Sample records for factor recptors interleukin-6

  1. Hypothermia increases interleukin-6 and interleukin-10 in juvenile endotoxemic mice.

    PubMed

    Stewart, Corrine R; Landseadel, Jessica P; Gurka, Matthew J; Fairchild, Karen D

    2010-01-01

    To develop a juvenile mouse model to establish effects of in vivo hypothermia on expression of the inflammation-modulating cytokines tumor necrosis factor-alpha, interleukin-1beta, interleukin-6, and interleukin-10. Although induced hypothermia is neuroprotective in some patients, the mechanisms of protection are not well understood and concerns remain over potential detrimental effects, particularly in the setting of infection. We previously showed that in vitro hypothermia increases production of tumor necrosis factor-alpha and interleukin-1beta in lipopolysaccharide-treated monocytes. : Laboratory investigation. Research laboratory. Juvenile (4-wk) male C57BL/6 mice. : Mice were given chlorpromazine to suspend thermoregulation and lipopolysaccharide to stimulate cytokine production. Core temperature was maintained at 32 degrees C or 37 degrees C for 6 hrs by adjusting environmental temperature. In separate experiments, lipopolysaccharide-treated mice were kept in a cooling chamber without chlorpromazine treatment. Plasma and organs were collected for cytokine quantitation. Chlorpromazine-treated hypothermic mice had 2.3-fold and 1.8-fold higher plasma interleukin-6 and interleukin-10 levels at 6 hrs compared with identically treated normothermic mice (p < .05), whereas plasma tumor necrosis factor-alpha and interleukin-1beta were not significantly different at 2 hrs or 6 hrs. Liver tumor necrosis factor-alpha and interleukin-6 were significantly higher in hypothermic vs. normothermic mice, but lung and brain cytokines were not different. Lipopolysaccharide-treated mice kept in a cooling chamber without chlorpromazine treatment developed varying degrees of hypothermia with associated increases in plasma interleukin-6 and interleukin-10. A nonspecific marker of stress (plasma corticosterone) was not affected by hypothermia in lipopolysaccharide-treated mice. Further studies are necessary to determine the mechanism and physiologic consequences of augmented systemic

  2. The interleukin-1, interleukin-2, interleukin-6 and tumour necrosis factor alpha serological levels in localised and systemic sclerosis.

    PubMed

    Alecu, M; Geleriu, L; Coman, G; Gălăţescu, L

    1998-01-01

    Serological level of interleukin-1 (IL-1), Interleukin-2 (IL-2), Interleukin-6 (IL-6) and tumour necrosis factor (TNF) alpha was investigated in 26 patients with scleroderma, divided into three lots, by the extension and the progress of the disease. Determinations were performed by ELISA in attack and in remission (after treatment with prednison). Normal values: IL-1 (0-5 pg/ml), IL-2 (0-5 pg/ml), IL-6 (5-15 pg/ml), TNF (0-16 pg/ml). Lot A. Results obtained at the first determination showed that IL-1 is elevated in 4 cases (10-15 pg/ml), IL-2 in 5 cases (10-32 pg/ml), IL-6 in 5 cases (15-42 pg/ml) and TNF in 4 cases (18-34 pg/ml). In the second determination IL-1 was increased in 1 case (8 pg/ml), IL-2 in 1 case (9 pg/ml), IL-6 in 2 cases (12 pg/ml) and TNF was normal. Lot B. In the first determination IL-1 was elevated in 5 cases (8-12 pg/ml), IL-2 in 5 cases (10-15 pg/ml), IL-6 in 7 cases (16-20 pg/ml) and TNF was raised in 3 cases (18-25 pg/ml). At the second determination IL-1 showed normal values in all the cases, IL-2 was raised in 2 cases (10 pg/ml), IL-6 in 2 cases (12.15 pg/ml), TNF in 1 case (20 pg/ml). Lot C. In the first determination there were raised values in 4 cases for IL-1 (6-8 pg/ml), 3 cases for IL-2 (10-18 pg/ml), 5 cases for IL-6 (18-20 pg/ml), 2 cases for TNF (20 pg/ml). At the second determination IL-2 was elevated in 1 case (10 pg/ml), IL-6 in 1 case (15 pg/ml). We consider that in scleroderma there is a disturbance of the investigated cytokines due to the activation and involvement of the secretory cells into the pathogenesis of the disease. The increase of the serological levels of IL-1, IL-2, IL-6 and TNF depends on the extension of the lesions and the clinical and biological activity periods of the disease. The absence of the increase of the serological levels does not exclude their activity at the lesional site.

  3. Hemoadsorption removes tumor necrosis factor, interleukin-6, and interleukin-10, reduces nuclear factor-kappaB DNA binding, and improves short-term survival in lethal endotoxemia.

    PubMed

    Kellum, John A; Song, Mingchen; Venkataraman, Ramesh

    2004-03-01

    Previous studies have shown that inflammatory mediators can be removed from the circulation with hemofiltration and that adsorption plays an important role. Because adsorptive capacity of hollow-fiber dialyzers is limited, we sought to determine whether hemoadsorption using high surface area beads would result in greater mediator removal and improved survival in experimental sepsis. Randomized controlled laboratory experiment. University laboratory. Sixty-six adult Sprague-Dawley rats. We conducted two ex vivo and two in vivo experiments. For in vivo experiments, we administered Escherichia coli endotoxin (20 mg/kg) by intravenous infusion and then randomized each animal to receive either hemoadsorption or a sham circuit for 4 hrs. Hemoadsorption was performed for 4 hrs using an arterial-venous circuit and a CytoSorb cartridge containing 10 g of polystyrene divinyl benzene copolymer beads with a biocompatible polyvinylpyrrolidone coating. Survival time was measured to a maximum of 12 hrs. In a separate set of experiments, we studied 12 animals using the same protocol except that we killed all animals at 4 hrs and removed standardized sections of liver for analysis of nuclear factor-kappaB DNA binding. Mean survival time among hemoadsorption-treated animals was 629+/-114 vs. 518+/-120 mins for sham-treated animals (p <.01). Overall survival (defined at 12 hrs) was also significantly better in the hemoadsorption group, seven of 20 vs. one of 20 (p <.05). Plasma interleukin-6 and interleukin-10 concentrations and liver nuclear factor-kappaB DNA binding were significantly reduced by hemoadsorption. Ex vivo experiments showed no endotoxin adsorption but strengthened our in vivo observations by showing rapid adsorption of tumor necrosis factor, interleukin-6, and interleukin-10. Hemoadsorption was associated with reduced inflammation and improved survival in this murine model of septic shock.

  4. Interleukin-6: structure-function relationships.

    PubMed Central

    Simpson, R. J.; Hammacher, A.; Smith, D. K.; Matthews, J. M.; Ward, L. D.

    1997-01-01

    Interleukin-6 (IL-6) is a multifunctional cytokine that plays a central role in host defense due to its wide range of immune and hematopoietic activities and its potent ability to induce the acute phase response. Overexpression of IL-6 has been implicated in the pathology of a number of diseases including multiple myeloma, rheumatoid arthritis, Castleman's disease, psoriasis, and post-menopausal osteoporosis. Hence, selective antagonists of IL-6 action may offer therapeutic benefits. IL-6 is a member of the family of cytokines that includes interleukin-11, leukemia inhibitory factor, oncostatin M, cardiotrophin-1, and ciliary neurotrophic factor. Like the other members of this family, IL-6 induces growth or differentiation via a receptor-system that involves a specific receptor and the use of a shared signaling subunit, gp130. Identification of the regions of IL-6 that are involved in the interactions with the IL-6 receptor, and gp130 is an important first step in the rational manipulation of the effects of this cytokine for therapeutic benefit. In this review, we focus on the sites on IL-6 which interact with its low-affinity specific receptor, the IL-6 receptor, and the high-affinity converter gp130. A tentative model for the IL-6 hexameric receptor ligand complex is presented and discussed with respect to the mechanism of action of the other members of the IL-6 family of cytokines. PMID:9144766

  5. Autoantibodies to BP180 associated with bullous pemphigoid release interleukin-6 and interleukin-8 from cultured human keratinocytes.

    PubMed

    Schmidt, E; Reimer, S; Kruse, N; Jainta, S; Bröcker, E B; Marinkovich, M P; Giudice, G J; Zillikens, D

    2000-11-01

    Bullous pemphigoid is an inflammatory subepidermal blistering disease that is associated with auto- antibodies to the keratinocyte surface protein, BP180. In addition to the binding of autoantibodies, the infiltration of inflammatory cells is necessary for blister formation. Cytokines, including interleukin-6 and interleukin-8, have been implicated in the disease process of both human and experimental murine bullous pemphigoid. This study was aimed at testing the hypothesis that the binding of anti-BP180 antibodies to their target antigen triggers a signal transduction event that results in the secretion of these pro-inflammatory cytokines. Consistent with this hypothesis, treatment of cultured normal human epidermal keratinocytes with bullous pemphigoid IgG, but not control IgG, led to increased levels of interleukin-6 and interleukin-8, but not interleukin-1alpha, interleukin-1beta, tumor necrosis factor-alpha, interleukin-10, or monocyte chemoattractant protein-1, in the culture medium. This effect was concentration- and time-dependent and was abolished by depleting the bullous pemphigoid IgG of reactivity to two distinct epitopes on the BP180 NC16A domain. Upregulation of interleukin-6 and interleukin-8 was found at both protein and mRNA levels. In addition, bullous pemphigoid IgG did not induce the release of interleukin-6 and interleukin-8 from BP180-deficient keratinocytes obtained from a patient with generalized atrophic benign epidermolysis bullosa. These data indicate that bullous pemphigoid-associated autoantibodies to the human BP180 ectodomain trigger a signal transducing event that leads to expression and secretion of interleukin-6 and interleukin-8 from human keratinocytes.

  6. Human monocytes and gingival fibroblasts release tumor necrosis factor-alpha, interleukin-1 alpha and interleukin-6 in response to particulate and soluble fractions of Prevotella melaninogenica and Fusobacterium nucleatum.

    PubMed

    Rossano, F; Rizzo, A; Sanges, M R; Cipollaro de L'Ero, G; Tufano, M A

    1993-01-01

    In this study we provide evidence that structural and soluble components of periodontopathogenic bacteria, such as Prevotella melaninogenica and Fusobacterium nucleatum, induce the release of cytokines in vitro known to cause in vivo necrotic inflammatory phenomena and bone resorption (tumor necrosis factor-alpha, interleukin-1 alpha and interleukin-6). Human monocytes and gingival fibroblasts were cultivated in vitro in the presence of both particulate and soluble bacterial fractions. A dose-dependent production of tumor necrosis factor-alpha by monocytes and gingival fibroblasts was observed in the presence of fractions of P. melaninogenica and F. nucleatum. Interleukin-1 alpha was produced in approximately the same quantities in the presence of soluble fractions of either P. melaninogenica or F. nucleatum, but in greater quantities in response to particulate fractions of P. melaninogenica. Monocytes released larger amounts of interleukin-1 alpha (about 3000 pg/ml) than gingival fibroblasts (about 1500 pg/ml). Interleukin-6 was released in greater quantities by monocytes in the presence of the pellet fraction of P. melaninogenica (about 5.5 ng/ml), but gingival fibroblasts released larger amounts of interleukin-6, especially in the presence of particulate and soluble components of F. nucleatum (about 12 ng/ml). The ability to induce the release of these cytokines notably increases the pathogenic potential of the bacteria involved in the damage of periodontal tissue.

  7. Interleukin-6 and tumor necrosis factor-alpha values in elk neonates

    USGS Publications Warehouse

    Barber-Meyer, S. M.; Johnson, C.R.; Murtaugh, M.P.; Mech, L.D.; White, P.J.

    2007-01-01

    Serological indicators of general condition would be helpful for monitoring or assessing ungulate wildlife. Toward that end, we report the 1st reference values for 2 cytokines, interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-??), in neonatal elk (Cervus elaphus). We obtained blood samples from 140 calves ??? 6 days old in Yellowstone National Park during summer 2003-2005. TL-6 values ranged from 0 to 1.21 pg/ml with a median of 0.03 pg/ml. TNF-?? values ranged from 0 to 225.43 pg/ml with a median of 1.85 pg/ml. IL-6 and TNF-?? concentrations were not significant predictors of elk calf survival through 21 days. Development of ungulate-based IL-6 and TNF-?? assays that provide greater sensitivity than cross-reacting human-based assays could be helpful in monitoring ungulate condition and health status comparisons among herds. Such information could provide indirect assessments of range quality or environmental influences among herds. 

  8. Tumor Necrosis Factor-Alpha and Interleukin 6 in Human Periapical Lesions

    PubMed Central

    Pršo, Ivana Brekalo; Kocjan, Willy; Šimić, Hrvoje; Brumini, Gordana; Pezelj-Ribarić, Sonja; Borčić, Josipa; Ferreri, Silvio; Karlović, Ivana Miletić

    2007-01-01

    Aim. The aim of this study was to evaluate the presence of the cytokines tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6) in human periapical lesions. Subjects and methods. Samples were obtained from three groups of teeth: symptomatic teeth, asymptomatic lesions, and uninflamed periradicular tissues as a control. Results. TNF-alpha levels were significantly increased in symptomatic lesions compared to control. Group with asymptomatic lesions had significantly higher concentrations compared to control. There were no significant differences in TNF-alpha levels between symptomatic and asymptomatic lesions. In group with symptomatic lesions, IL-6 levels were significantly higher than in group with asymptomatic lesions. The IL-6 levels in symptomatic group also showed significantly higher concentration in comparison with control group. In asymptomatic group, the IL-6 level had significantly higher concentrations compared to control. Conclusion. These results indicate that symptomatic lesions represent an immunologically active stage of disease, and asymptomatic lesions are the point from which the process advances toward healing. PMID:17497030

  9. Sex and interleukin-6 are prognostic factors for autoimmune toxicity following treatment with anti-CTLA4 blockade.

    PubMed

    Valpione, Sara; Pasquali, Sandro; Campana, Luca Giovanni; Piccin, Luisa; Mocellin, Simone; Pigozzo, Jacopo; Chiarion-Sileni, Vanna

    2018-04-11

    Ipilimumab is a licensed immunotherapy for metastatic melanoma patients and, in the US, as adjuvant treatment for high risk melanoma radically resected. The use of ipilimumab is associated with a typical but unpredictable pattern of side effects. The purpose of this study was to identify clinical features and blood biomarkers capable of predicting ipilimumab related toxicity. We performed a prospective study aimed at analyzing potential clinical and biological markers associated with immune-related toxicity in patients treated with ipilimumab (3 mg/kg, q3w). We enrolled 140 consecutive melanoma patients treated with ipilimumab for metastatic disease. The following prospectively collected data were utilized: patient characteristics, previous therapies, level of circulating biomarkers associated with tumour burden or immune-inflammation status (lactic dehydrogenase, C-reactive protein, β2-microglobulin, vascular endothelial growth factor, interleukin-2, interleukin-6, S-100, alkaline phosphatase, transaminases) and blood cells subsets (leukocyte and lymphocyte subpopulations). Logistic regression was used for multivariate analysis of data. Out of 140 patients, 36 (26%) experienced a severe adverse event, 33 (24%) discontinued treatment for severe toxicity. Among the immune-profile biomarkers analyzed, only interleukin-6 was associated with the risk of toxicity. Female patients had a further increase of immune-related adverse events. Low baseline interleukin-6 serum levels (OR = 2.84, 95% CI 1.34-6.03, P = 0.007) and sex female (OR = 1.5, 95% CI 1.06-2.16 P = 0.022) and were significant and independent risk factors for immune related adverse events. Baseline IL6 serum levels and female sex were significantly and independently associated with higher risk of severe toxicity and could be exploited in clinical practice to personalize toxicity surveillance in patients treated with ipilimumab.

  10. Quantification of Epstein-Barr virus DNA load, interleukin-6, interleukin-10, transforming growth factor-beta1 and stem cell factor in plasma of patients with nasopharyngeal carcinoma.

    PubMed

    Tan, Eng-lai; Selvaratnam, G; Kananathan, R; Sam, Choon-kook

    2006-09-24

    Nasopharyngeal carcinoma (NPC) is a common epithelial neoplasm among the Chinese populations in Southern China and South East Asia. Epstein-Barr virus (EBV) is known to be an important etiologic agent of NPC and the viral gene products are frequently detected in NPC tissues along with elevated antibody titres to the viral proteins (VCA and EA) in a majority of patients. Elevated plasma EBV DNA load is regarded as an important marker for the presence of the disease and for the monitoring of disease progression. However, other serum/plasma parameters such as the levels of certain interleukins and growth factors have also been implicated in NPC. The objectives of the present study are, 1) to investigate the correlations between plasma EBV DNA load and the levels of interleukin (IL)-6, IL-10, TGF-beta1 and SCF (steel factor) and 2) to relate these parameters to the stages of NPC and the effect of treatment. A total of 78 untreated NPC patients were enrolled in this study. Of these, 51 were followed-up after treatment. The remaining patients had irregular or were lost to follow-up. Plasma EBV DNA was quantified using real-time quantitative PCR. The levels of plasma interleukins and growth factors were quantified using ELISA. A significant decrease in EBV DNA load was detected in plasma of untreated NPC patients (1669 +/- 637 copies/mL; n = 51) following treatment (57 +/- 37 copies/mL, p < 0.05); n = 51). Plasma EBV DNA load was shown to be a good prognosticator for disease progression and clinical outcome in five of the follow-up patients. A significant difference in IL-6 levels was noted between the untreated patients (164 +/- 37 pg/mL; n = 51) and following treatment (58 +/- 16 pg/mL, p < 0.05; n = 51). Positive correlations between EBV DNA load and IL-10 (r(49) = 0.535, p < 0.01), between IL6 and IL-10 (r(49) = 0.474, p < 0.01) and between TGF and SCF (r(49) = 0.464, p < 0.01) were observed in patients following treatment. None of the parameters tested including Ig

  11. Essential role of interleukin-6 in post-stroke angiogenesis

    PubMed Central

    Gertz, Karen; Kronenberg, Golo; Kälin, Roland E.; Baldinger, Tina; Werner, Christian; Balkaya, Mustafa; Eom, Gina D.; Hellmann-Regen, Julian; Kröber, Jan; Miller, Kelly R.; Lindauer, Ute; Laufs, Ulrich; Dirnagl, Ulrich; Heppner, Frank L.

    2012-01-01

    Ambivalent effects of interleukin-6 on the pathogenesis of ischaemic stroke have been reported. However, to date, the long-term actions of interleukin-6 after stroke have not been investigated. Here, we subjected interleukin-6 knockout (IL-6−/−) and wild-type control mice to mild brain ischaemia by 30-min filamentous middle cerebral artery occlusion/reperfusion. While ischaemic tissue damage was comparable at early time points, IL-6−/− mice showed significantly increased chronic lesion volumes as well as worse long-term functional outcome. In particular, IL-6−/− mice displayed an impaired angiogenic response to brain ischaemia with reduced numbers of newly generated endothelial cells and decreased density of perfused microvessels along with lower absolute regional cerebral blood flow and reduced vessel responsivity in ischaemic striatum at 4 weeks. Similarly, the early genomic activation of angiogenesis-related gene networks was strongly reduced and the ischaemia-induced signal transducer and activator of transcription 3 activation observed in wild-type mice was almost absent in IL-6−/− mice. In addition, systemic neoangiogenesis was impaired in IL-6−/− mice. Transplantation of interleukin-6 competent bone marrow into IL-6−/− mice (IL-6chi) did not rescue interleukin-6 messenger RNA expression or the early transcriptional activation of angiogenesis after stroke. Accordingly, chronic stroke outcome in IL-6chi mice recapitulated the major effects of interleukin-6 deficiency on post-stroke regeneration with significantly enhanced lesion volumes and reduced vessel densities. Additional in vitro experiments yielded complementary evidence, which showed that after stroke resident brain cells serve as the major source of interleukin-6 in a self-amplifying network. Treatment of primary cortical neurons, mixed glial cultures or immortalized brain endothelia with interleukin 6-induced robust interleukin-6 messenger RNA transcription in each case

  12. The ubiquitous interleukin-6: a time for reappraisal.

    PubMed

    Fisman, Enrique Z; Tenenbaum, Alexander

    2010-10-11

    Interleukin-6 (IL-6) is a multifunctional cytokine regulating humoral and cellular responses and playing a central role in inflammation and tissue injury. Its effects are mediated through interaction with its receptor complex, IL-6Rβ (also known as gp130). It plays an important role in the pathogenesis of coronary artery disease and large quantities of IL-6 are found in human atherosclerotic plaques. IL-6 levels positively correlate with higher all-cause mortality, unstable angina, left ventricular dysfunction, propensity to diabetes and its complications, hypertension, obesity and several types of cancer. IL-6 levels augmentation demonstrates a remarkable parallel with another biomarkers reflecting harmful processes, like tumor necrosis factor alpha, interleukins 8 and 18, YKL-40, C reactive protein and resistin. Due to these facts, IL-6 was classified as a noxious interleukin. Nonetheless, there are several facts that challenge this usually accepted point of view. Since IL-6 has also anti-inflammatory activity, it seems reasonable to assume that favorable aspects exist. These aspects are two: 1. protection against bacterial infections, inactivating proinflammatory mediators, mitigating the course of septic shock and inducing the production of cortisol; and 2. influence on insulin sensitivity during exercise; this aspect is even more important. During exercise IL-6 is synthesized and released by muscles, with enhanced insulin action immediately at early recovery. Skeletal muscle may be considered as an endocrine organ; contracting muscles produce IL-6 and release it into the blood exerting its effects on other organs. The increase in circulating levels of IL-6 after exercise is consistent and proportional to exercise duration, intensity, muscle mass involved and endurance capacity. Thus, the fascinating possibility that the plenteous beneficial health effects of exercise could be ultimately mediated by IL-6 merits further elucidation. Interleukins were termed

  13. Enhancing Interleukin-6 and Interleukin-11 receptor cleavage.

    PubMed

    Lokau, Juliane; Wandel, Marieke; Garbers, Christoph

    2017-04-01

    Proteolytic cleavage of the membrane-bound Interleukin-6 receptor (IL-6R) by the metalloprotease ADAM17 releases an agonistic soluble form of the IL-6R (sIL-6R), which is responsible for the pro-inflammatory trans-signaling branch of the cytokine's activities. This proteolytic step, which is also called ectodomain shedding, is critically regulated by the cleavage site within the IL-6R stalk, because mutations or small deletions within this region are known to render the IL-6R irresponsive towards proteolysis. In the present study, we employed cleavage site profiling data of ADAM17 to generate an IL-6R with increased cleavage susceptibility. Using site-directed mutagenesis, we showed that the non-prime sites P3 and P2 and the prime site P1' were critical for this increase in proteolysis, whereas other positions within the cleavage site were of minor importance. Insertion of this optimized cleavage site into the stalk of the Interleukin-11 receptor (IL-11R) was not sufficient to enable ADAM17-mediated proteolysis, but transfer of different parts of the IL-6R stalk enabled shedding by ADAM17. These findings shed light on the cleavage site specificities of ADAM17 using a native substrate and reveal further differences in the proteolysis of IL-6R and IL-11R. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Glucocorticoid-dependent induction of interleukin-6 receptor expression in human hepatocytes facilitates interleukin-6 stimulation of amino acid transport.

    PubMed

    Fischer, C P; Bode, B P; Takahashi, K; Tanabe, K K; Souba, W W

    1996-05-01

    The authors studied the effects of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha) on glutamine and alanine transport in isolated human hepatocytes. They also evaluated the role of dexamethasone in modulating this response and its effects on the expression of the plasma membrane high-affinity IL-6 receptor. Animal studies indicate that cytokines are important mediators of the increased hepatic amino acid uptake that occurs during cancer and sepsis, but studies in human tissues are lacking. The control of transport by cytokines and cytokine receptor expression in the liver may provide a mechanism by which hepatocytes can modulate amino acid availability during catabolic disease states. Human hepatocytes were isolated from wedge biopsy specimens and plated in 24-well trays. Interleukin-6 and TNF-alpha, in combination with the synthetic glucocorticoid dexamethasone, were added to hepatocytes in culture, and the transport of radiolabeled glutamine and alanine was measured. Fluorescent-activated cell sorter (FACS) analysis was used to study the effects of dexamethasone on IL-6 receptor number in the well-differentiated human hepatoma HepG2. Both IL-6 and TNF-alpha exerted a small stimulatory effect on alanine and glutamine transport. Dexamethasone alone did not alter transport rates, but pretreatment of cells augmented the effects of both cytokines on carrier-mediated amino acid uptake. Dexamethasone pretreatment and a combination of IL-6 and TNF-alpha resulted in a greater than twofold increase in transport activity. Fluorescent-activated cell sorter analysis demonstrated that dexamethasone induced a threefold increase in the expression of high-affinity IL-6 receptors. Interleukin-6 and TNF-alpha work coordinately with glucocorticoids to stimulate amino acid uptake in human hepatocytes. Dexamethasone exerts a permissive effect on cytokine-mediated increases in transport by increasing IL-6 receptor expression on the cell surface. It is likely that this

  15. Tumor necrosis factor and interleukin-6 levels in hypertensive patients with and without left ventricular hypertrophy.

    PubMed

    Leibowitz, David; Planer, David; Ben-Ivgi, Fanny; Weiss, A Teddy; Bursztyn, Michael

    2005-01-01

    The objective of this prospective study was to examine the association between serum levels of TNF (tumor-necrosis factor) and IL-6 (interleukin-6) and left ventricular mass in hypertensive patients. Hypertensive patients currently receiving medical therapy were eligible. All subjects underwent echocardiography with measurements of left ventricular (LV) mass and ejection fraction (EF) and had serum levels of TNF and IL-6 measured by ELISA immunoassay. 35 subjects (20F, 15M; mean age 56.4 +/- 10.5 yrs) were studied. 19 patients (54%) had elevated LV mass. Of these patients, 6 (32%) had detectable serum TNF levels and 1 (7%) had detectable IL-6 levels, (p = NS). Hypertensive patients with elevated LV mass do not consistently exhibit elevated cytokine levels when compared to those with normal LV mass.

  16. Distinct activation of tumor necrosis factor-α and interleukin-6 in the spinal cord after surgical incision in rats.

    PubMed

    Zhang, Yan-Ling; Xu, Jun-Mei; Zhou, Pei; Zhong, Xiao-Lin; Dai, Ru-Ping

    2012-06-01

    In a previous study, we showed that a deep thoracic incision induces the segmental upregulation of interleukin-1β (IL-1β) in the spinal cord. However, whether the cytokines tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) are also activated in response to surgical incision remains to be determined. The present study aimed to investigate the expression pattern of TNF-α and IL-6 in the spinal cord following a deep thoracic incision. After surgical incision, the mRNA levels of TNF-α and IL-6 in the thoracic spinal cord were transiently upregulated as determined by real-time polymerase chain reaction (PCR) assay. However, the activation of IL-6 was detected at 1 h postoperatively, which was earlier compared to that of TNF-α, observed at 6 h postoperatively. The activated TNF-α was mainly localized in the neurons, but not in microglia or astrocytes as determined by immunohistochemistry and confocal microscopy. However, the increased IL-6-immunoreactivity was mainly expressed in blood vessels. The differential upregulation of TNF-α and IL-6 induced by incision suggests that the proinflammatory cytokines may play different roles in the development of surgical pain.

  17. Interleukin-6 overexpression induces pulmonary hypertension.

    PubMed

    Steiner, M Kathryn; Syrkina, Olga L; Kolliputi, Narasaish; Mark, Eugene J; Hales, Charles A; Waxman, Aaron B

    2009-01-30

    Inflammatory cytokine interleukin (IL)-6 is elevated in the serum and lungs of patients with pulmonary artery hypertension (PAH). Several animal models of PAH cite the potential role of inflammatory mediators. We investigated role of IL-6 in the pathogenesis of pulmonary vascular disease. Indices of pulmonary vascular remodeling were measured in lung-specific IL-6-overexpressing transgenic mice (Tg(+)) and compared to wild-type (Tg(-)) controls in both normoxic and chronic hypoxic conditions. The Tg(+) mice exhibited elevated right ventricular systolic pressures and right ventricular hypertrophy with corresponding pulmonary vasculopathic changes, all of which were exacerbated by chronic hypoxia. IL-6 overexpression increased muscularization of the proximal arterial tree, and hypoxia enhanced this effect. It also reproduced the muscularization and proliferative arteriopathy seen in the distal arteriolar vessels of PAH patients. The latter was characterized by the formation of occlusive neointimal angioproliferative lesions that worsened with hypoxia and were composed of endothelial cells and T-lymphocytes. IL-6-induced arteriopathic changes were accompanied by activation of proangiogenic factor, vascular endothelial growth factor, the proproliferative kinase extracellular signal-regulated kinase, proproliferative transcription factors c-MYC and MAX, and the antiapoptotic proteins survivin and Bcl-2 and downregulation of the growth inhibitor transforming growth factor-beta and proapoptotic kinases JNK and p38. These findings suggest that IL-6 promotes the development and progression of pulmonary vascular remodeling and PAH through proproliferative antiapoptotic mechanisms.

  18. The PPARdelta agonist GW501516 suppresses interleukin-6-mediated hepatocyte acute phase reaction via STAT3 inhibition.

    PubMed

    Kino, T; Rice, K C; Chrousos, G P

    2007-05-01

    Interleukin-6 and downstream liver effectors acute phase reactants are implicated in the systemic inflammatory reaction. Peroxisome proliferator-activated receptor delta (PPARdelta), which binds to and is activated by a variety of fatty acids, was recently shown to have anti-inflammatory actions. We examined the ability of the synthetic PPARdelta agonist GW501516 to suppress interleukin-6-induced expression of acute phase proteins in human hepatoma HepG2 cells and rat primary hepatocytes. Results GW501516 dose-dependently suppressed interleukin-6-induced mRNA expression of the acute phase protein alpha1-antichymotrypsin in HepG2 cells. The compound also suppressed interleukin-6-induced mRNA expression of alpha2-acid glycoprotein, beta-fibrinogen and alpha2-macroglobulin in and the secretion of C-reactive protein by rat primary hepatocytes. Depletion of the PPARdelta receptor, but not of PPARalpha or gamma, attenuated the suppressive effect of GW501516 on interleukin-6-induced alpha1-antichymotrypsin mRNA expression, indicating that PPARdelta specifically mediated this effect. Since interleukin-6 stimulates the transcriptional activity of the alpha1-antichymotrypsin promoter by activating the signal transducer and activator of transcription (STAT) 3, we examined functional interaction of this transcription factor and PPARdelta on this promoter. Overexpression of PPARdelta enhanced the suppressive effect of GW501516 on STAT3-activated transcriptional activity of the alpha1-antichymotrypsin promoter, while GW501516 suppressed interleukin-6-induced binding of this transcription factor to this promoter. These findings indicate that agonist-activated PPARdelta interferes with interleukin-6-induced acute phase reaction in the liver by inhibiting the transcriptional activity of STAT3. PPARdelta agonists might be useful for the suppression of systemic inflammatory reactions in which IL-6 plays a central role.

  19. A Histologically Distinctive Interstitial Pneumonia Induced by Overexpression of the Interleukin 6, Transforming Growth Factor β1, or Platelet-Derived Growth Factor B Gene

    NASA Astrophysics Data System (ADS)

    Yoshida, Mitsuhiro; Sakuma, Junko; Hayashi, Seiji; Abe, Kin'ya; Saito, Izumu; Harada, Shizuko; Sakatani, Mitsunoir; Yamamoto, Satoru; Matsumoto, Norinao; Kaneda, Yasufumi; Kishmoto, Tadamitsu

    1995-10-01

    Interstitial pneumonia is characterized by alveolitis with resulting fibrosis of the interstitium. To determine the relevance of humoral factors in the pathogenesis of interstitial pneumonia, we introduced expression vectors into Wistar rats via the trachea to locally overexpress humoral factors in the lungs. Human interleukin (IL) 6 and IL-6 receptor genes induced lymphocytic alveolitis without marked fibroblast proliferation. In contrast, overexpression of human transforming growth factor β1 or human platelet-derived growth factor B gene induced only mild or apparent cellular infiltration in the alveoli, respectively. However, both factors induced significant proliferation of fibroblasts and deposition of collagen fibrils. These histopathologic changes induced by the transforming growth factor β1 and platelet-derived growth factor B gene are partly akin to those changes seen in lung tissues from patients with pulmonary fibrosis and markedly contrast with the changes induced by overexpression of the IL-6 and IL-6 receptor genes that mimics lymphocytic interstitial pneumonia.

  20. Interleukin 1B variant -1473G/C (rs1143623) influences triglyceride and interleukin 6 metabolism

    USDA-ARS?s Scientific Manuscript database

    Interleukin 1b (IL1B or IL-1ß), is a key modulator of the immune response which exerts its functions mainly via interleukin 6 (IL6) regulation. Fatty meals cause transient hypertriglyceridemia and are considered to be proinflammatory, but the extent of these responses shows high interindividual susc...

  1. Haptoglobin gene polymorphisms and interleukin-6 and -8 levels in patients with sickle cell anemia

    PubMed Central

    Pierrot-Gallo, Bruna Spinella; Vicari, Perla; Matsuda, Sandra Satiko; Adegoke, Samuel Ademola; Mecabo, Grazielle; Figueiredo, Maria Stella

    2015-01-01

    Background Haptoglobin genotypes, and interleukin-6 and -8 participate in the pathophysiology of sickle cell anemia. The expression of cytokines is regulated by genetic mechanisms however the effect of haptoglobin polymorphisms on these cytokines is not fully understood. This study aimed to compare the frequency of haptoglobin genotypes and the interleukin-6 and -8 concentrations in sickle cell anemia patients and controls to investigate the association between haptoglobin genotypes and cytokine levels. Methods Sixty sickle cell anemia patients and 74 healthy individuals were analyzed. Haptoglobin genotypes were determined by multiplex polymerase chain reaction, and the interleukin-6 and -8 levels by enzyme linked immunosorbent assay. The association between haptoglobin genotypes and cytokines was investigated by statistical tests. Results Hp2-1 was the most common genotype in both the cases and controls while Hp1-1 was less frequent among sickle cell anemia patients. Interleukin-6 and -8 levels were higher in patients than controls (p-value <0.0001). There was no significant difference in interleukin-6 and -8 concentrations between the genotypes (p-value >0.05). A similar trend was observed among the controls. Conclusion Although, levels of interleukin-6 and -8 were higher in the sickle cell anemia patients, they appeared not to be related to the haptoglobin genotypes. Further investigations are necessary to identify factors responsible for increased secretion of the interleukin-6 and -8 pro-inflammatory cytokines in patients with sickle cell anemia. PMID:26408368

  2. Quantitation of Vascular Endothelial Growth Factor and Interleukin-6 in Different Stages of Breast Cancer.

    PubMed

    Raghunathachar Sahana, Kabbathi; Akila, Prashant; Prashant, Vishwanath; Sharath Chandra, Bellekere; Nataraj Suma, Maduvanahalli

    2017-10-01

    Determination of the impact of angiogenesis on tumor development and progression is essential. This study aimed to determine the serum levels of Vascular endothelial growth factor (VEGF) and Interleukin 6 (IL-6) in breast carcinoma, and to correlate them with tumor size, lymph node involvement, and cancer stage. Under aseptic precautions 5 ml of venous blood was collected from 37 breast cancer patients and 20 healthy females after obtaining due consent and ethical committee clearance. Serum levels of VEGF and IL-6 were determined by enzyme-linked immunosorbent assay (ELISA). Serum IL-6 and VEGF levels were both significantly greater in patients than controls (P = 0.001, P = 0.001, respectively). The serum IL-6 and VEGF levels also significantly correlated with TNM staging (P = 0.001, P = 0.001). Serum IL-6 and VEGF positively correlated with each other (r 2 = 0.668, P = 0.01). Serum IL-6 and VEGF levels did not correlate with tumor size (P = 0.45, P = 0.17) or lymph node metastasis (P = 0.95, P = 0.68). Serum IL-6 and VEGF were greater in breast cancer patients than controls. The levels increased with advanced tumor, nodes, metastasis (TNM) staging, thus correlating with the patients' prognoses. Serum IL-6 and VEGF levels can be used as diagnostic tools and prognostic factors in breast cancer.

  3. Identification of interleukin-6 as an autocrine growth factor for Epstein-Barr virus-immortalized B cells.

    PubMed Central

    Tosato, G; Tanner, J; Jones, K D; Revel, M; Pike, S E

    1990-01-01

    Autocrine growth factors are believed to be important for maintenance of an immortalized state by Epstein-Barr virus (EBV), because cell-free supernatants of EBV-immortalized cell lines promote the proliferation of autologous cells and permit their growth at low cell density. In this study, we provide evidence for the existence of two autocrine growth factor activities produced by EBV-immortalized lines distinguished by size and biological activities. Much of the autocrine growth factor activity in lymphoblastoid cell line supernatants resided in a low-molecular-weight (less than 5,000) fraction. However, up to 20 to 30% of the autocrine growth factor activity resided in the high-molecular-weight (greater than 5,000) fraction. While the nature of the low-molecular-weight growth factor activity remains undefined, the high-molecular-weight growth factor activity was identified as interleukin-6 (IL-6). Culture supernatants from six EBV-induced lymphoblastoid cell lines tested contained IL-6 activity, because they promoted proliferation in the IL-6-dependent hybridoma cell line B9. In addition, a rabbit antibody to human IL-6 neutralized the capacity of the high-molecular-weight (greater than 5,000) fraction of a lymphoblastoid cell line supernatant to promote growth both in autologous EBV-immortalized cells and in B9 cells. Similarly, this high-molecular-weight autocrine growth factor activity was neutralized by a monoclonal antibody to human IL-6. Furthermore, characteristic bands, attributable to IL-6, were visualized in supernatants of each of four EBV-induced lymphoblastoid cell lines after immunoprecipitation with a rabbit antiserum to human IL-6. Thus, in addition to its previously reported properties, IL-6 is an autocrine growth factor for EBV-immortalized B cells cultured under serum-free conditions. Images PMID:2159561

  4. Serum brain-derived neurotrophic factor and interleukin-6 response to high-volume mechanically demanding exercise.

    PubMed

    Verbickas, Vaidas; Kamandulis, Sigitas; Snieckus, Audrius; Venckunas, Tomas; Baranauskiene, Neringa; Brazaitis, Marius; Satkunskiene, Danguole; Unikauskas, Alvydas; Skurvydas, Albertas

    2018-01-01

    The aim of this study was to follow circulating brain-derived neurotrophic factor (BDNF) and interleukin-6 (IL-6) levels in response to severe muscle-damaging exercise. Young healthy men (N = 10) performed a bout of mechanically demanding stretch-shortening cycle exercise consisting of 200 drop jumps. Voluntary and electrically induced knee extension torque, serum BDNF levels, and IL-6 levels were measured before and for up to 7 days after exercise. Muscle force decreased by up to 40% and did not recover by 24 hours after exercise. Serum BDNF was decreased 1 hour and 24 hours after exercise, whereas IL-6 increased immediately and 1 hour after but recovered to baseline by 24 hours after exercise. IL-6 and 100-Hz stimulation torque were correlated (r = -0.64, P < 0.05) 24 hours after exercise. In response to acute, severe muscle-damaging exercise, serum BDNF levels decrease, whereas IL-6 levels increase and are associated with peripheral fatigue. Muscle Nerve 57: E46-E51, 2018. © 2017 Wiley Periodicals, Inc.

  5. Interleukin-6 production by human monocytes stimulated with Cryptococcus neoformans components.

    PubMed Central

    Delfino, D; Cianci, L; Lupis, E; Celeste, A; Petrelli, M L; Curró, F; Cusumano, V; Teti, G

    1997-01-01

    In order to ascertain if Cryptococcus neoformans components can induce interleukin-6 (IL-6) production, we stimulated human whole blood with purified capsular products. Their potencies in stimulating IL-6 release were mannoproteins > galactoxylomannan = glucuronoxylomannan > alpha(1-3)glucan. IL-6 production was tumor necrosis factor alpha independent and required the presence of monocytes and plasma. Since IL-6 can stimulate replication of the human immunodeficiency virus in monocytic cells, these findings may be clinically relevant. PMID:9169790

  6. [POEMS syndrome: role and value of interleukin-6].

    PubMed

    Andrès, E; Courouau, F; Kaltenbach, G; Maloisel, F; Imler, M

    1996-01-01

    POEMS syndrome is a systemic disorder with peripheral neuropathy, organomegaly, endocrinopathy, monoclonal gammopathy and skin changes. The association of POEMS syndrome with lympho-proliferative disorder is very commun. The pathogenesis remains poorly understood but implication of cytokines (interleukins 1 and 6) is suspected. We report a case of a classic POEMS syndrome (with polyneuropathy, hepatomegaly, diabetes melitus, hyperpigmentation, monoclonal IgG lambda, anasarca and solitary plasmocytoma), associated with high serum levels of interleukin 6.

  7. Arthritis is inhibited in Borrelia-primed and infected interleukin-17A-deficient mice after administration of anti-gamma-interferon, anti-tumor necrosis factor alpha and anti-interleukin-6 antibodies.

    PubMed

    Kuo, Joseph; Warner, Thomas F; Schell, Ronald F

    2017-08-31

    The role that cytokines play in the induction of Lyme arthritis is gradually being delineated. We showed previously that severe arthritis developed in a T-cell-driven murine model, even in mice lacking interleukin-17A (IL-17A) and administered anti-gamma-interferon (IFN-γ) antibody. Increased levels of tumor necrosis factor alpha (TNF-α) and interleukin-6 (IL-6), two pro-inflammatory cytokines, were detected in cultures of popliteal lymph node cells obtained from these mice. We hypothesized that concomitantly administered anti-IL-6, anti-TNF-α and anti-IFN-γ antibodies would inhibit the development of arthritis in IL-17A-deficient mice. Our results showed that swelling of the hind paws and histopathological changes consistent with arthritis were significantly reduced in IL-17A-deficient mice that administered the three anti-cytokine antibodies. These results suggest that treatment with multiple anti-cytokine antibodies can abrogate the induction of Lyme arthritis in mice. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Clinical Phenotype of Depression Affects Interleukin-6 Synthesis.

    PubMed

    Zadka, Łukasz; Dzięgiel, Piotr; Kulus, Michał; Olajossy, Marcin

    2017-06-01

    Major depressive disorder (MDD) is not a single disease, but a number of various ailments that form one entity. Psychomotor retardation, anhedonia, sleep disorders, an increased suicide risk, and anxiety are the main symptoms that often define the clinical diagnosis of depression. Interleukin-6 (IL-6), as one of the proinflammatory cytokines, seems to be overexpressed during certain mental disorders, including MDD. Overexpression of IL-6 in depression is thought to be a factor associated with bad prognosis and worse disease course. IL-6 may directly affect brain functioning and production of neurotransmitters; moreover, its concentration is correlated with certain clinical symptoms within the wide range of depressive symptomatology. Furthermore, there is a strong correlation between IL-6 synthesis and psychosomatic functioning of the patient. This article discusses potential sources and significance of IL-6 in the pathogenesis of depression.

  9. Interleukin-6, interleukin-8, and soluble tumor necrosis factor receptor-I in the cord blood as predictors of chronic lung disease in premature infants.

    PubMed

    An, Hiromi; Nishimaki, Shigeru; Ohyama, Makiko; Haruki, Atsushi; Naruto, Takuya; Kobayashi, Naoki; Sugai, Toshiyuki; Kobayashi, Yoshinori; Mori, Masaaki; Seki, Kazuo; Yokota, Shumpei

    2004-11-01

    In order to predict the late-development of chronic lung disease of prematurity (CLD), cytokines in the cord blood were assessed in this study. Eighteen premature infants with CLD were enrolled. Cord blood plasma levels of cytokines of these infants and 12 control infants without CLD were measured including interleukin (IL)-1beta, IL-2, IL-4, IL-6, IL-8, IL-10, interferon (IFN)-gamma, tumor necrosis factor (TNF)-alpha, soluble TNF receptor-I, and soluble IL-6 receptor using a cytometric bead array and an enzyme-linked immunosorbent assay. The cord blood IL-6, IL-8, and sTNFR-I levels were significantly elevated in CLD infants compared with those in control (P < .05). IL-1beta, IL-2, IL-4, IL-10, and IFN-gamma were undetectable in both groups. CLD infants with maternal chorioamnionitis had higher IL-6 than those without chorioamnionitis (P < .01). In CLD infants, IL-6 was higher in the infants who required prolonged oxygen therapy (P < .05). Elevated inflammatory cytokines in the cord blood are associated with the progression to CLD.

  10. [Growth Factors and Interleukins in Amniotic Membrane Tissue Homogenate].

    PubMed

    Stachon, T; Bischoff, M; Seitz, B; Huber, M; Zawada, M; Langenbucher, A; Szentmáry, N

    2015-07-01

    Application of amniotic membrane homogenate eye drops may be a potential treatment alternative for therapy resistant corneal epithelial defects. The purpose of this study was to determine the concentrations of epidermal growth factor (EGF), fibroblast growth factor basic (bFGF), hepatocyte growth factor (HGF), keratinocyte growth factor (KGF), interleukin-6 (IL-6) and interleukin-8 (IL-8) in amniotic membrane homogenates. Amniotic membranes of 8 placentas were prepared and thereafter stored at - 80 °C using the standard methods of the LIONS Cornea Bank Saar-Lor-Lux, Trier/Westpfalz. Following defreezing, amniotic membranes were cut in two pieces and homogenized in liquid nitrogen. One part of the homogenate was prepared in cell-lysis buffer, the other part was prepared in PBS. The tissue homogenates were stored at - 20 °C until enzyme-linked immunosorbent assay (ELISA) analysis for EGF, bFGF, HGF, KGF, IL-6 and IL-8 concentrations. Concentrations of KGF, IL-6 and IL-8 were below the detection limit using both preparation techniques. The EGF concentration in tissue homogenates treated with cell-lysis buffer (2412 pg/g tissue) was not significantly different compared to that of tissue homogenates treated with PBS (1586 pg/g tissue, p = 0.72). bFGF release was also not significantly different using cell-lysis buffer (3606 pg/g tissue) or PBS treated tissue homogenates (4649 pg/g tissue, p = 0.35). HGF release was significantly lower using cell-lysis buffer (23,555 pg/g tissue), compared to PBS treated tissue (47,766 pg/g tissue, p = 0.007). Containing EGF, bFGF and HGF, and lacking IL-6 and IL-8, the application of amniotic membrane homogenate eye drops may be a potential treatment alternative for therapy-resistant corneal epithelial defects. Georg Thieme Verlag KG Stuttgart · New York.

  11. Color of meconium and interleukin-6.

    PubMed

    Silva-Bravo, Raquel; Mayoral-Andrade, Gabriel; Zenteno, Edgar; Hernandez, Pedro; Martínez-Cruz, Ruth; Mayoral, Laura Perez-Campos; Aguilar-Ruiz, Sergio; Paz-Pacheco, Alberto; Zarate-Aspiros, Romeo; López-Bravo, Magdalena; Roldan-Aragon, Yuri; Pérez-Campos, Eduardo

    2012-01-01

    To test the hypothesis that the color of meconial fluid is associated with inflammatory biomarkers, by determining C-reactive protein (CRP) and Interleukin-6 (IL-6) in serum from the umbilical cord. In this prospective study, the authors selected 30 newborns with meconium-stained amniotic fluid (MSAF): 14 with green/brown 656 R color and 16 with brown/cinnamon 654 R color, and 20 newborns which showed clear amniotic fluid without MSAF (non-MSAF); all newborns were from mothers without risk factors for neonatal sepsis. IL-6 concentration from umbilical cord blood, [median of 12.9 pg/mL (interquartile range {IQR} 8.7-31.0)] of MSAF-green/brown 656 R increased significantly (p < 0.05) when compared with IL-6 concentration, [median of 9.2 pg/mL (IQR 7.2-12.2)] of newborns with clear amniotic fluid and without meconium. CRP from MSAF-green/brown 656 R was median of 0.5 mg/mL (IQR 0.0-2.7), and median of 1.0 mg/mL (IQR 0.0-5.5) from clear amniotic fluid, without meconium. Significant association was found between MSAF-green/brown 656 R and increase in IL-6, with normal CRP values.

  12. Interleukin-6 level and gene polymorphism in spontaneous miscarriage.

    PubMed

    Drozdzik, M; Szlarb, N; Kurzawski, M

    2013-09-01

    The aetiology of spontaneous miscarriage, the most common pregnancy complication, remains undefined. One of postulated factors involved in miscarriage pathology is interleukin 6 (IL-6). Therefore, the aim of the study was to evaluate IL-6 and interleukin 6 receptor (IL-6R) gene polymorphisms in patients with spontaneous miscarriage. One hundred fifty-seven patients diagnosed with spontaneous miscarriage and age and gestational time matched controls were included in the case-control study. In all study participants circulating IL-6 levels (chemiluminescent immunoassay) and IL6-174G>C as well as IL6R rs2228145:A>C polymorphisms were evaluated. The distribution of IL6 as well as IL6R alleles and genotypes were similar in the controls and patients with miscarriage. Only a trend of more frequent appearance of -174GC+CC and C allele in the patients with miscarriage was noted. Blood serum concentrations of IL-6 were significantly elevated in patients with miscarriage vs those with physiological pregnancy. Likewise, IL-6 concentrations differ significantly with the types of miscarriage. The highest concentrations of the cytokine was seen in subjects with incomplete miscarriage (4.28 ± 4.88 pg/ml) followed by imminent miscarriage (2.97 ± 2.42 pg/ml), and then missed miscarriage (2.07 ± 1.90 pg/ml), being significantly the lowest in missed miscarriage group. No association between the IL6 genotype and IL-6 serum concentration were noted, both in the miscarriage group and in the control group. The findings of the study support the role of IL-6 in spontaneous miscarriage irrespectively of its type. However, no correlation between circulating IL-6 and IL6 gene polymorphism, as well as IL-6 and IL-6R polymorphisms associations with spontaneous miscarriage were revealed. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Effects of modified Sanhuang decoction () enema on serum tumor necrosis factor-α and colonic mucosa interleukin-1β, interleukin-6 levels in ulcerative colitis rats.

    PubMed

    Wang, Shuai; Zhou, Tao; Zhai, Jun-Peng; Wang, Li-Hua; Chen, Jing

    2014-11-01

    To investigate the effects of Modified Sanhuang Decoction (, MSD) enema on the serum tumor necrosis factor alpha (TNF-α) and colonic mucosa interleukin-1β (IL-1β), interleukin-6 (IL-6) levels in experimental ulcerative colitis (UC) rats. Forty-five male Wistar rats were randomly divided into 4 groups: normal group (n=12), model group (n=11), salazosulfapyridine (SASP) group (n=11) and MSD group (n=11). The UC model was induced by 2,4,6-trinitrobenzene sulfonic acid (TNBS)/ethanol solution. Rats in the normal group and model group were clystered with 0.9% normal saline, while in the SASP group and MSD group were clystered with SASP and MSD enema, respectively. After drug administration (10 mL/kg body weight, for 7 days), colonic gross changes and colonic mucosa histology were observed, serum TNF-α and colonic mucosa IL-1β, IL-6 levels were tested by enzyme linked immunosorbent assay and radioimmunoassay, respectively. As compared with the normal group, the experimental UC rats, the colonic mucosal damage index scores (CMDIs), histopathological scores (HS) and the serum TNF-α and colonic mucosa IL-1β, IL-6 levels significantly increased (P<0.05 or P<0.01). In the MSD and SASP groups, the ulcer area significantly reduced, and edema disappeared. The CMDIs, HS, the serum TNF-α and colonic mucosa IL-1β, IL-6 levels in the MSD and SASP groups significantly decreased (P<0.05 or P<0.01) compared with the model group. The CMDIs in the MSD group were lower than that in the SASP group (P<0.05), but there were no significant differences in HS, serum TNF-α or colonic mucosa IL-1β, IL-6 levels between the MSD and SASP groups. MSD enema can improve colonic mucosa impairment and decrease serum TNF-α and colonic mucosa IL-1β, IL-6 levels in experimental UC.

  14. The accuracy of serum interleukin-6 and tumour necrosis factor as markers for ovarian torsion.

    PubMed

    Cohen, S B; Wattiez, A; Stockheim, D; Seidman, D S; Lidor, A L; Mashiach, S; Goldenberg, M

    2001-10-01

    The aim of this study was to investigate a possible role for interleukin-6 (IL-6) and tumour necrosis factor (TNF-alpha) as pre-operative markers for the diagnosis of ovarian torsion. Twenty consecutive patients admitted to the gynaecological emergency room with suspected clinical diagnosis of ovarian torsion were prospectively assigned to the study. Blood samples were drawn pre-operatively and examined for serum concentrations of IL-6 and TNF-alpha. Surgeons were blinded to laboratory results prior to laparoscopy. The pre-operative diagnosis of ovarian torsion was confirmed during an urgent diagnostic laparoscopy in 8 (40%) patients. The surgical diagnosis among the remaining 12 patients was a large ovarian cyst not in torsion. In six out of eight (75.0%) patients with ovarian torsion serum IL-6 concentrations were elevated. None of the 12 patients without torsion had elevated serum IL-6 concentrations. This difference was statistically significant (P < 0.001). There was no significant difference in the proportion of women with elevated serum TNF-alpha concentrations, two of eight (25.0%) patients with torsion and four of 12 (33.3%) control cases. Elevated serum IL-6 concentrations, but not serum TNF-alpha concentrations, were significantly associated with the occurrence of ovarian torsion. In patients with vague clinical signs of ovarian torsion, serum IL-6 might help to distinguish which patients should undergo diagnostic laparoscopy.

  15. Cumulative meta-analysis of interleukins 6 and 1β, tumour necrosis factor α and C-reactive protein in patients with major depressive disorder.

    PubMed

    Haapakoski, Rita; Mathieu, Julia; Ebmeier, Klaus P; Alenius, Harri; Kivimäki, Mika

    2015-10-01

    Cumulative meta-analyses are used to evaluate the extent to which further studies are needed to confirm or refute a hypothesis. We used this approach to assess observational evidence on systemic inflammation in individuals with major depressive disorder. We identified 58 studies of four common inflammatory markers in a literature search of PubMed, Embase and PsychInfo databases in May 2014. Pooled data from the earliest eight studies already showed an association between interleukin-6 concentrations and major depression; 23 more recent studies confirmed this finding (d=0.54, p<0.0001). A significant association between C-reactive protein levels and major depression was noted after 14 studies and this did not change after addition of six more studies (d=0.47, p<0.0001). For these two inflammatory markers, there was moderate heterogeneity in study-specific estimates, subgroup differences were small, and publication bias appeared to be an unlikely explanation for the findings. Sensitivity analyses including only high-quality studies and subjects free of antidepressant medication further verified the associations. While there was a link between tumour necrosis factor-α levels and major depression (d=0.40, p=0.002), the cumulative effect remained uncertain due to the extensive heterogeneity in study-specific estimates and inconsistencies between subgroups. No evidence was found for the association between interleukin-1β levels and major depression (d=-0.05, p=0.86). In conclusion, this cumulative meta-analysis confirmed higher mean levels of interleukin-6 and C-reactive protein in patients with major depression compared to non-depressed controls. No consistent association between tumour necrosis factor-α, interleukin-1β and major depression was observed. Future studies should clarify the specific immune mechanisms involved as well as continue testing anti-inflammatory therapies in patients suffering from major depression. Copyright © 2015 The Authors. Published by

  16. Noradrenaline inhibits lipopolysaccharide-induced tumor necrosis factor and interleukin 6 production in human whole blood.

    PubMed Central

    van der Poll, T; Jansen, J; Endert, E; Sauerwein, H P; van Deventer, S J

    1994-01-01

    Sepsis and lipopolysaccharide (LPS) trigger the systemic release of both cytokines and catecholamines. Cytokines are known to be capable of eliciting a stress hormone response in vivo. The present study sought insight into the effect of noradrenaline on LPS-induced release of tumor necrosis factor alpha (TNF) and interleukin 6 (IL-6) in human whole blood. Whole blood was incubated with LPS for 4 h at 37 degrees C in the presence and absence of noradrenaline and/or specific alpha and beta antagonists and agonists. Noradrenaline caused a dose-dependent inhibition of LPS-induced TNF and IL-6 production. This effect could be completely prevented by addition of the specific beta 1, antagonist metoprolol, while it was not affected by the alpha antagonist phentolamine. Specific beta-adrenergic stimulation by isoprenaline mimicked the inhibiting effect of noradrenaline on LPS-evoked cytokine production, whereas alpha-adrenergic stimulation by phenylephrine had no effect. Fluorescence-activated cell sorter analysis demonstrated that beta-adrenergic stimulation had no effect on LPS binding to and internalization into mononuclear cells or on the expression of CD14, the major receptor for LPS on mononuclear cells. In acute sepsis, enhanced release of noradrenaline may be part of a negative feedback mechanism meant to inhibit ongoing TNF and IL-6 production. PMID:8168970

  17. Measurement of Interleukin-6 in Cerebrospinal Fluid for the Diagnosis of Bacterial Meningitis.

    PubMed

    Dano, Ibrahim Dan; Sadou, Hassimi; Issaka, Bassira; Oukem-Boyer, Odile Ouwe Missi

    It is assessed whether the measurement of interleukin-6 in the cerebrospinal fluid can serve as a biomarker for the diagnosis of bacterial meningitis. Cerebrospinal fluid was obtained from 152 patients aged 0-15 years suspected of having meningitis. These patients were classified into the following groups: Bacterial meningitis (n = 85), aseptic meningitis (n = 35) and non-meningitis/control (n = 32) based on leukocyte count and bacterial identification by culture and molecular biology. Interleukin-6 concentrations in cerebrospinal fluid were measured by enzyme-linked immunosorbent assay. This study found a significant difference of the mean cerebrospinal fluid interleukin-6 level (p≤0.01) between patients with bacterial meningitis (3,538.69±2,560.78 pg mL -1) and patients with aseptic meningitis (332.51±470.69 pg mL -1) or those of the control group (205.83±79.39 pg mL -1). There was also a significant difference of the mean cerebrospinal fluid interleukin-6 level between patients with aseptic meningitis and those of the control group. Interleukin-6 had the highest area under the ROC curve: 0.94 (95% confidence interval: 0.901-0.979) compared to that of cerebrospinal fluid glucose and total protein. At a cut-off value of 1,065.96 pg mL -1, interleukin-6 had a sensitivity of 76.2% and specificity of 100%. Interleukin-6 is a potential biomarker for the differential diagnosis of meningitis.

  18. Adjunctive N-acetylcysteine in depression: exploration of interleukin-6, C-reactive protein and brain-derived neurotrophic factor.

    PubMed

    Hasebe, Kyoko; Gray, Laura; Bortolasci, Chiara; Panizzutti, Bruna; Mohebbi, Mohammadreza; Kidnapillai, Srisaiyini; Spolding, Briana; Walder, Ken; Berk, Michael; Malhi, Gin; Dodd, Seetal; Dean, Olivia M

    2017-12-01

    This study aimed to explore effects of adjunctive N-acetylcysteine (NAC) treatment on inflammatory and neurogenesis markers in unipolar depression. We embarked on a 12-week clinical trial of NAC (2000 mg/day compared with placebo) as an adjunctive treatment for unipolar depression. A follow-up visit was conducted 4 weeks following the completion of treatment. We collected serum samples at baseline and the end of the treatment phase (week 12) to determine changes in interleukin-6 (IL6), C-reactive protein (CRP) and brain-derived neurotrophic factor (BDNF) following NAC treatment. NAC treatment significantly improved depressive symptoms on the Montgomery-Asberg Depression Rating Scale (MADRS) over 16 weeks of the trial. Serum levels of IL6 were associated with reductions of MADRS scores independent of treatment response. However, we found no significant changes in IL6, CRP and BDNF levels following NAC treatment. Overall, this suggests that our results failed to support the hypothesis that IL6, CRP and BDNF are directly involved in the therapeutic mechanism of NAC in depression. IL6 may be a useful marker for future exploration of treatment response.

  19. Interleukin-6 and soluble interleukin-6 receptor suppress osteoclastic differentiation by inducing PGE(2) production in chondrocytes.

    PubMed

    Honda, Kazuhiro

    2011-03-01

    This study examined how interleukin-6 (IL-6) and soluble IL-6 receptor (sIL-6r) influence osteoclastic differentiation through the function of chondrocytes. Chondrocytes were cultured with or without IL-6 and/or sIL-6r in the presence or absence of NS398, a specific inhibitor of cyclooxygenase (COX)-2, for up to 28 days. Chondrocytes were also cultured with or without IL-6 and sIL-6r for 28 days, and the conditioned medium from cells cultured without IL-6 and sIL-6r was used to induce differentiation of RAW264.7 cells into osteoclast precursors. Osteoclastic differentiation was assessed by tartrate-resistant acid phosphatase (TRAP) staining. Expression of osteoprotegerin (OPG), receptor activator of NF-κB ligand (RANKL), COX-2, and prostaglandin E(2) (PGE(2)) increased in cells exposed to IL-6 and sIL-6r, whereas expression of macrophage colony-stimulating factor (M-CSF) and bone resorption-related enzymes decreased. NS398 blocked the stimulatory/suppressive effects of IL-6 and sIL-6r on the expression of OPG, RANKL, and M-CSF. Fewer TRAP-positive multinucleated cells were detected after treatment with conditioned medium from IL-6- and sIL-6r-treated chondrocytes than after treatment with conditioned medium from untreated chondrocytes. These results suggest that IL-6 and sIL-6r interfere with osteoclast function through the involvement of chondrocytes. Specifically, they appear to suppress the differentiation of osteoclast precursors into osteoclasts by inducing chondrocytic PGE(2) production, which, in turn, increases OPG secretion and decreases M-CSF secretion by chondrocytes.

  20. Tumour necrosis factor-α-mediated disruption of cerebrovascular endothelial barrier integrity in vitro involves the production of proinflammatory interleukin-6.

    PubMed

    Rochfort, Keith D; Collins, Laura E; McLoughlin, Alisha; Cummins, Philip M

    2016-02-01

    The co-involvement of tumour necrosis factor-α (TNF-α) and interleukin-6 (IL-6) during blood-brain barrier (BBB) injury has been reported in various models of neuroinflammation, although the precise functional interplay between these archetypal proinflammatory cytokines remains largely undefined within this context. In the current paper, we tested the hypothesis that TNF-α-mediated BBB disruption is measurably attributable in-part to induction of microvascular endothelial IL-6 production. In initial experiments, we observed that treatment of human brain microvascular endothelial cells (HBMvECs) with TNF-α (0-100 ng/mL, 0-24 h) robustly elicited both time- and dose-dependent induction of IL-6 expression and release, as well as expression of the IL-6 family receptor, GP130. Further experiments demonstrated that the TNF-α-dependent generation of reactive oxygen species, down-regulation of adherens/tight junction proteins, and concomitant elevation of HBMvEC permeability, were all significantly attenuated by blockade of IL-6 signalling using either an anti-IL-6 neutralizing antibody or an IL-6 siRNA. Based on these observations, we conclude that TNF-α treatment of HBMvECs in vitro activates IL-6 production and signalling, events that were shown to synergize with TNF-α actions to elicit HBMvEC permeabilization. These novel findings offer a constructive insight into the specific contribution of downstream cytokine induction to the injurious actions of TNF-α at the BBB microvascular endothelium interface. The co-involvement of tumour necrosis factor-α (TNF-α) and interleukin-6 (IL-6) during blood-brain barrier (BBB) injury has been widely reported. Using human brain microvascular endothelial cells (HBMvEC), we show that TNF-α-mediated BBB disruption is measurably attributable in-part to induction of endothelial IL-6 production and signalling. We demonstrate that the TNF-α-dependent generation of reactive oxygen species (ROS), down-regulation of

  1. Synergistic effect of interleukin-17 and tumour necrosis factor-α on inflammatory response in hepatocytes through interleukin-6-dependent and independent pathways.

    PubMed

    Beringer, A; Thiam, N; Molle, J; Bartosch, B; Miossec, P

    2018-04-20

    The proinflammatory cytokines interleukin (IL)-17 and tumour necrosis factor (TNF)-α are targets for treatment in many chronic inflammatory diseases. Here, we examined their role in liver inflammatory response compared to that of IL-6. Human hepatoma cells (HepaRG, Huh7.5 and HepG2 cells) and primary human hepatocytes (PHH) were cultured with IL-6, IL-17 and/or TNF-α. To determine the contribution of the IL-6 pathway in the IL-17/TNF-α-mediated effect, an anti-IL-6 receptor antibody was used. IL-17 and TNF-α increased in synergy IL-6 secretion by HepaRG cells and PHH but not by Huh7.5 and HepG2 cells. This IL-17/TNF-α synergistic cooperation enhanced the levels of C-reactive protein (CRP) and aspartate aminotransferase (ASAT) in HepaRG cell and PHH cultures through the induction of IL-6. IL-17/TNF-α also up-regulated IL-8, monocyte chemoattractant protein (MCP)-1 and chemokine (C-C motif) ligand 20 (CCL20) chemokines in synergy through an IL-6-independent pathway. Interestingly, first exposure to IL-17, but not to TNF-α, was crucial for the initiation of the IL-17/TNF-α synergistic effect on IL-6 and IL-8 production. In HepaRG cells, IL-17 enhanced IL-6 mRNA stability resulting in increased IL-6 protein levels. The IL-17A/TNF-α synergistic effect on IL-6 and IL-8 induction was mediated through the activation of extracellular signal-regulated kinase (ERK)-mitogen-activated protein kinase, nuclear factor-κB and/or protein kinase B (Akt)-phosphatidylinositol 3-kinase signalling pathways. Therefore, the IL-17/TNF-α synergistic interaction mediates systemic inflammation and cell damage in hepatocytes mainly through IL-6 for CRP and ASAT induction. Independently of IL-6, the IL-17A/TNF-α combination may also induce immune cell recruitment by chemokine up-regulation. IL-17 and/or TNF-α neutralization can be a promising therapeutic strategy to control both systemic inflammation and liver cell attraction. © 2018 British Society for Immunology.

  2. Interleukin-6 in cerebrospinal fluid as a biomarker of acute meningitis.

    PubMed

    García-Hernández, Pablo; Prieto, Belén; Martínez-Morillo, Eduardo; Rodríguez, Verónica; Álvarez, Francisco V

    2016-01-01

    Microbiological culture of cerebrospinal fluid is the gold standard to differentiate between aseptic and bacterial meningitis, but this method has low sensitivity. A fast and reliable new marker would be of interest in clinical practice. Interleukin-6, secreted by T cells in response to meningeal pathogens and quickly delivered into cerebrospinal fluid, was evaluated as a marker of acute meningitis. A total of 150 cerebrospinal fluid samples were analysed by an electrochemiluminescence method, selected according to patient diagnosis: (a) bacterial meningitis confirmed by positive culture (n = 26); (b) bacterial meningitis with negative culture or not performed (n = 15); (c) viral meningitis confirmed by polymerase chain reaction or immunoglobulin G determination (n = 23); (d) viral meningitis with polymerase chain reaction negative or not performed (n = 42); and (e) controls (n = 44). Cerebrospinal fluid interleukin-6 concentration showed significant differences between all pathologic groups and the control group (P < 0.001). As a diagnostic tool for bacterial meningitis, interleukin-6 showed an area under the curve of 0.937 (95% confidence intervals: 0.895-0.978), significantly higher than those of classical biomarkers. An interleukin-6 cutoff of 1418 pg/mL showed 95.5% sensitivity and 77.5% specificity, whereas a value of 15,060 pg/mL showed 63.6% sensitivity and 96.7% specificity, for diagnosis of bacterial meningitis. Interleukin-6 measured by electrochemiluminescence method is a promising marker for early differentiation between aseptic and bacterial meningitis. More studies are needed to validate clinical implications for future practice in an emergency laboratory. © The Author(s) 2015.

  3. An autoinflammatory neurological disease due to interleukin 6 hypersecretion

    PubMed Central

    2013-01-01

    Autoinflammatory diseases are rare illnesses characterized by apparently unprovoked inflammation without high-titer auto-antibodies or antigen-specific T cells. They may cause neurological manifestations, such as meningitis and hearing loss, but they are also characterized by non-neurological manifestations. In this work we studied a 30-year-old man who had a chronic disease characterized by meningitis, progressive hearing loss, persistently raised inflammatory markers and diffuse leukoencephalopathy on brain MRI. He also suffered from chronic recurrent osteomyelitis of the mandible. The hypothesis of an autoinflammatory disease prompted us to test for the presence of mutations in interleukin-1−pathway genes and to investigate the function of this pathway in the mononuclear cells obtained from the patient. Search for mutations in genes associated with interleukin-1−pathway demonstrated a novel NLRP3 (CIAS1) mutation (p.I288M) and a previously described MEFV mutation (p.R761H), but their combination was found to be non-pathogenic. On the other hand, we uncovered a selective interleukin-6 hypersecretion within the central nervous system as the likely pathogenic mechanism. This is also supported by the response to the anti-interleukin-6−receptor monoclonal antibody tocilizumab, but not to the recombinant interleukin-1−receptor antagonist anakinra. Exome sequencing failed to identify mutations in other genes known to be involved in autoinflammatory diseases. We propose that the disease described in this patient might be a prototype of a novel category of autoinflammatory diseases characterized by prominent neurological involvement. PMID:23432807

  4. Association of Gene Polymorphisms in Interleukin 6 in Infantile Bronchial Asthma.

    PubMed

    Babusikova, Eva; Jurecekova, Jana; Jesenak, Milos; Evinova, Andrea

    2017-07-01

    The genetic background of bronchial asthma is complex, and it is likely that multiple genes contribute to its development both directly and through gene-gene interactions. Cytokines contribute to different aspects of asthma, as they determine the type, severity and outcomes of asthma pathogenesis. Allergic asthmatics undergoing an asthmatic attack exhibit significantly higher levels of pro-inflammatory cytokines, such as interleukins and chemokines. In recent years, cytokines and their receptors have been shown to be highly polymorphic, and this prompted us to investigate interleukin 6 promoter polymorphisms at position -174G/C (rs1800795) and at -572G/C (rs1800796) in relation to asthma in children. Interleukin 6 promoter polymorphisms were analyzed in bronchial asthma patients and healthy children using polymerase chain reaction-restriction fragment length polymorphism analysis. We observed a significant association between polymorphism at -174G/C and bronchial asthma (OR=3.4, 95% CI: 2.045-5.638, P<.001). Higher associations between polymorphism at IL-6 -174G/C and bronchial asthma were observed in atopic patients (OR=4.1, 95% CI: 2.308-7.280, P<8.10 -7 ). Interleukin 6 polymorphism is associated with bronchial asthma, particularly its atopic phenotype. Expression and secretion of interleukins in asthmatic patients may be affected by genetic polymorphisms, and could have a disease-modifying effect in the asthmatic airway and modify the therapeutic response. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

  5. Metabolites associated with circulating interleukin-6 in older adults

    USDA-ARS?s Scientific Manuscript database

    Background: Circulating levels of the pro-inflammatory cytokine interleukin-6 (IL-6) levels are elevated in older adults, but mechanisms are unclear. In the current study, we used an untargeted metabolomic approach to develop an improved understanding about mechanisms related to circulating IL-6 in ...

  6. Kaposi's Sarcoma-Associated Herpesvirus Interleukin-6 Modulates Endothelial Cell Movement by Upregulating Cellular Genes Involved in Migration.

    PubMed

    Giffin, Louise; West, John A; Damania, Blossom

    2015-12-08

    Kaposi's sarcoma-associated herpesvirus (KSHV) is the causative agent of human Kaposi's sarcoma, a tumor that arises from endothelial cells, as well as two B cell lymphoproliferative diseases, primary effusion lymphoma and multicentric Castleman's disease. KSHV utilizes a variety of mechanisms to evade host immune responses and promote cellular transformation and growth in order to persist for the life of the host. A viral homolog of human interleukin-6 (hIL-6) named viral interleukin-6 (vIL-6) is encoded by KSHV and expressed in KSHV-associated cancers. Similar to hIL-6, vIL-6 is secreted, but the majority of vIL-6 is retained within the endoplasmic reticulum, where it can initiate functional signaling through part of the interleukin-6 receptor complex. We sought to determine how intracellular vIL-6 modulates the host endothelial cell environment by analyzing vIL-6's impact on the endothelial cell transcriptome. vIL-6 significantly altered the expression of many cellular genes associated with cell migration. In particular, vIL-6 upregulated the host factor carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) at the protein and message levels. CEACAM1 has been implicated in tumor invasion and metastasis and promotes migration and vascular remodeling in endothelial cells. We report that vIL-6 upregulates CEACAM1 by a STAT3-dependent mechanism and that CEACAM1 promotes vIL-6-mediated migration. Furthermore, latent and de novo KSHV infections of endothelial cells also induce CEACAM1 expression. Collectively, our data suggest that vIL-6 modulates endothelial cell migration by upregulating the expression of cellular factors, including CEACAM1. Kaposi's sarcoma-associated herpesvirus (KSHV) is linked with the development of three human malignancies, Kaposi's sarcoma, multicentric Castleman's disease, and primary effusion lymphoma. KSHV expresses many factors that enable the virus to manipulate the host environment in order to persist and induce disease

  7. Cumulative meta-analysis of interleukins 6 and 1β, tumour necrosis factor α and C-reactive protein in patients with major depressive disorder

    PubMed Central

    Haapakoski, Rita; Mathieu, Julia; Ebmeier, Klaus P.; Alenius, Harri; Kivimäki, Mika

    2015-01-01

    Cumulative meta-analyses are used to evaluate the extent to which further studies are needed to confirm or refute a hypothesis. We used this approach to assess observational evidence on systemic inflammation in individuals with major depressive disorder. We identified 58 studies of four common inflammatory markers in a literature search of PubMed, Embase and PsychInfo databases in May 2014. Pooled data from the earliest eight studies already showed an association between interleukin-6 concentrations and major depression; 23 more recent studies confirmed this finding (d = 0.54, p < 0.0001). A significant association between C-reactive protein levels and major depression was noted after 14 studies and this did not change after addition of six more studies (d = 0.47, p < 0.0001). For these two inflammatory markers, there was moderate heterogeneity in study-specific estimates, subgroup differences were small, and publication bias appeared to be an unlikely explanation for the findings. Sensitivity analyses including only high-quality studies and subjects free of antidepressant medication further verified the associations. While there was a link between tumour necrosis factor-α levels and major depression (d = 0.40, p = 0.002), the cumulative effect remained uncertain due to the extensive heterogeneity in study-specific estimates and inconsistencies between subgroups. No evidence was found for the association between interleukin-1β levels and major depression (d = −0.05, p = 0.86). In conclusion, this cumulative meta-analysis confirmed higher mean levels of interleukin-6 and C-reactive protein in patients with major depression compared to non-depressed controls. No consistent association between tumour necrosis factor-α, interleukin-1β and major depression was observed. Future studies should clarify the specific immune mechanisms involved as well as continue testing anti-inflammatory therapies in patients suffering from major depression. PMID

  8. In vitro and in vivo expression of interleukin-1alpha and tumor necrosis factor-alpha mRNA in pemphigus vulgaris: interleukin-1alpha and tumor necrosis factor-alpha are involved in acantholysis.

    PubMed

    Feliciani, C; Toto, P; Amerio, P; Pour, S M; Coscione, G; Shivji, G; Wang, B; Sauder, D N

    2000-01-01

    Keratinocyte-derived cytokines have been implicated in the pathogenesis of a number of skin diseases. In this study we examined the possible role of keratinocyte-derived cytokines in the development of acantholysis in pemphigus vulgaris. Nineteen patients with pemphigus vulgaris, demonstrating the characteristic clinical, pathologic, and immunopathologic findings were studied. In situ immunolabeling demonstrated the presence of two cytokines interleukin-1alpha and tumor necrosis factor-alpha, in lesional and perilesional areas. Results were confirmed by reverse transcriptase-polymerase chain reaction, demonstrating overexpression of both cytokines in vivo. To study the role of these cytokines in the pathogenesis of pemphigus vulgaris both in vitro and in vivo studies were performed. The results of the in vitro study demonstrated that pemphigus vulgaris IgG induced interleukin-1alpha and tumor necrosis factor-alpha mRNA in the skin. The potential pathogenic role of these mediators was demonstrated by a blocking study using antibodies against human interleukin-1alpha and tumor necrosis factor-alpha in keratinocytes cultures. A combination of anti-interleukin-1alpha and anti-tumor necrosis factor-alpha antibodies inhibited in vitro pemphigus vulgaris IgG induced acantholysis. To confirm the role of interleukin-1 and tumor necrosis factor-alpha in pemphigus, we utilized passive transfer studies using interleukin-1 deficient mice (ICE-/-, interleukin-1beta-/-) and tumor necrosis factor-alpha receptor deficient mice (TNFR1R2-/-). Both groups demonstrated a decreased susceptibility to the passive transfer of pemphigus. Our data support the role of cytokines interleukin-1 and tumor necrosis factor-alpha in the pathogenesis of pemphigus vulgaris.

  9. Gene expression and production of tumor necrosis factor alpha, interleukin 1, interleukin 6, and gamma interferon in C3H/HeN and C57BL/6N mice in acute Mycoplasma pulmonis disease.

    PubMed Central

    Faulkner, C B; Simecka, J W; Davidson, M K; Davis, J K; Schoeb, T R; Lindsey, J R; Everson, M P

    1995-01-01

    Studies were conducted to determine whether the production of various cytokines is associated with Mycoplasma pulmonis disease expression. Susceptible C3H/HeN and resistant C57BL/6N mice were inoculated intranasally with 10(7) CFU of virulent M. pulmonis UAB CT or avirulent M. pulmonis UAB T. Expression of genes for tumor necrosis factor alpha (TNF-alpha), interleukin 1 alpha (IL-1 alpha), IL-1 beta, IL-6, and gamma interferon (IFN-gamma) in whole lung tissue and TNF-alpha gene expression in bronchoalveolar lavage (BAL) cells was determined by reverse transcription-PCR using specific cytokine primers at various times postinoculation. In addition, concentrations of TNF-alpha, IL-1, IL-6, and IFN-gamma were determined in BAL fluid and serum samples at various times postinoculation. Our results showed that there was a sequential appearance of cytokines in the lungs of infected mice: TNF-alpha, produced primarily by BAL cells, appeared first, followed by IL-1 and IL-6, which were followed by IFN-gamma. Susceptible C3H/HeN mice had higher and more persistent concentrations of TNF-alpha and IL-6 in BAL fluid than did resistant C57BL/6N mice, indicating that TNF-alpha and possibly IL-6 are important factors in pathogenesis of acute M. pulmonis disease in mice. Serum concentrations of IL-6 were elevated in C3H/HeN mice, but not C57BL/6N mice, following infection with M. pulmonis, suggesting that IL-6 has both local and systemic effects in M. pulmonis disease. PMID:7558323

  10. Nature of the endogenous pyrogen (EP) induced by influenza viruses: lack of correlation between EP levels and content of the known pyrogenic cytokines, interleukin 1, interleukin 6 and tumour necrosis factor.

    PubMed

    Jakeman, K J; Bird, C R; Thorpe, R; Smith, H; Sweet, C

    1991-03-01

    Fever in influenza results from the release of endogenous pyrogen (EP) following virus-phagocyte interaction and its level correlates with the differing virulence of virus strains. However, the different levels of fever produced in ferrets by intracardial inoculation of EP obtained from the interaction of different virus strains with ferret of human phagocytes did not correlate with the levels of interleukin 1 (IL-1), IL-6 or tumour necrosis factor in the same samples as assayed by conventional in vitro methods. Hence, the EP produced by influenza virus appears to be different to these cytokines.

  11. Interleukin-6 in the injured patient. Marker of injury or mediator of inflammation?

    PubMed Central

    Biffl, W L; Moore, E E; Moore, F A; Peterson, V M

    1996-01-01

    OBJECTIVE: The effects of interleukin (IL)-6 in the injured patient are examined in an attempt to clarify the potential pathophysiologic role of IL-6 in the response to injury. SUMMARY BACKGROUND DATA: Interleukin-6 is an integral cytokine mediator of the acute phase response to injury and infection. However, prolonged and excessive elevations of circulating IL-6 levels in patients after trauma, burns, and elective surgery have been associated with complications and mortality. The mechanistic role of IL-6 in mediating these effects is unclear. METHODS: A review of current literature is performed to summarize the origins, mechanisms of action, and biologic effects of IL-6 and to characterize the IL-6 response to injury. RESULTS: Interleukin-6 is a multifunctional cytokine expressed by a variety of cells after a multitude of stimuli, under complex regulatory control mechanisms. The IL-6 response to injury is uniquely consistent and related to the magnitude of the insult. Moreover, the early postinjury IL-6 response correlates with complications as well as mortality. CONCLUSIONS: Interleukin-6 appears to play an active role in the postinjury immune response, making it an attractive therapeutic target in attempts to control hyperinflammatory provoked organ injury. Images Figure 2. PMID:8916880

  12. Analysis of Polymorphisms in Interleukin-10, Interleukin-6, and Interleukin-1 Receptor Antagonist in Mexican-Mestizo Women with Pre-eclampsia

    PubMed Central

    Valencia Villalvazo, Elith Yazmin; Canto-Cetina, Thelma; Romero Arauz, Juan Fernando; Coral-Vázquez, Ramón Mauricio; Canizales-Quinteros, Samuel; Coronel, Agustín; Carlos Falcón, Juan; Hernández Rivera, Jaime; Ibarra, Roberto; Polanco Reyes, Lucila

    2012-01-01

    Due to the fact that studies seeking associations of polymorphisms in regulatory regions of cytokine genes with pre-eclampsia (PE) have not always been consistent in different population analyses, the aim of this study was to investigate the possible association between rs1800896 of interleukin-10 (IL-10), rs1800795 of interleukin-6 (IL-6), and the variable number of tandem repeats (VNTR) in intron 2 of interleukin-1 receptor antagonist (IL-1Ra), as well as gene–gene interactions between these three polymorphisms with the presence of PE in Mexican-Mestizo women and one Amerindian population from México (Maya). A case–control study was performed where 411 pre-eclamptic cases and 613 controls were genotyped. For the rs1800896 of IL-10 and rs1800795 of IL-6, we used real-time polymerase chain reaction (PCR) allelic discrimination and for the VNTR of IL-1Ra, PCR. Allele frequency differences were assessed by Chi-squared test; logistic regression was used to test for associations; a gene–gene interaction was conducted. Genotypic and allelic distribution of the polymorphisms was similar in our population. The estimated of the gene–gene interaction between the polymorphisms did not differ significantly. However, we observed important differences in the distribution of the alleles and genotypes of the three polymorphisms analyzed between Mestiza-Mexicanas and Maya-Mestizo women. In conclusion, we did not find an association between polymorphisms in IL-10, IL-6, and IL-1Ra and PE in Mexican-Mestizo and Maya-Mestizo women. To our knowledge, this is the first time that these three polymorphisms were analyzed together with gene–gene interaction in women with PE. PMID:23013217

  13. Triggered Urine Interleukin-6 Correlates to Severity of Symptoms in Nonfebrile Lower Urinary Tract Infections.

    PubMed

    Sundén, Fredrik; Butler, Daniel; Wullt, Björn

    2017-07-01

    Objective diagnosis of symptomatic urinary tract infections in patients prone to asymptomatic bacteriuria is compromised by local host responses that are already present and the positive urine culture. We investigated interleukin-6 as a biomarker for nonfebrile urinary tract infection severity and diagnostic thresholds for interleukin-6 and 8, and neutrophils to differentiate between asymptomatic bacteriuria and urinary tract infection. Patients with residual urine and neurogenic bladders due to spinal lesions included in a long-term Escherichia coli 83972 asymptomatic bacteriuria inoculation trial were monitored for 2 years. Symptom scoring and urine sampling to estimate interleukin-6 and 8, and neutrophils were performed regularly monthly and at urinary tract infection episodes. Patients were followed in the complete study for a mean of 19 months (range 10 to 27) and those with asymptomatic bacteriuria with E. coli 83972 were followed a mean of 11 months (range 4 to 19). A total of 37 nonfebrile urinary tract infection episodes with complete data on interleukin-6 and 8, neutrophils and symptom scoring were documented. Interleukin-6 was the only marker that persistently increased during urinary tract infection compared to asymptomatic bacteriuria in pooled and paired intra-individual comparisons (p <0.05). Interleukin-6 above the threshold (greater than 25 ng/l) correlated to more severe urinary tract infection symptoms (p <0.05). The sensitivity and specificity of all biomarkers were poor/moderate when differentiating asymptomatic bacteriuria vs all urinary tract infection episodes. However, in urinary tract infections with worse symptoms interleukin-6 and neutrophils demonstrated equal good/excellent outcomes. Triggered interleukin-6 correlated to urinary tract infection symptom severity and demonstrated a promising differential diagnostic capacity to discriminate urinary tract infection from asymptomatic bacteriuria. Future studies should explore interleukin-6

  14. Synergistic stimulation of interleukin 6 release and gene expression by phorbol esters and interleukin 1 beta in rat cortical astrocytes: role of protein kinase C activation and blockade.

    PubMed

    Grimaldi, M; Arcone, R; Ciliberto, G; Schettini, G

    1995-05-01

    The involvement of protein kinase C and its interaction with interleukin 1 beta in the control of interleukin 6 release by cortical astrocytes was studied. The blockade of protein kinase C catalytic domain, by staurosporine, as well as the desensitization of protein kinase C by short-term phorbol 12-myristate 13-acetate pretreatment, increased the basal release of interleukin 6 by rat cortical astrocytes, whereas calphostin C, an antagonist of phorbol ester binding on protein kinase C regulatory domain, did not affect the basal release of the cytokine. The activation of protein kinase C by phorbol 12-myristate 13-acetate enhanced concentration- and time-dependently interleukin 6 release. This stimulatory action of phorbol 12-myristate 13-acetate was significantly reduced by staurosporine, by calphostin C and by the desensitization of protein kinase C. Interleukin 1 beta increased interleukin 6 release in a concentration-related manner. Protein kinase C inhibition, by staurosporine or desensitization, potentiated severalfold, whereas calphostin C reduced interleukin 1 beta stimulation of interleukin 6 release. The treatment of cortical astrocytes with both interleukin 1 beta (3 ng/ml) and phorbol 12-myristate 13-acetate (10 nM) caused a synergistic stimulation of interleukin 6 release and its gene expression, an effect that was not relieved by either 20 nM staurospine or by calphostin C but was slightly affected by protein kinase C desensitization. In conclusion, our data show that in rat cortical astrocytes the basal release of interleukin 6 is under a tonic inhibition exerted by a protein kinase C isoform or isoforms sensitive to blockade by staurosporine and desensitization but insensitive to calphostin C.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Serum tumour necrosis factor-α and interleukin-6 levels in Alzheimer's disease and mild cognitive impairment.

    PubMed

    Kim, Yo Sup; Lee, Kang Joon; Kim, Hyun

    2017-07-01

    Neuroinflammation has been recognized as a feature of Alzheimer's disease (AD), and mild cognitive impairment (MCI) is believed to share several pathological features with AD. The aim of the present study was to compare serum cytokine levels between patients with AD, subjects with MCI, and healthy controls, and to assess the correlation between cytokine levels and cognitive performance in these subjects. Participants included 35 patients with AD, 29 subjects with MCI, and 28 healthy controls from the Department of Psychiatry of IIlsan Paik Hospital in South Korea. Demographic and neuropsychological information were obtained, and peripheral cytokine levels, specifically tumour necrosis factor (TNF)-α and interleukin (IL)-6 levels, were measured for all subjects. After adjustment for age, a significant difference in IL-6 levels (P = 0.045), but not in TNF-α (P = 0.082) levels, was observed among the three groups. IL-6 levels were higher in patients with AD than in subjects with MCI and healthy controls. TNF-α and IL-6 levels negatively and positively correlated with Mini-Mental State Examination and Global Deterioration Scale scores, respectively. TNF-α and IL-6 levels were also positively correlated with each other. The present study suggests that serum IL-6 levels of patients with AD might be higher than those of subjects with MCI and healthy controls. Serum TNF-α and IL-6 levels might be negatively correlated with cognitive function, and we suspect that serum IL-6 levels could be biomarkers for AD. © 2017 Japanese Psychogeriatric Society.

  16. Targeting interleukin-6 for noninfectious uveitis

    PubMed Central

    Lin, Phoebe

    2015-01-01

    Interleukin-6 (IL-6) is a pleiotropic cytokine implicated in the pathogenesis of many immune-mediated disorders including several types of non-infectious uveitis. These uveitic conditions include Vogt-Koyanagi-Harada syndrome, uveitis associated with Behçet disease, and sarcoidosis. This review summarizes the role of IL-6 in immunity, highlighting its effect on Th17, Th1, and plasmablast differentiation. It reviews the downstream mediators activated in the process of IL-6 binding to its receptor complex. This review also summarizes the biologics targeting either IL-6 or the IL-6 receptor, including tocilizumab, sarilumab, sirukumab, olokizumab, clazakizumab, and siltuximab. The target, dosage, potential side effects, and potential uses of these biologics are summarized in this article based on the existing literature. In summary, anti-IL-6 therapy for non-infectious uveitis shows promise in terms of efficacy and side effect profile. PMID:26392750

  17. Interleukin-6 receptor pathways in coronary heart disease: a collaborative meta-analysis of 82 studies.

    PubMed

    Sarwar, Nadeem; Butterworth, Adam S; Freitag, Daniel F; Gregson, John; Willeit, Peter; Gorman, Donal N; Gao, Pei; Saleheen, Danish; Rendon, Augusto; Nelson, Christopher P; Braund, Peter S; Hall, Alistair S; Chasman, Daniel I; Tybjærg-Hansen, Anne; Chambers, John C; Benjamin, Emelia J; Franks, Paul W; Clarke, Robert; Wilde, Arthur A M; Trip, Mieke D; Steri, Maristella; Witteman, Jacqueline C M; Qi, Lu; van der Schoot, C Ellen; de Faire, Ulf; Erdmann, Jeanette; Stringham, Heather M; Koenig, Wolfgang; Rader, Daniel J; Melzer, David; Reich, David; Psaty, Bruce M; Kleber, Marcus E; Panagiotakos, Demosthenes B; Willeit, Johann; Wennberg, Patrik; Woodward, Mark; Adamovic, Svetlana; Rimm, Eric B; Meade, Tom W; Gillum, Richard F; Shaffer, Jonathan A; Hofman, Albert; Onat, Altan; Sundström, Johan; Wassertheil-Smoller, Sylvia; Mellström, Dan; Gallacher, John; Cushman, Mary; Tracy, Russell P; Kauhanen, Jussi; Karlsson, Magnus; Salonen, Jukka T; Wilhelmsen, Lars; Amouyel, Philippe; Cantin, Bernard; Best, Lyle G; Ben-Shlomo, Yoav; Manson, JoAnn E; Davey-Smith, George; de Bakker, Paul I W; O'Donnell, Christopher J; Wilson, James F; Wilson, Anthony G; Assimes, Themistocles L; Jansson, John-Olov; Ohlsson, Claes; Tivesten, Åsa; Ljunggren, Östen; Reilly, Muredach P; Hamsten, Anders; Ingelsson, Erik; Cambien, Francois; Hung, Joseph; Thomas, G Neil; Boehnke, Michael; Schunkert, Heribert; Asselbergs, Folkert W; Kastelein, John J P; Gudnason, Vilmundur; Salomaa, Veikko; Harris, Tamara B; Kooner, Jaspal S; Allin, Kristine H; Nordestgaard, Børge G; Hopewell, Jemma C; Goodall, Alison H; Ridker, Paul M; Hólm, Hilma; Watkins, Hugh; Ouwehand, Willem H; Samani, Nilesh J; Kaptoge, Stephen; Di Angelantonio, Emanuele; Harari, Olivier; Danesh, John

    2012-03-31

    Persistent inflammation has been proposed to contribute to various stages in the pathogenesis of cardiovascular disease. Interleukin-6 receptor (IL6R) signalling propagates downstream inflammation cascades. To assess whether this pathway is causally relevant to coronary heart disease, we studied a functional genetic variant known to affect IL6R signalling. In a collaborative meta-analysis, we studied Asp358Ala (rs2228145) in IL6R in relation to a panel of conventional risk factors and inflammation biomarkers in 125,222 participants. We also compared the frequency of Asp358Ala in 51,441 patients with coronary heart disease and in 136,226 controls. To gain insight into possible mechanisms, we assessed Asp358Ala in relation to localised gene expression and to postlipopolysaccharide stimulation of interleukin 6. The minor allele frequency of Asp358Ala was 39%. Asp358Ala was not associated with lipid concentrations, blood pressure, adiposity, dysglycaemia, or smoking (p value for association per minor allele ≥0·04 for each). By contrast, for every copy of 358Ala inherited, mean concentration of IL6R increased by 34·3% (95% CI 30·4-38·2) and of interleukin 6 by 14·6% (10·7-18·4), and mean concentration of C-reactive protein was reduced by 7·5% (5·9-9·1) and of fibrinogen by 1·0% (0·7-1·3). For every copy of 358Ala inherited, risk of coronary heart disease was reduced by 3·4% (1·8-5·0). Asp358Ala was not related to IL6R mRNA levels or interleukin-6 production in monocytes. Large-scale human genetic and biomarker data are consistent with a causal association between IL6R-related pathways and coronary heart disease. British Heart Foundation; UK Medical Research Council; UK National Institute of Health Research, Cambridge Biomedical Research Centre; BUPA Foundation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

    PubMed Central

    Oliviero, S; Cortese, R

    1989-01-01

    Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

  19. Brain-derived neurotrophic factor and interleukin-6 levels in the serum and cerebrospinal fluid of children with viral infection-induced encephalopathy.

    PubMed

    Morichi, Shinichiro; Yamanaka, Gaku; Ishida, Yu; Oana, Shingo; Kashiwagi, Yasuyo; Kawashima, Hisashi

    2014-11-01

    We investigated changes in the brain-derived neurotrophic factor (BDNF) and interleukin (IL)-6 levels in pediatric patients with central nervous system (CNS) infections, particularly viral infection-induced encephalopathy. Over a 5-year study period, 24 children hospitalized with encephalopathy were grouped based on their acute encephalopathy type (the excitotoxicity, cytokine storm, and metabolic error types). Children without CNS infections served as controls. In serum and cerebrospinal fluid (CSF) samples, BDNF and IL-6 levels were increased in all encephalopathy groups, and significant increases were noted in the influenza-associated and cytokine storm encephalopathy groups. Children with sequelae showed higher BDNF and IL-6 levels than those without sequelae. In pediatric patients, changes in serum and CSF BDNF and IL-6 levels may serve as a prognostic index of CNS infections, particularly for the diagnosis of encephalopathy and differentiation of encephalopathy types.

  20. Inhibitory effects of hepatocyte growth factor and interleukin-6 on transforming growth factor-beta1 mediated vocal fold fibroblast-myofibroblast differentiation.

    PubMed

    Vyas, Bimal; Ishikawa, Keiko; Duflo, Suzy; Chen, Xia; Thibeault, Susan L

    2010-05-01

    The role of myofibroblasts in vocal fold scarring has not been extensively studied, partly because of the lack of a robust in vitro model. The objective of this investigation was to develop and characterize a myofibroblast in vitro model that could be utilized to investigate the molecular mechanism of myofibroblast differentiation and function in injured vocal fold tissue. Differentiation of human primary vocal fold fibroblasts (hVFFs) to myofibroblasts was stimulated with 5, 10, or 20 ng/mL of recombinant transforming growth factor-beta1 (TGF-beta1). Cultures were analyzed by immunofluorescence and Western blotting, with an alpha-smooth muscle actin (alpha-SMA) antibody used as a myofibroblast marker. Normal rabbit vocal folds were treated with 10 ng/mL of TGF-beta1 for 7 days for in vivo corroboration. The effects of interleukin-6 (IL-6) and hepatocyte growth factor (HGF) on myofibroblast differentiation were studied with Western blots. The hVFFs demonstrated positive alpha-SMA labeling in cells stimulated by 10 and 20 ng/mL TGF-beta1, indicating that hVFFs were capable of differentiation to myofibroblasts. Transforming growth factor-beta1 induced the largest increase in alpha-SMA at 10 ng/mL on day 5 of treatment. Both HGF and IL-6 suppressed the expression of TGF-beta1-induced alpha-SMA. Our work characterizes a useful in vitro model of TGF-beta1-mediated vocal fold fibroblast-myofibroblast differentiation. The extent of differentiation appears to be attenuated by HGF, suggesting a potential mechanism to support prior work indicating that HGF plays a protective role in reducing scar formation in vocal fold injuries. Paradoxically, IL-6, which has been shown to play a profibrotic role in dermal studies, also attenuated the TGF-beta1 response.

  1. Tumour necrosis factor-α/interleukin-10 ratio in patients with obstructive sleep apnoea hypopnoea syndrome.

    PubMed

    Jiang, H; Cao, H; Wang, P; Liu, W; Cao, F; Chen, J

    2015-01-01

    To explore the significance of the tumour necrosis factor-α/interleukin-10 ratio and the effect of continuous positive airway pressure in patients with different degrees of obstructive sleep apnoea hypopnoea syndrome severity. This study comprised 135 patients with obstructive sleep apnoea hypopnoea syndrome and 94 control subjects. Tumour necrosis factor-α and tumour necrosis factor-α/interleukin-10 ratio values were significantly higher in the obstructive sleep apnoea hypopnoea syndrome group than in the control group, but interleukin-10 was significantly lower. Tumour necrosis factor-α/interleukin-10 ratio values increased in line with the severity of obstructive sleep apnoea hypopnoea syndrome. In multivariate analysis, the tumour necrosis factor-α/interleukin-10 ratio correlated positively with the apnoea-hypopnoea index and all indices of obstructive sleep apnoea hypopnoea syndrome, except for age, body mass index and neck circumference. After one month of continuous positive airway pressure therapy, levels of tumour necrosis factor-α decreased; interleukin-10 showed no change. The results suggest that inflammation is activated and anti-inflammatory cytokines are decreased in obstructive sleep apnoea hypopnoea syndrome patients. Tumour necrosis factor-α/interleukin-10 ratio may prove useful for severity monitoring and management of obstructive sleep apnoea hypopnoea syndrome patients, and may reduce the need for polysomnography.

  2. Influence of spaceflight on the production of interleukin-3 and interleukin-6 by rat spleen and thymus cells

    NASA Technical Reports Server (NTRS)

    Miller, Edwin S.; Koebel, D. Anne; Sonnefeld, Gerald

    1995-01-01

    Six adult male Sprague-Dawley rats were flown on the 7-day US space shuttle mission STS-54. After flight, the spleen and thymus from each animal were assayed for the capacity to secrete the cytokines interleukin-3 (IL-3) and IL-6. Spleen and thymus cells were incubated for 48 h in the presence of 5 microgram/ml of concanavalin A or 2 microgram/ml of bacterial lipopolysaccharide to stimulate the production of IL-3 and IL-6. IL-3 activity was measured using the IL-3/colony-stimulating-factor-dependent cell line 32D. IL-6 activity was measured using the IL-6-dependent cell line 7TD1. Spleen and thymus cells harvested from flown rats secreted significantly higher titers of biologically active IL-3 compared with ground control rats. Spaceflight significantly enhanced IL-6 production by thymus, but not spleen, cells. The results of this study demonstrate that spaceflight can enhance the production of certain cytokines by cells of the immune system.

  3. Prognostic value of interleukin-6 and interleukin-6 receptor in organ-confined clear-cell renal cell carcinoma: a 5-year conditional cancer-specific survival analysis.

    PubMed

    Fu, Qiang; Chang, Yuan; An, Huimin; Fu, Hangcheng; Zhu, Yu; Xu, Le; Zhang, Weijuan; Xu, Jiejie

    2015-12-01

    Interleukin-6 (IL-6) is the major cytokine that induces transcriptional acute and chronic inflammation responses, and was recently incorporated as a recurrence prognostication signature for localised clear-cell renal cell carcinoma (ccRCC). As the prognostic efficacy of initial risk factors may ebb during long-term practice, we aim to report conditional cancer-specific survival (CCSS) of RCC patients and evaluate the impact of IL-6 as well as its receptor (IL-6R) to offer more relevant prognostic information accounting for elapsing time. We enrolled 180 histologically proven localised ccRCC patients who underwent nephrectomy between 2001 and 2004 with available pathologic information. Five-year CCSS was determined and stratified by future prognostic factors. Constant Cox regression analysis and Harrell's concordance index were used to indicate the predictive accuracy of established models. The 5-year CCSS of organ-confined ccRCC patients with both IL-6- and IL-6R-positive expression was 52% at year 2 after surgery, which was close to locally advanced patients (48%, P=0.564) and was significantly poorer than organ-confined patients with IL-6- or IL-6R-negative expression (89%, P<0.001). Multivariate analyses proved IL-6 and IL-6R as independent predictors after adjusting for demographic factors. Concordance index of pT-IL-6-IL-6R risk stratification was markedly higher compared with the stage, size, grade and necrosis prognostic model (0.724 vs 0.669, P=0.002) or UCLA Integrated Staging System (0.724 vs 0.642, P=0.007) in organ-confined ccRCC population during the first 5 years. Combined IL-6 and IL-6R coexpression emerges as an independent early-stage immunologic prognostic factor for organ-confined ccRCC patients.

  4. Keap1 silencing boosts lipopolysaccharide-induced transcription of interleukin 6 via activation of nuclear factor κB in macrophages

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lv, Peng; Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709; Xue, Peng

    2013-11-01

    Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2more » activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation.« less

  5. Thalidomide suppressed interleukin-6 but not tumor necrosis factor-alpha in volunteers with experimental endotoxemia.

    PubMed

    Shannon, Edward; Noveck, Robert; Sandoval, Felipe; Kamath, Burde; Kearney, Michael

    2007-11-01

    An early rationale for using thalidomide to treat erythema nodosum leprosum had been based on some reports that it suppresses tumor necrosis factor-alpha (TNF-alpha). However, in vivo and in vitro studies have yielded variable results, having shown that thalidomide can either enhance or suppress TNF-alpha. Since the course of circulating cytokines like TNF-alpha after infusion of endotoxin into volunteers is reproducible and characteristic, we investigated the effect of thalidomide on endotoxin-induced synthesis of TNF-alpha, interleukin (IL)-6, and IL-8. The cytokine response from 18 placebo-treated subjects who had undergone the endotoxin challenge were pooled with a placebo-treated subject from the current study and were compared with 4 subjects who received thalidomide (100 mg) every 6 h for 5 doses before endotoxin challenge. Thirty minutes after the last dose of thalidomide or placebo, volunteers were infused with 4-ng/kg endotoxin. Plasma was collected and assayed for cytokines by enzyme-linked immunosorbent assay. Endotoxin evoked the synthesis of the cytokines in all volunteers. The peak response for TNF-alpha was 1.5 h, 2.5 h for IL-8, and 3.0 h for IL-6. Thalidomide did not significantly delay the release of cytokines into the circulating blood. At the peak response, thalidomide reduced the concentration of the cytokines in the plasma. Using the area under the dose response curve (AUC(0 to 24) h), thalidomide reduced the AUC for IL-6 by 56%, for IL-8 by 30%, and TNF-alpha by 32%. In this model, thalidomide did not suppress TNF-alpha or IL-8, but it did suppress IL-6 at 4-h postinfusion with lipopolysaccharide (P=0.004), at 6 h (P=0.014), at 12 h (P=0.001), and at 16 h (P=0.012).

