for conveyance of title to NSF. (a) The procedures established by...

  7. 75 FR 63450 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-15

    .../NSF High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory... CONTACT: John Kogut, Executive Secretary; High Energy Physics Advisory Panel; U.S. Department of Energy...

  8. National Science Foundation Fiscal Year 1986 Awards (by State and NSF Directorate).

    ERIC Educational Resources Information Center

    National Science Foundation, Washington, DC.

    Provided is a listing of National Science Foundation (NSF) program grants and contracts awarded in Fiscal Year 1986. Data, current as of Feburary 13, 1987, are arranged as follows: (1) by state, with totals for each state (foreign countries are alphabetized with states); (2) by NSF Directorate, with award and dollar totals for each NSF…

  9. 45 CFR 650.14 - Request for conveyance of title to NSF.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 45 Public Welfare 3 2011-10-01 2011-10-01 false Request for conveyance of title to NSF. 650.14 Section 650.14 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION PATENTS § 650.14 Request for conveyance of title to NSF. (a) The procedures established by...

  10. Curriculum Reform and the NSF Engineering Education Coalitions: A Case Study.

    ERIC Educational Resources Information Center

    Serow, Robert C.; And Others

    This paper presents the findings from an evaluation of SUCCEED (Southwestern University and College Coalition for Engineering Education), a National Science Foundation (NSF) coalition. The presentation is made in several stages: (1) a review of the background and goals of the NSF coalitions, SUCCEED in particular; (2) a discussion of the methods…

  11. 45 CFR 689.5 - Initial NSF handling of misconduct matters.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... Section 689.5 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION RESEARCH MISCONDUCT § 689.5 Initial NSF handling of misconduct matters. (a) NSF staff who learn of... regulation. (c) If OIG determines that alleged research misconduct involves potential civil or criminal...

  12. 45 CFR 689.5 - Initial NSF handling of misconduct matters.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... Section 689.5 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION RESEARCH MISCONDUCT § 689.5 Initial NSF handling of misconduct matters. (a) NSF staff who learn of... regulation. (c) If OIG determines that alleged research misconduct involves potential civil or criminal...

  13. 45 CFR 689.5 - Initial NSF handling of misconduct matters.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Section 689.5 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION RESEARCH MISCONDUCT § 689.5 Initial NSF handling of misconduct matters. (a) NSF staff who learn of... regulation. (c) If OIG determines that alleged research misconduct involves potential civil or criminal...

  14. NSF scientific and funding priorities in Earth sciences

    NASA Astrophysics Data System (ADS)

    Speidel, David H.; MacGregor, Ian D.

    The Earth Science Division (EAR) of the National Science Foundation provides about two-thirds of the funding for basic geological scientific research at academic institutions in the United States. This funding is provided through three budget units: Earth Science Project Support, which funds individual researchers; Instrumentation and Facilities, for the support of research equipment for individual investigators and larger facilities for shared use; and Continental Lithosphere, for the support of large multidisciplinary and multiinstitutional studies of the continental lithosphere.The latter two programs, established in 1984, open opportunities for new styles of research not previously available through the programs for individual investigators. From 1980 to 1988, the EAR budget increased from $25.98 million to $51.29 million, allowing the number of awards per year during that period to double. Over the same period, applications more than doubled, leading to a decline in the success rate from over 40% to less than 30%. Similarly, average award size increased but at a rate less than inflation. Congressional appropriations for EAR have been significantly less than the amounts requested in the President's budget r8—Hi-⅞ for NSF in the last 4 fiscal years, thus stalling the ability of the division to increase both the success rate and the amounts of individual grants and to move forward with a fully diversified research agenda. In 1986 the Advisory Committee for Earth Sciences (ACES), the official external advisor to the EAR scientific staff, reexamined this diversified agenda and began to develop a set of long-range scientific and fiscal priorities.

  15. NSF Internships in Public Science Education: Sensing the Radio Sky

    NASA Astrophysics Data System (ADS)

    Hund, L.; Boltuch, D.; Fultz, C.; Buck, S.; Smith, T.; Harris, R.; Moffett, D.; LaFratta, M.; Walsh, L.; Castelaz, M. W.

    2005-12-01

    The intent of the "Sensing the Radio Sky" project is to teach high school students the concepts and relevance of radio astronomy through presentations in STARLAB portable planetariums. The two year project began in the summer of 2004. A total of twelve interns and four faculty mentors from Furman University and UNCA have participated at the Pisgah Astronomical Research Institute to develop the Radio Sky project. The project united physics and multimedia majors and allowed these students to apply their knowledge of different disciplines to a common goal. One component of the project is the development and production of a cylinder to be displayed in portable STARLAB planetariums. The cylinder gives a thorough view of the Milky Way and of several other celestial sources in radio wavelengths, yet these images are difficult to perceive without prior knowledge of radio astronomy. Consequently, the Radio Sky team created a multimedia presentation to accompany the cylinder. This multimedia component contains six informative lessons on radio astronomy assembled by the physics interns and numerous illustrations and animations created by the multimedia interns. The cylinder and multimedia components complement each other and provide a unique, thorough, and highly intelligible perspective on radio astronomy. The project is near completion and the final draft will be sent to Learning Technologies, Inc., for marketing to owners of STARLAB planetariums throughout the world. The development of the Radio Sky project has also provided a template for potential similar projects that examine our universe in different wavelengths, such as gamma ray, x-ray, and infrared. We acknowledge support from the NSF Internship in Public Science Education Program grant number 0324729.

  16. CAISE: A NSF Resource Center for Informal Science Education

    NASA Astrophysics Data System (ADS)

    Dickow, Benjamin

    2012-01-01

    Informal science education (ISE) is playing an increasingly important role in how and where the public engages with science. A growing body of research is showing that people learn the majority of their science knowledge outside of school (Falk & Dierking, 2010). The ISE field includes a wide variety of sources, including the internet, TV programs, magazines, hobby clubs and museums. These experiences touch large numbers of people throughout their lifetimes. If you would like to share your research with the public, ISE can be an effective conduit for meaningful science communication. However, because the ISE field is so diverse, it can be overwhelming with its multiple entry points. If you already are part of an ISE initiative, knowing how to access the most useful resources easily can also be daunting. CAISE, the Center for Advancement of Informal Science Education, is a resource center for the ISE field funded by the National Science Foundation (NSF). CAISE can help connect you to the knowledge and people of ISE, through its website, products and in-person convenings. The proposed CAISE presentation will outline the diversity of the field and concisely present data that will make the case for the impact of ISE. We will focus on examples of successful programs that connect science with the public and that bring together AAS's science research community with practitioners and researchers within ISE. Pathways to various ISE resources in the form of current CAISE initiatives will be described as well. The presentation will include an interview section in which a CAISE staff member will ask questions of a scientist involved in an ISE initiative in order to detail one example of how ISE can be a valuable tool for engaging the public in science. Time for audience Q&A also will be included in the session.

  17. Viable cell sorting of dinoflagellates by multi-parametric flow cytometry.

    USDA-ARS?s Scientific Manuscript database

    Electronic cell sorting for isolation and culture of dinoflagellates and other marine eukaryotic phytoplankton was compared to the traditional method of manually picking of cells using a micropipette. Trauma to electronically sorted cells was not a limiting factor as fragile dinoflagellates, such a...

  18. Neonatal Intensive-Care Unit Graduates Show Persistent Difficulties in an Intradimensional Shift Card Sort

    ERIC Educational Resources Information Center

    Kittler, Phyllis M.; Brooks, Patricia J.; Rossi, Vanessa; Karmel, Bernard Z.; Gardner, Judith M.; Flory, Michael J.

    2013-01-01

    Neonatal intensive-care unit (NICU) graduates, a group at risk for attention problems and attention-deficit hyperactivity disorder, performed an intradimensional shift card sort at 34, 42, 51, and 60 months to assess executive function and to examine effects of individual risk factors. In the "silly" game, children sorted cards…

  19. Neonatal Intensive-Care Unit Graduates Show Persistent Difficulties in an Intradimensional Shift Card Sort

    ERIC Educational Resources Information Center

    Kittler, Phyllis M.; Brooks, Patricia J.; Rossi, Vanessa; Karmel, Bernard Z.; Gardner, Judith M.; Flory, Michael J.

    2013-01-01

    Neonatal intensive-care unit (NICU) graduates, a group at risk for attention problems and attention-deficit hyperactivity disorder, performed an intradimensional shift card sort at 34, 42, 51, and 60 months to assess executive function and to examine effects of individual risk factors. In the "silly" game, children sorted cards…

  20. Application of visible spectroscopy in waste sorting

    NASA Astrophysics Data System (ADS)

    Spiga, Philippe; Bourely, Antoine

    2011-10-01

    Today, waste recycling, (bottles, papers...), is a mechanical operation: the waste are crushed, fused and agglomerated in order to obtain new manufactured products (e.g. new bottles, clothes ...). The plastics recycling is the main application in the color sorting process. The colorless plastics recovered are more valuable than the colored plastics. Other emergent applications are in the paper sorting, where the main goal is to sort dyed paper from white papers. Up to now, Pellenc Selective Technologies has manufactured color sorting machines based on RGB cameras. Three dimensions (red, green and blue) are no longer sufficient to detect low quantities of dye in the considered waste. In order to increase the efficiency of the color detection, a new sorting machine, based on visible spectroscopy, has been developed. This paper presents the principles of the two approaches and their difference in terms of sorting performance, making visible spectroscopy a clear winner.

  1. Brokering technologies to realize the hydrology scenario in NSF BCube

    NASA Astrophysics Data System (ADS)

    Boldrini, Enrico; Easton, Zachary; Fuka, Daniel; Pearlman, Jay; Nativi, Stefano

    2015-04-01

    In the National Science Foundation (NSF) BCube project an international team composed of cyber infrastructure experts, geoscientists, social scientists and educators are working together to explore the use of brokering technologies, initially focusing on four domains: hydrology, oceans, polar, and weather. In the hydrology domain, environmental models are fundamental to understand the behaviour of hydrological systems. A specific model usually requires datasets coming from different disciplines for its initialization (e.g. elevation models from Earth observation, weather data from Atmospheric sciences, etc.). Scientific datasets are usually available on heterogeneous publishing services, such as inventory and access services (e.g. OGC Web Coverage Service, THREDDS Data Server, etc.). Indeed, datasets are published according to different protocols, moreover they usually come in different formats, resolutions, Coordinate Reference Systems (CRSs): in short different grid environments depending on the original data and the publishing service processing capabilities. Scientists can thus be impeded by the burden of discovery, access and normalize the desired datasets to the grid environment required by the model. These technological tasks of course divert scientists from their main, scientific goals. The use of GI-axe brokering framework has been experimented in a hydrology scenario where scientists needed to compare a particular hydrological model with two different input datasets (digital elevation models): - the Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) dataset, v.2. - the Shuttle Radar Topography Mission (SRTM) dataset, v.3. These datasets were published by means of Hyrax Server technology, which can provide NetCDF files at their original resolution and CRS. Scientists had their model running on ArcGIS, so the main goal was to import the datasets using the available ArcPy library and have EPSG:4326 with the same resolution grid as the

  2. The NSF-RCN Urban Heat Island Network

    NASA Astrophysics Data System (ADS)

    Snyder, P. K.; Twine, T. E.; Hamilton, P.; Shepherd, M.; Stone, B., Jr.

    2016-12-01

    In much of the world cities are warming at twice the rate of outlying rural areas. The frequency of urban heat waves is projected to increase with climate change through the 21st century. Addressing the economic, environmental, and human costs of urban heat islands requires a better understanding of their behavior from many disciplinary perspectives. The goal of this four-year Urban Heat Island Network is to (1) bring together scientists studying the causes and impacts of urban warming, (2) advance multidisciplinary understanding of urban heat islands, (3) examine how they can be ameliorated through engineering and design practices, and (4) share these new insights with a wide array of stakeholders responsible for managing urban warming to reduce their health, economic, and environmental impacts. The NSF-RCN Urban Heat Island Network involves atmospheric scientists, engineers, architects, landscape designers, urban planners, public health experts, and education and outreach experts, who will share knowledge, evaluate research directions, and communicate knowledge and research recommendations to the larger research community as well as stakeholders engaged in developing strategies to adapt to and mitigate urban warming. The first Urban Climate Institute was held in Saint Paul, MN in July 2013 and focused on the characteristics of urban heat islands. Scientists engaged with local practitioners to improve communication pathways surrounding issues of understanding, adapting to, and mitigating urban warming. The second Urban Climate Institute was held in Atlanta, Georgia in July 2014 and focused on urban warming and public health. The third Urban Climate Institute was held in Athens, GA in July 2015 and focused on urban warming and the role of the built environment. Scientists and practitioners discussed strategies for mitigation and adaptation. The fourth Institute was held in Saint Paul, MN in July 2016 and focused on putting research to practice. Evaluation experts

  3. The NSF-RCN Urban Heat Island Network

    NASA Astrophysics Data System (ADS)

    Twine, T. E.; Snyder, P. K.; Hamilton, P.; Shepherd, M.; Stone, B., Jr.

    2015-12-01

    In much of the world cities are warming at twice the rate of outlying rural areas. The frequency of urban heat waves is projected to increase with climate change through the 21st century. Addressing the economic, environmental, and human costs of urban heat islands requires a better understanding of their behavior from many disciplinary perspectives. The goal of this four-year Urban Heat Island Network is to (1) bring together scientists studying the causes and impacts of urban warming, (2) advance multidisciplinary understanding of urban heat islands, (3) examine how they can be ameliorated through engineering and design practices, and (4) share these new insights with a wide array of stakeholders responsible for managing urban warming to reduce their health, economic, and environmental impacts. The NSF-RCN Urban Heat Island Network involves atmospheric scientists, engineers, architects, landscape designers, urban planners, public health experts, and education and outreach experts, who will share knowledge, evaluate research directions, and communicate knowledge and research recommendations to the larger research community as well as stakeholders engaged in developing strategies to adapt to and mitigate urban warming. The first Urban Climate Institute was held in Saint Paul, MN in July 2013 and focused on the characteristics of urban heat islands. Scientists engaged with local practitioners to improve communication pathways surrounding issues of understanding, adapting to, and mitigating urban warming. The second Urban Climate Institute was held in Atlanta, Georgia in July 2014 and focused on urban warming and public health. The third Urban Climate Institute was held in Athens, GA in July 2015 and focused on urban warming and the role of the built environment. Scientists and practitioners discussed strategies for mitigation and adaptation. Evaluation experts at the Science Museum of Minnesota have extensively evaluated the Institutes to inform other research

  4. Flotillins bind to the dileucine sorting motif of β-site amyloid precursor protein-cleaving enzyme 1 and influence its endosomal sorting.

    PubMed

    John, Bincy A; Meister, Melanie; Banning, Antje; Tikkanen, Ritva

    2014-04-01

    The β-site amyloid precursor protein-cleaving enzyme 1 (BACE1) is a protease that participates in the amyloidogenic cleavage of the Alzheimer amyloid precursor protein. Trafficking of BACE1 has been shown to be largely mediated by an acidic cluster dileucine motif in its cytoplasmic tail. This sorting signal functions both in endocytosis and endosomal sorting/recycling of BACE1 by providing a binding site for various sorting factors, such as the Golgi-localizing γ-ear containing ADP ribosylation factor binding (GGA) proteins that mediate BACE1 sorting within endosomes. Because flotillin-1 has been suggested to bind to BACE1 cytoplasmic tail, we analyzed the role of flotillins in BACE1 sorting. We show that flotillin-1 directly binds to the dileucine motif in the cytoplasmic tail of BACE1, whereas flotillin-2 binding is mainly mediated by its interaction with flotillin-1. Depletion of flotillins results in altered subcellular localization of BACE1 in endosomes and stabilization of BACE1 protein. Furthermore, amyloidogenic processing of Alzheimer amyloid precursor protein is increased. Flotillins compete with GGA proteins for binding to the dileucine motif in the BACE1 tail, suggesting that they play an important role in endosomal sorting of BACE1. The present study shows for the first time that flotillins are involved in endosomal sorting of BACE1. Because the endosomal localization of BACE1 affects its function as the β-secretase by increasing amyloidogenic processing of the amyloid precursor protein, flotillins may play a novel role in Alzheimer's disease. The present study is the first to show that flotillins bind to a canonical sorting signal and influence the binding of endosomal sorting factors onto cargo tails.

  5. Log sort yard economics, planning, and feasibility

    Treesearch

    John Rusty Dramm; Robert Govett; Ted Bilek; Gerry L. Jackson

    2004-01-01

    This publication discusses basic marketing and economic concepts, planning approach, and feasibility methodology for assessing log sort yard operations. Special attention is given to sorting small diameter and underutilized logs from forest restoration, fuels reduction, and thinning operations. A planned programming approach of objectively determining the feasibility...

  6. Battling the GPA Bias: Selecting NSF-REU Participants for Transformative Research Experiences

    NASA Astrophysics Data System (ADS)

    Smith, M.; Kim, C. S.; Osborn, J.

    2014-12-01

    Student grade point average (GPA) is one of the most common metrics used to select REU participants, with >85% of NSF-funded research participants nationally having an average GPA at or above 3.0 (Russell, 2004). Yet, as efforts are made to expand and diversify the pool of undergraduates participating in research experiences, privileging candidates with GPAs above 3.0 may exclude promising STEM students who can most benefit from a research experience, including community college students and recent transfer students from community colleges. Myriad factors that impinge on student GPAs are salient in the literature, including (1) early academic failure related to pre-college under-preparation (Feldman, 1993); (2) transfer shock (Molinaro, 2014; Diaz, 1992); (3) employment (DeSimone, 2008); (4) limited social support for academic pursuits (Cheng, Ickes, & Verhofstadt, 2012); (5) food insecurity (Maroto, 2013); and inadequate advising (Pascarella & Terenzini, 2005). A discussion of these factors with examples from student transcripts and an overview of a scoring rubric that minimizes GPA bias and can assist PIs with an alternate approach to participant selection will be included in this session.

  7. Data parallel sorting for particle simulation

    NASA Technical Reports Server (NTRS)

    Dagum, Leonardo

    1992-01-01

    Sorting on a parallel architecture is a communications intensive event which can incur a high penalty in applications where it is required. In the case of particle simulation, only integer sorting is necessary, and sequential implementations easily attain the minimum performance bound of O (N) for N particles. Parallel implementations, however, have to cope with the parallel sorting problem which, in addition to incurring a heavy communications cost, can make the minimun performance bound difficult to attain. This paper demonstrates how the sorting problem in a particle simulation can be reduced to a merging problem, and describes an efficient data parallel algorithm to solve this merging problem in a particle simulation. The new algorithm is shown to be optimal under conditions usual for particle simulation, and its fieldwise implementation on the Connection Machine is analyzed in detail. The new algorithm is about four times faster than a fieldwise implementation of radix sort on the Connection Machine.

  8. Active droplet sorting in microfluidics: a review.

    PubMed

    Xi, Heng-Dong; Zheng, Hao; Guo, Wei; Gañán-Calvo, Alfonso M; Ai, Ye; Tsao, Chia-Wen; Zhou, Jun; Li, Weihua; Huang, Yanyi; Nguyen, Nam-Trung; Tan, Say Hwa

    2017-02-28

    The ability to manipulate and sort droplets is a fundamental issue in droplet-based microfluidics. Various lab-on-a-chip applications can only be realized if droplets are systematically categorized and sorted. These micron-sized droplets act as ideal reactors which compartmentalize different biological and chemical reagents. Array processing of these droplets hinges on the competence of the sorting and integration into the fluidic system. Recent technological advances only allow droplets to be actively sorted at the rate of kilohertz or less. In this review, we present state-of-the-art technologies which are implemented to efficiently sort droplets. We classify the concepts according to the type of energy implemented into the system. We also discuss various key issues and provide insights into various systems.

  9. Sorting by reciprocal translocations via reversals theory.

    PubMed

    Ozery-Flato, Michal; Shamir, Ron

    2007-05-01

    The understanding of genome rearrangements is an important endeavor in comparative genomics. A major computational problem in this field is finding a shortest sequence of genome rearrangements that transforms, or sorts, one genome into another. In this paper we focus on sorting a multi-chromosomal genome by translocations. We reveal new relationships between this problem and the well studied problem of sorting by reversals. Based on these relationships, we develop two new algorithms for sorting by reciprocal translocations, which mimic known algorithms for sorting by reversals: a score-based method building on Bergeron's algorithm, and a recursive procedure similar to the Berman-Hannenhalli method. Though their proofs are more involved, our procedures for reciprocal translocations match the complexities of the original ones for reversals.

  10. Data parallel sorting for particle simulation

    NASA Technical Reports Server (NTRS)

    Dagum, Leonardo

    1992-01-01

    Sorting on a parallel architecture is a communications intensive event which can incur a high penalty in applications where it is required. In the case of particle simulation, only integer sorting is necessary, and sequential implementations easily attain the minimum performance bound of O (N) for N particles. Parallel implementations, however, have to cope with the parallel sorting problem which, in addition to incurring a heavy communications cost, can make the minimun performance bound difficult to attain. This paper demonstrates how the sorting problem in a particle simulation can be reduced to a merging problem, and describes an efficient data parallel algorithm to solve this merging problem in a particle simulation. The new algorithm is shown to be optimal under conditions usual for particle simulation, and its fieldwise implementation on the Connection Machine is analyzed in detail. The new algorithm is about four times faster than a fieldwise implementation of radix sort on the Connection Machine.

  11. Administration's Proposed NSF Budget Includes a 5.5% Increase for Geosciences

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2013-04-01

    The fiscal year (FY) 2014 proposed federal budget for the U.S. National Science Foundation (NSF) is $7.63 billion, 7.3% above the FY 2012 actual amount. NSF acting director Cora Marrett said the budget reflects the administration's recognition of NSF and the importance of funding basic research. "We are pleased about where we stand and hope that Congress will be just as pleased with the budget proposal and will help move things forward," she said during a meeting of the NSF Advisory Committee for Geosciences on 11 April. Budget comparisons are to FY 2012 because the 2013 appropriations were enacted at the end of March, less than 2 weeks before President Barack Obama sent the proposed budget to Congress.

  12. Dopamine D1A directly interacts with otoferlin synaptic pathway proteins: Ca2+ and phosphorylation underlie an NSF-to-AP2mu1 molecular switch.

    PubMed

    Selvakumar, Dakshnamurthy; Drescher, Marian J; Deckard, Nathan A; Ramakrishnan, Neeliyath A; Morley, Barbara J; Drescher, Dennis G

    2017-01-01

    Dopamine receptors regulate exocytosis via protein-protein interactions (PPIs) as well as via adenylyl cyclase transduction pathways. Evidence has been obtained for PPIs in inner ear hair cells coupling D1A to soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein receptor (SNARE)-related proteins snapin, otoferlin, N-ethylmaleimide-sensitive factor (NSF), and adaptor-related protein complex 2, mu 1 (AP2mu1), dependent on [Ca(2+)] and phosphorylation. Specifically, the carboxy terminus of dopamine D1A was found to directly bind t-SNARE-associated protein snapin in teleost and mammalian hair cell models by yeast two-hybrid (Y2H) and pull-down assays, and snapin directly interacts with hair cell calcium-sensor otoferlin. Surface plasmon resonance (SPR) analysis, competitive pull-downs, and co-immunoprecipitation indicated that these interactions were promoted by Ca(2+) and occur together. D1A was also found to separately interact with NSF, but with an inverse dependence on Ca(2+) Evidence was obtained, for the first time, that otoferlin domains C2A, C2B, C2D, and C2F interact with NSF and AP2mu1, whereas C2C or C2E do not bind to either protein, representing binding characteristics consistent with respective inclusion or omission in individual C2 domains of the tyrosine motif YXXΦ. In competitive pull-down assays, as predicted by KD values from SPR (+Ca(2+)), C2F pulled down primarily NSF as opposed to AP2mu1. Phosphorylation of AP2mu1 gave rise to a reversal: an increase in binding by C2F to phosphorylated AP2mu1 was accompanied by a decrease in binding to NSF, consistent with a molecular switch for otoferlin from membrane fusion (NSF) to endocytosis (AP2mu1). An increase in phosphorylated AP2mu1 at the base of the cochlear inner hair cell was the observed response elicited by a dopamine D1A agonist, as predicted. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  13. A hybrid dielectrophoretic and hydrophoretic microchip for particle sorting using integrated prefocusing and sorting steps.

    PubMed

    Yan, Sheng; Zhang, Jun; Yuan, Yuan; Lovrecz, George; Alici, Gursel; Du, Haiping; Zhu, Yonggang; Li, Weihua

    2015-01-01

    This work explores dielectrophoresis (DEP)-active hydrophoresis in sorting particles and cells. The device consists of prefocusing region and sorting region with great potential to be integrated into advanced lab-on-a-chip bioanalysis devices. Particles or cells can be focused in the prefocusing region and then sorted in the sorting region. The DEP-active hydrophoretic sorting is not only based on size but also on dielectric properties of the particles or cells of interest without any labelling. A mixture of 3 and 10 μm particles were sorted and collected from corresponding outlets with high separation efficiency. According to the different dielectric properties of viable and nonviable Chinese Hamster Ovary (CHO) cells at the medium conductivity of 0.03 S/m, the viable CHO cells were focused well and sorted from cell sample with a high purity.

  14. Automated multi-parametric sorting of micron-sized particles via multi-trap laser tweezers

    NASA Astrophysics Data System (ADS)

    Kaputa, Daniel S.

    The capabilities of laser tweezers have rapidly expanded since the first demonstration by Ashkin and co-workers in 1970 of the ability to trap particles using optical energy. Laser tweezers have been used to measure piconewton forces in many biological and material science application, sort bacteria, measure DNA bond strength, and even perform microsurgery. The laser tweezers system developed for this dissertation foreshadows the next generation of laser tweezer systems that provide automated particle sorted based upon multiple criteria. Many laser tweezer sorting applications today entail the operator sorting cells from a bulk sample, one by one. This dissertation demonstrates the technologies of pattern recognition and image processing that allow for an entire microscope slide to be sorted without any operator intervention. We already live in an automated world where the cars we drive are built by machines instead of humans. The technology is there, and the only factors limiting the advancements of fully automated biological instrumentation is the lack of developers with the appropriate knowledge sets. This dissertation introduces the concept of sorting particles via a multi-parametric approach where several parameters such as size, fluorescence, and Raman spectra are used as sorting criteria. Since the advent of laser tweezers, several groups have demonstrated the ability to sort cells and other particle by size, or by fluorescence, or by any other parameter, but to our knowledge there does not exist a laser tweezer sorting system that can sort particles based upon multiple parameters. Sorting via a single parameter can be a severe limitation as the method lacks the robustness and class specificity that exists when sorting based upon multiple parameters. Simply put, it makes more sense to determine the worth of a baseball card by considering it's condition as well as it's age, rather then solely upon its condition. By adding another parameter such as the name of

  15. Manual sorting to eliminate aflatoxin from peanuts.

    PubMed

    Galvez, F C F; Francisco, M L D L; Villarino, B J; Lustre, A O; Resurreccion, A V A

    2003-10-01

    A manual sorting procedure was developed to eliminate aflatoxin contamination from peanuts. The efficiency of the sorting process in eliminating aflatoxin-contaminated kernels from lots of raw peanuts was verified. The blanching of 20 kg of peanuts at 140 degrees C for 25 min in preheated roasters facilitated the manual sorting of aflatoxin-contaminated kernels after deskinning. The manual sorting of raw materials with initially high aflatoxin contents (300 ppb) resulted in aflatoxin-free peanuts (i.e., peanuts in which no aflatoxin was detected). Verification procedures showed that the sorted sound peanuts contained no aflatoxin or contained low levels (<15 ppb) of aflatoxin. The results obtained confirmed that the sorting process was effective in separating contaminated peanuts whether or nor contamination was extensive. At the commercial level, when roasters were not preheated, the dry blanching of 50 kg of peanuts for 45 to 55 min facilitated the proper deskinning and subsequent manual sorting of aflatoxin-contaminated peanut kernels from sound kernels.

  16. Colloidal sorting in dynamic optical lattices

    NASA Astrophysics Data System (ADS)

    Smith, Ryan L.; Spalding, G. C.; Dholakia, K.; MacDonald, M. P.

    2007-08-01

    Passive microfluidic sorting techniques based upon the interaction of particles with an optically defined potential energy landscape have possible advantages over active sorting techniques such as microfluorescence activated cell sorting (FACS), including ease of integration into lab-on-a-chip systems, reconfigurability, and scalability. Rather than analysing and deflecting a single-file stream of particles one by one, a passive approach intrinsically aimed at parallel processing may, ultimately, offer greater potential for high throughput. However attempts to sort many particles simultaneously in high density suspensions are inevitably limited by particle particle interactions, which lead to a reduction in the efficiency of the sorting. In this paper we describe two different approaches aimed at reducing colloidal traffic flow problems. We find that continuous translation of the sorting lattice helps to reduce nearest neighbour particle spacing, providing promise for efficiency improvements in future high throughput applications, and that a flashing lattice yields a reduction in unwanted pile-up and spillover effects which otherwise limit the efficiency of sorting.

  17. An Unsupervised Online Spike-Sorting Framework.

    PubMed

    Knieling, Simeon; Sridharan, Kousik S; Belardinelli, Paolo; Naros, Georgios; Weiss, Daniel; Mormann, Florian; Gharabaghi, Alireza

    2016-08-01

    Extracellular neuronal microelectrode recordings can include action potentials from multiple neurons. To separate spikes from different neurons, they can be sorted according to their shape, a procedure referred to as spike-sorting. Several algorithms have been reported to solve this task. However, when clustering outcomes are unsatisfactory, most of them are difficult to adjust to achieve the desired results. We present an online spike-sorting framework that uses feature normalization and weighting to maximize the distinctiveness between different spike shapes. Furthermore, multiple criteria are applied to either facilitate or prevent cluster fusion, thereby enabling experimenters to fine-tune the sorting process. We compare our method to established unsupervised offline (Wave_Clus (WC)) and online (OSort (OS)) algorithms by examining their performance in sorting various test datasets using two different scoring systems (AMI and the Adamos metric). Furthermore, we evaluate sorting capabilities on intra-operative recordings using established quality metrics. Compared to WC and OS, our algorithm achieved comparable or higher scores on average and produced more convincing sorting results for intra-operative datasets. Thus, the presented framework is suitable for both online and offline analysis and could substantially improve the quality of microelectrode-based data evaluation for research and clinical application.

  18. Selective Sorting of Cargo Proteins into Bacterial Membrane Vesicles*

    PubMed Central

    Haurat, M. Florencia; Aduse-Opoku, Joseph; Rangarajan, Minnie; Dorobantu, Loredana; Gray, Murray R.; Curtis, Michael A.; Feldman, Mario F.

    2011-01-01

    In contrast to the well established multiple cellular roles of membrane vesicles in eukaryotic cell biology, outer membrane vesicles (OMV) produced via blebbing of prokaryotic membranes have frequently been regarded as cell debris or microscopy artifacts. Increasingly, however, bacterial membrane vesicles are thought to play a role in microbial virulence, although it remains to be determined whether OMV result from a directed process or from passive disintegration of the outer membrane. Here we establish that the human oral pathogen Porphyromonas gingivalis has a mechanism to selectively sort proteins into OMV, resulting in the preferential packaging of virulence factors into OMV and the exclusion of abundant outer membrane proteins from the protein cargo. Furthermore, we show a critical role for lipopolysaccharide in directing this sorting mechanism. The existence of a process to package specific virulence factors into OMV may significantly alter our current understanding of host-pathogen interactions. PMID:21056982

  19. Improved quality of sex-sorted sperm: a prerequisite for wider commercial application.

    PubMed

    Rath, D; Moench-Tegeder, G; Taylor, U; Johnson, L A

    2009-01-01

    To date the only successful method to sort sperm into X- and Y-chromosome-bearing populations is the Beltsville Sperm Sexing Technology. Fertility results continue to be variable even though the technology has been used in a commercial setting for nearly a decade. This is at least partly due to the reduced lifespan of sperm after sorting and freezing. Several technical and biological factors are responsible for this problem. Furthermore, to meet economic demands, only 10-15% of the number of sperm (compared to unsexed semen) are loaded in each straw, further limiting the chances for fertilization. A new protocol for preservation of bull sperm, utilizing Sexcess shows promise in extending the lifespan of sorted bull sperm. Motility and acrosome integrity are significantly increased using Sexcess. Conception rates achieved with heifers for those bulls tested with Sexcess and using a standard AI regime give results that do not differ from results achieved using regular AI. In addition to the improvements of the sorting technology itself, we recommend a thorough pre-selection of bulls. A reliable prediction method to determine whether a bull is suitable for a sex-sorting program still does not exist. Such a test is needed, especially for "custom sorting" programs. Currently, test sorts are the only means of obtaining information about the sorting efficiency of semen from a particular bull.

  20. Microscale synthesis and characterization of polystyrene: NSF-POLYED scholars project

    NASA Technical Reports Server (NTRS)

    Quaal, Karen S.; Wu, Chang-Ning

    1994-01-01

    Polystyrene is a familiar polymer with many commercial uses. Its applications range from the clear, high index of refraction, brittle plastic used to form audio cassette and CD cases to the foamed material used in insulated drink cups and packaging material. Polystyrene constitutes 11 percent of the plastics used in packaging with only High Density Polyethylene (HDPE) and Low Density Polyethylene (LDPE) contributing a larger share: so much polystyrene is used today, it is one of six common plastics that manufacturers have assigned an identification code. The code helps recycling efforts. Polystyrene's code is (PS code 6). During the summer and fall of 1992 several new polymeric experiments were developed by the NSF POLYED Scholars for introduction into the chemistry core curriculum. In this presentation, one such project will be discussed. This laboratory project is recommended for a first or second year laboratory course allowing the introduction of polymeric science to undergraduates at the earliest opportunity. The reliability of the experiments which make up this project and the recognition factor of polystyrene, a material we come in contact with everyday, makes the synthesis and characterization of polystyrene a good choice for the introduction of polymerization to undergraduates. This laboratory project appeals to the varied interests of students enrolled in the typical first year chemistry course and becomes an ideal way to introduce polymers to a wide variety of science and engineering students.

