Science.gov

Sample records for factor-1 alpha gene

  1. Cloning, expression and evolution of the gene encoding the elongation factor 1alpha from a low thermophilic Sulfolobus solfataricus strain.

    PubMed

    Masullo, Mariorosario; Cantiello, Piergiuseppe; Lamberti, Annalisa; Longo, Olimpia; Fiengo, Antonio; Arcari, Paolo

    2003-01-28

    The gene encoding the elongation factor 1alpha (EF-1alpha) from the archaeon Sulfolobus solfataricus strain MT3 (optimum growth temperature 75 degrees C) was cloned, sequenced and expressed in Escherichia coli. The structural and biochemical properties of the purified enzyme were compared to those of EF-1alpha isolated from S. solfataricus strain MT4 (optimum growth temperature 87 degrees C). Only one amino acid change (Val15-->Ile) was found. Interestingly, the difference was in the first guanine nucleotide binding consensus sequence G(13)HIDHGK and was responsible for a reduced efficiency in protein synthesis, which was accompanied by an increased affinity for both guanosine diphosphate (GDP) and guanosine triphosphate (GTP), and an increased efficiency in the intrinsic GTPase activity. Despite the different thermophilicities of the two microorganisms, only very marginal effects on the thermal properties of the enzyme were observed. Molecular evolution among EF-1alpha genes from Sulfolobus species showed that the average rate of nucleotide substitution per site per year (0.0312x10(-9)) is lower than that reported for other functional genes.

  2. Polymorphisms in the hypoxia-inducible factor 1 alpha gene in Mexican patients with preeclampsia: A case-control study

    PubMed Central

    2011-01-01

    Background Although the etiology of preeclampsia is still unclear, recent work suggests that changes in circulating angiogenic factors play a key role in its pathogenesis. In the trophoblast of women with preeclampsia, hypoxia-inducible factor 1 alpha (HIF-1α) is over-expressed, and induces the expression of non-angiogenic factors and inhibitors of trophoblast differentiation. This observation prompted the study of HIF-1α and its relation to preeclampsia. It has been described that the C1772T (P582S) and G1790A (A588T) polymorphisms of the HIF1A gene have significantly greater transcriptional activity, correlated with an increased expression of their proteins, than the wild-type sequence. In this work, we studied whether either or both HIF1A variants contribute to preeclampsia susceptibility. Results Genomic DNA was isolated from 150 preeclamptic and 105 healthy pregnant women. Exon 12 of the HIF1A gene was amplified by PCR, and the genotypes of HIF1A were determined by DNA sequencing. In preeclamptic women and controls, the frequencies of the T allele for C1772T were 4.3 vs. 4.8%, and the frequencies of the A allele for G1790A were 0.0 vs. 0.5%, respectively. No significant differences were found between groups. Conclusion The frequency of the C1772T and G1790A polymorphisms of the HIF1A gene is very low, and neither polymorphism is associated with the development of preeclampsia in the Mexican population. PMID:21414224

  3. Two genes encode related cytoplasmic elongation factors 1 alpha (EF-1 alpha) in Drosophila melanogaster with continuous and stage specific expression.

    PubMed Central

    Hovemann, B; Richter, S; Walldorf, U; Cziepluch, C

    1988-01-01

    We have characterized two previously cloned genes, F1 and F2 (1) that code for elongation factor EF - 1 alpha of Drosophila melanogaster. Genomic Southern blot hybridization revealed that they are the only gene copies present. We isolated cDNA clones of both transcripts from embryonal and pupal stage of development that cover the entire transcription unit. The 5' ends of both genes have been determined by primer extension and for F1 also by RNA sequencing. These start sites have been shown to be used consistently during development. Comparison of cDNA and genomic sequences revealed that EF - 1 alpha,F1 consists of two and EF - 1 alpha,F2 of five exons. The two described elongation factor genes exhibit several regions of strong sequence conservation when compared to five recently cloned eucaryotic elongation factors. Images PMID:3131735

  4. Transcription enhancer factor 1 interacts with a basic helix-loop-helix zipper protein, Max, for positive regulation of cardiac alpha-myosin heavy-chain gene expression.

    PubMed Central

    Gupta, M P; Amin, C S; Gupta, M; Hay, N; Zak, R

    1997-01-01

    The M-CAT binding factor transcription enhancer factor 1 (TEF-1) has been implicated in the regulation of several cardiac and skeletal muscle genes. Previously, we identified an E-box-M-CAT hybrid (EM) motif that is responsible for the basal and cyclic AMP-inducible expression of the rat cardiac alpha-myosin heavy chain (alpha-MHC) gene in cardiac myocytes. In this study, we report that two factors, TEF-1 and a basic helix-loop-helix leucine zipper protein, Max, bind to the alpha-MHC EM motif. We also found that Max was a part of the cardiac troponin T M-CAT-TEF-1 complex even when the DNA template did not contain an apparent E-box binding site. In the protein-protein interaction assay, a stable association of Max with TEF-1 was observed when glutathione S-transferase (GST)-TEF-1 or GST-Max was used to pull down in vitro-translated Max or TEF-1, respectively. In addition, Max was coimmunoprecipitated with TEF-1, thus documenting an in vivo TEF-1-Max interaction. In the transient transcription assay, overexpression of either Max or TEF-1 resulted a mild activation of the alpha-MHC-chloramphenicol acetyltransferase (CAT) reporter gene at lower concentrations and repression of this gene at higher concentrations. However, when Max and TEF-1 expression plasmids were transfected together, the repression mediated by a single expression plasmid was alleviated and a three- to fourfold transactivation of the alpha-MHC-CAT reporter gene was observed. This effect was abolished once the EM motif in the promoter-reporter construct was mutated, thus suggesting that the synergistic transactivation function of the TEF-1-Max heterotypic complex is mediated through binding of the complex to the EM motif. These results demonstrate a novel association between Max and TEF-1 and indicate a positive cooperation between these two factors in alpha-MHC gene regulation. PMID:9199327

  5. The variant hepatocyte nuclear factor 1 activates the P1 promoter of the human alpha-folate receptor gene in ovarian carcinoma.

    PubMed

    Tomassetti, Antonella; Mangiarotti, Fabio; Mazzi, Mimma; Sforzini, Sabrina; Miotti, Silvia; Galmozzi, Enrico; Elwood, Patrick C; Canevari, Silvana

    2003-02-01

    The alpha folate receptor (alpha FR) is a membrane glycoprotein that binds folates, and mediates their uptake and that of antifolate drugs. alpha FR is absent on ovarian surface epithelium (OSE) but is detectable during early transforming events in this epithelium, with increasing expression levels in association with tumor progression. Analysis of transcriptional regulation of the alpha FR gene have revealed two promoter regions, P1 and P4, flanking exons 1 and 4, respectively, and a requirement for three SP1 sites and an INR element for optimal P4 activity. Here, we focused on the P1 transcription regulation in ovarian carcinoma cells. RNase protection assay indicated that the 5'-untranslated region is heterogeneous because of different start sites and alternative splicing of exon 3. A core region of the P1 promoter was sufficient for maximal promoter activity in ovarian carcinoma cell lines but not in OSE cells or in alpha FR-nonexpressing cell lines. Deletion and mutation analysis of this core promoter identified a cis-regulatory element at position +27 to +33 of the untranslated exon 1, which is responsible for maximum P1 activity. This element formed an abundant DNA-protein complex with nuclear proteins from ovarian cancer cells but not from other cell lines or OSE cells. Competition experiments and supershift assays demonstrated binding of the P1 cis-regulatory element by a transcription factor involved in embryonic development, the variant hepatocyte nuclear factor-1 (vHNF1). Analysis of RNA from various cell lines and surgical specimens confirmed that vHNF1 is expressed in ovarian carcinomas. Thus, vHNF1 regulates tissue-specific transcription in ovarian carcinoma.

  6. The novel hypoxic cytotoxin, TX-2098 has antitumor effect in pancreatic cancer; possible mechanism through inhibiting VEGF and hypoxia inducible factor-1{alpha} targeted gene expression

    SciTech Connect

    Miyake, Kotaro; Nishioka, Masanori; Imura, Satoru; Batmunkh, Erdenebulgan; Uto, Yoshihiro; Nagasawa, Hideko; Hori, Hitoshi; Shimada, Mitsuo

    2012-08-01

    Tumor hypoxia has been considered to be a potential therapeutic target, because hypoxia is a common feature of solid tumors and is associated with their malignant phenotype. In the present study, we investigated the antitumor effect of a novel hypoxic cytotoxin, 3-[2-hydroxyethyl(methyl)amino]-2-quinoxalinecarbonitrile 1,4-dioxide (TX-2098) in inhibiting the expression of hypoxia inducible factor-1{alpha} (HIF-1{alpha}), and consequently vascular endothelial cell growth factor (VEGF) expression in pancreatic cancer. The antitumor effects of TX-2098 under hypoxia were tested against various human pancreatic cancer cell lines using WST-8 assay. VEGF protein induced pancreatic cancer was determined on cell-free supernatant by ELISA. Moreover, nude mice bearing subcutaneously (s.c.) or orthotopically implanted human SUIT-2 were treated with TX-2098. Tumor volume, survival and expression of HIF-1 and associated molecules were evaluated in treatment versus control groups. In vitro, TX-2098 inhibited the proliferation of various pancreatic cancer cell lines. In s.c model, tumors from nude mice injected with pancreatic cancer cells and treated with TX-2098 showed significant reductions in volume (P < 0.01 versus control). Quantitative real-time reverse transcription-PCR analysis revealed that TX-2098 significantly inhibited mRNA expression of the HIF-1 associated molecules, VEGF, glucose transporter 1 and Aldolase A (P < 0.01 versus control). These treatments also prolong the survival in orthotopic models. These results suggest that the effect of TX-2098 in pancreatic cancer might be correlated with the expression of VEGF and HIF-1 targeted molecules. -- Highlights: Black-Right-Pointing-Pointer We designed and synthesized novel hypoxic cytoxin, TX-2098. Black-Right-Pointing-Pointer TX-2098 inhibited the proliferation of human pancreatic cancer cells than TPZ. Black-Right-Pointing-Pointer TX-2098 reduced VEGF protein level than TPZ. Black-Right-Pointing-Pointer TX-2098

  7. Structure and expression of elongation factor 1 alpha in tomato.

    PubMed Central

    Pokalsky, A R; Hiatt, W R; Ridge, N; Rasmussen, R; Houck, C M; Shewmaker, C K

    1989-01-01

    A full-length cDNA clone, LeEF-1, has been isolated from tomato for the alpha subunit of elongation factor 1 (EF-1 alpha), a polypeptide which plays a central role in protein synthesis. The 448 amino acid protein encoded by this cDNA appears highly homologous to other EF-1 alpha s having a high degree of similarity (75-78%) to EF1 alpha previously described from both lower eukaryotes and animals. Southern analysis indicated that EF-1 alpha belongs to a small multigene family of 4-8 members in tomato. The pattern of expression of EF-1 alpha mRNA in various tomato tissues was analyzed by Northern analysis, in vitro translation and in situ hybridization. EF-1 alpha mRNA is an abundant species and higher levels of mRNA were found in developing tissues such as young leaves and green fruit compared to the mRNA levels observed in older tissues. The increased levels of EF-1 alpha mRNA therefore appear to correlate with higher levels of protein synthesis in developing tissues. Images PMID:2748335

  8. Cloning and characterization of the human beta2-glycoprotein I (beta2-GPI) gene promoter: roles of the atypical TATA box and hepatic nuclear factor-1alpha in regulating beta2-GPI promoter activity.

    PubMed Central

    Wang, Hsueh-Hsiao; Chiang, An-Na

    2004-01-01

    Beta2-glycoprotein I (beta2-GPI) is a plasma glycoprotein primarily synthesized in the liver. The interindividual variability of beta2-GPI expression in subjects with various metabolic syndromes and disease states suggests that it may have clinical importance. However, the regulation of beta2-GPI gene expression has not been clarified. To gain more insight into the control of beta2-GPI gene expression, we cloned the 4.1-kb 5'-flanking region and characterized the proximal promoter of the beta2- GPI gene in this study. Cis -acting elements required for beta2-GPI promoter activity were identified with transient transfection assays in the hepatoma cell lines HepG2 and Huh7 and in non-hepatic HeLa cells. Serial deletion analyses of the beta2-GPI 5'-flanking sequence revealed that the region from -197 to +7 had strong promoter activity in hepatoma cells but not in HeLa cells. Truncation and site-directed mutagenesis of putative cis -elements within this region showing an atypical TATA box and a HNF-1 (hepatic nuclear factor-1) element were both essential for the beta2-GPI promoter activity. Subsequent gel mobility shift assays confirmed the interaction of HNF-1alpha with the HNF-1 site residing downstream of the TATA box. Co-transfection of beta2-GPI promoter-luciferase vector with HNF-1alpha expression vector in Huh7 and HNF-1-deficient HeLa cells demonstrated the transactivation effect of HNF-1alpha on beta2-GPI promoter activity. In addition, overexpression of HNF-1alpha enhanced the endogenous beta2-GPI expression. These results suggest that the atypical TATA box and HNF-1 cis-element are critical for beta2-GPI transcription and HNF-1alpha may play an important role in cell-specific regulation of beta2-GPI gene expression. PMID:14984368

  9. Hypoxia-inducible factor-1alpha blocks differentiation of malignant gliomas.

    PubMed

    Lu, Huimin; Li, Yan; Shu, Minfeng; Tang, Jianjun; Huang, Yijun; Zhou, Yuxi; Liang, Yingjie; Yan, Guangmei

    2009-12-01

    Aberrant differentiation is a characteristic feature of neoplastic transformation, while hypoxia in solid tumors is believed to be linked to aggressive behavior and poor prognosis. However, the possible relationship between hypoxia and differentiation in malignancies remains poorly defined. Here we show that rat C6 and primary human malignant glioma cells can be induced to differentiate into astrocytes by the well-known adenylate cyclase activator forskolin. However, hypoxia-inducible factor-1alpha expression stimulated by the hypoxia mimetics cobalt chloride or deferoxamine blocks this differentiation and this effectiveness is reversible upon withdrawal of the hypoxia mimetics. Importantly, knockdown of hypoxia inducible factor-1alpha by RNA interference restores the differentiation capabilities of the cells, even in the presence of cobalt chloride, whereas stabilization of hypoxia-inducible factor-1alpha through retarded ubiquitination by von Hippel-Lindau tumor suppressor gene silence abrogates the induced differentiation. Moreover, targeting of HIF-1 using chetomin, a disrupter of HIF-1 binding to its transcriptional co-activator CREB-binding protein (CBP)/p300, abolishes the differentiation-inhibitory effect of hypoxia-inducible factor-1alpha. Administration of chetomin in combination with forskolin significantly suppresses malignant glioma growth in an in vivo xenograft model. Analysis of 95 human glioma tissues revealed an increase of hypoxia-inducible factor-1alpha protein expression with progressing tumor grade. Taken together, these findings suggest a key signal transduction pathway involving hypoxia-inducible factor-1alpha that contributes to a differentiation defect in malignant gliomas and sheds new light on the differentiation therapy of solid tumors by targeting hypoxia-inducible factor-1alpha.

  10. Temporal expression of the human alcohol dehydrogenase gene family during liver development correlates with differential promoter activation by hepatocyte nuclear factor 1, CCAAT/enhancer-binding protein alpha, liver activator protein, and D-element-binding protein.

    PubMed Central

    van Ooij, C; Snyder, R C; Paeper, B W; Duester, G

    1992-01-01

    The human class I alcohol dehydrogenase (ADH) gene family consists of ADH1, ADH2, and ADH3, which are sequentially activated in early fetal, late fetal, and postnatal liver, respectively. Analysis of ADH promoters revealed differential activation by several factors previously shown to control liver transcription. In cotransfection assays, the ADH1 promoter, but not the ADH2 or ADH3 promoter, was shown to respond to hepatocyte nuclear factor 1 (HNF-1), which has previously been shown to regulate transcription in early liver development. The ADH2 promoter, but not the ADH1 or ADH3 promoter, was shown to respond to CCAAT/enhancer-binding protein alpha (C/EBP alpha), a transcription factor particularly active during late fetal liver and early postnatal liver development. The ADH1, ADH2, and ADH3 promoters all responded to the liver transcription factors liver activator protein (LAP) and D-element-binding protein (DBP), which are most active in postnatal liver. For all three promoters, the activation by LAP or DBP was higher than that seen by HNF-1 or C/EBP alpha, and a significant synergism between C/EBP alpha and LAP was noticed for the ADH2 and ADH3 promoters when both factors were simultaneously cotransfected. A hierarchy of ADH promoter responsiveness to C/EBP alpha and LAP homo- and heterodimers is suggested. In all three ADH genes, LAP bound to the same four sites previously reported for C/EBP alpha (i.e., -160, -120, -40, and -20 bp), but DBP bound strongly only to the site located at -40 bp relative to the transcriptional start. Mutational analysis of ADH2 indicated that the -40 bp element accounts for most of the promoter regulation by the bZIP factors analyzed. These studies suggest that HNF-1 and C/EBP alpha help establish ADH gene family transcription in fetal liver and that LAP and DBP help maintain high-level ADH gene family transcription in postnatal liver. Images PMID:1620113

  11. Molecular characterization and expression analysis of five different elongation factor 1 alpha genes in the flatfish Senegalese sole (Solea senegalensis Kaup): Differential gene expression and thyroid hormones dependence during metamorphosis

    PubMed Central

    Infante, Carlos; Asensio, Esther; Cañavate, José Pedro; Manchado, Manuel

    2008-01-01

    Background Eukaryotic elongation factor 1 alpha (eEF1A) is one of the four subunits composing eukaryotic translation elongation factor 1. It catalyzes the binding of aminoacyl-tRNA to the A-site of the ribosome in a GTP-dependent manner during protein synthesis, although it also seems to play a role in other non-translational processes. Currently, little information is still available about its expression profile and regulation during flatfish metamorphosis. With regard to this, Senegalese sole (Solea senegalensis) is a commercially important flatfish in which eEF1A gene remains to be characterized. Results The development of large-scale genomics of Senegalese sole has facilitated the identification of five different eEF1A genes, referred to as SseEF1A1, SseEF1A2, SseEF1A3, SseEF1A4, and Sse42Sp50. Main characteristics and sequence identities with other fish and mammalian eEF1As are described. Phylogenetic and tissue expression analyses allowed for the identification of SseEF1A1 and SseEF1A2 as the Senegalese sole counterparts of mammalian eEF1A1 and eEF1A2, respectively, and of Sse42Sp50 as the ortholog of Xenopus laevis and teleost 42Sp50 gene. The other two elongation factors, SseEF1A3 and SseEF1A4, represent novel genes that are mainly expressed in gills and skin. The expression profile of the five genes was also studied during larval development, revealing different behaviours. To study the possible regulation of SseEF1A gene expressions by thyroid hormones (THs), larvae were exposed to the goitrogen thiourea (TU). TU-treated larvae exhibited lower SseEF1A4 mRNA levels than untreated controls at both 11 and 15 days after treatment, whereas transcripts of the other four genes remained relatively unchanged. Moreover, addition of exogenous T4 hormone to TU-treated larvae increased significantly the steady-state levels of SseEF1A4 with respect to untreated controls, demonstrating that its expression is up-regulated by THs. Conclusion We have identified five

  12. Tumor Necrosis Factor Alpha and Insulin-Like Growth Factor 1 Induced Modifications of the Gene Expression Kinetics of Differentiating Skeletal Muscle Cells

    PubMed Central

    Meyer, Swanhild U.; Krebs, Stefan; Thirion, Christian; Blum, Helmut; Krause, Sabine; Pfaffl, Michael W.

    2015-01-01

    Introduction TNF-α levels are increased during muscle wasting and chronic muscle degeneration and regeneration processes, which are characteristic for primary muscle disorders. Pathologically increased TNF-α levels have a negative effect on muscle cell differentiation efficiency, while IGF1 can have a positive effect; therefore, we intended to elucidate the impact of TNF-α and IGF1 on gene expression during the early stages of skeletal muscle cell differentiation. Methodology/Principal Findings This study presents gene expression data of the murine skeletal muscle cells PMI28 during myogenic differentiation or differentiation with TNF-α or IGF1 exposure at 0 h, 4 h, 12 h, 24 h, and 72 h after induction. Our study detected significant coregulation of gene sets involved in myoblast differentiation or in the response to TNF-α. Gene expression data revealed a time- and treatment-dependent regulation of signaling pathways, which are prominent in myogenic differentiation. We identified enrichment of pathways, which have not been specifically linked to myoblast differentiation such as doublecortin-like kinase pathway associations as well as enrichment of specific semaphorin isoforms. Moreover to the best of our knowledge, this is the first description of a specific inverse regulation of the following genes in myoblast differentiation and response to TNF-α: Aknad1, Cmbl, Sepp1, Ndst4, Tecrl, Unc13c, Spats2l, Lix1, Csdc2, Cpa1, Parm1, Serpinb2, Aspn, Fibin, Slc40a1, Nrk, and Mybpc1. We identified a gene subset (Nfkbia, Nfkb2, Mmp9, Mef2c, Gpx, and Pgam2), which is robustly regulated by TNF-α across independent myogenic differentiation studies. Conclusions This is the largest dataset revealing the impact of TNF-α or IGF1 treatment on gene expression kinetics of early in vitro skeletal myoblast differentiation. We identified novel mRNAs, which have not yet been associated with skeletal muscle differentiation or response to TNF-α. Results of this study may facilitate

  13. Hypoxia-inducible factor-1alpha regulates the expression of nucleotide excision repair proteins in keratinocytes.

    PubMed

    Rezvani, Hamid Reza; Mahfouf, Walid; Ali, Nsrein; Chemin, Cecile; Ged, Cecile; Kim, Arianna L; de Verneuil, Hubert; Taïeb, Alain; Bickers, David R; Mazurier, Frédéric

    2010-01-01

    The regulation of DNA repair enzymes is crucial for cancer prevention, initiation, and therapy. We have studied the effect of ultraviolet B (UVB) radiation on the expression of the two nucleotide excision repair factors (XPC and XPD) in human keratinocytes. We show that hypoxia-inducible factor-1alpha (HIF-1alpha) is involved in the regulation of XPC and XPD. Early UVB-induced downregulation of HIF-1alpha increased XPC mRNA expression due to competition between HIF-1alpha and Sp1 for their overlapping binding sites. Late UVB-induced enhanced phosphorylation of HIF-1alpha protein upregulated XPC mRNA expression by direct binding to a separate hypoxia response element (HRE) in the XPC promoter region. HIF-1alpha also regulated XPD expression by binding to a region of seven overlapping HREs in its promoter. Quantitative chromatin immunoprecipitation assays further revealed putative HREs in the genes encoding other DNA repair proteins (XPB, XPG, CSA and CSB), suggesting that HIF-1alpha is a key regulator of the DNA repair machinery. Analysis of the repair kinetics of 6-4 photoproducts and cyclobutane pyrimidine dimers also revealed that HIF-1alpha downregulation led to an increased rate of immediate removal of both photolesions but attenuated their late removal following UVB irradiation, indicating the functional effects of HIF-1alpha in the repair of UVB-induced DNA damage.

  14. Targeted genes and interacting proteins of hypoxia inducible factor-1

    PubMed Central

    Liu, Wei; Shen, Shao-Ming; Zhao, Xu-Yun; Chen, Guo-Qiang

    2012-01-01

    Heterodimeric transcription factor hypoxia inducible factor-1 (HIF-1) functions as a master regulator of oxygen homeostasis in almost all nucleated mammalian cells. The fundamental process adapted to cellular oxygen alteration largely depends on the refined regulation on its alpha subunit, HIF-1α. Recent studies have unraveled expanding and critical roles of HIF-1α, involving in a multitude of developmental, physiological, and pathophysiological processes. This review will focus on the current knowledge of HIF-1α-targeting genes and its interacting proteins, as well as the concomitant functional relationships between them. PMID:22773957

  15. Hypoxia-inducible factor-1alpha signaling in aquaporin upregulation after traumatic brain injury.

    PubMed

    Ding, Jamie Y; Kreipke, Christian W; Speirs, Susan L; Schafer, Patrick; Schafer, Steven; Rafols, José A

    2009-03-27

    Previous studies have demonstrated that traumatic brain injury (TBI) causes brain edema via aquaporins (AQPs), the water-transporting proteins. In the present study, we determined the role of hypoxia inducible factor-1alpha (HIF-1alpha), which is a transcription factor in response to physiological hypoxia, in regulating expression of AQP4 and AQP9. Adult male Sprague-Dawley rats (400-425g) received a closed head injury using the Marmarou weight drop model with a 450g weight and survived for 1, 4, 24 and 48h. Some animals were administered 30min after injury with 2-methoxyestradiol (2ME2), a naturally occurring metabolite of estradiol which is known to post-transcriptionally down-regulate HIF-1alpha expression, and sacrificed 4h after injury. Real-time PCR and Western blot were used, respectively, to detect gene and protein expressions of manganese superoxide dismutase (MnSOD, showing hypoxic stress), HIF-1alpha, AQP4, and AQP9. ANOVA analysis demonstrated a significant (p<0.05) increase in gene expression of MnSOD, HIF-1alpha, AQP4, and AQP9, starting at 1h after injury through 48h. Western blot analysis further indicated a significant (p<0.05) increase in protein expression of these molecules at the same time points. Pharmacological inhibition of HIF-1alpha by 2ME2 reduced the up-regulated levels of AQP4 and AQP9 after TBI. The present study suggests that hypoxic conditions determined by MnSOD expression after closed head injury contribute to HIF-1alpha expression. HIF-1alpha, in turn, up-regulates expression of AQP4 and AQP9. These results characterize the pathophysiological mechanisms, and suggest possible therapeutic targets for TBI patients.

  16. Induction of hypervascularity without leakage or inflammation in transgenic mice overexpressing hypoxia-inducible factor-1alpha.

    PubMed

    Elson, D A; Thurston, G; Huang, L E; Ginzinger, D G; McDonald, D M; Johnson, R S; Arbeit, J M

    2001-10-01

    Hypoxia-inducible factor-1alpha (HIF-1alpha) transactivates genes required for energy metabolism and tissue perfusion and is necessary for embryonic development and tumor explant growth. HIF-1alpha is overexpressed during carcinogenesis, myocardial infarction, and wound healing; however, the biological consequences of HIF-1alpha overexpression are unknown. Here, transgenic mice expressing constitutively active HIF-1alpha in epidermis displayed a 66% increase in dermal capillaries, a 13-fold elevation of total vascular endothelial growth factor (VEGF) expression, and a six- to ninefold induction of each VEGF isoform. Despite marked induction of hypervascularity, HIF-1alpha did not induce edema, inflammation, or vascular leakage, phenotypes developing in transgenic mice overexpressing VEGF cDNA in skin. Remarkably, blood vessel leakage resistance induced by HIF-1alpha overexpression was not caused by up-regulation of angiopoietin-1 or angiopoietin-2. Hypervascularity induced by HIF-1alpha could improve therapy of tissue ischemia.

  17. Hypoxia-inducible factor-1alpha suppresses squamous carcinogenic progression and epithelial-mesenchymal transition.

    PubMed

    Scortegagna, Marzia; Martin, Rebecca J; Kladney, Raleigh D; Neumann, Robert G; Arbeit, Jeffrey M

    2009-03-15

    Hypoxia-inducible factor-1 (HIF-1) is a known cancer progression factor, promoting growth, spread, and metastasis. However, in selected contexts, HIF-1 is a tumor suppressor coordinating hypoxic cell cycle suppression and apoptosis. Prior studies focused on HIF-1 function in established malignancy; however, little is known about its role during the entire process of carcinogenesis from neoplasia induction to malignancy. Here, we tested HIF-1 gain of function during multistage murine skin chemical carcinogenesis in K14-HIF-1alpha(Pro402A564G) (K14-HIF-1alphaDPM) transgenic mice. Transgenic papillomas appeared earlier and were more numerous (6 +/- 3 transgenic versus 2 +/- 1.5 nontransgenic papillomas per mouse), yet they were more differentiated, their proliferation was lower, and their malignant conversion was profoundly inhibited (7% in transgenic versus 40% in nontransgenic mice). Moreover, transgenic cancers maintained squamous differentiation whereas epithelial-mesenchymal transformation was frequent in nontransgenic malignancies. Transgenic basal keratinocytes up-regulated the HIF-1 target N-myc downstream regulated gene-1, a known tumor suppressor gene in human malignancy, and its expression was maintained in transgenic papillomas and cancer. We also discovered a novel HIF-1 target gene, selenium binding protein-1 (Selenbp1), a gene of unknown function whose expression is lost in human cancer. Thus, HIF-1 can function as a tumor suppressor through transactivation of genes that are themselves targets for negative selection in human cancers.

  18. The consumption of n-3 polyunsaturated fatty acids differentially modulates gene expression of peroxisome proliferator-activated receptor alpha and gamma and hypoxia-inducible factor 1 alpha in subcutaneous adipose tissue of obese adolescents.

    PubMed

    Mejía-Barradas, César M; Del-Río-Navarro, Blanca E; Domínguez-López, Aarón; Campos-Rodríguez, Rafael; Martínez-Godínez, María de-Los-Á; Rojas-Hernández, Saúl; Lara-Padilla, Eleazar; Abarca-Rojano, Edgar; Miliar-García, Ángel

    2014-02-01

    The aim of this study was to evaluate the effect of long-chain omega-3 polyunsaturated fatty acid (n-3 PUFA) supplementation on metabolic state and gene expression in subcutaneous adipose tissues of obese adolescents. Obese adolescents (n = 26, 10 girls and 16 boys) aged 12.4 ± 2.1 years were assigned to a 12-week regimen of n-3 PUFA intake. Five times per day, subjects received a food supplement consisting of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) (3 g per day, 944 mg EPA, and 2,088 mg DHA). Blood parameters were measured, and subcutaneous adipose tissue biopsies were analyzed to determine gene expression at baseline and after 12 weeks. Student's t test and the Wilcoxon signed-rank test were used to estimate differences in arithmetic means of pre- and post-dietary supplementation for various anthropometric, biochemical, clinical, and gene expression parameters. After 12 weeks, n-3 PUFA consumption was associated with decreased body mass index (29.7 ± 4.6 vs. 27.8 ± 4.4 kg/m(2); P < 0.001), waist circumference (93.2 ± 9.9 vs. 90.5 ± 10.0 cm; P < 0.003), hip circumference (102.9 ± 10.9 vs. 101.1 ± 10.9 cm; P < 0.014), and blood triglyceride levels (220.8 ± 27.4 vs. 99.7 ± 32.7 mg/dL; P < 0.001). Fatty acid supplementation/n3 PUFA supplementation was associated with a downregulated expression of the genes encoding PPARγ and PGC-1α (P < 0.001), and an upregulated expression of the genes encoding PPARα (P < 0.007) and SREBP1 (P < 0.021). The expressions of SOD2 (P < 0.04), CAT (P < 0.001), GPX3 (P < 0.032) and HIF-1α protein also decreased. Our study demonstrated that n-3 PUFA consumption and dietary restriction improved the anthropometric parameters and decreased the triglycerides levels of the adolescents, suggesting a reduction in hypoxia in subcutaneous adipose tissue.

  19. Activation of hypoxia-inducible factor-1; definition of regulatory domains within the alpha subunit.

    PubMed

    Pugh, C W; O'Rourke, J F; Nagao, M; Gleadle, J M; Ratcliffe, P J

    1997-04-25

    Hypoxia-inducible factor-1 (HIF-1), a heterodimeric DNA binding complex composed of two basic-helix-loop-helix Per-AHR-ARNT-Sim proteins (HIF-1alpha and -1beta), is a key component of a widely operative transcriptional response activated by hypoxia, cobaltous ions, and iron chelation. To identify regions of HIF-1 subunits responsible for oxygen-regulated activity, we constructed chimeric genes in which portions of coding sequence from HIF-1 genes were either linked to a heterologous DNA binding domain or encoded between such a DNA binding domain and a constitutive activation domain. Sequences from HIF-1alpha but not HIF-1beta conferred oxygen-regulated activity. Two minimal domains within HIF-1alpha (amino acids 549-582 and amino acids 775-826) were defined by deletional analysis, each of which could act independently to convey inducible responses. Both these regions confer transcriptional activation, and in both cases adjacent sequences appeared functionally repressive in transactivation assays. The inducible operation of the first domain, but not the second, involved major changes in the level of the activator fusion protein in transfected cells, inclusion of this sequence being associated with a marked reduction of expressed protein level in normoxic cells, which was relieved by stimulation with hypoxia, cobaltous ions, or iron chelation. These results lead us to propose a dual mechanism of activation in which the operation of an inducible activation domain is amplified by regulation of transcription factor abundance, most likely occurring through changes in protein stability.

  20. Class II histone deacetylases are associated with VHL-independent regulation of hypoxia-inducible factor 1 alpha.

    PubMed

    Qian, David Z; Kachhap, Sushant K; Collis, Spencer J; Verheul, Henk M W; Carducci, Michael A; Atadja, Peter; Pili, Roberto

    2006-09-01

    Hypoxia-inducible factor 1 alpha (HIF-1 alpha) plays a critical role in transcriptional gene activation involved in tumor angiogenesis. A novel class of agents, the histone deacetylase (HDAC) inhibitors, has been shown to inhibit tumor angiogenesis and HIF-1 alpha protein expression. However, the molecular mechanism responsible for this inhibition remains to be elucidated. In the current study, we investigated the molecular link between HIF-1 alpha inhibition and HDAC inhibition. Treatment of the VHL-deficient human renal cell carcinoma cell line UMRC2 with the hydroxamic HDAC inhibitor LAQ824 resulted in a dose-dependent inhibition of HIF-1 alpha protein via a VHL-independent mechanism and reduction of HIF-1 alpha transcriptional activity. HIF-1 alpha inhibition by LAQ824 was associated with HIF-1 alpha acetylation and polyubiquitination. HIF-1 alpha immunoprecipitates contained HDAC activity. Then, we tested different classes of HDAC inhibitors with diverse inhibitory activity of class I versus class II HDACs and assessed their capability of targeting HIF-1 alpha. Hydroxamic acid derivatives with known activity against both class I and class II HDACs were effective in inhibiting HIF-1 alpha at low nanomolar concentrations. In contrast, valproic acid and trapoxin were able to inhibit HIF-1 alpha only at concentrations that are effective against class II HDACs. Coimmunoprecipitation studies showed that class II HDAC4 and HDAC6 were associated with HIF-1 alpha protein. Inhibition by small interfering RNA of HDAC4 and HDAC6 reduced HIF-1 alpha protein expression and transcriptional activity. Taken together, these results suggest that class II HDACs are associated with HIF-1 alpha stability and provide a rationale for targeting HIF-1 alpha with HDAC inhibitors against class II isozymes.

  1. Elongation factor-1 alpha occurs as two copies in bees: implications for phylogenetic analysis of EF-1 alpha sequences in insects.

    PubMed

    Danforth, B N; Ji, S

    1998-03-01

    We report the complete sequence of a paralogous copy of elongation factor-1 alpha (EF-1 alpha) in the honeybee, Apis mellifera (Hymenoptera: Apidae). This copy differs from a previously described copy in the positions of five introns and in 25% of the nucleotide sites in the coding regions. The existence of two paralogous copies of EF-1 alpha in Drosophila and Apis suggests that two copies of EF-1 alpha may be widespread in the holometabolous insect orders. To distinguish between a single, ancient gene duplication and parallel, independent fly and bee gene duplications, we performed a phylogenetic analysis of hexapod EF-1 alpha sequences. Unweighted parsimony analysis of nucleotide sequences suggests an ancient gene duplication event, whereas weighted parsimony analysis of nucleotides and unweighted parsimony analysis of amino acids suggests the contrary: that EF-1 alpha underwent parallel gene duplications in the Diptera and the Hymenoptera. The hypothesis of parallel gene duplication is supported both by congruence among nucleotide and amino acid data sets and by topology-dependent permutation tail probability (T-PTP) tests. The resulting tree topologies are also congruent with current views on the relationships among the holometabolous orders included in this study (Diptera, Hymenoptera, and Lepidoptera). More sequences, from diverse orders of holometabolous insects, will be needed to more accurately assess the historical patterns of gene duplication in EF-1 alpha.

  2. Biphasic Stimulation of Translational Activity Correlates with Induction of Translation Elongation Factor 1 Subunit [alpha] upon Wounding in Potato Tubers.

    PubMed Central

    Morelli, J. K.; Shewmaker, C. K.; Vayda, M. E.

    1994-01-01

    Potato (Solanum tuberosum) tubers exhibit an increase in translational activity in response to mechanical wounding. The response is biphasic, with an initial stimulation apparent within the first 2 h after wounding and a second increase occurring 12 to 24 h after wounding. Increased activity is apparent by measurement of protein synthesis both in vivo and in vitro using a cell-free extract. Accumulation of the translational elongation factor 1 subunit [alpha] (EF-1[alpha]) parallels translational activity. Changes in the steady-state level of EF-1[alpha] mRNA, and expression of a chimeric EF-1[alpha] promoter/[beta]-glucuronidase construct in transgenic potato tubers, indicate that the gene encoding EF-1[alpha] is transcribed during both periods of translational stimulation. These results indicate that stimulation of translational activity is coordinated with increased expression and accumulation of translation factors. PMID:12232374

  3. Bundling of actin filaments by elongation factor 1 alpha inhibits polymerization at filament ends

    PubMed Central

    1996-01-01

    Elongation factor 1 alpha (EF1 alpha) is an abundant protein that binds aminoacyl-tRNA and ribosomes in a GTP-dependent manner. EF1 alpha also interacts with the cytoskeleton by binding and bundling actin filaments and microtubules. In this report, the effect of purified EF1 alpha on actin polymerization and depolymerization is examined. At molar ratios present in the cytosol, EF1 alpha significantly blocks both polymerization and depolymerization of actin filaments and increases the final extent of actin polymer, while at high molar ratios to actin, EF1 alpha nucleates actin polymerization. Although EF1 alpha binds actin monomer, this monomer-binding activity does not explain the effects of EF1 alpha on actin polymerization at physiological molar ratios. The mechanism for the inhibition of polymerization is related to the actin-bundling activity of EF1 alpha. Both ends of the actin filament are inhibited for polymerization and both bundling and the inhibition of actin polymerization are affected by pH within the same physiological range; at high pH both bundling and the inhibition of actin polymerization are reduced. Additionally, it is seen that the binding of aminoacyl-tRNA to EF1 alpha releases EF1 alpha's inhibiting effect on actin polymerization. These data demonstrate that EF1 alpha can alter the assembly of F-actin, a filamentous scaffold on which non- membrane-associated protein translation may be occurring in vivo. PMID:8947553

  4. Interaction of plant chimeric calcium/calmodulin-dependent protein kinase with a homolog of eukaryotic elongation factor-1alpha

    NASA Technical Reports Server (NTRS)

    Wang, W.; Poovaiah, B. W.

    1999-01-01

    A chimeric Ca2+/calmodulin-dependent protein kinase (CCaMK) was previously cloned and characterized in this laboratory. To investigate the biological functions of CCaMK, the yeast two-hybrid system was used to isolate genes encoding proteins that interact with CCaMK. One of the cDNA clones obtained from the screening (LlEF-1alpha1) has high similarity with the eukaryotic elongation factor-1alpha (EF-1alpha). CCaMK phosphorylated LlEF-1alpha1 in a Ca2+/calmodulin-dependent manner. The phosphorylation site for CCaMK (Thr-257) was identified by site-directed mutagenesis. Interestingly, Thr-257 is located in the putative tRNA-binding region of LlEF-1alpha1. An isoform of Ca2+-dependent protein kinase (CDPK) phosphorylated multiple sites of LlEF-1alpha1 in a Ca2+-dependent but calmodulin-independent manner. Unlike CDPK, CCaMK phosphorylated only one site, and this site is different from CDPK phosphorylation sites. This suggests that the phosphorylation of EF-1alpha by these two kinases may have different functional significance. Although the phosphorylation of LlEF-1alpha1 by CCaMK is Ca2+/calmodulin-dependent, in vitro binding assays revealed that CCaMK binds to LlEF-1alpha1 in a Ca2+-independent manner. This was further substantiated by coimmunoprecipitation of CCaMK and EF-1alpha using the protein extract from lily anthers. Dissociation of CCaMK from EF-1alpha by Ca2+ and phosphorylation of EF-1alpha by CCaMK in a Ca2+/calmodulin-dependent manner suggests that these interactions may play a role in regulating the biological functions of EF-1alpha.

  5. Oxygen-dependent expression of hypoxia-inducible factor-1alpha in renal medullary cells of rats.

    PubMed

    Zou, A P; Yang, Z Z; Li, P L; Cowley AW, J R

    2001-08-28

    Hypoxia-inducible factor-1alpha (HIF-1alpha) is a transcription factor that regulates the oxygen-dependent expression of a number of genes. This transcription factor may contribute to the abundant expression of many genes in renal medullary cells that function normally under hypoxic conditions. The present study was designed to determine the characteristics of HIF-1alpha cDNA cloned from the rat kidney and the expression profile of HIF-1alpha in different kidney regions and to explore the mechanism activating or regulating HIF-1alpha expression in renal medullary cells. A 3,718-bp HIF-1alpha cDNA from the rat kidney was first cloned and sequenced using RT-PCR and TA cloning technique. It was found that 823 amino acids deduced from this renal HIF-1alpha cDNA had 99%, 96%, and 90% identity with rat, mouse, or human HIF-1alpha deposited in GenBank, respectively. The 3'-untranslated region of HIF-1alpha mRNA from the rat kidney contained seven AUUUA instability elements, five of which were found to be conserved among rat, mouse, and human HIF-1alpha. Northern blot analyses demonstrated a corticomedullary gradient of HIF-1alpha mRNA expression in the kidney, with the greatest abundance in the renal inner medulla. Western blot analyses also detected a higher HIF-1alpha protein level in the nuclear extracts from the renal medulla than the renal cortex. A classic loop diuretic, furosemide (10 mg/kg ip), markedly increased renal medullary Po(2) levels from 22.5 to 52.2 mmHg, which was accompanied by a significant reduction of HIF-1alpha transcripts in renal medullary tissue. In in vitro experiments, low Po(2), but not elevated osmolarity, was found to significantly increase HIF-1alpha mRNA in renal medullary interstitial cells and inner medullary collecting duct cells. These results indicate that HIF-1alpha is more abundantly expressed in the renal medulla compared with the renal cortex. Increased abundance of HIF-1alpha mRNA in the renal medulla may represent an adaptive

  6. Elongation factor 1-alpha is released into the culture medium during growth of Giardia intestinalis trophozoites.

    PubMed

    Skarin, Hanna; Ringqvist, Emma; Hellman, Ulf; Svärd, Staffan G

    2011-04-01

    The molecular pathogenesis of the intestinal parasite Giardia intestinalis is still not fully understood but excretory-secretory products have been suggested to be important during host-parasite interactions. Here we used SDS-PAGE gels and MALDI-TOF analysis to identify proteins released by Giardia trophozoites during in vitro growth. Serum proteins (mainly bovine serum albumin) in the growth medium, bind to the parasite surface and they are continuously released, which interfere with parasite secretome characterization. However, we identified two released Giardia proteins: elongation factor-1 alpha (EF-1α) and a 58 kDa protein, identified as arginine deiminase (ADI). This is the first description of EF-1α as a released/secreted Giardia protein, whereas ADI has been identified in an earlier secretome study. Two genes encoding EF-1α were detected in the Giardia WB genome 35 kbp apart with almost identical coding sequences but with different promoter and 3' regions. Promoter luciferase-fusions showed that both genes are transcribed in trophozoites. The EF-1α protein localizes to the nuclear region in trophozoites but it relocalizes to the cytoplasm during host-cell interaction. Recombinant EF-1α is recognized by serum from giardiasis patients. Our results suggest that released EF-1α protein can be important during Giardia infections.

  7. Interaction of the human cytomegalovirus particle with the host cell induces hypoxia-inducible factor 1 alpha

    SciTech Connect

    McFarlane, Steven; Nicholl, Mary Jane; Sutherland, Jane S.; Preston, Chris M.

    2011-05-25

    The cellular protein hypoxia-inducible factor 1 alpha (HIF-1{alpha}) was induced after infection of human fibroblasts with human cytomegalovirus (HCMV). HCMV irradiated with ultraviolet light (uv-HCMV) also elicited the effect, demonstrating that the response was provoked by interaction of the infecting virion with the cell and that viral gene expression was not required. Although induction of HIF-1{alpha} was initiated by an early event, accumulation of the protein was not detected until 9 hours post infection, with levels increasing thereafter. Infection with uv-HCMV resulted in increased abundance of HIF-1{alpha}-specific RNA, indicating stimulation of transcription. In addition, greater phosphorylation of the protein kinase Akt was observed, and the activity of this enzyme was required for induction of HIF-1{alpha} to occur. HIF-1{alpha} controls the expression of many cellular gene products; therefore the findings reveal new ways in which interaction of the HCMV particle with the host cell may cause significant alterations to cellular physiology.

  8. Structure and chromosomal localization of the human stromal cell-derived factor 1 (SDF1) gene

    SciTech Connect

    Shirozu, Michio; Takano, Toru; Tada, Hideaki; Honjo, Tasuku

    1995-08-10

    Stromal cell-derived factors 1{alpha} and 1{beta} are small cytokines belonging to the intercrine CXC subfamily and originally isolated from a murine bone-marrow stroma cell line by the signal sequence trap method. cDNA and genomic clones of human SDF1{alpha} and SDF1{beta} (SDF1A and SDF1B) were isolated and characterized. cDNAs of SDF1{alpha} and SDF1{beta} encode proteins of 89 and 93 amino acids, respectively. SDF1{alpha} and SDF1{beta} sequences are more than 92% identical to those of the human counterparts. The genomic structure of the SDF1 gene revealed that human SDF1{alpha} and SDF1{beta} are encoded by a single gene and arise by alternative splicing. SDF1{alpha} and SDF1{beta} are encoded by 3 and 4 exons, respectively. Ubiquitous expression of the SDF1 gene, except in blood cells, was consistent with the presence of the GC-rich sequence in the 5{prime}-flanking region of the SDF1 gene, as is often the case in the {open_quotes}housekeeping{close_quotes} genes. Although genes encoding other members of the intercrine family are localized on chromosome 4q or 17q, the human SDF1 gene was mapped to chromosome 10q by fluorescence in situ hybridization. Strong evolutionary conservation and unique chromosomal localization of the SDF1 gene suggest that SDF1{alpha} and SDF1{beta} may have important functions distinct from those of other members of the intercrine family. 37 refs., 5 figs.

  9. Elongation factor 1 alpha concentration is highly correlated with the lysine content of maize endosperm.

    PubMed Central

    Habben, J E; Moro, G L; Hunter, B G; Hamaker, B R; Larkins, B A

    1995-01-01

    Lysine is the most limiting essential amino acid in cereals, and for many years plant breeders have attempted to increase its concentration to improve the nutritional quality of these grains. The opaque2 mutation in maize doubles the lysine content in the endosperm, but the mechanism by which this occurs is unknown. We show that elongation factor 1 alpha (EF-1 alpha) is overexpressed in opaque2 endosperm compared with its normal counterpart and that there is a highly significant correlation between EF-1 alpha concentration and the total lysine content of the endosperm. This relationship is also true for two other cereals, sorghum and barley. It appears that genetic selection for genotypes with a high concentration of EF-1 alpha can significantly improve the nutritional quality of maize and other cereals. Images Fig. 1 Fig. 2 PMID:7567989

  10. Synthesis of the alpha and beta subunits of coupling factor 1 by polysomes from pea chloroplasts.

    PubMed

    Bhaya, D; Jagendorf, A T

    1985-02-15

    Washed thylakoids of pea chloroplasts, containing tightly bound polysomes, incorporate radioactive amino acids into protein when supplied with soluble factors from Escherichia coli. Polyacrylamide gel electrophoresis with lithium dodecyl sulfate, followed by autoradiography of the labeled products, showed the synthesis of a number of different polypeptides. Two of the most heavily labeled products were in the region expected for the alpha and beta subunits of coupling factor 1, at 57 and 54 kDa. Positive identification of the subunits was made using monospecific antibodies. Furthermore, the same two polypeptides made by soluble polysomes located in the chloroplast stroma were found. While the major proportion of the newly formed alpha and beta subunits made by thylakoid-bound polysomes remained with the thylakoids after protein synthesis occurred, no evidence was found of incorporation into complete, EDTA-extractable coupling factor 1.