  6. The relationship of Interleukin-6 -174 G>C gene polymorphism in type 2 diabetic patients with and without diabetic foot ulcers in Turkish population.

    PubMed

    Erdogan, Mehmet; Kulaksizoglu, Mustafa; Solmaz, Soner; Berdeli, Afig

    2017-03-01

    We aims investigate Turkish type 2 diabetic patients with/without diabetic foot ulcers and healthy group and examined the contribution of Interleukin (IL)-6 -174 G>C gene polymorphism to the development of diabetic foot ulcers. The Interleukin (IL)-6 -174 G>C genotypes were determined prospectively in 50 patients with diabetic foot ulcers and 35 without diabetic foot ulcers and a control group of 119 healthy individuals. Genotyping of the Interleukin (IL)-6 -174 G>C gene polymorphisms for all individuals was performed by PCR-RFLP method. The genotype IL6 distribution did differ between the control group (CC 13.3%, GC 66.7%, GG 20%) and type 2 diabetic patients (CC 2.4%, GC 47.1%, GG 50.6%) (P<0.001). The genotype IL6 distribution did not differ between type 2 diabetic patients group (CC 0%, GC 45.7%, GG 54.3%) and diabetic foot ulcers (CC 4%, GC 48%, 48%) (P>0.05). The frequency of the polymorphic G allele in between the control group and type 2 diabetic patients was no similar for the groups (58.4% and 74.1%, respectively) (p<0.05). The frequency of the polymorphic G allele in between the type 2 diabetic patients and diabetic foot ulcers was similar for the groups (77.1% and 72%, respectively) (p>0.05). The gene polymorphism of Interleukin-6 -174 G>C and G allele are an risk factor for diabetes, but gene polymorphism of Interleukin-6 -174 G>C is not an independent risk factor for diabetic foot. Genetic factors in the pathogenesis of diabetic foot may also show any changes in different populations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Tumor necrosis factor-α -308 G>A and interleukin-6 -174 G>C promoter polymorphisms and pemphigus.

    PubMed

    Mosaad, Youssef M; Fathy, Hanan; Fawzy, Zakaria; El-Saied, Moustafa Ahmed

    2012-05-01

    The objective of this study was to analyze the possible involvement of the tumor necrosis factor (TNF)-α -308 G>A and interleukin-6 (IL-6) -174 G>C polymorphisms in the susceptibility and/or disease profile of pemphigus in Egyptian patients. Detection of TNF-α -308 G>A by amplification refractory mutation system and IL-6 -174 G>C by restriction fragment length polymorphism was performed for 70 patients and 203 controls. No significant differences were observed in the distribution of TNF-α -308 in pemphigus patients and controls. However, GA+AA genotypes were more frequent in pemphigus vulgaris (PV) patients only versus controls (p(c) = 0.046). The frequency of the C allele and CC/GC genotypes of IL-6 -174 was significantly higher in pemphigus patients and those with the 2 major clinical forms (PV and pemphigus foliaceus [PF]) compared with controls (p < 0.05). Comparison of the distribution of TNF-α -308 and IL-6 -174 variants in relation to clinical type of pemphigus (PV versus PF), activity score, recurrence, and demographic data of patients revealed no significant associations. The IL-6 -174 CC genotype represents a marker of increased susceptibility to pemphigus in Egyptian patients and GG genotype can be considered a low-risk genotype; TNF-α -308 A-containing genotypes contribute to the susceptibility to PV only. Copyright © 2012 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  8. Kaposi’s Sarcoma-Associated Herpesvirus Interleukin-6 Modulates Endothelial Cell Movement by Upregulating Cellular Genes Involved in Migration

    PubMed Central

    Giffin, Louise; West, John A.

    2015-01-01

    ABSTRACT Kaposi’s sarcoma-associated herpesvirus (KSHV) is the causative agent of human Kaposi’s sarcoma, a tumor that arises from endothelial cells, as well as two B cell lymphoproliferative diseases, primary effusion lymphoma and multicentric Castleman’s disease. KSHV utilizes a variety of mechanisms to evade host immune responses and promote cellular transformation and growth in order to persist for the life of the host. A viral homolog of human interleukin-6 (hIL-6) named viral interleukin-6 (vIL-6) is encoded by KSHV and expressed in KSHV-associated cancers. Similar to hIL-6, vIL-6 is secreted, but the majority of vIL-6 is retained within the endoplasmic reticulum, where it can initiate functional signaling through part of the interleukin-6 receptor complex. We sought to determine how intracellular vIL-6 modulates the host endothelial cell environment by analyzing vIL-6’s impact on the endothelial cell transcriptome. vIL-6 significantly altered the expression of many cellular genes associated with cell migration. In particular, vIL-6 upregulated the host factor carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) at the protein and message levels. CEACAM1 has been implicated in tumor invasion and metastasis and promotes migration and vascular remodeling in endothelial cells. We report that vIL-6 upregulates CEACAM1 by a STAT3-dependent mechanism and that CEACAM1 promotes vIL-6-mediated migration. Furthermore, latent and de novo KSHV infections of endothelial cells also induce CEACAM1 expression. Collectively, our data suggest that vIL-6 modulates endothelial cell migration by upregulating the expression of cellular factors, including CEACAM1. PMID:26646010

  9. Expression of Cytokines Interleukin-2, Interleukin-4, Interleukin-10 and Transforming Growth Factor β in Gastric Adenocarcinoma Biopsies Obtained from Mexican Patients

    PubMed Central

    Orea, Maria Alicia Diaz; Perez, Veronica Muñoz; Conde, Eduardo Gómez; Sánchez, Victor Omar Castellanos; Lopez, Rogelio Gonzalez; Alonso, J Carlos Flores; Cárdenas, M Elena; Galicia, A Luisa; Mendoza, Aurelio

    2017-01-01

    Objective: In this study, expression of Interleukin-2, Interleukin-4, Interleukin-10 and transforming growth factor beta in diffuse and intestinal type gastric cancers from Mexican patients was assessed for use as markers of malignancy. Methods: A total of 30 biopsies from gastric adenocarcinomas, 60% diffuse, 20% intestinal and 20% mixed in type, were studied by immunohistochemistry. Results: Regarding expression of cytokines, 23% were positive for IL-2, 26.7% for IL-4, 16.6% for IL-10 and none for TGF-β. There were found Significant statistically stage differences were noted. For example, for stages I-II 100% were IL-2 positive (p = 0.009), 87.5% were IL-4 positive (p = 0.005) and 100.0% IL-10 positive (p = 0.009). Young women were more likely to suffer gastric adenocarcinoma. In biopsies of male patients with gastric cancer, there was an increased expression of IL-2 and in biopsies from female patients in IL4. There was significantly greater detection of IL-4 and IL-10 expression in stages I and II than in stages III and IV. It was also found that IL-4, IL-10 had a higher positive expression in patients biopsies with low-level differentiations than patients with well differentiated gastric cancer in which cases were undetected. Conclusions: These results suggest that positive expression of IL-4 and IL-10 may be useful as a molecular marker to distinguish stage I and II diffuse gastric cancers which can be more readily controlled. PMID:28350427

  10. Role of Interleukin-6 in the Radiation Response of Liver Tumors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Miao-Fen, E-mail: miaofen@adm.cgmh.org.tw; College of Medicine, Chang Gung University, Taiwan; Hsieh, Ching-Chuan

    2012-12-01

    Purpose: To investigate the role of interleukin (IL)-6 in biological sequelae and tumor regrowth after irradiation for hepatic malignancy, which are critical for the clinical radiation response of liver tumors. Methods and Materials: The Hepa 1-6 murine hepatocellular cancer cell line was used to examine the radiation response by clonogenic assays and tumor growth delay in vivo. After irradiation in a single dose of 6 Gy in vitro or 15 Gy in vivo, biological changes including cell death and tumor regrowth were examined by experimental manipulation of IL-6 signaling. The effects of blocking IL-6 were assessed by cells preincubated inmore » the presence of IL-6-neutralizing antibody for 24 hours or stably transfected with IL-6-silencing vectors. The correlations among tumor responses, IL-6 levels, and myeloid-derived suppressor cells (MDSC) recruitment were examined using animal experiments. Results: Interleukin-6 expression was positively linked to irradiation and radiation resistance, as demonstrated by in vitro and in vivo experiments. Interleukin-6-silencing vectors induced more tumor inhibition and DNA damage after irradiation. When subjects were irradiated with a sublethal dose, the regrowth of irradiated tumors significantly correlated with IL-6 levels and MDSC recruitment in vivo. Furthermore, blocking of IL-6 could overcome irradiation-induced MDSC recruitment and tumor regrowth after treatment. Conclusion: These data demonstrate that IL-6 is important in determining the radiation response of liver tumor cells. Irradiation-induced IL-6 and the subsequent recruitment of MDSC could be responsible for tumor regrowth. Therefore, treatment with concurrent IL-6 inhibition could be a potential therapeutic strategy for increasing the radiation response of tumors.« less

  11. Health Behaviors Predict Higher Interleukin-6 levels Among Patients Newly Diagnosed with Head and Neck Squamous Cell Carcinoma

    PubMed Central

    Duffy, Sonia A.; Teknos, Theodoros; Taylor, Jeremy M.G.; Fowler, Karen E.; Islam, Mozaffarul; Wolf, Gregory T.; McLean, Scott; Ghanem, Tamer A.; Terrell, Jeffrey E.

    2013-01-01

    Background Health behaviors have been shown to be associated with recurrence risk and survival rates in cancer patients and are also associated with Interleukin-6 levels, but few epidemiologic studies have investigated the relationship of health behaviors and Interleukin-6 among cancer populations. The purpose of the study is to look at the relationship between five health behaviors: smoking, alcohol problems, body mass index (a marker of nutritional status), physical activity, and sleep and pretreatment Interleukin-6 levels in persons with head and neck cancer. Methods Patients (N=409) were recruited in otolaryngology clinic waiting rooms and invited to complete written surveys. A medical record audit was also conducted. Descriptive statistics and multivariate analyses were conducted to determine which health behaviors were associated with higher Interleukin-6 levels controlling for demographic and clinical variables among newly diagnosed head and neck cancer patients. Results While smoking, alcohol problems, body mass index, physical activity, and sleep were associated with Interleukin-6 levels in bivariate analysis, only smoking (current and former) and decreased sleep were independent predictors of higher Interleukin-6 levels in multivariate regression analysis. Covariates associated with higher Interleukin-6 levels were age and higher tumor stage, while comorbidities were marginally significant. Conclusion Health behaviors, particularly smoking and sleep disturbances, are associated with higher Interleukin-6 levels among head and neck cancer patients. Impact Treating health behavior problems, especially smoking and sleep disturbances, may be beneficial to decreasing Interleukin-6 levels which could have a beneficial effect on overall cancer treatment outcomes. PMID:23300019

  12. The Placental Interleukin-6 Signaling Controls Fetal Brain Development and Behavior

    PubMed Central

    Wu, Wei-Li; Hsiao, Elaine Y.; Yan, Zihao; Mazmanian, Sarkis K.; Patterson, Paul H.

    2016-01-01

    Epidemiological studies show that maternal immune activation (MIA) during pregnancy is a risk factor for autism. However, mechanisms for how MIA affects brain development and behaviors in offspring remain poorly described. To determine whether placental interleukin-6 (IL-6) signaling is required for mediating MIA on the offspring, we generated mice with restricted deletion of the receptor for IL-6 (IL-6Rα) in placental trophoblasts (Cyp19-Cre+;Il6rafl/fl), and tested offspring of Cyp19-Cre+;Il6rafl/fl mothers for immunological, pathological and behavioral abnormalities following induction of MIA. We reveal that MIA results in acute inflammatory responses in the fetal brain. Lack of IL-6 signaling in trophoblasts effectively blocks MIA-induced inflammatory responses in the placenta and the fetal brain. Furthermore, behavioral abnormalities and cerebellar neuropathologies observed in MIA control offspring are prevented in Cyp19-Cre+;Il6rafl/fl offspring. Our results demonstrate that IL-6 activation in placenta is required for relaying inflammatory signals to the fetal brain and impacting behaviors and neuropathologies relevant to neurodevelopmental disease. PMID:27838335

  13. Interleukin-6 and vascular endothelial growth factor release by renal cell carcinoma cells impedes lymphocyte-dendritic cell cross-talk.

    PubMed

    Cabillic, F; Bouet-Toussaint, F; Toutirais, O; Rioux-Leclercq, N; Fergelot, P; de la Pintière, C Thomas; Genetet, N; Patard, J-J; Catros-Quemener, V

    2006-12-01

    Anti-tumour T cell response requires antigen presentation via efficient immunological synapse between antigen presenting cells, e.g. dendritic cells (DC), and specific T cells in an adapted Th1 cytokine context. Nine renal cell carcinoma (RCC) primary culture cells were used as sources of tumour antigens which were loaded on DC (DC-Tu) for autologous T cell activation assays. Cytotoxic activity of lymphocytes stimulated with DC-Tu was evaluated against autologous tumour cells. Assays were performed with 75 grays irradiated tumour cells (Tu irr) and with hydrogen peroxide +/- heat shock (Tu H(2)O(2) +/- HS) treated cells. DC-Tu irr failed to enhance cytotoxic activity of autologous lymphocytes in seven of 13 assays. In all these defective assays, irradiated tumour cells displayed high interleukin (IL)-6 and vascular endothelial growth factor (VEGF) release. Conversely, when tumour cells released low IL-6 levels (n = 4), DC-Tu irr efficiently enhanced CTL activity. When assays were performed with the same RCC cells treated with H(2)O(2) + HS, DC-Tu stimulation resulted in improved CTL activity. H(2)O(2) + HS treatment induced post-apoptotic cell necrosis of tumour cells, totally abrogated their cytokine release [IL-6, VEGF, transforming growth factor (TGF)-beta1] and induced HSP70 expression. Taken together, data show that reduction in IL-6 and VEGF release in the environment of the tumour concomitantly to tumour cell HSP expression favours induction of a stronger anti-tumour CTL response.

  14. Interleukin 6 stimulates hepatic glucose release from prelabeled glycogen pools

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ritchie, D.G.

    1990-01-01

    Cytokines, derived from a wide variety of cell types, are now believed to initiate many of the physiological responses accompanying the inflammatory phase that follows either Gram-negative septicemia or thermal injury. Because hypoglycemia (after endotoxic challenge) and hyperglycemia (after thermal injury) represent well-characterized responses to these injuries, we sought to determine whether hepatic glycogen metabolism could be altered by specific cytokines. Cultured adult rat hepatocytes were prelabeled with ({sup 14}C)glucose for 24 h, a procedure that resulted in the labeling of hepatic glycogen pools that subsequently could be depleted (with concomitant ({sup 14}C)glucose release) by either glucagon or norepinephrine. Aftermore » the addition of a highly concentrated human monocyte-conditioned medium (MCM) or various cytokines to these prelabeled cells, ({sup 14}C)glucose release was stimulated by MCM and recombinant human interleukin 6 (IL-6) but was not stimulated by other cytokines tested. Furthermore, only antisera to IL-6 were capable of reducing the glucose-releasing factor activity found in MCM. These data therefore suggest a novel glucoregulatory role for IL-6.« less

  15. Urine interleukin-6, interleukin-8 and transforming growth factor β1 in infants with urinary tract infection and asymptomatic bacteriuria

    PubMed Central

    Krzemień, Grażyna; Turczyn, Agnieszka; Pańczyk-Tomaszewska, Małgorzata

    2016-01-01

    Introduction Urinary tract infection (UTI) occurs in 1.1% of girls and 1.4% of boys during the first year of life. Asymptomatic bacteriuria (ABU) is usually detected incidentally in 0.9% of girls and 2.5% of boys at this age. The aim of the study was to assess the usefulness of measurement of pro-inflammatory urine interleukin (IL)-6 and IL-8 concentrations and anti-inflammatory transforming growth factor β1 (TGF-β1) level in infants with febrile UTI, non-febrile UTI and ABU. Material and methods A total of 35 children, mean age 6.14 ±3.47 months, were divided into three groups: group I – febrile UTI (n = 13), group II – non-febrile UTI (n = 13) and group III – ABU (n = 9). At the time of enrollment urine IL-6, IL-8, TGF-β1 and serum C-reactive protein (CRP), erythrocyte sedimentation rate (ESR), and white blood cell count (WBC) were measured. Renal ultrasound was performed in all children, 99mTc-dimercaptosuccinic acid scintigraphy (DMSA) and voiding cystourethrography in children with UTI. Results Urine concentrations of IL-6 and IL-8 were significantly higher in febrile UTI compared to those with non-febrile UTI and ABU (p < 0.5, p < 0.01) and positively correlated with CRP, ESR and WBC (p < 0.01). Urine levels of TGF-β1 were significantly higher in children with febrile UTI compared to those with ABU (p < 0.05) and positively correlated with WBC (p < 0.01). Inflammatory changes in the DMSA scan were detected in 66.6% of children with UTI. No significant difference in frequency of an abnormal DMSA scan compared to a normal scan was found in groups with febrile and non-febrile UTI. No relations between urine cytokines, systemic inflammatory markers and changes in DMSA scan were observed. The cutoff value for detection of inflammatory changes in the DMSA scan for IL-8 was 120 pg/mg creatinine (Cr) and 40 pg/mg Cr for TGF-β1. Based on this value, the sensitivity for IL-8 was 58.3%, specificity 100% and for TGF-β1 66.7% and 83.7%, respectively

  16. The diagnostic value of interleukin-6 and interleukin-8 for early prediction of bacteremia and sepsis in children with febrile neutropenia and cancer.

    PubMed

    Urbonas, Vincas; Eidukaitė, Audronė; Tamulienė, Indrė

    2012-03-01

    Early diagnosis of sepsis in children with febrile neutropenia and cancer still remains a challenge for modern medicine because of lack of specific laboratory markers and clinical signs especially at the beginning of the infection. The objective of this study was to evaluate the ability of interleukin-6 and interleukin-8 to predict bacteremia and sepsis during the first 2 days in oncohematologic patients with febrile neutropenia. A total of 61 febrile neutropenic episodes in 37 children were studied. Serum samples were collected on day 1 and day 2 from the onset of fever and analyzed using an automated random access analyzer. Neutropenic children with febrile episodes were classified into the following 2 groups: (1) fever of unknown origin group--patients with a negative blood culture--and (2) bacteremia/sepsis group--patients with a positive blood culture or clinical sepsis. High negative predictive values were found on day 1 for interleukin-6 and interleukin-8 (89% and 82%, respectively) for exclusion of bacteremia/sepsis. These interleukins could be used as a screening tool for the rejection of sepsis or bacteremia on the first day of fever in neutropenic children with cancer.

  17. Interleukin-6 Detection with a Plasmonic Chip

    NASA Astrophysics Data System (ADS)

    Tawa, Keiko; Sumiya, Masashi; Toma, Mana; Sasakawa, Chisato; Sujino, Takuma; Miyaki, Tatsuki; Nakazawa, Hikaru; Umetsu, Mitsuo

    Interleukin-6, a cytokine relating inflammatory and autoimmune activity, was detected with three fluorescence assays using a plasmonic chip. In their assays, the way of surface modification, sample volume, incubation time and mixing solution, were found to influence the detection sensitivity. When the assay was revised in the point of a rapid and easy process, the detection sensitivity was not compromised compared to assays with sufficient sample volume and assay time. To suit the purpose of immunosensing, the assay conditions should be determined.

  18. Interleukin-6 is a potential therapeutic target in interleukin-6 dependent, estrogen receptor-α-positive breast cancer

    PubMed Central

    Casneuf, Tineke; Axel, Amy E; King, Peter; Alvarez, John D; Werbeck, Jillian L; Verhulst, Tinne; Verstraeten, Karin; Hall, Brett M; Sasser, A Kate

    2016-01-01

    Introduction Interleukin-6 (IL-6) is an important growth factor for estrogen receptor-α (ERα)-positive breast cancer, and elevated serum IL-6 is associated with poor prognosis. Methods The role of the phosphorylated signal transducer and activator of transcription 3 pathway was investigated in ERα-positive breast cancer. A panel of cell lines was treated with exogenous IL-6. An IL-6 specific gene signature was generated by profiling ten ERα-positive breast cancer cell lines alone or following treatment with 10 ng/mL recombinant IL-6 or human marrow stromal cell-conditioned media, with or without siltuximab (a neutralizing anti-IL-6 antibody) and grown in three-dimensional tumor microenvironment-aligned cultures for 4 days, 5 days, or 6 days. The established IL-6 signature was validated against 36 human ERα-positive breast tumor samples with matched serum. A comparative MCF-7 xenograft murine model was utilized to determine the role of IL-6 in estrogen-supplemented ERα-positive breast cancer to assess the efficacy of anti-IL-6 therapy in vivo. Results In eight of nine ERα-positive breast cancer cell lines, recombinant IL-6 increased phosphorylation of tyrosine 705 of STAT3. Differential gene expression analysis identified 17 genes that could be used to determine IL-6 pathway activation by combining their expression intensity into a pathway activation score. The gene signature included a variety of genes involved in immune cell function and migration, cell growth and apoptosis, and the tumor microenvironment. Validation of the IL-6 gene signature in 36 matched human serum and ERα-positive breast tumor samples showed that patients with a high IL-6 pathway activation score were also enriched for elevated serum IL-6 (≥10 pg/mL). When human IL-6 was provided in vivo, MCF-7 cells engrafted without the need for estrogen supplementation, and addition of estrogen to IL-6 did not further enhance engraftment. Subsequently, we prophylactically treated mice at MCF-7

  19. Effect of Exercise Training on Interleukin-6, Tumour Necrosis Factor Alpha and Functional Capacity in Heart Failure

    PubMed Central

    Smart, Neil A.; Larsen, Alf I.; Le Maitre, John P.; Ferraz, Almir S.

    2011-01-01

    Background. We pooled data from four studies, to establish whether exercise training programs were able to modulate systemic cytokine levels of tumour necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6). A second aim was to establish if differences in ExT regimens are related to degree of change in cytokines and peak VO2. Methods. Data from four centres relating to training protocol, exercise capacity, and cytokine measures (TNF-alpha and IL-6) were pooled for analysis. Results. Data for 106 CHF patients were collated (98 men, age 62 ± 10 yrs, wt 79 ± 14 Kg). Patients were moderately impaired (peak VO2 16.9 ± 4.4 mls/kg/min), with moderate LV systolic dysfunction (EF 30 ± 6.9%), 78% (83) had ischaemic cardiomyopathy. After ExT, peak VO2 increased 1.4 ± 3.4 ml/kg/min (P < .001), serum TNF-alpha decreased 1.9 ± 8.6 pg/ml (P = .02) and IL-6 was not significantly changed (0.5 ± 5.4 pg/ml, P = .32) for the whole group. Baseline and post-training peak VO2 changes were not correlated with change in cytokine levels. Conclusions. Exercise training reduces levels TNF-alpha but not IL-6 in CHF. However, across a heterogenic patient group, change in peak VO2 was not correlated with alterations in cytokine levels. While greater exercise volume (hours) was superior in improving peak VO2, no particular characteristic of ExT regimes appeared superior in effecting change in serum cytokines. PMID:21403878

  20. Lactoferrin release and interleukin-1, interleukin-6, and tumor necrosis factor production by human polymorphonuclear cells stimulated by various lipopolysaccharides: relationship to growth inhibition of Candida albicans.

    PubMed

    Palma, C; Cassone, A; Serbousek, D; Pearson, C A; Djeu, J Y

    1992-11-01

    Lipopolysaccharides (LPSs) from Escherichia coli, Serratia marcescens, and Salmonella typhimurium, at doses from 1 to 100 ng/ml, strongly enhanced growth inhibition of Candida albicans by human polymorphonuclear leukocytes (PMN) in vitro. Flow cytometry analysis demonstrated that LPS markedly augmented phagocytosis of Candida cells by increasing the number of yeasts ingested per neutrophil as well as the number of neutrophils capable of ingesting fungal cells. LPS activation caused augmented release of lactoferrin, an iron-binding protein which itself could inhibit the growth of C. albicans in vitro. Antibodies against lactoferrin effectively and specifically reduced the anti-C. albicans activity of both LPS-stimulated and unstimulated PMN. Northern (RNA blot) analysis showed enhanced production of mRNAs for interleukin-1 beta, tumor necrosis factor alpha, and interleukin-6 and in neutrophils within 1 h of stimulation with LPS. The cytokines were also detected in the supernatant of the activated PMN, and their synthesis was prevented by pretreatment of LPS-stimulated PMN with protein synthesis inhibitors, such as emetine and cycloheximide. These inhibitors, however, did not block either lactoferrin release or the anti-Candida activity of LPS-stimulated PMN. These results demonstrate the ability of various bacterial LPSs to augment neutrophil function against C. albicans and suggest that the release of a candidastatic, iron-binding protein, lactoferrin, may contribute to the antifungal effect of PMN. Moreover, the ability to produce cytokines upon stimulation by ubiquitous microbial products such as the endotoxins points to an extraphagocytic, immunomodulatory role of PMN during infection.

  1. Tumor Necrosis Factor-α, Interleukins-12(p40), 6, and 10 levels in cerebrospinal fluid and outcome prediction in Ossimi sheep with encephalitic listeriosis.

    PubMed

    Abdlla, Ossama A; Elboshy, Mohamed E; Reisha, Engy F; Gadlla, Hossam A; El-Khodery, Sabry A

    2015-06-01

    Encephalitic listeriosis in sheep is a life-threatening disease. However, little is known about the cytokine response and their predictive value in this disease. The aim of present study was to assess the prognostic significance of Tumor Necrosis Factor-α (TNF-α), Interleukin-12(p40) (IL-12 p40), Interleukin-6 (IL-6), and Interleukin 10 (IL-10) levels in cerebrospinal fluid (CSF) in sheep with encephalitic listeriosis. Fifty-nine ewes in 14 flocks were diagnosed clinically as having listeriosis. CSF was collected and subjected to bacteriological examination and estimation of selected cytokines. Twenty-eight ewes were confirmed to be infected with Listeria monocytogenes. Based on antimicrobial sensitivity test, sheep were treated and the outcome was recorded as survivors (n=10) and non-survivors (n=18). Cutoff points for CSF cytokines were determined by Receiver operating characteristic analysis (ROC). Association between levels of CSF cytokines and outcome of listeriosis was assessed by logistic regression. TNF-α, IL-6 and IL-12(p40) levels as well as TNF-α/IL-10 ratio were significantly higher in non-survivors than survivors (p=0.002, 0.0021, 0.0033, and 0.001, respectively). However, IL-10 level was significantly lower in non-survivors than survivors (p=0.0058). ROC analysis revealed that IL-6 and TNF-α/IL-10 ratio had the highest AUC values (0.98, 0.984, respectively). Final multivariate logistic regression model showed that TNF-α/IL-10 ratio was the only variable that has predictive value for mortality in diseased sheep (p: 0.001; OR: 7.2; 95% CI: 5.7-9.8). TNF-α showed a positive correlation with IL-12β (r=0.917) and IL-6 (r=0.965). IL-12 (p40) showed also a positive correlation with IL-6 (r=0.906). However, IL-10 showed a negative correlation with TNF-α (r=-0.915), IL-12(p40) (r=-0.790), and IL-6 (r=-0.902). In conclusion, TNF-α/IL-10 ratio may provide predictive information about outcome of encephalitic listeriosis in sheep. Copyright © 2015

  2. Cytokine-induced (interleukins-3, -6 and -8 and tumour necrosis factor-beta) activation and deactivation of human neutrophils.

    PubMed Central

    Brom, J; König, W

    1992-01-01

    The effect of various cytokines [interleukin-3(IL-3), IL-6, IL-8, tumour necrosis factor-beta (TNF-beta)] on human neutrophils (PMN) was analysed with regard to the generation of leukotrienes and the involvement of guanosine triphosphate (GTP)-binding proteins (G proteins). Incubation of cytochalasin B-pretreated PMN with cytokines alone did not lead to a generation of leukotrienes. However, the cytokines affected the formyl-methionyl-leucyl-phenylalanine-(FMLP)-induced formation of leukotrienes in a time-dependent manner. Preincubation of the cells with the different cytokines for short periods (15 seconds at 37 degrees) enhanced the subsequent FMLP-induced leukotriene generation, whereas preincubation for prolonged times resulted in a reduced formation of leukotrienes. These results correlated with the respective G protein-associated guanosine triphosphatase (GTPase) activities within isolated membrane fractions. The present study indicates a modulation of the FMLP-induced leukotriene formation by diverse cytokines via interaction with the GTP-binding proteins. PMID:1312995

  3. Anticandidal activity and interleukin-1 beta and interleukin-6 production by polymorphonuclear leukocytes are preserved in subjects with AIDS.

    PubMed Central

    Cassone, A; Palma, C; Djeu, J Y; Aiuti, F; Quinti, I

    1993-01-01

    Polymorphonuclear granulocytes (PMN; or neutrophils) from uninfected or human immunodeficiency virus-infected subjects were tested for their ability to inhibit growth of Candida albicans and produce interleukin-1 beta (IL-1 beta) and IL-6 in vitro. It was seen that PMN from AIDS (Centers for Disease Control stage IV) patients expressed equal if not greater anticandidal activity compared with the activity expressed by neutrophils from all other subjects examined. On exposure to granulocyte macrophage-colony-stimulating factor or to a mannoprotein constituent (MP-F2) from C. albicans itself, PMN from AIDS patients showed enhanced antifungal activity and production of remarkable quantities of IL-1 beta and IL-6. These findings suggest that the functional abilities of PMN to inhibit Candida growth and secrete relevant proinflammatory and immunomodulatory cytokines are intrinsically preserved in AIDS patients. PMID:8501241

  4. Interleukin-6 is associated with cognitive function: the Northern Manhattan Study

    PubMed Central

    Wright, C.B.; Sacco, R.L.; Rundek, T.R.; Delman, J.B.; Rabbani, L.E.; Elkind, M.S.V.

    2006-01-01

    Background and purpose Inflammation has been linked to cognitive decline and dementia but the mechanism is not clear and few studies have included Hispanic and black subjects that may be at increased risk of these disorders. Methods We performed a cross-sectional analysis of the association between inflammatory marker levels and cognition in the stroke-free population-based cohort of the Northern Manhattan Study. Mini Mental State Exam (MMSE) scores were the continuous outcome and we adjusted for sociodemographic and vascular risk factors as well as subclinical atherosclerosis. Results Of the inflammatory markers, only interleukin (IL)-6 levels were associated with the MMSE. In univariate analysis age, hypertension, diabetes, smoking, moderate alcohol use, total homocysteine, carotid intima media thickness, and body mass index were positively associated with IL-6 levels. Hispanics compared to whites, those with less than a high school education, hypertension, cardiac disease, and total homocysteine were associated with lower MMSE scores. In a multivariate linear regression model, IL-6 was negatively associated with MMSE score adjusting for sociodemographic and vascular risk factors. Conclusions IL-6 levels were negatively associated with performance on the MMSE in this multiethnic cohort. Adjusting for vascular disease and subclinical atherosclerosis did not attenuate the association, suggesting a direct effect on the brain. PMID:16501663

  5. Toll-Like Receptor Induced Pro-Interleukin-1β and Interleukin-6 in Monocytes Are Lower in Healthy Infants Compared to Adults

    PubMed Central

    Libraty, Daniel H.; Zhang, Lei; Woda, Marcia; Acosta, Luz P.; Obcena, AnaMae; Brion, Job D.; Capeding, Rosario Z.

    2013-01-01

    Infants have long been known to have higher infectious diseases morbidity and mortality and suboptimal vaccination responses compared to older children and adults. A variety of differences in innate and adaptive immune responses have been described between these two groups. We compared Toll-like receptor (TLR)-induced production of pro-interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α between 2-month-old infants and adults. TLR 7/8-induced production of pro-IL-1β and IL-6 in monocytes was lower in 2-month-old infants compared to adults. There was no difference in TLR 7/8-induced production of TNF-α. Lower TLR-induced production of pro-IL-1β and IL-6 in innate immune cells during early infancy likely contributes to suboptimal vaccine responses and infectious diseases susceptibility. PMID:24205068

  6. Toll-like receptor induced pro-interleukin-1β and interleukin-6 in monocytes are lower in healthy infants compared to adults.

    PubMed

    Libraty, Daniel H; Zhang, Lei; Woda, Marcia; Acosta, Luz P; Obcena, Anamae; Brion, Job D; Capeding, Rosario Z

    2013-01-01

    Infants have long been known to have higher infectious diseases morbidity and mortality and suboptimal vaccination responses compared to older children and adults. A variety of differences in innate and adaptive immune responses have been described between these two groups. We compared Toll-like receptor (TLR)-induced production of pro-interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α between 2-month-old infants and adults. TLR 7/8-induced production of pro-IL-1β and IL-6 in monocytes was lower in 2-month-old infants compared to adults. There was no difference in TLR 7/8-induced production of TNF-α. Lower TLR-induced production of pro-IL-1β and IL-6 in innate immune cells during early infancy likely contributes to suboptimal vaccine responses and infectious diseases susceptibility.

  7. Increased thrombin generation in a mouse model of cancer cachexia is partially interleukin-6 dependent.

    PubMed

    Reddel, C J; Allen, J D; Ehteda, A; Taylor, R; Chen, V M Y; Curnow, J L; Kritharides, L; Robertson, G

    2017-03-01

    Essentials Cancer cachexia and cancer-associated thrombosis have not previously been mechanistically linked. We assessed thrombin generation and coagulation parameters in cachectic C26 tumor-bearing mice. C26 mice are hypercoagulable, partially corrected by blocking tumor derived interleukin-6. Coagulability and anti-inflammatory interventions may be clinically important in cancer cachexia. Background Cancer cachexia and cancer-associated thrombosis are potentially fatal outcomes of advanced cancer, which have not previously been mechanistically linked. The colon 26 (C26) carcinoma is a well-established mouse model of complications of advanced cancer cachexia, partially dependent on high levels of interleukin-6 (IL-6) produced by the tumor. Objectives To assess if cancer cachexia altered the coagulation state and if this was attributable to tumor IL-6 production. Methods In male BALB/c*DBA2 (F1 hybrid) mice with a C26 tumor we used modified calibrated automated thrombogram and fibrin generation (based on overall hemostatic potential) assays to assess the functional coagulation state, and also examined fibrinogen, erythrocyte sedimentation rate (ESR), platelet count, tissue factor pathway inhibitor (TFPI) and hepatic expression of coagulation factors by microarray. C26 mice were compared with non-cachectic NC26, pair-fed and sham control mice. IL-6 expression in C26 cells was knocked down by lentiviral shRNA constructs. Results C26 mice with significant weight loss and highly elevated IL-6 had elevated thrombin generation, fibrinogen, ESR, platelets and TFPI compared with all control groups. Fibrin generation was elevated compared with pair-fed and sham controls but not compared with NC26 tumor mice. Hepatic expression of coagulation factors and fibrinolytic inhibitors was increased. Silencing IL-6 in the tumor significantly, but incompletely, attenuated the increased thrombin generation, fibrinogen and TFPI. Conclusions Cachectic C26 tumor-bearing mice are in a

  8. [Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].

    PubMed

    Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier

    2004-01-01

    Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues

  9. Modification of the interleukin-6 response to air pollution by interleukin-6 and fibrinogen polymorphisms.

    PubMed

    Ljungman, Petter; Bellander, Tom; Schneider, Alexandra; Breitner, Susanne; Forastiere, Francesco; Hampel, Regina; Illig, Thomas; Jacquemin, Bénédicte; Katsouyanni, Klea; von Klot, Stephanie; Koenig, Wolfgang; Lanki, Timo; Nyberg, Fredrik; Pekkanen, Juha; Pistelli, Riccardo; Pitsavos, Christos; Rosenqvist, Mårten; Sunyer, Jordi; Peters, Annette

    2009-09-01

    Evidence suggests that cardiovascular effects of air pollution are mediated by inflammation and that air pollution can induce genetic expression of the interleukin-6 gene (IL6). We investigated whether IL6 and fibrinogen gene variants can affect plasma IL-6 responses to air pollution in patients with cardiovascular disease. We repeatedly determined plasma IL-6 in 955 myocardial infarction survivors from six European cities (n = 5,539). We conducted city-specific analyses using additive mixed models adjusting for patient characteristics, time trend, and weather to assess the impact of air pollutants on plasma IL-6. We pooled city-specific estimates using meta-analysis methodology. We selected three IL6 single-nucleotide polymorphisms (SNPs) and one SNP each from the fibrinogen alpha-chain gene (FGA) and beta-chain gene (FGB) for gene-environment analyses. We found the most consistent modifications for variants in IL6 rs2069832 and FBG rs1800790 after exposure to carbon monoxide (CO; 24-hr average; p-values for interaction, 0.034 and 0.019, respectively). Nitrogen dioxide effects were consistently modified, but p-values for interaction were larger (0.09 and 0.19, respectively). The strongest effects were seen 6-11 hr after exposure, when, for example, the overall effect of a 2.2% increase in IL-6 per 0.64 mg/m(3) CO was modified to a 10% (95% confidence interval, 4.6-16%) increase in IL-6 (p-value for interaction = 0.002) for minor homozygotes of FGB rs1800790. The effect of gaseous traffic-related air pollution on inflammation may be stronger in genetic subpopulations with ischemic heart disease. This information could offer an opportunity to identify postinfarction patients who would benefit more than others from a cleaner environment and antiinflammatory treatment.

  10. Regulation of adiponectin production by insulin: interactions with tumor necrosis factor-α and interleukin-6.

    PubMed

    Hajri, Tahar; Tao, Huan; Wattacheril, Julia; Marks-Shulman, Pamela; Abumrad, Naji N

    2011-02-01

    Obesity is often associated with insulin resistance, low-grade systemic inflammation, and reduced plasma adiponectin. Inflammation is also increased in adipose tissue, but it is not clear whether the reductions of adiponectin levels are related to dysregulation of insulin activity and/or increased proinflammatory mediators. In this study, we investigated the interactions of insulin, tumor necrosis factor-α (TNF-α) and interleukin 6 (IL-6) in the regulation of adiponectin production using in vivo and in vitro approaches. Plasma adiponectin and parameters of insulin resistance and inflammation were assessed in a cohort of lean and obese insulin-resistant subjects. In addition, the effect of insulin was examined in vivo using the hyperinsulinemic-euglycemic clamp, and in adipose tissue (AT) cultures. Compared with lean subjects, the levels of total adiponectin, and especially the high-molecular-weight (HMW) isomer, were abnormally low in obese insulin-resistant subjects. The hyperinsulinemic clamp data confirmed the insulin-resistant state in the obese patients and showed that insulin infusion significantly increased the plasma adiponectin in lean but not obese subjects (P < 0.01). Similarly, insulin increased total adiponectin release from AT explants of lean and not obese subjects. Moreover, expression and secretion of TNF-α and IL-6 increased significantly in AT of obese subjects and were negatively associated with expression and secretion of adiponectin. In 3T3-L1 and human adipocyte cultures, insulin strongly enhanced adiponectin expression (2-fold) and secretion (3-fold). TNF-α, and not IL-6, strongly opposed the stimulatory effects of insulin. Intriguingly, the inhibitory effect of TNF-α was especially directed toward the HMW isomer of adiponectin. In conclusion, these studies show that insulin upregulates adiponectin expression and release, and that TNF-α opposes the stimulatory effects of insulin. A combination of insulin resistance and increased TNF

  11. Interleukin-6 and lung inflammation: evidence for a causative role in inducing respiratory system resistance increments.

    PubMed

    Rubini, Alessandro

    2013-10-01

    Interleukin-6 is a multifunctional cytokine that has been shown to be increased in some pathological conditions involving the respiratory system such as those experimentally induced in animals or spontaneously occurring in humans. Experimental data demonstrating that interleukin-6 plays a significant role in commonly occurring respiratory system inflammatory diseases are reviewed here. Those diseases, i.e. asthma and chronic obstructive pulmonary disease, are characterised by mechanical derangements of the respiratory system, for the most part due to increased elastance and airway resistance. Recent findings showing that interleukin-6 has a causative role in determining an increase in airway resistance are reviewed. The end-inflation occlusion method was used to study the mechanical properties of the respiratory system before and after interleukin-6 administration. The cytokine was shown to induce significant, dose-dependent increments in both the resistive pressure dissipation due to frictional forces opposing the airflow in the airway (ohmic resistance) and the additional resistive pressure dissipation due to the visco-elastic properties of the system, i.e. stress relaxation (visco-elastic resistance). There were no alterations in respiratory system elastance. Even when administered to healthy mammals, interleukin-6 determines a significant effect on respiratory system resistance causing an increase in the mechanical work of breathing during inspiration. IL-6 hypothetically plays an active role in the pathogenesis of respiratory system diseases and the mechanisms that may be involved are discussed here.

  12. Elimination of interleukin 6 attenuates coagulation activation in experimental endotoxemia in chimpanzees

    PubMed Central

    1994-01-01

    The role of interleukin 6 (IL-6) in the toxic sequelae of sepsis is controversial. To assess the part of IL-6 in inflammatory responses to endotoxin, we investigated eight chimpanzees after either a bolus intravenous injection of Escherichia coli endotoxin (n = 4; 4 ng/kg) or after the same dose of endotoxin with a simultaneous bolus intravenous injection of an anti-IL-6 mAb (30 mg; n = 4). Anti-IL-6 did not affect the induction of the cytokine network (tumor necrosis factor [TNF], soluble TNF receptors types I and II, and IL-8) by endotoxin, nor did it influence the occurrence of a neutrophilic leukocytosis and neutrophil degranulation, as monitored by the measurement of elastase- alpha 1-antitrypsin complexes. In contrast, anti-IL-6 markedly attenuated endotoxin-induced activation of coagulation, monitored with the plasma levels of the prothrombin fragment F1+2 and thrombin- antithrombin III complexes, whereas activation of fibrinolysis, determined with the plasma concentrations of plasmin-alpha 2- antiplasmin complexes, remained unaltered. We conclude that IL-6 does not have a feedback effect on the release of other cytokines after injection of endotoxin, and that it is not involved in endotoxin- induced neutrophilia or neutrophil degranulation. IL-6 is, however, an important intermediate factor in activation of coagulation in low grade endotoxemia in chimpanzees. PMID:8145042

  13. Targeting the Interleukin-6/Jak/Stat Pathway in Human Malignancies

    PubMed Central

    Sansone, Pasquale; Bromberg, Jacqueline

    2012-01-01

    The Janus kinase/signal transducer and activator of transcription (Jak/Stat) pathway was discovered 20 years ago as a mediator of cytokine signaling. Since this time, more than 2,500 articles have been published demonstrating the importance of this pathway in virtually all malignancies. Although there are dozens of cytokines and cytokine receptors, four Jaks, and seven Stats, it seems that interleukin-6–mediated activation of Stat3 is a principal pathway implicated in promoting tumorigenesis. This transcription factor regulates the expression of numerous critical mediators of tumor formation and metastatic progression. This review will examine the relative importance and function of this pathway in nonmalignant conditions as well as malignancies (including tumor intrinsic and extrinsic), the influence of other Stats, the development of inhibitors to this pathway, and the potential role of inhibitors in controlling or eradicating cancers. PMID:22355058

  14. Effects of granulocyte-macrophage colony-stimulating factor and interleukin 6 on the growth of leukemic blasts in suspension culture.

    PubMed

    Tsao, C J; Cheng, T Y; Chang, S L; Su, W J; Tseng, J Y

    1992-05-01

    We examined the stimulatory effects of recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin 6 (IL)-6 on the in vitro proliferation of leukemic blast cells from patients with acute leukemia. Bone marrow or peripheral blood leukemic blast cells were obtained from 21 patients, including 14 cases of acute myeloblastic leukemia (AML), four cases of acute lymphoblastic leukemia (ALL), two cases of acute undifferentiated leukemia, and one case of acute mixed-lineage leukemia. The proliferation of leukemic blast cells was evaluated by measuring the incorporation of 3H-thymidine into cells incubated with various concentrations of cytokines for 3 days. GM-CSF stimulated the DNA synthesis (with greater than 2.0 stimulation index) of blast cells in 9 of 14 (64%) AML cases, two cases of acute undifferentiated leukemia and one case of acute mixed-lineage leukemia. Only two cases of AML blasts responded to IL-6 to grow in the short-term suspension cultures. GM-CSF and IL-6 did not display a synergistic effect on the growth of leukemic cells. Moreover, GM-CSF and IL-6 did not stimulate the proliferation of ALL blast cells. Binding study also revealed the specific binding of GM-CSF on the blast cells of acute undifferentiated leukemia and acute mixed-lineage leukemia. Our results indicated that leukemic blast cells of acute undifferentiated leukemia and acute mixed-lineage leukemia possessed functional GM-CSF receptors.

  15. Investigation of the role of interleukin-6 and hepcidin antimicrobial peptide in the development of anemia with age

    PubMed Central

    McCranor, Bryan J.; Langdon, Jacqueline M.; Prince, Olivier D.; Femnou, Laurette K.; Berger, Alan E.; Cheadle, Chris; Civin, Curt I.; Kim, Airie; Rivera, Seth; Ganz, Tomas; Vaulont, Sophie; Xue, Qian-Li; Walston, Jeremy D.; Roy, Cindy N.

    2013-01-01

    Anemia is common in older adults and associated with adverse health outcomes in epidemiological studies. A thorough understanding of the complex pathophysiological mechanisms driving anemia in the elderly is lacking; but inflammation, iron restriction, and impaired erythroid maturation are thought to influence the phenotype. We hypothesized that interleukin-6 contributes to this anemia, given its pro-inflammatory activities, its ability to induce hepcidin antimicrobial peptide, and its negative impact on several tissues in older adults. We tested this hypothesis by comparing changes in indices of inflammation, iron metabolism and erythropoiesis in aged C57BL/6 mice to aged mice with targeted deletions of interleukin-6 or hepcidin antimicrobial peptide. Circulating neutrophil and monocyte numbers and inflammatory cytokines increased with age. Decline in hemoglobin concentration and red blood cell number indicated that C57BL/6, interleukin-6 knockout mice, and hepcidin antimicrobial peptide knockout mice all demonstrated impaired erythropoiesis by 24 months. However, the interleukin-6 knock out genotype and the hepcidin antimicrobial peptide knock out genotype resulted in improved erythropoiesis in aged mice. Increased erythropoietic activity in the spleen suggested that the erythroid compartment was stressed in aged C57BL/6 mice compared to aged interleukin-6 knockout mice. Our data suggest C57BL/6 mice are an appropriate mammalian model for the study of anemia with age. Furthermore, although interleukin-6 and hepcidin antimicrobial peptide are not required, they can participate in the development of anemia in aging mice, and could be targeted, pre-clinically, with existing interventions to determine the feasibility of such agents for the treatment of anemia in older adults. PMID:23996485

  16. Interleukin-6 as an early marker for fat embolism

    PubMed Central

    Yoga, R; Theis, JC; Walton, M; Sutherland, W

    2009-01-01

    Background Fat Embolism is a complication of long bone fractures, intramedullary fixation and joint arthroplasty. It may progress to fat embolism syndrome, which is rare but involves significant morbidity and can occasionally be fatal. Fat Embolism can be detected at the time of embolization by transoesophageal echocardiography or atrial blood sampling. Later, a combination of clinical signs and symptoms will point towards fat embolism but there is no specific test to confirm the diagnosis. We investigated serum Interleukin-6 (IL-6) as a possible early marker for fat embolism. Methods An animal study was conducted to simulate a hip replacement in 31 adult male Sprague Dawley rats. The procedure was performed under general anesthesia and the animals divided into 3 groups: control, uncemented and cemented. Following surgery and recovery from anaesthesia, the rats allowed to freely mobilize in their cages. Blood was taken before surgery and at 6 hours, 12 hours and 24 hours to measure serum IL-6 levels. The rats were euthanized at 24 hours and lungs removed and stained for fat. The amount of fat seen was then correlated with serum IL-6 levels. Results No rats in the control group had fat emboli. Numerous fat emboli were seen in both the uncemented and cemented implant groups. The interleukin levels were raised in all groups reaching a peak at 12 hours after surgery reaching 100 pg/ml in the control group and around 250 pg/ml in the uncemented and cemented implant groups. The IL-6 levels in the control group were significantly lower than any of the implant groups at 12 and 24 hours. At these time points, the serum IL-6 correlated with the amount of fat seen on lung histology. Conclusion Serum IL-6 is a possible early marker of fat embolism. PMID:19523233

  17. Evaluation of pretreatment serum interleukin-6 and tumour necrosis factor alpha as a potential biomarker for recurrence in patients with oral squamous cell carcinoma.

    PubMed

    Skrinjar, Ivana; Brailo, Vlaho; Vidovic-Juras, Danica; Vucicevic-Boras, Vanja; Milenovic, Aleksandar

    2015-07-01

    Oral squamous cell carcinoma (OSCC) constitutes 3 percent of all cancers with predominant occurrence in middle aged and elderly males. Tumour recurrence worsens disease prognosis and decreases quality of life in patients with OSCC. Proinflammatory cytokines such as interleukin-6 (IL-6) and tumour necrosis factor alpha (TNF-α) have been suggested to play a certain role in variety of tumours. The aim of this study was to investigate the relationship of pretreatment serum IL-6 and TNF-α levels on tumour recurrence in patients with OSCC in order to identify potential biomarkers for the early detection of disease recurrence. The patients with newly diagnosed OSCC were treated and followed from the first visit from November 2006 until January 2008. Serum IL-6 and TNF-α concentrations were measured. The records of the patients were re-examined in July 2012 and data were recorded about cancer characteristics and tumour recurrence. Disease free survival was analyzed by Kaplan-Meier survival curves, log rank test and Cox proportional hazards regression. Serum IL-6 was shown as an independent risk factor for tumour recurrence. Pretreatment serum IL-6 concentration may be a useful biomarker for identification of OSCC patients with increased risk of the disease recurrence.

  18. Socioeconomic status and stress-induced increases in interleukin-6.

    PubMed

    Brydon, L; Edwards, S; Mohamed-Ali, V; Steptoe, A

    2004-05-01

    Coronary artery disease (CAD) is more prevalent in people from a low socioeconomic background, and low socioeconomic status (SES) is associated with an increased exposure to psychological stress. The pro-inflammatory cytokine interleukin-6 (IL-6) plays a central role in CAD development. IL-6 is responsive to psychological stress and could potentially mediate the effect of psychosocial factors on CAD risk. Accordingly, we predicted that people of low SES would have greater and/or more sustained IL-6 responses to acute psychological stress. Based on previous findings, we also predicted that these people would have delayed post-stress cardiovascular recovery. Thirty-eight male civil servants were tested, with participants divided into high and low SES groups according to employment grade. There were no differences between the groups at baseline. However there were significant differences in IL-6 and heart rate responses to stress. Stress induced increases in plasma IL-6 in all participants. However, in the low SES group, IL-6 continued to increase between 75 min and 2h post-stress, whereas IL-6 levels stabilised at 75 min in the high SES group. Heart rate increased to the same extent following stress in both groups, however by 2h post-stress, it had returned to baseline in 75% of the high SES group compared with only 38.1% of the low SES group. These results suggest that low SES people are less able to adapt to stress than their high SES counterparts. Prolonged stress-induced increases in IL-6 in low SES groups represents a novel mechanism potentially linking socioeconomic position and heart disease.

  19. Resistin, interleukin-6, tumor necrosis factor-alpha, and human semen parameters in the presence of leukocytospermia, smoking habit, and varicocele.

    PubMed

    Moretti, Elena; Collodel, Giulia; Mazzi, Lucia; Campagna, MariaStella; Iacoponi, Francesca; Figura, Natale

    2014-08-01

    To explore the relationships between resistin, interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) and semen parameters, sperm apoptosis, and necrosis in infertile patients and in control subjects with unknown reproductive potential with/without smoking habits, leukocytospermia, and varicocele. Prospective study. Sperm laboratory. A total of 110 selected men. Family history, clinical/physical examination, ELISA determination (resistin, IL-6, TNF-α), semen analysis, annexin V/propidium iodide assay. Relationships among resistin, IL-6, and TNF-α and semen parameters in the presence of smoking habits, varicocele, leukocytospermia, and in infertile subjects. Resistin level was higher in semen than in serum. Resistin semen levels showed negative correlations with sperm motility and positive correlations with apoptotic, necrotic sperm and TNF-α and IL-6 levels. Resistin, TNF-α, and IL-6 levels were higher in smokers compared with nonsmokers and in cases with leukocytospermia, in which an increase in necrotic sperm and a decrease in the number of sperm with normal morphology and motility were observed. Cytokine levels were significantly higher in infertile patients compared with control subjects with unknown reproductive potential. A total of 74.5% of infertile patients showed leukocytospermia. Semen resistin correlated with IL-6, TNF-α, and sperm quality; in cases of leukocytospermia and smoking habits, resistin concentrations were increased, suggesting that resistin may play a regulatory role in inflammation of the male reproductive system. Copyright © 2014 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  20. Interleukin-6 is a key factor for immunoglobulin-like transcript-4-mediated immune injury in sepsis.

    PubMed

    Zhang, De Wen; He, Jian

    2018-01-01

    ILT4 + monocytes seem to be associated with poor prognosis of sepsis in humans, but the exact mechanisms are unknown. This study aimed to examine the biological behaviors and effects of immunoglobulin-like transcript-4 (ILT4) levels on monocytes during sepsis and on the prognosis of sepsis. ILT4 +/+ (WT) and ILT4-knockout (ILT4 -/- ) male BALB/c mice were used for sepsis modeling using cecal ligation puncture (CLP). Flow cytometry was used to measure the levels of ILT4 and major histocompatibility complex class II (MHC-II) on peripheral blood monocytes 24 h after CLP. ELISA was used to measure the serum levels of tumor necrosis factor-alpha (TNF-α), interleukin (IL)-1β, IL-6, and IL-12 at 0, 6, 12, and 24 h after CLP. Survival and prognosis were monitored over the course of 168 h. ILT4 was highly expressed in peripheral blood monocytes of septic mice 24 h after CLP (1292.00 ± 143.70 vs. 193.50 ± 52.54, p  < 0.05). MHC-II levels on peripheral blood monocytes in ILT4 -/- mice were significantly higher than those in WT mice (49.38 ± 5.66% vs. 24.25 ± 6.76%, p  < 0.05). Serum IL-6 was significantly elevated 24 h after CLP (470.75 ± 88.03 vs. 54.25 ± 20.04, p  < 0.05). The serum IL-6 levels were significantly lower in ILT4 -/- mice compared with those in WT mice after CLP (241.25 ± 45.10 vs. 470.75 ± 88.03, p  < 0.05), but TNF-α, IL-1β, and IL-12 were not changed. The survival of ILT4 -/- mice was significantly better after CLP compared with that of WT mice. High levels of ILT4 on monocytes were observed in peripheral blood during sepsis and found to be associated with high serum IL-6 levels and low MHC-II levels on monocytes, possibly associated with higher mortality. ILT-4-IL-6-MHC-II could be a potential signaling pathway involved in sepsis.

  1. Serum levels of ghrelin, tumor necrosis factor-alpha and interleukin-6 in infants and children with congenital heart disease.

    PubMed

    Afify, Mohamed Farouk; Mohamed, Gamal B; El-Maboud, Mohamed Abd; Abdel-Latif, Esmat A

    2009-12-01

    To estimate serum levels of ghrelin, tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6) in infants and children with congenital heart disease (CHD), compared with levels in age-matched controls, and to correlate the levels of ghrelin with TNF-alpha and IL-6. Case-control study. Suzan Moubarak Hospital of Al-Minya University, Egypt. We measured serum ghrelin, TNF-alpha and IL-6 levels using ELISA in 60 patients with CHD (40 acyanotic and 20 cyanotic) and in 20 control subjects. Our results showed that patients with CHD, regardless of the presence or absence of cyanosis, had significantly higher serum ghrelin, TNF-alpha and IL-6 than controls (p = 0.000). Serum levels of ghrelin and TNF-alpha in the acyanotic patients were significantly higher than in the cyanotic patients (p = 0.000). On the other hand, there was no significant difference in serum levels of IL-6 between the acyanotic and the cyanotic patients (p = 0.126). In acyanotic and cyanotic patients with CHD, there was a positive correlation between ghrelin and TNF-alpha (r = 0.424; p = 0.006 and r = 0.577; p = 0.008, respectively). Ghrelin levels were not correlated to IL-6 in the acyanotic and cyanotic patients with CHD (r = -0.211; p = 0.216 and r = -0.341; p = 0.08, respectively). Serum ghrelin, TNF-alpha and IL-6 levels are elevated in patients with CHD whether acyanotic or cyanotic. Increased ghrelin levels represent malnutrition and growth retardation in these patients. The relation of ghrelin with TNF-alpha may be explained by the possible effect of chronic congestive heart failure and chronic shunt hypoxemia.

  2. Polymorphisms of the interleukin-6 gene promoter and abdominal aortic aneurysm.

    PubMed

    Smallwood, L; Allcock, R; van Bockxmeer, F; Warrington, N; Palmer, L J; Iacopetta, B; Norman, P E

    2008-01-01

    Elevated levels of circulating interleukin-6 (IL-6) have been reported in patients with abdominal aortic aneurysms (AAAs). Although this implicates inflammation as a cause of AAAs, there is also evidence that the aneurysmal aorta may secrete IL-6 into the circulation as a result of aortic proteolysis. Genetic association studies are one means of trying to clarify the role of specific mediators in the causal pathway. The aim of the present study was to examine the association between variants of the IL-6 gene and AAAs. An association study involving 677 men with screen-detected AAAs and 656 age-matched controls was performed. Three variants in the IL-6 promoter region were analysed: IL-6-174G>C (rs1800795), IL-6-572G>C (rs1800796) and IL-6-597G>A (rs1800797). Univariate regression of SNP genotype on AAA as a binary outcome was initially performed under a range of genetic models (additive, dominant and recessive). This was followed by multivariate analyses, testing the same models but including risk factors known to be associated with AAAs. All analyses and haplotype estimation were performed under a generalized linear model framework. IL-6-572G>C polymorphism (frequency 1.5% in cases) was identified as an independent risk factor for AAA with an odds ratio (OR) of 6.00 (95%CI: 1.22, 29.41) when applied to the recessive model. No association was seen in the additive or dominant models. In a multivariate analysis using the most common haplotype (h.111, frequency 48.7%) as a reference, h.211 (frequency 4.4%) was an independent risk factor for AAA (OR 1.56, 95%CI: 1.02, 2.39). The IL-6 572G>C polymorphism (and h.211 haplotype) is associated with AAA, however it is too rare to be an important cause of most AAAs. This does not support the concept that the elevated level of IL-6 reported in patients with AAAs is a primary cause of the aneurysmal process.

  3. Peripheral and central blockade of interleukin-6 trans-signaling differentially affects sleep architecture.

    PubMed

    Oyanedel, Carlos N; Kelemen, Eduard; Scheller, Jürgen; Born, Jan; Rose-John, Stefan

    2015-11-01

    The immune system is known to essentially contribute to the regulation of sleep. Whereas research in this regard focused on the pro-inflammatory cytokines interleukin-1 and tumor necrosis factor, the role of interleukin-6 (IL-6) in sleep regulation has been less intensely studied, probably due to the so far seemingly ambiguous results. Yet, this picture might simply reflect that the effects of IL-6 are conveyed via two different pathways (with possibly different actions), i.e., in addition to the 'classical' signaling pathway via the membrane bound IL-6 receptor (IL-6R), IL-6 stimulates cells through the alternative 'trans-signaling' pathway via the soluble IL-6R. Here, we concentrated on the contributions of the trans-signaling pathway to sleep regulation. To characterize this contribution, we compared the effect of blocking IL-6 trans-signaling (by the soluble gp130Fc fusion protein) in the brain versus body periphery. Thus, we compared sleep in transgenic mice expressing the soluble gp130Fc protein only in the brain (GFAP mice) or in the body periphery (PEPCK mice), and in wild type mice (WT) during a 24-h period of undisturbed conditions and during 18 h following a 6-h period of sleep deprivation. Compared with WT mice, PEPCK mice displayed less sleep, particularly during the late light phase, and this was accompanied by decreases in slow wave sleep (SWS) and rapid eye movement (REM) sleep. Following sleep deprivation PEPCK mice primarily recovered REM sleep rather than SWS. GFAP mice showed a slight decrease in REM sleep in combination with a profound and persistent increase in EEG theta activity. In conclusion, peripheral and central nervous IL-6 trans-signaling differentially influences brain activity. Peripheral IL-6 trans-signaling appears to more profoundly contribute to sleep regulation, mainly by supporting SWS. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Combination of Serum Interleukin-1β and 6 Levels in the Diagnosis of Perinatal Asphyxia.

    PubMed

    Boskabadi, Hassan; Maamouri, Gholamali; Tavakkol Afshari, Jalil; Zakerihamidi, Maryam; Kalateh Molaee, Maryam; Bagheri, Fatemeh; Parizadeh, Mustafa; Ghayour-Mobarhan, Majid; Moradi, Ali; Ferns, Gordon A A

    2016-05-01

    Perinatal asphyxia is an important cause of death, as well as permanent neurological and developmental complications. Diagnosing in time would lead to better prognosis and applying the most proper treatment. We sought to define the predictive values of serum concentrations of interleukin-1β (IL-1β) and interleukin-6 (IL-6) in newborns with perinatal asphyxia to see if there is a relation between the short-term neurological deficit and serum IL-1β and IL-6 concentrations. This was a prospective (case-control) study conducted between March 2006 and April 2013, at the Neonatal Intensive Care Unit, Mashhad, Iran. Serum IL-1β and IL-6 levels were measured at birth in 38 consecutive uninfected neonates with perinatal asphyxia (blood pH < 7.2, low Apgar score, signs of fetal distress) and 47 randomly selected healthy newborns. The results were compared between the groups, using Chi-Square, t-tests, and Mann-Whitney tests, as well as receiver operator characteristics (ROC) curves and regression models. Serum IL-1β and IL-6 concentrations in the infants who developed perinatal asphyxia were significantly higher compared to values in the normal infants [16.88 vs  3.34 pg/mL for IL-1β, (P = 0.006), and 88.15 vs 6.74 pg/ mL for IL-6, (P < 0.001) respectively]. The sensitivity and  specificity for the diagnosis of perinatal asphyxia using serum IL-6 were 80.5% and 81.6% respectively. The sensitivity and specificity using serum IL-1β were 71% and 89.1%, respectively. Evaluating serum IL-6 and 1β simultaneously, could improve the sensitivity and specificity of early diagnosis of the perinatal  asphyxia. The most appropriate indicator of perinatal asphyxia is combined measurement of interleukin 1β and interleukin 6.

  5. Association between Serum Selenium Concentrations and Levels of Proinflammatory and Profibrotic Cytokines-Interleukin-6 and Growth Differentiation Factor-15, in Patients with Alcoholic Liver Cirrhosis.

    PubMed

    Prystupa, Andrzej; Kiciński, Paweł; Luchowska-Kocot, Dorota; Błażewicz, Anna; Niedziałek, Jarosław; Mizerski, Grzegorz; Jojczuk, Mariusz; Ochal, Andrzej; Sak, Jarosław J; Załuska, Wojciech

    2017-04-21

    According to some authors, serum selenium levels are strongly associated with the severity of liver diseases, including liver cirrhosis. The aim of this study was to determine the relationship between the concentration of selenium and pro-inflammatory and profibrotic cytokines-interleukin-6 (IL-6) and growth differentiation factor 15 (GDF-15) in patients with alcoholic liver cirrhosis. The parameters studied were determined in the serum of 99 patients with alcoholic liver cirrhosis divided based on the severity of disease according to the Child-Turcotte-Pugh criteria. In patients with liver cirrhosis, the serum selenium concentration was statistically lower, whereas serum IL-6 and GDF-15 concentrations were higher than those in the control group. Moreover, the concentration of selenium negatively correlated with the levels of GDF-15 and IL-6. The above results may indicate a role of selenium deficiency in the pathogenesis and progression of alcoholic liver disease.

  6. Clinical response to non-surgical periodontal treatment in patients with interleukin-6 and interleukin-10 polymorphisms

    PubMed Central

    Doufexi, Aikaterini-Ellisavet; Kouvatsi, Anastasia

    2017-01-01

    Background Genetic polymorphisms are commonly associated with altered transcriptional activity and possibly make individuals more susceptible to periodontal disease development, increased disease severity and poor treatment outcome. The study aimed to determine the effect of Interleukin-6 (IL-6) -572 G/C (rs1800796) and IL-10 -592 C/A (rs1800872) polymorphisms on the outcomes of non-surgical periodontal therapy in a Caucasian population. Material and Methods Sixty-eight patients with chronic periodontal disease were grouped according to their genotype: IL-6, IL-10, IL-6 and IL-10 susceptible (SCP) and non-susceptible (NSCP). All individuals were clinically evaluated at the first visit, and blood sample were collected from patients after checking the inclusion and exclusion criteria of the study. All patients received non-surgical periodontal therapy from a single-blinded periodontist. Clinical periodontal measurements were repeated 45 days after therapy. Results This population mean aged 47.63 years included 52.2% females and 58.2% non-smokers. Following DNA separation and genotyping, 65.7% of patients were homozygous carriers of the IL-6 - 572G; 49.3% were carriers of the IL-10 -592A- allele (AA and CA genotypes); and 35.8% carried SCP genotypes for both polymorphisms. The clinical parameters after therapy were not associated with the genotype status. The multiple logistic regression analysis did not show any statistically significant association between the genotypes and the variables tested. Conclusions Within the limitations of this longitudinal study, it can be suggested that IL-6 -572 G/C and IL-10 -592 C/A polymorphisms as well as their combination do not influence the outcome of nonsurgical periodontal therapy in Caucasian patients diagnosed with chronic periodontal disease. Key words:Gene polymorphism, genetics, interleukins, periodontal disease, treatment outcome. PMID:28624837

  7. Productive and Penicillin-Stressed Chlamydia pecorum Infection Induces Nuclear Factor Kappa B Activation and Interleukin-6 Secretion In Vitro.

    PubMed

    Leonard, Cory A; Schoborg, Robert V; Borel, Nicole

    2017-01-01

    Nuclear factor kappa B (NFκB) is an inflammatory transcription factor that plays an important role in the host immune response to infection. The potential for chlamydiae to activate NFκB has been an area of interest, however most work has focused on chlamydiae impacting human health. Given that inflammation characteristic of chlamydial infection may be associated with severe disease outcomes or contribute to poor overall fitness in farmed animals, we evaluated the ability of porcine chlamydiae to induce NFκB activation in vitro . C. pecorum infection induced both NFκB nuclear translocation and activation at 2 hours post infection (hpi), an effect strongly enhanced by suppression of host de novo protein synthesis. C. suis and C. trachomatis showed less capacity for NFκB activation compared to C. pecorum , suggesting a species-specific variation in NFκB activation. At 24 hpi, C. pecorum induced significant NFκB activation, an effect not abolished by penicillin (beta lactam)-induced chlamydial stress. C. pecorum -dependent secretion of interleukin 6 was also detected in the culture supernatant of infected cells at 24 hpi, and this effect, too, was unchanged by penicillin-induced chlamydial stress. Taken together, these results suggest that NFκB participates in the early inflammatory response to C. pecorum and that stressed chlamydiae can promote inflammation.

  8. Regulation of 1-alpha, 25-dihydroxyvitamin D3 on interleukin-6 and interleukin-8 induced by sulfur mustard (HD) on human skin cells.

    PubMed

    Arroyo, Carmen M; Kan, Robert K; Burman, Damon L; Kahler, David W; Nelson, Marian R; Corun, Charlene M; Guzman, Juanita J; Broomfield, Clarence A

    2003-05-01

    The regulatory effects of the active form of vitamin D, 1-alpha, 25-dihydroxyvitamin D3 (1-alpha, 25 (OH)2D3) were assessed on the cytokine and chemokine secretion induced by sulfur mustard on human skin fibroblasts and human epidermal keratinocytes. Stimulation of human skin fibroblasts with sulfur mustard (10(-4) M for 24 hr at 37 degrees ) resulted in approximately a 5 times increase in the secretion of interleukin-6 and over a 10 times increase for interleukin-8, which was inhibited by 1-alpha, 25 (OH)2D3, at interleukin-8 secretion by 5 times and interleukin-6 by 4 times on sulfur mustard-stimulated human epidermal keratinocytes at concentrations interleukin-6 and interleukin-8 induced by sulfur mustard on human skin fibroblasts/human epidermal keratinocytes, apparent at nanomolar concentrations. Our results indicate that the suppression of these inflammatory mediators by 1-alpha, 25 (OH)2D3 is dependent on the source of the primary cultures, cell densities, and kinetics of pretreatments. In contrast to the inhibition of cytokine/chemokine production, cell proliferation was enhanced by almost 1.7 times on treated human epidermal keratinocytes with 1-alpha, 25 (OH)2D3 (1 x 10(-9) M) after sulfur mustard-stimulation (10(-4) M for 24 hr at 37 degrees C). The observed enhancement diversified based on cell density, and kinetics of pretreatment with a maximal synergism (s) observed at 1 x 10(-9) M. Photomicrographs show typical signs of cellular degeneration caused by sulfur mustard such as chromatin condensation. The observed cellular degeneration was lessened when human epidermal keratinocytes were treated with 1-alpha, 25 (OH)2D3 (2 x 10(-9) M). 1-alpha, 25(OH)2D3 could be an alternative treatment for cutaneous inflammation disorders caused by sulfur mustard because we have demonstrated its ability to suppress inflammatory

  9. Interleukin-6 inhibits early differentiation of ATDC5 chondrogenic progenitor cells.

    PubMed

    Nakajima, Shoko; Naruto, Takuya; Miyamae, Takako; Imagawa, Tomoyuki; Mori, Masaaki; Nishimaki, Shigeru; Yokota, Shumpei

    2009-08-01

    Interleukin (IL)-6 is a causative agent of systemic juvenile idiopathic arthritis (sJIA), a chronic inflammatory disease complicated with severe growth impairment. Recent trials of anti-IL-6 receptor monoclonal antibody, tocilizumab, indicated that tocilizumab blocks IL-6/IL-6 receptor-mediated inflammation, and induces catch-up growth in children with sJIA. This study evaluates the effects of IL-6 on chondrogenesis by ATDC5 cells, a clonal murine chondrogenic cell line that provides an excellent model for studying endochondral ossification at growth plate. ATDC5 cells were examined for the expression of IL-6 receptor and gp130 by fluorescence-activated cell sorting analysis. Recombinant murine IL-6 was added to ATDC5 cultures to observe cell differentiation, using a quantitative RT-PCR for the chondrogenic differentiation markers type II collagen, aggrecan, and type X collagen. To block IL-6, the anti-mouse IL-6 receptor monoclonal antibody MR16-1 was added. As a result, the cells expressed IL-6 receptor and gp130. The expression of chondrogenic differentiation marker gene was reduced by IL-6, but this was abrogated by MR16-1. We conclude that IL-6 inhibits early chondrogenesis of ATDC5 cells suggesting that IL-6 may affect committed stem cells at a cellular level during chondrogenic differentiation of growth plate chondrocytes, and that IL-6 may be a cellular-level factor in growth impairment in sJIA.

  10. Avoidance-related EEG asymmetry predicts circulating interleukin-6.

    PubMed

    Shields, Grant S; Moons, Wesley G

    2016-03-01

    Recent research has linked avoidance-oriented motivational states to elevated pro-inflammatory cytokine levels. According to one of many theories regarding the association between avoidance and cytokine levels, because the evolutionarily basic avoidance system may be activated when an organism is threatened or overwhelmed, an associated inflammatory response may be adaptive for dealing with potential injury in such threatening situations. To examine this hypothesis, we tested whether the neural correlate of avoidance motivation associates with baseline levels of the circulating pro-inflammatory cytokine interleukin-6 (IL-6). Controlling for covariates, greater resting neural activity in the right frontal cortex relative to the left frontal cortex-the neural correlate of avoidance motivation-was associated with baseline IL-6. These results thus support the hypothesis that the avoidance motivational system may be closely linked to systemic inflammatory activity. (c) 2016 APA, all rights reserved).

  11. Evaluation of C-reactive protein and interleukin-6 in the peripheral blood of patients with chronic periodontitis.

    PubMed

    Gani, Dhruva Kumar; Lakshmi, Deepa; Krishnan, Rama; Emmadi, Pamela

    2009-05-01

    The aim of the present study was to investigate systemic levels of inflammatory markers of cardiovascular diseases like C-reactive protein and interleukin-6 in patients with chronic periodontitis, in comparison to periodontally healthy individuals. A total of 42 individuals, both males and females above the age of 30 years, were included in the study. Healthy controls (Group I, n = 14), chronic localized periodontitis (Group II, n = 14), and chronic generalized periodontitis (Group III, n = 14), all without any medical disorder, were recruited. Peripheral blood samples were taken and C-reactive protein (CRP) levels were estimated in the serum samples by using the Particle-Enhanced Turbidimetric Immunoassay (PETIA) technique. Serum samples of Interleukin-6 (IL-6) were assayed by using the Chemiluminescent Immunoassay (IMMULITE) technique. When mean CRP levels were compared between the groups, group III showed statistical significance when compared to group I (P = 0.04). Group III had a higher median IL-6 level (6.35 pg/mL) than Group II (< 5.0 pg/mL) and group I (< 5.0 pg/mL). Differences in median values of IL-6 were not statistically significant in any group (P = 0.29). Periodontitis results in higher systemic levels of CRP and IL-6. These elevated inflammatory factors may increase inflammatory activity in atherosclerotic lesions and potentially increasing the risk for cardiovascular events.

  12. Krüppel-like Factor 4 modulates interleukin-6 release in human dendritic cells after in vitro stimulation with Aspergillus fumigatus and Candida albicans.

    PubMed

    Czakai, Kristin; Leonhardt, Ines; Dix, Andreas; Bonin, Michael; Linde, Joerg; Einsele, Hermann; Kurzai, Oliver; Loeffler, Jürgen

    2016-06-27

    Invasive fungal infections are associated with high mortality rates and are mostly caused by the opportunistic fungi Aspergillus fumigatus and Candida albicans. Immune responses against these fungi are still not fully understood. Dendritic cells (DCs) are crucial players in initiating innate and adaptive immune responses against fungal infections. The immunomodulatory effects of fungi were compared to the bacterial stimulus LPS to determine key players in the immune response to fungal infections. A genome wide study of the gene regulation of human monocyte-derived dendritic cells (DCs) confronted with A. fumigatus, C. albicans or LPS was performed and Krüppel-like factor 4 (KLF4) was identified as the only transcription factor that was down-regulated in DCs by both fungi but induced by stimulation with LPS. Downstream analysis demonstrated the influence of KLF4 on the interleukine-6 expression in human DCs. Furthermore, KLF4 regulation was shown to be dependent on pattern recognition receptor ligation. Therefore KLF4 was identified as a controlling element in the IL-6 immune response with a unique expression pattern comparing fungal and LPS stimulation.

  13. Maternal immune activation alters fetal brain development through interleukin-6.

    PubMed

    Smith, Stephen E P; Li, Jennifer; Garbett, Krassimira; Mirnics, Karoly; Patterson, Paul H

    2007-10-03

    Schizophrenia and autism are thought to result from the interaction between a susceptibility genotype and environmental risk factors. The offspring of women who experience infection while pregnant have an increased risk for these disorders. Maternal immune activation (MIA) in pregnant rodents produces offspring with abnormalities in behavior, histology, and gene expression that are reminiscent of schizophrenia and autism, making MIA a useful model of the disorders. However, the mechanism by which MIA causes long-term behavioral deficits in the offspring is unknown. Here we show that the cytokine interleukin-6 (IL-6) is critical for mediating the behavioral and transcriptional changes in the offspring. A single maternal injection of IL-6 on day 12.5 of mouse pregnancy causes prepulse inhibition (PPI) and latent inhibition (LI) deficits in the adult offspring. Moreover, coadministration of an anti-IL-6 antibody in the poly(I:C) model of MIA prevents the PPI, LI, and exploratory and social deficits caused by poly(I:C) and normalizes the associated changes in gene expression in the brains of adult offspring. Finally, MIA in IL-6 knock-out mice does not result in several of the behavioral changes seen in the offspring of wild-type mice after MIA. The identification of IL-6 as a key intermediary should aid in the molecular dissection of the pathways whereby MIA alters fetal brain development, which can shed new light on the pathophysiological mechanisms that predispose to schizophrenia and autism.

  14. Glioma-secreted soluble factors stimulate microglial activation: The role of interleukin-1β and tumor necrosis factor-α.

    PubMed

    Hwang, Ji-Sun; Jung, Eun-Hye; Kwon, Mi-Youn; Han, Inn-Oc

    2016-09-15

    We aimed to elucidate the effect of soluble factors secreted by glioma on microglial activation. Conditioned medium (CM) from glioma cells, CRT-MG and C6, significantly induced nitric oxide (NO) production and stimulated the mRNA expression of inducible NO synthase (iNOS), interleukin (IL)-1beta, IL-6, tumor necrosis factor-alpha (TNF-α) and cyclooxygenase 2 (COX-2) in BV2 cells. Glioma CM stimulated p38 mitogen-activated protein kinase (MAPK) phosphorylation, and a p38 MAPK inhibitor, SB203580, suppressed CM-induced NO production in BV2 cells. In addition, CM stimulated nuclear factor-kappaB (NF-κB) DNA binding and transcriptional activity, which was repressed by SB203580. Gliomas displayed higher mRNA expression and release of TNF-α and IL-1β than primary astrocyte cells. Neutralization of TNF-α and IL-1β in C6-CM using a neutralizing antibody inhibited NO/iNOS expression in BV-2 cells. These results indicate potential contribution of diffusible tumor-derived factors to regulate microglial activation and subsequent tumor microenvironment. Copyright © 2016. Published by Elsevier B.V.

  15. [Diagnostic value of procalcitonin, interleukin 8, interleukin 6, and C-reactive protein for detecting bacteremia and fungemia in cancer patients].

    PubMed

    Aznar-Oroval, Eduardo; Sánchez-Yepes, Marina; Lorente-Alegre, Pablo; San Juan-Gadea, Mari Carmen; Ortiz-Muñoz, Blanca; Pérez-Ballestero, Pilar; Picón-Roig, Isabel; Maíquez-Richart, Joaquín

    2010-05-01

    Bacteremia is one of the most important causes of morbidity and mortality in cancer patients. The aim of this study was to evaluate the diagnostic usefulness of procalcitonin (PCT), interleukin 8 (IL-8), interleukin 6 (IL-6), and C-reactive protein (CRP) in the detection of bacteremia in cancer patients. PCT, IL-8, IL-6, and CPR levels were measured in 2 groups of cancer patients who had fever: one group with true bacteremia and another without bacteremia. Seventy-nine febrile episodes were analyzed in 79 patients, 43 men and 36 women. Forty-four patients were in the true bacteremia group. Significant differences in PCT (P<0.001), IL-8 (P<0.001), and IL-6 (P=0.002) values were found between patients with and without true bacteremia. CPR results were not significantly different between the groups (P=0.23). The cut-off point for PCT was 0.5 ng/mL and this parameter yielded the best specificity at 91.4%, with a sensitivity of 59.1%. Among the infection markers studied, PCT provided the most information for diagnosing bacteremia in cancer patients. (c) 2009 Elsevier España, S.L. All rights reserved.

  16. Functional polymorphism in the interleukin-6 and interleukin-10 genes in patients with paranoid schizophrenia--a case-control study.

    PubMed

    Paul-Samojedny, Monika; Kowalczyk, Malgorzata; Suchanek, Renata; Owczarek, Aleksander; Fila-Danilow, Anna; Szczygiel, Aleksandra; Kowalski, Jan

    2010-09-01

    Schizophrenia is a multifactorial disease with changes in immunological system. Such changes are the result of cytokine-level disturbances connected with cytokine gene polymorphisms. However, research about cytokine gene polymorphisms in schizophrenia has been surprisingly limited and ambiguous. The aim of the study was to identify whether polymorphisms of interleukin (IL)-6 and IL-10 are risk factors for the development of paranoid schizophrenia in case-control study. IL-6 (-174G/C; rs 1800795) and IL-10 (-1082G/A; rs 1800896) promoter polymorphisms in patients with paranoid schizophrenia and healthy individuals were genotyped using polymerase chain reaction-restriction fragment length polymorphism method. Differences in IL-6 and IL-10 promoter haplotypes may play an important role in determining the transcription level for IL-6 and IL-10 genes in schizophrenic patients. The presence of allele C at position -174 of IL-6 promoter sequence may correlate with increasing risk of paranoid schizophrenia in the Polish population, but research on a broadened group of people is needed. The presence of allele G at position -1082 of IL-10 promoter sequence correlates with increasing risk of paranoid schizophrenia in the Polish population. The coexistence of genotype GG at position -1082 of IL-10 promoter sequence and genotype GC at position -174 of IL-6 promoter sequence correlates with increasing risk of paranoid schizophrenia in the Polish population.

  17. Interleukin (IL)-1A and IL-6: Applications to the predictive diagnostic testing of radiation pneumonitis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen Yuhchyau; Hyrien, Ollivier; Williams, Jacqueline

    2005-05-01

    Purpose: To explore the application of interleukin (IL)-1{alpha} and IL-6 measurements in the predictive diagnostic testing for symptomatic radiation pneumonitis (RP). Methods and materials: In a prospective protocol investigating RP and cytokines, IL-1{alpha} and IL-6 values were analyzed by enzyme-linked immunosorbent assay from serial weekly blood samples of patients receiving chest radiation. We analyzed sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) over selected threshold values for both cytokines in the application to diagnostic testing. Results: The average coefficient of variation was 51% of the weekly mean IL-1{alpha} level and 39% of the weekly mean IL-6 value.more » Interleukin 1{alpha} and IL-6 became positively correlated with time. Specificity for both cytokines was better than sensitivity. IL-6 globally outperformed IL-1{alpha} in predicting RP, with higher PPV and NPV. Conclusions: Our data demonstrate the feasibility of applying IL-1{alpha} and IL-6 measurements of blood specimens to predict RP. Interleukin-6 measurements offer stronger positive predictive value than IL-1{alpha}. This application might be further explored in a larger sample of patients.« less

  18. Interleukin-1 Receptor Type 2 Acts with c-Fos to Enhance the Expression of Interleukin-6 and Vascular Endothelial Growth Factor A in Colon Cancer Cells and Induce Angiogenesis*

    PubMed Central

    Mar, Ai-Chung; Chu, Chun-Ho; Lee, Hui-Ju; Chien, Chia-Wen; Cheng, Jing-Jy; Yang, Shung-Haur; Jiang, Jeng-Kai; Lee, Te-Chang

    2015-01-01

    Interleukin-1 receptor type 2 (IL1R2) acts as a decoy receptor of exogenous IL-1; however, its intracellular activity is poorly understood. We previously demonstrated that IL1R2 intracellularly activates the expression of several proinflammatory cytokines and affects cell migration. In this study, we found that intracellular IL1R2 expression was increased in human colorectal cancer cells (CRCs) compared with normal colon cells. We also observed that the mRNA levels of IL1R2 were highly correlated with IL-6 in tumor tissues of CRC patients. By modulating its expression in CRC cells, we verified that enhanced IL1R2 expression transcriptionally activated the expression of IL-6 and VEGF-A. Conditioned medium harvested from IL1R2-overexpressing CRC cells contained higher levels of IL-6 and VEGF-A than that from vector control cells and significantly enhanced the proliferation, migration, and tube formation of cultured endothelial cells. We further demonstrated a positive association of intracellular IL1R2 levels with tumor growth and microvessel density in xenograft mouse models. These results revealed that IL1R2 activates the expression of angiogenic factors. Mechanistically, we revealed that IL1R2 complexes with c-Fos and binds to the AP-1 site at the IL-6 and VEGF-A promoters. Together, these results reveal a novel function of intracellular IL1R2 that acts with c-Fos to enhance the transcription of IL-6 and VEGF-A, which promotes angiogenesis in CRC. PMID:26209639

  19. Interleukin-6: a villain in the drama of pancreatic cancer development and progression.

    PubMed

    Holmer, Reinhild; Goumas, Freya A; Waetzig, Georg H; Rose-John, Stefan; Kalthoff, Holger

    2014-08-01

    Pancreatic ductal adenocarcinoma (PDAC) is a devastating malignancy with a poor prognosis and little treatment options. The development and progression of the disease is fostered by inflammatory cells and cytokines. One of these cytokines is interleukin-6 (IL-6), which plays an important role in a wide range of biologic activities. A systematic search of PubMed was performed to identify relevant studies using key words such as interleukin-6, inflammatory cytokines, inflammation and pancreatic cancer or PDAC. Articles related to IL-6 and pancreatic cancer were systematically reviewed. IL-6 is elevated in the serum of pancreatic cancer patients and correlates with cachexia, advanced tumor stage and poor survival. Its expression is enhanced by hypoxia and proteins involved in pancreatic cancer development like Kras, mesothelin or ZIP4. IL-6 in turn contributes to the generation of a pro-tumorigenic microenvironment and is probably involved in angiogenesis and metastasis. In experimental mouse models of PDAC, IL-6 was important for the development and progression of precursor lesions. IL-6 emerges as a key player in pancreatic cancer development and progression, and hence should be considered as a new therapeutic target.

  20. Aqueous Humor Levels of Different Interleukins 1-β, 2, 6 and 10, Tumor Necrosis Factor-α and Vascular Endothelial Growth Factor in Uveitis Treated with Adalimumab

    PubMed Central

    Hernández Garfella, María Luisa; Palomares Fort, Paula; Román Ivorra, José Andrés; Cervera Taulet, Enrique

    2015-01-01

    Purpose: To assess changes in aqueous humor levels of different interleukins (IL), tumor necrosis factor (TNF)-α and vascular endothelial growth factor (VEGF) in patients with uveitis treated with adalimumab. Methods: In this study, 24 aqueous humor samples including 12 pre- and post-treatment samples from 6 patients with uveitis treated with subcutaneous adalimumab and 12 samples from patients with cataracts (serving as controls) were evaluated. The levels of IL-1β, IL-2, IL-6, IL-10, TNF-α and VEGF were measured using a Luminex® 200™ flow cytometer (Merckmillipore, Merck KGaA, Darmstadt, Alemania) and a highly sensitive ELISA system. Results: The levels of IL-1β, IL-2, IL-6 and IL-10 in the aqueous humor before and after treatment with adalimumab did not show significant differences. Aqueous VEGF levels significantly reduced after treatment with adalimumab (P = 0.028). Aqueous TNF-α levels did not significantly change after treatment with adalimumab, however the post-treatment level was significantly higher in patients as compared to control subjects (P = 0.032). IL-2 showed significantly higher levels in uveitis patients before treatment as compared to controls (P = 0.024), while its post-treatment levels were almost normalized. Conclusion: Decrease in the aqueous humor levels of VEGF and IL-2 after treatment with systemic adalimumab indicates that anti-TNF-α therapy induces modifications of some inflammatory mediators involved in the pathogenesis of uveitis. Aqueous humor samples may be useful to assess the effect of adalimumab on intraocular inflammation through measurement of cytokines. PMID:26005553

  1. Productive and Penicillin-Stressed Chlamydia pecorum Infection Induces Nuclear Factor Kappa B Activation and Interleukin-6 Secretion In Vitro

    PubMed Central

    Leonard, Cory A.; Schoborg, Robert V.; Borel, Nicole

    2017-01-01

    Nuclear factor kappa B (NFκB) is an inflammatory transcription factor that plays an important role in the host immune response to infection. The potential for chlamydiae to activate NFκB has been an area of interest, however most work has focused on chlamydiae impacting human health. Given that inflammation characteristic of chlamydial infection may be associated with severe disease outcomes or contribute to poor overall fitness in farmed animals, we evaluated the ability of porcine chlamydiae to induce NFκB activation in vitro. C. pecorum infection induced both NFκB nuclear translocation and activation at 2 hours post infection (hpi), an effect strongly enhanced by suppression of host de novo protein synthesis. C. suis and C. trachomatis showed less capacity for NFκB activation compared to C. pecorum, suggesting a species-specific variation in NFκB activation. At 24 hpi, C. pecorum induced significant NFκB activation, an effect not abolished by penicillin (beta lactam)-induced chlamydial stress. C. pecorum-dependent secretion of interleukin 6 was also detected in the culture supernatant of infected cells at 24 hpi, and this effect, too, was unchanged by penicillin-induced chlamydial stress. Taken together, these results suggest that NFκB participates in the early inflammatory response to C. pecorum and that stressed chlamydiae can promote inflammation. PMID:28553623

  2. Interleukin 6 inhibits the differentiation of rat stem Leydig cells.

    PubMed

    Wang, Yiyan; Chen, Lanlan; Xie, Lubin; Li, Linchao; Li, Xiaoheng; Li, Huitao; Liu, Jianpeng; Chen, Xianwu; Mao, Baiping; Song, Tiantian; Lian, Qingquan; Ge, Ren-Shan

    2018-09-05

    Inflammation causes male hypogonadism. Several inflammatory cytokines, including interleukin 6 (IL-6), are released into the blood and may suppress Leydig cell development. The objective of the present study was to investigate whether IL-6 affected the proliferation and differentiation of rat stem Leydig cells. Leydig cell-depleted rat testis (in vivo) and seminiferous tubules (in vitro) with ethane dimethane sulfonate (EDS) were used to explore the effects of IL-6 on stem Leydig cell development. Intratesticular injection of IL-6 (10 and 100 ng/testis) from post-EDS day 14 to 28 blocked the regeneration of Leydig cells, as shown by the lower serum testosterone levels (21.6% of the control at 100 ng/testis dose), the down-regulated Leydig cell gene (Lhcgr, Star, Cyp11a1, Cyp17a1, and Hsd17b3) expressions, and the reduced Leydig cell number. Stem Leydig cells on the surface of the seminiferous tubules were induced to enter the Leydig cell lineage in vitro in the medium containing luteinizing hormone and lithium. IL-6 (1, 10, and 100 ng/ml) concentration-dependently decreased testosterone production and Lhcgr, Cyp11a1, Cyp17a1, Hsd17b3 and Insl3 mRNA levels. The IL-6 mediated effects were antagonized by Janus kinase 1 (JAK) inhibitor (filgotinib) and Signal Transducers and Activators of Transcription 3 (STAT3) inhibitor (S3I-201), indicating that a JAK-STAT3 signaling pathway is involved. In conclusion, our results demonstrated that IL-6 was an inhibitory factor of stem Leydig cell development. Copyright © 2017. Published by Elsevier B.V.

  3. Association between injury pattern of patients with multiple injuries and circulating levels of soluble tumor necrosis factor receptors, interleukin-6 and interleukin-10, and polymorphonuclear neutrophil elastase.

    PubMed

    Hensler, Thorsten; Sauerland, Stefan; Bouillon, Bertil; Raum, Marcus; Rixen, Dieter; Helling, Hanns-J; Andermahr, Jonas; Neugebauer, Edmund A M

    2002-05-01

    Our knowledge about the bidirectional interactions between brain and whole organism after trauma is still limited. It was the purpose of this prospective clinical study to determine the influence of severe head trauma (SHT) as well as trauma in different anatomic injury regions on posttraumatic inflammatory mediator levels from patients with multiple injuries. Thirty-five healthy controls, 33 patients with an isolated SHT, 47 patients with multiple injuries without SHT, and 45 patients with both SHT and multiple injuries were studied. The posttraumatic plasma levels of soluble tumor necrosis factor receptors p55 and p75, interleukin (IL)-6, IL-10, and polymorphonuclear neutrophil (PMN) elastase were monitored using enzyme-linked immunosorbent assay technique. The influence of head injuries as well as thorax, abdomen, and extremity injuries on the mediator release from patients with multiple injuries was investigated by multivariate linear regression models. The soluble tumor necrosis factor receptor p55/p75 ratio was significantly elevated within 3 hours of trauma in all three injury groups and returned to reference ratios after 12 hours. The lowest increase was found in patients suffering from an isolated SHT. Lowest mediator levels in this patient population were also found for IL-6, IL-10, and PMN elastase during the first 36 hours after trauma. Additional injuries to the head, thorax, abdomen, and extremity modulated mediator levels to a different degree. No specific effect was found for SHT when compared with other injury groups. Thorax injuries caused the quickest rise in mediator levels, whereas abdominal injuries significantly increased PMN elastase levels 12 to 24 hours after trauma. Traumatic injuries cause the liberation of various mediators, without any specific association between anatomic injury pattern and the pattern of mediator release.

  4. Evaluation of C-reactive protein and interleukin-6 in the peripheral blood of patients with chronic periodontitis

    PubMed Central

    Gani, Dhruva Kumar; Lakshmi, Deepa; Krishnan, Rama; Emmadi, Pamela

    2009-01-01

    Aims and Objectives: The aim of the present study was to investigate systemic levels of inflammatory markers of cardiovascular diseases like C-reactive protein and interleukin-6 in patients with chronic periodontitis, in comparison to periodontally healthy individuals. Materials and Methods: A total of 42 individuals, both males and females above the age of 30 years, were included in the study. Healthy controls (Group I, n = 14), chronic localized periodontitis (Group II, n = 14), and chronic generalized periodontitis (Group III, n = 14), all without any medical disorder, were recruited. Peripheral blood samples were taken and C-reactive protein (CRP) levels were estimated in the serum samples by using the Particle-Enhanced Turbidimetric Immunoassay (PETIA) technique. Serum samples of Interleukin-6 (IL-6) were assayed by using the Chemiluminescent Immunoassay (IMMULITE) technique. Results: When mean CRP levels were compared between the groups, group III showed statistical significance when compared to group I (P = 0.04). Group III had a higher median IL-6 level (6.35 pg/mL) than Group II (< 5.0 pg/mL) and group I (< 5.0 pg/mL). Differences in median values of IL-6 were not statistically significant in any group (P = 0.29). Conclusion: Periodontitis results in higher systemic levels of CRP and IL-6. These elevated inflammatory factors may increase inflammatory activity in atherosclerotic lesions and potentially increasing the risk for cardiovascular events. PMID:20407653

  5. Influence of glucoregulation quality on C-reactive protein, interleukin-6 and tumor necrosis factor-alpha level in patients with diabetes type 1.

    PubMed

    Mitrović, Milena; Ilić, Tatjana; Stokić, Edita; Paro, Jovanka Novaković; Naglić, Dragana Tomić; Bajkin, Ivana; Icin, Tijana

    2011-09-01

    Results of studies which have proved an increased inflammatory activity in diabetes type 1, have been published over recent years. One of possible mechanisms that are used to explain chronic inflammation in diabetes is the state of hyperglycemia leading to the enhanced synthesis of glycosylation end products (AGEs) which activate macrophages, increase the oxidative stress and affect the synthesis of interleukins (IL-1, IL-6), tumor necrosis factor-alpha (TNF-alpha) and C-reactive protein (CRP). The aim of the study was to determine the inflammatory markers (CRP, IL-6, TNF-alpha) in patients with diabetes type 1 and to establish their correlation with glucoregulation parameters and other cardiovascular risk factors as well as to compare them with the healthy controls. The study included 76 patients with diabetes type 1 and 30 healthy controls. We determined values of inflammatory markers (CRP, IL-6, TNF-alpha) and glucoregulation parameters (fasting glucose HbA(1c)). The values of CRP (p = 0.014), IL-6 (p = 0.020) and TNF-alpha (p = 0.037) were statistically significantly higher in the diabetic patients than in the healthy controls. There was a positive correlation between CRP with postprandial glycemia (p = 0.004); the multivariate regression analysis revealed a statistically significant correlation between CRP and age (p = 0.001), smoking (p = 0.055), fasting glucose (p = 0.021) and triglycerides (p = 0.048) as well as between IL-6 and LDL-cholesterol (p = 0.009). No statistically significant correlations were found between glycosilated hemoglobin (HbA(1c)) and the inflammatory markers (CRP, IL-6 and TNF-alpha). The patients with type 1 diabetes were found to have a low level of inflammatory activity manifested by the increased values of CRP, IL-6 and TNF-alpha.

  6. The short-term effects of non-surgical periodontal therapy on the circulating levels of interleukin-6 and C-reactive protein in patients with chronic periodontitis.

    PubMed

    George, Annie Kitty; Janam, Prasanthila

    2013-01-01

    Recent epidemiological studies have shown that periodontal infection is a risk factor for a number of systemic diseases and conditions. In addition to the conventional risk factors, chronic infection and the subsequent generation of a systemic inflammatory response may be associated with this increased risk. This study was conducted to determine whether the presence of chronic periodontitis and subsequent non-surgical periodontal therapy could influence the serum levels of interleukin-6 and C-reactive protein (CRP) in patients with severe chronic generalized periodontitis. Participants were selected from subjects who attended the Department of Periodontics and Oral Implantololgy, Government Dental College, Thiruvananthapuram. Sera were obtained from 25 patients with periodontitis for baseline examination and reassessment after completion of treatment. As a control, sera were also obtained from 20 subjects without periodontitis. Interleukin-6 was determined by sensitive enzyme-linked immunosorbent assay, and high-sensitivity CRP (hsCRP) was measured using latex turbidometric immunoassay. Data were analyzed using computer software, Statistical Package for Social Sciences (SPSS) version 10. The level of interleukin-6 and hsCRP in the sera of periodontitis patients was seen to be higher than those of healthy controls. Interleukin-6 level tended to decrease with improvement of the periodontal condition following treatment and approached that of control subjects, and this decline was statistically significant. The hsCRP levels also showed a decreasing trend following periodontal treatment. In this study, we were able to show that periodontal disease significantly affects the serum levels of systemic inflammatory markers and that non-surgical periodontal therapy could bring about a decrease in the levels of these inflammatory markers.

  7. Polymorphisms of interleukin 6 in Down syndrome individuals: a case-control study.

    PubMed

    Mattos, M F; Uback, L; Biselli-Chicote, P M; Biselli, J M; Goloni-Bertollo, E M; Pavarino, E C

    2017-08-17

    Down syndrome (DS) individuals present impaired adaptive immune system. However, the etiology of the immunological deficiency in these individuals is not completely understood. This study investigated the frequency of interleukin 6 polymorphisms (rs1800795, rs1800796, and rs1800797) in individuals with DS and individuals without the syndrome. The study included 282 individuals, 94 with DS attended at the General Genetics Outpatient Service of Hospital de Base, São José do Rio Preto, SP, Brazil, and 188 individuals without DS attended at the Pediatric Service of Hospital de Base de São José do Rio Preto, SP, Brazil. Genotyping was performed by allelic discrimination technique by real-time polymerase chain reaction using TaqMan SNP Genotyping Assays (Applied Biosystems). There was no difference in the genotype frequency between individuals with and without DS for the evaluated polymorphisms (P > 0.05). The frequency of interleukin 6 polymorphisms did not differ significantly between individuals with and without DS in the casuistic analyzed.

  8. Interleukin-6 is associated with chronic hyperglycemia and insulin resistance in patients after acute pancreatitis.

    PubMed

    Gillies, Nicola; Pendharkar, Sayali A; Asrani, Varsha M; Mathew, Juby; Windsor, John A; Petrov, Maxim S

    2016-01-01

    Diabetes is a pervasive disease, with a mounting prevalence and burden on health care systems. Under this collective term of diabetes falls diabetes after diseases of the exocrine pancreas, a condition which was previously under-recognised and often mislabeled as type 2 diabetes mellitus and is now increasingly acknowledged as a stand-alone entity. However, there is a paucity of clinical studies investigating the underlying pathophysiology of diabetes after acute pancreatitis, the most frequent disease of the pancreas. This study aimed to investigate the role of adipocytokines in glucose metabolism after acute pancreatitis. This was a cross-sectional follow-up study of a patient cohort diagnosed with acute pancreatitis. Fasting venous blood samples were collected to analyse markers of glucose metabolism (fasting blood glucose, haemoglobin A1c, homeostasis model assessment (HOMA-IR) as a measure of insulin resistance) and adypocytokines (adiponectin, interleukin-6, leptin, monocyte chemoattractant protein-1, retinol binding protein-4, resistin, and tumor necrosis factor-α). Participants were categorized into two groups: normoglycemia after acute pancreatitis and chronic hyperglycemia after acute pancreatitis (CHAP). Binary logistic regression and linear regression analyses were used to investigate the association between each of the adipocytokines and markers of glucose metabolism. Potential confounders were adjusted for in multivariate analyses. A total of 83 patients with acute pancreatitis were included, of whom 19 developed CHAP. Interleukin-6 was significantly associated with CHAP in both unadjusted and adjusted models (p = 0.030 and p = 0.018, respectively). Further, it was also significantly associated with HOMA-IR in both unadjusted and adjusted models (p = 0.029 and p = 0.037, respectively). Other adipocytokines were not significantly associated with markers of glucose metabolism. Interleukin-6 appears to be implicated in the development of chronic

  9. Serum cytokine tumor necrosis factor-alpha and interleukin-6 associated with the severity of coronary artery disease: indicators of an active inflammatory burden?

    PubMed

    Gotsman, Israel; Stabholz, Ayala; Planer, David; Pugatsch, Thea; Lapidus, Ludmila; Novikov, Yelena; Masrawa, Siham; Soskolne, Aubrey; Lotan, Chaim

    2008-07-01

    Atherosclerosis is a chronic inflammatory process resulting in coronary artery disease. To determine the relationship between inflammatory markers and the angiographic severity of CAD. We measured inflammatory markers in consecutive patients undergoing coronary angiography. This included C-reactive protein, fibrinogen, serum cytokines (interleukin-1 beta, IL-1 receptor antagonist, IL-6, IL-8, IL-10) and tumor necrosis factor-alpha), all measured by high sensitivity enzyme-linked immunoabsorbent assay. There was a significant correlation between TNFalpha and the severity of CAD as assessed by the number of obstructed coronary vessels and the Gensini severity score, which is based on the proximity and severity of the lesions. Patients had more coronary vessel disease (> 70% stenosis) with increasing tertiles of serum TNFalpha; the mean number of vessels affected was 1.15, 1.33, and 2.00 respectively (P< 0.001). IL-6 correlated with the Gensini severity score and coronary vessel disease (> 70% stenosis). A weaker correlation was present with IL-1 receptor antagonist. A significant correlation was not found with the other inflammatory markers. After adjustment for major risk factors, multivariate analyses showed that significant independent predictors of CAD vessel disease were TNFalpha (P< 0.05) and combined levels of TNFalpha and IL-6 (P< 0.05). IL-6 levels were independently predictive of Gensini coronary score (P< 0.05). TNFalpha and IL-6 are significant predictors of the severity of coronary artery disease. This association is likely an indicator of the chronic inflammatory burden and an important marker of increased atherosclerosis risk.

  10. Negative Emotions Predict Elevated Interleukin-6 in the United States but not in Japan

    PubMed Central

    Miyamoto, Yuri; Boylan, Jennifer Morozink; Coe, Christopher L.; Curhan, Katherine B.; Levine, Cynthia S.; Markus, Hazel Rose; Park, Jiyoung; Kitayama, Shinobu; Kawakami, Norito; Karasawa, Mayumi; Love, Gayle D.; Ryff, Carol D.