  1. The Q sort theory and technique.

    PubMed

    Nyatanga, L

    1989-10-01

    This paper is based on the author's experience of using the Q sort technique with BA Social Sciences (BASS) students, and the community psychiatric nursing (CPN, ENB No 811 course). The paper focuses on two main issues: 1. The theoretical assumptions underpinning the Q Sort technique. Carl Rogers' self theory and some of the values of humanistic psychology are summarised. 2. The actual technique procedure and meaning of results are highlighted. As the Q Sort technique is potentially useful in a variety of sittings some of which are listed in this paper, the emphasis has deliberately been placed in understanding the theoretical underpinning and the operationalisation (sensitive interpretation) of the theory to practice.

  2. An improved infrared technique for sorting pecans

    NASA Astrophysics Data System (ADS)

    Graeve, Thorsten; Dereniak, Eustace L.; Lamonica, John A., Jr.

    1991-10-01

    This paper presents the results of a study of pecan spectral reflectances. It describes an experiment for measuring the contrast between several components of raw pecan product to be sorted. An analysis of the experimental data reveals high contrast ratios in the infrared spectrum, suggesting a potential improvement in sorting efficiency when separating pecan meat from shells. It is believed that this technique has the potential to dramatically improve the efficiency of current sorting machinery, and to reduce the cost of processing pecans for the consumer market.

  3. 13. SANDSORTING BUILDING, THIRD FLOOR, VIBRATING SCREENS FOR SAND SORTING, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    13. SAND-SORTING BUILDING, THIRD FLOOR, VIBRATING SCREENS FOR SAND SORTING, LOOKING SOUTHWEST - Mill "C" Complex, Sand-Sorting Building, South of Dee Bennet Road, near Illinois River, Ottawa, La Salle County, IL

  4. Intuitive, Image-Based Cell Sorting Using Opto-fluidic Cell Sorting

    PubMed Central

    Kovac, J. R.; Voldman, J.

    2008-01-01

    We present a microfluidic cell sorting device which augments microscopy with the capability to perform facile image-based cell sorting. This combination enables intuitive, complex phenotype sorting based on spatio-temporal fluorescence or cell morphology. The microfluidic device contains a microwell array that can be passively loaded with mammalian cells via sedimentation and can be subsequently inspected with microscopy. After inspection, we use the scattering force from a focused infrared laser to levitate cells of interest from their wells into a flow field for collection. First, we demonstrate image-based sorting predicated on whole-cell fluorescence, which could enable sorting based on temporal whole-cell fluorescence behavior. Second, we demonstrate image-based sorting predicated on fluorescence localization (nuclear vs. whole-cell fluorescence), highlighting the capability of our approach to sort based on imaged sub-cellular events, such as localized protein expression or translocation events. We achieve post-sort purities up to 89%, and up to 155-fold enrichment of target cells. Optical manipulation literature and a direct cell viability assay suggest that cells remain viable after using our technique. The architecture is highly scalable and supports over 10,000 individually addressable trap sites. Our approach enables sorting of significant populations based on sub-cellular spatio-temporal information, which is difficult or impossible with existing widespread sorting technologies. PMID:18004819

  5. Filter-less submicron hydrodynamic size sorting.

    PubMed

    Fouet, M; Mader, M-A; Iraïn, S; Yanha, Z; Naillon, A; Cargou, S; Gué, A-M; Joseph, P

    2016-02-21

    We propose a simple microfluidic device able to separate submicron particles (critical size ∼0.1 μm) from a complex sample with no filter (minimum channel dimension being 5 μm) by hydrodynamic filtration. A model taking into account the actual velocity profile and hydrodynamic resistances enables prediction of the chip sorting properties for any geometry. Two design families are studied to obtain (i) small sizes within minutes (low-aspect ratio, two-level chip) and (ii) micron-sized sorting with a μL flow rate (3D architecture based on lamination). We obtain quantitative agreement of sorting performances both with experiments and with numerical solving, and determine the limits of the approach. We therefore demonstrate a passive, filter-less sub-micron size sorting with a simple, robust, and easy to fabricate design.

  6. Glycosaminoglycans: Sorting determinants in intracellular protein traffic.

    PubMed

    Mihov, Deyan; Spiess, Martin

    2015-11-01

    Intracellular transport of proteins to their appropriate destinations is crucial for the maintenance of cellular integrity and function. Sorting information is contained either directly in the amino acid sequence or in a protein's post-translational modifications. Glycosaminoglycans (GAGs) are characteristic modifications of proteoglycans. GAGs are long unbranched polysaccharide chains with unique structural and functional properties also contributing to protein sorting in various ways. By deletion or insertion of GAG attachment sites it has been shown that GAGs affect polarized sorting in epithelial cells, targeting to and storage in secretory granules, and endocytosis. Most recently, the role of GAGs as signals for rapid trans-Golgi-to-cell surface transport, dominant over the cytosolic sorting motifs in the core protein, was demonstrated. Here, we provide an overview on existing data on the roles of GAGs on protein and proteoglycan trafficking.

  7. Card Sorts, State Tests, and Meaningful Mathematics

    ERIC Educational Resources Information Center

    Chauvot, Jennifer B.; Benson, Sharon L. D.

    2008-01-01

    This article shares card-sorting activities that involve state-mandated test items to use with prospective and practicing mathematics teachers to teach about accountability measures while exploring reform-minded mathematics instruction recommendations. (Contains 2 figures.)

  8. Card Sorts, State Tests, and Meaningful Mathematics

    ERIC Educational Resources Information Center

    Chauvot, Jennifer B.; Benson, Sharon L. D.

    2008-01-01

    This article shares card-sorting activities that involve state-mandated test items to use with prospective and practicing mathematics teachers to teach about accountability measures while exploring reform-minded mathematics instruction recommendations. (Contains 2 figures.)

  9. Visual ergonomics interventions in mail sorting facilities.

    PubMed

    Hemphälä, H; Hansson, G-Å; Dahlqvist, C; Eklund, J

    2012-01-01

    This study was performed between 2004 and 2011 at mail sorting facilities in Sweden. During this time, different interventions were performed. The first was a lighting intervention that had a positive impact on the postal workers, especially those with eyestrain. A new lighting system also improved the illuminance and gave better light distribution. The second intervention involved new personal spectacles for the postal workers who needed them and this had a positive effect on eyestrain. The third intervention involved a specific type of sorting spectacles for the postal workers who already used progressive lenses privately. The reading distances that the postal workers had while sorting the mail was inverted to the distances in their regular progressive lenses. The new sorting spectacles had a positive effect on head postures and on muscular activity.

  10. Sorting it out: regulation of exosome loading.

    PubMed

    Villarroya-Beltri, Carolina; Baixauli, Francesc; Gutiérrez-Vázquez, Cristina; Sánchez-Madrid, Francisco; Mittelbrunn, María

    2014-10-01

    Extracellular vesicles (EVs), a term that includes both exosomes of endocytic origin and vesicles derived from plasma membranes, are continuously secreted by cells to the extracellular environment, and represent a novel vehicle for cell-cell communication. Exosomes contain specific repertoires of proteins and RNAs, indicating the existence of mechanisms that control the sorting of molecules into them. Although the molecular mechanisms that regulate the loading of proteins into exosomes have been studied for years, the sorting of RNA has been elusive until recently. Here we review the molecular mechanisms that control the sorting of molecules into exosomes, with special attention to the sorting of RNA. We also discuss how the cellular context affects the composition of exosomes, and thus the outcome of the communication between the exosome-producer and recipient cells, with particular focus on the communication between tumor cells and with cells of the tumor microenvironment.

  11. Flow Analysis and Sorting of Plant Chromosomes.

    PubMed

    Vrána, Jan; Cápal, Petr; Šimková, Hana; Karafiátová, Miroslava; Čížková, Jana; Doležel, Jaroslav

    2016-10-10

    Analysis and sorting of plant chromosomes (plant flow cytogenetics) is a special application of flow cytometry in plant genomics and its success depends critically on sample quality. This unit describes the methodology in a stepwise manner, starting with the induction of cell cycle synchrony and accumulation of dividing cells in mitotic metaphase, and continues with the preparation of suspensions of intact mitotic chromosomes, flow analysis and sorting of chromosomes, and finally processing of the sorted chromosomes. Each step of the protocol is described in detail as some procedures have not been used widely. Supporting histograms are presented as well as hints on dealing with plant material; the utility of sorted chromosomes for plant genomics is also discussed. © 2016 by John Wiley & Sons, Inc.

  12. Protein sorting at the trans-Golgi network.

    PubMed

    Guo, Yusong; Sirkis, Daniel W; Schekman, Randy

    2014-01-01

    The trans-Golgi network (TGN) is an important cargo sorting station within the cell where newly synthesized proteins are packaged into distinct transport carriers that are targeted to various destinations. To maintain the fidelity of protein transport, elaborate protein sorting machinery is employed to mediate sorting of specific cargo proteins into distinct transport carriers. Protein sorting requires assembly of the cytosolic sorting machinery onto the TGN membrane and capture of cargo proteins. We review the cytosolic and transmembrane sorting machinery that function at the TGN and describe molecular interactions and regulatory mechanisms that enable accurate protein sorting. In addition, we highlight the importance of TGN sorting in physiology and disease.

  13. Connecting NSF funding to patent innovation in nanotechnology (2001-2004)

    NASA Astrophysics Data System (ADS)

    Huang, Zan; Chen, Hsinchun; Li, Xin; Roco, Mihail C.

    2006-12-01

    Nanotechnology research has experienced growth rapid in knowledge and innovations; it also attracted significant public funding in recent years. Several countries have recognized nanotechnology as a critical research domain that promises to revolutionize a wide range of fields of applications. In this paper, we present an analysis of the funding for nanoscale science and engineering (NSE) at the National Science Foundation (NSF) and its implications on technological innovation (number of patents) in this field from 2001 to 2004. Using a combination of basic bibliometric analysis and content visualization tools, we identify growth trends, research topic distribution, and the evolution in NSF funding and commercial patenting activities recorded at the United States Patent Office (USPTO). The patent citations are used to compare the impact of the NSF-funded research on nanotechnology development with research supported by other sources in the United States and abroad. The analysis shows that the NSF-funded researchers and patents authored by them have significantly higher impact based on patent citation measures in the four-year period than other comparison groups. The NSF-authored patent impact is growing faster with the lifetime of a patent, indicating the long-term importance of fundamental research.

  14. Differential requirement for N-ethylmaleimide-sensitive factor in endosomal trafficking of transferrin receptor from anterograde trafficking of vesicular stomatitis virus glycoprotein G.

    PubMed

    Fan, Jiannan; Zhou, Xiaoxu; Wang, Yanli; Kuang, Cuifang; Sun, Yonghong; Liu, Xu; Toomre, Derek; Xu, Yingke

    2017-01-01

    N-ethylmaleimide-sensitive fusion factor (NSF) is an ATPase that plays a crucial role in vesicular transport. Here, we examined the effects of NSF knockdown on Golgi structure and different vesicle trafficking pathways in mammalian cells. NSF knockdown caused Golgi fragmentation and abolished transferrin receptor exocytosis, defects that were rescued by RNAi-resistant NSF. Strikingly, NSF deficiency in HeLa cells barely affected cell viability, anterograde trafficking of vesicular stomatitis virus glycoprotein G and transferrin endocytosis. These results confirm the central role of NSF in Golgi structure and reveal differential requirement of NSF for exocytic recycling and constitutive trafficking pathways. © 2016 Federation of European Biochemical Societies.

  15. Vertical sorting and the morphodynamics of bed-form-dominated rivers: An equilibrium sorting model

    NASA Astrophysics Data System (ADS)

    Blom, Astrid; Parker, Gary; Ribberink, Jan S.; de Vriend, Huib J.

    2006-02-01

    A modeling framework is developed for taking into account the effects of sediment sorting in the morphodynamic modeling of bed-form-dominated rivers for the case of equilibrium or stationary conditions dominated by bed load transport. To this end, the Blom and Parker (2004) framework for sediment continuity is reduced to an equilibrium sorting model. The predicted equilibrium sorting profile is mainly determined by the probability density function (PDF) of bed form trough elevations and by a lee sorting function. The PDF of trough elevations needs to be known from either model predictions or measurements. A simple formulation for the lee sorting function is suggested, yet data on the avalanche mechanism down lee faces of dunes is required so as to improve the function and make it generic. The equilibrium sorting model is calibrated and verified using data from flume experiments. The agreement between the predicted and measured equilibrium sorting profiles is reasonable, although the model does not reproduce an observed coarse top layer. In a hydraulic-morphodynamic model this equilibrium sorting model may be applied instantaneously if the timescale of large-scale morphological changes is much larger than the ones of changes in vertical sorting and dune dimensions.

  16. The NSF/RANN FY 1975 program for geothermal resources research and technology

    NASA Technical Reports Server (NTRS)

    Kruger, P.

    1974-01-01

    The specific goal of the NSF geothermal program is the rapid development by industry of the nation's geothermal resources that can be demonstrated to be commercially, environmentally and socially acceptable as alternate energy sources. NSF, as the lead agency for the federal geothermal energy research program, is expediting a program which encompasses the objectives necessary for significant utilization. These include: acceleration of exploration and assessment methods to identify commercial geothermal resources; development of innovative and improved technology to achieve economic feasibility; evaluation of policy options to resolve environmental, legal, and institutional problems; and support of experimental research facilities for each type of geothermal resource. Specific projects in each of these four objective areas are part of the NSF program for fiscal year 1975.

  17. The NSF Cybersecurity Center of Excellence: Translating Identity Management and Cybersecurity into Scientific Collaboration

    NASA Astrophysics Data System (ADS)

    Welch, V.

    2016-12-01

    Scientists care deeply about their collaborations: who is a member, who can access, produce, and correct data, and manager instruments critical to their science missions. The communities of cybersecurity and identity management professionals develop tools to support collaborations and the undertaking of trustworthy science, but there are large cultural and linguistic gaps between these communities and the scientists they service. The National Science Foundation has recently funded a NSF Cybersecurity Center of Excellence to help its community of projects by providing leadership and addressing the challenges of trustworthy science. A key goal of this NSF Center has been translating between the goals of the science community into requirements and risks understood by identity management and cybersecurity communities. This talk will give an update on the Center's efforts and other services it provides to the NSF community to bridge these cultures.

  18. Effect of Wildfire on Sediment Sorting in a Steep Channel

    NASA Astrophysics Data System (ADS)

    Florsheim, J. L.; Chin, A.; O'Hirok, L.; Storesund, R.

    2014-12-01

    Wildfire is an external forcing factor in the landscape. In chaparral environments, wildfire initiates transport of well-sorted fine sediment through dry-ravel processes on hillslopes and facilitates delivery of sediment to stream channels. In turn, this periodic post-fire sediment influx governs sorting of channel-bed material during subsequent floods that mobilize and transport the sediment downstream. We investigated the effects of the May 2013 Springs Wildfire in the Santa Monica Mountains in semi-arid southern California with field measurements and terrestrial LiDAR scanning. Before the fire, sediment sorting within the heterogeneous bed material present in Big Sycamore Creek was controlled by organized step-pool bedforms. Boulders formed steps with relatively finer cobbles, gravel, and sand filling the pools. Before the fire, the grain size distribution present in the substrate between boulder steps was relatively coarse (D84 = 250 mm), in contrast to that in the influx of sediment contributed by post-fire dry-ravel processes deposited at channel margins (D84 = 8 mm). Flow shear stress during one small flood in 2014 (post-fire) was adequate to mobilize fine dry ravel- related sediment. Transport capacity was sufficient to mobilize and transport this sediment within a study reach; however, it was not adequate to flush the fine material downstream. Shear stress required to mobilize sediment contributed by dry ravel was substantially less than that required to transport the substrate material present before the wildfire. The small flood deposited fine sediment (D84 = 16 mm) as flow lost capacity. Resulting deposition buried bedforms, changing the step-pool profile to a plane bed. The relatively poorly sorted, coarse, rough bed changed to a well sorted, fine, smooth, bed. These changes have implications for sediment transport dynamics and aquatic ecology. In steep, semi-arid, chaparral fluvial systems, sediment derived from dry-ravel processes influences the

  19. Extracellular vesicle sorting of α-Synuclein is regulated by sumoylation.

    PubMed

    Kunadt, Marcel; Eckermann, Katrin; Stuendl, Anne; Gong, Jing; Russo, Belisa; Strauss, Katrin; Rai, Surya; Kügler, Sebastian; Falomir Lockhart, Lisandro; Schwalbe, Martin; Krumova, Petranka; Oliveira, Luis M A; Bähr, Mathias; Möbius, Wiebke; Levin, Johannes; Giese, Armin; Kruse, Niels; Mollenhauer, Brit; Geiss-Friedlander, Ruth; Ludolph, Albert C; Freischmidt, Axel; Feiler, Marisa S; Danzer, Karin M; Zweckstetter, Markus; Jovin, Thomas M; Simons, Mikael; Weishaupt, Jochen H; Schneider, Anja

    2015-05-01

    Extracellular α-Synuclein has been implicated in interneuronal propagation of disease pathology in Parkinson's Disease. How α-Synuclein is released into the extracellular space is still unclear. Here, we show that α-Synuclein is present in extracellular vesicles in the central nervous system. We find that sorting of α-Synuclein in extracellular vesicles is regulated by sumoylation and that sumoylation acts as a sorting factor for targeting of both, cytosolic and transmembrane proteins, to extracellular vesicles. We provide evidence that the SUMO-dependent sorting utilizes the endosomal sorting complex required for transport (ESCRT) by interaction with phosphoinositols. Ubiquitination of cargo proteins is so far the only known determinant for ESCRT-dependent sorting into the extracellular vesicle pathway. Our study reveals a function of SUMO protein modification as a Ubiquitin-independent ESCRT sorting signal, regulating the extracellular vesicle release of α-Synuclein. We deciphered in detail the molecular mechanism which directs α-Synuclein into extracellular vesicles which is of highest relevance for the understanding of Parkinson's disease pathogenesis and progression at the molecular level. We furthermore propose that sumo-dependent sorting constitutes a mechanism with more general implications for cell biology.

  20. Microfluidic sorting in an optical lattice

    NASA Astrophysics Data System (ADS)

    MacDonald, M. P.; Spalding, G. C.; Dholakia, K.

    2003-11-01

    The response of a microscopic dielectric object to an applied light field can profoundly affect its kinetic motion. A classic example of this is an optical trap, which can hold a particle in a tightly focused light beam. Optical fields can also be used to arrange, guide or deflect particles in appropriate light-field geometries. Here we demonstrate an optical sorter for microscopic particles that exploits the interaction of particles-biological or otherwise-with an extended, interlinked, dynamically reconfigurable, three-dimensional optical lattice. The strength of this interaction with the lattice sites depends on the optical polarizability of the particles, giving tunable selection criteria. We demonstrate both sorting by size (of protein microcapsule drug delivery agents) and sorting by refractive index (of other colloidal particle streams). The sorting efficiency of this method approaches 100%, with values of 96% or more observed even for concentrated solutions with throughputs exceeding those reported for fluorescence-activated cell sorting. This powerful, non-invasive technique is suited to sorting and fractionation within integrated (`lab-on-a-chip') microfluidic systems, and can be applied in colloidal, molecular and biological research.

  1. Occu-Sort: Development and Evaluation of an Occupational Card Sort System.

    ERIC Educational Resources Information Center

    Jones, Lawrence K.

    1979-01-01

    Development of the Occu-Sort system, occupational card sorts, self-guided booklet, record sheet, and manual is discussed. Field testing using the cards with the self-guided booklet is reported. There is a moderate relationship between O-S and VPI codes. Thus O-S shows promise as an effective vocational counseling and career development tool.…

  2. Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

    PubMed

    Xi, Zhiqin; Deng, Wanni; Wang, Liang; Xiao, Fei; Li, Jie; Wang, Zhihua; Wang, Xin; Mi, Xiujuan; Wang, Na; Wang, Xuefeng

    2015-11-01

    Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

  3. Institutional transformation: An analysis of change initiatives at NSF ADVANCE institutions

    NASA Astrophysics Data System (ADS)

    Plummer, Ellen W.

    The purpose of this study was to examine how institutional culture promoted or impeded the implementation of round one and two NSF ADVANCE initiatives designed to improve academic climates for women in science and engineering. This study was conducted in two phases. In phase one, 35 participants from 18 institutions were interviewed to answer three research questions. Participants identified a policy, process, or program designed to improve academic cultures for women in science and engineering fields. Participants also identified strategies that promoted the implementation of these efforts, and discussed factors that impeded these efforts. In phase two, site visits were conducted at two institutions to answer a fourth research question. How did institutional culture shape the design and implementation of faculty search processes? Policies, processes, and programs were implemented by participants at the institutional, departmental, and individual levels and included family friendly and dual career policies at the institutional level, improved departmental faculty search and climate improvement processes, and mentoring programs and training for department heads at the individual level. Communication and leadership strategies were key to the successful implementation of policies, processes, and programs designed to achieve institutional transformation. Communication strategies involved shaping change messages to reach varied audiences often with the argument that change efforts would improve the climate for everyone not just women faculty members. Administrative and faculty leaders from multiple levels proved important to change efforts. Institutional Transformation Institutional culture shaped initiatives to improve faculty search processes. Faculty leaders in both settings used data to persuade faculty members of the need for change. At one site, data that included national availability information was critical to advancing the change agenda. At the other site

  4. Forces driving cell sorting in the amphibian embryo.

    PubMed

    Winklbauer, Rudolf; Parent, Serge E

    2017-04-01

    Adhesion differences are the main driver of cell sorting and related processes such as boundary formation or tissue positioning. In the early amphibian embryo, graded variations in cadherin density and localized expression of adhesion-modulating factors are associated with regional differences in adhesive properties including overall adhesion strength. The role of these differences in embryonic boundary formation has not been studied extensively, but available evidence suggests that adhesion strength differentials are not essential. On the other hand, the inside-out positioning of the germ layers is correlated with adhesion strength, although the biological significance of this effect is unclear. By contrast, the positioning of dorsal mesoderm tissues along the anterior-posterior body axis is essential for axis elongation, but the underlying sorting mechanism is not correlated with adhesion strength, and may rely on specific cell adhesion. Formation of the ectoderm-mesoderm boundary is the best understood sorting related process in the frog embryo. It relies on contact-induced cell repulsion at the tissue interface, driven by Eph-ephrin signaling and paraxial protocadherin-dependent self/non-self recognition.

  5. Microtubule and Motor-Dependent Endocytic Vesicle Sorting in Vitro

    PubMed Central

    Bananis, Eustratios; Murray, John W.; Stockert, Richard J.; Satir, Peter; Wolkoff, Allan W.

    2000-01-01

    Endocytic vesicles undergo fission to sort ligand from receptor. Using quantitative immunofluorescence and video imaging, we provide the first in vitro reconstitution of receptor–ligand sorting in early endocytic vesicles derived from rat liver. We show that to undergo fission, presegregation vesicles must bind to microtubules (MTs) and move upon addition of ATP. Over 13% of motile vesicles elongate and are capable of fission. After fission, one vesicle continues to move, whereas the other remains stationary, resulting in their separation. On average, almost 90% receptor is found in one daughter vesicle, whereas ligand is enriched by ∼300% with respect to receptor in the other daughter vesicle. Although studies performed on polarity marked MTs showed approximately equal plus and minus end–directed motility, immunofluorescence microscopy revealed that kinesins, but not dynein, were associated with these vesicles. Motility and fission were prevented by addition of 1 mM 5′-adenylylimido-diphosphate (AMP-PNP, an inhibitor of kinesins) or incubation with kinesin antibodies, but were unaffected by addition of 5 μM vanadate (a dynein inhibitor) or dynein antibodies. These studies indicate an essential role of kinesin-based MT motility in endocytic vesicle sorting, providing a system in which factors required for endocytic vesicle processing can be identified and characterized. PMID:11018063

  6. Flow karyotyping and sorting of human chromosomes

    SciTech Connect

    Gray, J.W.; Lucas, J.; Peters, D.; Pinkel, D.; Trask, B.; van den Engh, G.; Van Dilla, M.A.

    1986-07-16

    Flow cytometry and sorting are becoming increasingly useful as tools for chromosome classfication and for the detection of numerical and structural chromosome aberrations. Chromosomes of a single type can be purified with these tools to facilitate gene mapping or production of chromosome specific recombinant DNA libraries. For analysis of chromosomes with flow cytometry, the chromosomes are extracted from mitotic cells, stained with one or more fluorescent dyes and classified one-by-one according to their dye content(s). Thus, the flow approach is fundamentally different than conventional karyotyping where chromosomes are classified within the context of a metaphase spread. Flow sorting allows purification of chromosomes that can be distinguished flow cytometrically. The authors describe the basic principles of flow cytometric chromosome classification i.e. flow karyotyping, and chromosome sorting and describe several applications. 30 refs., 8 figs.

  7. Fruit Sorting Using Fuzzy Logic Techniques

    NASA Astrophysics Data System (ADS)

    Elamvazuthi, Irraivan; Sinnadurai, Rajendran; Aftab Ahmed Khan, Mohamed Khan; Vasant, Pandian

    2009-08-01

    Fruit and vegetables market is getting highly selective, requiring their suppliers to distribute the goods according to very strict standards of quality and presentation. In the last years, a number of fruit sorting and grading systems have appeared to fulfill the needs of the fruit processing industry. However, most of them are overly complex and too costly for the small and medium scale industry (SMIs) in Malaysia. In order to address these shortcomings, a prototype machine was developed by integrating the fruit sorting, labeling and packing processes. To realise the prototype, many design issues were dealt with. Special attention is paid to the electronic weighing sub-system for measuring weight, and the opto-electronic sub-system for determining the height and width of the fruits. Specifically, this paper discusses the application of fuzzy logic techniques in the sorting process.

  8. Vacuolar protein sorting mechanisms in plants.

    PubMed

    Xiang, Li; Etxeberria, Ed; Van den Ende, Wim

    2013-02-01

    Plant vacuoles are unique, multifunctional organelles among eukaryotes. Considerable new insights in plant vacuolar protein sorting have been obtained recently. The basic machinery of protein export from the endoplasmic reticulum to the Golgi and the classical route to the lytic vacuole and the protein storage vacuole shows many similarities to vacuolar/lysosomal sorting in other eukaryotes. However, as a result of its unique functions in plant defence and as a storage compartment, some plant-specific entities and sorting determinants appear to exist. The alternative post-Golgi route, as found in animals and yeast, probably exists in plants as well. Likely, adaptor protein complex 3 fulfils a central role in this route. A Golgi-independent route involving plant-specific endoplasmic reticulum bodies appears to provide sedentary organisms such as plants with extra flexibility to cope with changing environmental conditions. © 2012 The Authors Journal compilation © 2012 FEBS.

  9. Development of a Consensus Standard for School Equipment: NSF/NSSEA 380

    ERIC Educational Resources Information Center

    Breitner, Ashlee

    2011-01-01

    For many years, the school supplies and equipment industry has investigated methods to ensure product safety and compliance across all its product categories. In early 2010, NSF International and the National School Supply and Equipment Association (NSSEA) came together to develop quality standards for products and equipment designed for use in…

  10. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 5 Administrative Personnel 3 2012-01-01 2012-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  11. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 5 Administrative Personnel 3 2014-01-01 2014-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  12. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 5 Administrative Personnel 3 2013-01-01 2013-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  13. NSF/DARPA/NASA Digital Libraries Initiative: A Program Manager's Perspective.

    ERIC Educational Resources Information Center

    Griffin, Stephen M.

    1998-01-01

    Discusses the National Science Foundation (NSF)/United States Defense Advanced Research Projects Agency (DARPA)/National Aeronautics and Space Agency (NASA) Research in Digital Libraries Initiative (DLI). Highlights include benefits of digital libraries; the Federal High Performance Computing and Communications Program (HPCC); and program…

  14. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... support the work of the same investigator and his or her laboratory or group (if any) in the same general... current NSF employee would be a senior investigator or equivalent, unless it is a proposal for continuation or extension of support for work on which the employee served in that capacity before coming...

  15. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... support the work of the same investigator and his or her laboratory or group (if any) in the same general... current NSF employee would be a senior investigator or equivalent, unless it is a proposal for continuation or extension of support for work on which the employee served in that capacity before coming...

  16. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... support the work of the same investigator and his or her laboratory or group (if any) in the same general... current NSF employee would be a senior investigator or equivalent, unless it is a proposal for continuation or extension of support for work on which the employee served in that capacity before coming...

  17. Position Paper. Cutting the NSF-OSIS Budget: Potential Disaster for Information Science and Technology

    ERIC Educational Resources Information Center

    Smith, Joshua I.

    1974-01-01

    A statement submitted on behalf of ASIS to the Subcommitte on Science Research and Development of the Committee on Science and Astronautics of the U.S. House of Representatives on the NSF Authorization Act 1975, HR 12816. (Author/JB)

  18. NSF's Experimental Program to Stimulate Competitive Research (EPSCoR): Subsidizing Academic Research or State Budgets?

    ERIC Educational Resources Information Center

    Wu, Yonghong

    2009-01-01

    This cross-state empirical study focuses on the National Science Foundation's (NSF) Experimental Program to Stimulate Competitive Research (EPSCoR) and examines its impact on the academic research and development (R&D) expenditures financed by state governments. Based on a panel of 50 states during 1979-2006, the empirical results indicate that…

  19. 78 FR 14087 - DOE/NSF High Energy Physics Advisory Panel: Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-04

    ... High Energy Physics Advisory Panel: Correction AGENCY: Office of Science, Department of Energy. ACTION...) published a notice of open meeting for the DOE/NSF High Energy Physics Advisory Panel to be held on March 11... Kogut, Executive Secretary; High Energy Physics Advisory Panel; U.S. Department of Energy; SC-25...

  20. Carter Tough, Knowledgeable--Atkinson Sees Good Relationship Between NSF and White House

    ERIC Educational Resources Information Center

    BioScience, 1977

    1977-01-01

    An interview with Richard C. Atkinson, the new director of the National Science Foundation, is detailed. Topics discussed in the interview include basic research in universities, NSF policies, cutbacks of advisory committees, two year funding, the Science for Citizens program, and the RANN program. (BT)

  1. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 5 Administrative Personnel 3 2011-01-01 2011-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  2. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... SCIENCE FOUNDATION NATIONAL SCIENCE FOUNDATION RULES OF PRACTICE Rules of Practice for the National Science Foundation § 680.11 Staff involvement with NSF proposals and awards. (a)(1) Many scientists... field of science, engineering, or education, notwithstanding that the focus of the work may change...

  3. 45 CFR 680.12 - One-year NSF post-employment restrictions.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Section 680.12 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION NATIONAL SCIENCE FOUNDATION RULES OF PRACTICE AND STATUTORY CONFLICT-OF-INTEREST EXEMPTIONS Rules of Practice for the National Science Foundation § 680.12 One-year NSF post-employment...

  4. 45 CFR 680.11 - Staff involvement with NSF proposals and awards.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... SCIENCE FOUNDATION NATIONAL SCIENCE FOUNDATION RULES OF PRACTICE AND STATUTORY CONFLICT-OF-INTEREST EXEMPTIONS Rules of Practice for the National Science Foundation § 680.11 Staff involvement with NSF... investigator and his or her laboratory or group (if any) in the same general field of science, engineering,...

  5. 5 CFR 5301.104 - Participation in NSF-supported conferences.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Participation in NSF-supported conferences. 5301.104 Section 5301.104 Administrative Personnel NATIONAL SCIENCE FOUNDATION SUPPLEMENTAL STANDARDS OF ETHICAL CONDUCT FOR EMPLOYEES OF THE NATIONAL SCIENCE FOUNDATION § 5301.104 Participation...

  6. NSF/DARPA/NASA Digital Libraries Initiative: A Program Manager's Perspective.

    ERIC Educational Resources Information Center

    Griffin, Stephen M.

    1998-01-01

    Discusses the National Science Foundation (NSF)/United States Defense Advanced Research Projects Agency (DARPA)/National Aeronautics and Space Agency (NASA) Research in Digital Libraries Initiative (DLI). Highlights include benefits of digital libraries; the Federal High Performance Computing and Communications Program (HPCC); and program…

  7. NSF's Experimental Program to Stimulate Competitive Research (EPSCoR): Subsidizing Academic Research or State Budgets?

    ERIC Educational Resources Information Center

    Wu, Yonghong

    2009-01-01

    This cross-state empirical study focuses on the National Science Foundation's (NSF) Experimental Program to Stimulate Competitive Research (EPSCoR) and examines its impact on the academic research and development (R&D) expenditures financed by state governments. Based on a panel of 50 states during 1979-2006, the empirical results indicate that…

  8. 75 FR 57463 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-21

    ... Energy High Energy Physics Program. Discussion of National Science Foundation Elementary Particle Physics... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory...

  9. 77 FR 64799 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-23

    ... Elementary Particle Physics Program Reports on and Discussions of Topics of General Interest in High Energy... High Energy Physics Advisory Panel AGENCY: Department of Energy. ACTION: Notice of open Meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory Panel (HEPAP...

  10. 76 FR 19986 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-04-11

    .... Discussion of National Science Foundation Elementary Particle Physics Program. Reports on and Discussion of... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory...

  11. 76 FR 8358 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-14

    ... Particle Physics Program Reports on and Discussions of Topics of General Interest in High Energy Physics... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory...

  12. 77 FR 4027 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-26

    ... Energy High Energy Physics Program Discussion of National Science Foundation Elementary Particle Physics... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory...

  13. 78 FR 46330 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-31

    ... Elementary Particle Physics Program Reports on and Discussions of Topics of General Interest in High Energy... High Energy Physics Advisory Panel AGENCY: Office of Science, Department of Energy. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory...