  11. Synapse loss regulated by matrix metalloproteinases in traumatic brain injury is associated with hypoxia inducible factor-1alpha expression.

    PubMed

    Ding, Jamie Y; Kreipke, Christian W; Schafer, Patrick; Schafer, Steven; Speirs, Susan L; Rafols, José A

    2009-05-01

    The present study assessed the role of matrix metalloproteinase-2 (MMP-2) and -9 in synapse loss after traumatic brain injury (TBI) and the role of hypoxia inducible factor-1alpha (HIF-1alpha), a transcription factor up-regulated during hypoxia, in the regulation of MMP-2 and -9 expression post-TBI. Adult male Sprague-Dawley rats (n=6 per group, 400 g-425 g) were injured using Marmarou's closed-head acceleration impact model and allowed to survive for 1, 4, 24 and 48 h. In another set of experiments, 30 min after TBI, animals were treated with Minocycline (inhibitor of MMPs), or 2-Methoxyestradiol (2ME2, inhibitor of HIF-1alpha) and sacrificed at 4 h after injury. Relative amounts of synaptophysin, a presynaptic vesicular protein, HIF-1alpha, as well as MMP-2 and -9 were assessed by real-time PCR and Western blotting. Activity levels of MMP-2 and -9 were determined by zymography. Synaptophysin expression was significantly (p<0.05) decreased at 1 h through 48 h after TBI. A significant increase in gene and protein expressions of HIF-1alpha, MMP-2 and -9, as well as enzyme activity of MMP-2 and -9 at the same time points was also detected. Inhibition of either MMPs or HIF-1alpha significantly reversed the TBI-induced decrease in synaptophysin. Inhibition of HIF-1alpha reduced expression of MMP-2 and -9. This study showed an early detection of a correlation between synaptic loss and MMP expression after TBI. The data also supports a role for HIF-1alpha in the MMP regulatory cascade in synapse loss after TBI, suggesting potential targets for reducing loss of synaptic terminals.

  12. Hypoxia Inducible Factor 1 Alpha Is Expressed in Germ Cells throughout the Murine Life Cycle.

    PubMed

    Takahashi, Natsumi; Davy, Philip M C; Gardner, Lauren H; Mathews, Juanita; Yamazaki, Yuki; Allsopp, Richard C

    2016-01-01

    Pluripotent stem cells of the early embryo, and germ line cells, are essential to ensure uncompromised development to adulthood as well as species propagation, respectively. Recently, the transcription factor hypoxia inducible factor 1 alpha (Hif1α) has been shown to have important roles in embryonic stem cells; in particular, regulation of conversion to glycolytic metabolism and, as we have shown, maintenance of functional levels of telomerase. In the present study, we sought to assess whether Hif1α was also expressed in the primitive cells of the murine embryo. We observed expression of Hif1α in pre-implantation embryos, specifically the 2-cell stage, morula, and blastocyst. Robust Hif1α expression was also observed in male and female primordial germ cells. We subsequently assessed whether Hif1α was expressed in adult male and female germ cells. In the testis, Hif1α was robustly expressed in spermatogonial cells, in both juvenile (6-week old) and adult (3-month old) males. In the ovaries, Hif1α was expressed in mature oocytes from adult females, as assessed both in situ and in individual oocytes flushed from super-ovulated females. Analysis of Hif1α transcript levels indicates a mechanism of regulation during early development that involves stockpiling of Hif1α protein in mature oocytes, presumably to provide protection from hypoxic stress until the gene is re-activated at the blastocyst stage. Together, these observations show that Hif1α is expressed throughout the life-cycle, including both the male and female germ line, and point to an important role for Hif1α in early progenitor cells.

  13. Hypoxia Inducible Factor 1 Alpha Is Expressed in Germ Cells throughout the Murine Life Cycle

    PubMed Central

    Gardner, Lauren H.; Mathews, Juanita; Yamazaki, Yuki; Allsopp, Richard C.

    2016-01-01

    Pluripotent stem cells of the early embryo, and germ line cells, are essential to ensure uncompromised development to adulthood as well as species propagation, respectively. Recently, the transcription factor hypoxia inducible factor 1 alpha (Hif1α) has been shown to have important roles in embryonic stem cells; in particular, regulation of conversion to glycolytic metabolism and, as we have shown, maintenance of functional levels of telomerase. In the present study, we sought to assess whether Hif1α was also expressed in the primitive cells of the murine embryo. We observed expression of Hif1α in pre-implantation embryos, specifically the 2-cell stage, morula, and blastocyst. Robust Hif1α expression was also observed in male and female primordial germ cells. We subsequently assessed whether Hif1α was expressed in adult male and female germ cells. In the testis, Hif1α was robustly expressed in spermatogonial cells, in both juvenile (6-week old) and adult (3-month old) males. In the ovaries, Hif1α was expressed in mature oocytes from adult females, as assessed both in situ and in individual oocytes flushed from super-ovulated females. Analysis of Hif1α transcript levels indicates a mechanism of regulation during early development that involves stockpiling of Hif1α protein in mature oocytes, presumably to provide protection from hypoxic stress until the gene is re-activated at the blastocyst stage. Together, these observations show that Hif1α is expressed throughout the life-cycle, including both the male and female germ line, and point to an important role for Hif1α in early progenitor cells. PMID:27148974

  14. The role of hypoxia inducible factor 1alpha in cobalt chloride induced cell death in mouse embryonic fibroblasts.

    PubMed

    Vengellur, A; LaPres, J J

    2004-12-01

    Cobalt has been widely used in the treatment of anemia and as a hypoxia mimic in cell culture and it is known to activate hypoxic signaling by stabilizing the hypoxia inducible transcription factor 1alpha (HIF1alpha). However, cobalt exposure can lead to tissue and cellular toxicity. These studies were conducted to determine the role of HIF1alpha in mediating cobalt-induced toxicity. Mouse embryonic fibroblasts (MEFs) that were null for the HIF1alpha protein were used to show that HIF1alpha protein plays a major role in mediating cobalt-induced cytotoxicity. Previous work from our lab and others has shown that two BH3 domain containing cell death genes, BNip3 and NIX, are targets of hypoxia signaling. These experiments document that BNip3 and NIX expression is HIF1alpha-dependent, and cobalt induces their expression in a time and dose dependent manner. In addition, their expression is correlated with an increase in BNIP3 and NIX protein. Characteristically, the elevated level of BNIP3 was correlated with an increased presence of chromatin condensation, one marker for cell injury. Interestingly, this increased chromosomal condensation was not coupled to caspase-3 activation as usually seen in a typical apoptotic response. These results show that HIF1alpha is playing a major role in mediating cobalt-induced toxicity in mouse embryonic fibroblasts and may offer a possible mechanism for the underlying pathology of injuries seen in workers exposed to environmental contaminants that can influence the hypoxia signaling system, such as cobalt.

  15. Hypoxia-inducible factor-1alpha suppresses the expression of macrophage scavenger receptor 1.

    PubMed

    Shirato, Ken; Kizaki, Takako; Sakurai, Takuya; Ogasawara, Jun-Etsu; Ishibashi, Yoshinaga; Iijima, Takehiko; Okada, Chikako; Noguchi, Izumi; Imaizumi, Kazuhiko; Taniguchi, Naoyuki; Ohno, Hideki

    2009-11-01

    Macrophages are distributed in all peripheral tissues and play a critical role in the first line of the innate immune defenses against bacterial infection by phagocytosis of bacterial pathogens through the macrophage scavenger receptor 1 (MSR1). Within tissues, the partial pressure of oxygen (pO2) decreases depending on the distance of cells from the closest O2-supplying blood vessel. However, it is not clear how the expression of MSR1 in macrophages is regulated by low pO2. On the other hand, hypoxia-inducible factor (HIF)-1alpha is well known to control hypoxic responses through regulation of hypoxia-inducible genes. Therefore, we investigated the effects of hypoxia and HIF-1alpha on MSR1 expression and function in the macrophage cell line RAW264. Exposure to 1% O2 or treatment with the hypoxia-mimetic agent cobalt chloride (CoCl2) significantly suppressed the expression of MSR1 mRNA, accompanied by a markedly increase in levels of nuclear HIF-1alpha protein. The overexpression of HIF-1alpha in RAW264 cells suppressed the expression of MSR1 mRNA and protein, transcriptional activity of the MSR1 gene, and phagocytic capacity against the Gram-positive bacteria Listeria monocytogenes. The suppression of MSR1 mRNA by hypoxia or CoCl2 was inhibited by YC-1, an inhibitor of HIF-1alpha, or by the depletion of HIF-1alpha expression by small interference RNA. These results indicate that hypoxia transcriptionally suppresses MSR1 expression through HIF-1alpha.

  16. Epstein-Barr virus latent membrane protein 1 induces synthesis of hypoxia-inducible factor 1 alpha.

    PubMed

    Wakisaka, Naohiro; Kondo, Satoru; Yoshizaki, Tomokazu; Murono, Shigeyuki; Furukawa, Mitsuru; Pagano, Joseph S

    2004-06-01

    Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric basic helix-loop-helix transcription factor composed of HIF-1 alpha and HIF-1 beta that is the central regulator of responses to hypoxia. The specific binding of HIF-1 to the hypoxia-responsive element (HRE) induces the transcription of genes that respond to hypoxic conditions, including vascular endothelial growth factor (VEGF). Here we report that expression of HIF-1 alpha is increased in diverse Epstein-Barr virus (EBV)-infected type II and III cell lines, which express EBV latent membrane protein 1 (LMP1), the principal EBV oncoprotein, as well as other latency proteins, but not in the parental EBV-negative cell lines. We show first that transfection of an LMP1 expression plasmid into Ad-AH cells, an EBV-negative nasopharyngeal epithelial cell line, induces synthesis of HIF-1 alpha protein without increasing its stability or mRNA level. The mitogen-activated protein kinase (MAPK) kinase inhibitor PD98059 markedly reduces induction of HIF-1 alpha by LMP1. Catalase, an H(2)O(2) scavenger, strongly suppresses LMP1-induced production of H(2)O(2), which results in a decrease in the expression of HIF-1 alpha induced by LMP1. Inhibition of the NF-kappa B, c-jun N-terminal kinase, p38 MAPK, and phosphatidylinositol 3-kinase pathways did not affect HIF-1 alpha expression. Moreover, LMP1 induces HIF-1 DNA binding activity and upregulates HRE and VEGF promoter transcriptional activity. Finally, LMP1 increases the appearance of VEGF protein in extracellular fluids; induction of VEGF is suppressed by PD98059 or catalase. These results suggest that LMP1 increases HIF-1 activity through induction of HIF-1 alpha protein expression, which is controlled by p42/p44 MAPK activity and H(2)O(2). The ability of EBV, and specifically its major oncoprotein, LMP1, to induce HIF-1 alpha along with other invasiveness and angiogenic factors reported previously discloses additional oncogenic properties of this tumor virus.

  17. Stromal Cell-Derived Factor-1 Alpha is Cardioprotective After Myocardial Infarction

    PubMed Central

    Saxena, Ankur; Fish, Jason E.; White, Michael D.; Yu, Sangho; Smyth, James WP; Shaw, Robin M.; DiMaio, J. Michael; Srivastava, Deepak

    2009-01-01

    Background Heart disease is a leading cause of mortality throughout the world. Tissue damage from vascular occlusive events results in the replacement of contractile myocardium by nonfunctional scar tissue. The potential of new technologies to regenerate damaged myocardium is significant, although cell-based therapies must overcome several technical barriers. One possible cell-independent alternative is the direct administration of small proteins to damaged myocardium. Methods and Results Here we show that the secreted signaling protein stromal cell-derived factor-1 alpha (SDF-1α), which activates the cell-survival factor protein kinase B (PKB/Akt) via the G-protein-coupled receptor CXCR4, protected tissue after an acute ischemic event in mice and activated Akt within endothelial cells and myocytes of the heart. Significantly better cardiac function than in control mice was evident as early as 24 hours post-infarction as well as at 3, 14 and 28 days post-infarction. Prolonged survival of hypoxic myocardium was followed by an increase in levels of vascular endothelial growth factor (VEGF) protein and neo-angiogenesis. Consistent with improved cardiac function, mice exposed to SDF-1α demonstrated significantly decreased scar formation than control mice. Conclusions These findings suggest that SDF-1α may serve a tissue-protective and regenerative role for solid organs suffering a hypoxic insult. PMID:18427137

  18. A viral vector expressing hypoxia-inducible factor 1 alpha inhibits hippocampal neuronal apoptosis

    PubMed Central

    Chai, Xiqing; Kong, Weina; Liu, Lingyun; Yu, Wenguo; Zhang, Zhenqing; Sun, Yimin

    2014-01-01

    Hypoxia-inducible factor 1 (HIF-1) attenuates amyloid-beta protein neurotoxicity and decreases apoptosis induced by oxidative stress or hypoxia in cortical neurons. In this study, we constructed a recombinant adeno-associated virus (rAAV) vector expressing the human HIF-1α gene (rAAV-HIF-1α), and tested the assumption that rAAV-HIF-1α represses hippocampal neuronal apoptosis induced by amyloid-beta protein. Our results confirmed that rAAV-HIF-1α significantly reduces apoptosis induced by amyloid-beta protein in primary cultured hippocampal neurons. Direct intracerebral rAAV-HIF-1α administration also induced robust and prolonged HIF-1α production in rat hippocampus. Single rAAV-HIF-1α administration resulted in decreased apoptosis of hippocampal neurons in an Alzheimer's disease rat model established by intracerebroventricular injection of aggregated amyloid-beta protein (25–35). Our in vitro and in vivo findings demonstrate that HIF-1 has potential for attenuating hippocampal neuronal apoptosis induced by amyloid-beta protein, and provides experimental support for treatment of neurodegenerative diseases using gene therapy. PMID:25206774

  19. Functional properties of an isolated. cap alpha beta. heterodimeric human placenta insulin-like growth factor 1 receptor complex

    SciTech Connect

    Feltz, S.M.; Swanson, M.L.; Wemmie, J.A.; Pessin, J.E.

    1988-05-03

    Treatment of human placenta membranes at pH 8.5 in the presence of 2.0 mM dithiothreitol (DTT) for 5 min, followed by the simultaneous removal of the DTT and pH adjustment of pH 7.6, resulted in the formation of a functional ..cap alpha beta.. heterodimeric insulin-like growth factor 1 (IGF-1) receptor complex from the native ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric disulfide-linked state. The membrane-bound ..cap alpha beta.. heterodimeric complex displayed similar curvilinear /sup 125/I-IGF-1 equilibrium binding compared to the ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric complex. /sup 125/I-IGF-1 binding to both the isolated ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric and ..cap alpha beta.. heterodimeric complexes demonstrated a marked straightening of the Scatchard plots, compared to the placenta membrane-bound IGF-1 receptors, with a 2-fold increase in the high-affinity binding component. IGF-1 stimulation of IGF-1 receptor autophosphorylation indicated that the ligand-dependent activation of ..cap alpha beta.. heterodimeric protein kinase activity occurred concomitant with the reassociation into a covalent ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric state. These data demonstrate that (i) a combination of alkaline pH and DTT treatment of human placenta membranes results in the formation of an ..cap alpha beta.. heterodimeric IGF-1 receptor complex, (ii) unlike the insulin receptor, high-affinity homogeneous IGF-1 binding occurs in both the ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric and ..cap alpha beta.. heterodimeric complexes, and (iii) IGF-1-dependent autophosphorylation of the ..cap alpha beta.. heterodimeric IGF-1 receptor complex correlates wit an IGF-1 dependent covalent reassociation into an ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric disulfide-linked state.

  20. Expression of DDX3 Is Directly Modulated by Hypoxia Inducible Factor-1 Alpha in Breast Epithelial Cells

    PubMed Central

    Botlagunta, Mahendran; Krishnamachary, Balaji; Vesuna, Farhad; Winnard, Paul T.; Bol, Guus M.; Patel, Arvind H.; Raman, Venu

    2011-01-01

    DEAD box protein, DDX3, is aberrantly expressed in breast cancer cells ranging from weakly invasive to aggressive phenotypes and functions as an important regulator of cancer cell growth and survival. Here, we demonstrate that hypoxia inducible factor-1α is a transcriptional activator of DDX3 in breast cancer cells. Within the promoter region of the human DDX3 gene, we identified three putative hypoxia inducible factor-1 responsive elements. By luciferase reporter assays in combination with mutated hypoxia inducible factor-1 responsive elements, we determined that the hypoxia inducible factor-1 responsive element at position -153 relative to the translation start site is essential for transcriptional activation of DDX3 under hypoxic conditions. We also demonstrated that hypoxia inducible factor-1 binds to the DDX3 promoter and that the binding is specific, as revealed by siRNA against hypoxia inducible factor-1 and chromatin immunoprecipitation assays. Thus, the activation of DDX3 expression during hypoxia is due to the direct binding of hypoxia inducible factor-1 to hypoxia responsive elements in the DDX3 promoter. In addition, we observed a significant overlap in the protein expression pattern of hypoxia inducible factor-1α and DDX3 in MDA-MB-231 xenograft tumors. Taken together, our results demonstrate, for the first time, the role of DDX3 as a hypoxia-inducible gene that exhibits enhanced expression through the interaction of hypoxia inducible factor-1 with hypoxia inducible factor-1 responsive elements in its promoter region. PMID:21448281

  1. Functional defect of truncated hepatocyte nuclear factor-1{alpha} (G554fsX556) associated with maturity-onset diabetes of the young

    SciTech Connect

    Kooptiwut, Suwattanee; Sujjitjoon, Jatuporn; Plengvidhya, Nattachet; Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapapron; Semprasert, Namoiy; Furuta, Hiroto; Nanjo, Kishio; Banchuin, Napatawn; Yenchitsomanus, Pa-thai

    2009-05-22

    A novel frameshift mutation attributable to 14-nucleotide insertion in hepatocyte nuclear factor-1{alpha} (HNF-1{alpha}) encoding a truncated HNF-1{alpha} (G554fsX556) with 76-amino acid deletion at its carboxyl terminus was identified in a Thai family with maturity-onset diabetes of the young (MODY). The wild-type and mutant HNF-1{alpha} proteins were expressed by in vitro transcription and translation (TNT) assay and by transfection in HeLa cells. The wild-type and mutant HNF-1{alpha} could similarly bind to human glucose-transporter 2 (GLUT2) promoter examined by electrophoretic mobility shift assay (EMSA). However, the transactivation activities of mutant HNF-1{alpha} on human GLUT2 and rat L-type pyruvate kinase (L-PK) promoters in HeLa cells determined by luciferase reporter assay were reduced to approximately 55-60% of the wild-type protein. These results suggested that the functional defect of novel truncated HNF-1{alpha} (G554fsX556) on the transactivation of its target-gene promoters would account for the {beta}-cell dysfunction associated with the pathogenesis of MODY.

  2. Kaposi's sarcoma-associated herpesvirus viral IFN regulatory factor 3 stabilizes hypoxia-inducible factor-1 alpha to induce vascular endothelial growth factor expression.

    PubMed

    Shin, Young C; Joo, Chul-Hyun; Gack, Michaela U; Lee, Hye-Ra; Jung, Jae U

    2008-03-15

    Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent associated with Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman's disease. Hypoxia-inducible factor-1 (HIF-1) is the master regulator of both developmental and pathologic angiogenesis, composed of an oxygen-sensitive alpha-subunit and a constitutively expressed beta-subunit. HIF-1 activity in tumors depends on the availability of the HIF-1 alpha subunit, the levels of which are increased under hypoxic conditions. Recent studies have shown that HIF-1 plays an important role in KSHV reactivation from latency and pathogenesis. Here, we report a novel mechanism by which KSHV activates HIF-1 activity. Specific interaction between KSHV viral IFN regulatory factor 3 (vIRF3) and the HIF-1 alpha subunit led to the HIF-1 alpha stabilization and transcriptional activation, which induced vascular endothelial growth factor expression and ultimately facilitated endothelial tube formation. Remarkably, the central domain of vIRF3, containing double alpha-helix motifs, was sufficient not only for binding to HIF-1 alpha but also for blocking its degradation in normoxic conditions. This indicates that KSHV has developed a unique mechanism to enhance HIF-1 alpha protein stability and transcriptional activity by incorporating a viral homologue of cellular IRF gene into its genome, which may contribute to viral pathogenesis.

  3. Activation of the oxidative stress pathway by HIV-1 Vpr leads to induction of hypoxia-inducible factor 1alpha expression.

    PubMed

    Deshmane, Satish L; Mukerjee, Ruma; Fan, Shongshan; Del Valle, Luis; Michiels, Carine; Sweet, Thersa; Rom, Inna; Khalili, Kamel; Rappaport, Jay; Amini, Shohreh; Sawaya, Bassel E

    2009-04-24

    The detection of biomarkers of oxidative stress in brain tissue and cerebrospinal fluid of patients with human immunodeficiency virus, type 1 (HIV)-associated dementia indicates the involvement of stress pathways in the neuropathogenesis of AIDS. Although the biological importance of oxidative stress on events involved in AIDS neuropathogenesis and the HIV-1 proteins responsible for oxidative stress remain to be elucidated, our results point to the activation of hypoxia-inducible factor 1 (HIF-1) upon HIV-1 infection and its elevation in brain cells of AIDS patients with dementia. HIF-1 is a transcription factor that is responsive to oxygen. Under hypoxic conditions, HIF-1alpha becomes stable and translocates to the nucleus where it dimerizes with aryl hydrocarbon receptor nuclear translocator and modulates gene transcription. Activation of HIF-1 can also be mediated by the HIV-1 accessory protein Vpr. In addition, cellular components, including reactive oxygen species, contribute to the induction of HIF-1alpha. Our results show that Vpr induces reactive oxygen species by increasing H(2)O(2) production, which can contribute to HIF-1alpha accumulation. Interestingly, increased levels of HIF-1alpha stimulated HIV-1 gene transcription through HIF-1 association with HIV-1 long terminal repeat. These observations point to the existence of a positive feedback interplay between HIF-1alpha and Vpr and that, by inducing oxidative stress via activation of HIF-1, Vpr can induce HIV-1 gene expression and dysregulate multiple host cellular pathways.

  4. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  5. Cobalt chloride-induced estrogen receptor alpha down-regulation involves hypoxia-inducible factor-1alpha in MCF-7 human breast cancer cells.

    PubMed

    Cho, Jungyoon; Kim, Dukkyung; Lee, SeungKi; Lee, YoungJoo

    2005-05-01

    The estrogen receptor (ER) is down-regulated under hypoxia via a proteasome-dependent pathway. We studied the mechanism of ERalpha degradation under hypoxic mimetic conditions. Cobalt chloride-induced ERalpha down-regulation was dependent on the expression of newly synthesized protein(s), one possibility of which was hypoxia-inducible factor-1alpha (HIF-1alpha). To examine the role of HIF-1alpha expression in ERalpha down-regulation under hypoxic-mimetic conditions, we used a constitutively active form of HIF-1alpha, HIF-1alpha/herpes simplex viral protein 16 (VP16), constructed by replacing the transactivation domain of HIF-1alpha with that of VP16. Western blot analysis revealed that HIF-1alpha/VP16 down-regulated ERalpha in a dose-dependent manner via a proteasome-dependent pathway. The kinase pathway inhibitors PD98059, U0126, wortmannin, and SB203580 did not affect the down-regulation. A mammalian two-hybrid screen and immunoprecipitation assays indicated that ERalpha interacted with HIF-1alpha physically. These results suggest that ERalpha down-regulation under hypoxia involves protein-protein interactions between the ERalpha and HIF-1alpha.

  6. Immunohistochemical detection of hypoxia-inducible factor-1alpha in human renal allograft biopsies.

    PubMed

    Rosenberger, Christian; Pratschke, Johann; Rudolph, Birgit; Heyman, Samuel N; Schindler, Ralf; Babel, Nina; Eckardt, Kai-Uwe; Frei, Ulrich; Rosen, Seymour; Reinke, Petra

    2007-01-01

    Although it generally is accepted that renal hypoxia may occur in various situations after renal transplantation, direct evidence for such hypoxia is lacking, and possible implications on graft pathophysiology remain obscure. Hypoxia-inducible factors (HIF) are regulated at the protein level by oxygen-dependent enzymes and, hence, allow for tissue hypoxia detection. With the use of high-amplification HIF-1alpha immunohistochemistry in renal biopsies, hypoxia is shown at specific time points after transplantation with clinicohistologic correlations. Immediately after engraftment, in primarily functioning grafts, abundant HIF-1alpha is present and correlates with cold ischemic time >15 h and/or graft age >50 yr (P < 0.04). In contrast, a low HIF-1alpha score correlates with primary nonfunction, likely reflecting loss of oxygen consumption for tubular transport. Protocol biopsies at 2 wk show widespread HIF-1alpha induction, irrespective of histology. Beyond 3 mo, both protocol biopsies and indicated biopsies are virtually void of HIF-1alpha, with the only exception being clinical/subclinical rejection. HIF-derived transcriptional adaptation to hypoxia may counterbalance, at least partly, the negative impact of cold preservation and warm reflow injury. Transient hypoxia at 2 wk may be induced by hyperfiltration, hypertrophy, calcineurin inhibitor-induced toxicity, or a combination of these. Lack of detectable HIF-1alpha at 3 mo and beyond suggests that at this time point, graft oxygen homeostasis occurs. The strong correlation between hypoxia and clinical/subclinical rejection in long-term grafts suggests that hypoxia is involved in such graft dysfunction, and HIF-1alpha immunohistochemistry could enhance the specific diagnosis of acute rejection.

  7. Involvement of phosphatidylinositol 3-kinase in stromal cell-derived factor-1 alpha-induced lymphocyte polarization and chemotaxis.

    PubMed

    Vicente-Manzanares, M; Rey, M; Jones, D R; Sancho, D; Mellado, M; Rodriguez-Frade, J M; del Pozo, M A; Yáñez-Mó, M; de Ana, A M; Martínez-A, C; Mérida, I; Sánchez-Madrid, F

    1999-10-01

    The role of phosphatidylinositol 3-kinase (PI3-kinase), an important enzyme involved in signal transduction events, has been studied in the polarization and chemotaxis of lymphocytes induced by the chemokine stromal cell-derived factor-1 alpha (SDF-1 alpha). This chemokine was able to directly activate p85/p110 PI3-kinase in whole human PBL and to induce the association of PI3-kinase to the SDF-1 alpha receptor, CXCR4, in a pertussis toxin-sensitive manner. Two unrelated chemical inhibitors of PI3-kinase, wortmannin and Ly294002, prevented ICAM-3 and ERM protein moesin polarization as well as the chemotaxis of PBL in response to SDF-1 alpha. However, they did not interfere with the reorganization of either tubulin or the actin cytoskeleton. Moreover, the transient expression of a dominant negative form of the PI3-kinase 85-kDa regulatory subunit in the constitutively polarized Peer T cell line inhibited ICAM-3 polarization and markedly reduced SDF-1 alpha-induced chemotaxis. Conversely, overexpression of a constitutively activated mutant of the PI3-kinase 110-kDa catalytic subunit in the round-shaped PM-1 T cell line induced ICAM-3 polarization. These results underline the role of PI3-kinase in the regulation of lymphocyte polarization and motility and indicate that PI3-kinase plays a selective role in the regulation of adhesion and ERM proteins redistribution in the plasma membrane of lymphocytes.

  8. Role of hypoxia-inducible factor 1{alpha} in modulating cobalt-induced lung inflammation.

    PubMed

    Saini, Yogesh; Kim, Kyung Y; Lewandowski, Ryan; Bramble, Lori A; Harkema, Jack R; Lapres, John J

    2010-02-01

    Hypoxia plays an important role in development, cellular homeostasis, and pathological conditions, such as cancer and stroke. There is also growing evidence that hypoxia is an important modulator of the inflammatory process. Hypoxia-inducible factors (HIFs) are a family of proteins that regulate the cellular response to oxygen deficit, and loss of HIFs impairs inflammatory cell function. There is little known, however, about the role of epithelial-derived HIF signaling in modulating inflammation. Cobalt is capable of eliciting an allergic response and promoting HIF signaling. To characterize the inflammatory function of epithelial-derived HIF in response to inhaled cobalt, a conditional lung-specific HIF1alpha, the most ubiquitously expressed HIF, deletion mouse, was created. Control mice showed classic signs of metal-induced injury following cobalt exposure, including fibrosis and neutrophil infiltration. In contrast, HIF1alpha-deficient mice displayed a Th2 response that resembled asthma, including increased eosinophilic infiltration, mucus cell metaplasia, and chitinase-like protein expression. The results suggest that epithelial-derived HIF signaling has a critical role in establishing a tissue's inflammatory response, and compromised HIF1alpha signaling biases the tissue towards a Th2-mediated reaction.

  9. Prognostic Significance of Tumor Hypoxia Inducible Factor-1{alpha} Expression for Outcome After Radiotherapy in Oropharyngeal Cancer

    SciTech Connect

    Silva, Priyamal; Slevin, Nick J.; Sloan, Philip; Valentine, Helen; Cresswell, Jo; Ryder, David; Price, Patricia; Homer, Jarrod J.; West, Catharine

    2008-12-01

    Purpose: Head-and-neck squamous cell carcinoma (HNSCC) represents a heterogeneous group of patients in terms of subsite, treatment, and biology. Currently most management decisions are based on clinical parameters with little appreciation of patient differences in underlying tumor biology. We investigated the prognostic significance of clinicopathologic features and tumor hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) expression in a homogeneous series of patients who underwent radiotherapy. Methods and Materials: An audit identified 133 consecutive patients with histologically proven squamous cell carcinoma of the tonsil or tongue base. All patients received primary radiotherapy between 1996 and 2001. Tumor HIF-1{alpha} expression was examined in 79 patients. Results: Features associated with poor locoregional control were low Hb level (p = 0.05) and advancing T (p = 0.008), N (p = 0.03), and disease (p = 0.008) stage. HIF-1{alpha} expression was a more significant adverse prognostic factor in the tonsil (hazard ratio [HR], 23.1; 95% confidence interval [CI]. 3.04-176.7) than the tongue-base tumor (HR, 2.86; 95% CI, 1.14-7.19) group (p = 0.03, test for interaction). High tumor HIF-1{alpha} expression was associated with low blood Hb levels (p = 0.03). In a multivariate analysis HIF-1{alpha} expression retained prognostic significance for locoregional control (HR, 7.10; 95% CI, 3.07-16.43) and cancer-specific survival (HR, 9.19; 95% CI, 3.90-21.6). Conclusions: There are significant differences in radiation therapy outcome within a homogeneous subsite of the oropharynx related to molecular marker expression. The work highlights the importance of studying homogeneous groups of patients in HNSCC, and the complex interrelationships between tumor biology and clinicopathologic factors. The establishment of tumor-type specific markers would represent a major advance in this area.

  10. Nutrition-induced catch-up growth increases hypoxia inducible factor 1alpha RNA levels in the growth plate.

    PubMed

    Even-Zohar, N; Jacob, J; Amariglio, N; Rechavi, G; Potievsky, O; Phillip, M; Gat-Yablonski, G

    2008-03-01

    Although catch-up growth is a well-known phenomenon, the local pathways at the epiphyseal growth plate that govern this process remain poorly understood. To study the mechanisms governing catch-up growth in the growth plate, we subjected prepubertal rats to 10 days of 40% food restriction, followed by a renewal of the regular food supply to induce catch-up growth. The animals were weighed daily, and their humeral length was measured at sacrifice. The proximal tibial epiphyseal growth plates (EGPs) were studied, and findings were compared with EGPs from animals fed ad libitum and animals under food restriction. The gene expression profile in the growth plates was examined using DNA microarrays, and the expression levels of selected genes were validated by real-time polymerase chain reaction. To localize gene expression in different growth plate zones, microdissection was used. Protein levels and localization were examined using immunohistochemistry. We showed that the expression level of 550 genes decreased during food restriction and increased during catch-up growth, starting already one day after refeeding. HIF-1alpha, as well as several of its downstream targets, was found among these genes. Immunohistochemistry showed a similar pattern for HIF-1alpha protein abundance. Additionally, HIF-1alpha mRNA and protein levels were higher in the proliferating than in the hypertrophic zone, and this distribution was unaffected by nutritional status. These findings indicate that nutrition has a profound effect on gene expression level during growth plate growth, and suggest an important role for HIF-1alpha in the growth plate and its response to nutritional manipulation.

  11. Myeloid derived hypoxia inducible factor 1-alpha is required for protection against pulmonary Aspergillus fumigatus infection.

    PubMed

    Shepardson, Kelly M; Jhingran, Anupam; Caffrey, Alayna; Obar, Joshua J; Suratt, Benjamin T; Berwin, Brent L; Hohl, Tobias M; Cramer, Robert A

    2014-09-01

    Hypoxia inducible factor 1α (HIF1α) is the mammalian transcriptional factor that controls metabolism, survival, and innate immunity in response to inflammation and low oxygen. Previous work established that generation of hypoxic microenvironments occurs within the lung during infection with the human fungal pathogen Aspergillus fumigatus. Here we demonstrate that A. fumigatus stabilizes HIF1α protein early after pulmonary challenge that is inhibited by treatment of mice with the steroid triamcinolone. Utilizing myeloid deficient HIF1α mice, we observed that HIF1α is required for survival and fungal clearance early following pulmonary challenge with A. fumigatus. Unlike previously reported research with bacterial pathogens, HIF1α deficient neutrophils and macrophages were surprisingly not defective in fungal conidial killing. The increase in susceptibility of the myeloid deficient HIF1α mice to A. fumigatus was in part due to decreased early production of the chemokine CXCL1 (KC) and increased neutrophil apoptosis at the site of infection, resulting in decreased neutrophil numbers in the lung. Addition of recombinant CXCL1 restored neutrophil survival and numbers, murine survival, and fungal clearance. These results suggest that there are unique HIF1α mediated mechanisms employed by the host for protection and defense against fungal pathogen growth and invasion in the lung. Additionally, this work supports the strategy of exploring HIF1α as a therapeutic target in specific immunosuppressed populations with fungal infections.

  12. [Expression of elongation factor-1 alpha-A and beta-actin promoters in embryos of transgenic Medaka (Oryzias latipes)].

    PubMed

    Long, Hua

    2003-06-01

    Two expression vectors with the promoter of either Medaka (Oryzias latipes) elongation factor gene or beta-actin gene were constructed based on pBluescript SK+. Both of them are linked with green-fluorescent protein (GFP) gene. And they are named as pB-EF and pB-BA, respectively. The microinjection experiments were conducted with fertilized Medaka eggs at one-cell stage. The expression of two vectors, pB-EF and pB-BA, was observed under stereo-fluorescence microscope. The detection results showed that both EF-1 alpha-A promoter and beta-actin promoter are strong. In the process of embryo development, the activity of beta-actin promoter became stronger while that of EF-1 alpha-A promoter weaker gradually. beta-actin promoter was but EF-1 alpha-A promoter distributed throughout fish body uniformly. The expression rate of two vectors, pB-EF and pB-BA, are 8.23% and 6.10%, respectively.

  13. Chemokines, macrophage inflammatory protein-2 and stromal cell-derived factor-1{alpha}, suppress amyloid {beta}-induced neurotoxicity

    SciTech Connect

    Raman, Dayanidhi; Milatovic, Snjezana-Zaja; Milatovic, Dejan; Fan, Guo-Huang; Richmond, Ann

    2011-11-15

    Alzheimer's disease (AD) is characterized by a progressive cognitive decline and accumulation of neurotoxic oligomeric peptides amyloid-{beta} (A{beta}). Although the molecular events are not entirely known, it has become evident that inflammation, environmental and other risk factors may play a causal, disruptive and/or protective role in the development of AD. The present study investigated the ability of the chemokines, macrophage inflammatory protein-2 (MIP-2) and stromal cell-derived factor-1{alpha} (SDF-1{alpha}), the respective ligands for chemokine receptors CXCR2 and CXCR4, to suppress A{beta}-induced neurotoxicity in vitro and in vivo. Pretreatment with MIP-2 or SDF-1{alpha} significantly protected neurons from A{beta}-induced dendritic regression and apoptosis in vitro through activation of Akt, ERK1/2 and maintenance of metalloproteinase ADAM17 especially with SDF-1{alpha}. Intra-cerebroventricular (ICV) injection of A{beta} led to reduction in dendritic length and spine density of pyramidal neurons in the CA1 area of the hippocampus and increased oxidative damage 24 h following the exposure. The A{beta}-induced morphometric changes of neurons and increase in biomarkers of oxidative damage, F{sub 2}-isoprostanes, were significantly inhibited by pretreatment with the chemokines MIP-2 or SDF-1{alpha}. Additionally, MIP-2 or SDF-1{alpha} was able to suppress the aberrant mislocalization of p21-activated kinase (PAK), one of the proteins involved in the maintenance of dendritic spines. Furthermore, MIP-2 also protected neurons against A{beta} neurotoxicity in CXCR2-/- mice, potentially through observed up regulation of CXCR1 mRNA. Understanding the neuroprotective potential of chemokines is crucial in defining the role for their employment during the early stages of neurodegeneration. -- Research highlights: Black-Right-Pointing-Pointer Neuroprotective ability of the chemokines MIP2 and CXCL12 against A{beta} toxicity. Black-Right-Pointing-Pointer MIP-2 or

  14. High glucose concentrations attenuate hypoxia-inducible factor-1{alpha} expression and signaling in non-tumor cells

    SciTech Connect

    Dehne, Nathalie; Bruene, Bernhard

    2010-04-15

    Hypoxia-inducible factor (HIF) is the major transcription factor mediating adaption to hypoxia e.g. by enhancing glycolysis. In tumor cells, high glucose concentrations are known to increase HIF-1{alpha} expression even under normoxia, presumably by enhancing the concentration of tricarboxylic acid cycle intermediates, while reactions of non-tumor cells are not well defined. Therefore, we analyzed cellular responses to different glucose concentrations in respect to HIF activation comparing tumor to non-tumor cells. Using cells derived from non-tumor origin, we show that HIF-1{alpha} accumulation was higher under low compared to high glucose concentrations. Low glucose allowed mRNA expression of HIF-1 target genes like adrenomedullin. Transfection of C{sub 2}C{sub 12} cells with a HIF-1{alpha} oxygen-dependent degradation domaine-GFP fusion protein revealed that prolyl hydroxylase (PHD) activity is impaired at low glucose concentrations, thus stabilizing the fusion protein. Mechanistic considerations suggested that neither O{sub 2} redistribution nor an altered redox state explains impaired PHD activity in the absence of glucose. In order to affect PHD activity, glucose needs to be metabolized. Amino acids present in the medium also diminished HIF-1{alpha} expression, while the addition of fatty acids did not. This suggests that glucose or amino acid metabolism increases oxoglutarate concentrations, which enhances PHD activity in non-tumor cells. Tumor cells deprived of glutamine showed HIF-1{alpha} accumulation in the absence of glucose, proposing that enhanced glutaminolysis observed in many tumors enables these cells to compensate reduced oxoglutarate production in the absence of glucose.

  15. Protein kinase A activation of the surfactant protein B gene is mediated by phosphorylation of thyroid transcription factor 1.

    PubMed

    Yan, C; Whitsett, J A

    1997-07-11

    Thyroid transcription factor 1 (TTF-1) is a homeodomain-containing nuclear transcription factor expressed in epithelial cells of the lung and thyroid. TTF-1 binds to and activates the transcription of genes expressed selectively in the respiratory epithelium including pulmonary surfactant A, B, C and Clara cell secretory protein. Transfection with a plasmid encoding the cyclic AMP-dependent protein kinase (protein kinase A; PKA) catalytic subunit, Cat-beta, stimulated the phosphorylation of a TTF-1-flag fusion protein 6-7-fold in H441 pulmonary adenocarcinoma cells. Recombinant TTF-1 was phosphorylated by purified PKA catalytic subunit in the presence of [gamma-32P]ATP. PKA catalytic subunit family members, Cat-alpha and Cat-beta, markedly enhanced the transcriptional activation of surfactant B gene promoters by TTF-1 in vitro. Peptide mapping was used to identify a PKA phosphorylation site at the NH2 terminus of TTF-1. A 17-amino acid synthetic peptide comprising this site completely inhibited the PKA-dependent phosphorylation of TTF-1 in vitro. A substitution mutation of TTF-1 (Thr9 two head right arrow Ala) abolished phosphorylation by PKA and reduced transactivation of the surfactant B gene promoter. Transfection with a plasmid encoding the cAMP regulatory element binding factor inhibited transcriptional activity of the surfactant protein B gene promoter. Phosphorylation of TTF-1 mediates PKA-dependent activation of surfactant protein B gene transcription.

  16. Stromal cell-derived factor-1{alpha} (SDF-1{alpha}/CXCL12) stimulates ovarian cancer cell growth through the EGF receptor transactivation

    SciTech Connect

    Porcile, Carola; Bajetto, Adriana . E-mail: bajetto@cba.unige.it; Barbieri, Federica; Barbero, Simone; Bonavia, Rudy; Biglieri, Marianna; Pirani, Paolo; Florio, Tullio . E-mail: florio@cba.unige.it; Schettini, Gennaro

    2005-08-15

    Ovarian cancer (OC) is the leading cause of death in gynecologic diseases in which there is evidence for a complex chemokine network. Chemokines are a family of proteins that play an important role in tumor progression influencing cell proliferation, angiogenic/angiostatic processes, cell migration and metastasis, and, finally, regulating the immune cells recruitment into the tumor mass. We previously demonstrated that astrocytes and glioblastoma cells express both the chemokine receptor CXCR4 and its ligand stromal cell-derived factor-1 (SDF-1), and that SDF-1{alpha} treatment induced cell proliferation, supporting the hypothesis that chemokines may play an important role in tumor cells' growth in vitro. In the present study, we report that CXCR4 and SDF-1 are expressed in OC cell lines. We demonstrate that SDF-1{alpha} induces a dose-dependent proliferation in OC cells, by the specific interaction with CXCR4 and a biphasic activation of ERK1/2 and Akt kinases. Our results further indicate that CXCR4 activation induces EGF receptor (EGFR) phosphorylation that in turn was linked to the downstream intracellular kinases activation, ERK1/2 and Akt. In addition, we provide evidence for cytoplasmic tyrosine kinase (c-Src) involvement in the SDF-1/CXCR4-EGFR transactivation. These results suggest a possible important 'cross-talk' between SDF-1/CXCR4 and EGFR intracellular pathways that may link signals of cell proliferation in ovarian cancer.

  17. Characterization and phylogeny of Isaria spp. strains (Ascomycota: Hypocreales) using ITS1-5.8S-ITS2 and elongation factor 1-alpha sequences.

    PubMed

    D'Alessandro, Celeste P; Jones, Leandro R; Humber, Richard A; López Lastra, Claudia C; Sosa-Gomez, Daniel R

    2014-07-01

    The elongation factor 1-alpha (EF1-α) and the internal transcribed spacer (ITS) regions ITS1 and ITS2 (ITS1-5.8S-ITS2) sequences were used to characterize and to identify Isaria isolates from Argentina, Mexico, and Brazil, as well as to study the phylogenetic relationships among these isolates and other related fungi from the order Hypocreales. The molecular characterization, which was performed by PCR-RFLP of EF1-α and ITS1-5.8-ITS2 genes, was useful for resolving representative isolates of Isaria fumosorosea, Isaria farinosa, and Isaria tenuipes and to confirm the taxonomic identity of fungi from Argentina, Mexico, and Brazil. The phylogenetic analyses showed three clades corresponding to three families of Hypocreales. The genus Isaria was confirmed as polyphyletic and in family Cordycipitaceae, Isaria species were related to anamorphic species of Beauveria, Lecanicillium, and Simplicillium and to teleomorphic Cordyceps and Torrubiella. Therefore, EF1-α and ITS1-5.8S-ITS2 genes were found to be powerful tools for improving the characterization, identification, and phylogenetic relationship of the Isaria species and other entomopathogenic fungi.

  18. In cultured astrocytes, p53 and MDM2 do not alter hypoxia-inducible factor-1alpha function regardless of the presence of DNA damage.

    PubMed

    Rempe, David A; Lelli, Katherine M; Vangeison, Grace; Johnson, Randall S; Federoff, Howard J

    2007-06-01

    A principal molecular mechanism by which cells respond to hypoxia is by activation of the transcription factor hypoxia-inducible factor 1alpha (HIF-1alpha). Several studies describe a binding of p53 to HIF-1alpha in a protein complex, leading to attenuated function, half-life, and abundance of HIF-1alpha. However, these reports almost exclusively utilized transformed cell lines, and many employed transfection of p53 or HIF-1alpha plasmid constructs and/or p53 and HIF-1alpha reporter constructs as surrogates for endogenous protein activity and target expression, respectively. Thus, it remains an open and important question as to whether p53 inhibits HIF-1alpha-mediated transactivation of endogenous HIF-1alpha targets in nontransformed cells. After determining in primary astrocyte cultures the HIF-1alpha targets that were most dependent on HIF-1alpha function, we examined the effect of the loss of p53 function either alone or in combination with MDM2 on expression of these targets. Although p53 null astrocyte cultures resulted in markedly increased HIF-1alpha-dependent target expression compared with controls, this altered expression was determined to be the result of increased cell density of p53 null cultures and the accompanying acidosis, not loss of p53 protein. Although activation of p53 by DNA damage induced p53 target expression in astrocytes, it did not alter hypoxia-induced HIF-1alpha target expression. Finally, a combined loss of MDM2 and p53 did not alter HIF-1alpha target expression compared with loss of p53 alone. These data strongly suggest that p53 and MDM2 do not influence the hypoxia-induced transactivation of HIF-1alpha targets, regardless of p53 activation, in primary astrocytes.

  19. MUC1 mucin stabilizes and activates hypoxia-inducible factor 1 alpha to regulate metabolism in pancreatic cancer

    PubMed Central

    Chaika, Nina V.; Gebregiworgis, Teklab; Lewallen, Michelle E.; Purohit, Vinee; Radhakrishnan, Prakash; Liu, Xiang; Zhang, Bo; Mehla, Kamiya; Brown, Roger B.; Caffrey, Thomas; Yu, Fang; Johnson, Keith R.; Powers, Robert; Hollingsworth, Michael A.; Singh, Pankaj K.

    2012-01-01

    Aberrant glucose metabolism is one of the hallmarks of cancer that facilitates cancer cell survival and proliferation. Here, we demonstrate that MUC1, a large, type I transmembrane protein that is overexpressed in several carcinomas including pancreatic adenocarcinoma, modulates cancer cell metabolism to facilitate growth properties of cancer cells. MUC1 occupies the promoter elements of multiple genes directly involved in glucose metabolism and regulates their expression. Furthermore, MUC1 expression enhances glycolytic activity in pancreatic cancer cells. We also demonstrate that MUC1 expression enhances in vivo glucose uptake and expression of genes involved in glucose uptake and metabolism in orthotopic implantation models of pancreatic cancer. The MUC1 cytoplasmic tail is known to activate multiple signaling pathways through its interactions with several transcription factors/coregulators at the promoter elements of various genes. Our results indicate that MUC1 acts as a modulator of the hypoxic response in pancreatic cancer cells by regulating the expression/stability and activity of hypoxia-inducible factor-1α (HIF-1α). MUC1 physically interacts with HIF-1α and p300 and stabilizes the former at the protein level. By using a ChIP assay, we demonstrate that MUC1 facilitates recruitment of HIF-1α and p300 on glycolytic gene promoters in a hypoxia-dependent manner. Also, by metabolomic studies, we demonstrate that MUC1 regulates multiple metabolite intermediates in the glucose and amino acid metabolic pathways. Thus, our studies indicate that MUC1 acts as a master regulator of the metabolic program and facilitates metabolic alterations in the hypoxic environments that help tumor cells survive and proliferate under such conditions. PMID:22869720

  20. The cauliflower Orange gene enhances petiole elongation by suppressing expression of eukaryotic release factor 1.

    PubMed

    Zhou, Xiangjun; Sun, Tian-Hu; Wang, Ning; Ling, Hong-Qing; Lu, Shan; Li, Li

    2011-04-01

    The cauliflower (Brassica oleracea var. botrytis) Orange (Or) gene affects plant growth and development in addition to conferring β-carotene accumulation. This study was undertaken to investigate the molecular basis for the effects of the Or gene mutation in on plant growth. The OR protein was found to interact with cauliflower and Arabidopsis eukaryotic release factor 1-2 (eRF1-2), a member of the eRF1 family, by yeast two-hybrid analysis and by bimolecular fluorescence complementation (BiFC) assay. Concomitantly, the Or mutant showed reduced expression of the BoeRF1 family genes. Transgenic cauliflower plants with suppressed expression of BoeRF1-2 and BoeRF1-3 were generated by RNA interference. Like the Or mutant, the BoeRF1 RNAi lines showed increased elongation of the leaf petiole. This long-petiole phenotype was largely caused by enhanced cell elongation, which resulted from increased cell length and elevated expression of genes involved in cell-wall loosening. These findings demonstrate that the cauliflower Or gene controls petiole elongation by suppressing the expression of eRF1 genes, and provide new insights into the molecular mechanism of leaf petiole regulation.