    2013-01-01

    Previous studies conducted in Western cultures have shown that negative emotions predict higher levels of pro-inflammatory biomarkers, specifically interleukin-6 (IL-6). This link between negative emotions and IL-6 may be specific to Western cultures where negative emotions are perceived to be problematic and thus may not extend to Eastern cultures where negative emotions are seen as acceptable and normal. Using samples of 1044 American and 382 Japanese middle-aged and older adults, we investigated whether the relationship between negative emotions and IL-6 varies by cultural context. Negative emotions predicted higher IL-6 among American adults, whereas no association was evident among Japanese adults. Furthermore, the interaction between culture and negative emotions remained even after controlling for demographic variables, psychological factors (positive emotions, neuroticism, extraversion), health behaviors (smoking status, alcohol consumption), and health status (chronic conditions, BMI). These findings highlight the role of cultural context in shaping how negative emotions affect inflammatory physiology and underscore the importance of cultural ideas and practices relevant to negative emotions for understanding of the interplay between psychology, physiology, and health. PMID:23911591

  11. Interleukin-6 and granulocyte-macrophage colony-stimulating factor in apical periodontitis: correlation with clinical and histologic findings of the involved teeth.

    PubMed

    Radics, T; Kiss, C; Tar, I; Márton, I J

    2003-02-01

    Apical periodontitis is characterized by the presence of immunocompetent cells producing a wide variety of inflammatory mediators. Releasing cytokines with long-range action, such as interleukin-6 (IL-6) and granulocyte-macrophage colony-stimulating factor (GM-CSF), apical periodontitis may induce changes in remote organs of the host. This study quantified the levels of IL-6 and GM-CSF in symptomatic and asymptomatic human periradicular lesions. Lesions were also characterized by size and histologic findings. Tissue samples were homogenized and supernatants were assayed using an enzyme-linked immunosorbent assay (ELISA). Correlations between cytokine levels and characteristic features (as single variables) of the lesions were analysed. There was a trend for higher levels of IL-6 and GM-CSF in symptomatic than in asymptomatic lesions, but the difference was not significant. Levels also tended to be higher in large than in small lesions, in polymorphonuclear (PMN) cell-rich than in PMN cell-poor samples, and in epithelialized than in non-epithelialized lesions. Significantly higher levels of IL-6 (778.1 +/- 220.5 pg/microg) and GM-CSF (363.3 +/- 98.4 pg/microg) were found in samples coincidentally possessing symptomatic and epithelialized features than in asymptomatic, small, PMN cell-poor, non-epithelialized lesions (IL-6: 45.2 +/- 13.1 pg/microg and GM-CSF: 135.1 +/- 26.4 pg/microg). These results suggest that symptomatic lesions containing epithelial cells represent an immunologically active stage of apical periodontitis, whereas asymptomatic, small, PMN cell-poor, non-epithelialized lesions represent healing apical lesions.

  12. Circulating levels of C-reactive protein, interleukin-6 and tumor necrosis factor-α and risk of colorectal adenomas: a meta-analysis.

    PubMed

    Zhang, Xiaoqian; Liu, Shanglong; Zhou, Yanbing

    2016-09-27

    Results from publications on inflammatory markers of C-reactive protein (CRP), interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) and risk of colorectal adenomas are not consistent. A meta-analysis was conducted to explore the above-mentioned associations. Relevant studies were identified by a search of Embase, Medline and PubMed through February 2016. A random effect model was adopted to combine study-specific odds ratio (OR) and 95% confidence interval (95% CI). Between-study heterogeneity and publications bias were assessed. Dose-response relationships were assessed by restricted cubic splines. Nineteen observational studies were included. For highest vs. lowest levels, results from this meta-analysis did not support an association between circulating levels of CRP [OR (95% CI): 1.15 (0.94-1.40)], IL-6 [1.17 (0.94-1.46)] and TNF-α [0.99 (0.75-1.31)] and risk of colorectal adenomas, respectively. The findings were supported by sensitivity analysis and subgroup analysis. In dose-response analysis, the risk of colorectal adenomas increased by 2% [1.02 (0.97-1.08)] for each 1 mg/L increment in circulation CRP levels, 9% [1.09 (0.91-1.31)] for each 1 ng/L increment in circulation IL-6 levels, and 6% [1.06 (0.93-1.21)] for each 1 pg/mL increment in circulation TNF-α levels. Moderate between-study heterogeneity was found. No evidence of publication bias was found. Circulation levels of CRP, IL-6 and TNF-α might be not useful biomarkers for identifying colorectal adenomas, respectively.

  13. Interleukin-6 mediates low-threshold mechanical allodynia induced by intrathecal HIV-1 envelope glycoprotein gp120

    PubMed Central

    Schoeniger-Skinner, Diana K.; Ledeboer, Annemarie; Frank, Matthew G.; Milligan, Erin D.; Poole, Stephen; Martin, David; Maier, Steven F.; Watkins, Linda R.

    2007-01-01

    Spinal cord glia (microglia and astrocytes) contribute to enhanced pain states. One model that has been used to study this phenomenon is intrathecal (i.t.) administration of gp120, an envelope glycoprotein of HIV-1 known to activate spinal cord glia and thereby induce low-threshold mechanical allodynia, a pain symptom where normally innocuous (non-painful) stimuli are perceived as painful. Previous studies have shown that i.t. gp120-induced allodynia is mediated via the release of the glial pro-inflammatory cytokines, tumor necrosis factor-α (TNF), and interleukin-1β (IL-1). As we have recently reported that i.t. gp120 induces the release of interleukin-6 (IL-6), in addition to IL-1 and TNF, the present study tested whether this IL-6 release in spinal cord contributes to gp120-induced mechanical allodynia and/or to gp120-induced increases in TNF and IL-1. An i.t. anti-rat IL-6 neutralizing antibody was used to block IL-6 actions upon its release by i.t. gp120. This IL-6 blockade abolished gp120-induced mechanical allodynia. While the literature predominantly documents the cascade of pro-inflammatory cytokines as beginning with TNF, followed by the stimulation of IL-1, and finally TNF plus IL-1 stimulating the release of IL-6, the present findings indicate that a blockade of IL-6 inhibits the gp120-induced elevations of TNF, IL-1, and IL-6 mRNA in dorsal spinal cord, elevation of IL-1 protein in lumbar dorsal spinal cord, and TNF and IL-1 protein release into the surrounding lumbosacral cerebrospinal fluid. These results would suggest that IL-6 induces pain facilitation, and may do so in part by stimulating the production and release of other proinflammatory cytokines. PMID:17204394

  14. Candida albicans triggers interleukin-6 and interleukin-8 responses by oral fibroblasts in vitro.

    PubMed

    Dongari-Bagtzoglou, A; Wen, K; Lamster, I B

    1999-12-01

    Oral candidiasis is the most frequent opportunistic infection associated with an immunocompromised host. Production of proinflammatory cytokines, such as interleukin-6 (IL-6) and IL-8, by host cells in response to Candida albicans can be expected to have a major impact in the activation of immune effector cells against the invading microorganism. Using a human cell--C. albicans coculture model system, we determined that this microorganism can trigger secretion of these potent chemoattractant and proinflammatory cytokines by oral mucosal fibroblasts. This response varied depending on the infecting strain and required fungal viability, germination of yeast into hyphae and mannose-mediated direct contact between the host cell and Candida. The secretion of proinflammatory cytokines by oral mucosal fibroblasts in response to C. albicans suggests that these cells have the potential to enhance the host defense against this organism in vivo. This may have important implications in controlling fungal overgrowth in the oral cavity.

  15. The Role of Interleukin-6 Polymorphism (rs1800795) in Prostate Cancer Development and Progression.

    PubMed

    Jurečeková, Jana; Drobková, Henrieta; Šarlinová, Miroslava; Babušíková, Eva; Sivoňová, Monika Kmeťová; Matáková, Tatiana; Kliment, Ján; Halašová, Erika

    2018-06-01

    Interleukin-6 is an important modulator of inflammation, which is one of the factors involved in prostate cancer. The aim of the study was to evaluate the possible association of the IL-6 -174 polymorphism (rs1800795) with the risk of prostate cancer development and progression. The study population consisted of 446 prostate cancer patients, 377 benign prostatic hyperplasia (BHP) patients and 276 healthy men. Genotyping was performed by PCR-RFLP analysis. IL-6 plasma levels were measured by the ELISA method. The GC genotype (OR=0.61, p=0.005) and C allele (OR=0.8, p=0.04) of the IL-6 -174 polymorphism were significantly associated with prostate cancer. No genotype was associated with BHP. IL-6 plasma levels were significantly increased in prostate cancer patients compared to both healthy men (p=0.02) and BHP patients (p=0.008). No significant differences were observed in IL-6 plasma levels in connection with IL-6 -174 genotypes. The IL-6 -174 polymorphism was significantly associated with prostate cancer in Slovak patients. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  16. Interleukin 6 production in experimental cerebral malaria: modulation by anticytokine antibodies and possible role in hypergammaglobulinemia

    PubMed Central

    1990-01-01

    The production of Interleukin 6 (IL-6) was studied during experimental cerebral malaria (ECM) induced by Plasmodium berghei ANKA (PbA) infection. IL-6 is present in the serum of mice with ECM, the highest concentrations being observed in mice with full-blown neurological syndrome. High IL-6 levels were also observed, however, in the absence of pathology in nonlethal malaria infection. These data suggest that IL- 6 is produced in large amounts during malaria infection, but does not play a major role in the pathogenesis of ECM. A modulation of IL-6 production in ECM was achieved by in vivo treatment with other anticytokine antibodies: antibodies to interferon (IFN-gamma) or to tumor necrosis factor (TNF) abolished the rise of IL-6, while anti-IL-3 and anti-granulocyte/macrophage colony-stimulating factor antibodies only partially prevented this rise, suggesting that the two cytokines IFN-gamma and TNF are important intermediates in IL-6 production. Passive immunization against IL-6 did not prevent ECM, but significantly reduced serum IgG levels in malaria-infected mice. Thus, by its effects on B cells, IL-6 may be involved in hypergammaglobulinemia and immune-complex diseases, e.g., glomerulonephritis observed during malaria infection. PMID:2121890

  17. Suppression of chronic experimental autoimmune neuritis by nasally administered recombinant rat interleukin-6

    PubMed Central

    DERETZI, G; PELIDOU, S-H; ZOU, L-P; QUIDING, C; MIX, E; LEVI, M; WAHREN, B; ZHU, J

    1999-01-01

    Experimental autoimmune neuritis (EAN) is a CD4+ T-cell-mediated demyelinating disease of the peripheral nervous system (PNS) and serves as experimental model for human immune-demyelinating neurophathies, especially the Guillain–Barré syndrome. In this study, we examined the effect of recombinant rat interleukin-6 (rrIL-6) on chronic EAN in Lewis rats induced by immunization with P2 peptide 57-81 and Freund’s complete adjuvant (FCA). Nasal administration of rat rIL-6 (1 μg/rat/day) beginning in the initial phase of EAN as a therapeutic agent, decreased the severity and the duration of clinical EAN. Low-grade inflammation and suppression of regional demyelination within the sciatic nerves were seen in rrIL-6-treated rats. Hyporesponsiveness of lymph node T cells, down-regulation of serum tumour necrosis factor-α (TNF-α) and increased levels of P2-specific immunoglobulin G1 (IgG1) antibodies document that nasal administration of rrIL-6 was effective systemically. However, because of the non-specific nature of the treatment and multiple effects of IL-6, more experience and great caution are needed, before nasal administration of IL-6 can be considered as a treatment of human autoimmune demyelinating neurophathies. PMID:10447716

  18. The short-term effects of non-surgical periodontal therapy on the circulating levels of interleukin-6 and C-reactive protein in patients with chronic periodontitis

    PubMed Central

    George, Annie Kitty; Janam, Prasanthila

    2013-01-01

    Background: Recent epidemiological studies have shown that periodontal infection is a risk factor for a number of systemic diseases and conditions. In addition to the conventional risk factors, chronic infection and the subsequent generation of a systemic inflammatory response may be associated with this increased risk. Aims: This study was conducted to determine whether the presence of chronic periodontitis and subsequent non-surgical periodontal therapy could influence the serum levels of interleukin-6 and C-reactive protein (CRP) in patients with severe chronic generalized periodontitis. Settings and Design: Participants were selected from subjects who attended the Department of Periodontics and Oral Implantololgy, Government Dental College, Thiruvananthapuram. Materials and Methods: Sera were obtained from 25 patients with periodontitis for baseline examination and reassessment after completion of treatment. As a control, sera were also obtained from 20 subjects without periodontitis. Interleukin-6 was determined by sensitive enzyme-linked immunosorbent assay, and high-sensitivity CRP (hsCRP) was measured using latex turbidometric immunoassay. Statistical Analysis: Data were analyzed using computer software, Statistical Package for Social Sciences (SPSS) version 10. Results: The level of interleukin-6 and hsCRP in the sera of periodontitis patients was seen to be higher than those of healthy controls. Interleukin-6 level tended to decrease with improvement of the periodontal condition following treatment and approached that of control subjects, and this decline was statistically significant. The hsCRP levels also showed a decreasing trend following periodontal treatment. Conclusions: In this study, we were able to show that periodontal disease significantly affects the serum levels of systemic inflammatory markers and that non-surgical periodontal therapy could bring about a decrease in the levels of these inflammatory markers. PMID:23633770

  19. Charomers-Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery.

    PubMed

    Hahn, Ulrich

    2017-12-06

    Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2'-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers-in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld.

  20. Urinary interleukin-6 as a predictor of radiographic progression in rheumatoid arthritis: A 3-year evaluation.

    PubMed

    Park, Yune-Jung; Yoo, Seung-Ah; Kim, Ga-Ram; Cho, Chul-Soo; Kim, Wan-Uk

    2016-10-12

    Previously, we demonstrated that the urine proteome signature of patients with rheumatoid arthritis (RA) reflects inflammation-related cellular processes. Here, we measured interleukin (IL)-6, IL-8, and chemokine ligand 2 (CCL2) concentrations in the urine of RA patients and prospectively investigated their role in predicting RA activity and prognosis. One hundred seventy-three RA patients and 62 non-RA controls were recruited. Urinary IL-6, CCL2, and IL-8 levels were elevated in RA patients and correlated well with disease activity. Urinary IL-6 level at presentation was an independent risk factor of radiographic progression at 1 and 3 years. High urinary IL-6 level increased the risk ratio of radiographic progression by 2.9-fold, which was comparable to high serum CRP. Moreover, combination of urinary IL-6 and serum CRP measures synergistically increased the predictability of radiographic progression. In a subgroup with normal ESR, patients with the highest tertile of urinary IL-6 were at 6.4-fold greater risk of radiographic progression. Conclusively, high urinary IL-6 level at presentation is an independent risk factor for radiographic progression of RA, reflecting disease activity. Urinary IL-6 in combination with serum CRP may be a useful parameter for estimating RA prognosis.

  1. Impact of interleukin-6 promoter polymorphism and serum interleukin-6 level on the acute inflammation and neovascularization stages of patients with Eales’ disease

    PubMed Central

    Sen, Aditi; Paine, Suman Kalyan; Chowdhury, Imran Hussain; Mukherjee, Amrita; Choudhuri, Subhadip; Saha, Avijit; Mandal, Lakshmi Kanta

    2011-01-01

    Purpose To evaluate the role of interleukin-6 (IL-6) in the inflammatory and proliferative stages of Eales’ disease (ED) and to determine the influence of IL-6–174G/C polymorphism in the IL-6 and IL-6-regulated protein expression, as well as the development of ED. Methods One hundred and twenty-one patients diagnosed with ED, 223 matched healthy controls, and 16 control patients with macular holes were recruited from the eastern Indian population. Serum and vitreous levels of IL-6 and vascular endothelial growth factors (VEGF) were measured by enzyme-linked immunosorbent assay. Serum levels of high-sensitivity C-reactive protein (hsCRP) were measured by enzyme immunoassay. Subjects were genotyped for the IL-6–174G/C polymorphism (rs1800795) by a custom TaqMan single-nucleotide polymorphism (SNP) Genotyping Assays system. Results Serum IL-6 (p<0.0001), hsCRP (p<0.0001), and VEGF (p=0.0031) levels were significantly higher in the inflammatory stage of ED than in healthy controls. Serum IL-6 also significantly correlated with hsCRP (Spearman’s correlation coefficient; r=0.4992, p=0.0009), but not with VEGF in this stage in ED patients. At the proliferative stage of ED, significantly higher levels of vitreous IL-6 (p=<0.0001) and VEGF (p=<0.0001) were found compared with the vitreous of patients with macular holes. A significant correlation was observed between vitreous IL-6 and VEGF in ED patients (Spearman’s correlation coefficient; r=0.5834, p=0.0087). A statistically significant association was found between the −174GG genotype (p=0.006) and occurrence of ED. Mean serum and vitreous concentrations of IL-6 were also higher in the subjects with the GG genotype than in those with the GC or CC genotype in this population. Conclusions IL-6 expression, regulated by the allelic distribution of −174 loci and the enhanced level of IL-6, modulates CRP and VEGF concentration depending respectively on the acute inflammatory stimulation at the initial stage and

  2. Joint Analysis of Individual Participants’ Data from 17 Studies on the Association of the IL6 Variant -174G>C with Circulating Glucose Levels, Interleukin-6 Levels, and Body-Mass Index

    PubMed Central

    Huth, Cornelia; Illig, Thomas; Herder, Christian; Gieger, Christian; Grallert, Harald; Vollmert, Caren; Rathmann, Wolfgang; Hamid, Yasmin H.; Pedersen, Oluf; Hansen, Torben; Thorand, Barbara; Meisinger, Christa; Döring, Angela; Klopp, Norman; Gohlke, Henning; Lieb, Wolfgang; Hengstenberg, Christian; Lyssenko, Valeriya; Groop, Leif; Ireland, Helen; Stephens, Jeffrey W.; Asterholm, Ingrid Wernstedt; Jansson, John-Olov; Boeing, Heiner; Möhlig, Matthias; Stringham, Heather M.; Boehnke, Michael; Tuomilehto, Jaakko; Fernandez-Real, Jose-Manuel; Lopez-Bermejo, Abel; Gallart, Luis; Vendrell, Joan; Humphries, Steve E.; Kronenberg, Florian; Wichmann, H.-Erich; Heid, Iris M.

    2013-01-01

    Background Several studies have investigated associations between the -174G>C polymorphism (rs1800795) of the IL6-gene, but presented inconsistent results. Aims This joint analysis aimed to clarify whether IL6 -174G>C was associated with type 2 diabetes mellitus (T2DM) related quantitative phenotypes. Methods Individual-level data from all studies of the IL6-T2DM consortium on Caucasian subjects with available BMI were collected. As study-specific estimates did not show heterogeneity (P>0.1), they were combined by using the inverse-variance fixed-effect model. Results The main analysis included 9440, 7398, 24,117, or 5659 nondiabetic and manifest T2DM subjects for fasting glucose, 2-hour glucose, BMI or circulating interleukin-6 levels, respectively. IL6 -174 C-allele carriers had significantly lower fasting glucose (−0.091mmol/L, P=0.014). There was no evidence for association between IL6 -174G>C and BMI or interleukin-6. In an additional analysis of 641 subjects known to develop T2DM later on, the IL6 -174 CC-genotype was associated with higher baseline interleukin-6 (+0.75pg/mL, P=0.004), which was consistent with higher interleukin-6 in the 966 manifest T2DM subjects (+0.50pg/mL, P=0.044). Conclusions Our data suggest association between IL6 -174G>C and quantitative glucose, and exploratory analysis indicated modulated interleukin-6 levels in pre-diabetic subjects, being in-line with this SNP’s previously reported T2DM association and a role of circulating interleukin-6 as intermediate phenotype. PMID:18752089

  3. Type of Inflammation Differentially Affects Expression of Interleukin 1β and 6, Tumor Necrosis Factor-α and Toll-Like Receptors in Subclinical Endometritis in Mares

    PubMed Central

    Szóstek, Anna Z.; Gajos, Katarzyna; Kozdrowski, Roland; Nowak, Marcin; Okuda, Kiyoshi

    2016-01-01

    Mares that fail to conceive or lose their embryos, without showing typical signs of clinical endometritis, should be suspected of subclinical endometritis (SE). In this study, the question was addressed: does SE fully activate selected mechanisms of innate immunity in mares? For this aim, expression of mRNAs for Toll-like Receptor 2 and 4 (TLR 2/4), interleukin 1β (IL-1β), interleukin 6 (IL-6) and tumor necrosis factor α (TNF) was examined in control mares versus either mares suffering from chronic endometritis (ChE) or subacute suppurative endometritis (SSE). The concentrations of IL-1β, IL-6 and TNF-α in supernatants from endometrial tissue cultures after 4 h incubation were measured using the enzyme immunoassay (EIA) method. Eighty-two warmblood mares, of known breeding history, were enrolled in this study. Based on histopathological assessment, mares were classified as suffering from ChE, SSE or as being healthy. In addition, immuno-localization of both TLR2 and TLR4 as well as TNF-α was investigated in the equine endometria. The mRNA expression of TLR2 (P < 0.01), IL-1β (P < 0.0001), IL-6 (P < 0.0001) and TLR4 and TNF (P < 0.05) was up-regulated in endometria of mares suffering from SSE compared with unaffected mares. Concentrations of IL-6 and TNF-α were increased only in mares exhibiting SSE, compared with unaffected (P < 0.01 for both) and ChE mares (P < 0.05 for both). Immuno-localization of TNF-α and TLRs was confirmed, both in unaffected and SE-affected endometria, and was present in the luminal and glandular epithelia and stromal cells. The severity of inflammation impacts the immune response and fosters activation of innate immunity mechanisms, as observed in the endometria of mares. The intracellular localization of TLRs and TNF-α in the endometria indicates a key role of endometrial epithelial and stromal cells in the immune response and inflammation. PMID:27152525

  4. Interleukin-4 but not interleukin-10 inhibits the production of leukemia inhibitory factor by rheumatoid synovium and synoviocytes.

    PubMed

    Dechanet, J; Taupin, J L; Chomarat, P; Rissoan, M C; Moreau, J F; Banchereau, J; Miossec, P

    1994-12-01

    The expression of the proinflammatory cytokine leukemia inhibitory factor (LIF) has been reported in the cartilage and synovium of rheumatoid arthritis (RA) patients. Here, we show that high levels of LIF were constitutively produced by cultures of synovium pieces. Low levels of LIF were produced spontaneously by isolated synoviocytes, but interleukin (IL)-1 beta caused a fourfold enhancement of this secretion. The anti-inflammatory cytokine IL-4 reduced the production of LIF by synovium pieces by 75%, as observed earlier with IL-6, IL-1 beta and tumor necrosis factor (TNF)-alpha. IL-4 had a direct effect since it inhibited LIF production by unstimulated and IL-1 beta- or TNF-alpha-stimulated synoviocytes. Conversely, IL-4 enhanced the production of IL-6, which shares with LIF biological activities and receptor components. The inhibitory effect of IL-4 was dose dependent and was reversed using a blocking anti-IL-4 receptor antibody. Similar inhibitory action of IL-4 on LIF production was observed on synovium pieces from patients with osteoarthritis and on normal synoviocytes. IL-10, another anti-inflammatory cytokine acting on monocytes, had no effect on LIF production by either synovium pieces or isolated synoviocytes. Thus, the production of LIF by synovium tissue was inhibited by IL-4 through both a direct effect on synoviocytes and an indirect effect by inhibition of the production of LIF-inducing cytokines.

  5. Interleukin-6, vitamin D & diabetes risk-factors modified by a short-term yoga-based lifestyle intervention in overweight/obese individuals.

    PubMed

    Netam, Ritesh; Yadav, Raj Kumar; Khadgawat, Rajesh; Sarvottam, Kumar; Yadav, Rashmi

    2015-06-01

    Several diabetes prevention programmes have demonstrated a reduction in incidence of diabetes in individuals with prediabetes through weight loss. Short-term yoga-based lifestyle intervention programmes have also been shown to be efficacious in weight loss. This study was undertaken to investigate if interleukin (IL)-6, vitamin D, neopterin, vaspin, and diabetes risk factors can be modified by a short-term yoga-based lifestyle intervention in overweight/obese subjects. In this pilot study, 34 overweight/obese [body mass index (BMI) ≥ 23 to <35 kg/m [2] per Asian cut-off values] individuals were enrolled, and received directly supervised intervention for 10 days. Thereafter, they were advised to follow this yoga-based lifestyle at home for one month, and were reassessed for study variables at day 30. There was a reduction from baseline to day 10 in weight ( p <0.001), BMI ( P <0.001), waist/hip-ratio ( P <0.05), blood glucose ( P <0.01), and a significant improvement in lipid profile. There was a decrease in median fasting insulin ( P <0.05), homeostatic model assessment-insulin resistance ( P <0.01), and IL-6 ( Pp <0.05). A non-significant increase in 25-OH-vitamin D, and a decrease in neopterin and vaspin were observed. Twenty subjects returned for follow up assessments. At day 30, weight loss was sustained while systolic blood pressure also showed reduction ( P <0.05). Changes in vitamin D levels were significantly and negatively correlated with changes in weight, BMI and fasting blood glucose, and positively with change in high density lipoprotein. Changes in body weight and BMI significantly and positively correlated with insulin. Changes in IL-6 levels positively and significantly correlated with change in neopterin levels. The findings showed that IL-6, vitamin D, and diabetes risk factors were favourably modified by a short-term yoga-based lifestyle intervention in obesity. This study also highlighted the challenges in compliance associated with the follow

  6. Changes in body composition and metabolic profile during interleukin 6 inhibition in rheumatoid arthritis

    PubMed Central

    Pereira, Bruno; Dutheil, Fréderic; Giraud, Charlotte; Courteix, Daniel; Sapin, Vincent; Frayssac, Thomas; Mathieu, Sylvain; Malochet‐Guinamand, Sandrine; Soubrier, Martin

    2017-01-01

    Abstract Background Rheumatoid arthritis (RA) is a chronic inflammatory disease characterized by increased mortality associated with cardiometabolic disorders including dyslipidaemia, insulin resistance, and cachectic obesity. Tumour necrosis factor inhibitors and interleukin 6 receptor blocker licensed for the treatment of RA decrease inflammation and could thus improve cardiovascular risk, but their effects on body composition and metabolic profile need to be clarified. We investigated the effects of tocilizumab (TCZ), a humanized anti‐interleukin 6 receptor antibody, on body composition and metabolic profile in patients treated for RA. Methods Twenty‐one active RA patients treated with TCZ were included in a 1 year open follow‐up study. Waist circumference, body mass index, blood pressure, lipid profile, fasting glucose, insulin, serum levels of adipokines and pancreatic/gastrointestinal hormones, and body composition (dual‐energy X‐ray absorptiometry) were measured at baseline and 6 and 12 months of treatment. At baseline, RA patients were compared with 21 non‐RA controls matched for age, sex, body mass index, and metabolic syndrome. Results Compared with controls, body composition was altered in RA with a decrease in total and appendicular lean mass, whereas fat composition was not modified. Among RA patients, 28.6% had a skeletal muscle mass index below the cut‐off point for sarcopaenia (4.8% of controls). After 1 year of treatment with TCZ, there was a significant weight gain without changes for fat mass. In contrast, an increase in lean mass was observed with a significant gain in appendicular lean mass and skeletal muscle mass index between 6 and 12 months. Distribution of the fat was modified with a decrease in trunk/peripheral fat ratio and an increase in subcutaneous adipose tissue. No changes for waist circumference, blood pressure, fasting glucose, and atherogenic index were observed. Conclusions Despite weight gain during treatment

  7. Influence of interleukin-1β and interleukin-6 gene polymorphisms on the development of acute pancreatitis.

    PubMed

    Chi, D Z; Chen, J; Huang, D P

    2015-02-03

    We investigated the association between 3 main proinflammatory cytokines [interleukin (IL)-1β and IL-6] and the risk of acute pancreatitis. Polymerase chain reaction-restriction fragment length polymorphism was used to genotype IL-1β+3954 C/T (rs1143634) and IL-1β-511 C/T (rs16944) and IL-6 -174 G/C (rs1800795) and IL-6 -634 C/G (rs1800796). The genotype distributions of IL-1β+3954 C/T (rs1143634) and IL-1β-511 C/T (rs16944) and IL-6 -174 G/C (rs1800795) and IL-6 -634 C/G (rs1800796) were in Hardy-Weinberg equilibrium for the control group. Multivariate regression analyses showed that subjects carrying the rs1143634 TT genotype had a significantly increased risk of acute pancreatitis, with an adjusted odds ratio (95% confidence interval) of 2.11 (1.03-4.51). Subjects carrying the IL-1β rs1143634 TT genotype had a significantly increased risk of acute pancreatitis in our Chinese population.

  8. Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

    PubMed

    Crosswhite, Patrick; Sun, Zhongjie

    2010-06-01

    The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

  9. Plasma interleukin-6 levels, glutathione peroxidase and isoprostane in obese women before and after weight loss. Association with cardiovascular risk factors.

    PubMed

    Bougoulia, Maria; Triantos, Athanassios; Koliakos, George

    2006-01-01

    To evaluate the levels of Interleukin-6 (IL-6), glutathione peroxidase and isoprostane in obese women and their association with markers of cardiovascular risk factors before and after weight loss. 36 healthy obese women of reproductive age (group A: age (mean+/-SD) 35.4+/-9.2 years, Body Mass Index (BMI) 38.5+/-7 kg/m2) and 30 healthy, normal weight women (group B: age mean+/-SD 34.9+/-7.4 y., BMI 24+/-1.1 kg/m2) were included in the study. Glucose tolerance was normal in all participating women. Il-6, glutathione peroxidase and isoprostane, C-Reactive Protein (CRP), insulin, fasting plasma glucose, HOMA-IR as well as the lipid profile were evaluated. Body weight, BMI, Waist to Hip ratio (W/H) ratio, Waist Circumference (WC), %free fat mass and the %fat mass were also measured. A hypo-caloric diet was prescribed for the obese women and all participants were re-examined after six months. In obese women after weight loss, anthropometric obesity markers (BMI, W/H ratio), %fat, lipid profile, insulin levels and inflammation indices such as IL-6 and CRP, the oxidative stress index isoprostane, as well as glutathione peroxidase were significantly ameliorated. The levels of serum glutathione peroxidase activity were negatively correlated with IL-6 levels and were significantly increased after weight reduction. In obese women there was an association between IL-6 levels and the values of %fat, %free fat mass, insulin and HOMA-IR before and after weight loss. Weight loss is related to reduction of oxidative stress and inflammation; this beneficial effect could possibly be translated into reduction of cardiovascular risk in obese individuals.

  10. Effects of Serotonergic Activation by 5-Hydroxytryptophan on Sleep and Body Temperature of C57BL/6J and Interleukin-6-Deficient Mice are Dose and Time Related

    PubMed Central

    Morrow, Jonathan D.; Vikraman, Sundeep; Imeri, Luca; Opp, Mark R.

    2008-01-01

    Study Objectives: Extensive data implicate serotonin (5-hydroxytryptamine [5-HT]) in the regulation of sleep. Jouvet has hypothesized that 5-HT promotes wakefulness, yet is necessary for subsequent non-rapid eye movement (NREM) sleep, actions he proposes to be mediated by sleep factors. Studies in rat support this dual role for 5-HT. The objectives of this study were to (1) determine effects of serotonergic activation on sleep of mice and (2) elucidate a potential role for the cytokine interleukin-6 as a sleep factor mediating serotonergic effects on sleep. Design: C57BL/6J and B6.129S6-Il6tm1Kopf (interleukin-6 knockout [IL-6 KO]) mice were purchased from the Jackson Laboratory and instrumented for recording the electroencephalogram and body temperature. After recovery, separate groups of mice were injected intraperitoneally at either light or dark onset with vehicle or with the 5-HT precursor 5-hydroxytryptophan (5-HTP). Sleep-wake behavior was determined and body temperature recorded for 24 hours after injections. Results: 5-HTP induced hypothermia in both mouse strains. When injected at dark onset, the highest dose of 5-HTP (200 mg/kg) increased NREM sleep. Light onset administration initially increased wakefulness, with increases in NREM sleep apparent only during the subsequent dark period. For most parameters, there were no differences in responses between strains. However IL-6 KO mice at some doses exhibited a greater increase in NREM sleep. Conclusions: 5-HTP alters sleep-wake behavior and body temperature of mice in a manner similar to that of rats. Increases in NREM sleep after 5-HTP are apparent only during the dark period, which may represent a fundamental property of the serotonergic system. These results suggest that 5-HT should not be considered either wake promoting or NREM sleep promoting. Rather, the role of 5-HT in the regulation of sleep-wake behavior must be considered within the context of the degree to which the system is activated and the

  11. Induction of interleukin 6 and interleukin 8 expression by Broncho-Vaxom (OM-85 BV) via C-Fos/serum responsive element.

    PubMed Central

    Keul, R.; Roth, M.; Papakonstantinou, E.; Nauck, M.; Perruchoud, A. P.; Block, L. H.

    1996-01-01

    BACKGROUND: Broncho-Vaxom (OM-85 BV) increases the resistance of the respiratory tract to bacterial infections by modulating host immune responses. The compound increases serum IgG levels but decreases IgE levels in patients suffering from chronic bronchitis or chronic obstructive pulmonary disease. It increases concentrations of gamma-interferon (IFN-gamma), IgA, and interleukin (IL)-2 in bronchoalveolar lavage fluid of patients with bronchitis. Treatment with OM-85 BV increases the number of T helper and natural killer cells. In this study the effects of OM-85 BV on transcription of cytokines is investigated in human lung fibroblasts. METHODS: Transcription and synthesis of IL-6 and IL-8 were assessed in cultured primary human lung fibroblasts using standard methods of Northern blot analysis for the level of mRNAs and enzyme linked immunosorbent assay for proteins. RESULTS: Broncho-Vaxom (OM-85 BV) at different concentrations induced transcription of IL-6 and IL-8. The effect of the drug on transcription of IL-6 and IL-8 genes correlated with secretion of the proteins into cell supernatants. OM-85 BV-dependent expression of the interleukin genes involved C-Fos/serum responsive element (C-Fos/SRE). CONCLUSIONS: The data suggest that the various immunopharmacological activities of OM-85 BV that have been described in clinical studies may be explained by its ability to induce expression of IL-6 and IL-8. Images PMID:8711646

  12. Stimulation of interleukin-1beta-independent interleukin-6 production in human dental pulp cells by lipopolysaccharide.

    PubMed

    Hosoya, S; Matsushima, K; Ohbayashi, E; Yamazaki, M; Shibata, Y; Abiko, Y

    1996-12-01

    Dental pulpal infection is most commonly caused by extensive dental caries. A principal driving force behind pulpal disease response appears to lie in the immune system's response to bacteria. However, the production of interleukin (IL)-1beta and IL-6 in human dental pulp (HDP) cells in response to lipopolysaccharide (LPS) has not been well characterized. We examined IL-1beta and IL-6 production in HDP cells by challenging with LPS from Porphyromonas endodontalis, which is a Gram-negative bacteria found in root canals. Our results presented here showed that when HDP cells were stimulated by LPS, the production of IL-6 always preceded that of IL-1beta. Since the IL-6 production was observed even in the presence of the IL-1beta receptor antagonist, we concluded IL-6 production was independent of the IL-1beta molecule in LPS-stimulated HDP cells. This idea was further supported by the results obtained from RT-PCR experiments, in which IL-6 mRNA, but not IL-1beta mRNA, was present in the RNA preparation isolated from the early stage of cells.

  13. Interleukin-6 and Delayed Onset Muscle Soreness Do Not Vary during the Menstrual Cycle

    ERIC Educational Resources Information Center

    Chaffin, Morgan E.; Berg, Kris E.; Meendering, Jessica R.; Llewellyn, Tamra L.; French, Jeffrey A.; Davis, Jeremy E.

    2011-01-01

    The purpose of this study was to determine if a difference in interleukin-6 (IL-6) and delayed onset muscles soreness (DOMS) exists in two different phases of the menstrual cycle. Nine runners performed one 75-min high-intensity interval running session during the early follicular (EF) phase and once during the midluteal (ML) phase of the…

  14. Negative emotions predict elevated interleukin-6 in the United States but not in Japan.

    PubMed

    Miyamoto, Yuri; Boylan, Jennifer Morozink; Coe, Christopher L; Curhan, Katherine B; Levine, Cynthia S; Markus, Hazel Rose; Park, Jiyoung; Kitayama, Shinobu; Kawakami, Norito; Karasawa, Mayumi; Love, Gayle D; Ryff, Carol D

    2013-11-01

    Previous studies conducted in Western cultures have shown that negative emotions predict higher levels of pro-inflammatory biomarkers, specifically interleukin-6 (IL-6). This link between negative emotions and IL-6 may be specific to Western cultures where negative emotions are perceived to be problematic and thus may not extend to Eastern cultures where negative emotions are seen as acceptable and normal. Using samples of 1044 American and 382 Japanese middle-aged and older adults, we investigated whether the relationship between negative emotions and IL-6 varies by cultural context. Negative emotions predicted higher IL-6 among American adults, whereas no association was evident among Japanese adults. Furthermore, the interaction between culture and negative emotions remained even after controlling for demographic variables, psychological factors (positive emotions, neuroticism, extraversion), health behaviors (smoking status, alcohol consumption), and health status (chronic conditions, BMI). These findings highlight the role of cultural context in shaping how negative emotions affect inflammatory physiology and underscore the importance of cultural ideas and practices relevant to negative emotions for understanding of the interplay between psychology, physiology, and health. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. The short-term effects of treatment of chronic periodontitis on circulating levels of endotoxin, C-reactive protein, tumor necrosis factor-alpha, and interleukin-6.

    PubMed

    Ide, Mark; Jagdev, Daljit; Coward, Paula Y; Crook, Martin; Barclay, G Robin; Wilson, Ron F

    2004-03-01

    The acute-phase response involves molecules including tumor necrosis factor-alpha (TNF-alpha), interleukin-6 (IL-6), and C-reactive protein (CRP). This study aimed to determine whether subgingival scaling resulted in rapid changes in plasma concentrations of these molecules. Twenty-three non-smoking adults with chronic periodontitis received subgingival scaling for 60 minutes. Venous blood samples were taken at 0, 15, 30, 60, and 120 minutes. TNF-alpha and IL-6 were assayed from all samples and CRP from the baseline and final samples. Lipopolysaccharide (LPS) was assayed at 0, 15, and 30 minutes using limulus lysate assay (LAL) and EndoCAb Ig assays. LPS assays were suggestive of a transient low-grade bacteremia, but changes in LPS approaching significance (P=0.061) were seen with LAL only. There was a significant increase in circulating TNF-alpha (P=0.0387) and IL-6 (P<0.0001), and the degree of change in TNF-alpha was correlated with the severity of periodontal breakdown (P=0.001). There was also a significant correlation between levels of IL-6 and TNF-alpha (P<0.001). Chronic periodontitis patients undergoing an episode of subgingival scaling show a significant elevation in circulating TNF-alpha and IL-6. This may account for anecdotal reports of pyrexia following treatment and may be significant in terms of the relationship between periodontal disease, bacteremia, and cardiovascular disease.

  16. Interleukin-6 Regulates Adult Neural Stem Cell Numbers during Normal and Abnormal Post-natal Development.

    PubMed

    Storer, Mekayla A; Gallagher, Denis; Fatt, Michael P; Simonetta, Jaclin V; Kaplan, David R; Miller, Freda D

    2018-05-08

    Circulating systemic factors can regulate adult neural stem cell (NSC) biology, but the identity of these circulating cues is still being defined. Here, we have focused on the cytokine interleukin-6 (IL-6), since increased circulating levels of IL-6 are associated with neural pathologies such as autism and bipolar disorder. We show that IL-6 promotes proliferation of post-natal murine forebrain NSCs and that, when the IL-6 receptor is inducibly knocked out in post-natal or adult neural precursors, this causes a long-term decrease in forebrain NSCs. Moreover, a transient circulating surge of IL-6 in perinatal or adult mice causes an acute increase in neural precursor proliferation followed by long-term depletion of adult NSC pools. Thus, IL-6 signaling is both necessary and sufficient for adult NSC self-renewal, and acute perturbations in circulating IL-6, as observed in many pathological situations, have long-lasting effects on the size of adult NSC pools. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. STAT6: its role in interleukin 4-mediated biological functions.

    PubMed

    Takeda, K; Kishimoto, T; Akira, S

    1997-05-01

    Interleukin (IL) 4 is known to be a cytokine which plays a central role in the regulation of immune response. Studies on cytokine signal transduction have clarified the mechanism by which IL4 exerts its functions. Two cytoplasmic proteins, signal transducer and activator of transcription (STAT) 6 and IL4-induced phosphotyrosine substrate/insulin receptor substrate 2 (4PS/IRS2), are activated in IL4 signal transduction. Recent studies from STAT6-deficient mice have revealed the essential role of STAT6 in IL4-mediated biological actions. In addition, STAT6 has also been demonstrated to be important for the functions mediated by IL13, which is related to IL4. IL4 and IL13 have been shown to induce the production of IgE, which is a major mediator in an allergic response. These findings indicate that STAT6 activation is involved in IL4- and IL13-mediated disorders such as allergy.

  18. Charomers—Interleukin-6 Receptor Specific Aptamers for Cellular Internalization and Targeted Drug Delivery

    PubMed Central

    2017-01-01

    Interleukin-6 (IL-6) is a key player in inflammation and the main factor for the induction of acute phase protein biosynthesis. Further to its central role in many aspects of the immune system, IL-6 regulates a variety of homeostatic processes. To interfere with IL-6 dependent diseases, such as various autoimmune diseases or certain cancers like multiple myeloma or hepatocellular carcinoma associated with chronic inflammation, it might be a sensible strategy to target human IL-6 receptor (hIL-6R) presenting cells with aptamers. We therefore have selected and characterized different DNA and RNA aptamers specifically binding IL-6R. These IL-6R aptamers, however, do not interfere with the IL-6 signaling pathway but are internalized with the receptor and thus can serve as vehicles for the delivery of different cargo molecules like therapeutics. We succeeded in the construction of a chlorin e6 derivatized aptamer to be delivered for targeted photodynamic therapy (PDT). Furthermore, we were able to synthesize an aptamer intrinsically comprising the cytostatic 5-Fluoro-2′-deoxy-uridine for targeted chemotherapy. The α6β4 integrin specific DNA aptamer IDA, also selected in our laboratory is internalized, too. All these aptamers can serve as vehicles for targeted drug delivery into cells. We call them charomers—in memory of Charon, the ferryman in Greek mythology, who ferried the deceased into the underworld. PMID:29211023

  19. Tumor necrosis factor receptor-associated factor 6 (TRAF6) participates in anti-lipopolysaccharide factors (ALFs) gene expression in mud crab.

    PubMed

    Sun, Wan-Wei; Zhang, Xin-Xu; Wan, Wei-Song; Wang, Shu-Qi; Wen, Xiao-Bo; Zheng, Huai-Ping; Zhang, Yue-Ling; Li, Sheng-Kang

    2017-02-01

    Tumor necrosis factor receptor-associated factor 6 (TRAF6) is a key cytoplasm signal adaptor that mediates signals activated by tumor necrosis factor receptor (TNFR) superfamily and the Interleukin-1 receptor/Toll-like receptor (IL-1/TLR) superfamily. The full-length 2492 bp TRAF6 (Sp-TRAF6) from Scylla paramamosain contains 1800 bp of open reading frame (ORF) encoding 598 amino acids, including an N-terminal RING-type zinc finger, two TRAF-type zinc fingers and a conserved C-terminal meprin and TRAF homology (MATH) domain. Multiple alignment analysis shows that the putative amino acid sequence of Sp-TRAf6 has highest identity of 88% with Pt-TRAF6 from Portunus trituberculatus, while the similarity of Sp-TRAF6 with other crustacean sequences was 54-55%. RT-PCR analysis indicated that Sp-TRAF6 transcripts were predominantly expressed in the hepatopancreas and stomach, whereas it was barely detected in the heart and hemocytes in our study. Moreover, Sp-TRAF6 transcripts were significantly up-regulated after Vibrio parahemolyticus and LPS challenges. RNA interference assay was carried out used by siRNA to investigate the genes expression patterns regulated by Sp-TRAF6. The qRT-PCR results showed that silencing Sp-TRAF6 gene could inhibit SpALF1, SpALF2, SpALF5 and SpALF6 expression in hemocytes, while inhibit SpALF1, SpALF3, SpALF4, SpALF5 and SpALF6 expression in hepatopancreas. Taken together, the acute-phase response to immune challenges and the inhibition of SpALFs gene expression indicate that Sp-TRAF6 plays an important role in host defense against pathogen invasions via regulation of ALF gene expression in S. paramamosain. Copyright © 2016. Published by Elsevier Ltd.

  20. Structural Mimicry of Receptor Interaction by Antagonistic Interleukin-6 (IL-6) Antibodies*

    PubMed Central

    Blanchetot, Christophe; De Jonge, Natalie; Desmyter, Aline; Ongenae, Nico; Hofman, Erik; Klarenbeek, Alex; Sadi, Ava; Hultberg, Anna; Kretz-Rommel, Anke; Spinelli, Silvia; Loris, Remy; Cambillau, Christian; de Haard, Hans

    2016-01-01

    Interleukin 6 plays a key role in mediating inflammatory reactions in autoimmune diseases and cancer, where it is also involved in metastasis and tissue invasion. Neutralizing antibodies against IL-6 and its receptor have been approved for therapeutic intervention or are in advanced stages of clinical development. Here we describe the crystal structures of the complexes of IL-6 with two Fabs derived from conventional camelid antibodies that antagonize the interaction between the cytokine and its receptor. The x-ray structures of these complexes provide insights into the mechanism of neutralization by the two antibodies and explain the very high potency of one of the antibodies. It effectively competes for binding to the cytokine with IL-6 receptor (IL-6R) by using side chains of two CDR residues filling the site I cavities of IL-6, thus mimicking the interactions of Phe229 and Phe279 of IL-6R. In the first antibody, a HCDR3 tryptophan binds similarly to hot spot residue Phe279. Mutation of this HCDR3 Trp residue into any other residue except Tyr or Phe significantly weakens binding of the antibody to IL-6, as was also observed for IL-6R mutants of Phe279. In the second antibody, the side chain of HCDR3 valine ties into site I like IL-6R Phe279, whereas a LCDR1 tyrosine side chain occupies a second cavity within site I and mimics the interactions of IL-6R Phe229. PMID:27129274

  1. Structural Mimicry of Receptor Interaction by Antagonistic Interleukin-6 (IL-6) Antibodies.

    PubMed

    Blanchetot, Christophe; De Jonge, Natalie; Desmyter, Aline; Ongenae, Nico; Hofman, Erik; Klarenbeek, Alex; Sadi, Ava; Hultberg, Anna; Kretz-Rommel, Anke; Spinelli, Silvia; Loris, Remy; Cambillau, Christian; de Haard, Hans

    2016-06-24

    Interleukin 6 plays a key role in mediating inflammatory reactions in autoimmune diseases and cancer, where it is also involved in metastasis and tissue invasion. Neutralizing antibodies against IL-6 and its receptor have been approved for therapeutic intervention or are in advanced stages of clinical development. Here we describe the crystal structures of the complexes of IL-6 with two Fabs derived from conventional camelid antibodies that antagonize the interaction between the cytokine and its receptor. The x-ray structures of these complexes provide insights into the mechanism of neutralization by the two antibodies and explain the very high potency of one of the antibodies. It effectively competes for binding to the cytokine with IL-6 receptor (IL-6R) by using side chains of two CDR residues filling the site I cavities of IL-6, thus mimicking the interactions of Phe(229) and Phe(279) of IL-6R. In the first antibody, a HCDR3 tryptophan binds similarly to hot spot residue Phe(279) Mutation of this HCDR3 Trp residue into any other residue except Tyr or Phe significantly weakens binding of the antibody to IL-6, as was also observed for IL-6R mutants of Phe(279) In the second antibody, the side chain of HCDR3 valine ties into site I like IL-6R Phe(279), whereas a LCDR1 tyrosine side chain occupies a second cavity within site I and mimics the interactions of IL-6R Phe(229). © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Interleukin-6 signalling: more than Jaks and STATs.

    PubMed

    Eulenfeld, René; Dittrich, Anna; Khouri, Christina; Müller, Pia J; Mütze, Barbara; Wolf, Alexandra; Schaper, Fred

    2012-01-01

    The hallmark of signalling by many cytokines is the activation of the Janus kinase (Jak)/signal transducer and activator of transcription (STAT) pathway. However, cytokines additionally activate other pathways. In past years we realised that these pathways significantly contribute to the physiological functions of IL-6 and pathophysiological functions in the context of many inflammatory and proliferative diseases. Whereas other articles in this issue of the European Journal of Cell Biology focus on STAT activation and its regulation we here aim to summarise our knowledge and some remaining questions on interleukin-6 (IL-6)-induced STAT-independent pathways as well as the cross-talk with the Jak/STAT pathway. In the early stages of studying cytokine signalling we were used to analysing individual signalling pathways. These days we know about the importance of both, the crosstalk between pathways initiated by combinations of cytokines as well as the crosstalk between individual pathways initiated by a single cytokine. Whereas the inter-cytokine crosstalk can be studied relatively easily, more sophisticated experimental approaches are required to elucidate the intra-cytokine crosstalk. Copyright © 2011 Elsevier GmbH. All rights reserved.

  3. Additive prognostic value of interleukin-6 at peak phase of dobutamine stress echocardiography in patients with coronary artery disease. A 6-year follow-up study.

    PubMed

    Ikonomidis, Ignatios; Athanassopoulos, George; Stamatelopoulos, Kimon; Lekakis, John; Revela, Ioanna; Venetsanou, Kiriaki; Marinou, Margarita; Monaco, Claudia; Cokkinos, Dennis V; Nihoyannopoulos, Petros

    2008-08-01

    Interleukin-6 (IL-6) and tissue factor (TF) are elevated after myocardial ischemia during dobutamine stress echo (DSE). We examined the incremental prognostic value of IL-6 or TF measured during DSE over echocardiographic and clinical factors in patients with chronic coronary artery disease (CAD). We studied 106 patients with angiographically documented CAD. IL-6 and TF were measured at rest, peak, and during recovery. A wall motion score index was calculated. Fifty-seven (54%) patients had ischemia at DSE. During follow-up (63.7 +/- 20 months), 36 patients (33%) had an adverse event (12 cardiac deaths, 24 acute coronary events). Patients with events had a higher peak IL-6 (P = .02) but similar rest and recovery IL-6 than those without. Patients with peak IL-6 > or =3.14 pg/mL (upper tertile) had a hazard ratio of 2.7 (95% CI 1.44-5.37) (P < .01 for an adverse event). The addition of peak wall motion score index in a multivariable model including risk factors, ejection fraction, revascularization, and multivessel disease increased the model's c statistic from 0.66 to 0.70 (P = .04). The addition of peak IL-6 further increased the model's c statistic to 0.75 (P = .04). Tissue factor was not related with cardiac events. Interleuikin-6 levels measured during the peak phase of DSE incrementally contribute to risk stratification in patients with chronic CAD.

  4. The effect of periodontal treatment on serum leptin, interleukin-6, and C-reactive protein.

    PubMed

    Shimada, Yasuko; Komatsu, Yasutaka; Ikezawa-Suzuki, Ikuyo; Tai, Hideaki; Sugita, Noriko; Yoshie, Hiromasa

    2010-08-01

    Previous studies suggest that periodontitis is closely related to obesity and metabolic syndrome. Leptin, a pleiotrophic hormone produced by adipose tissue, has been reported to be related to periodontitis. This study investigates the effects of periodontal treatment on the serum levels of leptin and other cytokines in patients with chronic periodontitis (CP). Serum samples were taken from 33 CP patients (22 non-smokers, 11 smokers) and 18 healthy subjects. The serum leptin, adiponectin, tumor necrosis factor-alpha, interleukin (IL)-6, and C-reactive protein (CRP) levels were measured before and after non-surgical periodontal treatment. Significant differences between healthy and CP patients were found in serum leptin, IL-6, and CRP levels (P = 0.0018, P = 0.0064, and P = 0.0095, respectively). The serum leptin level was associated with mean probing depth, mean clinical attachment level, mean alveolar bone loss, and body mass index. There were significant associations between serum leptin levels and IL-6 and CRP levels. After non-surgical periodontal treatment, serum leptin, IL-6, and CRP levels were significantly decreased (mean +/- SD before and after, P value, respectively: leptin, 8.02 +/- 5.5, 7.10 +/- 4.4, P = 0.015; IL-6, 1.73 +/- 1.02, 1.36 +/- 0.73, P = 0.048; and CRP, 802.0 +/- 1065, 491.2 +/- 479.3, P = 0.047). Periodontal treatment is effective in reducing serum leptin, IL-6, and CRP levels. The results suggest that leptin, IL-6, and CRP could be mediating factors that connect metabolic syndrome and periodontitis.

  5. Modulation of enteric neurons by interleukin-6 and corticotropin-releasing factor contributes to visceral hypersensitivity and altered colonic motility in a rat model of irritable bowel syndrome

    PubMed Central

    Buckley, Maria M; O'Halloran, Ken D; Rae, Mark G; Dinan, Timothy G; O'Malley, Dervla

    2014-01-01

    Abstract The search for effective therapeutic strategies for irritable bowel syndrome (IBS) is hampered by an incomplete understanding of its underlying pathophysiology. Stress and altered plasma cytokine profiles indicative of immune activation are characteristic of the disorder. The neuromodulatory effects of interleukin-6 (IL-6) and corticotropin-releasing factor receptor (CRFR) 1 in visceral pain and stress-induced defecation in the Wistar Kyoto (WKY) rat model of IBS were investigated. Sprague Dawley and WKY rats were administered anti-IL-6 receptor antibodies (xIL-6R, 0.5 mg kg−1 i.p) with or without the CRFR1 antagonist antalarmin (10 mg kg−1 i.p). Post-intervention, the pain threshold to colorectal distension and stress-induced faecal output were compared and changes in colonic mucosal protein expression were investigated. The neuro-stimulatory effects of IBS plasma on the myenteric plexus is mediated by IL-6, IL-8 and CRF. The stimulatory effects of these soluble factors on myenteric neuron excitability and colonic contractility were additive. Moreover, inhibition of IL-6 and CRF1 receptors in vivo in the WKY IBS rat model normalized stress-induced defecation (P < 0.01) and visceral pain sensitivity (P < 0.001) with associated changes in protein expression of the tight junction proteins occludin and claudin 2, the visceral pain-associated T-type calcium channel CaV3.2 and intracellular signalling molecules STAT3, SOCS3 and ERK1/2. These studies demonstrate the additive effects of immune and stress factors on myenteric neuronal excitability. Moreover, combined targeting of peripheral IL-6 and CRF1 receptors is effective in alleviating IBS-like symptoms in the WKY rat. Thus, crosstalk between stress and immune factors during IBS flares may underlie symptom exacerbation. PMID:25260633

  6. Release of tumor necrosis factor alpha and interleukin 6 during antibiotic killing of Escherichia coli in whole blood: influence of antibiotic class, antibiotic concentration, and presence of septic serum.

    PubMed

    Prins, J M; Kuijper, E J; Mevissen, M L; Speelman, P; van Deventer, S J

    1995-06-01

    The concentration and accessibility of endotoxin can increase following antibiotic killing of gram-negative bacteria. There are indications that antibiotics may differ in this respect. We measured endotoxin levels in RPMI 1640 and tumor necrosis factor alpha (TNF-alpha) and interleukin-6 production in whole blood ex vivo after exposure of log-phase Escherichia coli to antibiotics belonging to different classes, in a final concentration of 0.5, 5, or 50 times the MIC. After 4 h of incubation at 50 times the MIC, ceftazidime and ciprofloxacin treatment resulted in levels of endotoxin, TNF-alpha, and interleukin-6 significantly higher than those of imipenem and gentamicin (P < 0.001). Similar differences in cytokine induction were measured after 8 h of incubation. At 0.5 times the MIC, the differences between the antibiotics in measured endotoxin and cytokine levels were small, with levels comparable to the levels in untreated cultures. Polymyxin B and, to a lesser degree, recombinant bactericidal/permeability-increasing protein 21 (rBPI-21) were found to be potent inhibitors of TNF-alpha release, supporting the concept that the differences between the antibiotics in cytokine production were indeed due to differences in amounts of biologically active endotoxin. The presence of serum from patients suffering from untreated sepsis decreased TNF-alpha production significantly, in a concentration-dependent manner.

  7. Interleukin-induced increase in Ia expression by normal mouse B cells.

    PubMed

    Roehm, N W; Leibson, H J; Zlotnik, A; Kappler, J; Marrack, P; Cambier, J C

    1984-09-01

    The constitutive culture supernatant (SN) of the macrophage tumor line P388D1 (P388 SN) and the concanavalin A (Con A)-induced culture supernatant of the T cell hybridoma FS6-14.13 (FS6 Con A SN) were shown to contain nonspecific factors capable of inducing increased Ia expression by normal resting B cells in a dose-dependent manner. In six consecutive experiments the relative increase in Ia expression induced by P388 SN was 4.9 +/- 0.9, with FS6 Con A SN 10.7 +/- 1.5, and with a combination of both preparations 13.0 +/- 1.7. This increase in Ia expression was observed to occur in virtually all the B cells, reaching maximum levels within 24 h of culture. The interleukin-induced increase in B cell Ia expression occurred in the absence of ancillary signals provided by ligand-receptor Ig cross-linking and despite the fact that virtually all the control B cells, cultured in the absence of factors, remained in G0. These results suggest that functional receptors for at least some interleukins are expressed on normal resting B cells and their effects can be manifest in the absence of additional activating signals. The increased Ia expression induced by the nonspecific factor preparations was shown to be correlated with enhanced antigen-presenting capacity by the B cells to T cell hybridomas. The nature of the interleukins responsible for these effects remains to be definitively determined, however, the activity of FS6 Con A SN was shown to correlate with B cell growth factor activity and increased B cell Ia expression was not observed using interleukin 2 (IL-2) or interferon-gamma, prepared by recombinant DNA technology.

  8. Synergistic inhibition of interleukin-6 production in adipose stem cells by tart cherry anthocyanins and atorvastatin

    USDA-ARS?s Scientific Manuscript database

    Studies have shown positive correlations between inflammatory cytokines such as interleukin-6 (IL-6) and the development of chronic diseases including cardiovascular disease by activating C-reactive prorein (CRP). Both atorvastatin calcium (lipitor) as well as flavonoid rich fruit such as tart cherr...

  9. Interleukin-6-driven progranulin expression increases cholangiocarcinoma growth by an Akt-dependent mechanism.

    PubMed

    Frampton, Gabriel; Invernizzi, Pietro; Bernuzzi, Francesca; Pae, Hae Yong; Quinn, Matthew; Horvat, Darijana; Galindo, Cheryl; Huang, Li; McMillin, Matthew; Cooper, Brandon; Rimassa, Lorenza; DeMorrow, Sharon

    2012-02-01

    Cholangiocarcinoma is a devastating cancer of biliary origin with limited treatment options. The growth factor, progranulin, is overexpressed in a number of tumours. The study aims were to assess the expression of progranulin in cholangiocarcinoma and to determine its effects on tumour growth. The expression and secretion of progranulin were evaluated in multiple cholangiocarcinoma cell lines and in clinical samples from patients with cholangiocarcinoma. The role of interleukin 6 (IL-6)-mediated signalling in the expression of progranulin was assessed using a combination of specific inhibitors and shRNA knockdown techniques. The effect of progranulin on proliferation and Akt activation and subsequent effects of FOXO1 phosphorylation were assessed in vitro. Progranulin knockdown cell lines were established, and the effects on cholangiocarcinoma growth were determined. Progranulin expression and secretion were upregulated in cholangiocarcinoma cell lines and tissue, which were in part via IL-6-mediated activation of the ERK1/2/RSK1/C/EBPβ pathway. Blocking any of these signalling molecules, by either pharmacological inhibitors or shRNA, prevented the IL-6-dependent activation of progranulin expression. Treatment of cholangiocarcinoma cells with recombinant progranulin increased cell proliferation in vitro by a mechanism involving Akt phosphorylation leading to phosphorylation and nuclear extrusion of FOXO1. Knockdown of progranulin expression in cholangiocarcinoma cells decreased the expression of proliferating cellular nuclear antigen, a marker of proliferative capacity, and slowed tumour growth in vivo. Evidence is presented for a role for progranulin as a novel growth factor regulating cholangiocarcinoma growth. Specific targeting of progranulin may represent an alternative for the development of therapeutic strategies.

  10. Interleukin 35 and Hepatocyte Growth Factor; as a novel combined immune gene therapy for Multiple Sclerosis disease.

    PubMed

    Moghadam, Samira; Erfanmanesh, Maryam; Esmaeilzadeh, Abdolreza

    2017-11-01

    An autoimmune demyelination disease of the Central Nervous System, Multiple Sclerosis, is a chronic inflammation which mostly involves young adults. Suffering people face functional loss with a severe pain. Most current MS treatments are focused on the immune response suppression. Approved drugs suppress the inflammatory process, but factually, there is no definite cure for Multiple Sclerosis. Recently developed knowledge has demonstrated that gene and cell therapy as a hopeful approach in tissue regeneration. The authors propose a novel combined immune gene therapy for Multiple Sclerosis treatment using anti-inflammatory and remyelination of Interleukine-35 and Hepatocyte Growth Factor properties, respectively. In this hypothesis Interleukine-35 and Hepatocyte Growth Factor introduce to Mesenchymal Stem Cells of EAE mouse model via an adenovirus based vector. It is expected that Interleukine-35 and Hepatocyte Growth Factor genes expressed from MSCs could effectively perform in immunotherapy of Multiple Sclerosis. Copyright © 2017. Published by Elsevier Ltd.

  11. High interleukin-6 and impulsivity: determining the role of endophenotypes in attempted suicide

    PubMed Central

    Isung, J; Aeinehband, S; Mobarrez, F; Nordström, P; Runeson, B; Åsberg, M; Piehl, F; Jokinen, J

    2014-01-01

    The dysregulation of inflammation has been associated with depression and, more recently, with suicidal behaviors. The reports regarding the relationship between interleukin-6 (IL-6) and suicide attempts are inconsistent. Personality traits such as impulsivity and aggression are considered endophenotypes and important factors that underlie suicidal behaviors. The aim of the current study was to assess whether plasma and cerebrospinal fluid (CSF) levels of IL-6 are associated with personality traits among suicide attempters. We assessed the relationships among personality traits, IL-6 and violent suicide attempts. The plasma and CSF levels of IL-6 were measured in suicide attempters (plasma=58, CSF=39) using antibody-based immunoassay systems. Personality domains were assessed using the Karolinska Scale of Personality (KSP). IL-6 levels in plasma and CSF were used to predict personality domains via regression models. Plasma IL-6 was significantly and positively correlated with extraversion as well as the KSP subscales impulsivity and monotony avoidance. CSF IL-6 was positively correlated with monotony avoidance. Violent suicide attempts tended to be associated with high plasma IL-6 levels. Plasma and CSF levels of IL-6 were not significantly associated with each other. These results indicate that impulsivity and the choice of a violent suicide attempt method might be related to higher levels of IL-6 in individuals who attempt suicide. The neuroinflammation hypothesis of suicidal behavior on the basis of elevated IL-6 levels might be partly explained by the positive association between IL-6 and impulsivity, which is a key element of the suicidal phenotype. PMID:25335166

  12. High interleukin-6 and impulsivity: determining the role of endophenotypes in attempted suicide.

    PubMed

    Isung, J; Aeinehband, S; Mobarrez, F; Nordström, P; Runeson, B; Asberg, M; Piehl, F; Jokinen, J

    2014-10-21

    The dysregulation of inflammation has been associated with depression and, more recently, with suicidal behaviors. The reports regarding the relationship between interleukin-6 (IL-6) and suicide attempts are inconsistent. Personality traits such as impulsivity and aggression are considered endophenotypes and important factors that underlie suicidal behaviors. The aim of the current study was to assess whether plasma and cerebrospinal fluid (CSF) levels of IL-6 are associated with personality traits among suicide attempters. We assessed the relationships among personality traits, IL-6 and violent suicide attempts. The plasma and CSF levels of IL-6 were measured in suicide attempters (plasma=58, CSF=39) using antibody-based immunoassay systems. Personality domains were assessed using the Karolinska Scale of Personality (KSP). IL-6 levels in plasma and CSF were used to predict personality domains via regression models. Plasma IL-6 was significantly and positively correlated with extraversion as well as the KSP subscales impulsivity and monotony avoidance. CSF IL-6 was positively correlated with monotony avoidance. Violent suicide attempts tended to be associated with high plasma IL-6 levels. Plasma and CSF levels of IL-6 were not significantly associated with each other. These results indicate that impulsivity and the choice of a violent suicide attempt method might be related to higher levels of IL-6 in individuals who attempt suicide. The neuroinflammation hypothesis of suicidal behavior on the basis of elevated IL-6 levels might be partly explained by the positive association between IL-6 and impulsivity, which is a key element of the suicidal phenotype.

  13. Enhancement of in vivo antitumor activity of a novel antimitotic 1-phenylpropenone derivative, AM-132, by tumor necrosis factor-alpha or interleukin-6.

    PubMed

    Tatsumi, Y; Arioka, H; Ikeda, S; Fukumoto, H; Miyamoto, K; Fukuoka, K; Ohe, Y; Saijo, N; Nishio, K

    2001-07-01

    TK5048 and its derivatives, AM-132, AM-138, and AM-97, are recently developed antimitotic (AM) compounds. These 1-phenylpropenone derivatives induce cell cycle arrest at the G2 / M phase of the cell cycle. TK5048 inhibited tubulin polymerization in human lung cancer PC-14 cells in a concentration-dependent manner. In a polymerization assay using bovine brain tubulin, AM-132 and AM-138 were quite strong, AM-97 was moderately strong, and TK5048 was a relatively weak inhibitor of tubulin polymerization. A murine leukemia cell line resistant to a sulfonamide antimitotic agent, E7010, which binds to colchicine-binding sites on tubulin, was cross-resistant to the in vitro growth-inhibitory effect of AM compounds. Inhibition of tubulin polymerization is therefore one of the mechanisms of action of these AM compounds against tumor cells. To profile the antitumor effect of AM compounds, the in vivo antitumor effect of AM-132 was evaluated against cytokine-secreting Lewis lung carcinoma (LLC). Tumor-bearing mice were treated with intravenous AM-132 using three different treatment schedules. LLC tumors expressing tumor necrosis factor-alpha (TNF-alpha), granulocyte macrophage colony-stimulating factor (GM-CSF), or interleukin (IL)-6 were very sensitive to AM-132. In particular, LLC tumors expressing IL-6 were markedly reduced by AM-132 treatment, and showed coloring of the tumor surface and unusual hemorrhagic necrosis. These results suggest a combined effect of AM-132 and cytokines on the blood supply to tumors.

  14. Complement activation and interleukin response in major abdominal surgery.

    PubMed

    Kvarnström, A L; Sarbinowski, R T; Bengtson, J-P; Jacobsson, L M; Bengtsson, A L

    2012-05-01

    The objective of this study was to evaluate whether major abdominal surgery leads to complement activation and interleukin response and whether the kind of anaesthesia influence complement activation and the release of inflammatory interleukins. The study design was prospective and randomised. Fifty patients undergoing open major colorectal surgery due to cancer disease or inflammatory bowel disease were studied. Twenty-five patients were given total intravenous anaesthesia (TIVA) with propofol and remifentanil, and 25 patients were given inhalational anaesthesia with sevoflurane and fentanyl. To determine complement activation (C3a and SC5b-9) and the release of pro- and anti-inflammatory interleukins (tumour necrosis factor-a (TNF-a)), interleukin-1b (IL-1b), IL-6, IL-8, IL-4 and IL-10), blood samples were drawn preoperatively, 60 minutes after start of surgery, 30 minutes after end of surgery and 24 hours postoperatively. Complement was activated and pro-inflammatory interleukins (IL-6 and IL-8) and anti-inflammatory interleukins (IL-10) were released during major colorectal surgery. There was no significant difference between TIVA and inhalational anaesthesia regarding complement activation and cytokine release. Major colorectal surgery leads to activation of the complement cascade and the release of both pro-inflammatory and anti-inflammatory cytokines. There are no significant differences between total intravenous anaesthesia (TIVA) with propofol and remifentanil and inhalational anaesthesia with sevoflurane and fentanyl regarding complement activation and the release of pro- and anti-inflammatory interleukins. © 2012 The Authors. Scandinavian Journal of Immunology © 2012 Blackwell Publishing Ltd. Scandinavian Journal of Immunology.

  15. Human interleukin for DA cells or leukemia inhibitory factor is released by Vero cells in human embryo coculture.

    PubMed

    Papaxanthos-Roche, A; Taupin, J L; Mayer, G; Daniel, J Y; Moreau, J F

    1994-09-01

    In the light of the newly discovered implications of human interleukin for DA cells and leukemia inhibitory factor in embryology, we searched for the presence of this soluble cytokine in the supernatant of Vero cell coculture systems. Using a bioassay as well as a specific ELISA, we demonstrated that Vero cells are able to release large quantities of human interleukin for DA cells and leukemia inhibitory factor in the embryo-growing medium of such cocultures.

  16. Physiological and molecular effects of interleukin-18 administration on the mouse kidney.

    PubMed

    Yamanishi, Kyosuke; Mukai, Keiichiro; Hashimoto, Takuya; Ikubo, Kaoru; Nakasho, Keiji; El-Darawish, Yosif; Li, Wen; Okuzaki, Daisuke; Watanabe, Yuko; Hayakawa, Tetsu; Nojima, Hiroshi; Yamanishi, Hiromichi; Okamura, Haruki; Matsunaga, Hisato

    2018-03-07

    The cytokine interleukin-18 was originally identified as an interferon-γ-inducing proinflammatory factor; however, there is increasing evidence to suggest that it has non-immunological effects on physiological functions. We previously investigated the potential pathophysiological relationship between interleukin-18 and dyslipidemia, non-alcoholic fatty liver disease, and non-alcoholic steatohepatitis, and suggested interleukin-18 as a possible novel treatment for not only these diseases but also for cancer immunotherapy. Before clinical application, the effects of interleukin-18 on the kidney need to be determined. In the current study, we examined the kidney of interleukin-18 knockout (Il18 -/- ) mice and the effects of interleukin-18 on the kidney following intravenous administration of recombinant interleukin-18. Il18 -/- male mice were generated on the C57Bl/6 background and littermate C57Bl/6 Il18 +/+ male mice were used as controls. To assess kidney damage, serum creatinine and blood urea nitrogen levels were measured and histopathological analysis was performed. For molecular analysis, microarray and quantitative reverse transcription PCR was performed using mice 6 and 12 weeks old. To evaluate the short- and long-term effects of interleukin-18 on the kidney, recombinant interleukin-18 was administered for 2 and 12 weeks, respectively. Compared with Il18 +/+ mice, Il18 -/- mice developed kidney failure in their youth-6 weeks of age, but the condition was observed to improve as the mice aged, even though dyslipidemia, arteriosclerosis, and higher insulin resistance occurred. Analyses of potential molecular mechanisms involved in the onset of early kidney failure in Il18 -/- mice identified a number of associated genes, such as Itgam, Nov, and Ppard. Intravenous administration of recombinant interleukin-18 over both the short and long term showed no effects on the kidney despite significant improvement in metabolic diseases. Short- and long

  17. Serotonin Transporter Gene, Depressive Symptoms and Interleukin-6

    PubMed Central

    Su, Shaoyong; Zhao, Jinying; Bremner, J. Douglas; Miller, Andrew H.; Tang, Weining; Bouzyk, Mark; Snieder, Harold; Novik, Olga; Afzal, Nadeem; Goldberg, Jack; Vaccarino, Viola

    2009-01-01

    Background We explored the relationship of genetic variants of the serotonin transporter gene SLC6A4, a key regulator of the serotonergic neurotransmission, with both depressive symptoms and plasma Interleukin-6 (IL-6) levels. Methods and Results We genotyped 20 polymorphisms in 360 male twins (mean age: 54) from the Vietnam Era Twin Registry. Current depressive symptoms were measured with the Beck Depression Inventory-II (BDI-II). IL-6 was assessed using a commercially available ELISA kit. Genotype associations were analyzed using generalized estimating equations. To study how SLC6A4 genetic vulnerability influences the relationship between depressive symptoms and IL-6, bivariate models were constructed using structural equation modeling. Of the 20 polymorphisms examined, the effective number of independent tests was 6 and the threshold of significance after Bonferroni correction was 0.008. There were 6 SNPs significantly associated with BDI (P≤0.008), including rs8071667, rs2020936, rs25528, rs6354, rs11080122 and rs8076005, and 1 SNP borderline associated (rs12150214, P=0.017). Of these 7 SNPs, 3 were also significantly associated with IL-6 (P<0.008), including rs25528, rs6354 and rs8076005, and the other 4 were borderline associated (P=0.009~0.025). The subjects with one copy of the minor allele of these 7 SNPs had higher BDI scores and IL-6 levels. Further bivariate modeling revealed that approximately 10% of the correlation between BDI and IL-6 could be explained by the SLC6A4 gene. Conclusions Genetic vulnerability involving the SLC6A4 gene is significantly associated with both increased depressive symptoms and elevated IL-6 plasma levels. Common pathophysiological processes may link depression and inflammation, and implicate the serotonin pathway in neural-immune interactions. PMID:20031642

  18. The role of the inhibitors of interleukin-6 signal transduction SHP2 and SOCS3 for desensitization of interleukin-6 signalling.

    PubMed Central

    Fischer, Patrick; Lehmann, Ute; Sobota, Radoslaw M; Schmitz, Jochen; Niemand, Claudia; Linnemann, Sonja; Haan, Serge; Behrmann, Iris; Yoshimura, Akihiko; Johnston, James A; Müller-Newen, Gerhard; Heinrich, Peter C; Schaper, Fred

    2004-01-01

    The immediate early response of cells treated with IL-6 (interleukin-6) is the activation of the signal transducer and activator of transcription (STAT)3. The Src homology domain 2 (SH2)-containing protein tyrosine phosphatase SHP2 and the feedback inhibitor SOCS3 (suppressor of cytokine signalling) are potent inhibitors of IL-6 signal transduction. Impaired function of SOCS3 or SHP2 leads to enhanced and prolonged IL-6 signalling. The inhibitory function of both proteins depends on their recruitment to the tyrosine motif 759 within glycoprotein gp130. In contrast to inactivation, desensitization of signal transduction is regarded as impaired responsiveness due to prestimulation. Usually, after activation the sensing receptor becomes inactivated by modifications such as phosphorylation, internalization or degradation. We designed an experimental approach which allows discrimination between desensitization and inactivation of IL-6 signal transduction. We observed that pre-stimulation with IL-6 renders cells less sensitive to further stimulation with IL-6. After several hours, the cells become sensitive again. We show that not only signal transduction through previously activated receptors is affected by desensitization but signalling through receptors which were not targeted by the first stimulation was also attenuated ( trans -desensitization). Interestingly, in contrast to inhibition, desensitization does not depend on the presence of functional SHP2. Furthermore, cells lacking SOCS3 show constitutive STAT3 activation which is not affected by pre-stimulation with IL-6. All these observations suggest that desensitization and inhibition of signalling are mechanistically distinct. PMID:14611646

  19. Identification of Granulocyte Colony-Stimulating Factor and Interleukin-6 as Candidate Biomarkers of CBLB502 Efficacy as a Medical Radiation Countermeasure

    PubMed Central

    Krivokrysenko, Vadim I.; Shakhov, Alexander N.; Singh, Vijay K.; Bone, Frederick; Kononov, Yevgeniy; Shyshynova, Inna; Cheney, Alec; Maitra, Ratan K.; Purmal, Andrei; Whitnall, Mark H.; Feinstein, Elena

    2012-01-01

    Given an ever-increasing risk of nuclear and radiological emergencies, there is a critical need for development of medical radiation countermeasures (MRCs) that are safe, easily administered, and effective in preventing and/or mitigating the potentially lethal tissue damage caused by acute high-dose radiation exposure. Because the efficacy of MRCs for this indication cannot be ethically tested in humans, development of such drugs is guided by the Food and Drug Administration's Animal Efficacy Rule. According to this rule, human efficacious doses can be projected from experimentally established animal efficacious doses based on the equivalence of the drug's effects on efficacy biomarkers in the respective species. Therefore, identification of efficacy biomarkers is critically important for drug development under the Animal Efficacy Rule. CBLB502 is a truncated derivative of the Salmonella flagellin protein that acts by triggering Toll-like receptor 5 (TLR5) signaling and is currently under development as a MRC. Here, we report identification of two cytokines, granulocyte colony-stimulating factor (G-CSF) and interleukin-6 (IL-6), as candidate biomarkers of CBLB502's radioprotective/mitigative efficacy. Induction of both G-CSF and IL-6 by CBLB502 1) is strictly TLR5-dependent, 2) occurs in a CBLB502 dose-dependent manner within its efficacious dose range in both nonirradiated and irradiated mammals, including nonhuman primates, and 3) is critically important for the ability of CBLB502 to rescue irradiated animals from death. After evaluation of CBLB502 effects on G-CSF and IL-6 levels in humans, these biomarkers will be useful for accurate prediction of human efficacious CBLB502 doses, a key step in the development of this prospective radiation countermeasure. PMID:22837010

  20. Interleukin-6 as an endogenous pyrogen: induction of prostaglandin E2 in brain but not in peripheral blood mononuclear cells.

    PubMed

    Dinarello, C A; Cannon, J G; Mancilla, J; Bishai, I; Lees, J; Coceani, F

    1991-10-25

    Fever induced by endogenous as well as exogenous pyrogens is often prevented by cyclooxygenase inhibitors; endogenous pyrogens stimulate prostaglandin E2 (PGE2) in or near the thermoregulatory centers of the brain. The cytokines, interleukin-1 (IL-1) and tumor necrosis factor (TNF), are two pyrogens which stimulate brain PGE2 formation during fever and also increase PGE2 synthesis in human mononuclear cells in vitro. In the present study, we examined whether interleukin-6 (IL-6) stimulates PGE2 formation in a manner similar to IL-1 and TNF. Both glycosylated and non-glycosylated forms of recombinant human IL-6 were tested. Following intravenous injection into rabbits, the glycosylated IL-6 was more pyrogenic than the non-glycosylated form and there was no evidence of synergy in the production of fever when IL-6 and IL-1 were given simultaneously. IL-6 fever was blocked by prior administration of the cyclooxygenase inhibitor ibuprofen. IL-6 was also pyrogenic in the cat by either the systemic or the intraventricular route. However, in both species, IL-6 was less effective than IL-1 beta. When given intraventricularly to cats, IL-6 produced an increase in PGE2 levels of the cerebrospinal fluid in parallel with the rise in body temperature. In the latter respect, IL-6 imitated IL-1 beta; however, IL-6 from 0.15-15 micrograms/ml did not increase mononuclear cell PGE2 production in vitro whereas IL-1 beta induced 20-30-fold increases in PGE2 at 100 ng/ml.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Midazolam suppresses interleukin-1β-induced interleukin-6 release from rat glial cells

    PubMed Central

    2011-01-01

    Background Peripheral-type benzodiazepine receptor (PBR) expression levels are low in normal human brain, but their levels increase in inflammation, brain injury, neurodegenerative states and gliomas. It has been reported that PBR functions as an immunomodulator. The mechanisms of action of midazolam, a benzodiazepine, in the immune system in the CNS remain to be fully elucidated. We previously reported that interleukin (IL)-1β stimulates IL-6 synthesis from rat C6 glioma cells and that IL-1β induces phosphorylation of inhibitory kappa B (IκB), p38 mitogen-activated protein (MAP) kinase, stress-activated protein kinase (SAPK)/c-Jun N-terminal kinase (JNK), extracellular signal-regulated kinase 1/2, and signal transducer and activator of transcription (STAT)3. It has been shown that p38 MAP kinase is involved in IL-1β-induced IL-6 release from these cells. In the present study, we investigated the effect of midazolam on IL-1β-induced IL-6 release from C6 cells, and the mechanisms of this effect. Methods Cultured C6 cells were stimulated by IL-1β. IL-6 release from C6 cells was measured using an enzyme-linked immunosorbent assay, and phosphorylation of IκB, the MAP kinase superfamily, and STAT3 was analyzed by Western blotting. Results Midazolam, but not propofol, inhibited IL-1β-stimulated IL-6 release from C6 cells. The IL-1β-stimulated levels of IL-6 were suppressed by wedelolactone (an inhibitor of IκB kinase), SP600125 (an inhibitor of SAPK/JNK), and JAK inhibitor I (an inhibitor of JAK 1, 2 and 3). However, IL-6 levels were not affected by PD98059 (an inhibitor of MEK1/2). Midazolam markedly suppressed IL-1β-stimulated STAT3 phosphorylation without affecting the phosphorylation of p38 MAP kinase, SAPK/JNK or IκB. Conclusion These results strongly suggest that midazolam inhibits IL-1β-induced IL-6 release in rat C6 glioma cells via suppression of STAT3 activation. Midazolam may affect immune system function in the CNS. PMID:21682888

  2. Evaluation of selected interleukins in patients with different gastric neoplasms: a preliminary report.

    PubMed

    Madej-Michniewicz, Anna; Budkowska, Marta; Sałata, Daria; Dołęgowska, Barbara; Starzyńska, Teresa; Błogowski, Wojciech

    2015-10-21

    Abnormal interactions between cytokines may be an overlooked mechanism linking the development of different types of gastric neoplasms. In this study a comprehensive analysis of the systemic levels of interleukins (IL-1,IL-6, IL-8,IL-10 and IL-12) was performed in 75 patients with different gastric neoplasms (cancer, gastrointestinal stromal tumors, neuroendocrine neoplasms, lymphomas) and 40 healthy volunteers. Patients with gastric cancer (GC) have significantly higher IL-6 levels, and lower IL-8 and IL-10 concentrations, in comparison to controls and patients with other gastric neoplasms. Analogous results were observed in terms of IL-6/IL-8 and IL-6/IL-10 ratios, whose values were also higher in GC patients. In GC patients no associations were detected between the systemic levels/values of interleukins (ratios) and TNM staging. IL-6, IL-10, IL-6/IL-8 and IL-6/IL-10 ratios appeared to hold diagnostic potential in confirming/excluding the presence of GC. Their sensitivity/specificity in GC detection/exclusion was approximately 54-72%. In conclusion, disturbed systemic biochemical balance in multiple interleukins exists at the earliest stages of and appears to be specific to GC. The interleukin ratios proposed here seem to be more promising indicators of GC in humans than direct systemic levels of interleukins, and probably possess the potential to be applied as a supporting factor for techniques routinely used.

  3. Interleukin-1β and interleukin-6 enhance thermal prolongation of the LCR in decerebrate piglets.

    PubMed

    Xia, Luxi; Bartlett, Donald; Leiter, J C

    2016-08-01

    Thermal stress and prior upper respiratory tract infection are risk factors for the Sudden Infant Death Syndrome. The adverse effects of prior infection are likely mediated by interleukin-1β (IL-1β). Therefore, we examined the single and combined effects of IL-1β and elevated body temperature on the duration of the Laryngeal Chemoreflex (LCR) in decerebrate neonatal piglets ranging in age from post-natal day (P) 3 to P7. We examined the effects of intraperitoneal (I.P.) injections of 0.3mg/Kg IL-1β with or without I.P. 10mg/Kg indomethacin pretreatment on the duration of the LCR, and in the same animals we also examined the duration of the LCR when body temperature was elevated approximately 2°C. We found that IL-1β significantly increased the duration of the LCR even when body temperature was held constant. There was a significant multiplicative effect when elevated body temperature was combined with IL-1β treatment: prolongation of the LCR was significantly greater than the sum of independent thermal and IL-1β-induced prolongations of the LCR. The effects of IL-1β, but not elevated body temperature, were blocked by pretreatment with indomethacin alone. We also tested the interaction between IL-6 given directly into the nucleus of the solitary tract (NTS) bilaterally in 100ngm microinjections of 50μL and pretreatment with indomethacin. Here again, there was a multiplicative effect of IL-6 treatment and elevated body temperature, which significantly prolonged the LCR. The effect of IL-6 on the LCR, but not elevated body temperature, was blocked by pretreatment with indomethacin. We conclude that cytokines interact with elevated body temperature, probably through direct thermal effects on TRPV1 receptors expressed pre-synaptically in the NTS and through cytokine-dependent sensitization of the TRPV1 receptor. This sensitization is likely initiated by cyclo-oxygenase-2 dependent synthesis of prostaglandin E2, which is stimulated by elevated levels of IL-1

  4. Interleukin-1β and interleukin-6 enhance thermal prolongation of the LCR in decerebrate piglets

    PubMed Central

    Xia, Luxi; Bartlett, Donald; Leiter, J.C.

    2017-01-01

    Thermal stress and prior upper respiratory tract infection are risk factors for the Sudden Infant Death Syndrome. The adverse effects of prior infection are likely mediated by interleukin-1β (IL-1β). Therefore, we examined the single and combined effects of IL-1β and elevated body temperature on the duration of the Laryngeal Chemoreflex (LCR) in decerebrate neonatal piglets ranging in age from post-natal day (P) 3 to P7. We examined the effects of intraperitoneal (I.P.) injections of 0.3 mg/Kg IL-1β with or without I.P. 10 mg/Kg indomethacin pretreatment on the duration of the LCR, and in the same animals we also examined the duration of the LCR when body temperature was elevated approximately 2 °C. We found that IL-1β significantly increased the duration of the LCR even when body temperature was held constant. There was a significant multiplicative effect when elevated body temperature was combined with IL-1β treatment: prolongation of the LCR was significantly greater than the sum of independent thermal and IL-1β-induced prolongations of the LCR. The effects of IL-1β, but not elevated body temperature, were blocked by pretreatment with indomethacin alone. We also tested the interaction between IL-6 given directly into the nucleus of the solitary tract (NTS) bilaterally in 100 ngm microinjections of 50 μL and pre-treatment with indomethacin. Here again, there was a multiplicative effect of IL-6 treatment and elevated body temperature, which significantly prolonged the LCR. The effect of IL-6 on the LCR, but not elevated body temperature, was blocked by pretreatment with indomethacin. We conclude that cytokines interact with elevated body temperature, probably through direct thermal effects on TRPV1 receptors expressed pre-synaptically in the NTS and through cytokine-dependent sensitization of the TRPV1 receptor. This sensitization is likely initiated by cyclo-oxygenase-2 dependent synthesis of prostaglandin E2, which is stimulated by elevated levels of

  5. Comparison of Oral Lichen Planus and Systemic Lupus Erythematosus in Interleukins Level.

    PubMed

    Agha-Hosseini, Farzaneh; Moosavi, Mahdieh-Sadat; Hajifaraj Tabrizi, Mina

    2015-10-01

    Lichen planus (LP) is a chronic inflammatory mucocutaneous disorder with unknown etiology. Systemic lupus erythematosus (SLE) is known as a prototypic autoimmune disease. Cytokines play a key role in the pathogenesis of both diseases. Various cytokines, such as interleukin 6 (IL-6), interleukin 10 (IL-10), interferon alpha (INF-a), and Tumor Necrosis Factor-alpha (TNF-a) can serve as biomarkers to predict SLE severity and monitor disease activity. In this review, we compare interleukins in oral lichen planus and lupus erythematosus as an autoimmune disease prototype. So, this review may provide insight for researchers in completing the cytokine network in OLP. Among the etiologic factors, the imbalance between Th-1 and Th-2 cytokine production plays an important role in the development of both diseases. By understanding cytokines and immunoregulatory networks of cytokines in these patients, appropriate treatment can be offered. There are many limitations in cytokine studies, which we have described in this article.

  6. Serum Interleukin-6, insulin, and HOMA-IR in male individuals with colorectal adenoma.

    PubMed

    Sasaki, Yu; Takeda, Hiroaki; Sato, Takeshi; Orii, Tomohiko; Nishise, Shoichi; Nagino, Ko; Iwano, Daisuke; Yaoita, Takao; Yoshizawa, Kazuya; Saito, Hideki; Tanaka, Yasuhisa; Kawata, Sumio

    2012-01-15

    It is widely acknowledged that chronic low-grade inflammation plays a key role in the development of obesity-related insulin resistance and type 2 diabetes. The level of circulating interleukin-6 (IL-6), one of the major proinflammatory adipokines, is correlated with obesity and insulin resistance, which are known to be risk factors for colorectal adenoma. We examined the association between the circulating level of IL-6 and the presence of colorectal adenoma. In a total colonoscopy-based cross-sectional study conducted between January and December 2008, serum levels of IL-6 were measured in samples of venous blood obtained from 336 male participants attending health checkups (118 individuals with colorectal adenoma and 218 age-matched controls) after an overnight fast. In the colorectal adenoma group, the median levels of serum IL-6 (1.24 vs. 1.04 pg/mL; P = 0.01), triglyceride, insulin, and homeostasis model assessment of insulin resistance (HOMA-IR) were to be significantly higher than those in the control group. When restricted to individuals with adenoma, levels of IL-6 were positively correlated with body mass index, insulin, and HOMA-IR. Multiple logistic analyses adjusted to include insulin or HOMA-IR showed that high levels of IL-6 were associated with the presence of colorectal adenoma. There was no significant interaction of IL-6 with HOMA-IR to modify this association. Our findings suggest that increased serum levels of IL-6 are positively associated with the presence of colorectal adenoma in men, independently of insulin and HOMA-IR. ©2011 AACR.

  7. Discovery and characterization of olokizumab: a humanized antibody targeting interleukin-6 and neutralizing gp130-signaling.

    PubMed

    Shaw, Stevan; Bourne, Tim; Meier, Chris; Carrington, Bruce; Gelinas, Rich; Henry, Alistair; Popplewell, Andrew; Adams, Ralph; Baker, Terry; Rapecki, Steve; Marshall, Diane; Moore, Adrian; Neale, Helen; Lawson, Alastair

    2014-01-01

    Interleukin-6 (IL-6) is a critical regulator of the immune system and has been widely implicated in autoimmune disease. Here, we describe the discovery and characterization of olokizumab, a humanized antibody to IL-6. Data from structural biology, cell biology and primate pharmacology demonstrate the therapeutic potential of targeting IL-6 at "Site 3", blocking the interaction with the signaling co-receptor gp130.

  8. Interleukin-6 counteracts therapy-induced cellular oxidative stress in multiple myeloma by up-regulating manganese superoxide dismutase.

    PubMed

    Brown, Charles O; Salem, Kelley; Wagner, Brett A; Bera, Soumen; Singh, Neeraj; Tiwari, Ajit; Choudhury, Amit; Buettner, Garry R; Goel, Apollina

    2012-06-15

    IL (interleukin)-6, an established growth factor for multiple myeloma cells, induces myeloma therapy resistance, but the resistance mechanisms remain unclear. The present study determines the role of IL-6 in re-establishing intracellular redox homoeostasis in the context of myeloma therapy. IL-6 treatment increased myeloma cell resistance to agents that induce oxidative stress, including IR (ionizing radiation) and Dex (dexamethasone). Relative to IR alone, myeloma cells treated with IL-6 plus IR demonstrated reduced annexin/propidium iodide staining, caspase 3 activation, PARP [poly(ADP-ribose) polymerase] cleavage and mitochondrial membrane depolarization with increased clonogenic survival. IL-6 combined with IR or Dex increased early intracellular pro-oxidant levels that were causally related to activation of NF-κB (nuclear factor κB) as determined by the ability of N-acetylcysteine to suppress both pro-oxidant levels and NF-κB activation. In myeloma cells, upon combination with hydrogen peroxide treatment, relative to TNF (tumour necrosis factor)-α, IL-6 induced an early perturbation in reduced glutathione level and increased NF-κB-dependent MnSOD (manganese superoxide dismutase) expression. Furthermore, knockdown of MnSOD suppressed the IL-6-induced myeloma cell resistance to radiation. MitoSOX Red staining showed that IL-6 treatment attenuated late mitochondrial oxidant production in irradiated myeloma cells. The present study provides evidence that increases in MnSOD expression mediate IL-6-induced resistance to Dex and radiation in myeloma cells. The results of the present study indicate that inhibition of antioxidant pathways could enhance myeloma cell responses to radiotherapy and/or chemotherapy.

  9. Interleukin-6 counteracts therapy-induced cellular oxidative stress in multiple myeloma by up-regulating manganese superoxide dismutase

    PubMed Central

    Brown, Charles O.; Salem, Kelley; Wagner, Brett A.; Bera, Soumen; Singh, Neeraj; Tiwari, Ajit; Choudhury, Amit; Buettner, Garry R.; Goel, Apollina

    2012-01-01

    IL (interleukin)-6, an established growth factor for multiple myeloma cells, induces myeloma therapy resistance, but the resistance mechanisms remain unclear. The present study determines the role of IL-6 in re-establishing intracellular redox homoeostasis in the context of myeloma therapy. IL-6 treatment increased myeloma cell resistance to agents that induce oxidative stress, including IR (ionizing radiation) and Dex (dexamethasone). Relative to IR alone, myeloma cells treated with IL-6 plus IR demonstrated reduced annexin/propidium iodide staining, caspase 3 activation, PARP [poly(ADP-ribose) polymerase] cleavage and mitochondrial membrane depolarization with increased clonogenic survival. IL-6 combined with IR or Dex increased early intracellular pro-oxidant levels that were causally related to activation of NF-κB (nuclear factor κB) as determined by the ability of N-acetylcysteine to suppress both pro-oxidant levels and NF-κB activation. In myeloma cells, upon combination with hydrogen peroxide treatment, relative to TNF (tumour necrosis factor)-α, IL-6 induced an early perturbation in reduced glutathione level and increased NF-κB-dependent MnSOD (manganese superoxide dismutase) expression. Furthermore, knockdown of MnSOD suppressed the IL-6-induced myeloma cell resistance to radiation. MitoSOX Red staining showed that IL-6 treatment attenuated late mitochondrial oxidant production in irradiated myeloma cells. The present study provides evidence that increases in MnSOD expression mediate IL-6-induced resistance to Dex and radiation in myeloma cells. The results of the present study indicate that inhibition of antioxidant pathways could enhance myeloma cell responses to radiotherapy and/or chemotherapy. PMID:22471522

  10. Interleukin-6-driven progranulin expression increases cholangiocarcinoma growth by an Akt-dependent mechanism

    PubMed Central

    Frampton, Gabriel; Invernizzi, Pietro; Bernuzzi, Francesca; Pae, Hae Yong; Quinn, Matthew; Horvat, Darijana; Galindo, Cheryl; Huang, Li; McMillin, Matthew; Cooper, Brandon; Rimassa, Lorenza; DeMorrow, Sharon

    2015-01-01

    Background and objectives Cholangiocarcinoma is a devastating cancer of biliary origin with limited treatment options. The growth factor, progranulin, is overexpressed in a number of tumours. The study aims were to assess the expression of progranulin in cholangiocarcinoma and to determine its effects on tumour growth. Methods The expression and secretion of progranulin were evaluated in multiple cholangiocarcinoma cell lines and in clinical samples from patients with cholangiocarcinoma. The role of interleukin 6 (IL-6)-mediated signalling in the expression of progranulin was assessed using a combination of specific inhibitors and shRNA knockdown techniques. The effect of progranulin on proliferation and Akt activation and subsequent effects of FOXO1 phosphorylation were assessed in vitro. Progranulin knockdown cell lines were established, and the effects on cholangiocarcinoma growth were determined. Results Progranulin expression and secretion were upregulated in cholangiocarcinoma cell lines and tissue, which were in part via IL-6-mediated activation of the ERK1/2/RSK1/C/EBPβ pathway. Blocking any of these signalling molecules, by either pharmacological inhibitors or shRNA, prevented the IL-6-dependent activation of progranulin expression. Treatment of cholangiocarcinoma cells with recombinant progranulin increased cell proliferation in vitro by a mechanism involving Akt phosphorylation leading to phosphorylation and nuclear extrusion of FOXO1. Knockdown of progranulin expression in cholangiocarcinoma cells decreased the expression of proliferating cellular nuclear antigen, a marker of proliferative capacity, and slowed tumour growth in vivo. Conclusions Evidence is presented for a role for progranulin as a novel growth factor regulating cholangiocarcinoma growth. Specific targeting of progranulin may represent an alternative for the development of therapeutic strategies. PMID:22068162

  11. The contribution of interleukin-2 to effective wound healing.

    PubMed

    Doersch, Karen M; DelloStritto, Daniel J; Newell-Rogers, M Karen

    2017-02-01

    Ineffective skin wound healing is a significant source of morbidity and mortality. Roughly 6.5 million Americans experience chronically open wounds and the cost of treating these wounds numbers in the billions of dollars annually. In contrast, robust wound healing can lead to the development of either hypertrophic scarring or keloidosis, both of which can cause discomfort and can be cosmetically undesirable. Appropriate wound healing requires the interplay of a variety of factors, including the skin, the local microenvironment, the immune system, and the external environment. When these interactions are perturbed, wounds can be a nidus for infection, which can cause them to remain open an extended period of time, or can scar excessively. Interleukin-2, a cytokine that directs T-cell expansion and phenotypic development, appears to play an important role in wound healing. The best-studied role for Interleukin-2 is in influencing T-cell development. However, other cell types, including fibroblasts, the skin cells responsible for closing wounds, express the Interleukin-2 receptor, and therefore may respond to Interleukin-2. Studies have shown that treatment with Interleukin-2 can improve the strength of healed skin, which implicates Interleukin-2 in the wound healing process. Furthermore, diseases that involve impaired wound healing, such as diabetes and systemic lupus erythematosus, have been linked to deficiencies in Interleukin-2 or defects Interleukin-2-receptor signaling. The focus of this review is to summarize the current understanding of the role of Interleukin-2 in wound healing, to highlight diseases in which Interleukin-2 and its receptor may contribute to impaired wound healing, and to assess Interleukin-2-modulating approaches as potential therapies to improve wound healing.

  12. The contribution of interleukin-2 to effective wound healing

    PubMed Central

    DelloStritto, Daniel J; Newell-Rogers, M Karen

    2016-01-01

    Ineffective skin wound healing is a significant source of morbidity and mortality. Roughly 6.5 million Americans experience chronically open wounds and the cost of treating these wounds numbers in the billions of dollars annually. In contrast, robust wound healing can lead to the development of either hypertrophic scarring or keloidosis, both of which can cause discomfort and can be cosmetically undesirable. Appropriate wound healing requires the interplay of a variety of factors, including the skin, the local microenvironment, the immune system, and the external environment. When these interactions are perturbed, wounds can be a nidus for infection, which can cause them to remain open an extended period of time, or can scar excessively. Interleukin-2, a cytokine that directs T-cell expansion and phenotypic development, appears to play an important role in wound healing. The best-studied role for Interleukin-2 is in influencing T-cell development. However, other cell types, including fibroblasts, the skin cells responsible for closing wounds, express the Interleukin-2 receptor, and therefore may respond to Interleukin-2. Studies have shown that treatment with Interleukin-2 can improve the strength of healed skin, which implicates Interleukin-2 in the wound healing process. Furthermore, diseases that involve impaired wound healing, such as diabetes and systemic lupus erythematosus, have been linked to deficiencies in Interleukin-2 or defects Interleukin-2-receptor signaling. The focus of this review is to summarize the current understanding of the role of Interleukin-2 in wound healing, to highlight diseases in which Interleukin-2 and its receptor may contribute to impaired wound healing, and to assess Interleukin-2-modulating approaches as potential therapies to improve wound healing. PMID:27798123

  13. Higher concentration of interleukin 6 - A possible link between major depressive disorder and childhood abuse.

    PubMed

    Munjiza, Ana; Kostic, Milutin; Pesic, Danilo; Gajic, Milan; Markovic, Ivanka; Tosevski, Dusica Lecic

    2018-06-01

    Little is known about the correlation between IL-6 and childhood abuse and neglect which may be risk factors for the development of affective disorders in adulthood. The aim of this study was to analyze differences in serum concentrations of IL-6 between patients with major depressive disorder and healthy controls, and to investigate possible correlations with adverse childhood experiences. Peripheral venous blood samples were obtained from 64 patients who fulfilled DSM-IV-R criteria for a current major depressive episode without psychotic symptoms (MDD) and 53 healthy controls, matched for age and gender. Participants were assessed by the Beck Depression Inventory (BDI), Childhood Trauma Questionnaire (CTQ), Hamilton Depression Rating Scale (HDRS) and Hamilton Anxiety Rating Scale (HARS). The concentration of IL-6 was significantly higher in patients with major depressive disorder compared to healthy controls. The total score of childhood trauma questionnaire highly statistically significantly correlated with IL-6 levels in patient group. Persons who were physically abused, physically neglected and emotionally abused had higher levels of IL-6. Interleukin 6 as a pro-inflammatory immune marker could be an important developmental mediator linking physical and emotional abuse in early life with the development of depressive disorder in adulthood. Copyright © 2018. Published by Elsevier B.V.

  14. Evaluation of selected interleukins in patients with different gastric neoplasms: a preliminary report

    PubMed Central

    Madej-Michniewicz, Anna; Budkowska, Marta; Sałata, Daria; Dołęgowska, Barbara; Starzyńska, Teresa; Błogowski, Wojciech

    2015-01-01

    Abnormal interactions between cytokines may be an overlooked mechanism linking the development of different types of gastric neoplasms. In this study a comprehensive analysis of the systemic levels of interleukins (IL-1,IL-6, IL-8,IL-10 and IL-12) was performed in 75 patients with different gastric neoplasms (cancer, gastrointestinal stromal tumors, neuroendocrine neoplasms, lymphomas) and 40 healthy volunteers. Patients with gastric cancer (GC) have significantly higher IL-6 levels, and lower IL-8 and IL-10 concentrations, in comparison to controls and patients with other gastric neoplasms. Analogous results were observed in terms of IL-6/IL-8 and IL-6/IL-10 ratios, whose values were also higher in GC patients. In GC patients no associations were detected between the systemic levels/values of interleukins (ratios) and TNM staging. IL-6, IL-10, IL-6/IL-8 and IL-6/IL-10 ratios appeared to hold diagnostic potential in confirming/excluding the presence of GC. Their sensitivity/specificity in GC detection/exclusion was approximately 54–72%. In conclusion, disturbed systemic biochemical balance in multiple interleukins exists at the earliest stages of and appears to be specific to GC. The interleukin ratios proposed here seem to be more promising indicators of GC in humans than direct systemic levels of interleukins, and probably possess the potential to be applied as a supporting factor for techniques routinely used. PMID:26486258

  15. Effect of dexmedetomidine and cold stress in a rat model of neuropathic pain: Role of interleukin-6 and tumor necrosis factor-α.