  14. 78 FR 12043 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-21

    ... Foundation Elementary Particle Physics Program. ] Reports on and Discussions of Topics of General Interest in... High Energy Physics Advisory Panel AGENCY: Office of Science, Department of Energy. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory...

  15. 76 FR 41234 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-13

    ... Elementary Particle Physics Program. Reports on and Discussions of Topics of General Interest in High Energy... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory...

  16. 77 FR 33449 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-06

    ... Foundation Elementary Particle Physics Program. Reports on and Discussions of Topics of General Interest in... High Energy Physics Advisory Panel AGENCY: Office of Science, Department of Energy. ACTION: Notice of open meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory...

  17. 78 FR 69839 - DOE/NSF High Energy Physics Advisory Panel

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-11-21

    ... Elementary Particle Physics Program Reports on and Discussions of Topics of General Interest in High Energy... High Energy Physics Advisory Panel AGENCY: Department of Energy, Office of Science. ACTION: Notice of Open Meeting. SUMMARY: This notice announces a meeting of the DOE/NSF High Energy Physics Advisory...

  18. Development of a Consensus Standard for School Equipment: NSF/NSSEA 380

    ERIC Educational Resources Information Center

    Breitner, Ashlee

    2011-01-01

    For many years, the school supplies and equipment industry has investigated methods to ensure product safety and compliance across all its product categories. In early 2010, NSF International and the National School Supply and Equipment Association (NSSEA) came together to develop quality standards for products and equipment designed for use in…

  19. 45 CFR 650.14 - Request for conveyance of title to NSF.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... § 650.4(a) to request conveyance of title to a subject invention if certain conditions exist. (b) The... designee title in one or more countries to any invention to which the awardee has elected not to retain title. The NSF Patent Assistant may request immediate conveyance of title to a subject invention if...

  20. 45 CFR 681.6 - When may NSF issue a complaint?

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false When may NSF issue a complaint? 681.6 Section 681.6 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION PROGRAM FRAUD CIVIL REMEDIES ACT REGULATIONS Procedures Leading to Issuance of A Complaint § 681.6 When...

  1. The 1983-1984 NSF Chautauqua-Type Short Course Program.

    ERIC Educational Resources Information Center

    Zeitler, William R.; Ogletree, Owen, Jr.

    1984-01-01

    National Science Foundation (NSF) Chautauqua-type short courses offer undergraduate science teachers the opportunity to absorbe new ideas from highly respected scholars. A complete list of courses, course directors, locations, dates, and registration fees for the 1983-84 program is provided. Subject areas include: instructional composting, cells…

  2. Evaluation of NSF's International Research Fellowship Program: Final Report

    ERIC Educational Resources Information Center

    Martinez, Alina; Epstein, Carter; Parsad, Amanda; Whittaker, Karla

    2012-01-01

    Among the National Science Foundation's (NSF) postdoctoral programs, the International Research Fellowship Program (IRFP) is unique in its emphasis on providing postdoctoral fellows with international research experiences. Established in 1992, IRFP provides financial support to postdoctoral scientists for a research experience abroad lasting…

  3. Differences in Math and Science Understanding between NSF GK-12 Participant Groups: A Year Long Study

    ERIC Educational Resources Information Center

    Wilhelm, Jennifer; She, Xiaobo; Morrison, Darrellee Clem

    2011-01-01

    In this study, interdisciplinary environments were created in NSF institutes and classrooms with graduate fellows and teachers. Using a mixed methodology, we examined how experiential learning influenced participants' mathematical/scientific actions and compared differences in mathematics/science efficacy and content understanding between…

  4. Innovating and Evaluating Science Education: NSF Evaluation Forums 1992-94.

    ERIC Educational Resources Information Center

    Westat, Inc., Rockville, MD.

    This document contains papers from a series of Evaluation Forums of the National Science Foundation. The titles are: "Education Program Evaluation at NSF: What Difference Does It Make?" (D. E. Chubin); "Interagency Efforts to Review and Evaluate Science, Mathematics, and Engineering Programs Through the Federal Coordinating Council…

  5. Order-Sorted Parameterization and Induction

    NASA Astrophysics Data System (ADS)

    Meseguer, José

    Parameterization is one of the most powerful features to make specifications and declarative programs modular and reusable, and our best hope for scaling up formal verification efforts. This paper studies order-sorted parameterization at three different levels: (i) its mathematical semantics; (ii) its operational semantics by term rewriting; and (iii) the inductive reasoning principles that can soundly be used to prove properties about such specifications. It shows that achieving the desired properties at each of these three levels is a considerably subtler matter than for many-sorted specifications, but that such properties can be attained under reasonable conditions.

  6. Curvature-Driven Lipid Sorting in Biomembranes

    PubMed Central

    Callan-Jones, Andrew; Sorre, Benoit; Bassereau, Patricia

    2011-01-01

    It has often been suggested that the high curvature of transport intermediates in cells may be a sufficient means to segregate different lipid populations based on the relative energy costs of forming bent membranes. In this review, we present in vitro experiments that highlight the essential physics of lipid sorting at thermal equilibrium: It is driven by a trade-off between bending energy, mixing entropy, and interactions between species. We collect evidence that lipid sorting depends strongly on lipid–lipid and protein–lipid interactions, and hence on the underlying composition of the membrane and on the presence of bound proteins. PMID:21421916

  7. Linking the GLOBE Program With NASA and NSF Large-Scale Experiments

    NASA Astrophysics Data System (ADS)

    Filmer, P. E.

    2005-12-01

    NASA and the NSF, the sponsoring Federal agencies for the GLOBE Program, are seeking the participation of science teams who are working at the cutting edge of Earth systems science in large integrated Earth systems science programs. Connecting the GLOBE concept and structure with NASA and NSF's leading Earth systems science programs will give GLOBE schools and students access to top scientists, and expose them to programs that have been designated as scientific priorities. Students, teachers, parents, and their communities will be able to see how scientists of many disciplines work together to learn about the Earth system. The GLOBE solicitation released by the NSF targets partnerships between GLOBE and NSF/NASA-funded integrated Earth systems science programs. This presentation will focus on the goals and requirements of the NSF solicitation. Proponents will be expected to provide ways for the GLOBE community to interact with a group of scientists from their science programs as part of a wider joint Earth systems science educational strategy (the sponsoring agencies', GLOBE's, and the proposing programs'). Teams proposing to this solicitation must demonstrate: - A focus on direct connections with major NSF Geosciences and/or Polar Programs and/or NASA Earth-Sun research programs that are related to Earth systems science; - A demonstrable benefit to GLOBE and to NSF Geosciences and/or Polar Programs or NASA Earth-Sun education goals (providing access to program researchers and data, working with GLOBE in setting up campaigns where possible, using tested GLOBE or non-GLOBE protocols to the greatest extent possible, actively participating in the wider GLOBE community including schools, among other goals); - An international component; - How the existing educational efforts of the large science program will coordinate with GLOBE; - An Earth systems science education focus, rather than a GLOBE protocol-support focus; - A rigorous evaluation and assessment component

  8. Retromer-mediated endosomal protein sorting: The role of unstructured domains.

    PubMed

    Mukadam, Aamir S; Seaman, Matthew N J

    2015-09-14

    The retromer complex is a key element of the endosomal protein sorting machinery that is conserved through evolution and has been shown to play a role in diseases such as Alzheimer's disease and Parkinson's disease. Through sorting various membrane proteins (cargo), the function of retromer complex has been linked to physiological processes such as lysosome biogenesis, autophagy, down regulation of signalling receptors and cell spreading. The cargo-selective trimer of retromer recognises membrane proteins and sorts them into two distinct pathways; endosome-to-Golgi retrieval and endosome-to-cell surface recycling and additionally the cargo-selective trimer functions as a hub to recruit accessory proteins to endosomes where they may regulate and/or facilitate retromer-mediated endosomal proteins sorting. Unstructured domains present in cargo proteins or accessory factors play key roles in both these aspects of retromer function and will be discussed in this review.

  9. Global nanotechnology development from 1991 to 2012: patents, scientific publications, and effect of NSF funding

    NASA Astrophysics Data System (ADS)

    Chen, Hsinchun; Roco, Mihail C.; Son, Jaebong; Jiang, Shan; Larson, Catherine A.; Gao, Qiang

    2013-09-01

    In a relatively short interval for an emerging technology, nanotechnology has made a significant economic impact in numerous sectors including semiconductor manufacturing, catalysts, medicine, agriculture, and energy production. A part of the United States (US) government investment in basic research has been realized in the last two decades through the National Science Foundation (NSF), beginning with the nanoparticle research initiative in 1991 and continuing with support from the National Nanotechnology Initiative after fiscal year 2001. This paper has two main goals: (a) present a longitudinal analysis of the global nanotechnology development as reflected in the United States Patent and Trade Office (USPTO) patents and Web of Science (WoS) publications in nanoscale science and engineering (NSE) for the interval 1991-2012; and (b) identify the effect of basic research funded by NSF on both indicators. The interval has been separated into three parts for comparison purposes: 1991-2000, 2001-2010, and 2011-2012. The global trends of patents and scientific publications are presented. Bibliometric analysis, topic analysis, and citation network analysis methods are used to rank countries, institutions, technology subfields, and inventors contributing to nanotechnology development. We then, examined how these entities were affected by NSF funding and how they evolved over the past two decades. Results show that dedicated NSF funding used to support nanotechnology R&D was followed by an increased number of relevant patents and scientific publications, a greater diversity of technology topics, and a significant increase of citations. The NSF played important roles in the inventor community and served as a major contributor to numerous nanotechnology subfields.

  10. Microwave Conductivity of Sorted CNT Assemblies

    PubMed Central

    Bulmer, John S.; Martens, Jon; Kurzepa, Lukasz; Gizewski, Tomasz; Egilmez, M.; Blamire, M. G.; Yahya, Noorhana; Koziol, Krzysztof K. K.

    2014-01-01

    Recent progress with tailored growth and post-process sorting enables carbon nanotube (CNT) assemblies with predominantly metallic or semi-conducting concentrations. Cryogenic and microwave measurements performed here show transport dimensionality and overall order increasing with increasing metallic concentration, even in atmospheric doping conditions. By 120 GHz, the conductivity of predominantly semi-conducting assemblies grew to 400% its DC value at an increasing growth rate, while other concentrations a growth rate that tapered off. A generalized Drude model fits to the different frequency dependent behaviors and yields useful quality control parameters such as plasma frequency, mean free path, and degree of localization. As one of the first demonstrations of waveguides fabricated from this material, sorted CNTs from both as-made and post-process sources were inserted into sections of practical micro-strip. With both sources, sorted CNT micro-strip increasingly outperformed the unsorted with increasing frequency-- illustrating that sorted CNT assemblies will be important for high frequency applications. PMID:24446019

  11. Wavelet adaptation for automatic voice disorders sorting.

    PubMed

    Erfanian Saeedi, Nafise; Almasganj, Farshad

    2013-07-01

    Early diagnosis of voice disorders and abnormalities by means of digital speech processing is a subject of interest for many researchers. Various methods are introduced in the literature, some of which are able to extensively discriminate pathological voices from normal ones. Voice disorders sorting, on the other hand, has received less attention due to the complexity of the problem. Although, previous publications show satisfactory results in classifying one type of disordered voice from normal cases, or two different types of abnormalities from each other, no comprehensive approach for automatic sorting of vocal abnormalities has been offered yet. In this paper, a solution for this problem is suggested. We create a powerful wavelet feature extraction approach, in which, instead of standard wavelets, adaptive wavelets are generated and applied to the voice signals. Orthogonal wavelets are parameterized via lattice structure and then, the optimal parameters are investigated through an iterative process, using the genetic algorithm (GA). GA is guided by the classifier results. Based on the generated wavelet, a wavelet-filterbank is constructed and the voice signals are decomposed to compute eight energy-based features. A support vector machine (SVM) then classifies the signals using the extracted features. Experimental results show that six various types of vocal disorders: paralysis, nodules, polyps, edema, spasmodic dysphonia and keratosis are fully sorted via the proposed method. This could be a successful step toward sorting a larger number of abnormalities associated with the vocal system. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Sorting cells by their dynamical properties

    NASA Astrophysics Data System (ADS)

    Henry, Ewan; Holm, Stefan H.; Zhang, Zunmin; Beech, Jason P.; Tegenfeldt, Jonas O.; Fedosov, Dmitry A.; Gompper, Gerhard

    2016-10-01

    Recent advances in cell sorting aim at the development of novel methods that are sensitive to various mechanical properties of cells. Microfluidic technologies have a great potential for cell sorting; however, the design of many micro-devices is based on theories developed for rigid spherical particles with size as a separation parameter. Clearly, most bioparticles are non-spherical and deformable and therefore exhibit a much more intricate behavior in fluid flow than rigid spheres. Here, we demonstrate the use of cells’ mechanical and dynamical properties as biomarkers for separation by employing a combination of mesoscale hydrodynamic simulations and microfluidic experiments. The dynamic behavior of red blood cells (RBCs) within deterministic lateral displacement (DLD) devices is investigated for different device geometries and viscosity contrasts between the intra-cellular fluid and suspending medium. We find that the viscosity contrast and associated cell dynamics clearly determine the RBC trajectory through a DLD device. Simulation results compare well to experiments and provide new insights into the physical mechanisms which govern the sorting of non-spherical and deformable cells in DLD devices. Finally, we discuss the implications of cell dynamics for sorting schemes based on properties other than cell size, such as mechanics and morphology.

  13. Systematic Sorting: Teacher Characteristics and Class Assignments

    ERIC Educational Resources Information Center

    Kalogrides, Demetra; Loeb, Susanna; Beteille, Tara

    2013-01-01

    Although prior research has documented differences in the distribution of teacher characteristics across schools serving different student populations, few studies have examined the extent to which teacher sorting occurs within schools. This study uses data from one large urban school district and compares the class assignments of teachers who…

  14. Fuzzy logic-based spike sorting system.

    PubMed

    Balasubramanian, Karthikeyan; Obeid, Iyad

    2011-05-15

    We present a new method for autonomous real-time spike sorting using a fuzzy logic inference engine. The engine assigns each detected event a 'spikiness index' from zero to one that quantifies the extent to which the detected event is like an ideal spike. Spikes can then be sorted by simply clustering the spikiness indices. The sorter is defined in terms of natural language rules that, once defined, are static and thus require no user intervention or calibration. The sorter was tested using extracellular recordings from three animals: a macaque, an owl monkey and a rat. Simulation results show that the fuzzy sorter performed equal to or better than the benchmark principal component analysis (PCA) based sorter. Importantly, there was no degradation in fuzzy sorter performance when the spikes were not temporally aligned prior to sorting. In contrast, PCA sorter performance dropped by 27% when sorting unaligned spikes. Since the fuzzy sorter is computationally trivial and requires no spike alignment, it is suitable for scaling into large numbers of parallel channels where computational overhead and the need for operator intervention would preclude other spike sorters.

  15. Credit Scores, Race, and Residential Sorting

    ERIC Educational Resources Information Center

    Nelson, Ashlyn Aiko

    2010-01-01

    Credit scores have a profound impact on home purchasing power and mortgage pricing, yet little is known about how credit scores influence households' residential location decisions. This study estimates the effects of credit scores on residential sorting behavior using a novel mortgage industry data set combining household demographic, credit, and…

  16. A multispectral sorting device for wheat kernels

    USDA-ARS?s Scientific Manuscript database

    A low-cost multispectral sorting device was constructed using three visible and three near-infrared light-emitting diodes (LED) with peak emission wavelengths of 470 nm (blue), 527 nm (green), 624 nm (red), 850 nm, 940 nm, and 1070 nm. The multispectral data were collected by rapidly (~12 kHz) blin...

  17. Economics of Grading and Sorting Pallet Parts

    Treesearch

    Daniel L. Schmoldt; John A. McLeod; Philip A. Araman

    1993-01-01

    Before trying to develop an automated inspection system for pallet part grading we analyzed the economics of such a system. Our results suggest that higher quality pallets produced by grading and sorting pallet parts would be attractive to both manufacturers and their customers, who would have to pay increased prices for higher quality pallets. Reductions in cost-per-...

  18. Systematic Sorting: Teacher Characteristics and Class Assignments

    ERIC Educational Resources Information Center

    Kalogrides, Demetra; Loeb, Susanna; Beteille, Tara

    2013-01-01

    Although prior research has documented differences in the distribution of teacher characteristics across schools serving different student populations, few studies have examined the extent to which teacher sorting occurs within schools. This study uses data from one large urban school district and compares the class assignments of teachers who…

  19. Sorting of fungal-damaged white sorghum

    USDA-ARS?s Scientific Manuscript database

    A high-speed, color image-based sorting machine was modified to separate white sorghum with symptoms of fungal damage. Most of the sorghum tested was typically white, but over 27% of the bulk contained grains with fungal damage of various degrees, from severe to very slight. Grains with slight fun...

  20. Integration through a Card-Sort Activity

    ERIC Educational Resources Information Center

    Green, Kris; Ricca, Bernard P.

    2015-01-01

    Learning to compute integrals via the various techniques of integration (e.g., integration by parts, partial fractions, etc.) is difficult for many students. Here, we look at how students in a college level Calculus II course develop the ability to categorize integrals and the difficulties they encounter using a card sort-resort activity. Analysis…

  1. Credit Scores, Race, and Residential Sorting

    ERIC Educational Resources Information Center

    Nelson, Ashlyn Aiko

    2010-01-01

    Credit scores have a profound impact on home purchasing power and mortgage pricing, yet little is known about how credit scores influence households' residential location decisions. This study estimates the effects of credit scores on residential sorting behavior using a novel mortgage industry data set combining household demographic, credit, and…

  2. Integration through a Card-Sort Activity

    ERIC Educational Resources Information Center

    Green, Kris; Ricca, Bernard P.

    2015-01-01

    Learning to compute integrals via the various techniques of integration (e.g., integration by parts, partial fractions, etc.) is difficult for many students. Here, we look at how students in a college level Calculus II course develop the ability to categorize integrals and the difficulties they encounter using a card sort-resort activity. Analysis…

  3. Web page sorting algorithm based on query keyword distance relation

    NASA Astrophysics Data System (ADS)

    Yang, Han; Cui, Hong Gang; Tang, Hao

    2017-08-01

    In order to optimize the problem of page sorting, according to the search keywords in the web page in the relationship between the characteristics of the proposed query keywords clustering ideas. And it is converted into the degree of aggregation of the search keywords in the web page. Based on the PageRank algorithm, the clustering degree factor of the query keyword is added to make it possible to participate in the quantitative calculation. This paper proposes an improved algorithm for PageRank based on the distance relation between search keywords. The experimental results show the feasibility and effectiveness of the method.

  4. Physiology and pathology of endosome-to-Golgi retrograde sorting.

    PubMed

    Burd, Christopher G

    2011-08-01

    Bidirectional traffic between the Golgi apparatus and the endosomal system sustains the functions of the trans-Golgi network (TGN) in secretion and organelle biogenesis. Export of cargo from the TGN via anterograde trafficking pathways depletes the organelle of sorting receptors, processing proteases, SNARE molecules, and other factors, and these are subsequently retrieved from endosomes via the retrograde pathway. Recent studies indicate that retrograde trafficking is vital to early metazoan development, nutrient homeostasis, and for processes that protect against Alzheimer's and other neurological diseases.

  5. A Study of NSF Teacher Enhancement Program (TEP) Participants and Principal Investigators: 1984-1989. Volume II: Technical Report.

    ERIC Educational Resources Information Center

    Abt Associates, Inc., Cambridge, MA.

    This study documents the effects of participation in the Teacher Enhancement Program (TEP) of the National Science Foundation (NSF). The NSF awarded more than 600 grants to scientists, mathematicians, and educators to develop and operate inservice teacher training programs between 1984 and 1989. The present study focuses specifically upon the…

  6. PhySortR: a fast, flexible tool for sorting phylogenetic trees in R

    PubMed Central

    Stephens, Timothy G.; Bhattacharya, Debashish; Ragan, Mark A.

    2016-01-01

    A frequent bottleneck in interpreting phylogenomic output is the need to screen often thousands of trees for features of interest, particularly robust clades of specific taxa, as evidence of monophyletic relationship and/or reticulated evolution. Here we present PhySortR, a fast, flexible R package for classifying phylogenetic trees. Unlike existing utilities, PhySortR allows for identification of both exclusive and non-exclusive clades uniting the target taxa based on tip labels (i.e., leaves) on a tree, with customisable options to assess clades within the context of the whole tree. Using simulated and empirical datasets, we demonstrate the potential and scalability of PhySortR in analysis of thousands of phylogenetic trees without a priori assumption of tree-rooting, and in yielding readily interpretable trees that unambiguously satisfy the query. PhySortR is a command-line tool that is freely available and easily automatable. PMID:27190724

  7. PhySortR: a fast, flexible tool for sorting phylogenetic trees in R.

    PubMed

    Stephens, Timothy G; Bhattacharya, Debashish; Ragan, Mark A; Chan, Cheong Xin

    2016-01-01

    A frequent bottleneck in interpreting phylogenomic output is the need to screen often thousands of trees for features of interest, particularly robust clades of specific taxa, as evidence of monophyletic relationship and/or reticulated evolution. Here we present PhySortR, a fast, flexible R package for classifying phylogenetic trees. Unlike existing utilities, PhySortR allows for identification of both exclusive and non-exclusive clades uniting the target taxa based on tip labels (i.e., leaves) on a tree, with customisable options to assess clades within the context of the whole tree. Using simulated and empirical datasets, we demonstrate the potential and scalability of PhySortR in analysis of thousands of phylogenetic trees without a priori assumption of tree-rooting, and in yielding readily interpretable trees that unambiguously satisfy the query. PhySortR is a command-line tool that is freely available and easily automatable.

  8. The sorting of proglucagon to secretory granules is mediated by carboxypeptidase E and intrinsic sorting signals.

    PubMed

    McGirr, Rebecca; Guizzetti, Leonardo; Dhanvantari, Savita

    2013-05-01

    Proglucagon is expressed in pancreatic alpha cells, intestinal L cells and brainstem neurons. Tissue-specific processing of proglucagon yields the peptide hormones glucagon in the alpha cell and glucagon-like peptide (GLP)-1 and GLP-2 in L cells. Both glucagon and GLP-1 are secreted in response to nutritional status and are critical for regulating glycaemia. The sorting of proglucagon to the dense-core secretory granules of the regulated secretory pathway is essential for the appropriate secretion of glucagon and GLP-1. We examined the roles of carboxypeptidase E (CPE), a prohormone sorting receptor, the processing enzymes PC1/3 and PC2 and putative intrinsic sorting signals in proglucagon sorting. In Neuro 2a cells that lacked CPE, PC1/3 and PC2, proglucagon co-localised with the Golgi marker p115 as determined by quantitative immunofluorescence microscopy. Expression of CPE, but not of PC1/3 or PC2, enhanced proglucagon sorting to granules. siRNA-mediated knockdown of CPE disrupted regulated secretion of glucagon from pancreatic-derived alphaTC1-6 cells, but not of GLP-1 from intestinal cell-derived GLUTag cells. Mutation of the PC cleavage site K70R71, the dibasic R17R18 site within glucagon or the alpha-helix of glucagon, all significantly affected the sub-cellular localisation of proglucagon. Protein modelling revealed that alpha helices corresponding to glucagon, GLP-1 and GLP-2, are arranged within a disordered structure, suggesting some flexibility in the sorting mechanism. We conclude that there are multiple mechanisms for sorting proglucagon to the regulated secretory pathway, including a role for CPE in pancreatic alpha cells, initial cleavage at K70R71 and multiple sorting signals.

  9. Differential expression of axon-sorting molecules in mouse olfactory sensory neurons.

    PubMed

    Ihara, Naoki; Nakashima, Ai; Hoshina, Naosuke; Ikegaya, Yuji; Takeuchi, Haruki

    2016-08-01

    In the mouse olfactory system, the axons of olfactory sensory neurons that express the same type of odorant receptor (OR) converge to a specific set of glomeruli in the olfactory bulb (OB). It is widely accepted that expressed OR molecules instruct glomerular segregation by regulating the expression of axon-sorting molecules. Although the relationship between the expression of axon-sorting molecules and OR types has been analyzed in detail, those between the expressions of axon-sorting molecules remain to be elucidated. Here we collected the expression profiles of four axon-sorting molecules from a large number of glomeruli in the OB. These molecules demonstrated position-independent mosaic expressions, but their patterns were not identical in the OB. Comparing their expressions identified positive and negative correlations between several pairs of genes even though they showed various expressions. Furthermore, the principal component analysis revealed that the factor loadings in the principal component 1, which explain the largest amount of variation, were most likely to reflect the degree of the cyclic nucleotide-gated (CNG) channel dependence on the expression of axon-sorting molecules. Thus, neural activity generated through the CNG channel is a major component in the generation of a wide variety of expressions of axon-sorting molecules in glomerular segregation. © 2016 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  10. Endosomal type Iγ PIP 5-kinase controls EGF receptor lysosomal sorting.

    PubMed

    Sun, Yue; Hedman, Andrew C; Tan, Xiaojun; Schill, Nicholas J; Anderson, Richard A

    2013-04-29

    Endosomal trafficking and degradation of epidermal growth factor receptor (EGFR) play an essential role in the control of its signaling. Phosphatidylinositol-4,5-bisphosphate (PtdIns4,5P(2)) is an established regulator of endocytosis, whereas PtdIns3P modulates endosomal trafficking. However, we demonstrate here that type I gamma phosphatidylinositol phosphate 5-kinase i5 (PIPKIγi5), an enzyme that synthesizes PtdIns4,5P(2), controls endosome-to-lysosome sorting of EGFR. In this pathway, PIPKIγi5 interacts with sorting nexin 5 (SNX5), a protein that binds PtdIns4,5P(2) and other phosphoinositides. PIPKIγi5 and SNX5 localize to endosomes, and loss of either protein blocks EGFR sorting into intraluminal vesicles (ILVs) of the multivesicular body. Loss of ILV sorting greatly enhances and prolongs EGFR signaling. PIPKIγi5 and SNX5 prevent Hrs ubiquitination, and this facilitates the Hrs association with EGFR that is required for ILV sorting. These findings reveal that PIPKIγi5 and SNX5 form a signaling nexus that controls EGFR endosomal sorting, degradation, and signaling.

  11. Optical design of the NASA-NSF extreme precision Doppler spectrograph concept "WISDOM"

    NASA Astrophysics Data System (ADS)

    Barnes, Stuart I.; Fżrész, Gábor; Simcoe, Robert A.; Shectman, Stephen A.; Woods, Deborah F.

    2016-08-01

    The WISDOM instrument concept was developed at MIT as part of a NASA-NSF funded study to equip the 3.5m WIYN telescope with an extremely precise radial velocity spectrometer. The spectrograph employs an asymmetric white pupil optical design, where the instrument is split into two nearly identical "Short" (380 to 750 nm) and "Long"" (750 to 1300 nm) wavelength channels. The echelle grating and beam sizes are R3.75/125mm and R6/80mm in the short and long channels respectively. Together with the pupil slicer, and octagonal to rectangular fibre coupling, this permits resolving powers over R = 120k with a 1.2" diameter fibre on the sky. A factor of two reduction in the focal length between the main collimator OAP and the transfer collimator ensures a very compact instrument, with a small white pupil footprint, thereby enabling small cross-dispersing and camera elements. A dichroic is used near the white pupil to split each of the long and short channels into two, so that the final spectrograph has 4 channels; namely "Blue," "Green," "Red" and "NIR." Each of these channels has an anamorphic VPH grism for cross-dispersion, and a fully dioptric all-spherical camera objective. The spectral footprints cover 4k×4k and 6k×6k CCDs with 15 µm pixels in the short "Blue" and "Green" wavelength channels, respectively. A 4k×4k CCD with 15 μm pixels is used in the long "Red" channel, with a HgCdTe 1.7 μm cutoff 4k×4k detector with 10um pixels is to be used in the long "NIR" channel. The white pupil relay includes a Mangin mirror very close to the intermediate focus to correct the white pupil relay Petzval curvature before it is swept into a cylinder by the cross-dispersers. This design decision allows each of the dioptric cameras to be fully optimised and tested independently of the rest of the spectrograph. The baseline design for the cameras also ensures that the highest possible (diffraction limited) image quality is achieved across all wavelengths, while also ensuring

  12. Molecular requirements for sorting of the chemokine interleukin-8/CXCL8 to endothelial Weibel-Palade bodies.

    PubMed

    Hol, Johanna; Küchler, Axel M; Johansen, Finn-Eirik; Dalhus, Bjørn; Haraldsen, Guttorm; Oynebråten, Inger

    2009-08-28

    Sorting of proteins to Weibel-Palade bodies (WPB) of endothelial cells allows rapid regulated secretion of leukocyte-recruiting P-selectin and chemokines as well as procoagulant von Willebrand factor (VWF). Here we show by domain swap studies that the exposed aspartic acid in loop 2 (Ser(44)-Asp(45)-Gly(46)) of the CXC chemokine interleukin (IL)-8 is crucial for targeting to WPB. Loop 2 also governs sorting of chemokines to alpha-granules of platelets, but the fingerprint of the loop 2 of these chemokines differs from that of IL-8. On the other hand, loop 2 of IL-8 closely resembles a surface-exposed sequence of the VWF propeptide, the region of VWF that directs sorting of the protein to WPB. We conclude that loop 2 of IL-8 constitutes a critical signal for sorting to WPB and propose a general role for this loop in the sorting of chemokines to compartments of regulated secretion.

  13. Advancing Capabilities for Understanding the Earth System Through Intelligent Systems, the NSF Perspective

    NASA Astrophysics Data System (ADS)

    Gil, Y.; Zanzerkia, E. E.; Munoz-Avila, H.

    2015-12-01

    The National Science Foundation (NSF) Directorate for Geosciences (GEO) and Directorate for Computer and Information Science (CISE) acknowledge the significant scientific challenges required to understand the fundamental processes of the Earth system, within the atmospheric and geospace, Earth, ocean and polar sciences, and across those boundaries. A broad view of the opportunities and directions for GEO are described in the report "Dynamic Earth: GEO imperative and Frontiers 2015-2020." Many of the aspects of geosciences research, highlighted both in this document and other community grand challenges, pose novel problems for researchers in intelligent systems. Geosciences research will require solutions for data-intensive science, advanced computational capabilities, and transformative concepts for visualizing, using, analyzing and understanding geo phenomena and data. Opportunities for the scientific community to engage in addressing these challenges are available and being developed through NSF's portfolio of investments and activities. The NSF-wide initiative, Cyberinfrastructure Framework for 21st Century Science and Engineering (CIF21), looks to accelerate research and education through new capabilities in data, computation, software and other aspects of cyberinfrastructure. EarthCube, a joint program between GEO and the Advanced Cyberinfrastructure Division, aims to create a well-connected and facile environment to share data and knowledge in an open, transparent, and inclusive manner, thus accelerating our ability to understand and predict the Earth system. EarthCube's mission opens an opportunity for collaborative research on novel information systems enhancing and supporting geosciences research efforts. NSF encourages true, collaborative partnerships between scientists in computer sciences and the geosciences to meet these challenges.

  14. Better Accountability Procedures Needed in NSF and NIH Research Grant Systems.

    DTIC Science & Technology

    1981-09-30

    research at colleges and universities. Peer review (expert advice of selected researchers) is the primary component of the research grant scientific...and found that the peer review and internal review systems are working reasonably well. Although the systems are basically the same at the two...agencies, the procedures differ. GAO found that some of the NIH peer review procedures have advantages over those at NSF, but believes that changes are

  15. US Global Change Research Program Distributed Cost Budget Interagency Funds Transfer from DOE to NSF

    SciTech Connect

    Uhle, Maria

    2016-09-22

    These funds were transferred from DOE to NSF as DOE's contribution to the U.S. Global Change Research Program in support of 4 internationalnactivities/programs as approved by the U.S. Global Change Research Program on 14 March 2014. The programs are the International Geosphere-Biosphere Programme, the DIVERSITAS programme, and the World Climate Research Program. All program awards ended as of 09-23-2015.

  16. Current trends on 2D materials for photonics devices: an NSF perspective (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Fallahi, Mahmoud

    2017-05-01

    Recent advancements in two-dimensional (2D) materials have opened significant research opportunities in optics and photonics. While the initial focus on 2D materials was on Graphene, new generation of 2D materials such as hexagonal boron nitride (h-BN), transition metal dichalcogenides (TMDCs), monolayer black phosphorous (BP) and other monolayer structures have shown unique electrical and optical properties. For example, h-BN is an insulator, while monolayers of some TMDCs such as MoS2 and WSe2 are direct band-gap semiconductors. Depending on the choice of material compositional and layer variations their optical properties can be engineered, making them particularly attractive as novel light sources, photodetectors, modulators and photovoltaic components, in particular for few photon applications. Plasmonic properties of 2D materials make them suitable for nanophotonics and monolithic integration with other conventional materials. The National Science Foundation (NSF) is a US federal agency dedicated to promote progress of science and engineering. NSF is the funding source for approximately 24 percent of all federally supported basic research conducted by America's colleges and universities. NSF has recently supported several initiatives related to novel 2D material and device research. In this talk, I will first give an overview of the NSF programs and funding opportunities. The second part of the talk will be focused on the programs related to 2D materials for photonic devices and program specific initiatives. Several highlights of the recent achievements and awards in the field of 2D materials for photonic devices will be presented.

  17. Córdova to Be Nominated as New Head of NSF

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2013-08-01

    President Barack Obama announced on 31 July that he intends to nominate France Anne Córdova to become the next director of the National Science Foundation (NSF). Córdova was president of Purdue University from 2007 to 2012 and has been a professor of physics and astronomy there. Previously, Córdova was chancellor of the University of California, Riverside from 1996 to 2002.