  1. Toxoplasma gondii Elongation Factor 1-Alpha (TgEF-1α) Is a Novel Vaccine Candidate Antigen against Toxoplasmosis.

    PubMed

    Wang, Shuai; Zhang, Zhenchao; Wang, Yujian; Gadahi, Javaid A; Xu, Lixin; Yan, Ruofeng; Song, Xiaokai; Li, Xiangrui

    2017-01-01

    Toxoplasma gondii (T. gondii) is an obligate intracellular parasite which can infect almost all warm-blood animals, leading to toxoplasmosis. Screening and discovery of an effective vaccine candidate or new drug target is crucial for the control of this disease. In this study, the recombinant T. gondii elongation factor 1-alpha (rTgEF-1α) was successfully expressed in in Escherichia coli. Passive immunization of mice with anti-rTgEF-1α polyclonal antibody following challenge with a lethal dose of tachyzoites significantly increased the survival time compared with PBS control group. The survival time of mice challenged with tachyzoites pretreated with anti-rTgEF-1α PcAb also was significantly increased. Invasion of tachyzoites into mouse macrophages was significantly inhibited in the anti-rTgEF-1α PcAb pretreated group. Mice vaccinated with rTgEF-1α induced a high level of specific anti-T. gondii antibodies and production of IFN-gamma, interleukin-4. The expression levels of MHC-I and MHC-II molecules as well as the percentages of CD4(+) and CD8(+) T cells in mice vaccinated with rTgEF-1α was significantly increased, respectively (P < 0.05), compared with all the controls. Immunization with rTgEF-1α significantly (P < 0.05) prolonged survival time (14.53 ± 1.72 days) after challenge infection with the virulent T. gondii RH strain. These results indicate that T. gondii EF-1α plays an essential role in mediating host cell invasion by the parasite and, as such, could be a candidate vaccine antigen against toxoplasmosis.

  2. Mathematically-Engineered Stromal Cell-Derived Factor 1alpha Stem Cell Cytokine Analogue Enhances Mechanical Properties of Infarcted Myocardium

    PubMed Central

    Jr, John W. MacArthur; Trubelja, Alen; Shudo, Yasuhiro; Hsiao, Philip; Fairman, Alex; Yang, Elaine; Hiesinger, William; Atluri, Pavan; Woo, Y Joseph

    2014-01-01

    Background The biomechanical response to a myocardial infarction consists of ventricular remodeling that leads to dilation, loss of contractile function, abnormal stress patterns and ultimately heart failure. We hypothesized that intramyocardial injection of our previously designed pro-angiogenic chemokine, an engineered stromal cell derived factor 1alpha analogue(ESA), improves mechanical properties of the heart post-infarction. Methods Male rats (n=54) underwent either sham surgery (n=17) with no coronary artery ligation or ligation of the LAD (n=37). Rats in the MI group were then randomized to receive either saline (0.1cc, n=18) or ESA (6μg/kg, n=19) injected into the myocardium at 4 predetermined spots around the borderzone. Echocardiograms were performed preoperatively and before the terminal surgery. After 4 weeks the hearts were explanted and longitudinally sectioned. Uniaxial tensile testing was completed using an Instron 5543 Microtester. Optical strain was evaluated utilizing custom image acquisition software, Digi-Velpo, and analyzed in MATLAB. Results Compared to the saline control group at 4 weeks, the ESA injected hearts had higher ejection fractions (71.8% ± 9.0 vs. 55.3% ± 12.6, p= 0.0004) smaller end-diastolic left ventricular internal dimensions (0.686cm ± 0.110 vs. 0.763cm ± 0.160, p= 0.04), higher cardiac output (36ml/min ± 11.6 vs. 26.9ml/min ± 7.3, p= 0.05) and the tensile modulus was lower(251kPa ± 56 vs. 301kPa ± 81, p= 0.04). The tensile modulus for the sham group was 195kPa ± 56, indicating ESA injection results in a less stiff ventricle. Conclusions Direct injection of ESA alters the biomechanical response to MI, improving the mechanical properties in the post-infarct heart. PMID:23244259

  3. Toxoplasma gondii Elongation Factor 1-Alpha (TgEF-1α) Is a Novel Vaccine Candidate Antigen against Toxoplasmosis

    PubMed Central

    Wang, Shuai; Zhang, Zhenchao; Wang, Yujian; Gadahi, Javaid A.; Xu, Lixin; Yan, Ruofeng; Song, Xiaokai; Li, Xiangrui

    2017-01-01

    Toxoplasma gondii (T. gondii) is an obligate intracellular parasite which can infect almost all warm-blood animals, leading to toxoplasmosis. Screening and discovery of an effective vaccine candidate or new drug target is crucial for the control of this disease. In this study, the recombinant T. gondii elongation factor 1-alpha (rTgEF-1α) was successfully expressed in in Escherichia coli. Passive immunization of mice with anti-rTgEF-1α polyclonal antibody following challenge with a lethal dose of tachyzoites significantly increased the survival time compared with PBS control group. The survival time of mice challenged with tachyzoites pretreated with anti-rTgEF-1α PcAb also was significantly increased. Invasion of tachyzoites into mouse macrophages was significantly inhibited in the anti-rTgEF-1α PcAb pretreated group. Mice vaccinated with rTgEF-1α induced a high level of specific anti-T. gondii antibodies and production of IFN-gamma, interleukin-4. The expression levels of MHC-I and MHC-II molecules as well as the percentages of CD4+ and CD8+ T cells in mice vaccinated with rTgEF-1α was significantly increased, respectively (P < 0.05), compared with all the controls. Immunization with rTgEF-1α significantly (P < 0.05) prolonged survival time (14.53 ± 1.72 days) after challenge infection with the virulent T. gondii RH strain. These results indicate that T. gondii EF-1α plays an essential role in mediating host cell invasion by the parasite and, as such, could be a candidate vaccine antigen against toxoplasmosis. PMID:28243226

  4. Characterization and phylogeny of entomopathogenic Isaria spp. (Ascomycota: Hypocreales) using ITS1-5.8X-ITS2 and elongation factor 1-alpha sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The elongation factor 1-alpha (EF1-a) and the internal transcribed spacer regions ITS1 and ITS2 (ITS1-5.8S-ITS2) sequences were used to characterize and identify Isaria isolates from Argentina and Brazil, as well as to study the phylogenetic relationships among these isolates and other related fungi...

  5. Insulin-like Growth Factor 1 gene polymorphism and breast cancer risk.

    PubMed

    Costa-Silva, Danylo R; Barros-Oliveira, Maria DA Conceição; Borges, Rafael S; Tavares, Cléciton B; Borges, Umbelina S; Alves-Ribeiro, Francisco A; Silva, Vladimir C; Silva, Benedito B DA

    2016-01-01

    Insulin-like Growth Factor-1 (IGF-1) gene polymorphism has been associated with an increased risk for breast cancer. IGF-1 is a key regulator of proliferation, cell differentiation and apoptosis. It has important mitogenic and anti-apoptotic activities in normal cells and in breast cancer cells, acting synergistically with estrogen to increase neoplastic cell proliferation. This review aims to present the recent finds of IGF-1 gene polymorphism and its relationship with the risk of breast cancer through following the polymorphic dinucleotide repeat cytosine-adenine (CA) and single nucleotide polymorphisms (SNPs) by searching in the PubMed database publications focused studies published from 2010 to 2015 related to IGF-1 gene polymorphism and breast cancer risk. A growing number of studies support an association between IGF-1 gene polymorphism and breast cancer risk with conflicting results, nevertheless elucidation of the patterns of IGF-1 gene expression may permit characterization of women at high-risk for breast cancer, as well as the development of strategies for early diagnosis and efficient treatment against the disease.

  6. The involvement of hypoxia-inducible factor-1alpha in the susceptibility to gamma-rays and chemotherapeutic drugs of oral squamous cell carcinoma cells.

    PubMed

    Sasabe, Eri; Zhou, Xuan; Li, Dechao; Oku, Naohisa; Yamamoto, Tetsuya; Osaki, Tokio

    2007-01-15

    The transcription factor hypoxia-inducible factor-1alpha (HIF-1alpha) is the key regulator that controls the hypoxic response of mammalian cells. The overexpression of HIF-1alpha has been demonstrated in many human tumors. However, the role of HIF-1alpha in the therapeutic efficacy of chemotherapy and radiotherapy in cancer cells is poorly understood. In this study, we investigated the influence of HIF-1alpha expression on the susceptibility of oral squamous cell carcinoma (OSCC) cells to chemotherapeutic drugs (cis-diamminedichloroplatinum and 5-fluorouracil) and gamma-rays. Treatment with chemotherapeutic drugs and gamma-rays enhanced the expression and nuclear translocation of HIF-1alpha, and the susceptibility of OSCC cells to the drugs and gamma-rays was negatively correlated with the expression level of HIF-1alpha protein. The overexpression of HIF-1alpha induced OSCC cells to become more resistant to the anticancer agents, and down-regulation of HIF-1alpha expression by small interfering RNA enhanced the susceptibility of OSCC cells to them. In the HIF-1alpha-knockdown OSCC cells, the expression of P-glycoprotein, heme oxygenase-1, manganese-superoxide dismutase and ceruloplasmin were downregulated and the intracellular levels of chemotherapeutic drugs and reactive oxygen species were sustained at higher levels after the treatment with the anticancer agents. These results suggest that enhanced HIF-1alpha expression is related to the resistance of tumor cells to chemo- and radio-therapy and that HIF-1alpha is an effective therapeutic target for cancer treatment.

  7. F-actin sequesters elongation factor 1alpha from interaction with aminoacyl-tRNA in a pH-dependent reaction

    PubMed Central

    1996-01-01

    The machinery of eukaryotic protein synthesis is found in association with the actin cytoskeleton. A major component of this translational apparatus, which is involved in the shuttling of aa-tRNA, is the actin- binding protein elongation factor 1alpha (EF-1alpha). To investigate the consequences for translation of the interaction of EF-1alpha with F- actin, we have studied the effect of F-actin on the ability of EF- 1alpha to bind to aa-tRNA. We demonstrate that binding of EF-1alpha:GTP to aa-tRNA is not pH sensitive with a constant binding affinity of approximately 0.2 microM over the physiological range of pH. However, the sharp pH dependence of binding of EF-1alpha to F-actin is sufficient to shift the binding of EF-1alpha from F-actin to aa-tRNA as pH increases. The ability of EF-1alpha to bind either F-actin or aa- tRNA in competition binding experiments is also consistent with the observation that EF-1alpha's binding to F-actin and aa-tRNA is mutually exclusive. Two pH-sensitive actin-binding sequences in EF-1alpha are identified and are predicted to overlap with the aa-tRNA-binding sites. Our results suggest that pH-regulated recruitment and release of EF- 1alpha from actin filaments in vivo will supply a high local concentration of EF-1alpha to facilitate polypeptide elongation by the F-actin-associated translational apparatus. PMID:8922379

  8. Differential dependence of hypoxia-inducible factors 1 alpha and 2 alpha on mTORC1 and mTORC2.

    PubMed

    Toschi, Alfredo; Lee, Evan; Gadir, Noga; Ohh, Michael; Foster, David A

    2008-12-12

    Constitutive expression of hypoxia-inducible factor (HIF) has been implicated in several proliferative disorders. Constitutive expression of HIF1 alpha and HIF2 alpha has been linked to a number of human cancers, especially renal cell carcinoma (RCC), in which HIF2 alpha expression is the more important contributor. Expression of HIF1 alpha is dependent on the mammalian target of rapamycin (mTOR) and is sensitive to rapamycin. In contrast, there have been no reports linking HIF2 alpha expression with mTOR. mTOR exists in two complexes, mTORC1 and mTORC2, which are differentially sensitive to rapamycin. We report here that although there are clear differences in the sensitivity of HIF1 alpha and HIF2 alpha to rapamycin, both HIF1 alpha and HIF2 alpha expression is dependent on mTOR. HIF1 alpha expression was dependent on both Raptor (a constituent of mTORC1) and Rictor (a constitutive of mTORC2). In contrast, HIF2 alpha was dependent only on the mTORC2 constituent Rictor. These data indicate that although HIF1 alpha is dependent on both mTORC1 and mTORC2, HIF2 alpha is dependent only on mTORC2. We also examined the dependence of HIF alpha expression on the mTORC2 substrate Akt, which exists as three different isoforms, Akt1, Akt2, and Akt3. Interestingly, the expression of HIF2 alpha was dependent on Akt2, whereas that of HIF1 alpha was dependent on Akt3. Because HIF2 alpha is apparently more critical in RCC, this study underscores the importance of targeting mTORC2 and perhaps Akt2 signaling in RCC and other proliferative disorders in which HIF2 alpha has been implicated.

  9. Functional significance of Wnt inhibitory factor-1 gene in kidney cancer.

    PubMed

    Kawakami, Kazumori; Hirata, Hiroshi; Yamamura, Soichiro; Kikuno, Nobuyuki; Saini, Sharanjot; Majid, Shahana; Tanaka, Yuichiro; Kawamoto, Ken; Enokida, Hideki; Nakagawa, Masayuki; Dahiya, Rajvir

    2009-11-15

    Wnt inhibitory factor-1 (WIF-1) has been identified as one of the secreted antagonists that bind Wnt protein. WIF-1 has been described as a tumor suppressor in various types of cancer. However, the molecular function of WIF-1 gene has never been examined in human renal cell carcinoma (RCC). Therefore, we hypothesized that WIF-1 functions as a tumor suppressor gene and overexpression of this gene may induce apoptosis and inhibit tumor growth in RCC cells. Immunohistochemistry and real-time reverse transcription-PCR revealed that WIF-1 was significantly downregulated in RCC samples and RCC cell lines, respectively. Bisulfite sequencing of the WIF-1 promoter region in RCC cell lines showed it to be densely methylated, whereas there was no methylation of WIF-1 promoter in normal kidney. Significant inhibition of cell growth and colony formation in WIF-1-transfected cells compared with controls were observed. WIF-1 transfection significantly induced apoptosis and suppressed in vivo tumor growth. Also, Wnt signaling activity and beta-catenin expression were reduced by WIF-1 transfection. In conclusion, this is the first report documenting that the WIF-1 is downregulated by promoter methylation and functions as a tumor suppressor gene by inducing apoptosis in RCC cells.

  10. Isolation and characterization of the human Gs alpha gene.

    PubMed Central

    Kozasa, T; Itoh, H; Tsukamoto, T; Kaziro, Y

    1988-01-01

    The gene for Gs alpha (the alpha subunit of the guanine nucleotide-binding protein Gs) was isolated from human genomic libraries using rat Gs alpha cDNA as a probe. Comparison of the nucleotide sequence of the human gene with that of the rat cDNA revealed that the human Gs alpha gene spans approximately equal to 20 kilobases and is composed of 13 exons and 12 introns. Genomic Southern blot analysis suggests that the human haploid genome contains a single Gs alpha gene. Previous reports indicated the presence of multiple species of Gs alpha cDNA. The structure of the human Gs alpha gene suggests that four types of Gs alpha mRNAs may be generated from a single Gs alpha gene by alternate use of exon 3 and/or of two 3' splice sites of intron 3, where an unusual splice junction sequence (TG) instead of the consensus (AG) is used. S1 nuclease mapping analysis of human Gs alpha mRNA identified multiple transcriptional initiation sites. The promoter region of the human Gs alpha gene has extremely high G + C content (85%). It contains 4 "GC" boxes, but no typical "TATA" or "CAAT" box sequence. In the 5' flanking region, there are several blocks of sequences that are similar to the sequences of the 5' flanking region of the human c-Ki-ras2 gene. Images PMID:3127824

  11. Effect of elongation factor 1alpha promoter and SUMF1 over in vitro expression of N-acetylgalactosamine-6-sulfate sulfatase.

    PubMed

    Alméciga-Díaz, Carlos J; Rueda-Paramo, Maria A; Espejo, Angela J; Echeverri, Olga Y; Montaño, Adriana; Tomatsu, Shunji; Barrera, Luis A

    2009-09-01

    Morquio A is an autosomal recessive disease caused by the deficiency of N-acetylgalactosamine-6-sulfate sulfatase (GALNS), leading to the lysosomal accumulation of keratan-sulfate and chondroitin-6-sulfate. We evaluated in HEK293 cells the effect of the cytomegalovirus immediate early enhancer/promoter (CMV) or the elongation factor 1alpha (EF1alpha) promoters, and the coexpression with the sulfatase modifying factor 1 (SUMF1) on GALNS activity. Four days postransfection GALNS activity in transfected cells with CMV-pIRES-GALNS reached a plateau, whereas in cells transfected with EF1alpha-pIRES-GALNS continued to increase until day 8. Co-transfection with pCXN-SUMF1 showed an increment up to 2.6-fold in GALNS activity. Finally, computational analysis of transcription factor binding-sites and CpG islands showed that EF1alpha promoter has long CpG islands and high-density binding-sites for Sp1 compared to CMV. These results show the advantage of the SUMF1 coexpression on GALNS activity and indicate a considerable effect on the expression stability using EF1alpha promoter compared to CMV.

  12. Insulin-Like Growth Factor-1 Inscribes a Gene Expression Profile for Angiogenic Factors and Cancer Progression in Breast Epithelial Cells1

    PubMed Central

    Oh, JS; Kucab, JE; Bushel, PR; Martin, K; Bennett, L; Collins, J; DiAugustine, RP; Barrett, JC; Afshari, CA; Dunn, SE

    2002-01-01

    Abstract Activation of the insulin-like growth factor-1 receptor (IGF-1R) by IGF-1 is associated with the risk and progression of many types of cancer, although despite this it remains unclear how activated IGF-1R contributes to cancer progression. In this study, gene expression changes elicited by IGF-1 were profiled in breast epithelial cells. We noted that many genes are functionally linked to cancer progression and angiogenesis. To validate some of the changes observed, the RNA and/or protein was confirmed for c-fos, cytochrome P450 1A1, cytochrome P450 1B1, interleukin-1 beta, fas ligand, vascular endothelial growth factor, and urokinase plasminogen activator. Nuclear proteins were also temporally monitored to address how gene expression changes were regulated. We found that IGF-1 stimulated the nuclear translocation of phosphorylated AKT, hypoxic-inducible factor-1 alpha, and phosphorylated cAMP-responsive element-binding protein, which correlated with temporal changes in gene expression. Next, the promoter regions of IGF-1-regulated genes were searched in silico. The promoters of genes that clustered together had similar regulatory regions. In summary, IGF-1 inscribes a gene expression profile relevant to cancer progression, and this study provides insight into the mechanism(s) whereby some of these changes occur. PMID:11988840

  13. Endothelial monocyte activating polypeptide-II modulates endothelial cell responses by degrading hypoxia-inducible factor-1alpha through interaction with PSMA7, a component of the proteasome

    SciTech Connect

    Tandle, Anita T.; Calvani, Maura; Uranchimeg, Badarch; Zahavi, David; Melillo, Giovanni; Libutti, Steven K.

    2009-07-01

    The majority of human tumors are angiogenesis dependent. Understanding the specific mechanisms that contribute to angiogenesis may offer the best approach to develop therapies to inhibit angiogenesis in cancer. Endothelial monocyte activating polypeptide-II (EMAP-II) is an anti-angiogenic cytokine with potent effects on endothelial cells (ECs). It inhibits EC proliferation and cord formation, and it suppresses primary and metastatic tumor growth in-vivo. However, very little is known about the molecular mechanisms behind the anti-angiogenic activity of EMAP-II. In the present study, we explored the molecular mechanism behind the anti-angiogenic activity exerted by this protein on ECs. Our results demonstrate that EMAP-II binds to the cell surface {alpha}5{beta}1 integrin receptor. The cell surface binding of EMAP-II results in its internalization into the cytoplasmic compartment where it interacts with its cytoplasmic partner PSMA7, a component of the proteasome degradation pathway. This interaction increases hypoxia-inducible factor 1-alpha (HIF-1{alpha}) degradation under hypoxic conditions. The degradation results in the inhibition of HIF-1{alpha} mediated transcriptional activity as well as HIF-1{alpha} mediated angiogenic sprouting of ECs. HIF-1{alpha} plays a critical role in angiogenesis by activating a variety of angiogenic growth factors. Our results suggest that one of the major anti-angiogenic functions of EMAP-II is exerted through its inhibition of the HIF-1{alpha} activities.

  14. Andrographolide down-regulates hypoxia-inducible factor-1{alpha} in human non-small cell lung cancer A549 cells

    SciTech Connect

    Lin, Hui-Hsuan; Tsai, Chia-Wen; Chou, Fen-Pi; Wang, Chau-Jong; Hsuan, Shu-Wen; Wang, Cheng-Kun; Chen, Jing-Hsien

    2011-02-01

    Andrographolide (Andro), a diterpenoid lactone isolated from a traditional herbal medicine Andrographis paniculata, is known to possess multiple pharmacological activities. In our previous study, Andro had been shown to inhibit non-small cell lung cancer (NSCLC) A549 cell migration and invasion via down-regulation of phosphatidylinositol 3-kinase (PI3K)/Akt signaling pathway. Here we demonstrated that Andro inhibited the expression of hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) in A549 cells. HIF-1{alpha} plays an important role in tumor growth, angiogenesis and lymph node metastasis of NSCLC. The Andro-induced decrease of cellular protein level of HIF-1{alpha} was correlated with a rapid ubiquitin-dependent degradation of HIF-1{alpha}, and was accompanied by increased expressions of hydroxyl-HIF-1{alpha} and prolyl hydroxylase (PHD2), and a later decrease of vascular endothelial growth factor (VEGF) upon the treatment of Andro. The Andro-inhibited VEGF expression appeared to be a consequence of HIF-1{alpha} inactivation, because its DNA binding activity was suppressed by Andro. Molecular data showed that all these effects of Andro might be mediated via TGF{beta}1/PHD2/HIF-1{alpha} pathway, as demonstrated by the transfection of TGF{beta}1 overexpression vector and PHD2 siRNA, and the usage of a pharmacological MG132 inhibitor. Furthermore, we elucidated the involvement of Andro in HIF-1{alpha} transduced VEGF expression in A549 cells and other NSCLC cell lines. In conclusion, these results highlighted the potential effects of Andro, which may be developed as a chemotherapeutic or an anti-angiogenesis agent for NSCLC in the future.

  15. HNF1alpha is involved in tissue-specific regulation of CFTR gene expression.

    PubMed Central

    Mouchel, Nathalie; Henstra, Sytse A; McCarthy, Victoria A; Williams, Sarah H; Phylactides, Marios; Harris, Ann

    2004-01-01

    The CFTR (cystic fibrosis transmembrane conductance regulator) gene shows a complex pattern of expression with tissue-specific and temporal regulation. However, the genetic elements and transcription factors that control CFTR expression are largely unidentified. The CFTR promoter does not confer tissue specificity on gene expression, suggesting that there are regulatory elements outside the upstream region. Analysis of potential regulatory elements defined as DNase 1-hypersensitive sites within introns of the gene revealed multiple predicted binding sites for the HNF1alpha (hepatocyte nuclear factor 1alpha) transcription factor. HNF1alpha, which is expressed in many of the same epithelial cell types as CFTR and shows similar differentiation-dependent changes in gene expression, bound to these sites in vitro. Overexpression of heterologous HNF1alpha augmented CFTR transcription in vivo. In contrast, antisense inhibition of HNF1 alpha transcription decreased the CFTR mRNA levels. Hnf1 alpha knockout mice showed lower levels of CFTR mRNA in their small intestine in comparison with wild-type mice. This is the first report of a transcription factor, which confers tissue specificity on the expression of this important disease-associated gene. PMID:14656222

  16. Both microtubule-stabilizing and microtubule-destabilizing drugs inhibit hypoxia-inducible factor-1alpha accumulation and activity by disrupting microtubule function.

    PubMed

    Escuin, Daniel; Kline, Erik R; Giannakakou, Paraskevi

    2005-10-01

    We have recently identified a mechanistic link between disruption of the microtubule cytoskeleton and inhibition of tumor angiogenesis via the hypoxia-inducible factor-1 (HIF-1) pathway. Based on this model, we hypothesized that other microtubule-targeting drugs may have a similar effect on HIF-1alpha. To test that hypothesis, we studied the effects of different clinically relevant microtubule-disrupting agents, including taxotere, epothilone B, discodermolide, vincristine, 2-methoxyestradiol, and colchicine. In all cases, HIF-1alpha protein, but not mRNA, was down-regulated in a drug dose-dependent manner. In addition, HIF-1alpha transcriptional activity was also inhibited by all drugs tested. To further examine whether these effects were dependent on microtubule network disruption, we tested the ability of epothilone B to inhibit HIF-1alpha protein in the human ovarian cancer cell line 1A9 and its beta-tubulin mutant epothilone-resistant subclone 1A9/A8. Our data showed that epothilone B treatment down-regulated HIF-1alpha protein in the parental 1A9 cells but had no effect in the resistant 1A9/A8 cells. These observations were confirmed by confocal microscopy, which showed impaired nuclear accumulation of HIF-1alpha in parental 1A9 cells at epothilone B concentrations that induced extensive microtubule stabilization. In contrast, epothilone B treatment had no effect on either microtubules or HIF-1alpha nuclear accumulation in the resistant 1A9/A8 cells. Furthermore, epothilone B inhibited HIF-1 transcriptional activity in 1A9 cells, as evidenced by a hypoxia response element-luciferase reporter assay, but had no effect on HIF-1 activity in the resistant 1A9/A8 cells. These data directly link beta-tubulin drug binding with HIF-1alpha protein inhibition. Our results further provide a strong rationale for testing taxanes and epothilones in clinical trials targeting HIF-1 in cancer patients.

  17. Identification of Dictyostelium G alpha genes expressed during multicellular development.

    PubMed Central

    Hadwiger, J A; Wilkie, T M; Strathmann, M; Firtel, R A

    1991-01-01

    Guanine nucleotide-binding protein (G protein)-mediated signal transduction constitutes a common mechanism by which cells receive and respond to a diverse set of environmental signals. Many of the signals involved in the developmental life cycle of the slime mold Dictyostelium have been postulated to be transduced by such pathways and, in some cases, these pathways have been demonstrated to be dependent on specific G proteins. Using the polymerase chain reaction, we have identified two additional Dictyostelium G alpha genes, G alpha 4 and G alpha 5, that are developmentally regulated. Transcripts from both of these genes are primarily expressed during the multicellular stages of development, suggesting possible roles in cell differentiation or morphogenesis. The entire G alpha 4 gene was sequenced and found to encode a protein consisting of 345 amino acids. The G alpha 4 subunit is homologous to other previously identified G alpha subunits, including the Dictyostelium G alpha 1 (43% identity) and G alpha 2 (41% identity) subunits. However, the G alpha 4 subunit contains some unusual sequence divergences in residues highly conserved among most eukaryotic G alpha subunits, suggesting that G alpha 4 may be a member of another class of G alpha subunits. Images PMID:1910174

  18. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  19. Regulation of chick early B-cell factor-1 gene expression in feather development.

    PubMed

    El-Magd, Mohammed Abu; Sayed-Ahmed, Ahmed; Awad, Ashraf; Shukry, Mustafa

    2014-05-01

    The chick Ebf1 (early B-cell factor-1) gene is a member of a novel family of helix loop helix transcription factors. The expression profile, regulation and significance of this gene have been extensively studied in lymphatic, nervous, adipose and muscular tissues. However, cEbf1 expression, regulation and function in the feather of chick embryo have not yet been investigated. cEbf1 expression was first detected throughout the mesenchymal core of some few feather placodes (D7-D7.5). After feathers became mature and grew distally (D9 and D10), the mesenchymal expression of cEbf1 became confined to the caudal margin of the proximal half of all formed feather buds. Because this dynamic pattern of expression resembles that of Sonic Hedgehog (Shh) protein and bone morphogenetic protein (Bmp4) plus the crucial role of these two major signals in feather development, we hypothesized that cEbf1 expression in the feather may be regulated by Shh and Bmp4. In a feather explant culture system, Shh signals are necessary to initiate and maintain cEbf1 expression in the posterior half of the feather bud, while Bmp4 is crucial for the initial cEbf1 expression in the anterior half of the feather bud. Inhibition of Shh, not only down-regulates cEbf1, but also changes the morphology of feather buds, which become irregular and fused. This is the first study to demonstrate that cEbf1 expression in the feather bud is under the control of Shh and Bmp4 signals and that expression may play a role in the normal development of feathers.

  20. The chromosomal arrangement of human alpha-like globin genes: sequence homology and alpha-globin gene deletions.

    PubMed

    Lauer, J; Shen, C K; Maniatis, T

    1980-05-01

    We report the isolation of a cluster of four alpha-like globin genes from a bacteriophage lambda library of human DNA (Lawn et al., 1978). Analysis of the cloned DNA confirms the linkage arrangement of the two adult alpha-globin genes (alpha 1 and alpha 2) previously derived from genomic blotting experiments (Orkin, 1978) and identifies two additional closely linked alpha-like genes. The nucleotide sequence of a portion of each of these alpha-like genes was determined. One of these sequences is tentatively identified as an embryonic zeta-globin gene (zeta 1) by comparison with structural data derived from purified zeta-globin protein (J. Clegg, personal communication), while the other sequence cannot be matched with any known alpha-like polypeptide sequence (we designate this sequence phi alpha 1). Localization of the four alpha-like sequences on a restriction map of the gene cluster indicates that the genes have the same transcriptional orientation and are arranged in the order 5'-zeta 1-phi alpha 1-alpha 2-alpha 1-3'. Genomic blotting experiments identified a second, nonallelic zeta-like globin gene (phi 2) located 10-12 kb 5' to the cloned zeta-globin gene. Comparison of the locations of restriction sites within alpha 1 and alpha 2 and heteroduplex studies reveal extensive sequence homology within and flanking the two genes. The homologous sequences, which are interrupted by two blocks of nonhomology, span a region of approximately 4 kb. This extensive sequence homology between two genes which are thought to be the products of an ancient duplication event suggests the existence of a mechanism for sequence matching during evolution. One consequence of this arrangement of homologous sequences is the occurrence of two types of deletions in recombinant phage DNA during propagation in E. coli. The locations and sizes of the two types of deletions are indistinguishable from those of the two types of deletions associated with alpha-thalassemia 2 (Embury et al., 1979

  1. Human brain factor 1, a new member of the fork head gene family

    SciTech Connect

    Murphy, D.B.; Wiese, S.; Burfeind, P.

    1994-06-01

    Analysis of cDNA clones that cross-hybridized with the fork head domain of the rat HNF-3 gene family revealed 10 cDNAs from human fetal brain and human testis cDNA libraries containing this highly conserved DNA-binding domain. Three of these cDNAs (HFK1, HFK2, and HFK3) were further analyzed. The cDNA HFK1 has a length of 2557 nucleotides and shows strong homology at the nucleotide level (91.2%) to brain factor 1 (BF-1) from rat. The HFK1 cDNA codes for a putative 476 amino acid protein. The homology to BF-1 from rat in the coding region at the amino acid level is 87.5%. The fork head homologous region includes 111 amino acids starting at amino acid 160 and has a 97.5% homology to BF-1. Southern hybridization revealed that HFK1 is highly conserved among mammalian species and possibly birds. Northern analysis with total RNA from human tissues and poly(A)-rich RNA from mouse revealed a 3.2-kb transcript that is present in human and mouse fetal brain and in adult mouse brain. In situ hybridization with sections of mouse embryo and human fetal brain reveals that HFK1 expression is restricted to the neuronal cells in the telencepthalon, with strong expression being observed in the developing dentate gyrus and hippocampus. HFK1 was chromosomally localized by in situ hybridization to 14q12. The cDNA clones HFK2 and HFK3 were analyzed by restriction analysis and sequencing. HFK2 and HFK3 were found to be closely related but different from HFK1. Therefore, it would appear that HFK1, HFK2, HFK3, and BF-1 form a new fork head related subfamily. 33 refs., 6 figs.

  2. Self-renewal and pluripotency is maintained in human embryonic stem cells by co-culture with human fetal liver stromal cells expressing hypoxia inducible factor 1alpha.

    PubMed

    Ji, Lei; Liu, Yu-xiao; Yang, Chao; Yue, Wen; Shi, Shuang-shuang; Bai, Ci-xian; Xi, Jia-fei; Nan, Xue; Pei, Xue-Tao

    2009-10-01

    Human embryonic stem (hES) cells are typically maintained on mouse embryonic fibroblast (MEF) feeders or with MEF-conditioned medium. However, these xenosupport systems greatly limit the therapeutic applications of hES cells because of the risk of cross-transfer of animal pathogens. The stem cell niche is a unique tissue microenvironment that regulates the self-renewal and differentiation of stem cells. Recent evidence suggests that stem cells are localized in the microenvironment of low oxygen. We hypothesized that hypoxia could maintain the undifferentiated phenotype of embryonic stem cells. We have co-cultured a human embryonic cell line with human fetal liver stromal cells (hFLSCs) feeder cells stably expressing hypoxia-inducible factor-1 alpha (HIF-1alpha), which is known as the key transcription factor in hypoxia. The results suggested HIF-1alpha was critical for preventing differentiation of hES cells in culture. Consistent with this observation, hypoxia upregulated the expression of Nanog and Oct-4, the key factors expressed in undifferentiated stem cells. We further demonstrated that HIF-1alpha could upregulate the expression of some soluble factors including bFGF and SDF-1alpha, which are released into the microenvironment to maintain the undifferentiated status of hES cells. This suggests that the targets of HIF-1alpha are secreted soluble factors rather than a cell-cell contact mechanism, and defines an important mechanism for the inhibition of hESCs differentiation by hypoxia. Our findings developed a transgene feeder co-culture system and will provide a more reliable alternative for future therapeutic applications of hES cells.

  3. EFFECTS OF HEAT AND BROMOCHLOROACETIC ACID ON MALE REPRODUCTION IN HEAT SHOCK FACTOR-1 GENE KNOCKOUT MICE

    EPA Science Inventory

    Effects of heat and bromochloroacetic acid on male reproduction in heat shock factor-1 gene knockout mice.
    Luft JC1, IJ Benjamin2, JB Garges1 and DJ Dix1. 1Reproductive Toxicology Division, USEPA, RTP, NC, 27711 and 2Dept of Internal Medicine, Univ.of Texas Southwestern Med C...

  4. Enhancement of glucocorticoid receptor-mediated gene expression by constitutively active heat shock factor 1.

    PubMed

    Jones, Thomas J; Li, Dapei; Wolf, Irene M; Wadekar, Subhagya A; Periyasamy, Sumudra; Sánchez, Edwin R

    2004-03-01

    To further define the role of heat shock factor 1 (HSF1) in the stress potentiation of glucocorticoid receptor (GR) activity, we placed a constitutively active mutant of human HSF1 (hHSF1-E189) under the control of a doxycycline (DOX)-inducible vector. In mouse L929 cells, DOX-induced expression of hHSF1-E189 correlated with in vivo occupancy of the human heat shock protein 70 (hHsp70) promoter (chromatin-immunoprecipitation assay) and with increased activity under nonstress conditions at the hHsp70 promoter controlling expression of chloramphenicol acetyl transferase (CAT) (p2500-CAT). Comparison of hHSF1-E189 against stress-activated, endogenous HSF1 for DNA-binding, p2500-CAT, and Hsp70 protein expression activities showed the mutant factor to have lower, but clearly detectable, activities as compared with wild-type factor. Thus, the hHSF1-E189 mutant is capable of replicating these key functions of endogenous HSF1, albeit at reduced levels. To assess the involvement of hHSF1-E189 in GR activity, DOX-induced expression of hHSF1-E189 was performed in L929 cells expressing the minimal pGRE(2)E1B-CAT reporter. hHSF1-E189 protein expression in these cells was maximal at 24 h of DOX and remained constant up to 72 h. hHSF1-E189 expressed under these conditions was found both in the cytosolic and nuclear compartments, in a state capable of binding DNA. More importantly, GR activity at the pGRE(2)E1B-CAT promoter was found to increase after DOX-induced expression of hHSF1-E189. The potentiation of GR by hHSF1-E189 occurred at saturating concentrations of hormone and was dependent on at least 48 h of hHSF1-E189 up-regulation, suggesting that time was needed for an HSF1-induced factor to accumulate to a threshold level. Initial efforts to characterize how hHSF1-E189 controls GR signaling showed that it does not occur through alterations of GR protein levels or changes in GR hormone binding capacity. In summary, our observations provide the first molecular evidence for the

  5. Human mast cells transmigrate through human umbilical vein endothelial monolayers and selectively produce IL-8 in response to stromal cell-derived factor-1 alpha.

    PubMed

    Lin, T J; Issekutz, T B; Marshall, J S

    2000-07-01

    Mature mast cells are generally considered to be less mobile cells residing within tissue sites. However, mast cell numbers are known to increase in the context of inflammation, and mast cells are recognized to be important in regulating local neutrophil infiltration. CXC chemokines may play a critical role in this process. In this study two human mast cell-like lines, HMC-1 and KU812, and human cord blood-derived primary cultured mast cells were employed to examine role of stromal cell-derived factor-1 (SDF-1) in regulating mast cell migration and mediator production. It was demonstrated that human mast cells constitutively express mRNA and protein for CXCR4. Stimulation of human mast cells with SDF-1, the only known ligand for CXCR4, induced a significant increase in intracellular calcium levels. In vitro, SDF-1 alpha mediated dose-dependent migration of human cord blood-derived mast cells and HMC-1 cells across HUVEC monolayers. Although SDF-1 alpha did not induce mast cell degranulation, it selectively stimulated production of the neutrophil chemoattractant IL-8 without affecting TNF-alpha, IL-1beta, IL-6, GM-CSF, IFN-gamma, or RANTES production, providing further evidence of the selective modulation of mast cell function by this chemokine. These findings provide a novel, SDF-1-dependent mechanism for mast cell transendothelial migration and functional regulation, which may have important implications for the local regulation of mast cells in disease.

  6. A novel thiol compound, N-acetylcysteine amide, attenuates allergic airway disease by regulating activation of NF-kappaB and hypoxia-inducible factor-1alpha.

    PubMed

    Lee, Kyung Sun; Kim, So Ri; Park, Hee Sun; Park, Seoung Ju; Min, Kyung Hoon; Lee, Ka Young; Choe, Yeong Hun; Hong, Sang Hyun; Han, Hyo Jin; Lee, Young Rae; Kim, Jong Suk; Atlas, Daphne; Lee, Yong Chul

    2007-12-31

    Reactive oxygen species (ROS) play an important role in the pathogenesis of airway inflammation and hyperresponsiveness. Recent studies have demonstrated that antioxidants are able to reduce airway inflammation and hyperreactivity in animal models of allergic airway disease. A newly developed antioxidant, small molecular weight thiol compound, N-acetylcysteine amide (AD4) has been shown to increase cellular levels of glutathione and to attenuate oxidative stress related disorders such as Alzheimer's disease, Parkinson's disease, and multiple sclerosis. However, the effects of AD4 on allergic airway disease such as asthma are unknown. We used ovalbumin (OVA)-inhaled mice to evaluate the role of AD4 in allergic airway disease. In this study with OVA-inhaled mice, the increased ROS generation, the increased levels of Th2 cytokines and VEGF, the increased vascular permeability, the increased mucus production, and the increased airway resistance in the lungs were significantly reduced by the administration of AD4. We also found that the administration of AD4 decreased the increases of the NF-kappaB and hypoxia-inducible factor-1alpha (HIF-1alpha) levels in nuclear protein extracts of lung tissues after OVA inhalation. These results suggest that AD4 attenuates airway inflammation and hyperresponsiveness by regulating activation of NF-kappaB and HIF-1alpha as well as reducing ROS generation in allergic airway disease.

  7. A DC-81-indole conjugate agent suppresses melanoma A375 cell migration partially via interrupting VEGF production and stromal cell-derived factor-1{alpha}-mediated signaling

    SciTech Connect

    Hsieh, Ming-Chu; Hu, Wan-Ping; Yu, Hsin-Su; Wu, Wen-Chuan; Chang, Long-Sen; Kao, Ying-Hsien; Wang, Jeh-Jeng

    2011-09-01

    Pyrrolo[2,1-c][1,4]benzodiazepine (PBD) chemicals are antitumor antibiotics inhibiting nucleic acid synthesis. An indole carboxylate-PBD hybrid with six-carbon spacer structure (IN6CPBD) has been previously demonstrated to induce melanoma cell apoptosis and reduce metastasis in mouse lungs. This study aimed at investigating the efficacy of the other hybrid compound with four-carbon spacer (IN4CPBD) and elucidating its anti-metastatic mechanism. Human melanoma A375 cells with IN4CPBD treatment underwent cytotoxicity and apoptosis-associated assays. Transwell migration assay, Western blotting, and ELISA were used for mechanistic study. IN4CPBD exhibited potent melanoma cytotoxicity through interrupting G1/S cell cycle progression, increasing DNA fragmentation and hypodipoidic DNA contents, and reducing mitochondrial membrane potential. Caspase activity elevation suggested that both intrinsic and extrinsic pathways were involved in IN4CPBD-induced melanoma apoptosis. IN4CPBD up-regulated p53 and p21, thereby concomitantly derailing the equilibrium between Bcl-2 and Bax levels. Transwell migration assay demonstrated that stromal cell-derived factor-1{alpha} (SDF-1{alpha}) stimulated A375 cell motility, while kinase inhibitors treatment confirmed that Rho/ROCK, Akt, ERK1/2, and p38 MAPK pathways were involved in SDF-1{alpha}-enhanced melanoma migration. IN4CPBD not only abolished the SDF-1{alpha}-enhanced chemotactic motility but also suppressed constitutive MMP-9 and VEGF expression. Mechanistically, IN4CPBD down-regulated Akt, ERK1/2, and p38 MAPK total proteins and MYPT1 phosphorylation. In conclusion, beyond the fact that IN4CPBD induces melanoma cell apoptosis at cytotoxic dose, the interruption in the VEGF expression and the SDF-1{alpha}-related signaling at cytostatic dose may partially constitute the rationale for its in vivo anti-metastatic potency. - Research Highlights: > A novel carboxylate-PBD hybrid as anti-melanoma drug. > IN4CPBD interrupts melanoma cell

  8. Alpha thalassaemia and extended alpha globin genes in Sri Lanka.

    PubMed

    Suresh, Sasikala; Fisher, Christopher; Ayyub, Helena; Premawardhena, Anuja; Allen, Angela; Perera, Ashok; Bandara, Dayananda; Olivieri, Nancy; Weatherall, David

    2013-02-01

    The α-globin genes were studied in nine families with unexplained hypochromic anaemia and in 167 patients with HbE β thalassaemia in Sri Lanka. As well as the common deletion forms of α(+) thalassaemia three families from an ethnic minority were found to carry a novel form of α(0) thalassaemia, one family carried a previously reported form of α(0) thalassaemia, --(THAI), and five families had different forms of non-deletional thalassaemia. The patients with HbE β thalassaemia who had co-inherited α thalassaemia all showed an extremely mild phenotype and reduced levels of HbF and there was a highly significant paucity of α(+) thalassaemia in these patients compared with the normal population. Extended α gene arrangements, including ααα, αααα and ααααα, occurred at a low frequency and were commoner in the more severe phenotypes of HbE β thalassaemia. As well as emphasising the ameliorating effect of α thalassaemia on HbE β thalassaemia the finding of a novel form of α(0) thalassaemia in an ethnic minority, together with an unexpected diversity of forms of non-deletion α thalassaemia in Sri Lanka, further emphasises the critical importance of micro-mapping populations for determining the frequency of clinically important forms of the disease.

  9. The distribution of Elongation Factor-1 Alpha (EF-1alpha), Elongation Factor-Like (EFL), and a non-canonical genetic code in the ulvophyceae: discrete genetic characters support a consistent phylogenetic framework.

    PubMed

    Gile, Gillian H; Novis, Philip M; Cragg, David S; Zuccarello, Giuseppe C; Keeling, Patrick J

    2009-01-01

    The systematics of the green algal class Ulvophyceae have been difficult to resolve with ultrastructural and molecular phylogenetic analyses. Therefore, we investigated relationships among ulvophycean orders by determining the distribution of two discrete genetic characters previously identified only in the order Dasycladales. First, Acetabularia acetabulum uses the core translation GTPase Elongation Factor 1alpha (EF-1alpha) while most Chlorophyta instead possess the related GTPase Elongation Factor-Like (EFL). Second, the nuclear genomes of dasycladaleans A. acetabulum and Batophora oerstedii use a rare non-canonical genetic code in which the canonical termination codons TAA and TAG instead encode glutamine. Representatives of Ulvales and Ulotrichales were found to encode EFL, while Caulerpales, Dasycladales, Siphonocladales, and Ignatius tetrasporus were found to encode EF-1alpha, in congruence with the two major lineages previously proposed for the Ulvophyceae. The EF-1alpha of I. tetrasporus supports its relationship with Caulerpales/Dasycladales/Siphonocladales, in agreement with ultrastructural evidence, but contrary to certain small subunit rRNA analyses that place it with Ulvales/Ulotrichales. The same non-canonical genetic code previously described in A. acetabulum was observed in EF-1alpha sequences from Parvocaulis pusillus (Dasycladales), Chaetomorpha coliformis, and Cladophora cf. crinalis (Siphonocladales), whereas Caulerpales use the universal code. This supports a sister relationship between Siphonocladales and Dasycladales and further refines our understanding of ulvophycean phylogeny.

  10. Fibrin patch-based insulin-like growth factor-1 gene-modified stem cell transplantation repairs ischemic myocardium

    PubMed Central

    Li, Jun; Zhu, Kai; Yang, Shan; Wang, Yulin; Guo, Changfa; Yin, Kanhua; Wang, Chunsheng

    2015-01-01

    Bone marrow mesenchymal stem cells (BMSCs), tissue-engineered cardiac patch, and therapeutic gene have all been proposed as promising therapy strategies for cardiac repair after myocardial infarction. In our study, BMSCs were modified with insulin-like growth factor-1 (IGF-1) gene, loaded into a fibrin patch, and then transplanted into a porcine model of ischemia/reperfusion (I/R) myocardium injury. The results demonstrated that IGF-1 gene overexpression could promote proliferation of endothelial cells and cardiomyocyte-like differentiation of BMSCs in vitro. Four weeks after transplantation of fibrin patch loaded with gene-modified BMSCs, IGF-1 overexpression could successfully promote angiogenesis, inhibit remodeling, increase grafted cell survival and reduce apoptosis. In conclusion, the integrated strategy, which combined fibrin patch with IGF-1 gene modified BMSCs, could promote the histological cardiac repair for a clinically relevant porcine model of I/R myocardium injury. PMID:25767192

  11. Cloning and targeted mutations of G alpha 7 and G alpha 8, two developmentally regulated G protein alpha-subunit genes in Dictyostelium.