    PubMed

    Farghaly, Hanan Sayed M; Mahmoud, Ahmed Mostafa; Abdel-Sater, Khaled A

    2016-04-05

    Dexmedetomidine (Dex) is a novel Alpha 2-adrenoceptor agonist. It decreases sympathetic tone and attenuates the stress responses to anesthesia and surgery. People exposed to cold suffer unpleasant thermal pain, which is experienced as stress and causes the release of noradrenaline from the sympathetic terminals. The present study investigated the effects of cold stress and dexmedetomidine on chronic constriction injury (CCI) model of the sciatic nerve in rats. Sixty four male Wistar rats were divided into seven groups of eight rats each: repeated cold stress (RCS) group, sham RCS group, CCI group, sham CCI group, Dex-treated group received a single dose of Dex (5 μg/kg), CCI+Dex group, CCI+RCS group. Interleukin-6 (IL-6) and tumor necrosis factor- alpha (TNF-α) levels in the serum were measured by enzyme-linked immunosorbent assay. The mean body weight of CCI, RCS, CCI+RCS, CCI+Dex and RCS+Dex groups decreased significantly compared with pre-values. Dexmedetomidine and CCI caused significant changes of the systolic, diastolic and mean blood pressure. Both RCS and CCI groups showed significant decreased of reaction time in the hot plate test. The RCS and CCI groups demonstrated a significant mechanical hyperalgesia, while pain threshold was increased in the RCS+Dex group. A significant decrease of serum IL-6 and TNF-α was demonstrated in CCI+RCS and CCI+Dex groups. The therapeutic effectiveness of dexmedetomidine in neuropathic pain may be through inhibition of proinflammatory cytokines, primarily IL-6 and TNF-α. Moreover, cold stress may result in increased resistance to neuropathic pain. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Strikingly higher interleukin (IL)-1alpha, IL-1beta and soluble interleukin-1 receptor antagonist (sIL-1RA) but similar IL-2, sIL-2R, IL-3, IL-4, IL-6, sIL-6R, IL-10, tumour necrosis factor (TNF)-alpha, transforming growth factor (TGF)-beta and interferon IFN-gamma urine levels in healthy females compared to healthy males: protection against urinary tract injury?

    PubMed

    Sadeghi, M; Daniel, V; Naujokat, C; Weimer, R; Opelz, G

    2005-11-01

    The aim of this prospective study was to examine gender-related differences of cytokines in the plasma and urine of healthy individuals that might provide a clue concerning the lower rate of chronic renal diseases in females. Soluble interleukin-1 receptor antagonist (sIL-1RA), interleukin (IL)-1alpha, IL-1beta, IL-2, sIL-2R, IL-3, IL-4, IL-6, sIL-6R, IL-10, tumor necrosis factor (TNF)-alpha, transforming growth factor (TGF)-beta(2) and interferon (IFN)-gamma were determined using standard enzyme-linked immunosorbent assay (ELISA). Cytokine levels were determined in simultaneously obtained plasma and urine samples of 18 male and 28 female healthy members of our laboratory staff. Urine cytokine levels were studied three times at 1-month intervals. All individuals had a negative urine nitrite test and showed no symptoms of urinary tract infection (UTI). Plasma levels of all studied cytokines were similar in males and females (P = n.s.). However, females had significantly higher urine IL-1alpha (P < 0.0001; P < 0.0001; P < 0.0001) and sIL-1RA (P = 0.0001; P = 0.0003; P = 0.0002) than males at three and higher IL-1beta at one of the three investigations (P = 0.098; P = 0.003; P = 0.073). Urine levels of the other cytokines were similar in males and females. Higher urine levels of IL-1alpha, IL-1beta and sIL-1RA in females may result from stimulation of cells in the urinary tract. Increased sIL-1RA might block T lymphocyte activation. The elevated cytokines may play a role in the protection of the female urinary tract from certain renal diseases, such as pyelonephritis and other inflammatory and sclerotic kidney diseases.

  17. Interleukin-2 therapy reverses some immunosuppressive effects of skeletal unloading

    NASA Technical Reports Server (NTRS)

    Armstrong, Jason W.; Balch, Signe; Chapes, Stephen K.

    1994-01-01

    Using antiorthostatic suspension, we characterized hematopoietic changes that may be responsible for the detrimental effect of skeletal unloading on macrophage development. Skeletally unloaded mice had suppressed macrophage development in unloaded and loaded bones, which indicated a systemic effect. Bone marrow cells from unloaded mice secreted less macrophage colony-stimulating factor and interleukin-6 than control mice. Additionally, T-lymphocyte proliferation was reduced after skeletal unloading. We show that polyethylene glycol-interleukin-2 therapy reversed the effects of skeletal unloading on macrophage development and cell proliferation.

  18. Interleukin-6 and chondrocyte mineralisation act in tandem to promote experimental osteoarthritis.

    PubMed

    Nasi, Sonia; So, Alexander; Combes, Christèle; Daudon, Michel; Busso, Nathalie

    2016-07-01

    Basic calcium phosphate (BCP) crystal and interleukin 6 (IL-6) have been implicated in osteoarthritis (OA). We hypothesise that these two factors may be linked in a reciprocal amplification loop which leads to OA. Primary murine chondrocytes and human cartilage explants were incubated with hydroxyapatite (HA) crystals, a form of BCP, and the modulation of cytokines and matrix-degrading enzymes assayed. The ability of IL-6 to stimulate chondrocyte calcification was assessed in vitro. The mechanisms underlying the effects of HA on chondrocytes were investigated using chemical inhibitors, and the pathways mediating IL-6-induced calcification characterised by quantifying the expression of genes involved in chondrocyte mineralisation. The role of calcification in vivo was studied in the meniscectomy model of murine OA (MNX), and the link between IL-6 and cartilage degradation investigated by histology. In chondrocytes, BCP crystals stimulated IL-6 secretion, further amplified in an autocrine loop, through signalling pathways involving Syk and PI3 kinases, Jak2 and Stat3 molecules. Exogenous IL-6 promoted calcium-containing crystal formation and upregulation of genes involved in calcification: the pyrophosphate channel Ank, the calcium channel Annexin5 and the sodium/phosphate cotransporter Pit-1. Treatment of chondrocytes with IL-6 inhibitors significantly inhibited IL-6-induced crystal formation. In meniscectomised mice, increasing deposits of BCP crystals were observed around the joint and correlated with cartilage degradation and IL-6 expression. Finally, BCP crystals induced proteoglycan loss and IL-6 expression in human cartilage explants, which were reduced by an IL-6 inhibitor. BCP crystals and IL-6 form a positive feedback loop leading to OA. Targeting calcium-containing crystal formation and/or IL-6 are promising therapeutic strategies in OA. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please

  19. Increase in interleukin-6 immediately after wheelchair basketball games in persons with spinal cord injury: preliminary report.

    PubMed

    Kinoshita, T; Nakamura, T; Umemoto, Y; Kojima, D; Moriki, T; Mitsui, T; Goto, M; Ishida, Y; Tajima, F

    2013-06-01

    Case series. To investigate the effects of wheelchair basketball game on plasma interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), C-reactive protein (CRP) and blood cell counts in persons with spinal cord injury (SCI). The 2009 Mei-shin League of Wheelchair Basketball Games held at Wakayama, Japan. Five wheelchair basketball players with SCI voluntarily participated in this study. Blood samples were taken approximately 1 h before the player warm-up for the game and immediately after the game. IL-6, TNF-α, CRP and blood cell count were measured. Plasma IL-6 level and number of monocytes were significantly increased after the game, compared with pre-game measurements (P<0.05). No changes were observed in other measurements. There was a significant relationship between increased IL-6 levels and accumulated play duration. The lack of change in TNF-α and CRP levels suggested that the exercise-induced rise in IL-6 was not related to exercise-induced inflammatory response. Furthermore, the associated increase in the number of monocytes did not correlate with exercise-induced IL-6 changes, negating monocytes as the source of IL-6.

  20. Induction of immunoglobulin G1, interleukin-6 and interleukin-10 by Taenia crassiceps metacestode carbohydrates

    PubMed Central

    Dissanayake, Senarath; Khan, Nasir; Shahin, Allen; Wijesinghe, Shanaka; Lukic, Miodrag

    2002-01-01

    T helper type 2 (Th2) -polarized immune responses are characteristically dominant in helminth infections. Two murine models that show a Th1 to Th2 polarization with infection progression are those of Schistosoma mansoni and Taenia crassiceps. In both, an early Th1 response is replaced by a late Th2 response. We report that the nucleic acid-, protein- and lipid-free carbohydrate fraction of T. crassiceps metacestodes (denoted T-CHO) possesses Th2-like immunomodulatory activity. Immunization of two strains of rats (Dark Agouti and Albino Oxford) and BALB/c mice with chicken albumin in the presence of T-CHO resulted in selective enhancement of immunoglobulin G1 (IgG1) antibodies, considered to be associated with Th2 responses in both rats and mice. Interleukin-6 (IL-6) followed by IL-10 were the dominant cytokines detected in in vitro cultures of mouse spleen cells stimulated with T-CHO. IL-4 and IL-5 were not detected in these culture supernates. Furthermore, Taenia carbohydrates were mitogenic to spleen cells, activated serine phosphorylation of proteins and up-regulated the expression of the anti-apoptotic protein, Bcl-2. When mouse spleen cells were cultured in the presence of Taenia carbohydrates, a concentration-dependent down-regulation of IL-2 and an overlapping up-regulation of IL-6 secretion were seen. PMID:12460185

  1. Intrinsic catch-up growth of hypoplastic fetal lungs is mediated by interleukin-6.

    PubMed

    Nogueira-Silva, Cristina; Moura, Rute S; Esteves, Nuno; Gonzaga, Sílvia; Correia-Pinto, Jorge

    2008-07-01

    Fetal lung hypoplasia is a common finding in several fetal conditions such as congenital diaphragmatic hernia (CDH). Interestingly, previous studies have demonstrated that hypoplastic lungs have the ability to recover to normal size, when relieved from mechanical factors. However, the underlying mechanisms remain largely unknown. Recently, interleukin-6 (IL-6) has been involved in catch-up growth phenomenon in children. Thus, we hypothesized that IL-6 could mediate fetal growth recover from hypoplastic lungs. Control and nitrofen-induced hypoplastic lung explants were cultured either in normal conditions or with IL-6 neutralizing antibodies. The total number of peripheral airway buds, epithelial perimeter, and total explant area were analyzed and daily branching rates were calculated. Additionally, IL-6 mRNA and protein expression was assessed both in qualitative (by in situ hybridization and immunohistochemistry) and in quantitative (by real-time PCR and Western blot) approaches, in control and hypoplastic lungs (nitrofen and CDH groups). Nitrofen-induced hypoplastic lungs showed in vitro, out of systemic environment, the ability to recover from hypoplasia and presented daily branching rates significantly higher than controls. Blocking IL-6 activity significantly diminished the intrinsic capacity of hypoplastic fetal lungs to recover from hypoplasia and attenuated their daily branching rates. Although more exacerbated in CDH, both nitrofen-exposed lungs presented significant IL-6 mRNA and protein over-expression throughout all studied gestational ages. The present study suggests, for the first time, that fetal lung is able to recover from growth retardation through a way that resembles the catch-up growth phenomenon, and it seems to be, at least partially, orchestrated by intrinsic mechanisms implicating IL-6.

  2. Hydrocortisone prevents immunosuppression by interleukin-10+ natural killer cells after trauma-hemorrhage.

    PubMed

    Roquilly, Antoine; Broquet, Alexis; Jacqueline, Cédric; Masson, Damien; Segain, Jean Pierre; Braudeau, Cecile; Vourc'h, Mickael; Caillon, Jocelyne; Altare, Frédéric; Josien, Regis; Retière, Christelle; Villadangos, Jose; Asehnoune, Karim

    2014-12-01

    Trauma induces a state of immunosuppression, which is responsible for the development of nosocomial infections. Hydrocortisone reduces the rate of pneumonia in patients with trauma. Because alterations of dendritic cells and natural killer cells play a central role in trauma-induced immunosuppression, we investigated whether hydrocortisone modulates the dendritic cell/natural killer cell cross talk in the context of posttraumatic pneumonia. Experimental study. Research laboratory from an university hospital. Bagg Albino/cJ mice (weight, 20-24 g). First, in an a priori substudy of a multicenter, randomized, double-blind, placebo-controlled trial of hydrocortisone (200 mg/d for 7 d) in patients with severe trauma, we have measured the blood levels of five cytokines (tumor necrosis factor-α, interleukin-6, interleukin-10, interleukin-12, interleukin-17) at day 1 and day 8. In a second step, the effects of hydrocortisone on dendritic cell/natural killer cell cross talk were studied in a mouse model of posttraumatic pneumonia. Hydrocortisone (0.6 mg/mice i.p.) was administered immediately after hemorrhage. Twenty-four hours later, the mice were challenged with Staphylococcus aureus (7 × 10 colony-forming units). Using sera collected during a multicenter study in patients with trauma, we found that hydrocortisone decreased the blood level of interleukin-10, a cytokine centrally involved in the regulation of dendritic cell/natural killer cell cluster. In a mouse model of trauma-hemorrhage-induced immunosuppression, splenic natural killer cells induced an interleukin-10-dependent elimination of splenic dendritic cell. Hydrocortisone treatment reduced this suppressive function of natural killer cells and increased survival of mice with posthemorrhage pneumonia. The reduction of the interleukin-10 level in natural killer cells by hydrocortisone was partially dependent on the up-regulation of glucocorticoid-induced tumor necrosis factor receptor-ligand (TNFsf18) on

  3. Molecular modeling and SPRi investigations of interleukin 6 (IL6) protein and DNA aptamers.

    PubMed

    Rhinehardt, Kristen L; Vance, Stephen A; Mohan, Ram V; Sandros, Marinella; Srinivas, Goundla

    2018-06-01

    Interleukin 6 (IL6), an inflammatory response protein has major implications in immune-related inflammatory diseases. Identification of aptamers for the IL6 protein aids in diagnostic, therapeutic, and theranostic applications. Three different DNA aptamers and their interactions with IL6 protein were extensively investigated in a phosphate buffed saline (PBS) solution. Molecular-level modeling through molecular dynamics provided insights of structural, conformational changes and specific binding domains of these protein-aptamer complexes. Multiple simulations reveal consistent binding region for all protein-aptamer complexes. Conformational changes coupled with quantitative analysis of center of mass (COM) distance, radius of gyration (R g ), and number of intermolecular hydrogen bonds in each IL6 protein-aptamer complex was used to determine their binding performance strength and obtain molecular configurations with strong binding. A similarity comparison of the molecular configurations with strong binding from molecular-level modeling concurred with Surface Plasmon Resonance imaging (SPRi) for these three aptamer complexes, thus corroborating molecular modeling analysis findings. Insights from the natural progression of IL6 protein-aptamer binding modeled in this work has identified key features such as the orientation and location of the aptamer in the binding event. These key features are not readily feasible from wet lab experiments and impact the efficacy of the aptamers in diagnostic and theranostic applications.

  4. Neuroprotective effect of interleukin-6 in a rat model of cerebral ischemia

    PubMed Central

    FENG, QILIN; WANG, YI; YANG, YINGDA

    2015-01-01

    Interleukin (IL)-6 is known to be a key cytokine in immune regulation in addition to serving crucial functions in various autoimmune diseases; however, the neuroprotective potential of IL-6 has not been fully investigated. The aim of the present study was to investigate the neuroprotective effects of the inflammatory cytokine IL-6 in a rat model of cerebral ischemia. Rat cerebral ischemia was induced by intraluminal middle cerebral artery occlusion. Following treatment with 500 or 50 ng IL-6, the infarct volumes and symptoms of neurological deficit were ameliorated. Furthermore, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling staining suggested that the IL-6 treatment reduced neuronal apoptosis in vivo, which was consistent with a lower percentage of annexin V- and caspase-3-positive cortical neurons. In addition, IL-6 in vitro induced the phosphorylation of signal transducer and activator of transcription (STAT) 3 and the expression of induced myeloid leukemia cell differentiation protein Mcl-1, but not the expression of B-cell lymphoma 2, suggesting the activation of the Janus kinase/STAT pathway by IL-6. IL-6 also appeared to be involved in the regulation of cytokine secretion and blood-brain barrier (BBB) integrity in cerebral ischemia. IL-6 downregulated a number of inflammatory cytokines, including tumor necrosis factor-α and IL-1β, as well as myeloperoxidase activity, indicating the accumulation of granulocytes in the ischemic brain tissue. IL-6 was also observed to support the integrity of the BBB by reducing Evans blue leakage in vivo and suppressing the expression of matrix metalloproteinase-9 in ischemic brain tissue. In conclusion, the results of the present study indicate that the neuroprotective effects of IL-6 in cerebral ischemia are the result of a range of processes, including the modulation of cell apoptosis, cytokine secretion and the integrity of the BBB. IL-6 could therefore be used as a therapeutic agent in clinical

  5. CGI-99 promotes breast cancer metastasis via autocrine interleukin-6 signaling.

    PubMed

    Lin, C; Liao, W; Jian, Y; Peng, Y; Zhang, X; Ye, L; Cui, Y; Wang, B; Wu, X; Xiong, Z; Wu, S; Li, J; Wang, X; Song, L

    2017-06-29

    Metastatic relapse remains largely incurable and a major challenge of clinical management in breast cancer, but the underlying mechanisms are poorly understood. Herein, we report that CGI-99 is overexpressed in breast cancer tissues from patients with metastatic recurrence within 5 years. High CGI-99 significantly predicts poorer 5-year metastasis-free patient survival. We find that CGI-99 increases breast cancer stem cell properties, and potentiates efficient tumor lung colonization and outgrowth in vivo. Furthermore, we demonstrate that CGI-99 activates the autocrine interleukin-6 (IL-6)/STAT3 signaling by increasing the accumulation and activity of RNA polymerase II and p300 cofactor at the proximal promoter of IL-6. Importantly, delivery of the IL-6-receptor humanized monoclonal antibody tocilizumab robustly abrogates CGI-99-induced metastasis in vivo. Finally, we find that high levels of CGI-99 are significantly correlated with STAT3 hyperactivation in breast cancer patients. These findings reveal a potential mechanism for constitutive activation of autocrine IL-6/STAT3 signaling and may suggest a novel target for clinical intervention in breast cancer.

  6. Radiation Inhibits Interleukin-12 Production via Inhibition of C-Rel through the Interleukin-6/ Signal Transducer and Activator of Transcription 3 Signaling Pathway in Dendritic Cells

    PubMed Central

    Lee, Eun-Jung; Lee, Seo Jin; Kim, Ji-Hye; Kim, Kyoung-Jin; Yang, Seung-Hyun; Jeong, Keun-Yeong; Seong, Jinsil

    2016-01-01

    Radiotherapy (RT) is a potent anti-tumor modality. However, unwanted effects including increased recurrence and metastasis that involve factors such as cytokines, which induce complex molecular mechanisms, have also been reported. In a previous study, we showed that interleukin (IL)-12 and radiotherapy combination treatment suppressed tumor growth and metastasis in a hepatoma mouse model. In this study, we investigated the mechanism underlying the IL-12 anti-tumor effect during radiotherapy. In tumor-bearing mice, irradiation decreased IL-12 expression in the tumors and spleens. However, a number of dendritic cells infiltrated into the tumors in which IL-12 expression did not decrease. To further study the underlying detailed mechanism for this decrease in IL-12, LPS-stimulated bone marrow–derived dendritic cells (BMDCs) were irradiated, and then IL-12– and IL-6–associated molecules were examined in irradiated tumors and BMDCs. Irradiation resulted in IL-12 suppression and IL-6 increase. IL-6 and signal transducer and activator of transcription 3 (STAT3) inhibitors restored the irradiation-induced IL-12 decrease via suppression of C-Rel activation. Taken together, our study suggests that irradiation-induced IL-6 can decrease IL-12 production through the inhibition of C-Rel phosphorylation by the IL-6/STAT3 signaling pathway. PMID:26745884

  7. The interleukins of fish.

    PubMed

    Secombes, C J; Wang, T; Bird, S

    2011-12-01

    Interleukins are a subgroup of cytokines, molecules involved in the intercellular regulation of the immune system. The term interleukin was first coined in 1979 to refer to molecules that signal between different leucocyte types, although not exclusively restricted to leucocyte communication. Whilst it is now known that interleukins are produced by a wide variety of cell types, nevertheless many are synthesised by CD4(+) T helper cells, macrophages/monocytes and endothelial cells. The nomenclature is relatively straightforward, with interleukin 1 the first discovered and interleukin 2 the second, etc. However, whilst 35 interleukins are currently described in mammals, several are in fact terms referring to subfamilies of more molecules, as with the IL-1 family where 11 members (IL-1F1-IL-1F11) are present, and the IL-17 family where 6 members (IL-17A-IL-17F) are present. So the total is much higher and splice variants and allelic variation increase this diversity further. This review will focus on what is known about interleukins in fish, and will refer to the major subfamilies rather than try to work through 35 descriptions in a row. It is clear that many direct homologues of molecules known in mammals are present in fish, but that not all are present and some novel interleukins exist that may have arisen from fish specific gene duplication events. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Three-Dimensional Conformal Radiotherapy in Prostate Cancer Patients: Rise in Interleukin 6 (IL-6) but not IL-2, IL-4, IL-5, Tumor Necrosis Factor-{alpha}, MIP-1-{alpha}, and LIF Levels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oliveira Lopes, Carlos; Callera, Fernando, E-mail: fcallera@gmail.com

    Purpose: To investigate the effect of radiotherapy (RT) on serum levels of interleukin-2 (IL-2), IL-4, IL-5, IL-6, tumor necrosis factor alpha (TNF-{alpha}), macrophage inflammatory protein-1-alpha (MIP-1-{alpha}) and leukemia inhibitory factor (LIF) in patients with prostate cancer. Methods and Materials: Forty eight patients with prostate cancer received three-dimensional conformal blocking radiation therapy with a linear accelerator. IL-2, IL-4, IL-5, IL-6, TNF-{alpha}, MIP-1-{alpha}, and LIF levels were measured by the related immunoassay kit 1 day before the beginning of RT and during RT at days 15 and 30. Results: The mean IL-2 values were elevated before and during the RT in contrastmore » with those of IL-4, IL-5, IL-6, TNF-{alpha}, MIP-1-{alpha}, and LIF, which were within the normal range under the same conditions. Regarding markers IL-2, IL-4, IL-5, TNF-{alpha}, MIP-1-{alpha}, and LIF, comparisons among the three groups (before treatment and 15 and 30 days during RT) did not show significant differences. Although values were within the normal range, there was a significant rise in IL-6 levels at day 15 of RT (p = 0.0049) and a decline at day 30 to levels that were similar to those observed before RT. Conclusions: IL-6 appeared to peak after 15 days of RT before returning to pre-RT levels. In contrast, IL-2, IL-4, IL-5, TNF-{alpha}, MIP-1-{alpha}, and LIF levels were not sensitive to irradiation. The increased levels of IL-6 following RT without the concurrent elevation of other cytokines involved in the acute phase reaction did not suggest a classical inflammatory response to radiation exposure. Further studies should be designed to elucidate the role of IL-6 levels in patients with prostate cancer treated with RT.« less

  9. Interleukin 6 inhibits proliferation and, in cooperation with an epidermal growth factor receptor autocrine loop, increases migration of T47D breast cancer cells.

    PubMed

    Badache, A; Hynes, N E

    2001-01-01

    Interleukin (IL)-6, a multifunctional regulator of immune response, hematopoiesis, and acute phase reactions, has also been shown to regulate cancer cell proliferation. We have investigated IL-6 signaling pathways and cellular responses in the T47D breast carcinoma cell line. The IL-6-type cytokines, IL-6 and oncostatin M, simultaneously inhibited cell proliferation and increased cell migration. In T47D cells, IL-6 stimulated the activation of Janus-activated kinase 1 tyrosine kinase and signal transducers and activators of transcription (STAT) 1 and STAT3 transcription factors. Expression of dominant negative STAT3 in the cells strongly reduced IL-6-mediated growth inhibition but did not prevent IL-6-induced cell migration. IL-6 treatment led to activation of the mitogen-activated protein kinase (MAPK) and the phosphatidylinositol 3'-kinase (PI3K) pathways. Inhibition of MAPK or PI3K activity reversed IL-6- and oncostatin M-stimulated migration. Because cross-talk between cytokine receptors and members of the ErbB family of receptor tyrosine kinases has been described previously, we have examined their interaction in T47D cells. Down-regulation of ErbB receptor activity, through the use of specific pharmacological inhibitors or dominant negative receptor constructs, revealed that IL-6-induced MAPK activation was largely dependent on epidermal growth factor (EGF) receptor activity, but not on ErbB-2 activity. Using a monoclonal antibody that interferes with EGF receptor-ligand interaction, we have shown that in T47D cells, IL-6 cooperates with an EGF receptor autocrine activity loop for signaling through the MAPK and PI3K pathways and for cell migration. Both the tyrosine phosphatase SHP-2 and the multisubstrate docking molecule Gab1, which are potential links between IL-6 and the MAPK/PI3K pathways, were constitutively associated with the active EGF receptor. On IL-6 stimulation, SHP-2 and Gab1 were recruited to the gp130 subunit of the IL-6 receptor and tyrosine

  10. Effect of nutritional status and dietary patterns on human serum C-reactive protein and interleukin-6 concentrations.

    PubMed

    Smidowicz, Angelika; Regula, Julita

    2015-11-01

    The inflammatory process plays an important role in the pathogenesis of many chronic diseases, such as cardiovascular diseases, diabetes mellitus type 2, and metabolic syndrome. Serum C-reactive protein (CRP) and interleukin-6 (IL-6) are widely tested inflammatory markers involved in the development of these diseases. Several studies indicate a relation between nutritional status and the concentrations of human high-sensitivity CRP and IL-6. Similarly, the role of diet in reducing inflammation and thereby modulating the risk of non-communicable diseases is supported by numerous studies. This review focuses on the effects of the selected nutrition models in humans on the concentrations of CRP and IL-6. It seems that the Mediterranean diet model is most effective in inhibiting inflammation. The Dietary Approaches to Stop Hypertension model and the plant nutrition model also have proven to be beneficial. The data on low-fat and low-carbohydrate diets are inconclusive. Comprehensive studies are necessary, taking into account the cumulative effect of dietary and other factors on the inflammatory process. © 2015 American Society for Nutrition.

  11. Consensus statement on blocking the effects of interleukin-6 and in particular by interleukin-6 receptor inhibition in rheumatoid arthritis and other inflammatory conditions

    PubMed Central

    Smolen, Josef S; Schoels, Monika M; Nishimoto, Norihiro; Breedveld, Ferdinand C; Burmester, Gerd R; Dougados, Maxime; Emery, Paul; Ferraccioli, Gianfranco; Gabay, Cem; Gibofsky, Allan; Gomez-Reino, Juan Jesus; Jones, Graeme; Kvien, Tore K; Murakami, Miho; Betteridge, Neil; Bingham, Clifton O; Bykerk, Vivian; Choy, Ernest H; Combe, Bernard; Cutolo, Maurizio; Graninger, Winfried; Lanas, Angel; Martin-Mola, Emilio; Montecucco, Carlomaurizio; Ostergaard, Mikkel; Pavelka, Karel; Rubbert-Roth, Andrea; Sattar, Naveed; Scholte-Voshaar, Marieke; Tanaka, Yoshiya; Trauner, Michael; Valentini, Gabriele; Winthrop, Kevin L; de Wit, Maarten; van der Heijde, Désirée

    2013-01-01

    Background Since approval of tocilizumab (TCZ) for treatment of rheumatoid arthritis (RA) and juvenile idiopathic arthritis (JIA), interleukin 6 (IL-6) pathway inhibition was evaluated in trials of TCZ and other agents targeting the IL-6 receptor and ligand in various RA populations and other inflammatory diseases. This consensus document informs on interference with the IL-6 pathway based on evidence and expert opinion. Methods Preparation of this document involved international experts in RA treatment and RA patients. A systematic literature search was performed that focused on TCZ and other IL6-pathway inhibitors in RA and other diseases. Subsequently, incorporating available published evidence and expert opinion, the steering committee and a broader expert committee (both including RA patients) formulated the current consensus statement. Results The consensus statement covers use of TCZ as combination- or monotherapy in various RA populations and includes clinical, functional and structural aspects. The statement also addresses the second approved indication in Europe JIA and non-approved indications. Also early phase trials involving additional agents that target the IL-6 receptor or IL-6 were evaluated. Safety concerns, including haematological, hepatic and metabolic issues as well as infections, are addressed likewise. Conclusions The consensus statement identifies points to consider when using TCZ, regarding indications, contraindications, screening, dose, comedication, response evaluation and safety. The document is aimed at supporting clinicians and informing patients, administrators and payers on opportunities and limitations of IL-6 pathway inhibition. PMID:23172750

  12. Interleukin-1beta and interleukin-6 disturb the antioxidant enzyme system in bovine chondrocytes: a possible explanation for oxidative stress generation.

    PubMed

    Mathy-Hartert, M; Hogge, L; Sanchez, C; Deby-Dupont, G; Crielaard, J M; Henrotin, Y

    2008-07-01

    Beside matrix metalloproteinases, reactive oxygen species (ROS) are the main biochemical factors of cartilage degradation. To prevent ROS toxicity, chondrocytes possess a well-coordinated enzymatic antioxidant system formed principally by superoxide dismutases (SODs), catalase (CAT) and glutathione peroxidase (GPX). This work was designed to assess the effects of interleukin (IL)-1beta and IL-6 on the enzymatic activity and gene expression of SODs, CAT and GPX in bovine chondrocytes. Bovine chondrocytes were cultured in monolayer for 4-96 h in the absence or in the presence of IL-1beta (0.018-1.8ng/ml) or IL-6 (10-100 ng/ml). To study signal transduction pathway, inhibitors of mitogen-activated protein kinases (MAPK) (PD98059, SB203580 and SP600125) (5-20 microM) and nuclear factor (NF)-kappaB inhibitors [BAY11-7082 (1-10 microM) and MG132 (0.1-10 microM)] were used. SODs, CAT and GPX enzymatic activities were evaluated in cellular extract by using colorimetric enzymatic assays. Mn SODs, Cu/Zn SOD, extracellular SOD (EC SOD), CAT and GPX gene expressions were quantified by real-time and quantitative polymerase chain reaction (PCR). Mn SOD and GPX activities were dose and time-dependently increased by IL-1beta. In parallel, IL-1beta markedly enhanced Mn SOD and GPX gene expressions, but decreased Cu/Zn SOD, EC SOD and CAT gene expressions. Induction of SOD enzymatic activity and Mn SOD mRNA expression were inhibited by NF-kappaB inhibitors but not by MAPK inhibitors. IL-6 effects were similar but weaker than those of IL-1beta. In conclusion, IL-1beta, and to a lesser extend IL-6, dysregulates enzymatic antioxidant defenses in chondrocyte. These changes could lead to a transient accumulation of H(2)O(2) in mitochondria, and consequently to mitochondria damage. These changes contribute to explain the mitochondrial dysfunction observed in osteoarthritis chondrocytes.

  13. Interleukin-Driven Insulin-Like Growth Factor Promotes Prostatic Inflammatory Hyperplasia

    PubMed Central

    Hahn, Alana M.; Myers, Jason D.; McFarland, Eliza K.; Lee, Sanghee

    2014-01-01

    Prostatic inflammation is of considerable importance to urologic research because of its association with benign prostatic hyperplasia and prostate cancer. However, the mechanisms by which inflammation leads to proliferation and growth remain obscure. Here, we show that insulin-like growth factors (IGFs), previously known as critical developmental growth factors during prostate organogenesis, are induced by inflammation as part of the proliferative recovery to inflammation. Using genetic models and in vivo IGF receptor blockade, we demonstrate that the hyperplastic response to inflammation depends on interleukin-1–driven IGF signaling. We show that human prostatic hyperplasia is associated with IGF pathway activation specifically localized to foci of inflammation. This demonstrates that mechanisms of inflammation-induced epithelial proliferation and hyperplasia involve the induction of developmental growth factors, further establishing a link between inflammatory and developmental signals and providing a mechanistic basis for the management of proliferative diseases by IGF pathway modulation. PMID:25292180

  14. The function of the soluble interleukin 6 (IL-6) receptor in vivo: sensitization of human soluble IL-6 receptor transgenic mice towards IL- 6 and prolongation of the plasma half-life of IL-6

    PubMed Central

    1996-01-01

    Interleukin 6 (IL-6) is considered an important mediator of acute inflammatory responses. Moreover, IL-6 functions as a differentiation and growth factor of hematopoietic precursor cells, B cells, T cells, keratinocytes, neuronal cells, osteoclasts, and endothelial cells. IL-6 exhibits its action via a receptor complex consisting of a specific IL- 6 receptor (IL-6R) and a signal transducing subunit (gp130). Soluble forms of both receptor components are generated by shedding and are found in patients with various diseases such as acquired immune deficiency syndrome, rheumatoid arthritis, and others. The function of the soluble (s)IL-6R in vivo is unknown. Since human (h)IL-6 acts on human and murine target cells, but murine IL-6 on murine cells only, we constructed transgenic mice expressing the hsIL-6R. We report here that in the presence of hsIL-6R, mice are hypersensitized towards hIL-6, mounting an acute phase protein gene induction at significantly lower IL-6 dosages compared to control animals. Furthermore, in hsIL-6R transgenic mice, the detected acute phase response persists for a longer period of time. The IL-6/IL-6R complex prolongs markedly the Il- 6 plasma half-life. Our results reinforce the role of the hsIL-6R as an agonistic protein, help to understand the function of the hsIL-6R in vivo, and highlight the significance of the receptor in the induction of the acute phase response. PMID:8666898

  15. Regulation of Epigenetic Modifiers, Including KDM6B, by Interferon-γ and Interleukin-4 in Human Macrophages.

    PubMed

    Yıldırım-Buharalıoğlu, Gökçe; Bond, Mark; Sala-Newby, Graciela B; Hindmarch, Charles C T; Newby, Andrew C

    2017-01-01

    Interferon-γ (IFN-γ) or interleukin-4 (IL-4) drives widely different transcriptional programs in macrophages. However, how IFN-γ and IL-4 alter expression of histone-modifying enzymes involved in epigenetic regulation and how this affects the resulting phenotypic polarization is incompletely understood. We investigated steady-state messenger RNA levels of 84 histone-modifying enzymes and related regulators in colony-stimulating factor-1 differentiated primary human macrophages using quantitative polymerase chain reaction. IFN-γ or IL-4 treatment for 6-48 h changed 11 mRNAs significantly. IFN-γ increased CIITA, KDM6B, and NCOA1, and IL-4 also increased KDM6B by 6 h. However, either cytokine decreased AURKB, ESCO2, SETD6, SUV39H1, and WHSC1, whereas IFN-γ alone decreased KAT2A, PRMT7, and SMYD3 mRNAs only after 18 h, which coincided with decreased cell proliferation. Rendering macrophages quiescent by growth factor starvation or adenovirus-mediated overexpression of p27 kip1 inhibited expression of AURKB, ESCO2, SUV39H1, and WHSC1, and mRNA levels were restored by overexpressing the S-phase transcription factor E2F1, implying their expression, at least partly, depended on proliferation. However, CIITA, KDM6B, NCOA1, KAT2A, PRMT7, SETD6, and SMYD3 were regulated independently of effects on proliferation. Silencing KDM6B, the only transcriptional activator upregulated by both IFN-γ and IL-4, pharmacologically or with short hairpin RNA, blunted a subset of responses to each cytokine. These findings demonstrate that IFN-γ or IL-4 can regulate the expression of histone acetyl transferases and histone methyl transferases independently of effects on proliferation and that upregulation of the histone demethylase, KDM6B, assists phenotypic polarization by both cytokines.

  16. The associations of interleukin-6 (IL-6) and downstream inflammatory markers with risk of cardiovascular disease: the Caerphilly Study.

    PubMed

    Patterson, Christopher C; Smith, Anne E; Yarnell, John W G; Rumley, Ann; Ben-Shlomo, Yoav; Lowe, Gordon D O

    2010-04-01

    Interleukin-6 (IL-6) is a key pro-inflammatory cytokine which mediates expression of several 'downstream' inflammatory markers and may play a role in atherothrombosis. However, it is not yet known whether IL-6 plays a role in mediating the associations of each marker with risk of coronary heart disease (CHD) or ischaemic stroke (IS). We examined the role of IL-6 and several "downstream" markers of inflammation (leucocyte counts, plasma and serum viscosity, fibrinogen, C-reactive protein, alpha1-antitrypsin and alpha2-macroglobulin) with risk of subsequent CHD, IS, and a combined endpoint (CHD/IS) in a population of British men. 2208 men aged 45-64 years were followed for a median of 13.4 years and 486 men had experienced a cardiovascular event. In age-adjusted analyses, most inflammatory markers were significantly associated with risk of CHD or CHD/IS, but for IS associations were weaker. On multivariable analyses, including conventional risk factors, associations of serum viscosity, alpha2-macroglobulin and leucocyte count became non-significant for CHD and CHD/IS, while no inflammatory marker retained a significant association with risk of IS. In contrast, IL-6 retained a significant association with CHD and CHD/IS and, after adjustment for IL-6, hazard ratios for downstream inflammatory markers were attenuated to non-significance. These findings suggest that IL-6 may play a role in mediating the associations of circulating inflammatory markers with risk of CHD in men. Further studies are required to assess whether this is also the case for risk of IS, and for CHD/IS in women. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

  17. Acute meningitis prognosis using cerebrospinal fluid interleukin-6 levels.

    PubMed

    Vázquez, Jorge Alejandro; Adducci, Maria del Carmen; Coll, Carlos; Godoy Monzón, Daniel; Iserson, Kenneth V

    2012-08-01

    Improved diagnostic tests would aid in diagnosing and treating community-acquired meningitis. To analyze the diagnostic value of interleukin-6 (IL-6) in the cerebrospinal fluid (CSF) of patients presenting with symptoms of acute meningitis. In a 6-month prospective, observational, cross-sectional emergency department (ED) study, serum and CSF samples were obtained from all patients with a headache and fever in whom the physician suspected meningitis. Patients were excluded if computed tomography findings contraindicated a lumbar puncture, if they had bleeding disorders, or if their serum indicated bleeding. IL-6 levels were measured and compared in patients with (Group A) and without (Group B) bacterial meningitis. Samples were obtained from 53 patients, of whom 40 were ultimately found to have meningitis. These 40 patients averaged 49.6 ± 21.9 years, with number of men 18 (45%), hospitalizations 21 (52%), mortality 3 (.07%), and IL-6 average rating 491 (median: 14.5; range 0000-6000). Findings in the two groups were: Group A (with meningitis): n = 13, average IL-6 level: 1495 (median: 604; 25/75 percentiles: 232.5-2030; 95% confidence interval [CI] 371.7-2618.6; range 64-6000). Group B (with aseptic meningitis): n = 27, average IL-6 level: 7.34 (median: 5; 25/75 percentiles: 0.0/15.1; 95% CI 3.94-10.73; range 0-23.6). Mann-Whitney rank sum test: p < 0.0001. In patients with acute bacterial meningitis, CSF cytokine concentrations are elevated. Measuring CSF inflammatory cytokine levels in patients with acute meningitis could be a valuable ED diagnostic tool. Using this tool could improve the prognosis of patients with bacterial meningitis by allowing more rapid initiation of antibiotic treatment. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Anti-interleukin-6 receptor antibody (tocilizumab) treatment of multicentric Castleman's disease.

    PubMed

    Matsuyama, Masashi; Suzuki, Takeshi; Tsuboi, Hiroto; Ito, Satoshi; Mamura, Mizuko; Goto, Daisuke; Matsumoto, Isao; Tsutsumi, Akito; Sumida, Takayuki

    2007-01-01

    We report three cases of multicentric Castleman's disease (MCD) successfully treated with anti-interleukin-6 receptor antibody (tocilizumab). Tocilizumab was administered intravenously at a dose of 8 mg/kg every 2 weeks. In each case, tocilizumab alleviated symptoms, including generalized fatigue, pyrexia, and alleviated biochemical abnormalities, including anemia, hypoalbuminemia, hypergammaglobulinemia, and increased C-reactive protein (CRP). Side effects included hypercholesterolemia, acute pyelonephritis, mild inflammation of the parotid glands, and upper respiratory system inflammation. Other severe side effects were not observed. These results indicate that tocilizumab is effective for the treatment of MCD. This is the first report on tocilizumab efficacy for Castleman's disease after approval for use for Castleman's disease.

  19. Elevated serum high-sensitivity C-reactive protein levels in fibromyalgia syndrome patients correlate with body mass index, interleukin-6, interleukin-8, erythrocyte sedimentation rate.

    PubMed

    Xiao, Yangming; Haynes, Wanda L; Michalek, Joel E; Russell, I Jon

    2013-05-01

    The levels of several inflammatory cytokines are abnormal in many patients with the fibromyalgia syndrome (FMS) and may play a role in its pathogenesis. The inflammatory marker C-reactive protein (CRP) is associated with the disease activity in patients with inflammatory rheumatic diseases, but its role in FMS is unknown. We undertook this study to determine whether high-sensitivity CRP (hsCRP) is elevated in FMS and whether its levels relate to key biologic or clinical measures. One hundred and five patients with FMS (1990 ACR criteria) and 61 healthy normal controls (HNC) at a ratio of 2:1 were recruited. The serum concentrations of hsCRP, interleukin-8 (IL-8), and interleukin-6 (IL-6) were assessed using enzyme-linked immunosorbent assays. The hsCRP levels were marginally higher in FMS than in HNC (p = 0.06) and its abnormality rate (>1.5 SD above the HNC mean) was significantly higher in FMS (25 %) compared with HNC (6.8 %) (p = 0.03). Serum IL-8 levels, IL-6 levels, and erythrocyte sedimentation rate (ESR) in FMS did not differ from those in HNC. Body mass index (BMI), ESR, IL-8, and IL-6 levels correlated with hsCRP levels in FMS. No associations were found between hsCRP and age, gender, ethnicity, or other clinical measures. Serum CRP levels were higher in FMS and significantly correlated with BMI, ESR, IL-8, and IL-6 levels, suggesting that inflammation may contribute to the symptoms in some FMS patients, particularly those who are obese. Weight loss and therapies directed against inflammation may be useful in the management of FMS patients with elevated hsCRP.

  20. Regulation of rat heme oxygenase-1 expression by interleukin-6 via the Jak/STAT pathway in hepatocytes.

    PubMed

    Tron, Kyrylo; Samoylenko, Anatoly; Musikowski, Gernot; Kobe, Fritz; Immenschuh, Stephan; Schaper, Fred; Ramadori, Giuliano; Kietzmann, Thomas

    2006-07-01

    Heme oxygenase-1 (HO-1) can be induced by various stimuli, one of which is interleukin-6 (IL-6). Therefore, the aim of this study was to elucidate the molecular mechanisms responsible for IL-6-dependent HO-1 induction in the liver. The IL-6-dependent HO-1 regulation in rat primary hepatocytes and HepG2 hepatoma cells was studied by Northern and Western blot analyses, HO-1 promoter reporter gene assays and EMSA. The HO-1 expression was transcriptionally induced by IL-6 in a time- and dose-dependent manner. Activation of signal transducers and activators of transcription (STAT) factors by the IL-6 receptor was crucial for HO-1 induction. By contrast, negative regulation of HO-1 expression appeared to be mediated through the SH2-domain-containing tyrosine phosphatase-2 (SHP2)/ suppressors of cytokine signaling-3 (SOCS3) binding site within the gp130 IL-6 receptor subunit. Among the three putative STAT binding elements (SBE) in the HO-1 promoter, only the distal one was functional and when deleted, the remaining Luc induction was completely obliterated by the phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002. The HO-1 SBE3 mediates HO-1 gene induction by IL-6 mainly via activation of the Jak/STAT pathway.

  1. Effect of Marine-Derived n-3 Polyunsaturated Fatty Acids on C-Reactive Protein, Interleukin 6 and Tumor Necrosis Factor α: A Meta-Analysis

    PubMed Central

    Li, Kelei; Huang, Tao; Zheng, Jusheng; Wu, Kejian; Li, Duo

    2014-01-01

    Background Previous studies did not draw a consistent conclusion about the effects of marine-derived n-3 polyunsaturated fatty acids (PUFAs) on fasting blood level of C-reactive protein (CRP), interleukin 6 (IL-6) and tumor necrosis factor α (TNF-α). Methods and Findings A comprehensive search of Web of Science, PubMed, Embase and Medline (from 1950 to 2013) and bibliographies of relevant articles was undertaken. Sixty-eight RCTs with a total of 4601 subjects were included in the meta-analysis. Marine-derived n-3 PUFAs supplementation showed a lowering effect on Marine-derived n-3 PUFAs supplementation had a significant lowering effect on TNF-α, IL-6 and CRP in three groups of subjects (subjects with chronic non-autoimmune disease, subjects with chronic autoimmune disease and healthy subjects). A significant negative linear relationship between duration and effect size of marine-derived n-3 PUFAs supplementation on fasting blood levels of TNF-α and IL-6 in subjects with chronic non-autoimmune disease was observed, indicating that longer duration of supplementation could lead to a greater lowering effect. A similar linear relationship was also observed for IL-6 levels in healthy subjects. Restricted cubic spline analysis and subgroup analysis showed that the lowering effect of marine-derived n-3 PUFAs on CRP, IL-6 and TNF-α in subjects with chronic non-autoimmune disease became weakened when body mass index was greater than 30 kg/m2. The effect of marine-derived n-3 PUFAs from dietary intake was only assessed in subjects with chronic non-autoimmune disease, and a significant lowering effect was observed on IL-6, but not on CRP and TNF-α. Conclusions Marine-derived n-3 PUFAs supplementation had a significant lowering effect on CRP, IL-6 and TNF-α level. The lowering effect was most effective in non-obese subjects and consecutive long-term supplementation was recommended. PMID:24505395

  2. Interleukin-10 promoter (-1082) polymorphism in association with repeated hospital-acquired infections in elderly patients.

    PubMed

    Bories, Phuong-Nhi; Laurent, Marie; Liuu, Evelyne; Denjean, Lydie; Popovici, Theodora; Paillaud, Elena

    2014-02-01

    Infections are frequent complications of hospitalization, particularly in the elderly. Pro- and anti-inflammatory cytokines are essential components of the host response to pathogens and polymorphisms in their genes may contribute to inter-individual variations of the inflammatory response. The aim of this study was to investigate whether cytokine polymorphisms, separately or in combination, could be determining factors in the development of repeated nosocomial infections in elderly hospitalized patients. Tumor necrosis factor-α (-308) and (-238), interleukin-6 (-174) and (-6331), interleukin-10 (-1082) and (-592) polymorphisms were genotyped by PCR and hybridization with fluorescent-labeled probes in 245 hospitalized elderly patients (mean age 85.2 years; SD 6) and compared with those in 145 healthy adults. The distribution of genotypes did not differ between elderly patients and control subjects. The presence of the interleukin-10 A(592) or A(1082) allele was more frequent individually and after adjustment for multiple comparisons in patients who suffered from several infections (p = 0.012, odds ratio = 5.3; 95 % confidence interval = 1.2-23.1). Our data support a determinant role for interleukin-10 (-1082) polymorphism in the development of nosocomial infections.

  3. The influence of a prophylactic dose of dexamethasone for postoperative nausea and vomiting on plasma interleukin concentrations after laparoscopic cholecystectomy: a randomised trial.

    PubMed

    Ionescu, Daniela C; Hadade, Adina I; Mocan, Teodora A; Margarit, Simona D

    2014-04-01

    Little is known about the effects of small doses of dexamethasone used for the prophylaxis of postoperative nausea and vomiting on the innate host response. We studied the influence of dexamethasone 4 mg on the perioperative plasma concentrations of interleukins after laparoscopic cholecystectomy. We hypothesised that there would be differences in pro-inflammatory interleukin concentrations in patients who received dexamethasone. A randomised controlled study. University hospital. Forty-six patients undergoing laparoscopic cholecystectomy under total intravenous anaesthesia were allocated randomly into one of two study groups; 42 patients completed the study. Patients in group 1 (dexamethasone, n = 22) received dexamethasone 4 mg and group 2 (n = 20) acted as controls. Plasma levels of tumour necrosis factor alpha and interleukins 1β, 6, 8, 10 and 13 were measured before anaesthesia, before surgery and 2 and 24 h after surgery. The frequency and number of episodes of postoperative nausea and vomiting were recorded. Areas under the curve of the percentage variation of interleukins 6 and 8 were significantly lower in the dexamethasone group. There were no significant differences between groups in the areas under the curve for tumour necrosis factor alpha and interleukins 1β, 10 and 13. The greatest variation in interleukin concentrations was 2 h postoperatively, when the concentration of interleukin 6 was greater in the control group, whereas the concentration of interleukin 10 was higher in the dexamethasone group. Twenty-four hours after surgery, only the concentration of interleukin 6 remained significantly increased in both groups (P = 0.001 and P = 0.002, respectively). There were no significant differences between groups in respect of postoperative nausea and vomiting. Prophylactic dexamethasone given before laparoscopic cholecystectomy produced a significant decrease in concentrations of interleukins 6 and 8. Further studies are

  4. IL-17 Promotes Angiogenic Factors IL-6, IL-8, and Vegf Production via Stat1 in Lung Adenocarcinoma.

    PubMed

    Huang, Qi; Duan, Limin; Qian, Xin; Fan, Jinshuo; Lv, Zhilei; Zhang, Xiuxiu; Han, Jieli; Wu, Feng; Guo, Mengfei; Hu, Guorong; Du, Jiao; Chen, Caiyun; Jin, Yang

    2016-11-07

    Inflammation and angiogenesis are two hallmarks of carcinoma. The proinflammatory cytokine interleukin-17 (IL-17) facilitates angiogenesis in lung cancer; however, the underlying mechanism is not fully understood. In this study, tumour microvessel density (MVD) was positively associated with IL-17, interleukin-6 (IL-6), interleukin-8 (IL-8), and vascular endothelial cell growth factor (VEGF) expression in human lung adenocarcinoma tissues, and it was increased in tumour tissues of A549-IL-17 cell-bearing nude mice. Importantly, positive correlations were also detected between IL-17 expression and IL-6, IL-8 and VEGF expression in human lung adenocarcinoma tissues. Furthermore, IL-6, IL-8 and VEGF production, as well as STAT1 phosphorylation, were increased in tumour tissues of A549-IL-17 cell-bearing nude mice in vivo and in A549 and H292 cells following IL-17 stimulation in vitro. In addition, STAT1 knockdown using an inhibitor and siRNA attenuated the IL-17-mediated increases in IL-6, IL-8 and VEGF expression in A549 and H292 cells. In conclusion, IL-17 may promote the production of the angiogenic inducers IL-6, IL-8 and VEGF via STAT1 signalling in lung adenocarcinoma.

  5. Immunohistochemical expression of interleukin-2 receptor and interleukin-6 in patients with prostate cancer and benign prostatic hyperplasia: association with asymptomatic inflammatory prostatitis NIH category IV.

    PubMed

    Engelhardt, Paul Friedrich; Seklehner, Stephan; Brustmann, Hermann; Lusuardi, Lukas; Riedl, Claus R

    2015-04-01

    This study prospectively investigated the immunohistochemical expression of interleukin-2 receptor (IL-2R) and interleukin-6 (IL-6) in patients with prostate cancer and benign prostatic hyperplasia (BPH), and a possible association of these conditions with asymptomatic inflammatory prostatitis National Institutes of Health (NIH) category IV. The study included 139 consecutive patients who underwent transurethral resection of the prostate and transvesical enucleation of the prostate (n = 82) or radical prostatectomy (n = 57). To characterize inflammatory changes the criteria proposed by Irani et al. [J Urol 1997;157:1301-3] were used. IL-2R and IL-6 expression was studied by a standard immunohistochemical method. Results were correlated with tumour, node, metastasis stage, Gleason scores, total prostate-specific antigen, International Prostate Symptom Score and body mass index. IL-2R and IL-6 expression was significantly higher in neoplastic prostate cancer tissue than in normal tissue of prostate cancer patients (p < 0.001 and p < 0.04, respectively). Prostate cancer patients with prostatitis showed significantly higher IL-2R expression than those without inflammation (p < 0.03). In patients with BPH, expression of IL-2R as well as IL-6 was higher in patients with prostatitis than in those without (p < 0.01 and p < 0.02, respectively). IL-2R and IL-6 expression was significantly higher in prostate cancer tissue than in normal tissue. Patients with asymptomatic inflammatory prostatitis NIH category IV showed significantly greater activity.

  6. Clinical Implications of Hepatocyte Growth Factor, Interleukin-20, and Interleukin-22 in Serum and Bronchoalveolar Fluid of Patients with Non-Small Cell Lung Cancer.

    PubMed

    Naumnik, W; Naumnik, B; Niklińska, W; Ossolińska, M; Chyczewska, E

    2016-01-01

    Hepatocyte growth factor (HGF) is involved in tumorigenesis, interleukin-20 (IL-20) is an inhibitor of angiogenesis, and interleukin-22 (IL-22) stimulates tumor growth. The aim of this study was to determine the level of HGF, IL-20, and IL-22 in both serum and bronchoalveolar lavage fluid (BALF) of non-small cell lung cancer (NSCLC) patients before onset of chemotherapy, the nature of the interrelationships between these markers, and their prognostic significance regarding post-chemotherapy survival time. We studied 46 NSCLC patients and 15 healthy subjects as a control group. We found significantly higher serum levels of HGF and IL-22 in the NSCLC patients than those in controls [pg/ml: HGF - 1911 (693-6510) vs. 1333 (838-3667), p = 0.0004; IL-22 - 10.66 (1.44-70.34) vs. 4.69 (0.35-12.29), p = 0.0007]. In contrast, concentrations of HGF and IL-22 in BALF were lower in NSCLC patients than those in controls [pg/ml: HGF - 72 (6-561) vs. 488 (14-2003), p = 0.0002; IL-22 - 2.28 (0.70-6.52) vs. 3.72 (2.76-5.64), p = 0.002]. In the NSCLC patients, there was a negative correlation between the serum level of IL-20 and time to tumor progression (r = -0.405, p = 0.04) and between the serum level of HGF and survival time (r = -0.41, p = 0.005). In addition, a higher serum level of HGF and a higher BALF level of IL-22 in patients were linked with a shorter overall survival. We conclude that HGF, IL-20, and IL-22 in the serum and BALF of NSCLC patients before chemotherapy may be a prognostic of cancer progression.

  7. Stimulation of interleukin-6 production of periodontal ligament cells by Porphyromonas endodontalis lipopolysaccharide.

    PubMed

    Ogura, N; Shibata, Y; Kamino, Y; Matsuda, U; Hayakawa, M; Oikawa, T; Takiguchi, H; Izumi, H; Abiko, Y

    1994-12-01

    Interleukin-6 (IL-6), which is a multifunctional cytokine, has important roles in acute and chronic inflammation and may also be implicated in bone resorption. We examined the IL-6 production in periodontal ligament (PDL) cells which were treated with lipopolysaccharide (LPS) from several oral inflammatory pathogens. The LPS from Porphyromonas endodontalis, which was isolated from infected root canals and radicular cyst fluids, was more potent than the LPS from any other periodontal organisms examined. P. endodontalis LPS stimulated IL-6 release from PDL cells in a time- and dose-dependent manner. Northern blot hybridization analysis revealed that the IL-6 mRNA level in PDL cells was increased by P. endodontalis LPS. These results suggest that stimulation of the IL-6 release of PDL cells by P. endodontalis LPS may have a role in the progression of inflammation and alveolar bone resorption in periodontal and periapical diseases.

  8. Increased levels of circulating interleukin-6 in patients with Hodgkin's disease.

    PubMed

    Gause, A; Scholz, R; Klein, S; Jung, W; Diehl, V; Tesch, H; Hasenclever, D; Pfreundschuh, M

    1991-01-01

    Expression of interleukin-6 (IL-6) and IL-6 receptors has been demonstrated in Hodgkin and Reed-Sternberg (H and RS) cells in vitro and in vivo. In order to evaluate the clinical significance of IL-6 serum levels in patients with Hodgkin's disease (HD), we tested the sera of 56 untreated patients with HD by means of a sensitive sandwich ELISA. While IL-6 was only rarely detectable in healthy controls or patients with non-Hodgkin's lymphoma, 32 of 56 patients (57 per cent) had detectable IL-6 levels (range 12-32 pg/ml). The rates of detectable IL-6 levels and the median levels were not correlated with age, sex, histological subtype, stage or the presence of B-symptoms, nor with any of a wide spectrum of laboratory parameters tested, including erythrocyte sedimentation rate, total leukocyte and lymphocyte counts, serum levels of soluble CD8, CD25 or CD30. The rates of complete remissions and freedom from treatment failure were not different in IL-6-negative and IL-6-positive patients. Except in one of 23 follow-up sera taken after therapy, IL-6 was no longer detectable even for patients who suffered from progressing disease, suggesting that the neoplastic H and RS cells are not the major source of circulating IL-6.

  9. Interleukin 6 protects pancreatic β cells from apoptosis by stimulation of autophagy.

    PubMed

    Linnemann, Amelia K; Blumer, Joseph; Marasco, Michelle R; Battiola, Therese J; Umhoefer, Heidi M; Han, Jee Young; Lamming, Dudley W; Davis, Dawn Belt

    2017-09-01

    IL-6 is a pleiotropic cytokine with complex roles in inflammation and metabolic disease. The role of IL-6 as a pro- or anti-inflammatory cytokine is still unclear. Within the pancreatic islet, IL-6 stimulates secretion of the prosurvival incretin hormone glucagon-like peptide 1 (GLP-1) by α cells and acts directly on β cells to stimulate insulin secretion in vitro Uncovering physiologic mechanisms promoting β-cell survival under conditions of inflammation and stress can identify important pathways for diabetes prevention and treatment. Given the established role of GLP-1 in promoting β-cell survival, we hypothesized that IL-6 may also directly protect β cells from apoptosis. Herein, we show that IL-6 robustly activates signal transducer and activator of transcription 3 (STAT3), a transcription factor that is involved in autophagy. IL-6 stimulates LC3 conversion and autophagosome formation in cultured β cells. In vivo IL-6 infusion stimulates a robust increase in lysosomes in the pancreas that is restricted to the islet. Autophagy is critical for β-cell homeostasis, particularly under conditions of stress and increased insulin demand. The stimulation of autophagy by IL-6 is regulated via multiple complementary mechanisms including inhibition of mammalian target of rapamycin complex 1 (mTORC1) and activation of Akt, ultimately leading to increases in autophagy enzyme production. Pretreatment with IL-6 renders β cells resistant to apoptosis induced by proinflammatory cytokines, and inhibition of autophagy with chloroquine prevents the ability of IL-6 to protect from apoptosis. Importantly, we find that IL-6 can activate STAT3 and the autophagy enzyme GABARAPL1 in human islets. We also see evidence of decreased IL-6 pathway signaling in islets from donors with type 2 diabetes. On the basis of our results, we propose direct stimulation of autophagy as a novel mechanism for IL-6-mediated protection of β cells from stress-induced apoptosis.-Linnemann, A. K

  10. Heat stress, gastrointestinal permeability and interleukin-6 signaling - Implications for exercise performance and fatigue.

    PubMed

    Vargas, Nicole; Marino, Frank

    2016-01-01

    Exercise in heat stress exacerbates performance decrements compared to normothermic environments. It has been documented that the performance decrements are associated with reduced efferent drive from the central nervous system (CNS), however, specific factors that contribute to the decrements are not completely understood. During exertional heat stress, blood flow is preferentially distributed away from the intestinal area to supply the muscles and brain with oxygen. Consequently, the gastrointestinal barrier becomes increasingly permeable, resulting in the release of lipopolysaccharides (LPS, endotoxin) into the circulation. LPS leakage stimulates an acute-phase inflammatory response, including the release of interleukin (IL)-6 in response to an increasingly endotoxic environment. If LPS translocation is too great, heat shock, neurological dysfunction, or death may ensue. IL-6 acts initially in a pro-inflammatory manner during endotoxemia, but can attenuate the response through signaling the hypothalamic pituitary adrenal (HPA)-axis. Likewise, IL-6 is believed to be a thermoregulatory sensor in the gut during the febrile response, hence highlighting its role in periphery - to - brain communication. Recently, IL-6 has been implicated in signaling the CNS and influencing perceptions of fatigue and performance during exercise. Therefore, due to the cascade of events that occur during exertional heat stress, it is possible that the release of LPS and exacerbated response of IL-6 contributes to CNS modulation during exertional heat stress. The purpose of this review is to evaluate previous literature and discuss the potential role for IL-6 during exertional heat stress to modulate performance in favor of whole body preservation.

  11. Soluble urokinase-type plasminogen activator receptor (suPAR) and interleukin-6 levels in hyperemesis gravidarum.

    PubMed

    Desdicioglu, Raziye; Yildirim, Melahat; Kocaoglu, Gulcan; Demir Cendek, Busra; Avcioglu, Gamze; Tas, Emre Erdem; Sengul, Ozlem; Erel, Ozcan; Yavuz, Ayse Filiz

    2017-10-09

    The aim was to compare serum soluble urokinase-type plasminogen activator receptor (suPAR) levels as well as interleukin-6 levels (IL-6) in pregnant women with hyperemesis gravidarum (HG) and asymptomatic pregnant women. Our study population consists of voluntary first trimester-pregnant women who applied to the outpatient clinic of the department of obstetrics and gynecology of Ankara Ataturk Training and Research Hospital. Between February and May 2016, 60 pregnant women were included in our prospective study. Serum suPAR and IL-6 levels were evaluated with the ELISA method. Twenty-nine pregnant women with HG and 31 asymptomatic pregnant women were included in the study. Serum suPAR level in the HG group was measured as 0.36 ± 0.56 ng/ml, whereas this level in the healthy pregnant control group was measured as 0.15 ± 0.15 ng/ml (p < 0.05). The interleukin-6 level in the HG group was 5.69 ± 2.16 pg/ml, whereas in the control group it was measured as 3.88 ± 0.28 pg/ml (p < 0.05). Serum suPAR and IL-6 levels proved to be high in the HG group. It is likely that suPAR could play a role in the etiopathogenesis of hyperemesis gravidarum. Copyright © 2017. Published by Elsevier Taiwan LLC.

  12. Identifying the association between interleukin-6 and lichen planus: A meta-analysis.

    PubMed

    Yin, Meng; Li, Guifeng; Song, Hui; Lin, Song

    2017-05-01

    Numerous studies have examined the association between interleukin-6 and the pathogenesis of lichen planus (LP)/oral LP (OLP) in various populations; however, there is a lack of systematic analysis. The aim of the present study was to assess this association more precisely, thus a meta-analysis was performed. Case-control studies, which were published up to December 2015, were obtained from PubMed, Embase and the China National Knowledge Infrastructure databases. Data were extracted and pooled mean differences (MDs) with 95% confidence intervals (CIs) were calculated. Ultimately, eight studies were included, comprising 299 LP/OLP cases and 231 control subjects. Overall, the pooled MD for IL-6 was 16.24 (95% CI, 9.84-22.64; I 2 =99% for heterogeneity). In the subgroup analysis by ethnicity, a significant increase of the IL-6 expression level was identified among Asian individuals, but not in Caucasian individuals. Thus, IL-6 may be significant in the pathogenesis of LP. However, further studies are required to validate these associations.

  13. Omega-3 fatty acid therapy reduces triglycerides and interleukin-6 in hypertriglyeridemic HIV patients.

    PubMed

    Metkus, T S; Timpone, J; Leaf, D; Bidwell Goetz, M; Harris, W S; Brown, T T

    2013-10-01

    Cardiovascular disease and osteoporosis are common in HIV-infected patients and residual systemic inflammation is thought to contribute to both of these disorders. We performed a randomized placebo-controlled trial of omega-3-acid (O3A) ethyl esters in HIV-infected patients with hypertriglyceridaemia, hypothesizing that O3A would decrease serum levels of triglycerides, markers of systemic inflammation, and markers of bone turnover. HIV-infected patients (n = 48 recruited at three sites) with CD4 count >200 cells/μL, suppressed viral load, and triglycerides >200 mg/dL were randomized to placebo or 3.6 g/d of O3A. Fasting lipid profiles and markers of inflammation and bone turnover were assessed at baseline and after 8 weeks of treatment. Baseline HIV status, lipid profile, bone metabolism and cardiovascular risk factors were similar between the groups. Inflammatory markers were similar between the treatment groups at baseline, except for interleukin (IL)-6 and tumour necrosis factor (TNF)-α, which were higher in the O3A group. The concentration of triglycerides in patients receiving O3A decreased by a median (interquartile range (IQR)) of -34 (-149, 9.5) mg/dL vs. a median increase of 46.5 (-51, 123) mg/dL in the placebo group (P = 0.01). The median percentage change in IL-6 was greater in the O3A group compared with the placebo group [-39% (-63, 12%) vs. 29% (10, 177%), respectively; P = 0.006]. Similar results were observed for TNF-α, but not other inflammatory or bone turnover markers. O3A ethyl esters decreased the concentrations of triglycerides, IL-6 and TNF-α in patients with well-controlled HIV infection and hypertriglyceridaemia. Larger studies are required to confirm these findings and investigate their clinical significance. © 2013 British HIV Association.

  14. The combined role of serotonin and interleukin-6 as biomarker for autism.

    PubMed

    Yang, C-J; Liu, C-L; Sang, B; Zhu, X-M; Du, Y-J

    2015-01-22

    Autism is a severe neurodevelopmental disorder characterized by impairments in social interaction and repetitive behaviors. Diagnosis of autism is currently phenotype based with no reliable laboratory test available to assist clinicians. It has been shown that dysfunction of serotonin (5-HT) and interleukin-6 (IL-6) are involved in autism. The goal of this study was to evaluate the combined role of 5-HT and IL-6 as potential biomarkers for autism. The whole blood concentration of 5-HT and plasma concentration of IL-6 of individuals with autism were significantly elevated compared with the control group, and the concentration of 5-HT and IL-6 had positive correlations with the severity of autism. The results of receiver operating characteristic (ROC) analysis indicated that the combination of 5-HT and IL-6 produced the best sensitivity and specificity for diagnosis of autism. Therefore, the present study has revealed a simple clinical method with great potential for assisting the diagnosis of autism. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  15. Interleukin-10 and tumour necrosis factor-alpha serum levels in chronic Chagas disease patients.

    PubMed

    Vasconcelos, R H T; Azevedo, E de A N; Diniz, G T N; Cavalcanti, M da G A de M; de Oliveira, W; de Morais, C N L; Gomes, Y de M

    2015-07-01

    In Chagas disease, chronically infected individuals may be asymptomatic or may present cardiac or digestive complications, and it is well known that the human immune response is related to different clinical manifestations. Different patterns of cytokine levels have been previously described in different clinical forms of this disease, but contradictory results are reported. Our aim was to evaluate the serum levels of interleukin-10 and tumour necrosis factor-alpha in patients with asymptomatic and cardiac Chagas disease. The serum interleukin-10 levels in patients with cardiomyopathy were higher than those in asymptomatic patients, mainly in those without heart enlargement. Although no significant difference was observed in serum tumour necrosis factor-alpha levels among the patients, we found that cardiac patients also present high levels of this cytokine, largely those with heart dilatation. Therefore, these cytokines play an important role in chronic Chagas disease cardiomyopathy. Follow-up investigations of these and other cytokines in patients with chronic Chagas disease need to be conducted to improve the understanding of the immunopathology of this disease. © 2015 John Wiley & Sons Ltd.

  16. Interleukin-17A correlates with interleukin-6 production in human cystic echinococcosis: a possible involvement of IL-17A in immunoprotection against Echinococcus granulosus infection.

    PubMed

    Mezioug, Dalila; Touil-Boukoffa, Chafia

    2012-01-01

    Hydatidosis is a parasitic disease caused by the development, in humans and other mammals, of the larval form of Taenia, Echinococcus granulosus. It is one of the world's major zoonotic infections. This study aimed to examine interleukin-6 (IL-6), interferon-γ (IFN-γ) and interleukin-17A (IL-17A) production in patients with cystic echinococcosis (CE), and the role of IL-17A in the modulation of the immune response against the extracellular parasite, E. granulosus. A relationship between IL-6, IL-17A production and C reactive Protein (CRP) levels was also assessed. IL-6, IFN-γ, IL-17A and CRP production were determined in serum from Algerian hydatid patients. Cytokine production was also measured in supernatants from cultures of peripheral blood mononuclear cells (PBMCs) from hydatid patients stimulated by a major parasitic antigen (antigen-5). The increased activity of IL-6, IFN-γ and IL-17A were observed in most serum samples from patients. In contrast, healthy controls showed only minor levels. Similarly, high levels of CRP were detected. Our in vitro results indicate a positive correlation between IL-6, IFN-γ and IL-17A production in PBMC culture supernatants. However, IL-6, IFN-γ and IL-17A activity was low in serum and supernatants of PBMC cultures from relapsing patients, and there was no evidence of an immune response against parasitic antigen. Collectively, our results show that IL-17A was produced during human cystic echinococcosis, and was involved in the host defense mechanisms against the extracellular parasite E. granulosus. Our data suggest that IL-17A plays an immunoprotective role in this parasitic, helminth infection.

  17. The Thyroid Hormone Receptors Inhibit Hepatic Interleukin-6 Signaling During Endotoxemia.

    PubMed

    Contreras-Jurado, Constanza; Alonso-Merino, Elvira; Saiz-Ladera, Cristina; Valiño, Arturo José; Regadera, Javier; Alemany, Susana; Aranda, Ana

    2016-08-03

    Decreased thyroidal hormone production is found during lipopolysaccharide (LPS)-induced endotoxic shock in animals as well as in critically ill patients. Here we studied the role of the thyroid hormone receptors (TRs) in activation of STAT3, NF-κB and ERK, which play a key role in the response to inflammatory cytokines during sepsis. TR knockout mice showed down-regulation of hepatic inflammatory mediators, including interleukin 6 (IL-6) in response to LPS. Paradoxically, STAT3 and ERK activity were higher, suggesting that TRs could act as endogenous repressors of these pathways. Furthermore, hyperthyroidism increased cytokine production and mortality in response to LPS, despite decreasing hepatic STAT3 and ERK activity. This suggested that TRs could directly repress the response of the cells to inflammatory mediators. Indeed, we found that the thyroid hormone T3 suppresses IL-6 signalling in macrophages and hepatocarcinoma cells, inhibiting STAT3 activation. Consequently, the hormone strongly antagonizes IL-6-stimulated gene transcription, reducing STAT3 recruitment and histone acetylation at IL-6 target promoters. In conclusion, TRs are potent regulators of inflammatory responses and immune homeostasis during sepsis. Reduced responses to IL-6 should serve as a negative feedback mechanism for preventing deleterious effects of excessive hormone signaling during infections.

  18. The Thyroid Hormone Receptors Inhibit Hepatic Interleukin-6 Signaling During Endotoxemia

    PubMed Central

    Contreras-Jurado, Constanza; Alonso-Merino, Elvira; Saiz-Ladera, Cristina; Valiño, Arturo José; Regadera, Javier; Alemany, Susana; Aranda, Ana

    2016-01-01

    Decreased thyroidal hormone production is found during lipopolysaccharide (LPS)-induced endotoxic shock in animals as well as in critically ill patients. Here we studied the role of the thyroid hormone receptors (TRs) in activation of STAT3, NF-κB and ERK, which play a key role in the response to inflammatory cytokines during sepsis. TR knockout mice showed down-regulation of hepatic inflammatory mediators, including interleukin 6 (IL-6) in response to LPS. Paradoxically, STAT3 and ERK activity were higher, suggesting that TRs could act as endogenous repressors of these pathways. Furthermore, hyperthyroidism increased cytokine production and mortality in response to LPS, despite decreasing hepatic STAT3 and ERK activity. This suggested that TRs could directly repress the response of the cells to inflammatory mediators. Indeed, we found that the thyroid hormone T3 suppresses IL-6 signalling in macrophages and hepatocarcinoma cells, inhibiting STAT3 activation. Consequently, the hormone strongly antagonizes IL-6-stimulated gene transcription, reducing STAT3 recruitment and histone acetylation at IL-6 target promoters. In conclusion, TRs are potent regulators of inflammatory responses and immune homeostasis during sepsis. Reduced responses to IL-6 should serve as a negative feedback mechanism for preventing deleterious effects of excessive hormone signaling during infections. PMID:27484112

  19. Polysaccharide peptide from Coriolus versicolor induces interleukin 6-related extension of endotoxin fever in rats.

    PubMed

    Jedrzejewski, Tomasz; Piotrowski, Jakub; Kowalczewska, Malgorzata; Wrotek, Sylwia; Kozak, Wieslaw

    2015-01-01

    Polysaccharide peptide (PSP) extracted from the Coriolus versicolor mushroom is frequently suggested as an adjunct to the chemo- or radiotherapy in cancer patients. In a previous study we showed that PSP induced a tumour necrosis factor-α (TNF-α)-dependent anapyrexia-like response in rats. Thus, PSP appears to be a factor which modifies a number of pathophysiological responses. Because of this, PSP is suggested as a potential adjuvant for cancer therapy during which cancer patients frequently contract microbial infections accompanied by fever. The aim of the present study was to investigate whether or not PSP can modulate the course of the fever in response to an antigen such as lipopolysaccharide (LPS). Body temperature (Tb) of male Wistar rats was measured by biotelemetry. PSP was injected intraperitoneally (i.p.) at a dose of 100 mg kg(-1), 2 h before LPS administration (50 µg kg(-1), i.p.). The levels of interleukin (IL)-6 and TNF-α in the plasma of rats were estimated 3 h and 14 h post-injection of PSP using a standard sandwich ELISA kit. We report that i.p. pre-injection of PSP 2 h before LPS administration expanded the duration of endotoxin fever in rats. This phenomenon was accompanied by a significant elevation of the blood IL-6 level of rats both 3 h and 14 h post-injection of PSP. Pre-treatment i.p. of the rats with anti-IL-6 antibody (30 µg/rat) prevented the PSP-induced prolongation of endotoxin fever. Based on these data, we conclude that PSP modifies the LPS-induced fever in IL-6-related fashion.

  20. Arecoline decreases interleukin-6 production and induces apoptosis and cell cycle arrest in human basal cell carcinoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Li-Wen; Hsieh, Bau-Shan; Cheng, Hsiao-Ling

    2012-01-15

    Arecoline, the most abundant areca alkaloid, has been reported to decrease interleukin-6 (IL-6) levels in epithelial cancer cells. Since IL-6 overexpression contributes to the tumorigenic potency of basal cell carcinoma (BCC), this study was designed to investigate whether arecoline altered IL-6 expression and its downstream regulation of apoptosis and the cell cycle in cultured BCC-1/KMC cells. BCC-1/KMC cells and a human keratinocyte cell line, HaCaT, were treated with arecoline at concentrations ranging from 10 to 100 μg/ml, then IL-6 production and expression of apoptosis- and cell cycle progress-related factors were examined. After 24 h exposure, arecoline inhibited BCC-1/KMC cell growthmore » and decreased IL-6 production in terms of mRNA expression and protein secretion, but had no effect on HaCaT cells. Analysis of DNA fragmentation and chromatin condensation showed that arecoline induced apoptosis of BCC-1/KMC cells in a dose-dependent manner, activated caspase-3, and decreased expression of the anti-apoptotic protein Bcl-2. In addition, arecoline induced progressive and sustained accumulation of BCC-1/KMC cells in G2/M phase as a result of reducing checkpoint Cdc2 activity by decreasing Cdc25C phosphatase levels and increasing p53 levels. Furthermore, subcutaneous injection of arecoline led to decreased BCC-1/KMC tumor growth in BALB/c mice by inducing apoptosis. This study demonstrates that arecoline has potential for preventing BCC tumorigenesis by reducing levels of the tumor cell survival factor IL-6, increasing levels of the tumor suppressor factor p53, and eliciting cell cycle arrest, followed by apoptosis. Highlights: ► Arecoline has potential to prevent against basal cell carcinoma tumorigenesis. ► It has more effectiveness on BCC as compared with a human keratinocyte cell line. ► Mechanisms involved including reducing tumor cells’ survival factor IL-6, ► Decreasing Cdc25C phosphatase, enhancing tumor suppressor factor p53,

  1. Regulation of body temperature and neuroprotection by endogenous interleukin-6 in cerebral ischemia.

    PubMed

    Herrmann, Oliver; Tarabin, Victoria; Suzuki, Shigeaki; Attigah, Nicolas; Coserea, Irinel; Schneider, Armin; Vogel, Johannes; Prinz, Simone; Schwab, Stefan; Monyer, Hannah; Brombacher, Frank; Schwaninger, Markus

    2003-04-01

    Although the function of fever is still unclear, it is now beyond doubt that body temperature influences the outcome of brain damage. An elevated body temperature is often found in stroke patients and denotes a bad prognosis. However, the pathophysiologic basis and treatment options of elevated body temperature after stroke are still unknown. Cerebral ischemia rapidly induced neuronal interleukin-6 (IL-6) expression in mice. In IL-6-deficient mice, body temperature was markedly decreased after middle cerebral artery occlusion (MCAO), but infarct size was comparable to that in control mice. If body temperature was controlled by external warming after MCAO, IL-6-deficient mice had a reduced survival, worse neurologic status, and larger infarcts than control animals. In cell culture, IL-6 exerted an antiapoptotic and neuroprotective effect. These data suggest that IL-6 is a key regulator of body temperature and an endogenous neuroprotectant in cerebral ischemia. Neuroprotective properties apparently compensate for its pyretic action after MCAO and enhance the safety of this endogenous pyrogen.

  2. Effect of exercise intensity on cerebrospinal fluid interleukin-6 concentration during recovery from exhaustive exercise in rats.

    PubMed

    Kılıç, M; Ulusoy, Ö; Cırrık, S; Hindistan, I E; Ozkaya, Y Gül

    2014-03-01

    The purpose of this study was to investigate the possible role of moderate and strenuous swimming training on plasma and cerebrospinal fluid (CSF) IL-6 (interleukin-6) levels during recovery from exhaustive exercise in rats. Wistar rats were divided into three groups: sedentary control (C), moderately trained (MT) and strenuously trained (ST). MT rats underwent swimming exercise for one hour/day and 5 days/week for 8 weeks. Animals in the ST group began swimming with 1 h/day and swimming duration was progressively increased by 30 min/wk, reaching 2.5 h/day by week 4 and stayed constant for an additional 4 weeks. After all animals underwent an acute exhaustive swimming exercise, animals were divided into 3 groups, and decapitated immediately, 24 and 48 hours after exhaustion to obtain tissue samples. Muscle citrate synthase activity, plasma and CSF IL-6 levels were determined. The citrate synthase activity was found to be higher in MT and ST groups compared to the C group. Although plasma IL-6 levels were found unaltered among all groups, the CSF IL-6 concentration was found to be increased 24 hours after exhaustive exercise of the ST group. We conclude that exercise training intensity is an important factor determining cerebrospinal IL-6 concentration after exhaustive exercise.

  3. The impact of anxiety and catastrophizing on interleukin-6 responses to acute painful stress

    PubMed Central

    Lazaridou, Asimina; Martel, Marc O; Cahalan, Christine M; Cornelius, Marise C; Franceschelli, Olivia; Campbell, Claudia M; Haythornthwaite, Jennifer A; Smith, Michael; Riley, Joseph; Edwards, Robert R

    2018-01-01

    Objective To examine the influence of anxiety and pain-related catastrophizing on the time course of acute interleukin-6 (IL-6) responses to standardized noxious stimulation among patients with chronic pain. Methods Data were collected from 48 participants in the following demographically matched groups: patients with chronic pain (n=36) and healthy controls (n=12). Participants underwent a series of Quantitative Sensory Testing (QST) procedures assessing responses to mechanical and thermal stimuli during two separate visits, in a randomized order. One visit consisted of standard, moderately painful QST procedures, while the other visit involved nonpainful analogs to these testing procedures. Blood samples were taken at baseline, and then for up to 2 hours after QST in order to study the time course of IL-6 responses. Results Results of multilevel analyses revealed that IL-6 responses increased across assessment time points in both visits (p<0.001). While patients with chronic pain and healthy controls did not differ in the magnitude of IL-6 responses, psychological factors influenced IL-6 trajectories only in the chronic pain group. Among patients, increases in catastrophizing over the course of the QST session were associated with elevated IL-6 responses only during the painful QST session (p<0.05). When controlling for anxiety, results indicated that the main multilevel model among patients remained significant (p<0.05). Conclusion Under specific conditions (eg, application of a painful stressor), catastrophizing may be associated with amplified proinflammatory responses in patients with persistent pain. These findings suggest that psychosocial interventions that reduce negative pain-related cognitions may benefit patients’ inflammatory profiles. PMID:29636630

  4. Interleukin 1 and Tumor Necrosis Factor Inhibit Cardiac Myocyte β -adrenergic Responsiveness

    NASA Astrophysics Data System (ADS)

    Gulick, Tod; Chung, Mina K.; Pieper, Stephen J.; Lange, Louis G.; Schreiner, George F.

    1989-09-01

    Reversible congestive heart failure can accompany cardiac allograft rejection and inflammatory myocarditis, conditions associated with an immune cell infiltrate of the myocardium. To determine whether immune cell secretory products alter cardiac muscle metabolism without cytotoxicity, we cultured cardiac myocytes in the presence of culture supernatants from activated immune cells. We observed that these culture supernatants inhibit β -adrenergic agonist-mediated increases in cultured cardiac myocyte contractility and intracellular cAMP accumulation. The myocyte contractile response to increased extracellular Ca2+ concentration is unaltered by prior exposure to these culture supernatants, as is the increase in myocyte intracellular cAMP concentration in response to stimulation with forskolin, a direct adenyl cyclase activator. Inhibition occurs in the absence of alteration in β -adrenergic receptor density or ligand binding affinity. Suppressive activity is attributable to the macrophage-derived cytokines interleukin 1 and tumor necrosis factor. Thus, these observations describe a role for defined cytokines in regulating the hormonal responsiveness and function of contractile cells. The effects of interleukin 1 and tumor necrosis factor on intracellular cAMP accumulation may be a model for immune modulation of other cellular functions dependent upon cyclic nucleotide metabolism. The uncoupling of agonist-occupied receptors from adenyl cyclase suggests that β -receptor or guanine nucleotide binding protein function is altered by the direct or indirect action of cytokines on cardiac muscle cells.

  5. Early interleukin-6 enhances hepatic ketogenesis in APPSWE/PSEN1dE9 mice via 3-hydroxy-3-methylglutary-CoA synthase 2 signaling activation by p38/nuclear factor κB p65.

    PubMed

    Shi, Le; Zhao, Daina; Hou, Chen; Peng, Yunhua; Liu, Jing; Zhang, Shuangxi; Liu, Jiankang; Long, Jiangang

    2017-08-01

    Alzheimer's disease (AD) is considered a multifactorial disease that affects the central nervous system and periphery. A decline in brain glucose metabolism is an early feature of AD and is accompanied by a phenotypic shift from aerobic glycolysis to ketogenesis. The liver is responsible for the generation of the ketone body. However, the mechanism that underlies hepatic ketogenesis in AD remains unclear. Here, we investigated hepatic ketogenesis during the early stage of AD pathogenesis in amyloid precursor protein (APP SWE ) and presenilin (PSEN1dE9) (APP/PS1) mice. We observed that β-hydroxybutyric acid was increased in the brain of the postmortem mild cognitive impairment and AD subjects and in 3-month-old APP/PS1 AD mice. A rise in 3-hydroxy-3-methylglutary-CoA synthase 2 (HMGCS2), a key enzyme for catalyzing β-hydroxybutyric acid production, was observed in early AD mice. We further showed that proinflammatory cytokines were activated in the liver prior to their activation in the brain of 3-month-old APP/PS1 mice. Among the cytokines, interleukin-6 significantly activated HMGCS2 through the binding of nuclear factor κB (NF-κB) p65 to the HMGCS2 promoter. Additionally, interleukin-6 stimulated phosphorylation of p38 mitogen activated protein kinases, an upstream molecule for NF-κB p65 signaling. We have demonstrated that a hepatic inflammatory factor enhances ketogenesis through HMGCS2 signaling activation by p38/NF-κB p65. These results provide a novel peripheral metabolic mechanism for enhanced ketone production and suggest a plausible early AD phenotype to diagnose AD. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Selection of hammerhead ribozymes for optimum cleavage of interleukin 6 mRNA.

    PubMed Central

    Hendrix, C; Anné, J; Joris, B; Van Aerschot, A; Herdewijn, P

    1996-01-01

    Four GUC triplets in the coding region of the MRNA of interleukin 6 (IL-6) were examined for their suitabilty to serve as a target for hammerhead ribozome-mediated cleavage. This selection procedure was performed with the intention to downregulate IL-6 production as a potential treatment of those diseases in which IL-6 overexpression is involved. Hammerhead ribozymes and their respective short synthetic substrates (19-mers) were synthesized for these four GUC triplets. Notwithstanding the identical catalytic core sequences, the difference in base composition of the helices involved in substrate binding caused substantial variation in cleavage activity. The cleavage reactions on the 1035 nucleotide IL-6 mRNA transcript revealed that two ribozymes were able to cleave this substrate, showing a decrease in catalytic efficiency to 1/30 and 1/300 of the short substrate. This study indicates that the GUC triplet located at nucleotide 510 of the mRNA of IL-6 is the best site for hammerhead ribozyme-mediated cleavage. We suggest that in future targeting of chemically modified hammerhead ribosomes for cleavage of IL-6 RNA should be directed at this location. PMID:8670082

  7. Interleukin-6 amplifies glucagon secretion: coordinated control via the brain and pancreas

    PubMed Central

    Barnes, Tammy M.; Otero, Yolanda F.; Elliott, Amicia D.; Locke, Alicia D.; Malabanan, Carlo M.; Coldren, Anastasia G.; Brissova, Marcela; Piston, David W.

    2014-01-01

    Inappropriate glucagon secretion contributes to hyperglycemia in inflammatory disease. Previous work implicates the proinflammatory cytokine interleukin-6 (IL-6) in glucagon secretion. IL-6-KO mice have a blunted glucagon response to lipopolysaccharide (LPS) that is restored by intravenous replacement of IL-6. Given that IL-6 has previously been demonstrated to have a transcriptional (i.e., slow) effect on glucagon secretion from islets, we hypothesized that the rapid increase in glucagon following LPS occurred by a faster mechanism, such as by action within the brain. Using chronically catheterized conscious mice, we have demonstrated that central IL-6 stimulates glucagon secretion uniquely in the presence of an accompanying stressor (hypoglycemia or LPS). Contrary to our hypothesis, however, we found that IL-6 amplifies glucagon secretion in two ways; IL-6 not only stimulates glucagon secretion via the brain but also by direct action on islets. Interestingly, IL-6 augments glucagon secretion from both sites only in the presence of an accompanying stressor (such as epinephrine). Given that both adrenergic tone and plasma IL-6 are elevated in multiple inflammatory diseases, the interactions of the IL-6 and catecholaminergic signaling pathways in regulating GCG secretion may contribute to our present understanding of these diseases. PMID:25205821

  8. Cloning of a cancer cell-producing hepatocyte growth factor, vascular endothelial growth factor, and interleukin-8 from gastric cancer cells.

    PubMed

    Iwai, Mineko; Matsuda, Masahiko; Iwai, Yoshiaki

    2003-01-01

    A cell colony (IM95m) that produces hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF), and interleukin-8 (IL-8) was cloned from gastric cancer cells (IM95 cell line). In culture medium, the highest levels of HGF, VEGF, and IL-8 were about 1.1, 0.9, and 0.17 ng/ml culture medium at 3 d from 10(5) cells. IM95m may be useful in elucidating the role of tumor cells in angiogenesis.

  9. Interleukin-6 Level among Shift and Night Workers in Japan: Cross-Sectional Analysis of the J-HOPE Study.

    PubMed

    Amano, Hoichi; Fukuda, Yoshiharu; Yokoo, Takashi; Yamaoka, Kazue

    2018-03-27

    Shift workers have a high risk of cardiovascular disease (CVD). Systemic inflammation measured has been associated with the risk of CVD onset, in addition to classical risk factors. However, the association between work schedule and inflammatory cytokine levels remains unclear. The purpose of this study was to examine the association between work schedule and interleukin-6 (IL-6)/high-sensitivity C-reactive protein (hs-CRP) levels among Japanese workers. The present cross-sectional study was a part of the Japanese Study of Health, Occupation and Psychosocial Factors Related Equity (J-HOPE). A total of 5259 persons who measured inflammatory cytokine were analyzed in this study. One-way analysis of variance was used to test log-transformed IL-6/hs-CRP differences by work schedule. Multiple regression analysis was used to examine the difference adjusted for other possible CVD risk factors. There were 3660 participants who had a regular work schedule; the remaining schedules were shift work without night work for 181 participants, shift work with night work for 1276 participants, and only night work for 142 participants. The unadjusted model showed that only night workers were significantly related to high levels of IL-6 compared with regular workers. Even in the multiple regression analysis, the higher level of IL-6 among only night workers remained significant (β=0.058, P=0.01). On the contrary, hs-CRP was not. The present study revealed that only night shift work is significantly associated with high levels of IL-6 in Japanese workers. These observations help us understand the mechanism for the association between work schedule and CVD onset.

  10. Gene-specific regulation of hepatic selenoprotein expression by interleukin-6.

    PubMed

    Martitz, J; Becker, N-P; Renko, K; Stoedter, M; Hybsier, S; Schomburg, L

    2015-11-01

    Sepsis is a severe inflammatory disease resulting in excessive production of pro-inflammatory cytokines including interleukin-6 (IL-6), causing oxidative stress, tissue damage and organ dysfunction. Health benefits have been observed upon selenium (Se) supplementation in severe sepsis. Selenium is incorporated into selenoproteins implicated in anti-oxidative defence, thyroid hormone metabolism and immunoregulation. Selenium metabolism is controlled by hepatocytes synthesizing and secreting the Se transporter selenoprotein P (SePP). The circulating SePP declines in sepsis causing low serum Se levels. Dysregulation of the hepatic selenoenzyme deiodinase type 1 (DIO1) potentially contributes to the low T3 (thyroid hormone) syndrome observed in severe diseases. We hypothesized that IL-6 affects hepatic selenoprotein biosynthesis directly. Testing human hepatocytes in culture, IL-6 reduced the concentrations of SePP mRNA and secreted SePP in a dose-dependent manner. In parallel, expression of DIO1 declined at the mRNA, protein and enzyme activity level. The effects of IL-6 on glutathione peroxidase (GPX) expression were isozyme-specific; GPX1 remained unaffected, while transcript concentrations of GPX2 increased and those of GPX4 decreased. This pattern of IL-6-dependent effects was mirrored in reporter gene experiments with SePP, DIO1, GPX1, and GPX2 promoter constructs pointing to direct transcriptional effects of IL-6. The redirection of hepatic selenoprotein biosynthesis by IL-6 may represent a central regulatory circuit responsible for the decline of serum Se and low T3 concentrations in sepsis. Accordingly, therapeutic IL-6 targeting may be effective for improving the Se and thyroid hormone status, adjuvant Se supplementation success and survival in sepsis.

  11. Phospholipase C-{delta}{sub 1} regulates interleukin-1{beta} and tumor necrosis factor-{alpha} mRNA expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chung, Eric; Jakinovich, Paul; Bae, Aekyung

    Phospholipase C-{delta}{sub 1} (PLC{delta}{sub 1}) is a widely expressed highly active PLC isoform, modulated by Ca{sup 2+} that appears to operate downstream from receptor signaling and has been linked to regulation of cytokine production. Here we investigated whether PLC{delta}{sub 1} modulated expression of the pro-inflammatory cytokines interleukin-1{beta} (IL-1{beta}), tumor necrosis factor-{alpha} (TNF-{alpha}) and interleukin-6 (IL-6) in rat C6 glioma cells. Expression of PLC{delta}{sub 1} was specifically suppressed by small interfering RNA (siRNA) and the effects on cytokine mRNA expression, stimulated by the Toll-like receptor (TLR) agonist, lipopolysaccharide (LPS), were examined. Real-time polymerase chain reaction (RT-PCR) results showed that PLC{delta}{sub 1}more » knockdown enhanced expression IL-1{beta} and tumor necrosis factor-{alpha} (TNF-{alpha}) mRNA by at least 100 fold after 4 h of LPS stimulation compared to control siRNA treatment. PLC{delta}{sub 1} knock down caused persistently high Nf{kappa}b levels at 4 h of LPS stimulation compared to control siRNA-treated cells. PLC{delta}{sub 1} knockdown was also associated with elevated nuclear levels of c-Jun after 30 min of LPS stimulation, but did not affect LPS-stimulated p38 or p42/44 MAPK phosphorylation, normally associated with TLR activation of cytokine gene expression; rather, enhanced protein kinase C (PKC) phosphorylation of cellular proteins was observed in the absence of LPS stimulation. An inhibitor of PKC, bisindolylmaleimide II (BIM), reversed phosphorylation, prevented elevation of nuclear c-Jun levels, and inhibited LPS-induced increases of IL-1{beta} and TNF-{alpha} mRNA's induced by PLC{delta}{sub 1} knockdown. Our results show that loss of PLC{delta}{sub 1} enhances PKC/c-Jun signaling and up-modulates pro-inflammatory cytokine gene transcription in concert with the TLR-stimulated p38MAPK/Nf{kappa}b pathway. Our findings are consistent with the idea that PLC{delta}{sub 1} is

  12. Secretory vesicles of immune cells contain only a limited number of interleukin 6 molecules.

    PubMed

    Verboogen, Daniëlle R J; Ter Beest, Martin; Honigmann, Alf; van den Bogaart, Geert

    2018-05-01

    Immune cells communicate by releasing large quantities of cytokines. Although the mechanisms of cytokine secretion are increasingly understood, quantitative knowledge of the number of cytokines per vesicle is still lacking. Here, we measured with quantitative microscopy the release rate of vesicles potentially carrying interleukin-6 (IL-6) in human dendritic cells. By comparing this to the total secreted IL-6, we estimate that secretory vesicles contain about 0.5-3 IL-6 molecules, but with a large spread among cells/donors. Moreover, IL-6 did not accumulate within most cells, indicating that synthesis and not trafficking is the bottleneck for IL-6 production. IL-6 accumulated in the Golgi apparatus only in ~ 10% of the cells. Understanding how immune cells produce cytokines is important for designing new immunomodulatory drugs. © 2018 The Authors. FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  13. The Dose–Response Association between Nitrogen Dioxide Exposure and Serum Interleukin-6 Concentrations

    PubMed Central

    Perret, Jennifer L.; Bowatte, Gayan; Lodge, Caroline J.; Knibbs, Luke D.; Gurrin, Lyle C.; Kandane-Rathnayake, Rangi; Johns, David P.; Lowe, Adrian J.; Burgess, John A.; Thompson, Bruce R.; Thomas, Paul S.; Wood-Baker, Richard; Morrison, Stephen; Giles, Graham G.; Marks, Guy; Markos, James; Tang, Mimi L. K.; Abramson, Michael J.; Walters, E. Haydn; Matheson, Melanie C.; Dharmage, Shyamali C.

    2017-01-01

    Systemic inflammation is an integral part of chronic obstructive pulmonary disease (COPD), and air pollution is associated with cardiorespiratory mortality, yet the interrelationships are not fully defined. We examined associations between nitrogen dioxide (NO2) exposure (as a marker of traffic-related air pollution) and pro-inflammatory cytokines, and investigated effect modification and mediation by post-bronchodilator airflow obstruction (post-BD-AO) and cardiovascular risk. Data from middle-aged participants in the Tasmanian Longitudinal Health Study (TAHS, n = 1389) were analyzed by multivariable logistic regression, using serum interleukin (IL)-6, IL-8 and tumor necrosis factor-α (TNF-α) as the outcome. Mean annual NO2 exposure was estimated at residential addresses using a validated satellite-based land-use regression model. Post-BD-AO was defined by post-BD forced expiratory ratio (FEV1/FVC) < lower limit of normal, and cardiovascular risk by a history of either cerebrovascular or ischaemic heart disease. We found a positive association with increasing serum IL-6 concentration (geometric mean 1.20 (95% CI: 1.1 to 1.3, p = 0.001) per quartile increase in NO2). This was predominantly a direct relationship, with little evidence for either effect modification or mediation via post-BD-AO, or for the small subgroup who reported cardiovascular events. However, there was some evidence consistent with serum IL-6 being on the causal pathway between NO2 and cardiovascular risk. These findings raise the possibility that the interplay between air pollution and systemic inflammation may differ between post-BD airflow obstruction and cardiovascular diseases. PMID:28481326

  14. Human Bone Marrow-Derived Mesenchymal Cell Reactions to 316L Stainless Steel: An in Vitro Study on Cell Viability and Interleukin-6 Expression.

    PubMed

    Anwar, Iwan Budiwan; Santoso, Asep; Saputra, Eko; Ismail, Rifky; Jamari, J; Van der Heide, Emile

    2017-06-01

    Purpose: Human bone marrow-derived mesenchymal cell (hBMC) reactions to 316L stainless steel (316L-SS) have never been evaluated. The objective of this study was to assess cell viability and interleukin-6 expression of hBMC cultures upon treatment with a 316L-SS implant. Methods: A cytotoxicity analysis was conducted with a 3-(4,5-dimethylthiazol 2-yl)-2,5-diphenyltetrazolium (MTT) assay after a period of 24, 48 and 72 hours of incubation. Expression of interleukin-6 was measured using enzyme-linked immunosorbent assay (ELISA). Results: Cell viability measurement was performed via IC50 formula. All treatment group showed a > 50 % cell viability with a range of 56,5 - 96,9 % at 24 hours, 51,8-77,3% at 48 hours and 70,1- 120 % at 72 hours. Interleukin-6 expression was downregulated subsequent to treatment with 316L-SS compared to the control group. Conclusion: We found that 316L-SS did not exhibit toxicity towards hBMC culture.

  15. Human Bone Marrow-Derived Mesenchymal Cell Reactions to 316L Stainless Steel: An in Vitro Study on Cell Viability and Interleukin-6 Expression

    PubMed Central

    Anwar, Iwan Budiwan; Santoso, Asep; Saputra, Eko; Ismail, Rifky; Jamari, J.; Van der Heide, Emile

    2017-01-01

    Purpose: Human bone marrow-derived mesenchymal cell (hBMC) reactions to 316L stainless steel (316L-SS) have never been evaluated. The objective of this study was to assess cell viability and interleukin-6 expression of hBMC cultures upon treatment with a 316L-SS implant. Methods: A cytotoxicity analysis was conducted with a 3-(4,5-dimethylthiazol 2-yl)-2,5-diphenyltetrazolium (MTT) assay after a period of 24, 48 and 72 hours of incubation. Expression of interleukin-6 was measured using enzyme-linked immunosorbent assay (ELISA). Results: Cell viability measurement was performed via IC50 formula. All treatment group showed a > 50 % cell viability with a range of 56,5 - 96,9 % at 24 hours, 51,8-77,3% at 48 hours and 70,1- 120 % at 72 hours. Interleukin-6 expression was downregulated subsequent to treatment with 316L-SS compared to the control group. Conclusion: We found that 316L-SS did not exhibit toxicity towards hBMC culture. PMID:28761837

  16. Interleukin-6 and Interleukin-8 Levels Correlate With the Severity of Aplastic Anemia in Children.

    PubMed

    Gupta, Vineeta; Kumar, Sushil; Sonowal, Rimjhim; Singh, Surya K

    2017-04-01

    The aim of this study was to evaluate the levels of interleukin (IL)-6 and IL-8 in patients with aplastic anemia and its correlation with severity of the disease. IL-6 and IL-8 levels were measured in 40 patients with aplastic anemia in the age group of 4 to 14 years. A total of 40 healthy children served as controls. Quantitative estimation of IL-6 and IL-8 was performed using a solid-phase sandwich ELISA kit. Results were presented as IL-6 and IL-8 concentrations in pg/mL. Patients received immunosuppressive therapy per the British Committee for Standards in Haematology Guidelines 2009. Mean age of the patients was 9.78±2.74 years. IL-6 level of patients was elevated compared with controls (193.48±352.3 vs. 4.58±3.39; P<0.001). IL-8 levels were also significantly elevated in patients compared with controls (15.58±18.0 vs. 1.85±0.95; P<0.001). IL levels were also assessed in relation to severity of the disease. Levels were the highest in patients with very severe aplastic anemia (724.33±519.42), followed by severe aplastic anemia (80.51±66.28 pg/mL), and non-severe aplastic anemia (6.01±1.89). Differences were statistically significant. A similar trend was also observed for IL-8 levels, where the levels were 41.02±24.23, 11.34±8.0, and 1.67±0.71 for very severe aplastic anemia, severe aplastic anemia, and non-severe aplastic anemia, respectively. The differences were again statistically significant. IL levels were also correlated with the treatment outcome. Responders had lower levels compared with nonresponders, but the difference was not statistically significant (186.36±322.45 vs. 198.74±368.10). Levels of ILs decreased in responders, but were not comparable with that of controls 6 months after therapy. High levels of IL-6 and IL-8 were observed in children with aplastic anemia. Increased levels showed correlation with disease severity and therefore appear to play an important role in aplastic anemia. However, levels had no significant correlation

  17. Identifying the association between interleukin-6 and lichen planus: A meta-analysis

    PubMed Central

    Yin, Meng; Li, Guifeng; Song, Hui; Lin, Song

    2017-01-01

    Numerous studies have examined the association between interleukin-6 and the pathogenesis of lichen planus (LP)/oral LP (OLP) in various populations; however, there is a lack of systematic analysis. The aim of the present study was to assess this association more precisely, thus a meta-analysis was performed. Case-control studies, which were published up to December 2015, were obtained from PubMed, Embase and the China National Knowledge Infrastructure databases. Data were extracted and pooled mean differences (MDs) with 95% confidence intervals (CIs) were calculated. Ultimately, eight studies were included, comprising 299 LP/OLP cases and 231 control subjects. Overall, the pooled MD for IL-6 was 16.24 (95% CI, 9.84–22.64; I2=99% for heterogeneity). In the subgroup analysis by ethnicity, a significant increase of the IL-6 expression level was identified among Asian individuals, but not in Caucasian individuals. Thus, IL-6 may be significant in the pathogenesis of LP. However, further studies are required to validate these associations. PMID:28529737

  18. Impairment of Hepcidin Upregulation by Lipopolysaccharide in the Interleukin-6 Knockout Mouse Brain.

    PubMed

    Zhang, Fa-Li; Hou, Hui-Min; Yin, Zhi-Nan; Chang, Lan; Li, Fe-Mi; Chen, Y-J; Ke, Ya; Qian, Zhong-Ming

    2017-01-01

    To find out whether the Interleukin-6 (IL-6)/signal transducer and activator of transcription 3 (STAT3) signaling pathway is involved in the expression of hepcidin in the mouse brain in vivo , we investigated the phosphorylation of STAT3, as well as the expression of hepcidin mRNA, ferroportin 1 (Fpn1) and ferritin light chain (Ft-L) proteins in the cortex and hippocampus of LPS-treated wild type (IL-6+/+) and IL-6 knockout (IL-6-/-) mice. We demonstrated that IL-6 knockout could significantly reduce the response of hepcidin mRNA, phospho-STAT3, Fpn1 and Ft-L protein expression to LPS treatment, in both the cortex and hippocampus of mice. Also, Stattic, an inhibitor of STAT3, significantly reduced the expression of phospho-STAT3 and hepcidin mRNA in the cortex and hippocampus of the LPS-treated wild type mice. These findings provide in vivo evidence for the involvement of the IL-6/STAT3 signaling pathway in the expression of hepcidin.