  18. Parallel integer sorting with medium and fine-scale parallelism

    NASA Technical Reports Server (NTRS)

    Dagum, Leonardo

    1993-01-01

    Two new parallel integer sorting algorithms, queue-sort and barrel-sort, are presented and analyzed in detail. These algorithms do not have optimal parallel complexity, yet they show very good performance in practice. Queue-sort designed for fine-scale parallel architectures which allow the queueing of multiple messages to the same destination. Barrel-sort is designed for medium-scale parallel architectures with a high message passing overhead. The performance results from the implementation of queue-sort on a Connection Machine CM-2 and barrel-sort on a 128 processor iPSC/860 are given. The two implementations are found to be comparable in performance but not as good as a fully vectorized bucket sort on the Cray YMP.

  19. HydroShare: Applying professional software engineering to a new NSF-funded large software project

    NASA Astrophysics Data System (ADS)

    Idaszak, R.; Tarboton, D. G.; Ames, D.; Saleem Arrigo, J. A.; Band, L. E.; Bedig, A.; Castronova, A. M.; Christopherson, L.; Coposky, J.; Couch, A.; Dash, P.; Gan, T.; Goodall, J.; Gustafson, K.; Heard, J.; Hooper, R. P.; Horsburgh, J. S.; Jackson, S.; Johnson, H.; Maidment, D. R.; Mbewe, P.; Merwade, V.; Miles, B.; Reeder, S.; Russell, T.; Song, C.; Taylor, A.; Thakur, S.; Valentine, D. W.; Whiteaker, T. L.

    2013-12-01

    HydroShare is an online, collaborative system being developed for sharing hydrologic data and models as part of the NSF's Software Infrastructure for Sustained Innovation (SI2) program (NSF collaborative award numbers 1148453 and 1148090). HydroShare involves a large software development effort requiring cooperative research and distributed software development between domain scientists, professional software engineers (here 'professional' denotes previous commercial experience in the application of modern software engineering), and university software developers. HydroShare expands upon the data sharing capabilities of the Hydrologic Information System of the Consortium of Universities for the Advancement of Hydrologic Sciences, Inc. (CUAHSI) by broadening the classes of data accommodated, expanding capability to include the sharing of models and model components, and taking advantage of emerging social media functionality to enhance information about and collaboration around hydrologic data and models. With a goal of enabling better science concomitant with improved sustainable software practices, we will describe our approach, experiences, and lessons learned thus-far in applying professional software engineering to a large NSF-funded software project from the project's onset.

  20. The Role of EPO Professionals in Communicating and Teaching the Science of NASA and NSF

    NASA Astrophysics Data System (ADS)

    Steinberg, D.; Swilley, S.; Andrews, J.

    2008-06-01

    NSF and NASA have similar Education and Public Outreach (EPO) requirements and each endorses an important community of outreach professionals to facilitate broader impact goals. EPO professionals hold a critical role in the national quest for a scientifically and technologically literate population, and are often key connectors between investigators conducting cutting-edge research at NASA and NSF centers, pre-college educators and the public. Each owns unique perspectives on how to translate science and engineering research into effective research-based programs. NASA and NSF center EPO professionals could share lessons learned and best practices to promote efficient and effective education program development and implementation that includes leading scientists and engineers. Both groups could explore collaboration opportunities between the Astronomical Society of the Pacific and the National Science Foundation Research Center Educators Network to build on specific strengths and similarities. Through collaboration, each group can better promote recognition of this emerging field and profession. Working together, collaborators will enhance existing expertise, improve job performance, promote standards for this emerging profession, and achieve well-deserved recognition. Collaboration will improve individual ability to meet the higher standards of accountability to which each group is held and improve efforts in this new, flat world.

  1. A Neuroprotective Function of NSF1 Sustains Autophagy and Lysosomal Trafficking in Drosophila

    PubMed Central

    Babcock, Daniel T.; Shen, Wei; Ganetzky, Barry

    2015-01-01

    A common feature of many neurodegenerative diseases is the accumulation of toxic proteins that disrupt vital cellular functions. Degradative pathways such as autophagy play an important protective role in breaking down misfolded and long-lived proteins. Neurons are particularly vulnerable to defects in these pathways, but many of the details regarding the link between autophagy and neurodegeneration remain unclear. We previously found that temperature-sensitive paralytic mutants in Drosophila are enriched for those exhibiting age-dependent neurodegeneration. Here we show that one of these mutants, comatose (comt), in addition to locomotor defects, displays shortened lifespan and progressive neurodegeneration, including loss of dopaminerigic (DA) neurons. comt encodes N-ethyl-maleimide sensitive fusion protein (NSF1), which has a well-documented role in synaptic transmission. However, the neurodegenerative phenotypes we observe in comt mutants do not appear to depend on defects in synaptic transmission, but rather from their inability to sustain autophagy under stress, due at least in part to a defect in trafficking of lysosomal proteases such as cathepsin-L. Conversely, overexpression of NSF1 rescues α-synuclein-induced toxicity of DA neurons in a model of Parkinson’s disease. Our results demonstrate a neuroprotective role for NSF1 that involves mediation of fusion events crucial for degradative pathways such as autophagy, providing greater understanding of cellular dysfunctions common to several neurodegenerative diseases. PMID:25519897

  2. An Analysis of NSF Research Experience for Undergraduate Site Programs from 2009 through 2014

    NASA Astrophysics Data System (ADS)

    Vargas, R.; Patino, L. C.; Rom, E. L.; Adams, A. S.

    2015-12-01

    The Research Experience for Undergraduate (REU) Program at the U.S. National Science Foundation (NSF) supports U.S. institutions so that they can provide undergraduate students from any college or university the opportunity to conduct research at many different institutions. Participants also gain a better understanding of pathways for research careers. In 2013 a new system for annual report data collection was implemented by the National Science Foundation for all awards, including REU Sites. As a result, REU Site Directors must ask students to self-report data using the NSF Fastlane system. NSF has been collecting this data for several years and information is now available about the effectiveness of this new data collection system. Information on the GEO REU Site student demographics from 2014 will be presented and compared to data from previous years. Results show low participation rates by REU students in the data submission process. Many students who do participate skip questions or chose not to provide answers to the questions. Methods for increasing student participation in the data collection process will be discussed and suggestions for other ways to improve data collection as a community will be presented. Accurate information on student demographics for GEO REU Site programs are important because these students often go on to graduate programs and are the future role models for a diverse workforce.

  3. NSF's solar-terrestrial research program and RISE. [RISE (Radiative Inputs of the Sun to Earth)

    SciTech Connect

    Schatten, K.H.

    1992-01-01

    SunRISE has become a top priority proposed initiative for solar terrestrial science at NSF. NSF's priorities include People, Education, Infrastructure, and Competitiveness in Science. Within NSF's Atmospheric Division, the Solar Terrestrial (ST) Program considers the Sun as the principle driver of dynamic phenomena in the atmospheric and geospace environments. The ST [open quotes]Core[close quotes] program will place increased emphasis on the nature of solar variability and the resultant terrestrial responses. Solar variability, emphasized dramatically by flares is not well understood, particularly below the atmosphere. Yet in all its forms, outstanding problems exist from the base of the convection zone, through the photosphere, chromosphere, and corona, and into the solar wind, where interactions with the Earth system occur. Areas of increased emphasis will be to answer the following questions. How does solar variability manifest itself in terrestrial atmospheric effects What is the nature of solar activity and how does it change in its transit from deep within the Sun to the Earth How does the Sun's variable radiative emission, flares, and corpuscular radiation affect the Earth's atmosphere The impact the Sun has upon the Earth's climate through its radiative drivers is the focus for the new initiative [open quotes]SunRISE[close quotes] (Radiative Inputs of the Sun to Earth). At present, there are large uncertainties in the contribution of solar irradiance variations to global change. Properly subtracting out, the contribution of solar variability from the climate record is critical for determining human-induced changes during the present epoch.

  4. Building Bridges Between EPO Professionals Across Scientific Disciplines: Partnerships with NSF Centers (First Steps)

    NASA Astrophysics Data System (ADS)

    Steinberg, D.; Black, K.; Schultz, S.

    2010-08-01

    NASA, NSF and other funding organizations support science education and outreach to achieve their broader impact goals. Organizations like ASP and the NSF Research Centers Educators Network (NRCEN) are building networks of education and public outreach (EPO) professionals to enhance programmatic success in reaching these goals. As the professionals who provide these programs to the various scientific communities, we are often the key connectors between investigators at cutting-edge research centers, the education world and the public. However, our profession does not have strong ties for sharing best practices across the different scientific disciplines. To develop those ties, we need to identify our common interests and build on them by sharing lessons learned and best practices. We will use the technique of concept mapping to develop a schematic of how each of us addresses our broader impact goals and discuss the common and divergent features. We will also present the education and outreach logic model that was recently developed by the 27 Education Directors of NSF-funded Materials Research Science and Engineering Centers (MRSEC). Building on this information, we will collaboratively develop a list of key areas of similar interest between ASP and NRCEN EPO professionals.

  5. Information sharing and sorting in a community

    NASA Astrophysics Data System (ADS)

    Bhattacherjee, Biplab; Manna, S. S.; Mukherjee, Animesh

    2013-06-01

    We present the results of a detailed numerical study of a model for the sharing and sorting of information in a community consisting of a large number of agents. The information gathering takes place in a sequence of mutual bipartite interactions where randomly selected pairs of agents communicate with each other to enhance their knowledge and sort out the common information. Although our model is less restricted compared to the well-established naming game, the numerical results strongly indicate that the whole set of exponents characterizing this model are different from those of the naming game and they assume nontrivial values. Finally, it appears that in analogy to the emergence of clusters in the phenomenon of percolation, one can define clusters of agents here having the same information. We have studied in detail the growth of the largest cluster in this article and performed its finite-size scaling analysis.

  6. Photo sorting and compression in frequency domain

    NASA Astrophysics Data System (ADS)

    Lu, Yang; Wong, Tien-Tsin; Heng, Pheng-Ann

    2004-10-01

    With the increasing popularity of digital camera, organizing and managing the large collection of digital photos effectively are therefore required. In this paper, we study the photo album sorting, clustering and compression techniques in DCT frequency domain without having to decompress JPEG photos into spatial domain firstly. We utilize the first several non-zero DCT coefficients to build our feature set and calculate the energy histograms in frequency domain directly. We then calculate the similarity distance of every two photos, and perform photo album sorting and adaptive clustering algorithms to group the most similar photos together. We further compress those clustered photos by a MPEG-like algorithm with variable IBP frames and adaptive search windows. Our methods provide a compact and reasonable format for people to store and transmit their large number of digital photos. Experiments prove that our algorithm is efficient and effective for digital photo processing.

  7. A mower detector to judge soil sorting

    SciTech Connect

    Bramlitt, E.T.; Johnson, N.R.

    1995-12-31

    Thermo Nuclear Services (TNS) has developed a mower detector as an inexpensive and fast means for deciding potential value of soil sorting for cleanup. It is a shielded detector box on wheels pushed over the ground (as a person mows grass) at 30 ft/min with gamma-ray counts recorded every 0.25 sec. It mirror images detection by the TNS transportable sorter system which conveys soil at 30 ft/min and toggles a gate to send soil on separate paths based on counts. The mower detector shows if contamination is variable and suitable for sorting, and by unique calibration sources, it indicates detection sensitivity. The mower detector has been used to characterize some soil at Department of Energy sites in New Jersey and South Carolina.

  8. Population Enrichment and Isolation with Magnetic Sorting

    DTIC Science & Technology

    2011-09-01

    diposable, microfluidic cartridges. Along with magnetic sorting methods, we detail flow cytometry analysis techniques to quantify cell population...panel. The red signal in each plot is the background cell fluorescence measured in the PE emission channel . Either a histogram of PE-H vs. count or...Recently, the U.S. Army Research Laboratory (ARL) transitioned a microfluidic magnetic sorter (MMS) from Cynvenio Biosystems during an ICB 6.2

  9. The Area-Time Complexity of Sorting.

    DTIC Science & Technology

    1984-12-01

    computation. In the context of VLSI computa- tion, this phenomenon takes the form of area-time trade-off, and plays a central role in the theory. The rigorous...electrical connections responsible for information transfer as well as for power supply and distribution of timing waveforms. A given computation graph...logn + O(logn). After explaining why this particular U value of keylength plays a central role in the construction of sorting circuits, we turn our

  10. Exploiting osmosis for blood cell sorting.

    PubMed

    Parichehreh, Vahidreza; Estrada, Rosendo; Kumar, Srikanth Suresh; Bhavanam, Kranthi Kumar; Raj, Vinay; Raj, Ashok; Sethu, Palaniappan

    2011-06-01

    Blood is a valuable tissue containing cellular populations rich in information regarding the immediate immune and inflammatory status of the body. Blood leukocytes or white blood cells (WBCs) provide an ideal sample to monitor systemic changes and understand molecular signaling mechanisms in disease processes. Blood samples need to be processed to deplete contaminating erythrocytes or red blood cells (RBCs) and sorted into different WBC sub-populations prior to analysis. This is typically accomplished using immuno-affinity protocols which result in undesirable activation. An alternative is size based sorting which by itself is unsuitable for WBCs sorting due to size overlap between different sub-populations. To overcome this limitation, we investigated the possibility of using controlled osmotic exposure to deplete and/or create a differential size increase between WBC populations. Using a new microfluidic cell docking platform, the response of RBCs and WBCs to deionized (DI) water was evaluated. Time lapse microscopy confirms depletion of RBCs within 15 s and creation of > 3 μm size difference between lymphocytes, monocytes and granulocytes. A flow through microfluidic device was also used to expose different WBCs to DI water for 30, 60 and 90 s to quantify cell loss and activation. Results confirm preservation of ~100% of monocytes, granulocytes and loss of ~30% of lymphocytes (mostly CD3+/CD4+) with minimal activation. These results indicate feasibility of this approach for monocyte, granulocyte and lymphocyte (sub-populations) isolation based on size.

  11. How Schwann Cells Sort Axons: New Concepts.

    PubMed

    Feltri, M Laura; Poitelon, Yannick; Previtali, Stefano Carlo

    2016-06-01

    Peripheral nerves contain large myelinated and small unmyelinated (Remak) fibers that perform different functions. The choice to myelinate or not is dictated to Schwann cells by the axon itself, based on the amount of neuregulin I-type III exposed on its membrane. Peripheral axons are more important in determining the final myelination fate than central axons, and the implications for this difference in Schwann cells and oligodendrocytes are discussed. Interestingly, this choice is reversible during pathology, accounting for the remarkable plasticity of Schwann cells, and contributing to the regenerative potential of the peripheral nervous system. Radial sorting is the process by which Schwann cells choose larger axons to myelinate during development. This crucial morphogenetic step is a prerequisite for myelination and for differentiation of Remak fibers, and is arrested in human diseases due to mutations in genes coding for extracellular matrix and linkage molecules. In this review we will summarize progresses made in the last years by a flurry of reverse genetic experiments in mice and fish. This work revealed novel molecules that control radial sorting, and contributed unexpected ideas to our understanding of the cellular and molecular mechanisms that control radial sorting of axons.

  12. Generalized sorting profile of alluvial fans

    NASA Astrophysics Data System (ADS)

    Miller, Kimberly Litwin; Reitz, Meredith D.; Jerolmack, Douglas J.

    2014-10-01

    Alluvial rivers often exhibit self-similar gravel size distributions and abrupt gravel-sand transitions. Experiments suggest that these sorting patterns are established rapidly, but how—and how fast—this convergence occurs in the field is unknown. We examine the establishment of downstream sorting patterns in a kilometer-scale alluvial fan. The sharp transition from canyon to unconfined, channelized fan provides a well-defined boundary condition. The channel changes from deep and entrenched at the fan apex to shallow and depositional over a short distance, exhibiting nonequilibrium behavior. The resulting gravel-fining profile is not self-similar; the particle size distribution narrows until approximate equal mobility is achieved. Downfan, the gravel-sand transition appears to exhibit a self-similar form; field and laboratory data collapse when downstream distance is normalized by the location of the transition. Results suggest a generalized sorting profile for alluvial fans as a consequence of the threshold of motion and nonequilibrium channels.

  13. My eSorts and Digital Extensions of Word Study

    ERIC Educational Resources Information Center

    Zucker, Tricia A.; Invernizzi, Marcia

    2008-01-01

    "My eSorts" is a strategy for helping children learn to read and spell in a socially motivated context. It is based on developmental spelling research and the word study approach to teaching phonics and spelling. "eSorting" employs digital desktop publishing tools that allow children to author their own electronic word sorts and then share these…

  14. Automatic Color Sorting of Hardwood Edge-Glued Panel Parts

    Treesearch

    D. Earl Kline; Richard Conners; Qiang Lu; Philip A. Araman

    1997-01-01

    This paper describes an automatic color sorting system for red oak edge-glued panel parts. The color sorting system simultaneously examines both faces of a panel part and then determines which face has the "best" color, and sorts the part into one of a number of color classes at plant production speeds. Initial test results show that the system generated over...

  15. Categorizing Variations of Student-Implemented Sorting Algorithms

    ERIC Educational Resources Information Center

    Taherkhani, Ahmad; Korhonen, Ari; Malmi, Lauri

    2012-01-01

    In this study, we examined freshmen students' sorting algorithm implementations in data structures and algorithms' course in two phases: at the beginning of the course before the students received any instruction on sorting algorithms, and after taking a lecture on sorting algorithms. The analysis revealed that many students have insufficient…

  16. Gender Sorting across K-12 Schools in the United States

    ERIC Educational Resources Information Center

    Long, Mark C.; Conger, Dylan

    2013-01-01

    This article documents evidence of nonrandom gender sorting across K-12 schools in the United States. The sorting exists among coed schools and at all grade levels, and it is highest in the secondary school grades. We observe some gender sorting across school sectors and types: for instance, males are slightly underrepresented in private schools…

  17. Is it time to revisit the log-sort yard?

    Treesearch

    John Dramm; Gerry Jackson

    2000-01-01

    Log-sort yards provide better utilization and marketing with improved value recovery of currently available timber resources in North America. Log-sort yards provide many services in marketing wood and fiber by concentrating, merchandising, manufacturing, sorting, and adding value to logs. Such operations supply forest products firms with desired raw materials, which...

  18. Categorizing Variations of Student-Implemented Sorting Algorithms

    ERIC Educational Resources Information Center

    Taherkhani, Ahmad; Korhonen, Ari; Malmi, Lauri

    2012-01-01

    In this study, we examined freshmen students' sorting algorithm implementations in data structures and algorithms' course in two phases: at the beginning of the course before the students received any instruction on sorting algorithms, and after taking a lecture on sorting algorithms. The analysis revealed that many students have insufficient…

  19. Study of Sort Stories: Leveled Reading Supplement to Words Their Way: Word Sorts for Letter Name-Alphabet Spellers

    ERIC Educational Resources Information Center

    Zugel, Kevin

    2005-01-01

    "Sort Stories: Leveled Reading Supplement to Words Their Way: Word Sorts for Letter Name-Alphabet Spellers" effectiveness was tested using five English language learner (ELL) students in the fifth and sixth grade. "Sort Stories" uses the word lists and accompanying clip-art from "Words Their Way" in developmental, grade-level specific, short read…

  20. Airborne microorganisms associated with packaging glass sorting facilities.

    PubMed

    Pinto, Marta Jorge de Vasconcelos; Veiga, José Miguel; Fernandes, Paulo; Ramos, Carla; Gonçalves, Sérgio; Velho, Maria Manuela Lemos Vaz; Guerreiro, Joana Santos

    2015-01-01

    In recent years, efforts have been undertaken to reduce the volume of residual waste through sorting and recycling. The waste management and recycling sector is thriving and the number of workers there is increasing. In this context, prior knowledge of the risks to which workers may be exposed is of crucial importance, and preventive measures need to be put in place to accurately identify and quantify those risks. This study aimed to assess occupational risk of exposure to biological agents (viable bacteria and fungi) in a Portuguese waste packaging glass sorting plant. Air samples were collected from selected locations in waste sorting cabins (critical area, CA), administrative services (noncritical area, NCA) and outdoors (control point, CP). Duplicate air samples were collected through an impaction method. The investigation was carried out over an 8-mo period with two collection periods, autumn/winter (AW) and spring/summer (SS), in order to access the influence of any seasonal variation. In the 36 air samples collected, 319 bacterial and 196 mold identifications were performed. Air samples revealed existence of high environmental contamination by bacteria (1.6 × 10(4) colony forming units [cfu]/m(3)) and fungi (1.5 × 10(4) cfu/m(3)). The predominant bacterial genus was Staphylococcus (coagulase negative) with values ranging from 29.6 to 60% of the total count of bacteria. Genera Bacillus, Micrococcus, and Staphylococcus (coagulase negative) were also present at all sampling sites, regardless of the season. However, the counts of these genera, in the CA, were higher in warmer seasons. The genus Penicillium was the most frequent genus present with an approximate value of 95% of total fungal count in the CA. Seasonal variation was a significant factor for total bacteria and fungi, except for NCA versus CP. Overall, the highest levels of bacterial and fungal species (10(4) cfu/m(3)) were found in the waste sorting cabin (CA). These results highlight the

  1. Optical Science and Engineering. New Directions and Opportunities in Research and Education. NSF Workshop (Arlington, VA, May 23-24, 1994).

    ERIC Educational Resources Information Center

    National Science Foundation, Arlington, VA.

    The National Science Foundation (NSF) workshop on Optical Science and Engineering was organized to examine approaches NSF could use to identify opportunities in optical science, engineering, and education that meet both the mission of NSF and its broader national goals. The workshop participants identified opportunities where optical science and…

  2. Thermal conductivity of chirality-sorted carbon nanotube networks

    NASA Astrophysics Data System (ADS)

    Lian, Feifei; Llinas, Juan P.; Li, Zuanyi; Estrada, David; Pop, Eric

    2016-03-01

    The thermal properties of single-walled carbon nanotubes (SWNTs) are of significant interest, yet their dependence on SWNT chirality has been, until now, not explored experimentally. Here, we used electrical heating and infrared thermal imaging to simultaneously study thermal and electrical transport in chirality-sorted SWNT networks. We examined solution processed 90% semiconducting, 90% metallic, purified unsorted (66% semiconducting), and as-grown HiPco SWNT films. The thermal conductivities of these films range from 80 to 370 W m-1 K-1 but are not controlled by chirality, instead being dependent on the morphology (i.e., mass and junction density, quasi-alignment) of the networks. The upper range of the thermal conductivities measured is comparable to that of the best metals (Cu and Ag), but with over an order of magnitude lower mass density. This study reveals important factors controlling the thermal properties of light-weight chirality-sorted SWNT films, for potential thermal and thermoelectric applications.

  3. An integrated optofluidic platform for Raman-activated cell sorting.

    PubMed

    Lau, Adrian Y; Lee, Luke P; Chan, James W

    2008-07-01

    We report on integrated optofluidic Raman-activated cell sorting (RACS) platforms that combine multichannel microfluidic devices and laser tweezers Raman spectroscopy (LTRS) for delivery, identification, and simultaneous sorting of individual cells. The system allows label-free cell identification based on Raman spectroscopy and automated continuous cell sorting. Two optofluidic designs using hydrodynamic focusing and pinch-flow fractionation are evaluated based on their sorting design and flow velocity effect on the laser trapping efficiency at different laser power levels. A proof-of-principle demonstration of the integrated optofluidic LTRS system for the identification and sorting of two leukemia cell lines is presented. This functional prototype lays the foundation for the development of a label-free cell sorting platform based on intrinsic Raman markers for automated sampling and sorting of a large number of individual cells in solution.

  4. Online sorting of recovered wood waste by automated XRF-technology: part II. Sorting efficiencies.

    PubMed

    Hasan, A Rasem; Solo-Gabriele, Helena; Townsend, Timothy

    2011-04-01

    Sorting of waste wood is an important process practiced at recycling facilities in order to detect and divert contaminants from recycled wood products. Contaminants of concern include arsenic, chromium and copper found in chemically preserved wood. The objective of this research was to evaluate the sorting efficiencies of both treated and untreated parts of the wood waste stream, and metal (As, Cr and Cu) mass recoveries by the use of automated X-ray fluorescence (XRF) systems. A full-scale system was used for experimentation. This unit consisted of an XRF-detection chamber mounted on the top of a conveyor and a pneumatic slide-way diverter which sorted wood into presumed treated and presumed untreated piles. A randomized block design was used to evaluate the operational conveyance parameters of the system, including wood feed rate and conveyor belt speed. Results indicated that online sorting efficiencies of waste wood by XRF technology were high based on number and weight of pieces (70-87% and 75-92% for treated wood and 66-97% and 68-96% for untreated wood, respectively). These sorting efficiencies achieved mass recovery for metals of 81-99% for As, 75-95% for Cu and 82-99% of Cr. The incorrect sorting of wood was attributed almost equally to deficiencies in the detection and conveyance/diversion systems. Even with its deficiencies, the system was capable of producing a recyclable portion that met residential soil quality levels established for Florida, for an infeed that contained 5% of treated wood.

  5. Dental Alloy Sorting By the Thermoelectric Method

    PubMed Central

    Kikuchi, Masafumi

    2010-01-01

    Objectives: A nondestructive, rapid, and practical method of dental alloy sorting is desirable. In this study, the hypothesis to be tested is that dental alloys show significantly different and high thermoelectric power values, on the basis of which alloy sorting is possible. Methods: Six silver-colored commercial dental casting alloys are used in this study: two silver alloys, one gold-silver-palladium alloy, one cobalt-chromium alloy, one nickel-chromium alloy, and one titanium alloy. The thermoelectric power of their castings was determined against constantan using a simple apparatus developed in a previous study. Linear least square fitting was applied to the measured thermal-EMF-temperature curve to determine the thermoelectric power for the temperature ranges of 298–303 K (temperature difference Δt = 5 K), 298–308 K (Δt=10 K), 298–313 K (Δt=15 K), and 298–318 K (Δt=20 K). The results were analyzed using one-way ANOVA and by the Scheffé’s test at a significance level of α=0.01. Results: When the temperature difference was 10 K or less, the difference in the thermoelectric powers of the alloys was not always statistically significant. However, when the temperature difference was 15 K or more, the thermoelectric powers of the six alloys differed significantly. Conclusions: The results indicated the feasibility of rapid sorting of specific dental alloys by the thermoelectric method, provided a sufficiently large temperature difference is achieved. PMID:20046482

  6. Insect's intestinal organ for symbiont sorting.

    PubMed

    Ohbayashi, Tsubasa; Takeshita, Kazutaka; Kitagawa, Wataru; Nikoh, Naruo; Koga, Ryuichi; Meng, Xian-Ying; Tago, Kanako; Hori, Tomoyuki; Hayatsu, Masahito; Asano, Kozo; Kamagata, Yoichi; Lee, Bok Luel; Fukatsu, Takema; Kikuchi, Yoshitomo

    2015-09-15

    Symbiosis has significantly contributed to organismal adaptation and diversification. For establishment and maintenance of such host-symbiont associations, host organisms must have evolved mechanisms for selective incorporation, accommodation, and maintenance of their specific microbial partners. Here we report the discovery of a previously unrecognized type of animal organ for symbiont sorting. In the bean bug Riptortus pedestris, the posterior midgut is morphologically differentiated for harboring specific symbiotic bacteria of a beneficial nature. The sorting organ lies in the middle of the intestine as a constricted region, which partitions the midgut into an anterior nonsymbiotic region and a posterior symbiotic region. Oral administration of GFP-labeled Burkholderia symbionts to nymphal stinkbugs showed that the symbionts pass through the constricted region and colonize the posterior midgut. However, administration of food colorings revealed that food fluid enters neither the constricted region nor the posterior midgut, indicating selective symbiont passage at the constricted region and functional isolation of the posterior midgut for symbiosis. Coadministration of the GFP-labeled symbiont and red fluorescent protein-labeled Escherichia coli unveiled selective passage of the symbiont and blockage of E. coli at the constricted region, demonstrating the organ's ability to discriminate the specific bacterial symbiont from nonsymbiotic bacteria. Transposon mutagenesis and screening revealed that symbiont mutants in flagella-related genes fail to pass through the constricted region, highlighting that both host's control and symbiont's motility are involved in the sorting process. The blocking of food flow at the constricted region is conserved among diverse stinkbug groups, suggesting the evolutionary origin of the intestinal organ in their common ancestor.

  7. Thermocapillary valve for droplet production and sorting

    NASA Astrophysics Data System (ADS)

    Baroud, Charles N.; Delville, Jean-Pierre; Gallaire, François; Wunenburger, Régis

    2007-04-01

    Droplets are natural candidates for use as microfluidic reactors, if active control of their formation and transport can be achieved. We show here that localized heating from a laser can block the motion of a water-oil interface, acting as a microfluidic valve for two-phase flows. A theoretical model is developed to explain the forces acting on a drop due to thermocapillary flow, predicting a scaling law that favors miniaturization. Finally, we show how the laser forcing can be applied to sorting drops, thus demonstrating how it may be integrated in complex droplet microfluidic systems.

  8. Lateral chirality-sorting optical forces

    PubMed Central

    Hayat, Amaury; Mueller, J. P. Balthasar; Capasso, Federico

    2015-01-01

    The transverse component of the spin angular momentum of evanescent waves gives rise to lateral optical forces on chiral particles, which have the unusual property of acting in a direction in which there is neither a field gradient nor wave propagation. Because their direction and strength depends on the chiral polarizability of the particle, they act as chirality-sorting and may offer a mechanism for passive chirality spectroscopy. The absolute strength of the forces also substantially exceeds that of other recently predicted sideways optical forces. PMID:26453555

  9. NSF Lower Atmospheric Observing Facilities (LAOF) in support of science and education

    NASA Astrophysics Data System (ADS)

    Baeuerle, B.; Rockwell, A.

    2012-12-01

    Researchers, students and teachers who want to understand and describe the Earth System require high quality observations of the atmosphere, ocean, and biosphere. Making these observations requires state-of-the-art instruments and systems, often carried on highly capable research platforms. To support this need of the geosciences community, the National Science Foundation's (NSF) Division of Atmospheric and Geospace Sciences (AGS) provides multi-user national facilities through its Lower Atmospheric Observing Facilities (LAOF) Program at no cost to the investigator. These facilities, which include research aircraft, radars, lidars, and surface and sounding systems, receive NSF financial support and are eligible for deployment funding. The facilities are managed and operated by five LAOF partner organizations: the National Center for Atmospheric Research (NCAR); Colorado State University (CSU); the University of Wyoming (UWY); the Center for Severe Weather Research (CSWR); and the Center for Interdisciplinary Remotely-Piloted Aircraft Studies (CIRPAS). These observational facilities are available on a competitive basis to all qualified researchers from US universities, requiring the platforms and associated services to carry out various research objectives. The deployment of all facilities is driven by scientific merit, capabilities of a specific facility to carry out the proposed observations, and scheduling for the requested time. The process for considering requests and setting priorities is determined on the basis of the complexity of a field campaign. The poster will describe available observing facilities and associated services, and explain the request process researchers have to follow to secure access to these platforms for scientific as well as educational deployments. NSF/NCAR GV Aircraft

  10. Proceedings of the Fifth NASA/NSF/DOD Workshop on Aerospace Computational Control

    NASA Technical Reports Server (NTRS)

    Wette, M. (Editor); Man, G. K. (Editor)

    1993-01-01

    The Fifth Annual Workshop on Aerospace Computational Control was one in a series of workshops sponsored by NASA, NSF, and the DOD. The purpose of these workshops is to address computational issues in the analysis, design, and testing of flexible multibody control systems for aerospace applications. The intention in holding these workshops is to bring together users, researchers, and developers of computational tools in aerospace systems (spacecraft, space robotics, aerospace transportation vehicles, etc.) for the purpose of exchanging ideas on the state of the art in computational tools and techniques.

  11. President's Budget Proposal Favors NSF, Though Congress Could Push for Reductions

    NASA Astrophysics Data System (ADS)

    Showstack, Randy

    2011-03-01

    The U.S. National Science Foundation (NSF) is one of the winners in the Obama administration's proposed budget for fiscal year (FY) 2012, which begins on 1 October, with a proposed funding level of $7.767 billion; this would be an increase of 13% above the congressionally enacted FY 2010 budget level. However, the administration's proposed budget is just a starting point for discussions. Congress has approved a 2-week budget continuing resolution (CR) for the current fiscal year, 2011. A longer-term CR passed by the House of Representatives (HR 1) could dramatically cut this year's funding for some federal agencies and also affect budget discussions for FY 2012.

  12. An Alternative Approach for the Analyses and Interpretation of Attachment Sort Items

    ERIC Educational Resources Information Center

    Kirkland, John; Bimler, David; Drawneek, Andrew; McKim, Margaret; Scholmerich, Axel

    2004-01-01

    Attachment Q-Sort (AQS) is a tool for quantifying observations about toddler/caregiver relationships. Previous studies have applied factor analysis to the full 90 AQS item set to explore the structure underlying them. Here we explore that structure by applying multidimensional scaling (MDS) to judgements of inter-item similarity. AQS items are…

  13. Seed availability constrains plant species sorting along a soil fertility gradient

    Treesearch

    Bryan L. Foster; Erin J. Questad; Cathy D. Collins; Cheryl A. Murphy; Timothy L. Dickson; Val H. Smith

    2011-01-01

    1. Spatial variation in species composition within and among communities may be caused by deterministic, niche-based species sorting in response to underlying environmental heterogeneity as well as by stochastic factors such as dispersal limitation and variable species pools. An important goal in ecology is to reconcile deterministic and stochastic perspectives of...