    PubMed Central

    Wu, L; Gaskins, C; Zhou, K; Firtel, R A; Devreotes, P N

    1994-01-01

    GTP-binding protein (G protein)-mediated signal transduction pathways play essential roles during the aggregation and differentiation process of Dictyostelium. In addition to the five known G protein alpha-subunit genes, we recently identified three novel alpha-subunit genes, G alpha 6, G alpha 7, and G alpha 8, using the polymerase chain reaction technique. We present here a more complete analysis of G alpha 7 and G alpha 8. The cDNAs of these two genes were cloned, and their complete nucleotide sequences were determined. Sequence analyses indicate that G alpha 8 possesses some unusual features. It lacks the "TCATDT" motif, a sequence of amino acids highly conserved among G alpha subunits, and has an additional 50 amino acids at its C-terminus consisting of long stretches of asparagine. Moreover, G alpha 8 is unusually resistant to protease digestion, which may indicate a slow GTP hydrolysis rate. The possible functions of these alpha-subunits were assessed by generating mutants lacking G alpha 7 or G alpha 8 by gene targeting through homologous recombination and by overexpressing G alpha 7 or G alpha 8 protein. Overexpression of G alpha 7 resulted in abnormal morphogenesis starting at the slug stage, whereas analysis of the other strains failed to reveal any obvious growth or developmental defects under either normal or stressful conditions. The implications of these results are discussed. Images PMID:7949425

  12. The cauliflower Orange gene enhances petiole elongation by suppressing expression of eukaryotic release factor 1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cauliflower Or gene affects plant growth and development in addition to conferring beta-carotene accumulation. This study was undertaken to investigate the molecular basis of the Or gene mutation in controlling plant growth. The OR protein was found to interact with cauliflower and Arabidopsis e...

  13. Human GABAA receptor alpha 1 and alpha 3 subunits genes and alcoholism.

    PubMed

    Parsian, A; Cloninger, C R

    1997-05-01

    gamma-Aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the brain. GABA effects are largely mediated by binding to the postsynaptic GABAA receptor, causing the opening of an integral chloride-ion channel. The GABAA antagonists picrotoxin and bicuculline reduce some ethanol-induced behaviors, such as motor impairment, sedation, and hypnosis. The role of this receptor in alcoholism is further supported by effective alleviation of alcohol withdrawal symptoms by GABAA agonists. To determine the role of the GABAA receptor (GABR) genes in the development of alcoholism, we have used alpha 1 and alpha 3 simple sequence repeat polymorphisms in a sample of unrelated alcoholics, alcoholic probands with both parents, and psychiatrically normal controls. For the GABR alpha 1 gene, the differences between allele frequencies, when all alleles were compared together, were not significant between total alcoholics, subtypes of alcoholics, and normal controls. However, for GABR alpha 3, the differences between total alcoholics and normal controls were significant when all alleles were compared together. The differences between subtypes of alcoholics and normal controls were not significant. The results of haplotype relative risk analysis for both genes, GABR alpha 1 and GABR alpha 3, were also negative. It is possible that the sample size in the haplotype relative risk is too small to have power to detect the differences in transmitted versus nontransmitted alleles. There is a need for a replication study in a large family sample that will allow haplotype relative risk or affected sib-pair analysis.

  14. Hypoxia-Inducible Factor-1α Target Genes Contribute to Retinal Neuroprotection

    PubMed Central

    Cheng, Lin; Yu, Honghua; Yan, Naihong; Lai, Kunbei; Xiang, Mengqing

    2017-01-01

    Hypoxia-inducible factor (HIF) is a transcription factor that facilitates cellular adaptation to hypoxia and ischemia. Long-standing evidence suggests that one isotype of HIF, HIF-1α, is involved in the pathogenesis of various solid tumors and cardiac diseases. However, the role of HIF-1α in retina remains poorly understood. HIF-1α has been recognized as neuroprotective in cerebral ischemia in the past two decades. Additionally, an increasing number of studies has shown that HIF-1α and its target genes contribute to retinal neuroprotection. This review will focus on recent advances in the studies of HIF-1α and its target genes that contribute to retinal neuroprotection. A thorough understanding of the function of HIF-1α and its target genes may lead to identification of novel therapeutic targets for treating degenerative retinal diseases including glaucoma, age-related macular degeneration, diabetic retinopathy, and retinal vein occlusions. PMID:28289375

  15. Metal transcription factor-1 regulation via MREs in the transcribed regions of selenoprotein H and other metal- responsive genes

    PubMed Central

    Stoytcheva, Zoia R.; Vladimirov, Vladimir; Douet, Vanessa; Stoychev, Ilko; Berry, Marla J.

    2009-01-01

    Selenoprotein H is a redox-sensing DNA binding protein that upregulates genes involved in antioxidant responses. Given the known links between oxidative stress and heavy metals, we investigated the potential for regulation of selenoprotein H by metals. In silico analysis of the selenoprotein H genes from nine species reveals multiple predicted metal response elements (MREs). To validate MRE function, we investigated the effects of zinc or cadmium addition and metal-responsive transcription factor 1 (MTF-1) knockout on selenoprotein H mRNA levels. Chromatin immunoprecipitation was used to directly assess physical binding of the transcription factor to MREs in the human and mouse selenoprotein H genes. The results reported herein show that selenoprotein H is a newly identified target for MTF-1. Further, whereas nearly all prior studies of MREs focused on those located in promoters, we demonstrate binding of MTF-1 to MREs located downstream of the transcription start sites in the human and murine selenoprotein H genes. Finally, we identified MREs in downstream sequences in 15 additional MTF-1 regulated genes lacking promoter MREs, and demonstrated MTF-1 binding in three of these genes. This regulation via sequences downstream of promoters highlights a new direction for identifying previously unrecognized target genes for MTF-1. PMID:19913599

  16. Involvement of the clock gene Rev-erb alpha in the regulation of glucagon secretion in pancreatic alpha-cells.

    PubMed

    Vieira, Elaine; Marroquí, Laura; Figueroa, Ana Lucia C; Merino, Beatriz; Fernandez-Ruiz, Rebeca; Nadal, Angel; Burris, Thomas P; Gomis, Ramon; Quesada, Ivan

    2013-01-01

    Disruption of pancreatic clock genes impairs pancreatic beta-cell function, leading to the onset of diabetes. Despite the importance of pancreatic alpha-cells in the regulation of glucose homeostasis and in diabetes pathophysiology, nothing is known about the role of clock genes in these cells. Here, we identify the clock gene Rev-erb alpha as a new intracellular regulator of glucagon secretion. Rev-erb alpha down-regulation by siRNA (60-70% inhibition) in alphaTC1-9 cells inhibited low-glucose induced glucagon secretion (p<0.05) and led to a decrease in key genes of the exocytotic machinery. The Rev-erb alpha agonist GSK4112 increased glucagon secretion (1.6 fold) and intracellular calcium signals in alphaTC1-9 cells and mouse primary alpha-cells, whereas the Rev-erb alpha antagonist SR8278 produced the opposite effect. At 0.5 mM glucose, alphaTC1-9 cells exhibited intrinsic circadian Rev-erb alpha expression oscillations that were inhibited by 11 mM glucose. In mouse primary alpha-cells, glucose induced similar effects (p<0.001). High glucose inhibited key genes controlled by AMPK such as Nampt, Sirt1 and PGC-1 alpha in alphaTC1-9 cells (p<0.05). AMPK activation by metformin completely reversed the inhibitory effect of glucose on Nampt-Sirt1-PGC-1 alpha and Rev-erb alpha. Nampt inhibition decreased Sirt1, PGC-1 alpha and Rev-erb alpha mRNA expression (p<0.01) and glucagon release (p<0.05). These findings identify Rev-erb alpha as a new intracellular regulator of glucagon secretion via AMPK/Nampt/Sirt1 pathway.

  17. HRF, a putative basic helix-loop-helix-PAS-domain transcription factor is closely related to hypoxia-inducible factor-1 alpha and developmentally expressed in blood vessels.

    PubMed

    Flamme, I; Fröhlich, T; von Reutern, M; Kappel, A; Damert, A; Risau, W

    1997-04-01

    Transcription factors of the bHLH-PAS protein family are important regulators of developmental processes such as neurogenesis and tracheal development in invertebrates. Recently a bHLH-PAS protein, named trachealess (trl) was identified as a master regulator of tracheogenesis. Hypoxia-inducible factor, HIF-1 alpha, is a vertebrate relative of trl which is likely to be involved in growth of blood vessels by the induction of vascular endothelial growth factor (VEGF) in response to hypoxia. In the present study we describe mRNA cloning and mRNA expression pattern of mouse HIF-related factor (HRF), a novel close relative of HIF-1 alpha which is expressed most prominently in brain capillary endothelial cells and other blood vessels as well as in bronchial epithelium in the embryo and the adult. In addition, smooth muscle cells of the uterus, neurons, brown adipose tissue and various epithelial tissues express HRF mRNA as well. High expression levels of HRF mRNA in embryonic choroid plexus and kidney glomeruli, places where VEGF is highly expressed, suggest a role of this factor in VEGF gene activation similar to that of HIF-1 alpha. Given the similarity between morphogenesis of the tracheal system and the vertebrate vascular system, the expression pattern of HRF in the vasculature and the bronchial tree raises the possibility that this family of transcription factors may be involved in tubulogenesis.

  18. Hepatocyte nuclear factor 1α downregulates HBV gene expression and replication by activating the NF-κB signaling pathway

    PubMed Central

    Shen, Zhongliang; Liu, Yanfeng; Wang, Wei; Tao, Shuai; Cui, Xiaoxian; Liu, Jing

    2017-01-01

    The role of hepatocyte nuclear factor 1α (HNF1α) in the regulation of gene expression and replication of hepatitis B virus (HBV) is not fully understood. Previous reports have documented the induction of the expression of viral large surface protein (LHBs) by HNF1α through activating viral Sp1 promoter. Large amount of LHBs can block the secretion of hepatitis B surface antigen (HBsAg). Here we found that HNF1α overexpression inhibited HBV gene expression and replication in Huh7 cells, resulting in marked decreases in HBsAg, hepatitis B e antigen (HBeAg) and virion productions. In contrast, knockdown of endogenous HNF1α expression enhanced viral gene expression and replication. This HNF1α-mediated inhibition did not depend on LHBs. Instead, HNF1α promoted the expression of NF-κB p65 and slowed p65 protein degradation, leading to nuclear accumulation of p65 and activation of the NF-κB signaling, which in turn inhibited HBV gene expression and replication. The inhibitor of the NF-κB signaling, IκBα-SR, could abrogate this HNF1α-mediated inhibition. While the dimerization domain of HNF1α was dispensable for the induction of LHBs expression, all the domains of HNF1α was required for the inhibition of HBV gene expression. Our findings identify a novel role of HNF1α in the regulation of HBV gene expression and replication. PMID:28319127

  19. Mice devoid of interferon regulatory factor 1 (IRF-1) show normal expression of type I interferon genes.

    PubMed Central

    Reis, L F; Ruffner, H; Stark, G; Aguet, M; Weissmann, C

    1994-01-01

    The transcription factor interferon regulatory factor 1 (IRF-1) binds tightly to the interferon (IFN)-beta promoter and has been implicated in the induction of type I IFNs. We generated mice devoid of functional IRF-1 by targeted gene disruption. As reported by others, IRF-1-deficient mice showed a discrete phenotype: the CD4/CD8 ratio was increased and IFN-gamma-induced levels of macrophage iNO synthase mRNA were strongly diminished. However, type I IFN induction in vivo by virus or double-stranded RNA was unimpaired, as evidenced by serum IFN titers and IFN mRNA levels in spleen, liver and lung. There was also no impairment in the response of type I IFN-inducible genes. Therefore, IRF-1 is not essential for these processes in vivo. Images PMID:7957048

  20. Eye-Specific Gene Expression following Embryonic Ethanol Exposure in Zebrafish: Roles for Heat Shock Factor 1

    PubMed Central

    Kashyap, Bhavani; Pegorsch, Laurel; Frey, Ruth A.; Sun, Chi; Shelden, Eric A.; Stenkamp, Deborah L.

    2014-01-01

    The mechanisms through which ethanol exposure results in developmental defects remain unclear. We used the zebrafish model to elucidate eye-specific mechanisms that underlie ethanol-mediated microphthalmia (reduced eye size), through time-series microarray analysis of gene expression within eyes of embryos exposed to 1.5% ethanol. 62 genes were differentially expressed (DE) in ethanol-treated as compared to control eyes sampled during retinal neurogenesis (24-48 hours post-fertilization). The EDGE (extraction of differential gene expression) algorithm identified >3000 genes DE over developmental time in ethanol-exposed eyes as compared to controls. The DE lists included several genes indicating a mis-regulated cellular stress response due to ethanol exposure. Combined treatment with sub-threshold levels of ethanol and a morpholino targeting heat shock factor 1 mRNA resulted in microphthalmia, suggesting convergent molecular pathways. Thermal preconditioning partially prevented ethanol-mediated microphthalmia while maintaining Hsf-1 expression. These data suggest roles for reduced Hsf-1 in mediating microphthalmic effects of embryonic ethanol exposure. PMID:24355176

  1. Ethanol enhances tumor angiogenesis in vitro induced by low-dose arsenic in colon cancer cells through hypoxia-inducible factor 1 alpha pathway.

    PubMed

    Wang, Lei; Son, Young-Ok; Ding, Songze; Wang, Xin; Hitron, John Andrew; Budhraja, Amit; Lee, Jeong-Chae; Lin, Qinchen; Poyil, Pratheeshkumar; Zhang, Zhuo; Luo, Jia; Shi, Xianglin

    2012-12-01

    Health effects due to environmental exposure to arsenic are a major global health concern. Arsenic has been known to induce carcinogenesis and enhance tumor development via complex and unclear mechanism. Ethanol is also a well-established risk factor for many malignancies. However, little is known about the effects of coexposure to arsenic and ethanol in tumor development. In this study, we investigate the signaling and angiogenic effect of coexposure of arsenic and ethanol on different colon cancer cell lines. Results show that ethanol markedly enhanced arsenic-induced tumor angiogenesis in vitro. These responses are related to intracellular reactive oxygen species (ROS) generation, NADPH oxidase activation, and upregulation of PI3K/Akt and hypoxia-inducible factor 1 alpha (HIF-1α) signaling. We have also found that ethanol increases the arsenic-induced expression and secretion of angiogenic signaling molecules such as vascular endothelial growth factor, which further confirmed the above observation. Antioxidant enzymes inhibited arsenic/ethanol-induced tumor angiogenesis, demonstrating that the responsive signaling pathways of coexposure to arsenic and ethanol are related to ROS generation. We conclude that ethanol is able to enhance arsenic-induced tumor angiogenesis in colorectal cancer cells via the HIF-1α pathway. These results indicate that alcohol consumption should be taken into consideration in the investigation of arsenic-induced carcinogenesis in arsenic-exposed populations.

  2. Effects of Histone Deacetylase Inhibitor (Valproic Acid) on the Expression of Hypoxia-inducible Factor-1 Alpha in Human Retinal Müller Cells

    PubMed Central

    Kim, Young Jun; Park, Sang Jun; Kim, Na Rae

    2017-01-01

    Purpose To evaluate the effects of valproic acid (VPA), a histone deacetylase inhibitor (HDACI), on the expression of hypoxia-inducible factor-1 alpha (HIF-1α) and vascular endothelial growth factor (VEGF) in human retinal Müller cells under hypoxic conditions. Methods Chemical hypoxia was induced in human retinal Müller cells (MIO-M1) by treatment with increasing concentrations of cobalt(II) chloride (CoCl2). Müller cells were also treated with a set concentration of CoCl2, along with various concentrations of VPA. The expression of HIF-1α and VEGF in the treated Müller cells was determined by enzyme-linked immunosorbent assay. Results Exposure of human retinal Müller cells to increasing concentrations of CoCl2 produced a dose-dependent increase in HIF-1α expression. The addition of increasing concentrations of VPA lead to a dose-dependent decrease in expression of HIF-1α and VEGF in Müller cells exposed to a set concentration of CoCl2. Conclusions HDACI VPA downregulated the expressions of HIF-1α and VEGF in human retinal Müller cells under hypoxic conditions. Using HDACI to target HIF-1α expression in Müller cells could be a new therapeutic strategy for the treatment of retinal vascular diseases. PMID:28243027

  3. tRNA is entrapped in similar, but distinct, nuclear and cytoplasmic ribonucleoprotein complexes, both of which contain vigilin and elongation factor 1 alpha.

    PubMed Central

    Kruse, C; Grünweller, A; Willkomm, D K; Pfeiffer, T; Hartmann, R K; Müller, P K

    1998-01-01

    Vigilin, which is found predominantly in cells and tissues with high levels of protein biosynthesis, was isolated in its native form from human HEp-2 cells (A.T.C.C. CCL23) by immunoaffinity chromatography. Here we demonstrate that vigilin is part of a novel large tRNA-binding ribonucleoprotein complex (tRNP), found not only in the cytoplasm, but also in the nuclei of human cells. Compositional differences in the protein pattern were detected between the nuclear and cytoplasmic tRNPs, although some properties of the purified nuclear tRNP, such as tRNA protection against nuclease attack, were identical with those of the cytoplasmic tRNP. By using either a pool of total human nuclear RNA or radioactively labelled yeast tRNAAsp in rebinding experiments, we could show that tRNA is specifically recaptured by the RNA-depleted, vigilin-containing nuclear complex. We could also show that vigilin is capable of binding tRNA in vitro. Another tRNA-binding protein is elongation factor 1 alpha, which appears to be enriched in the cytoplasmic and nuclear tRNP complexes. This suggests that the cytoplasmic tRNP may be involved in the channelled tRNA cycle in the cytoplasm of eukaryotic cells. Our results also suggest that the nuclear vigilin-containing tRNP may be related to the nuclear export of tRNA. PMID:9445390

  4. Drosophilia alpha-tubulin genes and their transcription patterns.

    PubMed

    Kalfayan, L; Loewenberg, J; Wensink, P C

    1982-01-01

    There are four different alpha-tubulin genes in D. melanogaster DNA; three of them appear as single copies and the other is present as either one or two copies in the haploid genome. The transcripts of three of these genes were examined. Each of them is complementary to a transcript of different length, implying that each is transcribed. Since these transcripts are found on polysomes, it is likely that they are translated. At least two of the genes are complementary to several transcripts, indicating that each of them has more than one transcription start or stop site or perhaps that there are alternative paths of posttranscriptional processing. There is a different developmental pattern of concentrations for transcripts from each of these genes, and different RNAs from the same gene also have different patterns. We conclude that the concentration of transcripts from each gene appears to be independently controlled and that even different transcription products from the same gene appear to independently controlled.

  5. Challenges and Prospects for Alpha-1 Antitrypsin Deficiency Gene Therapy.

    PubMed

    Wozniak, Joanna; Wandtke, Tomasz; Kopinski, Piotr; Chorostowska-Wynimko, Joanna

    2015-11-01

    Alpha-1 antitrypsin (AAT) is a protease inhibitor belonging to the serpin family. A number of identified mutations in the SERPINA1 gene encoding this protein result in alpha-1 antitrypsin deficiency (AATD). A decrease in AAT serum concentration or reduced biological activity causes considerable risk of chronic respiratory and liver disorders. As a monogenic disease, AATD appears to be an attractive target for gene therapy, particularly for patients with pulmonary dysfunction, where augmentation of functional AAT levels in plasma might slow down respiratory disease development. The short AAT coding sequence and its activity in the extracellular matrix would enable an increase in systemic serum AAT production by cellular secretion. In vitro and in vivo experimental AAT gene transfer with gamma-retroviral, lentiviral, adenoviral, and adeno-associated viral (AAV) vectors has resulted in enhanced AAT serum levels and a promising safety profile. Human clinical trials using intramuscular viral transfer with AAV1 and AAV2 vectors of the AAT gene demonstrated its safety, but did not achieve a protective level of AAT >11 μM in serum. This review provides an in-depth critical analysis of current progress in AATD gene therapy based on viral gene transfer. The factors affecting transgene expression levels, such as site of administration, dose and type of vector, and activity of the immune system, are discussed further as crucial variables for optimizing the clinical effectiveness of gene therapy in AATD subjects.

  6. Alpha-globin gene markers identify genetic differences between Australian aborigines and Melanesians.

    PubMed Central

    Tsintsof, A S; Hertzberg, M S; Prior, J F; Mickleson, K N; Trent, R J

    1990-01-01

    Australian aborigines exhibit a number of alpha-globin cluster rearrangements involving both alpha- and zeta-globin genes. alpha+-Thalassemia (-alpha/) in this population is heterogeneous and includes the 3.7 types I, II, and III gene deletions. The alpha alpha alpha/ and zeta zeta zeta/ rearrangements are each found in association with two haplotypes, indicating origins from at least two separate DNA crossover events. Differences in alpha-globin cluster rearrangements and in haplotypes between Australian aborigines, Papua New Guinea highlanders and island Melanesians, are consistent with multiple colonizing events into Australia. PMID:2294746

  7. Analysis of Expression of Vascular Endothelial Growth Factor A and Hypoxia Inducible Factor-1alpha in Patients Operated on Stage I Non-Small-Cell Lung Cancer

    PubMed Central

    Honguero Martínez, Antonio Francisco; Arnau Obrer, Antonio; Figueroa Almánzar, Santiago; León Atance, Pablo; Guijarro Jorge, Ricardo

    2014-01-01

    Objectives. Recent studies show that expression of hypoxia inducible factor-1alpha (HIF-1α) favours expression of vascular endothelial growth factor A (VEGF-A), and these biomarkers are linked to cellular proliferation, angiogenesis, and metastasis in different cancers. We analyze expression of HIF-1α and VEGF-A to clinicopathologic features and survival of patients operated on stage I non-small-cell lung cancer. Methodology. Prospective study of 52 patients operated on with stage I. Expression of VEGF-A and HIF-1α was performed through real-time quantitative polymerase chain reaction (qRT-PCR). Results. Mean age was 64.7 and 86.5% of patients were male. Stage IA represented 23.1% and stage IB 76.9%. Histology classification was 42.3% adenocarcinoma, 34.6% squamous cell carcinoma, and 23.1% others. Median survival was 81.0 months and 5-year survival 67.2%. There was correlation between HIF-1α and VEGF-A (P = 0.016). Patients with overexpression of HIF-1α had a tendency to better survival with marginal statistical significance (P = 0.062). Patients with overexpression of VEGF-A had worse survival, but not statistically significant (P = 0.133). Conclusion. The present study revealed that VEGF-A showed correlation with HIF-1α. HIF-1α had a tendency to protective effect with a P value close to statistical significance. VEGF-A showed a contrary effect but without statistical significance. PMID:26316946

  8. Overexpression of hypoxia-inducible factor 1 alpha impacts FoxP3 levels in mycosis fungoides--cutaneous T-cell lymphoma: clinical implications.

    PubMed

    Alcántara-Hernández, M; Torres-Zárate, C; Pérez-Montesinos, G; Jurado-Santacruz, F; Domínguez-Gómez, M A; Peniche-Castellanos, A; Ferat-Osorio, E; Neri, N; Nambo, M J; Alvarado-Cabrero, I; Moreno-Lafont, M; Huerta-Yepez, S; Bonifaz, L C

    2014-05-01

    Mycosis fungoides (MF) is the most common variant of primary cutaneous T-cell lymphoma, and decreased forkhead box P3 (FoxP3) expression has been reported in MF late stages. Hypoxia-inducible factor 1 alpha (HIF-1α) may regulate FoxP3 expression; however, it is unknown whether HIF-1α is expressed in the CD4(+) T cells of MF patients and how it could affect the expression of FoxP3. Therefore, we evaluated the expression of HIF-1α and FoxP3 in CD4(+) T cells obtained from the skin lesions of MF patients. We found increased cell proliferation and an increase in CD4(+) T cells with an aberrant phenotype among early stage MF patients. HIF-1α was overexpressed in these CD4(+) T cells. In addition, we found a decrease in the percentage of FoxP3(+) cells both in the skin of MF patients, when compared with control skin samples, and with disease progression. In addition, a negative correlation was established between HIF-1α and FoxP3 expression. Skin HIF-1α expression in MF patients correlated with the extent of the affected area and increased with the disease progression. Finally, we showed that ex vivo inhibition of HIF-1α degradation increases the percentage of FoxP3(+) T cells in skin lesions. Our results suggest that overexpression of HIF-1α affects the levels of FoxP3 in MF patients, which could have relevant implications in terms of disease outcome.

  9. Digoxin and ouabain induce P-glycoprotein by activating calmodulin kinase II and hypoxia-inducible factor-1alpha in human colon cancer cells

    SciTech Connect

    Riganti, Chiara

    2009-11-01

    Digoxin and ouabain are cardioactive glycosides, which inhibit the Na{sup +}/K{sup +}-ATPase pump and in this way they increase the intracellular concentration of cytosolic calcium ([Ca{sup ++}]{sub i}). They are also strong inducers of the P-glycoprotein (Pgp), a transmembrane transporter which extrudes several drugs, including anticancer agents like doxorubicin. An increased amount of Pgp limits the absorption of drugs through epithelial cells, thus inducing resistance to chemotherapy. The mechanism by which cardioactive glycosides increase Pgp is not known and in this work we investigated whether digoxin and ouabain elicited the expression of Pgp with a calcium-driven mechanism. In human colon cancer HT29 cells both glycosides increased the [Ca{sup ++}]{sub i} and this event was dependent on the calcium influx via the Na{sup +}/Ca{sup ++} exchanger. The increased [Ca{sup ++}]{sub i} enhanced the activity of the calmodulin kinase II enzyme, which in turn activated the transcription factor hypoxia-inducible factor-1alpha. This one was responsible for the increased expression of Pgp, which actively extruded doxorubicin from the cells and significantly reduced the pro-apoptotic effect of the drug. All the effects of glycosides were prevented by inhibiting the Na{sup +}/Ca{sup ++} exchanger or the calmodulin kinase II. This work clarified the molecular mechanisms by which digoxin and oubain induce Pgp and pointed out that the administration of cardioactive glycosides may widely affect the absorption of drugs in colon epithelia. Moreover, our results suggest that the efficacy of chemotherapeutic agent substrates of Pgp may be strongly reduced in patients taking digoxin.

  10. Enhancement of CYP3A4 activity in Hep G2 cells by lentiviral transfection of hepatocyte nuclear factor-1 alpha.

    PubMed

    Chiang, Tsai-Shin; Yang, Kai-Chiang; Chiou, Ling-Ling; Huang, Guan-Tarn; Lee, Hsuan-Shu

    2014-01-01

    Human hepatoma cell lines are commonly used as alternatives to primary hepatocytes for the study of drug metabolism in vitro. However, the phase I cytochrome P450 (CYP) enzyme activities in these cell lines occur at a much lower level than their corresponding activities in primary hepatocytes, and thus these cell lines may not accurately predict drug metabolism. In the present study, we selected hepatocyte nuclear factor-1 alpha (HNF1α) from six transcriptional regulators for lentiviral transfection into Hep G2 cells to optimally increase their expression of the CYP3A4 enzyme, which is the major CYP enzyme in the human body. We subsequently found that HNF1α-transfected Hep G2 enhanced the CYP3A4 expression in a time- and dose-dependent manner and the activity was noted to increase with time and peaked 7 days. With a multiplicity of infection (MOI) of 100, CYP3A4 expression increased 19-fold and enzyme activity more than doubled at day 7. With higher MOI (1,000 to 3,000), the activity increased 8- to 10-fold; however, it was noted the higher MOI, the higher cell death rate and lower cell survival. Furthermore, the CYP3A4 activity in the HNF1α-transfected cells could be induced by CYP3A4-specific inducer, rifampicin, and metabolized nifedipine in a dose-dependent manner. With an MOI of 3,000, nifedipine-metabolizing activity was 6-fold of control and as high as 66% of primary hepatocytes. In conclusion, forceful delivery of selected transcriptional regulators into human hepatoma cells might be a valuable method to enhance the CYP activity for a more accurate determination of drug metabolism in vitro.

  11. Hypoxia-inducible factor 1 alpha is required for the tumourigenic and aggressive phenotype associated with Rab25 expression in ovarian cancer

    PubMed Central

    Gomez-Roman, Natividad; Sahasrabudhe, Neha Mohan; McGregor, Fiona; Chalmers, Anthony J.; Cassidy, Jim; Plumb, Jane

    2016-01-01

    The small GTPase Rab25 has been functionally linked to tumour progression and aggressiveness in ovarian cancer and promotes invasion in three-dimensional environments. This type of migration has been shown to require the expression of the hypoxia-inducible factor 1 alpha (HIF-1α). In this report we demonstrate that Rab25 regulates HIF-1α protein expression in an oxygen independent manner in a panel of cancer cell lines. Regulation of HIF-1α protein expression by Rab25 did not require transcriptional upregulation, but was dependent on de novo protein synthesis through the Erbb2/ERK1/2 and p70S6K/mTOR pathways. Rab25 expression induced HIF-1 transcriptional activity, increased cisplatin resistance, and conferred intraperitoneal growth to the A2780 cell line in immunocompromised mice. Targeting HIF1 activity by silencing HIF-1β re-sensitised cells to cisplatin in vitro and reduced tumour formation of A2780-Rab25 expressing cells in vivo in a mouse ovarian peritoneal carcinomatosis model. Similar effects on cisplatin resistance in vitro and intraperitoneal tumourigenesis in vivo were obtained after HIF1b knockdown in the ovarian cancer cell line SKOV3, which expresses endogenous Rab25 and HIF-1α at atmospheric oxygen concentrations. Our results suggest that Rab25 tumourigenic potential and chemoresistance relies on HIF1 activity in aggressive and metastatic ovarian cancer. Targeting HIF-1 activity may potentially be effective either alone or in combination with standard chemotherapy for aggressive metastatic ovarian cancer. PMID:26967059

  12. Stromal Cell-Derived Growth Factor-1 Alpha-Elastin Like Peptide Fusion Protein Promotes Cell Migration and Revascularization of Experimental Wounds in Diabetic Mice

    PubMed Central

    Yeboah, Agnes; Maguire, Tim; Schloss, Rene; Berthiaume, Francois; Yarmush, Martin L.

    2017-01-01

    Objective: In previous work, we demonstrated the development of a novel fusion protein containing stromal cell-derived growth factor-1 alpha juxtaposed to an elastin-like peptide (SDF1-ELP), which has similar bioactivity, but is more stable in elastase than SDF1. Herein, we compare the ability of a single topical application of SDF1-ELP to that of SDF1 in healing 1 × 1 cm excisional wounds in diabetic mice. Approach: Human Leukemia-60 cells were used to demonstrate the chemotactic potential of SDF1-ELP versus SDF1 in vitro. Human umbilical vascular endothelial cells were used to demonstrate the angiogenic potential of SDF1-ELP versus SDF1 in vitro. The bioactivity of SDF1-ELP versus SDF1 after incubation in ex-vivo diabetic wound fluid was compared. The in-vivo effectiveness of SDF1-ELP versus SDF1 was compared in diabetic mice wound model by monitoring for the number of CD31+ cells in harvested wound tissues. Results: SDF1-ELP promotes the migration of cells and induces vascularization similar to SDF1 in vitro. SDF1-ELP is more stable in wound fluids compared to SDF1. In vivo, SDF1-ELP induced a higher number of vascular endothelial cells (CD31+ cells) compared to SDF1 and other controls, suggesting increased vascularization. Innovation: While growth factors have been shown to improve wound healing, this strategy is largely ineffective in chronic wounds. In this work, we show that SDF1-ELP is a promising agent for the treatment of chronic skin wounds. Conclusion: The superior in vivo performance and stability of SDF1-ELP makes it a promising agent for the treatment of chronic skin wounds. PMID:28116224

  13. Genetic analysis of the Drosophila Gs(alpha) gene.

    PubMed

    Wolfgang, W J; Hoskote, A; Roberts, I J; Jackson, S; Forte, M

    2001-07-01

    One of the best understood signal transduction pathways activated by receptors containing seven transmembrane domains involves activation of heterotrimeric G-protein complexes containing Gs(alpha), the subsequent stimulation of adenylyl cyclase, production of cAMP, activation of protein kinase A (PKA), and the phosphorylation of substrates that control a wide variety of cellular responses. Here, we report the identification of "loss-of-function" mutations in the Drosophila Gs(alpha) gene (dgs). Seven mutants have been identified that are either complemented by transgenes representing the wild-type dgs gene or contain nucleotide sequence changes resulting in the production of altered Gs(alpha) protein. Examination of mutant alleles representing loss-of-Gs(alpha) function indicates that the phenotypes generated do not mimic those created by mutational elimination of PKA. These results are consistent with the conclusion reached in previous studies that activation of PKA, at least in these developmental contexts, does not depend on receptor-mediated increases in intracellular cAMP, in contrast to the predictions of models developed primarily on the basis of studies in cultured cells.

  14. Genetic analysis of the Drosophila Gs(alpha) gene.

    PubMed Central

    Wolfgang, W J; Hoskote, A; Roberts, I J; Jackson, S; Forte, M

    2001-01-01

    One of the best understood signal transduction pathways activated by receptors containing seven transmembrane domains involves activation of heterotrimeric G-protein complexes containing Gs(alpha), the subsequent stimulation of adenylyl cyclase, production of cAMP, activation of protein kinase A (PKA), and the phosphorylation of substrates that control a wide variety of cellular responses. Here, we report the identification of "loss-of-function" mutations in the Drosophila Gs(alpha) gene (dgs). Seven mutants have been identified that are either complemented by transgenes representing the wild-type dgs gene or contain nucleotide sequence changes resulting in the production of altered Gs(alpha) protein. Examination of mutant alleles representing loss-of-Gs(alpha) function indicates that the phenotypes generated do not mimic those created by mutational elimination of PKA. These results are consistent with the conclusion reached in previous studies that activation of PKA, at least in these developmental contexts, does not depend on receptor-mediated increases in intracellular cAMP, in contrast to the predictions of models developed primarily on the basis of studies in cultured cells. PMID:11454767

  15. Mechanism of developmental regulation of alpha pi, the chicken embryonic alpha-globin gene.

    PubMed Central

    Knezetic, J A; Felsenfeld, G

    1993-01-01

    The chicken alpha pi-globin gene is expressed during development only in the primitive erythrocyte lineage and not in the definitive lineage. We show that stage-specific expression is maintained when plasmids containing the alpha pi promoter are transfected into primitive and definitive lineage primary erythroid cells and that the information contained in the promoter is sufficient to confer this specificity. Detailed analysis of binding sites in the promoter for trans-acting factors, together with studies of the effects of mutagenesis on expression, reveals that the factors critical to stage-specific expression are all present in both primitive and definitive lineages, but at various concentrations. We identify three proteins, an NF1 family member, a Y-box factor, and an Sp1-like factor, which interact to stimulate or inhibit transcription. We propose that the concentration-dependent action of these factors, together with the general erythroid factor GATA-1, is responsible for the stage-specific expression of the alpha pi-globin gene. Images PMID:8336706

  16. Silver nanoparticles inhibit the function of hypoxia-inducible factor-1 and target genes: insight into the cytotoxicity and antiangiogenesis.

    PubMed

    Yang, Tieshan; Yao, Qian; Cao, Fei; Liu, Qianqian; Liu, Binlei; Wang, Xiu-Hong

    Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that is activated upon exposure to hypoxic stress. It modulates a number of cellular responses including proliferation, apoptosis, angiogenesis, and metabolism by activating a panel of target genes in response to hypoxia. The HIF-1 level is often upregulated in the hypoxic microenvironment of solid tumors, which contributes to cancer treatment failure. Here we report that silver nanoparticles (AgNPs), which are widely used as an antimicrobial agent, are an effective inhibitor of HIF-1. AgNPs inhibited the activation of a HIF-dependent reporter construct after the cells were exposed to hypoxic conditions or treated with cobalt chloride, a hypoxia mimetic agent. The AgNPs also interfered with the accumulation of HIF-1α protein and the induction of the endogenous HIF target genes, VEGF-A and GLUT1. Since both HIF-1 and vascular endothelial growth factor-A play an important role in angiogenesis, AgNPs also inhibited angiogenesis in vitro. Our data reveal a new mechanism of how AgNPs act on cellular function, that is, they disrupt HIF signaling pathway. This finding provides a novel insight into how AgNPs can inhibit cancer cell growth and angiogenesis.

  17. Polymorphism of insulin-like growth factor 1 gene is associated with breast muscle yields in chickens.

    PubMed

    Sato, Shinichi; Ohtake, Tsuyoshi; Uemoto, Yoshinobu; Okumura, Yumi; Kobayashi, Eiji

    2012-01-01

    Insulin-like growth factor-1 (IGF1) plays an important role in muscle development in chickens. In this study, an F2 chicken population of 362 individuals, obtained from an intercross between high breast muscle yield line males and low breast muscle yield (LB) line females, was constructed for investigating the associations between IGF1 gene and breast muscle yields. The IGF1 sequence was investigated in the grandparents. There were no differences in the exon sequences. However, sequence analysis of the IGF1 promoter revealed a known single nucleotide polymorphism (g.570C>A) in LB line grandparents. PCR - restriction fragment length polymorphism was used for screening the F2 population, which was evaluated for body weight (BW), carcass weight (CW), breast muscle weight (BMW), and breast fillet weight (BFW). Significant associations with the polymorphism were detected for BMW, BFW, BMW% and BFW%, although there were no associations between the polymorphism and BW or CW. The allelic effect on BMW, BFW, BMW% and BFW% acted in additive and dominance modes. We confirmed that the g.570C>A polymorphism is significantly associated with breast muscle yields in the F2 population. Therefore, this polymorphism in the IGF1 gene may help improve breast muscle yields by marker-assisted selection.

  18. Silver nanoparticles inhibit the function of hypoxia-inducible factor-1 and target genes: insight into the cytotoxicity and antiangiogenesis

    PubMed Central

    Yang, Tieshan; Yao, Qian; Cao, Fei; Liu, Qianqian; Liu, Binlei; Wang, Xiu-Hong

    2016-01-01

    Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that is activated upon exposure to hypoxic stress. It modulates a number of cellular responses including proliferation, apoptosis, angiogenesis, and metabolism by activating a panel of target genes in response to hypoxia. The HIF-1 level is often upregulated in the hypoxic microenvironment of solid tumors, which contributes to cancer treatment failure. Here we report that silver nanoparticles (AgNPs), which are widely used as an antimicrobial agent, are an effective inhibitor of HIF-1. AgNPs inhibited the activation of a HIF-dependent reporter construct after the cells were exposed to hypoxic conditions or treated with cobalt chloride, a hypoxia mimetic agent. The AgNPs also interfered with the accumulation of HIF-1α protein and the induction of the endogenous HIF target genes, VEGF-A and GLUT1. Since both HIF-1 and vascular endothelial growth factor-A play an important role in angiogenesis, AgNPs also inhibited angiogenesis in vitro. Our data reveal a new mechanism of how AgNPs act on cellular function, that is, they disrupt HIF signaling pathway. This finding provides a novel insight into how AgNPs can inhibit cancer cell growth and angiogenesis. PMID:27994464

  19. The stromal cell-derived factor-1alpha dependent migration of human cord blood CD34 haematopoietic stem and progenitor cells switches from protein kinase C (PKC)-alpha dependence to PKC-alpha independence upon prolonged culture in the presence of Flt3-ligand and interleukin-6.

    PubMed

    Kasenda, Benjamin; Kassmer, Susannah H; Niggemann, Bernd; Schiermeier, Sven; Hatzmann, Wolfgang; Zänker, Kurt S; Dittmar, Thomas

    2008-09-01

    Addition of the inflammatory cytokine interleukin (IL)-6 to the culture medium of human cord blood haematopoietic stem and progenitor cells (HSPCs) has been shown to lead to an altered stromal cell-derived factor-1alpha-dependent migratory phenotype. This study investigated whether this effect was attributed to a differential engagement of protein kinase C (PKC) isotypes. The migratory activity of both Flt3-ligand and Flt3-ligand/IL-6 cultured cord blood HSPCs was PKC-alpha dependent on day 1, but PKC-alpha independent after 5 d of cultivation. PKC-alpha expression was not down-regulated in cells cultured for 5 d indicating a switch of signalling molecules directing cell migration.

  20. Peroxisome proliferator-activated receptor alpha target genes.

    PubMed

    Rakhshandehroo, Maryam; Knoch, Bianca; Müller, Michael; Kersten, Sander

    2010-01-01

    The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well.

  1. Peroxisome Proliferator-Activated Receptor Alpha Target Genes

    PubMed Central

    Rakhshandehroo, Maryam; Knoch, Bianca; Müller, Michael; Kersten, Sander

    2010-01-01

    The peroxisome proliferator-activated receptor alpha (PPARα) is a ligand-activated transcription factor involved in the regulation of a variety of processes, ranging from inflammation and immunity to nutrient metabolism and energy homeostasis. PPARα serves as a molecular target for hypolipidemic fibrates drugs which bind the receptor with high affinity. Furthermore, PPARα binds and is activated by numerous fatty acids and fatty acid-derived compounds. PPARα governs biological processes by altering the expression of a large number of target genes. Accordingly, the specific role of PPARα is directly related to the biological function of its target genes. Here, we present an overview of the involvement of PPARα in lipid metabolism and other pathways through a detailed analysis of the different known or putative PPARα target genes. The emphasis is on gene regulation by PPARα in liver although many of the results likely apply to other organs and tissues as well. PMID:20936127

  2. Activation of nicotinamide N-methyltransferase gene promoter by hepatocyte nuclear factor-1beta in human papillary thyroid cancer cells.

    PubMed

    Xu, Jimin; Capezzone, Marco; Xu, Xiao; Hershman, Jerome M

    2005-02-01

    We previously demonstrated that the human nicotinamide N-methytransferase (NNMT) gene was highly expressed in many papillary thyroid cancers and cell lines. The expression in other papillary and follicular cancers or cell lines and normal thyroid cells was low or undetectable. To gain an understanding of the molecular mechanism of this cell-specific expression, the NNMT promoter was cloned and studied by luciferase reporter gene assay. The promoter construct was expressed highly in papillary cancer cell lines, including those with higher (e.g. BHP 2-7) and lower (e.g. BHP 14-9) NNMT gene expression, and expressed weakly in follicular thyroid cancer cell lines. Further study with 5'-deletion promoter construct suggested that the NNMT promoter was regulated differently in BHP 2-7 and BHP 14-9 cells. In BHP 2-7 cells, promoter activity was dependent on an upstream sequence. In BHP 14-9 cells, sequence in the basal promoter region contributed notably to the overall promoter activity. RT-PCR or Western blot analysis indicated that hepatocyte nuclear factor-1beta (HNF-1beta) was expressed in only papillary cancer cell lines with high NNMT gene expression. HNF-1beta was not expressed or expressed very weakly in other papillary, follicular, and Hurthle cancer cell lines and primary cultures of normal thyroid cells and benign thyroid conditions. A HNF-1 binding site was identified in the NNMT basal promoter region. Mutations in this site decreased NNMT promoter activity in the HNF-1beta-positive BHP 2-7 cells, but not in the HNF-1beta-negative BHP 14-9 cells. HNF-1beta bound to the HNF-1 site specifically as a homodimer as determined by gel retardation assays with HNF-1beta-specific antibody. Cotransfection of a HNF-1beta expression plasmid increased NNMT promoter activity significantly in both HNF-1beta-positive and -negative thyroid cancer cell lines and Hep G2 liver cancer cells. Furthermore, transient expression of HNF-1beta in BHP 14-9 cells increased endogenous NNMT

  3. Gene Therapy for Alpha-1 Antitrypsin Deficiency Lung Disease.

    PubMed

    Chiuchiolo, Maria J; Crystal, Ronald G

    2016-08-01

    Alpha-1 antitrypsin (AAT) deficiency, characterized by low plasma levels of the serine protease inhibitor AAT, is associated with emphysema secondary to insufficient protection of the lung from neutrophil proteases. Although AAT augmentation therapy with purified AAT protein is efficacious, it requires weekly to monthly intravenous infusion of AAT purified from pooled human plasma, has the risk of viral contamination and allergic reactions, and is costly. As an alternative, gene therapy offers the advantage of single administration, eliminating the burden of protein infusion, and reduced risks and costs. The focus of this review is to describe the various strategies for AAT gene therapy for the pulmonary manifestations of AAT deficiency and the state of the art in bringing AAT gene therapy to the bedside.

  4. Cloning and characterization of the rat HIF-1 alpha prolyl-4-hydroxylase-1 gene.

    PubMed

    Cobb, Ronald R; McClary, John; Manzana, Warren; Finster, Silke; Larsen, Brent; Blasko, Eric; Pearson, Jennifer; Biancalana, Sara; Kauser, Katalin; Bringmann, Peter; Light, David R; Schirm, Sabine

    2005-08-01

    Prolyl-4-hydroxylase domain-containing enzymes (PHDs) mediate the oxygen-dependent regulation of the heterodimeric transcription factor hypoxia-inducible factor-1 (HIF-1). Under normoxic conditions, one of the subunits of HIF-1, HIF-1alpha, is hydroxylated on specific proline residues to target HIF-1alpha for degradation by the ubiquitin-proteasome pathway. Under hypoxic conditions, the hydroxylation by the PHDs is attenuated by lack of the oxygen substrate, allowing HIF-1 to accumulate, translocate to the nucleus, and mediate HIF-mediated gene transcription. In several mammalian species including humans, three PHDs have been identified. We report here the cloning of a full-length rat cDNA that is highly homologous to the human and murine PHD-1 enzymes and encodes a protein that is 416 amino acids long. Both cDNA and protein are widely expressed in rat tissues and cell types. We demonstrate that purified and crude baculovirus-expressed rat PHD-1 exhibits HIF-1alpha specific prolyl hydroxylase activity with similar substrate affinities and is comparable to human PHD-1 protein.

  5. Human hTM. cap alpha. gene: Expression in muscle and nonmuscle tissue

    SciTech Connect

    MacLeod, A.R.; Gooding, C.

    1988-01-01

    The authors isolated a cDNA clone from a human skeletal muscle library which contains the complete protein-coding sequence of a skeletal muscle ..cap alpha..-tropomyosin. This cDNA sequence defines a fourth human tropomyosin gene, the hTM..cap alpha.. gene, which is distinct from the hTM/sub nm/ gene encoding a closely related isoform of skeletal muscle ..cap alpha..-tropomyosin. In cultured human fibroblasts, the hTM..cap alpha.. gene encodes both skeletal-muscle- and smooth-muscle-type ..cap alpha..-tropomyosins by using an alternative mRNA-splicing mechanism.

  6. Hypoxia-inducible factor 1 alpha mediates epidermal growth factor-induced down-regulation of E-cadherin expression and cell invasion in human ovarian cancer cells.

    PubMed

    Cheng, Jung-Chien; Klausen, Christian; Leung, Peter C K

    2013-02-28

    Hypoxia-inducible factor 1α (HIF-1α) regulates the transcription of a number of genes under hypoxia and other extracellular stimulations. It has been shown that E-cadherin is down-regulated by epidermal growth factor receptor (EGF) stimulation, and that cells with low E-cadherin expression are more invasive. Our recent study demonstrated a novel mechanism by which EGF down-regulates E-cadherin expression through production of hydrogen peroxide (H(2)O(2)) and the activation of p38 MAPK in human ovarian cancer cells. In this study, we were interested in examining the potential role of HIF-1α in cell invasion under normoxic conditions, specifically when cells are treated with EGF, which is known to down-regulate E-cadherin and increase invasiveness. We show that EGF treatment induces HIF-1α expression in two human ovarian cancer cell lines (SKOV3 and OVCAR5), and that this effect is diminished by treatment with a membrane-permeable H(2)O(2) scavenger, PEG-catalase. However, the induction of HIF-1α by EGF did not require the activation of p38 MAPK. Treatment with siRNA targeting HIF-1α reduces both basal and EGF-induced HIF-1α levels. Importantly, treatment with HIF-1α siRNA diminishes the up-regulation of Snail and Slug as well as the down-regulation of E-cadherin by EGF. The involvement of HIF-1α in the down-regulation of E-cadherin was confirmed with cobalt chloride (CoCl(2)), a hypoxia-mimetic reagent. Finally, we also show that EGF-induced cell invasion is attenuated by treatment with HIF-1α siRNA. This study demonstrates an important role for HIF-1α in mediating the effects of EGF on Snail, Slug and E-cadherin expression as well as invasiveness in human ovarian cancer cells.

  7. Radioprotective effect on HepG2 cells of low concentrations of cobalt chloride: induction of hypoxia-inducible factor-1 alpha and clearance of reactive oxygen species.