  19. Cytokines in the sera of patients with pemphigus vulgaris: interleukin-6 and tumour necrosis factor-alpha levels are significantly increased as compared to healthy subjects and correlate with disease activity.

    PubMed

    D'Auria, L; Bonifati, C; Mussi, A; D'Agosto, G; De Simone, C; Giacalone, B; Ferraro, C; Ameglio, F

    1997-12-01

    Cytokine serum levels, when detectable, are currently measured in many disease states, both to evaluate a possible pathogenetic involvement of such molecules and for clinical purposes. No data are currently available on the cytokine levels in the sera of patients with pemphigus vulgaris (PV), a rare bullous disease of autoimmune origin. This study presents data concerning the levels of 13 different cytokines assayed in the sera of 25 patients affected with PV as compared with 20 healthy subjects using high sensitivity ELISA kits. Of the 13 molecules analyzed, no differences in the levels of most cytokines were observed between pemphigus and control sera, with the exception of tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6). Serum TNF-alpha and IL-6 levels were found to be significantly higher in PV patients than in normal controls (p < 0.001). Furthermore, the levels of the two cytokines decreased after one month of corticosteroid therapy. A significant correlation was found between the serum levels of both TNF-alpha and IL-6 and the number of lesions for each patient (p < 0.001). The data presented support an involvement of at least IL-6 and TNF-alpha in the biological modifications associated with PV manifestations.

  20. Interleukins 6 and 8 and abdominal fat depots are distinct correlates of lipid moieties in healthy pre- and postmenopausal women.

    PubMed

    Veldhuis, Johannes D; Dyer, Roy B; Trushin, Sergey A; Bondar, Olga P; Singh, Ravinder J; Klee, George G

    2016-12-01

    Available data associate lipids concentrations in men with body mass index, anabolic steroids, age, and certain cytokines. Data were less clear in women, especially across the full adult lifespan, and when segmented by premenopausal and postmenopausal status. 120 healthy women (60 premenopausal and 60 postmenopausal) in Olmsted County, MN, USA, a stable well studied clinical population. Dependent variables: measurements of 10 h fasting high-density lipoprotein cholesterol, total cholesterol, low-density lipoprotein cholesterol, and triglycerides. testosterone, estrone, estradiol, 5-alpha-dihydrotestosterone, and sex-hormone binding globulin (by mass spectrometry); insulin, glucose, and albumin; abdominal visceral, subcutaneous, and total abdominal fat [abdominal visceral fat, subcutaneous fat, total abdominal fat by computerized tomography scan]; and a panel of cytokines (by enzyme-linked immunosorbent assay). Multivariate forward-selection linear-regression analysis was applied constrained to P < 0.01. Lifetime data: High-density lipoprotein cholesterol was correlated jointly with age (P < 0.0001, positively), abdominal visceral fat (P < 0.0001, negatively), and interleukin-6 (0.0063, negatively), together explaining 28.1 % of its variance (P = 2.3 × 10 -8 ). Total cholesterol was associated positively with multivariate age only (P = 6.9 × 10 -4 , 9.3 % of variance). Triglycerides correlated weakly with sex-hormone binding globulin (P = 0.0115), and strongly with abdominal visceral fat (P < 0.0001), and interleukin-6 (P = 0.0016) all positively (P = 1.6 × 10 -12 , 38.9 % of variance). Non high-density lipoprotein cholesterol and low-density lipoprotein cholesterol correlated positively with both total abdominal fat and interleukin-8 (P = 2.0 × 10 -5 , 16.9 % of variance; and P = 0.0031, 9.4 % of variance, respectively). Premenopausal vs. postmenopausal comparisons identified specific

  1. Interleukin-6 genotypes and serum levels in Chinese Hui population

    PubMed Central

    Gao, Shu-Ping; Liang, Shu; Pan, Min; Sun, Rong-Liang; Chen, Chu; Luan, Hong; Jiang, Min-Hui

    2014-01-01

    Interleukin-6 (IL-6) is a key pro-inflammatory cytokine involved in different physiologic and pathophysiologic processes, and circulating levels of IL-6 differ greatly between individuals. The Chinese Hui is one of the largest ethnic minorities, little is known about the distribution of IL-6 genetic variations and their effects on serum levels in Hui population. The aim of the present study is to determine the prevalence of -174G/C (rs1800795), -597G/A (rs1800797), and -634C/G (rs1800796) polymorphisms in the IL-6 gene promoter region and their association with IL-6 serum levels in the Ningxia Hui population. A total of 96 Hui subjects, (57 men and 39 women; mean age 49.65 ± 19.73 years) unrelated nationality residents in Ningxia Hui Autonomous Region were enrolled. Genotyping of the three polymorphisms were performed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) combined with gel electrophoresis and then confirmed by direct sequencing. The -174G/C (97.92% GG, 2.08% GC, and 0% CC) and -597G/A (98.96% GG, 1.04% GA, and 0% AA) polymorphisms were rare. The frequencies of -634C/G genotypes CC, CG, and GG were found to be 54.17%, 40.62%, and 5.21%, respectively in total studied subjects, the derived allele frequencies for the C and G alleles were 74.48% and 25.52%. Increased IL-6 levels were correlated with the IL-6 -634G allele carriers (CG+GG genotypes). The results suggest that IL-6 -174G/C and -597G/A are rare but -634C/G is common in the Ningxia Hui population, and the -634G allele is associated with circulating levels of IL-6. PMID:25356148

  2. Heat stress, gastrointestinal permeability and interleukin-6 signaling — Implications for exercise performance and fatigue

    PubMed Central

    Vargas, Nicole; Marino, Frank

    2016-01-01

    ABSTRACT Exercise in heat stress exacerbates performance decrements compared to normothermic environments. It has been documented that the performance decrements are associated with reduced efferent drive from the central nervous system (CNS), however, specific factors that contribute to the decrements are not completely understood. During exertional heat stress, blood flow is preferentially distributed away from the intestinal area to supply the muscles and brain with oxygen. Consequently, the gastrointestinal barrier becomes increasingly permeable, resulting in the release of lipopolysaccharides (LPS, endotoxin) into the circulation. LPS leakage stimulates an acute-phase inflammatory response, including the release of interleukin (IL)-6 in response to an increasingly endotoxic environment. If LPS translocation is too great, heat shock, neurological dysfunction, or death may ensue. IL-6 acts initially in a pro-inflammatory manner during endotoxemia, but can attenuate the response through signaling the hypothalamic pituitary adrenal (HPA)-axis. Likewise, IL-6 is believed to be a thermoregulatory sensor in the gut during the febrile response, hence highlighting its role in periphery – to – brain communication. Recently, IL-6 has been implicated in signaling the CNS and influencing perceptions of fatigue and performance during exercise. Therefore, due to the cascade of events that occur during exertional heat stress, it is possible that the release of LPS and exacerbated response of IL-6 contributes to CNS modulation during exertional heat stress. The purpose of this review is to evaluate previous literature and discuss the potential role for IL-6 during exertional heat stress to modulate performance in favor of whole body preservation. PMID:27857954

  3. Stress hormones promote growth of B16-F10 melanoma metastases: an interleukin 6- and glutathione-dependent mechanism.

    PubMed

    Valles, Soraya L; Benlloch, María; Rodriguez, María L; Mena, Salvador; Pellicer, José A; Asensi, Miguel; Obrador, Elena; Estrela, José M

    2013-03-22

    Interleukin (IL)-6 (mainly of tumor origin) activates glutathione (GSH) release from hepatocytes and its interorgan transport to B16-F10 melanoma metastatic foci. We studied if this capacity to overproduce IL-6 is regulated by cancer cell-independent mechanisms. Murine B16-F10 melanoma cells were cultured, transfected with red fluorescent protein, injected i.v. into syngenic C57BL/6J mice to generate lung and liver metastases, and isolated from metastatic foci using high-performance cell sorting. Stress hormones and IL-6 levels were measured by ELISA, and CRH expression in the brain by in situ hybridization. DNA binding activity of NF-κB, CREB, AP-1, and NF-IL-6 was measured using specific transcription factor assay kits. IL-6 expression was measured by RT-PCR, and silencing was achieved by transfection of anti-IL-6 small interfering RNA. GSH was determined by HPLC. Cell death analysis was distinguished using fluorescence microscopy, TUNEL labeling, and flow cytometry techniques. Statistical analyses were performed using Student's t test. Plasma levels of stress-related hormones (adrenocorticotropin hormone, corticosterone, and noradrenaline) increased, following a circadian pattern and as compared to non-tumor controls, in mice bearing B16-F10 lung or liver metastases. Corticosterone and noradrenaline, at pathophysiological levels, increased expression and secretion of IL-6 in B16-F10 cells in vitro. Corticosterone- and noradrenaline-induced transcriptional up-regulation of IL-6 gene involves changes in the DNA binding activity of nuclear factor-κB, cAMP response element-binding protein, activator protein-1, and nuclear factor for IL-6. In vivo inoculation of B16-F10 cells transfected with anti-IL-6-siRNA, treatment with a glucocorticoid receptor blocker (RU-486) or with a β-adrenoceptor blocker (propranolol), increased hepatic GSH whereas decreased plasma IL-6 levels and metastatic growth. Corticosterone, but not NORA, also induced apoptotic cell death in

  4. Serum levels of interleukin-1 beta, interleukin-6 and melatonin over summer and winter in kidney deficiency syndrome in Bizheng rats.

    PubMed

    Zhang, Miao; Wang, Tong; Chen, Huai-Min; Chen, Yan-Qin; Deng, Yang-Chun; Li, Ya-Tian

    2014-06-01

    To observe the seasonal changes in serum levels of interleukin-1 beta (IL-1β), interleukin-6 (IL-6) and melatonin (MT) in Bizheng rat model, and explore the relationship between MT and the pathogenesis of rheumatoid arthritis. One hundred and sixty Sprague-Dawley rats were randomly divided into four groups in summer (n=80) and winter (n=80) respectively: normal group, collagen-induced arthritis (CIA) model group, operation group, and sham-operation group (n=20 in each group). The CIA model group was injected with collagen emulsion at the base of the tail to induce arthritis. The rats in the operation group received pineal gland resection, and 7 days after the first operation, underwent testectomy or oophorectomy. The rats in the sham-operation group were operated to ligature the sagittal sinus, without extracting the pineal gland. After the operations, the operation group and the sham-operation group both were immunized as the CIA group was. The serum levels of IL-1β, IL-6 and MT in different groups were measured by radioimmunoassay. Compared with the normal group, the serum levels of IL-1β and IL-6 increased in the CIA model, operation, and sham-operation groups both in summer and in winter (IL-1β in summer, P=0.008, P<0.01, P=0.012; IL-1β in winter, P=0.019, P<0.01, P=0.027; IL-6 in summer, P=0.028, P<0.01, P=0.024; IL-6 in winter, P=0.006, P<0.01, P=0.008). In the operation group, the serum levels of IL-1β and IL-6 in winter were higher than in summer, but with no statistically significant differences (P=0.844, 0.679). Compared with the normal group, the serum level of MT significantly increased in summer and winter in both the CIA model group (P=0.002, 0.008) and the sham-operation group (P=0.003, 0.007), while significantly decreased in the operation group (P=0.023, 0.003). There was no significant difference in MT level in the operation group between summer and winter (P=0.947). The increase of serum levels of IL-1β and IL-6 may exacerbate the

  5. Macrophage interleukin-6 and tumour necrosis factor-α are induced by coronavirus fixation to Toll-like receptor 2/heparan sulphate receptors but not carcinoembryonic cell adhesion antigen 1a

    PubMed Central

    Jacques, Alexandre; Bleau, Christian; Turbide, Claire; Beauchemin, Nicole; Lamontagne, Lucie

    2009-01-01

    A rapid antiviral immune response may be related to viral interaction with the host cell leading to activation of macrophages via pattern recognition receptors (PPRs) or specific viral receptors. Carcinoembryonic cell adhesion antigen 1a (CEACAM1a) is the specific receptor for the mouse hepatitis virus (MHV), a coronavirus known to induce acute viral hepatitis in mice. The objective of this study was to understand the mechanisms responsible for the secretion of high-pathogenic MHV3-induced inflammatory cytokines. We report that the induction of the pro-inflammatory cytokines interleukin (IL)-6 and tumour necrosis factor (TNF)-α in peritoneal macrophages does not depend on CEACAM1a, as demonstrated in cells isolated from Ceacam1a−/− mice. The induction of IL-6 and TNF-α production was related rather to the fixation of the spike (S) protein of MHV3 on Toll-like receptor 2 (TLR2) in regions enriched in heparan sulphate and did not rely on viral replication, as demonstrated with denatured S protein and UV-inactivated virus. High levels of IL-6 and TNF-α were produced in livers from infected C57BL/6 mice but not in livers from Tlr2−/− mice. The histopathological observations were correlated with the levels of those inflammatory cytokines. Depending on mouse strain, the viral fixation to heparan sulfate/TLR2 stimulated differently the p38 mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-κB in the induction of IL-6 and TNF-α. These results suggest that TLR2 and heparan sulphate receptors can act as new viral PPRs involved in inflammatory responses. PMID:19740307

  6. Inhibition of interleukin-6 decreases atrogene expression and ameliorates tail suspension-induced skeletal muscle atrophy

    PubMed Central

    Yakabe, Mitsutaka; Ota, Hidetaka; Iijima, Katsuya; Eto, Masato; Ouchi, Yasuyoshi; Akishita, Masahiro

    2018-01-01

    Background Interleukin-6 (IL-6) is an inflammatory cytokine. Whether systemic IL-6 affects atrogene expression and disuse-induced skeletal muscle atrophy is unclear. Methods Tail-suspended mice were used as a disuse-induced muscle atrophy model. We administered anti-mouse IL-6 receptor antibody, beta-hydroxy-beta-methylbutyrate (HMB) and vitamin D to the mice and examined the effects on atrogene expression and muscle atrophy. Results Serum IL-6 levels were elevated in the mice. Inhibition of IL-6 receptor suppressed muscle RING finger 1 (MuRF1) expression and prevented muscle atrophy. HMB and vitamin D inhibited the serum IL-6 surge, downregulated the expression of MuRF1 and atrogin-1 in the soleus muscle, and ameliorated atrophy in the mice. Conclusion Systemic IL-6 affects MuRF1 expression and disuse-induced muscle atrophy. PMID:29351340

  7. Plasma Level of Interleukin-35 as an Independent Prognostic Indicator in Hepatocellular Carcinoma.

    PubMed

    Qiu, Xiangting; Wang, Xinhua; Song, Yucui; Chen, Lingling

    2016-12-01

    Hepatocellular carcinoma is a major type of liver cancer with poor prognosis. The aim of the study was to determine the prognostic significance of plasma interleukin-35 level in hepatocellular carcinoma. A total of 153 hepatocellular carcinoma patients and 153 healthy controls were enrolled. Blood samples were obtained at admission. Plasma interleukin-35 level was analyzed by enzyme-linked immunosorbent assay. Distribution of T cell subset and expression of Fas/FasL protein were detected by flow cytometry. The patients were followed up for 2 years. Poor prognosis was defined as death of hepatocellular carcinoma. The plasma levels of interleukin-35 were significantly higher in the patients than the controls (25.1 ± 13.1, 9.3 ± 6.3 pg/mL, P < 0.001). After adjusted for multiple confounding factors, the multivariate logistic regression analyses reported that high level of interleukin-35 (≥25.0 pg/mL) was associated with the poor prognosis in the patients (OR 6.63, 95 % CI 3.27-13.47). Compared with the patients with low level of interleukin-35 (<25.0 pg/mL), the patients with high level of interleukin-35 showed higher frequencies of CD4+CD25+FoxP3+ and CD3+Foxp3+ regulatory T cells (P < 0.001 and P < 0.001) and also showed higher apoptosis levels of CD8+ T cells (P < 0.001). Circulating interleukin-35 concentration might be an independent prognostic indicator in hepatocellular carcinoma. Such prognostic significance could be partly involved in the activation of regulatory T cell and the apoptosis of CD8+ T cell.

  8. Aptamer conjugated silver nanoparticles for the detection of interleukin 6

    NASA Astrophysics Data System (ADS)

    Locke, Andrea K.; Norwood, Nicole; Marks, Haley L.; Schechinger, Monika; Jackson, George W.; Graham, Duncan; Coté, Gerard L.

    2016-03-01

    The controlled assembly of plasmonic nanoparticles by a molecular binding event has emerged as a simple yet sensitive methodology for protein detection. Metallic nanoparticles (NPs) coated with functionalized aptamers can be utilized as biosensors by monitoring changes in particle optical properties, such as the LSPR shift and enhancement of the SERS spectra, in the presence of a target protein. Herein we test this method using two modified aptamers selected for the protein biomarker interleukin 6, an indicator of the dengue fever virus and other diseases including certain types of cancers, diabetes, and even arthritis. IL6 works by inducing an immunological response within the body that can be either anti-inflammatory or pro-inflammatory. The results show that the average hydrodynamic diameter of the NPs as measured by Dynamic Light Scattering was ~42 nm. After conjugation of the aptamers, the peak absorbance of the AgNPs shifted from 404 to 408 nm indicating a surface modification of the NPs due to the presence of the aptamer. Lastly, preliminary results were obtained showing an increase in SERS intensity occurs when the IL-6 protein was introduced to the conjugate solution but the assay will still need to be optimized in order for it to be able to monitor varying concentration changes within and across the desired range.

  9. Post-menopausal Women Exhibit Greater Interleukin-6 Responses to Mental Stress Than Older Men.

    PubMed

    Endrighi, Romano; Hamer, Mark; Steptoe, Andrew

    2016-08-01

    Acute stress triggers innate immune responses and elevation in circulating cytokines including interleukin-6 (IL-6). The effect of sex on IL-6 responses remains unclear due to important limitations of previous studies. The purpose of this study was to examine sex differences in IL-6 responses to mental stress in a healthy, older (post-menopausal) sample accounting for several moderating factors. Five hundred six participants (62.9 ± 5.60 years, 55 % male) underwent 10 min of mental stress consisting of mirror tracing and Stroop task. Blood was sampled at baseline, after stress, and 45 and 75 min post-stress, and assayed using a high sensitivity kit. IL-6 reactivity was computed as the mean difference between baseline and 45 min and between baseline and 75 min post-stress. Main effects and interactions were examined using ANCOVA models. There was a main effect of time for the IL-6 response (F 3,1512 = 201.57, p = <.0001) and a sex by time interaction (F 3,1512 = 17.07, p = <.001). In multivariate adjusted analyses, IL-6 reactivity was significantly greater in females at 45 min (M = 0.37 ± 0.04 vs. 0.20 ± 0.03 pg/mL, p = .01) and at 75 min (M = 0.57 ± 0.05 vs. 0.31 ± 0.05 pg/mL, p = .004) post-stress compared to males. Results were independent of age, adiposity, socioeconomic position, depression, smoking and alcohol consumption, physical activity, statin use, testing time, task appraisals, hormone replacement, and baseline IL-6. Other significant predictors of IL-6 reactivity were lower household wealth, afternoon testing, and baseline IL-6. Healthy, post-menopausal females exhibit substantially greater IL-6 responses to acute stress. Inflammatory responses if sustained over time may have clinical implications for the development and maintenance of inflammatory-related conditions prevalent in older women.

  10. Association of interleukin-6 methylation in leukocyte DNA with serum level and the risk of ischemic heart disease.

    PubMed

    Yang, Qinghui; Zhao, Yushi; Zhang, Zhijie; Chen, Jianxin

    2016-07-01

    Background Interleukin-6 (IL-6), a multifunctional cytokine, plays an important role in the development of ischemic heart disease (IHD), and DNA hypomethylation of 2 CpGs, located downstream in the proximity of the IL-6 gene promoter, has been associated with risk factor for IHD. This study was to examine the association of blood leukocyte DNA methylation of the 2 CpGs in IL-6 with the risk of IHD and the serum IL-6 level. Methods IL-6 methylation levels of 582 cases and 673 controls were measured using the bisulfite pyrosequencing technology. Serum level of IL-6 was measured using enzyme-linked immunosorbent assay. Results The IL-6 methylation was significantly lower in IHD cases than in the controls, irrespective of CpG site. After multivariate adjustment, lower (< median) average IL-6 methylation was associated with an increased risk of IHD (OR 1.57, 95% CI 1.22-2.02, p < 0.001). Average IL-6 methylation level was inversely associated with serum IL-6 level (β = -1.02 pg/mL per increase in IL-6 methylation, p = 0.002) among IHD cases. This significant relationship was not observed among controls. Conclusions DNA hypomethylation of IL-6 gene measured in blood leukocytes was associated with increased risk of IHD. IL-6 demethylation may upregulate its expression, whereby exerting its risk effect on the development of IHD.

  11. Interleukin-6 is an independent predictor of progressive atherosclerosis in the carotid artery: The Tromsø Study.

    PubMed

    Eltoft, Agnethe; Arntzen, Kjell Arne; Wilsgaard, Tom; Mathiesen, Ellisiv B; Johnsen, Stein Harald

    2018-04-01

    Novel biomarkers are linked to cardiovascular disease (CVD). The aim of the present study was to investigate the association between 28 blood biomarkers and the formation and progression of carotid plaque. In a nested case control study with 703 participants from the population based Tromsø Study, a large biomarker panel was measured in blood obtained at baseline. Carotid ultrasound was assessed both at baseline and at 6 years of follow-up. Four groups were defined: Group 1: no plaque at baseline or at follow-up (reference group); Group 2: novel plaque at follow-up; Group 3: stable plaque at follow-up; Group 4: progression of plaque at follow-up. By multinomial logistic regression analyses, we assessed the risk of being in the different plaque groups with regard to traditional cardiovascular risk factors and levels of biomarkers at baseline. Adjusted for traditional risk factors, interleukin-6 (IL-6) was an independent predictor of plaque progression (OR 1.44, 95% CI 1.12-1.85 per SD increase in IL-6 level). This result remained significant after inclusion of other novel biomarkers to the model, and when subjects with former CVD were excluded. Neopterin was protective of novel plaque formation (OR 0.73, 95% CI 0.57-0.93). Myeloperoxidase and Caspase-1 were independent predictors of plaque progression, but this effect disappeared when excluding subjects with former CVD. IL-6 is an independent predictor of plaque progression, suggesting that it may be a marker of progressive atherosclerosis in the general population and that its central role in CVD may be related to promotion of plaque growth. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Aberrant histone acetylation contributes to elevated interleukin-6 production in rheumatoid arthritis synovial fibroblasts.

    PubMed

    Wada, Takuma Tsuzuki; Araki, Yasuto; Sato, Kojiro; Aizaki, Yoshimi; Yokota, Kazuhiro; Kim, Yoon Taek; Oda, Hiromi; Kurokawa, Riki; Mimura, Toshihide

    2014-02-21

    Accumulating evidence indicates that epigenetic aberrations have a role in the pathogenesis of rheumatoid arthritis (RA). However, reports on histone modifications are as yet quite limited in RA. Interleukin (IL)-6 is an inflammatory cytokine which is known to be involved in the pathogenesis of RA. Here we report the role of histone modifications in elevated IL-6 production in RA synovial fibroblasts (SFs). The level of histone H3 acetylation (H3ac) in the IL-6 promoter was significantly higher in RASFs than osteoarthritis (OA) SFs. This suggests that chromatin structure is in an open or loose state in the IL-6 promoter in RASFs. Furthermore, curcumin, a histone acetyltransferase (HAT) inhibitor, significantly reduced the level of H3ac in the IL-6 promoter, as well as IL-6 mRNA expression and IL-6 protein secretion by RASFs. Taken together, it is suggested that hyperacetylation of histone H3 in the IL-6 promoter induces the increase in IL-6 production by RASFs and thereby participates in the pathogenesis of RA. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Stearidonic and eicosapentaenoic acids inhibit interleukin-6 expression in ob/ob mouse adipose stem cells via toll-like receptor-2-mediated pathways

    USDA-ARS?s Scientific Manuscript database

    Increases in adipose tissue weight positively correlates with increased circulating inflammatory cytokines such as interleukin-6 (IL-6). We previously have shown that adipose stem cell produce significantly higher levels of IL-6 when compared to other cell types in the adipose tissue in genetically ...

  14. Serum interleukin-6 levels in murine models of Candida albicans infection.

    PubMed

    Kovács, Renátó; Czudar, Anita; Horváth, László; Szakács, Levente; Majoros, László; Kónya, József

    2014-03-01

    Two Balb/C mouse models of Candida infection were used to detect serum interleukin-6 (IL-6) responses. The first model used systemic infection by Candida albicans ATCC 10231 strain infected through the lateral tail vein of mice without any specific pretreatment. The median Candida burdens of the kidneys were 1.5 × 106 CFU/ml 24 h postinoculation (p.i.) and 1.2 × 107 CFU/ml 72 h p.i., while median serum IL-6 levels were 479.3 pg/ml and 934.5 pg/ml, respectively. The Candida burden showed significant correlation with serum IL-6 24 h p.i. (R2 = 0.6358; P = 0.0082) but not 72 h p.i.The second model was a mouse vaginitis model applying intravaginal inoculation of mice pretreated with subcutaneous estradiol-valerate (10 mg/ml) 3 days before infection. Candida cell count in vaginal lavage fluid was 2.8 × 106 CFU/ml 24 h p.i. and 1.4 × 108 CFU/ml 72 h p.i. Serum IL-6 response was detected in 4 of 15 mice 24 h p.i. and 9 of 15 mice 72 h p.i. Even the responders had low IL-6 serum levels (mean values 29.9 pg/ml and 60.1 pg/ml, respectively) not correlating with Candida cell count in vaginal lavage fluid.In conclusion, serum IL-6 had strong relationship with systemic C. albicans infection while the local C. albicans infection of the vagina led to partial, prolonged and limited serum IL-6 response.

  15. Kaposi's sarcoma-associated herpesvirus-encoded interleukin-6.

    PubMed

    Aoki, Y; Jones, K D; Tosato, G

    2000-04-01

    Since the discovery of the virus in 1994, the rapid pace with which Karposi's sarcoma-associated herpesvirus (KSHV) research has progressed has quickly led to a broad understanding of the structure of the virus and its biology and pathology in humans. Molecular piracy of potentially useful cellular genes has emerged as a characteristic feature of this virus. The viral homolog of human IL-6, vIL-6 is an example in kind. Studies in vitro and in vivo have shown that vIL-6 can stimulate the growth of KSHV-infected primary infusion lymphoma (PEL) cells, can promote hematopoiesis, and act as an angiogenic factor through the induction of vascular endothelial growth factor (VEGF). It is not difficult to envision how vIL-6, through these properties and perhaps others yet to be identified, can contribute to KSHV survival and spread in the human population.

  16. Discrimination of skin sensitizers from non-sensitizers by interleukin-1α and interleukin-6 production on cultured human keratinocytes.

    PubMed

    Jung, Daun; Che, Jeong-Hwan; Lim, Kyung-Min; Chun, Young-Jin; Heo, Yong; Seok, Seung Hyeok

    2016-09-01

    In vitro testing methods for classifying sensitizers could be valuable alternatives to in vivo sensitization testing using animal models, such as the murine local lymph node assay (LLNA) and the guinea pig maximization test (GMT), but there remains a need for in vitro methods that are more accurate and simpler to distinguish skin sensitizers from non-sensitizers. Thus, the aim of our study was to establish an in vitro assay as a screening tool for detecting skin sensitizers using the human keratinocyte cell line, HaCaT. HaCaT cells were exposed to 16 relevant skin sensitizers and 6 skin non-sensitizers. The highest dose used was the dose causing 75% cell viability (CV75) that we determined by an MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. The levels of extracellular production of interleukin-1α (IL-1α) and IL-6 were measured. The sensitivity of IL-1α was 63%, specificity was 83% and accuracy was 68%. In the case of IL-6, sensitivity: 69%, specificity: 83% and accuracy: 73%. Thus, this study suggests that measuring extracellular production of pro-inflammatory cytokines IL-1α and IL-6 by human HaCaT cells may potentially classify skin sensitizers from non-sensitizers. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

  17. Ciliary neurotrophic factor is an endogenous pyrogen.

    PubMed

    Shapiro, L; Zhang, X X; Rupp, R G; Wolff, S M; Dinarello, C A

    1993-09-15

    Fever is initiated by the action of polypeptide cytokines called endogenous pyrogens, which are produced by the host during inflammation, trauma, or infection and which elevate the thermoregulatory set point in the hypothalamus. Ciliary neurotrophic factor (CNTF) supports the differentiation and survival of central and peripheral neurons. We describe the activity of CNTF as intrinsically pyrogenic in the rabbit. CNTF induced a monophasic fever which rose rapidly (within the first 12 min) following intravenous injection; CNTF fever was blocked by pretreatment with indomethacin. The fever induced by CNTF was not due to contaminating endotoxins. Increasing doses of CNTF resulted in prolongation of the fever, suggesting the subsequent induction of additional endogenous pyrogenic activity. After passive transfer of plasma obtained during CNTF-induced fever, endogenous pyrogen activity was not present in the circulation; CNTF also did not induce the endogenous pyrogens interleukin 1, tumor necrosis factor, or interleukin 6 in vitro. Nevertheless, a second endogenous pyrogen may originate within the central nervous system following the systemic injection of CNTF. Of the four endogenous pyrogens described to date (interleukin 1, tumor necrosis factor, interferon, and interleukin 6), CNTF, like interleukin 6, utilizes the cell-surface gp 130 signal-transduction apparatus.

  18. Interleukin-6 (IL-6) rs1800796 and cyclin dependent kinase inhibitor (CDKN2A/CDKN2B) rs2383207 are associated with ischemic stroke in indigenous West African Men.

    PubMed

    Akinyemi, Rufus; Arnett, Donna K; Tiwari, Hemant K; Ovbiagele, Bruce; Sarfo, Fred; Srinivasasainagendra, Vinodh; Irvin, Marguerite Ryan; Adeoye, Abiodun; Perry, Rodney T; Akpalu, Albert; Jenkins, Carolyn; Owolabi, Lukman; Obiako, Reginald; Wahab, Kolawole; Sanya, Emmanuel; Komolafe, Morenikeji; Fawale, Michael; Adebayo, Philip; Osaigbovo, Godwin; Sunmonu, Taofiki; Olowoyo, Paul; Chukwuonye, Innocent; Obiabo, Yahaya; Akpa, Onoja; Melikam, Sylvia; Saulson, Raelle; Kalaria, Raj; Ogunniyi, Adesola; Owolabi, Mayowa

    2017-08-15

    Inherited genetic variations offer a possible explanation for the observed peculiarities of stroke in sub - Saharan African populations. Interleukin-6 polymorphisms have been previously associated with ischemic stroke in some non-African populations. Herein we investigated, for the first time, the association of genetic polymorphisms of IL-6, CDKN2A- CDKN2B and other genes with ischemic stroke among indigenous West African participants in the Stroke Investigative Research and Education Network (SIREN) Study. Twenty-three previously identified single nucleotide polymorphisms (SNPs) in 14 genes of relevance to the neurobiology of ischemic stroke were investigated. Logistic regression models adjusting for known cardiovascular disease risk factors were constructed to assess the associations of the 23 SNPs in rigorously phenotyped cases (N=429) of ischemic stroke (Men=198; Women=231) and stroke- free (N=483) controls (Men=236; Women=247). Interleukin-6 (IL6) rs1800796 (C minor allele; frequency: West Africans=8.6%) was significantly associated with ischemic stroke in men (OR=2.006, 95% CI=[1.065, 3.777], p=0.031) with hypertension in the model but not in women. In addition, rs2383207 in CDKN2A/CDKN2B (minor allele A with frequency: West Africans=1.7%) was also associated with ischemic stroke in men (OR=2.550, 95% CI=[1.027, 6.331], p=0.044) with primary covariates in the model, but not in women. Polymorphisms in other genes did not show significant association with ischemic stroke. Polymorphisms rs1800796 in IL6 gene and rs2383207 in CDKN2A/CDKN2B gene have significant associations with ischemic stroke in indigenous West African men. CDKN2A/CDKN2B SNP rs2383207 is independently associated with ischemic stroke in indigenous West African men. Further research should focus on the contributions of inflammatory genes and other genetic polymorphisms, as well as the influence of sex on the neurobiology of stroke in people of African ancestry. Copyright © 2017 Elsevier B

  19. Immunology mini-review: the basics of T(H)17 and interleukin-6 in transplantation.

    PubMed

    Nakagiri, T; Inoue, M; Minami, M; Shintani, Y; Okumura, M

    2012-05-01

    The outcomes of organ transplantation are determined by graft rejection, the mechanisms of which are some of the most important areas of study in the transplantation field. The main cause of rejection is the immunologic response of the recipient toward the transplanted organ. The immunologic responses are regulated by T-cell subsets, especially helper T-cells, which have been characterized as T(H)1 or T(H)2 cells according to their profiles of cytokines production. A unique subset of recently identified lymphocytes, the regulatory T cells (T(reg)s), seem to play a role in tolerance. The recently identified T(H)17 cells are a subset of effector-helper lymphocytes that specifically secrete interleukin (IL) 17. Interestingly, T(H)17 and T(reg) both develop from naïve T cells on stimulation by transforming growth factor β. The difference is only the existence of IL-6, a proinflammatory cytokine. T(H)17 clears pathogens that are not adequately handled by T(H)1 and T(H)2 elements, as well as contributing to autoimmune diseases, such as rheumatoid arthritis, systemic lupus erythematosus, and inflammatory diseases. Autoimmune diseases are caused by reactions to self-antigens. T(H)17 (or IL-17) and IL-6 are also thought to be involved in rejection after organ transplantation. We examined the contributions of T(H)17 and IL-6 in bronchiolitis obliterans (BO), the histologic finding in chronic rejection of lung transplantations. Earlier studies have reported that T(H)17 and IL-6 contribute not only to chronic rejection of lung transplantations, but also to the rejection of other solid organs, e.g., heart, liver, and kidney. In addition, prospective avenues of research on T(H)17 and IL-6 in transplantation have emerged from the perspectives of recent studies. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Prevention of early postnatal hyperalimentation protects against activation of transforming growth factor-β/bone morphogenetic protein and interleukin-6 signaling in rat lungs after intrauterine growth restriction.

    PubMed

    Alcázar, Miguel Angel Alejandre; Dinger, Katharina; Rother, Eva; Östreicher, Iris; Vohlen, Christina; Plank, Christian; Dötsch, Jörg

    2014-12-01

    Intrauterine growth restriction (IUGR) is intimately linked with postnatal catch-up growth, leading to impaired lung structure and function. However, the impact of catch-up growth induced by early postnatal hyperalimentation (HA) on the lung has not been addressed to date. The aim of this study was to investigate whether prevention of HA subsequent to IUGR protects the lung from 1) deregulation of the transforming growth factor-β(TGF-β)/bone morphogenetic protein (BMP) pathway, 2) activation of interleukin (IL)-6 signaling, and 3) profibrotic processes. IUGR was induced in Wistar rats by isocaloric protein restriction during gestation by feeding a control (Co) or a low-protein diet with 17% or 8% casein, respectively. On postnatal day 1 (P1), litters from both groups were randomly reduced to 6 pups per dam to induce HA or adjusted to 10 pups and fed with standard diet: Co, Co with HA (Co-HA), IUGR, and IUGR with HA (IUGR-HA). Birth weights in rats after IUGR were lower than in Co rats (P < 0.05). HA during lactation led to accelerated body weight gain from P1 to P23 (Co vs. Co-HA, IUGR vs. IUGR-HA; P < 0.05). At P70, prevention of HA after IUGR protected against the following: 1) activation of both TGF-β [phosphorylated SMAD (pSMAD) 2; plasminogen activator inhibitor 1 (Pai1)] and BMP signaling [pSMAD1; inhibitor of differentiation (Id1)] compared with Co (P < 0.05) and Co or IUGR (P < 0.05) rats, respectively; 2) greater mRNA expression of interleukin (Il) 6 and Il13 (P < 0.05) as well as activation of signal transducer and activator of transcription 3 (STAT3) signaling (P < 0.05) after IUGR-HA; and 3) greater gene expression of collagen Iα1 and osteopontin (P < 0.05) and increased deposition of bronchial subepithelial connective tissue in IUGR-HA compared with Co and IUGR rats. Moreover, HA had a significant additive effect (P < 0.05) on the increased enhanced pause (indicator of airway resistance) in the IUGR group (P < 0.05) at P70. This study demonstrates

  1. Correlation between Interleukin-6 and Thrombin-Antithrombin III Complex Levels in Retinal Diseases.

    PubMed

    Ehrlich, Rita; Zahavi, Alon; Axer-Siegel, Ruth; Budnik, Ivan; Dreznik, Ayelet; Dahbash, Mor; Nisgav, Yael; Megiddo, Elinor; Kenet, Gili; Weinberger, Dov; Livnat, Tami

    2017-09-01

    This study aims to evaluate and correlate the levels of interleukin-6 (IL-6) and thrombin-antithrombin III complex (TAT) in the vitreous of patients with different vitreoretinal pathologies. Vitreous samples were collected from 78 patients scheduled for pars plana vitrectomy at a tertiary medical center. Patients were divided by the underlying vitreoretinal pathophysiology, as follows: macular hole (MH)/epiretinal membrane (ERM) (n = 26); rhegmatogenous retinal detachment (RRD) (n = 32); and proliferative diabetic retinopathy (PDR) (n = 20). Levels of IL-6 and TAT were measured by enzyme-linked immunosorbent assay and compared among the groups. A significant difference was found in the vitreal IL-6 and TAT levels between the MH/ERM group and both the PDR and RRD groups (P < 0.001 for all). Diabetes was associated with higher IL-6 levels in the RRD group. Different relationships between the IL-6 and TAT levels were revealed in patients with different ocular pathologies. Our results imply that variations in vitreal TAT level may be attributable not only to an inflammatory reaction or blood-retinal barrier breakdown, but also to intraocular tissue-dependent regulation of thrombin.

  2. Activation of the transcription factor nuclear factor-kappa B in uterine luminal epithelial cells by interleukin 1 Beta 2: a novel interleukin 1 expressed by the elongating pig conceptus.

    PubMed

    Mathew, Daniel J; Newsom, Emily M; Guyton, Jennifer M; Tuggle, Christopher K; Geisert, Rodney D; Lucy, Matthew C

    2015-04-01

    Conceptus mortality is greatest in mammals during the peri-implantation period, a time when conceptuses appose and attach to the uterine surface epithelium while releasing proinflammatory molecules. Interleukin 1 beta (IL1B), a master proinflammatory cytokine, is released by the primate, rodent, and pig blastocyst during the peri-implantation period and is believed to be essential for establishment of pregnancy. The gene encoding IL1B has duplicated in the pig, resulting in a novel gene. Preliminary observations indicate that the novel IL1B is specifically expressed by pig conceptuses during the peri-implantation period. To verify this, IL1B was cloned from mRNA isolated from Day 12 pig conceptuses and compared with IL1B cloned from mRNA isolated from pig peripheral blood leukocytes (PBLs). The pig conceptuses, but not the PBLs, expressed a novel IL1B, referred to here as interleukin 1 beta 2 (IL1B2). Porcine endometrium was treated with recombinant porcine interleukin 1 beta 1 (IL1B1), the prototypical cytokine, and IL1B2 proteins. Immunohistochemistry and real-time RT-PCR were used to measure activation of nuclear factor-kappa B (NFKB) and NFKB-regulated transcripts, respectively, within the endometrium. Both IL1B1 and IL1B2 activated NFKB in the uterine luminal epithelium within 4 h. The NFKB activation and related gene expression, however, were lower in endometrium treated with IL1B2, suggesting that the conceptus-derived cytokine may have reduced activity within the uterus. In conclusion, the peri-implantation pig conceptus expresses a novel IL1B that can activate NFKB within the uterine surface epithelium, likely creating a proinflammatory microenvironment during establishment of pregnancy in the pig. © 2015 by the Society for the Study of Reproduction, Inc.

  3. Genetic partitioning of interleukin-6 signalling in mice dissociates Stat3 from Smad3-mediated lung fibrosis

    PubMed Central

    O'Donoghue, Robert J J; Knight, Darryl A; Richards, Carl D; Prêle, Cecilia M; Lau, Hui Ling; Jarnicki, Andrew G; Jones, Jessica; Bozinovski, Steven; Vlahos, Ross; Thiem, Stefan; McKenzie, Brent S; Wang, Bo; Stumbles, Philip; Laurent, Geoffrey J; McAnulty, Robin J; Rose-John, Stefan; Zhu, Hong Jian; Anderson, Gary P; Ernst, Matthias R; Mutsaers, Steven E

    2012-01-01

    Idiopathic pulmonary fibrosis (IPF) is a fatal disease that is unresponsive to current therapies and characterized by excessive collagen deposition and subsequent fibrosis. While inflammatory cytokines, including interleukin (IL)-6, are elevated in IPF, the molecular mechanisms that underlie this disease are incompletely understood, although the development of fibrosis is believed to depend on canonical transforming growth factor (TGF)-β signalling. We examined bleomycin-induced inflammation and fibrosis in mice carrying a mutation in the shared IL-6 family receptor gp130. Using genetic complementation, we directly correlate the extent of IL-6-mediated, excessive Stat3 activity with inflammatory infiltrates in the lung and the severity of fibrosis in corresponding gp130757F mice. The extent of fibrosis was attenuated in B lymphocyte-deficient gp130757F;µMT−/− compound mutant mice, but fibrosis still occurred in their Smad3−/− counterparts consistent with the capacity of excessive Stat3 activity to induce collagen 1α1 gene transcription independently of canonical TGF-β/Smad3 signalling. These findings are of therapeutic relevance, since we confirmed abundant STAT3 activation in fibrotic lungs from IPF patients and showed that genetic reduction of Stat3 protected mice from bleomycin-induced lung fibrosis. PMID:22684844

  4. Interleukin-6 (IL-6) mediated the increased contraction of distal colon in streptozotocin-induced diabetes in rats via IL-6 receptor pathway

    PubMed Central

    Chang, Xin-Wen; Qin, Ying; Jin, Zhi; Xi, Tao-Fang; Yang, Xiao; Lu, Ze-Hao; Tang, Yu-Ping; Cai, Wen-Ting; Chen, Shao-Jun; Xie, Dong-Ping

    2015-01-01

    Colonic dysmotility occurs in diabetes and blood plasma interleukin (IL)-6 levels are significantly elevated in type 1 diabetes mellitus. The aim of this study was to investigate whether IL-6 and the IL-6 receptor pathway mediates colonic dysfunction in type 1 diabetes mellitus. Male SD rats were treated with a single intraperitoneally injected dose of streptozotocin (STZ), and those displaying sustained high blood glucose were selected as diabetes mellitus models. Longitudinal muscle strips of colon were prepared to monitor colonic contraction in vitro. Contractile responses of strips of colon were recorded following treatment with IL-6 in control animals, and following anti IL-6 antibody treatment in STZ-induced diabetes in rats. Concentration of IL-6 in plasma and colon were determined by ELISA. Expressions of IL-6 α-receptor and IL-6 β-receptor in colon tissues were determined by immunohistochemistry or Western blot analysis. The non-diabetes rats treated with IL-6 and the untreated diabetes rats showed increased contraction of distal colon, whereas the diabetes rats treated with anti-IL-6 antibody showed decreased contraction of distal colon compared with the untreated diabetes rats. The IL-6 levels of plasma but not colon increased in diabetes rats. The expression of IL-6 α-receptor increased in diabetes rats. These results indicate that diabetes rats show an increase in the contractions of distal colon partly via the IL-6-IL-6 receptor pathway. PMID:26191141

  5. Adiponectin, interleukin-6, and cardiovascular disease risk factors are modified by a short-term yoga-based lifestyle intervention in overweight and obese men.

    PubMed

    Sarvottam, Kumar; Magan, Dipti; Yadav, Raj Kumar; Mehta, Nalin; Mahapatra, Sushil C

    2013-05-01

    To investigate the effect of a short-term yoga-based lifestyle intervention on risk factors for cardiovascular disease (CVD) and markers of inflammation and endothelial function in overweight and obese men. Nonrandomized prospective lifestyle intervention study with pre-post design. SETTING AND LOCATION: Integral Health Clinic, an outpatient facility providing yoga-based lifestyle intervention programs for prevention and management of chronic diseases. Overweight and obese men (n=51) were enrolled in the study. Subjects who were physically unable to participate and those participating in other interventions were excluded from the study. A pretested intervention program including asanas (physical postures), pranayama (breathing exercises), group discussions, lectures, and individualized advice. The primary outcome measure was weight loss, and the secondary outcome measures were clinical and laboratory correlates of CVD risk, levels of interleukin-6 (IL-6), adiponectin, and endothelin-1 (ET-1). Men (n=51, body mass index [BMI] 26.26±2.42 kg/m(2)) were enrolled and underwent a yoga-based lifestyle intervention for 10 days. Of 51 subjects, 30 completed the study. There was a significant reduction in weight from Baseline to Day 10 (74.60±7.98, 72.69±8.37 kg, p<0.001, respectively), BMI (26.26±2.42, 25.69±2.47 kg/m(2), p<0.001, respectively), and systolic BP (121.73±11.58, 116.73±9.00, p=0.042, respectively). There was a significant reduction in plasma IL-6 from Baseline to Day 10 (median 2.24 vs. 1.26 pg/mL, respectively, p=0.012). There was a significant increase in the plasma adiponectin from Baseline to Day 10 (median 4.95 vs. 6.26 μg/mL, respectively, p=0.014). Plasma ET-1 level remained unchanged. These findings suggest that even a short-term yoga-based lifestyle intervention may be an important modality to reduce the risk for CVD as indicated by weight loss, reduction in systolic blood pressure, an increase in adiponectin, and decrease in IL-6 in

  6. Napping reverses the salivary interleukin-6 and urinary norepinephrine changes induced by sleep restriction.

    PubMed

    Faraut, Brice; Nakib, Samir; Drogou, Catherine; Elbaz, Maxime; Sauvet, Fabien; De Bandt, Jean-Pascal; Léger, Damien

    2015-03-01

    Neuroendocrine and immune stresses imposed by chronic sleep restriction are known to be involved in the harmful cardiovascular effects associated with poor sleep. Despite a well-known beneficial effect of napping on alertness, its effects on neuroendocrine stress and immune responses after sleep restriction are largely unknown. This study was a strictly controlled (sleep-wake status, light environment, caloric intake), crossover, randomized design in continuously polysomnography-monitored subjects. The study was conducted in a laboratory-based study. The subjects were 11 healthy young men. We investigated the effects on neuroendocrine and immune biomarkers of a night of sleep restricted to 2 h followed by a day without naps or with 30 minute morning and afternoon naps, both conditions followed by an ad libitum recovery night starting at 20:00. Salivary interleukin-6 and urinary catecholamines were assessed throughout the daytime study periods. The increase in norepinephrine values seen at the end of the afternoon after the sleep-restricted night was not present when the subjects had the opportunity to take naps. Interleukin-6 changes observed after sleep deprivation were also normalized after napping. During the recovery day in the no-nap condition, there were increased levels of afternoon epinephrine and dopamine, which was not the case in the nap condition. A recovery night after napping was associated with a reduced amount of slow-wave sleep compared to after the no-nap condition. Our data suggest that napping has stress-releasing and immune effects. Napping could be easily applied in real settings as a countermeasure to the detrimental health consequences of sleep debt.

  7. Adipose-Derived Stem Cells Enhance Cancer Stem Cell Property and Tumor Formation Capacity in Lewis Lung Carcinoma Cells Through an Interleukin-6 Paracrine Circuit.

    PubMed

    Lu, Jui-Hua; Wei, Hong-Jian; Peng, Bou-Yue; Chou, Hsin-Hua; Chen, Wei-Hong; Liu, Hen-Yu; Deng, Win-Ping

    2016-12-01

    Adipose-derived stem cells (ADSCs) are multipotent cells that have attracted much recent attention and emerged as therapeutic approaches in several medical fields. Although current knowledge of the biological impacts of ADSCs in cancer research is greatly improved, the underlying effects of ADSCs in tumor development remain controversial and cause the safety concerns in clinical utilization. Hence, we isolated primary ADSCs from the abdominal fat of mice and conducted interaction of ADSCs with Lewis lung carcinoma cells in culture and in mice to investigate the impacts of ADSCs on tumor development. Cytokine array and neutralizing antibody were further utilized to identify the key regulator and downstream signaling pathway. In this study, we demonstrated that ADSCs enhance the malignant characteristics of LLC1 cells, including cell growth ability and especially cancer stem cell property. ADSCs were then identified to promote tumor formation and growth in mice. We further determined that ADSC interaction with LLC1 cells stimulates increased secretion of interleukin-6 mainly from ADSCs, which then act in a paracrine manner on LLC1 cells to enhance their malignant characteristics. Interleukin-6 was also identified to regulate genes related to cell proliferation and cancer stem cell, as well as to activate JAK2/STAT3, a predominant interleukin-6-activated pathway, in LLC1 cells. Collectively, we demonstrated that ADSCs play a pro-malignant role in tumor development of Lewis lung carcinoma cells by particularly promoting cancer stem cell property through interleukin-6 paracrine circuit, which is important for safety considerations regarding the clinical application of ADSCs.

  8. Interleukin-6/Stat3 signaling has an essential role in the host antimicrobial response to urinary tract infection.

    PubMed

    Ching, Christina B; Gupta, Sudipti; Li, Birong; Cortado, Hanna; Mayne, Nicholas; Jackson, Ashley R; McHugh, Kirk M; Becknell, Brian

    2018-06-01

    The signaling networks regulating antimicrobial activity during urinary tract infection (UTI) are incompletely understood. Interleukin-6 (IL-6) levels increase with UTI severity, but the specific contributions of IL-6 to host immunity against bacterial uropathogens are unknown. To clarify this we tested whether IL-6 activates the Stat3 transcription factor, to drive a program of antimicrobial peptide gene expression in infected urothelium during UTI. Transurethral inoculation of uropathogenic Escherichia coli led to IL-6 secretion, urothelial Stat3 phosphorylation, and activation of antimicrobial peptide transcription, in a Toll-like receptor 4-dependent manner in a murine model of cystitis. Recombinant IL-6 elicited Stat3 phosphorylation in primary urothelial cells in vitro, and systemic IL-6 administration promoted urothelial Stat3 phosphorylation and antimicrobial peptide expression in vivo. IL-6 deficiency led to decreased urothelial Stat3 phosphorylation and antimicrobial peptide mRNA expression following UTI, a finding mirrored by conditional Stat3 deletion. Deficiency in IL-6 or Stat3 was associated with increased formation of intracellular bacterial communities, and exogenous IL-6 reversed this phenotype in IL-6 knockout mice. Moreover, chronic IL-6 depletion led to increased renal bacterial burden and severe pyelonephritis in C3H/HeOuJ mice. Thus, IL-6/Stat3 signaling drives a transcriptional program of antimicrobial gene expression in infected urothelium, with key roles in limiting epithelial invasion and ascending infection. Copyright © 2018 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  9. Association of interleukin 18, interleukin 2, and tumor necrosis factor polymorphisms with subacute sclerosing panencephalitis.

    PubMed

    Piskin, Ibrahim Etem; Karakas-Celik, Sevim; Calik, Mustafa; Abuhandan, Mahmut; Kolsal, Ebru; Genc, Gunes Cakmak; Iscan, Akin

    2013-06-01

    Subacute sclerosing panencephalitis (SSPE) is a progressive inflammatory and degenerative disorder of the central nervous system. The measles virus (MV) and host and environmental factors are involved in the development of SSPE, but the precise mechanism by which the MV causes SSPE is still unknown. Studies have indicated that in SSPE patients, specific polymorphisms of certain genes are most likely involved in impairing the host's ability to eradicate the MV. The purpose of our study was to elucidate the role of polymorphisms in the genes encoding interleukin (IL)-2, IL-18, and tumor necrosis factor alpha (TNF-α) in the development of SSPE. Using the polymerase chain reaction with sequence-specific primers, the single-nucleotide polymorphisms (SNPs) of the promoter regions of IL-2 (-330), TNF-α (-308), and IL-18 (-137 and -607) were studied in 54 patients with SSPE and 72 healthy controls. The frequency of SSPE patients with the AA genotype of IL-18 at position -607 was significantly higher than the frequency of those with the CC genotype (p<0.001, odds ratio [OR]: 5.76), and a significantly higher proportion of patients had the C allele at -137 compared with the controls (p=0.002, OR: 2.72). In a haplotype analysis of two SNPs in the IL-18 gene, the frequency of the CA haplotype was significantly higher in SSPE patients (p<0.001, OR: 3.99) than in the controls. The IL-2 (-330) and TNF-α (-308) polymorphisms revealed no significant differences. In conclusion, these data suggest that the IL-18 gene polymorphisms at position -607 and -137 might be genetic risk factors for the SSPE disease.

  10. Impact of fasting followed by short-term exposure to interleukin-6 on cytochrome P450 mRNA in mice.

    PubMed

    Rasmussen, Martin Krøyer; Bertholdt, Lærke; Gudiksen, Anders; Pilegaard, Henriette; Knudsen, Jakob G

    2018-01-05

    The gene expression of the cytochrome P450 (CYP) enzyme family is regulated by numerous factors. Fasting has been shown to induce increased hepatic CYP mRNA in both humans and animals. However, the coordinated regulation of CYP, CYP-regulating transcription factors, and transcriptional co-factors in the liver linking energy metabolism to detoxification has never been investigated. Interleukin-6 (IL-6) has been suggested to be released during fasting and has been shown to regulate CYP expression. The present study investigated the hepatic mRNA content of selected CYP, AhR, CAR, PXR and PPARα in mice fasted for 18h and subsequently exposed to IL-6. Furthermore, the impact of fasting on PGC-1α, HNF-4α, SIRT1 and SIRT3 mRNA was examined. Fasting induced a marked increase in Cyp2b10, Cyp2e1 and Cyp4a10 mRNA, while CYP1a1, Cyp1a2, Cyp2a4 and Cyp3a11 mRNA levels remained unchanged. In accordance, the mRNA levels of CAR and PPARα were also increased with fasting. The PGC-1α, SIRT1 and SIRT3 mRNA levels were also increased after fasting, while the HNF-4α mRNA levels remained unchanged. In mice subjected to IL-6 injection, the fasting-induced PXR, PPARα and PGC-1α mRNA responses were lower than after saline injection. In conclusion, fasting was demonstrated to be a strong inducer of hepatic CYP mRNA as well as selected transcription factors controlling the expression of the investigated CYP. Moreover, the mRNA levels of transcriptional co-factors acting as energy sensors and co-factors for CYP regulation was also increased in the liver, suggesting crosstalk at the molecular level between regulation of energy metabolism and detoxification. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Interleukin-6 deficiency attenuates angiotensin II-induced cardiac pathogenesis with increased myocyte hypertrophy.

    PubMed

    Chen, Fan; Chen, Dandan; Zhang, Yubin; Jin, Liang; Zhang, Han; Wan, Miyang; Pan, Tianshu; Wang, Xiaochuan; Su, Yuheng; Xu, Yitao; Ye, Junmei

    2017-12-16

    Interleukin-6 (IL-6) signaling is critical for cardiomyocyte hypertrophy, while the role of IL-6 in the pathogenesis of myocardium hypertrophy remains controversial. To determine the essential role of IL-6 signaling for the cardiac development during AngII-induced hypertension, and to elucidate the mechanisms, wild-type (WT) and IL-6 knockout (IL-6 KO) mice were infused subcutaneously with either vehicle or AngII (1.5 μg/h/mouse) for 1 week. Immunohistological and serum studies revealed that the extents of cardiac fibrosis, inflammation and apoptosis were reduced in IL-6 KO heart during AngII-stimulation, while cardiac hypertrophy was obviously induced. To investigate the underlying mechanisms, by using myocardial tissue and neonatal cardiomyocytes, we observed that IL-6/STAT3 signaling was activated under the stimulation of AngII both in vivo and in vitro. Further investigation suggested that STAT3 activation enhances the inhibitory effect of EndoG on MEF2A and hampers cardiomyocyte hypertrophy. Our study is the first to show the important role of IL-6 in regulating cardiac pathogenesis via inflammation and apoptosis during AngII-induced hypertension. We also provide a novel link between IL-6/STAT3 and EndoG/MEF2A pathway that affects cardiac hypertrophy during AngII stimulation. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. The association between sex-related interleukin-6 gene polymorphisms and the risk for cerebral palsy.

    PubMed

    Bi, Dan; Chen, Mingjie; Zhang, Xiaoli; Wang, Honglian; Xia, Lei; Shang, Qing; Li, Tongchuan; Zhu, Dengna; Blomgren, Klas; He, Lin; Wang, Xiaoyang; Xing, Qinghe; Zhu, Changlian

    2014-06-06

    The relationship between genetic factors and the development of cerebral palsy (CP) has recently attracted much attention. Polymorphisms in the genes encoding proinflammatory cytokines have been shown to be associated with susceptibility to perinatal brain injury and development of CP. Interleukin-6 (IL-6) is a proinflammatory cytokine that plays a pivotal role in neonatal brain injury, but conflicting results have been reported regarding the association between IL-6 single nucleotide polymorphisms (SNPs) and CP. The purpose of this study was to analyze IL-6 gene polymorphisms and protein expression and to explore the role of IL-6 in the Chinese CP population. A total of 753 healthy controls and 713 CP patients were studied to detect the presence of five SNPs (rs1800796, rs2069837, rs2066992, rs2069840, and rs10242595) in the IL-6 locus. Of these, 77 healthy controls and 87 CP patients were selected for measurement of plasma IL-6 by Luminex assay. The SHEsis program was used to analyze the genotyping data. For all comparisons; multiple testing on each individual SNP was corrected by the SNPSpD program. There were no differences in allele or genotype frequencies between the overall CP patients and controls among the five genetic polymorphisms. However, subgroup analysis found significant sex-related differences in allele and genotype frequencies. Differences were found between spastic CP and controls in males for rs2069837; between CP with periventricular leukomalacia and controls in males for rs1800796 and rs2066992; and between term CP and controls in males for rs2069837. Plasma IL-6 levels were higher in CP patients than in the controls, and this difference was more robust in full-term male spastic CP patients. Furthermore, the genotype has an effect on IL-6 synthesis. The influence of IL-6 gene polymorphisms on IL-6 synthesis and the susceptibility to CP is related to sex and gestational age.

  13. The association between sex-related interleukin-6 gene polymorphisms and the risk for cerebral palsy

    PubMed Central

    2014-01-01

    Background The relationship between genetic factors and the development of cerebral palsy (CP) has recently attracted much attention. Polymorphisms in the genes encoding proinflammatory cytokines have been shown to be associated with susceptibility to perinatal brain injury and development of CP. Interleukin-6 (IL-6) is a proinflammatory cytokine that plays a pivotal role in neonatal brain injury, but conflicting results have been reported regarding the association between IL-6 single nucleotide polymorphisms (SNPs) and CP. The purpose of this study was to analyze IL-6 gene polymorphisms and protein expression and to explore the role of IL-6 in the Chinese CP population. Methods A total of 753 healthy controls and 713 CP patients were studied to detect the presence of five SNPs (rs1800796, rs2069837, rs2066992, rs2069840, and rs10242595) in the IL-6 locus. Of these, 77 healthy controls and 87 CP patients were selected for measurement of plasma IL-6 by Luminex assay. The SHEsis program was used to analyze the genotyping data. For all comparisons; multiple testing on each individual SNP was corrected by the SNPSpD program. Results There were no differences in allele or genotype frequencies between the overall CP patients and controls among the five genetic polymorphisms. However, subgroup analysis found significant sex-related differences in allele and genotype frequencies. Differences were found between spastic CP and controls in males for rs2069837; between CP with periventricular leukomalacia and controls in males for rs1800796 and rs2066992; and between term CP and controls in males for rs2069837. Plasma IL-6 levels were higher in CP patients than in the controls, and this difference was more robust in full-term male spastic CP patients. Furthermore, the genotype has an effect on IL-6 synthesis. Conclusions The influence of IL-6 gene polymorphisms on IL-6 synthesis and the susceptibility to CP is related to sex and gestational age. PMID:24903966

  14. Ciliary neurotrophic factor is an endogenous pyrogen.

    PubMed Central

    Shapiro, L; Zhang, X X; Rupp, R G; Wolff, S M; Dinarello, C A

    1993-01-01

    Fever is initiated by the action of polypeptide cytokines called endogenous pyrogens, which are produced by the host during inflammation, trauma, or infection and which elevate the thermoregulatory set point in the hypothalamus. Ciliary neurotrophic factor (CNTF) supports the differentiation and survival of central and peripheral neurons. We describe the activity of CNTF as intrinsically pyrogenic in the rabbit. CNTF induced a monophasic fever which rose rapidly (within the first 12 min) following intravenous injection; CNTF fever was blocked by pretreatment with indomethacin. The fever induced by CNTF was not due to contaminating endotoxins. Increasing doses of CNTF resulted in prolongation of the fever, suggesting the subsequent induction of additional endogenous pyrogenic activity. After passive transfer of plasma obtained during CNTF-induced fever, endogenous pyrogen activity was not present in the circulation; CNTF also did not induce the endogenous pyrogens interleukin 1, tumor necrosis factor, or interleukin 6 in vitro. Nevertheless, a second endogenous pyrogen may originate within the central nervous system following the systemic injection of CNTF. Of the four endogenous pyrogens described to date (interleukin 1, tumor necrosis factor, interferon, and interleukin 6), CNTF, like interleukin 6, utilizes the cell-surface gp 130 signal-transduction apparatus. PMID:8378338

  15. Modulation of Interleukins in Sepsis-Associated Clotting Disorders: Interplay With Hemostatic Derangement.

    PubMed

    Low, Christopher; Syed, Daneyal; Khan, Daniel; Tetik, Sermin; Walborn, Amanda; Hoppensteadt, Debra; Mosier, Michael; Fareed, Jawed

    2017-01-01

    Interleukins play a central role in the immune system and are involved in a variety of immunological, inflammatory, and infectious disease states including sepsis syndrome. Levels of interleukins may correlate with overall survival and may directly or indirectly affect some of the regulators of coagulation and fibrinolysis, thereby disrupting hemostasis and thrombosis. Our hypothesis is that in sepsis-associated coagulopathies (SACs), interleukins may be upregulated, leading to hemostatic imbalance by generating thrombogenic mediators. We profiled the levels of interleukins IL-1α, IL-1β, IL-2, IL-4, IL-6, IL-8, and IL-10 in addition to d-dimer (DD) in patients with SAC and in normal donors. We observed the highest increase in interleukins IL-6 (322-fold), IL-8 (48-fold), IL-10 (72-fold), and DD (18-fold). This suggests that interleukins such as IL-6 and IL-10 have a close association with coagulopathy and fibrinolytic dysregulation in sepsis and can be considered as candidates for potential therapeutic targets in SAC. © The Author(s) 2016.

  16. Cytokine Profiling of Ascites at Primary Surgery Identifies an Interaction of Tumor Necrosis Factor-α and Interleukin-6 in Predicting Reduced Progression-Free Survival in Epithelial Ovarian Cancer

    PubMed Central

    Kolomeyevskaya, Nonna; Eng, Kevin H.; Khan, Anm Nazmul H.; Grzankowski, Kassondra S.; Singel, Kelly L.; Moysich, Kirsten; Segal, Brahm H.

    2015-01-01

    Objectives Epithelial ovarian cancer (EOC) typically presents with advanced disease. Even with optimal debulking and response to adjuvant chemotherapy, the majority of patients will have disease relapse. We evaluated cytokine and chemokine profiles in ascites at primary surgery as biomarkers for progression-free survival (PFS) and overall survival (OS) in patients with advanced EOC. Methods Retrospective analysis of patients (n =70) who underwent surgery at Roswell Park Cancer Institute between 2002-12, followed by platinum-based chemotherapy. Results The mean age at diagnosis was 61.8 years, 85.3% had serous EOC, and 95.7% had stage IIIB, IIIC, or IV disease. Univariate analysis showed that ascites levels of tumor necrosis factor (TNF)-α were associated with reduced PFS after primary surgery. Although the ascites concentration of interleukin (IL)-6 was not by itself predictive of PFS, we found that stratifying patients by high TNF-α and high IL-6 levels identified a sub-group of patients at high risk for rapid disease relapse. This effect was largely independent of clinical prognostic variables. Conclusions The combination of high TNF-α and high IL-6 ascites levels at primary surgery predicts worse PFS in patients with advanced EOC. These results suggest an interaction between ascites TNF-α and IL-6 in driving tumor progression and resistance to chemotherapy in advanced EOC, and raise the potential for pre-treatment ascites levels of these cytokines as prognostic biomarkers. This study involved a small sample of patients and was an exploratory analysis; therefore, findings require validation in a larger independent cohort. PMID:26001328

  17. Cytokine profiling of ascites at primary surgery identifies an interaction of tumor necrosis factor-α and interleukin-6 in predicting reduced progression-free survival in epithelial ovarian cancer.

    PubMed

    Kolomeyevskaya, Nonna; Eng, Kevin H; Khan, Anm Nazmul H; Grzankowski, Kassondra S; Singel, Kelly L; Moysich, Kirsten; Segal, Brahm H

    2015-08-01

    Epithelial ovarian cancer (EOC) typically presents with advanced disease. Even with optimal debulking and response to adjuvant chemotherapy, the majority of patients will have disease relapse. We evaluated cytokine and chemokine profiles in ascites at primary surgery as biomarkers for progression-free survival (PFS) and overall survival (OS) in patients with advanced EOC. Retrospective analysis of patients (n =70) who underwent surgery at Roswell Park Cancer Institute between 2002 and 2012, followed by platinum-based chemotherapy. The mean age at diagnosis was 61.8 years, 85.3% had serous EOC, and 95.7% had stage IIIB, IIIC, or IV disease. Univariate analysis showed that ascites levels of tumor necrosis factor (TNF)-α were associated with reduced PFS after primary surgery. Although the ascites concentration of interleukin (IL)-6 was not by itself predictive of PFS, we found that stratifying patients by high TNF-α and high IL-6 levels identified a sub-group of patients at high risk for rapid disease relapse. This effect was largely independent of clinical prognostic variables. The combination of high TNF-α and high IL-6 ascites levels at primary surgery predicts worse PFS in patients with advanced EOC. These results suggest an interaction between ascites TNF-α and IL-6 in driving tumor progression and resistance to chemotherapy in advanced EOC, and raise the potential for pre-treatment ascites levels of these cytokines as prognostic biomarkers. This study involved a small sample of patients and was an exploratory analysis; therefore, findings require validation in a larger independent cohort. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Role of interleukin-6 and pentraxin 3 as an early marker in Peyronie's disease.

    PubMed

    Atar, Arda; Kural, Alev; Yenice, Gurkan; Comez, Ilker; Tugcu, Volkan

    2017-04-01

    Inflammation is mechanistically involved in the development of Peyronie's disease (PD). The aim of this study is to assess the relevance of serum pentraxin 3 (PTX3) and interleukin-6 (IL-6) concentrations in PD. The study enrolled 40 patients with PD in the acute phase and 40 healthy controls. Plasma PTX3 and IL-6 concentrations were evaluated in 40 patients in the acute phase of PD and 40 healthy controls by enzyme-linked immunosorbent assay. Serum concentrations of both PTX3 and IL-6 were significantly higher in the PD patients than in the control group (p=0.001 and p=0.001, respectively). There was a significant correlation between concentration of PTX3 and painful erections. IL-6 concentrations were significantly higher in patients with erectile dysfunction. IL-6 and PTX3 levels showed no correlation with age, serum C-reactive protein, degree of curvature, and disease duration. IL-6 trans-signaling and PTX3 amplification at the site of inflammation could have a role in pathophysiological mechanisms of PD. Biological drugs may be used for treatment during the acute phase of the disease based on this mechanism. Copyright © 2017. Published by Elsevier Taiwan.

  19. Effect of 1.2% of simvastatin gel as a local drug delivery system on Gingival Crevicular Fluid interleukin-6 & interleukin-8 levels in non surgical treatment of chronic periodontitis patients.

    PubMed

    Gunjiganur Vemanaradhya, Gayathri; Emani, Shilpa; Mehta, Dhoom Singh; Bhandari, Shilpy

    2017-10-01

    The present study was carried out to evaluate the effect of 1.2% simvastatin gel as local drug delivery (LDD) system on Gingival Crevicular Fluid (GCF) Interleukin -6 (IL-6) and Interleukin-8 (IL-8) levels in chronic periodontitis patients, in addition to scaling and root planing (SRP). A total of 46 chronic periodontitis patients were equally divided into two groups. Group I patients were treated by SRP; Group II patients were treated by SRP followed by LDD of 1.2% simvastatin (SMV) gel. Plaque index (PI), Gingival index(GI), Sulcus Bleeding Index (SBI), Probing pocket depth (PPD) and Relative clinical attachment level (CAL) were recorded & GCF samples were collected at baseline (0day) and at 45th day from both the groups. The collected GCF samples were analysed for IL-6 and IL-8 levels with enzyme-linked immunosorbent assay (ELISA). Both the groups showed significant reduction in all the clinical parameters scores and IL-6 and IL-8 levels after non-surgical periodontal therapy (SRP for group I/SRP+1.2% SMV gel for group II) in contrast to baseline values. However, a greater reduction was observed in group II. A non-significant positive correlation was observed between clinical parameters and IL-6 and IL-8 levels except at baseline, a significant correlation was observed between PPD &IL 6 levels in group II. In adjunct to SRP, 1.2% Simvastatin gel acts as an effective local drug delivery agent for the management of chronic periodontitis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Interleukin 6 Inhibition and Coronary Artery Disease in a High-Risk Population: A Prospective Community-Based Clinical Study.

    PubMed

    Bacchiega, Bruno Cesar; Bacchiega, Ana Beatriz; Usnayo, Magali Justina Gomez; Bedirian, Ricardo; Singh, Gurkirpal; Pinheiro, Geraldo da Rocha Castelar

    2017-03-13

    Atherosclerosis is a chronic inflammatory disease, with interleukin 6 (IL-6) as a major player in inflammation cascade. IL-6 blockade may reduce cardiovascular risk, but current treatments to block IL-6 also induce dyslipidemia, a finding with an uncertain prognosis. We aimed to determine the endothelial function responses to the IL-6-blocking agent tocilizumab, anti-tumor necrosis factor α, and synthetic disease-modifying antirheumatic drug therapies in patients with rheumatoid arthritis in a 16-week prospective study. Sixty consecutive patients with rheumatoid arthritis were enrolled. Tocilizumab and anti-tumor necrosis factor α therapy were started in 18 patients each while 24 patients were treated with synthetic disease-modifying antirheumatic drugs. Forty patients completed the 16-week follow-up period. The main outcome was flow-mediated dilation percentage variation before and after therapy. In the tocilizumab group, flow-mediated dilation percentage variation increased statistically significantly from a pre-treatment mean of (3.43% [95% CI, 1.28-5.58] to 5.96% [95% CI, 3.95-7.97]; P =0.03). Corresponding changes were 4.78% (95% CI, 2.13-7.42) to 6.75% (95% CI, 4.10-9.39) ( P =0.09) and 2.87% (95% CI, -2.17 to 7.91) to 4.84% (95% CI, 2.61-7.07) ( P =0.21) in the anti-tumor necrosis factor α and the synthetic disease-modifying antirheumatic drug groups, respectively (both not statistically significant). Total cholesterol increased significantly in the tocilizumab group from 197.5 (95% CI, 177.59-217.36) to 232.3 (201.62-263.09) ( P =0.003) and in the synthetic disease-modifying antirheumatic drug group from 185.8 (95% CI, 169.76-201.81) to 202.8 (95% CI, 176.81-228.76) ( P =0.04), but not in the anti-tumor necrosis factor α group. High-density lipoprotein did not change significantly in any group. Endothelial function is improved by tocilizumab in a high-risk population, even as it increases total cholesterol and low-density lipoprotein levels. © 2017 The

  1. Discovery and hit-to-lead optimization of 2,6-diaminopyrimidine inhibitors of interleukin-1 receptor-associated kinase 4

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McElroy, William T.; Michael Seganish, W.; Jason Herr, R.

    2015-05-01

    Interleukin receptor-associated kinase 4 (IRAK4) is a critical element of the Toll-like/interleukin-1 receptor inflammation signaling pathway. A screening campaign identified a novel diaminopyrimidine hit that exhibits weak IRAK4 inhibitory activity and a ligand efficiency of 0.25. Hit-to-lead activities were conducted through independent SAR studies of each of the four pyrimidine substituents. Optimal activity was observed upon removal of the pyrimidine C-4 chloro substituent. The intact C-6 carboribose is required for IRAK4 inhibition. Numerous heteroaryls were tolerated at the C-5 position, with azabenzothiazoles conferring the best activities. Aminoheteroaryls were preferred at the C-2 position. These studies led to the discovery ofmore » inhibitors 35, 36, and 38 that exhibit nanomolar inhibition of IRAK4, improved ligand efficiencies, and modest kinase selectivities.« less

  2. Discovery and hit-to-lead optimization of 2,6-diaminopyrimidine inhibitors of interleukin-1 receptor-associated kinase 4.

    PubMed

    McElroy, William T; Michael Seganish, W; Jason Herr, R; Harding, James; Yang, Jinhai; Yet, Larry; Komanduri, Venukrishnan; Prakash, Koraboina Chandra; Lavey, Brian; Tulshian, Deen; Greenlee, William J; Sondey, Christopher; Fischmann, Thierry O; Niu, Xiaoda

    2015-05-01

    Interleukin receptor-associated kinase 4 (IRAK4) is a critical element of the Toll-like/interleukin-1 receptor inflammation signaling pathway. A screening campaign identified a novel diaminopyrimidine hit that exhibits weak IRAK4 inhibitory activity and a ligand efficiency of 0.25. Hit-to-lead activities were conducted through independent SAR studies of each of the four pyrimidine substituents. Optimal activity was observed upon removal of the pyrimidine C-4 chloro substituent. The intact C-6 carboribose is required for IRAK4 inhibition. Numerous heteroaryls were tolerated at the C-5 position, with azabenzothiazoles conferring the best activities. Aminoheteroaryls were preferred at the C-2 position. These studies led to the discovery of inhibitors 35, 36, and 38 that exhibit nanomolar inhibition of IRAK4, improved ligand efficiencies, and modest kinase selectivities. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Dehydroepiandrosterone in relation to other adrenal hormones during an acute inflammatory stressful disease state compared with chronic inflammatory disease: role of interleukin-6 and tumour necrosis factor.

    PubMed

    Straub, Rainer H; Lehle, Karin; Herfarth, Hans; Weber, Markus; Falk, Werner; Preuner, Jurgen; Scholmerich, Jurgen

    2002-03-01

    Serum levels of dehydroepiandrosterone (DHEA) and DHEA sulphate (DHEAS) are low in chronic inflammatory diseases, although the reasons are unexplained. Furthermore, the behaviour of serum levels of these hormones during an acute inflammatory stressful disease state is not well known. In this study in patients with an acute inflammatory stressful disease state (13 patients undergoing cardiothoracic surgery) and patients with chronic inflammation (61 patients with inflammatory bowel diseases (IBD)) vs. 120 controls, we aimed to investigate adrenal hormone shifts looking at serum levels of DHEA in relation to other adrenal hormones. Furthermore, we tested the predictive role of serum tumour necrosis factor (TNF) and interleukin-6 (IL-6) for a change of serum levels of DHEA in relation to other adrenal hormones. The molar ratio of serum levels of DHEA/androstenedione (ASD) was increased in patients with an acute inflammatory stressful disease state and was decreased in patients with chronic inflammation. The molar ratio of serum levels of DHEAS/DHEA was reduced during an acute inflammatory stressful disease state and was increased in patients with chronic inflammation. A multiple linear regression analysis revealed that elevated serum levels of TNF were associated with a high ratio of serum levels of DHEA/ASD in all groups (for IL-6 in patients with an acute inflammatory stressful disease state only), and, similarly, elevated serum levels of TNF were associated with a high ratio of serum levels of DHEAS/DHEA only in IBD (for IL-6 only in healthy subjects). This study indicates that changes of serum levels of DHEA in relation to serum levels of other adrenal hormones are completely different in patients with an acute inflammatory stressful disease state compared with patients with chronic inflammation. The decrease of serum levels of DHEAS and DHEA is typical for chronic inflammation and TNF and IL-6 play a predictive role for these changes.

  4. Interleukin-17B Antagonizes Interleukin-25-Mediated Mucosal Inflammation.

    PubMed

    Reynolds, Joseph M; Lee, Young-Hee; Shi, Yun; Wang, Xiaohu; Angkasekwinai, Pornpimon; Nallaparaju, Kalyan C; Flaherty, Stephanie; Chang, Seon Hee; Watarai, Hiroshi; Dong, Chen

    2015-04-21

    The interleukin-17 (IL-17) family of cytokines has emerged as a critical player in inflammatory diseases. Among them, IL-25 has been shown to be important in allergic inflammation and protection against parasitic infection. Here we have demonstrated that IL-17B, a poorly understood cytokine, functions to inhibit IL-25-driven inflammation. IL-17B and IL-25, both binding to the interleukin-17 receptor B (IL-17RB), were upregulated in their expression after acute colonic inflammation. Individual inhibition of these cytokines revealed opposing functions in colon inflammation: IL-25 was pathogenic but IL-17B was protective. Similarly opposing phenotypes were observed in Citrobacter rodentium infection and allergic asthma. Moreover, IL-25 was found to promote IL-6 production from colon epithelial cells, which was inhibited by IL-17B. Therefore, our data demonstrate that IL-17B is an anti-inflammatory cytokine in the IL-17 family. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Tissue-Specific Autoregulation of the stat3 Gene and Its Role in Interleukin-6-Induced Survival Signals in T Cells

    PubMed Central

    Narimatsu, Masahiro; Maeda, Hisoka; Itoh, Shousaku; Atsumi, Toru; Ohtani, Takuya; Nishida, Keigo; Itoh, Motoyuki; Kamimura, Daisuke; Park, Sung-Joo; Mizuno, Katsunori; Miyazaki, Jun-ichi; Hibi, Masahiko; Ishihara, Katsuhiko; Nakajima, Koichi; Hirano, Toshio

    2001-01-01

    Signal transducer and activator of transcription 3 (STAT3) mediates signals of various growth factors and cytokines, including interleukin-6 (IL-6). In certain IL-6-responsive cell lines, the stat3 gene is autoregulated by STAT3 through a composite IL-6 response element in its promoter that contains a STAT3-binding element (SBE) and a cyclic AMP-responsive element. To reveal the nature and roles of the stat3 autoregulation in vivo, we generated mice that harbor a mutation in the SBE (stat3mSBE). The intact SBE was crucial for IL-6-induced stat3 gene activation in the spleen, especially in the red pulp region, the kidney, and both mature and immature T lymphocytes. The SBE was not required, however, for IL-6-induced stat3 gene activation in hepatocytes. T lymphocytes from the stat3mSBE/mSBE mice were more susceptible to apoptosis despite the presence of IL-6 than those from wild-type mice. Consistent with this, IL-6-dependent activation of the Pim-1 and junB genes, direct target genes for STAT3, was attenuated in T lymphocytes of the stat3mSBE/mSBE mice. Thus, the tissue-specific autoregulation of the stat3 gene operates in vivo and plays a role in IL-6-induced antiapoptotic signaling in T cells. PMID:11533249

  6. Muscle interleukin-6 and fasting-induced PDH regulation in mouse skeletal muscle.

    PubMed

    Gudiksen, Anders; Bertholdt, Laerke; Vingborg, Mikkel Birkkjaer; Hansen, Henriette Watson; Ringholm, Stine; Pilegaard, Henriette

    2017-03-01

    Fasting prompts a metabolic shift in substrate utilization from carbohydrate to predominant fat oxidation in skeletal muscle, and pyruvate dehydrogenase (PDH) is seen as a controlling link between the competitive oxidation of carbohydrate and fat during metabolic challenges like fasting. Interleukin (IL)-6 has been proposed to be released from muscle with concomitant effects on both glucose and fat utilization. The aim was to test the hypothesis that muscle IL-6 has a regulatory impact on fasting-induced suppression of skeletal muscle PDH. Skeletal muscle-specific IL-6 knockout (IL-6 MKO) mice and floxed littermate controls (control) were either fed or fasted for 6 or 18 h. Lack of muscle IL-6 elevated the respiratory exchange ratio in the fed and early fasting state, but not with prolonged fasting. Activity of PDH in the active form (PDHa) was higher in fed and fasted IL-6 MKO than in control mice at 18 h, but not at 6 h, whereas lack of muscle IL-6 did not prevent downregulation of PDHa activity in skeletal muscle or changes in plasma and muscle substrate levels in response to 18 h of fasting. Phosphorylation of three of four sites on PDH-E1α increased with 18 h of fasting, but was lower in IL-6 MKO mice than in control. In addition, both PDK4 mRNA and protein increased with 6 and 18 h of fasting in both genotypes, but PDK4 protein was lower in IL-6 MKO than in control. In conclusion, skeletal muscle IL-6 seems to regulate whole body substrate utilization in the fed, but not fasted, state and influence skeletal muscle PDHa activity in a circadian manner. However, skeletal muscle IL-6 is not required for maintaining metabolic flexibility in response to fasting. Copyright © 2017 the American Physiological Society.

  7. Gender, Race/Ethnicity, Personality, and Interleukin-6 in Urban Primary Care Patients

    PubMed Central

    Chapman, Benjamin P.; Khan, Ayesha; Harper, Mary; Stockman, Doug; Fiscella, Kevin; Walton, James; Duberstein, Paul; Talbot, Nancy; Lyness, Jeffrey M.; Moynihan, Jan

    2009-01-01

    Gender, race/ethnicity, and personality are markers of significant psychosocial and biological variability. Each may have implications for allostatic load and resulting inflammatory processes, yet findings have been largely mixed. We investigated whether women, minorities, and those higher in Neuroticism and lower in Extraversion were at risk for elevated circulating levels of the pro-inflammatory cytokine interleukin (IL)-6 in a sample of 103 middle aged and older urban primary care patients. Regression analyses controlling for age, education, current depression levels, and chronic medical conditions revealed that women, minorities, and individuals lower in Extraversion had higher circulating levels of IL-6. Analyses of more specific personality traits revealed that the sociability and positive emotions components of Extraversion were unassociated with IL-6, but the activity facet--reflecting dispositional vigor and energy--was robustly associated with IL-6. The difference between high (+1 Standard Deviation (SD)) and low (−1 SD) trait activity was sufficient to shift IL-6 levels beyond a previously established high risk cut-point in both white and minority women. These findings suggest that while broad group differences between genders and races/ethnicities exist, personality represents an important source of individual differences in inflammation within groups. Future work should examine to what extent IL-6 levels are linked to temperament or genetic activity levels vs. physical activity itself, and whether IL-6 levels may be reduced by boosting regular activity levels in demographic segments such as women and minorities who appear susceptible to greater inflammation. PMID:19162168

  8. Mangiferin inhibits lipopolysaccharide-induced production of interleukin-6 in human oral epithelial cells by suppressing toll-like receptor signaling.

    PubMed

    Li, Hao; Wang, Qi; Chen, Xinmin; Ding, Yi; Li, Wei

    2016-11-01

    Oral epithelial cells have currently been found to play an important role in inflammatory modulation in periodontitis. Mangiferin is a natural glucosylxanthone with anti-inflammatory activity. The aim of this study was to investigate the regulatory effect of mangiferin on lipopolysaccharide (LPS)-induced production of proinflammatory cytokine interleukin-6 (IL-6) in oral epithelial cells and the underlying mechanisms. The levels of LPS-induced IL-6 production in OKF6/TERT-2 oral keratinocytes were detected using enzyme-linked immunosorbent assay (ELISA). The expression of Toll-like receptor (TLR) 2 and TLR4 was determined using western blot analysis. And the phosphorylation of TLR downstream nuclear factor-κB (NF-κB), p38 mitogen-activated protein kinase (p38 MAPK) and c-Jun N-terminal kinase (JNK) was examined using cell-based protein phosphorylation ELISA kits. We found that mangiferin reduced LPS-upregulated IL-6 production in OKF6/TERT-2 cells. Additionally, mangiferin inhibited LPS-induced TLR2 and TLR4 overexpression, and suppressed the phosphorylation of NF-κB, p38 MAPK and JNK. Moreover, mangiferin repressed IL-6 production and TLR signaling activation in a dose-dependent manner after 24h treatment. Mangiferin decreases LPS-induced production of IL-6 in human oral epithelial cells by suppressing TLR signaling, and this glucosylxanthone may have potential for the treatment of periodontitis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Tumor Necrosis Factor-α and Interleukin (IL)-1β, IL-6, and IL-8 Impair In Vitro Migration and Induce Apoptosis of Gingival Fibroblasts and Epithelial Cells, Delaying Wound Healing.

    PubMed

    Basso, Fernanda G; Pansani, Taisa N; Turrioni, Ana Paula S; Soares, Diana G; de Souza Costa, Carlos Alberto; Hebling, Josimeri

    2016-08-01

    Multiple factors affect oral mucosal healing, such as the persistence of an inflammatory reaction. The present study evaluates effects of tumor necrosis factor (TNF)-α and interleukin (IL)-1β, IL-6, and IL-8 on epithelial cells (ECs) and human gingival fibroblasts (GFs) in vitro. GFs and ECs were seeded in 96-well plates (1 × 10(4) cells/well) in plain culture medium (Dulbecco's modified Eagle's medium [DMEM]) containing 1% antibiotic/antimycotic solution and 10% fetal bovine serum, and incubated for 24 hours. Both cell lines were exposed for 24 hours to the following cytokines: 1) TNF-α (100 ng/mL); 2) IL-1β (1 ng/mL); 3) IL-6 (10 ng/mL); and 4) IL-8 (10 ng/mL). All cytokines were diluted in serum-free DMEM. Control cultures were exposed only to serum-free DMEM. Effects of exposure to inflammatory cytokines were determined by means of: 1) apoptosis (anexin V); 2) cell migration (wound healing assay); 3) inflammatory cytokine synthesis (enzyme-linked immunosorbent assay). Data were analyzed by Kruskal-Wallis and Mann-Whitney U tests (α = 0.05). Increased apoptosis rates were noted when cells were exposed to inflammatory cytokines, except ECs exposed to IL-1β. Cell migration was negatively affected by all inflammatory cytokines for both cell lines. ECs and GFs exposed to IL-6 and IL-8 significantly increased synthesis of TNF-α and IL-1β. Demonstrated results indicate negative effects of tested inflammatory cytokines on ECs and GFs, inducing apoptosis and impairing cell migration. These results can justify delayed oral mucosa healing in the presence of inflammatory reaction.

  10. Pyropheophorbide-a methyl ester-mediated photosensitization activates transcription factor NF-kappaB through the interleukin-1 receptor-dependent signaling pathway.

    PubMed

    Matroule, J Y; Bonizzi, G; Morlière, P; Paillous, N; Santus, R; Bours, V; Piette, J

    1999-01-29

    Pyropheophorbide-a methyl ester (PPME) is a second generation of photosensitizers used in photodynamic therapy. We demonstrated that PPME photosensitization activated NF-kappaB transcription factor in colon cancer cells. Unexpectedly, this activation occurred in two separate waves, i.e. a rapid and transient one and a second slower but sustained phase. The former was due to photosensitization by PPME localized in the cytoplasmic membrane which triggered interleukin-1 receptor internalization and the transduction pathways controlled by the interleukin-1 type I receptor. Indeed, TRAF6 dominant negative mutant abolished NF-kappaB activation by PPME photosensitization, and TRAF2 dominant negative mutant was without any effect, and overexpression of IkappaB kinases increased gene transcription controlled by NF-kappaB. Oxidative stress was not likely involved in the activation. On the other hand, the slower and sustained wave could be the product of the release of ceramide through activation of the acidic sphingomyelinase. PPME localization within the lysosomal membrane could explain why ceramide acted as second messenger in NF-kappaB activation by PPME photosensitization. These data will allow a better understanding of the molecular basis of tumor eradication by photodynamic therapy, in particular the importance of the host cell response in the treatment.

  11. Interleukin-6 predicts recurrence and survival among head and neck cancer patients.

    PubMed

    Duffy, Sonia A; Taylor, Jeremy M G; Terrell, Jeffrey E; Islam, Mozaffarul; Li, Yun; Fowler, Karen E; Wolf, Gregory T; Teknos, Theodoros N

    2008-08-15

    Increased pretreatment serum interleukin (IL)-6 levels among patients with head and neck squamous cell carcinoma (HNSCC) have been shown to correlate with poor prognosis, but sample sizes in prior studies have been small and thus unable to control for other known prognostic variables. A longitudinal, prospective cohort study determined the correlation between pretreatment serum IL-6 levels, and tumor recurrence and all-cause survival in a large population (N = 444) of previously untreated HNSCC patients. Control variables included age, sex, smoking, cancer site and stage, and comorbidities. Kaplan-Meier plots and univariate and multivariate Cox proportional hazards models were used to study the association between IL-6 levels, control variables, and time to recurrence and survival. The median serum IL-6 level was 13 pg/mL (range, 0-453). The 2-year recurrence rate was 35.2% (standard error, 2.67%). The 2-year death rate was 26.5% (standard error, 2.26%). Multivariate analyses showed that serum IL-6 levels independently predicted recurrence at significant levels [hazard ratio (HR) = 1.32; 95% confidence interval (CI), 1.11 to 1.58; P = .002] as did cancer site (oral/sinus). Serum IL-6 level was also a significant independent predictor of poor survival (HR = 1.22; 95% CI, 1.02 to 1.46; P = .03), as were older age, smoking, cancer site (oral/sinus), higher cancer stage, and comorbidities. Pretreatment serum IL-6 could be a valuable biomarker for predicting recurrence and overall survival among HNSCC patients. Using IL-6 as a biomarker for recurrence and survival may allow for earlier identification and treatment of disease relapse. 2008 American Cancer Society

  12. Evaluation of interleukin-6 and serotonin as biomarkers to predict response to fluoxetine.

    PubMed

    Manoharan, Aarthi; Rajkumar, Ravi Philip; Shewade, Deepak Gopal; Sundaram, Rajan; Muthuramalingam, Avin; Paul, Abialbon

    2016-05-01

    Only 30% of major depressive disorder (MDD) patients achieve complete remission with a serotonergic antidepressant (selective serotonin reuptake inhibitor). We investigated the potential of serotonin (5-HT) and interleukin-6 (IL-6) to serve as functional biomarkers of fluoxetine response. Serum IL-6 and 5-HT were measured in 73 MDD patients (39 responders and 34 non-responders) pre- and 6 weeks post-treatment and in 44 normal controls with ELISA. Fluoxetine and norfluoxetine were measured using LC MS/MS. IL-6 levels were significantly higher in MDD patients when compared with controls (p < 0.01), and 5-HT levels were significantly lower in non-responders compared with controls (p = 0.0131). Pre- and post-treatment levels of both biomarkers individually and in combination did not significantly differ between responders and non-responders. Area under the receiver operating characteristics curve for the biomarkers was 0.5. Significant correlation was seen between the percentage change in IL-6 and percentage change in Hamilton Rating Scale for Depression score in responders. Fluoxetine and norfluoxetine concentrations were not significantly different in responders and non-responders, and there was no correlation between fluoxetine concentrations and percentage reduction in 5-HT from week 0 to 6. 5-HT and IL-6 may not serve as useful markers of response to fluoxetine because of inconsistent results across different studies. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  13. Thrombopoietic effects of interleukin-6 in long-term administration in mice.

    PubMed

    Ishibashi, T; Shikama, Y; Kimura, H; Kawaguchi, M; Uchida, T; Yamamoto, T; Okano, A; Akiyama, Y; Hirano, T; Kishimoto, T

    1993-05-01

    To further investigate the thrombopoietic and adverse effects of interleukin-6 (IL-6), 2 or 10 micrograms/day of recombinant human (rh) IL-6 was administered intraperitoneally (i.p.) to mice for up to 30 days. IL-6 increased platelet count, which plateaued at a level 30 to 40% higher than control after 5 days of treatment. This cytokine also maintained the high platelet count for the duration of treatment. The count exceeded normal levels 7 days after cessation of the 30-day treatment. IL-6 also induced a remarkable increase in the size but not the frequency of megakaryocytes in bone marrow sections. The number of bone marrow colony-forming units megakaryocyte (CFU-MK) and colony-forming units granulocyte-macrophage (CFU-GM) was not augmented by the administration of IL-6 in this protocol, while spleen progenitors were significantly stimulated. Small but significant increases did occur in the number of bone marrow megakaryocytes and CFU-MK, and in the proportion of CFU-MK in the DNA synthetic phase in mice treated with 10 micrograms/day of IL-6 for 30 days. Electron microscopic examination of bone marrow demonstrated that IL-6 remarkably developed the distribution of the demarcation membrane system (DMS) in mice treated for 30 days, with little change in mice treated for 5 days. The administration of 2 micrograms/day for 30 days induced a 2.2-fold increase in fibrinogen. No changes were observed in the hepatic or renal functions. Histologic and immunofluorescence studies on the kidneys revealed no significant changes compared with controls, indicating that proliferation of the glomerular mesangium did not occur. No neutralizing antibodies were detected in mice treated for 30 days. We conclude that the long-term administration of IL-6 in mice stimulates megakaryocyte maturation and platelet production with few adverse effects, and that this cytokine may be a candidate for the treatment of thrombocytopenia in humans.

  14. Overexpression of interleukin-6 and -8, cell growth inhibition and morphological changes in 2-hydroxyethyl methacrylate-treated human dental pulp mesenchymal stem cells.

    PubMed

    Trubiani, O; Cataldi, A; De Angelis, F; D'Arcangelo, C; Caputi, S

    2012-01-01

    To evaluate morphological features, cell growth and interleukin-6 (IL-6) and interleukin-8 (IL-8) secretion in expanded ex vivo human dental pulp mesenchymal stem cells (DP-MSCs) after exposure to 2-hydroxyethyl methacrylate (HEMA).   Dental pulp mesenchymal stem cells were derived from the dental pulps of 10 young donors. After in vitro isolation, DP-MSCs were treated with 3 and 5 mmol L(-1) HEMA, and after 24, 48 and 72 h of incubation, their morphological features, cell growth, IL-6 and IL-8 secretion were analysed. Differences in the cell growth and in the interleukin secretion were analysed for statistical significance with two-way anova tests and the Holm-Sidak method for multiple comparisons.   Dental pulp mesenchymal stem cells revealed a decrease in cell growth with both treatments (P < 0.05), more evident at 5 mmol L(-1) . Microscopic analysis displayed extensive cytotoxic effects in treated cells, which lost their fibroblastoid features and became retracted, even roundish, with a large number of granules. An up-regulation of IL-6 and IL-8 in treated cells cytokines was evident (P < 0.05).   2-Hydroxyethyl methacrylate exhibited cytotoxicity, inhibited cell growth and induced morphological changes in cultured DP-MSCs. Moreover, in treated samples, an up-regulation of soluble mediators of inflammation such as IL-6 and IL-8 cytokines was found. The direct application of HEMA potentially induces an inflammation process that could be the starting point for toxic response and cell damage in DP-MSCs. © 2011 International Endodontic Journal.

  15. Deletion of interleukin-6 alleviated interstitial fibrosis in streptozotocin-induced diabetic cardiomyopathy of mice through affecting TGFβ1 and miR-29 pathways.

    PubMed

    Zhang, Yang; Wang, Jing-Hao; Zhang, Yi-Yuan; Wang, Ying-Zhe; Wang, Jin; Zhao, Yue; Jin, Xue-Xin; Xue, Gen-Long; Li, Peng-Hui; Sun, Yi-Lin; Huang, Qi-He; Song, Xiao-Tong; Zhang, Zhi-Ren; Gao, Xu; Yang, Bao-Feng; Du, Zhi-Min; Pan, Zhen-Wei

    2016-03-14

    Interleukin 6 (IL-6) has been shown to be an important regulator of cardiac interstitial fibrosis. In this study, we explored the role of interleukin-6 in the development of diabetic cardiomyopathy and the underlying mechanisms. Cardiac function of IL-6 knockout mice was significantly improved and interstitial fibrosis was apparently alleviated in comparison with wildtype (WT) diabetic mice induced by streptozotocin (STZ). Treatment with IL-6 significantly promoted the proliferation and collagen production of cultured cardiac fibroblasts (CFs). High glucose treatment increased collagen production, which were mitigated in CFs from IL-6 KO mice. Moreover, IL-6 knockout alleviated the up-regulation of TGFβ1 in diabetic hearts of mice and cultured CFs treated with high glucose or IL-6. Furthermore, the expression of miR-29 reduced upon IL-6 treatment, while increased in IL-6 KO hearts. Overexpression of miR-29 blocked the pro-fibrotic effects of IL-6 on cultured CFs. In summary, deletion of IL-6 is able to mitigate myocardial fibrosis and improve cardiac function of diabetic mice. The mechanism involves the regulation of IL-6 on TGFβ1 and miR-29 pathway. This study indicates the therapeutic potential of IL-6 suppression on diabetic cardiomyopathy disease associated with fibrosis.

  16. In enterovirus 71 encephalitis with cardio-respiratory compromise, elevated interleukin 1β, interleukin 1 receptor antagonist, and granulocyte colony-stimulating factor levels are markers of poor prognosis.

    PubMed

    Griffiths, Michael J; Ooi, Mong H; Wong, See C; Mohan, Anand; Podin, Yuwana; Perera, David; Chieng, Chae H; Tio, Phaik H; Cardosa, Mary J; Solomon, Tom

    2012-09-15

    Enterovirus 71 (EV71) causes large outbreaks of hand, foot, and mouth disease (HFMD), with severe neurological complications and cardio-respiratory compromise, but the pathogenesis is poorly understood. We measured levels of 30 chemokines and cytokines in serum and cerebrospinal fluid (CSF) samples from Malaysian children hospitalized with EV71 infection (n = 88), comprising uncomplicated HFMD (n = 47), meningitis (n = 8), acute flaccid paralysis (n = 1), encephalitis (n = 21), and encephalitis with cardiorespiratory compromise (n = 11). Four of the latter patients died. Both pro-inflammatory and anti-inflammatory mediator levels were elevated, with different patterns of mediator abundance in the CSF and vascular compartments. Serum concentrations of interleukin 1β (IL-1β), interleukin 1 receptor antagonist (IL-1Ra), and granulocyte colony-stimulating factor (G-CSF) were raised significantly in patients who developed cardio-respiratory compromise (P = .013, P = .004, and P < .001, respectively). Serum IL-1Ra and G-CSF levels were also significantly elevated in patients who died, with a serum G-CSF to interleukin 5 ratio of >100 at admission being the most accurate prognostic marker for death (P < .001; accuracy, 85.5%; sensitivity, 100%; specificity, 84.7%). Given that IL-1β has a negative inotropic action on the heart, and that both its natural antagonist, IL-1Ra, and G-CSF are being assessed as treatments for acute cardiac impairment, the findings suggest we have identified functional markers of EV71-related cardiac dysfunction and potential treatment options.

  17. Endothelial-derived interleukin-6 induces cancer stem cell motility by generating a chemotactic gradient towards blood vessels.

    PubMed

    Kim, Hong Sun; Chen, Yu-Chih; Nör, Felipe; Warner, Kristy A; Andrews, April; Wagner, Vivian P; Zhang, Zhaocheng; Zhang, Zhixiong; Martins, Manoela D; Pearson, Alexander T; Yoon, Euisik; Nör, Jacques E

    2017-11-21

    Recent evidence suggests that the metastatic spread of head and neck squamous cell carcinomas (HNSCC) requires the function of cancer stem cells endowed with multipotency, self-renewal, and high tumorigenic potential. We demonstrated that cancer stem cells reside in perivascular niches and are characterized by high aldehyde dehydrogenase (ALDH) activity and high CD44 expression (ALDH high CD44 high ) in HNSCC. Here, we hypothesize that endothelial cell-secreted interleukin-6 (IL-6) contributes to tumor progression by enhancing the migratory phenotype and survival of cancer stem cells. Analysis of tissue microarrays generated from the invasive fronts of 77 HNSCC patients followed-up for up to 11 years revealed that high expression of IL-6 receptor (IL-6R) (p=0.0217) or co-receptor gp130 (p=0.0422) correlates with low HNSCC patient survival. We observed that endothelial cell-secreted factors induce epithelial to mesenchymal transition (EMT) and enhance invasive capacity of HNSCC cancer stem cells. Conditioned medium from CRISPR/Cas9-mediated IL-6 knockout primary human endothelial cells is less chemotactic for cancer stem cells in a microfluidics-based system than medium from control endothelial cells (p<0.05). Blockade of the IL-6 pathway with a humanized anti-IL-6R antibody (tocilizumab) inhibited endothelial cell-induced motility in vitro and decreased the fraction of cancer stem cells in vivo . Notably, xenograft HNSCC tumors vascularized with IL-6-knockout endothelial cells exhibited slower tumor growth and smaller cancer stem cell fraction. These findings demonstrate that endothelial cell-secreted IL-6 enhances the motility and survival of highly tumorigenic cancer stem cells, suggesting that endothelial cells can create a chemotactic gradient that enables the movement of carcinoma cells towards blood vessels.

  18. [Correlation analysis between interleukin 6 polymorphism and adolescent idiopathic scoliosis susceptibility and bracing effectiveness].