  14. Pulsed laser activated cell sorter (PLACS) for high-throughput fluorescent mammalian cell sorting

    NASA Astrophysics Data System (ADS)

    Chen, Yue; Wu, Ting-Hsiang; Chung, Aram; Kung, Yu-Chung; Teitell, Michael A.; Di Carlo, Dino; Chiou, Pei-Yu

    2014-09-01

    We present a Pulsed Laser Activated Cell Sorter (PLACS) realized by exciting laser induced cavitation bubbles in a PDMS microfluidic channel to create high speed liquid jets to deflect detected fluorescent samples for high speed sorting. Pulse laser triggered cavitation bubbles can expand in few microseconds and provide a pressure higher than tens of MPa for fluid perturbation near the focused spot. This ultrafast switching mechanism has a complete on-off cycle less than 20 μsec. Two approaches have been utilized to achieve 3D sample focusing in PLACS. One is relying on multilayer PDMS channels to provide 3D hydrodynamic sheath flows. It offers accurate timing control of fast (2 m sec-1) passing particles so that synchronization with laser bubble excitation is possible, an critically important factor for high purity and high throughput sorting. PLACS with 3D hydrodynamic focusing is capable of sorting at 11,000 cells/sec with >95% purity, and 45,000 cells/sec with 45% purity using a single channel in a single step. We have also demonstrated 3D focusing using inertial flows in PLACS. This sheathless focusing approach requires 10 times lower initial cell concentration than that in sheath-based focusing and avoids severe sample dilution from high volume sheath flows. Inertia PLACS is capable of sorting at 10,000 particles sec-1 with >90% sort purity.

  15. ALG-2 activates the MVB sorting function of ALIX through relieving its intramolecular interaction.

    PubMed

    Sun, Sheng; Zhou, Xi; Corvera, Joe; Gallick, Gary E; Lin, Sue-Hwa; Kuang, Jian

    2015-01-01

    The modular adaptor protein ALIX is critically involved in endosomal sorting complexes required for transport (ESCRT)-mediated multivesicular body (MVB) sorting of activated epidermal growth factor receptor (EGFR); however, ALIX contains a default intramolecular interaction that renders ALIX unable to perform this ESCRT function. The ALIX partner protein ALG-2 is a calcium-binding protein that belongs to the calmodulin superfamily. Prompted by a defined biological function of calmodulin, we determined the role of ALG-2 in regulating ALIX involvement in MVB sorting of activated EGFR. Our results show that calcium-dependent ALG-2 interaction with ALIX completely relieves the intramolecular interaction of ALIX and promotes CHMP4-dependent ALIX association with the membrane. EGFR activation induces increased ALG-2 interaction with ALIX, and this increased interaction is responsible for increased ALIX association with the membrane. Functionally, inhibition of ALIX activation by ALG-2 inhibits MVB sorting of activated EGFR as effectively as inhibition of ALIX interaction with CHMP4 does; however, inhibition of ALIX activation by ALG-2 does not affect cytokinetic abscission or equine infectious anemia virus (EIAV) budding. These findings indicate that calcium-dependent ALG-2 interaction with ALIX is specifically responsible for generating functional ALIX that supports MVB sorting of ubiquitinated membrane receptors.

  16. Designing a simple ratcheting system to sort microcapsules by mechanical properties.

    PubMed

    Smith, Kurt A; Alexeev, Alexander; Verberg, Rolf; Balazs, Anna C

    2006-08-01

    Using computational modeling, we analyze the fluid-driven motion of compliant particles over a rigid, saw-toothed surface. The particles are modeled as fluid-filled elastic shells and, thus, simulate ex vivo biological cells or polymeric microcapsules. Through the model, we demonstrate how the patterned surface and an oscillatory shear flow can be combined to produce a ratcheting motion, yielding a straightforward method for sorting these capsules by their relative stiffness. Since the approach exploits the capsule's inherent response to the substrate, it does not involve explicit measurement and assessment. Because the process utilizes an oscillatory shear, the sorting can be accomplished over a relatively short portion of the substrate. Due to these factors, this sorting mechanism can prove to be both efficient and relatively low-cost.

  17. A common assembly module in injectisome and flagellar type III secretion sorting platforms.

    PubMed

    Notti, Ryan Q; Bhattacharya, Shibani; Lilic, Mirjana; Stebbins, C Erec

    2015-05-21

    Translocating proteins across the double membrane of Gram-negative bacteria, type III secretion systems (T3SS) occur in two evolutionarily related forms: injectisomes, delivering virulence factors into host cells, and the flagellar system, secreting the polymeric filament used for motility. While both systems share related elements of a cytoplasmic sorting platform that facilitates the hierarchical secretion of protein substrates, its assembly and regulation remain unclear. Here we describe a module mediating the assembly of the sorting platform in both secretion systems, and elucidate the structural basis for segregation of homologous components among these divergent T3SS subtypes sharing a common cytoplasmic milieu. These results provide a foundation for the subtype-specific assembly of T3SS sorting platforms and will support further mechanistic analysis and anti-virulence drug design.

  18. Problem-solving deficits in alcoholics: evidence from the California Card Sorting Test.

    PubMed

    Beatty, W W; Katzung, V M; Nixon, S J; Moreland, V J

    1993-11-01

    In an attempt to clarify the nature of the problem-solving deficits exhibited by chronic alcoholics, the California Card Sorting Test (CCST) and other measures of abstraction and problem solving were administered to 23 alcoholics and 16 nonalcoholic controls, equated for age, education and vocabulary. On the CCST, the alcoholics exhibited three types of deficits which appeared to be relatively independent. First, the alcoholics generated and identified fewer correct concepts than controls, although they executed concepts normally when cued by the examiner. Second, the alcoholics made more perseverative sorting responses and perseverative verbal explanations for their sorting behavior than did controls. Third, alcoholics provided less complete verbal explanations of the concepts that they correctly generated or identified. The differential importance of these factors on various measures of problem solving may help to explain the varied patterns of inefficient problem solving exhibited by alcoholics.

  19. A common assembly module in injectisome and flagellar type III secretion sorting platforms

    NASA Astrophysics Data System (ADS)

    Notti, Ryan Q.; Bhattacharya, Shibani; Lilic, Mirjana; Stebbins, C. Erec

    2015-05-01

    Translocating proteins across the double membrane of Gram-negative bacteria, type III secretion systems (T3SS) occur in two evolutionarily related forms: injectisomes, delivering virulence factors into host cells, and the flagellar system, secreting the polymeric filament used for motility. While both systems share related elements of a cytoplasmic sorting platform that facilitates the hierarchical secretion of protein substrates, its assembly and regulation remain unclear. Here we describe a module mediating the assembly of the sorting platform in both secretion systems, and elucidate the structural basis for segregation of homologous components among these divergent T3SS subtypes sharing a common cytoplasmic milieu. These results provide a foundation for the subtype-specific assembly of T3SS sorting platforms and will support further mechanistic analysis and anti-virulence drug design.

  20. A common assembly module in injectisome and flagellar type III secretion sorting platforms

    PubMed Central

    Notti, Ryan Q.; Bhattacharya, Shibani; Lilic, Mirjana; Stebbins, C. Erec

    2015-01-01

    Translocating proteins across the double membrane of Gram-negative bacteria, type III secretion systems (T3SS) occur in two evolutionarily related forms: injectisomes, delivering virulence factors into host cells, and the flagellar system, secreting the polymeric filament used for motility. While both systems share related elements of a cytoplasmic sorting platform that facilitates the hierarchical secretion of protein substrates, its assembly and regulation remain unclear. Here we describe a module mediating the assembly of the sorting platform in both secretion systems, and elucidate the structural basis for segregation of homologous components among these divergent T3SS subtypes sharing a common cytoplasmic milieu. These results provide a foundation for the subtype-specific assembly of T3SS sorting platforms and will support further mechanistic analysis and anti-virulence drug design. PMID:25994170

  1. PACMan to Help Sort Hubble Proposals

    NASA Astrophysics Data System (ADS)

    Kohler, Susanna

    2017-04-01

    Every year, astronomers submit over a thousand proposals requesting time on the Hubble Space Telescope (HST). Currently, humans must sort through each of these proposals by hand before sending them off for review. Could this burden be shifted to computers?A Problem of VolumeAstronomer Molly Peeples gathered stats on the HST submissions sent in last week for the upcoming HST Cycle 25 (the deadline was Friday night), relative to previous years. This years proposal round broke the record, with over 1200 proposals submitted in total for Cycle 25. [Molly Peeples]Each proposal cycle for HST time attracts on the order of 1100 proposals accounting for far more HST time than is available. The proposals are therefore carefully reviewed by around 150 international members of the astronomy community during a six-month process to select those with the highest scientific merit.Ideally, each proposal will be read by reviewers that have scientific expertise relevant to the proposal topic: if a proposal requests HST time to study star formation, for instance, then the reviewers assigned to it should have research expertise in star formation.How does this matching of proposals to reviewers occur? The current method relies on self-reported categorization of the submitted proposals. This is unreliable, however; proposals are often mis-categorized by submitters due to misunderstanding or ambiguous cases.As a result, the Science Policies Group at the Space Telescope Science Institute (STScI) which oversees the review of HST proposals must go through each of the proposals by hand and re-categorize them. The proposals are then matched to reviewers with self-declared expertise in the same category.With the number of HST proposals on the rise and the expectation that the upcoming James Webb Space Telescope (JWST) will elicit even more proposals for time than Hubble scientists at STScI and NASA are now asking: could the human hours necessary for this task be spared? Could a computer program

  2. Small Peptide Recognition Sequence for Intracellular Sorting

    PubMed Central

    Pandey, Kailash N.

    2010-01-01

    Increasing evidence indicate that complex arrays of short signals and recognition peptide sequence ensure accurate trafficking and distribution of transmembrane receptors and/or proteins and their ligands into intracellular compartments. Internalization and subsequent trafficking of cell-surface receptors into the cell interior is mediated by specific short-sequence peptide signals within the cytoplasmic domains of these receptor proteins. The short signals usually consist of small linear amino acid sequences, which are recognized by adaptor coat proteins along the endocytic and sorting pathways. In recent years, much has been learned about the function and mechanisms of endocytic pathways responsible for the trafficking and molecular sorting of membrane receptors and their ligands into intracellular compartments, however, the significance and scope of the short sequence motifs in these cellular events is not well understood. Here a particular emphasis has been given to the functions of short-sequence signal motifs responsible for the itinerary and destination of membrane receptors and proteins moving into subcellular compartments. PMID:20817434

  3. Efficiency at Sorting Cards in Compressed Air

    PubMed Central

    Poulton, E. C.; Catton, M. J.; Carpenter, A.

    1964-01-01

    At a site where compressed air was being used in the construction of a tunnel, 34 men sorted cards twice, once at normal atmospheric pressure and once at 3½, 2½, or 2 atmospheres absolute pressure. An additional six men sorted cards twice at normal atmospheric pressure. When the task was carried out for the first time, all the groups of men performing at raised pressure were found to yield a reliably greater proportion of very slow responses than the group of men performing at normal pressure. There was reliably more variability in timing at 3½ and 2½ atmospheres absolute than at normal pressure. At 3½ atmospheres absolute the average performance was also reliably slower. When the task was carried out for the second time, exposure to 3½ atmospheres absolute pressure had no reliable effect. Thus compressed air affected performance only while the task was being learnt; it had little effect after practice. No reliable differences were found related to age, to length of experience in compressed air, or to the duration of the exposure to compressed air, which was never less than 10 minutes at 3½ atmospheres absolute pressure. PMID:14180485

  4. Developing Automated Methods of Waste Sorting

    SciTech Connect

    Shurtliff, Rodney Marvin

    2002-08-01

    The U.S. Department of Energy (DOE) analyzed the need complex-wide for remote and automated technologies as they relate to the treatment and disposal of mixed wastes. This analysis revealed that several DOE sites need the capability to open drums containing waste, visually inspect and sort the contents, and finally repackage the containers that are acceptable at a waste disposal facility such as the Waste Isolation Pilot Plant (WIPP) in New Mexico. Conditioning contaminated waste so that it is compatible with the WIPP criteria for storage is an arduous task whether the waste is contact handled (waste having radioactivity levels below 200 mrem/hr) or remote handled. Currently, WIPP non-compliant items are removed from the waste stream manually, at a rate of about one 55-gallon drum per day. Issues relating to contamination-based health hazards as well as repetitive motion health hazards are steering industry towards a more user-friendly, method of conditioning or sorting waste.

  5. ImmuSort, a database on gene plasticity and electronic sorting for immune cells

    PubMed Central

    Wang, Pingzhang; Yang, Yehong; Han, Wenling; Ma, Dalong

    2015-01-01

    Gene expression is highly dynamic and plastic. We present a new immunological database, ImmuSort. Unlike other gene expression databases, ImmuSort provides a convenient way to view global differential gene expression data across thousands of experimental conditions in immune cells. It enables electronic sorting, which is a bioinformatics process to retrieve cell states associated with specific experimental conditions that are mainly based on gene expression intensity. A comparison of gene expression profiles reveals other applications, such as the evaluation of immune cell biomarkers and cell subsets, identification of cell specific and/or disease-associated genes or transcripts, comparison of gene expression in different transcript variants and probe set quality evaluation. A plasticity score is introduced to measure gene plasticity. Average rank and marker evaluation scores are used to evaluate biomarkers. The current version includes 31 human and 17 mouse immune cell groups, comprising 10,422 and 3,929 microarrays derived from public databases, respectively. A total of 20,283 human and 20,963 mouse genes are available to query in the database. Examples show the distinct advantages of the database. The database URL is http://202.85.212.211/Account/ImmuSort.html. PMID:25988315

  6. A cell sorting protocol for selecting high-producing sub-populations of Sf9 and High Five™ cells.

    PubMed

    Vidigal, João; Dias, Mafalda M; Fernandes, Fabiana; Patrone, Marco; Bispo, Cláudia; Andrade, Cláudia; Gardner, Rui; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P

    2013-12-01

    Insect cell lines such as Sf9 and High Five™ have been widely used to produce recombinant proteins mostly by the lytic baculovirus vector system. We have recently established an expression platform in Sf9 cells using a fluorescence-based recombinase mediated cassette exchange (RMCE) strategy which has similar development timelines but avoids baculovirus infection. To expedite cell engineering efforts, a robust fluorescence-activated cell sorting (FACS) protocol optimized for insect cells was developed here. The standard sorting conditions used for mammalian cells proved to be unsuitable, resulting in post-sorting viabilities below 10% for both cell lines. We found that the extreme sensitivity to the shear stress displayed by Sf9 and High Five™ cells was the limiting factor, and using Pluronic F-68 in the cell suspension could increase post-sorting viabilities in a dose dependent manner. The newly developed protocol was then used to sort stable populations of both cell lines tagged with a DsRed-expressing cassette. Before sorting, the average fluorescence intensity of the Sf9 cell population was 3-fold higher than that of the High Five™ cell population. By enriching with the 10% strongest DsRed-fluorescent cells, the productivity of both cell populations could be successfully improved. The established sorting protocol potentiates the use of RMCE technology for recombinant protein production in insect cells.

  7. Unravelling the pivotal role of Alix in MVB sorting and silencing of the activated EGFR.

    PubMed

    Sun, Sheng; Zhou, Xi; Zhang, Wei; Gallick, Gary E; Kuang, Jian

    2015-03-15

    Endosomal sorting complex required for transport (ESCRT)-III-mediated membrane invagination and scission are a critical step in multivesicular body (MVB) sorting of ubiquitinated membrane receptors, and generally thought to be required for degradation of these receptors in lysosomes. The adaptor protein Alix is critically involved in multiple ESCRT-III-mediated, membrane-remodelling processes in mammalian cells. However, Alix knockdown does not inhibit degradation of the activated epidermal growth factor receptor (EGFR) in mammalian cell lines, leading to a widely held notion that Alix is not critically involved in MVB sorting of ubiquitinated membrane receptors in mammalian cells. In the present study, we demonstrate that, despite its non-essential role in degradation of the activated EGFR, Alix plays a critical role in its MVB sorting and silencing Epidermal growth factor (EGF) stimulation of mammalian cell lines induces Alix's interaction with the ubiquitinated EGFR via the Alix V domain, and increases Alix's association with membrane-bound charged multivesicular body protein 4 (CHMP4) via the Alix Bro1 domain. Under both continuous and pulse-chase EGF stimulation conditions, inhibition of Alix's interaction with membrane-bound CHMP4, inhibition of Alix dimerization through the V domain or Alix knockdown dramatically inhibits MVB sorting of the activated EGFR and promotes sustained activation of extracellular-signal regulated kinase (ERK)1/2. Under the continuous EGF stimulation conditions, these cell treatments also retard degradation of the activated EGFR. These findings indicate that Alix is critically involved in MVB sorting of ubiquitinated membrane receptors in mammalian cells.

  8. Field fertility of sex-sorted and non-sorted frozen-thawed stallion spermatozoa.

    PubMed

    Clulow, J R; Buss, H; Sieme, H; Rodger, J A; Cawdell-Smith, A J; Evans, G; Rath, D; Morris, L H A; Maxwell, W M C

    2008-11-01

    In the 2004/2005 breeding season, the fertility of sex-sorted (SS) and non-sorted (NS) frozen stallion spermatozoa from two Hannovarian stallions was compared. A hysteroscopic insemination technique [Morris, L.H., Tiplady, C., Allen, W.R., 2003a. Pregnancy rates in mares after a single fixed time hysteroscopic insemination of low numbers of frozen-thawed spermatozoa onto the uterotubal junction. Equine Vet. J. 35, 197-201] was used to deposit low doses (6, 13 or 25 x 10(6) frozen-thawed SS or NS spermatozoa) onto the utero-tubal junction at 32 or 38 h after the administration of Chorulon (2500 IU, Intervet). Fertility was low, with one pregnancy (13 x 10(6) spermatozoa, 500 microL) obtained after artificial insemination with frozen SS spermatozoa (n=29 cycles) which resulted in the birth of a filly. Two pregnancies were obtained in mares inseminated with 6 x 10(6) NS spermatozoa in 250 microL (n=31 cycles). Mares failing to conceive on two experimental cycles were allocated to the conventional insemination group. Insemination with >500 x 10(6) motile NS frozen-thawed spermatozoa, yielded satisfactory per cycle conception rates (35.5%, 22/62) for both stallions combined and was within the values of their normal fertility as quoted by the stud's records. This suggests that the quality of the frozen semen was acceptable and that the freezing processes yielded viable spermatozoa capable of fertilisation. The poor fertility after hysteroscopic insemination with low doses of sex-sorted or non-sorted spermatozoa from the same stallions may be directly attributable to the low dose insemination conditions with frozen-thawed rather than sex-sorted spermatozoa.

  9. Cold Weather Wind Turbines: A Joint NASA/NSF/DOE Effort in Technology Transfer and Commercialization

    NASA Technical Reports Server (NTRS)

    Flynn, Michael; Bubenheim, David; Chiang, Erick; Goldman, Peter; Kohout, Lisa; Norton, Gary; Kliss, Mark (Technical Monitor)

    1997-01-01

    Renewable energy sources and their integration with other power sources to support remote communities is of interest for Mars applications as well as Earth communities. The National Science Foundation (NSF), NASA, and the Department of Energy (DOE) have been jointly supporting development of a 100 kW cold weather wind turbine through grants and SBIRs independently managed by each agency but coordinated by NASA. The NSF grant addressed issues associated with the South Pole application and a 3 kW direct drive unit is being tested there in anticipation of the 100 kW unit operation. The DOE-NREL contract focused on development of the 100 kW direct drive generator. The NASA SBIR focused on the development of the 100 kW direct drive wind turbine. The success of this effort has required coordination and team involvement of federal agencies and the industrial partners. Designs of the wind turbine and component performance testing results will be presented. Plans for field testing of wind turbines, based on this design, in village energy systems in Alaska and in energy production at the South Pole Station will be discussed. Also included will be a discussion of terrestrial and space use of hybrid energy systems, including renewable energy sources, such as the wind turbine, to support remote communities.

  10. Cold Weather Wind Turbines: A Joint NASA/NSF/DOE Effort in Technology Transfer and Commercialization

    NASA Technical Reports Server (NTRS)

    Flynn, Michael; Bubenheim, David; Chiang, Erick; Goldman, Peter; Kohout, Lisa; Norton, Gary; Kliss, Mark (Technical Monitor)

    1997-01-01

    Renewable energy sources and their integration with other power sources to support remote communities is of interest for Mars applications as well as Earth communities. The National Science Foundation (NSF), NASA, and the Department of Energy (DOE) have been jointly supporting development of a 100 kW cold weather wind turbine through grants and SBIRs independently managed by each agency but coordinated by NASA. The NSF grant addressed issues associated with the South Pole application and a 3 kW direct drive unit is being tested there in anticipation of the 100 kW unit operation. The DOE-NREL contract focused on development of the 100 kW direct drive generator. The NASA SBIR focused on the development of the 100 kW direct drive wind turbine. The success of this effort has required coordination and team involvement of federal agencies and the industrial partners. Designs of the wind turbine and component performance testing results will be presented. Plans for field testing of wind turbines, based on this design, in village energy systems in Alaska and in energy production at the South Pole Station will be discussed. Also included will be a discussion of terrestrial and space use of hybrid energy systems, including renewable energy sources, such as the wind turbine, to support remote communities.

  11. The NSF CubeSat Program: The Promise of Scientific Projects (Invited)

    NASA Astrophysics Data System (ADS)

    Moretto, T.

    2009-12-01

    Working in the cubesat regime of space missions imposes obvious limitations on the complexity and scope of experiments that can be accomplished. However, these very small satellite projects also offer substantial advantages. In comparison to the traditional large satellite missions they provide a means to fast, near immediate, implementation of scientific ideas; to narrowly focused science investigations; to extended multi-point measurements; and to try out creative new, but high-risk, experimental approaches. Relatively simple but well-chosen measurements from CubeSat missions can complement observations from ground or large spacecraft missions to observe phenomena of interest over different geographic locations, at higher or lower altitudes, an at different local times. They can also provide crucial information on the small-scale structure of phenomena or help provide a global view. The powerful utility of all of these features is verified in the rich collection of scientific ideas emerging in response to the newly established NSF CubeSat program. The assortment of scientific investigations being proposed spans all across solar, magnetospheric, ionospheric, upper-atmospheric, and space weather research. Based on examples from current projects and potential future directions for the NSF CubeSat program, the presentation will explore the prolific scientific promise of the program.

  12. Building a research group of Space Physics at UAHuntsville -- the impact of an NSF career award

    NASA Astrophysics Data System (ADS)

    Li, G.

    2011-12-01

    G. Li (1,2) (1) Department of Physics, University of Alabama in Huntsville Huntsville, AL, 35899 (2) CSPAR, University of Alabama in Huntsville Huntsville, AL, 35899 The author joined the faculty of the department of Physics at University of Alabama in Huntsville in August 2008. He was awarded the NSF Career award ATM-0847719 in 2009. To date, the Career award has provided partial supports to one postdoc, two graduate students and three undergraduate students for a variety of periods. Three publications came out as a result of the award (one of which is first authored by one undergraduate). Another two publications are in preparation. The award also helped the PI to be further recognized by the field of space plasma physics and cosmic ray physics. For example, in July 2009, the PI was awarded the Young Scientist Medal by the International Union of Pure and Applied Physics (IUPAP); in April 2010, the PI won an Oak Ridge Associated Universities (ORAU) 2010 Ralph E. Powe Junior Faculty Enhancement Award. In short, the NSF CAREER has helped the PI to start his career at a level without which, will be impossible.

  13. Cargo-dependent degradation of ESCRT-I as a feedback mechanism to modulate endosomal sorting.

    PubMed

    Malerød, Lene; Pedersen, Nina Marie; Sem Wegner, Catherine Elisabeth; Lobert, Viola Hélène; Leithe, Edward; Brech, Andreas; Rivedal, Edgar; Liestøl, Knut; Stenmark, Harald

    2011-09-01

    Ligand-mediated lysosomal degradation of growth factor receptors, mediated by the endosomal sorting complex required for transport (ESCRT) machinery, is a mechanism that attenuates the cellular response to growth factors. In this article, we present a novel regulatory mechanism that involves ligand-mediated degradation of a key component of the sorting machinery itself. We have investigated the endosomal localization of subunits of the four ESCRTs-Hrs (ESCRT-0), Tsg101 (ESCRT-I), EAP30/Vps22 (ESCRT-II) and charged multivesicular body protein 3/Vps24 (ESCRT-III). All the components were detected on the limiting membrane of multivesicular endosomes (MVEs). Surprisingly, however, Tsg101 and other ESCRT-I subunits were also detected within intraluminal vesicles (ILVs) of MVEs. Tsg101 was sequestered along with cargo during endosomal sorting into ILVs and further degraded in lysosomes. Importantly, ESCRT-mediated downregulation of two distinct cargoes, epidermal growth factor receptor (EGFR) and connexin43, mutually made cells refractory to degradation of the other cargo. Our observations indicate that the degradation of a key ESCRT component along with cargo represents a novel feedback control of endosomal sorting by preventing collateral degradation of cell surface receptors following stimulation of one specific pathway.

  14. Extension of the sorting instructions for household plastic packaging and changes in exposure to bioaerosols at materials recovery facilities.

    PubMed

    Schlosser, O; Déportes, I Z; Facon, B; Fromont, E

    2015-12-01

    The aim of this study was to assess how extending the sorting instructions for plastic packaging would affect the exposure of workers working at materials recovery facility (MRF) to dust, endotoxins, fungi and bacteria, taking into consideration other factors that could have an influence on this exposure. Personal sampling was carried out at four MRFs during six sampling campaigns at each facility, both in sorting rooms and when the workers were involved in "mobile tasks" away from the rooms. The data was analysed by describing the extension of sorting instructions both using a qualitative variable (after vs before) and using data for the pots and trays recycling stream, including or excluding plastic film. Overall, before the extension of the sorting guidelines, the geometric mean of personal exposure levels in sorting rooms was 0.3mg/m(3) for dust, 27.7 EU/m(3) for endotoxins, 13,000 CFU/m(3) for fungi and 1800 CFU/m(3) for bacteria. When workers were involved in mobile tasks away from the rooms, these averages were 0.5mg/m(3), 25.7 EU/m(3), 28,000 CFU/m(3) and 5100 CFU/m(3) respectively.The application by households of instructions to include pots, trays and film with other recyclable plastic packaging led to an increase in exposure to endotoxins, fungi and bacteria at MRFs. For an increase of 0.5 kg per inhabitant per year in the pots, trays and film recycling stream, exposure in sorting rooms rose by a factor of 1.4-2.2, depending on the biological agent. Exposure during mobile tasks increased by a factor of 3.0-3.6. The age of the waste amplified the effect of the extension of sorting instructions on exposure to fungi, bacteria and endotoxins. Factors that had a significant influence on the exposure of workers to dust and/or bioaerosols included the presence of paper, newspapers and magazines in the sorted waste, the order in which incoming waste was treated and the quality of the ventilation system in the sorting rooms. The levels of exposure observed in

  15. Phase sorting wave-particle correlator

    NASA Astrophysics Data System (ADS)

    Kletzing, C. A.; LaBelle, J.; Bounds, S. R.; Dolan, J.; Kaeppler, S. R.; Dombrowski, M.

    2017-02-01

    Wave-particle correlations, particularly of Langmuir waves and electrons, have been the subject of significant interest extending back to the 1970s. Often, these correlations have been simply observing modulation of the electrons at the plasma frequency with no phase resolution. The first phase-resolving correlators were developed at UC Berkeley in the late 1980s and reported by Ergun in the early 1990s. A design is presented which further improves on phase resolution in correlations of Langmuir waves and electrons with phase resolution of 22.5°. In this technique, a phase-locked loop (PLL) is used to lock onto the wave and subdivide the phase. Electrons are sorted on-the-fly as they arrive into the phase bins. Discussed are details of accurate timing, testing, and calibration of this system as well as results from rocket flights in which statistically significant phase correlations have been observed.

  16. Molecular shape sorting using molecular organic cages.

    PubMed

    Mitra, Tamoghna; Jelfs, Kim E; Schmidtmann, Marc; Ahmed, Adham; Chong, Samantha Y; Adams, Dave J; Cooper, Andrew I

    2013-04-01

    The energy-efficient separation of chemical feedstocks is a major sustainability challenge. Porous extended frameworks such as zeolites or metal-organic frameworks are one potential solution to this problem. Here, we show that organic molecules, rather than frameworks, can separate other organic molecules by size and shape. A molecular organic cage is shown to separate a common aromatic feedstock (mesitylene) from its structural isomer (4-ethyltoluene) with an unprecedented perfect specificity for the latter. This specificity stems from the structure of the intrinsically porous cage molecule, which is itself synthesized from a derivative of mesitylene. In other words, crystalline organic molecules are used to separate other organic molecules. The specificity is defined by the cage structure alone, so this solid-state 'shape sorting' is, uniquely, mirrored for cage molecules in solution. The behaviour can be understood from a combination of atomistic simulations for individual cage molecules and solid-state molecular dynamics simulations.

  17. Passive chip-based droplet sorting

    DOEpatents

    Beer, Neil Reginald; Lee, Abraham P; Hatch, Andrew C; Fisher, Jeffrey S

    2015-11-05

    An apparatus for passive sorting of microdroplets including a main flow channel, a flow stream of microdroplets in the main flow channel wherein the microdroplets have substantially the same diameter and wherein the flow stream of microdroplets includes first microdroplets having a first degree of stiffness and second microdroplets having a second degree of stiffness wherein the second degree of stiffness is different than the first degree of stiffness. A second flow channel is connected to the main flow channel for the second microdroplets having a second degree of stiffness. A separator separates the second microdroplets having a second degree of stiffness from the first microdroplets and directs the second microdroplets having a second degree of stiffness into the second flow channel.

  18. Passive chip-based droplet sorting

    DOEpatents

    Beer, Neil Reginald; Lee, Abraham P; Hatch, Andrew C; Fisher, Jeffrey S

    2015-03-03

    An apparatus for passive sorting of microdroplets including a main flow channel, a flow stream of microdroplets in the main flow channel wherein the microdroplets have substantially the same diameter and wherein the flow stream of microdroplets includes first microdroplets having a first degree of stiffness and second microdroplets having a second degree of stiffness wherein the second degree of stiffness is different than the first degree of stiffness. A second flow channel is connected to the main flow channel for the second microdroplets having a second degree of stiffness. A separator separates the second microdroplets having a second degree of stiffness from the first microdroplets and directs the second microdroplets having a second degree of stiffness into the second flow channel.

  19. The NSF Arctic Data Center: Leveraging the DataONE Federation to Build a Sustainable Archive for the NSF Arctic Research Community

    NASA Astrophysics Data System (ADS)

    Budden, A. E.; Arzayus, K. M.; Baker-Yeboah, S.; Casey, K. S.; Dozier, J.; Jones, C. S.; Jones, M. B.; Schildhauer, M.; Walker, L.

    2016-12-01

    The newly established NSF Arctic Data Center plays a critical support role in archiving and curating the data and software generated by Arctic researchers from diverse disciplines. The Arctic community, comprising Earth science, archaeology, geography, anthropology, and other social science researchers, are supported through data curation services and domain agnostic tools and infrastructure, ensuring data are accessible in the most transparent and usable way possible. This interoperability across diverse disciplines within the Arctic community facilitates collaborative research and is mirrored by interoperability between the Arctic Data Center infrastructure and other large scale cyberinfrastructure initiatives. The Arctic Data Center leverages the DataONE federation to standardize access to and replication of data and metadata to other repositories, specifically the NOAA's National Centers for Environmental Information (NCEI). This approach promotes long-term preservation of the data and metadata, as well as opening the door for other data repositories to leverage this replication infrastructure with NCEI and other DataONE member repositories. The Arctic Data Center uses rich, detailed metadata following widely recognized standards. Particularly, measurement-level and provenance metadata provide scientists the details necessary to integrate datasets across studies and across repositories while enabling a full understanding of the provenance of data used in the system. The Arctic Data Center gains this deep metadata and provenance support by simply adopting DataONE services, which results in significant efficiency gains by eliminating the need to develop systems de novo. Similarly, the advanced search tool developed by the Knowledge Network for Biocomplexity and extended for data submission by the Arctic Data Center, can be used by other DataONE-compliant repositories without further development. By standardizing interfaces and leveraging the DataONE federation

  20. 34. VIEW OF VIVIANNA WORKS ORE SORTING AND CRUSHING PLATFORM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. VIEW OF VIVIANNA WORKS ORE SORTING AND CRUSHING PLATFORM LOOKING EAST, NORTHEAST. NOTICE RAIL TIES EMBEDDED IN CONCRETE. - Mariscal Quicksilver Mine & Reduction Works, Terlingua, Brewster County, TX

  1. Hardware-assisted visibility sorting for unstructured volume rendering.

    PubMed

    Callahan, Steven P; Ikits, Milan; Comba, João L D; Silva, Cláudio T

    2005-01-01

    Harvesting the power of modern graphics hardware to solve the complex problem of real-time rendering of large unstructured meshes is a major research goal in the volume visualization community. While, for regular grids, texture-based techniques are well-suited for current GPUs, the steps necessary for rendering unstructured meshes are not so easily mapped to current hardware. We propose a novel volume rendering technique that simplifies the CPU-based processing and shifts much of the sorting burden to the GPU, where it can be performed more efficiently. Our hardware-assisted visibility sorting algorithm is a hybrid technique that operates in both object-space and image-space. In object-space, the algorithm performs a partial sort of the 3D primitives in preparation for rasterization. The goal of the partial sort is to create a list of primitives that generate fragments in nearly sorted order. In image-space, the fragment stream is incrementally sorted using a fixed-depth sorting network. In our algorithm, the object-space work is performed by the CPU and the fragment-level sorting is done completely on the GPU. A prototype implementation of the algorithm demonstrates that the fragment-level sorting achieves rendering rates of between one and six million tetrahedral cells per second on an ATI Radeon 9800.