    PubMed

    Jin, Wensen; Wang, Juan; Xu, Shiguo; Xiao, Linlin; Chen, Guangfu; Zhang, Wukui; Li, Jun

    2013-03-01

    It has been found that low doses of certain toxicants might generate a protective response to cellular damage. Previous data have shown that elevated doses of cobalt (Co) induce injury to cells and organisms or result in radiological combined toxicity. Whether low doses of Co generate a protective effect or not, however, remains controversial. In this study, we investigated the effect and mechanism of action of low dose cobalt chloride (CoCl2, 100 μM) on the viability of irradiated cells. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay was used to observe the radio-sensitivity of HepG2 cells under different pretreatments. The alteration of intracellular DNA damage was further measured using micronucleus (MN) assay. Levels of hypoxia inducible factor-1α (HIF-1α) expression and its target gene, EPO, were monitored by western blot and reverse transcription polymerase chain reaction (RT-PCR), respectively, and intracellular reactive oxygen species (ROS) content was determined by 2',7'-dichlorofluorescein diacetate (DCFH-DA) probe staining. Our results show that low dose CoCl2does not influence HepG2 cell viability, but induces the expression of HIF-1α, followed by increased radio-resistance. Additionally, cells treated with HIF-1α siRNA retained a partial refractory response to irradiation concomitant with a marked reduction in intracellular ROS. The change of MN further indicated that the reduction of DNA damage was confirmed with the alteration of ROS. Our results demonstrate that low dose CoCl2may protect cells against irradiative harm by two mechanisms, namely HIF-1α expression and ROS clearance.

  8. Gene Regulatory Network Inference of Immunoresponsive Gene 1 (IRG1) Identifies Interferon Regulatory Factor 1 (IRF1) as Its Transcriptional Regulator in Mammalian Macrophages.

    PubMed

    Tallam, Aravind; Perumal, Thaneer M; Antony, Paul M; Jäger, Christian; Fritz, Joëlle V; Vallar, Laurent; Balling, Rudi; Del Sol, Antonio; Michelucci, Alessandro

    2016-01-01

    Immunoresponsive gene 1 (IRG1) is one of the highest induced genes in macrophages under pro-inflammatory conditions. Its function has been recently described: it codes for immune-responsive gene 1 protein/cis-aconitic acid decarboxylase (IRG1/CAD), an enzyme catalysing the production of itaconic acid from cis-aconitic acid, a tricarboxylic acid (TCA) cycle intermediate. Itaconic acid possesses specific antimicrobial properties inhibiting isocitrate lyase, the first enzyme of the glyoxylate shunt, an anaplerotic pathway that bypasses the TCA cycle and enables bacteria to survive on limited carbon conditions. To elucidate the mechanisms underlying itaconic acid production through IRG1 induction in macrophages, we examined the transcriptional regulation of IRG1. To this end, we studied IRG1 expression in human immune cells under different inflammatory stimuli, such as TNFα and IFNγ, in addition to lipopolysaccharides. Under these conditions, as previously shown in mouse macrophages, IRG1/CAD accumulates in mitochondria. Furthermore, using literature information and transcription factor prediction models, we re-constructed raw gene regulatory networks (GRNs) for IRG1 in mouse and human macrophages. We further implemented a contextualization algorithm that relies on genome-wide gene expression data to infer putative cell type-specific gene regulatory interactions in mouse and human macrophages, which allowed us to predict potential transcriptional regulators of IRG1. Among the computationally identified regulators, siRNA-mediated gene silencing of interferon regulatory factor 1 (IRF1) in macrophages significantly decreased the expression of IRG1/CAD at the gene and protein level, which correlated with a reduced production of itaconic acid. Using a synergistic approach of both computational and experimental methods, we here shed more light on the transcriptional machinery of IRG1 expression and could pave the way to therapeutic approaches targeting itaconic acid levels.

  9. Gene Regulatory Network Inference of Immunoresponsive Gene 1 (IRG1) Identifies Interferon Regulatory Factor 1 (IRF1) as Its Transcriptional Regulator in Mammalian Macrophages

    PubMed Central

    Tallam, Aravind; Perumal, Thaneer M.; Antony, Paul M.; Jäger, Christian; Fritz, Joëlle V.; Vallar, Laurent; Balling, Rudi; del Sol, Antonio; Michelucci, Alessandro

    2016-01-01

    Immunoresponsive gene 1 (IRG1) is one of the highest induced genes in macrophages under pro-inflammatory conditions. Its function has been recently described: it codes for immune-responsive gene 1 protein/cis-aconitic acid decarboxylase (IRG1/CAD), an enzyme catalysing the production of itaconic acid from cis-aconitic acid, a tricarboxylic acid (TCA) cycle intermediate. Itaconic acid possesses specific antimicrobial properties inhibiting isocitrate lyase, the first enzyme of the glyoxylate shunt, an anaplerotic pathway that bypasses the TCA cycle and enables bacteria to survive on limited carbon conditions. To elucidate the mechanisms underlying itaconic acid production through IRG1 induction in macrophages, we examined the transcriptional regulation of IRG1. To this end, we studied IRG1 expression in human immune cells under different inflammatory stimuli, such as TNFα and IFNγ, in addition to lipopolysaccharides. Under these conditions, as previously shown in mouse macrophages, IRG1/CAD accumulates in mitochondria. Furthermore, using literature information and transcription factor prediction models, we re-constructed raw gene regulatory networks (GRNs) for IRG1 in mouse and human macrophages. We further implemented a contextualization algorithm that relies on genome-wide gene expression data to infer putative cell type-specific gene regulatory interactions in mouse and human macrophages, which allowed us to predict potential transcriptional regulators of IRG1. Among the computationally identified regulators, siRNA-mediated gene silencing of interferon regulatory factor 1 (IRF1) in macrophages significantly decreased the expression of IRG1/CAD at the gene and protein level, which correlated with a reduced production of itaconic acid. Using a synergistic approach of both computational and experimental methods, we here shed more light on the transcriptional machinery of IRG1 expression and could pave the way to therapeutic approaches targeting itaconic acid levels

  10. Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor {alpha}/retinoid X receptor

    SciTech Connect

    Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.; Akita, Geoffrey Y.; Cheng, Seng H.; Gregory, Richard J.; Jiang Canwen

    2007-12-21

    In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferase I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.

  11. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters.

    PubMed

    Zhang, Ning; McHale, Leah K; Finer, John J

    2016-01-01

    Introns, especially the first intron in the 5' untranslated region (5'UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement.

  12. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters

    PubMed Central

    Zhang, Ning; McHale, Leah K.; Finer, John J.

    2016-01-01

    Introns, especially the first intron in the 5’ untranslated region (5’UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement. PMID:27806110

  13. Molecular mechanisms of alpha-fetoprotein gene expression.

    PubMed

    Lazarevich, N L

    2000-01-01

    Alpha-fetoprotein (AFP) is the main component of mammalian fetal serum. It is synthesized by visceral endoderm of the yolk sac and by fetal liver. Immediately after birth AFP level in blood decreases dramatically. AFP synthesis is reactivated in liver tumors and germinogeneous teratoblastomas, in a lesser degree after chemical and mechanical liver injuries followed by regeneration (i.e., acute viral hepatitis). AFP blood level change is an important marker for liver tumors that is widely used in clinical practice. Therefore, the study of the molecular and cellular mechanisms participating in regulation of the oncoembryonal protein AFP is an important task. On various experimental models it has been shown that the expression is regulated mainly on the transcriptional level, the AFP gene having a 7 kb regulatory region upstream. Within this region a tissue-specific promoter, three independent enhancers, and a silencer that is at least partially responsible for AFP gene expression decrease in adult liver have been defined. Some ubiquitous and some tissue-specific transcription factors, including hepatocyte nuclear factors (HNFs), which mediate the transcription of most of the liver-specific genes, have been shown to bind to the promoter. However, the mechanisms determining drastic changes of AFP synthesis level in the course of ontogenesis and carcinogenesis remain incompletely clarified. Also, little is known about negative regulators of AFP gene expression in cells of non-hepatic origin and in adult liver.

  14. Mutations in the paralogous human alpha-globin genes yielding identical hemoglobin variants.

    PubMed

    Moradkhani, Kamran; Préhu, Claude; Old, John; Henderson, Shirley; Balamitsa, Vera; Luo, Hong-Yuan; Poon, Man-Chiu; Chui, David H K; Wajcman, Henri; Patrinos, George P

    2009-06-01

    The human alpha-globin genes are paralogues, sharing a high degree of DNA sequence similarity and producing an identical alpha-globin chain. Over half of the alpha-globin structural variants reported to date are only characterized at the amino acid level. It is likely that a fraction of these variants, with phenotypes differing from one observation to another, may be due to the same mutation but on a different alpha-globin gene. There have been very few previous examples of hemoglobin variants that can be found at both HBA1 and HBA2 genes. Here, we report the results of a systematic multicenter study in a large multiethnic population to identify such variants and to analyze their differences from a functional and evolutionary perspective. We identified 14 different Hb variants resulting from identical mutations on either one of the two human alpha-globin paralogue genes. We also showed that the average percentage of hemoglobin variants due to a HBA2 gene mutation (alpha2) is higher than the percentage of hemoglobin variants due to the same HBA1 gene mutation (alpha1) and that the alpha2/alpha1 ratio varied between variants. These alpha-globin chain variants have most likely occurred via recurrent mutations, gene conversion events, or both. Based on these data, we propose a nomenclature for hemoglobin variants that fall into this category.

  15. Immunohistochemical detection of osteopontin in advanced head-and-neck cancer: Prognostic role and correlation with oxygen electrode measurements, hypoxia-inducible-factor-1{alpha}-related markers, and hemoglobin levels

    SciTech Connect

    Bache, Matthias; Reddemann, Rolf; Said, Harun M.; Holzhausen, Hans-Juergen; Taubert, Helge; Becker, Axel; Kuhnt, Thomas; Haensgen, Gabriele; Dunst, Juergen; Vordermark, Dirk . E-mail: vordermark_d@klinik.uni-wuerzburg.de

    2006-12-01

    Purpose: The tumor-associated glycoprotein osteopontin (OPN) is discussed as a plasma marker of tumor hypoxia. However, the association of immunohistochemical OPN expression in tumor sections with tumor oxygenation parameters (HF5, median pO{sub 2}), the hypoxia-related markers hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) and carbonic anhydrase IX (CAIX), or hemoglobin and systemic vascular endothelial growth factor (VEGF) levels has not been investigated. Methods and Materials: Tumor tissue sections of 34 patients with advanced head-and-neck cancer treated with radiotherapy were assessed by immunochemistry for the expression of OPN, HIF-1{alpha}, and CA IX. Relationship of OPN expression with tumor oxygenation parameters (HF5, median pO{sub 2}), HIF-1{alpha} and CA IX expression, hemoglobin and serum VEGF level, and clinical parameters was studied. Results: Bivariate analysis showed a significant correlation of positive OPN staining with low hemoglobin level (p = 0.02), high HIF-1{alpha} expression (p = 0.02), and high serum vascular endothelial growth factor level (p = 0.02) for advanced head-and-neck cancer. Furthermore, considering the 31 Stage IV patients, the median pO{sub 2} correlated significantly with the OPN expression (p = 0.02). OPN expression alone had only a small impact on prognosis. However, in a univariate Cox proportional hazard regression model, the expression of either OPN or HIF-1{alpha} or CA IX was associated with a 4.1-fold increased risk of death (p = 0.02) compared with negativity of all three markers. Conclusion: Osteopontin expression detected immunohistochemically is associated with oxygenation parameters in advanced head-and-neck cancer. When the results of OPN, HIF-1{alpha}, and CA IX immunohistochemistry are combined into a hypoxic profile, a strong and statistically significant impact on overall survival is found.

  16. Involvement of PPAR gamma co-activator-1, nuclear respiratory factors 1 and 2, and PPAR alpha in the adaptive response to endurance exercise.

    PubMed

    Baar, Keith

    2004-05-01

    Endurance exercise training induces an increase in the respiratory capacity of muscle, resulting in an increased capacity to generate ATP as well as improved efficiency of muscle contraction. Such adaptations are largely the result of a coordinated genetic response that increases mitochondrial proteins, fatty acid oxidation enzymes and the exercise- and insulin-stimulated glucose transporter GLUT4, and shifts the contractile and regulatory proteins to their more efficient isoforms. In recent years a number of the transcriptional regulators involved in this genetic response have been identified and these factors can be classified into two different groups. The first group comprises transcription factors such as nuclear respiratory factors (NRF) 1 and 2 and PPAR alpha that bind DNA in a sequence-specific manner. The second group, referred to as transcriptional co-activators, alter transcription without directly binding to DNA. The PPAR gamma co-activator (PGC) family of proteins have been identified as the central family of transcriptional co-activators for induction of mitochondrial biogenesis. PGC-1 alpha is activated by exercise, and is sufficient to produce the endurance phenotype through direct interactions with NRF-1 and PPAR alpha, and potentially NRF-2. Furthering the understanding of the activation of PGC proteins following exercise has implications beyond improving athletic performance, including the possibility of providing targets for the treatment of frailty in the elderly, obesity and diseases such as mitochondrial myopathies and diabetes.

  17. [Nucleotide sequence of genes for alpha- and beta-subunits of luciferase from Photobacterium leiognathi].

    PubMed

    Illarionov, B A; Protopopova, M V; Karginov, V A; Mertvetsov, N P; Gitel'zon, I I

    1988-03-01

    Nucleotide sequence of the Photobacterium leiognathi DNA containing genes of alpha and beta subunits of luciferase has been determined. We also deduced amino acid sequence and molecular mass of luciferase and localized luciferase genes in the sequenced DNA fragment.

  18. Vascular endothelial growth factor and hypoxia-inducible factor-1α gene polymorphisms and coronary collateral formation in patients with coronary chronic total occlusions

    PubMed Central

    Amoah, Vincent; Wrigley, Benjamin; Holroyd, Eric; Smallwood, Andrew; Armesilla, Angel L; Nevill, Alan; Cotton, James

    2016-01-01

    Introduction: We evaluated the association between two single nucleotide polymorphisms of the vascular endothelial growth factor gene and one of the hypoxia-inducible factor-1α gene and the degree of coronary collateral formation in patients with a coronary chronic total occlusion. Methods: Totally, 98 patients with symptomatic coronary artery disease and a chronic total occlusion observed during coronary angiography were recruited. Genotyping of two vascular endothelial growth factor promoter single nucleotide polymorphisms (−152G>A and −165C>T) and the C1772T single nucleotide polymorphism of hypoxia-inducible factor-1α were performed using polymerase chain reaction and restriction fragment length polymorphism analysis. The presence and extent of collateral vessel filling was scored by blinded observers using the Rentrop grade. Results: We found no association between the vascular endothelial growth factor −152G>A, −165C>T and hypoxia-inducible factor-1α −1772C>T with the presence and filling of coronary collateral vessels. A history of percutaneous coronary intervention and transient ischaemic attack/cerebrovascular accident were associated with the presence of enhanced collateral vessel formation following binary logistic regression analysis. Conclusion: The study findings suggest that coronary collateral formation is not associated with the tested polymorphic variants of vascular endothelial growth factor and hypoxia-inducible factor-1α in patients with symptomatic coronary artery disease and the presence of a chronic total occlusion. PMID:27621802

  19. The neuronal nicotinic acetylcholine receptor {alpha}7 subunit gene: Cloning, mapping, structure, and targeting in mouse

    SciTech Connect

    Orr-Urtreger, A.; Baldini, A.; Beaudet, A.L.

    1994-09-01

    The neuronal nicotinic acetylcholine receptor {alpha}7 subunit is a member of a family of ligand-gated ion channels, and is the only subunit know to bind {alpha}-bungarotoxin in mammalian brain. {alpha}-Bungarotoxin binding sites are known to be more abundant in the hippocampus of mouse strains that are particularly sensitive to nicotine-induced seizures. The {alpha}7 receptor is highly permeable to calcium, which could suggest a role in synaptic plasticity in the nervous system. Auditory gating deficiency, an abnormal response to a second auditory stimulus, is characteristic of schizophrenia. Mouse strains that exhibit a similar gating deficit have reduced hippocampal expression of the {alpha}7 subunit. We have cloned and sequenced the full length cDNA for the mouse {alpha}7 gene (Acra-7) and characterized its gene structure. The murine {alpha}7 shares amino acid identity of 99% and 93% with the rat and human {alpha}7 subunits, respectively. Using an interspecies backcross panel, the murine gene was mapped to chromosome 7 near the p locus, a region syntenic with human chromosome 15; the human gene (CHRNA7) was confirmed to map to 15q13-q14 by FISH. To generate a mouse {alpha}7 mutant by homologous recombination, we have constructed a replacement vector which will delete transmembrane domains II-IV and the cytoplasmic domain from the gene product. Recombinant embryonic stem (ES) cell clones were selected and used to develop mouse chimeras that are currently being bred to obtain germline transmission.

  20. Methylation impact analysis of erythropoietin (EPO) Gene to hypoxia inducible factor-1α (HIF-1α) activity.

    PubMed

    Dewi, Firli Rahmah Primula; Fatchiyah, Fatchiyah

    2013-01-01

    Erythropoietin (EPO) is a glycoprotein hormone that play a role as key regulator in the production of red blood cells. The promoter region of EPO is methylated in normoxic (non-hypoxia) condition, but not in hypoxic condition. Methylation of the EPO enhancer region decline the transcription activity of EPO gene. The aim of this study is to investigate how different methylation percentage affected on the regulation and transcriptional activity of EPO gene. The DNA sequence of erythropoietin gene and protein sequence was retrieved from the sequence database of NCBI. DNA structure was constructed using 3D-DART web server and modeling structure of HIF1 predicted using SWISS-MODEL web server. Methylated DNA sequence of EPO gene using performed with YASARA View software and docking of EPO gene and transcription factor HIF1 analyzed by using HADDOCK webserver. Our result showed that binding energy in 46% methylated DNA was higher (-161,45 kcal/mol) than in unmethylated DNA (-194,16 kcal/mol) and 8% methylated DNA (-175,94 kcal/mol). So, we presume that a silencing mechanism of the Epo gene by methylation is correlated with the binding energy, which is required for interaction. A higher methylation percentage correlates with a higher binding energy which can cause an unstable interaction between DNA and transcription factor. In conclution, methylation of promoter and enhancer region of Epo gene leads to silencing.

  1. Up-regulation of hypoxia-inducible factor-1 alpha by cobalt chloride prevents hearing loss in noise-exposed mice.

    PubMed

    Chung, Jong Woo; Shin, Jung-Eun; Han, Kwang Woo; Ahn, Joong Ho; Kim, Young-Jin; Park, Jong-Wan; So, Hong-Seob

    2011-01-01

    Since hypoxia-inducible factor-1α (HIF-1α) is the key transcription factor that enables cells to survive in hypoxia, we have investigated whether an upregulation of HIF-1α prevents the noise-induced hearing loss in BALB/c hybrid mice, which were intraperitoneally injected with CoCl(2) (a HIF-1α inducer) and exposed to white band noise with 120 dB peak equivalent sound pressure level for 3h once daily for 3 days. In the CoCl(2) treatment group, HIF-1α was found to be up-regulated in the cochlear tissues and the hearing loss was largely prevented. Histologically, the loss of sensory hair cells was also significantly lower in the CoCl(2) treatment group than the Control group. However, YC-1 (a HIF-1α inhibitor) attenuated the preventive effect of CoCl(2) on the noise-induced hearing loss. These results suggest that HIF-1α plays a crucial role in the prevention against noise trauma in the inner ear.

  2. AMPK activation represses the human gene promoter of the cardiac isoform of acetyl-CoA carboxylase: Role of nuclear respiratory factor-1

    SciTech Connect

    Adam, Tasneem; Opie, Lionel H.; Essop, M. Faadiel

    2010-07-30

    Research highlights: {yields} AMPK inhibits acetyl-CoA carboxylase beta gene promoter activity. {yields} Nuclear respiratory factor-1 inhibits acetyl-CoA carboxylase beta promoter activity. {yields} AMPK regulates acetyl-CoA carboxylase beta at transcriptional level. -- Abstract: The cardiac-enriched isoform of acetyl-CoA carboxylase (ACC{beta}) produces malonyl-CoA, a potent inhibitor of carnitine palmitoyltransferase-1. AMPK inhibits ACC{beta} activity, lowering malonyl-CoA levels and promoting mitochondrial fatty acid {beta}-oxidation. Previously, AMPK increased promoter binding of nuclear respiratory factor-1 (NRF-1), a pivotal transcriptional modulator controlling gene expression of mitochondrial proteins. We therefore hypothesized that NRF-1 inhibits myocardial ACC{beta} promoter activity via AMPK activation. A human ACC{beta} promoter-luciferase construct was transiently transfected into neonatal cardiomyocytes {+-} a NRF-1 expression construct. NRF-1 overexpression decreased ACC{beta} gene promoter activity by 71 {+-} 4.6% (p < 0.001 vs. control). Transfections with 5'-end serial promoter deletions revealed that NRF-1-mediated repression of ACC{beta} was abolished with a pPII{beta}-18/+65-Luc deletion construct. AMPK activation dose-dependently reduced ACC{beta} promoter activity, while NRF-1 addition did not further decrease it. We also investigated NRF-1 inhibition in the presence of upstream stimulatory factor 1 (USF1), a known transactivator of the human ACC{beta} gene promoter. Here NRF-1 blunted USF1-dependent induction of ACC{beta} promoter activity by 58 {+-} 7.5% (p < 0.001 vs. control), reversed with a dominant negative NRF-1 construct. NRF-1 also suppressed endogenous USF1 transcriptional activity by 55 {+-} 6.2% (p < 0.001 vs. control). This study demonstrates that NRF-1 is a novel transcriptional inhibitor of the human ACC{beta} gene promoter in the mammalian heart. Our data extends AMPK regulation of ACC{beta} to the transcriptional level.

  3. Association of elongation factor 1 alpha and ribosomal protein L3 with the proline-rich region of yeast adenylyl cyclase-associated protein CAP.

    PubMed

    Yanagihara, C; Shinkai, M; Kariya, K; Yamawaki-Kataoka, Y; Hu, C D; Masuda, T; Kataoka, T

    1997-03-17

    CAP is a multifunctional protein; the N-terminal region binds adenylyl cyclase and controls its response to Ras while the C-terminal region is involved in cytoskeletal regulation. In between the two regions, CAP possesses two proline-rich segments, P1 and P2, resembling a consensus sequence for binding SH3 domains. We have identified two yeast proteins with molecular sizes of 48 and 46 kDa associated specifically with P2. Determination of partial protein sequences demonstrated that the 48-kDa and 46-kDa proteins correspond to EF1 alpha and rL3, respectively, neither of which contains any SH3-domain-like sequence. Deletion of P2 from CAP resulted in loss of the activity to bind the two proteins either in vivo or in vitro. Yeast cells whose chromosomal CAP was replaced by the P2-deletion mutant displayed an abnormal phenotype represented by dissociated localizations of CAP and F-actin, which were colocalized in wild-type cells. These results suggest that these associations may have functional significance.

  4. Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

    SciTech Connect

    Goodyer, P.R.; Torban, E.; Dehbi, M.

    1994-09-01

    The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-length WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.

  5. Alpha tubulin genes from Leishmania braziliensis: genomic organization, gene structure and insights on their expression

    PubMed Central

    2013-01-01

    Background Alpha tubulin is a fundamental component of the cytoskeleton which is responsible for cell shape and is involved in cell division, ciliary and flagellar motility and intracellular transport. Alpha tubulin gene expression varies according to the morphological changes suffered by Leishmania in its life cycle. However, the objective of studying the mechanisms responsible for the differential expression has resulted to be a difficult task due to the complex genome organization of tubulin genes and to the non-conventional mechanisms of gene regulation operating in Leishmania. Results We started this work by analyzing the genomic organization of α-tubulin genes in the Leishmania braziliensis genome database. The genomic organization of L. braziliensis α-tubulin genes differs from that existing in the L. major and L. infantum genomes. Two loci containing α-tubulin genes were found in the chromosomes 13 and 29, even though the existence of sequence gaps does not allow knowing the exact number of genes at each locus. Southern blot assays showed that α-tubulin locus at chromosome 13 contains at least 8 gene copies, which are tandemly organized with a 2.08-kb repetition unit; the locus at chromosome 29 seems to contain a sole α-tubulin gene. In addition, it was found that L. braziliensis α-tubulin locus at chromosome 13 contains two types of α-tubulin genes differing in their 3′ UTR, each one presumably containing different regulatory motifs. It was also determined that the mRNA expression levels of these genes are controlled by post-transcriptional mechanisms tightly linked to the growth temperature. Moreover, the decrease in the α-tubulin mRNA abundance observed when promastigotes were cultured at 35°C was accompanied by parasite morphology alterations, similar to that occurring during the promastigote to amastigote differentiation. Conclusions Information found in the genome databases indicates that α-tubulin genes have been reorganized in a drastic

  6. High Nuclear Hypoxia-Inducible Factor 1 Alpha Expression Is a Predictor of Distant Recurrence in Patients With Resected Pancreatic Adenocarcinoma

    SciTech Connect

    Colbert, Lauren E.; Fisher, Sarah B.; Balci, Serdar; Saka, Burcu; Chen, Zhengjia; Kim, Sungjin; El-Rayes, Bassel F.; Adsay, N. Volkan; Maithel, Shishir K.; Landry, Jerome C.; and others

    2015-03-01

    Purpose: To evaluate nuclear hypoxia-inducible factor 1α (HIF-1α) expression as a prognostic factor for distant recurrence (DR) and local recurrence (LR) after pancreatic adenocarcinoma resection. Methods and Materials: Tissue specimens were collected from 98 patients with pancreatic adenocarcinoma who underwent resection without neoadjuvant therapy between January 2000 and December 2011. Local recurrence was defined as radiographic or pathologic evidence of progressive disease in the pancreas, pancreatic bed, or associated nodal regions. Distant recurrence was defined as radiographically or pathologically confirmed recurrent disease in other sites. Immunohistochemical staining was performed and scored by an independent pathologist blinded to patient outcomes. High HIF-1α overall expression score was defined as high percentage and intensity staining and thus score >1.33. Univariate analysis was performed for HIF-1α score with LR alone and with DR. Multivariate logistic regression was used to determine predictors of LR and DR. Results: Median follow-up time for all patients was 16.3 months. Eight patients (8%) demonstrated isolated LR, 26 patients (26.5%) had isolated DR, and 13 patients had both LR and DR. Fifty-three patients (54%) had high HIF-1α expression, and 45 patients (46%) had low HIF-1α expression. High HIF-1α expression was significantly associated with DR (P=.03), and low HIF-1α expression was significantly associated with isolated LR (P=.03). On multivariate logistic regression analysis, high HIF-1α was the only significant predictor of DR (odds ratio 2.46 [95% confidence interval 1.06-5.72]; P=.03). In patients with a known recurrence, an HIF-1α score ≥2.5 demonstrated a specificity of 100% for DR. Conclusions: High HIF-1α expression is a significant predictor of distant failure versus isolated local failure in patients undergoing resection of pancreatic adenocarcinoma. Expression of HIF-1α may have utility in determining candidates for

  7. Phylogenetic relationships within the genus Equus and the evolution of alpha and theta globin genes.

    PubMed

    Oakenfull, E A; Clegg, J B

    1998-12-01

    Sequences of the alpha1, alpha2 and theta globin genes from six equid species have been determined to investigate relationships within the genus Equus. Analyses using standard phylogenetic methods, or an approach designed to account for the effects of gene conversion between the alpha genes, gave broadly similar results and show that the horses diverged from the zebra/ass ancestor approximately 2.4 million years ago and that the zebra and ass species arose in a rapid radiation approximately 0.9 million years ago. These results from the alpha genes are corroborated by theta gene data and are in contrast to mitochondrial DNA studies of the phylogeny of this genus, which suggest a more gradual set of speciation events.

  8. Hb Bronte or alpha93(FG5)Val-->Gly: a new unstable variant of the alpha2-globin gene, associated with a mild alpha(+)-thalassemia phenotype.

    PubMed

    Lacerra, Giuseppina; Testa, Rosario; De Angioletti, Maria; Schilirò, Gino; Carestia, Clementina

    2003-08-01

    We report a new unstable variant identified in three carriers of a family from East Sicily; it was named Hb Bronte after the place from which the family originated. DNA sequencing from nucleotides -181 to +894 (alpha1) and to +884 (alpha2) revealed a GTG-->GGG substitution at codon 93 of the alpha2-globin gene. The MCV and MCH values were at the lower end of the normal range in the carriers. On cation exchange high performance liquid chromatography (HPLC), the Hb A2 level was apparently increased to around 6%, and a small abnormal peak (0.3-0.4%) was detected after Hb A2. Two abnormal bands were detected by cellulose acetate electrophoresis: a major band (about 3-4%) migrated between Hb A and Hb F; a minor band (<1%) migrated between Hb A2 and carbonic anhydrase. Normal values of Hb A2 were detected by DEAE microchromatography. On reversed phase HPLC the variant chain was not detected, and most likely it was eluted with the alpha chain peak. The isopropanol stability test was very slightly positive in the carriers. Hemolytic symptoms were absent with the exception of indirect bilirubin, which was at high borderline in 2/3 carriers. In biosynthesis in vitro, the specific activity of the alpha chains was much higher than that of the beta-globin chains, and the alpha/beta biosynthetic ratio in the mother and proband was of the beta-thalassemia (thal) type (2.24 and 2.54, respectively). Time course experiments showed that the increase of the 3H-specific activity of the peak containing normal and variant alpha chains was not linear and was much higher than that of beta chains; moreover, the alpha/beta biosynthetic ratio varied during the 2 hours incubation.

  9. Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

    SciTech Connect

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi . E-mail: INOUE-GER@h.u-tokyo.ac.jp

    2007-07-06

    Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  10. The primary transcription unit of the human alpha 2 globin gene defined by quantitative RT/PCR.

    PubMed Central

    Owczarek, C M; Enriquez-Harris, P; Proudfoot, N J

    1992-01-01

    We have set up an experimental system to map the primary transcription unit of the human alpha 2 globin gene. The duplicated human alpha globin genes (alpha 2-alpha 1) were linked to the alpha globin locus Positive Regulatory Element (PRE) and stably transfected into murine erythroleukaemia cells. We then developed a quantitative reverse transcriptase, polymerase chain reaction assay to map alpha 2 primary transcripts using primer pairs derived from different parts of the alpha 2 globin gene and its 3' flanking region. This approach has revealed the presence of steady state nuclear RNA past the poly(A) site of the alpha 2 globin gene at approximately 40% of the level of unspliced intron transcript. Furthermore, these 3' flanking transcripts diminish 500 bp into the 3' flanking region, identifying this part of the alpha 2 globin gene as the principal region of termination of transcription. Images PMID:1371868

  11. Central venous hypoxemia is a determinant of human atrial ATP-sensitive potassium channel expression: evidence for a novel hypoxia-inducible factor 1alpha-Forkhead box class O signaling pathway.

    PubMed

    Raeis, Véronique; Philip-Couderc, Pierre; Roatti, Angela; Habre, Walid; Sierra, Jorge; Kalangos, Afksendyios; Beghetti, Maurice; Baertschi, Alex J

    2010-05-01

    ATP-sensitive potassium channels couple cell excitability to energy metabolism, thereby providing life-saving protection of stressed cardiomyocytes. The signaling for ATP-sensitive potassium channel expression is still unknown. We tested involvement of biochemical and biophysical parameters and potential transcription factors Forkhead box (FOX) and hypoxia-inducible factor (HIF-1alpha). Right atrial tissues were obtained during surgery from 28 children with heart disease. Expression of K(+)-inward-rectifier subunits Kir6.1/Kir6.2; sulfonyl urea receptors (SURs) SUR1A/B and SUR2A/B; and FOX class O (FOXO) 1, FOXO3, FOXF2, and HIF-1alpha were related to 31 parameters, including personal data, blood chemistry, and echocardiography. Venous hypoxemia (but not other ischemia indicators, such as venous hypercapnia or low glucose) predicts increased Kir6.1 (P<0.003) and Kir6.2 (P<0.03) protein. Kir6.1 associates with SUR2A/B mRNA (P<0.05) and correlates with FOXOs (P<0.002). FOXOs correlate with HIF-1alpha (P<0.01) and HIF-1alpha with venous hypoxemia (P<0.003). Electrophoretic mobility-shift assays suggest causal links among hypoxia, HIF-1alpha, FOXO1, and Kir6.1. To mimic mild ischemia encountered in some patients, cultured rat atrial myocytes were tested in hypoxia, hypercapnia, or low glucose, with normal conditions serving as the control. Mild hypoxia (24-hour) increases expression of HIF-1alpha, FOXO1, and SUR2A/B/Kir6.1 in culture (P<0.01), whereas hypercapnia and low glucose have no or opposite effects. Gene knockdown of HIF-1alpha or FOXO1 by small-interfering RNAs abolishes hypoxia-induced expression of FOXO1 and SUR2A/B/Kir6.1. These results suggest that low tissue oxygen determines increased expression of the atrial SUR2A/B/Kir6.1 gene via activation of HIF-1alpha-FOXO1. Because increased SUR2A/B/Kir6.1 has known survival benefits, this pathway offers novel therapeutic targets for children with heart disease.

  12. UV-induced expression of key component of the tanning process, the POMC and MC1R genes, is dependent on the p-38-activated upstream stimulating factor-1 (USF-1).

    PubMed

    Corre, Sébastien; Primot, Aline; Sviderskaya, Elena; Bennett, Dorothy C; Vaulont, Sophie; Goding, Colin R; Galibert, Marie-Dominique

    2004-12-03

    Protection against UV-mediated DNA damage and the onset of oncogenesis is afforded by the tanning response in which UV irradiation triggers melanocytes to increase production of melanin that is then transferred to keratinocytes. A key component of the tanning process is the UV-mediated induction of the pro-opiomelanocortin (POMC) and MC1R genes encoding the alpha-melanocyte-stimulating hormone and its receptor, respectively, which play a crucial role in pigmentation by regulating the intracellular levels of cAMP. How these genes are regulated in response to UV irradiation is not known. Here we have shown that UV-induced activation of the POMC and MC1R promoters is mediated by p38 stress-activated kinase signaling to the transcription factor, upstream stimulating factor-1 (USF-1). Importantly, melanocytes derived from USF-1 -/- mice exhibit a defective UV response and fail to activate POMC and MC1R expression in response to UV irradiation. The results define USF-1 as a critical UV-responsive activator of genes implicated in protection from solar radiation.

  13. Expression pattern of the RAR alpha-PML fusion gene in acute promyelocytic leukemia.

    PubMed Central

    Alcalay, M; Zangrilli, D; Fagioli, M; Pandolfi, P P; Mencarelli, A; Lo Coco, F; Biondi, A; Grignani, F; Pelicci, P G

    1992-01-01

    Two chimeric genes, PML-RAR alpha and RAR alpha-PML, are formed as a consequence of the acute promyelocytic leukemia (APL)-specific reciprocal translocation of chromosomes 15 and 17 [t(15;17)]. PML-RAR alpha is expressed as a fusion protein. We investigated the organization and expression pattern of the RAR alpha-PML gene in a series of APL patients representative of the molecular heterogeneity of the t(15;17) and found (i) two types of RAR alpha-PML mRNA junctions (RAR alpha exon 2/PML exon 4 or RAR alpha exon 2/PML exon 7) that maintain the RAR alpha and PML longest open reading frames aligned and are the result of chromosome 15 breaking at two different sites; and (ii) 10 different RAR alpha-PML fusion transcripts that differ for the assembly of their PML coding exons. A RAR alpha-PML transcript was present in most, but not all, APL patients. Images PMID:1317574

  14. Physical and Functional Interaction between the Bloom's Syndrome Gene Product and the Largest Subunit of Chromatin Assembly Factor 1

    PubMed Central

    Jiao, Renjie; Bachrati, Csanád Z.; Pedrazzi, Graziella; Kuster, Patrick; Petkovic, Maja; Li, Ji-Liang; Egli, Dieter; Hickson, Ian D.; Stagljar, Igor

    2004-01-01

    Bloom's syndrome (BS) is a genomic instability disorder characterized by cancer susceptibility. The protein defective in BS, BLM, belongs to the RecQ family of DNA helicases. In this study, we found that BLM interacts with hp150, the largest subunit of chromatin assembly factor 1 (CAF-1), in vitro and in vivo. Colocalization of a proportion of the cellular complement of these two proteins is found at specific nuclear foci coinciding with sites of DNA synthesis in the S phase. This colocalization increases in the presence of agents that damage DNA or inhibit DNA replication. In support of a functional interaction between BLM and CAF-1, we show that BLM inhibits CAF-1-mediated chromatin assembly during DNA repair in vitro. Although CAF-1 activity is not altered in BLM-deficient cells, the absence of BLM does impair the ability of CAF-1 to be mobilized within the nucleus in response to hydroxyurea treatment. Our results provide the first link between BLM and chromatin assembly coupled to DNA repair and suggest that BLM and CAF-1 function in a coordinated way to promote survival in response to DNA damage and/or replication blockade. PMID:15143166

  15. Concomitant T-cell receptor alpha and delta gene rearrangements in individual T-cell precursors.

    PubMed Central

    Thompson, S D; Pelkonen, J; Hurwitz, J L

    1990-01-01

    A debate has recently surfaced concerning the degree of precommitment attained by alpha beta and gamma delta T-cell precursors prior to T-cell receptor (TCR) gene rearrangement. It has been suggested that precursors may be precommitted to rearrange either alpha or delta genes, but not both, thus giving rise to alpha beta- and gamma delta-producing T cells, respectively. Alternatively, the precursors may be flexible with regard to potential TCR gene rearrangements. To address this controversy, the gene rearrangements among a group of T-cell hybridomas from fetal, newborn, and early postnatal mouse thymi were examined. Six probes spanning the delta and alpha loci were used in Southern blot analyses to characterize the rearrangements which occurred on homologous chromosomes in each cell. Although homologous chromosomes often rearranged in synchrony within the alpha locus, a number of hybridomas were found which had retained a delta rearrangement on one chromosome and an alpha rearrangement on the second. Results show that a precommitment by T cells to rearrange delta or alpha genes in a mutually exclusive manner is not an absolute feature of mouse thymocyte development. Images PMID:2164690

  16. Insulin-like growth factor 1 gene (CA)n repeats and a variable number of tandem repeats of the insulin gene in Brazilian children born small for gestational age

    PubMed Central

    Coletta, Rocio R D; Jorge, Alexander A L; D' Alva, Catarina Brasil; Pinto, Emília M; Billerbeck, Ana Elisa C; Pachi, Paulo R; Longui, Carlos A; Garcia, Ricardo M; Boguszewski, Margaret; Arnhold, Ivo J P; Mendonca, Berenice B; Costa, Elaine M F

    2013-01-01

    OBJECTIVE: To investigate the influence of (CA)n repeats in the insulin-like growth factor 1 gene and a variable number of tandem repeats of the insulin gene on birth size in children who are small or adequate-sized for gestational age and to correlate these polymorphisms with serum insulin-like growth factor 1 levels and insulin sensitivity in children who are small for gestational age, with and without catch-up growth. PATIENTS AND METHODS: We evaluated 439 infants: 297 that were adequate-sized for gestational age and 142 that were small for gestational age (66 with and 76 without catch-up). The number of (CA)n repeat in the insulin-like growth factor 1 gene and a variable number of tandem repeats in the insulin gene were analyzed using GENESCAN software and polymerase chain reaction followed by enzymatic digestion, respectively. Clinical and laboratory data were obtained from all patients. RESULTS: The height, body mass index, paternal height, target height and insulin-like growth factor 1 serum levels were higher in children who were small for gestational age with catch-up. There was no difference in the allelic and genotypic distributions of both polymorphisms between the adequate-sized and small infants or among small infants with and without catch-up. Similarly, the polymorphisms were not associated with clinical or laboratory variables. CONCLUSION: Polymorphisms of the (CA)n repeats of the insulin-like growth factor 1 gene and a variable number of tandem repeats of the insulin gene, separately or in combination, did not influence pre- or postnatal growth, insulin-like growth factor 1 serum levels or insulin resistance. PMID:23778474

  17. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.

    PubMed

    Periz, G; Keller, L R

    1997-07-01

    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements.

  18. Differential regulation of alpha7 nicotinic receptor gene (CHRNA7) expression in schizophrenic smokers.

    PubMed

    Mexal, Sharon; Berger, Ralph; Logel, Judy; Ross, Randal G; Freedman, Robert; Leonard, Sherry

    2010-01-01

    The alpha7 neuronal nicotinic receptor gene (CHRNA7) has been implicated in the pathophysiology of schizophrenia by genetic and pharmacological studies. Expression of the alpha7* receptor, as measured by [(125)I]alpha-bungarotoxin autoradiography, is decreased in postmortem brain of schizophrenic subjects compared to non-mentally ill controls. Most schizophrenic patients are heavy smokers, with high levels of serum cotinine. Smoking changes the expression of multiple genes and differentially regulates gene expression in schizophrenic hippocampus. We examined the effects of smoking on CHRNA7 expression in the same tissue and find that smoking differentially regulates expression of both mRNA and protein for this gene. CHRNA7 mRNA and protein levels are significantly lower in schizophrenic nonsmokers compared to control nonsmokers and are brought to control levels in schizophrenic smokers. Sufficient protein but low surface expression of the alpha7* receptor, seen in the autoradiographic studies, suggests aberrant assembly or trafficking of the receptor.

  19. The human glucokinase gene beta-cell-type promoter: an essential role of insulin promoter factor 1/PDX-1 in its activation in HIT-T15 cells.

    PubMed

    Watada, H; Kajimoto, Y; Umayahara, Y; Matsuoka, T; Kaneto, H; Fujitani, Y; Kamada, T; Kawamori, R; Yamasaki, Y

    1996-11-01

    The glycolytic enzyme glucokinase plays a primary role in the glucose-responsive secretion of insulin, and defects of this enzyme can cause NIDDM. As a step toward understanding the molecular basis of glucokinase (GK) gene regulation, we assessed the structure and regulation of the human GK gene beta-cell-type promoter. The results of reporter gene analyses using HIT-T15 cells revealed that the gene promoter was comprised of multiple cis-acting elements, including two primarily important cis-motifs: a palindrome structure, hPal-1, and the insulin gene cis-motif A element-like hUPE3. While both elements were bound specifically by nuclear proteins, it was the homeodomain-containing transcription factor insulin promoter factor 1 (IPF1)/STF-1/PDX-1 that bound to the hUPE3 site: IPF1, when expressed in CHO-K1 cells, became bound to the hUPE3 site and activated transcription. An anti-IPF1 antiserum used in gel-mobility shift analysis supershifted the DNA protein complex formed with the hUPE3 probe and nuclear extracts from HIT-T15 cells, thus supporting the involvement of IPF1 in GK gene activation in HIT-T15 cells. In contrast to the insulin gene, however, neither the synergistic effect of the Pan1 expression on the IPF1-induced promoter activation nor the glucose responsiveness of the activity was observed for the GK gene promoter. These results revealed some conservative but unique features for the transcriptional regulation of the beta-cell-specific genes in humans. Being implicated in insulin and GK gene regulations as a common transcription factor, IPF1/STF-1/PDX-1 is likely to play an essential role in maintaining normal beta-cell functions.

  20. Human collagen genes encoding basement membrane. cap alpha. 1(IV) and. cap alpha. 2(IV) chains map to the distal long arm of chromosome 13

    SciTech Connect

    Griffin, C.A.; Emanuel, B.S.; Hansen, J.R.; Cavenee, W.K.; Myers, J.C.

    1987-01-01

    At least 20 genes encode the structurally related collagen chains that comprise > 10 homo- or heterotrimeric types. Six members of this multigene family have been assigned to five chromosomes in the human genome. The two type I genes, ..cap alpha..1 and ..cap alpha..2, are located on chromosomes 17 and 7, respectively, and the ..cap alpha..1(II) gene is located on chromosome 12. Their recent mapping of the ..cap alpha..1(III) and ..cap alpha..2(V) genes to the q24.3 ..-->.. q31 region of chromosome 2 provided the only evidence that the collagen genes are not entirely dispersed. To further determine their organization, the authors and others localized the ..cap alpha..1(IV) gene to chromosome 13 and in their experiments sublocalized the gene to band q34 by in situ hybridization. Here they show the presence of the ..cap alpha..2 type IV locus also on the distal long arm of chromosome 13 by hybridizing a human ..cap alpha..2(IV) cDNA clone to rodent-human hybrids and to metaphase chromosomes. These studies represent the only demonstration of linkage between genes encoding both polypeptide chains of the same collagen type.

  1. Structure, organization, and transcription units of the human {alpha}-platelet-derived growth factor receptor gene, PDGFRA

    SciTech Connect

    Kawagishi, Jun; Yamamoto, Tokuo; Kumabe, Toshihiro; Yoshimoto, Takashi

    1995-11-20

    Isolation and characterization of genomic clones encoding human {alpha}-platelet derived growth factor receptor (HGAM-approved symbol PDGFRA) revealed that the gene spans approximately 65 kb and contains 23 exons. The 5{prime}-untranslated region of the mRNA is encoded by exon 1, and a large intron of 23 kb separates exon 2 encoding the translation initiator codon AUG and the signal sequence. The locations of exon/intron boundaries in the extracellular immunoglobulin-like domains, the transmembrane domain, the two cytoplasmic tyrosine kinase domains, and the kinase insertion domain are very similar to those in c-kit and macrophage colony stimulating factor-1 receptor genes. The transcription start site was mapped to a position 393 bp upstream of the AUG translation initiator codon by Si mapping and primer extension analysis. The 5{prime}-flanking region of the gene lacks a typical TATA box but contains a typical CCAAT box and GATA motifs. This region also contains potential sites for AP-1, AP-2, Oct-1, Oct-2, and Sp1. The 5{prime}-flanking region of the gene was fused to the luciferase reporter gene, and transcription units of the gene were determined. 49 refs., 6 figs., 1 tab.

  2. The alpha-tubulin gene family expressed during cell differentiation in Naegleria gruberi

    PubMed Central

    1988-01-01

    Genes that direct the programmed synthesis of flagellar alpha-tubulin during the differentiation of Naegleria gruberi from amebae to flagellates have been cloned, and found to be novel with respect to gene organization, sequence, and conservation. The flagellar alpha- tubulin gene family is represented in the genome by about eight homologous DNA segments that are exceptionally similar and yet are neither identical nor arrayed in a short tandem repeat. The coding regions of three of these genes have been sequenced, two from cDNA clones and one from an intronless genomic gene. These three genes encode an identical alpha-tubulin that is conserved relative to the alpha-tubulins of other organisms except at the carboxyl terminus, where the protein is elongated by two residues and ends in a terminal glutamine instead of the canonical tyrosine. In spite of the protein conservation, the Naegleria DNA sequence has diverged markedly from the alpha-tubulin genes of other organisms, a counterexample to the idea that tubulin genes are conserved. alpha-Tubulin mRNA homologous to this gene family has not been detected in amebae. This mRNA increases markedly in abundance during the first hour of differentiation, and then decreases even more rapidly with a half-life of approximately 8 min. The abundance of physical alpha-tubulin mRNA rises and subsequently falls in parallel with the abundance of translatable flagellar tubulin mRNA and with the in vivo rate of flagellar tubulin synthesis, which indicates that flagellar tubulin synthesis is directly regulated by the relative rates of transcription and mRNA degradation. PMID:2838492

  3. Thiazolidinediones inhibit REG I{alpha} gene transcription in gastrointestinal cancer cells

    SciTech Connect

    Yamauchi, Akiyo; Takahashi, Iwao; Takasawa, Shin; Nata, Koji; Noguchi, Naoya; Ikeda, Takayuki; Yoshikawa, Takeo; Shervani, Nausheen J.; Suzuki, Iwao; Uruno, Akira; Unno, Michiaki; Okamoto, Hiroshi Sugawara, Akira

    2009-02-13

    REG (Regenerating gene) I{alpha} protein functions as a growth factor for gastrointestinal cancer cells, and its mRNA expression is strongly associated with a poor prognosis in gastrointestinal cancer patients. We here demonstrated that PPAR{gamma}-agonist thiazolidinediones (TZDs) inhibited cell proliferation and REG I{alpha} protein/mRNA expression in gastrointestinal cancer cells. TZDs inhibited the REG I{alpha} gene promoter activity, via its cis-acting element which lacked PPAR response element and could not bind to PPAR{gamma}, in PPAR{gamma}-expressing gastrointestinal cancer cells. The inhibition was reversed by co-treatment with a specific PPAR{gamma}-antagonist GW9662. Although TZDs did not inhibit the REG I{alpha} gene promoter activity in PPAR{gamma}-non-expressing cells, PPAR{gamma} overexpression in the cells recovered their inhibitory effect. Taken together, TZDs inhibit REG I{alpha} gene transcription through a PPAR{gamma}-dependent pathway. The TZD-induced REG I{alpha} mRNA reduction was abolished by cycloheximide, indicating the necessity of novel protein(s) synthesis. TZDs may therefore be a candidate for novel anti-cancer drugs for patients with gastrointestinal cancer expressing both REG I{alpha} and PPAR{gamma}.