    PubMed

    Gao, Junsheng; Zhang, Lu; Liu, Zhiang; Yao, Shuaihui; Gao, Songming

    2018-06-01

    To analyze the correlation between the polymorphism on interleukin 6 (IL-6) gene promoter region-174 locus and adolescent idiopathic scoliosis (AIS), including the susceptibility, the bracing effectiveness, and the possible mechanism. The 182 AIS patients and 210 healthy controls who met the inclusion criteria between January 2013 and January 2016 were collected as research objects. The genotype of IL-6 gene promoter region-174 locus, the serum IL-6, the bone mineral density (BMD) of femoral neck and vertebrae (L 1-4 ), and the bone metabolism parameters, including bone alkaline phosphatase (BALP), bone gla protein (BGP), tartrate resistant acid phosphatase 5b (TRACP-5b), urine Ca, and urine Ca/Cr, were detected. All research objects were divided into the AIS group and the control group according to whether they had AIS, the GG, CG, CC groups according to their genotype, and progression-free group and progression group according to the therapeutic effectiveness of 1-year bracing treatment. Statistical analysis for the indexes were conducted respectively. There were significant differences in AIS history, BMD of femoral neck and lumbar vertebrae between the AIS group and control group ( P <0.05). According to the therapeutic effecitveness of 1-year bracing treatment, 182 AIS patients were divided into progression-free group in 110 cases and progression group in 72 cases. The results of single factor analysis showed that there were significant differences in the genotype and allele distribution of IL-6 gene promoter region-174 locus, BMD of femoral neck and lumbar vertebrae, IL-6, TRACP-5b, urine Ca, and urine Ca/Cr between the progression-free group and progression group ( P <0.05). The results of multivariable analysis showed that the BMD of lumbar vertebrae, TRACP-5b, and urine Ca were the influencing factors of bracing efficacy ( P< 0.05). According to the results of genotype detection, all research objects were divided into GG group in 264 cases, CG group in 104

  19. Sensitization of dural afferents underlies migraine-related behavior following meningeal application of interleukin-6 (IL-6)

    PubMed Central

    2012-01-01

    Background Migraine headache is one of the most common neurological disorders, but the pathophysiology contributing to migraine is poorly understood. Intracranial interleukin-6 (IL-6) levels have been shown to be elevated during migraine attacks, suggesting that this cytokine may facilitate pain signaling from the meninges and contribute to the development of headache. Methods Cutaneous allodynia was measured in rats following stimulation of the dura with IL-6 alone or in combination with the MEK inhibitor, U0126. The number of action potentials and latency to the first action potential peak in response to a ramp current stimulus as well as current threshold were measured in retrogradely-labeled dural afferents using patch-clamp electrophysiology. These recordings were performed in the presence of IL-6 alone or in combination with U0126. Association between ERK1 and Nav1.7 following IL-6 treatment was also measured by co-immunoprecipitation. Results Here we report that in awake animals, direct application of IL-6 to the dura produced dose-dependent facial and hindpaw allodynia. The MEK inhibitor U0126 blocked IL-6-induced allodynia indicating that IL-6 produced this behavioral effect through the MAP kinase pathway. In trigeminal neurons retrogradely labeled from the dura, IL-6 application decreased the current threshold for action potential firing. In response to a ramp current stimulus, cells treated with IL-6 showed an increase in the numbers of action potentials and a decrease in latency to the first spike, an effect consistent with phosphorylation of the sodium channel Nav1.7. Pretreatment with U0126 reversed hyperexcitability following IL-6 treatment. Moreover, co-immunoprecipitation experiments demonstrated an increased association between ERK1 and Nav1.7 following IL-6 treatment. Conclusions Our results indicate that IL-6 enhances the excitability of dural afferents likely via ERK-mediated modulation of Nav1.7 and these responses contribute to migraine

  20. The interleukin-6 receptor as a target for prevention of coronary heart disease: a mendelian randomisation analysis

    PubMed Central

    2012-01-01

    Summary Background A high circulating concentration of interleukin 6 is associated with increased risk of coronary heart disease. Blockade of the interleukin-6 receptor (IL6R) with a monoclonal antibody (tocilizumab) licensed for treatment of rheumatoid arthritis reduces systemic and articular inflammation. However, whether IL6R blockade also reduces risk of coronary heart disease is unknown. Methods Applying the mendelian randomisation principle, we used single nucleotide polymorphisms (SNPs) in the gene IL6R to evaluate the likely efficacy and safety of IL6R inhibition for primary prevention of coronary heart disease. We compared genetic findings with the effects of tocilizumab reported in randomised trials in patients with rheumatoid arthritis. Findings In 40 studies including up to 133 449 individuals, an IL6R SNP (rs7529229) marking a non-synonymous IL6R variant (rs8192284; p.Asp358Ala) was associated with increased circulating log interleukin-6 concentration (increase per allele 9·45%, 95% CI 8·34–10·57) as well as reduced C-reactive protein (decrease per allele 8·35%, 95% CI 7·31–9·38) and fibrinogen concentrations (decrease per allele 0·85%, 95% CI 0·60–1·10). This pattern of effects was consistent with IL6R blockade from infusions of tocilizumab (4–8 mg/kg every 4 weeks) in patients with rheumatoid arthritis studied in randomised trials. In 25 458 coronary heart disease cases and 100 740 controls, the IL6R rs7529229 SNP was associated with a decreased odds of coronary heart disease events (per allele odds ratio 0·95, 95% CI 0·93–0·97, p=1·53×10−5). Interpretation On the basis of genetic evidence in human beings, IL6R signalling seems to have a causal role in development of coronary heart disease. IL6R blockade could provide a novel therapeutic approach to prevention of coronary heart disease that warrants testing in suitably powered randomised trials. Genetic studies in populations could be used more widely to help to

  1. Polyacrylic resins regulate transcriptional control of interleukin-6, gp80, and gp130 genes in human gingival fibroblasts.

    PubMed

    Borelli, Bruna; Zarone, Fernando; Rivieccio, Virginia; Riccitiello, Francesco; Simeone, Michele; Sorrentino, Roberto; Rengo, Sandro; Spagnuolo, Gianrico; Procino, Alfredo

    2017-03-31

    Studies have failed to identify the molecular mechanisms that regulate the genotoxic and cytotoxic effects of methacrylate resins, which are important in the biocompatibility of dental materials. Interleukin (IL)-6 has a crucial role in the control of acute-phase protein response during inflammation. In humans, the synthesis and release of two major acute-phase proteins, C-reactive protein and serum amyloid A, are regulated by IL-6. This study focused on IL-6 and activation of its receptors gp80 and gp130 in human gingival fibroblasts in order to assess the effects of the commercial acid resins Jet Kit, Unifast, and Duralay on control of inflammation.

  2. Interleukin-6 induces an epithelial-mesenchymal transition phenotype in human adamantinomatous craniopharyngioma cells and promotes tumor cell migration

    PubMed Central

    Zhou, Jie; Zhang, Chao; Pan, Jun; Chen, Ligang; Qi, Song-Tao

    2017-01-01

    Total resection of adamantinomatous craniopharyngioma (ACP) is complex and often leads to postoperative recurrence. This is due to the tendency of the tumor to invade the surrounding brain tissue and the generation of a local inflammatory state between the tumor cells and parenchyma. While there is evidence to suggest that interleukin-6 (IL-6) induces craniopharyngioma (CP)-associated inflammation, particularly in ACP, the role of IL-6 in the progression of ACP remains unclear. The results of the present study demonstrated that CP inflammation was associated with pathological classification, extent of surgery, degree of calcification and postoperative hypothalamic status scale. Cytokine antibody arrays were conducted to measure the expression of IL-6 and other inflammatory factors in tumor tissues in response to various levels of inflammatory exposure. IL-6, IL-6 receptor (IL-6R) and glycoprotein 130 expression was detected by immunohistochemistry. In addition, an ELISA was performed to quantify the levels of soluble IL-6R (sIL-6R) in the cystic fluid and supernatants of ACP cells and tumor-associated fibroblasts. These measurements demonstrated that ACP cells produce IL-6 and its associated proteins. In addition, the results revealed that while the viability of ACP cells was not affected, the migration of ACP cells was promoted by IL-6 treatment in a concentration-dependent manner. Conversely, treatment with an IL-6-blocking monoclonal antibody significantly decreased the migration of ACP cells. In addition, IL-6 treatment increased the expression of vimentin and decreased the expression of E-cadherin in a dose-dependent manner. The findings of the present study demonstrate that IL-6 may promote migration in vitro via the classic- and trans-signaling pathways by inducing epithelial-mesenchymal transition in ACP cell cultures. PMID:28487953

  3. Serum levels of interleukin-22, cardiometabolic risk factors and incident type 2 diabetes: KORA F4/FF4 study.

    PubMed

    Herder, Christian; Kannenberg, Julia M; Carstensen-Kirberg, Maren; Huth, Cornelia; Meisinger, Christa; Koenig, Wolfgang; Peters, Annette; Rathmann, Wolfgang; Roden, Michael; Thorand, Barbara

    2017-01-31

    Interleukin-22 (IL-22) has beneficial effects on body weight, insulin resistance and inflammation in different mouse models, but its relevance for the development of type 2 diabetes in humans is unknown. We aimed to identify correlates of serum IL-22 levels and to test the hypothesis that higher IL-22 levels are associated with lower diabetes incidence. Cross-sectional associations between serum IL-22, cardiometabolic risk factors and glucose tolerance status were investigated in 1107 persons of the population-based KORA F4 study. The prospective association between serum IL-22 and incident type 2 diabetes was assessed in 504 initially non-diabetic study participants in both the KORA F4 study and its 7-year follow-up examination KORA FF4, 76 of whom developed diabetes. Male sex, current smoking, lower HDL cholesterol, lower estimated glomerular filtration rate and higher serum interleukin-1 receptor antagonist were associated with higher IL-22 levels after adjustment for confounders (all P < 0.05). Serum IL-22 showed no associations with glucose tolerance status, prediabetes or type 2 diabetes. Baseline serum IL-22 levels (median, 25th/75th percentiles) for incident type 2 diabetes cases and non-cases were 6.28 (1.95; 12.35) and 6.45 (1.95; 11.80) pg/ml, respectively (age and sex-adjusted P = 0.744). The age and sex-adjusted OR (95% CI) per doubling of IL-22 for incident type 2 diabetes of 1.02 (0.85; 1.23) was almost unchanged after consideration of further confounders. High serum levels of IL-22 were positively rather than inversely associated with several cardiometabolic risk factors. However, these associations did not translate into an increased risk for type 2 diabetes. Thus, our data argue against the utility of IL-22 as biomarker for prevalent or incident type 2 diabetes in humans, but identify potential determinants of IL-22 levels which merits further research in the context of cardiovascular diseases.

  4. Interleukin-6 Directly Impairs the Erythroid Development of Human TF-1 Erythroleukemic Cells

    PubMed Central

    McCranor, Bryan J.; Kim, Min Jung; Cruz, Nicole M.; Xue, Qian-Li; Berger, Alan E.; Walston, Jeremy D.; Civin, Curt I.; Roy, Cindy N.

    2013-01-01

    Anemia of inflammation or chronic disease is a highly prevalent form of anemia. The inflammatory cytokine interleukin-6 (IL-6) negatively correlates with hemoglobin concentration in many disease states. The IL-6-hepcidin antimicrobial peptide axis promotes iron-restricted anemia; however the full role of IL-6 in anemia of inflammation is not well-defined. We previously reported that chronic inflammation had a negative impact on maturation of erythroid progenitors in a mouse model. We hypothesized that IL-6 may be responsible for impaired erythropoiesis, independent of iron restriction. To test the hypothesis we utilized the human erythroleukemia TF-1 cell line to model erythroid maturation and exposed them to varying doses of IL-6 over six days. At 10 ng/ml, IL-6 significantly repressed erythropoietin-dependent TF-1 erythroid maturation. While IL-6 did not decrease the expression of genes associated with hemoglobin synthesis, we observed impaired hemoglobin synthesis as demonstrated by decreased benzidine staining. We also observed that IL-6 down regulated expression of the gene SLC4a1 which is expressed late in erythropoiesis. Those findings suggested that IL-6-dependent inhibition of hemoglobin synthesis might occur. We investigated the impact of IL-6 on mitochondria. IL-6 decreased the mitochondrial membrane potential at all treatment doses, and significantly decreased mitochondrial mass at the highest dose. Our studies indicate that IL-6 may impair mitochondrial function in maturing erythroid cells resulting in impaired hemoglobin production and erythroid maturation. Our findings may indicate a novel pathway of action for IL-6 in the anemia of inflammation, and draw attention to the potential for new therapeutic targets that affect late erythroid development. PMID:24119518

  5. Estimation of Plasma Levels of Tumor Necrosis Factor-a, Interleukin-4 and 6 in Patients with Chronic Periodontitis and Type II Diabetes Mellitus.

    PubMed

    Bakshi, Dipanshu; Kaur, Guneet; Singh, Deepinder; Sahota, Jasjit; Thakur, Ambika; Grover, Shekhar

    2018-02-01

    Both periodontitis and type II diabetes mellitus (T2DM) are common diseases with a multifactorial etiology and have influence of cytokines in their pathogenesis and thus may also influence each other. In recent times, more attention has been given to understanding the influences of these inflammatory cytokines which are a main part of oral chronic inflammation on systemic health of the individuals. Therefore, the aim of this study was to evaluate the plasma cytokine levels, specifically tumor necrosis factor-a (TNF-a), interleukin (IL)-6, and IL-4, in chronic periodontitis patients and T2DM patients, so as to investigate the influence of chronic periodontitis in systemic inflammation associated with diabetes mellitus. The present study comprised a total sample size of 60 patients. A detailed history along with complete periodontal examination were done for each person. These patients were subdivided into four study groups with 15 subjects (n = 15) in each group: group I: healthy individuals, group II: chronic periodontitis, group III: diabetes mellitus without chronic periodontitis, and group IV: diabetes mellitus with chronic periodontitis. Venous blood was withdrawn for obtaining serum samples from the subjects. Hemoglobin A1c (HbAlc) levels were measured from the automated chromatography. Using enzyme-linked immunosorbent assay kit, TNF-a, IL-4, and IL-6 were measured. It was observed that the difference between almost all the results showed statistical significance. Not much of a difference was seen when TNF-a and IL-6 findings of group II were compared with group III. Furthermore, IL-4 also did not differ when group II was compared with group IV. The inflammatory cytokines together control the inflammation process and a balance is maintained. However, in patients with diabetes mellitus, this balance is interrupted, which affects the final development and progression of the disease. Thus, hyperglycemia may be partly associated with the severity of the

  6. Effect of proinflammatory interleukins on jejunal nutrient transport

    PubMed Central

    Hardin, J; Kroeker, K; Chung, B; Gall, D

    2000-01-01

    AIM—We examined the effect of proinflammatory and anti-inflammatory interleukins on jejunal nutrient transport and expression of the sodium-glucose linked cotransporter (SGLT-1).
METHODS—3-O-methyl glucose and L-proline transport rates were examined in New Zealand White rabbit stripped, short circuited jejunal tissue. The effects of the proinflammatory cytokines interleukin (IL)-1α, IL-6, and IL-8, IL-1α plus the specific IL-1 antagonist, IL-1ra, and the anti-inflammatory cytokine IL-10 were investigated. In separate experiments, passive tissue permeability was assessed and brush border SGLT-1 expression was measured by western blot in tissues exposed to proinflammatory interleukins.
RESULTS—The proinflammatory interleukins IL-6, IL-1α, and IL-8 significantly increased glucose absorption compared with control levels. This increase in glucose absorption was due to an increase in mucosal to serosal flux. IL-1α and IL-8 also significantly increased L-proline absorption due to an increase in absorptive flux. The anti-inflammatory IL-10 had no effect on glucose transport. The receptor antagonist IL-1ra blocked the ability of IL-1α to stimulate glucose transport. IL-8 had no effect on passive tissue permeability. SGLT-1 content did not differ in brush border membrane vesicles (BBMV) from control or interleukin treated tissue.
CONCLUSIONS—These findings suggest that intestinal inflammation and release of inflammatory mediators such as interleukins increase nutrient absorption in the gut. The increase in glucose transport does not appear to be due to changes in BBMV SGLT-1 content.


Keywords: glucose transport; small intestine; intestinal inflammation; inflammation PMID:10896908

  7. Beneficial effects of interleukin-6 in neonatal mouse models of group B streptococcal disease.

    PubMed Central

    Mancuso, G; Tomasello, F; Migliardo, M; Delfino, D; Cochran, J; Cook, J A; Teti, G

    1994-01-01

    Previous studies have shown that tumor necrosis factor alpha (TNF-alpha) plays a pathophysiologic role in sepsis induced in rat pups by group B streptococci (GBS). In this model, TNF-alpha is also partially responsible for the induction of interleukin-6 (IL-6). The present study was undertaken to investigate the role of IL-6 in neonatal BALB/c mice infected with type III GBS. The effect of anti-IL-6 monoclonal antibodies and recombinant IL-6 on lethality and TNF-alpha production was investigated. In mouse pups infected with GBS strain COH1, plasma IL-6 reached levels of 3,067 +/- 955 and 1,923 +/- 891 U/ml when measured at 22 and 48 h, respectively (P < 0.05 compared with uninfected controls). Pretreatment with 25 micrograms of anti-IL-6 antibodies totally prevented the increase in circulating IL-6 bioactivity at both 22 and 48 h after infection (P < 0.05). Treatment with anti-IL-6 also induced a moderate decrease in survival time of mice infected with lethal doses of strains COH1 and COH31, as evidenced by increased lethality (P < 0.05) at 24 to 48 h but not at 96 h. Mouse recombinant IL-6 (12,500 U) given 6 h before challenge with strains COH1 and COH31 consistently increased survival time, as evidenced by decreased (P < 0.05) lethality at 48 to 72 h but not at 96 h. The effects of IL-6 pretreatment were dose dependent, since no protection was observed with doses lower than 12,500 U. In addition, no effects on lethality were noted when IL-6 was given at the time of challenge or at later times. TNF-alpha elevations (P < 0.05 compared with uninfected controls) were measured at 12, 22, and 48 h after challenge with strain COH1 (68 +/- 28, 233 +/- 98, and 98 +/- 34 U, respectively). Pretreatment with IL-6 significantly (P < 0.05) decreased plasma TNF-alpha levels at 12 and 22 h, with 55 and 69% inhibitions, respectively. Anti-IL-6 had an opposite effect, as evidenced by a 145% increase (P < 0.05) in TNF-alpha levels at 48 h after challenge. Collectively, our data are

  8. Persistent Low Level of Osterix Accelerates Interleukin-6 Production and Impairs Regeneration after Tissue Injury

    PubMed Central

    Baek, Wook-Young; Park, Seung-Yoon; Kim, Yeo Hyang; Lee, Min-A; Kwon, Tae-Hwan; Park, Kwon-Moo; de Crombrugghe, Benoit; Kim, Jung-Eun

    2013-01-01

    Osterix (Osx) is an essential transcription factor for osteoblast differentiation and bone formation. Osx knockout show a complete absence of bone formation, whereas Osx conditional knockout in osteoblasts produce an osteopenic phenotype after birth. Here, we questioned whether Osx has a potential role in regulating physiological homeostasis. In Osx heterozygotes expressing low levels of Osx in bones, the expression levels of pro-inflammatory cytokines were significantly elevated, indicating that reduced Osx expression may reflect an inflammatory-prone state. In particular, the expression of interleukin-6, a key mediator of chronic inflammation, was increased in Osx heterozygotes and decreased in Osx overexpressing osteoblasts, and transcriptionally down-regulated by Osx. Although no significant differences were revealed in renal morphology and function between Osx heterozygotes and wild-type under normoxic conditions, recovery of kidneys after ischemic damage was remarkably delayed in Osx heterozygotes, as indicated by elevated blood urea nitrogen and creatinine levels, and by morphological alterations consistent with acute tubular necrosis. Eventually, protracted low Osx expression level caused an inflammatory-prone state in the body, resulting in the enhanced susceptibility to renal injury and the delayed renal repair after ischemia/reperfusion. This study suggests that the maintenance of Osx expression in bone is important in terms of preventing the onset of an inflammatory-prone state. PMID:23922826

  9. Regulation of interleukin 10 release by tumor necrosis factor in humans and chimpanzees

    PubMed Central

    1994-01-01

    Interleukin 10 (IL-10) has been shown to inhibit endotoxin-induced tumor necrosis factor (TNF) production. To assess the role of TNF in the induction of IL-10 in endotoxemia, four healthy men were studied after a bolus intravenous injection of recombinant human TNF (50 micrograms/m2). In addition, 13 healthy chimpanzees were investigated after a bolus intravenous injection of Escherichia coli endotoxin (4 ng/kg), 6 animals received endotoxin only, 4 animals received a simultaneous intravenous injection of a monoclonal anti-TNF antibody, whereas 3 chimpanzees were treated with an anti-TNF F(ab')2 fragment 30 min after the administration of endotoxin. TNF induced a modest rise in IL-10 concentrations peaking after 45 min (47 +/- 32 pg/ml; p < 0.05). IL-10 peaked 2 h after injection of endotoxin (202 +/- 61 pg/ml; p < 0.005). In both anti-TNF-treated groups, the early endotoxin-induced TNF activity was completely neutralized. Simultaneous anti-TNF treatment attenuated endotoxin-induced IL-10 release (73 +/- 13 pg/ml; p < 0.01 versus endotoxin alone), whereas postponed anti-TNF treatment did not significantly affect this response (p = 0.21). These results indicate that TNF, in part, mediates the induction of IL-10 in endotoxemia, resulting in an autoregulatory feedback loop. PMID:7964475

  10. Levels of interleukins 2, 6, 8, and 10 in patients with irritable bowel syndrome.

    PubMed

    Patel, Shaileshkumar R; Singh, Anshul; Misra, Vatsala; Misra, Sri Prakash; Dwivedi, Manisha; Trivedi, Pawan

    2017-01-01

    Irritable bowel syndrome (IBS) was previously considered as a psychosomatic disorder. But recent studies indicate that inflammation plays a significant role. The present study was undertaken to evaluate role of pro-inflammatory (IL 2, IL 6 and IL 8) and anti-inflammatory (IL 10) cytokines in clinically diagnosed patients of IBS. 51 patients and 29 controls were included in this study. On the basis of history of gastrointestinal infection, patients were divided into Post Infectious (PIIBS) and Non Post Infectious (NPIIBS) groups. All subsequently underwent colonoscopy and a rectosigmoid biopsy as well as measurement of levels of IL 2, 6, 8 and 10. The levels of IL 2 and IL 8 were significantly raised in IBS patients compared to controls with the mean level of IL 2,6 and 8 higher in PIIBS group than NPIIBS group but statistically significant for IL 8 only. The mean level IL-10 was reduced in patients compared to controls but statistically insignificant. Present study shows that Interleukin levels are altered in patients suffering from IBS and may have a key role in its pathogenesis.

  11. [Predictive value of interleukin 6 from the umbilical cord blood in early neonatal infection].

    PubMed

    Cosićkić, Almira; Skokić, Fahrija

    2009-01-01

    We have analyzed diagnostic value of interleukin 6 (IL-6) from the umbilical cord blood in recognition of early neonatal infection (ENI) of newborns whose mothers have obstetrical risks. The study included 120 newborns with birth weight <2500 gr., gestational age from 37 to 42 weeks, which mothers had some of the obstetrical risks. We established three groups: group A (newborns with microbiological proof of ENI), group B (clinical signs and hematological parameters of ENI) and group C (newborns without ENI). Median of IL-6 value in group A was 48.5 pg/ml with sensitivity, specificity and diagnostic value in recognition of ENI 78%, 81% and 80%. In group B median of IL-6 was 49 pg/ml with sensitivity, specificity and diagnostic value 65%, 80% and 77%. In group C median of IL-6 was 9.7 pg/ml. We noticed significant connection between value of IL-6 and mother's urinary tract infection; group A (p=0.023), group B (p = 0.007). Also there was a remarkable relationship between mother's colpitis and level of IL-6 in newborn with ENI in group A (p=0.011) and group B (p = 0.012). High levels of IL-6 in umbilical cord blood can help us in recognition of newborns that are endangered by infection and they are clearly connected with some of mother's obstetrical risks.

  12. Ultraviolet radiation-induced interleukin 6 release in HeLa cells is mediated via membrane events in a DNA damage-independent way.

    PubMed

    Kulms, D; Pöppelmann, B; Schwarz, T

    2000-05-19

    Evidence exists that ultraviolet radiation (UV) affects molecular targets in the nucleus or at the cell membrane. UV-induced apoptosis was found to be mediated via DNA damage and activation of death receptors, suggesting that nuclear and membrane effects are not mutually exclusive. To determine whether participation of nuclear and membrane components is also essential for other UV responses, we studied the induction of interleukin-6 (IL-6) by UV. Exposing HeLa cells to UV at 4 degrees C, which inhibits activation of surface receptors, almost completely prevented IL-6 release. Enhanced repair of UV-mediated DNA damage by addition of the DNA repair enzyme photolyase did not affect UV-induced IL-6 production, suggesting that in this case membrane events predominant over nuclear effects. UV-induced IL-6 release is mediated via NFkappaB since the NFkappaB inhibitor MG132 or transfection of cells with a super-repressor form of the NFkappaB inhibitor IkappaB reduced IL-6 release. Transfection with a dominant negative mutant of the signaling protein TRAF-2 reduced IL-6 release upon exposure to UV, indicating that UV-induced IL-6 release is mediated by activation of the tumor necrosis factor receptor-1. These data demonstrate that UV can exert biological effects mainly by affecting cell surface receptors and that this is independent of its ability to induce nuclear DNA damage.

  13. Genetic polymorphism of interleukin-6 influences susceptibility to HBV-related hepatocellular carcinoma in a male Chinese Han population.

    PubMed

    Tang, Shengli; Yuan, Yufeng; He, Yueming; Pan, Dingyu; Zhang, Yongxi; Liu, Yuanyuan; Liu, Quanyan; Zhang, Zhonglin; Liu, Zhisu

    2014-04-01

    As a multifunctional cytokine, interleukin-6 (IL-6) plays a key role in chronic inflammation as well as tumor growth and progression of hepatitis B virus (HBV) infection. Recent studies have implicated that single nucleotide polymorphism (SNP) -572C>G (rs1800796) located within the promoter region of IL-6 gene was associated with susceptibility to several diseases. Here, a case-control study was undertaken to investigate the association between this polymorphism and HBV-related hepatocellular carcinoma (HCC) susceptibility in a Chinese Han population. A total of 900 patients with chronic HBV infection, including 505 HBV-related HCC patients and 395 HBV infected patients without HCC were enrolled, and rs1800796 polymorphism was genotyped by the TaqMan method and DNA sequencing technology. The results indicated no significant association between rs1800796 polymorphism and the risk of HBV-related HCC in all subjects; however, a significant difference was identified in male subjects. Under the dominant model, male subjects with the G allele (CG/GG) have higher susceptibility to HBV-related HCC than those with CC genotype after adjusting confounding factors (P=0.012, odds ratio [OR] 1.68, 95% confidence interval [95% CI] 1.15-2.42). Our results suggested that rs1800796 polymorphism of IL-6 gene was associated with susceptibility to HBV-related HCC in a male Chinese Han population. Copyright © 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  14. Association of serum interleukin-10, interleukin-17A and transforming growth factor-α levels with human benign and malignant breast diseases

    PubMed Central

    Lv, Zhuangwei; Liu, Min; Shen, Jinghui; Xiang, Dong; Ma, Yunfeng; Ji, Yanhong

    2018-01-01

    Interleukin-10 (IL-10), interleukin-17A (IL-17A) and transforming growth factor α (TGF-α) have been implicated in the progression of breast cancer. However, the diagnostic and prognostic roles of these cytokines in ductal carcinoma remain unclear. The present study therefore aimed to determine the serum levels of IL-10, IL-17 and TGF-α in subjects with benign and malignant breast diseases and to evaluate the clinical significance of these cytokines in ductal carcinoma. Pre-operative serum samples were collected from 378 patients with breast disease and 70 healthy subjects. IL-10, IL-17A and TGF-α levels were measured using ELISA. Serum levels of these cytokine in patients with different breast diseases were evaluated. Furthermore, correlations between levels of these cytokines and the expression of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) in ductal carcinoma were determined. The results demonstrated that serum levels of IL-10 and IL-17A were significantly increased in subjects with atypical hyperplasia and ductal carcinoma. Furthermore, IL-10 and IL-17A levels were increased in patients with a more serious clinical tumor stage and tumors that were ER− and PR−. Furthermore, high serum levels of TGF-α were associated with HER2+ tumors. A strong positive correlation was identified between TGF-α and IL-17A levels. Therefore, the results of the current study revealed that elevated serum IL-10, IL-17A and TGF-α levels are strongly associated with ductal carcinoma, specifically with tumor stage. High serum levels of IL-10 and IL-17A were also associated with the negative expression of ER and PR in ductal carcinoma, and high serum levels of TGF-α were associated with the positive expression of HER2 in ductal carcinoma. Thus, serum cytokine levels may be measured to identify patients with a poor prognosis who may benefit from more aggressive management and treatment. PMID:29904427

  15. Association of serum interleukin-10, interleukin-17A and transforming growth factor-α levels with human benign and malignant breast diseases.

    PubMed

    Lv, Zhuangwei; Liu, Min; Shen, Jinghui; Xiang, Dong; Ma, Yunfeng; Ji, Yanhong

    2018-06-01

    Interleukin-10 (IL-10), interleukin-17A (IL-17A) and transforming growth factor α (TGF-α) have been implicated in the progression of breast cancer. However, the diagnostic and prognostic roles of these cytokines in ductal carcinoma remain unclear. The present study therefore aimed to determine the serum levels of IL-10, IL-17 and TGF-α in subjects with benign and malignant breast diseases and to evaluate the clinical significance of these cytokines in ductal carcinoma. Pre-operative serum samples were collected from 378 patients with breast disease and 70 healthy subjects. IL-10, IL-17A and TGF-α levels were measured using ELISA. Serum levels of these cytokine in patients with different breast diseases were evaluated. Furthermore, correlations between levels of these cytokines and the expression of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) in ductal carcinoma were determined. The results demonstrated that serum levels of IL-10 and IL-17A were significantly increased in subjects with atypical hyperplasia and ductal carcinoma. Furthermore, IL-10 and IL-17A levels were increased in patients with a more serious clinical tumor stage and tumors that were ER - and PR - . Furthermore, high serum levels of TGF-α were associated with HER2 + tumors. A strong positive correlation was identified between TGF-α and IL-17A levels. Therefore, the results of the current study revealed that elevated serum IL-10, IL-17A and TGF-α levels are strongly associated with ductal carcinoma, specifically with tumor stage. High serum levels of IL-10 and IL-17A were also associated with the negative expression of ER and PR in ductal carcinoma, and high serum levels of TGF-α were associated with the positive expression of HER2 in ductal carcinoma. Thus, serum cytokine levels may be measured to identify patients with a poor prognosis who may benefit from more aggressive management and treatment.

  16. Interleukin-6 enhances cancer stemness and promotes metastasis of hepatocellular carcinoma via up-regulating osteopontin expression.

    PubMed

    Wang, Chao-Qun; Sun, Hao-Ting; Gao, Xiao-Mei; Ren, Ning; Sheng, Yuan-Yuan; Wang, Zheng; Zheng, Yan; Wei, Jin-Wang; Zhang, Kai-Li; Yu, Xin-Xin; Zhu, Yin; Luo, Qin; Yang, Lu-Yu; Dong, Qiong-Zhu; Qin, Lun-Xiu

    2016-01-01

    Interleukin-6 (IL-6), one of the most important inflammatory cytokines, plays a pivotal role in metastasis and stemness of solid tumors. However, the underlying mechanisms of IL-6 in HCC metastasis remain unclear. In the present study, we demonstrated that stemness and metastatic potential of HCC cells were significantly enhanced after IL-6 stimulation. IL-6 could induce expression of osteopontin (OPN), along with other stemness-related genes, including HIF1α, BMI1, and HEY1. Block of OPN induction could significantly abrogate the effect of IL-6 on stemness and metastasis of HCC cells. Furthermore, IL-6 level was positively correlated with OPN in HCC. Patients with high plasma IL-6 or OPN level had poorer prognosis. In multivariate analysis, IL-6 and OPN were demonstrated to be independent prognostic indicators for HCC patients, and their combination had a better prognostic performance than IL-6 or OPN alone. Collectively, our findings indicate that IL-6 could enhance stemness and promote metastasis of HCC via up-regulating OPN expression, which can be a potential therapeutic target for combating HCC metastasis, and the combination of IL-6 and OPN serves as a promising prognostic predictor for HCC.

  17. Increased Expression of Interleukin-6 Family Members and Receptors in Urinary Bladder with Cyclophosphamide-Induced Bladder Inflammation in Female Rats

    PubMed Central

    Girard, Beatrice M.; Cheppudira, Bopaiah P.; Malley, Susan E.; Schutz, Kristin C.; May, Victor; Vizzard, Margaret A.

    2011-01-01

    Recent studies suggest that janus-activated kinases–signal transducer and activator of transcription signaling pathways contribute to increased voiding frequency and referred pain of cyclophosphamide (CYP)-induced cystitis in rats. Potential upstream chemical mediator(s) that may be activated by CYP-induced cystitis to stimulate JAK/STAT signaling are not known in detail. In these studies, members of the interleukin (IL)-6 family of cytokines including, leukemia inhibitory factor (LIF), IL-6, and ciliary neurotrophic factor (CNTF) and associated receptors, IL-6 receptor (R) α, LIFR, and gp130 were examined in the urinary bladder in control and CYP-treated rats. Cytokine and receptor transcript and protein expression and distribution were determined in urinary bladder after CYP-induced cystitis using quantitative, real-time polymerase chain reaction (Q-PCR), western blotting, and immunohistochemistry. Acute (4 h; 150 mg/kg; i.p.), intermediate (48 h; 150 mg/kg; i.p.), or chronic (75 mg/kg; i.p., once every 3 days for 10 days) cystitis was induced in adult, female Wistar rats with CYP treatment. Q-PCR analyses revealed significant (p ≤ 0.01) CYP duration- and tissue- (e.g., urothelium, detrusor) dependent increases in LIF, IL-6, IL-6Rα, LIFR, and gp130 mRNA expression. Western blotting demonstrated significant (p ≤ 0.01) increases in IL-6, LIF, and gp130 protein expression in whole urinary bladder with CYP treatment. CYP-induced cystitis significantly (p ≤ 0.01) increased LIF-immunoreactivity (IR) in urothelium, detrusor, and suburothelial plexus whereas increased gp130-IR was only observed in urothelium and detrusor. These studies suggest that IL-6 and LIF may be potential upstream chemical mediators that activate JAK/STAT signaling in urinary bladder pathways. PMID:21373362

  18. Influence of high dose tumescent local anaesthesia with prilocaine on systemic interleukin (IL)-6, IL-8 and tumour necrosis factor-α.

    PubMed

    Schmittner, M D; Faulhaber, J; Kemler, B; Koenen, W; Thumfart, J O; Weiss, C; Neumaier, M; Beck, G C

    2010-12-01

    Tumescent local anaesthesia (TLA) with high prilocaine doses leads to formation of methemoglobin (MHb) which is known to be a potent activator of pro-inflammatory endothelial cell response in vitro. As TLA is widely used for large dermatological resections, the aim of this study was to investigate the effects of high prilocaine doses on the systemic inflammatory response in vivo and its clinical relevance. This prospective study examines the influence of MHb on serum interleukin (IL)-6, IL-8 and tumour necrosis tumour necrosis (TNF)-α levels up to 72 h after application of TLA with prilocaine in doses higher than 600 mg. A total of 30 patients received prilocaine in a median dose of 1500 mg (range: 880-4160 mg) for large resections. Peak prilocaine serum concentration was reached 4 h (0.72 ± 0.07 μg/mL), the maximum concentration of MHb (7.43 ± 0.87%) and IL-6 (28.4 ± 4.1 U/L) 12 h after TLA application. TNF-α and IL-8 release were not found significantly increased. Three patients developed MHb concentrations >15%. This clinical study shows for the first time that a high prilocaine serum concentration leads in vivo to elevated systemic levels of IL-6 but not of IL-8 and TNF-α because of initial high MHb levels. Because of possible and unpredictable high MHb concentrations, TLA should only be performed with prilocaine in doses of 2.5 mg/kg. In general, new solutions of TLA are necessary to achieve adequate anaesthesia for large dermatological resections to decrease the risk of methemoglobinaemia. © 2010 The Authors. Journal compilation © 2010 European Academy of Dermatology and Venereology.

  19. Serum Interleukin-6 as a Serologic Marker of Chronic Periapical Lesions: A Case-control Study

    PubMed Central

    Abdolsamadi, Hamid Reza; Vahedi, Mohammad; Esmaeili, Farzad; Nazari, Shahrzad; Abdollahzadeh, Shermin

    2008-01-01

    Background and aims Chronic periapical disease with pulpal origin is an inflammatory condition caused by bacterial infection. Chronic infection could affect general health by increasing the production of cytokines such as interleukin-6 (IL-6) that probably play a role in pathogenesis of pulpal and periapical diseases. The aim of the present study was a comparative evaluation of the level of serum IL 6 in patients with periapical lesions and healthy controls. Materials and methods This analytical case-control study included 40 patients with chronic peri-apical lesions and 40 individuals without any oral diseases. All of the participants were in good general health. After obtaining an informed consent, clinical and radiographic examinations were carried out and blood samples were collected. Serum IL-6 was measured using ELISA. Data were analyzed using t-test by SPSS 14.0 computer software. Results Serum IL-6 concentration was significantly higher in test group compared to the controls (P < 0.05). Conclusion The results of the present study indicate that IL-6 produced in periapical lesions may serve as a marker of pathologic inflammatory activities in chronic periapical lesions. PMID:23289057

  20. Expression and functional characterization of killer whale (Orcinus orca) interleukin-6 (IL-6) and development of a competitive immunoassay.

    PubMed

    Funke, Christina; King, Donald P; McBain, Jim F; Adelung, Dieter; Stott, Jeffrey L

    2003-05-30

    Interleukin-6 (IL-6) is a cytokine that can reach detectable systemic levels and is a major inducer of the acute phase response. As such, clinical assays to identify this cytokine in mammalian sera are of diagnostic value. A 558 base-pair (bp) fragment of killer whale IL-6 was cloned and expressed as a 21 kDa protein in Escherichia coli. Biological activity of the recombinant killer whale IL-6 (rkwIL-6) was demonstrated using the IL-6-dependent B9 mouse hybridoma cell line; acute phase sera from a killer whale and supernatants from lipopolysaccharide (LPS)-stimulated killer whale peripheral blood mononuclear cells (PBMCs) also supported the proliferation of the B9 hybridoma. Rat anti-mouse IL-6 receptor antibody effectively blocked biological activity of all three sources of IL-6. Polyclonal antisera, specific for the recombinant protein, were obtained by successive immunization of a rabbit with rkwIL-6. The polyclonal antibody was capable of neutralizing the biological activity of both recombinant and native kwIL-6. A competitive enzyme-linked immunosorbent assay (ELISA) was developed using the polyclonal rabbit anti-rkwIL-6 and the recombinant protein; sensitivity of the assay was in the range of 1 ng/ml. The ELISA was subsequently used to identify the presence of native IL-6 in acute phase sera of two species of delphinidae, a killer whale and a bottlenose dolphin. The application of quantitative cytokine assays as diagnostic tools for monitoring cetacean health are becoming feasible as many animals are now being trained for fluke presentation, making blood collection a routine procedure.

  1. Interleukin-6 Contributes to Inflammation and Remodeling in a Model of Adenosine Mediated Lung Injury

    PubMed Central

    Pedroza, Mesias; Schneider, Daniel J.; Karmouty-Quintana, Harry; Coote, Julie; Shaw, Stevan; Corrigan, Rebecca; Molina, Jose G.; Alcorn, Joseph L.; Galas, David; Gelinas, Richard; Blackburn, Michael R.

    2011-01-01

    Background Chronic lung diseases are the third leading cause of death in the United States due in part to an incomplete understanding of pathways that govern the progressive tissue remodeling that occurs in these disorders. Adenosine is elevated in the lungs of animal models and humans with chronic lung disease where it promotes air-space destruction and fibrosis. Adenosine signaling increases the production of the pro-fibrotic cytokine interleukin-6 (IL-6). Based on these observations, we hypothesized that IL-6 signaling contributes to tissue destruction and remodeling in a model of chronic lung disease where adenosine levels are elevated. Methodology/Principal Findings We tested this hypothesis by neutralizing or genetically removing IL-6 in adenosine deaminase (ADA)-deficient mice that develop adenosine dependent pulmonary inflammation and remodeling. Results demonstrated that both pharmacologic blockade and genetic removal of IL-6 attenuated pulmonary inflammation, remodeling and fibrosis in this model. The pursuit of mechanisms involved revealed adenosine and IL-6 dependent activation of STAT-3 in airway epithelial cells. Conclusions/Significance These findings demonstrate that adenosine enhances IL-6 signaling pathways to promote aspects of chronic lung disease. This suggests that blocking IL-6 signaling during chronic stages of disease may provide benefit in halting remodeling processes such as fibrosis and air-space destruction. PMID:21799929

  2. Growth Factor FGF2 Cooperates with Interleukin-17 to Repair Intestinal Epithelial Damage.

    PubMed

    Song, Xinyang; Dai, Dai; He, Xiao; Zhu, Shu; Yao, Yikun; Gao, Hanchao; Wang, Jingjing; Qu, Fangfang; Qiu, Ju; Wang, Honglin; Li, Xiaoxia; Shen, Nan; Qian, Youcun

    2015-09-15

    The intestinal epithelial barrier plays a critical role in the mucosal immunity. However, it remains largely unknown how the epithelial barrier is maintained after damage. Here we show that growth factor FGF2 synergized with interleukin-17 (IL-17) to induce genes for repairing of damaged epithelium. FGF2 or IL-17 deficiency resulted in impaired epithelial proliferation, increased pro-inflammatory microbiota outgrowth, and consequently worse pathology in a DSS-induced colitis model. The dysregulated microbiota in the model induced transforming growth factor beta 1 (TGFβ1) expression, which in turn induced FGF2 expression mainly in regulatory T cells. Act1, an essential adaptor in IL-17 signaling, suppressed FGF2-induced ERK activation through binding to adaptor molecule GRB2 to interfere with its association with guanine nucleotide exchange factor SOS1. Act1 preferentially bound to IL-17 receptor complex, releasing its suppressive effect on FGF2 signaling. Thus, microbiota-driven FGF2 and IL-17 cooperate to repair the damaged intestinal epithelium through Act1-mediated direct signaling cross-talk. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. CHANGES IN RESTING SALIVARY TESTOSTERONE, CORTISOL AND INTERLEUKIN-6 AS BIOMARKERS OF OVERTRAINING.

    PubMed

    Anderson, Travis; Haake, Simon; Lane, Amy R; Hackney, Anthony C

    2016-01-01

    Overtraining (OVT) is a concern for many athletes. Immunological (increased interleukin-6 [IL-6]) and hormonal (increased cortisol [C], decreased free testosterone [fT]) biomarkers have been analyzed during training to detect OVT development. This study determined if resting levels of salivary IL-6, T, and C change during a pre-season resistance training (RT) program in 20 Division I American football players (mean ± SD: age = 19.1 ± 1.1 years; height = 185.4 ± 6.7 cm; mass = 102.0 ± 22.2 kg; body fat = 14.7 ± 7.6%). 1RM squat, bench press and Olympic-style clean, IL-6, C and T were assessed at baseline (WK1), week 4 (WK4), week 6 (WK6) along with psychological status (PS) to determine affective state. 1RM (bench press: 121.6 ± 36.3 kg vs. 127.4 ± 35.9 kg, squat: 187.2 ± 30.2 kg, 190.9 ± 28.1 kg, clean: 116.8 ± 14.6 kg, vs. 119.2 ± 14.5 kg), IL-6 (1.42 ± 1.77 pg/mL vs. 5.60 ± 12.57 pg/mL) and C (2.57 ± 2.46 nmol/L vs. 5.33 ± 4.94) increased signihcantly from WK1 to WK6 ( p < .05), fT decreased signihcantly (417.44 ± 83.63 pmol/Lvs. 341.10 ± 87.79 pmol/L) from WK1 to WK6 ( p < .05). PS was minimally affected during the study. Signihcant biomarker changes were detected, but no OVT was induced (i.e. performance improved). Therefore, directional changes in these biomarkers may not be sufficiently reflective of OVT in RT programs.

  4. Microvesicle Tissue Factor Activity and Interleukin-8 Levels are Associated with Mortality in Patients with Influenza A/H1N1 Infection.

    PubMed

    Rondina, Matthew T; Tatsumi, Kohei; Bastarache, Julie A; Mackman, Nigel

    2016-07-01

    To identify plasma biomarkers that can be early predictors of mortality in critically ill patients with primary influenza A/H1N1. A prospective, multicenter, case-cohort pilot study. Three academic ICUs. Fifteen patients with primary influenza A/H1N1 that included seven survivors and eight nonsurvivors. For comparison, age- and gender-matched healthy controls (n = 27) were also studied. Plasma was prepared from whole blood drawn on ICU admission in patients with influenza (ICU day 1). Microvesicle tissue factor activity, thrombin-antithrombin complexes, and D-dimers were measured as procoagulant markers and markers of activation of coagulation. Plasma cytokine levels were measured on the same blood samples in a subset of 12 patients with influenza using the Luminex Multi-Analyte Profiling system (Luminex Corporation, DeSoto, TX). Patients were followed up for the primary outcome of 28-day mortality. The average admission Acute Physiology and Chronic Health Evaluation II score of the patients was 25.5 ± 9.3, 60% of patients had shock, and the 28-day mortality rate was 53.3% (n = 8/15). Patients with influenza had dysregulated indices of coagulation and inflammation compared with controls. Among the markers of activation of coagulation measured on ICU day 1, only increased microvesicle tissue factor activity was significantly associated with subsequent influenza-related mortality (5.6 ± 1.2 pg/mL in nonsurvivors vs 1.8 ± 0.8 pg/mL in survivors; p < 0.05). Interleukin-8 was significantly higher in nonsurvivors compared with survivors (71.8 ± 29.1 pg/mL, n = 5 vs 17.3 ± 3.7 pg/mL, n = 7; p < 0.05). In addition, microvesicle tissue factor activity and interleukin-8 levels were significantly and positively correlated (r = 0.60; p = 0.003). Other cytokines, thrombin-antithrombin complexes, and D-dimer were not different between nonsurvivors and survivors and did not correlate with illness severity or mortality. This study identifies an association

  5. Deletion of Interleukin-6 Attenuates Pressure Overload-Induced Left Ventricular Hypertrophy and Dysfunction

    PubMed Central

    Afzal, Muhammad R.; Samanta, Anweshan; Xuan, Yu-Ting; Girgis, Magdy; Elias, Harold K; Zhu, Yanqing; Davani, Arash; Yang, Yanjuan; Chen, Xing; Ye, Sheng; Wang, Ou-Li; Chen, Lei; Hauptman, Jeryl; Vincent, Robert J.; Dawn, Buddhadeb

    2016-01-01

    Rationale The role of interleukin (IL)-6 in the pathogenesis of cardiac myocyte hypertrophy remains controversial. Objective To conclusively determine whether IL-6 signaling is essential for the development of pressure overload-induced left ventricular (LV) hypertrophy, and to elucidate the underlying molecular pathways. Methods and Results Wild-type (WT) and IL-6 knockout (IL-6−/−) mice underwent sham surgery or transverse aortic constriction (TAC) to induce pressure overload. Serial echocardiograms and terminal hemodynamic studies revealed attenuated LV hypertrophy and superior preservation of LV function in IL-6−/− mice after TAC. The extents of LV remodeling, fibrosis, and apoptosis were reduced in IL-6−/− hearts after TAC. Transcriptional and protein assays of myocardial tissue identified CaMKII and STAT3 activation as important underlying mechanisms during cardiac hypertrophy induced by TAC. The involvement of these pathways in myocyte hypertrophy was verified in isolated cardiac myocytes from WT and IL-6−/− mice exposed to pro-hypertrophy agents. Furthermore, overexpression of CaMKII in H9c2 cells increased STAT3 phosphorylation, and exposure of H9c2 cells to IL-6 resulted in STAT3 activation that was attenuated by CaMKII inhibition. Together these results identify the importance of CaMKII-dependent activation of STAT3 during cardiac myocyte hypertrophy via IL-6 signaling. Conclusions Genetic deletion of IL-6 attenuates TAC-induced LV hypertrophy and dysfunction, indicating a critical role played by IL-6 in the pathogenesis of LV hypertrophy in response to pressure overload. CaMKII plays an important role in IL-6-induced STAT3 activation and consequent cardiac myocyte hypertrophy. These findings may have significant therapeutic implications for LV hypertrophy and failure in patients with hypertension. PMID:27126808

  6. Interleukin Expression after Injury and the Effects of Interleukin-1 Receptor Antagonist

    PubMed Central

    Chamberlain, Connie S.; Leiferman, Ellen M.; Frisch, Kayt E.; Brickson, Stacey L.; Murphy, William L.; Baer, Geoffrey S.; Vanderby, Ray

    2013-01-01

    Ligament healing follows a series of complex coordinated events involving various cell types, cytokines, as well as other factors, producing a mechanically inferior tissue more scar-like than native tissue. Macrophages provide an ongoing source of cytokines to modulate inflammatory cell adhesion and migration as well as fibroblast proliferation. Studying interleukins inherent to ligament healing during peak macrophage activation and angiogenesis may elucidate inflammatory mediators involved in subsequent scar formation. Herein, we used a rat healing model assayed after surgical transection of their medial collateral ligaments (MCLs). On days 3 and 7 post-injury, ligaments were collected and used for microarray analysis. Of the 12 significantly modified interleukins, components of the interleukin-1 family were significantly up-regulated. We therefore examined the influence of interleukin-1 receptor antagonist (IL-1Ra) on MCL healing. Transected rat MCLs received PBS or IL-1Ra at the time of surgery. Inhibition of IL-1 activation decreased pro-inflammatory cytokines (IL-1α, IL-1β, IL-12, IL-2, and IFN-γ), myofibroblasts, and proliferating cells, as well as increased anti-inflammatory cytokines (IL-10), endothelial cells/blood vessel lumen, M2 macrophages, and granulation tissue size without compromising the mechanical properties. These results support the concept that IL-1Ra modulates MCL-localized granulation tissue components and cytokine production to create a transient environment that is less inflammatory. Overall, IL-1Ra may have therapeutic potential early in the healing cascade by stimulating the M2 macrophages and altering the granulation tissue components. However, the single dose of IL-1Ra used in this study was insufficient to maintain the more regenerative early response. Due to the transient influence on most of the healing components tested, IL-1Ra may have greater therapeutic potential with sustained delivery. PMID:23936523

  7. Inhibitory effects of Turkish folk remedies on inflammatory cytokines: interleukin-1alpha, interleukin-1beta and tumor necrosis factor alpha.

    PubMed

    Yeşilada, E; Ustün, O; Sezik, E; Takaishi, Y; Ono, Y; Honda, G

    1997-09-01

    In this study, in vitro inhibitory effects of 55 extracts or fractions obtained from 10 plant species on interleukin-1 (IL-1alpha, IL-1beta) and tumor necrosis factor (TNF-alpha) biosynthesis were studied. The following plant materials from Turkish folk medicine for the treatment of various diseases which are thought to be inflammatory in nature e.g. rheumatism, fever, infections, edemas or related inflammatory diseases were selected as the subject of this study: Cistus laurifolius leaves, Clematis flammna flowering herbs, Crataegus orientalis roots, Daphne oleoides ssp. oleoides whole plant, Ecbalium elaterium roots, Rosa canina roots, Rubus discolor roots, Rubus hirtus roots, Sambucus ebulus flowers and leaves, Sambucus nigra flowers and leaves. All plants showed inhibitory activity against at least one of these models in various percentages depending upon the concentration, thus supporting the folkloric utilization. Daphne oleoides was found to be the most active plant against the test models.

  8. Nomenclature for secreted regulatory proteins of the immune system (interleukins). WHO-IUIS Nomenclature Subcommittee on Interleukin Designation.

    PubMed Central

    1991-01-01

    The recommended procedures and criteria for interleukin designations are described. The officially adopted designations are, in sequence, from interleukin-1 to interleukin-10, including interleukin-1 alpha and interleukin-1 beta. PMID:1934243

  9. Serum Levels of Anticyclic Citrullinated Peptide Antibodies, Interleukin-6, Tumor Necrosis Factor-α, and C-Reactive Protein Are Associated with Increased Carotid Intima-Media Thickness: A Cross-Sectional Analysis of a Cohort of Rheumatoid Arthritis Patients without Cardiovascular Risk Factors

    PubMed Central

    Vázquez-Del Mercado, Mónica; Nuñez-Atahualpa, Lourdes; Figueroa-Sánchez, Mauricio; Gómez-Bañuelos, Eduardo; Rocha-Muñoz, Alberto Daniel; Martín-Márquez, Beatriz Teresita; Martínez-García, Erika Aurora; Macias-Reyes, Héctor; Gamez-Nava, Jorge Ivan; Navarro-Hernandez, Rosa Elena; Nuñez-Atahualpa, María Alejandra; Andrade-Garduño, Javier

    2015-01-01

    The main cause of death in rheumatoid arthritis (RA) is cardiovascular events. We evaluated the relationship of anticyclic citrullinated peptide (anti-CCP) antibody levels with increased carotid intima-media thickness (cIMT) in RA patients. Methods. Forty-five anti-CCP positive and 37 anti-CCP negative RA patients, and 62 healthy controls (HC) were studied. All groups were assessed for atherogenic index of plasma (AIP) and cIMT. Anti-CCP, C-reactive protein (CRP), and levels of tumor necrosis factor alpha (TNFα) and interleukin-6 (IL-6) were measured by enzyme-linked immunosorbent assay (ELISA). Results. The anti-CCP positive RA patients showed increased cIMT compared to HC and anti-CCP negative (P < 0.001). Anti-CCP positive versus anti-CCP negative RA patients, had increased AIP, TNFα and IL-6 (P < 0.01), and lower levels of high density lipoprotein cholesterol (HDL-c) (P = 0.02). The cIMT correlated with levels of anti-CCP (r = 0.513, P = 0.001), CRP (r = 0.799, P < 0.001), TNFα (r = 0.642, P = 0.001), and IL-6 (r = 0.751, P < 0.001). In multiple regression analysis, cIMT was associated with CRP (P < 0.001) and anti-CCP levels (P = 0.03). Conclusions. Levels of anti-CCP and CRP are associated with increased cIMT and cardiovascular risk supporting a clinical role of the measurement of cIMT in RA in predicting and preventing cardiovascular events. PMID:25821796

  10. Serum levels of anticyclic citrullinated peptide antibodies, interleukin-6, tumor necrosis factor-α, and C-reactive protein are associated with increased carotid intima-media thickness: a cross-sectional analysis of a cohort of rheumatoid arthritis patients without cardiovascular risk factors.

    PubMed

    Vázquez-Del Mercado, Mónica; Nuñez-Atahualpa, Lourdes; Figueroa-Sánchez, Mauricio; Gómez-Bañuelos, Eduardo; Rocha-Muñoz, Alberto Daniel; Martín-Márquez, Beatriz Teresita; Corona-Sanchez, Esther Guadalupe; Martínez-García, Erika Aurora; Macias-Reyes, Héctor; Gonzalez-Lopez, Laura; Gamez-Nava, Jorge Ivan; Navarro-Hernandez, Rosa Elena; Nuñez-Atahualpa, María Alejandra; Andrade-Garduño, Javier

    2015-01-01

    The main cause of death in rheumatoid arthritis (RA) is cardiovascular events. We evaluated the relationship of anticyclic citrullinated peptide (anti-CCP) antibody levels with increased carotid intima-media thickness (cIMT) in RA patients. Forty-five anti-CCP positive and 37 anti-CCP negative RA patients, and 62 healthy controls (HC) were studied. All groups were assessed for atherogenic index of plasma (AIP) and cIMT. Anti-CCP, C-reactive protein (CRP), and levels of tumor necrosis factor alpha (TNFα) and interleukin-6 (IL-6) were measured by enzyme-linked immunosorbent assay (ELISA). The anti-CCP positive RA patients showed increased cIMT compared to HC and anti-CCP negative (P < 0.001). Anti-CCP positive versus anti-CCP negative RA patients, had increased AIP, TNFα and IL-6 (P < 0.01), and lower levels of high density lipoprotein cholesterol (HDL-c) (P = 0.02). The cIMT correlated with levels of anti-CCP (r = 0.513, P = 0.001), CRP (r = 0.799, P < 0.001), TNFα (r = 0.642, P = 0.001), and IL-6 (r = 0.751, P < 0.001). In multiple regression analysis, cIMT was associated with CRP (P < 0.001) and anti-CCP levels (P = 0.03). Levels of anti-CCP and CRP are associated with increased cIMT and cardiovascular risk supporting a clinical role of the measurement of cIMT in RA in predicting and preventing cardiovascular events.

  11. Effect of interleukin-6 polymorphism on risk of preterm birth within population strata: a meta-analysis.

    PubMed

    Wu, Wilfred; Clark, Erin A S; Stoddard, Gregory J; Watkins, W Scott; Esplin, M Sean; Manuck, Tracy A; Xing, Jinchuan; Varner, Michael W; Jorde, Lynn B

    2013-04-25

    Because of the role of inflammation in preterm birth (PTB), polymorphisms in and near the interleukin-6 gene (IL6) have been association study targets. Several previous studies have assessed the association between PTB and a single nucleotide polymorphism (SNP), rs1800795, located in the IL6 gene promoter region. Their results have been inconsistent and SNP frequencies have varied strikingly among different populations. We therefore conducted a meta-analysis with subgroup analysis by population strata to: (1) reduce the confounding effect of population structure, (2) increase sample size and statistical power, and (3) elucidate the association between rs1800975 and PTB. We reviewed all published papers for PTB phenotype and SNP rs1800795 genotype. Maternal genotype and fetal genotype were analyzed separately and the analyses were stratified by population. The PTB phenotype was defined as gestational age (GA) < 37 weeks, but results from earlier GA were selected when available. All studies were compared by genotype (CC versus CG+GG), based on functional studies.For the maternal genotype analysis, 1,165 PTBs and 3,830 term controls were evaluated. Populations were stratified into women of European descent (for whom the most data were available) and women of heterogeneous origin or admixed populations. All ancestry was self-reported. Women of European descent had a summary odds ratio (OR) of 0.68, (95% confidence interval (CI) 0.51 - 0.91), indicating that the CC genotype is protective against PTB. The result for non-European women was not statistically significant (OR 1.01, 95% CI 0.59 - 1.75). For the fetal genotype analysis, four studies were included; there was no significant association with PTB (OR 0.98, 95% CI 0.72 - 1.33). Sensitivity analysis showed that preterm premature rupture of membrane (PPROM) may be a confounding factor contributing to phenotype heterogeneity. IL6 SNP rs1800795 genotype CC is protective against PTB in women of European descent. It is

  12. T-helper 17 cytokines (interleukins 17, 21, 22, and 6, and tumor necrosis factor-α) in patients with alopecia areata: association with clinical type and severity.

    PubMed

    Atwa, Mona A; Youssef, Nahed; Bayoumy, Nervana M

    2016-06-01

    Alopecia areata (AA) is an organ-specific autoimmune disease characterized by T-cell infiltrates and cytokine production. T-helper 17 (Th17) cells are crucially involved in the pathogenesis of autoimmune diseases. Our aim was to assess the association of Th17 with AA. We examined interleukin (IL)-17, IL-21, IL-22, IL-6, and tumor necrosis factor-alpha (TNF-α) levels in the serum of patients with AA and studied their association with clinical type and severity of AA. The serum concentrations of IL-17, IL-21, IL-22, IL-6, and TNF-α were measured in 47 patients with AA and 40 healthy controls. The clinical type of AA was determined, and the severity of hair loss was assessed in accordance with the Alopecia Areata Investigational Assessment Guideline criteria. The serum concentrations of IL-17, IL-21, IL-22, IL-6, and TNF-α were significantly higher in patients with AA as compared with healthy controls (mean: IL-17 33.23 ± 11.58 vs. 4.62 ± 1.88 pg/ml; P = 0.000, IL-21 62.10 ± 6.11 vs. 48.38 ± 3.31 pg/ml; P = 0.000, IL-22 19.27 ± 3.36 vs. 7.09 ± 1.62 pg/ml; P = 0.000, IL-6 17.18 ± 3.08 vs. 4.59 ± 1.66 pg/ml; P = 0.000, TNF-α 19.94 ± 3.59 vs. 9.95 ± 2.42 pg/ml; P = 0.000, respectively). There were significant positive correlations between serum IL-17, TNF-α, and disease severity. There was also significant positive correlation between serum IL-22 and duration of AA. Our results showed high serum levels of Th17 cytokines among patients with AA that may suggest a functional role of these cytokines in the pathogenesis of this important skin disease. It could also provide the rationale for new treatment strategies in AA. © 2015 The International Society of Dermatology.

  13. Defining a Role for Acid Sphingomyelinase in the p38/Interleukin-6 Pathway*

    PubMed Central

    Perry, David M.; Newcomb, Benjamin; Adada, Mohamad; Wu, Bill X.; Roddy, Patrick; Kitatani, Kazuyuki; Siskind, Leah; Obeid, Lina M.; Hannun, Yusuf A.

    2014-01-01

    Acid sphingomyelinase (ASM) is one of the key enzymes involved in regulating the metabolism of the bioactive sphingolipid ceramide in the sphingolipid salvage pathway, yet defining signaling pathways by which ASM exerts its effects has proven difficult. Previous literature has implicated sphingolipids in the regulation of cytokines such as interleukin-6 (IL-6), but the specific sphingolipid pathways and mechanisms involved in inflammatory signaling need to be further elucidated. In this work, we sought to define the role of ASM in IL-6 production because our previous work showed that a parallel pathway of ceramide metabolism, acid β-glucosidase 1, negatively regulates IL-6. First, silencing ASM with siRNA abrogated IL-6 production in response to the tumor promoter, 4β-phorbol 12-myristate 13-acetate (PMA), in MCF-7 cells, in distinction to acid β-glucosidase 1 and acid ceramidase, suggesting specialization of the pathways. Moreover, treating cells with siRNA to ASM or with the indirect pharmacologic inhibitor desipramine resulted in significant inhibition of TNFα- and PMA-induced IL-6 production in MDA-MB-231 and HeLa cells. Knockdown of ASM was found to significantly inhibit PMA-dependent IL-6 induction at the mRNA level, probably ruling out mechanisms of translation or secretion of IL-6. Further, ASM knockdown or desipramine blunted p38 MAPK activation in response to TNFα, revealing a key role for ASM in activating p38, a signaling pathway known to regulate IL-6 induction. Last, knockdown of ASM dramatically blunted invasion of HeLa and MDA-MB-231 cells through Matrigel. Taken together, these results demonstrate that ASM plays a critical role in p38 signaling and IL-6 synthesis with implications for tumor pathobiology. PMID:24951586

  14. Vacuum-assisted closure therapy increases local interleukin-8 and vascular endothelial growth factor levels in traumatic wounds.

    PubMed

    Labler, Ludwig; Rancan, Mario; Mica, Ladislav; Härter, Luc; Mihic-Probst, Daniela; Keel, Marius

    2009-03-01

    Clinical observations are suggesting accelerated granulation tissue formation in traumatic wounds treated with vacuum-assisted closure (VAC). Aim of this study was to determine the impact of VAC therapy versus alternative Epigard application on local inflammation and neovascularization in traumatic soft tissue wounds. Thirty-two patients with traumatic wounds requiring temporary coverage (VAC n = 16; Epigard n = 16) were included. At each change of dressing, samples of wound fluid and serum were collected (n = 80). The cytokines interleukin (IL)-6, IL-8, vascular endothelial growth factor (VEGF), and fibroblast growth factor-2 were measured by ELISA. Wound biopsies were examined histologically for inflammatory cells and degree of neovascularization present. All cytokines were found to be elevated in wound fluids during both VAC and Epigard treatment, whereas serum concentrations were negligible or not detectable. In wound fluids, significantly higher IL-8 (p < 0.001) and VEGF (p < 0.05) levels were detected during VAC therapy. Furthermore, histologic examination revealed increased neovascularization (p < 0.05) illustrated by CD31 and von Willebrand factor immunohistochemistry in wound biopsies of VAC treatment. In addition, there was an accumulation of neutrophils as well as an augmented expression of VEGF (p < 0.005) in VAC wound biopsies. This study suggests that VAC therapy of traumatic wounds leads to increased local IL-8 and VEGF concentrations, which may trigger accumulation of neutrophils and angiogenesis and thus, accelerate neovascularization.

  15. Fish Oil Supplementation Reduces Heart Levels of Interleukin-6 in Rats with Chronic Inflammation due to Epilepsy

    PubMed Central

    Nejm, Mariana Bocca; Haidar, André Abou; Hirata, Aparecida Emiko; Oyama, Lila Missae; de Almeida, Antonio-Carlos Guimarães; Cysneiros, Roberta Monterazzo; Cavalheiro, Esper Abrão; Scorza, Carla Alessandra; Scorza, Fulvio Alexandre

    2017-01-01

    Sudden unexpected death in epilepsy (SUDEP) is a major cause of premature death related to epilepsy. The causes of SUDEP remain unknown, but cardiac arrhythmias and asphyxia have been suggested as a major mechanism of this event. Inflammation has been implicated in the pathogenesis of both epilepsy and ventricular arrhythmia, with interleukin-6 (IL-6) being recognized as a crucial orchestrator of inflammatory states. Our group previously reported that levels of IL-6 were increased in the hearts of epileptic rats. In this scenario, anti-inflammatory actions are among the beneficial effects of fish oil dietary supplementation. This investigation revealed that elevated levels of IL-6 in the heart were markedly reduced in epileptic rats that were treated in the long-term with fish oil, suggesting protective anti-inflammatory actions against dangerously high levels of IL-6. Based on these findings, our results suggest beneficial effects of long-term intake of fish oil in reducing the inflammation associated with chronic epilepsy. PMID:28649227

  16. Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression.

    PubMed

    Cathcart, Jillian M; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

    2016-09-20

    Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype.

  17. Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression

    PubMed Central

    Cathcart, Jillian M.; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

    2016-01-01

    Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype. PMID:27531896

  18. Role of Helicobacter pylori and interleukin 6 -174 gene polymorphism in dyslipidemia: a case-control study.

    PubMed

    Pohjanen, Vesa-Matti; Koivurova, Olli-Pekka; Niemelä, Seppo E; Karttunen, Riitta A; Karttunen, Tuomo J

    2016-01-18

    To assess the role of Helicobacter pylori infection and interleukin 6 polymorphism -174 (rs1800795) in dyslipidemia. Case-control study comparing serum lipids between H. pylori positive and negative patients and controlling for IL-6 -174 polymorphism, age, sex and smoking. 3 hospitals performing outpatient endoscopies in the city of Oulu, Finland. 199 adult patients with dyspepsia symptoms fulfilling Rome criteria originating from ethnically Finnish population. Patients with an immunosuppressive disorder or malignant disease, treated H. pylori infection, immunosuppressive or anticoagulant medication, previous gastric surgery or ongoing antibiotic treatment were excluded. Association of H. pylori infection and serum lipid concentrations in the whole group or in genotype-based subgroups. The associations between peptic ulcer, gastric mucosal inflammation and serum lipid concentrations were assessed as secondary outcomes. The median high-density lipoprotein (HDL) serum concentration was significantly lower in the H. pylori positive group (0.81 mmol/L) than in the negative group (0.95 mmol/L; p<0.001). In the genotype subgroup analyses, a similar association between H. pylori infection and HDL serum levels was seen within the IL-6 -174 CC genotype group (HDL 0.72 vs 1.06 mmol/L, respectively; p<0.001), but no significant associations were seen in the GC or GG genotype groups. Additionally, patients with peptic ulcer demonstrated lower HDL levels (0.75 mmol/L) than H. pylori positive patients without ulcer (0.86 mmol/L; p=0.010). H. pylori infection associated significantly with low serum levels of HDL in the IL-6 -174 CC genotype patients but not in the other genotypes. This suggests that the association between H. pylori infection and serum HDL could be transmitted through IL-6. We suggest that the role of IL-6 genotype should also be studied in relation to other associations between gastrointestinal microbiome and cardiovascular risk factors. Published by the BMJ

  19. Hepatocyte Growth Factor and Interleukin-6 in Prostate Cancer Bone Metastasis

    DTIC Science & Technology

    2006-06-01

    Wif1 Wnt inhibitory factor 1 ## ## ## ## Cxcl4 Chemokine (C-X-C motif) ligand 4 ## ## ## ## Cxcl12 Chemokine (C-X-C motif) ligand 12...CGGCTGAAGAACAACAACAG GGCGTCTGACTCACACCTCT Clu CAGCTGGCTAACCTCACACA AACAGCTTCACCACCACCTC Cxcl4 AGTCCTGAGCTGCTGCTTCT CCCAGAGGAGATGGTCTTCA Col1A1 GAGAGCATGACCGATGGATT

  20. Vitamin D deficiency and high serum IL-6 concentration as risk factors for tubal factor infertility in Chinese women.

    PubMed

    Chen, Weiwei; Jiao, Xianting; Zhang, Jun; Wang, Lei; Yu, Xiaodan

    2018-05-01

    The aim of this study was to investigate the relationship between 25-hydroxyvitamin-D [25(OH)D] and female infertility and to further explore the role of inflammatory cytokines. We recruited 356 infertile women diagnosed with tubal factor infertility (TFI) or polycystic ovary syndrome (PCOS) or endometriosis, as well as 180 fertile women. Serum concentrations of 25(OH)D, interleukin (IL)-6, IL-1 β, and interferon-α were measured. The 25(OH)D concentration in TFI women was the lowest (16.9 ng/mL) and was significantly different from that in the fertile women (19.4 ng/mL; P <0.05)]; whereas women with TFI had higher IL-6 concentrations. After adjusting for confounders, 25(OH)D deficiency presented a risk factor for TFI (odds ratio [OR], 4.2; 95% confidence interval [CI], 1.5-11.3). There was a dose-effect relation between IL-6 tertiles and TFI: the higher the IL-6, the higher the risk for TFI (middle versus low: OR, 3.7; 95% CI, 1.5-9.5; high versus low: OR, 13.2; 95% CI, 4.8-36.4). IL-6 showed a negative correlation with 25(OH)D (r = -0.19). Women with both high IL-6 and low 25(OH)D had the highest risk for TFI (OR, 10.6; 95% CI, 4.2-26.3). Both vitamin D deficiency and high serum IL-6 concentration are risk factors for TFI. Serum 25(OH)D concentration was significantly and negatively correlated with serum IL-6. There was an interaction between IL-6 and 25(OH)D for the risk for TFI-related infertility. We hypothesized that vitamin D might reduce the risk for TFI through suppressing the production of IL-6. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Interleukin 6 Influences Germinal Center Development and Antibody Production via a Contribution of C3 Complement Component

    PubMed Central

    Kopf, Manfred; Herren, Suzanne; Wiles, Michael V.; Pepys, Mark B.; Kosco-Vilbois, Marie H.

    1998-01-01

    Mice rendered deficient for interleukin (IL) 6 by gene targeting were evaluated for their response to T cell–dependent antigens. Antigen-specific immunoglobulin (Ig)M levels were unaffected whereas all IgG isotypes showed varying degrees of alteration. Germinal center reactions occurred but remained physically smaller in comparison to those in the wild-type mice. This concurred with the observations that molecules involved in initial signaling events leading to germinal center formation were not altered (e.g., B7.2, CD40 and tumor necrosis factor R1). T cell priming was not impaired nor was a gross imbalance of T helper cell (Th) 1 versus Th2 cytokines observed. However, B7.1 molecules, absent from wild-type counterparts, were detected on germinal center B cells isolated from the deficient mice suggesting a modification of costimulatory signaling. A second alteration involved impaired de novo synthesis of C3 both in serum and germinal center cells from IL-6–deficient mice. Indeed, C3 provided an essential stimulatory signal for wild-type germinal center cells as both monoclonal antibodies that interrupted C3-CD21 interactions and sheep anti–mouse C3 antibodies caused a significant decrease in antigen-specific antibody production. In addition, germinal center cells isolated from C3–deficient mice produced a similar defect in isotype production. Low density cells with dendritic morphology were the local source of IL-6 and not the germinal center lymphocytes. Adding IL-6 in vitro to IL-6–deficient germinal center cells stimulated cell cycle progression and increased levels of antibody production. These findings reveal that the germinal center produces and uses molecules of the innate immune system, evolutionarily pirating them in order to optimally generate high affinity antibody responses. PMID:9815267

  2. Increased expression of interleukin-6 (IL-6) gene transcript in relation to IL-6 promoter hypomethylation in gingival tissue from patients with chronic periodontitis.

    PubMed

    Kobayashi, Tetsuo; Ishida, Kohei; Yoshie, Hiromasa

    2016-09-01

    DNA methylation of the cytokine genes may play a role in the pathogenesis of periodontitis. The aim of this study is to evaluate whether the alteration of interleukin-6 (IL-6) gene promoter methylation in the gingival tissue (GT) and peripheral blood (PB) is unique to chronic periodontitis (CP). DNA isolated from the GT and PB of 25 patients with (CP) and 20 healthy controls (H) was modified with sodium bisulfite and analyzed for IL-6 promoter methylation with direct sequencing. The levels of IL-6 mRNA and serum IL-6 protein were evaluated by a quantitative reverse transcription polymerase chain reaction and an enzyme-linked immunosorbent assay. The CP group showed that the overall methylation rates of IL-6 promoter that contained 19 cytosine-guanine dinucleotide (CpG) motifs were significantly decreased in GT in comparison to PB (p<0.001), which was significantly negatively correlated with the probing depth (p=0.003). The GT and PB of the H group displayed similar overall methylation rates. No significant difference was observed in the methylation rates at each CpG in GT in comparison to the PB in both groups. The levels of IL-6 mRNA in the GT and PB and serum IL-6 of the two groups were comparable. The ratio of IL-6 mRNA in the GT relative to the PB was significantly higher in the CP group than in the H group (p=0.03). The increased expression of IL-6 gene transcription may be related to IL-6 promoter hypomethylation in the GT from CP patients. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Lapatinib increases motility of triple-negative breast cancer cells by decreasing miRNA-7 and inducing Raf-1/MAPK-dependent interleukin-6.

    PubMed

    Hsiao, Yu-Chun; Yeh, Ming-Hsin; Chen, Yun-Ju; Liu, Ju-Fang; Tang, Chih-Hsin; Huang, Wei-Chien

    2015-11-10

    Lapatinib, a dual epidermal growth factor receptor (EGFR) and HER2 tyrosine kinase inhibitor (TKI), has been approved for HER2-positive breast cancer patients. Nevertheless, its inhibitory effect on EGFR did not deliver clinical benefits for triple-negative breast cancer (TNBC) patients even EGFR overexpression was frequently found in this disease. Moreover, lapatinib was unexpectedly found to enhance metastasis of TNBC cells, but the underlying mechanisms are not fully understood. In this study, we explored that the level of interleukin-6 (IL-6) was elevated in lapatinib-treated TNBC cells. Treatment with IL-6 antibody abolished the lapatinib-induced migration. Mechanistically, the signaling axis of Raf-1/mitogen-activated protein kinases (MAPKs), c-Jun N-terminal kinases (JNKs), p38 MAPK, and activator protein 1 (AP-1) was activated in response to lapatinib treatment to induce IL-6 expression. Furthermore, our data showed that microRNA-7 directly binds and inhibits Raf-1 3'UTR activity, and that down-regulation of miR-7 by lapatinib contributes to the activation of Raf-1 signaling pathway and the induction of IL-6 expression. Our results not only revealed IL-6 as a key regulator of lapatinib-induced metastasis, but also explored the requirement of miR7/Raf-1/MAPK/AP-1 axis in lapatinib-induced IL-6 expression.

  4. Lapatinib increases motility of triple-negative breast cancer cells by decreasing miRNA-7 and inducing Raf-1/MAPK-dependent interleukin-6

    PubMed Central

    Chen, Yun-Ju; Liu, Ju-Fang; Tang, Chih-Hsin; Huang, Wei-Chien

    2015-01-01

    Lapatinib, a dual epidermal growth factor receptor (EGFR) and HER2 tyrosine kinase inhibitor (TKI), has been approved for HER2-positive breast cancer patients. Nevertheless, its inhibitory effect on EGFR did not deliver clinical benefits for triple-negative breast cancer (TNBC) patients even EGFR overexpression was frequently found in this disease. Moreover, lapatinib was unexpectedly found to enhance metastasis of TNBC cells, but the underlying mechanisms are not fully understood. In this study, we explored that the level of interleukin-6 (IL-6) was elevated in lapatinib-treated TNBC cells. Treatment with IL-6 antibody abolished the lapatinib-induced migration. Mechanistically, the signaling axis of Raf-1/mitogen-activated protein kinases (MAPKs), c-Jun N-terminal kinases (JNKs), p38 MAPK, and activator protein 1 (AP-1) was activated in response to lapatinib treatment to induce IL-6 expression. Furthermore, our data showed that microRNA-7 directly binds and inhibits Raf-1 3′UTR activity, and that down-regulation of miR-7 by lapatinib contributes to the activation of Raf-1 signaling pathway and the induction of IL-6 expression. Our results not only revealed IL-6 as a key regulator of lapatinib-induced metastasis, but also explored the requirement of miR7/Raf-1/MAPK/AP-1 axis in lapatinib-induced IL-6 expression. PMID:26513016

  5. Interleukin-6 Modulates Colonic Transepithelial Ion Transport in the Stress-Sensitive Wistar Kyoto Rat

    PubMed Central

    O’Malley, Dervla; Dinan, Timothy G.; Cryan, John F.

    2012-01-01

    Immunological challenge stimulates secretion of the pro-inflammatory cytokine interleukin (IL)-6, resulting in variety of biological responses. In the gastrointestinal tract, IL-6 modulates the excitability of submucosal neurons and stimulates secretion into the colonic lumen. When considered in the context of the functional bowel disorder, irritable bowel syndrome (IBS), where plasma levels of IL-6 are elevated, this may reflect an important molecular mechanism contributing to symptom flares, particularly in the diarrhea-predominant phenotype. In these studies, colonic ion transport, an indicator of absorption and secretion, was assessed in the stress-sensitive Wistar Kyoto (WKY) rat model of IBS. Mucosa-submucosal colonic preparations from WKY and control Sprague Dawley (SD) rats were mounted in Ussing chambers and the basal short circuit current (ISC) was electrophysiologically recorded and compared between the strains. Exposure to IL-6 (1 nM) stimulated a secretory current of greater amplitude in WKY as compared to SD samples. Furthermore, the observed IL-6-mediated potentiation of secretory currents evoked by veratridine and capsaicin in SD rats was blunted in WKY rats. Exposure to IL-6 also stimulated an increase in transepithelial resistance in both SD and WKY colonic tissue. These studies demonstrate that the neuroexcitatory effects of IL-6 on submucosal plexi have functional consequences with alterations in both colonic secretory activity and permeability. The IL-6-induced increase in colonic secretory activity appears to neurally mediated. Thus, local increases in IL-6 levels and subsequent activation of enteric neurons may underlie alterations in absorpto-secretory function in the WKY model of IBS. PMID:23162465

  6. Interleukin-6 infusion blunts proinflammatory cytokine production without causing systematic toxicity in a swine model of uncontrolled hemorrhagic shock.

    PubMed

    Brundage, Susan I; Zautke, N A; Holcomb, J B; Spain, D A; Lam, J C; Mastrangelo, M A; Macaitis, J M; Tweardy, D J

    2004-11-01

    Serum elevations of interleukin-6 (IL-6) correlate with multiple organ dysfunction syndrome and mortality in critically injured trauma patients. Data from rodent models of controlled hemorrhage suggest that recombinant IL-6 (rIL-6) infusion protects tissue at risk for ischemia-reperfusion injury. Exogenous rIL-6 administered during shock appears to abrogate inflammation, providing a protective rather than a deleterious influence. In an examination of this paradox, the current study aimed to determine whether rIL-6 decreases inflammation in a clinically relevant large animal model of uncontrolled hemorrhagic shock, (UHS), and to investigate the mechanism of protection. Swine were randomized to four groups (8 animals in each): (1) sacrifice, (2) sham (splenectomy followed by hemodilution and cooling to 33 degrees C), (3) rIL-6 infusion (sham plus UHS using grade 5 liver injury with packing and resuscitation plus blinded infusion of rIL-6 [10 mcg/kg]), and (4) placebo (UHS plus blinded vehicle). After 4 hours, blood was sampled, estimated blood loss determined, animals sacrificed, and lung harvested for RNA isolation. Quantitative reverse transcriptase-polymerase chain reaction was used to assess granulocyte colony-stimulating factor (G-CSF), IL-6, and tumor necrosis factor-alpha (TNFalpha) messenger ribonucleic acid (mRNA) levels. Serum levels of IL-6 and TNFalpha were measured by enzyme-linked immunoassay (ELISA). As compared with placebo, IL-6 infusion in UHS did not increase estimated blood loss or white blood cell counts, nor decrease hematocrit or platelet levels. As compared with the sham condition, lung G-CSF mRNA production in UHS plus placebo increased eightfold (*p < 0.05). In contrast, rIL-6 infusion plus UHS blunted G-CSF mRNA levels, which were not significantly higher than sham levels (p = 0.1). Infusion of rIL-6 did not significantly affect endogenous production of either lung IL-6 or mRNA. As determined by ELISA, rIL-6 infusion did not increase final

  7. Mutant soluble ectodomain of fibroblast growth factor receptor-2 IIIc attenuates bleomycin-induced pulmonary fibrosis in mice.

    PubMed

    Yu, Zhi-hong; Wang, Ding-ding; Zhou, Zhi-you; He, Shui-lian; Chen, An-an; Wang, Ju

    2012-01-01

    We have developed a strong inhibitor (S252W mutant soluble ectodomain of fibroblast growth factor recptor-2 IIIc, msFGFR2) that binds FGFs strongly and blocks the activation of FGFRs. In vitro, msFGFR2 could inhibit the promoting effect of transforming growth factor (TGF)-β1 on the proliferation of primary lung fibroblasts. In vivo, msFGFR2 alleviated lung fibrosis through inhibiting the expression of α-smooth muscle actin (SMA) and collagen deposit. In Western blotting of the right lung tissues and immunohistochemical assay, we found the level of p-FGFRs, p-mitogen activated protein kinase (MAPK) and p-Smad3 in the mice of bleomycin (BLM) group treated with msFGFR2 was down dramatically compared with the mice of BLM group, which suggested the activations of FGF and TGF-β signals were blocked meanwhile. In summary, msFGFR2 attenuated BLM-induced fibrosis and is an attractive therapeutic candidate for human pulmonary fibrosis.

  8. Successful control of juvenile dermatomyositis-associated macrophage activation syndrome and interstitial pneumonia: distinct kinetics of interleukin-6 and -18 levels.

    PubMed

    Wakiguchi, Hiroyuki; Hasegawa, Shunji; Hirano, Reiji; Kaneyasu, Hidenobu; Wakabayashi-Takahara, Midori; Ohga, Shouichi

    2015-11-18

    Macrophage activation syndrome (MAS) is the secondary hemophagocytic lymphohistiocytosis associated with rheumatic diseases. Recently, the different cytokine profiles between systemic juvenile idiopathic arthritis (sJIA)-associated MAS (sJIA-MAS) and juvenile systemic lupus erythematosus (JSLE)-associated MAS (JSLE-MAS) were reported. However, there is little information about juvenile dermatomyositis (JDM)-associated MAS (JDM-MAS). A 4-year-old girl with JDM was hospitalized because of fever, erythema, hepatosplenomegaly, cytopenia, liver dysfunction and coagulopathy. Bone marrow aspiration revealed appreciable numbers of activated and hemophagocytosing macrophages. She was diagnosed as having JDM-MAS complicated with interstitial pneumonia (IP) based on the findings of the elevation of serum Krebs von den Lungen-6 (KL-6) levels and chest computed tomography findings. We analyzed circulating levels of interleukin (IL)-2,4,6,10,18, tumor necrosis factor-α and interferon-γ in the patient. Hypercytokinemia occurred at the diagnosis of MAS and IP, showing with the prominent elevations of IL-6 and IL-18 levels. The cytokine profiles were distinct from those reported in patients with sJIA-MAS or JSLE-MAS. High-dose corticosteroid and cyclosporine therapy led to a drastic improvement of MAS with decreased IL-6 levels. Subsequent cyclophosphamide therapy successfully controlled IP, paralleled with the declining pattern of IL-18 and KL-6 levels. This is the first report to describe a successful treatment and the cytokine profile of JDM-MAS and IP. Serum IL-6 and IL-18 levels may be useful for predicting the disease activity of JDM-MAS and IP, respectively.

  9. Changes in serum interleukin-6, C-reactive protein and thrombomodulin levels under periodontal ultrasonic debridement.

    PubMed

    Ushida, Yuka; Koshy, Geena; Kawashima, Yoko; Kiji, Makoto; Umeda, Makoto; Nitta, Hiroshi; Nagasawa, Toshiyuki; Ishikawa, Isao; Izumi, Yuichi

    2008-11-01

    This study aimed to compare the effect of single-visit full-mouth mechanical debridement (FMD) and quadrant-wise mechanical debridement (QMD) on the levels of serum interleukin (IL)-6, C-reactive protein (CRP) and soluble thrombomodulin. Thirty-six subjects with chronic periodontitis were randomly allocated to three groups: undergoing QMD, single-visit FMD with povidone iodine or with water. Serum IL-6 and soluble thrombomodulin were measured by enzyme-linked immunosorbent assay, and serum CRP was measured by the latex-enhanced nephelometric method. Serum IL-6 level increased significantly immediately after debridement in all the three groups, with this increase being greatest in the full-mouth groups. However, the increase in the full-mouth groups was not significantly higher than that of quadrant-wise group. In the quadrant-wise group, serum IL-6 level decreased significantly 1 month after debridement compared with baseline. Serum-soluble thrombomodulin decreased significantly in the full-mouth groups but not in the quadrant-wise group. Changes in CRP level were not significant at baseline or after debridement in all the three groups. FMD increased serum IL-6 and reduced serum-soluble thrombomodulin to a greater extent than QMD, suggesting that the former technique has stronger transient effects on systemic vascular endothelial functions than the latter.

  10. Radiation-induced interleukin-6 expression through MAPK/p38/NF-kappaB signaling pathway and the resultant antiapoptotic effect on endothelial cells through Mcl-1 expression with sIL6-Ralpha.

    PubMed

    Chou, Chia-Hung; Chen, Shee-Uan; Cheng, Jason Chia-Hsien

    2009-12-01

    To investigate the mechanism of interleukin-6 (IL-6) activity induced by ionizing radiation. Human umbilical vascular endothelial cells (HUVECs) were irradiated with different doses to induce IL-6. The IL-6 promoter assay and reverse transcriptase-polymerase chain reaction (RT-PCR) were used to examine transcriptional regulation. Specific chemical inhibitors, decoy double-stranded oligodeoxynucleotides, and Western blotting were conducted to investigate the signal transduction pathway. Recombinant soluble human IL-6 receptor alpha-chain (sIL6-Ralpha) and specific small interfering RNA were used to evaluate the biologic function of radiation-induced IL-6. Four grays of radiation induced the highest level of IL-6 protein. The promoter assay and RT-PCR data revealed that the induction of IL-6 was mediated through transcriptional regulation. The p38 inhibitor SB203580, by blocking nuclear factor-kappaB (NF-kappaB) activation, prevented both the transcriptional and translational regulation of radiation-induced IL-6 expression. The addition of sIL6-Ralpha rescued HUVECs from radiation-induced death in an IL-6 concentratio-dependent manner. The antiapoptotic effect of combined sIL6-Ralpha and radiation-induced IL-6 was inhibited by mcl-1-specific small interfering RNA. Radiation transcriptionally induces IL-6 expression in endothelial cells through mitogen-activated protein kinase/p38-mediated NF-kappaB/IkappaB (inhibitor of NF-kappaB) complex activation. In the presence of sIL6-Ralpha, radiation-induced IL-6 expression acts through Mcl-1 expression to rescue endothelial cells from radiation-induced death.

  11. Common elements in interleukin 4 and insulin signaling pathways in factor-dependent hematopoietic cells.

    PubMed Central

    Wang, L M; Keegan, A D; Li, W; Lienhard, G E; Pacini, S; Gutkind, J S; Myers, M G; Sun, X J; White, M F; Aaronson, S A

    1993-01-01

    Interleukin 4 (IL-4), insulin, and insulin-like growth factor I (IGF-I) efficiently induced DNA synthesis in the IL-3-dependent murine myeloid cell lines FDC-P1 and FDC-P2. Although these factors could not individually sustain long-term growth of these lines, a combination of IL-4 with either insulin or IGF-I did support continuous growth. The principal tyrosine-phosphorylated substrate observed in FDC cells stimulated with IL-4, previously designated 4PS, was of the same size (170 kDa) as the major substrate phosphorylated in response to insulin or IGF-I. These substrates had phosphopeptides of the same size when analyzed by digestion with Staphylococcus aureus V8 protease, and each tightly associated with the 85-kDa component of phosphatidylinositol 3-kinase after factor stimulation. IRS-1, the principal substrate phosphorylated in response to insulin or IGF-I stimulation in nonhematopoietic cells, is similar in size to 4PS. However, anti-IRS-1 antibodies failed to efficiently precipitate 4PS, and some phosphopeptides generated by V8 protease digestion of IRS-1 were distinct in size from the phosphopeptides of 4PS. Nevertheless, IL-4, insulin, and IGF-I were capable of stimulating tyrosine phosphorylation of IRS-1 in FDC cells that expressed this substrate as a result of transfection. These findings indicate that (i) IL-4, insulin, and IGF-I use signal transduction pathways in FDC lines that have at least one major feature in common, the rapid tyrosine phosphorylation of 4PS, and (ii) insulin and IGF-I stimulation of hematopoietic cell lines leads to the phosphorylation of a substrate that may be related to but is not identical to IRS-1. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7683417

  12. Interleukin-6 triggers human cerebral endothelial cells proliferation and migration: The role for KDR and MMP-9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianhua S.; Zhai Wenwu; Young, William L.

    2006-04-21

    Interleukin-6 (IL-6) is involved in angiogenesis. However, the underlying mechanisms are unknown. Using human cerebral endothelial cell (HCEC), we report for First time that IL-6 triggers HCEC proliferation and migration in a dose-dependent manner, specifically associated with enhancement of VEGF expression, up-regulated and phosphorylated VEGF receptor-2 (KDR), and stimulated MMP-9 secretion. We investigated the signal pathway of IL-6/IL-6R responsible for KDR's regulation. Pharmacological inhibitor of PI3K failed to inhibit IL-6-mediated VEGF overexpression, while blocking ERK1/2 with PD98059 could abolish IL-6-induced KDR overexpression. Further, neutralizing endogenous VEGF attenuated KDR expression and phosphorylation, suggesting that IL-6-induced KDR activation is independent of VEGFmore » stimulation. MMP-9 inhibitor GM6001 significantly decreases HCEC proliferation and migration (p < 0.05), indicating the crucial function of MMP-9 in promoting angiogenic changes in HCECs. We conclude that IL-6 triggers VEGF-induced angiogenic activity through increasing VEGF release, up-regulates KDR expression and phosphorylation through activating ERK1/2 signaling, and stimulates MMP-9 overexpression.« less

  13. Tumor necrosis factor alpha (-308), interleukin-6 (-174) and interleukin-10 (-1082) gene polymorphisms in polycystic ovary syndrome.

    PubMed

    Vural, Pervin; Değirmencioğlu, Sevgin; Saral, Neslihan Y; Akgül, Cemil

    2010-05-01

    The imbalance between pro- and anti-inflammatory cytokines and polymorphism of cytokine genes may play a role in the etiology of the polycystic ovary syndrome (PCOS). The aim of this study was to investigate the association of polymorphisms of TNFalpha, IL-6 and IL-10 genes with the occurrence and the clinical/laboratory characteristics of PCOS in the Turkish population. Single nucleotide polymorphisms (SNPs) of TNFalpha (-308 G/A), IL-6 (-174 G/C), IL-10 (-1082 G/A) genes in DNA from peripheral blood leukocytes of 97 PCOS patients and 95 healthy control women were investigated. There is a tendency toward lower frequency of the IL-6 CC genotype and C allele among PCOS women compared with healthy controls although the difference did not reach a significant level. No notable differences were observed in allele or genotype frequencies for TNFalpha and IL-10 genes between groups. The concomitant presence of wild homozygous TNFalpha genotype together with mutant IL-6 C allele has a protective effect against PCOS with an OR=0.45 (95% CI=0.23-0.86). While TNFalpha (-308) and IL-10 (-1082) genotypes did not influence clinical/laboratory parameters in PCOS, IL-6 (-174) CC or pooled CG+CC genotypes have lower glucose, insulin, HOMA, cholesterol, triglyceride, and LDL-C, and higher GIR and HDL-C values than GG genotypes. We suggest that the IL-6 promoter region polymorphism may be related to occurrence and metabolic abnormalities seen in PCOS in the Turkish population. However, more studies with larger sample size are necessary to support our findings in other populations before any statement can be made about the relationship between PCOS and cytokine polymorphism. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.

  14. Attenuated fever in rats during late pregnancy is linked to suppressed interleukin-6 production after localized inflammation with turpentine.

    PubMed

    Aguilar-Valles, Argel; Poole, Stephen; Mistry, Yogesh; Williams, Sylvain; Luheshi, Giamal N

    2007-08-15

    An attenuated fever response to pathogens during late pregnancy is a phenomenon that has been described in several mammalian species, and although mechanisms are not completely understood, decreased prostaglandin E2 (PGE2) synthesis has been implicated. Upstream of PGE2, there is evidence to suggest that anti-inflammatory cytokines such as interleukin-1 receptor antagonist (IL-1ra) could play a significant role. In the present study we addressed the role of pro-inflammatory cytokines during late pregnancy, specifically interleukin-6 (IL-6), an important circulating mediator in fever. Turpentine oil (TURP), a very potent pyrogen and activator of IL-6, was injected into the hind-limb muscle of rats at the 18th day of pregnancy (GD 18) or in non-pregnant (NP) age-matched female controls. As expected, TURP injection induced a highly significant fever in the NP animals, which peaked 11 h post-injection and lasted for over 24 h. This was accompanied by a significant rise in circulating IL-6 levels, which correlated with changes in PGE2 synthesizing enzymes expression in the hypothalamus. In complete contrast, TURP-induced fever was totally absent in GD 18 animals whose body temperature did not deviate from basal values. The lack of response was additionally reflected by the absence of change in IL-6 concentration and by the significant attenuation of PGE2 synthesizing enzymes expression, which correlated with the suppressed expression of SOCS3, a hypothalamic marker of IL-6 activity. Contrary to the changes in circulating IL-6 levels at GD 18, IL-1ra was induced to levels comparable to those of NP females, suggesting that the influence of this anti-inflammatory cytokine on the fever response to TURP is at best minimal. These data further confirm the importance of IL-6 in fever generation and provide evidence that it may be a key component of the attenuated fever response in late pregnancy.

  15. Attenuated fever in rats during late pregnancy is linked to suppressed interleukin-6 production after localized inflammation with turpentine

    PubMed Central

    Aguilar-Valles, Argel; Poole, Stephen; Mistry, Yogesh; Williams, Sylvain; Luheshi, Giamal N

    2007-01-01

    An attenuated fever response to pathogens during late pregnancy is a phenomenon that has been described in several mammalian species, and although mechanisms are not completely understood, decreased prostaglandin E2 (PGE2) synthesis has been implicated. Upstream of PGE2, there is evidence to suggest that anti-inflammatory cytokines such as interleukin-1 receptor antagonist (IL-1ra) could play a significant role. In the present study we addressed the role of pro-inflammatory cytokines during late pregnancy, specifically interleukin-6 (IL-6), an important circulating mediator in fever. Turpentine oil (TURP), a very potent pyrogen and activator of IL-6, was injected into the hind-limb muscle of rats at the 18th day of pregnancy (GD 18) or in non-pregnant (NP) age-matched female controls. As expected, TURP injection induced a highly significant fever in the NP animals, which peaked 11 h post-injection and lasted for over 24 h. This was accompanied by a significant rise in circulating IL-6 levels, which correlated with changes in PGE2 synthesizing enzymes expression in the hypothalamus. In complete contrast, TURP-induced fever was totally absent in GD 18 animals whose body temperature did not deviate from basal values. The lack of response was additionally reflected by the absence of change in IL-6 concentration and by the significant attenuation of PGE2 synthesizing enzymes expression, which correlated with the suppressed expression of SOCS3, a hypothalamic marker of IL-6 activity. Contrary to the changes in circulating IL-6 levels at GD 18, IL-1ra was induced to levels comparable to those of NP females, suggesting that the influence of this anti-inflammatory cytokine on the fever response to TURP is at best minimal. These data further confirm the importance of IL-6 in fever generation and provide evidence that it may be a key component of the attenuated fever response in late pregnancy. PMID:17556393

  16. Interleukin-6 genotype is associated with high-density lipoprotein cholesterol responses to exercise training.

    PubMed

    Halverstadt, Amy; Phares, Dana A; Roth, Stephen; Ferrell, Robert E; Goldberg, Andrew P; Hagberg, James M

    2005-05-15

    High-density lipoprotein cholesterol (HDL-C) and its subfractions are modifiable with exercise training and these responses are heritable. The interleukin-6 (IL6)-174G/C polymorphism may be associated with HDL-C levels. We hypothesized that the IL6-174G/C polymorphism would be associated with plasma HDL-C response to exercise training. Sixty-five 50- to 75-year-olds on a standardized diet were studied before and after 24 weeks of aerobic exercise training. Significant differences existed among genotype groups for change with exercise training in HDL-C, HDL3-C, integrated HDL4,5NMR-C, and HDLsize. The CC genotype group increased HDL-C more than the GG (7.0 +/- 1.3 v. 1.0 +/- 1.1 mg/dL, p = 0.001) and GC groups (3.3 +/- 0.9 mg/dL, p = 0.02); for HDL3-C, the CC group increased more than the GG (6.1 +/- 1.0 v. 0.9 +/- 0.9, mg/dL p < 0.001) and GC groups (2.5 +/- 0.7 mg/dL, p = 0.006). Integrated HDL4,5NMR-C increased more in the CC than GG group (6.5 +/- 1.6 mg/dL v. 1.0 +/- 1.3 mg/dL, p = 0.01), as did HDLsize compared to the GG (CC: 0.3 +/- 0.1 v. GG: 0.1 +/- 0.1 nm, p = 0.02) and GC (0.0 +/- 0.0 nm, p = 0.007) groups. IL6 genotype is associated with HDL-C response to exercise training.

  17. Interleukin 6 trigged ataxia-telangiectasia mutated activation facilitates lung cancer metastasis via MMP-3/MMP-13 up-regulation.

    PubMed

    Jiang, Yi Na; Yan, Hong Qiong; Huang, Xiao Bo; Wang, Yi Nan; Li, Qing; Gao, Feng Guang

    2015-12-01

    Our previous studies show that the phosphorylation of ataxia-telangiectasia mutated (ATM) induced by interleukin 6 (IL-6) treatment contributes to multidrug resistance formation in lung cancer cells, but the exact role of ATM activation in IL-6 increased metastasis is still elusive. In the present study, matrix metalloproteinase-3 (MMP-3) and MMP-13 were firstly demonstrated to be involved in IL-6 correlated cell migration. Secondly, IL-6 treatment not only increased MMP-3/MMP-13 expression but also augmented its activities. Thirdly, the inhibition of ATM phosphorylation efficiently abolished IL-6 up-regulating MMP-3/MMP-13 expression and increasing abilities of cell migration. Most importantly, the in vivo test showed that the inhibition of ATM abrogate the effect of IL-6 on lung cancer metastasis via MMP-3/MMP-13 down-regulation. Taken together, these findings demonstrate that IL-6 inducing ATM phosphorylation increases the expression of MMP-3/MMP-13, augments the abilities of cell migration, and promotes lung cancer metastasis, indicating that ATM is a potential target molecule to overcome IL-6 correlated lung cancer metastasis.

  18. Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santhanam, U.; Ray, A.; Sehgal, P.B.

    1991-09-01

    The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

  19. In Vitro Interleukin-1 and 2 Production and Interleukin 2 Receptor Expression in the Rhesus Monkey

    NASA Technical Reports Server (NTRS)

    Schmitt, Didier A.; Sonnenfeld, Gerald; Husson, David; Tkaczuk, Jean; Andre, Eric; Schaffar, Laurance

    1996-01-01

    Anti-human monoclonal antibodies were used to detect and quantify interleukins-1 and 2 and interleukin-2 receptor expression in peripheral blood mononuclear cells from a rhesus monkey. Interleukin-1 production could be induced by phorbol esters (PMA) and was potentiated by phytohemagglutinin (PHA). Interleukin-2 secretion could also be induced by the combination of PHA and PMA, but only weakly with PHA alone. Interleukin-2 receptor expression was present in a subpopulation of unstimulated lymphocytes and could be enhanced by PHA or PMA. These data show once again that the rhesus monkey immune system is cross-reactive with the human one and that rhesus macaque could be a good model to study interleukin therapy.

  20. PTP1B is a negative regulator of interleukin 4–induced STAT6 signaling

    PubMed Central

    Lu, Xiaoqing; Malumbres, Raquel; Shields, Benjamin; Jiang, Xiaoyu; Sarosiek, Kristopher A.; Natkunam, Yasodha

    2008-01-01

    Protein tyrosine phosphatase 1B (PTP1B) is a ubiquitously expressed enzyme shown to negatively regulate multiple tyrosine phosphorylation-dependent signaling pathways. PTP1B can modulate cytokine signaling pathways by dephosphorylating JAK2, TYK2, and STAT5a/b. Herein, we report that phosphorylated STAT6 may serve as a cytoplasmic substrate for PTP1B. Overexpression of PTP1B led to STAT6 dephosphorylation and the suppression of STAT6 transcriptional activity, whereas PTP1B knockdown or deficiency augmented IL-4–induced STAT6 signaling. Pretreatment of these cells with the PTK inhibitor staurosporine led to sustained STAT6 phosphorylation consistent with STAT6 serving as a direct substrate of PTP1B. Furthermore, PTP1B-D181A “substrate-trapping” mutants formed stable complexes with phosphorylated STAT6 in a cellular context and endogenous PTP1B and STAT6 interacted in an interleukin 4 (IL-4)–inducible manner. We delineate a new negative regulatory loop of IL-4–JAK-STAT6 signaling. We demonstrate that IL-4 induces PTP1B mRNA expression in a phosphatidylinositol 3-kinase–dependent manner and enhances PTP1B protein stability to suppress IL-4–induced STAT6 signaling. Finally, we show that PTP1B expression may be preferentially elevated in activated B cell–like diffuse large B-cell lymphomas. These observations identify a novel regulatory loop for the regulation of IL-4–induced STAT6 signaling that may have important implications in both neoplastic and inflammatory processes. PMID:18716132

  1. Low-Dose Pulsatile Interleukin-6 As a Treatment Option for Diabetic Peripheral Neuropathy.

    PubMed

    Cox, April Ann; Sagot, Yves; Hedou, Gael; Grek, Christina; Wilkes, Travis; Vinik, Aaron I; Ghatnekar, Gautam

    2017-01-01

    Diabetic peripheral neuropathy (DPN) remains one of the most common and serious complications of diabetes. Currently, pharmacological agents are limited to treating the pain associated with DPN, and do not address the underlying pathological mechanisms driving nerve damage, thus leaving a significant unmet medical need. Interestingly, research conducted using exercise as a treatment for DPN has revealed interleukin-6 (IL-6) signaling to be associated with many positive benefits such as enhanced blood flow and lipid metabolism, decreased chronic inflammation, and peripheral nerve fiber regeneration. IL-6, once known solely as a pro-inflammatory cytokine, is now understood to signal as a multifunctional cytokine, capable of eliciting both pro- and anti-inflammatory responses in a context-dependent fashion. IL-6 released from muscle in response to exercise signals as a myokine and as such has a unique kinetic profile, whereby levels are transiently elevated up to 100-fold and return to baseline levels within 4 h. Importantly, this kinetic profile is in stark contrast to long-term IL-6 elevation that is associated with pro-inflammatory states. Given exercise induces IL-6 myokine signaling, and exercise has been shown to elicit numerous beneficial effects for the treatment of DPN, a causal link has been suggested. Here, we discuss both the clinical and preclinical literature related to the application of IL-6 as a treatment strategy for DPN. In addition, we discuss how IL-6 may directly modulate Schwann and nerve cells to explore a mechanistic understanding of how this treatment elicits a neuroprotective and/or regenerative response. Collectively, studies suggest that IL-6, when administered in a low-dose pulsatile strategy to mimic the body's natural response to exercise, may prove to be an effective treatment for the protection and/or restoration of peripheral nerve function in DPN. This review highlights the studies supporting this assertion and provides rationale

  2. [Bone metabolism, biochemical markers of bone resorption and formation processes and interleukine 6 cytokin level during coeliac disease].