  2. Learning Cellular Sorting Pathways Using Protein Interactions and Sequence Motifs

    PubMed Central

    Lin, Tien-Ho; Bar-Joseph, Ziv

    2011-01-01

    Abstract Proper subcellular localization is critical for proteins to perform their roles in cellular functions. Proteins are transported by different cellular sorting pathways, some of which take a protein through several intermediate locations until reaching its final destination. The pathway a protein is transported through is determined by carrier proteins that bind to specific sequence motifs. In this article, we present a new method that integrates protein interaction and sequence motif data to model how proteins are sorted through these sorting pathways. We use a hidden Markov model (HMM) to represent protein sorting pathways. The model is able to determine intermediate sorting states and to assign carrier proteins and motifs to the sorting pathways. In simulation studies, we show that the method can accurately recover an underlying sorting model. Using data for yeast, we show that our model leads to accurate prediction of subcellular localization. We also show that the pathways learned by our model recover many known sorting pathways and correctly assign proteins to the path they utilize. The learned model identified new pathways and their putative carriers and motifs and these may represent novel protein sorting mechanisms. Supplementary results and software implementation are available from http://murphylab.web.cmu.edu/software/2010_RECOMB_pathways/. PMID:21999284

  3. Sorting of Lipids and Proteins in Membrane Curvature Gradients

    PubMed Central

    Tian, A.; Baumgart, T.

    2009-01-01

    The sorting of lipids and proteins in cellular trafficking pathways is a process of central importance in maintaining compartmentalization in eukaryotic cells. However, the mechanisms behind these sorting phenomena are currently far from being understood. Among several mechanistic suggestions, membrane curvature has been invoked as a means to segregate lipids and proteins in cellular sorting centers. To assess this hypothesis, we investigate the sorting of lipid analog dye trace components between highly curved tubular membranes and essentially flat membranes of giant unilamellar vesicles. Our experimental findings indicate that intracellular lipid sorting, contrary to frequent assumptions, is unlikely to occur by lipids fitting into membrane regions of appropriate curvature. This observation is explained in the framework of statistical mechanical lattice models that show that entropy, rather than curvature energy, dominates lipid distribution in the absence of strongly preferential lateral intermolecular interactions. Combined with previous findings of curvature induced phase segregation, we conclude that lipid cooperativity is required to enable efficient sorting. In contrast to lipid analog dyes, the peripheral membrane binding protein Cholera toxin subunit B is effectively curvature-sorted. The sorting of Cholera toxin subunit B is rationalized by statistical models. We discuss the implications of our findings for intracellular sorting mechanisms. PMID:19348750

  4. Pattern matching based active optical sorting of colloids/cells

    NASA Astrophysics Data System (ADS)

    Verma, R. S.; Dasgupta, R.; Ahlawat, S.; Kumar, N.; Uppal, A.; Gupta, P. K.

    2013-08-01

    We report active optical sorting of colloids/cells by employing a cross correlation based pattern matching technique for selection of the desired objects and thereafter sorting using dynamically controllable holographic optical traps. The problem of possible collision between the different sets of objects during sorting was avoided by raising one set of particles to a different plane. We also present the results obtained on using this approach for some representative applications such as sorting of silica particles of two different sizes, of closely packed colloids and of white blood cells and red blood cells from a mixture of the two.

  5. 17. VIEW LOOKING NORTHEAST, SHOWING SORTING AND SHIPPING SHED WITH ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. VIEW LOOKING NORTHEAST, SHOWING SORTING AND SHIPPING SHED WITH SAWMILL BEHIND - Ichabod T. Williams & Sons Sawmill & Veneer Plant, Roosevelt Avenue at Carteret Avenue, Carteret, Middlesex County, NJ

  6. Learning sorting algorithms through visualization construction

    NASA Astrophysics Data System (ADS)

    Cetin, Ibrahim; Andrews-Larson, Christine

    2016-01-01

    Recent increased interest in computational thinking poses an important question to researchers: What are the best ways to teach fundamental computing concepts to students? Visualization is suggested as one way of supporting student learning. This mixed-method study aimed to (i) examine the effect of instruction in which students constructed visualizations on students' programming achievement and students' attitudes toward computer programming, and (ii) explore how this kind of instruction supports students' learning according to their self-reported experiences in the course. The study was conducted with 58 pre-service teachers who were enrolled in their second programming class. They expect to teach information technology and computing-related courses at the primary and secondary levels. An embedded experimental model was utilized as a research design. Students in the experimental group were given instruction that required students to construct visualizations related to sorting, whereas students in the control group viewed pre-made visualizations. After the instructional intervention, eight students from each group were selected for semi-structured interviews. The results showed that the intervention based on visualization construction resulted in significantly better acquisition of sorting concepts. However, there was no significant difference between the groups with respect to students' attitudes toward computer programming. Qualitative data analysis indicated that students in the experimental group constructed necessary abstractions through their engagement in visualization construction activities. The authors of this study argue that the students' active engagement in the visualization construction activities explains only one side of students' success. The other side can be explained through the instructional approach, constructionism in this case, used to design instruction. The conclusions and implications of this study can be used by researchers and

  7. VIP21/caveolin, glycosphingolipid clusters and the sorting of glycosylphosphatidylinositol-anchored proteins in epithelial cells.

    PubMed Central

    Zurzolo, C; van't Hof, W; van Meer, G; Rodriguez-Boulan, E

    1994-01-01

    We studied the role of the association between glycosylphosphatidylinositol (GPI)-anchored proteins and glycosphingolipid (GSL) clusters in apical targeting using gD1-DAF, a GPI-anchored protein that is differentially sorted by three epithelial cell lines. Differently from MDCK cells, where both gD1-DAF and glucosylceramide (GlcCer) are sorted to the apical membrane, in MDCK Concanavalin A-resistant cells (MDCK-ConAr) gD1-DAF was mis-sorted to both surfaces, but GlcCer was still targeted to the apical surface. In both MDCK and MDCK-ConAr cells, gD1-DAF became associated with TX-100-insoluble GSL clusters during transport to the cell surface. In dramatic contrast with MDCK cells, the Fischer rat thyroid (FRT) cell line targeted both gD1-DAF and GlcCer basolaterally. The targeting differences for GSLs in FRT and MDCK cells cannot be accounted for by a differential ability to form clusters because, in spite of major differences in the GSL composition, both cell lines assembled GSLs into TX-100-insoluble complexes with identical isopycnic densities. Surprisingly, in FRT cells, gD1-DAF did not form clusters with GSLs and, therefore, remained completely soluble. This clustering defect in FRT cells correlated with the lack of expression of VIP21/caveolin, a protein localized to both the plasma membrane caveolae and the trans Golgi network. This suggests that VIP21/caveolin may have an important role in recruiting GPI-anchored proteins into GSL complexes necessary for their apical sorting. However, since MDCK-ConAr cells expressed caveolin and clustered GPI-anchored proteins normally, yet mis-sorted them, our results also indicate that clustering and caveolin are not sufficient for apical targeting, and that additional factors are required for the accurate apical sorting of GPI-anchored proteins. Images PMID:8306971

  8. An analytical comparison of the information in sorted and non-sorted cosine-tuned spike activity

    NASA Astrophysics Data System (ADS)

    Won, D. S.; Tiesinga, P. H. E.; Henriquez, C. S.; Wolf, P. D.

    2007-09-01

    Spike sorting is a technologically expensive component of the signal processing chain required to interpret population spike activity acquired in a neuromotor prosthesis. No systematic analysis of the value of spike sorting has been carried out, and little is known about the effects of spike sorting error on the ability of a brain-machine interface (BMI) to decode intended motor commands. We developed a theoretical framework to examine the effects of spike processing on the information available to a BMI decoder. We computed the mutual information in neural activity in a simplified model of directional cosine tuning to compare the effects of pooling activity from up to four neurons to the effects of sorting with varying amounts of spike error. The results showed that information in a small population of cosine-tuned neurons is maximized when the responses are sorted and there is diverse tuning of units, but information was affected little when pooling units with similar preferred directions. Spike error had adverse effects on information, such that non-sorted population activity had 79-92% of the information in its sorted counterpart for reasonable amounts of detection and sorting error and for units with moderate differences in preferred direction. This quantification of information loss associated with pooling units and with spike detection and sorting error will help to guide the engineering decisions in designing a BMI spike processing system.

  9. Limiting Index Sort: A New Non-Dominated Sorting Algorithm and its Comparison to the State-of-the-Art

    DTIC Science & Technology

    2010-05-01

    Skyline Algorithm ( SaLSa ), and the Divide-and-Conquer (D&C) approach. LIS outperformed SaLSa in all tests, and it outperformed D&C when sorting...dominé de pointe, le Sort and Limit Skyline Algorithm ( SaLSa ) et l’algorithme Divide-and-Conquer (D&C). LIS a surclassé SaLSa dans tous les tests...art non-dominated sorting algorithms, the Sort and Limit Skyline Algorithm ( SaLSa ), and the Divide-and-Conquer (D&C) approach. LIS outperformed

  10. Seminal plasma affects sperm sex sorting in boars.

    PubMed

    Alkmin, Diego V; Parrilla, Inmaculada; Tarantini, Tatiana; Del Olmo, David; Vazquez, Juan M; Martinez, Emilio A; Roca, Jordi

    2016-04-01

    Two experiments were conducted in boar semen samples to evaluate how both holding time (24h) and the presence of seminal plasma (SP) before sorting affect sperm sortability and the ability of sex-sorted spermatozoa to tolerate liquid storage. Whole ejaculate samples were divided into three aliquots immediately after collection: one was diluted (1:1, v/v) in Beltsville thawing solution (BTS; 50% SP); the SP of the other two aliquots was removed and the sperm pellets were diluted with BTS + 10% of their own SP (10% SP) or BTS alone (0% SP). The three aliquots of each ejaculate were divided into two portions, one that was processed immediately for sorting and a second that was sorted after 24h storage at 15-17°C. In the first experiment, the ability to exhibit well-defined X- and Y-chromosome-bearing sperm peaks (split) in the cytometry histogram and the subsequent sorting efficiency were assessed (20 ejaculates). In contrast with holding time, the SP proportion influenced the parameters examined, as evidenced by the higher number of ejaculates exhibiting split and better sorting efficiency (P<0.05) in semen samples with 0-10% SP compared with those with 50% SP. In a second experiment, the quality (viability, total and progressive motility) and functionality (plasma membrane fluidity and intracellular generation of reactive oxygen species) of sex-sorted spermatozoa were evaluated after 0, 72 and 120h storage at 15-17°C (10 ejaculates). Holding time and SP proportion did not influence the quality or functionality of stored sex-sorted spermatozoa. In conclusion, a holding time as long as 24h before sorting did not negatively affect sex sorting efficiency or the ability of sorted boar spermatozoa to tolerate long-term liquid storage. A high proportion of SP (50%) in the semen samples before sorting reduced the number of ejaculates to be sorted and negatively influenced the sorting efficiency, but did not affect the ability of sex-sorted spermatozoa to tolerate liquid

  11. Preparing Scientists for Scientific Careers: Broader Impacts from an NSF CAREER Award

    NASA Astrophysics Data System (ADS)

    Crosby, Alfred

    2008-03-01

    The scientific focus of my NSF CAREER Award is the impact of patterns, topographical and surface chemical in design, on the adhesion of soft polymer interfaces. Although this topic has provided a strong foundation for the mentoring and training of graduate students, the primary broader impacts of my award have focused on the development of ``soft'' skills in graduate and post-doctoral researchers in STEM disciplines. I have developed a course on ``Scientific and Engineering Management,'' which provides an open forum for students to explore the skills that, in many ways, define successful careers for many scientists. Topics include: leadership, proposal writing, group management, communication in diverse environments, and ethics. In this presentation, I highlight the primary phases of this program, how it meshes with scientific goals, and general statements about the mission of education outreach within STEM disciplines.

  12. Structural analysis of wind turbine rotors for NSF-NASA Mod-0 wind power system

    NASA Technical Reports Server (NTRS)

    Spera, D. A.

    1976-01-01

    Preliminary estimates are presented of vibratory loads and stresses in hingeless and teetering rotors for the proposed NSF-NASA Mod-0 wind power system. Preliminary blade design utilizes a tapered tubular aluminum spar which supports nonstructural aluminum ribs and skin and is joined to the rotor hub by a steel shank tube. Stresses in the shank of the blade are calculated for static, rated, and overload operating conditions. Blade vibrations were limited to the fundamental flapping modes, which were elastic cantilever bending for hingeless rotor blades and rigid-body rotation for teetering rotor blades. The MOSTAB-C computer code was used to calculate aerodynamic and mechanical loads. The teetering rotor has substantial advantages over the hingeless rotor with respect to shank stresses, fatigue life, and tower loading. The hingeless rotor analyzed does not appear to be structurally stable during overloads.

  13. Joint DOE/NSF workshop on flow of particulates and fluids. Proceedings

    SciTech Connect

    Plasynski, S.I.; Peters, W.C.; Roco, M.C.

    1991-12-31

    These proceedings are the result of the third DOE-NSF Workshop on fundamental research in the area of particulate two-phase flow and granular flow. The present collection of 23 contributions from universities and national laboratories is based on research projects sponsored by either the Department of Energy or the National Science Foundation. These papers illustrate some of the latest advancements in theory, simulations, and experiments. The papers from the Workshop held October 22--24, 1991 have been separated into three basic areas: experiments, theory, and numerical simulations. A list of attendees at the workshop is included at the end of the proceedings. Topics discussed include multiphase flow, slurry flow, particle fluidization, properties of suspensions, boundary value problems, numerical simulation. (VC)

  14. Joint DOE/NSF workshop on flow of particulates and fluids

    SciTech Connect

    Plasynski, S.I.; Peters, W.C. ); Roco, M.C. )

    1991-01-01

    These proceedings are the result of the third DOE-NSF Workshop on fundamental research in the area of particulate two-phase flow and granular flow. The present collection of 23 contributions from universities and national laboratories is based on research projects sponsored by either the Department of Energy or the National Science Foundation. These papers illustrate some of the latest advancements in theory, simulations, and experiments. The papers from the Workshop held October 22--24, 1991 have been separated into three basic areas: experiments, theory, and numerical simulations. A list of attendees at the workshop is included at the end of the proceedings. Topics discussed include multiphase flow, slurry flow, particle fluidization, properties of suspensions, boundary value problems, numerical simulation. (VC)

  15. Joint DOE/NSF workshop on flow of particulates and fluids

    NASA Astrophysics Data System (ADS)

    Plasynski, S. I.; Peters, W. C.; Roco, Mike C.

    These proceedings are the result of the third DOE-NSF Workshop on fundamental research in the area of particulate two-phase flow and granular flow. The present collection of 23 contributions from universities and national laboratories is based on research projects sponsored by either the Department of Energy or the National Science Foundation. These papers illustrate some of the latest advancements in theory, simulations, and experiments. The papers from the Workshop held October 22-24, 1991 have been separated into three basic areas: experiments, theory, and numerical simulations. A list of attendees at the workshop is included at the end of the proceedings. Topics discussed include multiphase flow, slurry flow, particle fluidization, properties of suspensions, boundary value problems, and numerical simulation.

  16. Proceedings: Joint DOE/NSF Workshop on flow of particulates and fluids

    SciTech Connect

    Not Available

    1993-12-31

    These proceedings are the result of the Fifth DOR-NSF Workshop on fundamental research in the area of particulate two-phase flow and granular flow. The present collection of twenty contributions from universities and national laboratories is based on research projects sponsored by either the Department of Energy or the National Science Foundation. These papers illustrate some of the latest advances in theory, simulations, and experiments. The papers from the Workshop held September 29--October 1, 1993 have been separated into three basic areas: experiments, theory, and numerical simulations. A list of attendees at the workshop is included at the end of the proceedings. Selected papers have been indexed separately for inclusion in the Energy Science and Technology Database.

  17. Improving Science Teacher Preparation through the APS PhysTEC and NSF Noyce Programs

    NASA Astrophysics Data System (ADS)

    Williams, Tasha; Tyler, Micheal; van Duzor, Andrea; Sabella, Mel

    2013-03-01

    Central to the recruitment of students into science teaching at a school like CSU, is a focus on the professional nature of teaching. The purpose of this focus is twofold: it serves to change student perceptions about teaching and it prepares students to become teachers who value continued professional development and value the science education research literature. The Noyce and PhysTEC programs at CSU place the professional nature of teaching front and center by involving students in education research projects, paid internships, attendance at conferences, and participation in a new Teacher Immersion Institute and a Science Education Journal Reading Class. This poster will focus on specific components of our teacher preparation program that were developed through these two programs. In addition we will describe how these new components provide students with diverse experiences in the teaching of science to students in the urban school district. Supported by the NSF Noyce Program (0833251) and the APS PhysTEC Program.

  18. Crossing Borders to Advance the Frontier: NSF's Role in International Outreach

    NASA Astrophysics Data System (ADS)

    Bement, Arden

    2006-04-01

    The globalization of today's science and engineering is unprecedented. Ideas and discoveries emerge around the world and are transmitted instantaneously. Skills and capabilities are moving to new venues. We can view this free flow of investment and intellectual capital not only as a challenge, but also as an opportunity to form partnerships that integrate our strengths with those of other cultures and economies. As a nation, we can seek additional ways to become a valued partner in the global arena. We can train scientists and engineers that are not only technically competent but also skilled in cross-disciplinary, multi-cultural collaborations. NSF is committed to building bridges across borders to pursue these goals and collaboratively advance the frontiers of science and engineering.

  19. Structural analysis of wind turbine rotors for NSF-NASA Mod-0 wind power system

    NASA Technical Reports Server (NTRS)

    Spera, D. A.

    1976-01-01

    Preliminary estimates are presented of vibratory loads and stresses in hingeless and teetering rotors for the proposed NSF-NASA Mod-0 wind power system. Preliminary blade design utilizes a tapered tubular aluminum spar which supports nonstructural aluminum ribs and skin and is joined to the rotor hub by a steel shank tube. Stresses in the shank of the blade are calculated for static, rated, and overload operating conditions. Blade vibrations were limited to the fundamental flapping modes, which were elastic cantilever bending for hingeless rotor blades and rigid-body rotation for teetering rotor blades. The MOSTAB-C computer code was used to calculate aerodynamic and mechanical loads. The teetering rotor has substantial advantages over the hingeless rotor with respect to shank stresses, fatigue life, and tower loading. The hingeless rotor analyzed does not appear to be structurally stable during overloads.

  20. Geoscience Education Programs in the NSF Division of Undergraduate Education: Different Acronyms with Similar Intent

    NASA Astrophysics Data System (ADS)

    Singer, J.; Ryan, J. G.

    2014-12-01

    For the past three decades, the National Science Foundation's (NSF) Division of Undergraduate Education (DUE) has administered a succession of programs intended to improve undergraduate STEM education for all students. The IUSE (Improving Undergraduate STEM Education) program is the latest program in this succession, and reflects an expanded, NSF-wide effort to make sustainable improvements in STEM education on a national scale. The origins and thinking behind IUSE can be in part traced back to precursor programs including: ILI (Instrumentation and Laboratory Improvement), CCD (Course and Curriculum Development), UFE (Undergraduate Faculty Enhancement), CCLI (Course, Curriculum and Laboratory Improvement), and TUES (Transforming Undergraduate Education in STEM), all of which sought to support faculty efforts to investigate and improve curriculum and instructional practice in undergraduate STEM education, and to disseminate effective STEM educational practices for broad adoption. IUSE, like its predecessor programs, is open to all STEM fields, and as such is intended to support improvements in geoscience education, spanning the atmospheric, ocean, and Earth sciences, as well as in environmental science, GIS science, climate change and sustainability/resilience. An emphasis on discipline-based research on learning that had origins in the CCLI and TUES programs is a new priority area in IUSE, with the ambition that projects will take advantage of the integrated expertise of domain scientists, educational practioners, and experts in learning science. We trace and describe the history of undergraduate education efforts with an emphasis placed on the recently introduced IUSE program. Understanding the origin of DUE's IUSE program can provide insights for faculty interested in developing proposals for submission and gain a greater appreciation of trends and priorities within the division.

  1. A Five Year Summary of the NSF PAARE Project at SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, S. D.; Cash, J.; Hartmann, D.; Howell, S. B.; King, J. R.; Leising, M. D.; Mighell, K. J.; Smith, D. M.

    2013-01-01

    We summarize the progress made over five years of “A Partnership in Observational and Computational Astronomy (POCA)”. This NSF-funded project is part of the “Partnerships in Astronomy and Astrophysics Research and Education (PAARE)" program. Our partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory. Graduate fellowships provided by POCA as well as recruitment efforts on the national level have resulted in enrolling a total of four underrepresented minorities into the Ph.D. program in astronomy at Clemson. One of these has completed her M.S. in astronomy, while the others continue on toward the doctorate. We summarize the success and challenges of recruiting students into the undergraduate physics major with astronomy option at SC State and the support POCA has provided for nearly two dozen of them. Our summer REU program under POCA includes underrepresented students from across the country conducting research at each of our three institutions. Their work can be found elsewhere at this conference (Hernandez et al., Kurgatt et al. and Pugh et al.) Examples are given of our inquiry-based, laboratory exercises and web- based activities related to cosmology that have been developed with PAARE funding. We discuss our ground-based photometric and spectroscopic study of RV Tauri and Semiregular variables as well as our successful Kepler Cycle 2 and Cycle 4 study of a dozen of these objects . Support for the POCA project is provided by the NSF PAARE program to South Carolina State University under award AST-0750814 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under award NNX11AB82G. Additional details can be found at: http://physics.scsu.edu/paare/

  2. Update on the NSF PAARE Project at South Carolina State University

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, S. D.; Cash, J.; Hartmann, D.; Hinkle, K. H.; Howell, S. B.; King, J. R.; Leising, M. D.; Mighell, K. J.; Smith, D. M.

    2014-01-01

    We summarize the progress made over the past six years of “A Partnership in Observational and Computational Astronomy (POCA)”. This NSF-funded project is part of the “Partnerships in Astronomy and Astrophysics Research and Education (PAARE)" program. Our partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory. We summarize the results to date of our ongoing ground and space-based study of RV Tauri and Semiregular variables. We also examine our work on two unusual stars, R Coronae Borealis and XX Oph. The research on our Kepler objects is nearing completion and includes new international collaborators. We have developed 2 new cosmology labs and 5 new web simulations in the past year. These are being used in the science classes at South Carolina State University and are available to the community at our website listed below. Our success and the challenge of recruiting and retaining underrepresented students into the field as physics majors at South Carolina State University is reviewed. We recently graduated from Clemson a POCA student with a M.S. in astronomy who has since continued on for a Ph.D. in a related field, while another underrepresented student continues toward her Ph.D. in astronomy. Support for the POCA project is provided by the NSF PAARE program to South Carolina State University under award AST-0750814 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under awards NNX11AB82G and NNX13AC24G. Additional details can be found at: http://physics.scsu.edu/paare/

  3. Year 4 Of The NSF-funded PAARE Project At SC State

    NASA Astrophysics Data System (ADS)

    Walter, Donald K.; Brittain, S. D.; Cash, J. L.; Hartmann, D. H.; Howell, S. B.; King, J. R.; Leising, M. D.; Mayo, E. A.; Mighell, K. J.; Smith, D. M.

    2012-01-01

    We summarize the progress made through Year 4 of "A Partnership in Observational and Computational Astronomy (POCA)". This NSF-funded project is part of the "Partnerships in Astronomy and Astrophysics Research and Education (PAARE)" program. Our partnership includes South Carolina State University (a Historically Black College/University), Clemson University (a Ph.D. granting institution) and the National Optical Astronomy Observatory. Fellowships provided by POCA as well as recruitment efforts on the national level have resulted in enrolling a total of four underrepresented minorities into the Ph.D. program in astronomy at Clemson. We report on the success and challenges to recruiting students into the undergraduate physics major with astronomy option at SC State. Our summer REU program under POCA includes underrepresented students from across the country conducting research at each of our three institutions. Examples are given of our inquiry-based, laboratory exercises and web- based activities related to cosmology that have been developed with PAARE funding. We discuss our ground-based photometric and spectroscopic study of RV Tauri and Semi-Regular variables which has been expanded to include successful Cycle 2 Kepler observations of a dozen of these objects reported elsewhere at this conference (see D.K. Walter, et.al.). Support for the POCA project is provided by the NSF PAARE program to South Carolina State University under award AST-0750814 as well as resources and support provided by Clemson University and the National Optical Astronomy Observatory. Support for the Kepler observations is provided by NASA to South Carolina State University under award NNX11AB82G.

  4. Disentangling Dimensions in the Dimensional Change Card-Sorting Task

    ERIC Educational Resources Information Center

    Kloo, Daniela; Perner, Josef

    2005-01-01

    The dimensional change card-sorting task (DCCS task) is frequently used to assess young children's executive abilities. However, the source of children's difficulty with this task is still under debate. In the standard DCCS task, children have to sort, for example, test cards with a red cherry or a blue banana into two boxes marked with target…

  5. Processes of Overall Similarity Sorting in Free Classification

    ERIC Educational Resources Information Center

    Milton, Fraser; Longmore, Christopher A.; Wills, A. J.

    2008-01-01

    The processes of overall similarity sorting were investigated in 5 free classification experiments. Experiments 1 and 2 demonstrated that increasing time pressure can reduce the likelihood of overall similarity categorization. Experiment 3 showed that a concurrent load also reduced overall similarity sorting. These findings suggest that overall…

  6. Real-Time Implementation of a Color Sorting System

    Treesearch

    Srikathyanyani Srikanteswara; Qiang Lu; William King; Thomas Drayer; Richard Conners; D. Earl Kline; Philip A. Araman

    1997-01-01

    Wood edge glued panels are used extensively in the furniture and cabinetry industries. They are used to make doors, tops, and sides of solid wood furniture and cabinets. Since lightly stained furniture and cabinets are gaining in popularity, there is an increasing demand to color sort the parts used to make these edge glued panels. The goal of the sorting processing is...

  7. Disentangling Dimensions in the Dimensional Change Card-Sorting Task

    ERIC Educational Resources Information Center

    Kloo, Daniela; Perner, Josef

    2005-01-01

    The dimensional change card-sorting task (DCCS task) is frequently used to assess young children's executive abilities. However, the source of children's difficulty with this task is still under debate. In the standard DCCS task, children have to sort, for example, test cards with a red cherry or a blue banana into two boxes marked with target…

  8. Supramolecular fibres: Self-sorting shows its true colours

    NASA Astrophysics Data System (ADS)

    Draper, Emily R.; Adams, Dave J.

    2016-08-01

    Self-sorting events in supramolecular assembly lead to complex systems that are attractive for the design of functional materials, but have remained difficult to understand and control. Now, the growth of self-sorted supramolecular nanofibres has been elucidated by direct imaging through real-time in situ confocal microscopy.

  9. Surface free energy activated high-throughput cell sorting.

    PubMed

    Zhang, Xinru; Zhang, Qian; Yan, Tao; Jiang, Zeyi; Zhang, Xinxin; Zuo, Yi Y

    2014-09-16

    Cell sorting is an important screening process in microbiology, biotechnology, and clinical research. Existing methods are mainly based on single-cell analysis as in flow cytometric and microfluidic cell sorters. Here we report a label-free bulk method for sorting cells by differentiating their characteristic surface free energies (SFEs). We demonstrated the feasibility of this method by sorting model binary cell mixtures of various bacterial species, including Pseudomonas putida KT2440, Enterococcus faecalis ATCC 29212, Salmonella Typhimurium ATCC 14028, and Escherichia coli DH5α. This method can effectively separate 10(10) bacterial cells within 30 min. Individual bacterial species can be sorted with up to 96% efficiency, and the cell viability ratio can be as high as 99%. In addition to its capacity of sorting evenly mixed bacterial cells, we demonstrated the feasibility of this method in selecting and enriching cells of minor populations in the mixture (presenting at only 1% in quantity) to a purity as high as 99%. This SFE-activated method may be used as a stand-alone method for quickly sorting a large quantity of bacterial cells or as a prescreening tool for microbial discrimination. Given its advantages of label-free, high-throughput, low cost, and simplicity, this SFE-activated cell sorting method has potential in various applications of sorting cells and abiotic particles.

  10. The PreferenSort: A Holistic Instrument for Career Counseling

    ERIC Educational Resources Information Center

    Amit, Adi; Sagiv, Lilach

    2013-01-01

    We present the PreferenSort, a career counseling instrument that derives counselees' vocational interests from their preferences among occupational titles. The PreferenSort allows for a holistic decision process, while taking into account the full complexity of occupations and encouraging deliberation about one's preferences and acceptable…

  11. Processes of Overall Similarity Sorting in Free Classification

    ERIC Educational Resources Information Center

    Milton, Fraser; Longmore, Christopher A.; Wills, A. J.

    2008-01-01

    The processes of overall similarity sorting were investigated in 5 free classification experiments. Experiments 1 and 2 demonstrated that increasing time pressure can reduce the likelihood of overall similarity categorization. Experiment 3 showed that a concurrent load also reduced overall similarity sorting. These findings suggest that overall…

  12. Sorting: Groups and Graphs. Used Numbers. Grades 2-3.

    ERIC Educational Resources Information Center

    Russell, Susan Jo; Corwin, Rebecca B.

    A unit of study that introduces sorting and classification as a way of organizing data is presented. Suitable for students in grades 2 and 3, it provides a foundation for further work in statistics and data analysis. The investigations may extend from one to five class sessions and are grouped into three parts: "Introduction to Sorting"; "Sorting…

  13. Sediment sorting at a side channel bifurcation

    NASA Astrophysics Data System (ADS)

    van Denderen, Pepijn; Schielen, Ralph; Hulscher, Suzanne

    2017-04-01

    Side channels have been constructed to reduce the flood risk and to increase the ecological value of the river. In various Dutch side channels large aggradation in these channels occurred after construction. Measurements show that the grain size of the deposited sediment in the side channel is smaller than the grain size found on the bed of the main channel. This suggest that sorting occurs at the bifurcation of the side channel. The objective is to reproduce with a 2D morphological model the fining of the bed in the side channel and to study the effect of the sediment sorting on morphodynamic development of the side channel. We use a 2D Delft3D model with two sediment fractions. The first fraction corresponds with the grain size that can be found on the bed of the main channel and the second fraction corresponds with the grain size found in the side channel. With the numerical model we compute several side channel configurations in which we vary the length and the width of the side channel, and the curvature of the upstream channel. From these computations we can derive the equilibrium state and the time scale of the morphodynamic development of the side channel. Preliminary results show that even when a simple sediment transport relation is used, like Engelund & Hansen, more fine sediment enters the side channel than coarse sediment. This is as expected, and is probably related to the bed slope effects which are a function of the Shields parameter. It is expected that by adding a sill at the entrance of the side channel the slope effect increases. This might reduce the amount of coarse sediment which enters the side channel even more. It is unclear whether the model used is able to reproduce the effect of such a sill correctly as modelling a sill and reproducing the correct hydrodynamic and morphodynamic behaviour is not straightforward in a 2D model. Acknowledgements: This research is funded by STW, part of the Dutch Organization for Scientific Research under

  14. ArfGAPs: key regulators for receptor sorting

    PubMed Central

    Shiba, Yoko; Randazzo, Paul A.

    2015-01-01

    Mammalian cells have many membranous organelles that require proper composition of proteins and lipids. Cargo sorting is a process required for transporting specific proteins and lipids to appropriate organelles, and if this process is disrupted, organelle function as well as cell function is disrupted. ArfGAP family proteins have been found to be critical for receptor sorting. In this review, we summarize our recent knowledge about the mechanism of cargo sorting that require function of ArfGAPs in promoting the formation of transport vesicles, and discuss the involvement of specific ArfGAPs for the sorting of a variety of receptors, such as MPR, EGFR, TfR, Glut4, TRAIL-R1/DR4, M5-muscarinic receptor, c-KIT, rhodopsin and β1-integrin. Given the importance of many of these receptors to human disease, the studies of ArfGAPs may provide novel therapeutic strategies in addition to providing mechanistic insight of receptor sorting. PMID:26046097

  15. The riddle of the plant vacuolar sorting receptors.

    PubMed

    Masclaux, F G; Galaud, J-P; Pont-Lezica, R

    2005-12-01

    Proteins synthesized on membrane-bound ribosomes are sorted at the Golgi apparatus level for delivery to various cellular destinations: the plasma membrane or the extracellular space, and the lytic vacuole or lysosome. Sorting involves the assembly of vesicles, which preferentially package soluble proteins with a common destination. The selection of proteins for a particular vesicle type involves the recognition of proteins by specific receptors, such as the vacuolar sorting receptors for vacuolar targeting. Most eukaryotic organisms have one or two receptors to target proteins to the lytic vacuole. Surprisingly, plants have several members of the same family, seven in Arabidopsis thaliana. Why do plants have so many proteins to sort soluble proteins to their respective destinations? The presence of at least two types of vacuoles, lytic and storage, seems to be a partial answer. In this review we analyze the last experimental evidence supporting the presence of different subfamilies of plant vacuolar sorting receptors.

  16. Categorizing variations of student-implemented sorting algorithms

    NASA Astrophysics Data System (ADS)

    Taherkhani, Ahmad; Korhonen, Ari; Malmi, Lauri

    2012-06-01

    In this study, we examined freshmen students' sorting algorithm implementations in data structures and algorithms' course in two phases: at the beginning of the course before the students received any instruction on sorting algorithms, and after taking a lecture on sorting algorithms. The analysis revealed that many students have insufficient understanding of implementing sorting algorithms. For example, they include unnecessary swaps in their Insertion or Selection sort implementations resulting in more complicated and inefficient code. Based on the data, we present a categorization of these types of variations and discuss the implications of the results. In addition, we introduce an instrument to recognize these algorithms automatically. This is done in terms of white-box testing. Our aim is to develop an automatic assessment system to help teachers in the burden of marking students' assignments and give feedback to the students on their algorithmic solutions. We outline how the presented results can be used to develop the instrument further.