  4. Late reperfusion of a totally occluded infarct-related artery increases granulocyte-colony stimulation factor and reduces stroma-derived factor-1alpha blood levels in patients with ongoing ischemia after acute myocardial infarction.

    PubMed

    Kuo, Li-Tang; Chen, Shih-Jen; Cherng, Wen-Jin; Yang, Ning-I; Lee, Chen-Chin; Cheng, Chi-Wen; Verma, Subodh; Wang, Chao-Hung

    2009-07-01

    After acute myocardial infarction (AMI), reopening of a totally occluded infarct-related artery (IRA) at a subacute stage is still controversial in symptom-free patients. However, in patients with persistent ischemic symptoms and inadequate collaterals to the infarct area, recanalization is thought to provide beneficial effects. In addition to augmenting myocardial perfusion, we hypothesized that the benefit of recanalization involves the manipulation of circulating stem cell-mobilizing cytokines. This study included 30 patients with a totally occluded IRA and ongoing ischemic symptoms (the study group) and 30 patients with a partially occluded IRA (the control group). All patients underwent successful angioplasty and/or stenting. Before and immediately after the coronary intervention, blood granulocyte-colony-stimulating factor (G-CSF), stem-cell factor (SCF), vascular endothelial growth factor (VEGF), and stroma-derived factor-1 (SDF-1alpha) were measured. After recanalization, G-CSF levels significantly increased in the study group compared to the control group (P=0.03). SDF-1alpha levels in the study group decreased relative to the controls (P=0.02). However, no significant changes in VEGF or SCF levels between the two groups were found. In the multivariate analysis, reopening of a totally occluded IRA was independently and significantly associated with changes in G-CSF and SDF-1alpha levels after recanalization. In conclusion, our data suggest that the benefits of late reperfusion of a totally occluded IRA in patients with ongoing myocardial ischemia may involve mechanisms associated with stem cell-mobilizing and plaque-stabilizing cytokines. This study provides the rationale to investigate serial changes in cytokines and the numbers of circulating progenitors after reperfusion in the future.

  5. Recombinant AAV-PR39-mediated hypoxia-inducible factor 1α gene expression attenuates myocardial infarction.

    PubMed

    Sun, Lijun; Hao, Yuewen; Nie, Xiaowei; Xu, Jian; Li, Zhenwu; Zhang, Wei; Liu, Ying; Zhang, Xuexin

    2014-01-01

    PR39 is an angiogenic masterswitch protein, belonging to the second generation of angiogenic growth factors. However, the role of recombinant adeno-associated virus (AAV) carrying the PR39 fusion gene (AAV-PR39) in acute myocardial infarction remains unclear. Therefore, in this study, we investigated the role of AAV-PR39 in an experimental animal model of acute myocardial infarction. The PR39 gene was fused with the transmembrane peptide, TAT, 6xHis‑tag and NT4 signal sequences. AAV-PR39 was then obtained by calcium phosphate co-precipitation. A total of 18 healthy Chinese mini pigs were randomly divided into an experimental groups (the AAV-PR39-treated group) and a control group [phosphated-buffered saline (PBS)-treated group]. Following the induction of myocardial infarction, enhanced 3.0T MR imaging was performed to observe the changes in myocardial signal intensity at 0 h, 1, 2 and 3 weeks. The expression of hypoxia-inducible factor‑1α (HIF-1α) in the myocardial tissues was determined by SABC immunohistochemistry. In addition, in vitro experiments using CRL-1730 endothelial cells transfected with AAV vector containing NT4-TAT-His-PR39 revealed that the AAV-PR39-treated group had a significantly higher expression of HIF-1α compared with the control group. Moreover, PR39 regulated the HIF-1α-induced expression of angiogenic growth factors. Under hypoxic conditions, the anti-apoptotic effects in the AAV-PR39 group were more pronounced than those observed in the control (PBS-treated) group. In vivo, the enforced expression of recombinant PR39 elevated the level of HIF-1α under hypoxic conditions and decreased the size of the infarcted areas by upregulating the expression of HIF-1α in the areas surrounding the infarct area. Taken together, our data demonstrate that the recombinant AAV-PR39-mediated HIF-1α expression attenuates myocardial infarction, indicating that AAV-PR39 may serve as a novel therapeutic agent for the treatment of myocardial infarction.

  6. Drift diffusion model of reward and punishment learning in rare alpha-synuclein gene carriers.

    PubMed

    Moustafa, Ahmed A; Kéri, Szabolcs; Polner, Bertalan; White, Corey

    2017-03-20

    To understand the cognitive effects of alpha-synuclein polymorphism, we employed a drift diffusion model (DDM) to analyze reward- and punishment-guided probabilistic learning task data of participants with the rare alpha-synuclein gene duplication and age- and education-matched controls. Overall, the DDM analysis showed that, relative to controls, asymptomatic alpha-synuclein gene duplication carriers had significantly increased learning from negative feedback, while they tended to show impaired learning from positive feedback. No significant differences were found in response caution, response bias, or motor/encoding time. We here discuss the implications of these computational findings to the understanding of the neural mechanism of alpha-synuclein gene duplication.

  7. Human tumor necrosis factor alpha gene regulation by virus and lipopolysaccharide.

    PubMed

    Goldfeld, A E; Doyle, C; Maniatis, T

    1990-12-01

    We have identified a region of the human tumor necrosis factor alpha (TNF-alpha) gene promoter that is necessary for maximal constitutive, virus-induced, and lipopolysaccharide (LPS)-induced transcription. This region contains three sites that match an NF-kappa B binding-site consensus sequence. We show that these three sites specifically bind NF-kappa B in vitro, yet each of these sites can be deleted from the TNF-alpha promoter with little effect on the induction of the gene by virus or LPS. Moreover, when multimers of these three sites are placed upstream from a truncated TNF-alpha promoter, or a heterologous promoter, an increase in the basal level of transcription is observed that is influenced by sequence context and cell type. However, these multimers are not sufficient for virus or LPS induction of either promoter. Thus, unlike other virus- and LPS-inducible promoters that contain NF-kappa B binding sites, these sites from the TNF-alpha promoter are neither required nor sufficient for virus or LPS induction. Comparison of the sequence requirements of virus induction of the human TNF-alpha gene in mouse L929 and P388D1 cells reveals significant differences, indicating that the sequence requirements for virus induction of the gene are cell type-specific. However, the sequences required for virus and LPS induction of the gene in a single cell type, P388D1, overlap.

  8. Phytol directly activates peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) and regulates gene expression involved in lipid metabolism in PPAR{alpha}-expressing HepG2 hepatocytes

    SciTech Connect

    Goto, Tsuyoshi; Takahashi, Nobuyuki; Kato, Sota; Egawa, Kahori; Ebisu, Shogo; Moriyama, Tatsuya; Fushiki, Tohru; Kawada, Teruo . E-mail: fat@kais.kyoto-u.ac.jp

    2005-11-18

    The peroxisome proliferator-activated receptor (PPAR) is one of the indispensable transcription factors for regulating lipid metabolism in various tissues. In our screening for natural compounds that activate PPAR using luciferase assays, a branched-carbon-chain alcohol (a component of chlorophylls), phytol, has been identified as a PPAR{alpha}-specific activator. Phytol induced the increase in PPAR{alpha}-dependent luciferase activity and the degree of in vitro binding of a coactivator, SRC-1, to GST-PPAR{alpha}. Moreover, the addition of phytol upregulated the expression of PPAR{alpha}-target genes at both mRNA and protein levels in PPAR{alpha}-expressing HepG2 hepatocytes. These findings indicate that phytol is functional as a PPAR{alpha} ligand and that it stimulates the expression of PPAR{alpha}-target genes in intact cells. Because PPAR{alpha} activation enhances circulating lipid clearance, phytol may be important in managing abnormalities in lipid metabolism.

  9. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    SciTech Connect

    Altabella, T.; Chrispeels, M.J. )

    1990-06-01

    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  10. Karyopherin alpha2: a control step of glucose-sensitive gene expression in hepatic cells.

    PubMed Central

    Guillemain, Ghislaine; Muñoz-Alonso, Maria J; Cassany, Aurélia; Loizeau, Martine; Faussat, Anne-Marie; Burnol, Anne-Françoise; Leturque, Armelle

    2002-01-01

    Glucose is required for an efficient expression of the glucose transporter GLUT2 and other genes. We have shown previously that the intracytoplasmic loop of GLUT2 can divert a signal, resulting in the stimulation of glucose-sensitive gene transcription. In the present study, by interaction with the GLUT2 loop, we have cloned the rat karyopherin alpha2, a receptor involved in nuclear import. The specificity of the binding was restricted to GLUT2, and not GLUT1 or GLUT4, and to karyopherin alpha2, not alpha1. When rendered irreversible by a cross-linking agent, this transitory interaction was detected in vivo in hepatocytes. A role for karyopherin alpha2 in the transcription of two glucose-sensitive genes was investigated by transfection of native and inactive green fluorescent protein-karyopherin alpha2 in GLUT2-expressing hepatoma cells. The amount of inactive karyopherin alpha2 receptor reduced, in a dose-dependent manner, the GLUT2 and liver pyruvate kinase mRNA levels by competition with endogenous active receptor. In contrast, the overexpression of karyopherin alpha2 did not significantly stimulate GLUT2 and liver pyruvate kinase mRNA accumulation in green fluorescent protein-sorted cells. The present study suggests that, in concert with glucose metabolism, karyopherin alpha2 transmits a signal to the nucleus to regulate glucose-sensitive gene expression. The transitory tethering of karyopherin alpha2 to GLUT2 at the plasma membrane might indicate that the receptor can load the cargo to be imported locally. PMID:11988093

  11. Karyopherin alpha2: a control step of glucose-sensitive gene expression in hepatic cells.

    PubMed

    Guillemain, Ghislaine; Muñoz-Alonso, Maria J; Cassany, Aurélia; Loizeau, Martine; Faussat, Anne-Marie; Burnol, Anne-Françoise; Leturque, Armelle

    2002-05-15

    Glucose is required for an efficient expression of the glucose transporter GLUT2 and other genes. We have shown previously that the intracytoplasmic loop of GLUT2 can divert a signal, resulting in the stimulation of glucose-sensitive gene transcription. In the present study, by interaction with the GLUT2 loop, we have cloned the rat karyopherin alpha2, a receptor involved in nuclear import. The specificity of the binding was restricted to GLUT2, and not GLUT1 or GLUT4, and to karyopherin alpha2, not alpha1. When rendered irreversible by a cross-linking agent, this transitory interaction was detected in vivo in hepatocytes. A role for karyopherin alpha2 in the transcription of two glucose-sensitive genes was investigated by transfection of native and inactive green fluorescent protein-karyopherin alpha2 in GLUT2-expressing hepatoma cells. The amount of inactive karyopherin alpha2 receptor reduced, in a dose-dependent manner, the GLUT2 and liver pyruvate kinase mRNA levels by competition with endogenous active receptor. In contrast, the overexpression of karyopherin alpha2 did not significantly stimulate GLUT2 and liver pyruvate kinase mRNA accumulation in green fluorescent protein-sorted cells. The present study suggests that, in concert with glucose metabolism, karyopherin alpha2 transmits a signal to the nucleus to regulate glucose-sensitive gene expression. The transitory tethering of karyopherin alpha2 to GLUT2 at the plasma membrane might indicate that the receptor can load the cargo to be imported locally.

  12. Identification of a gonad-expression differential gene insulin-like growth factor-1 receptor (Igf1r) in the swamp eel (Monopterus albus).

    PubMed

    Mei, Jie; Yan, Wei; Fang, Jie; Yuan, Gailing; Chen, Nan; He, Yan

    2014-08-01

    In vertebrate species, the biopotential embryonic gonad differentiation is affected by many key genes and key steroidogenic enzymes. Insulin-like growth factor-1 receptor (Igf1r) has been considered as an important sex-differentiation gene in mammals and could mediate the biological action of Igf1, an important regulator of key steroidogenic enzymes. However, Igf1r gene is still unknown in the swamp eel, an economically important fish. In our study, we identified Igf1r gene in the swamp eel, which was a 2,148-bp open-reading frame encoding a protein of 716 amino acids. The alignment and the phylogenetic tree showed that Igf1r of the swamp eel had a conservative sequence with other vertebrates, especial fishes. Western blotting of Igf1r showed that Igf1r expressed much more in ovotestis and testis than in ovary, indicating an important role of Igf1r during gonad differentiation. We analyzed ubiquitination of Igf1r by co-immunoprecipitation and found the amount of ubiquitinated Igf1r was increased from ovary, ovotestis to testis, which was reversely to the trend of Hsp10 expression during gonadal transformation. It was possible that Hsp10 could suppress Igf1r ubiquitination during gonadal development of the swamp eel.

  13. Analysis of the human [alpha]-globin gene cluster in transgenic mice

    SciTech Connect

    Sharpe, J.A.; Vyas, P.; Higgs, D.R.; Wood, W.G. ); Wells, D.J. ); Whitelaw, E. )

    1993-11-15

    A 350-bp segment of DNA associated with an erythroid-specific DNase I-hypersensitive site (HS -40), upstream of the [alpha]-globin gene cluster, has been identified as the major tissue-specific regulator of the [alpha]-globin genes. However, this element does not direct copy number-dependent or developmentally stable expression of the human genes in transgenic mice. To determine whether additional upstream hypersensitive sites could provide more complete regulation of [alpha] gene expression, the authors have studied 17 lines of transgenic mice bearing various DNA fragments containing HSs -33, -10, -8, and -4, in addition to HS -40. Position-independent, high-level expression of the human [zeta]- and [alpha]-globin genes was consistently observed in embryonic erythroid cells. However, the additional HSs did not confer copy-number dependence, alter the level of expression, or prevent the variable down-regulation of expression in adults. These results suggest that the region upstream of the human [alpha]-globin genes is not equivalent to that upstream of the [beta] locus and that although the two clusters are coordinately expressed, there may be differences in their regulation.

  14. Localization of the {alpha}7 integrin gene (ITGA7) on human chromosome 12q13: Clustering of integrin and Hox genes implies parallel evolution of these gene families

    SciTech Connect

    Wang, W.; Wu, W.; Kaufman, S.J.

    1995-04-10

    Expression of the {alpha}7 integrin gene (ITGA7) is developmentally regulated during the formation of skeletal muscle. Increased levels of expression and production of isoforms containing different cytoplasmic and extracellular domains accompany myogenesis. To determine whether a single or multiple {alpha}7 gene(s) underlie the structural diversity in this alpha chain that accompanies development, we have examined the rat and human genomes by Southern blotting and in situ hybridization. Our results demonstrate that there is only one {alpha}7 gene in both the rat and the human genomes. In the human, ITGA7 is present on chromosome 12q13. Phylogenetic analysis of the integrin alpha chain sequences suggests that the early integrin genes evolved in two pathways to form the I-integrins and the non-I-integrins. The I-integrin alpha chains contain an additional sequence of approximately 180 amino acids and arose as a result of an early insertion into the non-I-gene. The I-chain subfamily further evolved by duplications within the same chromosome. The non-I-integrin alpha chain genes are localized in clusters on chromosomes 2, 12, and 17, and this closely coincides with the localization of the human homeobox gene clusters. Non-I-integrin alpha chain genes appear to have evolved in parallel and in proximity to the Hox clusters. Thus, the Hox genes that underlie the design of body structure and the Integrin genes that underlie informed cell-cell and cell-matrix interactions appear to have evolved in parallel and coordinate fashions. 52 refs., 5 figs., 2 tabs.

  15. A binding site for the transcription factor Grainyhead/Nuclear transcription factor-1 contributes to regulation of the Drosophila proliferating cell nuclear antigen gene promoter.

    PubMed

    Hayashi, Y; Yamagishi, M; Nishimoto, Y; Taguchi, O; Matsukage, A; Yamaguchi, M

    1999-12-03

    The Drosophila proliferating cell nuclear antigen promoter contains multiple transcriptional regulatory elements, including upstream regulatory element (URE), DNA replication-related element, E2F recognition sites, and three common regulatory factor for DNA replication and DNA replication-related element-binding factor genes recognition sites. In nuclear extracts of Drosophila embryos, we detected a protein factor, the URE-binding factor (UREF), that recognizes the nucleotide sequence 5'-AAACCAGTTGGCA located within URE. Analyses in Drosophila Kc cells and transgenic flies revealed that the UREF-binding site plays an important role in promoter activity both in cultured cells and in living flies. A yeast one-hybrid screen using URE as a bait allowed isolation of a cDNA encoding a transcription factor, Grainyhead/nuclear transcription factor-1 (GRH/NTF-1). The nucleotide sequence required for binding to GRH was indistinguishable from that for UREF detected in embryo nuclear extracts. Furthermore, a specific antibody to GRH reacted with UREF in embryo nuclear extracts. From these results we conclude that GRH is identical to UREF. Although GRH has been thought to be involved in regulation of differentiation-related genes, this study demonstrates, for the first time, involvement of a GRH-binding site in regulation of the DNA replication-related proliferating cell nuclear antigen gene.

  16. Candidate genes associated with testicular development, sperm quality, and hormone levels of inhibin, luteinizing hormone, and insulin-like growth factor 1 in Brahman bulls.

    PubMed

    Fortes, Marina R S; Reverter, Antonio; Hawken, Rachel J; Bolormaa, Sunduimijid; Lehnert, Sigrid A

    2012-09-01

    Bull fertility is an important target for genetic improvement, and early prediction using genetic markers is therefore a goal for livestock breeding. We performed genome-wide association studies to identify genes associated with fertility traits measured in young bulls. Data from 1118 Brahman bulls were collected for six traits: blood hormone levels of inhibin (IN) at 4 mo, luteinizing hormone (LH) following a gonadotropin-releasing hormone challenge at 4 mo, and insulin-like growth factor 1 (IGF1) at 6 mo, scrotal circumference (SC) at 12 mo, ability to produce sperm (Sperm) at 18 mo, and percentage of normal sperm (PNS) at 24 mo. All the bulls were genotyped with the BovineSNP50 chip. Sires and dams of the bull population (n = 304) were genotyped with the high-density chip (∼800 000 polymorphisms) to allow for imputation, thereby contributing detail on genome regions of interest. Polymorphism associations were discovered for all traits, except for Sperm. Chromosome 2 harbored polymorphisms associated with IN. For LH, associated polymorphisms were located in five different chromosomes. A region of chromosome 14 contained polymorphisms associated with IGF1 and SC. Regions of the X chromosome showed associations with SC and PNS. Associated polymorphisms yielded candidate genes in chromosomes 2, 14, and X. These findings will contribute to the development of genetic markers to help select cattle with improved fertility and will lead to better annotation of gene function in the context of reproductive biology.

  17. Replication of Early B-cell Factor 1 (EBF1) Gene-by-psychosocial Stress Interaction Effects on Central Adiposity in a Korean Population

    PubMed Central

    Min, Jin-Young

    2016-01-01

    Objectives Central obesity plays a major role in the development of many chronic diseases, including cardiovascular disease and cancer. Chronic stress may be involved in the pathophysiology of central obesity. Although several large-scale genome-wide association studies have reported susceptibility genes for central adiposity, the effects of interactions between genes and psychosocial stress on central adiposity have rarely been examined. A recent study focusing on Caucasians discovered the novel gene early B-cell factor 1 (EBF1), which was associated with central obesity-related traits via interactions with stress levels. We aimed to evaluate EBF1 gene-by-stress interaction effects on central adiposity traits, including visceral adipose tissue (VAT), in Korean adults. Methods A total of 1467 Korean adults were included in this study. We selected 22 single-nucleotide polymorphisms (SNPs) in the EBF1 gene and analyzed their interactions with stress on central adiposity using additive, dominant, and recessive genetic modeling. Results The four SNPs that had strong linkage disequilibrium relationships (rs10061900, rs10070743, rs4704967, and rs10056564) demonstrated significant interactions with the waist-hip ratio in the dominant model (pint<0.007). In addition, two other SNPs (rs6556377 and rs13180086) were associated with VAT by interactions with stress levels, especially in the recessive genetic model (pint<0.007). As stress levels increased, the mean values of central adiposity traits according to SNP genotypes exhibited gradual but significant changes (p<0.05). Conclusions These results suggest that the common genetic variants for EBF1 are associated with central adiposity through interactions with stress levels, emphasizing the importance of managing stress in the prevention of central obesity. PMID:27744667

  18. [Cloning and structure of gene encoded alpha-latrocrustoxin from the Black widow spider venom].

    PubMed

    Danilevich, V N; Luk'ianov, S A; Grishin, E V

    1999-07-01

    The primary structure of the crusta gene encoding alpha-latrocrustoxin (alpha-LCT), a high molecular mass neurotoxin specific to crustaceans, was determined in the black widow spider Latrodectus mactans tredicimguttatus genome. The total length of the sequenced DNA was 4693 bp. The structural part of the black widow spider chromosome gene encoding alpha-LCT does not contain introns. The sequenced DNA contains a single extended open reading frame (4185 bp) and encodes a protein precursor of alpha-LCT, comprising 1395 aa. We assume the Met residue at position -10 relative to the N-terminal residue of Glu1 of the mature toxin to be the first one in the protein precursor. The calculated molecular mass of the precursor (156147 Da) exceeds that of the mature toxin by approximately 30 kDa. These data are in agreement with the notion that over the course of maturation the protein precursor undergoes double processing--cleavage of a decapeptide from the N-terminal part and of a approximately 200-aa fragment from the C-terminal part. alpha-LCT displayed a number of imperfect ankyrin-like repeats and areas of structural homology with earlier studied latrotoxins; the highest homology degree (62%) was revealed with alpha-latroinsectotoxin (alpha-LIT).

  19. Estrogen-related receptor {alpha} is essential for the expression of antioxidant protection genes and mitochondrial function

    SciTech Connect

    Rangwala, Shamina M. . E-mail: shamina.rangwala@novartis.com; Li, Xiaoyan; Lindsley, Loren; Wang, Xiaomei; Shaughnessy, Stacey; Daniels, Thomas G.; Szustakowski, Joseph; Nirmala, N.R.; Wu, Zhidan; Stevenson, Susan C.

    2007-05-25

    Estrogen-related receptor {alpha} (ERR{alpha}) is an important mediator of mitochondrial biogenesis and function. To investigate the transcriptional network controlling these phenomena, we investigated mitochondrial gene expression in embryonic fibroblasts isolated from ERR{alpha} null mice. Peroxisome proliferator-activated receptor {gamma} coactivator-1{alpha} (PGC-1{alpha}) stimulated mitochondrial gene expression program in control cells, but not in the ERR{alpha} null cells. Interestingly, the induction of levels of mitochondrial oxidative stress protection genes in response to increased PGC-1{alpha} levels was dependent on ERR{alpha}. Furthermore, we found that the PGC-1{alpha}-mediated induction of estrogen-related receptor {gamma} and nuclear respiratory factor 2 (NRF-2), was dependent on the presence of ERR{alpha}. Basal levels of NRF-2 were decreased in the absence of ERR{alpha}. The absence of ERR{alpha} resulted in a decrease in citrate synthase enzyme activity in response to PGC-1{alpha} overexpression. Our results indicate an essential role for ERR{alpha} as a key regulator of oxidative metabolism.

  20. Chicken alpha-globin switching depends on autonomous silencing of the embryonic pi globin gene by epigenetics mechanisms.

    PubMed

    Rincón-Arano, Héctor; Guerrero, Georgina; Valdes-Quezada, Christian; Recillas-Targa, Félix

    2009-10-15

    Switching in hemoglobin gene expression is an informative paradigm for studying transcriptional regulation. Here we determined the patterns of chicken alpha-globin gene expression during development and erythroid differentiation. Previously published data suggested that the promoter regions of alpha-globin genes contain the complete information for proper developmental regulation. However, our data show a preferential trans-activation of the embryonic alpha-globin gene independent of the developmental or differentiation stage. We also found that DNA methylation and histone deacetylation play key roles in silencing the expression of the embryonic pi gene in definitive erythrocytes. However, drug-mediated reactivation of the embryonic gene during definitive erythropoiesis dramatically impaired the expression of the adult genes, suggesting gene competition or interference for enhancer elements. Our results also support a model in which the lack of open chromatin marks and localized recruitment of chicken MeCP2 contribute to autonomous gene silencing of the embryonic alpha-globin gene in a developmentally specific manner. We propose that epigenetic mechanisms are necessary for in vivo chicken alpha-globin gene switching through differential gene silencing of the embryonic alpha-globin gene in order to allow proper activation of adult alpha-globin genes.

  1. Cyclic AMP-responsive expression of the surfactant protein-A gene is mediated by increased DNA binding and transcriptional activity of thyroid transcription factor-1.

    PubMed

    Li, J; Gao, E; Mendelson, C R

    1998-02-20

    Surfactant protein (SP)-A gene transcription is stimulated by factors that increase cyclic AMP. In the present study, we observed that three thyroid transcription factor-1 (TTF-1) binding elements (TBEs) located within a 255 base pair region flanking the 5'-end of the baboon SP-A2 (bSP-A2) gene are required for maximal cyclic AMP induction of bSP-A2 promoter activity. We found that TTF-1 DNA binding activity was increased in nuclear extracts of pulmonary type II cells cultured in the presence of cyclic AMP. By contrast, the levels of immunoreactive TTF-1 protein were similar in nuclear extracts of control and cyclic AMP-treated type II cells. The incorporation of [32P]orthophosphate into immunoprecipitated TTF-1 protein also was markedly increased by cyclic AMP treatment. Moreover, exposure of nuclear extracts from cyclic AMP-treated type II cells either to potato acid phosphatase or alkaline phosphatase abolished the cyclic AMP-induced increase in TTF-1 DNA-binding activity. Interestingly, the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA), known to activate protein kinase C, also enhanced incorporation of [32P]orthophosphate into TTF-1 protein; however, the DNA binding activity of TTF-1 was decreased in nuclear extracts of TPA-treated type II cells. Expression vectors encoding TTF-1 and the catalytic subunit of protein kinase A (PKA-cat) were cotransfected into A549 lung adenocarcinoma cells together with an SPA:human growth hormone fusion gene (255 base pairs of 5'-flanking DNA from the baboon SP-A2 gene linked to human growth hormone, as reporter) containing TBEs, or with a reporter gene construct containing three tandem TBEs fused upstream of the bSP-A2 gene TATA box and the transcription initiation site. Coexpression of TTF-1 and PKA-cat increased fusion gene expression 3-4-fold as compared with expression of TTF-1 in the absence of PKA-cat. Moreover, the transcriptional activity of TTF-1 was suppressed by cotransfection of a dominant negative form

  2. Sequence heterogeneity, multiplicity, and genomic organization of alpha- and beta-tubulin genes in sea urchins.

    PubMed Central

    Alexandraki, D; Ruderman, J V

    1981-01-01

    We analyzed the multiplicity, heterogeneity, and organization of the genes encoding the alpha and beta tubulins in the sea urchin Lytechinus pictus by using cloned complementary deoxyribonucleic acid (cDNA) and genomic tubulin sequences. cDNA clones were constructed by using immature spermatogenic testis polyadenylic acid-containing ribonucleic acid as a template. alpha- and beta-tubulin clones were identified by hybrid selection and in vitro translation of the corresponding messenger ribonucleic acids, followed by immunoprecipitation and two-dimensional gel electrophoresis of the translation products. The alpha cDNA clone contains a sequence that encodes the 48 C-terminal amino acids of alpha tubulin and 104 base pairs of the 3' nontranslated portion of the messenger ribonucleic acid. The beta cDNA insertion contains the coding sequence for the 100-C terminal amino acids of beta tubulin and 83 pairs of the 3' noncoding sequence. Hybrid selections performed at different criteria demonstrated the presence of several heterogeneous, closely related tubulin messenger ribonucleic acids, suggesting the existence of heterogeneous alpha- and beta-tubulin genes. Hybridization analyses indicated that there are at least 9 to 13 sequences for each of the two tubulin gene families per haploid genome. Hybridization of the cDNA probes to both total genomic DNA and cloned germline DNA fragments gave no evidence for close physical linkage of alpha-tubulin genes with beta-tubulin genes at the DNA level. In contrast, these experiments indicated that some genes within the same family are clustered. Images PMID:6287219

  3. Sequence heterogeneity, multiplicity, and genomic organization of. cap alpha. - and. beta. -tubulin genes in Sea Urchins

    SciTech Connect

    Alexandraki, D.; Ruderman, J.V.

    1981-12-01

    The authors analyzed the multiplicity, heterogeneity, and organization of the genes encoding the ..cap alpha.. and ..beta.. tubulins in the sea urchin Lytechinus pictus by using cloned complementary deoxyribonucleic acid (cDNA) and genomic tubulin sequences. cDNA clones were constructed by using immature spermatogenic testis polyadenylic acid-containing ribonucleic acid as a template. ..cap alpha.. and ..beta..-tubulin clones were identified by hybrid selection and in vitro translation of the corresponding messenger ribonucleic acids, followed by immunoprecipitation and two-dimensional gel electrophoresis of the translation products. The ..cap alpha.. cDNA clone contains a sequence that encodes the 48 C-terminal amino acids of ..cap alpha.. tubulin and 104 base pairs of the 3' nontranslated portion of the messenger ribonucleic acid. The ..beta.. cDNA insertion contains the coding sequence for the 100 C-terminal amino acids of ..beta.. tubulin and 83 base pairs of the 3' noncoding sequence. Hybrid selections performed at different criteria demonstrated the presence of several heterogeneous, closely related tubulin messenger ribonucleic acids, suggesting the existence of heterogeneous ..cap alpha..- and ..beta..-tubulin genes. Hybridization analyses indicated that there are at least 9 to 13 sequences for each of the two tubulin gene families per haploid genome. Hybridization of the cDNA probes to both total genomic DNA and cloned germline DNA fragments gave no evidence for close physical linkage of ..cap alpha..-tubulin genes with ..beta..-tubulin genes at the DNA level. In contrast, these experiments indicated that some genes within the same family are clustered.

  4. TNF-alpha gene polymorphisms in type 1 (insulin-dependent) diabetes mellitus.

    PubMed

    Badenhoop, K; Schwarz, G; Trowsdale, J; Lewis, V; Usadel, K H; Gale, E A; Bottazzo, G F

    1989-07-01

    Type 1 (insulin-dependent) diabetes mellitus, like some other autoimmune diseases, is linked to certain alleles coded by genes in the HLA-D region. Sequence analysis of DQ beta chains indicates that aspartic acid at codon 57 confers resistance to the development of Type 1 diabetes. However, a full explanation for the HLA-association of Type 1 diabetes, particularly the increased susceptibility of DR3/4 heterozygotes is still awaited. The localisation of tumour necrosis factor genes on the short arm of chromosome 6 between HLA-B and the complement genes (Class III) prompted us to investigate a possible polymorphism of TNF-alpha at the genomic level in relation to Type 1 diabetes susceptibility. A dialleleic TNF-alpha restriction fragment length polymorphism was found with Ncol and its segregation with HLA-haplotypes analysed in diabetic families. We describe here a strong linkage of TNF-alpha alleles with certain DR haplotypes. For example, the common extended haplotype HLA A1-B8-DR3 was almost exclusively associated with the 5.5 kb TNF-alpha allele whereas Bw62-DR4 with the 10.5 kb allele. Thus both alleles segregate to diabetic patients. DR matched haplotypes of affected family members differed significantly from those of the non-affected at the TNF alpha locus. All affected sibling pairs in 11 multiplex affected families were identical for TNF-alpha alleles, even if they were only haploidentical for HLA-B-DR haplotypes. In addition, heterozygosity for the TNF-alpha alleles was significantly more frequent in the patients. This tight linkage of TNF-alpha alleles with some extended haplotypes could help to explain the HLA-association of Type 1 diabetes as well as some other autoimmune diseases.

  5. Heterologous expression of the cloned guinea pig alpha 2A, alpha 2B, and alpha 2C adrenoceptor subtypes. Radioligand binding and functional coupling to a CAMP-responsive reporter gene.

    PubMed

    Svensson, S P; Bailey, T J; Porter, A C; Richman, J G; Regan, J W

    1996-02-09

    Functional studies have shown that 6-chloro-9-[(3-methyl-2-butenyl)oxy]-3-methyl-1H-2,3,4,5-tetrahydro-3- benzazepine (SKF 104078) has very low affinity for prejunctional alpha 2-adrenoceptors (alpha 2-AR) in the guinea pig atrium. In this study, we have cloned guinea pig homologues of the human alpha 2-C10, alpha 2-C4 AR subtypes and have studied them in isolation by heterologous expression in cultured mammalian cells. Oligonucleotide primers, designed from conserved areas of the human alpha 2-ARs were used in a polymerase chain reaction (PCR) with template cDNA synthesized from guinea pig atrial mRNA. Three PCR products were obtained that shared identity with the three human alpha 2-AR subtypes. A guinea pig (gp) genomic library was screened with a cDNA clone encoding a portion of the gp-alpha 2A, and genes containing the complete coding sequences of the guinea pig alpha 2A, alpha 2B, and alpha 2C AR subtypes were obtained. These guinea pig genes were subcloned into a eukaryotic expression plasmid and were expressed transiently in COS-7 cells. The binding of the alpha 2-selective antagonist [3H]MK-912 to membranes prepared from these cells was specific and of high affinity with Kd values of 810 pM for gp-alpha 2A, 2700 pM for gp-alpha 2B and 110 pM for gp-alpha 2C. Competition for the binding of [3H]MK-912 by SKF 104078 indicated that it was of moderately high affinity (approximately 100 nM) but that it was not selective for any of the guinea pig alpha 2-AR subtypes. Co-expression of guinea pig alpha 2-AR subtypes with a cyclicAMP-responsive chloramphenicol acetyltransferase (CAT) reporter gene resulted in agonist-dependent modulation of CAT activity. For the gp-alpha 2 A, a biphasic response was obtained with low concentrations of noradrenaline (NE) decreasing forskolin-stimulated CAT activity and high concentrations causing a reversal. For the gp-alpha 2B, NE produced mostly potentiation of forskolin-stimulated activity, and for the gp-alpha 2C, NE caused

  6. Host cell factor-1 recruitment to E2F-bound and cell-cycle-control genes is mediated by THAP11 and ZNF143.

    PubMed

    Parker, J Brandon; Yin, Hanwei; Vinckevicius, Aurimas; Chakravarti, Debabrata

    2014-11-06

    Host cell factor-1 (HCF-1) is a metazoan transcriptional coregulator essential for cell-cycle progression and cell proliferation. Current models suggest a mechanism whereby HCF-1 functions as a direct coregulator of E2F proteins, facilitating the expression of genes necessary for cell proliferation. In this report, we show that HCF-1 recruitment to numerous E2F-bound promoters is mediated by the concerted action of zinc finger transcription factors THAP11 and ZNF143, rather than E2F proteins directly. THAP11, ZNF143, and HCF-1 form a mutually dependent complex on chromatin, which is independent of E2F occupancy. Disruption of the THAP11/ZNF143/HCF-1 complex results in altered expression of cell-cycle control genes and leads to reduced cell proliferation, cell-cycle progression, and cell viability. These data establish a model in which a THAP11/ZNF143/HCF-1 complex is a critical component of the transcriptional regulatory network governing cell proliferation.

  7. Total alpha-globin gene cluster deletion has high frequency in Filipinos

    SciTech Connect

    Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

    1994-09-01

    Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms; {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).

  8. The phylogenetic and evolutionary history of a novel alpha-globin-type gene in orangutans (Pongo pygmaeus).

    PubMed

    Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

    2006-07-01

    The alpha-globin genes are implicated in human resistance to malaria, a disease caused by Plasmodium parasites. This study is the first to analyze DNA sequences from a novel alpha-globin-type gene in orangutans, a species affected by Plasmodium. Phylogenetic methods show that the gene is a duplication of an alpha-globin gene and is located 5' of alpha-2 globin. The alpha-globin-type gene is notable for having four amino acid replacements relative to the orangutan's alpha-1 and alpha-2 globin genes, with no synonymous differences. Pairwise K(a)/K(s) methods and likelihood ratio tests (LRTs) revealed that the evolutionary history of the alpha-globin-type gene has been marked by either neutral or positive evolution, but not purifying selection. A comparative analysis of the amino acid replacements of the alpha-globin-type gene with human hemoglobinopathies and hemoglobin structure showed that two of the four replaced sites are members of the same molecular bond, one that is crucial to the proper functioning of the hemoglobin molecule. This suggested an adaptive evolutionary change. Functionally, this locus may result in a thalassemia-like phenotype in orangutans, possibly as an adaptation to combat Plasmodium.

  9. Adaptive evolution after gene duplication in alpha-KT x 14 subfamily from Buthus martensii Karsch.

    PubMed

    Cao, Zhijian; Mao, Xin; Xu, Xiuling; Sheng, Jiqun; Dai, Chao; Wu, Yingliang; Luo, Feng; Sha, Yonggang; Jiang, Dahe; Li, Wenxin

    2005-07-01

    A series of isoforms of alpha-KT x 14 (short chain potassium channel scorpion toxins) were isolated from the venom of Buthus martensii Karsch by RACE and screening cDNA library methods. These isoforms adding BmKK1--3 and BmSKTx1--2 together shared high homology (more than 97%) with each other. The result of genomic sequence analysis showed that a length 79 bp intron is inserted Ala codes between the first and the second base at the 17th amino acid of signal peptide. The introns of these isoforms also share high homology with those of BmKK2 and BmSKT x 1 reported previously. Sequence analysis of many clones of cDNA and genomic DNA showed that a species population or individual polymorphism of alpha-KT x 14 genes took place in scorpion Buthus martensii Karsch and accelerated evolution played an important role in the forming process of alpha-KT x 14 scorpion toxins subfamily. The result of southern hybridization indicated that alpha-KT x 14 toxin genes existed in scorpion chromosome with multicopies. All findings maybe provided an important evidence for an extensive evolutionary process of the scorpion "pharmacological factory": at the early course of evolution, the ancestor toxic gene duplicated into a series of multicopy genes integrated at the different chromosome; at the late course of evolution, subsequent functional divergence of duplicate genes was generated by mutations, deletions and insertion.

  10. Association Study Between Metabolic Syndrome and rs8066560 Polymorphism in the Promoter Region of Sterol Regulatory Element-binding Transcription Factor 1 Gene in Iranian Children and Adolescents

    PubMed Central

    Miranzadeh-Mahabadi, Hajar; Emadi-Baygi, Modjtaba; Nikpour, Parvaneh; Kelishadi, Roya

    2016-01-01

    Background: Metabolic syndrome (MetS) is a prevalent disorder in pediatric age groups, described by a combination of genetic and environmental factors. Sterol regulatory element-binding transcription factor 1 (SREBF-1) induces the expression of a family of genes involved in fatty acid synthesis. Moreover, dysregulation of miR-33b, which is located within the intron 17 of the SREBF-1 gene, disrupts fatty acid oxidation and insulin signaling, thus leading to MetS. The aim of the present study was to investigate the association between SREBF-1 rs8066560 polymorphism and MetS in Iranian children and adolescents. Methods: This study includes 100 MetS and 100 normal individuals aged 9–19 years. Anthropological and biochemical indexes were measured. The -1099G > A polymorphism was genotyped by TaqMan real-time polymerase chain reaction. Results: Significant differences were observed in anthropometric measurements and lipid profiles between MetS and normal children. There were no differences in the genotype frequencies or allele distribution for -1099G > A polymorphism between MetS and control groups. High-density lipoprotein cholesterol levels were significantly higher in the MetS GG group than in the A allele carrier group. The genotype AA controls had significantly increased cholesterol and low-density lipoprotein cholesterol levels than AG genotypes. By logistic regression using different genetic models, no significant association was observed between SREBF-1 rs8066560 polymorphism and the risk of MetS. Conclusions: We conclude that the -1099G > A variant on SREBF-1 gene associated with serum lipid profiles, however, it may not be a major risk factor for the MetS in Iranian children and adolescents. PMID:27076879

  11. Heterology Expression of the Arabidopsis C-Repeat/Dehydration Response Element Binding Factor 1 Gene Confers Elevated Tolerance to Chilling and Oxidative Stresses in Transgenic Tomato1

    PubMed Central

    Hsieh, Tsai-Hung; Lee, Jent-Turn; Yang, Pei-Tzu; Chiu, Li-Hui; Charng, Yee-yung; Wang, Yu-Chie; Chan, Ming-Tsair

    2002-01-01

    In an attempt to improve stress tolerance of tomato (Lycopersicon esculentum) plants, an expression vector containing an Arabidopsis C-repeat/dehydration responsive element binding factor 1 (CBF1) cDNA driven by a cauliflower mosaic virus 35S promoter was transferred into tomato plants. Transgenic expression of CBF1 was proved by northern- and western-blot analyses. The degree of chilling tolerance of transgenic T1 and T2 plants was found to be significantly greater than that of wild-type tomato plants as measured by survival rate, chlorophyll fluorescence value, and radical elongation. The transgenic tomato plants exhibited patterns of growth retardation; however, they resumed normal growth after GA3 (gibberellic acid) treatment. More importantly, GA3-treated transgenic plants still exhibited a greater degree of chilling tolerance compared with wild-type plants. Subtractive hybridization was performed to isolate the responsive genes of heterologous Arabidopsis CBF1 in transgenic tomato plants. CATALASE1 (CAT1) was obtained and showed activation in transgenic tomato plants. The CAT1 gene and catalase activity were also highly induced in the transgenic tomato plants. The level of H2O2 in the transgenic plants was lower than that in the wild-type plants under either normal or cold conditions. The transgenic plants also exhibited considerable tolerance against oxidative damage induced by methyl viologen. Results from the current study suggest that heterologous CBF1 expression in transgenic tomato plants may induce several oxidative-stress responsive genes to protect from chilling stress. PMID:12114563

  12. Complete structure and expression of the rat alpha B-crystallin gene.

    PubMed

    Srinivasan, A N; Bhat, S P

    1994-06-01

    alpha B-Crystallin, a member of the small heat shock family of proteins, is synthesized as a component of various developmental programs, in response to stress and in a number of pathological states. We have determined the complete structure of the alpha B-crystallin gene (6,806 bp encompassing 2,299 bp upstream from ATG and 859 bp at the 3' end, past the first polyadenylation signal). Comparison of the rat and the human alpha B-crystallin genes reveals significant conservation of the nucleotide sequences in almost all regions except in intron 2. The 1-kb region immediately upstream of ATG shows about 75% overall homology. A 78-bp sequence in the intron 1 and sequences in the 3' untranslated region show about 95% and 85% sequence identity, respectively. Characterization of the expression of this gene in different tissues in the rat by extensive analyses, utilizing primer extension. RNase protection, and rapid amplification of cDNA ends (RACE) revealed a predominant transcription initiation site 44 bp upstream of ATG. Northern analyses with "coding-only" and upstream "noncoding" probes did not support the thesis that heterogeneity in the alpha B-crystallin mRNAs arises from variations in the sequences immediately upstream of the predominant transcription initiation site. Importantly, the known relative levels of alpha B-crystallin protein in different tissues correlate best with the presence of transcripts starting from this initiation site.

  13. MHC evolution in three salmonid species: a comparison between class II alpha and beta genes.

    PubMed

    Gómez, Daniela; Conejeros, Pablo; Marshall, Sergio H; Consuegra, Sofia

    2010-08-01

    The genes of the major histocompatibility complex (MHC) are amongst the most variable in vertebrates and represent some of the best candidates to study processes of adaptive evolution. However, despite the number of studies available, most of the information on the structure and function of these genes come from studies in mammals and birds in which the MHC class I and II genes are tightly linked and class II alpha exhibits low variability in many cases. Teleost fishes are among the most primitive vertebrates with MHC and represent good organisms for the study of MHC evolution because their class I and class II loci are not physically linked, allowing for independent evolution of both classes of genes. We have compared the diversity and molecular mechanisms of evolution of classical MH class II alpha and class II beta loci in farm populations of three salmonid species: Oncorhynchus kisutch, Oncorhynchus mykiss and Salmo salar. We found single classical class II loci and high polymorphism at both class II alpha and beta genes in the three species. Mechanisms of evolution were common for both class II genes, with recombination and point mutation involved in generating diversity and positive selection acting on the peptide-binding residues. These results suggest that the maintenance of variability at the class IIalpha gene could be a mechanism to increase diversity in the MHC class II in salmonids in order to compensate for the expression of one single classical locus and to respond to a wider array of parasites.

  14. Chromosomal localization of the human genes for {alpha}{sub 1A}, {alpha}{sub 1B}, and {alpha}{sub 1E} voltage-dependent Ca{sup 2+} channel subunits

    SciTech Connect

    Diriong, S.; Lory, P.; Taviaux, S.

    1995-12-10

    The {alpha}{sub 1} subunit genes encoding voltage-dependent Ca{sup 2+} channels are members of a gene family. We have used human brain cDNA probes to localize the neuronal isoform genes CACNL1A4 ({alpha}{sub 1A}), CACNL1A5 ({alpha}{sub 1B}), and CACNL1A6 ({alpha}{sub 1E}) to 19p13, 9q34, and 1q25-q31, respectively, using fluorescene in situ hybridization on human chromosomes. These genes are particularly interesting gene candidates in the pathogenesis of neuronal disorders. Although genetic disorders have been linked to loci 9q34 and 19p13, no genetic disease related to Ca{sup 2+} signaling defects has yet been linked to these loci. 22 refs., 2 figs., 1 tab.

  15. Increased levels of insulin and insulin-like growth factor-1 hybrid receptors and decreased glycosylation of the insulin receptor alpha- and beta-subunits in scrapie-infected neuroblastoma N2a cells.

    PubMed

    Nielsen, Daniel; Gyllberg, Hanna; Ostlund, Pernilla; Bergman, Tomas; Bedecs, Katarina

    2004-06-01

    We have previously shown that ScN2a cells (scrapie-infected neuroblastoma N2a cells) express 2-fold- and 4-fold-increased levels of IR (insulin receptor) and IGF-1R (insulin-like growth factor-1 receptor) respectively. In addition, the IR alpha- and beta-subunits are aberrantly processed, with apparent molecular masses of 128 and 85 kDa respectively, as compared with 136 and 95 kDa in uninfected N2a cells. Despite the 2-fold increase in IR protein, the number of (125)I-insulin-binding sites was slightly decreased in ScN2a cells [Ostlund, Lindegren, Pettersson and Bedecs (2001) Brain Res. 97, 161-170]. In order to determine the cellular localization of IR in ScN2a cells, surface biotinylation was performed, showing a correct IR trafficking and localization to the cell surface. The present study shows for the first time that neuroblastoma N2a cells express significant levels of IR-IGF-1R hybrid receptors, and in ScN2a cells the number of hybrid receptors was 2-fold higher than that found in N2a cells, potentially explaining the apparent loss of insulin-binding sites due to a lower affinity for insulin compared with the homotypic IR. Furthermore, the decreased molecular mass of IR subunits in ScN2a cells is not caused by altered phosphorylation or proteolytic processing, but rather by altered glycosylation. Enzymic deglycosylation of immunoprecipitated IR from N2a and ScN2a cells with endoglycosidase H, peptide N-glycosidase F and neuraminidase all resulted in subunits with increased electrophoretic mobility; however, the 8-10 kDa shift remained. Combined enzymic or chemical deglycosylation using anhydrous trifluoromethane sulphonic acid treatment ultimately showed that the IR alpha- and beta-subunits from ScN2a cells are aberrantly glycosylated. The increased formation of IR-IGF-1R hybrids in ScN2a cells may be part of a neuroprotective response to prion infection. The degree and functional significance of aberrantly glycosylated proteins in ScN2a cells remain to be

  16. The PPAR alpha gene is associated with triglyceride, low-density cholesterol and inflammation marker response to fenofibrate intervention: the GOLDN study

    Technology Transfer Automated Retrieval System (TEKTRAN)

    As a peroxisome proliferator-activated receptor alpha (PPAR Alpha) agonist, fenofibrate favorably modulates dyslipidemia and inflammation markers, which are associated with cardiovascular risk. To determine whether variation in the PPAR Alpha receptor gene was associated with lipid and inflammatory ...