    PubMed

    Fekih, Monia; Sahli, Hela; Ben Mustapha, Nadia; Mestiri, Imen; Fekih, Moncef; Boubaker, Jalel; Kaabachi, Naziha; Sellami, Mohamed; Kallel, Lamia; Filali, Azza

    2013-01-01

    Celiac disease (CD) is characterized by a malabsorption syndrom. The bone anomalies are one of the principal complications of this disease. The osteoporosis frequency is high: 3.4% among patients having with CD versus 0.2% in the general population. To study the bone mineral density during the CD, to compare it to a control group and to determine the anomalies of biochemical markers of bone turn over and level of interleukin 6 cytokin (IL6) in these patients. All patients with CD have a measurement of bone mineral density by dual-energy x-ray absorptiometry (DXA), a biological exam with dosing calcemia, vitamin D, parathormone (PTH), the osteoblastic bone formation markers (serum osteocalcin, ALP phosphates alkaline), bone osteoclastic activity (C Télopeptide: CTX) and of the IL6. 42 patients were included, with a median age of 33.6 years. 52. 8% of the patients had a low level of D vitamine associated to a high level of PTH. An osteoporosis was noted in 21.5% of patients. No case of osteoporosis was detected in the control group. The mean level of the CTX, ostéocalcine and the IL6 was higher among patients having an osteoporosis or ostéopenia compared to patients with normal bone (p = 0,017). The factors associated with an bone loss (osteopenia or osteoporosis) were: an age > 30 years, a weight <50 kg, a level of ALP phosphates alkaline > 90 UI/ml, an hypo albuminemia < 40 g/l and a level of CTX higher than 1.2. Our study confirms the impact of the CD on the bone mineral statute. The relative risk to have an osteopenia or an osteoporosis was 5 in our series. The measurement of the osseous mineral density would be indicated among patients having a CD.

  3. Does granulocyte colony-stimulating factor ameliorate the proinflammatory response in human meningococcal septic shock?

    PubMed

    Rojahn, Astrid; Brusletto, Berit; Øvstebø, Reidun; Haug, Kari B F; Kierulf, Peter; Brandtzaeg, Petter

    2008-09-01

    To test the hypothesis that granulocyte colony-stimulating factor acts cooperatively with interleukin-10 in down-regulating monocyte function in severe meningococcal septic shock. 1) We quantified the plasma levels of granulocyte colony-stimulating factor, interleukin-10, Neisseria meningitidis lipopolysaccharide and the number of N. meningitidis DNA copies in 28 patients with systemic meningococcal disease. 2) We studied the inhibitory effect of recombinant human granulocyte colony-stimulating factor on normal human monocytes stimulated with purified meningococcal lipopolysaccaride. 3) We monitored the inhibitory effects of endogenously produced granulocyte colony-stimulating factor and interleukin-10 in meningococcal shock plasmas on monocytes. Comparative, experimental study. University Hospital and laboratory. Twenty-eight patients with systemic meningococcal disease, 13 with persistent shock, 7 died, and 15 without shock. The median levels of granulocyte colony-stimulating factor in shock and nonshock patients were 1.7 x 10(6) and 8.1 x 10(2) pg/mL; interleukin-10, 2.1 x 10(4) and 4 x 10(1) pg/mL; number of N. meningitidis DNA copies, 2.9 x 10(7) and <10(3)/mL; and lipopolysaccharide, 105 and <0.04 endotoxin units/mL, respectively. The plasma levels of granulocyte colony-stimulating factor were reduced by 50% within 4 to 6 hrs after initiation of antibiotic treatment. In model experiments with lipopolysaccharide-stimulated human monocytes, recombinant human granulocyte colony-stimulating factor and interleukin-10 reduced the release of tumor necrosis factor-alpha by mean 30% and 92%, respectively. When plasmas from three shock patients were depleted of native granulocyte colony-stimulating factor or interleukin-10 by immunoprecipitation, no increase in tumor necrosis factor-alpha release occurred after removal of granulocyte colony-stimulating factor, whereas removal of interleukin-10 increased the tumor necrosis factor-alpha release eight-fold. Although

  4. Distribution of mast cells and macrophages and expression of interleukin-6 in periapical cysts.

    PubMed

    Bracks, Igor Vieira; Armada, Luciana; Gonçalves, Lúcio Souza; Pires, Fábio Ramôa

    2014-01-01

    Mast cells and macrophages are important components of the inflammatory infiltrate found in inflammatory periapical diseases. Several cytokines participate in the mechanisms of inflammation, tissue repair, and bone resorption associated with periapical cysts. The aim of the present study was to evaluate the distribution of mast cells and macrophages and the expression of interleukin-6 (IL-6) in periapical cysts. Thirty periapical cysts were selected for the study, and clinical, demographic, and gross information from the cases was obtained from the laboratory records. Five-micrometer sections stained with hematoxylin-eosin were reviewed for analysis of the microscopic features of the cysts, and 3-μm sections on silanized slides were used for immunohistochemical reactions with anti-tryptase, anti-CD68, and anti-IL-6. There was no statistically significant difference in the mean number of mast cells and macrophages when comparing superficial and deep regions of the fibrous capsule of the cysts. Mean number of mast cells on the superficial region of the fibrous capsule was higher in cysts showing intense superficial inflammation and exocytosis. Macrophages were more commonly found in areas showing IL-6 expression, and IL-6 was less expressed in deep regions of the fibrous capsule in cysts showing greater gross volume. The results reinforced the participation of mast cells and macrophages in the pathogenesis of periapical cysts and suggested that IL-6 is not the major bone resorption mediator in larger periapical cysts. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  5. Interleukin and interleukin receptor gene polymorphisms in inflammatory bowel diseases susceptibility.

    PubMed

    Magyari, Lili; Kovesdi, Erzsebet; Sarlos, Patricia; Javorhazy, Andras; Sumegi, Katalin; Melegh, Bela

    2014-03-28

    Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), represents a group of chronic inflammatory disorders caused by dysregulated immune responses in genetically predisposed individuals. Genetic markers are associated with disease phenotype and long-term evolution, but their value in everyday clinical practice is limited at the moment. IBD has a clear immunological background and interleukins play key role in the process. Almost 130 original papers were revised including meta-analysis. It is clear these data are very important for understanding the base of the disease, especially in terms of clinical utility and validity, but text often do not available for the doctors use these in the clinical practice nowadays. We conducted a systematic review of the current literature on interleukin and interleukin receptor gene polymorphisms associated with IBD, performing an electronic search of PubMed Database from publications of the last 10 years, and used the following medical subject heading terms and/or text words: IBD, CD, UC, interleukins and polymorphisms.

  6. Toll-Like Receptor 4 and Myeloid Differentiation Factor 88 Provide Mechanistic Insights Into the Cause and Effects of Interleukin-6 Activation in Mouse Liver Regeneration

    PubMed Central

    Vaquero, Javier; Campbell, Jean S.; Haque, Jamil; McMahan, Ryan S.; Riehle, Kimberly J.; Bauer, Renay L.; Fausto, Nelson

    2014-01-01

    Partial hepatectomy (PH) consistently results in an early increase of circulating interleukin- 6 (IL-6), which is thought to play a major role in liver regeneration. Activation of this cytokine after PH requires the adaptor protein, MyD88, but the specific MyD88-related receptors involved remain unidentified. It is also unknown whether the magnitude of IL-6 elevation determines the extent of subsequent hepatocyte proliferation. Here, we uncovered artifacts in the assessment of circulating IL-6 levels when using cardiac puncture in mice after PH. By using retro-orbital bleed sampling, we show that the circulating levels of IL-6 after PH were not directly correlated with the extent of hepatocyte DNA synthesis in individual mice. The IL-6 increase after PH was attenuated in all lipopolysaccharide-hyporesponsive mouse strains studied (e.g., C3H/HeJ, Tlr4 null, Cd14 null, Tlr2,4,9 null, and Tlr2,4-Caspase1 null) and was severely abrogated in Myd88 null mice. Despite attenuated IL-6 levels, Tlr4 null mice showed normal signaling downstream of IL-6 and normal hepatocyte proliferation. In contrast, Myd88 null mice showed severe impairments in signal transducer and activator of transcription 3 phosphorylation and Socs3 induction, but had enhanced and prolonged extracellular signal-related kinase 1 and 2 phosphorylation in the first 6 hours after PH. Unexpectedly, these changes were associated with accelerated initiation of hepatocyte proliferation, as assessed by hepatocyte bromodeoxyuridine incorporation, phospho-histone H3 immunostaining, and cyclin E and A protein expression. Conclusion TLR-4 signaling contributes to IL-6 activation after PH, but the Tlr4-independent component appears sufficient for ensuring intact signaling downstream of IL-6. The lack of correlation between IL-6 levels and hepatocyte proliferation after PH, and the accelerated start of hepatocyte proliferation in Myd88 null mice despite abrogated cytokine activation, may highlight relevant

  7. Interleukin-6 signaling in patients with chronic heart failure treated with cardiac resynchronization therapy

    PubMed Central

    Ptaszynska-Kopczynska, Katarzyna; Szpakowicz, Anna; Marcinkiewicz-Siemion, Marta; Lisowska, Anna; Waszkiewicz, Ewa; Witkowski, Marcin; Jakim, Piotr; Galar, Bogdan; Musial, Wlodzimierz J.

    2016-01-01

    Introduction Increased expression of interleukin-6 (IL-6) has been described in left ventricular dysfunction in the course of chronic heart failure. Cardiac resynchronization therapy (CRT) is a unique treatment method that may reverse the course of chronic heart failure (CHF) with reduced ejection fraction (HF-REF). We aimed to evaluate the IL-6 system, including soluble IL-6 receptor (sIL-6R) and soluble glycoprotein 130 (sgp130), in HF-REF patients, with particular emphasis on CRT effects. Material and methods The study enrolled 88 stable HF-REF patients (63.6 ±11.1 years, 12 females, EF < 35%) and 35 comorbidity-matched controls (63.5 ±9.8 years, 7 females). Forty-five HF-REF patients underwent CRT device implantation and were followed up after 6 months. Serum concentrations of IL-6, sIL-6R and sgp130 were determined using ELISA kits. Results The HF-REF patients had higher IL-6 (median: 2.6, IQR: 1.6–3.8 vs. 2.1, IQR: 1.4–3.1 pg/ml, p = 0.03) and lower sIL-6R concentrations compared to controls (median: 51, IQR: 36–64 vs. 53. IQR 44–76 ng/ml, p = 0.008). There was no significant difference between sgp130 concentrations. In the HF-REF group IL-6 correlated negatively with EF (r = –0.5, p = 0.001) and positively with BNP (r = 0.5, p = 0.008) and CRP concentrations (r = 0.4, p = 0.02). Patients who presented a positive response after CRT showed a smaller change of sIL-6R concentration compared to nonresponders (ΔsIL-6R: –0.2 ±7.1 vs. 7 ±14 ng/ml; p = 0.04). Conclusions HF-REF patients present higher IL-6 and lower sIL-6R levels. IL-6 concentration reflects their clinical status. CRT-related improvement of patients’ functional status is associated with a smaller change of sIL-6R concentration in time. PMID:28883848

  8. Skin-homing interleukin-4 and -13-producing cells contribute to bullous pemphigoid: remission of disease is associated with increased frequency of interleukin-10-producing cells.

    PubMed

    Teraki, Y; Hotta, T; Shiohara, T

    2001-11-01

    Although evidence is accumulating that type 2 cytokines play a part in the pathogenesis of bullous pemphigoid, little information is available concerning characterization of the cellular source of these cytokines involved in the pathogenesis of bullous pemphigoid. By using multiparameter flow cytometry, we investigated T cells capable of producing interleukin-2, -4, -10, and -13, interferon-gamma, and tumor necrosis factor-alpha and their correlated expression of skin-homing receptor (cutaneous lymphocyte-associated antigen) in peripheral blood and skin blister of patients with bullous pemphigoid. In peripheral blood of bullous pemphigoid patients, significantly increased frequencies of interleukin-4- and interleukin-13-producing cells were found as compared with those of healthy controls, and the majority of these type 2 cells was found in the cutaneous lymphocyte-associated antigen-positive population. The frequency of interferon-gamma-producing cells was also increased as compared with healthy subjects; however, the majority of this subset was found in the cutaneous lymphocyte-associated antigen-negative population. In the skin blister, the frequencies of interleukin-13- and interleukin-4-producing cells were much higher than those in the peripheral blood of bullous pemphigoid, whereas that of interferon-gamma producing cells was significantly lower. Furthermore, in bullous pemphigoid patients after therapy with systemic corticosteroids, the frequency of cutaneous lymphocyte-associated antigen-positive, but not cutaneous lymphocyte-associated antigen-negative, interleukin-13-producing cells was significantly decreased accompanied by an increased frequency of interleukin-10-producing cells, which was associated with clinical improvement. Thus, our results suggest that bullous pemphigoid is a unique organ-specific autoimmune disease characterized by an expansion of skin-homing interleukin-13-producing cells. In addition, corticosteroids may control such type 2

  9. Inhibition of interleukin-17-stimulated interleukin-6 and -8 production by cranberry components in human gingival fibroblasts and epithelial cells.

    PubMed

    Tipton, D A; Cho, S; Zacharia, N; Dabbous, M K

    2013-10-01

    Gingival epithelial cells and fibroblasts participate in periodontal inflammation and destruction, producing interleukin (IL)-6, a regulator of osteoclastic bone resorption, and the neutrophil chemoattractant IL-8. IL-17, a product of T-helper 17 cells, may play a role in periodontitis by stimulating cytokine production by gingival cells. The cranberry (Vaccinium macrocarpon) is rich in polyphenols, particularly proanthocyanidins, which have antioxidant and other beneficial properties. Cranberry components inhibit pro-inflammatory activities of lipopolysaccharide-stimulated human macrophages, gingival fibroblasts, and epithelial cells, but little is known of its effects on IL-17-stimulated cytokine production. The objectives were to determine the effects of IL-17 ± cranberry components on IL-6 and IL-8 production by human gingival epithelial cells and fibroblasts. Cranberry high molecular weight non-dialyzable material (NDM), which is rich in proanthocyanidins, was derived from cranberry juice. Human gingival epithelial cells and normal human gingival fibroblasts were incubated with NDM (5-50 μg/mL), IL-17 (0.5-100 ng/mL), or NDM + IL-17 in serum-free medium for 6 d. IL-6 and IL-8 in culture supernatants were measured by ELISA. Membrane damage and viability were assessed by lactate dehydrogenase activity released into cell supernatants and activity of a mitochondrial enzyme, respectively. Data were analyzed using ANOVA and Scheffe's F procedure for post hoc comparisons. In both cell lines, IL-17 (≥ ~5-10 ng/mL) significantly stimulated production of IL-6 (p < 0.005) and IL-8 (p < 0.03). Non-toxic levels of NDM inhibited constitutive IL-6 and IL-8 production by epithelial cells (p ≤ 0.01) and fibroblasts (p ≤ 0.03) as well as IL-17-stimulated cytokine production by epithelial cells [IL-6 (maximum ~80% inhibition; p ≤ 0.0001); IL-8 (maximum ~70% inhibition; p ≤ 0.03)] and fibroblasts [IL-6 (maximum ~90% inhibition; p ≤ 0.0001); IL

  10. Interleukin-6 and Depressive Mood Symptoms: Mediators of the Association Between Childhood Abuse and Cognitive Performance in Middle-Aged Adults.

    PubMed

    Davis, Mary C; Lemery-Chalfant, Kathryn; Yeung, Ellen WanHeung; Luecken, Linda J; Zautra, Alex J; Irwin, Michael R

    2018-03-19

    Childhood abuse is a risk factor for the development of cognitive deficits in adulthood, a relation that is likely mediated by stress-sensitive psychological and physiological indicators. To evaluate whether the link between exposure to childhood abuse and cognitive function in middle adulthood is mediated by interleukin-6 (IL-6), metabolic risk, and depressive mood symptoms. Participants were 770 adults aged 40-65 recruited from the community, who completed the following: (i) a questionnaire assessing exposure to abuse prior to age 18, (ii) a phone interview assessing current depressive mood symptoms, and (iii) a home visit that included blood sampling for evaluation of IL-6 and assessment of metabolic risk indices. A follow-up telephone assessment evaluating cognitive function was completed by 555 of the participants. Structural equation modeling was used to test study hypotheses. Childhood abuse predicted higher levels of IL-6, depressive mood symptoms, and metabolic risk scores (p < .05). The relation between childhood abuse and poorer cognitive performance was mediated by IL-6 (p = .046) and depressive mood symptoms (p = .023), but not metabolic risk. IL-6 and depressive mood symptoms significantly mediated the relation between childhood abuse and adult cognitive function. Exposure to early abuse conveys enduring physiological and psychological effects, which may contribute to cognitive deficits that are evident by middle adulthood. Increased vulnerability for cognitive decline among adults with a history of early trauma and the mediating roles of IL-6 and depressive mood symptoms point to the potential value of interventions that address inflammation or depression, singly or together, to prevent cognitive decline in this at-risk population.

  11. Increased expression of C-reactive protein gene in inflamed gingival tissues could be derived from endothelial cells stimulated with interleukin-6.

    PubMed

    Maekawa, Tomoki; Tabeta, Koichi; Kajita-Okui, Keiko; Nakajima, Takako; Yamazaki, Kazuhisa

    2011-11-01

    Epidemiological studies have suggested periodontitis as a risk factor for ischemic heart disease. High sensitive C-reactive protein (hs-CRP), a predictor of cardiovascular risk, is elevated in periodontitis patients. Therefore, local infection-induced elevation of systemic CRP could account for the relationship between the 2 diseases. However, the underlying mechanism of CRP production in the periodontal tissues has not been fully elucidated. Therefore, the aim of the present study was to clarify the mechanism of CRP production in periodontal tissues. Gene expression of CRP in gingival biopsies was analysed by quantitative PCR. Human gingival epithelial cells (HGECs), human gingival fibroblasts (HGFBs), and human coronary artery endothelial cells (HCAECs) were characterized for CRP-producing ability by incubating with interleukin (IL)-1β, IL-6, soluble IL-6 receptor (sIL-6R), and Porphyromonas gingivalis strain W83. Gene expression of CRP is significantly elevated in periodontitis lesions compared with gingivitis lesions. HCAECs, but not HGECs and HGFBs, produced CRP in response to IL-6 and IL-1β in the presence of sIL-6R. In contrast to IL-6, the effect of IL-1β on CRP production was indirect via induction of IL-6. IL-1β was produced by HGECs and HGFBs with stimulation of P. gingivalis antigens. These results suggest that CRP induced locally by periodontal infection may play another role in the pathogenesis of periodontal disease, and to a much lesser extent, has the potential to modulate systemic CRP level by extra-hepatic CRP production. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Mortality Benefit of Recombinant Human Interleukin-1 Receptor Antagonist for Sepsis Varies by Initial Interleukin-1 Receptor Antagonist Plasma Concentration.

    PubMed

    Meyer, Nuala J; Reilly, John P; Anderson, Brian J; Palakshappa, Jessica A; Jones, Tiffanie K; Dunn, Thomas G; Shashaty, Michael G S; Feng, Rui; Christie, Jason D; Opal, Steven M

    2018-01-01

    Plasma interleukin-1 beta may influence sepsis mortality, yet recombinant human interleukin-1 receptor antagonist did not reduce mortality in randomized trials. We tested for heterogeneity in the treatment effect of recombinant human interleukin-1 receptor antagonist by baseline plasma interleukin-1 beta or interleukin-1 receptor antagonist concentration. Retrospective subgroup analysis of randomized controlled trial. Multicenter North American and European clinical trial. Five hundred twenty-nine subjects with sepsis and hypotension or hypoperfusion, representing 59% of the original trial population. Random assignment of placebo or recombinant human interleukin-1 receptor antagonist × 72 hours. We measured prerandomization plasma interleukin-1 beta and interleukin-1 receptor antagonist and tested for statistical interaction between recombinant human interleukin-1 receptor antagonist treatment and baseline plasma interleukin-1 receptor antagonist or interleukin-1 beta concentration on 28-day mortality. There was significant heterogeneity in the effect of recombinant human interleukin-1 receptor antagonist treatment by plasma interleukin-1 receptor antagonist concentration whether plasma interleukin-1 receptor antagonist was divided into deciles (interaction p = 0.046) or dichotomized (interaction p = 0.028). Interaction remained present across different predicted mortality levels. Among subjects with baseline plasma interleukin-1 receptor antagonist above 2,071 pg/mL (n = 283), recombinant human interleukin-1 receptor antagonist therapy reduced adjusted mortality from 45.4% to 34.3% (adjusted risk difference, -0.12; 95% CI, -0.23 to -0.01), p = 0.044. Mortality in subjects with plasma interleukin-1 receptor antagonist below 2,071 pg/mL was not reduced by recombinant human interleukin-1 receptor antagonist (adjusted risk difference, +0.07; 95% CI, -0.04 to +0.17), p = 0.230. Interaction between plasma interleukin-1 beta concentration and recombinant human

  13. Prognostic value of blood interleukin-6 in the prediction of functional outcome after stroke: a systematic review and meta-analysis.

    PubMed

    Bustamante, Alejandro; Sobrino, Tomás; Giralt, Dolors; García-Berrocoso, Teresa; Llombart, Victor; Ugarriza, Iratxe; Espadaler, Marc; Rodríguez, Noelia; Sudlow, Cathie; Castellanos, Mar; Smith, Craig J; Rodríguez-Yánez, Manuel; Waje-Andreassen, Ulrike; Tanne, David; Oto, Jun; Barber, Mark; Worthmann, Hans; Wartenberg, Katja E; Becker, Kyra J; Chakraborty, Baidarbhi; Oh, Seung-Hun; Whiteley, William N; Castillo, José; Montaner, Joan

    2014-09-15

    We aimed to quantify the association of blood interleukin-6 (IL-6) concentrations with poor outcome after stroke and its added predictive value over clinical information. Meta-analysis of 24 studies confirmed this association with a weighted mean difference of 3.443 (1.592-5.294) pg/mL, despite high heterogeneity and publication bias. Individual participant data including 4112 stroke patients showed standardized IL-6 levels in the 4th quartile were independently associated with poor outcome (OR=2.346 (1.814-3.033), p<0.0001). However, the additional predictive value of IL-6 was moderate (IDI=1.5%, NRI=5.35%). Overall these results indicate an unlikely translation of IL-6 into clinical practice for this purpose. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Inhibitory Effect of Anti-rheumatic Drug Iguratimod for Hepatocellular Carcinogenesis by Inhibition of Serum Interleukin-8 Production.

    PubMed

    Sakamoto, Taro; Ishii, Yuji; Shiba, Hiroaki; Furukawa, Kenei; Fujiwara, Yuki; Haruki, Koichiro; Iwase, Ryota; Shirai, Yoshihiro; Yanaga, Katsuhiko

    2016-07-01

    Angiogenesis is a known factor for the development of hepatocellular carcinoma (HCC). The aim of this study was to assess the property of iguratimod, that is an anti-inflammatory drug for rheumatoid arthritis, on anti-angiogenesis and anti-carcinogensis for HCC. In vitro, human umbilical vein endothelial cells were cultured under interleukin-8 (IL-8) with or without iguratimod. In vivo, a rat model with HCC received iguratimod or distilled water for 6 weeks. Diameter of the largest tumor, number of tumors and serum interleukin-8 concentration were compared between iguratimod and control groups. By an in vitro angiogenesis assay, it was found angiogenesis in iguratimod group was significantly lower than that in control group (p=0.013). In vivo, largest tumor diameter (p=0.036), number of the tumor (p=0.011) and serum interleukin-8 concentration (p=0.036) in the iguratimod group were significantly smaller and lower than those in the control group. Iguratimod may inhibit hepatocellular carcinogensis by inhibition of interleukin-8 production in a rat model. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  15. Absolute Measurements of Macrophage Migration Inhibitory Factor and Interleukin-1-β mRNA Levels Accurately Predict Treatment Response in Depressed Patients.

    PubMed

    Cattaneo, Annamaria; Ferrari, Clarissa; Uher, Rudolf; Bocchio-Chiavetto, Luisella; Riva, Marco Andrea; Pariante, Carmine M

    2016-10-01

    Increased levels of inflammation have been associated with a poorer response to antidepressants in several clinical samples, but these findings have had been limited by low reproducibility of biomarker assays across laboratories, difficulty in predicting response probability on an individual basis, and unclear molecular mechanisms. Here we measured absolute mRNA values (a reliable quantitation of number of molecules) of Macrophage Migration Inhibitory Factor and interleukin-1β in a previously published sample from a randomized controlled trial comparing escitalopram vs nortriptyline (GENDEP) as well as in an independent, naturalistic replication sample. We then used linear discriminant analysis to calculate mRNA values cutoffs that best discriminated between responders and nonresponders after 12 weeks of antidepressants. As Macrophage Migration Inhibitory Factor and interleukin-1β might be involved in different pathways, we constructed a protein-protein interaction network by the Search Tool for the Retrieval of Interacting Genes/Proteins. We identified cutoff values for the absolute mRNA measures that accurately predicted response probability on an individual basis, with positive predictive values and specificity for nonresponders of 100% in both samples (negative predictive value=82% to 85%, sensitivity=52% to 61%). Using network analysis, we identified different clusters of targets for these 2 cytokines, with Macrophage Migration Inhibitory Factor interacting predominantly with pathways involved in neurogenesis, neuroplasticity, and cell proliferation, and interleukin-1β interacting predominantly with pathways involved in the inflammasome complex, oxidative stress, and neurodegeneration. We believe that these data provide a clinically suitable approach to the personalization of antidepressant therapy: patients who have absolute mRNA values above the suggested cutoffs could be directed toward earlier access to more assertive antidepressant strategies

  16. Polymorphisms of genes encoding tumor necrosis factor-alpha, interleukin-10, cluster of differentiation-14 and interleukin-1ra in critically ill patients.

    PubMed

    Surbatovic, Maja; Grujic, Krasimirka; Cikota, Bojana; Jevtic, Miodrag; Filipovic, Nikola; Romic, Predrag; Strelic, Natasa; Magic, Zvonko

    2010-09-01

    The aim of the study was to determine whether distributions of tumor necrosis factor (TNF)-α(308), interleukin (IL)-10(1082), CD14(159), and IL-1ra gene intron 2 genotypes in critically ill patients are associated with outcome, underlying cause of sepsis, and type of microorganism. Blood samples from 106 critically ill white patients were genotyped by method based on polymerase chain reaction for TNF-α(308), IL-10(1082), CD14(159), and IL-1ra gene intron 2. All patients with TNF-α(308)AA genotype survived; relative risk (RR) of death in patients with AG was 3.250 and with GG, 1.923 (P < .01). In patients with Gram-positive sepsis, IL-10(1082)AA and then AG genotypes were the most frequent ones (odds ratio [OR], 18.67 and 7.20, respectively; P < .01). When comparing IL-10(1082)AA with AG, RR of pancreatitis was 1.80 and OR was 3.40. When AA and GG were compared, RR was 7.33 and OR was 20.00. In patients with GG, RR of peritonitis was 4.07 and OR was 5.88 (P < .01). In patients with Gram-positive sepsis, CD14(159)CT was the most frequent one with OR of 5.25. Distribution of 6 IL-1ra gene intron 2 genotypes showed no significant association. Distribution of TNF-α(308) genotypes is associated with outcome, IL-10(1082) with type of microorganism and underlying cause of sepsis, and CD14(159) with type of microorganism. Copyright © 2010. Published by Elsevier Inc.

  17. Interleukins and interleukin receptors in rheumatoid arthritis: Research, diagnostics and clinical implications

    PubMed Central

    Magyari, Lili; Varszegi, Dalma; Kovesdi, Erzsebet; Sarlos, Patricia; Farago, Bernadett; Javorhazy, Andras; Sumegi, Katalin; Banfai, Zsolt; Melegh, Bela

    2014-01-01

    Rheumatoid arthritis (RA) is an autoimmune disease, resulting in a chronic, systemic inflammatory disorder. It may affect many tissues and organs, but it primarily affects the flexible joints. In clinical practice patient care generates many questions about diagnosis, prognosis, and treatment. It is challenging for health care specialists to keep up to date with the medical literature. This review summarizes the pathogenesis, the polymorphisms of interleukin and interleukin genes and the standard available and possible future immunologic targets for RA treatment. The identification of disease-associated interleukin and interleukin receptor genes can provide precious insight into the genetic variations prior to disease onset in order to identify the pathways important for RA pathogenesis. The knowledge of the complex genetic background may prove useful for developing novel therapies and making personalized medicine based on the individual’s genetics. PMID:25232528

  18. Interleukin-6 (IL-6) receptor/IL-6 fusion protein (Hyper IL-6) effects on the neonatal mouse brain: possible role for IL-6 trans-signaling in brain development and functional neurobehavioral outcomes.

    PubMed

    Brunssen, Susan H; Moy, Sheryl S; Toews, Arrel D; McPherson, Christopher A; Harry, G Jean

    2013-01-01

    Adverse neurodevelopmental outcomes are linked to perinatal production of inflammatory mediators, including interleukin 6 (IL-6). While a pivotal role for maternal elevation in IL-6 has been established in determining neurobehavioral outcomes in the offspring and considered the primary target mediating the fetal inflammatory response, questions remain as to the specific actions of IL-6 on the developing brain. CD-1 male mice received a subdural injection of the bioactive fusion protein, hyper IL-6 (HIL-6) on postnatal-day (PND)4 and assessed from preweaning until adulthood. Immunohistochemical evaluation of astrocytes and microglia and mRNA levels for pro-inflammatory cytokines and host response genes indicated no evidence of an acute neuroinflammatory injury response. HIL-6 accelerated motor development and increased reactivity to stimulation and number of entries in a light/dark chamber, decreased ability to learn to withhold a response in passive avoidance, and effected deficits in social novelty behavior. No changes were observed in motor activity, pre-pulse startle inhibition, or learning and memory in the Morris water maze or radial arm maze, as have been reported for models of more severe developmental neuroinflammation. In young animals, mRNA levels for MBP and PLP/DM20 decreased and less complexity of MBP processes in the cortex was evident by immunohistochemistry. The non-hydroxy cerebroside fraction of cerebral lipids was increased. These results provide evidence for selective effects of IL-6 signaling, particularly trans-signaling, in the developing brain in the absence of a general neuroinflammatory response. These data contribute to our further understanding of the multiple aspects of IL-6 signaling in the developing brain. Published by Elsevier Inc.

  19. [The influence of interleukin gene polymorphism on the serum cytokine level in the patients presenting with chonic suppurative otitis media].

    PubMed

    Baike, E V; Vitkovsky, Yu A; Dutova, A A

    The objective of the present work was to study the influence of allelic variant associations of 1-beta interleukin (C3953T, &511C, T31C), interleukin-6 (C174G), and tumour necrosis factor-alpha (G308A) gene polymorphisms on the serum cytokine level in the patients presenting with chronic suppurative otitis media. A total of 299 patients at the age varying from 16 to 55 years with this condition divided into three groups were examined. Group 1 was comprised of 146 patients suffering from the tubotympanic form of chronic suppurative otitis media (CSOM). Group 2 was composed of 153 patients with epitympanic antral form of this condition. The control group included 183 subjects who have never suffered pathological changes in the middle ear. Human genomic DNA was analyzed with the use of the polymerase chain reaction (PCR). The serum cytokine levels were measured by the solid-state enzyme immunoassay in the beginning and at the end of the treatment period. The study has demonstrated that 56.2% of the healthy residents of the trans-Baikal region had the C/T Il-1b (C3953T) genotype. 79.1% of the patients presenting with the carious carious-destructive form of chronic suppurative otitis media were the heterozygous carriers of the T511C gene of 1-beta interleukin and had the maximally high concentrations of this interleukin in the blood serum. A rise in the production of the pro-inflammatory mediator (IL-6) was found to be related to the severity of the inflammatory process in the middle ear. The TNF-alpha content in the patients with CSOM during the active period of the disease proved to increase by a factor of 6 in comparison with that in the subjects of the control group irrespective of the type of mutation.

  20. Interleukin-6 and airflow limitation in chemical warfare patients with chronic obstructive pulmonary disease

    PubMed Central

    Attaran, Davood; Lari, Shahrzad M; Towhidi, Mohammad; Marallu, Hassan Ghobadi; Ayatollahi, Hossein; Khajehdaluee, Mohammad; Ghanei, Mostafa; Basiri, Reza

    2010-01-01

    Objectives Chronic obstructive pulmonary disease (COPD) is one of the main late complications of sulfur mustard poisoning. The aim of this study was to evaluate serum levels of interleukin (IL)-6 in war veterans with pulmonary complications of sulfur mustard poisoning and their correlation with severity of airways disease. Methods Fifty consecutive patients with sulfur mustard poisoning and stable COPD, and of mean age 46.3 ± 9.18 years were enrolled in this study. Thirty healthy men were selected as controls and matched to cases by age and body mass index. Spirometry, arterial blood gas, six- minute walk test, BODE (body mass index, obstruction, dyspnea, and exercise capacity), and St George’s Respiratory Questionnaire about quality of life were evaluated. Serum IL-6 was measured in both patient and control groups. Results Fifty-four percent of patients had moderate COPD. Mean serum IL-6 levels were 15.01 ± standard deviation (SD) 0.61 pg/dL and 4.59 ± 3.40 pg/dL in the case and control groups, respectively (P = 0.03). There was a significant correlation between IL-6 levels and Global Initiative for Chronic Obstructive Lung Disease stage (r = 0.25, P = 0.04) and between IL-6 and BODE index (r = 0.38, P = 0.01). There was also a significant negative correlation between serum IL-6 and forced expiratory volume in one second (FEV1, r = −0.36, P = 0.016). Conclusion Our findings suggest that serum IL-6 is increased in patients with sulfur mustard poisoning and COPD, and may have a direct association with airflow limitation. PMID:21037957

  1. The chemokine receptor CXCR6 controls the functional topography of interleukin-22 producing intestinal innate lymphoid cells.

    PubMed

    Satoh-Takayama, Naoko; Serafini, Nicolas; Verrier, Thomas; Rekiki, Abdessalem; Renauld, Jean-Christophe; Frankel, Gad; Di Santo, James P

    2014-11-20

    Interleukin-22 (IL-22) plays a critical role in mucosal defense, although the molecular mechanisms that ensure IL-22 tissue distribution remain poorly understood. We show that the CXCL16-CXCR6 chemokine-chemokine receptor axis regulated group 3 innate lymphoid cell (ILC3) diversity and function. CXCL16 was constitutively expressed by CX3CR1(+) intestinal dendritic cells (DCs) and coexpressed with IL-23 after Citrobacter rodentium infection. Intestinal ILC3s expressed CXCR6 and its ablation generated a selective loss of the NKp46(+) ILC3 subset, a depletion of intestinal IL-22, and the inability to control C. rodentium infection. CD4(+) ILC3s were unaffected by CXCR6 deficiency and remained clustered within lymphoid follicles. In contrast, the lamina propria of Cxcr6(-/-) mice was devoid of ILC3s. The loss of ILC3-dependent IL-22 epithelial stimulation reduced antimicrobial peptide expression that explained the sensitivity of Cxcr6(-/-) mice to C. rodentium. Our results delineate a critical CXCL16-CXCR6 crosstalk that coordinates the intestinal topography of IL-22 secretion required for mucosal defense. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Decreased production of interleukin-6 and prostaglandin E2 associated with inhibition of delta-5 desaturation of omega6 fatty acids in mice fed safflower oil diets supplemented with sesamol.

    PubMed

    Chavali, S R; Forse, R A

    1999-12-01

    The differences in the immune responses in mice fed sesame oil diets and those fed sesamin may be attributed to the presence of other lignans in the non-fat portion of the oil. The fatty acid composition (mean +/- SD mol. %) of liver membrane phospholipids and the levels of endotoxin-induced prostaglandin (PG) E2, interleukin (IL)-6, IL-10, IL-12 and tumor necrosis factor (TNF)-alpha were determined in mice fed diets supplemented with 5% safflower oil (SO) in the absence or presence of 1% sesamol. The levels of dihomo-gamma-linolenic acid (20:3omega6) were markedly higher (P<0.025) in the livers from mice fed sesamol supplemented SO diets (1.6 +/- 0.1) compared to the controls (1.4 +/- 0.1). These data suggest that sesamol or its metabolite could inhibit the in vivo delta-5 desaturation of omega6 fatty acids. Further, in animals fed sesamol supplemented SO diets, the levels of PGE2 (228 +/- 41 pg/ml) were markedly lower (P<0.01) compared to those fed SO diet alone (1355 +/- 188 pg/ml). Concomitantly, the concentrations of IL-6 were also lower (P<0.01) in mice fed sesamol diet (63 +/- 11 ng/ml) compared to the controls (143 +/- 22 ng/ml). A marked reduction in the levels of PGE2 in animals fed sesamol diets suggests that sesamol or its metabolite could inhibit the activity of cyclooxygenase enzyme.

  3. [C1q/tumor necrosis factor related protein 6 (CTRP6) is involved in gentamicin-induced acute kidney injury in rats].

    PubMed

    Li, Rong; Yang, Xiaoxia; Yu, Yan; Zhou, Meilan; Tian, Xiujuan; Feng, Shidong; Wang, Hanmin

    2016-11-01

    Objective To explore the role of the anti-inflammatory cytokine C1q/tumor necrosis factor related protein 6 (CTRP6) in gentamicin-induced acute kidney injury in rats. Methods SD rats were divided into 5 groups including control group, model group and the other 3 experimental groups. The rats in model group and experimental groups were subcutaneously injected with gentamicin at the dose of 400 mg/(kg.d) for consecutive 2 days to induce acute renal injury. Two days before gentamicin injection, the rats in the 3 experimental groups were given pAd-CTRP6 at the doses of 0.5, 5 and 50 mg/kg, respectively. The serum levels of blood urea nitrogen (BUN) and creatinine (Cr) were respectively assayed with picric acid colorimetry and ultraviolet spectrophotometry; ELISA was used to detect serum CTRP6 content and the production of interleukin 1β (IL-1β) and tumor necrosis factor α (TNF-α) in the kidney homogenate; Western blotting was performed to detect the expressions of CTRP6, caspase-1 and pyrin domain containing 3 (NLRP3) proteins in the renal tissues of rats. Results Compared with control group, serum BUN and Cr contents increased in the model rats; the secretion of inflammatory factors IL-1β and TNF-α, as well as the expressions of caspase-1 and NLRP3 were also enhanced in the model group. Compared with the model group, serum BUN and Cr contents decreased in the experimental groups; the secretion of IL-1β and TNF-α, as well as the expressions of caspase-1 and NLRP3 were also attenuated in the experimental groups. Moreover, with the increase of the injection dosage of pAd-CTRP6, the suppressive effect was gradually strengthened. Conclusion CTRP6 can attenuate gentamicin-induced acute renal injury in rats in a dose-dependent manner.

  4. Effects of methyl gallate and gallic acid on the production of inflammatory mediators interleukin-6 and interleukin-8 by oral epithelial cells stimulated with Fusobacterium nucleatum.

    PubMed

    Kang, Mi-Sun; Jang, Hee-Sook; Oh, Jong-Suk; Yang, Kyu-Ho; Choi, Nam-Ki; Lim, Hoi-Soon; Kim, Seon-Mi

    2009-12-01

    Interactions between periodontal bacteria and human oral epithelial cells can lead to the activation and expression of a variety of inflammatory mediators in epithelial cells. Fusobacterium nucleatum is a filamentous human pathogen that is strongly associated with periodontal diseases. This study examined the effects of methyl gallate (MG) and gallic acid (GA) on the production of inflammatory mediators, interleukin (IL)-6 and IL-8, by oral epithelial cells stimulated by F. nucleatum. In a real-time reverse transcription-polymerase chain reaction and an enzyme-linked immunosorbent assay, live F. nucleatum induced high levels of gene expression and protein release of IL-6 and IL-8. The effects of MG and GA were examined by treating KB oral epithelial cells with MG and GA and stimulating them with F. nucleatum. MG and GA inhibited significantly the increases in the IL-6 and IL-8 gene and protein levels in a dose-dependent manner. These Compounds also inhibited the growth of F. nucleatum. No visible effects of MG and GA on the adhesion and invasion of KB cells by F. nucleatum were observed. In conclusion, both MG and GA inhibit IL-6 and IL-8 production from F. nucleatum-activated KB cells.

  5. Interleukin-1 and tumor necrosis factor alpha inhibit repair of the porcine meniscus in vitro

    PubMed Central

    Hennerbichler, Alfred; Moutos, Franklin T.; Hennerbichler, Diana; Weinberg, J. Brice; Guilak, Farshid

    2011-01-01

    OBJECTIVE Injury or removal of the knee meniscus leads to progressive joint degeneration, and current surgical therapies for meniscal tears seek to maximally preserve meniscal structure and function. However, the factors that influence intrinsic repair of the meniscus are not well understood. The goal of this study was to investigate the capacity of meniscus tissue to repair a simulated defect in vitro and to examine the effect of pro-inflammatory cytokines on this process. METHODS Cylindrical explants were harvested from the outer one-third of medial porcine menisci. To simulate a full-thickness defect, a central core was removed and reinserted immediately into the defect. Explants were cultured for 2, 4, or 6 weeks in serum-containing media in the presence or absence of interleukin-1 (IL-1) or tumor necrosis factor alpha (TNF-alpha), and meniscal repair was investigated using mechanical testing and fluorescence confocal microscopy. RESULTS Meniscal lesions in untreated samples showed a significant capacity for intrinsic repair in vitro, with increasing cell accumulation and repair strength over time in culture. In the presence of IL-1 or TNF-alpha, no repair was observed despite the presence of abundant viable cells. CONCLUSIONS This study demonstrates that the meniscus exhibits an intrinsic repair response in vitro. However, the presence of pro-inflammatory cytokines completely inhibited repair. These findings suggest that increased levels of pro-inflammatory cytokines post-injury or under arthritic conditions may inhibit meniscal repair. Therefore, inhibition of these cytokines may provide a means of accelerating repair of damaged or injured menisci in vivo. PMID:17448702

  6. Can coenzyme Q10 supplementation effectively reduce human tumour necrosis factor-α and interleukin-6 levels in chronic diseases? Protocol for a systematic review and meta-analysis of randomised controlled trials.

    PubMed

    Farsi, Farnaz; Heshmati, Javad; Janani, Leila; Irandoost, Pardis; Mesri Alamdari, Naeimeh; Keshtkar, Abbasali; Akbari, Abolfazl; Vafa, Mohammadreza

    2017-10-08

    Inflammation, as a critical factor, can cause numerous chronic diseases by creating various proinflammatory cytokines. Coenzyme Q10 (CoQ10) can potentially exert an anti-inflammatory agent; in turn, this agent can reduce the systemic inflammatory response. The aims of this study are to conduct a comprehensive systematic review and a meta-analysis for the determination of the CoQ10 efficacy on the changes in serum interleukin-6 (IL-6) and the tumour necrosis factor-α (TNF-α) levels in unhealthy subjects. We will conduct an electronic search for articles published between January 1990 and January 2017 using a prespecified search strategy in MEDLINE, SCOPUS, EMBASE, CENTRAL and Web of Science.Our search will focus only on randomised controlled clinical trials in unhealthy subjects that employ either a parallel or a crossover design; this search will involve concurrent control groups. The primary outcomes of the literature are to determine the CoQ10 efficacy on the changes in the serum IL-6 and the TNF-α levels in unhealthy subjects. Secondary outcomes such as body mass index, serum adiponectin and high-sensitivity C-reactive protein levels, lipid profile and the heterogeneity assessment of the primary studies will be evaluated. The stages of screen articles, the extracts of relevant data and the assessment of study quality using the Cochrane risk of bias tool will be conducted independently by the two reviewers. Any disagreement will be resolved by discussion with a third person. If the number of eligible studies is sufficient, we will carry out a meta-analysis according to both outcomes. This study is the protocol for a systematic review and no ethics approval is needed. The findings from the full systematic review will be published in a peer-reviewed journal, and they will also be exhibited at national/international academic and clinical conferences. CRD42016052200. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article

  7. Role of the C-terminus in the activity, conformation, and stability of interleukin-6.

    PubMed Central

    Ward, L. D.; Hammacher, A.; Zhang, J. G.; Weinstock, J.; Yasukawa, K.; Morton, C. J.; Norton, R. S.; Simpson, R. J.

    1993-01-01

    Two murine interleukin-6 (mIL-6) variants were constructed using the polymerase chain reaction (PCR), one lacking the last five residues (183-187) at the C-terminus (pMC5) and another with the last five residues of mIL-6 substituted by the corresponding residues of human IL-6 (pMC5H). The growth stimulatory activity of pMC5 on the mouse hybridoma cell line 7TD1 was < 0.05% of mIL-6, whereas pMC5H and mIL-6 were equipotent. The loss of biological activity of pMC5 correlated with its negligible receptor binding affinity on 7TD1 cells, while the binding of pMC5H was comparable to that of mIL-6. Both pMC5 and pMC5H, like mIL-6, failed to interact with recombinant soluble human IL-6 receptor when assayed by surface plasmon resonance-based biosensor analysis. These studies suggest that the C-terminal seven amino acids of human IL-6, alone, do not define species specificity for receptor binding. A variety of biophysical techniques, as well as the binding of a conformational-specific monoclonal antibody, indicated that the global fold of the mIL-6 variants was similar to that of mIL-6, although small changes in the NMR spectra, particularly for pMC5, were observed. Some of these changes involved residues widely separated in the primary structure. For instance, interactions involving Tyr-22 were influenced by the C-terminal amino acids suggesting that the N- and C-termini of mIL-6 are in close proximity. Equilibrium unfolding experiments indicated that pMC5 was 0.8 kcal/mol less stable than mIL-6, whereas pMC5H was 1.4 kcal/mol more stable. These studies emphasize the structural importance of the C-terminal amino acids of IL-6 and suggest that truncation or mutation of this region could lead to small but significant alterations in other regions of the molecule. PMID:8401231

  8. Usefulness of interleukin 6 levels in the cerebrospinal fluid for the diagnosis of bacterial meningitis.

    PubMed

    Takahashi, Waka; Nakada, Taka-aki; Abe, Ryuzo; Tanaka, Kumiko; Matsumura, Yosuke; Oda, Shigeto

    2014-08-01

    Interleukin 6 (IL-6) is a proinflammatory cytokine produced during infections. We hypothesized that IL-6 levels in the cerebrospinal fluid (CSF) would be elevated in bacterial meningitis and useful for diagnosing and predicting neurologic outcomes. For the differentiation of bacterial meningitis, serum and CSF samples were obtained from patients with an altered level of consciousness. Patients were classified into 3 groups: bacterial meningitis, nonbacterial central nervous system disease, and other site sepsis. Of the 70 patients included in this study, there were 13 in the bacterial meningitis group, 21 in the nonbacterial central nervous system disease group, and 36 in the other site sepsis group. The CSF IL-6 level was significantly higher in the bacterial meningitis group than in the other 2 groups (P<.0001). Of the 5 CSF parameters assessed, CSF IL-6 level exhibited the largest area under the receiver operating characteristic curve (0.962), with a cut-off value of 644 pg/mL (sensitivity, 92.3%; specificity, 89.5%). To examine a potential association between a high CSF level and neurologic outcome, CSF IL-6 levels were divided into 4 quartiles, and each level was compared with the frequency of a good neurologic outcome. The frequency of a good neurologic outcome was significantly lower in the highest CSF IL-6 quartile than in the other 3 quartiles (odds ratio, 0.18; 95% confidence interval, 0.05-0.69; P=.013). Measurement of the CSF IL-6 level is useful for diagnosing bacterial meningitis. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Modification of tissue-factor mRNA and protein response to thrombin and interleukin 1 by high glucose in cultured human endothelial cells.

    PubMed

    Boeri, D; Almus, F E; Maiello, M; Cagliero, E; Rao, L V; Lorenzi, M

    1989-02-01

    Because diabetic vascular disease is accompanied by a state of hypercoagulability, manifested by increased thrombin activity and foci of intravascular coagulation, we investigated whether a specific procoagulant property of the endothelium--production and surface expression of tissue factor--is modified by elevated glucose concentrations. In unperturbed human vascular endothelial cells, tissue factor mRNA and expression of the functional protein were undetectable and were not induced by 10-12 days of exposure to 30 mM glucose. In thrombin-stimulated cultures, tissue-factor expression was related inversely to cellular density, with confluent cultures producing (per 10(5) cells) half the amount of tissue factor measured in sparse cultures. Cells exposed to high glucose and studied when cell number and thymidine incorporation were identical to control cells manifested increased tissue-factor mRNA level and functional protein production in response to thrombin (P = .002). This effect was not attributable to hypertonicity and was not observed after short exposure to high glucose. In contrast, the tissue-factor response to interleukin 1, a modulator of endothelial function in the context of host defense, was decreased in cells cultured in high glucose (P = .04). These findings indicate that exposure to high glucose can alter tissue-factor gene expression in perturbed vascular endothelium. The reciprocal effects of high glucose on the tissue-factor response to thrombin and interleukin 1 points to different pathways of tissue-factor stimulation by the two agents and suggests functional consequences pertinent to the increased thrombin activity and compromised host-defense mechanisms observed in diabetes.

  10. Expression of proinflammatory cytokine interleukin-6 in tissue samples of human prostate obtained by needle biopsy.

    PubMed

    Miličević, Nevenka; Mrčela, Milanka; Galić, Josip; Marjanović, Ksenija

    2015-11-01

    Interleukin-6 (IL-6) has been associated with the development of prostate cancer. The aim of the study was to clarify whether IL-6 expression in prostate tissue could be a useful marker in differentiation of prostate diseases in small foci by pathologist visual scoring. Archival paraffin-embedded specimens of benign prostate hyperplasia (BPH), high-grade prostatic intraepithelial neoplasia (PIN), prostatitis and prostate adenocarcinoma were studied by immunohistochemistry with a mouse monoclonal antibody IL-6 using the streptavidin-biotin method. Significantly, lower IL-6 immunoreactivity was observed in normal epithelial cells (p=0.000) and basal cells (p=0.000) in the samples of prostate adenocarcinoma in comparison to the samples with BPH, PIN and prostatitis. There was no significant difference in IL-6 expression in malignant and premalignant cells (p=0.814) as well as in stromal cells among the four diagnoses (p=0.22). IL-6 was expressed in normal epithelial cells, premalignant epithelial cells and malignant epithelial cells as well as in stromal cells. However, in our research IL-6 was of limited utility as a single marker for differential diagnosis of the prostate diseases in small foci needle biopsy by pathologist visual scoring. The standardization of immunohistochemical (IHC) staining protocol for IL-6 is required to determine IL-6 expression in order to avoid possible misinterpretation of the IHC results. Copyright © 2015 Elsevier GmbH. All rights reserved.

  11. Energy Balance Regulating Neuropeptides Are Expressed through Pregnancy and Regulated by Interleukin-6 Deficiency in Mouse Placenta.

    PubMed

    Pazos, Patricia; Lima, Luis; Diéguez, Carlos; García, María C

    2014-01-01

    The placenta produces a number of signaling molecules including metabolic and reproductive hormones as well as several inflammatory mediators. Among them, Interleukin-6 (IL-6), a well-known immune and metabolic regulator, acts peripherally modulating metabolic function and centrally increasing energy expenditure and reducing body fat. IL-6 interacts with key hypothalamic neuropeptidergic systems controlling energy homeostasis such as those producing the orexigenic/anabolic: neuropeptide Y (NPY) and agouti-related peptide (AgRP) and anorectic/catabolic neuropeptides: proopiomelanocortin (POMC) and cocaine and amphetamine regulated transcript (CART). Human and rat placenta have been identified as source of these neuropeptides, but their expression and regulation in murine placental tissues remain unknown. Therefore, placental mRNA levels of IL-6, NPY, AgRP, POMC, and CART at different pregnancy stages (gestational days 13, 15, and 18) were analyzed by real time PCR, as were the effect of IL-6 deficiency (IL-6 knockout mice) on their placental expression. Our results showed that placenta-derived neuropeptides were regulated by gestational age and IL-6 throughout the second half of mouse pregnancy. These data suggest that IL-6 may participate in the fine tune control of energy balance during pregnancy by extending its action as a metabolic signal to the main organ at the fetomaternal interface: the placenta.

  12. Energy Balance Regulating Neuropeptides Are Expressed through Pregnancy and Regulated by Interleukin-6 Deficiency in Mouse Placenta

    PubMed Central

    Pazos, Patricia; Lima, Luis; Diéguez, Carlos; García, María C.

    2014-01-01

    The placenta produces a number of signaling molecules including metabolic and reproductive hormones as well as several inflammatory mediators. Among them, Interleukin-6 (IL-6), a well-known immune and metabolic regulator, acts peripherally modulating metabolic function and centrally increasing energy expenditure and reducing body fat. IL-6 interacts with key hypothalamic neuropeptidergic systems controlling energy homeostasis such as those producing the orexigenic/anabolic: neuropeptide Y (NPY) and agouti-related peptide (AgRP) and anorectic/catabolic neuropeptides: proopiomelanocortin (POMC) and cocaine and amphetamine regulated transcript (CART). Human and rat placenta have been identified as source of these neuropeptides, but their expression and regulation in murine placental tissues remain unknown. Therefore, placental mRNA levels of IL-6, NPY, AgRP, POMC, and CART at different pregnancy stages (gestational days 13, 15, and 18) were analyzed by real time PCR, as were the effect of IL-6 deficiency (IL-6 knockout mice) on their placental expression. Our results showed that placenta-derived neuropeptides were regulated by gestational age and IL-6 throughout the second half of mouse pregnancy. These data suggest that IL-6 may participate in the fine tune control of energy balance during pregnancy by extending its action as a metabolic signal to the main organ at the fetomaternal interface: the placenta. PMID:24744782

  13. Is male factor infertility associated with midlife low-grade inflammation? A population based study.

    PubMed

    Hærvig, Katia Keglberg; Kierkegaard, Lene; Lund, Rikke; Bruunsgaard, Helle; Osler, Merete; Schmidt, Lone

    2018-06-01

    Male factor infertility is associated with an increased risk of disease and mortality, which has been related to markers of chronic systemic inflammation. The objective of this study was to investigate the association between male factor infertility and low-grade inflammation and furthermore to examine the lifetime prevalence of male factor infertility and overall infertility (also including female and couple infertility). The study population consisted of 2140 members of the Metropolit 1953 Danish Male Birth Cohort who had participated in the Copenhagen Aging and Midlife Biobank data collection in 2009-2011. Information on male factor infertility and overall infertility was obtained from a questionnaire, and low-grade inflammation was evaluated as the highest plasma levels of C-reactive protein, interleukin-6 and tumour necrosis factor-alpha in the population. The level of interleukin-6 was significantly higher among men with male factor infertility compared with other men adjusted for potential confounders. This was not found for the two other inflammatory markers. The lifetime prevalence of male factor infertility and overall infertility were 10.2% and 17.9%, respectively. The findings suggest that male factor infertility might be associated with an increased level of interleukin-6.

  14. Aciculatin Inhibits Granulocyte Colony-Stimulating Factor Production by Human Interleukin 1β-Stimulated Fibroblast-Like Synoviocytes

    PubMed Central

    Shih, Kao-Shang; Wang, Jyh-Horng; Wu, Yi-Wen; Teng, Che-Ming; Chen, Chien-Chih; Yang, Chia-Ron

    2012-01-01

    The expression of granulocyte colony-stimulating factor (G-CSF), the major regulator of neutrophil maturation, by human fibroblast-like synoviocytes (FLS) can be stimulated by the inflammatory cytokine interleukin-1β (IL-1β). G-CSF is known to contribute to the pathologic processes of destructive arthritis, but the induction mechanism remains unknown. The aims of this study were to identify the signaling pathways involved in IL-1β-stimulated G-CSF production and to determine whether this process was inhibited by aciculatin (8-((2R,4S,5S,6R)-tetrahydro-4,5-dihydroxy-6-methyl-2H-pyran-2-yl)-5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4H-chromen-4-one), the major bioactive component of Chrysopogon aciculatus. IL-1β-induced cytokine expression was evaluated by measuring mRNA and protein levels by RT-PCR, ELISA, and Milliplex® assay. Whether aciculatin inhibited IL-1β-stimulated G-CSF expression, and if so, how, were evaluated using western blot assay, an electrophoretic mobility shift assay, and a reporter gene assay. Neutrophil differentiation was determined by Wright-Giemsa staining and flow cytometry. Aciculatin markedly inhibited G-CSF expression induced by IL-1β (10 ng/mL) in a concentration-dependent manner (1–10 µM). In clarifying the mechanisms involved, aciculatin was found to inhibit the IL-1β-induced activation of the IκB kinase (IKK)/IκB/nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) pathways by suppressing the DNA binding activity of the transcription factors NF-κB and activator protein (AP)-1. Furthermore, aciculatin significantly inhibited the G-CSF-mediated phosphorylation of Janus kinase-signal transducer and activator of transcription (JAK-STAT) and Akt and neutrophil differentiation from precursor cells. Our results show that aciculatin inhibits IL-1β-stimulated G-CSF expression and the subsequent neutrophil differentiation, suggesting that it might have therapeutic potential for inflammatory arthritis. PMID

  15. Interleukin and interleukin receptor gene polymorphisms in inflammatory bowel diseases susceptibility

    PubMed Central

    Magyari, Lili; Kovesdi, Erzsebet; Sarlos, Patricia; Javorhazy, Andras; Sumegi, Katalin; Melegh, Bela

    2014-01-01

    Inflammatory bowel disease (IBD), which includes Crohn’s disease (CD) and ulcerative colitis (UC), represents a group of chronic inflammatory disorders caused by dysregulated immune responses in genetically predisposed individuals. Genetic markers are associated with disease phenotype and long-term evolution, but their value in everyday clinical practice is limited at the moment. IBD has a clear immunological background and interleukins play key role in the process. Almost 130 original papers were revised including meta-analysis. It is clear these data are very important for understanding the base of the disease, especially in terms of clinical utility and validity, but text often do not available for the doctors use these in the clinical practice nowadays. We conducted a systematic review of the current literature on interleukin and interleukin receptor gene polymorphisms associated with IBD, performing an electronic search of PubMed Database from publications of the last 10 years, and used the following medical subject heading terms and/or text words: IBD, CD, UC, interleukins and polymorphisms. PMID:24695754

  16. Multiple lipopolysaccharide (LPS) injections alter interleukin 6 (IL-6), IL-7, IL-10 and IL-6 and IL-7 receptor mRNA in CNS and spleen.

    PubMed

    Szot, Patricia; Franklin, Allyn; Figlewicz, Dianne P; Beuca, Timothy Petru; Bullock, Kristin; Hansen, Kim; Banks, William A; Raskind, Murray A; Peskind, Elaine R

    2017-07-04

    Neuroinflammation is proposed to be an important component in the development of several central nervous system (CNS) disorders including depression, Alzheimer's disease, Parkinson's disease, and traumatic brain injury. However, exactly how neuroinflammation leads to, or contributes to, these central disorders is unclear. The objective of the study was to examine and compare the expression of mRNAs for interleukin-6 (IL-6), IL-7, IL-10 and the receptors for IL-6 (IL-6R) and IL-7 (IL-7R) using in situ hybridization in discrete brain regions and in the spleen after multiple injections of 3mg/kg lipopolysaccharide (LPS), a model of neuroinflammation. In the spleen, LPS significantly elevated IL-6 mRNA expression, then IL-10 mRNA, with no effect on IL-7 or IL-7R mRNA, while significantly decreasing IL-6R mRNA expression. In the CNS, LPS administration had the greatest effect on IL-6 and IL-6R mRNA. LPS increased IL-6 mRNA expression only in non-neuronal cells throughout the brain, but significantly elevated IL-6R mRNA in neuronal populations, where observed, except the cerebellum. LPS resulted in variable effects on IL-10 mRNA, and had no effect on IL-7 or IL-7R mRNA expression. These studies indicate that LPS-induced neuroinflammation has substantial but variable effects on the regional and cellular patterns of CNS IL-6, IL-7 and IL-10, and for IL-6R and IL-7R mRNA expression. It is apparent that administration of LPS can affect non-neuronal and neuronal cells in the brain. Further research is required to determine how CNS inflammatory changes associated with IL-6, IL-10 and IL-6R could in turn contribute to the development of CNS neurological disorders. Published by Elsevier Ltd.

  17. Dialysate interleukin-6 predicts increasing peritoneal solute transport rate in incident peritoneal dialysis patients

    PubMed Central

    2014-01-01

    Background Repeated exposure to peritoneal dialysis (PD) solutions contributes to cumulative intraperitoneal inflammation and peritoneal injury. The present study aimed to explore the capacity of dialysate interleukin-6(IL-6) to a) predict peritoneal membrane function and peritonitis in incident PD patients, and b) to evaluate the influence of neutral pH, low glucose degradation product (GDP) PD solution on dialysate IL-6 levels. Methods The study included 88 incident participants from the balANZ trial who had completed 24-months of follow-up. Change in peritoneal solute transport rate (PSTR) and peritonitis were primary outcome measures, and the utility of IL-6 and IL-6 appearance rate (IL-6 AR) in predicting these outcomes was analyzed using multilevel linear regression and Cox proportional hazards models, respectively. Sensitivity analyses were performed by analyzing outcomes in a peritonitis-free cohort (n = 56). Results Dialysate IL-6 concentration significantly increased from baseline to 24 months (mean difference 19.07 pg/mL; P < 0.001) but was not affected by the type of PD solution received (P = 0.68). An increase in PSTR from baseline was associated with higher levels of IL-6 (P = 0.004), the use of standard solutions (P = 0.005) and longer PD duration (P < 0.001). Baseline IL-6 level was not associated with a shorter time to first peritonitis (adjusted hazard ratio 1.00, 95% CI 0.99-1.00, P = 0.74). Analysis of IL-6 AR as well as sensitivity analyses in a peritonitis-free cohort yielded comparable results. Conclusion Dialysate IL-6 concentration increased with longer PD duration and was a significant, independent predictor of PSTR. The use of biocompatible PD solutions exerted no significant effect on dialysate IL-6 levels but did abrogate the increase in PSTR associated with standard PD solutions. This is the first study to examine the impact of biocompatible solutions on the utility of IL-6 in predicting PSTR and peritonitis. PMID:24410736

  18. Differential regulation of interleukin 12 and interleukin 23 production in human dendritic cells

    PubMed Central

    Gerosa, Franca; Baldani-Guerra, Barbara; Lyakh, Lyudmila A.; Batoni, Giovanna; Esin, Semih; Winkler-Pickett, Robin T.; Consolaro, Maria Rita; De Marchi, Mario; Giachino, Daniela; Robbiano, Angela; Astegiano, Marco; Sambataro, Angela; Kastelein, Robert A.; Carra, Giuseppe; Trinchieri, Giorgio

    2008-01-01

    We analyzed interleukin (IL) 12 and IL-23 production by monocyte-derived dendritic cells (mono-DCs). Mycobacterium tuberculosis H37Rv and zymosan preferentially induced IL-23. IL-23 but not IL-12 was efficiently induced by the combination of nucleotide-binding oligodimerization domain and Toll-like receptor (TLR) 2 ligands, which mimics activation by M. tuberculosis, or by the human dectin-1 ligand β-glucan alone or in combination with TLR2 ligands, mimicking induction by zymosan. TLR2 ligands inhibited IL-12 and increased IL-23 production. DC priming with interferon (IFN) γ strongly increased IL-12 production, but was not required for IL-23 production and inhibited IL-23 production induced by β-glucan. The pattern of IL-12 and IL-23 induction was reflected in accumulation of the IL-12p35 and IL-23p19 transcripts, respectively, but not IL-12/23p40. Although IL-23, transforming growth factor β, and IL-6 contained in the supernatants of activated mono-DCs played a role in the induction of IL-17 by human CD4+ T cells, IL-1β, in combination with one or more of those factors, was required for IL-17 production, and its production determined the differential ability of the stimuli used to elicit mono-DCs to produce soluble factors directing IL-17 production. Thus, the differential ability of pathogens to induce antigen-presenting cells to produce cytokines regulates the immune response to infection. PMID:18490488

  19. Effects of cholesterol, C-reactive protein, and interleukin-6 on prostate cancer risk in a population of African ancestry.

    PubMed

    Tulloch-Reid, Marshall K; McFarlane-Anderson, Norma; Bennett, Franklyn I; Aiken, William D; Jackson, Maria D

    2017-11-01

    To investigate the association between serum cholesterol and prostate cancer and whether any effect may be mediated through inflammatory markers. Data from a case-control study of 40-80 years old Jamaican male patients (229 cases; 252 controls) were used. Cases had incident histologically-confirmed prostate cancer and controls were men with normal digital rectal examination and prostate-specific antigen (PSA) < 4 μg/L or free: total PSA > 0.15 obtained from the same clinic. Total and HDL cholesterol, interleukin-6 (IL-6), and C-reactive protein (CRP) were measured from a non-fasting sample. Multivariable logistic regression models were used to evaluate the associations between these factors and prostate cancer, adjusting for age, body mass index, waist circumference, family history of prostate cancer, diabetes, hypertension, use of cholesterol-lowering drugs, and smoking. Total cholesterol [Mean (cases, 4.71 ± 1.07; controls, 4.64 ± 1.07 mmol/L)], CRP [median (cases, 2.11; controls, 2.09 µg/ml)], and IL-6: [median (cases, 3.34; controls, 3.24 pg/ml)] did not differ by PCA status. Higher total cholesterol was associated with an increased risk of low-grade disease after adjusting for potential confounders [multivariable-adjusted OR (95% CI): tertile 2: 3.32(1.66, 6.45), tertile 3: 2.14(1.07, 4.32)]. Total cholesterol was unrelated to overall prostate cancer or high-grade disease. There was no significant association between HDL cholesterol or any of the inflammatory markers with prostate cancer. Increasing total cholesterol but not inflammatory markers were associated with low-grade prostate cancer in Caribbean men.

  20. Neutralizing anti-interleukin-1β antibodies modulate fetal blood-brain barrier function after ischemia.

    PubMed

    Chen, Xiaodi; Sadowska, Grazyna B; Zhang, Jiyong; Kim, Jeong-Eun; Cummings, Erin E; Bodge, Courtney A; Lim, Yow-Pin; Makeyev, Oleksandr; Besio, Walter G; Gaitanis, John; Threlkeld, Steven W; Banks, William A; Stonestreet, Barbara S

    2015-01-01

    We have previously shown that increases in blood-brain barrier permeability represent an important component of ischemia-reperfusion related brain injury in the fetus. Pro-inflammatory cytokines could contribute to these abnormalities in blood-brain barrier function. We have generated pharmacological quantities of mouse anti-ovine interleukin-1β monoclonal antibody and shown that this antibody has very high sensitivity and specificity for interleukin-1β protein. This antibody also neutralizes the effects of interleukin-1β protein in vitro. In the current study, we hypothesized that the neutralizing anti-interleukin-1β monoclonal antibody attenuates ischemia-reperfusion related fetal blood-brain barrier dysfunction. Instrumented ovine fetuses at 127 days of gestation were studied after 30 min of carotid occlusion and 24h of reperfusion. Groups were sham operated placebo-control- (n=5), ischemia-placebo- (n=6), ischemia-anti-IL-1β antibody- (n=7), and sham-control antibody- (n=2) treated animals. Systemic infusions of placebo (0.154M NaCl) or anti-interleukin-1β monoclonal antibody (5.1±0.6 mg/kg) were given intravenously to the same sham or ischemic group of fetuses at 15 min and 4h after ischemia. Concentrations of interleukin-1β protein and anti-interleukin-1β monoclonal antibody were measured by ELISA in fetal plasma, cerebrospinal fluid, and parietal cerebral cortex. Blood-brain barrier permeability was quantified using the blood-to-brain transfer constant (Ki) with α-aminoisobutyric acid in multiple brain regions. Interleukin-1β protein was also measured in parietal cerebral cortices and tight junction proteins in multiple brain regions by Western immunoblot. Cerebral cortical interleukin-1β protein increased (P<0.001) after ischemia-reperfusion. After anti-interleukin-1β monoclonal antibody infusions, plasma anti-interleukin-1β monoclonal antibody was elevated (P<0.001), brain anti-interleukin-1β monoclonal antibody levels were higher (P<0

  1. Modulation of CYP1A2 and CYP3A6 catalytic activities by serum from rabbits with a turpentine-induced inflammatory reaction and interleukin 6.

    PubMed

    Kourylko, Oksana; Fradette, Caroline; Arcand, Mathieu; du Souich, Patrick

    2006-01-01

    Inflammatory reactions reduce the activity of cytochrome P450 isoforms. The aim of the study was to determine the mechanisms underlying the decrease in CYP1A2 and CYP3A6 catalytic activities produced by serum from rabbits with a turpentine-induced inflammatory reaction (S(TIIR)) and interleukin 6 (IL-6). S(TIIR) and IL-6 were incubated with cultured primary hepatocytes from control rabbits (H(CONT)), and from rabbits with a turpentine-induced inflammatory reaction (H(TIIR)) in the absence or presence of pyrrolidine dithiocarbamate (PDTC), an antioxidant and inhibitor of nuclear factor kappaB transcription; 2'-amino-3'-methoxyflavone (PD98059), an inhibitor of extracellular signal-related kinase (Erk1/2); 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)1H-imidazole (SB203580), an inhibitor of p38MAPK; Nomega-nitro-L-arginine methyl ester, an inhibitor of nitric-oxide synthase 2 (NOS2); the combination of PDTC, PD98059, and SB203580; and genistein, an inhibitor of Janus-associated protein tyrosine kinase (JAK). After 4 and 24 h of incubation of H(CONT) with S(TIIR) and IL-6, CYP1A2 activity was reduced without changes in expression; the reduction in activity was partially prevented by the inhibition of JAK, Erk1/2, and NOS2. In H(CONT), S(TIIR) and IL-6 did not affect CYP3A6 activity; however, PDTC reduced CYP3A6 activity by 40 and 80% after 4 and 24 h of incubation. In H(TIIR), S(TIIR) and IL-6 reduced both CYP1A2 and CYP3A6 activities; this decrease is partially prevented by inhibitors of protein tyrosine kinases, Erk1/2, and NOS2. In H(TIIR), SB203580 increased CYP3A6 activity in a dose-dependent manner without changes in protein expression. These results show that the signal transduction pathways mediating the decrease in CYP1A2 and 3A6 activity, produced by S(TIIR) and IL-6, involve JAK, Erk1/2, and NOS2.

  2. Tumor necrosis factor and interleukin 1 as mediators of endotoxin-induced beneficial effects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Urbaschek, R.; Urbaschek, B.

    Bacterial lipopolysaccharides or endotoxins are known to induce tumor necrosis; enhanced nonspecific resistance to bacterial, viral, and parasitic infections and to radiation sickness; and tolerance to lethal doses of endotoxin. These beneficial effects are achieved by pretreatment with minute amounts of endotoxin. Recombinant tumor necrosis factor (TNF) and interleukin 1 (IL-1) are among the mediators capable of invoking radioprotection or resistance to the consequences of cecal ligation and puncture. Both cytokines are potent inducers of serum colony-stimulating factor (CSF) in C3H/HeJ mice (low responders to endotoxin). The number of splenic granulocyte-macrophage precursors was found to increase 5 days after injectionmore » of TNF in these mice. Although with IL-1 no increase in the number of granulocyte-macrophage colonies occurred in culture in the presence of serum CSF, a marked stimulation was observed when TNF was added. This stimulation of myelopoiesis observed in vivo and in vitro may be related to the radioprotective effect of TNF. The data presented suggest that TNF and IL-1 released after injection of endotoxin participate in the mediation of endotoxin-induced enhancement of nonspecific resistance and stimulation of hematopoiesis. 76 references.« less

  3. Interleukin-Encoding Adenoviral Vectors as Genetic Adjuvant for Vaccination against Retroviral Infection

    PubMed Central

    Ohs, Inga; Windmann, Sonja; Wildner, Oliver; Dittmer, Ulf; Bayer, Wibke

    2013-01-01

    Interleukins (IL) are cytokines with stimulatory and modulatory functions in the immune system. In this study, we have chosen interleukins which are involved in the enhancement of TH2 responses and B cell functions to analyze their potential to improve a prophylactic adenovirus-based anti-retroviral vaccine with regard to antibody and virus-specific CD4+ T cell responses. Mice were vaccinated with an adenoviral vector which encodes and displays the Friend Virus (FV) surface envelope protein gp70 (Ad.pIXgp70) in combination with adenoviral vectors encoding the interleukins IL4, IL5, IL6, IL7 or IL23. Co-application of Ad.pIXgp70 with Ad.IL5, Ad.IL6 or Ad.IL23 resulted in improved protection with high control over FV-induced splenomegaly and reduced viral loads. Mice co-immunized with adenoviral vectors encoding IL5 or IL23 showed increased neutralizing antibody responses while mice co-immunized with Ad.IL6 or Ad.IL23 showed improved FV-specific CD4+ T cell responses compared to mice immunized with Ad.pIXgp70 alone. We show that the co-application of adenoviral vectors encoding specific interleukins is suitable to improve the vaccination efficacy of an anti-retroviral vaccine. Improved protection correlated with improved CD4+ T cell responses and especially with higher neutralizing antibody titers. The co-application of selected interleukin-encoding adenoviral vectors is a valuable tool for vaccination with regard to enhancement of antibody mediated immunity. PMID:24349306

  4. Generation of TNFalpha and interleukin-6 by peritoneal macrophages after overnight dwells with bicarbonate- or lactate-buffered dialysis fluid.

    PubMed

    Liberek, Tomasz; Lichodziejewska-Niemierko, Monika; Knopinska-Posluszny, Wanda; Schaub, Thomas P; Kirchgessner, Judith; Passlick-Deetjen, Jutta; Rutkowski, Boleslaw

    2002-01-01

    In order to evaluate the biocompatibility profile of a newly designed peritoneal dialysis fluid (PDF), we evaluated peritoneal leukocyte (PMphi) cytokine release following overnight in vivo dwells using standard, lactate-buffered, single-chamber bag PDF (Lac-PDF) and purely bicarbonate-buffered, double-chamber bag PDF containing 34 (Bic-PDF) or 39 (Bic Hi-PDF) mmol/L bicarbonate. A randomized, open, crossover clinical trial with single weekly test dwells was performed in stable, long-term continuous ambulatory PD patients (n = 8). During 8-hour overnight dwells, PMphi were exposed to different PDF containing 1.5% glucose. After drainage, peritoneal cells were isolated and incubated with RPMI 1640 medium for 2 or 3 hours, with and without stimulation by lipopolysaccharide (LPS). Ex vivo release of tumor necrosis factor (TNF)-alpha and interleukin (IL)-6 was measured by specific ELISA technique. After pre-exposure to Lac-PDF, PMphi generated 242 +/- 279 pg TNFalpha/10(6) cells and 157 +/- 105 pg IL-6/10(6) cells. When pre-exposed to Bic-PDF and Bic Hi-PDF, TNFa and IL-6 production of PMphi was not significantly different from Lac-PDF. After LPS stimulation (100 ng/mL), PMD secretion of TNFalpha and IL-6 pre-exposed to three PDF revealed no significant differences between groups: TNFalpha was 2,864 +/- 1,216, 2,910 +/- 1,202, and 3,291 +/- 558 pg/10(6) cells after overnight dwells with Lac-PDF, Bic-PDF, and Bic Hi-PDF, respectively. Comparably, LPS-stimulated (100 pg/ mL) PMphi showed IL-6 secretion of 891 +/- 335, 1,380 +/- 1,149, and 1,442 +/- 966 pg/10(6) cells for Lac-PDF, Bic-PDF, and Bic Hi-PDF. After long-term overnight dwells, initial pH, the different buffers, and varying glucose degradation product levels of PDF do not strongly affect PMphi function with respect to cytokine release. The lack of significant differences between fluids may result from the complete dialysate equilibration achieved during the overnight intraperitoneal dwell.

  5. [Influence of low frequency magnetic field used in magnetotherapy on interleukin 6 (IL-6) contents in rat heart and brain].

    PubMed

    Ciejka, Elżbieta; Skibska, Beata; Gorąca, Anna

    2017-06-27

    The human population is exposed ever more frequently to magnetic fields (MF). This is due to both technological progress and development of the economy as well as to advances made in medical science. That is why the thorough understanding and systematized knowledge about mechanisms by which MF exerts its effects on living organisms play such an important role. In this context the health of MF-exposed people is the subject of particular concern. The aim of the study was to evaluate the effect of extremely low frequency magnetic field (ELFMF) used in magnetotherapy on the concentration of interleukin 6 (IL-6) in rat heart and brain. The male rats were randomly divided into 3 experimental groups: group I - control, without contact with magnetic field; group II - exposed to bipolar, rectangular magnetic field 40 Hz, induction "peak-to-peak" 7 mT 30 min/day for 2 weeks; and group III - exposed to bipolar, rectangular magnetic field 40 Hz, 7 mT 60 min/day for 2 weeks. Concentration of IL-6 in the heart and brain of animals was measured after MF exposure. Exposure to ELFMF: 40 Hz, induction "peak-to-peak" 7 mT 30 min/day for 2 weeks caused a significant IL-6 increase in rat hearts compared to the control group (p < 0.05) and a non-significant IL-6 decrease in rat brain. The magnetic field applied for 60 min resulted in non-significant IL-6 increase in rat hearts compared to the control group and significant IL-6 decrease in rat brain (p < 0.05). The influence of magnetic field on inflammation in the body varies depending on the MF parameters and the affected tissues or cells. Med Pr 2017;68(4):517-523. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.

  6. Development and validation of panoptic Meso scale discovery assay to quantify total systemic interleukin-6

    PubMed Central

    Chaturvedi, Shalini; Siegel, Derick; Wagner, Carrie L; Park, Jaehong; van de Velde, Helgi; Vermeulen, Jessica; Fung, Man-Cheong; Reddy, Manjula; Hall, Brett; Sasser, Kate

    2015-01-01

    Aim Interleukin-6 (IL-6), a multifunctional cytokine, exists in several forms ranging from a low molecular weight (MW 20–30 kDa) non-complexed form to high MW (200–450 kDa), complexes. Accurate baseline IL-6 assessment is pivotal to understand clinical responses to IL-6-targeted treatments. Existing assays measure only the low MW, non-complexed IL-6 form. The present work aimed to develop a validated assay to measure accurately total IL-6 (complexed and non-complexed) in serum or plasma as matrix in a high throughput and easily standardized format for clinical testing. Methods Commercial capture and detection antibodies were screened against humanized IL-6 and evaluated in an enzyme-linked immunosorbent assay format. The best antibody combinations were screened to identify an antibody pair that gave minimum background and maximum recovery of IL-6 in the presence of 100% serum matrix. A plate-based total IL-6 assay was developed and transferred to the Meso Scale Discovery (MSD) platform for large scale clinical testing. Results The top-performing antibody pair from 36 capture and four detection candidates was validated on the MSD platform. The lower limit of quantification in human serum samples (n = 6) was 9.77 pg l–1, recovery ranged from 93.13–113.27%, the overall pooled coefficients of variation were 20.12% (inter-assay) and 8.67% (intra-assay). High MW forms of IL-6, in size fractionated serum samples from myelodysplastic syndrome and rheumatoid arthritis patients, were detected by the assay but not by a commercial kit. Conclusion This novel panoptic (sees all forms) IL-6 MSD assay that measures both high and low MW forms may have clinical utility. PMID:25847183

  7. The interleukin-6-572G/C gene polymorphism and the risk of intracranial aneurysms in a Chinese population.

    PubMed

    Liu, Yi; Sun, Jidong; Wu, Cong; Cao, Xudong; He, Min; You, Chao

    2012-07-01

    Interleukin-6 (IL-6) is an important proinflammatory cytokine that plays an important role in the pathogenesis of intracranial aneurysms (IAs). The aim of this study was to investigate the association between the IL-6-572G/C polymorphism and the risk of IAs in a Chinese population. The IL-6-572G/C gene polymorphisms in 220 IA cases and 220 controls were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. The IL-6-572GG (odds ratio [OR]=3.35, 95% confidence intervals [CIs]=1.65, 6.82; p=0.001) and G allele frequencies (OR=1.48, 95% CIs=1.09, 2.00; p=0.01) in the IA group were higher than those in the control group. The C allele frequencies (OR=0.68, 95% CIs=0.50, 0.92; p=0.01) were significantly lower in patients than in controls. When stratified by the site, shape, size, and the Fisher Grade of IAs, no statistically significant result was observed. This study suggested that the IL-6-572GG genotype was associated with a higher risk of IA in a Chinese population.

  8. Antagonistic effect of disulfide-rich peptide aptamers selected by cDNA display on interleukin-6-dependent cell proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nemoto, Naoto, E-mail: nemoto@fms.saitama-u.ac.jp; Innovation Center for Startups, National Institute of Advanced Industrial Science and Technology, 2-2-2 Marunouchi, Chiyoda-ku, Tokyo 100-0005; Janusys Corporation, 508, Saitama Industrial Technology Center, Skip City, 3-12-18 Kami-Aoki, Kawaguchi, Saitama 333-0844

    2012-04-27

    Highlights: Black-Right-Pointing-Pointer Disulfide-rich peptide aptamer inhibits IL-6-dependent cell proliferation. Black-Right-Pointing-Pointer Disulfide bond of peptide aptamer is essential for its affinity to IL-6R. Black-Right-Pointing-Pointer Inhibitory effect of peptide depends on number and pattern of its disulfide bonds. -- Abstract: Several engineered protein scaffolds have been developed recently to circumvent particular disadvantages of antibodies such as their large size and complex composition, low stability, and high production costs. We previously identified peptide aptamers containing one or two disulfide-bonds as an alternative ligand to the interleukin-6 receptor (IL-6R). Peptide aptamers (32 amino acids in length) were screened from a random peptide library bymore » in vitro peptide selection using the evolutionary molecular engineering method 'cDNA display'. In this report, the antagonistic activity of the peptide aptamers were examined by an in vitro competition enzyme-linked immunosorbent assay (ELISA) and an IL-6-dependent cell proliferation assay. The results revealed that a disulfide-rich peptide aptamer inhibited IL-6-dependent cell proliferation with similar efficacy to an anti-IL-6R monoclonal antibody.« less

  9. Toll-like receptor 4 and myeloid differentiation factor 88 provide mechanistic insights into the cause and effects of interleukin-6 activation in mouse liver regeneration.

    PubMed

    Vaquero, Javier; Campbell, Jean S; Haque, Jamil; McMahan, Ryan S; Riehle, Kimberly J; Bauer, Renay L; Fausto, Nelson

    2011-08-01

    Partial hepatectomy (PH) consistently results in an early increase of circulating interleukin-6 (IL-6), which is thought to play a major role in liver regeneration. Activation of this cytokine after PH requires the adaptor protein, MyD88, but the specific MyD88-related receptors involved remain unidentified. It is also unknown whether the magnitude of IL-6 elevation determines the extent of subsequent hepatocyte proliferation. Here, we uncovered artifacts in the assessment of circulating IL-6 levels when using cardiac puncture in mice after PH. By using retro-orbital bleed sampling, we show that the circulating levels of IL-6 after PH were not directly correlated with the extent of hepatocyte DNA synthesis in individual mice. The IL-6 increase after PH was attenuated in all lipopolysaccharide-hyporesponsive mouse strains studied (e.g., C3H/HeJ, Tlr4 null, Cd14 null, Tlr2,4,9 null, and Tlr2,4-Caspase1 null) and was severely abrogated in Myd88 null mice. Despite attenuated IL-6 levels, Tlr4 null mice showed normal signaling downstream of IL-6 and normal hepatocyte proliferation. In contrast, Myd88 null mice showed severe impairments in signal transducer and activator of transcription 3 phosphorylation and Socs3 induction, but had enhanced and prolonged extracellular signal-related kinase 1 and 2 phosphorylation in the first 6 hours after PH. Unexpectedly, these changes were associated with accelerated initiation of hepatocyte proliferation, as assessed by hepatocyte bromodeoxyuridine incorporation, phospho-histone H3 immunostaining, and cyclin E and A protein expression. TLR-4 signaling contributes to IL-6 activation after PH, but the Tlr4-independent component appears sufficient for ensuring intact signaling downstream of IL-6. The lack of correlation between IL-6 levels and hepatocyte proliferation after PH, and the accelerated start of hepatocyte proliferation in Myd88 null mice despite abrogated cytokine activation, may highlight relevant antiproliferative

  10. Thalidomide reduces tumour necrosis factor alpha and interleukin 12 production in patients with chronic active Crohn's disease.

    PubMed

    Bauditz, J; Wedel, S; Lochs, H

    2002-02-01

    Thalidomide improves clinical symptoms in patients with therapy refractory Crohn's disease, as shown in two recent studies. The mechanism of this effect however is still unknown. Suppression of tumour necrosis factor alpha (TNF-alpha) by thalidomide has been suggested as a possible mechanism. However, effects on other cytokines have not been adequately investigated. The aim of our study was to investigate the effects of thalidomide on cytokine production in patients with inflammatory bowel disease (IBD). Ten patients with therapy refractory IBD (nine Crohn's disease, one ulcerative colitis) received thalidomide 300 mg daily in a 12 week open label study. Production of TNF-alpha, interleukin (IL)-1 beta, IL-6, and IL-12 was investigated in short term cultures of stimulated colonic lamina propria mononuclear cells (LPMC) and peripheral blood monocytes (PBMC) before and after 12 weeks of treatment. LPMC were also cultured with graded doses of thalidomide. Three patients discontinued treatment because of sedative side effects. In the other patients, disease activity decreased significantly, with four patients achieving remission. Production of TNF-alpha and IL-12 decreased during treatment with thalidomide: LPMC (TNF-alpha: 42.3 (8.3) pg/ml v 16.4 (6.3); IL-12: 9.7 (3.3) v 5.0 (2.5); p<0.04) and PBMC (TNF-alpha: 62.8 (14.6) v 22.5 (9.2); p<0.02). Production of IL-1 beta and IL-6 did not change significantly. Culturing of LPMC with thalidomide showed a dose dependent decrease in TNF-alpha and IL-12 production. The clinical effects of thalidomide in Crohn's disease may be mediated by reduction of both TNF-alpha and IL-12.

  11. The combination effects of licl and the active leflunomide metabolite, A771726, on viral-induced interleukin 6 production and EV-A71 replication.

    PubMed

    Hung, Hui-Chen; Shih, Shin-Ru; Chang, Teng-Yuan; Fang, Ming-Yu; Hsu, John T-A

    2014-01-01

    Enterovirus 71 (EV-A71) is a neurotropic virus that can cause severe complications involving the central nervous system. No effective antiviral therapeutics are available for treating EV-A71 infection and drug discovery efforts are rarely focused to target this disease. Thus, the main goal of this study was to discover existing drugs with novel indications that may effectively inhibit EV-A71 replication and the inflammatory cytokines elevation. In this study, we showed that LiCl, a GSK3β inhibitor, effectively suppressed EV-A71 replication, apoptosis and inflammatory cytokines production (Interleukin 6, Interleukin-1β) in infected cells. Furthermore, LiCl and an immunomodular agent were shown to strongly synergize with each other in suppressing EV-A71 replication. The results highlighted potential new treatment regimens in suppressing sequelae caused by EV-A71 replication.

  12. Coal-induced interleukin-6 gene expression is mediated through ERKs and p38 MAPK pathways.

    PubMed

    Huang, X; Zhang, Q

    2003-08-15

    In the present study, we have tested the ability of coal dust to stimulate kinase phosphorylation of activator protein-1 (AP-1) signal transduction pathways and production of interleukin-6 (IL-6) in both mouse epidermal JB6 and human lung epithelial A549 cells. Seven coal samples from three coalmine regions of Pennsylvania (PA), West Virginia (WV), and Utah (UT) with high, medium, and low prevalence of coal workers' pneumoconiosis (CWP), respectively, were investigated. Results from the present study indicate that three PA coals stimulated the mitogen-activated protein kinase (MAPK) family of extracellular signal-regulated kinases (ERKs) and p38 MAPK, but not c-Jun-NH2-terminal kinases (JNKs) in human lung A549 cells. The effects of three UT coals on the kinase phosphorylation were less as compared to those of the PA coals. Coal dusts from three coalmine regions induced IL-6 in a dose-dependent manner in both JB6 and A549 cells. Interestingly, levels of IL-6 in both cells treated with coals from three coalmine regions correlated well with CWP prevalence from that region. To assess the role of AP-1 pathways in coal-mediated transcriptional activation of IL-6, various inhibitors were used in cells treated with one PA coal, which induced a maximal response. It was found that the increase in IL-6 protein and mRNA by the PA coal was completely eliminated by the pretreatment of both cell types with PD98059, a specific MEK1 inhibitor, and SB202190, a p38 kinase inhibitor. Our results indicate that coal dust can stimulate IL-6 release from mouse epidermal JB6 cells and human lung epithelial A549 cells, and the coal-induced IL-6 increase may involve ERKs and p38 MAPK pathways.

  13. Soluble tumour necrosis factor-alpha receptor I and interleukin-6 as markers of activity in thyrotoxic Graves' disease.

    PubMed

    Pichler, R; Maschek, W; Hatzl-Griesenhofer, M; Huber, H; Crespillo-Gómez, C; Berg, J

    2003-07-01

    Autoimmune thyroid diseases are thought to be mediated by pro-inflammatory cytokines such as TNFalpha and IL-6. Serum levels of cytokines may indicate activity levels of immune functions. We investigated serum levels of IL-6 and of the soluble receptor of TNFalpha in patients with newly diagnosed onset of Graves' hyperthyroidism. The predominantly female group consisted of 39 patients, mean fT4 was 47.6 pg/ml (normal values 7.5=19.0 pg/ml). After diagnosis, all patients were treated with anti-thyroid drugs. Soluble Tumour Necrosis Factor Receptor I (TNF-RI) serum levels were found significantly increased (mean 3.7+/-1.3 ng/ml; p<0,01) compared to a matched group of apparent healthy individuals (mean sTNF-RI 1.8+/-0.5 ng/ml) and to a matched group of patients with treated Graves' disease (mean sTNF-RI 1.9+/-0.6 ng/ml). When IL-6 was assessed only 4 of the 39 patients exhibited increased serum levels. Our finding may indicate that sTNF-RI and possibly its ligand, TNFalpha, could play an important role in the onset of the acute stage of Graves' disease.

  14. Effect of azithromycin on Prevotella intermedia lipopolysaccharide-induced production of interleukin-6 in murine macrophages.

    PubMed

    Choi, Eun-Young; Jin, Ji-Young; Choi, Jeom-Il; Choi, In Soon; Kim, Sung-Jo

    2014-04-15

    Interleukin-6 (IL-6) is a key proinflammatory cytokine which plays a central role in the pathogenesis of periodontal disease. Host modulatory agents targeting at inhibiting IL-6, therefore, appear to be beneficial in slowing the progression of periodontal disease and potentially reducing destructive aspects of the host response. The present study was designed to investigate the effect of the macrolide antibiotic azithromycin on IL-6 generation in murine macrophages treated with lipopolysaccharide (LPS) from Prevotella intermedia, a pathogen implicated in inflammatory periodontal disease, and its mechanisms of action. Azithromycin significantly suppressed IL-6 production as well as its mRNA expression in P. intermedia LPS-activated RAW264.7 cells. LPS-induced activation of JNK and p38 was not affected by azithromycin treatment. Azithromycin failed to prevent P. intermedia LPS from degrading IκB-α. Instead, azithromycin significantly diminished nuclear translocation and DNA binding activity of NF-κB p50 subunit induced with LPS. Azithromycin inhibited P. intermedia LPS-induced STAT1 and STAT3 phosphorylation. In addition, azithromycin up-regulated the mRNA level of SOCS1 in cells treated with LPS. In conclusion, azithromycin significantly attenuated P. intermedia LPS-induced production of IL-6 in murine macrophages via inhibition of NF-κB, STAT1 and STAT3 activation, which is possibly related to the activation of SOCS1 signaling. Further in vivo studies are required to better evaluate the potential of azithromycin in the treatment of periodontal disease. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Interleukins for the paediatric pulmonologist.

    PubMed

    Rozycki, Henry J; Zhao, Wei

    2014-03-01

    Interleukins are critical immune modulators and since their first description in 1977, there has been a steady increase in the recognition of their roles in many paediatric respiratory diseases. This basic and clinical knowledge is now maturing into both approved and investigational therapies aimed at blocking or modifying the interleukin response. The purpose of this review is to bring up to date what is known about interleukin function in paediatric pulmonology, focusing on nine important lung conditions. This is followed by summaries about 18 interleukins which have been associated with these paediatric pulmonary conditions. Throughout, emphasis is placed on where interventions have been tested. Over the next several years, it is likely that many more treatments based on interleukin biology and function will become available and understanding the basis for these therapies will allow the practicing paediatric pulmonologist to take appropriate advantage of them. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Blockade of interleukin-6 signalling with siltuximab enhances melphalan cytotoxicity in preclinical models of multiple myeloma.

    PubMed

    Hunsucker, Sally A; Magarotto, Valeria; Kuhn, Deborah J; Kornblau, Steven M; Wang, Michael; Weber, Donna M; Thomas, Sheeba K; Shah, Jatin J; Voorhees, Peter M; Xie, Hong; Cornfeld, Mark; Nemeth, Jeffrey A; Orlowski, Robert Z

    2011-03-01

    Signalling through the interleukin (IL)-6 pathway induces proliferation and drug resistance of multiple myeloma cells. We therefore sought to determine whether the IL-6-neutralizing monoclonal antibody siltuximab, formerly CNTO 328, could enhance the activity of melphalan, and to examine some of the mechanisms underlying this interaction. Siltuximab increased the cytotoxicity of melphalan in KAS-6/1, INA-6, ANBL-6, and RPMI 8226 human myeloma cell lines (HMCLs) in an additive-to-synergistic manner, and sensitized resistant RPMI 8226.LR5 cells to melphalan. These anti-proliferative effects were accompanied by enhanced activation of drug-specific apoptosis in HMCLs grown in suspension, and in HMCLs co-cultured with a human-derived stromal cell line. Siltuximab with melphalan enhanced activation of caspase-8, caspase-9, and the downstream effector caspase-3 compared with either of the single agents. This increased induction of cell death occurred in association with enhanced Bak activation. Neutralization of IL-6 also suppressed signalling through the phosphoinositide 3-kinase/Akt pathway, as evidenced by decreased phosphorylation of Akt, p70 S6 kinase and 4E-BP1. Importantly, the siltuximab/melphalan regimen demonstrated enhanced anti-proliferative effects against primary plasma cells derived from patients with myeloma, monoclonal gammopathy of undetermined significance, and amyloidosis. These studies provide a rationale for translation of siltuximab into the clinic in combination with melphalan-based therapies. © 2011 Blackwell Publishing Ltd.

  17. Hyperthermia increases interleukin-6 in mouse skeletal muscle

    PubMed Central

    Welc, Steven S.; Phillips, Neil A.; Oca-Cossio, Jose; Wallet, Shannon M.; Chen, Daniel L.

    2012-01-01

    Skeletal muscles produce and contribute to circulating levels of IL-6 during exercise. However, when core temperature is reduced, the response is attenuated. Therefore, we hypothesized that hyperthermia may be an important and independent stimulus for muscle IL-6. In cultured C2C12 myotubes, hyperthermia (42°C) increased IL-6 gene expression 14-fold after 1 h and 35-fold after 5 h of 37°C recovery; whereas exposure to 41°C resulted in a 2.6-fold elevation at 1 h. IL-6 protein was secreted and significantly elevated in the cell supernatant. Similar but reduced responses to heat were seen in C2C12 myoblasts. Isolated soleus muscles from mice, exposed ex vivo to 41°C for 1 h, yielded similar IL-6 gene responses (>3-fold) but without a significant effect on protein release. When whole animals were exposed to passive hyperthermia, such that core temperature increased to 42.4°C, IL-6 mRNA in soleus increased 5.4-fold compared with time matched controls. Interestingly, TNF-α gene expression was routinely suppressed at all levels of hyperthermia (40.5–42°C) in the isolated models, but TNF-α was elevated (4.2-fold) in the soleus taken from intact mice exposed, in vivo, to hyperthermia. Muscle HSP72 mRNA increased as a function of the level of hyperthermia, and IL-6 mRNA responses increased proportionally with HSP72. In cultured C2C12 myotubes, when heat shock factor was pharmacologically blocked with KNK437, both HSP72 and IL-6 mRNA elevations, induced by heat, were suppressed. These findings implicate skeletal muscle as a “heat stress sensor” at physiologically relevant hyperthermia, responding with a programmed cytokine expression pattern characterized by elevated IL-6. PMID:22673618

  18. Meprin metalloproteases inactivate interleukin 6.

    PubMed

    Keiffer, Timothy R; Bond, Judith S

    2014-03-14

    Meprins have been implicated in the pathogenesis of several inflammatory diseases, including inflammatory bowel disease, in which the cytokine IL-6 is a prominent effector molecule. Because IL-6 levels are elevated markedly in meprin α and α/β knockout mice in an experimental model of inflammatory bowel disease, the interaction between meprins and IL-6 was studied. The results demonstrate that rodent and human meprin A and B cleave IL-6 to a smaller product and, subsequently, are capable of extensive degradation of the cytokine. Analysis of the limited degradation product formed by meprin A indicated that three to five amino acids are removed from the C terminus of the cytokine. Meprin A and meprin B cleaved IL-6 with micromolar affinities (Km of 4.7 and 12.0 μM, respectively) and with high efficiencies (kcat/Km of 0.2 and 2.5 (M(-1)/s(-1)) × 10(6), respectively). These efficiency constants are among the highest for known meprin substrates. Madin-Darby canine kidney cells transiently transfected with meprin α or meprin β constructs also cleave exogenous IL-6. Both human and murine IL-6 cleaved by meprin A or B are inactivated, as demonstrated by their decreased capability to stimulate proliferation of B9 cells. These results are consistent with the proposition that one function of meprin metalloproteases is to modulate inflammation by inactivating IL-6.

  19. Detection and characterization of interleukin-6 gene variants in Canis familiaris: association studies with periodontal disease.

    PubMed

    Morinha, Francisco; Albuquerque, Carlos; Requicha, João; Dias, Isabel; Leitão, José; Gut, Ivo; Guedes-Pinto, Henrique; Viegas, Carlos; Bastos, Estela

    2011-10-10

    Periodontal disease (PD) is the most common inflammatory disease of the oral cavity of domestic carnivores. In Human Medicine molecular genetics research showed that several genes play a role in the predisposition and progression of this complex disease, primarily through the regulation of inflammatory mediators, but the exactly mechanisms are poorly understood. This study aims to contribute to the characterization of the genetic basis of PD in the dog, a classically accepted model in Periodontology. We searched for genetic variations in the interleukin-6 (IL6) gene, in order to verify its association with PD in a case-control study including 25 dogs in the PD case group and 45 dogs in the control group. We indentified and characterized three new genetic variations in IL6 gene. No statistically significant differences were detected between the control and PD cases groups. Our results do not support an evidence for a major role contribution of these variants in the susceptibility to PD in the analyzed population. Nevertheless, the sequence variant I/5_g.105G>A leads to an amino acid change (arginine to glutamine) and was predicted to be possibly damaging to the IL6 protein. A larger cohort and functional studies would be of extreme importance in a near future to understand the possible role of IL6 variants in this disease. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Association Between Interleukin-6 and Striatal Prediction-Error Signals Following Acute Stress in Healthy Female Participants.

    PubMed

    Treadway, Michael T; Admon, Roee; Arulpragasam, Amanda R; Mehta, Malavika; Douglas, Samuel; Vitaliano, Gordana; Olson, David P; Cooper, Jessica A; Pizzagalli, Diego A

    2017-10-15

    Stress is widely known to alter behavioral responses to rewards and punishments. It is believed that stress may precipitate these changes through modulation of corticostriatal circuitry involved in reinforcement learning and motivation, although the intervening mechanisms remain unclear. One candidate is inflammation, which can rapidly increase following stress and can disrupt dopamine-dependent reward pathways. Here, in a sample of 88 healthy female participants, we first assessed the effect of an acute laboratory stress paradigm on levels of plasma interleukin-6 (IL-6), a cytokine known to be both responsive to stress and elevated in depression. In a second laboratory session, we examined the effects of a second laboratory stress paradigm on reward prediction error (RPE) signaling in the ventral striatum. We show that individual differences in stress-induced increases in IL-6 (session 1) were associated with decreased ventral striatal RPE signaling during reinforcement learning (session 2), though there was no main effect of stress on RPE. Furthermore, changes in IL-6 following stress predicted intraindividual variability in perceived stress during a 4-month follow-up period. Taken together, these data identify a novel link between IL-6 and striatal RPEs during reinforcement learning in the context of acute psychological stress, as well as future appraisal of stressful life events. Copyright © 2017 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  1. Pleiotropic effects of interleukin-6 in a "two-hit" murine model of acute respiratory distress syndrome.

    PubMed

    Goldman, Julia L; Sammani, Saad; Kempf, Carrie; Saadat, Laleh; Letsiou, Eleftheria; Wang, Ting; Moreno-Vinasco, Liliana; Rizzo, Alicia N; Fortman, Jeffrey D; Garcia, Joe G N

    2014-06-01

    Patients with acute respiratory distress syndrome (ARDS) exhibit elevated levels of interleukin-6 (IL-6), which correlate with increased morbidity and mortality. The exact role of IL-6 in ARDS has proven difficult to study because it exhibits either pro- or anti-inflammatory actions in mouse models of lung injury, depending on the model utilized. In order to improve understanding of the role of this complex cytokine in ARDS, we evaluated IL-6 using the clinically relevant combination of lipopolysaccharide (LPS) and ventilator-induced lung injury (VILI) in IL-6(-/-) mice. Bronchoalveolar lavage fluid (BAL), whole-lung tissue, and histology were evaluated for inflammatory markers of injury. Transendothelial electrical resistance was used to evaluate the action of IL-6 on endothelial cells in vitro. In wild-type mice, the combination model showed a significant increase in lung injury compared to either LPS or VILI alone. IL-6(-/-) mice exhibited a statistically significant decrease in BAL cellular inflammation as well as lower histologic scores for lung injury, changes observed only in the combination model. A paradoxical increase in BAL total protein was observed in IL-6(-/-) mice exposed to LPS, suggesting that IL-6 provides protection from vascular leakage. However, in vitro data showed that IL-6, when combined with its soluble receptor, actually caused a significant increase in endothelial cell permeability, suggesting that the protection seen in vivo was likely due to complex interactions of IL-6 and other inflammatory mediators rather than to direct effects of IL-6. These studies suggest that a dual-injury model exhibits utility in evaluating the pleiotropic effects of IL-6 in ARDS on inflammatory cells and lung endothelium.

  2. Impact of an exercise program on muscular and functional performance and plasma levels of interleukin 6 and soluble receptor tumor necrosis factor in prefrail community-dwelling older women: a randomized controlled trial.