  17. Chromosome photoinactivation, a new method for high speed chromosome sorting

    SciTech Connect

    Martin, J.C.; Park, M.; Han, K.T.; Cram, L.S. )

    1993-01-01

    A new optical high-speed chromosome sorting concept is under development which relies on chromosome inactivation rather than droplet sorting to meet the demands of large volume sorting for cloning into large insert vectors. Inactivation can be achieved by photosensitizing and cross-linking metaphase chromosomes. By eliminating the need to create droplets, sorting rates 50 to 100 times faster than the sorting rates of commercial sorters will be achieved. Preliminary experiments using 8-methoxy psoralen in combination with UV doses of about 20 kJ/m2 have shown that: (1) DNA is cross-linked and remains double stranded even under denaturing conditions, (2) the ability of psoralen treated plasmid DNA to transect E. coli XL1-Blue cells is totally blocked following UV exposure, and (3) an average of one interstrand cross-link per 6 kb is produced with these UV doses.

  18. Regular expression order-sorted unification and matching

    PubMed Central

    Kutsia, Temur; Marin, Mircea

    2015-01-01

    We extend order-sorted unification by permitting regular expression sorts for variables and in the domains of function symbols. The obtained signature corresponds to a finite bottom-up unranked tree automaton. We prove that regular expression order-sorted (REOS) unification is of type infinitary and decidable. The unification problem presented by us generalizes some known problems, such as, e.g., order-sorted unification for ranked terms, sequence unification, and word unification with regular constraints. Decidability of REOS unification implies that sequence unification with regular hedge language constraints is decidable, generalizing the decidability result of word unification with regular constraints to terms. A sort weakening algorithm helps to construct a minimal complete set of REOS unifiers from the solutions of sequence unification problems. Moreover, we design a complete algorithm for REOS matching, and show that this problem is NP-complete and the corresponding counting problem is #P-complete. PMID:26523088

  19. Cell sorting using efficient light shaping approaches

    NASA Astrophysics Data System (ADS)

    Bañas, Andrew; Palima, Darwin; Villangca, Mark; Glückstad, Jesper

    2016-03-01

    Early detection of diseases can save lives. Hence, there is emphasis in sorting rare disease-indicating cells within small dilute quantities such as in the confines of lab-on-a-chip devices. In our work, we use optical forces to isolate red blood cells detected by machine vision. This approach is gentler, less invasive and more economical compared to conventional FACS systems. As cells are less responsive to plastic or glass beads commonly used in the optical manipulation literature, and since laser safety would be an issue in clinical use, we develop efficient approaches in utilizing lasers and light modulation devices. The Generalized Phase Contrast (GPC) method that can be used for efficiently illuminating spatial light modulators or creating well-defined contiguous optical traps is supplemented by diffractive techniques capable of integrating the available light and creating 2D or 3D beam distributions aimed at the positions of the detected cells. Furthermore, the beam shaping freedom provided by GPC can allow optimizations in the beam's propagation and its interaction with the catapulted cells.

  20. Nanoplasmonic lenses for bacteria sorting (Presentation Recording)

    NASA Astrophysics Data System (ADS)

    Zhu, Xiangchao; Yanik, Ahmet A.

    2015-08-01

    We demonstrate that patches of two dimensional arrays of circular plasmonic nanoholes patterned on gold-titanium thin film enables subwavelength focusing of visible light in far field region. Efficient coupling of the light with the excited surface plasmon at metal dielectric interface results in strong light transmission. As a result, surface plasmon plays an important role in the far field focusing behavior of the nanohole-aperture patches device. Furthermore, the focal length of the focused beam was found to be predominantly dependent on the overall size of the patch, which is in good agreement with that calculated by Rayleigh-Sommerfield integral formula. The focused light beam can be utilized to separate bio-particles in the dynamic range from 0.1 μm to 1 μm through mainly overcoming the drag force induced by fluid flow. In our proposed model, focused light generated by our plasmonic lenses will push the larger bio-particles in size back to the source of fluid flow and allow the smaller particles to move towards the central aperture of the patch. Such a new kind of plasmonic lenses open up possibility of sorting bacterium-like particles with plasmonic nanolenses, and also represent a promising tool in the field of virology.

  1. Automated sorting of mixed mode environment's data.

    SciTech Connect

    Roberts, Nathaniel David; Cap, Jerome Scot

    2005-03-01

    Transportation of sensitive flight hardware requires information about the expected transportation environment as well as the actual transportation environment during the part's movement--typically vibration with superimposed intermittent shocks. Each data type has different sampling, processing, and specification requirements. Analyzing shock data requires high sampling rates and leads to large file sizes. A barrier to analyzing data has been the vast quantity of information acquired. Previous approaches have focused either on manually separating data or on selectively recording extreme data. The use of an automated approach allows for quickly verifying vibration and shock levels while retaining the robustness of the underlying data set. Further, the automated approach allows the environments engineer to select criteria for shock/vibration sorting, which removes the subjectivity associated with visual differentiation. This automated technique evaluated several vehicles over four different road conditions in the same time that one data set could have been processed using visual discrimination. Automated processing of satellite shipment vibration and shock data is made thoroughly and objectively vs. traditional shock and tilt indicators. The automated technique could also be useful in processing large amounts of on-orbit data for changes in vibration signature.

  2. Microfluidic-chip platform for cell sorting

    NASA Astrophysics Data System (ADS)

    Malik, Sarul; Balyan, Prerna; Akhtar, J.; Agarwal, Ajay

    2016-04-01

    Cell sorting and separation are considered to be very crucial preparatory steps for numerous clinical diagnostics and therapeutics applications in cell biology research arena. Label free cell separation techniques acceptance rate has been increased to multifold by various research groups. Size based cell separation method focuses on the intrinsic properties of the cell which not only avoids clogging issues associated with mechanical and centrifugation filtration methods but also reduces the overall cost for the process. Consequentially flow based cell separation method for continuous flow has attracted the attention of millions. Due to the realization of structures close to particle size in micro dimensions, the microfluidic devices offer precise and rapid particle manipulation which ultimately leads to an extraordinary cell separation results. The proposed microfluidic device is fabricated to separate polystyrene beads of size 1 µm, 5 µm, 10 µm and 20 µm. The actual dimensions of blood corpuscles were kept in mind while deciding the particle size of polystyrene beads which are used as a model particles for study.

  3. An investigation of the effect of membrane curvature on transmembrane-domain dependent protein sorting in lipid bilayers

    PubMed Central

    Fossati, Matteo; Goud, Bruno; Borgese, Nica; Manneville, Jean-Baptiste

    2014-01-01

    Sorting of membrane proteins within the secretory pathway of eukaryotic cells is a complex process involving discrete sorting signals as well as physico-chemical properties of the transmembrane domain (TMD). Previous work demonstrated that tail-anchored (TA) protein sorting at the interface between the Endoplasmic Reticulum (ER) and the Golgi complex is exquisitely dependent on the length and hydrophobicity of the transmembrane domain, and suggested that an imbalance between TMD length and bilayer thickness (hydrophobic mismatch) could drive long TMD-containing proteins into curved membrane domains, including ER exit sites, with consequent export of the mismatched protein out of the ER. Here, we tested a possible role of curvature in TMD-dependent sorting in a model system consisting of Giant Unilamellar Vesicles (GUVs) from which narrow membrane tubes were pulled by micromanipulation. Fluorescent TA proteins differing in TMD length were incorporated into GUVs of uniform lipid composition or made of total ER lipids, and TMD-dependent sorting and diffusion, as well as the bending rigidity of bilayers made of microsomal lipids, were investigated. Long and short TMD-containing constructs were inserted with similar orientation, diffused equally rapidly in GUVs and in tubes pulled from GUVs, and no difference in their final distribution between planar and curved regions was detected. These results indicate that curvature alone is not sufficient to drive TMD-dependent sorting at the ER-Golgi interface, and set the basis for the investigation of the additional factors that must be required. PMID:25210649

  4. An investigation of the effect of membrane curvature on transmembrane-domain dependent protein sorting in lipid bilayers.

    PubMed

    Fossati, Matteo; Goud, Bruno; Borgese, Nica; Manneville, Jean-Baptiste

    2014-01-01

    Sorting of membrane proteins within the secretory pathway of eukaryotic cells is a complex process involving discrete sorting signals as well as physico-chemical properties of the transmembrane domain (TMD). Previous work demonstrated that tail-anchored (TA) protein sorting at the interface between the Endoplasmic Reticulum (ER) and the Golgi complex is exquisitely dependent on the length and hydrophobicity of the transmembrane domain, and suggested that an imbalance between TMD length and bilayer thickness (hydrophobic mismatch) could drive long TMD-containing proteins into curved membrane domains, including ER exit sites, with consequent export of the mismatched protein out of the ER. Here, we tested a possible role of curvature in TMD-dependent sorting in a model system consisting of Giant Unilamellar Vesicles (GUVs) from which narrow membrane tubes were pulled by micromanipulation. Fluorescent TA proteins differing in TMD length were incorporated into GUVs of uniform lipid composition or made of total ER lipids, and TMD-dependent sorting and diffusion, as well as the bending rigidity of bilayers made of microsomal lipids, were investigated. Long and short TMD-containing constructs were inserted with similar orientation, diffused equally rapidly in GUVs and in tubes pulled from GUVs, and no difference in their final distribution between planar and curved regions was detected. These results indicate that curvature alone is not sufficient to drive TMD-dependent sorting at the ER-Golgi interface, and set the basis for the investigation of the additional factors that must be required.

  5. CellSort: a support vector machine tool for optimizing fluorescence-activated cell sorting and reducing experimental effort.

    PubMed

    Yu, Jessica S; Pertusi, Dante A; Adeniran, Adebola V; Tyo, Keith E J

    2017-03-15

    High throughput screening by fluorescence activated cell sorting (FACS) is a common task in protein engineering and directed evolution. It can also be a rate-limiting step if high false positive or negative rates necessitate multiple rounds of enrichment. Current FACS software requires the user to define sorting gates by intuition and is practically limited to two dimensions. In cases when multiple rounds of enrichment are required, the software cannot forecast the enrichment effort required. We have developed CellSort, a support vector machine (SVM) algorithm that identifies optimal sorting gates based on machine learning using positive and negative control populations. CellSort can take advantage of more than two dimensions to enhance the ability to distinguish between populations. We also present a Bayesian approach to predict the number of sorting rounds required to enrich a population from a given library size. This Bayesian approach allowed us to determine strategies for biasing the sorting gates in order to reduce the required number of enrichment rounds. This algorithm should be generally useful for improve sorting outcomes and reducing effort when using FACS. Source code available at http://tyolab.northwestern.edu/tools/ . k-tyo@northwestern.edu. Supplementary data are available at Bioinformatics online.

  6. A Review of the Efficacy and Role of the Card Sort Exercise in the Treatment of Bipolar Disorder.

    PubMed

    Tern, Paul Jie Wen; Abdaal, Ali; Tobin, Jake; Macfarland, Katherine; Hunt, Molly; Agius, Mark

    2017-09-01

    The current card sort exercise described by Agius et al. in 2006 provides a tool for patients and their families to characterise the temporal pattern of occurrence of both stereotyped and idiosyncratic prodromal symptoms that serve as early warning signs predicting a relapse. This 'individual relapse signature' is highly specific for bipolar relapse, and aids identification of a relapse such that patients can be channeled into appropriate early intervention pathways. This review examines the role of the card sort exercise in the treatment of bipolar disorder, and evaluates the evidence for its efficacy. Few studies involve the card sort exercise, and those that do paired it with other early therapeutic interventions, such that it was difficult to assess the true contribution of the card sort exercise alone to outcome measures such as time-to-relapse or hospitalisation avoidance. We went back to first principles and evaluated the literature concerning various factors necessary for the card sort exercise to be useful. We concluded that there is good evidence that replicable relapse signatures exist as early warning signs for bipolar relapse, and that a certain subgroup of patients and their families can reliably use these signs to seek help and activate therapeutic interventions to abort the relapse episode. Early intervention is both possible and efficacious, which makes early identification of relapse yet more important. The card sort is of less use for depressive relapses, where prodromal symptoms are harder to pinpoint. The card sort exercise is useful in elucidating the relapse signature for each patient, which can then be used in psychoeducation or identification of future relapse episodes. However, more research is needed directly assessing the usefulness of the card sort exercise in helping patients and their families gain insight into the possibility of an imminent relapse.

  7. Spatial Sorting Drives Morphological Variation in the Invasive Bird, Acridotheris tristis

    PubMed Central

    Berthouly-Salazar, Cécile; van Rensburg, Berndt J.; Le Roux, Johannes J.; van Vuuren, Bettine J.; Hui, Cang

    2012-01-01

    The speed of range expansion in many invasive species is often accelerating because individuals with stronger dispersal abilities are more likely to be found at the range front. This ‘spatial sorting’ of strong dispersers will drive the acceleration of range expansion. In this study, we test whether the process of spatial sorting is at work in an invasive bird population (Common myna, Acridotheris tristis) in South Africa. Specifically, we sampled individuals across its invasive range and compared morphometric measurements relevant and non-relevant to the dispersal ability. Besides testing for signals of spatial sorting, we further examined the effect of environmental factors on morphological variations. Our results showed that dispersal-relevant traits are significantly correlated with distance from the range core, with strong sexual dimorphism, indicative of sex-biased dispersal. Morphological variations were significant in wing and head traits of females, suggesting females as the primary dispersing sex. In contrast, traits not related to dispersal such as those associated with foraging showed no signs of spatial sorting but were significantly affected by environmental variables such as the vegetation and the intensity of urbanisation. When taken together, our results support the role of spatial sorting in facilitating the expansion of Common myna in South Africa despite its low propensity to disperse in the native range. PMID:22693591

  8. Improvement of phytoplankton culture isolation using single cell sorting by flow cytometry.

    PubMed

    Marie, Dominique; Le Gall, Florence; Edern, Roseline; Gourvil, Priscillia; Vaulot, Daniel

    2017-04-01

    Flow cytometry provides a tool to physically sort single algal cells in order to obtain clonal cultures. During sorting, cells are submitted to physical stress factors such as high fluidic pressure, exposure to the laser beam, electrostatic charges, deflection through high voltage fields, and collisions with container surfaces. All of these can damage the cells of interest and success rates for initiation of cultures from flow-sorted cells are generally very low. We found that the addition of bovine serum albumin in the culture medium into which cells were sorted drastically improved the success of initiation of pico- and nano-eukaryotic phytoplankton strains. Adding a mixture of antibiotics (Penicillin, Neomycin, Streptomycin) to the medium in order to slow down bacterial growth further improved culture development. This approach was successfully used to isolate taxonomically diverse strains, including novel taxa, from a fresh sample obtained in the English Channel and from enrichment cultures established during an Atlantic meridional transect cruise. We anticipate that these improvements will be useful to clone or purify existing cultures and to isolate novel cultures from oceanic samples. © 2016 Phycological Society of America.

  9. Solid- and gas-phase structures and spectroscopic and chemical properties of tris(pentafluorosulfanyl)amine, N(SF5)3, and bis(pentafluorosufanyl)aminyl radical, rad N(SF5)2

    NASA Astrophysics Data System (ADS)

    Nielsen, Jon B.; Zylka, Petra; Kronberg, Marc; Zeng, Xiaoqing; Robinson, Kerry D.; Bott, Simon G.; Zhang, Hongming; Atwood, Jerry L.; Oberhammer, Heinz; Willner, Helge; Thrasher, Joseph S.

    2017-03-01

    Tris(pentafluorosulfanyl)amine, N(SF5)3, and the bis(pentafluorosulfanyl)aminyl radical, rad N(SF5)2, have been synthesized and characterized by gas electron diffraction, single crystal XRD, NMR, EPR, FT-IR, Raman, and UV-vis spectroscopy, and by their thermal decompositions. The amine possesses a planar molecular structure of D3 symmetry with an unusually long Nsbnd S bond of 1.829(6) Å. The long Nsbnd S bonds are in accordance with the small Arrhenius activation barrier for the decay into rad N(SF5)2 and rad SF5 radicals of 6.9 kcal mol-1, and its half-life at room temperature is only 50 min. The aminyl radical possesses C2 symmetry with Nsbnd S = 1.692(4) Å and Ssbnd Nsbnd S = 135.1(5)°, and its structure is similar to that of FN(SF5)2. This radical is much more stable than the amine (half-life at room temperature is 130 min). Dimerization and formation of the corresponding hydrazine, (SF5)2NN(SF5)2, was not observed, nor was the nitrene:NSF5 or its isomer FNdbnd SF4.

  10. Heterogeneity within compulsive buyers: a Q-sort study.

    PubMed

    Thornhill, Kate; Kellett, Stephen; Davies, Jason

    2012-06-01

    This study investigated how compulsive buyers make sense of their excessive shopping behaviour to explore possible sources of heterogeneity between compulsive buyers. Twenty female participants met 'caseness' for compulsive buying (CB) on the CB Scale (CBS), prior to completing a Q-sort specifically related to their experiences of shopping. Participants provided details of occupation, income, and debt levels and completed two psychometric scales: the Hospital Anxiety and Depression Scale (HADS) and Yale Brown Obsessive Compulsive Scale-Shopping Version (YBOCS-SV). Principle component analysis (PCA) identified two groups within the compulsive buyers (labelled positive reinforcement and emotional distress) that explained 44% of the study variance. Ten women defined the positive reinforcement factor and tended to identify with pleasurable aspects of buying. Six women characterized the emotional distress factor and endorsed varied financial, emotional, and interpersonal difficulties associated with their CB. The emotional distress group carried significantly greater current debt levels and had significantly more severe CB. The study illustrates that compulsive buyers can relate to their 'symptoms' in dissimilar ways. The clinical implications of such heterogeneity are discussed, methodological shortcomings identified, and areas for future research indicated. ©2011 The British Psychological Society.

  11. Undergraduate Research as a Process for STEM Teaching and Learning Systemic Change: Lessons Learned from the Council on Undergraduate Research NSF CCLI and TUES Projects

    NASA Astrophysics Data System (ADS)

    Ambos, E. L.; Havholm, K. G.; Malachowski, M.; Osborn, J.; Karukstis, K.

    2013-12-01

    concerted efforts to affect policy, workload, tenure and promotion and resource issues, which are often core factors in any STEM education change process. Several systems are now connecting individual campus-based undergraduate research efforts more effectively, and tying undergraduate research to regional workforce and economic development programs. Many campus teams are moving their department and colleges toward curricular innovations that emphasize scaffolding undergraduate research throughout the undergraduate curriculum. An NSF EAGER/WIDER supplement to the CUR CCLI III award was received in October 2012 and expanded the scope of the project to include deeper study of the changes processes underway at each of the six systems and to tease out the factors that can either promote or retard expansion of undergraduate research as a teaching and learning paradigm. Lessons learned from one of the six systems, the University of Wisconsin, will be highlighted.

  12. Microfluidic EmbryoSort technology: towards in flow analysis, sorting and dispensing of individual vertebrate embryos

    NASA Astrophysics Data System (ADS)

    Fuad, Nurul M.; Wlodkowic, Donald

    2013-12-01

    The demand to reduce the numbers of laboratory animals has facilitated the emergence of surrogate models such as tests performed on zebrafish (Danio rerio) or African clawed frog's (Xenopus levis) eggs, embryos and larvae. Those two model organisms are becoming increasingly popular replacements to current adult animal testing in toxicology, ecotoxicology and also in drug discovery. Zebrafish eggs and embryos are particularly attractive for toxicological analysis due their size (diameter 1.6 mm), optical transparency, large numbers generated per fish and very straightforward husbandry. The current bottleneck in using zebrafish embryos for screening purposes is, however, a tedious manual evaluation to confirm the fertilization status and subsequent dispensing of single developing embryos to multitier plates to perform toxicity analysis. Manual procedures associated with sorting hundreds of embryos are very monotonous and as such prone to significant analytical errors due to operator's fatigue. In this work, we present a proofof- concept design of a continuous flow embryo sorter capable of analyzing, sorting and dispensing objects ranging in size from 1.5 - 2.5 mm. The prototypes were fabricated in polymethyl methacrylate (PMMA) transparent thermoplastic using infrared laser micromachining. The application of additive manufacturing processes to prototype Lab-on-a-Chip sorters using both fused deposition manufacturing (FDM) and stereolithography (SLA) were also explored. The operation of the device was based on a revolving receptacle capable of receiving, holding and positioning single fish embryos for both interrogation and subsequent sorting. The actuation of the revolving receptacle was performed using a DC motor and/or microservo motor. The system was designed to separate between fertilized (LIVE) and non-fertilized (DEAD) eggs, based on optical transparency using infrared (IR) emitters and receivers.

  13. Flow virometric sorting and analysis of HIV quasispecies from plasma

    PubMed Central

    Jones, Jennifer C.; Keele, Brandon F.; Jenkins, Lisa M. Miller; Demberg, Thorsten

    2017-01-01

    Flow cytometry is utilized extensively for cellular analysis, but technical limitations have prevented its routine application for characterizing virus. The recent introduction of nanoscale fluorescence-activated cytometric cell sorting now allows analysis of individual virions. Here, we demonstrate staining and sorting of infectious HIV. Fluorescent antibodies specific for cellular molecules found on budding virions were used to label CCR5-tropic Bal HIV and CXCR4-tropic NL4.3 HIV Env-expressing pseudovirions made in THP-1 cells (monocyte/macrophage) and H9 cells (T cells), respectively. Using a flow cytometer, we resolved the stained virus beyond isotype staining and demonstrated purity and infectivity of sorted virus populations on cells with the appropriate coreceptors. We subsequently sorted infectious simian/human immunodeficiency virus from archived plasma. Recovery was approximately 0.5%, but virus present in plasma was already bound to viral-specific IgG generated in vivo, likely contributing to the low yield. Importantly, using two broadly neutralizing HIV antibodies, PG9 and VRC01, we also sorted virus from archived human plasma and analyzed the sorted populations genetically and by proteomics, identifying the quasispecies present. The ability to sort infectious HIV from clinically relevant samples provides material for detailed molecular, genetic, and proteomic analyses applicable to future design of vaccine antigens and potential development of personalized treatment regimens. PMID:28239654

  14. Sortilin regulates sorting and secretion of Sonic hedgehog.

    PubMed

    Campbell, Charles; Beug, Shawn; Nickerson, Philip E B; Peng, Jimmy; Mazerolle, Chantal; Bassett, Erin A; Ringuette, Randy; Jama, Fadumo A; Morales, Carlos; Christ, Annabel; Wallace, Valerie A

    2016-10-15

    Sonic Hedgehog (Shh) is a secreted morphogen that is an essential regulator of patterning and growth. The Shh full-length protein undergoes autocleavage in the endoplasmic reticulum to generate the biologically active N-terminal fragment (ShhN), which is destined for secretion. We identified sortilin (Sort1), a member of the VPS10P-domain receptor family, as a new Shh trafficking receptor. We demonstrate that Sort-Shh interact by performing coimmunoprecipitation and proximity ligation assays in transfected cells and that they colocalize at the Golgi. Sort1 overexpression causes re-distribution of ShhN and, to a lesser extent, of full-length Shh to the Golgi and reduces Shh secretion. We show loss of Sort1 can partially rescue Hedgehog-associated patterning defects in a mouse model that is deficient in Shh processing, and we show that Sort1 levels negatively regulate anterograde Shh transport in axons in vitro and Hedgehog-dependent axon-glial interactions in vivo Taken together, we conclude that Shh and Sort1 can interact at the level of the Golgi and that Sort1 directs Shh away from the pathways that promote its secretion.

  15. Label-free density difference amplification-based cell sorting.

    PubMed

    Song, Jihwan; Song, Minsun; Kang, Taewook; Kim, Dongchoul; Lee, Luke P

    2014-11-01

    The selective cell separation is a critical step in fundamental life sciences, translational medicine, biotechnology, and energy harvesting. Conventional cell separation methods are fluorescent activated cell sorting and magnetic-activated cell sorting based on fluorescent probes and magnetic particles on cell surfaces. Label-free cell separation methods such as Raman-activated cell sorting, electro-physiologically activated cell sorting, dielectric-activated cell sorting, or inertial microfluidic cell sorting are, however, limited when separating cells of the same kind or cells with similar sizes and dielectric properties, as well as similar electrophysiological phenotypes. Here we report a label-free density difference amplification-based cell sorting (dDACS) without using any external optical, magnetic, electrical forces, or fluidic activations. The conceptual microfluidic design consists of an inlet, hydraulic jump cavity, and multiple outlets. Incoming particles experience gravity, buoyancy, and drag forces in the separation chamber. The height and distance that each particle can reach in the chamber are different and depend on its density, thus allowing for the separation of particles into multiple outlets. The separation behavior of the particles, based on the ratio of the channel heights of the inlet and chamber and Reynolds number has been systematically studied. Numerical simulation reveals that the difference between the heights of only lighter particles with densities close to that of water increases with increasing the ratio of the channel heights, while decreasing Reynolds number can amplify the difference in the heights between the particles considered irrespective of their densities.

  16. Microfluidic droplet sorting using integrated bilayer micro-valves

    NASA Astrophysics Data System (ADS)

    Chen, Yuncong; Tian, Yang; Xu, Zhen; Wang, Xinran; Yu, Sicong; Dong, Liang

    2016-10-01

    This paper reports on a microfluidic device capable of sorting microfluidic droplets utilizing conventional bilayer pneumatic micro-valves as sorting controllers. The device consists of two micro-valves placed symmetrically on two sides of a sorting area, each on top of a branching channel at an inclined angle with respect to the main channel. Changes in transmitted light intensity, induced by varying light absorbance by each droplet, are used to divert the droplet from the sorting area into one of the three outlet channels. When no valve is activated, the droplet flows into the outlet channel in the direction of the main channel. When one of the valves is triggered, the flexible membrane of valve will first be deflected. Once the droplet leaves the detection point, the deflected membrane will immediately return to its default flattened position, thereby exerting a drawing pressure on the droplet and deviating it from its original streamline to the outlet on the same side as the valve. This sorting method will be particularly suitable for numerous large-scale integrated microfluidic systems, where pneumatic micro-valves are already used. Only few structural modifications are needed to achieve droplet sorting capabilities in these systems. Due to the mechanical nature of diverting energy applied to droplets, the proposed sorting method may induce only minimal interference to biological species or microorganisms encapsulated inside the droplets that may accompany electrical, optical and magnetic-based techniques.

  17. Calibration and Field Deployment of the NSF G-V VCSEL Hygrometer

    NASA Astrophysics Data System (ADS)

    DiGangi, J. P.; O'Brien, A.; Diao, M.; Hamm, C.; Zhang, Q.; Beaton, S. P.; Zondlo, M. A.

    2012-12-01

    Cloud formation and dynamics have a significant influence on the Earth's radiative forcing budget, which illustrates the importance of clouds with respect to global climate. Therefore, an accurate understanding of the microscale processes dictating cloud formation is crucial for accurate computer modeling of global climate change. A critical tool for understanding these processes from an airborne platform is an instrument capable of measuring water vapor with both high accuracy and time, thus spatial, resolution. Our work focuses on an open-path, compact, vertical-cavity surface-emitting laser (VCSEL) absorption-based hygrometer, capable of 25 Hz temporal resolution, deployed on the NSF/NCAR Gulfstream-V aircraft platform. The open path nature of our instrument also helps to minimize sampling artifacts. We will discuss our efforts toward achieving within 5% accuracy over 5 orders of magnitude of water vapor concentrations. This involves an intercomparison of five independent calibration methods: ice surface saturators using an oil temperature bath, solvent slush baths (e.g. chloroform/LN2, water/ice), a research-grade frost point hygrometer, static pressure experiments, and Pt catalyzed hydrogen gas. This wide variety of available tools allows us to accurately constrain the calibrant water vapor concentrations both before and after the VCSEL hygrometer sampling chamber. For example, the mixing ratio as measured by research-grade frost point hygrometer after the VCSEL hygrometer agreed within 2% of the mixing ration expected from the water/ice bubbler source before the VCSEL over the temperature range -50°C to 20°C. Finally, due to the compact nature of our instrument, we are able to perform these calibrations simultaneously at the same temperatures (-80°C to 30°C) and pressures (150 mbar to 760 mbar) as sampled ambient air during a flight. This higher accuracy can significantly influence the science utilizing this data, which we will illustrate using

  18. Professional Development for Graduate Students through Internships at Federal Labs: an NSF/USGS Collaboration

    NASA Astrophysics Data System (ADS)

    Snow, E.; Jones, E.; Patino, L. C.; Wasserman, E.; Isern, A. R.; Davies, T.

    2016-12-01

    In 2013 the White House initiated an effort to coordinate STEM education initiatives across federal agencies. This idea spawned several important collaborations, one of which is a set of National Science Foundation programs designed to place graduate students in federal labs for 2-12 months of their Ph.D. training. The Graduate Research Internship Program (GRIP) and the Graduate Student Preparedness program (GSP) each have the goal of exposing PhD students to the federal work environment while expanding their research tools and mentoring networks. Students apply for supplementary support to their Graduate Research Fellowship (GRIP) or their advisor's NSF award (GSP). These programs are available at several federal agencies; the USGS is one partner. At the U.S. Geological Survey, scientists propose projects, which students can find online by searching USGS GRIP, or students and USGS scientists can work together to develop a research project. At NSF, projects are evaluated on both the scientific merit and the professional development opportunities they afford the student. The career development extends beyond the science (new techniques, data, mentors) into the professional activity of writing the proposal, managing the budget, and working in a new and different environment. The USGS currently has 18 GRIP scholars, including Madeline Foster-Martinez, a UC Berkeley student who spent her summer as a GRIP fellow at the USGS Pacific Coastal and Marine Science Center working with USGS scientist Jessica Lacy. Madeline's Ph.D. work is on salt marshes and she has studied geomorphology, accretion, and gas transport using a variety of research methods. Her GRIP fellowship allowed her to apply new data-gathering tools to the question of sediment delivery to the marsh, and build and test a model for sediment delivery along marsh edges. In addition, she gained professional skills by collaborating with a new team of scientists, running a large-scale field deployment, and

  19. An Analysis of NSF Geosciences Research Experience for Undergraduate Site Programs from 2009 through 2011

    NASA Astrophysics Data System (ADS)

    Rom, E. L.; Patino, L. C.; Weiler, S.; Sanchez, S. C.; Colon, Y.; Antell, L.

    2011-12-01

    The Research Experience for Undergraduate (REU) Program at the U.S. National Science Foundation (NSF) provides U.S. undergraduate students from any college or university the opportunity to conduct research at a different institution and gain a better understanding of research career pathways. The Geosciences REU Sites foster research opportunities in areas closely aligned with geoscience programs, particularly those related to earth, atmospheric and ocean sciences. The aim of this paper is to provide an overview of the Geosciences REU Site programs run in 2009 through 2011. A survey requesting information on recruitment methods, student demographics, enrichment activities, and fields of research was sent to the Principal Investigators of each of the active REU Sites. Over 70% of the surveys were returned with the requested information from about 50 to 60 sites each year. The internet is the most widely used mechanism to recruit participants, with personal communication as the second most important recruiting tool. The admissions rate for REU Sites in Geosciences varies from less than 10% to 50%, with the majority of participants being rising seniors and juniors. Many of the participants come from non-PhD granting institutions. Among the participants, gender distribution varies by discipline, with ocean sciences having a large majority of women and earth sciences having a majority of men. Regarding ethnic diversity, the REU Sites reflect the difficulty of attracting diverse students into Geosciences as a discipline; a large majority of participants are Caucasian and Asian students. Furthermore, participants from minority-serving institutions and community colleges constitute a small percentage of those taking part in these research experiences. The enrichment activities are very similar across the REU Sites, and mimic activities common to the scientific community, including intellectual exchange of ideas (lab meetings, seminars, and professional meetings

  20. An Analysis of NSF Geosciences 2009 Research Experience for Undergraduate Site Programs

    NASA Astrophysics Data System (ADS)

    Sanchez, S. C.; Patino, L. C.; Rom, E. L.; Weiler, S. C.