  17. Increase in gene dosage is a mechanism of HIF-1alpha constitutive expression in head and neck squamous cell carcinomas.

    PubMed

    Secades, Pablo; Rodrigo, Juan Pablo; Hermsen, Mario; Alvarez, Cesar; Suarez, Carlos; Chiara, María-Dolores

    2009-05-01

    The HIF-1alpha protein plays a key role in the cellular response to hypoxia via transcriptional regulation of genes involved in erythropoiesis, angiogenesis, and metabolism. Overexpression of HIF-1alpha is commonly found in solid tumors in significant association with increased patient mortality and resistance to therapy. The predominant mode of HIF-1alpha regulation by hypoxia occurs at the level of protein stability. In addition to hypoxia, HIF-1alpha protein stability and synthesis is regulated by nonhypoxic signals such as inactivation of tumor suppressors and activation of oncogenes. Here, we show that an increase in gene dosage may contribute to HIF-1alpha mRNA and protein overexpression in a nonhypoxic environment in head and neck squamous cell carcinomas (HNSCC). Increased HIF-1alpha gene dosage was found in one out of five HNSCC-derived cell lines and three out of 27 HNSCC primary tumors. Significantly, increased gene dosage in those samples was associated with high HIF-1alpha mRNA and protein levels. Normoxic overexpression of HIF-1alpha protein in HNSCC-derived cell lines was also paralleled by higher expression levels of HIF-1alpha target genes. Array CGH analysis confirmed the copy number increase of HIF-1alpha gene and revealed that the gene is contained within a region of amplification at 14q23-q24.2 both in the cell line and primary tumors. In addition, FISH analysis revealed the presence of 11-13 copies on a tetraploid background in SCC2 cells. These data suggest that increased HIF-1alpha gene dosage is a mechanism of HIF-1alpha protein overexpression in HNSCC that possibly prepares the cells for a higher activity in an intratumoral hypoxic environment.

  18. Estrogen-related receptor alpha modulates the expression of adipogenesis-related genes during adipocyte differentiation.

    PubMed

    Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko; Yagi, Ken; Okazaki, Yasushi; Inoue, Satoshi

    2007-07-06

    Estrogen-related receptor alpha (ERRalpha) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERRalpha in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERRalpha and ERRalpha-related transcriptional coactivators, peroxisome proliferator-activated receptor gamma (PPARgamma) coactivator-1alpha (PGC-1alpha) and PGC-1beta, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERRalpha-specific siRNA results in mRNA down-regulation of fatty acid binding protein 4, PPARgamma, and PGC-1alpha in 3T3-L1 cells in the adipogenesis medium. ERRalpha and PGC-1beta mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERRalpha in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERRalpha may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.

  19. Developmental study of the distribution of hypoxia-induced factor-1 alpha and microtubule-associated protein 2 in children's brainstem: comparison between controls and cases with signs of perinatal hypoxia.

    PubMed

    Coveñas, R; González-Fuentes, J; Rivas-Infante, E; Lagartos-Donate, M J; Cebada-Sánchez, S; Arroyo-Jiménez, M M; Insausti, R; Marcos, P

    2014-06-20

    Perinatal asphyxia and hypoxia are common causes of morbidity in neonates. Prenatal birth associated with hypoxemia often results in several disorders because of the lack of oxygen in the brain. Survival rates from perinatal hypoxia have improved, but appropriate treatments for recovery are still limited, with great impact on patients, their families, society in general and health systems. The aim of this work is to contribute to a better understanding of the cellular mechanisms underlying the brainstem responses to hypoxia. For this purpose, distributions of two proteins, hypoxia-inducible factor-1 alpha (HIF-1α) and microtubule-associated protein 2 (MAP-2) were analyzed in brainstems of 11 children, four of them showing neuropathological evidence of brain hypoxia. They were included in control or hypoxic groups, and then in several subgroups according to their age. Immunohistochemical labeling for these proteins revealed only cell bodies containing HIF-1α, and both cell bodies and fibers positive for MAP-2 in the children's brainstems. The distribution of HIF-1α was more restricted than that of MAP-2, and it can be suggested that the expression of HIF-1α increased with age. The distribution pattern of MAP-2 in the medulla oblongata could be more due to age-related changes than to a response to hypoxic damage, whereas in the pons several regions, such as the nucleus ambiguus or the solitary nucleus, showed different immunolabeling patterns in controls and hypoxic cases. The distribution patterns of these two proteins suggest that some brainstem regions, such as the reticular formation or the central gray, could be less affected by conditions of hypoxia.

  20. 3 alpha-hydroxysteroid dehydrogenase: three dimensional structure and gene regulation.

    PubMed

    Penning, T M

    1996-09-01

    Mammalian 3 alpha-hydroxysteroid dehydrogenases (3 alpha-HSDs) regulate steroid hormone levels. cDNA cloning indicates that the rat and human liver isoforms display high sequence identity and that they belong to the aldo-keto reductase (AKR) superfamily. Of these the most extensively characterized is rat liver 3 alpha-HSD. The recently solved X-ray crystal structure shows that this enzyme adopts an (alpha/beta)8-barrel scaffold (Hoog et al. 1994). NAD(P)H binds in an extended anti-conformation and lies along the inner surface of the barrel. The nicotinamide ring is stabilized by interaction with Y216. The 4-pro(R)-hydrogen transferred in the reaction is in close proximity to Y55. K84, D50 and H117 which are implicated in catalysis. These residues are located at the base of a hydrophobic pocket which is presumed to be involved in binding steroid hormone. This catalytic tetrad is conserved in members of the AKR superfamily. Mutant enzymes support roles for Y55 in steroid binding and for K84 as the general acid involved in catalysis. The gene for rat 3 alpha-HSD has been cloned and is 47 kb in length and contains 9 exon-intron boundaries which are highly conserved in the human gene(s). The 5'-flanking regions of the rat and human genes contain consensus sequences for AP-1, Oct-1 and multiple copies of perfect and imperfect steroid hormone response elements (REs) (estrogen, glucocorticoid (GRE), and progesterone) which may comprise a steroid response unit (SRU) (Lin & Penning 1995). Constitutive and regulated expression of the rat 3 alpha-HSD gene has been studied by transiently transfecting reporter gene (chloramphenicol acetyltransferase, CAT) constructs into human hepatoma (HepG2) cells. With respect to the transcription start-site (+1), a proximal (-498 to -199bp) and distal (-20 to -4.0kb) enhancer, as well as a powerful silencer (-755 to -498 bp) were located in the promoter. Band-shift and supershift assays provide evidence that Oct-1 binds to the silencer

  1. Molecular cloning, pathologically-correlated expression and functional characterization of the colonystimulating factor 1 receptor (CSF-1R) gene from a teleost, Plecoglossus altivelis

    PubMed Central

    CHEN, Qiang; LU, Xin-Jiang; LI, Ming-Yun; CHEN, Jiong

    2016-01-01

    Colony-stimulating factor 1 receptor (CSF-1R) is an important regulator of monocytes/macrophages (MO/MΦ). Although several CSF-1R genes have been identified in teleosts, the precise role of CSF- 1R in ayu (Plecoglossus altivelis) remains unclear. In this study, we characterized the CSF-1R homologue from P. altivelis, and named it PaCSF-1R. Multiple sequence alignment and phylogenetic tree analysis showed that PaCSF-1R was most closely related to that of Japanese ricefish (Oryzias latipes). Tissue distribution and expression analysis showed that the PaCSF-1R transcript was mainly expressed in the head kidney-derived MO/MΦ, spleen, and head kidney, and its expression was significantly altered in various tissues upon Vibrio anguillarum infection. After PaCSF-1R neutralization for 48 h, the phagocytic activity of MO/MΦ was significantly decreased, suggesting that PaCSF-1R plays a role in regulating the phagocytic function of ayu MO/MΦ. PMID:27029867

  2. Evolution, organization, and expression of alpha-tubulin genes in the antarctic fish Notothenia coriiceps. Adaptive expansion of a gene family by recent gene duplication, inversion, and divergence.

    PubMed

    Parker, S K; Detrich, H W

    1998-12-18

    To assess the organization and expression of tubulin genes in ectothermic vertebrates, we have chosen the Antarctic yellowbelly rockcod, Notothenia coriiceps, as a model system. The genome of N. coriiceps contains approximately 15 distinct DNA fragments complementary to alpha-tubulin cDNA probes, which suggests that the alpha-tubulins of this cold-adapted fish are encoded by a substantial multigene family. From an N. coriiceps testicular DNA library, we isolated a 13.8-kilobase pair genomic clone that contains a tightly linked cluster of three alpha-tubulin genes, designated NcGTbalphaa, NcGTbalphab, and NcGTbalphac. Two of these genes, NcGTbalphaa and NcGTbalphab, are linked in head-to-head (5' to 5') orientation with approximately 500 bp separating their start codons, whereas NcGTbalphaa and NcGTbalphac are linked tail-to-tail (3' to 3') with approximately 2.5 kilobase pairs between their stop codons. The exons, introns, and untranslated regions of the three alpha-tubulin genes are strikingly similar in sequence, and the intergenic region between the alphaa and alphab genes is significantly palindromic. Thus, this cluster probably evolved by duplication, inversion, and divergence of a common ancestral alpha-tubulin gene. Expression of the NcGTbalphac gene is cosmopolitan, with its mRNA most abundant in hematopoietic, neural, and testicular tissues, whereas NcGTbalphaa and NcGTbalphab transcripts accumulate primarily in brain. The differential expression of the three genes is consistent with distinct suites of putative promoter and enhancer elements. We propose that cold adaptation of the microtubule system of Antarctic fishes is based in part on expansion of the alpha- and beta-tubulin gene families to ensure efficient synthesis of tubulin polypeptides.

  3. A polymorphism in the insulin-like growth factor 1 gene is associated with postpartum resumption of ovarian cyclicity in Holstein-Friesian cows under grazing conditions

    PubMed Central

    2013-01-01

    Background Insulin-like growth factor 1 (IGF-1) gene is considered as a promising candidate for the identification of polymorphisms affecting cattle performance. The objectives of the current study were to determine the association of the single nucleotide polymorphism (SNP) IGF-1/SnaBI with fertility, milk production and body condition traits in Holstein-Friesian dairy cows under grazing conditions. Methods Seventy multiparous cows from a commercial herd were genotyped for the SNP IGF-1/SnaBI. Fertility measures evaluated were: interval to commencement of luteal activity (CLA), calving to first service (CFS) and calving to conception (CC) intervals. Milk production and body condition score were also evaluated. The study period extended from 3 wk before calving to the fourth month of lactation. Results and discussion Frequencies of the SNP IGF-1/SnaBI alleles A and B were 0.59 and 0.41, respectively. Genotype frequencies were 0.31, 0.54 and 0.14 for AA, AB and BB, respectively. Cows with the AA genotype presented an early CLA and were more likely to resume ovarian cyclicity in the early postpartum than AB and BB ones. No effect of the SNP IGF-1/SnaBI genotype was evidenced on body condition change over the experimental period, suggesting that energy balance is not responsible for the outcome of postpartum ovarian resumption in this study. Traditional fertility measures were not affected by the SNP IGF-1/SnaBI. Conclusion To our knowledge this is the first report describing an association of the SNP IGF-1/SnaBI with an endocrine fertility measure like CLA in cattle. Results herein remark the important role of the IGF-1gene in the fertility of dairy cows on early lactation and make the SNP IGF-1/SnaBI an interesting candidate marker for genetic improvement of fertility in dairy cattle. PMID:23409757

  4. Hepatocyte nuclear factor 1 regulates the expression of the organic cation transporter 1 via binding to an evolutionary conserved region in intron 1 of the OCT1 gene.

    PubMed

    O'Brien, Valerie P; Bokelmann, Kristin; Ramírez, Jacqueline; Jobst, Karoline; Ratain, Mark J; Brockmöller, Jürgen; Tzvetkov, Mladen V

    2013-10-01

    The organic cation transporter 1 (OCT1), also known as solute carrier family 22 member 1, is strongly and specifically expressed in the human liver. Here we show that the hepatocyte nuclear factor 1 (HNF1) regulates OCT1 transcription and contributes to the strong, liver-specific expression of OCT1. Bioinformatic analyses revealed strong conservation of HNF1 binding motifs in an evolutionary conserved region (ECR) in intron 1 of the OCT1 gene. Electrophoretic mobility shift and chromatin immunoprecipitation assays confirmed the specific binding of HNF1 to the intron 1 ECR. In reporter gene assays performed in HepG2 cells, the intron 1 ECR increased SV40 promoter activity by 22-fold and OCT1 promoter activity by 13-fold. The increase was reversed when the HNF1 binding sites in the intron 1 ECR were mutated or the endogenous HNF1α expression was downregulated with small interfering RNA. Following HNF1α overexpression in Huh7 cells, the intron 1 ECR increased SV40 promoter activity by 11-fold and OCT1 promoter activity by 6-fold. Without HNF1α overexpression, the increases were only 3- and 2-fold, respectively. Finally, in human liver samples, high HNF1 expression was significantly correlated with high OCT1 expression (r = 0.48, P = 0.002, n = 40). In conclusion, HNF1 is a strong regulator of OCT1 expression. It remains to be determined whether genetic variants, disease conditions, or drugs that affect HNF1 activity may affect the pharmacokinetics and efficacy of OCT1-transported drugs such as morphine, tropisetron, ondansetron, tramadol, and metformin. Beyond OCT1, this study demonstrates the validity and usefulness of interspecies comparisons in the discovery of functionally relevant genomic sequences.

  5. Association between Insulin-Like Growth Factor 1 Gene rs12423791 or rs6214 Polymorphisms and High Myopia: A Meta-Analysis

    PubMed Central

    Guo, Lan; Du, Xueying; Lu, Ciyong; Zhang, Wei-Hong

    2015-01-01

    Objective To evaluate the association of insulin-like growth factor 1 gene rs12423791 and rs6214 polymorphisms with high myopia. Methods An electronic search was conducted on PubMed, Embase, the Cochrane Library and the Chinese Biological Abstract Database for articles published prior to May 6, 2014. A meta-analysis was performed using Revman 5.1 and Stata 12.0, and the odds ratios with 95% confidence intervals were calculated in fixed or random effects models based on the results of the Q test. The subgroup analysis was conducted on the basis of the various regions, the sensitivity analysis was also performed to evaluate the stability of the results, and the publication bias was evaluated by a funnel plot and Egger’s linear regression analysis. Results This comprehensive meta-analysis included 2808 high myopia patients and 2778 controls from five unrelated studies. The results demonstrated that the significant association was not present in any genetic models between IGF-1 rs12423791 or rs6214 and high myopia. However, subgroup analysis indicated that rs12423791 polymorphism was associated with high myopia in the Chinese populations in the allelic contrast model (C vs. G: OR=1.24, 95% CI=1.04-1.48 in the fixed-effects model), the dominant model (CC+CG vs. GG: OR=1.40, 95% CI=1.16-1.69 in the fixed-effects model), and the codominant model (CG vs. GG: OR=1.37, 95% CI= 1.12-1.68 in the fixed-effects model). Additionally, none of the individual studies significantly affected the association between IGF-1 rs12423791 and high myopia, according to sensitivity analysis. Conclusion This meta-analysis shows that IGF-1 rs12423791 or rs6214 gene polymorphism is not associated with high myopia. PMID:26076017

  6. Kidney development and gene expression in the HIF2alpha knockout mouse.

    PubMed

    Steenhard, Brooke M; Freeburg, Paul B; Isom, Kathryn; Stroganova, Larysa; Borza, Dorin-Bogdan; Hudson, Billy G; St John, Patricia L; Zelenchuk, Adrian; Abrahamson, Dale R

    2007-04-01

    The hypoxia-inducible transcription factor-2 (HIF2), a heterodimer composed of HIF2alpha and HIF1beta subunits, drives expression of genes essential for vascularization, including vascular endothelial growth factor (VEGF) and VEGF receptor-2 (VEGFR-2, Flk-1). Here, we used a HIF2alpha/LacZ transgenic mouse to define patterns of HIF2alpha transcription during kidney development and maturation. Our results from embryonic heterozygotes showed HIF2alpha/LacZ expression by apparently all renal endothelial cells. At 4 weeks of age, glomerular mesangial and vascular smooth muscle cells were also positive together with endothelial cells. These expression patterns were confirmed by electron microscopy using Bluo-gal as a beta-galactosidase substrate. Small numbers of glomerular and tubular epithelial cells were also positive at all stages examined. Light and electron microscopic examination of kidneys from HIF2alpha null embryos showed no defects in renal vascular development or nephrogenesis. Similarly, the same amounts of Flk-1 protein were seen on Western blots of kidney extracts from homozygous and heterozygous HIF2alpha mutants. To examine responsiveness of HIF2alpha null kidneys to hypoxia, embryonic day 13.5 metanephroi were cultured in room air or in mild (5% O(2)) hypoxia. For both heterozygous and null samples, VEGF mRNA levels doubled when metanephroi were cultured in mild hypoxia. Anterior chamber grafts of embryonic HIF2alpha knockouts were morphologically indistinguishable from heterozygous grafts. Endothelial markers, platelet endothelial cell adhesion molecule and BsLB4, as well as glomerular epithelial markers, GLEPP1 and WT-1, were all expressed appropriately. Finally, we undertook quantitative real-time polymerase chain reaction of kidneys from HIF2alpha null embryos and wild-type siblings and found no compensatory up-regulation of HIF1alpha or -3alpha. Our results show that, although HIF2alpha was widely transcribed by kidney endothelium and vascular

  7. Gallus gallus orthologous to human alpha-dystroglycanopathies candidate genes: Gene expression and characterization during chicken embryogenesis.

    PubMed

    Izquierdo-Lahuerta, Adriana; de Luis, Oscar; Gómez-Esquer, Francisco; Cruces, Jesús; Coloma, Antonio

    2016-09-23

    Alpha-dystroglycanopathies are a heterogenic group of human rare diseases that have in common defects of α-dystroglycan O-glycosylation. These congenital disorders share common features as muscular dystrophy, malformations on central nervous system and more rarely altered ocular development, as well as mutations on a set of candidate genes involved on those syndromes. Severity of the syndromes is variable, appearing Walker-Warburg as the most severe where mutations at protein O-mannosyl transferases POMT1 and POMT2 genes are frequently described. When studying the lack of MmPomt1 in mouse embryonic development, as a murine model of Walker-Warburg syndrome, MmPomt1 null phenotype was lethal because Reitchert's membrane fails during embryonic development. Here, we report gene expression from Gallus gallus orthologous genes to human candidates on alpha-dystroglycanopathies POMT1, POMT2, POMGnT1, FKTN, FKRP and LARGE, making special emphasis in expression and localization of GgPomt1. Results obtained by quantitative RT-PCR, western-blot and immunochemistry revealed close gene expression patterns among human and chicken at key tissues affected during development when suffering an alpha-dystroglycanopathy, leading us to stand chicken as a useful animal model for molecular characterization of glycosyltransferases involved in the O-glycosylation of α-Dystroglycan and its role in embryonic development.

  8. The impact of interferon-alpha2 on HLA genes in patients with polycythemia vera and related neoplasms.

    PubMed

    Skov, Vibe; Riley, Caroline Hasselbalch; Thomassen, Mads; Kjær, Lasse; Stauffer Larsen, Thomas; Bjerrum, Ole Weis; Kruse, Torben A; Hasselbalch, Hans Carl

    2017-08-01

    Gene expression profiling in Philadelphia-negative chronic myeloproliferative neoplasms (MPNs) have unraveled significant deregulation of several immune and inflammation genes of potential importance for clonal evolution. Other mechanisms might be downregulation of major histocompatibility class I and II genes used by tumor cells to escape antitumor T-cell-mediated immune responses. Several genes encoding human leukocyte antigen (HLA) class I and II molecules have been shown to be significantly downregulated. Upregulation of HLA genes is considered one of the mechanisms of action of interferon (IFN)-alpha2, but regulation of these genes during IFN-alpha2 treatment in MPNs has never been studied. Our findings show a significant upregulation of several HLA genes of importance for tumor immune surveillance by IFN-alpha2 treatment in MPNs. This mechanism might enhance the cytotoxic potential of immune cells against MPNs and explain the induction of minimal residual disease by IFN-alpha2 treatment in these patients.

  9. Nucleotide sequence and expression of the Enterobacter aerogenes alpha-acetolactate decarboxylase gene in brewer's yeast.

    PubMed Central

    Sone, H; Fujii, T; Kondo, K; Shimizu, F; Tanaka, J; Inoue, T

    1988-01-01

    The nucleotide sequence of a 1.4-kilobase DNA fragment containing the alpha-acetolactate decarboxylase gene of Enterobacter aerogenes was determined. The sequence contains an entire protein-coding region of 780 nucleotides which encodes an alpha-acetolactate decarboxylase of 260 amino acids. The DNA sequence coding for alpha-acetolactate decarboxylase was placed under the control of the alcohol dehydrogenase I promoter of the yeast Saccharomyces cerevisiae in a plasmid capable of autonomous replication in both S. cerevisiae and Escherichia coli. Brewer's yeast cells transformed by this plasmid showed alpha-acetolactate decarboxylase activity and were used in laboratory-scale fermentation experiments. These experiments revealed that the diacetyl concentration in wort fermented by the plasmid-containing yeast strain was significantly lower than that in wort fermented by the parental strain. These results indicated that the alpha-acetolactate decarboxylase activity produced by brewer's yeast cells degraded alpha-acetolactate and that this degradation caused a decrease in diacetyl production. PMID:3278689

  10. Twenty novel mutations in the alpha-galactosidase A gene causing Fabry disease.

    PubMed Central

    Topaloglu, A. K.; Ashley, G. A.; Tong, B.; Shabbeer, J.; Astrin, K. H.; Eng, C. M.; Desnick, R. J.

    1999-01-01

    BACKGROUND: Fabry disease, an X-linked inborn error of glycosphingolipid catabolism, results from the deficient activity of the lysosomal exoglycohydrolase alpha-galactosidase A (EC 3.2.1.22; alpha-Gal A). The nature of the molecular lesions in the alpha-Gal A gene in 30 unrelated families was determined to provide precise heterozygote detection, prenatal diagnosis, and define genotype-phenotype correlations. MATERIALS AND METHODS: Genomic DNA was isolated from affected males and/or carrier females from 30 unrelated families with Fabry disease. The entire alpha-Gal A coding region and flanking intronic sequences were analyzed by PCR amplification and automated sequencing. RESULTS: Twenty new mutations were identified, each in a single family: C142R, G183D, S235C, W236L, D244H, P259L, M267I, I289F, Q321E, C378Y, C52X, W277X, IVS4(+4), IVS6(+2), IVS6(-1), 35del13, 256del1, 892ins1, 1176del4, and 1188del1. In the remaining 10 unrelated Fabry families, 9 previously reported mutations were detected: M42V, R112C, S148R, D165V, N215S (in 2 families), Q99X, C142X, R227X, and 1072del3. Haplotype analysis using markers closely flanking the alpha-Gal A gene indicated that the two patients with the N215S lesion were unrelated. The IVS4(+4) mutation was a rare intronic splice site mutation that causes Fabry disease. CONCLUSIONS: These studies further define the heterogeneity of mutations in the alpha-Gal A gene causing Fabry disease, permit precise heterozygote detection and prenatal diagnosis, and help delineate phenotype-genotype correlations in this disease.

  11. Role of oxidants in NF-kappa B activation and TNF-alpha gene transcription induced by hypoxia and endotoxin.

    PubMed

    Chandel, N S; Trzyna, W C; McClintock, D S; Schumacker, P T

    2000-07-15

    The transcription factor NF-kappa B stimulates the transcription of proinflammatory cytokines including TNF-alpha. LPS (endotoxin) and hypoxia both induce NF-kappa B activation and TNF-alpha gene transcription. Furthermore, hypoxia augments LPS induction of TNF-alpha mRNA. Previous reports have indicated that antioxidants abolish NF-kappa B activation in response to LPS or hypoxia, which suggests that reactive oxygen species (ROS) are involved in NF-kappa B activation. This study tested whether mitochondrial ROS are required for both NF-kappaB activation and the increase in TNF-alpha mRNA levels during hypoxia and LPS. Our results indicate that hypoxia (1.5% O2) stimulates NF-kappa B and TNF-alpha gene transcription and increases ROS generation as measured by the oxidant sensitive dye 2',7'-dichlorofluorescein diacetate in murine macrophage J774.1 cells. The antioxidants N-acetylcysteine and pyrrolidinedithiocarbamic acid abolished the hypoxic activation of NF-kappa B, TNF-alpha gene transcription, and increases in ROS levels. Rotenone, an inhibitor of mitochondrial complex I, abolished the increase in ROS signal, the activation of NF-kappa B, and TNF-alpha gene transcription during hypoxia. LPS stimulated NF-kappa B and TNF-alpha gene transcription but not ROS generation in J774.1 cells. Rotenone, pyrrolidinedithiocarbamic acid, and N-acetylcysteine had no effect on the LPS stimulation of NF-kappa B and TNF-alpha gene transcription, indicating that LPS activates NF-kappa B and TNF-alpha gene transcription through a ROS-independent mechanism. These results indicate that mitochondrial ROS are required for the hypoxic activation of NF-kappa B and TNF-alpha gene transcription, but not for the LPS activation of NF-kappa B.

  12. Characterization of the lys2 gene of Penicillium chrysogenum encoding alpha-aminoadipic acid reductase.

    PubMed

    Casqueiro, J; Gutiérrez, S; Bañuelos, O; Fierro, F; Velasco, J; Martín, J F

    1998-09-01

    A DNA fragment containing a gene homologous to LYS2 gene of Saccharomyces cerevisiae was cloned from a genomic DNA library of Penicillium chrysogenum AS-P-78. It encodes a protein of 1409 amino acids (Mr 154859) with strong similarity to the S. cerevisiae (49.9% identity) Schizosaccharomyces pombe (51.3% identity) and Candida albicans (48.12% identity) alpha-aminoadipate reductases and a lesser degree of identity to the amino acid-activating domains of the non-ribosomal peptide synthetases, including the alpha-aminoadipate-activating domain of the alpha-aminoadipyl-cysteinyl-valine synthetase of P. chrysogenum (12.4% identical amino acids). The lys2 gene contained one intron in the 5'-region and other in the 3'-region, as shown by comparing the nucleotide sequences of the cDNA and genomic DNA, and was transcribed as a 4.7-kb monocistronic mRNA. The lys2 gene was localized on chromosome III (7.5 Mb) in P. chrysogenum AS-P-78 and on chromosome IV (5.6 Mb) in strain P2, whereas the penicillin gene cluster is known to be located in chromosome I in both strains. The lys2-encoded protein is a member of the aminoacyladenylate-forming enzyme family with a reductase domain in its C-terminal region.

  13. A functional polymorphism of the TNF-{alpha} gene that is associated with type 2 DM

    SciTech Connect

    Susa, Shinji; Daimon, Makoto Sakabe, Jun-Ichi; Sato, Hidenori; Oizumi, Toshihide; Karasawa, Shigeru; Wada, Kiriko; Jimbu, Yumi; Kameda, Wataru; Emi, Mitsuru; Muramatsu, Masaaki; Kato, Takeo

    2008-05-09

    To examine the association of the tumor necrosis factor-{alpha} (TNF-{alpha}) gene region with type 2 diabetes (DM), 11 single-nucleotide polymorphisms (SNPs) of the region were analyzed. The initial study using a sample set (148 cases vs. 227 controls) showed a significant association of the SNP IVS1G + 123A of the TNF-{alpha} gene with DM (p = 0.0056). Multiple logistic regression analysis using an enlarged sample set (225 vs. 716) revealed the significant association of the SNP with DM independently of any clinical traits examined (OR: 1.49, p = 0.014). The functional relevance of the SNP were examined by the electrophoretic mobility shift assays using nuclear extracts from the U937 and NIH3T3 cells and luciferase assays in these cells with Simian virus 40 promoter- and TNF-{alpha} promoter-reporter gene constructs. The functional analyses showed that YY1 transcription factor bound allele-specifically to the SNP region and, the IVS1 + 123A allele had an increase in luciferase expression compared with the G allele.

  14. The bean. alpha. -amylase inhibitor is encoded by a lectin gene

    SciTech Connect

    Moreno, J.; Altabella, T.; Chrispeels, M.J. )

    1989-04-01

    The common bean, Phaseolus vulgaris, contains an inhibitor of insect and mammalian {alpha}-amylases that does not inhibit plant {alpha}-amylase. This inhibitor functions as an anti-feedant or seed-defense protein. We purified this inhibitor by affinity chromatography and found that it consists of a series of glycoforms of two polypeptides (Mr 14,000-19,000). Partial amino acid sequencing was carried out, and the sequences obtained are identical with portions of the derived amino acid sequence of a lectin-like gene. This lectin gene encodes a polypeptide of MW 28,000, and the primary in vitro translation product identified by antibodies to the {alpha}-amylase inhibitor has the same size. Co- and posttranslational processing of this polypeptide results in glycosylated polypeptides of 14-19 kDa. Our interpretation of these results is that the bean lectins constitute a gene family that encodes diverse plant defense proteins, including phytohemagglutinin, arcelin and {alpha}-amylase inhibitor.

  15. Optimization of alpha-acylaminoketone ecdysone agonists for control of gene expression.

    PubMed

    Tice, Colin M; Hormann, Robert E; Thompson, Christine S; Friz, Jennifer L; Cavanaugh, Caitlin K; Saggers, Jessica A

    2003-06-02

    Fifteen new alpha-acylaminoketones were prepared by four different routes in an initial effort to optimize the potency of these compounds as ecdysone agonists. The compounds were assayed in mammalian cells expressing the ecdysone receptors from Bombyx mori (BmEcR) and Choristoneura fumiferana (CfEcR) for their ability to cause expression of a reporter gene downstream of an ecdysone response element. A new alpha-acylaminoketone was identified which had activity equal to that of the standard dibenzoylhydrazine ecdysone agonist GS()-E in the assay based on CfEcR.

  16. C7L Family of Poxvirus Host Range Genes Inhibits Antiviral Activities Induced by Type I Interferons and Interferon Regulatory Factor 1

    PubMed Central

    Meng, Xiangzhi; Schoggins, John; Rose, Lloyd; Cao, Jingxin; Ploss, Alexander; Rice, Charles M.

    2012-01-01

    Vaccinia virus (VACV) K1L and C7L function equivalently in many mammalian cells to support VACV replication and antagonize antiviral activities induced by type I interferons (IFNs). While K1L is limited to orthopoxviruses, genes that are homologous to C7L are found in diverse mammalian poxviruses. In this study, we showed that the C7L homologues from sheeppox virus and swinepox virus could rescue the replication defect of a VACV mutant deleted of both K1L and C7L (vK1L−C7L−). Interestingly, the sheeppox virus C7L homologue could rescue the replication of vK1L−C7L− in human HeLa cells but not in murine 3T3 and LA-4 cells, in contrast to all other C7L homologues. Replacing amino acids 134 and 135 of the sheeppox virus C7L homologue, however, made it functional in the two murine cell lines, suggesting that these two residues are critical for antagonizing a putative host restriction factor which has some subtle sequence variation in human and murine cells. Furthermore, the C7L family of host range genes from diverse mammalian poxviruses were all capable of antagonizing type I IFN-induced antiviral activities against VACV. Screening of a library of more than 350 IFN-stimulated genes (ISGs) identified interferon-regulated factor 1 (IRF1) as an inhibitor of vK1L−C7L− but not wild-type VACV. Expression of either K1L or C7L, however, rendered vK1L−C7L− resistant to IRF1-induced antiviral activities. Altogether, our data show that K1L and C7L antagonize IRF1-induced antiviral activities and that the host modulation function of C7L is evolutionally conserved in all poxviruses that can readily replicate in tissue-cultured mammalian cells. PMID:22345458

  17. Multiplex pcr assay for detection of human interferon alpha2b gene in transgenic plants.

    PubMed

    Gerasymenko, I M; Sakhno, L O; Mazur, M G; Sheludko, Y V

    2012-01-01

    During the last decade interferons are regarded as potent candidates for generation of plant-based edible vaccines because of broad spectrum of antiviral activities and adjuvant properties. Establishment and certification of numerous interferon producing plant systems requests development of fast and efficient multiplex PCR protocol for the transgene detection in GM plants. Here we represent a protocol for simultaneous amplification in one assay of fragments of hIFN alpha 2b gene and two control genes, namely virD1 of Agrobacterium tumefaciens and conservative region of plant actin gene.

  18. Growth-related gene product {alpha}: A chemotactic cytokine for neutrophils in rheumatoid arthritis

    SciTech Connect

    Koch, A.E.; Pope, R.M. |; Shah, M.R.; Hosaka, S.

    1995-10-01

    Leukocyte recruitment is critical in the inflammation seen in rheumatoid arthritis (RA). To determine whether the chemokine growth-related gene product {alpha} (gro{alpha}) plays a role in this process, we examined synovial tissue (ST), synovial fluid (SF), and plasma samples from 102 patients with arthritis. RA SF contained more antigenic gro{alpha} (mean 5.3 {+-} 1.9 ng/ml) than did SFs from either osteoarthritis (OA) or other forms of arthritis (mean 0.1 ng/ml) (p < 0.05). RA plasma contained more gro{alpha} (mean 4.3 {+-} 1.8 ng/ml) than normal plasma (mean 0.1 ng/ml) (p < 0.05). RA ST fibroblasts (1.2 x 10{sup 5}/cells/ml RPMI 1640/24 h) produced antigenic gro{alpha} (mean 0.2 {+-} 0.1 ng/ml), and this production was increased significantly upon incubation with TNF-{alpha} (mean 1.3 {+-} 0.3 ng/ml) or IL-1{beta} (mean 2.3 {+-} 0.6 ng/ml) (p < 0.05). Cells from RA SF also produced gro{alpha}: neutrophils (PMNs) (10{sup 7} cells/ml/24 h) produced 3.7 {+-} 0.7 ng/ml. RA SF mononuclear cells produced gro{alpha}, particularly upon incubation with LPS or PHA. Immunoreactive ST gro{alpha} was found in greater numbers of RA compared with either OA or normal lining cells, as well as in RA compared with OA subsynovial macrophages (p < 0.05). IL-8 accounted for a mean of 36% of the RA SF chemotactic activity for PMNs, while epithelial neutrophil-activating peptide-78 accounted for 34%, and gro{alpha} for 28%, of this activity. Combined neutralization of all three chemokines in RA SFs resulted in a mean decrease of 50% of the chemotactic activity for PMNs present in the RA SFs. These results indicate that gro{alpha} plays an important role in the ingress of PMNs into the RA joint. 54 refs., 6 figs., 1 tab.

  19. Muscle-targeted hydrodynamic gene introduction of insulin-like growth factor-1 using polyplex nanomicelle to treat peripheral nerve injury.

    PubMed

    Nagata, Kazuya; Itaka, Keiji; Baba, Miyuki; Uchida, Satoshi; Ishii, Takehiko; Kataoka, Kazunori

    2014-06-10

    The recovery of neurologic function after peripheral nerve injury often remains incomplete because of the prolonged reinnervation process, which leads to skeletal muscle atrophy and articular contracture from disuse over time. To rescue the skeletal muscle and promote functional recovery, insulin-like growth factor-1 (IGF-1), a potent myogenic factor, was introduced into the muscle by hydrodynamic injection of IGF-1-expressing plasmid DNA using a biocompatible nonviral gene carrier, a polyplex nanomicelle. In a mouse model of sciatic nerve injury, the introduction of IGF-1 into the skeletal muscle of the paralyzed limb effectively alleviated a decrease in muscle weight compared with that in untreated control mice. Histologic analysis of the muscle revealed the IGF-1-expressing plasmid DNA (pDNA) to have a myogenic effect, inducing muscle hypertrophy with the upregulation of the myogenic regulatory factors, myogenin and MyoD. The evaluation of motor function by walking track analysis revealed that the group that received the hydrodynamic injection of IGF-1-expressing pDNA using the polyplex nanomicelle had significantly early recovery of motor function compared with groups receiving negative control pDNA and untreated controls. Early recovery of sensation in the distal area of sciatic nerve injury was also induced by the introduction of IGF-1-expressing pDNA, presumably because of the effect of secreted IGF-1 protein in the vicinity of the injured sciatic nerve exerting a synergistic effect with muscle hypertrophy, inducing a more favorable prognosis. This approach of introducing IGF-1 into skeletal muscle is promising for the treatment of peripheral nerve injury by promoting early motor function recovery.

  20. Cloning and gene expression of allograft inflammatory factor-1 (AIF-1) provide new insights into injury and bacteria response of the sea cucumber Apostichopus japonicus (Selenka, 1867).

    PubMed

    Ji, Nanjing; Chang, Yaqing; Zhao, Chong; Pang, Zhengguo; He, Zhou

    2014-06-01

    Allograft inflammatory factor-1 (AIF-1) is an interferon (IFN)-γ-inducible Ca(2+)-binding cytokine that associates with the immune defense and inflammatory response. In this study, we reported AIF-1 gene in sea cucumber Apostichopus japonicus (AjAIF-1). The full-length cDNA of AjAIF-1 is 1541 bp with an open reading frame (ORF) of 477 bp encoding 158 amino acids. Two EF-hand Ca(2+)-binding motifs were found in the deduced AjAIF-1. AjAIF-1 was widely expressed in all tested tissues (body wall, intestine, respiratory tree, tube feet, coelomocytes and longitudinal muscle), with the highest expression in respiratory tree. After Vibrio splendidus challenge and physical injury, AjAIF-1 transcripts were significantly upregulated in coelomocytes. The mRNA expression level of AjAIF-1 in coelomocytes reached to the highest value at 4 h (3.38-folds vs. the PBS control, P < 0.05) post injection. After papilla injury, the mRNA level of AjAIF-1 in coelomocytes was upregulated, and its peak value was found at 4 h (3.88-folds vs. the control, P < 0.05). These results indicated that 1) AjAIF-1 sensitively responds to pathogen infection; 2) AjAIF-1 is involved in acute inflammatory response. Our findings gain general information about the role of AjAIF-1 in the innate immunity of A. japonicus.

  1. Associations between genetic variants in the promoter region of the insulin-like growth factor-1 (IGF1) gene and blood serum IGF1 concentration in Hanwoo cattle.

    PubMed

    Chung, H Y; Choi, Y J; Park, H N; Davis, M E

    2015-04-10

    In this study, we investigated the associations between genetic variants in the promoter region of the insulin-like growth factor-1 (IGF1) gene and blood serum IGF1 concentration in Hanwoo cattle. Polymerase chain reaction primers were based on GenBank accession No. AF404761 and amplified approximately 533-bp segments. Newly identified sequences were submitted to GenBank (accession No. DQ267493). Sequence analysis revealed that genetic variants were located at a nucleotide position 323 for the nucleotide substitution C/A that was first reported in this study and positions 326-349 for a repeat motif (CA10-11). The allele frequencies of g.323C>A were 0.264 (C) and 0.736 (A) without significant deviation from Hardy-Weinberg equilibrium. Frequencies of the repeat motif CA(10) and CA(11) were 0.604 and 0.396, respectively. Statistical analysis revealed that the genetic variation g.323C>A was significantly associated with blood serum IGF1 concentrations with significant additive genetic effects, whereas no associations were found for the repeat motif. IGF1 concentrations were positively (r = 0.453) and negatively (r = -0.445) correlated with weights in the growing stages (16-21 months) and late fattening stages (22-30 months), respectively. The results of the present study and future genotypic data for Hanwoo beef cattle based on the robust genetic variation of IGF1 will provide critical information for genetic improvement and will have a large impact on commercial markets.

  2. Transcriptional regulation of the mouse alpha A-crystallin gene: binding of USF to the -7/+5 region.

    PubMed

    Sax, C M; Cvekl, A; Piatigorsky, J

    1997-02-07

    Lens preferred-expression of the mouse alpha A-crystallin gene (alpha A-cry) is regulated at the transcriptional level by multiple elements located in the 5' flanking region of the gene. Here we present the first analysis of the functional role of the mouse alpha A-cry +1 region and the protein(s) which bind to it. The -7/+5 region of this promoter exhibits sequence similarity with the consensus upstream stimulating factor (USF) transcription factor binding site. A wild type oligodeoxyribonucleotide (oligo) spanning the mouse alpha A-cry -15/+15 region specifically inhibited the activity of a mouse alpha A-cry promoter-cat gene fusion (p alpha A 111aCAT) in competitive co-transfection studies in the mouse alpha TN4-1 lens cell line, as did an oligo containing the adenovirus 2 major late promoter strong USF binding site. In contrast, an alpha A-cry oligo mutated (-3/+3) within the USF-like binding site did not inhibit p alpha A111aCAT activity. Western blot analysis indicated that alpha TN4-1 cells express USF1. Co-transfection of p alpha A111aCAT and a USF1 cDNA expression vector into alpha TN4-1 cells resulted in a repression of mouse alpha A-cry promoter activity. Electrophoretic mobility shift analyses (EMSA) demonstrated that proteins in an alpha TN4-1 nuclear extract form a single major complex on synthetic oligos spanning the mouse alpha A-cry -15/+15 region. The formation of this complex was inhibited by the presence of unlabeled -15/+15 oligos or an anti-USF1 antibody. In addition, purified USF1 bound to this region, producing a complex similar in size to that observed with alpha TN4-1 nuclear extracts. Taken together, our findings show that USF can bind to the mouse alpha A-cry +1 site, and support the possibility that USF plays a role in promoter activity of this gene. Sequence similarities surrounding the +1 region of the alpha A-cry gene of the mouse, mole rat, hamster, and human, as well as the previously observed utilization of USF by different cry

  3. Functional effect of point mutations in the alpha-folate receptor gene of CABA I ovarian carcinoma cells.

    PubMed

    Mangiarotti, F; Miotti, S; Galmozzi, E; Mazzi, M; Sforzini, S; Canevari, S; Tomassetti, A

    2001-01-01

    The alpha-folate receptor (alpha FR) is overexpressed in 90% of nonmucinous ovarian carcinomas. In addition to the known role of alpha FR binding and mediating the internalization of folates, functional interaction of alpha FR with signaling molecules was recently shown. To identify a model to study the role of alpha FR in ovarian carcinoma, we characterized the alpha FR gene in the ovarian carcinoma cell line CABA I in comparison to a reference line, IGROV1. In CABA I cells, Northern blot analysis revealed an alpha FR transcript of the expected length and FACS analysis indicated receptor expression on the cell membrane; however, RNase protection assay revealed no specific signals. Southern blot and genomic PCR analysis suggested the presence of a rearrangement(s) involving the 5' region of the gene in CABA I cells as compared to IGROV1 cells. Cloning and sequencing of CABA I alpha FR cDNA revealed several point mutations. The partitioning of alpha FR in membrane microdomains from CABA I cells and its association with regulatory molecules was comparable to that of IGROV1 cells. By contrast, the alpha FR expressed on the CABA I cell membrane bound folic acid with lower affinity, and ectopic expression of the corresponding cDNA in CHO cells confirmed impaired folic acid binding. Thus, CABA I cells may provide a tool to delineate functional domains of the alpha FR.

  4. Characterization of the rat transforming growth factor alpha gene and identification of promoter sequences.

    PubMed Central

    Blasband, A J; Rogers, K T; Chen, X R; Azizkhan, J C; Lee, D C

    1990-01-01

    We have determined the complete nucleotide sequence of rat transforming growth factor alpha (TGF alpha) mRNA and characterized the six exons that encode this transcript. These six exons span approximately 85 kilobases of genomic DNA, with exons 1 to 3 separated by particularly large introns. What had previously been thought to represent a species-specific difference in the size of the TGF alpha precursor (proTGF alpha) is now shown to be due to microheterogeneity in the splicing of exons 2 and 3. This results from a tandem duplication of the acceptor CAG and gives rise to two alternate forms (159 and 160 amino acids) of the integral membrane precursor. Exon 6, which encodes the 3' untranslated region of TGF alpha mRNA, also encodes, on the opposite strand, a small (approximately 200-nucleotide) transcript whose sequence predicts an open reading frame of 51 amino acids. Expression of this latter transcript does not appear to be coregulated with that of TGF alpha mRNA. Primer extension and S1 nuclease analyses of authentic TGF alpha transcripts revealed two major and multiple minor 5' ends which span more than 200 base pairs of DNA in a G + C-rich region that lacks canonical CCAAT or TATA sequences. The 5' ends of six independently derived cDNAs localized to five different sites in this same region. Restriction fragments that overlap these transcription start sites and extend approximately 300 base pairs in the 5' direction faithfully promote transcription in vitro with HeLa cell nuclear extracts. In addition, they direct the expression of the bacterial chloramphenicol acetyltransferase gene in transient-transfection assays. Images PMID:2325647

  5. Activating mutations of the G[sub s] [alpha]-gene in nonfucntioning pituitary tumors

    SciTech Connect

    Tordjman, K.; Stern, N.; Friedman, E.; Ouaknine, G.; Razon, N.; Yossiphov, Y. ); Nordenskjoeld, M.; Friedman, E. )

    1993-09-01

    The majority of pituitary tumors are of monoclonal origin; however, the molecular basis for their formation is poorly understood. Somatic mutations in the [alpha]-subunit of the GTP-binding protein, G[sub s][alpha] (gsp oncogene) have been found in about one third of GH-secreting tumors. Mutations in another [alpha]-subunit of a GTP-binding protein, G[sub i2][alpha] (gip mutations) have been described in other endocrine tumors. In this study, the authors examined 21 nonfunctioning pituitary tumors and 4 macro-prolactinomas for gsp mutations and 27 nonfunctioning tumors and 4 macroprolactinomas for gip mutations. Using the polymerase chain reaction and denaturing gradient gel electrophoresis, 2 nonfunctioning pituitary tumors displayed migration abnormalities when the G[sub s] [alpha]-gene was analyzed. Sequence analysis of these abnormally migrating polymerase chain reaction products revealed two previously known gsp mutations: arginine at codon 201 altered to cysteine, and glutamine at codon 227 changed to leucine. No gip mutations could be demonstrated. These findings emphasize the monoclonal origin of nonfunctioning pituitary tumors and suggest that cAMP may play a role in tumorigenesis of nonfunctioning pituitary tumors. 27 refs., 3 figs., 1 tab.

  6. Erythroid cell-specific alpha-globin gene regulation by the CP2 transcription factor family.

    PubMed

    Kang, Ho Chul; Chae, Ji Hyung; Lee, Yeon Ho; Park, Mi-Ae; Shin, June Ho; Kim, Sung-Hyun; Ye, Sang-Kyu; Cho, Yoon Shin; Fiering, Steven; Kim, Chul Geun

    2005-07-01

    We previously demonstrated that ubiquitously expressed CP2c exerts potent erythroid-specific transactivation of alpha-globin through an unknown mechanism. This mechanism is reported here to involve specific CP2 splice variants and protein inhibitor of activated STAT1 (PIAS1). We identify a novel murine splice isoform of CP2, CP2b, which is identical to CP2a except that it has an additional 36 amino acids encoded by an extra exon. CP2b has an erythroid cell-specific transcriptional activation domain, which requires the extra exon and can form heteromeric complexes with other CP2 isoforms, but lacks the DNA binding activity found in CP2a and CP2c. Transcriptional activation of alpha-globin occurred following dimerization between CP2b and CP2c in erythroid K562 and MEL cells, but this dimerization did not activate the alpha-globin promoter in nonerythroid 293T cells, indicating that an additional erythroid factor is missing in 293T cells. PIAS1 was confirmed as a CP2 binding protein by the yeast two-hybrid screen, and expression of CP2b, CP2c, and PIAS1 in 293T cell induced alpha-globin promoter activation. These results show that ubiquitously expressed CP2b exerts potent erythroid cell-specific alpha-globin gene expression by complexing with CP2c and PIAS1.

  7. Tumor necrosis factor-alpha regulation of the Id gene family in astrocytes and microglia during CNS inflammatory injury.