    PubMed

    Lustosa, Lygia Paccini; Máximo Pereira, Leani Souza; Coelho, Fernanda Matos; Pereira, Daniele Sirineu; Silva, Juscélio Pereira; Parentoni, Adriana Netto; Dias, Rosângela Correa; Domingues Dias, João Marcos

    2013-04-01

    To examine the impact of a muscle resistance program (MRP) on muscular and functional performance and on interleukin 6 (IL-6) and soluble tumor necrosis factor receptor-1 (sTNFr1) plasma levels in prefrail community-dwelling women. Randomized controlled trial crossover design with a postintervention and short-term follow-up. University hospital. Prefrail community-dwelling women (N=32; ≥65y). The MRP was designed based on the exercise at 75% of each participant's maximum load (10wk, 3 times/wk). Plasma concentrations of IL-6 and sTNFr1 (high-sensitivity enzyme-linked immunosorbent assay kits), muscle strength of the knee extensors (isokinetic), and functional performance (Timed Up & Go [TUG] test and 10-meter walk test [10MWT]). There were significant differences in functional and muscular performance between the pre-MRP, post-MRP, and 10-week follow-up period. After the MRP, both functional (TUG, pre-MRP=11.1s vs post-MRP=10.4s, P=.00; 10MWT, pre-MRP=4.9s vs post-MRP, 4.4s, P=.00) and muscular performances (pre-MRP=77.8% and post-MRP=83.1%, P=.02) improved. After cessation of the MRP (follow-up period), sTNFr1 plasma levels increased by 21.4% at 10-week follow-up (post-MRP, 406.4pg/mL; 10-week follow-up, 517.0pg/mL; P=.03). There were significant differences in sTNFr1 (P=.01). The MRP was effective in improving functional and muscular performances, although alterations in plasma levels of IL-6 and sTNFr1 could not be identified after the MRP. Cessation of the MRP after 10 weeks resulted in increased plasma levels of sTNFr1. Copyright © 2013 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  3. Interleukin-6 from subchondral bone mesenchymal stem cells contributes to the pathological phenotypes of experimental osteoarthritis

    PubMed Central

    Wu, Xiaofeng; Cao, Lei; Li, Fan; Ma, Chao; Liu, Guangwang; Wang, Qiugen

    2018-01-01

    As a main cause of morbidity in the aged population, osteoarthritis (OA) is characterized by cartilage destruction, synovium inflammation, osteophytes, and subchondral bone sclerosis. To date its etiology remains elusive. Recent data highlight an important role of subchondral bone in the onset and progression of OA. Therefore, elucidating the mechanisms underlying abnormal subchondral bone could be of importance in the treatment of OA. Interleukin-6 is a proinflammatory cytokine involved in many physiological and pathological processes. Although in vitro and in vivo studies have indicated that IL-6 is an important cytokine in the physiopathogenesis of OA, its effects on subchondral bone have not been studied in OA animal models. In this study, we aimed to i) investigate the role of IL-6 in the pathological phenotypes of OA subchondral bone MSCs including increase in cell numbers, mineralization disorder and abnormal type I collagen production; ii) explore whether the systemic blockade of IL-6 signaling could alleviate the pathological phenotypes of experimental OA. We found that IL-6 was over-secreted by OA subchondral bone MSCs compared with normal MSCs and IL-6/STAT3 signaling was over-activated in subchondral bone MSCs, which contributed to the pathological phenotypes of OA subchondral bone MSCs. More importantly, systemic inhibition of IL-6/STAT3 signaling with IL-6 antibody or STAT3 inhibitor AG490 decreased the severity of pathological phenotypes of OA subchondral bone MSCs and cartilage lesions in OA. Our findings provide strong evidence for a pivotal role for IL-6 signaling in OA and open up new therapeutic perspectives. PMID:29736207

  4. Hepatocyte growth factor modulates interleukin-6 production in bone marrow derived macrophages: implications for inflammatory mediated diseases.

    PubMed

    Coudriet, Gina M; He, Jing; Trucco, Massimo; Mars, Wendy M; Piganelli, Jon D

    2010-11-02

    The generation of the pro-inflammatory cytokines IL-6, TNF-α, and IL-1β fuel the acute phase response (APR). To maintain body homeostasis, the increase of inflammatory proteins is resolved by acute phase proteins via presently unknown mechanisms. Hepatocyte growth factor (HGF) is transcribed in response to IL-6. Since IL-6 production promotes the generation of HGF and induces the APR, we posited that accumulating HGF might be a likely candidate for quelling excess inflammation under non-pathological conditions. We sought to assess the role of HGF and how it influences the regulation of inflammation utilizing a well-defined model of inflammatory activation, lipopolysaccharide (LPS)-stimulation of bone marrow derived macrophages (BMM). BMM were isolated from C57BL6 mice and were stimulated with LPS in the presence or absence of HGF. When HGF was present, there was a decrease in production of the pro-inflammatory cytokine IL-6, along with an increase in the anti-inflammatory cytokine IL-10. Altered cytokine production correlated with an increase in phosphorylated GSK3β, increased retention of the phosphorylated NFκB p65 subunit in the cytoplasm, and an enhanced interaction between CBP and phospho-CREB. These changes were a direct result of signaling through the HGF receptor, MET, as effects were reversed in the presence of a selective inhibitor of MET (SU11274) or when using BMM from macrophage-specific conditional MET knockout mice. Combined, these data provide compelling evidence that under normal circumstances, HGF acts to suppress the inflammatory response.

  5. Young women post-MI have higher plasma concentrations of interleukin-6 before and after stress testing.

    PubMed

    Rooks, Cherie R; Ibeanu, Ijeoma; Shah, Amit; Pimple, Pratik; Murrah, Nancy; Shallenberger, Lucy; Pace, Thaddeus; Douglas Bremner, J; Raggi, Paolo; Vaccarino, Viola

    2016-01-01

    Young women have poorer prognosis after myocardial infarction (MI) and a higher rate of mental stress-induced ischemia compared with similarly aged men. A higher inflammatory status may help explain these sex differences. We examined 98 patients (49 women and 49 men) age 18-59years with recent MI (past 6months). Women and men were matched for age, type of MI, and time since MI. Interleukin 6 (IL-6) concentrations were measured at baseline, after mental stress using a speech task, and after exercise/pharmacologic stress (60 and 90min). Depressive symptoms were measured with the Beck Depression Inventory (BDI-II) and angiographic coronary artery disease (CAD) severity was quantified with the Gensini score. Single-photon emission computed tomography (SPECT) was used to obtain a computerized measurement of stress-induced ischemia (summed difference score, or SDS) and determine whether severity of stress-induced ischemia affects the inflammatory response to stress. Analysis was stratified by the median age of 50. Geometric mean concentrations of IL-6 were obtained from general linear regression models. In both age groups, women had less angiographic CAD and a similar level of conventional risk factors compared with men. Despite this, baseline IL-6 geometric means before both mental and physical stress were twice as high in women ⩽50years of age compared to age-matched men (3.8 vs. 1.8pg/mL, p=0.001, across both conditions), while they were similar in women and men age >50years (2.3 vs. 2.2pg/mL, p=0.83). After mental stress, IL-6 concentrations increased in both women and men in a similar fashion and remained twice as high in women ⩽50years than men at both 60min (5.4 vs. 2.6pg/mL, p=0.002) and 90min (5.9 vs. 3.4pg/mL, p=0.01). No significant difference was found between women and men >50years of age at any time point after mental stress. Results were similar for physical stress. After accounting for SDS, IL-6 concentrations in young women remained higher after both

  6. Serum levels of interleukin 6 in schizophrenic patients during treatment augmentation with sarcosine (results of the PULSAR study).

    PubMed

    Strzelecki, Dominik; Urban-Kowalczyk, Małgorzata; Wysokiński, Adam

    2018-03-01

    Augmentation of sarcosine, a natural inhibitor of the glycine transporter type I, normalizes glutamatergic neurotransmission, having beneficial impact on primary negative symptoms in schizophrenia and may also influence immune system and interleukin 6 (IL-6) levels. Finding a relationship between initial IL-6 serum concentrations or its changes and severity of symptoms as a result of sarcosine addition to stable antipsychotic treatment. Fifity-eight individuals with schizophrenia with predominantly negative symptoms completed a 6-month randomized, double-blind placebo-controlled prospective study. Patients received 2 g of sarcosine (n = 29) or placebo (n = 30) daily per os. We measured IL-6 levels and severity of symptoms at the beginning, after 6 weeks and 6 months. As main clinical tools, we used Positive and Negative Syndrome Scale (PANSS) and Calgary depression scale for schizophrenia (CDSS). Augmentation with sarcosine had no effect on IL-6 serum levels in all time points. We noted significant improvements in negative symptoms, general psychopathology, and total PANSS score in the sarcosine group. We found correlation of initial serum IL-6 with severity of positive symptoms and negative association between IL-6 levels reduction and positive symptoms reduction. Sarcosine does not significantly affect IL-6 concentrations but IL-6 may be involved in mechanisms related to the presence of positive symptoms. Copyright © 2018 John Wiley & Sons, Ltd.

  7. Expression of interleukin-6 by a recombinant rabies virus enhances its immunogenicity as a potential vaccine.

    PubMed

    Luo, Jun; Zhang, Boyue; Wu, Yuting; Tian, Qin; Zhao, Jing; Lyu, Ziyu; Zhang, Qiong; Mei, Mingzhu; Luo, Yongwen; Guo, Xiaofeng

    2017-02-07

    Several studies have confirmed that interleukin-6 (IL6) mediates multiple biological effects that enhance immune responses when used as an adjuvant. In the present study, recombinant rabies virus (RABV) expressing canine IL6 (rHEP-CaIL6) was rescued and its pathogenicity and immunogenicity were investigated in mice. We demonstrated that mice received a single intramuscular immunization with rHEP-CaIL6 showed an earlier increase and higher maximum titres of virus-neutralizing antibody (VNA) as well as anti-RABV antibodies compared with mice immunized with the parent strain. Moreover, survival rates of mice immunized with rHEP-CaIL6 were higher compared with mice immunized with parent HEP-Flury according to the challenge assay. Flow cytometry further confirmed that immunization with rHEP-CaIL6 induced the strong recruitment of mature B cells and CD8 + T cells to lymph nodes, which may partially explain the high levels of VNA and enhanced cellular immunity. Quantitative real-time PCR indicated that rHEP-CaIL6 induced stronger inflammatory and immune responses in the central nervous system, which might have allowed virus clearance in the early infection phase. Furthermore, mice infected intranasally with rHEP-CaIL6 developed no clinical symptoms while mice infected with HEP-Flury showed piloerection. In summary, these data indicate that rHEP-CaIL6 induces a strong, protective immune response with a good safety profile. Therefore, a recombinant RABV strain expressing canine IL6 may aid the development of an effective, safe attenuated rabies vaccine. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Inflammation and elevated levels of fibroblast growth factor 23 are independent risk factors for death in chronic kidney disease.

    PubMed

    Munoz Mendoza, Jair; Isakova, Tamara; Cai, Xuan; Bayes, Liz Y; Faul, Christian; Scialla, Julia J; Lash, James P; Chen, Jing; He, Jiang; Navaneethan, Sankar; Negrea, Lavinia; Rosas, Sylvia E; Kretzler, Matthias; Nessel, Lisa; Xie, Dawei; Anderson, Amanda Hyre; Raj, Dominic S; Wolf, Myles

    2017-03-01

    Inflammation is a consequence of chronic kidney disease (CKD) and is associated with adverse outcomes in many clinical settings. Inflammation stimulates production of fibroblast growth factor 23 (FGF23), high levels of which are independently associated with mortality in CKD. Few large-scale prospective studies have examined inflammation and mortality in patients with CKD, and none tested the interrelationships among inflammation, FGF23, and risk of death. Therefore, we conducted a prospective investigation of 3875 participants in the Chronic Renal Insufficiency Cohort (CRIC) study with CKD stages 2 to 4 to test the associations of baseline plasma interleukin-6, high-sensitivity C-reactive protein, and FGF23 levels with all-cause mortality, censoring at the onset of end-stage renal disease. During a median follow-up of 6.9 years, 550 participants died (20.5/1000 person-years) prior to end-stage renal disease. In separate multivariable-adjusted analyses, higher levels of interleukin-6 (hazard ratio per one standard deviation increase of natural log-transformed levels) 1.35 (95% confidence interval, 1.25-1.46), C-reactive protein 1.28 (1.16-1.40), and FGF23 1.45 (1.32-1.60) were each independently associated with increased risk of death. With further adjustment for FGF23, the risks of death associated with interleukin-6 and C-reactive protein were minimally attenuated. Compared to participants in the lowest quartiles of inflammation and FGF23, the multivariable-adjusted hazard ratio of death among those in the highest quartiles of both biomarkers was 4.38 (2.65-7.23) for interleukin-6 and FGF23, and 5.54 (3.04-10.09) for C-reactive protein and FGF23. Thus, elevated levels of interleukin-6, C-reactive protein, and FGF23 are independent risk factors for mortality in CKD. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  9. Effects of epidermal growth factor, interleukin 1 and nitric oxide on prostaglandin production by guinea-pig uterus.

    PubMed

    Keeble, J E; Poyser, N L

    2002-08-01

    Initial experiments in the present study investigated the effects of epidermal growth factor (EGF), interleukin 1beta (IL-1beta) and sodium nitroprusside (a nitric oxide donor) on the output of prostaglandins from guinea-pig uterus on day 7 of the oestrous cycle. Superfusion of day 7 guinea-pig uterus in vitro with either EGF or sodium nitroprusside increased the output of PGF(2alpha) and 6-keto-PGF(1alpha), but not of PGE(2). IL-1beta had no effect on the output of these three prostaglandins. EGF still increased the output of PGF(2alpha), but did not increase the output of 6-keto-PGF(1alpha) in a calcium-depleted superfusate. Subsequent experiments investigated the effect of sodium nitroprusside on contractile activity of day 7 guinea-pig uterus. Basal spontaneous activity of both the intact uterus and isolated myometrium superfused in vitro was low. Sodium nitroprusside increased the contractile activity of these tissues two- to fourfold. EGF did not affect the contractile activity of the uterus, indicating that sodium nitroprusside-induced contractions are not due to increased prostaglandin production. Overall, the findings indicate that EGF and nitric oxide may act as mediators in the mechanism by which oestradiol acting on a progesterone-primed uterus stimulates the increase in PGF(2alpha) production by the guinea-pig uterus necessary for luteolysis. Nitric oxide may increase the spontaneous activity of the uterus when this activity is low.

  10. Interleukin-6 promotes systemic lupus erythematosus progression with Treg suppression approach in a murine systemic lupus erythematosus model.

    PubMed

    Mao, Xiaoli; Wu, Yunyun; Diao, Huitian; Hao, Jianlei; Tian, Gaofei; Jia, Zhenghu; Li, Zheng; Xiong, Sidong; Wu, Zhenzhou; Wang, Puyue; Zhao, Liqing; Yin, Zhinan

    2014-11-01

    Our aim is to reveal the role of interleukin 6 (IL-6) in the pathogenesis of systemic lupus erythematosus (SLE) in a murine model of SLE. Normal female C57BL/6 mice were immunized with syngeneic-activated lymphocyte-derived DNA (ALD-DNA) to induce SLE. Non-immunized mice were used as control. SLE-associated markers, including anti-double-stranded DNA (anti-dsDNA) Abs, urine protein, and kidney histopathology, were assayed to ensure the induction of the disease. Compared with control mice, ALD-DNA immunized mice exhibited high levels of anti-dsDNA Abs, IL-6 expression in vivo and in vitro. We also found that IL-6 knockout (IL-6KO) mice were resistant to ALD-DNA-induced SLE. The activation of CD4(+) T cells in immunized IL-6KO mice was lower than in immunized wild-type (Wt) mice. Intracellular cytokine staining showed that Foxp3 expression in immunized IL-6KO mice was higher than in immunized Wt mice, which might be associated with the disease severity. We further discovered that ALD-DNA-stimulated dendritic cells supernatants could result in higher IL-6 and TNF-α expression and could suppress Foxp3 expression. In addition, blocking IL-6 could up-regulate Foxp3 expression. Therefore, our findings show that IL-6 promotes the progression of SLE via suppressing Treg differentiation.

  11. Sex difference in link between interleukin-6 and stress.

    PubMed

    Jankord, Ryan; Turk, James R; Schadt, James C; Casati, Jennifer; Ganjam, Venkataseshu K; Price, Elmer M; Keisler, Duane H; Laughlin, M Harold

    2007-08-01

    Inflammation contributes to disease development, and the neuroimmunoendocrine interface is a potential site of action for inflammatory products like IL-6 to affect health. Although plasma IL-6 can stimulate the activity of the hypothalamo-pituitary-adrenocortical (HPA) axis, the precise role, if any, for IL-6 in the HPA response to nonimmunological stressors is unclear. The purpose of this study was to test the hypothesis that IL-6 in the stalk median eminence (SME) can be directly involved in stimulating ACTH secretion in response to acute stress in female swine. This study was undertaken as a result of finding IL-6 localized to the external zone of the SME next to the hypophyseal portal vessels. Results indicate that content of IL-6 in the SME decreases in response to acute stress along with an increase in nuclear phosphorylated signal transducer and activator of transcription-3 (pSTAT-3) in pituitary corticotrophs and a simultaneous increase in plasma concentrations of IL-6 and ACTH. Furthermore, we show that females concomitantly display greater SME content of IL-6 and greater HPA responsiveness to stress, thereby suggesting that IL-6 release from the SME is an integral factor contributing to enhanced stress responsiveness in females. Our results provide evidence for a direct link between IL-6 and ACTH release and reveal a sex difference in this relationship.

  12. Interleukin-6 downregulated vascular smooth muscle cell contractile proteins via ATG4B-mediated autophagy in thoracic aortic dissection.

    PubMed

    An, Zhao; Qiao, Fan; Lu, Qijue; Ma, Ye; Liu, Yang; Lu, Fanglin; Xu, Zhiyun

    2017-12-01

    Interleukin-6 (IL-6) overexpression played an important role in the pathogenesis of thoracic aortic dissection (TAD). Our previous study found enhanced autophagy accompanying with contractile proteins α smooth muscle actin (α-SMA) and smooth muscle 22α (SM22α) degradation in TAD aortic vascular smooth muscle cells (VSMCs). Autophagy is an important way for intracellular proteins degradation, while IL-6 has been found as a contributing factor of autophagy in some cancers. These indicated IL-6 might contribute to the occurrence of TAD by promoting autophagy-induced contractile proteins degradation, which has not been investigated. The aim of the present study is to verify this hypothesis and investigate the mechanism of it. We collected 10 TAD and 10 control aortic specimens from patients underwent TAD surgical repair and coronary artery bypass grafting, respectively. Quantitative real-time polymerase chain reaction was used to detect mRNA expression. Protein expression level was assessed by enzyme-linked immunosorbent assay, western blot, and immunohistochemistry. Microtubule-associated protein 1 light chain 3 beta overexpression adenovirus with green and red fluorescent protein tags and transmission electron microscopy were used to detect autophagy level in VSMCs. 3-Methyladenine (3-MA) and chloroquine were used to block autophagy in human VSMCs. Experiment results showed that the expression of IL-6 was significantly increased accompanying with up-regulated autophagy in TAD aortic wall compared with controls. In vitro results showed that IL-6 stimulation decreased the expression of VSMCs contractile proteins α-SMA and SM22α accompanying with up-regulated autophagy. Blocking autophagy with 3-MA or chloroquine inhibited IL-6 induced α-SMA and SM22α degradation. Further investigation showed that autophagy-related 4B cysteine peptidase (ATG4B) was significantly overexpressed in TAD aortic wall and played important role in IL-6 induced autophagy up

  13. Interleukin-10 -1082 gene polymorphism and susceptibility to cervical cancer among Japanese women.

    PubMed

    Matsumoto, Koji; Oki, Akinori; Satoh, Toyomi; Okada, Satoshi; Minaguchi, Takeo; Onuki, Mamiko; Ochi, Hiroyuki; Nakao, Sari; Sakurai, Manabu; Abe, Azusa; Hamada, Hiromi; Yoshikawa, Hiroyuki

    2010-11-01

    Polymorphisms in cytokine genes can influence immune responses to human papillomavirus infection, possibly modifying risks of cervical cancer. Using an amplification refractory mutation system-polymerase chain reaction method, we analyzed a single nucleotide polymorphism (A/G) at position -1082 in interleukin-10 promoter region in 440 Japanese women: 173 women with normal cytology, 163 women with cervical intraepithelial neoplasia and 104 women with invasive cervical cancer. The carrier frequency of interleukin-10 -1082 G alleles associated with higher interleukin-10 production increased with disease severity: 9.8% for normal cytology; 19.6% for cervical intraepithelial neoplasia; 29.8% for invasive cervical cancer (P for trend < 0.001). Among cytologically normal women, human papillomavirus infections were more common in those who were positive for an interleukin-10 -1082 G allele (P = 0.04). In conclusion, our data suggest that interleukin-10 -1082 gene polymorphism may serve as a marker of genetic susceptibility to cervical cancer among Japanese women.

  14. Tumor necrosis factor -α, interleukin-10, intercellular and vascular adhesion molecules are possible biomarkers of disease severity in complicated Plasmodium vivax isolates from Pakistan.

    PubMed

    Raza, Afsheen; Ghanchi, Najia K; Sarwar Zubairi, Ali bin; Raheem, Ahmed; Nizami, Sobia; Beg, Mohammad Asim

    2013-01-01

    Cytokine-mediated endothelial activation pathway is a known mechanism of pathogenesis employed by Plasmodium falciparum to induce severe disease symptoms in human host. Though considered benign, complicated cases of Plasmodium vivax are being reported worldwide and from Pakistan. It has been hypothesized that P.vivax utilizes similar mechanism of pathogenesis, as that of P.falciparum for manifestations of severe malaria. Therefore, the main objective of this study was to characterize the role of cytokines and endothelial activation markers in complicated Plasmodium vivax isolates from Pakistan. A case control study using plasma samples from well-characterized groups suffering from P.vivax infection including uncomplicated cases (n=100), complicated cases (n=82) and healthy controls (n=100) were investigated. Base line levels of Tumor necrosis factor-α (TNF-α), Interleukin-6 (IL-6), Interleukin-10 (IL-10), Intercellular adhesion molecule-1 (ICAM-1), Vascular adhesion molecule-1(VCAM-1) and E-selectin were measured by ELISA. Correlation of cytokines and endothelial activation markers was done using Spearman's correlation analysis. Furthermore, significance of these biomarkers as indicators of disease severity was also analyzed. The results showed that TNF-α, IL-10, ICAM-1and VCAM-1 were 3-fold, 3.7 fold and 2 fold increased between uncomplicated and complicated cases. Comparison of healthy controls with uncomplicated cases showed no significant difference in TNF-α concentrations while IL-6, IL-10, ICAM-1, VCAM-1 and E-selectin were found to be elevated respectively. In addition, significant positive correlation was observed between TNF-α and IL-10/ ICAM-1, IL-6 and IL-10, ICAM-1 and VCAM-1.A Receiver operating curve (ROC) was generated which showed that TNF-α, IL-10, ICAM-1 and VCAM-1 were the best individual predictors of complicated P.vivax malaria. The results suggest that though endothelial adhesion molecules are inducible by pro-inflammatory cytokine TNF

  15. Neuronal NLRP1 inflammasome activation of Caspase-1 coordinately regulates inflammatory interleukin-1-beta production and axonal degeneration-associated Caspase-6 activation

    PubMed Central

    Kaushal, V; Dye, R; Pakavathkumar, P; Foveau, B; Flores, J; Hyman, B; Ghetti, B; Koller, B H; LeBlanc, A C

    2015-01-01

    Neuronal active Caspase-6 (Casp6) is associated with Alzheimer disease (AD), cognitive impairment, and axonal degeneration. Caspase-1 (Casp1) can activate Casp6 but the expression and functionality of Casp1-activating inflammasomes has not been well-defined in human neurons. Here, we show that primary cultures of human CNS neurons expressed functional Nod-like receptor protein 1 (NLRP1), absent in melanoma 2, and ICE protease activating factor, but not the NLRP3, inflammasome receptor components. NLRP1 neutralizing antibodies in a cell-free system, and NLRP1 siRNAs in neurons hampered stress-induced Casp1 activation. NLRP1 and Casp1 siRNAs also abolished stress-induced Casp6 activation in neurons. The functionality of the NLRP1 inflammasome in serum-deprived neurons was also demonstrated by NLRP1 siRNA-mediated inhibition of speck formation of the apoptosis-associated speck-like protein containing a caspase recruitment domain conjugated to green fluorescent protein. These results indicated a novel stress-induced intraneuronal NLRP1/Casp1/Casp6 pathway. Lipopolysaccharide induced Casp1 and Casp6 activation in wild-type mice brain cortex, but not in that of Nlrp1−/− and Casp1−/− mice. NLRP1 immunopositive neurons were increased 25- to 30-fold in AD brains compared with non-AD brains. NLRP1 immunoreactivity in these neurons co-localized with Casp6 activity. Furthermore, the NLRP1/Casp1/Casp6 pathway increased amyloid beta peptide 42 ratio in serum-deprived neurons. Therefore, CNS human neurons express functional NLRP1 inflammasomes, which activate Casp1 and subsequently Casp6, thus revealing a fundamental mechanism linking intraneuronal inflammasome activation to Casp1-generated interleukin-1-β-mediated neuroinflammation and Casp6-mediated axonal degeneration. PMID:25744023

  16. Sex Differences in the Association between Stressor-Evoked Interleukin-6 Reactivity and C-Reactive Protein

    PubMed Central

    Lockwood, Kimberly G.; Marsland, Anna L.; Cohen, Sheldon; Gianaros, Peter J.

    2016-01-01

    Individuals differ consistently in the magnitude of their inflammatory responses to acute stressors, with females often showing larger responses than males. While the clinical significance of these individual differences remains unclear, it may be that greater inflammatory responses relate to increased systemic inflammation and thereby risk for chronic inflammatory disease. Here, we examined whether acute stressor-evoked interleukin (IL)-6 responses associate with resting levels of C-reactive protein (CRP), a marker of systemic inflammation, and whether this association differs by sex. Subjects were 57 healthy midlife adults (30–51 years; 33% female; 68% white). Blood was drawn before and 30-min after two mental stress tasks: a multisource interference task and a Stroop color word task. Hierarchical regressions controlling for age, sex, race, and BMI tested whether stressor-evoked IL-6 responses were associated with resting CRP and whether this association differed by sex. Results indicated that sex and stressor-evoked IL-6 responses interacted to predict CRP (ΔR2 = .08, B = −1.33, β = −.39, p = .02). In males, larger stressor-evoked IL-6 responses associated with higher CRP, whereas in females, stressor-evoked IL-6 responses showed a non-significant negative association with CRP. These findings indicate that inflammatory responses to acute stressors associate with resting levels of CRP; however, this association differs by sex. Previous literature suggests that there are sex differences in stressor-evoked IL-6 responses, but this is the first study to show sex differences in the relationship between acute inflammatory responses and systemic inflammation. The contribution of these sex differences to inflammatory disease risk warrants further investigation. PMID:27377561

  17. Proinflammatory interleukins' production by adipose tissue-derived mesenchymal stromal cells: the impact of cell culture conditions and cell-to-cell interaction.

    PubMed

    Andreeva, Elena; Andrianova, Irina; Rylova, Julia; Gornostaeva, Aleksandra; Bobyleva, Polina; Buravkova, Ludmila

    2015-08-01

    The impact of culture conditions and interaction with activated peripheral blood mononuclear cells on the interleukin (IL) gene expression profile and proinflammatory IL-6 and IL-8 production by adipose-derived stromal cells (ASCs) was investigated. A microarray analysis revealed a wide range of IL genes either under standard (20%) or hypoxic (5%) O2 concentrations, some highly up-regulated at hypoxia. IL-6 and IL-8 production was inversely dependent on cell culture density. In early (first-third) passages, IL-6 and IL-8 concentration was higher at 20% O2 and in late (8th-12th) passages under 5% O2. Interaction between ASCs and mononuclear cells in indirect setting was accompanied with a significant decrease of IL-6 and did not result in the elevation of IL-8 concentration. Thereby, the production of proinflammatory interleukins (IL-6 and IL-8) may be affected by the ASC intrinsic features (density in culture, and duration of expansion), as well as by microenvironmental factors, such as hypoxia and the presence of blood-borne cells. These data are important for elucidating ASC paracrine activity regulation in vitro. They would also be on demand for optimisation of the cell therapy protocols, based on the application of ASC biologically active substances. SIGNIFICANCE PARAGRAPH: Ex vivo expansion is widely used for increasing the number of adipose-derived stromal cells (ASCs) and improving of their quality. The present study was designed to elucidate the particular factors influencing the interleukin production in ASCs. The presented data specified the parameters (i.e. cell density, duration of cultivation, hypoxia, etc.) that should be taken in mind when ASCs are intended to be used in protocols implying their paracrine activity. These data would be of considerable interest for researchers and clinicians working in the biomedical science. Copyright © 2015 John Wiley & Sons, Ltd.

  18. Thalidomide reduces tumour necrosis factor α and interleukin 12 production in patients with chronic active Crohn's disease

    PubMed Central

    Bauditz, J; Wedel, S; Lochs, H

    2002-01-01

    Background: Thalidomide improves clinical symptoms in patients with therapy refractory Crohn's disease, as shown in two recent studies. The mechanism of this effect however is still unknown. Suppression of tumour necrosis factor α (TNF-α) by thalidomide has been suggested as a possible mechanism. However, effects on other cytokines have not been adequately investigated. Aim: The aim of our study was to investigate the effects of thalidomide on cytokine production in patients with inflammatory bowel disease (IBD). Methods: Ten patients with therapy refractory IBD (nine Crohn's disease, one ulcerative colitis) received thalidomide 300 mg daily in a 12 week open label study. Production of TNF-α, interleukin (IL)-1β, IL-6, and IL-12 was investigated in short term cultures of stimulated colonic lamina propria mononuclear cells (LPMC) and peripheral blood monocytes (PBMC) before and after 12 weeks of treatment. LPMC were also cultured with graded doses of thalidomide. Results: Three patients discontinued treatment because of sedative side effects. In the other patients, disease activity decreased significantly, with four patients achieving remission. Production of TNF-α and IL-12 decreased during treatment with thalidomide: LPMC (TNF-α: 42.3 (8.3) pg/ml v 16.4 (6.3); IL-12: 9.7 (3.3) v 5.0 (2.5); p<0.04) and PBMC (TNF-α: 62.8 (14.6) v 22.5 (9.2); p<0.02). Production of IL-1β and IL-6 did not change significantly. Culturing of LPMC with thalidomide showed a dose dependent decrease in TNF-α and IL-12 production. Conclusion: The clinical effects of thalidomide in Crohn's disease may be mediated by reduction of both TNF-α and IL-12. PMID:11788559

  19. Rhinovirus stimulation of interleukin-6 in vivo and in vitro. Evidence for nuclear factor kappa B-dependent transcriptional activation.

    PubMed Central

    Zhu, Z; Tang, W; Ray, A; Wu, Y; Einarsson, O; Landry, M L; Gwaltney, J; Elias, J A

    1996-01-01

    To further understand the biology of rhinovirus (RV), we determined whether IL-6 was produced during RV infections and characterized the mechanism by which RV stimulates lung cell IL-6 production. In contrast to normals and minimally symptomatic volunteers, IL-6 was detected in the nasal washings from patients who developed colds after RV challenge. RV14 and RV1A, major and minor receptor group RVs, respectively, were potent stimulators of IL-6 protein production in vitro. These effects were associated with significant increases in IL-6 mRNA accumulation and gene transcription. RV was also a potent stimulator of IL-6 promoter-driven luciferase activity. This stimulation was modestly decreased by mutation of the nuclear factor (NF)-IL-6 site and abrogated by mutation of the NF-kappa B site in this promoter. An NF-kappa B-DNA binding activity, mediated by p65, p50, and p52 NF-kappa B moieties, was rapidly induced in RV-infected cells. Activator protein 1-DNA binding was not similarly altered. These studies demonstrate that IL-6 is produced during symptomatic RV infections, that RVs are potent stimulators of IL-6 elaboration, and that RV stimulation IL-6 production is mediated by an NF-kappa B-dependent transcriptional stimulation pathway. IL-6 may play an important role in the pathogenesis of RV infection, and NF-kappa B activation is likely to be an important event in RV-induced pathologies. PMID:8567963

  20. The Monocyte Chemotactic Protein-1 — Interleukin-6 — Osteopontin Pathway of Intra-Aneurysmal Tissue Healing

    PubMed Central

    Hosaka, Koji; Rojas, Kelley; Fazal, Hanain Z; Schneider, Matheus B; Shores, Jorma; Federico, Vincent; McCord, Matthew; Lin, Li; Hoh, Brian

    2017-01-01

    Background and Purpose We have previously demonstrated that the local delivery of monocyte chemotactic protein-1 (MCP-1) via a MCP-1-releasing poly(lactic-co-glycolic acid) (PLGA) -coated coil promotes intra-aneurysmal tissue healing. In this study, we demonstrate that interleukin-6 (IL-6) and osteopontin (OPN) are downstream mediators in the MCP-1-mediated aneurysm healing pathway. Methods Murine carotid aneurysms were created in C57BL/6 mice. Drug-releasing coils (MCP-1, IL-6 and OPN) and control PLGA coils were created and then implanted into the aneurysms in order to evaluate their intra-aneurysmal healing capacity. In order to investigate the downstream mediators for aneurysm healing, blocking antibodies for IL-6 receptor and OPN were given to the mice implanted with the MCP-1-releasing coils. A histological analysis of both murine and human aneurysms was utilized to cross-validate the data. Results We observed increased expression of IL-6 in MCP-1-coil treated aneurysms and not in control-PLGA-only treated aneurysms. MCP-1-mediated intra-aneurysmal healing is inhibited in mice given blocking antibody to IL-6 receptor. MCP-1-mediated intra-aneurysmal healing is also inhibited by blocking antibody to OPN. The role of IL-6 in intra-aneurysmal healing is in recruiting of endothelial cells and fibroblasts. Local delivery of OPN to murine carotid aneurysms via OPN-releasing coil significantly promotes intra-aneurysmal healing, but IL-6-releasing coil does not, suggesting that IL-6 cannot promote aneurysm healing independent of MCP-1. In the MCP-1-mediated aneurysm healing, OPN expression is dependent on IL-6; inhibition of IL-6 receptor significantly inhibits OPN expression in MCP-1-mediated aneurysm healing. Conclusions Our findings suggest that IL-6 and OPN are key downstream mediators of MCP-1-mediated intra-aneurysmal healing. PMID:28292871

  1. Coexpression of interleukin-6 and -2 from giant panda in Escherichia coli and the biological activity of the fusion protein.

    PubMed

    Yi, Y; Nian, Y-Y; Ji, H-W; Zhang, H; Zhu, L; Xu, Z-W

    2013-06-14

    To construct a fusion cytokine protein with more and stronger bioactivities to enhance the immunity of the cytokine alone, we expressed interleukin (IL)-6/(IL)-2 from giant panda (Ailuropoda melanoleuca) in Escherichia coli as a 59.4-kDa fusion protein. Subsequently, the inclusion bodies were solubilized with 8 M urea and applied onto a Ni-nitrilotriacetic acid column. The final production of IL-6/IL-2 reached 6 mg/L in soluble form, and the purified final product was >96% pure. In Western blot assays, the recombinant IL-6/IL-2 was recognized by polyclonal antibodies against IL-6 and IL-2 of giant panda. The results demonstrated that the protein mixture contained correctly folded IL-2 and IL-6 proteins. A 3-(4,5-dimethylthiazol-2-yl) 2,5-diphenyltetrazolium bromide assay demonstrated that IL-6/IL-2 can promote lymphocyte proliferation and differentiation. These data suggest that the fusion protein could be used to develop a novel immunoadjuvant to enhance the immunity of animals against infectious diseases.

  2. Comparison of interleukin-6 removal properties among hemofilters consisting of varying membrane materials and surface areas: an in vitro study.

    PubMed

    Hirayama, Yo; Oda, Shigeto; Wakabayashi, Kiyohito; Sadahiro, Tomohito; Nakamura, Masataka; Watanabe, Eizo; Tateishi, Yoshihisa

    2011-01-01

    We sought to identify the most relevant hemofilter for cytokine removal based on the mechanisms of filtration and adsorption. Ascites were filtered using four types of hemofilters composed of different membrane materials (polymethyl methacrylate, PMMA, cellulose triacetate, CTA, or polysulfone, PS) and different surface areas (1.0 or 2.1 m(2)) to investigate the rate of interleukin-6 (IL-6) filtration. Next, ascites were perfused through each hemofilter without obtaining a filtrate to study each filter's adsorptive capability. The PMMA hemofilters resulted in a marginal observed IL-6 filtration rates, whereas the CTA and PS hemofilters resulted in highly effective IL-6 filtration. Regarding the IL-6 adsorptive capabilities of the filters, the PMMA hemofilter with a large surface area showed the highest level of IL-6 clearance. The present findings suggest that when cytokine removal based on filtration is desired, CTA or PS hemofilters should be selected. When IL-6 removal based on adsorption is desired, a PMMA hemofilter with a large surface area should be selected. Copyright © 2010 S. Karger AG, Basel.

  3. In vitro effects of the dicyclohexylammonium salt of hyperforin on interleukin-6 release in different experimental models.

    PubMed

    Gobbi, Marco; Moia, Manuela; Funicello, Marcella; Riva, Antonella; Morazzoni, Paolo; Mennini, Tiziana

    2004-07-01

    Cytokine hypersecretion might be involved in the onset and maintenance of depressive disorders and it has been suggested that St. John's wort extracts (Hypericum perforatum, SJW) might exert their antidepressant-like effects by affecting peripheral interleukin-6 (IL6) expression. We found that hyperforin, one putative active principle of SJW, and its dicyclohexylammonium salt (hyperforin-DCHA), inhibited the substance P (SP)-induced [L6 release inhuman astrocytoma cells (U373MG) with an Cs50 of 1.6 pM, indicating that hyperforin is likely to account for the inhibitory effect previously found in the same experimental model with SJW ex-tracts. [3H]SP binding experiments in parallel on the same intact cells indicate that hyperforin-DCHA does not interact with neuro-kinin-I receptors but very likely interacts with some intracellular steps leading to the synthesis and/or release of IL6. Hyperforin-DCHA also inhibited, with a similar IC50, the IL6 release induced in U373MG cells by two other classic proinflammatory stimuli,ILl and lipopolysaccharide (LPS), as well as the LPS-induced IL6 release in whole rat blood. Hyperforin-DCHA was less active in whole human blood. The concentrations required in vitro to inhibit LPS-induced IL6 release from rat and human whole blood are about one order of magnitude higher than the hyperforin levels measured in the plasma of rats or humans treated with pharmaco-logically active doses of SJW or hyperforin-DCHA.

  4. Interleukin-22 promotes aerobic glycolysis associated with tumor progression via targeting hexokinase-2 in human colon cancer cells.

    PubMed

    Liu, Yulin; Xiang, Fan; Huang, Yongming; Shi, Liang; Hu, Chaojie; Yang, Yiming; Wang, Di; He, Nan; Tao, Kaixiong; Wu, Ke; Wang, Guobin

    2017-04-11

    Interleukin-22 has been explored extensively in human cancer, but its functions and underlying mechanisms are incompletely understood. Here, we show that aberrant interleukin-22 expression facilitates aerobic glycolysis in colon cancer cells. Elevated interleukin-22 mRNA expression was observed and positively correlated with hexokinase-2 in colon cancer tissues. In vitro, interleukin-22 enhanced glucose consumption and lactate production via targeting hexokinase-2 in colon cancer cells. Moreover, the transcriptional factor c-Myc and signal transducer and activator of transcription 3 were involved in interleukin-22-induced up-regulation of hexokinase-2. We further demonstrated that hexokinase-2 partly accounted for interleukin-22-mediated cellular proliferation in DLD-1 cells. In vivo, our data demonstrated that interleukin-22 significantly promoted tumor growth along with elevated expression of c-Myc and hexokinase-2 in mice. In summary, our findings provide a new perspective on the pro-inflammatory cytokine interleukin-22 in promoting aerobic glycolysis associated with tumor progression in human colon cancer cells.

  5. Big 5 personality traits and interleukin-6: evidence for "healthy Neuroticism" in a US population sample.

    PubMed

    Turiano, Nicholas A; Mroczek, Daniel K; Moynihan, Jan; Chapman, Benjamin P

    2013-02-01

    The current study investigated if the Big 5 personality traits predicted interleukin-6 (IL-6) levels in a national sample over the course of 5years. In addition, interactions among the Big 5 were tested to provide a more accurate understanding of how personality traits may influence an inflammatory biomarker. Data included 1054 participants in the Midlife Development in the U.S. (MIDUS) biomarkers subproject. The Big 5 personality traits were assessed in 2005-2006 as part of the main MIDUS survey. Medication use, comorbid conditions, smoking behavior, alcohol use, body mass index, and serum levels of IL-6 were assessed in 2005-2009 as part of the biomarkers subproject. Linear regression analyses examined personality associations with IL-6. A significant Conscientiousness*Neuroticism interaction revealed that those high in both Conscientiousness and Neuroticism had lower circulating IL-6 levels than people with all other configurations of Conscientiousness and Neuroticism. Adjustment for health behaviors diminished the magnitude of this association but did not eliminate it, suggesting that lower comorbid conditions and obesity may partly explain the lower inflammation of those high in both Conscientiousness and Neuroticism. Our findings suggest, consistent with prior speculation, that average to higher levels of Neuroticism can in some cases be associated with health benefits - in this case when it is accompanied by high Conscientiousness. Using personality to identify those at risk may lead to greater personalization in the prevention and remediation of chronic inflammation. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Loss of Interleukin 1 Receptor Antagonist Enhances Susceptibility to Ebola Virus Infection.

    PubMed

    Hill-Batorski, Lindsay; Halfmann, Peter; Marzi, Andrea; Lopes, Tiago J S; Neumann, Gabriele; Feldmann, Heinz; Kawaoka, Yoshihiro

    2015-10-01

    The current outbreak of Ebola virus (EBOV) infection in West Africa is unprecedented, with nearly 26 000 confirmed cases and >10 000 deaths. Comprehensive data on the pathogenesis of EBOV infection are lacking; however, recent studies suggested that fatal EBOV infections are characterized by dysregulation of the innate immune response and a subsequent cytokine storm. Specifically, several studies suggested that hypersecretion of interleukin 1 receptor antagonist (IL-1Ra) correlates with lethal EBOV infections. To examine the significance of IL-1Ra in EBOV infections, we infected mice that lack the gene encoding IL-1Ra, Il1rn (IL-1RN-KO), and mice with wild-type Il1rn (IL-1RN-WT) with a mouse-adapted EBOV (MA-EBOV). Infected IL-1RN-KO mice lost more weight and had a lower survival rate than IL-1RN-WT mice infected with MA-EBOV. In addition, IL-1RN-KO mice infected with wild-type EBOV, which does not cause lethal infection in adult immunocompetent mice, such as C57BL/6 mice, experienced greater weight loss than IL-1RN-WT mice infected with wild-type EBOV. Further studies revealed that the levels of 6 cytokines in spleens-IL-1α, IL-1β, interleukin 12p40, interleukin 17, granulocyte colony-stimulating factor, and regulated on activation, normal T-cell expressed and secreted-were significantly different between IL-1RN-KO mice and IL-1RN-WT mice infected with MA-EBOV. Collectively, our data suggest that IL-1Ra may have a protective effect upon EBOV infection, likely by damping an overactive proinflammatory immune response. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  7. Insulin Resistance Is Associated with Interleukin 1β (IL-1β) in Non-Diabetic Hemodialysis Patients

    PubMed Central

    Ai, Honglan; Wu, Qiaoming; Fan, Qiang; Ding, Feng; Hu, Chun

    2018-01-01

    Background Insulin resistance (IR) and inflammation are associated with increased risk of complications in chronic kidney disease (CKD) patients. However, the relationship between IR and the important proinflammatory interleukin-1β (IL-1β) is unclear in CKD patients. Material/Methods We conducted a cross-sectional study including 79 non-diabetic patients who received hemodialysis after the exclusion process. Homeostasis model assessment (HOMA-IR) and leptin adiponectin ratio (LAR) were used to evaluate IR. Inflammation was assessed through C-reactive protein (CRP), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), and IL-1β evaluation. We tested associations of IR with IL-1β using logistic analysis and linear regression. Results Patients were divided into a HOMA-IR-positive group and a HOMA-IR-negative group. Although there were no differences between the 2 groups in terms of etiological causes, age, sex, BMI, triglyceride, cholesterol, ferritin, uric acid, and inflammatory indicators such as CRP, we found that IL-6, TNF-α, and IL-1β were significantly increased in the HOMA-IR-positive group compared with the HOMA-IR-negative group. Moreover, IL-1β contributed to HOMA-IR positivity and was positively correlated with LAR after adjusting for possible confounding factors. Conclusions Insulin resistance correlates positively with IL-1β among non-diabetic hemodialysis patients, which suggests that IL-1β may be involved in the pathogenesis of IR in this setting. PMID:29436520

  8. Interleukin-6 treatment reverses apoptosis and blunts susceptibility to intraperitoneal bacterial challenge following hemorrhagic shock.

    PubMed

    Arikan, Ayse Akcan; Yu, Bi; Mastrangelo, Mary-Ann; Tweardy, David J

    2006-03-01

    Resuscitation from hemorrhagic shock (HS) predisposes to subsequent infections. Susceptibility to infection following sepsis has been attributed to apoptosis. Interleukin (IL)-6 has been shown to have antiapoptotic properties and to decrease postresuscitation inflammation in rodent and porcine models of HS. The objective was to determine if HS increases host susceptibility to infection, if IL-6 administration at resuscitation reduces this susceptibility, and if changes in susceptibility to infection are accompanied by parallel changes in apoptosis. Mice were randomized into three groups-HS, sham, and no-surgery control-and each group was further randomized to receive either IL-6 (3 microg/kg; HS/IL-6) or placebo (HS/P) at the start of resuscitation. In the HS-infection protocol, each mouse was challenged intraperitoneally the next day with a sublethal dose of Staphylococcus aureus (4x107 colony-forming units); 24 hrs later, the peritoneal cavity was lavaged and the major organs were harvested for culture. In the HS-apoptosis protocol, the livers were harvested the next day and analyzed by means of the terminal deoxynucleotidyl transferase dUTP-biotin nick-end-labeling (TUNEL) assay. HS/P mice had a six- to eight-fold increase in total bacterial counts in comparison with sham and control mice that was attributable to a seven- to nine-fold increase in liver burden. IL-6 treatment reduced total and liver bacterial counts in HS/IL-6 mice by 62% and 69%, respectively, to levels statistically indistinguishable from IL-6-treated sham and control mice. The number of TUNEL-positive liver cells in the HS/P group was increased eight-fold vs. that in the sham group (p=.002); IL-6 resuscitation completely reversed the HS-induced increase in TUNEL-positive cells in the HS/IL-6 group (p=.002). IL-6 treatment at resuscitation eliminated the HS-mediated increase in total and liver bacterial burden and protected the liver from HS-induced apoptosis. Reduced liver apoptosis may

  9. Granulocyte-macrophage colony-stimulating factor primes interleukin-13 production by macrophages via protease-activated receptor-2.

    PubMed

    Aoki, Manabu; Yamaguchi, Rui; Yamamoto, Takatoshi; Ishimaru, Yasuji; Ono, Tomomichi; Sakamoto, Arisa; Narahara, Shinji; Sugiuchi, Hiroyuki; Hirose, Eiji; Yamaguchi, Yasuo

    2015-04-01

    Chronic inflammation is often linked to the presence of type 2-polarized macrophages, which are induced by the T helper type 2 cytokines interleukin-4 and interleukin-13 (IL-13). IL-13 is a key mediator of tissue fibrosis caused by T helper type 2-based inflammation. Human neutrophil elastase (HNE) plays a pivotal role in the pathogenesis of pulmonary fibrosis. This study investigated the priming effect of granulocyte-macrophage colony-stimulating factor (GM-CSF) on IL-13 expression by macrophages stimulated with HNE. Adherent macrophages were obtained from primary cultures of human mononuclear cells. Expression of IL-13 mRNA and protein by GM-CSF-dependent macrophages was investigated after stimulation with HNE, using the polymerase chain reaction and enzyme-linked immunosorbent assay. GM-CSF had a priming effect on IL-13 mRNA and protein expression by macrophages stimulated with HNE, while this effect was not observed for various other cytokines. GM-CSF-dependent macrophages showed a significant increase in the expression of protease activated receptor-2 (PAR-2) mRNA and protein. The response of IL-13 mRNA to HNE was significantly decreased by pretreatment with alpha1-antitrypsin, a PAR-2 antibody (SAM11), or a PAR-2 antagonist (ENMD-1068). These findings suggest that stimulation with HNE can induce IL-13 production by macrophages, especially GM-CSF-dependent macrophages. Accordingly, neutrophil elastase may have a key role in fibrosis associated with chronic inflammation. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Interleukin-6 mediates enhanced thrombus development in cerebral arterioles following a brief period of focal brain ischemia

    PubMed Central

    Tang, Ya Hui; Vital, Shantel; Russell, Janice; Seifert, Hilary; Granger, D. Neil

    2015-01-01

    Objective The cerebral microvasculature is rendered more vulnerable to thrombus formation following a brief (5.0 min) period of focal ischemia. This study examined the contribution of interleukin-6 (IL-6), a neuroprotective and prothrombotic cytokine produced by the brain, to transient ischemia-induced thrombosis in cerebral arterioles. Approach & results The middle cerebral artery of C57BL/6J mice was occluded for 5 minutes, followed by 24 hrs of reperfusion (MCAo/R). Intravital fluorescence microscopy was used to monitor thrombus development in cerebral arterioles induced by light/dye photoactivation. Thrombosis was quantified as the time of onset of platelet aggregation on the vessel wall and the time for complete blood flow cessation. MCAo/R in wild type (WT) mice yielded an acceleration of thrombus formation that was accompanied by increased IL-6 levels in plasma and in post-ischemic brain tissue. The exaggerated thrombosis response to MCAo/R was blunted in WT mice receiving an IL-6 receptor-blocking antibody and in IL-6 deficient (IL-6−/−) mice. Bone marrow chimeras, produced by transplanting IL-6−/− marrow into WT recipients, did not exhibit protection against MCAo/R-induced thrombosis. Conclusions The increased vulnerability of the cerebral vasculature to thrombus development after MCAo/R is mediated by IL-6, which is likely derived from brain cells rather than circulating blood cells. These findings suggest that anti-IL-6 therapy may reduce the likelihood of cerebral thrombus development after a transient ischemic attack. PMID:26054883

  11. The Interaction of Obstructive Sleep Apnea and Obesity on the Inflammatory Markers C-Reactive Protein and Interleukin-6: The Icelandic Sleep Apnea Cohort

    PubMed Central

    Arnardottir, Erna S.; Maislin, Greg; Schwab, Richard J.; Staley, Bethany; Benediktsdottir, Bryndis; Olafsson, Isleifur; Juliusson, Sigurdur; Romer, Micah; Gislason, Thorarinn; Pack, Allan I.

    2012-01-01

    Study Objectives: To assess the relative roles and interaction of obstructive sleep apnea (OSA) severity and obesity on interleukin-6 (IL-6) and C-reactive protein (CRP) levels. Design: Cross-sectional cohort. Setting: The Icelandic Sleep Apnea Cohort. Participants: 454 untreated OSA patients (380 males and 74 females), mean ± standard deviation age 54.4 ± 10.6 yr. Interventions: N/A. Measurements and Results: Participants underwent a sleep study, abdominal magnetic resonance imaging to measure total abdominal and visceral fat volume, and had fasting morning IL-6 and CRP levels measured in serum. A significantly higher correlation was found for BMI than visceral fat volume with CRP and IL-6 levels. Oxygen desaturation index, hypoxia time, and minimum oxygen saturation (SaO2) significantly correlated with IL-6 and CRP levels, but apnea-hypopnea index did not. When stratified by body mass index (BMI) category, OSA severity was associated with IL-6 levels in obese participants only (BMI > 30 kg/m2). A multiple linear regression model with interaction terms showed an independent association of OSA severity with IL-6 levels and an interaction between OSA severity and BMI, i.e., degree of obesity altered the relationship between OSA and IL-6 levels. An independent association of OSA severity with CRP levels was found for minimum SaO2 only. A similar interaction of OSA severity and BMI on CRP levels was found for males and postmenopausal women. Conclusions: OSA severity is an independent predictor of levels of IL-6 and CRP but interacts with obesity such that this association is found only in obese patients. Citation: Arnardottir ES; Maislin G; Schwab RJ; Staley B; Benediktsdottir B; Olafsson I; Juliusson S; Romer M; Gislason T; Pack AI. The interaction of obstructive sleep apnea and obesity on the inflammatory markers c-reactive protein and interleukin-6: the Icelandic Sleep Apnea Cohort. SLEEP 2012;35(7):921-932. PMID:22754038

  12. Curcumin suppresses the production of interleukin-6 in Prevotella intermedia lipopolysaccharide-activated RAW 264.7 cells

    PubMed Central

    2011-01-01

    Purpose Curcumin is known to exert numerous biological effects including anti-inflammatory activity. In this study, we investigated the effects of curcumin on the production of interleukin-6 (IL-6) by murine macrophage-like RAW 264.7 cells stimulated with lipopolysaccharide (LPS) from Prevotella intermedia, a major cause of inflammatory periodontal disease, and sought to determine the underlying mechanisms of action. Methods LPS was prepared from lyophilized P. intermedia ATCC 25611 cells by the standard hot phenol-water method. Culture supernatants were collected and assayed for IL-6. We used real-time polymerase chain reaction to detect IL-6 mRNA expression. IκB-α degradation, nuclear translocation of NF-κB subunits, and STAT1 phosphorylation were characterized via immunoblotting. DNA-binding of NF-κB was also analyzed. Results Curcumin strongly suppressed the production of IL-6 at both gene transcription and translation levels in P. intermedia LPS-activated RAW 264.7 cells. Curcumin did not inhibit the degradation of IκB-α induced by P. intermedia LPS. Curcumin blocked NF-κB signaling through the inhibition of nuclear translocation of NF-κB p50 subunit. Curcumin also attenuated DNA binding activity of p50 and p65 subunits and suppressed STAT1 phosphorylation. Conclusions Although further study is required to explore the detailed mechanism of action, curcumin may contribute to blockade of the host-destructive processes mediated by IL-6 and appears to have potential therapeutic values in the treatment of inflammatory periodontal disease. PMID:21811692

  13. Serum levels of interleukin-9 correlate with negative prognostic factors in extranodal NK/T-cell lymphoma.

    PubMed

    Zhang, Jing; Wang, Wei-da; Geng, Qi-Rong; Wang, Liang; Chen, Xiao-Qin; Liu, Cheng-Cheng; Lv, Yue

    2014-01-01

    Interleukin-9 (IL-9) is more functionally diverse than previously expected, especially with regards to lymphomagenesis. However, the relationship between IL-9 and the clinicopathological features of extranodal NK/T-cell lymphoma is less well established. Patients with this lymphoma in Sun Yat-Sen University Cancer Center between January 2003 and March 2013 were systematically reviewed in an intention-to-treat analysis. Baseline serum IL-9 levels were determined using sandwich enzyme-linked immunosorbent assays. A total of seventy-four patients were enrolled in this study. The mean concentration of serum IL-9 for all patients was 6.48 pg/mL (range: 1.38-51.87 pg/mL). Age, B symptoms and local lymph node involvement were found to be related to high serum IL-9 levels. Patients with low IL-9 levels tended to have higher rates of complete remission. Notably, the median progression-free survival (PFS) and overall survival (OS) were longer in the low IL-9 level group than in the high IL-9 level group (PFS: 68.7 months vs. 28.3 months, P<0.001; OS: 86 months vs. 42.8 months, P = 0.001). Multivariate analysis revealed independent prognostic factors for PFS. Similarly, high IL-9 levels (P = 0.003) and old age (P = 0.007) were independently predictive of shorter OS. Serum IL-9 is closely related to several clinical features, such as age, B symptoms and local lymph node involvement. It can also be a significant independent prognostic factor for extranodal NK/T-cell lymphoma, which suggests a role for IL-9 in the pathogenesis of this disease and offers new insight into potential therapeutic strategies.

  14. Cervical fluid interleukin 6 and intra-amniotic complications of preterm prelabor rupture of membranes.

    PubMed

    Musilova, Ivana; Andrys, Ctirad; Drahosova, Marcela; Soucek, Ondrej; Pliskova, Lenka; Jacobsson, Bo; Kacerovsky, Marian

    2018-04-01

    To determine if cervical fluid interleukin (IL)-6 concentrations in women with preterm prelabor rupture of membranes (PPROM) allows identification of microbial invasion of the amniotic cavity (MIAC) and/or intra-amniotic inflammation (IAI). One hundred forty-four women with singleton pregnancies complicated by PPROM were included in this prospective cohort study. Cervical and amniotic fluids were collected at the time of admission and concentrations of IL-6 were measured using an ELISA and point-of-care test, respectively. Cervical fluid was obtained using a Dacron polyester swab and amniotic fluid was obtained by transabdominal amniocentesis. MIAC was diagnosed based on a positive PCR result for Ureaplasma species, M. hominis, and/or C. trachomatis and/or by positivity for the 16 S rRNA gene. IAI was defined as amniotic fluid point-of-care IL-6 concentrations ≥745 pg/mL. The women were assigned to four subgroups based on the presence of MIAC and/or IAI: microbial-associated IAI (both MIAC and IAI), sterile IAI (IAI alone), MIAC alone, and without either MIAC or IAI. (1) Women with microbial-associated IAI had higher cervical fluid IL-6 concentrations (median 560 pg/mL) than did women with sterile IAI (median 303 pg/mL; p = .001), women with MIAC alone (median 135 pg/mL; p = .0004), and women without MIAC and IAI (median 180 pg/mL; p = .0001). (2) No differences were found in cervical fluid IL-6 concentrations among women with sterile IAI, with MIAC alone, and without MIAC and IAI. (3) A positive correlation was observed between cervical fluid IL-6 concentrations and the amount of Ureaplasma species in amniotic fluid (copies DNA/mL; rho = 0.57, p < .0001). (4) A weak positive correlation was detected between cervical and amniotic fluid IL-6 concentrations (rho = 0.33, p < .0001). The presence of microbial-associated IAI is associated with the highest cervical fluid IL-6 concentrations. Cervical IL-6 can be helpful in the

  15. Interleukin-6-driven inflammatory response induces retinal pathology in a model of ocular toxoplasmosis reactivation.

    PubMed

    Rochet, Élise; Brunet, Julie; Sabou, Marcela; Marcellin, Luc; Bourcier, Tristan; Candolfi, Ermanno; Pfaff, Alexander W

    2015-05-01

    Ocular inflammation is one of the consequences of infection with the protozoan parasite Toxoplasma gondii. Even if lesions are self-healing in immunocompetent persons, they pose a lifetime risk of reactivation and are a serious threat to vision. As there are virtually no immunological data on reactivating ocular toxoplasmosis, we established a model of direct intravitreal injection of parasites in previously infected mice with a homologous type II strain. Two different mouse strains with variable ability to control retinal infection were studied in order to describe protective and deleterious reaction patterns. In Swiss-Webster mice, which are already relatively resistant to primary infection, no peak of parasite load was observed upon reinfection. In contrast, the susceptible inbred strain C57BL/6 showed high parasite loads after 7 days, as well as marked deterioration of retinal architecture. Both parameters were back to normal on day 21. C57BL/6 mice also reacted with a strong local production of inflammatory and Th1-type cytokines, like interleukin-6 (IL-6), IL-17A, and gamma interferon (IFN-γ), while Swiss-Webster mice showed only moderate expression of the Th2 cytokine IL-31. Interestingly, rapid intraocular production of anti-Toxoplasma antibodies was observed in Swiss-Webster but not in C57BL/6 mice. We then localized the cellular source of different immune mediators within the retina by immunofluorescence. Finally, neutralization experiments of IFN-γ or IL-6 demonstrated the respective protective and deleterious roles of these cytokines for parasite control and retinal integrity during reinfection. In conclusion, we developed and immunologically characterized a promising mouse model of reactivating ocular toxoplasmosis. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. [Tobacco--a producer of recombinant interleukins].

    PubMed

    Budzianowski, Jaromir

    2012-01-01

    Interleukins are cytokines of highly pleiotropic activity and they have high potential for application in the treatment of cancer and autoimmune diseases. Trials of recombinant interleukin production in plants relate almost exclusively to tobacco, where through the transformation of the nuclear genome (agroinfection) monomeric (IL-2, IL-4, IL-13, IL-18), homodimeric (IL-10) and single-chain heterodimeric (IL-12) interleukins have been obtained. The expression of IL-10 as a homodimer in the chloroplast genome could not be reached. Expression of the given interleukin was obtained in the leaves, cell culture and culture of hairy roots of tobacco. Interleukins obtained in tobacco showed similar in vitro biological activity as commercial ILs produced mostly in E. coli. Glycosylated IL-13 obtained in tobacco was much more resistant to proteolytic digestion than commercial non-glycosylated IL-13; therefore in the case of sufficiently large production it could be suitable for oral administration in the treatment of type I diabetes.

  17. Prostaglandin E2 mediates growth arrest in NFS-60 cells by down-regulating interleukin-6 receptor expression.

    PubMed

    de Silva, Kumudika I; Daud, Asif N; Deng, JiangPing; Jones, Stephen B; Gamelli, Richard L; Shankar, Ravi

    2003-02-15

    Interleukin-6 (IL-6), a potent myeloid mitogen, and the immunosuppressive prostanoid prostaglandin E2 (PGE2) are elevated following thermal injury and sepsis. We have previously demonstrated that bone marrow myeloid commitment shifts toward monocytopoiesis and away from granulocytopoiesis during thermal injury and sepsis and that PGE2 plays a central role in this alteration. Here we investigated whether PGE2 can modulate IL-6-stimulated growth in the promyelocytic cell line, NFS-60, by down-regulating IL-6 receptor (IL-6r) expression. Exposure of NFS-60 cells to PGE2 suppressed IL-6-stimulated proliferation as well as IL-6r expression. Receptor down-regulation is functionally significant since IL-6-induced signal transduction through activators of transcription (STAT)-3 is also decreased. Down-regulation of IL-6r correlated with the ability of PGE2 to arrest cells in the G0/G1 phase of the cell cycle. PGE2 appears to signal through EP2 receptors. Butaprost (EP2 agonist) but not sulprostone (EP3 agonist) inhibited IL-6-stimulated proliferation. In addition, an EP2 antagonist (AH6809) alleviated the anti-proliferative effects of PGE2. NFS-60 cells express predominantly EP2 and EP4 receptors. While PGE2 down-regulated both the IL-6r protein and mRNA expression, it had no influence on EP2 or EP4 mRNA expression. The present study demonstrates that PGE2 is a potent down-regulator of IL-6r expression and thus may provide a mechanistic explanation for the granulocytopenia seen in thermal injury and sepsis.

  18. Interleukin 6 deficiency modulates the hypothalamic expression of energy balance regulating peptides during pregnancy in mice.

    PubMed

    Pazos, Patricia; Lima, Luis; Casanueva, Felipe F; Diéguez, Carlos; García, María C

    2013-01-01

    Pregnancy is associated with hyperphagia, increased adiposity and multiple neuroendocrine adaptations. Maternal adipose tissue secretes rising amounts of interleukin 6 (IL6), which acts peripherally modulating metabolic function and centrally increasing energy expenditure and reducing body fat. To explore the role of IL6 in the central mechanisms governing dam's energy homeostasis, early, mid and late pregnant (gestational days 7, 13 and 18) wild-type (WT) and Il6 knockout mice (Il6-KO) were compared with virgin controls at diestrus. Food intake, body weight and composition as well as indirect calorimetry measurements were performed in vivo. Anabolic and orexigenic peptides: neuropeptide Y (Npy) and agouti-related peptide (Agrp); and catabolic and anorectic neuropeptides: proopiomelanocortin (Pomc), corticotrophin and thyrotropin-releasing hormone (Crh and Trh) mRNA levels were determined by in situ hybridization. Real time-PCR and western-blot were used for additional tissue gene expression and protein studies. Non-pregnant Il6-KO mice were leaner than WT mice due to a decrease in fat but not in lean body mass. Pregnant Il6-KO mice had higher fat accretion despite similar body weight gain than WT controls. A decreased fat utilization in absence of Il6 might explain this effect, as shown by increased respiratory exchange ratio (RER) in virgin Il6-KO mice. Il6 mRNA levels were markedly enhanced in adipose tissue but reduced in hypothalamus of mid and late pregnant WT mice. Trh expression was also stimulated at gestational day 13 and lack of Il6 blunted this effect. Conversely, in late pregnant mice lessened hypothalamic Il6 receptor alpha (Il6ra), Pomc and Crh mRNA were observed. Il6 deficiency during this stage up-regulated Npy and Agrp expression, while restoring Pomc mRNA levels to virgin values. Together these results demonstrate that IL6/IL6Ra system modulates Npy/Agrp, Pomc and Trh expression during mouse pregnancy, supporting a role of IL6 in the central

  19. Activation of the protein tyrosine phosphatase SHP2 via the interleukin-6 signal transducing receptor protein gp130 requires tyrosine kinase Jak1 and limits acute-phase protein expression.

    PubMed

    Schaper, F; Gendo, C; Eck, M; Schmitz, J; Grimm, C; Anhuf, D; Kerr, I M; Heinrich, P C

    1998-11-01

    Stimulation of the interleukin-6 (IL-6) signalling pathway occurs via the IL-6 receptor-glycoprotein 130 (IL-6R-gp130) receptor complex and results in the regulation of acute-phase protein genes in liver cells. Ligand binding to the receptor complex leads to tyrosine phosphorylation and activation of Janus kinases (Jak), phosphorylation of the signal transducing subunit gp130, followed by recruitment and phosphorylation of the signal transducer and activator of transcription factors STAT3 and STAT1 and the src homology domain (SH2)-containing protein tyrosine phosphatase (SHP2). The tyrosine phosphorylated STAT factors dissociate from the receptor, dimerize and translocate to the nucleus where they bind to enhancer sequences of IL-6 target genes. Phosphorylated SHP2 is able to bind growth factor receptor bound protein (grb2) and thus might link the Jak/STAT pathway to the ras/raf/mitogen-activated protein kinase pathway. Here we present data on the dose-dependence, kinetics and kinase requirements for SHP2 phosphorylation after the activation of the signal transducer, gp130, of the IL-6-type family receptor complex. When human fibrosarcoma cell lines deficient in Jak1, Jak2 or tyrosine kinase 2 (Tyk2) were stimulated with IL-6-soluble IL-6R complexes it was found that only in Jak1-, but not in Jak 2- or Tyk2-deficient cells, SHP2 activation was greatly impaired. It is concluded that Jak1 is required for the tyrosine phosphorylation of SHP2. This phosphorylation depends on Tyr-759 in the cytoplasmatic domain of gp130, since a Tyr-759-->Phe exchange abrogates SHP2 activation and in turn leads to elevated and prolonged STAT3 and STAT1 activation as well as enhanced acute-phase protein gene induction. Therefore, SHP2 plays an important role in acute-phase gene regulation.

  20. Interleukin-6-stimulated progranulin expression contributes to the malignancy of hepatocellular carcinoma cells by activating mTOR signaling.

    PubMed

    Liu, Feng; Zhang, Wen; Yang, Fusheng; Feng, Tingting; Zhou, Meng; Yu, Yuan; Yu, Xiuping; Zhao, Weiming; Yi, Fan; Tang, Wei; Lu, Yi

    2016-02-16

    This study aimed to determine the expression of progranulin (PGRN) in hepatocellular carcinoma (HCC) cells in response to interleukin 6 (IL-6), a non-cellular component of the tumor microenvironment, and the molecular mechanism of PGRN oncogenic activity in hepatocarcinogenesis. Levels of IL-6 and PGRN were increased and positively correlated in HCC tissues. IL-6 dose- and time-dependently increased PGRN level in HCC cells. IL-6-driven PGRN expression was at least in part mediated by Erk/C/EBPβ signaling, and reduced expression of PGRN impaired IL-6-stimulated proliferation, migration and invasion of HepG2 cells. PGRN activated mammalian target of rapamycin (mTOR) signaling, as evidenced by increased phosphorylation of p70S6K, 4E-BP1, and Akt-Ser473/FoxO1. Inhibition of mTOR signaling with rapamycin, an mTOR signaling inhibitor, disturbed PGRN- or IL-6-mediated proliferation, migration and invasion of HCC cells in vitro. Persistent activation of mTOR signaling by knockdown of TSC2 restored PGRN-knockdown-attenuated pro-proliferation effects of IL-6 in HepG2 cells. In addition, rapamycin treatment in vivo in mice slowed tumor growth stimulated by recombinant human PGRN. Our findings provide a better understanding of the biological activities of the IL-6/PGRN/mTOR cascade in the carcinogenesis of HCC, which may suggest a novel target in the treatment of HCC.

  1. Minority Stress and Inflammatory Mediators: Covering Moderates Associations between Perceived Discrimination and Salivary Interleukin-6 in Gay Men

    PubMed Central

    Doyle, David Matthew; Molix, Lisa

    2016-01-01

    Physical health disparities by sexual orientation are widespread yet under-investigated. Drawing upon theories of biological embedding of social adversity, we tested whether minority stress (in the form of perceived discrimination) is associated with salivary interleukin-6 (IL-6), an inflammatory mediator. Furthermore, we examined whether covering, a strategy involving downplaying a stigmatized social identity, modified this association. A community sample (N = 99) of gay men (n = 78) and lesbian women (n = 21) completed self-report measures of minority stress and identity management and provided saliva samples which were assayed for IL-6. Among gay men, results from generalized linear models supported a hypothesized interaction between perceived discrimination and covering, such that perceived discrimination was predictive of higher levels of IL-6 for those who engaged in less covering but not for those who engaged in more covering. This interaction was robust to a number of potential covariates (alcohol, medication, body mass index, race and age). Results for lesbian women suggested a different pattern: the only statistically significant association detected was between greater perceived discrimination and lower levels of IL-6. Findings from the current study point to an important role for inflammatory processes in understanding and remediating health disparities based upon sexual orientation that stem from exposure to prejudice and discrimination. PMID:27534538

  2. Development of combination tapered fiber-optic biosensor dip probe for quantitative estimation of interleukin-6 in serum samples

    NASA Astrophysics Data System (ADS)

    Wang, Chun Wei; Manne, Upender; Reddy, Vishnu B.; Oelschlager, Denise K.; Katkoori, Venkat R.; Grizzle, William E.; Kapoor, Rakesh

    2010-11-01

    A combination tapered fiber-optic biosensor (CTFOB) dip probe for rapid and cost-effective quantification of proteins in serum samples has been developed. This device relies on diode laser excitation and a charged-coupled device spectrometer and functions on a technique of sandwich immunoassay. As a proof of principle, this technique was applied in a quantitative estimation of interleukin IL-6. The probes detected IL-6 at picomolar levels in serum samples obtained from a patient with lupus, an autoimmune disease, and a patient with lymphoma. The estimated concentration of IL-6 in the lupus sample was 5.9 +/- 0.6 pM, and in the lymphoma sample, it was below the detection limit. These concentrations were verified by a procedure involving bead-based xMAP technology. A similar trend in the concentrations was observed. The specificity of the CTFOB dip probes was assessed by analysis with receiver operating characteristics. This analysis suggests that the dip probes can detect 5-pM or higher concentration of IL-6 in these samples with specificities of 100%. The results provide information for guiding further studies in the utilization of these probes to quantify other analytes in body fluids with high specificity and sensitivity.

  3. Granulocyte Macrophage Colony-Stimulating Factor-Activated Eosinophils Promote Interleukin-23 Driven Chronic Colitis

    PubMed Central

    Griseri, Thibault; Arnold, Isabelle C.; Pearson, Claire; Krausgruber, Thomas; Schiering, Chris; Franchini, Fanny; Schulthess, Julie; McKenzie, Brent S.; Crocker, Paul R.; Powrie, Fiona

    2015-01-01

    Summary The role of intestinal eosinophils in immune homeostasis is enigmatic and the molecular signals that drive them from protective to tissue damaging are unknown. Most commonly associated with Th2 cell-mediated diseases, we describe a role for eosinophils as crucial effectors of the interleukin-23 (IL-23)-granulocyte macrophage colony-stimulating factor (GM-CSF) axis in colitis. Chronic intestinal inflammation was characterized by increased bone marrow eosinopoiesis and accumulation of activated intestinal eosinophils. IL-5 blockade or eosinophil depletion ameliorated colitis, implicating eosinophils in disease pathogenesis. GM-CSF was a potent activator of eosinophil effector functions and intestinal accumulation, and GM-CSF blockade inhibited chronic colitis. By contrast neutrophil accumulation was GM-CSF independent and dispensable for colitis. In addition to TNF secretion, release of eosinophil peroxidase promoted colitis identifying direct tissue-toxic mechanisms. Thus, eosinophils are key perpetrators of chronic inflammation and tissue damage in IL-23-mediated immune diseases and it suggests the GM-CSF-eosinophil axis as an attractive therapeutic target. PMID:26200014

  4. Proton receptor GPR68 expression in dendritic-cell-like S100β-positive cells of rat anterior pituitary gland: GPR68 induces interleukin-6 gene expression in extracellular acidification.

    PubMed

    Horiguchi, Kotaro; Higuchi, Masashi; Yoshida, Saishu; Nakakura, Takashi; Tateno, Kozue; Hasegawa, Rumi; Takigami, Shu; Ohsako, Shunji; Kato, Takako; Kato, Yukio

    2014-11-01

    S100β-positive cells, which do not express the classical pituitary hormones, appear to possess multifunctional properties and are assumed to be heterogeneous in the anterior pituitary gland. The presence of several protein markers has shown that S100β-positive cells are composed of populations such as stem/progenitor cells, epithelial cells, astrocytes and dendritic cells. Recently, we succeeded in separating S100β-positive cells into round-cell (dendritic-cell-like) and process-cell types. We also found the characteristic expression of anti-inflammatory factors (interleukin-6, Il-6) and membrane receptors (integrin β-6) in the round type. Here, we further investigate the function of the subpopulation of S100β-positive cells. Since IL-6 is also a paracrine factor that regulates hormone producing-cells, we examine whether a correlation exists among extracellular acid stress, IL-6 and hormone production by using primary cultures of anterior pituitary cells. Dendritic-cell-like S100β-positive cells notably expressed Gpr68 (proton receptor) and Il-6. Furthermore, the expression of Il-6 and proopiomelanocortin (Pomc) was up-regulated by extracellular acidification. The functional role of IL-6 and GPR68 in the gene expression of Pomc during extracellular acidification was also examined. Small interfering RNA for Il-6 up-regulated Pomc expression and that for Gpr68 reversed the down-regulation of Il-6 and up-regulated Pomc expression by extracellular acidification. Thus, S100β-positive dendritic-like cells can sense an increase in extracellular protons via GPR68 and respond by the production of IL-6 in order to suppress the up-regulation of Pomc expression.

  5. Analysis of polymorphisms in the promoter region and protein levels of interleukin-6 gene among gout patients.

    PubMed

    Tsai, P-C; Chen, C-J; Lai, H-M; Chang, S-J

    2008-01-01

    To explore the associations between the polymorphisms and protein levels of interleukin-6 (IL-6) gene and gout disease. A total of 120 male gout patients and 184 healthy controls were enrolled. Each patient was matched with 1-2 gout-free controls by age within three years. Four polymorphisms in the promoter of IL-6 gene, including -597G/A, -572C/G, -373A(m)T(n), and -174G/C, and the IL-6 levels were analyzed. The clinical characteristics and biochemical markers in plasma were measured, including age of gout onset, duration of gout history, tophus number, gout attack frequency, uric acid, total cholesterol, triglycerides and creatinine. The mean IL-6 level for gout patients was 9.80 (+/-11.76 pg/ml) which showed no significant difference from the controls (7.06+/-7.58 pg/ml, p=0.230). When the IL-6 levels were dichotomized according to the median value (5 pg/ml), there were significantly higher proportions of the gout patients (59.66%) than controls (44%) with high IL-6 levels (OR=1.88, 95% CI=1.17-3.02, p=0.008). Unique genotype was found at polymorphisms -174G/C and -597G/A. Neither the polymorphisms -572C/G nor -373A(m)T(n) in the genotype or allele distributions showed a significant association related to clinical characteristics, biochemical markers, IL-6 levels or gout disease (all p>0.05). Those with gout disease have greater proportions of high IL-6 levels in plasma than controls, and there is no significant association between the four polymorphisms in the promoter region of IL-6 gene and gout disease.

  6. Restoration of pharyngeal dilator muscle force in dystrophin-deficient (mdx) mice following co-treatment with neutralizing interleukin-6 receptor antibodies and urocortin 2.

    PubMed

    Burns, David P; Rowland, Jane; Canavan, Leonie; Murphy, Kevin H; Brannock, Molly; O'Malley, Dervla; O'Halloran, Ken D; Edge, Deirdre

    2017-09-01

    What is the central question of this study? We previously reported impaired upper airway dilator muscle function in the mdx mouse model of Duchenne muscular dystrophy (DMD). Our aim was to assess the effect of blocking interleukin-6 receptor signalling and stimulating corticotrophin-releasing factor receptor 2 signalling on mdx sternohyoid muscle structure and function. What is the main finding and its importance? The interventional treatment had a positive inotropic effect on sternohyoid muscle force, restoring mechanical work and power to wild-type values, reduced myofibre central nucleation and preserved the myosin heavy chain type IIb fibre complement of mdx sternohyoid muscle. These data might have implications for development of pharmacotherapies for DMD with relevance to respiratory muscle performance. The mdx mouse model of Duchenne muscular dystrophy shows evidence of impaired pharyngeal dilator muscle function. We hypothesized that inflammatory and stress-related factors are implicated in airway dilator muscle dysfunction. Six-week-old mdx (n = 26) and wild-type (WT; n = 26) mice received either saline (0.9% w/v) or a co-administration of neutralizing interleukin-6 receptor antibodies (0.2 mg kg -1 ) and corticotrophin-releasing factor receptor 2 agonist (urocortin 2; 30 μg kg -1 ) over 2 weeks. Sternohyoid muscle isometric and isotonic contractile function was examined ex vivo. Muscle fibre centronucleation and muscle cellular infiltration, collagen content, fibre-type distribution and fibre cross-sectional area were determined by histology and immunofluorescence. Muscle chemokine content was examined by use of a multiplex assay. Sternohyoid peak specific force at 100 Hz was significantly reduced in mdx compared with WT. Drug treatment completely restored force in mdx sternohyoid to WT levels. The percentage of centrally nucleated muscle fibres was significantly increased in mdx, and this was partly ameliorated after drug treatment. The areal

  7. Significance of interleukin-6 (IL-6) and C-reactive protein (CRP) in children and young adults with febrile neutropenia during chemotherapy for cancer: a prospective study.

    PubMed

    Chaudhary, Narendra; Kosaraju, Kranthi; Bhat, Kamalakshi; Bairy, Indira; Borker, Anupama

    2012-11-01

    We evaluated the usefulness of interleukin-6 (IL-6) and C-reactive protein (CRP) at the onset of febrile neutropenia and 72 hours later, in identifying risk groups and assessing response to antibiotic therapy. All episodes of febrile neutropenia were divided in 3 study groups-microbiologically documented infection (MDI), clinically documented infection (CDI), and fever of unknown origin (FUO). Three outcome groups were defined as those responding to first-line antibiotics (R1), those responding to second-line antibiotics (R2), and those requiring antifungal therapy (RAF). Median values of IL-6 and CRP were compared between the groups. There were 57 episodes of febrile neutropenia among 26 patients younger than 25 years during 1 year of study period. On day 1, median IL-6 level was significantly lower in FUO group compared with CDI+MDI groups combined (P < 0.001). Rise in CRP on day 3 was highly significant to differentiate MDI group from other 2 groups (P < 0.001). The CRP also increased significantly on day 3 in RAF (P < 0.001) and R2 (P = 0.002) groups than in R1 group. Low level of IL-6 may help differentiate patients with FUO from those with documented infections. A rising CRP is indicative of serious infection.

  8. Correlation between serum interleukin-6 level and type 1 diabetes mellitus: A systematic review and meta-analysis.

    PubMed

    Chen, Yin-Ling; Qiao, Yong-Chao; Pan, Yan-Hong; Xu, Yan; Huang, Yong-Cheng; Wang, Yin-Hui; Geng, Li-Jun; Zhao, Hai-Lu; Zhang, Xiao-Xi

    2017-06-01

    This report aimed to explore the association between the change of circulating interleukin-6 (IL-6) in patients and the development of type 1 diabetes mellitus (T1DM). Four databases (PubMed, CNKI, WanFang and Civip) were used to search and list all clinical case-control studies about serum IL-6 level in T1DM patients between Jan 1, 2000 and Aug 31, 2016. A total of 20 case-control studies with 1238 T1DM patients and 742 healthy controls were included in this study. Compared to healthy controls, the serum content of IL-6 in patients with T1DM was significantly greater (overall: SMD, 1.49; 95% CI, 1.04 to 1.93; p<0.001), and notably increased in all subgroup with different age, ethnic and disease duration (all p<0.001). Furthermore, the analysis in subgroup exhibited that serum levels of IL-6 in the age greater than 20-year old (SMD, 1.64; 95% CI, 0.57-2.71; p<0.001), the diseased duration among 0-10years (SMD, 2.43; 95% CI, 1.42-3.44; p<0.001) and the sorted American group (SMD, 1.68; 95% CI, 0.85-2.51; p<0.001) were higher than those in control groups. Patients with T1DM were found to be linked to elevated level of serum IL-6, which the age, ethnic and disease durations in T1DM patients had no effect on the serum IL-6 levels for promoting diabetes mellitus. Copyright © 2017. Published by Elsevier Ltd.

  9. Induction of an angiogenic phenotype in endometriotic stromal cell cultures by interleukin-1beta.

    PubMed

    Lebovic, D I; Bentzien, F; Chao, V A; Garrett, E N; Meng, Y G; Taylor, R N

    2000-03-01

    Activated peritoneal macrophages are associated with endometriosis and may play a central role in its aetiology by releasing interleukin-1beta (IL-1beta) in response to refluxed endometrium. Pari passu with the establishment of endometriotic implants is the development of a vascular supply. In this study we investigated the angiogenic properties of two endometrial proteins, vascular endothelial growth factor (VEGF) and interleukin-6 (IL-6), and assessed their production in response to IL-1beta stimulation in human stromal cells isolated from normal endometrium (NE) and endometriotic lesions (EI). Proliferation of bovine brain capillary endothelial cells (BBCE) with a [(3)H]-thymidine incorporation assay was observed when VEGF (2.1 +/- 0.2-fold; P < 0.05) or VEGF and IL-6 (1.8 +/- 0.1-fold; P < 0.05) were added in vitro, relative to saline-treated control cultures. Northern blot analysis showed induction of VEGF mRNA (2.6-fold; P < 0.05) and IL-6 mRNA (6.3-fold; P < 0.05) transcripts in EI cells, but not NE cells, exposed to IL-1beta. A similar induction was seen with VEGF and IL-6 protein secretion in the responsive EI cells. Reverse transcription-polymerase chain reaction (RT-PCR) for the IL-1 receptor type I (IL-1 RI) indicated that the differential effects of IL-1beta on NE and EI cells was associated with 2.4 +/- 0.1-fold more receptor mRNA in EI versus NE cells. We propose that the ability of IL-1beta to activate an angiogenic phenotype in EI stromal cells but not in NE cells, is mediated by the IL-1 RI.

  10. A role for interleukins in ochronosis in a chondrocyte in vitro model of alkaptonuria.

    PubMed

    Mistry, J B; Jackson, D J; Bukhari, M; Taylor, A M

    2016-07-01

    Alkaptonuria is a rare autosomal recessive condition resulting from inability to breakdown homogentisic acid (HGA), an intermediate in tyrosine degradation. The condition has a triad of clinical features, the most damaging of which is ochronotic osteoarthropathy. HGA is elevated from birth, but pigmentation takes many years. We hypothesise that interleukins play a role in initiation and progression of ochronotic osteoarthropathy. C20/A4 cells were cultured and maintained in 9-cm petri dishes containing either HGA at 0.33 mM, a single interleukin (IL-1β, IL-6 or IL-10) at 1 ng/ml or a combination of HGA and a single interleukin. Statistical analysis of pigment deposits and cell viability was performed using analysis of variance with Newman-Keuls post-test. All cultures containing HGA showed a significant increase in pigment deposition compared to control and IL cultures alone. The cultures containing HGA and IL-6 showed a significant increase in pigment deposits compared to HGA alone. The cell viability counts across all cultures on day 10 demonstrated a significant decrease in cultures containing HGA compared to those which did not. There was no significant difference between cultures containing just HGA or those combined with an interleukin. This work demonstrates a role for cytokines present in the joint(s) in the pigmentation process, particularly IL-6, and that the presence of HGA in joint tissues appears more detrimental to chondrocytes than the presence of any of the interleukins found in response to joint injury, trauma and osteoarthritis (OA). This further supports the evidence that the arthropathy in alkaptonuria is much more severe and rapidly progressing.

  11. The plasma interleukin-6 response to acute psychosocial stress in humans is detected by a magnetic multiplex assay: comparison to high-sensitivity ELISA.

    PubMed

    Quinn, Andrea M; Williams, Allison R; Sivilli, Teresa I; Raison, Charles L; Pace, Thaddeus W W

    2018-03-13

    Circulating concentrations of interleukin (IL)-6, an inflammatory biomarker widely assessed in humans to study the inflammatory response to acute psychological stress, have for decades been quantified using enzyme-linked immunosorbent assay (ELISA). However, biobehavioral researchers are increasingly using cytokine multiplex assays instead of ELISA to measure IL-6 and other cytokines. Despite this trend, multiplex assays have not been directly compared to ELISA for their ability to detect subtle stress-induced changes of IL-6. Here, we tested the prediction that a high-sensitivity multiplex assay (human Magnetic Luminex Performance Assay, R&D Systems, Minneapolis, MN) would detect changes in IL-6 as a result of acute stress challenge in a manner comparable to high-sensitivity ELISA. Blood was collected from 12 healthy adults immediately before and then 90 and 210 min after the start of the Trier Social Stress Test (TSST), an acute laboratory psychosocial stress challenge. In addition to quantifying IL-6 concentrations in plasma with both multiplex and ELISA, we also assessed concentrations of tumor necrosis factor-alpha, IL-8, IL-10, IL-5, and IL-2 with multiplex. The multiplex detected IL-6 in all samples. Concentrations strongly correlated with values determined by ELISA across all samples (r = 0.941, p < .001) as well as among samples collected at individual TSST time points. IL-6 responses to the TSST (i.e. area under the curve) captured by multiplex and ELISA were also strongly correlated (r s   = 0.937, p < .001). While other cytokines were detected by multiplex, none changed as a result of TSST challenge at time points examined. These results suggest high-sensitivity magnetic multiplex assay is able to detect changes in plasma concentrations of IL-6 as a result of acute stress in humans.

  12. Interleukin 1 increases thymidine labeling index of normal tissues of mic but not the tumor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zaghloul, M.S.; Dorie, M.J.; Kallman, R.F.

    1994-07-01

    This study was conducted to investigate the action of human recombinant interleukin 1 as a radioprotector for different mouse normal cells other than bone marrow cells. Semi-continuous injections of tritiated thymidine were administered every 6 h, over 24 h to determine thymidine labeling index. Mice were injected with recombinant human interleukin 1 24 h prior to tritiated thymidine and were compared to control animals that did not receive interleukin 1. Mice were killed 1 h after the last thymidine injection. The 24 h thymidine labeling index for normal tissues and RIF-1 tumor was determined. Labeling indices were also determined 1-14more » days after a series of fractionated irradiations with or without pretreatment with a single dose of interleukin 1 administered 24 h prior to the first radiation. The thymidine labeling index of normal tissues was higher following the injection of recombinant human interleukin 1 24 h before radiolabeling. This was found in all normal tissues tested. The thymidine labeling index of RIF-1 fibrosarcoma was not affected by interleukin 1 injection. A single interleukin 1 injection 24 h before the first radiation fraction also increased the thymidine labeling indices of normal tissues after localized fractionated irradiation. The thymidine labeling index of RIF-1 tumor was not increased by interleukin 1 administration except after relatively high radiation doses (20 Gy in five fractions). The ability of interleukin 1 to enhance the thymidine labeling index declined after the first day following the completion of fractionated irradiation. Recombinant human interleukin 1 increased the 24 h thymidine labeling index in normal tissues in mice, but not in RIF-1 tumor. Fractionated irradiation could maintain the effect of a single dose of interleukin 1, administered 24 h prior to the first fraction, up to 24 h after the end of radiation. 25 refs., 3 figs., 1 tab.« less

  13. Health behaviors predict higher interleukin-6 levels among patients newly diagnosed with head and neck squamous cell carcinoma.

    PubMed

    Duffy, Sonia A; Teknos, Theodoros; Taylor, Jeremy M G; Fowler, Karen E; Islam, Mozaffarul; Wolf, Gregory T; McLean, Scott; Ghanem, Tamer A; Terrell, Jeffrey E

    2013-03-01

    Health behaviors have been shown to be associated with recurrence risk and survival rates in patients with cancer and are also associated with interleukin-6 (IL-6) levels, but few epidemiologic studies have investigated the relationship of health behaviors and IL-6 among cancer populations. The purpose of the study is to look at the relationship between five health behaviors, viz.: smoking, alcohol problems, body mass index (BMI; a marker of nutritional status), physical activity, and sleep and pretreatment IL-6 levels in persons with head and neck cancer. Patients (N = 409) were recruited in otolaryngology clinic waiting rooms and invited to complete written surveys. A medical record audit was also conducted. Descriptive statistics and multivariate analyses were conducted to determine which health behaviors were associated with higher IL-6 levels controlling for demographic and clinical variables among patients with newly diagnosed head and neck cancer. While smoking, alcohol problems, BMI, physical activity, and sleep were associated with IL-6 levels in bivariate analysis, only smoking (current and former) and decreased sleep were independent predictors of higher IL-6 levels in multivariate regression analysis. Covariates associated with higher IL-6 levels were age and higher tumor stage, whereas comorbidities were marginally significant. Health behaviors, particularly smoking and sleep disturbances, are associated with higher IL-6 levels among patients with head and neck cancer. Treating health behavior problems, especially smoking and sleep disturbances, may be beneficial to decreasing IL-6 levels, which could have a beneficial effect on overall cancer treatment outcomes.

  14. Features of Postoperative Immune Suppression Are Reversible With Interferon Gamma and Independent of Interleukin-6 Pathways.

    PubMed

    Longbottom, E Rebecca; Torrance, Hew D T; Owen, Helen C; Fragkou, Paraskevi C; Hinds, Charles J; Pearse, Rupert M; O'Dwyer, Michael J

    2016-08-01

    The aim of this study was to evaluate the role of interleukin (IL)-6 pathways in postoperative immune suppression and to assess the reversibility of this phenomenon. The postoperative period is characterized by increased IL-6 production and features of immune suppression. In vitro, IL-6 mediates anti-inflammatory effects through inhibition of interferon gamma (IFN-γ) pathways. The significance of the immunomodulatory effects of IL-6 in the clinical setting of postoperative immune suppression remains unclear. Patients over 45 years old undergoing elective surgery, involving the gastrointestinal tract, were recruited. IL-6 levels were assayed using an enzyme linked immunosorbent assay preoperatively, and at 24 and 48 hours. Peripheral blood mononuclear cells from healthy volunteers were cultured in perioperative serum and CD14Human Leukocyte Antigen-DR (HLA-DR) [monocyte HLA-DR (mHLA-DR)] geometric mean florescent intensity was measured in the presence and absence of IL-6 neutralizing antibody and recombinant IFN-γ. Of the 108 patients, 41 developed a postoperative infection. The IL-6 levels increased 19-fold from the preoperative sample to 24 hours postoperatively (P < 0.0001). Higher IL-6 levels at 24 (P = 0.0002) and 48 hours (P = 0.003) were associated with subsequent postoperative infectious complications. mHLA-DR mean florescent intensity fell when healthy peripheral blood mononuclear cells were cultured with postoperative serum compared with preoperative serum (P = 0.008). This decrease was prevented by the presence of IFN-γ in the culture media, but not by the presence of IL-6-neutralizing antibody. IL-6 levels increase after a major surgery and are associated with an increased susceptibility to postoperative infections. Serum obtained from postoperative patients induces an immunosuppressive response, reflected in reduced mHLA-DR levels, mediated through IL-6 independent pathways and is reversible with IFN-γ. These data may have

  15. Significance of the interleukin-1 receptor antagonist/interleukin-1 beta ratio as a prognostic factor in patients with pulmonary sarcoidosis.

    PubMed

    Mikuniya, T; Nagai, S; Takeuchi, M; Mio, T; Hoshino, Y; Miki, H; Shigematsu, M; Hamada, K; Izumi, T

    2000-01-01

    Various factors such as serum angiotensin-converting enzyme (sACE) activity, bronchoalveolar lavage (BAL) fluid lymphocyte percent, CD4/CD8 ratio, and shadows on chest radiograph have been identified as indexes of disease activity in patients with sarcoidosis. However, it remains to be confirmed whether these factors can predict clinical outcomes. To examine whether the interleukin-1 receptor antagonist (IL-1ra)/IL-1 beta ratio can predict the clinical course, we prospectively followed the clinical courses of 30 patients with pulmonary sarcoidosis 4 years after measurement of immunoreactive amounts of IL-1ra or IL-1 beta in the culture supernatants obtained from BAL fluid macrophages. Immunoreactive amounts of IL-1ra or IL-1 beta were measured using ELISA. Changes in pulmonary function, sACE activity, and shadows on chest radiographs during observation periods were evaluated as markers of changes in disease activity. We found that the patients whose shadows on chest radiographs showed improvement had a higher molar IL-1ra/IL-1 beta ratio than the patients whose shadows persistently remained 4 years after BAL examination (p < 0.05). The molar ratio was found to be positively correlated with improvement of percent vital capacity (p < 0.05) and negatively correlated with the ratio of sACE activity at the time of the last observation to sACE activity at the time of BAL (sACE(LAST)/sACE(BAL), p < 0.01). The sACE(LAST)/sACE(BAL) ratio was significantly lower in patients whose shadows on chest radiographs decreased than in those whose shadows remained unchanged (p < 0.005). The IL-1ra/IL-1 beta ratio in the BAL fluid macrophage culture supernatants in patients with pulmonary sarcoidosis could be a useful marker in predicting the persistence of granulomatous lesions (chronicity). Copyright 2000 S. Karger AG, Basel

  16. [Effects of prophylactic antibiotic agent on interleukin-6 level in open chest surgery--comparison between imipenem and flomoxef].

    PubMed

    Sohma, A; Kitaura, K; Toda, S; Satoh, S; Wada, Y; Yamagishi, H; Oka, T; Fujita, N

    1998-09-01

    Cytokines are known to increase in the patients subjected to open chest surgery. Those patients are usually administered with antibiotic agents for prophylaxis, while some of antibiotic agents might yield significantly higher level of cytokines than other agents especially in patients suffering from severe infections. It is believed that imipenem may yield lower interleukin-6 (IL6) level than cephem antibiotics. To study whether such difference could be observed in the patients who show no sign of severe infections, a total of 13 patients underwent scheduled open chest surgery were allocated at random into two groups, the imipenem-group and the flomoxef-group. The cytokine levels of the patients in the two groups were compared, while the prophylactic administration of imipenem or flomoxef. In both groups, IL6 increased immediately after the operation while endotoxin remained unchanged. Thereafter IL6 decreased gradually in both groups, however, the decrease of IL6 in the imipenem-group was faster and greater than the flomoxef-group resulting in the significantly lower level of IL6 on the 4th day after operation. One week after the operation, there existed no difference in the IL6 levels between these two groups. In conclusion, it was suggested that, depending on the choice of a prophylactic antibiotic agent, some invasive burden could be added to those patients underwent open chest surgery, a certain number of whom would develop severe infection.

  17. Characterization of mouse natural killer cell activating factor (NKAF) induced by OK-432: evidence for interferon- and interleukin 2-independent NK cell activation.

    PubMed Central

    Ichimura, O.; Suzuki, S.; Sugawara, Y.; Osawa, T.

    1984-01-01

    The bacterial immunopotentiator OK-432 induced natural killer cell activating factor (NKAF) from mouse spleen cells. OK-432-induced NKAF showed a single peak with an apparent mol. wt of 70 Kd by Sephadex G-100 chromatography and OK-432-induced interleukin 2 (IL-2) had the same mol. wt as NKAF. However, OK-432-induced interferon (IFN) showed molecular heterogeneity with two peaks at 90 Kd and 45 Kd. Further purification was achieved by Blue Sepharose affinity chromatography which copurified NKAF and IFN. The affinity-purified NKAF, however, was stable to heat (56 degrees C) and acid (pH 2) treatments. Moreover, anti-IFN failed to abolish NKAF activity and this activity was not absorbed by IL-2 dependent T cells. From isoelectric focusing analysis, a dissociation of NKAF and IFN was observed over the range of pI 6.5 to 8.0. Based on these results, KNAF appears to be a new kind of cytokine distinguishable from IFN and IL-2. PMID:6204667

  18. Jejunal brush border microvillous alterations in Giardia muris-infected mice: role of T lymphocytes and interleukin-6.

    PubMed

    Scott, K G; Logan, M R; Klammer, G M; Teoh, D A; Buret, A G

    2000-06-01

    Intestinal colonization with the protozoan Giardia causes diffuse brush border microvillous alterations and disaccharidase deficiencies, which in turn are responsible for intestinal malabsorption and maldigestion. The role of T cells and/or cytokines in the pathogenesis of Giardia-induced microvillous injury remains unclear. The aim of this study was to assess the role of T cells and interleukin-6 (IL-6) in the brush border pathophysiology of acute murine giardiasis in vivo. Athymic nude (nu(-)/nu(-)) CD-1 mice and isogenic immunocompetent (nu(+)/nu(+)) CD-1 mice (4 weeks old) received an axenic Giardia muris trophozoite inoculum or vehicle (control) via orogastric gavage. Weight gain and food intake were assessed daily. On day 6, segments of jejunum were assessed for parasite load, brush border ultrastructure, IL-6 content, maltase and sucrase activities, villus-crypt architecture, and intraepithelial lymphocyte (IEL) infiltration. Despite similar parasitic loads on day 6, infected immunocompetent animals, but not infected nude mice, showed a diffuse loss of brush border microvillous surface area, which was correlated with a significant reduction in maltase and sucrase activities and a decrease in jejunal IL-6 concentration. In both athymic control and infected mice, jejunal brush border surface area and disaccharidases were high, but levels of tissue IL-6 were low and comparable to the concentration measured in immunocompetent infected animals. In both immunocompetent and nude mice, infection caused a small but significant increase in the numbers of IELs. These findings suggest that the enterocyte brush border injury and malfunction seen in giardiasis is, at least in part, mediated by thymus-derived T lymphocytes and that suppressed jejunal IL-6 does not necessarily accompany microvillous shortening.

  19. Increased IL-6 levels are not related to NF-κB or HIF-1α transcription factors activity in the vitreous of proliferative diabetic retinopathy.

    PubMed

    Arjamaa, Olli; Pöllönen, Matti; Kinnunen, Kati; Ryhänen, Tuomas; Kaarniranta, Kai

    2011-01-01

    The purpose was to assess the activity of nuclear factor (NF)-κB and hypoxia inducible factor (HIF)-1α transcription factors and the expression levels of inflammation markers [interleukin (IL)-6 and IL-8] in the vitreous of patients suffering from proliferative diabetic retinopathy (PDR) scheduled for elective vitreous surgery in a single academic-based retina practice in a prospective clinical study. Twenty-seven patients with PDR were enrolled in the study. The severity of retinopathy was classified (0, 1, 2, 3, 4) and the activity of neovascularization was graded (0, 1, 2, 3, 4) by the surgeon intraoperatively. Samples of the vitreous were collected during surgery, and the activity of NF-κB and HIF-1α transcription factors and the expression levels of IL-6 and IL-8 were measured. The majority of samples fell into the retinopathy class 3 (n = 12) or 4 (n = 13). The level of IL-6 increased from 68.9 ± 46.8 pg/ml to 102.7 ± 94.1 pg/ml, and IL-8 increased from 165.1 ± 136.0 pg/ml to 521.0 ± 870.9 pg/ml (mean ± S.D., nonsignificant change: normality test followed with Mann-Whitney Rank Sum Test). According to the neovascularization activity, the samples fell into grade 1 (n = 7), 2 (n = 12) or 3 (n = 7). In IL-6, there was a statistically significant increase (P < .05) from grade 2 to 3: 58.6 ± 40.3 pg/ml and 158.4 ± 102.5 pg/ml, respectively (Kruskal-Wallis One-Way Analysis of Variance on Ranks followed with Dunn's Method). The level of IL-8 was as follows: in grade 1: 118.0 ± 62.4 pg/ml, in grade 2: 192.3 ± 127.1 pg/ml and in grade 3: 884.3 ± 1161.0 pg/ml (statistically nonsignificant change). There was a statistically significant linear regression between IL-6 and IL-8 (P < .001): IL-6 = 51.88 pg/ml + (0.092*IL-8), r = 0.772. Increased activity of the NF-κB and HIF-1α transcription factors was not observed. Interleukin-6 is a candidate to indicate activity of neovascularization process in PDR. It might be a new molecular therapeutic target to

  20. Role of the JAKs/STATs pathway in the intracellular calcium changes induced by interleukin-6 in hippocampal neurons.

    PubMed

    Orellana, D I; Quintanilla, R A; Gonzalez-Billault, C; Maccioni, R B

    2005-11-01

    Recent studies show that inflammation has an active role in the onset of neurodegenerative diseases. It is known that in response to extracellular insults microglia and/or astrocytes produce inflammatory agents. These contribute to the neuropathological events in the aging process and neuronal degeneration. Interleukin-6 (IL-6) has been involved in the pathogenesis of neurodegenerative disorders, such as Alzheimer's and Parkinson's diseases. Here, we show that IL-6 treatment of rat hippocampal neurons increases the calcium influx via NMDA-receptor, an effect that is prevented by the specific NMDA receptor antagonist MK-801 (dizocilpine). We also show that this calcium influx is mediated by the JAKs/STATs pathway, since the inhibitor of JAKs/STATs pathway, JAK 3 inhibitor, blocks calcium influx even in the presence of IL-6. This increase in calcium signal was dependent on external sources, since this signal was not observed in the presence of EGTA. Additional studies indicate that the increase in cytosolic calcium induces tau protein hyperphosphorylation, as revealed by using specific antibodies against Alzheimer phosphoepitopes. This anomalous tau hyperphosphorylation was dependent on both the JAKs/STATs pathway and NMDA receptor. These results suggest that IL-6 would induce a cascade of molecular events that produce a calcium influx through NMDA receptors, mediated by the JAKs/STATs pathway, which subsequently modifies the tau hyperphosphorylation patterns.