    2009-12-01

    The Research Experience for Undergraduate (REU) Program at the U.S. National Science Foundation (NSF) provides undergraduate students the opportunity to conduct research at different institutions and in areas that may not be available in their home campuses. The Geosciences REU Sites foster research opportunities in areas closely aligned with undergraduate majors and facilitates discovery of the multidisciplinary nature of the Geosciences. The aim of this paper is to provide an overview of the Geosciences REU Site programs run in 2009. A survey requesting information on recruitment methods, student demographics, enrichment activities, and fields of research was sent to the Principal Investigators of each of the 50 active REU Sites; over 70% of the surveys were returned with the requested information. The internet is the most widely used mechanism to recruit participants, but the survey did not distinguish among different tools like websites, emails, social networks, etc. The admissions rate for REU Sites in Geosciences varies from less than 10% to 50%, with the majority of participants being rising seniors and juniors. A few Sites include rising sophomores. At least 40% of the participants come from non-PhD granting institutions. Among the participants, gender distribution is balanced, with a slightly larger number of female participants. Regarding ethnic diversity, the REU Sites reflect the difficulty of attracting diverse students into Geosciences as a discipline; more than 75% of the participants are Caucasian and Asian students. Furthermore, participants from minority-serving institutions constitute a small percentage of those taking part in these research experiences. The enrichment activities are very similar across the REU Sites, and mimic well activities common to the scientific community, including intellectual exchange of ideas (lab meetings, seminars, and professional meetings), networking and social activities. There are some clear similarities among

  1. The U.S. NSF Ocean Observatories Initiative: A Modern Virtual Observatory

    NASA Astrophysics Data System (ADS)

    Orcutt, John; Vernon, Frank; Peach, Cheryl; Arrott, Matthew; Graybeal, John; Farcas, Claudiu; Farcas, Emilia; Krueger, Ingolf; Meisinger, Michael; Chave, Alan

    2010-05-01

    The NSF Ocean Observatories Initiative (OOI) began a five-year construction period in October 2009. The Consortium on Ocean Leadership (COL) manages the overall program with Implementing Organizations for Coastal/Global Scale Nodes (CGSN) at Woods Hole, Oregon State and Scripps; the Regional Cabled Network (RCN) at U of Washington and Cyberinfrastructure (CI) at UCSD and more than ten subcontractors. The NSF has made a commitment to support the observatory operations and maintenance for a 30-year period; a minimal period of time to measure physical, chemical and biological data over a length of time possibly sufficient to measure secular changes associated with climate and geodesy. The CI component is a substantial departure from previous approaches to data distribution and management. These innovations include the availability of data in near-real-time with latencies of seconds, open access to all data, analysis of the data stream for detection and modeling, use of the derived knowledge to modify the network with minimal or no human interaction and maintenance of data provenance through time as new versions of the data are created through QA/QC processes. The network architecture is designed to be scalable so that addition of new sensors is straightforward and inexpensive with costs increasing linearly at worst. Rather than building new computer infrastructure (disk farms and computer clusters), we are presently exploiting Amazon's Extensible Computing Cloud (EC2) and Simple Storage System (S3) to reduce long-term commitments to hardware and maintenance in order to minimize operations and maintenance costs. The OOI CI is actively partnering with other organizations (e.g. NOAA's IOOS) to integrate existing data systems using many of the same technologies to improve broad access to existing and planned observing systems, including those that provide critical climate data. Because seasonal and annual variability of most measureable parameters is so large, the

  2. Patterns of mitochondrial sorting in yeast zygotes.

    PubMed Central

    Azpiroz, R; Butow, R A

    1993-01-01

    Inheritance of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae is usually biparental. Pedigree studies of zygotic first buds indicate limited mixing of wild-type (p+) parental mtDNAs: end buds are frequently homoplasmic for one parental mtDNA, while heteroplasmic and recombinant progeny usually arise from medial buds. In crosses involving certain petites, however, mitochondrial inheritance can be uniparental. In this study we show that mitochondrial sorting can be influenced by the parental mtDNAs and have identified intermediates in the process. In crosses where mtDNA mixing is limited and one parent is prelabeled with the matrix enzyme citrate synthase 1 (CS1), the protein freely equilibrates throughout the zygote before the first bud has matured. Furthermore, if one parent is p0 (lacking mtDNA), mtDNA from the p+ parent can also equilibrate; intracellular movement of mtDNA is unhindered in this case. Surprisingly, in zygotes from a p0 CS1+ x p+ CS1- cross, CS1 is quantitatively translocated to the p+ end of the zygote before mtDNA movement; subsequently, both components equilibrate throughout the cell. This initial vectorial transfer does not require respiratory function in the p+ parent, although it does not occur if that parent is p-. Mouse dihydrofolate reductase (DHFR) present in the mitochondrial matrix can also be vectorially translocated, indicating that the process is general. Our data suggest that in zygotes mtDNA movement may be separately controlled from the movement of bulk matrix constituents. Images PMID:8443407

  3. Hydrodynamic and label-free sorting of circulating tumor cells from whole blood

    NASA Astrophysics Data System (ADS)

    Geislinger, Thomas M.; Stamp, Melanie E. M.; Wixforth, Achim; Franke, Thomas

    2015-11-01

    We demonstrate continuous, passive, and label-free sorting of different in vitro cancer cell lines (MV3, MCF7, and HEPG2) as model systems for circulating tumor cells (CTCs) from undiluted whole blood employing the non-inertial lift effect as driving force. This purely viscous, repulsive cell-wall interaction is sensitive to cell size and deformability differences and yields highly efficient cell separation and high enrichment factors. We show that the performance of the device is robust over a large range of blood cell concentrations and flow rates as well as for the different cell lines. The collected samples usually contain more than 90% of the initially injected CTCs and exhibit average enrichment factors of more than 20 for sorting from whole blood samples.

  4. Increasing Access for Economically Disadvantaged Students: The NSF/CSEM & S-STEM Programs at Louisiana State University

    ERIC Educational Resources Information Center

    Wilson, Zakiya S.; Iyengar, Sitharama S.; Pang, Su-Seng; Warner, Isiah M.; Luces, Candace A.

    2012-01-01

    Increasing college degree attainment for students from disadvantaged backgrounds is a prominent component of numerous state and federal legislation focused on higher education. In 1999, the National Science Foundation (NSF) instituted the "Computer Science, Engineering, and Mathematics Scholarships" (CSEMS) program; this initiative was designed to…

  5. 77 FR 30330 - Notice of Intent To Seek Approval To Establish an Information Collection for the NSF Graduate...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-22

    ... Fellowship Program AGENCY: National Science Foundation. ACTION: Notice and Request for Comments. SUMMARY: The... Reporting Requirements for the Graduate Research Fellowship Program. OMB Number: 3145-NEW. Expiration Date... collection. Abstract Proposed Project: The purpose of the NSF Graduate Research Fellowship Program is to help...

  6. Increasing Access for Economically Disadvantaged Students: The NSF/CSEM & S-STEM Programs at Louisiana State University

    ERIC Educational Resources Information Center

    Wilson, Zakiya S.; Iyengar, Sitharama S.; Pang, Su-Seng; Warner, Isiah M.; Luces, Candace A.

    2012-01-01

    Increasing college degree attainment for students from disadvantaged backgrounds is a prominent component of numerous state and federal legislation focused on higher education. In 1999, the National Science Foundation (NSF) instituted the "Computer Science, Engineering, and Mathematics Scholarships" (CSEMS) program; this initiative was designed to…

  7. A Patron for Pure Science. The National Science Foundation's Formative Years, 1945-57. NSF 82-24.

    ERIC Educational Resources Information Center

    England, J. Merton

    Provided in this book is a legislative and administrative history of the National Science Foundation (NSF) during its formative years (1945-57). The 15 chapter book is organized into three parts. Part 1 ("The Long Debate, 1945-50") narrates the legislative history of the Foundation's creation. Part 2 ("Beginning, 1950-54")…

  8. Master Teachers in Residence: Bringing a Classroom Perspective to Course Reform for NSF's Oklahoma Teacher Education Collaborative (O-TEC).

    ERIC Educational Resources Information Center

    Ramsey, Sarah; Neathery, Faye; Fholer, Gwen; Weger, Elayne; Voth, Bonnie; Townsend, Joyce; Campbell, DeAnn; Boedecker, Martha

    Master teachers can be influential in course revision. The Oklahoma Teacher Education Collaborative (O-TEC) teacher reform effort is a consortium of nine higher education institutions working with the National Science Foundation's (NSF's) reform effort to produce teachers better equipped for teaching science and mathematics. The reform emphasizes…

  9. Year-Long Peer Mentoring Activity to Enhance the Retention of Freshmen STEM Students in a NSF Scholarship Program

    ERIC Educational Resources Information Center

    Cutright, Teresa J.; Evans, Edward

    2016-01-01

    The last year of a National Science Foundation (NSF) funded scholarship program was used to provide pseudo-formal peer mentoring activities to engineering, mathematics, and science undergraduates. A one-credit class was used to afford time for peer mentors and mentees to interact. During the fall semester, seniors augmented each week's topics with…

  10. Exploration of NSF-ATE Projects Approaches in the Integration of Technology and Engineering Education at the K-12 Levels

    ERIC Educational Resources Information Center

    Strobel, Johannes; Mendoza Díaz, Noemi V.

    2012-01-01

    Access to post-secondary education, specifically in the technical, two-year institution area, is a topic of growing interest in the country. Funding agencies, such as NSF, via the Advanced Technological Education Program (ATE), are supporting initiatives and research aimed at increasing the number of technicians and engineers and improving…

  11. Industrial Funding of Academic R&D Continues to Decline in FY 2004. Info Brief. NSF 06-315

    ERIC Educational Resources Information Center

    Britt, Ronda

    2006-01-01

    Industrial funding for research and development in academic science and engineering (S&E) dropped by 2.6 percent in FY 2004, the third consecutive year of declining support from this sector, according to data from the National Science Foundation (NSF) Survey of Research and Development Expenditures at Universities and Colleges (table 1). The…

  12. Year-Long Peer Mentoring Activity to Enhance the Retention of Freshmen STEM Students in a NSF Scholarship Program

    ERIC Educational Resources Information Center

    Cutright, Teresa J.; Evans, Edward

    2016-01-01

    The last year of a National Science Foundation (NSF) funded scholarship program was used to provide pseudo-formal peer mentoring activities to engineering, mathematics, and science undergraduates. A one-credit class was used to afford time for peer mentors and mentees to interact. During the fall semester, seniors augmented each week's topics with…

  13. Evaluation of NSF's Program of Grants and Vertical Integration of Research and Education in the Mathematical Sciences (VIGRE)

    ERIC Educational Resources Information Center

    National Academies Press, 2009

    2009-01-01

    In 1998, the National Science Foundation (NSF) launched a program of Grants for Vertical Integration of Research and Education in the Mathematical Sciences (VIGRE). These grants were designed for institutions with PhD-granting departments in the mathematical sciences, for the purpose of developing high-quality education programs, at all levels,…

  14. A Study of NSF Teacher Enhancement Program (TEP) Participants and Principal Investigators: 1984-1989. Volume I: Summary Report.

    ERIC Educational Resources Information Center

    Abt Associates, Inc., Cambridge, MA.

    The National Science Foundation (NSF) supported more than 600 inservice teacher training programs between 1984 and 1989 under its Teacher Enhancement Program (TEP). Two studies were undertaken of TEP: the first was a survey of the 600 Principal Investigators (PIs) who had operated inservice teacher enhancement projects and the second, a survey of…

  15. Annual Report of the National Science Foundation on Contract NSF-C414 Task III July 1966 through June 1967.

    ERIC Educational Resources Information Center

    American Chemical Society, Columbus, OH. Chemical Abstracts Service.

    This Annual Report describes in detail the work performed during the first year of Task III of Contract NSF-C414 and the present status of Task III work. The programs and achievements described constitute the first significant efforts to develop a user-oriented, cooperative program between major secondary scientific and technical information…

  16. QED: Final Report on the NSF Grant to the Science Academy of Austin, 1994. Publication Number 94.04.

    ERIC Educational Resources Information Center

    Turner, Jeannine

    The Science Academy of Austin, part of the Austin Independent School District (Texas), was given a 4-year National Science Foundation (NSF) grant beginning in 1990-91 to link public and private sectors to create a "thinking curriculum." This evaluation report covers the fourth, and last, year of the grant's implementation. The new…

  17. A Novel Auto-Sorting System for Chinese Cabbage Seeds.

    PubMed

    Huang, Kuo-Yi; Cheng, Jian-Feng

    2017-04-18

    This paper presents a novel machine vision-based auto-sorting system for Chinese cabbage seeds. The system comprises an inlet-outlet mechanism, machine vision hardware and software, and control system for sorting seed quality. The proposed method can estimate the shape, color, and textural features of seeds that are provided as input neurons of neural networks in order to classify seeds as "good" and "not good" (NG). The results show the accuracies of classification to be 91.53% and 88.95% for good and NG seeds, respectively. The experimental results indicate that Chinese cabbage seeds can be sorted efficiently using the developed system.

  18. Efficient sorting of free electron orbital angular momentum

    NASA Astrophysics Data System (ADS)

    McMorran, Benjamin J.; Harvey, Tyler R.; Lavery, Martin P. J.

    2017-02-01

    We propose a method for sorting electrons by orbital angular momentum (OAM). Several methods now exist to prepare electron wavefunctions in OAM states, but no technique has been developed for efficient, parallel measurement of pure and mixed electron OAM states. The proposed technique draws inspiration from the recent demonstration of the sorting of OAM through modal transformation. We show that the same transformation can be performed on electrons with electrostatic optical elements. Specifically, we show that a charged needle and an array of electrodes perform the transformation and phase correction necessary to sort OAM states. This device may enable the analysis of the spatial mode distribution of inelastically scattered electrons.

  19. Sorting and recycling of domestic waste. Review of occupational health problems and their possible causes.

    PubMed

    Poulsen, O M; Breum, N O; Ebbehøj, N; Hansen, A M; Ivens, U I; van Lelieveld, D; Malmros, P; Matthiasen, L; Nielsen, B H; Nielsen, E M

    1995-05-19

    In order to reduce the strain on the environment from the deposition of waste in landfills and combustion at incineration plants, several governments throughout the industrialized world have planned greatly increased recycling of domestic waste by the turn of the millennium. To implement the plans, new waste recycling facilities are to be built and the number of workers involved in waste sorting and recycling will increase steadily during the next decade. Several studies have reinforced the hypothesis that exposure to airborne microorganisms and the toxic products thereof are important factors causing a multitude of health problems among workers at waste sorting and recycling plants. Workers at transfer stations, landfills and incineration plants may experience an increased risk of pulmonary disorders and gastrointestinal problems. High concentrations of total airborne dust, bacteria, faecal coliform bacteria and fungal spores have been reported. The concentrations are considered to be sufficiently high to cause adverse health effects. In addition, a high incidence of lower back injuries, probably due to heavy lifting during work, has been reported among workers at landfills and incineration plants. Workers involved in manual sorting of unseparated domestic waste, as well as workers at compost plants experience more or less frequent symptoms of organic dust toxic syndrome (ODTS) (cough, chest-tightness, dyspnoea, influenza-like symptoms such as chills, fever, muscle ache, joint pain, fatigue and headache), gastrointestinal problems such as nausea and diarrhoea, irritation of the skin, eye and mucous membranes of the nose and upper airways, etc. In addition cases of severe occupational pulmonary diseases (asthma, alveolitis, bronchitis) have been reported. Manual sorting of unseparated domestic waste may be associated with exposures to large quantities of airborne bacteria and endotoxin. Several work functions in compost plants can result in very high exposure to

  20. Perspectives from the NSF-sponsored workshop on Grand Challenges in Nanomaterials

    NASA Astrophysics Data System (ADS)

    Hull, Robert

    2004-03-01

    At an NSF-sponsored workshop in June 2003, about seventy research leaders in the field of nanomaterials met to discuss, explore and identify future new directions and critical needs ("Grand Challenges") for the next decade and beyond. The key pervasive theme that was identified was the need to develop techniques for assembly of nanoscaled materials over multiple lengths scales, at the levels of efficiency, economy, and precision necessary to realize broad new classes of applications in such diverse technologies as electronics, computation, telecommunications, data storage, energy storage / transmission / generation, health care, transportation, civil infrastructure, military applications, national security, and the environment. Elements of this strategy include development of new self-assembly and lithographic techniques; biologically-mediated synthesis; three-dimensional atomic-scale measurement of structure, properties and chemistry; harnessing of the sub-atomic properties of materials such as electron spin and quantum interactions; new computational methods that span all relevant length- and time- scales; a fundamental understanding of acceptable / achievable "fault tolerance" at the nanoscale; and methods for real-time and distributed sensing of nanoscale assembly. A parallel theme was the need to provide education concerning the potential, applications, and benefits of nanomaterials to all components of society and all levels of the educational spectrum. This talk will summarize the conclusions and recommendations from this workshop, and illustrate the future potential of this field through presentation of selected break-through results provided by workshop participants.

  1. Calibration and intercomparison of water vapor instrumentation used on the NSF/NCAR HIAPER aircraft

    NASA Astrophysics Data System (ADS)

    Kraemer, D.; Campos, T.; Flocke, F.; Jensen, J.; Wang, J.; Cole, H.; Korn, E.; Lauritsen, D.; Kraemer, M.

    2007-12-01

    Subject of the study is the characterization of a Kahn DCS-80 water vapor calibration system and the calibration of two water vapor sensors used on research aircraft, namely a Buck Instruments B-1001 chilled mirror sensor and a MayComm Tunable Diode Laser Absorption Hygrometer. A series of Vaisala drop sondes were also characterized and compared to the aircraft instruments. In an effort to assess the precision of the water vapor sensors that are being used on board the NSF/NACR GV aircraft (HIAPER), the instruments were tested at ambient pressure (800 mbar) inside an environmental chamber to simulate temperature conditions during flight. Tested dewpoints ranged from -70 to +20 degrees Celsius. The TDL - hygrometer was calibrated in preparation for an international water vapor measurement intercomparison campaign at the Forschungszentrum Karlsruhe, Germany. We will present the detailed calibration and characterization procedure, the laboratory setup for the different sensors, results from the calibrations of all instruments, assess their precision and useful operating range, and present some preliminary results from the international intercomparison campaign.

  2. Beyond Earth: Weaving Science and Indigenous Culture - A 1-year NSF Planning Grant

    NASA Astrophysics Data System (ADS)

    Young, Timothy; Guy, M.; Baker Big-Back, C.; Froelich, K.

    2011-01-01

    We present results of a 1-year NSF planning grant called Beyond Earth. The project is designed to engage Native American, urban, and rural families in science learning while piloting curriculum development and implementation that incorporates both Native and Western epistemologies. Physical, earth, and space science content is juxtaposed with indigenous culture, stories, language and epistemology in after-school programs and teacher training. Project partners include the Dakota Science Center, Fort Berthold Community College, and Sitting Bull College. The Native American tribes represented in this initiative illustrate partnerships between the Dakota, Lakota, Nakota, Hidatsa, Mandan, and Arikara. Over the past year the primary project deliverables include a culturally responsive curriculum Beyond Earth Moon Module, teacher training workshops, a project website. The curriculum module introduces students to the moon's appearance, phases, and positions in the sky using the Night Sky Planetarium Experience Station to explore core concepts underlying moon phases and eclipses using the interactive Nature Experience Station before engaging in the culminating Mission Challenge in which they apply their knowledge to problem solving situations and projects. The Native Science and Western Science activities developed, planetarium explorations created, and website toolkit utilizations are presented.

  3. Educational outreach at the NSF Engineering Research Center for Data Storage Systems

    NASA Astrophysics Data System (ADS)

    Williams, James E., Jr.

    1996-07-01

    An aspect of the National Science Foundation Engineering Research Center in Data Storage Systems (DSSC) program that is valued by our sponsors is the way we use our different educational programs to impact the data storage industry in a positive fashion. The most common way to teach data storage materials is in classes that are offered as part of the Carnegie Mellon curriculum. Another way the DSSC attempts to educate students is through outreach programs such as the NSF Research Experiences for Undergraduates and Young Scholars programs, both of which have been very successful and place emphasis and including women, under represented minorities and disable d students. The Center has also established cooperative outreach partnerships which serve to both educate students and benefit the industry. One example is the cooperative program we have had with the Magnetics Technology Centre at the National University of Singapore to help strengthen their research and educational efforts to benefit U.S. data storage companies with plants in Singapore. In addition, the Center has started a program that will help train outstanding students from technical institutes to increase their value as technicians to the data storage industry when they graduate.

  4. Engineering and Technical Configuration Aspects of HIAPER, the new NSF/NCAR Research Aircraft

    NASA Astrophysics Data System (ADS)

    Friesen, R.; Laursen, K.

    2002-12-01

    The High-performance Instrumented Airborne Platform for Environmental Research, or HIAPER, is the new research aircraft presently being developed at the National Center for Atmospheric Research (NCAR) to serve the environmental research needs of the National Science Foundation (NSF) for the next several decades. The basic aircraft -- a Gulfstream V (G-V) business jet -- has been completed and will shortly undergo extensive modification to prepare it for future deployments in support of a variety of geosciences research missions. This presentation will focus on the many design and engineering considerations that have been made and are yet to come in converting a "green" business jet into a versatile research aircraft to serve the environmental research community. The project teams composed of engineers and scientists from NCAR and the scientific community at large are faced with trade offs involving costs of modifications, airframe structural integrity, aircraft performance (e.g. weight, drag), cabin environment, locations of inlet and sampling ports and FAA certification requirements. Many of the specific engineering specifications and modifications that have been made to date will be presented by way of engineering drawings, graphical depictions and actual photographs of the aircraft structure. Additionally, projected performance data of the modified-for-research aircraft will be presented along with some of the analyses performed to arrive at critical decisions (e.g. CFD airflow analysis). Finally, some of the details of the aircraft "infrastructure" such as signal and power wiring, generic cabin layout and data acquisition will be discussed.

  5. Bringing Geoscientific Practices to Schools Through Guided Inquiry and the NSF-MSP-funded RITES Project

    NASA Astrophysics Data System (ADS)

    Cardace, D.; Schifman, L. A.; Kortz, K. M.; Saul, K.; Veeger, A. I.; Murray, D. P.

    2012-12-01

    The Rhode Island Technology Enhanced Science (RITES) Project is in its fifth of five years of funding from the NSF Math Science Partnership Program. At this stage, RITES has exceptional engagement of school districts across Rhode Island and growing momentum with partners in schools (covering the demographic spectrum present in Rhode Island) to enhance science education state-wide. One RITES product that will endure is the wide use by teachers of a Rock Cycle focused guided inquiry module, of constructivist design, that corresponds well to both the Rhode Island Grade Span Expectations (GSE) and the Next Generation Science Standards (with probable nationwide implementation) released in May 2012. The Rock Cycle teaching module has been piloted and edited following use in middle and high school classrooms. In this presentation, we evaluate the implementation fidelity of this curricular module, integrating commentary by the design team (Kortz and Saul) with data from teacher interviews, teacher reports on class use, and focus groups during which teachers discuss successes and challenges pertinent to the Rock Cycle from classroom experiences. In this presentation, we pay particular attention to the skills developed through the Rock Cycle module that resonate with research-supported approaches, such as observation, evidence-based hypothesis resolution, diverse science communication strategies, etc., all of which are also necessary scientific research skills.

  6. An essential and NSF independent role for α-SNAP in store-operated calcium entry

    PubMed Central

    Miao, Yong; Miner, Cathrine; Zhang, Lei; Hanson, Phyllis I; Dani, Adish; Vig, Monika

    2013-01-01

    Store-operated calcium entry (SOCE) by calcium release activated calcium (CRAC) channels constitutes a primary route of calcium entry in most cells. Orai1 forms the pore subunit of CRAC channels and Stim1 is the endoplasmic reticulum (ER) resident Ca2+ sensor. Upon store-depletion, Stim1 translocates to domains of ER adjacent to the plasma membrane where it interacts with and clusters Orai1 hexamers to form the CRAC channel complex. Molecular steps enabling activation of SOCE via CRAC channel clusters remain incompletely defined. Here we identify an essential role of α-SNAP in mediating functional coupling of Stim1 and Orai1 molecules to activate SOCE. This role for α-SNAP is direct and independent of its known activity in NSF dependent SNARE complex disassembly. Importantly, Stim1-Orai1 clustering still occurs in the absence of α-SNAP but its inability to support SOCE reveals that a previously unsuspected molecular re-arrangement within CRAC channel clusters is necessary for SOCE. DOI: http://dx.doi.org/10.7554/eLife.00802.001 PMID:23878724

  7. NSF RET in Southern Africa: community and research experiences in soil science

    NASA Astrophysics Data System (ADS)

    Mladenov, N.; Pollard, A.; Wellbeloved-Stone, R.; Riffel, H.; Chavarro, D.; D'Odorico, P.

    2010-12-01

    Collaborative research on belowground carbon storage in the Kalahari Desert has provided opportunities for international research experience for US middle and high school teachers, funded by the National Science Foundation Research Experience for Teachers (RET) Program. This presentation will highlight the field research experiences, international high school visit, relationships fostered with Botswana high school teachers, and new soil science curricula developed by three US environmental science teachers. New lesson plans and activities on carbon sequestration, fine and coarse root mapping, and soil organic carbon cycling and other learning tools have been incorporated into the existing Underground Safari webpage (instaar.colorado.edu/undergroundsafari) (Figure 1). An interactive blog, undergroundsafari.edublogs.org, has been developed to allow dynamic discourse between students, teachers and researchers on this project. Lessons learned from classroom trials of curriculum and use of other RET experience-motivated activities in the classroom will be discussed. Figure 1. Screen capture of the "Videos" page from the Underground Safari website for NSF DEB project, "Collaborative Research: Distribution and dynamics of belowground carbon in savannas."

  8. A Critical Role for Toxoplasma gondii Vacuolar Protein Sorting VPS9 in Secretory Organelle Biogenesis and Host Infection

    PubMed Central

    Sakura, Takaya; Sindikubwabo, Fabien; Oesterlin, Lena K.; Bousquet, Hugo; Slomianny, Christian; Hakimi, Mohamed-Ali; Langsley, Gordon; Tomavo, Stanislas

    2016-01-01

    Accurate sorting of proteins to the three types of parasite-specific secretory organelles namely rhoptry, microneme and dense granule in Toxoplasma gondii is crucial for successful host cell invasion by this obligate intracellular parasite. Despite its tiny body architecture and limited trafficking machinery, T. gondii relies heavily on transport of vesicles containing proteins, lipids and important virulence-like factors that are delivered to these secretory organelles. However, our understanding on how trafficking of vesicles operates in the parasite is still limited. Here, we show that the T. gondii vacuolar protein sorting 9 (TgVps9), has guanine nucleotide exchange factor (GEF) activity towards Rab5a and is crucial for sorting of proteins destined to secretory organelles. Our results illuminate features of TgVps9 protein as a key trafficking facilitator that regulates protein maturation, secretory organelle formation and secretion, thereby ensuring a primary role in host infection by T. gondii. PMID:27966671

  9. Exploring student preferences with a Q-sort: the development of an individualized renal physiology curriculum.

    PubMed

    Roberts, John K; Hargett, Charles W; Nagler, Alisa; Jakoi, Emma; Lehrich, Ruediger W

    2015-09-01

    Medical education reform is underway, but the optimal course for change has yet to be seen. While planning for the redesign of a renal physiology course at the Duke School of Medicine, the authors used a Q-sort survey to assess students' attitudes and learning preferences to inform curricular change. The authors invited first-year medical students at the Duke School of Medicine to take a Q-sort survey on the first day of renal physiology. Students prioritized statements related to their understanding of renal physiology, learning preferences, preferred course characteristics, perceived clinical relevance of renal physiology, and interest in nephrology as a career. By-person factor analysis was performed using the centroid method. Three dominant factors were strongly defined by learning preferences: "readers" prefer using notes, a textbook, and avoid lectures; "social-auditory learners" prefer attending lectures, interactivity, and working with peers; and "visual learners" prefer studying images, diagrams, and viewing materials online. A smaller, fourth factor represented a small group of students with a strong predisposition against renal physiology and nephrology. In conclusion, the Q-sort survey identified and then described in detail the dominant viewpoints of our students. Learning style preferences better classified first-year students rather than any of the other domains. A more individualized curriculum would simultaneously cater to the different types of learners in the classroom. Copyright © 2015 The American Physiological Society.

  10. Exploring student preferences with a Q-sort: the development of an individualized renal physiology curriculum

    PubMed Central

    Roberts, John K.; Hargett, Charles W.; Nagler, Alisa; Jakoi, Emma

    2015-01-01

    Medical education reform is underway, but the optimal course for change has yet to be seen. While planning for the redesign of a renal physiology course at the Duke School of Medicine, the authors used a Q-sort survey to assess students' attitudes and learning preferences to inform curricular change. The authors invited first-year medical students at the Duke School of Medicine to take a Q-sort survey on the first day of renal physiology. Students prioritized statements related to their understanding of renal physiology, learning preferences, preferred course characteristics, perceived clinical relevance of renal physiology, and interest in nephrology as a career. By-person factor analysis was performed using the centroid method. Three dominant factors were strongly defined by learning preferences: “readers” prefer using notes, a textbook, and avoid lectures; “social-auditory learners” prefer attending lectures, interactivity, and working with peers; and “visual learners” prefer studying images, diagrams, and viewing materials online. A smaller, fourth factor represented a small group of students with a strong predisposition against renal physiology and nephrology. In conclusion, the Q-sort survey identified and then described in detail the dominant viewpoints of our students. Learning style preferences better classified first-year students rather than any of the other domains. A more individualized curriculum would simultaneously cater to the different types of learners in the classroom. PMID:26330030

  11. The EARP Complex and Its Interactor EIPR-1 Are Required for Cargo Sorting to Dense-Core Vesicles

    PubMed Central

    Topalidou, Irini; Cattin-Ortolá, Jérôme; MacCoss, Michael J.

    2016-01-01

    The dense-core vesicle is a secretory organelle that mediates the regulated release of peptide hormones, growth factors, and biogenic amines. Dense-core vesicles originate from the trans-Golgi of neurons and neuroendocrine cells, but it is unclear how this specialized organelle is formed and acquires its specific cargos. To identify proteins that act in dense-core vesicle biogenesis, we performed a forward genetic screen in Caenorhabditis elegans for mutants defective in dense-core vesicle function. We previously reported the identification of two conserved proteins that interact with the small GTPase RAB-2 to control normal dense-core vesicle cargo-sorting. Here we identify several additional conserved factors important for dense-core vesicle cargo sorting: the WD40 domain protein EIPR-1 and the endosome-associated recycling protein (EARP) complex. By assaying behavior and the trafficking of dense-core vesicle cargos, we show that mutants that lack EIPR-1 or EARP have defects in dense-core vesicle cargo-sorting similar to those of mutants in the RAB-2 pathway. Genetic epistasis data indicate that RAB-2, EIPR-1 and EARP function in a common pathway. In addition, using a proteomic approach in rat insulinoma cells, we show that EIPR-1 physically interacts with the EARP complex. Our data suggest that EIPR-1 is a new interactor of the EARP complex and that dense-core vesicle cargo sorting depends on the EARP-dependent trafficking of cargo through an endosomal sorting compartment. PMID:27191843

  12. Brazil Nuts on Eros: Size-Sorting of Asteroid Regolith

    NASA Technical Reports Server (NTRS)

    Asphaug, E.; King, P. J.; Swift, M. R.; Merrifield, M. R.

    2001-01-01

    We consider the hypothesis that frequent cratering produces size- or compositionally-sorted asteroid regolith, affecting the structure, texture, and in extreme cases the shape of asteroids. Additional information is contained in the original extended abstract.

  13. Unsupervised spike sorting based on discriminative subspace learning.

    PubMed

    Keshtkaran, Mohammad Reza; Yang, Zhi

    2014-01-01

    Spike sorting is a fundamental preprocessing step for many neuroscience studies which rely on the analysis of spike trains. In this paper, we present two unsupervised spike sorting algorithms based on discriminative subspace learning. The first algorithm simultaneously learns the discriminative feature subspace and performs clustering. It uses histogram of features in the most discriminative projection to detect the number of neurons. The second algorithm performs hierarchical divisive clustering that learns a discriminative 1-dimensional subspace for clustering in each level of the hierarchy until achieving almost unimodal distribution in the subspace. The algorithms are tested on synthetic and in-vivo data, and are compared against two widely used spike sorting methods. The comparative results demonstrate that our spike sorting methods can achieve substantially higher accuracy in lower dimensional feature space, and they are highly robust to noise. Moreover, they provide significantly better cluster separability in the learned subspace than in the subspace obtained by principal component analysis or wavelet transform.

  14. Natural Selection Is a Sorting Process: What Does that Mean?

    ERIC Educational Resources Information Center

    Price, Rebecca M.

    2013-01-01

    To learn why natural selection acts only on existing variation, students categorize processes as either creative or sorting. This activity helps students confront the misconception that adaptations evolve because species need them.

  15. Sorting on STAR. [CDC computer algorithm timing comparison

    NASA Technical Reports Server (NTRS)

    Stone, H. S.

    1978-01-01

    Timing comparisons are given for three sorting algorithms written for the CDC STAR computer. One algorithm is Hoare's (1962) Quicksort, which is the fastest or nearly the fastest sorting algorithm for most computers. A second algorithm is a vector version of Quicksort that takes advantage of the STAR's vector operations. The third algorithm is an adaptation of Batcher's (1968) sorting algorithm, which makes especially good use of vector operations but has a complexity of N(log N)-squared as compared with a complexity of N log N for the Quicksort algorithms. In spite of its worse complexity, Batcher's sorting algorithm is competitive with the serial version of Quicksort for vectors up to the largest that can be treated by STAR. Vector Quicksort outperforms the other two algorithms and is generally preferred. These results indicate that unusual instruction sets can introduce biases in program execution time that counter results predicted by worst-case asymptotic complexity analysis.

  16. Recent progress in multi-electrode spike sorting methods.

    PubMed

    Lefebvre, Baptiste; Yger, Pierre; Marre, Olivier

    2017-03-02

    In recent years, arrays of extracellular electrodes have been developed and manufactured to record simultaneously from hundreds of electrodes packed with a high density. These recordings should allow neuroscientists to reconstruct the individual activity of the neurons spiking in the vicinity of these electrodes, with the help of signal processing algorithms. Algorithms need to solve a source separation problem, also known as spike sorting. However, these new devices challenge the classical way to do spike sorting. Here we review different methods that have been developed to sort spikes from these large-scale recordings. We describe the common properties of these algorithms, as well as their main differences. Finally, we outline the issues that remain to be solved by future spike sorting algorithms.

  17. Reflection-Impulsivity and Color-Form Sorting

    ERIC Educational Resources Information Center

    Katz, Judith Milstein

    1971-01-01

    A study to determine whether the differential development of conceptual tempo can predict preferences. Conceptual tempo predicted preferences in color-form sorting among 67 children ranging in age from 44 to 65 months. (WY)

  18. Using Sorting Networks for Skill Building and Reasoning

    ERIC Educational Resources Information Center

    Andre, Robert; Wiest, Lynda R.

    2007-01-01

    Sorting networks, used in graph theory, have instructional value as a skill- building tool as well as an interesting exploration in discrete mathematics. Students can practice mathematics facts and develop reasoning and logic skills with this topic. (Contains 4 figures.)

  19. 63. THIRD FLOOR, SHIPPING COURT, CONVEYORS FROM SORTING AREA TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    63. THIRD FLOOR, SHIPPING COURT, CONVEYORS FROM SORTING AREA TO PACKAGE HANDLING AND WRAPPING - Sears Roebuck & Company Mail Order Plant, Merchandise Building, 924 South Homan Avenue, Chicago, Cook County, IL

  20. 23. LOWER END OF HIDE CHUTE, BASEMENT LEVEL; NOTE SORTING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. LOWER END OF HIDE CHUTE, BASEMENT LEVEL; NOTE SORTING TABLE AND HANDCART FOR MOVING HIDES - Rath Packing Company, Beef Killing Building, Sycamore Street between Elm & Eighteenth Streets, Waterloo, Black Hawk County, IA