    PubMed

    Tzeng, S F; Kahn, M; Liva, S; De Vellis, J

    1999-04-01

    The inhibitors of DNA binding (Id) gene family is highly expressed during embryogenesis and throughout adulthood in the rat central nervous system (CNS). In vitro studies suggest that the Id gene family is involved in the regulation of cell proliferation and differentiation. Recently, Id gene expression was shown to be expressed in immature and mature astrocytes during development and upregulated in reactive astrocytes after spinal cord injury. These results suggest that the Id gene family may play an important role in regulating astrocyte development and reactivity; however, the factors regulating Id expression in astrocytes remain undefined. Tumor necrosis factor-alpha (TNF alpha), a proinflammatory cytokine, is thought to play a crucial role in astrocyte/microglia activation after injury to the CNS. To determine if TNF alpha plays a role in Id gene expression, we exogenously administered TNF alpha into developing postnatal rats. We report that TNF alpha injections resulted in a rapid and transient increase in both cell number and mRNA expression for Id2 and Id3 when compared to levels observed in noninjected or control-injected animals. Id1 mRNA levels were also upregulated after TNF alpha treatment, but to a lesser degree. Significant increases in TNF alpha-induced Id2 and Id3 mRNA were observed in the ventricular/subventricular zone, cingulum and corpus callosum. TNF alpha also increased Id2 mRNA expression in the caudate putamen and hippocampus at the injection site. Id2 and Id3 mRNA+ cells were identified as GFAP+ and S100 alpha + astrocytes as well as ED1+ microglia. This is the first report to show TNF-alpha-induced modulation of the Id gene family and suggests that Id may be involved in the formation of reactive astrocytes and activated microglia in the rodent brain. These results suggest a putative role for the Id family in the molecular mechanisms regulating cellular responsiveness to TNF alpha and CNS inflammation.

  8. Six mouse alpha-tubulin mRNAs encode five distinct isotypes: testis-specific expression of two sister genes.

    PubMed Central

    Villasante, A; Wang, D; Dobner, P; Dolph, P; Lewis, S A; Cowan, N J

    1986-01-01

    Five mouse alpha-tubulin isotypes are described, each distinguished by the presence of unique amino acid substitutions within the coding region. Most, though not all of these isotype-specific amino acids, are clustered at the carboxy terminus. One of the alpha-tubulin isotypes described is expressed exclusively in testis and is encoded by two closely related genes (M alpha 3 and M alpha 7) which have homologous 3' untranslated regions but which differ at multiple third codon positions and in their 5' untranslated regions. We show that a subfamily of alpha-tubulin genes encoding the same testis-specific isotype also exists in humans. Thus, we conclude that the duplication event leading to a pair of genes encoding a testis-specific alpha-tubulin isotype predated the mammalian radiation, and both members of the duplicated sequence have been maintained since species divergence. A second alpha-tubulin gene, M alpha 6, is expressed ubiquitously at a low level, whereas a third gene, M alpha 4, is unique in that it does not encode a carboxy-terminal tyrosine residue. This gene yields two transcripts: a 1.8-kilobase (kb) mRNA that is abundant in muscle and a 2.4-kb mRNA that is abundant in testis. Whereas the 1.8-kb mRNA encodes a distinct alpha-tubulin isotype, the 2.4-kb mRNA is defective in that the methionine residue required for translational initiation is missing. Patterns of developmental expression of the various alpha-tubulin isotypes are presented. Our data support the view that individual tubulin isotypes are capable of conferring functional specificity on different kinds of microtubules. Images PMID:3785200

  9. alpha. -Amylase of Clostridium thermosulfurogenes EM1: Nucleotide sequence of the gene, processing of the enzyme, and comparison to other. alpha. -amylases

    SciTech Connect

    Bahl, H.; Burchhardt, G.; Spreinat, A.; Haeckel, K.; Wienecke, A.; Antranikian, G.; Schmidt, B. )

    1991-05-01

    The nucleotide sequence of the {alpha}-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes Em1 suggested that the {alpha}-amylase is translated form mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature {alpha}-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 {alpha}-amylase with those from other bacterial and eukaryotic {alpha}-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca{sup 2+}-binding site (consensus region I) of this Ca{sub 2+}-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the {alpha}-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the {beta}-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains.

  10. alpha-Amylase of Clostridium thermosulfurogenes EM1: nucleotide sequence of the gene, processing of the enzyme, and comparison of other alpha-amylases.

    PubMed Central

    Bahl, H; Burchhardt, G; Spreinat, A; Haeckel, K; Wienecke, A; Schmidt, B; Antranikian, G

    1991-01-01

    The nucleotide sequence of the alpha-amylase gene (amyA) from Clostridium thermosulfurogenes EM1 cloned in Escherichia coli was determined. The reading frame of the gene consisted of 2,121 bp. Comparison of the DNA sequence data with the amino acid sequence of the N terminus of the purified secreted protein of C. thermosulfurogenes EM1 suggested that the alpha-amylase is translated from mRNA as a secretory precursor with a signal peptide of 27 amino acid residues. The deduced amino acid sequence of the mature alpha-amylase contained 679 residues, resulting in a protein with a molecular mass of 75,112 Da. In E. coli the enzyme was transported to the periplasmic space and the signal peptide was cleaved at exactly the same site between two alanine residues. Comparison of the amino acid sequence of the C. thermosulfurogenes EM1 alpha-amylase with those from other bacterial and eucaryotic alpha-amylases showed several homologous regions, probably in the enzymatically functioning regions. The tentative Ca(2+)-binding site (consensus region I) of this Ca(2+)-independent enzyme showed only limited homology. The deduced amino acid sequence of a second obviously truncated open reading frame showed significant homology to the malG gene product of E. coli. Comparison of the alpha-amylase gene region of C. thermosulfurogenes EM1 (DSM3896) with the beta-amylase gene region of C. thermosulfurogenes (ATCC 33743) indicated that both genes have been exchanged with each other at identical sites in the chromosomes of these strains. PMID:1854207

  11. Comparative gene expression profiles induced by PPAR{gamma} and PPAR{alpha}/{gamma} agonists in rat hepatocytes

    SciTech Connect

    Rogue, Alexandra; Renaud, Marie Pierre; Claude, Nancy; Guillouzo, Andre; Spire, Catherine

    2011-07-01

    Species-differential toxic effects have been described with PPAR{alpha} and PPAR{gamma} agonists between rodent and human liver. PPAR{alpha} agonists (fibrates) are potent hypocholesterolemic agents in humans while they induce peroxisome proliferation and tumors in rodent liver. By contrast, PPAR{gamma} agonists (glitazones) and even dual PPAR{alpha}/{gamma} agonists (glitazars) have caused idiosyncratic hepatic and nonhepatic toxicities in human without evidence of any damage in rodent during preclinical studies. The mechanisms involved in such differences remain largely unknown. Several studies have identified the major target genes of PPAR{alpha} agonists in rodent liver while no comprehensive analysis has been performed on gene expression changes induced by PPAR{gamma} and dual PPAR{alpha}/{gamma} agonists. Here, we investigated transcriptomes of rat hepatocytes after 24 h treatment with two PPAR{gamma} (troglitazone and rosiglitazone) and two PPAR{alpha}/{gamma} (muraglitazar and tesaglitazar) agonists. Although, hierarchical clustering revealed a gene expression profile characteristic of each PPAR agonist class, only a limited number of genes was specifically deregulated by glitazars. Functional analyses showed that many genes known as PPAR{alpha} targets were also modulated by both PPAR{gamma} and PPAR{alpha}/{gamma} agonists and quantitative differences in gene expression profiles were observed between these two classes. Moreover, most major genes modulated in rat hepatocytes were also found to be deregulated in rat liver after tesaglitazar treatment. Taken altogether, these results support the conclusion that differential toxic effects of PPAR{alpha} and PPAR{gamma} agonists in rodent liver do not result from transcriptional deregulation of major PPAR target genes but rather from qualitative and/or quantitative differential responses of a small subset of genes.

  12. Increase in expression level of alpha- and beta-tubulin genes in Arabidopsis seedlings under hypergravity conditions

    NASA Astrophysics Data System (ADS)

    Saito, Y.; Soga, K.; Wakabayashi, K.; Hoson, T.

    Hypergravity, a gravitational force of more than 1 g, suppresses elongation growth of shoots of various plants. The analysis of the changes in gene expression by hypergravity treatment in Arabidopsis hypocotyls by the differential display method showed that a gene encoding alpha-tubulin, which is a component of microtubules, was up-regulated by hypergravity [Yoshioka et al. (2003) Adv. Space Res. 31: 2187-2193]. However, the detailed relation between hypergravity treatment and the changes in alpha-tubulin gene levels has not been determined yet. Microtubules are formed by the spontaneous polymerization of dimers consisting of one alpha- and one beta-tubulin protein molecule. Thus, the expression levels of beta-tubulin genes may also be affected by hypergravity. In the present study, we examined the dose-response and the time course relations of change in the expression of both alpha- and beta-tubulin genes in Arabidopsis hypocotyls grown under hypergravity conditions. Elongation growth of Arabidopsis hypocotyls was suppressed by increasing gravity. The expression levels of both alpha- and beta-tubulin genes were increased depending on the magnitude of gravity. At 300 g, expression levels of alpha- and beta-tubulin genes were about 400% and 350% of the 1 g control, respectively. The increases in expression of both tubulin genes were detected within a few hours, when the seedlings grown at 1 g were transferred to hypergravity conditions. The increase in alpha- and beta-tubulin genes preceded or occurred at the same time as growth suppression. These results suggest that Arabidopsis hypocotyls regulate the expression level of alpha- and beta-tubulin genes promptly in response to gravity stimuli. The increase in the amount of microtubules due to the activation of tubulin gene expression may be involved in the regulation by gravity signal of shoot growth.

  13. Genome-Wide Screening of Alpha-Tocopherol Sensitive Genes in Heart Tissue from Alpha-Tocopherol Transfer Protein Null Mice (ATTP−/−)

    PubMed Central

    Vasu, Vihas T.; Hobson, Brad; Gohil, Kishorchandra; Cross, Carroll E.

    2009-01-01

    Alpha tocopherol transfer protein (ATTP) null mice (ATTP−/−) have a systemic deficiency of alpha-tocopherol (AT). The heart AT levels of ATTP−/− are <10% of those in ATTP+/+ mice. The genomic responses of heart to AT deficiency were determined in 3 months old male ATTP−/− mice and compared with their ATTP+/+ littermate controls using Affymetrix 430A 2.0 high density oligonucleotide arrays. Differential analysis of ~13,000 genes identified repression of genes related to immune system and activation of genes related to lipid metabolism and inflammation with no significant change in the expression of classical antioxidant genes (catalase, superoxide dismutase, glutathione peroxidase) in ATTP−/− as compared to ATTP+/+ mice. The present data identifies novel classes of AT sensitive genes in heart tissue. PMID:17382327

  14. Dexamethasone impairs hypoxia-inducible factor-1 function

    SciTech Connect

    Wagner, A.E.; Huck, G.; Stiehl, D.P.; Jelkmann, W.; Hellwig-Buergel, T.

    2008-07-25

    Hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription-factor composed of {alpha}- and {beta}-subunits. HIF-1 is not only necessary for the cellular adaptation to hypoxia, but it is also involved in inflammatory processes and wound healing. Glucocorticoids (GC) are therapeutically used to suppress inflammatory responses. Herein, we investigated whether GC modulate HIF-1 function using GC receptor (GR) possessing (HepG2) and GR deficient (Hep3B) human hepatoma cell cultures as model systems. Dexamethasone (DEX) treatment increased HIF-1{alpha} levels in the cytosol of HepG2 cells, while nuclear HIF-1{alpha} levels and HIF-1 DNA-binding was reduced. In addition, DEX dose-dependently lowered the hypoxia-induced luciferase activity in a reporter gene system. DEX suppressed the hypoxic stimulation of the expression of the HIF-1 target gene VEGF (vascular endothelial growth factor) in HepG2 cultures. DEX did not reduce hypoxically induced luciferase activity in HRB5 cells, a Hep3B derivative lacking GR. Transient expression of the GR in HRB5 cells restored the susceptibility to DEX. Our study discloses the inhibitory action of GC on HIF-1 dependent gene expression, which may be important with respect to the impaired wound healing in DEX-treated patients.

  15. Detection of Clostridium perfringens alpha toxin gene in lambs by loop mediated isothermal amplification

    PubMed Central

    Radhika, B.; Kumar, N. Vinod; Sreenivasulu, D.

    2016-01-01

    Aim: The loop mediated isothermal amplification (LAMP) was standardized for rapid detection of Clostridium perfringens. Materials and Methods: A total of 120 fecal samples were collected from enterotoxemia suspected lambs were used for screening of C. perfringens cpa gene by LAMP. The specificity of the LAMP amplified products was tested by digesting with restriction enzyme XmnI for alpha toxin gene. Results: Out of 120 samples screened 112 (93.3%) samples were positive by both LAMP and polymerase chain reaction (PCR) for detection of cpa gene which indicated the equal sensitivity of both the tests. The enzyme produced single cut in 162 base pair amplified product of alpha toxin gene at 81 base pair resulting in a single band in gel electrophoresis. Conclusion: Both LAMP and PCR for detection of cpa gene indicated the equal sensitivity of both the tests. Standardization of LAMP reaction for amplification of epsilon and beta toxin genes will help to identify the C. perfringens toxin types from the clinical samples. The test could be a suitable alternative to the PCR in detection of toxin types without the help of sophisticated machinery like thermal cycler. Considering its simplicity in operation and high sensitivity, there is the potential use of this technique in clinical diagnosis and surveillance of infectious diseases. PMID:27051186

  16. PPAR{alpha} gene expression is up-regulated by LXR and PXR activators in the small intestine

    SciTech Connect

    Inoue, Jun; Satoh, Shin-ichi; Kita, Mariko; Nakahara, Mayuko; Hachimura, Satoshi; Miyata, Masaaki; Nishimaki-Mogami, Tomoko; Sato, Ryuichiro

    2008-07-11

    LXR, PXR, and PPAR{alpha} are members of a nuclear receptor family which regulate the expression of genes involved in lipid metabolism. Here, we show the administration of T0901317 stimulates PPAR{alpha} gene expression in the small intestine but not in the liver of both normal and FXR-null mice. The administration of LXR specific ligand GW3965, or PXR specific ligand PCN has the same effect, indicating that ligand-dependent activation of LXR and PXR, but not FXR, is responsible for the increased gene expression of PPAR{alpha} in the mouse small intestine.

  17. Regional assignment of the structural gene for human alpha-L-iduronidase.

    PubMed Central

    Schuchman, E H; Astrin, K H; Aula, P; Desnick, R J

    1984-01-01

    The structural gene encoding human alpha-L-iduronidase has been assigned to chromosome 22 by using immunologic, electrophoretic, and somatic cell hybridization techniques. Polyclonal rabbit antibodies raised against purified human low-uptake alpha-L-iduronidase were used to discriminate the human and murine isozymes by a sensitive immuno-precipitation assay. The human chromosome constitution of each clone was determined by cytogenetic and enzyme marker electrophoretic techniques. In 65 human (fibroblast)-mouse (RAG) somatic cell hybrids (from four independent fusions), the expression of human alpha-L-iduronidase was 100% concordant with the presence of human chromosome 22; the assignment was confirmed by the demonstration of the human enzyme in tertiary somatic cell hybrids containing only chromosome 22. Further verification of the gene assignment was made by detection of the human enzyme in tertiary chromosome 22 positive hybrids by Ouchterlony immunodiffusion and rocket immunoelectrophoretic experiments with polyclonal anti-human alpha-L-iduronidase antibodies that were monospecific for the human enzyme. Expression of human enzymatic activity in chromosome 22 positive hybrid lines was markedly reduced; for example, a tertiary hybrid (R-G21-J-15), which contained an average of 1.7 chromosome 22s per cell, only had about 15% of the activity detected in normal diploid fibroblasts. Immunologic studies suggested that the reduced expression was due to abnormal post-translational processing or aggregation (or both) of the human and murine isozymes in these hybrids. Regional assignment of the human structural gene to 22pter----q11 was accomplished by gene dosage studies using diploid human fibroblast lines that were partially monosomic or trisomic for chromosome 22. Images PMID:6422468

  18. Construction of an amylolytic industrial strain of Saccharomyces cerevisiae containing the Schwanniomyces occidentalis alpha-amylase gene.

    PubMed

    Kang, Na-Young; Park, Jeong-Nam; Chin, Jong-Eon; Lee, Hwanghee Blaise; Im, Suhn-Young; Bai, Suk

    2003-11-01

    The gene encoding Schwanniomyces occidentalis alpha-amylase (AMY) was introduced into the chromosomal delta sequences of an industrial strain of Saccharomyces cerevisiae. To obtain a strain suitable for commercial use, an delta-integrative cassette devoid of bacterial DNA sequences was constructed that contains the AMY gene and aureobasidin A resistance gene (AUR1-C) as the selection marker. The AMY gene was expressed under the control of the alcohol dehydrogenase gene promoter (ADC1p). The alpha-amylase activity of Sacc. cerevisiae transformed with this integrative cassette was 6 times higher than that of Sch. occidentalis. The transformants (integrants) were mitotically stable after 100 generations in nonselective medium.

  19. Effect of TNF{alpha} on activities of different promoters of human apolipoprotein A-I gene

    SciTech Connect

    Orlov, Sergey V.; Mogilenko, Denis A.; Shavva, Vladimir S.; Dizhe, Ella B.; Ignatovich, Irina A.; Perevozchikov, Andrej P.

    2010-07-23

    Research highlights: {yields} TNF{alpha} stimulates the distal alternative promoter of human apoA-I gene. {yields} TNF{alpha} acts by weakening of promoter competition within apoA-I gene (promoter switching). {yields} MEK1/2 and nuclear receptors PPAR{alpha} and LXRs take part in apoA-I promoter switching. -- Abstract: Human apolipoprotein A-I (ApoA-I) is a major structural and functional protein component of high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by pro-inflammatory cytokines such as IL-1{beta} and TNF{alpha}. Recently, two novel additional (alternative) promoters for human apoA-I gene have been identified. Nothing is known about the role of alternative promoters in TNF{alpha}-mediated downregulation of apoA-I gene. In this article we report for the first time about the different effects of TNF{alpha} on two alternative promoters of human apoA-I gene. Stimulation of HepG2 cells by TNF{alpha} leads to activation of the distal alternative apoA-I promoter and downregulation of the proximal alternative and the canonical apoA-I promoters. This effect is mediated by weakening of the promoter competition within human apoA-I 5'-regulatory region (apoA-I promoter switching) in the cells treated by TNF{alpha}. The MEK1/2-ERK1/2 cascade and nuclear receptors PPAR{alpha} and LXRs are important for TNF{alpha}-mediated apoA-I promoter switching.

  20. Evaluation of "at risk" alpha 1-antitrypsin genotype SZ with synthetic oligonucleotide gene probes.

    PubMed Central

    Nukiwa, T; Brantly, M; Garver, R; Paul, L; Courtney, M; LeCocq, J P; Crystal, R G

    1986-01-01

    Alpha 1-antitrypsin (alpha 1AT), a 52,000-mol-wt serum glycoprotein produced by hepatocytes and mononuclear phagocytes, functions as the major inhibitor of neutrophil elastase. The alpha 1AT haplotype S is associated with childhood liver disease and/or adult emphysema when inherited with the Z haplotype to give the phenotype SZ. To accurately identify the SZ phenotype at the level of genomic DNA, four 32P-labeled 19-mer synthetic oligonucleotide probes were prepared; two to identify the M and S difference in exon III, and two to identify the M and Z difference in exon V. These probes were hybridized with various cloned DNAs and genomic DNAs cut with the restriction endonucleases BgII and EcoRI; the genomic DNAs represented all six possible phenotype combinations of the M, S, and Z haplotypes (MM, MS, MZ, SS, ZZ, and SZ). Using the four probes to evaluate 42 samples of genomic DNA, the "at risk" SZ and ZZ phenotypes were correctly identified in all cases, as were the "not at risk" phenotypes SS, MS, MM, and MZ, demonstrating that both exon III and exon V directed probes are necessary to properly identify all of the major "at risk" alpha 1AT genes. However, when used to evaluate a very rare family carrying a null allele, these four oligonucleotide probes misidentified the "at risk" null-null and S null phenotypes as "not at risk" MM and SM combinations. These observations indicate that oligonucleotide gene probes yielded reliable and accurate assessment of "at risk" alpha 1AT genotypes in almost all situations, but in the context of prenatal diagnosis and genetic counseling this approach must be used with caution and in combination with family studies so as not to misidentify rare genotypes that may be associated with a risk for disease. Images PMID:3484754

  1. Differential expression of alphaB-crystallin and Hsp27-1 in anaplastic thyroid carcinomas because of tumor-specific alphaB-crystallin gene (CRYAB) silencing

    PubMed Central

    Mineva, Ivelina; Gartner, Wolfgang; Hauser, Peter; Kainz, Alexander; Löffler, Michael; Wolf, Gerhard; Oberbauer, Rainer; Weissel, Michael; Wagner, Ludwig

    2005-01-01

    Expression of the small heat shock protein alphaB-crystallin in differentiated thyroid tumors has been described recently. In this study, we investigated the molecular mechanisms that affect the expression of alphaB-crystallin in benign goiters (n = 7) and highly malignant anaplastic thyroid carcinomas (ATCs) (n = 3). AlphaB-crystallin expression was compared with that of Hsp27-1. Immunoblot and quantitative real-time (RT) polymerase chain reaction revealed marked downregulation of alphaB-crystallin in all the tested ATCs and the ATC-derived cell line C-643 . In contrast, considerable expression of Hsp27-1 in benign and malignant thyroid tissue was demonstrated. Immunofluorescence analysis revealed no relevant topological differences between benign and malignant thyrocytes in the cytoplasmic staining of both proteins. Consistent and marked downregulation of TFCP2L1 was identified as one of the main mechanisms contributing to CRYAB gene silencing in ATCs. In addition, CRYAB gene promoter methylation seems to occur in distinct ATCs. In silico analysis revealed that the differential expression of alphaB-crystallin and Hsp27-1 results from differences between the alphaB-crystallin and Hsp27-1 promoter fragments (712 bp upstream from the transcriptional start site). Biological activity of the analyzed promoter element is confirmed by its heat shock inducibility. In conclusion, we demonstrate downregulation of alphaB-crystallin expression in highly dedifferentiated ATCs because of a tumor-specific transcription factor pattern. The differential expression of alphaB-crystallin and Hsp27-1 indicates functional differences between both proteins. PMID:16184762

  2. Differential expression of alphaB-crystallin and Hsp27-1 in anaplastic thyroid carcinomas because of tumor-specific alphaB-crystallin gene (CRYAB) silencing.

    PubMed

    Mineva, Ivelina; Gartner, Wolfgang; Hauser, Peter; Kainz, Alexander; Löffler, Michael; Wolf, Gerhard; Oberbauer, Rainer; Weissel, Michael; Wagner, Ludwig

    2005-01-01

    Expression of the small heat shock protein alphaB-crystallin in differentiated thyroid tumors has been described recently. In this study, we investigated the molecular mechanisms that affect the expression of alphaB-crystallin in benign goiters (n = 7) and highly malignant anaplastic thyroid carcinomas (ATCs) (n = 3). AlphaB-crystallin expression was compared with that of Hsp27-1. Immunoblot and quantitative real-time (RT) polymerase chain reaction revealed marked downregulation of alphaB-crystallin in all the tested ATCs and the ATC-derived cell line C-643 . In contrast, considerable expression of Hsp27-1 in benign and malignant thyroid tissue was demonstrated. Immunofluorescence analysis revealed no relevant topological differences between benign and malignant thyrocytes in the cytoplasmic staining of both proteins. Consistent and marked downregulation of TFCP2L1 was identified as one of the main mechanisms contributing to CRYAB gene silencing in ATCs. In addition, CRYAB gene promoter methylation seems to occur in distinct ATCs. In silico analysis revealed that the differential expression of alphaB-crystallin and Hsp27-1 results from differences between the alphaB-crystallin and Hsp27-1 promoter fragments (712 bp upstream from the transcriptional start site). Biological activity of the analyzed promoter element is confirmed by its heat shock inducibility. In conclusion, we demonstrate downregulation of alphaB-crystallin expression in highly dedifferentiated ATCs because of a tumor-specific transcription factor pattern. The differential expression of alphaB-crystallin and Hsp27-1 indicates functional differences between both proteins.

  3. Molecular nature of alpha-globin genes in the Saudi population

    PubMed Central

    Borgio, J. Francis

    2015-01-01

    Alpha-thalassemia (α-thal) is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal). Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis. PMID:26593158

  4. Do products of the myc proto-oncogene play a role in transcriptional regulation of the prothymosin alpha gene?

    PubMed Central

    Mol, P C; Wang, R H; Batey, D W; Lee, L A; Dang, C V; Berger, S L

    1995-01-01

    The Myc protein has been reported to activate transcription of the rat prothymosin alpha gene by binding to an enhancer element or E box (CACGTG) located in the first intron (S. Gaubatz et al., Mol. Cell. Biol. 14:3853-3862, 1994). The human prothymosin alpha gene contains two such motifs: in the promoter region at kb -1.2 and in intron 1, approximately 2 kb downstream of the transcriptional start site in a region which otherwise bears little homology to the rat gene. Using chloramphenicol acetyltransferase (CAT) reporter constructs driven either by the 5-kb human prothymosin alpha promoter or by a series of truncated promoters, we showed that removal of the E-box sequence had no effect on transient expression of CAT activity in mouse L cells. When intron 1 of the prothymosin alpha gene was inserted into the most extensive promoter construct downstream of the CAT coding region, a diminution in transcription, which remained virtually unchanged upon disruption of the E boxes, was observed. CAT constructs driven by the native prothymosin alpha promoter or the native promoter and intron were indifferent to Myc; equivalent CAT activity was observed in the presence of ectopic normal or mutant Myc genes. Similarly, expression of a transiently transfected wild-type prothymosin alpha gene as the reporter was not affected by a repertoire of myc-derived genes, including myc itself and dominant or recessive negative myc mutants. In COS-1 cells, equivalent amounts of the protein were produced from transfected prothymosin alpha genes regardless of whether genomic E boxes were disrupted, intron 1 was removed, or a repertoire of myc-derived genes was included in the transfection cocktail. More importantly, cotransfection of a dominant negative Max gene failed to reduce transcription of the endogenous prothymosin alpha gene in COS cells or the wild-type transfected gene in COS or L cells. Taken together, the data do not support the idea that Myc activates transcription of the

  5. Increased tumor necrosis factor-alpha (TNF-alpha) gene expression in parainfluenza type 1 (Sendai) virus-induced bronchiolar fibrosis.

    PubMed Central

    Uhl, E. W.; Moldawer, L. L.; Busse, W. W.; Jack, T. J.; Castleman, W. L.

    1998-01-01

    Increased airway resistance and airway hyperresponsiveness induced in rats by infection with parainfluenza type I (Sendai) virus is associated with bronchiolar fibrosis. To determine whether increased tumor necrosis factor (TNF)-alpha gene expression is an important regulatory event in virus-induced bronchiolar fibrosis, pulmonary TNF-alpha mRNA and protein expression was assessed in rat strains that are susceptible (Brown Norway; BN) and resistant (Fischer 344; F344) to virus-induced bronchiolar fibrosis. Virus-inoculated BN rats had increased TNF-alpha pulmonary mRNA levels (P < 0.05) and increased numbers of bronchiolar macrophages and fibroblasts expressing TNF-alpha protein compared with virus-inoculated F344 rats (P < 0.05). Virus inoculation also induced elevated TNF-alpha mRNA and protein levels (P < 0.05) in cultured rat alveolar macrophages (NR8383 cells). A 55-kd soluble TNF receptor-immunoglobulin G fusion protein (sTNFR-IgG) was used to inhibit TNF-alpha bioactivity in virus-inoculated BN rats. Treated rats had fewer proliferating bronchiolar fibroblasts, as detected by bromodeoxyuridine incorporation, compared with virus-inoculated control rats (P < 0.05). There was also increased mortality in p55sTNFR-IgG-treated virus-inoculated rats associated with increased viral replication and decreased numbers of macrophages and lymphocytes in bronchoalveolar lavage fluid (P < 0.05). The results of this study indicate that 1) Sendai virus can directly up-regulate TNF-alpha mRNA and protein expression in macrophages, 2) TNF-alpha is an important mediator of virus-induced bronchiolar fibrosis, and 3) TNF-alpha has a critical role in the termination of Sendai viral replication in the lung. Images Figure 2 PMID:9466578

  6. High tumor necrosis factor alpha (TNF-alpha) production in Trypanosoma cruzi-infected pregnant mice and increased TNF-alpha gene transcription in their offspring.

    PubMed Central

    Rivera, M T; Marques de Araujo, S; Lucas, R; Deman, J; Truyens, C; Defresne, M P; de Baetselier, P; Carlier, Y

    1995-01-01

    Since tumor necrosis factor alpha (TNF-alpha) is known to be involved in the feto-maternal relationship, this cytokine was studied in Trypanosoma cruzi-infected pregnant BALB/c mice and their fetuses and offspring. Pregnant chronically infected mice displayed significantly higher levels of circulating TNF-alpha than animals either only infected or only pregnant. TNF-alpha was undetectable in sera of uninfected and nonpregnant mice as well as in breast milk obtained from infected and uninfected animals. Fetuses from infected mice exhibited significantly more cells containing TNF-alpha mRNA in their thymus than fetuses from uninfected mothers. When infected 2 months after birth, offspring born to infected and uninfected mothers displayed similar amounts of circulating TNF-alpha during chronic infection, whereas this cytokine was only weakly detectable during the acute phase of the disease. An intravenous injection of lipopolysaccharide during acute infection strongly increased the production of TNF-alpha in offspring born to infected mothers to levels higher than those in progeny from uninfected mice. These results suggest that TNF-alpha is an important cytokine in the feto-maternal relationship during T. cruzi infection and that fetuses and offspring of infected mothers are primed to produce elevated levels of TNF-alpha. PMID:7822027

  7. Matrix metalloproteinase-12 gene regulation by a PPAR alpha agonist in human monocyte-derived macrophages

    SciTech Connect

    Souissi, Imen Jguirim; Billiet, Ludivine; Cuaz-Perolin, Clarisse; Rouis, Mustapha

    2008-11-01

    MMP-12, a macrophage-specific matrix metalloproteinase with large substrate specificity, has been reported to be highly expressed in mice, rabbits and human atherosclerotic lesions. Increased MMP-12 from inflammatory macrophages is associated with several degenerative diseases such as atherosclerosis. In this manuscript, we show that IL-1{beta}, a proinflammatory cytokine found in atherosclerotic plaques, increases both mRNA and protein levels of MMP-12 in human monocyte-derived macrophages (HMDM). Since peroxisome proliferator-activated receptors (PPARs), such as PPAR{alpha} and PPAR{gamma}, are expressed in macrophages and because PPAR activation exerts an anti-inflammatory effect on vascular cells, we have investigated the effect of PPAR{alpha} and {gamma} isoforms on MMP-12 regulation in HMDM. Our results show that MMP-12 expression (mRNA and protein) is down regulated in IL-1{beta}-treated macrophages only in the presence of a specific PPAR{alpha} agonist, GW647, in a dose-dependent manner. In contrast, this inhibitory effect was abolished in IL-1{beta}-stimulated peritoneal macrophages isolated from PPAR{alpha}{sup -/-} mice and treated with the PPAR{alpha} agonist, GW647. Moreover, reporter gene transfection experiments using different MMP-12 promoter constructs showed a reduction of the promoter activities by {approx} 50% in IL-1{beta}-stimulated PPAR{alpha}-pre-treated cells. However, MMP-12 promoter analysis did not reveal the presence of a PPRE response element. The IL-1{beta} effect is known to be mediated through the AP-1 binding site. Mutation of the AP-1 site, located at - 81 in the MMP-12 promoter region relative to the transcription start site, followed by transfection analysis, gel shift and ChIP experiments revealed that the inhibitory effect was the consequence of the protein-protein interaction between GW 647-activated PPAR{alpha} and c-Fos or c-Jun transcription factors, leading to inhibition of their binding to the AP-1 motif. These studies

  8. Identification of gene-based responses in human blood cells exposed to alpha particle radiation

    PubMed Central

    2014-01-01

    Background The threat of a terrorist-precipitated nuclear event places humans at danger for radiological exposures. Isotopes which emit alpha (α)-particle radiation pose the highest risk. Currently, gene expression signatures are being developed for radiation biodosimetry and triage with respect to ionizing photon radiation. This study was designed to determine if similar gene expression profiles are obtained after exposures involving α-particles. Methods Peripheral blood mononuclear cells (PBMCs) were used to identify sensitive and robust gene-based biomarkers of α-particle radiation exposure. Cells were isolated from healthy individuals and were irradiated at doses ranging from 0-1.5 Gy. Microarray technology was employed to identify transcripts that were differentially expressed relative to unirradiated cells 24 hours post-exposure. Statistical analysis identified modulated genes at each of the individual doses. Results Twenty-nine genes were common to all doses with expression levels ranging from 2-10 fold relative to control treatment group. This subset of genes was further assessed in independent complete white blood cell (WBC) populations exposed to either α-particles or X-rays using quantitative real-time PCR. This 29 gene panel was responsive in the α-particle exposed WBCs and was shown to exhibit differential fold-changes compared to X-irradiated cells, though no α-particle specific transcripts were identified. Conclusion Current gene panels for photon radiation may also be applicable for use in α-particle radiation biodosimetry. PMID:25017500

  9. DNA restriction-site polymorphisms associated with the alpha 1-antitrypsin gene.

    PubMed Central

    Cox, D W; Billingsley, G D; Mansfield, T

    1987-01-01

    Restriction-site variation in and around the alpha 1-antitrypsin gene has been studied using two genomic probes. With use of restriction enzymes SstI, MspI, and AvaII, three polymorphic sites have been described with a 4.6-kb probe in the 5' portion of the gene. With use of a 6.5-kb probe, polymorphisms in the coding and 3' regions of the gene have been detected with AvaII, MaeIII, and TaqI. All of these polymorphisms are of sufficiently high frequency to be useful in genetic mapping studies. The polymorphisms with AvaII and MaeIII (6.5-kb probe) are particularly useful for prenatal diagnosis. PI types and M subtypes tend to be associated with specific DNA haplotypes; there are two different types of DNA haplotypes associated with PI M1. The extent of linkage disequilibrium differs throughout the region of the alpha 1-antitrypsin gene. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:2890296

  10. Sequence analysis of the EF-1 alpha gene family of Mucor racemosus.

    PubMed Central

    Sundstrom, P; Lira, L M; Choi, D; Linz, J E; Sypherd, P S

    1987-01-01

    Our previous studies have shown that Mucor racemosus possesses three genes (TEF-1, -2 and -3) for EF-1 alpha, and that all three genes are transcribed. However, the level of transcription varies markedly between the three genes, with TEF-1 mRNA levels being approximately two fold higher than TEF-3 and 6 fold higher than TEF-2. We have now completed the DNA sequence of both strands of all three genes and have found that these genes are highly homologous. TEF-2 and TEF-3 are more similar to each other than they are to TEF-1. The TEF-2 and the TEF-3 coding regions differ from TEF-1 at 30 and 37 positions respectively out of 1374 nucleotides. Twenty-six of these nucleotide substitutions were common to both TEF-2 and TEF-3, and the majority of the substitutions were clustered in the 5' region of the coding sequences. While the majority of these changes were silent, TEF-2 and TEF-3 differed from TEF-1 by having a lysine instead of a glutamate at amino acid position 41. In addition, TEF-2 and -3, but not TEF-1, each have an intron located near the 5' end of the coding region, although its size and sequence is not conserved between the two genes. All three genes have a conserved intron near the 3' end of the coding region. The sequence data have been analyzed with respect to the structure and function of EF-1 alpha in protein biosynthesis. PMID:3697088

  11. Isotypic and allotypic variation of human class II histocompatibility antigen alpha-chain genes.

    PubMed

    Auffray, C; Lillie, J W; Arnot, D; Grossberger, D; Kappes, D; Strominger, J L

    DNA sequences of four human class II histocompatibility antigen alpha chain DNA sequences (derived from cDNA and genomic clones representing DC1 alpha, DC4 alpha, DX alpha and SB alpha) are presented and compared to DR alpha and to mouse I-A alpha and I-E alpha sequences. These data suggest possible mechanisms for the generation of polymorphism and the evolution of the DR, DC and SB families.

  12. The interferon-alpha gene family of Marmota himalayana, a Chinese marmot species with susceptibility to woodchuck hepatitis virus infection.

    PubMed

    Lu, Yinping; Wang, Baoju; Huang, Hongping; Tian, Yongjun; Bao, Junjie; Dong, Jihua; Roggendorf, Michael; Lu, Mengji; Yang, Dongliang

    2008-01-01

    The interferon-alpha (IFN-alpha) gene family is an important part of the immune system. Recombinant interferon-alpha is widely used to treat viral hepatitis and malignant diseases. Marmota himalayana has been found to be susceptible to woodchuck hepatitis virus, a virus genetically related to hepatitis B virus (HBV), and is suitable as an animal model for studies on HBV infection. Here, the IFN-alpha gene family of M. himalayana (cwIFN-alpha) was characterized. Sequence data indicate that the cwIFN-alpha family consists of at least 8 functional sequences and 6 pseudogenes with high homology within the family and to IFN-alpha of Marmota monax, a related species and well-established animal model. The recombinant cwIFN-alpha subtypes were expressed and tested to be active in viral protection assay and to induce expression of MxA in a species-specific manner. This work provides essential information for future work on testing new therapeutic approaches of HBV infection based on IFN-alpha in M. himalayana.

  13. Binding of tissue-specific forms of alpha A-CRYBP1 to their regulatory sequence in the mouse alpha A-crystallin-encoding gene: double-label immunoblotting of UV-crosslinked complexes.

    PubMed

    Kantorow, M; Becker, K; Sax, C M; Ozato, K; Piatigorsky, J

    1993-09-15

    The alpha A-CRYBP1 regulatory sequence (alpha A-CRYBP1RS), at nucleotides -66 to -57 of the mouse alpha A-crystallin-encoding gene (alpha A-CRY) promoter, is an important control element involved in the regulation of mouse alpha A-CRY expression. The gene encoding a protein (alpha A-CRYBP1) that specifically binds to the alpha A-CRYBP1RS sequence has been cloned from a cultured mouse lens cell line. In the present study, we have used an antibody (specific to the alpha A-CRYBP1 protein and made against a synthetic peptide) to directly identify UV-crosslinked protein-DNA complexes via a double-label immunoblotting technique. Multiple alpha A-CRYB1 antigenically related proteins interacted with alpha A-CRYBP1RS in nuclear extracts from both a cloned mouse lens cell line (alpha TN4-1) that expresses alpha A-CRY and a mouse fibroblast line (L929) that does not express the gene. Two sizes (50 kDa and 90 kDa) of proteins reacting with the alpha A-CRYBP1-specific Ab were detected in both cell lines and, in addition, a > 200-kDa protein reacting with the Ab was unique to the fibroblast line. Thus, alpha A-CRYBP1 antigenically related proteins interact with alpha A-CRYBP1RS regardless of alpha A-CRY expression. Moreover, differential processing of the alpha A-CRYBP1 protein and/or alternative splicing of the alpha A-CRY transcript may affect expression of alpha A-CRY.

  14. Characterization of the gene and protein of the common alpha 1-antitrypsin normal M2 allele.

    PubMed Central

    Nukiwa, T; Brantly, M L; Ogushi, F; Fells, G A; Crystal, R G

    1988-01-01

    The normal M2 variant of alpha 1-antitrypsin (alpha 1AT) was cloned from a genomic DNA library of an individual homozygous for this allele. Sequencing of all coding exons of the M2 gene revealed it was identical to the common M1(Val213) gene except for two bases (M1(Val213) CGT Arg101, M2 CAT His101; M1(Val213) GAA Glu376 M2 GAC Asp376). Analysis of the sequence of the M1(Val213) and M2 genes around residue 101 revealed the M1 Arg101----M2 His101 caused a loss of the cutting site for the restriction endonuclease RsaI. Using this enzyme, as well as 19-mer oligonucleotides probes centered at residues 101 and 376, evaluation of genomic DNA from 22 M1 alleles and 14 M2 alleles revealed that residue 101 was Arg in all M1 alleles and His in all M2 alleles, while residue 376 was Glu in all M1 alleles and Asp in all M2 alleles. Despite the differences in sequence at two amino acids, the M1(Val213) and M2 proteins function similarly as assessed by quantification of the association rate constant of each for their natural substrate neutrophil elastase. In the context that there are two mutations separating the M1(Val213) and M2 alleles, it is likely that there is another alpha 1AT variant that was an intermediate in the evolution of these genes. Images Figure 2 Figure 4 Figure 1 Figure 3 PMID:2901226

  15. The Hd0053 gene of Haemophilus ducreyi encodes an alpha2,3-sialyltransferase.

    PubMed

    Li, Yanhong; Sun, Mingchi; Huang, Shengshu; Yu, Hai; Chokhawala, Harshal A; Thon, Vireak; Chen, Xi

    2007-09-21

    Haemophilus ducreyi is a Gram-negative bacterium that causes chancroid, a sexually transmitted genital ulcer disease. Different lipooligosaccharide (LOS) structures have been identified from H. ducreyi strain 35000, including those sialylated glycoforms. Surface LOS of H. ducreyi is considered an important virulence factor that is involved in ulcer formation, cell adhesion, and invasion of host tissue. Gene Hd0686 of H. ducreyi, designated lst (for lipooligosaccharide sialyltransferase), was identified to encode an alpha2,3-sialyltransferase that is important for the formation of sialylated LOS. Here, we show that Hd0053 of H. ducreyi genomic strain 35000HP, the third member of the glycosyltransferase family 80 (GT80), also encodes an alpha2,3-sialyltransferase that may be important for LOS sialylation.

  16. The Drosophila melanogaster importin alpha3 locus encodes an essential gene required for the development of both larval and adult tissues.

    PubMed Central

    Mason, D Adam; Máthé, Endre; Fleming, Robert J; Goldfarb, David S

    2003-01-01

    The nuclear transport of classical nuclear localization signal (cNLS)-containing proteins is mediated by the cNLS receptor importin alpha. The conventional importin alpha gene family in metazoan animals is composed of three clades that are conserved between flies and mammals and are referred to here as alpha1, alpha2, and alpha3. In contrast, plants and fungi contain only alpha1 genes. In this study we report that Drosophila importin alpha3 is required for the development of both larval and adult tissues. Importin alpha3 mutant flies die around the transition from first to second instar larvae, and homozygous importin alpha3 mutant eyes are defective. The transition to second instar larvae was rescued with importin alpha1, alpha2, or alpha3 transgenes, indicating that Importin alpha3 is normally required at this stage for an activity shared by all three importin alpha's. In contrast, an alpha3-specific biochemical activity(s) of Importin alpha3 is probably required for development to adults and photoreceptor cell development, since only an importin alpha3 transgene rescued these processes. These results are consistent with the view that the importin alpha's have both overlapping and distinct functions and that their role in animal development involves the spatial and temporal control of their expression. PMID:14704178

  17. Gene encoding the human beta-hexosaminidase beta chain: extensive homology of intron placement in the alpha- and beta-chain genes.

    PubMed Central

    Proia, R L

    1988-01-01

    Lysosomal beta-hexosaminidase (EC 3.2.1.52) is composed of two structurally similar chains, alpha and beta, that are the products of different genes. Mutations in either gene causing beta-hexosaminidase deficiency result in the lysosomal storage disease GM2-gangliosidosis. To enable the investigation of the molecular lesions in this disorder and to study the evolutionary relationship between the alpha and beta chains, the beta-chain gene was isolated, and its organization was characterized. The beta-chain coding region is divided into 14 exons distributed over approximately 40 kilobases of DNA. Comparison with the alpha-chain gene revealed that 12 of the 13 introns interrupt the coding regions at homologous positions. This extensive sharing of intron placement demonstrates that the alpha and beta chains evolved by way of the duplication of a common ancestor. PMID:2964638

  18. Mechanism of rifampicin and pregnane X receptor inhibition of human cholesterol 7 alpha-hydroxylase gene transcription.

    PubMed

    Li, Tiangang; Chiang, John Y L

    2005-01-01

    Bile acids, steroids, and drugs activate steroid and xenobiotic receptor pregnane X receptor (PXR; NR1I2), which induces human cytochrome P4503A4 (CYP3A4) in drug metabolism and cholesterol 7 alpha-hydroxylase (CYP7A1) in bile acid synthesis in the liver. Rifampicin, a human PXR agonist, inhibits bile acid synthesis and has been used to treat cholestatic diseases. The objective of this study is to elucidate the mechanism by which PXR inhibits CYP7A1 gene transcription. The mRNA expression levels of CYP7A1 and several nuclear receptors known to regulate the CYP7A1 gene were assayed in human primary hepatocytes by quantitative real-time PCR (Q-PCR). Rifampicin reduced CYP7A1 and small heterodimer partner (SHP; NR02B) mRNA expression suggesting that SHP was not involved in PXR inhibition of CYP7A1. Rifampicin inhibited CYP7A1 reporter activity and a PXR binding site was localized to the bile acid response element-I. Mammalian two-hybrid assays revealed that PXR interacted with hepatic nuclear factor 4 alpha (HNF4 alpha, NR2A1) and rifampicin was required. Coimmunoprecipitation assay confirmed PXR interaction with HNF4 alpha. PXR also interacted with peroxisome proliferator-activated receptor gamma coactivator (PGC-1 alpha), which interacted with HNF4 alpha and induced CYP7A1 gene transcription. Rifampicin enhanced PXR interaction with HNF4 alpha and reduced PGC-1 alpha interaction with HNF4 alpha. Chromatin immunoprecipitation assay showed that PXR, HNF4 alpha, and PGC-1 alpha bound to CYP7A1 chromatin, and rifampicin dissociated PGC-1 alpha from chromatin. These results suggest that activation of PXR by rifampicin promotes PXR interaction with HNF4 alpha and blocks PGC-1 alpha activation with HNF4 alpha and results in inhibition of CYP7A1 gene transcription. Rifampicin inhibition of bile acid synthesis may be a protective mechanism against drug and bile acid-induced cholestasis.

  19. Predicting gene expression levels from codon biases in alpha-proteobacterial genomes.

    PubMed

    Karlin, Samuel; Barnett, Melanie J; Campbell, Allan M; Fisher, Robert F; Mrazek, Jan

    2003-06-10

    Predicted highly expressed (PHX) genes in five currently available high G+C complete alpha-proteobacterial genomes are analyzed. These include: the nitrogen-fixing plant symbionts Sinorhizobium meliloti (SINME) and Mesorhizobium loti (MESLO), the nonpathogenic aquatic bacterium Caulobacter crescentus (CAUCR), the plant pathogen Agrobacterium tumefaciens (AGRTU), and the mammalian pathogen Brucella melitensis (BRUME). Three of these genomes, SINME, AGRTU, and BRUME, contain multiple chromosomes or megaplasmids (>1 Mb length). PHX genes in these genomes are concentrated mainly in the major (largest) chromosome with few PHX genes found in the secondary chromosomes and megaplasmids. Tricarboxylic acid cycle and aerobic respiration genes are strongly PHX in all five genomes, whereas anaerobic pathways of glycolysis and fermentation are mostly not PHX. Only in MESLO (but not SINME) and BRUME are most glycolysis genes PHX. Many flagellar genes are PHX in MESLO and CAUCR, but mostly are not PHX in SINME and AGRTU. The nonmotile BRUME also carries many flagellar genes but these are generally not PHX and all but one are located in the second chromosome. CAUCR stands out among available prokaryotic genomes with 25 PHX TonB-dependent receptors. These are putatively involved in uptake of iron ions and other nonsoluble compounds.

  20. Estrogen receptor-alpha gene expression in the cortex: sex differences during development and in adulthood.

    PubMed

    Wilson, Melinda E; Westberry, Jenne M; Trout, Amanda L

    2011-03-01

    17β-estradiol is a hormone with far-reaching organizational, activational and protective actions in both male and female brains. The organizational effects of early estrogen exposure are essential for long-lasting behavioral and cognitive functions. Estradiol mediates many of its effects through the intracellular receptors, estrogen receptor-alpha (ERα) and estrogen receptor-beta (ERβ). In the rodent cerebral cortex, estrogen receptor expression is high early in postnatal life and declines dramatically as the animal approaches puberty. This decline is accompanied by decreased expression of ERα mRNA. This change in expression is the same in both males and females in the developing isocortex and hippocampus. An understanding of the molecular mechanisms involved in the regulation of estrogen receptor alpha (ERα) gene expression is critical for understanding the developmental, as well as changes in postpubertal expression of the estrogen receptor. One mechanism of suppressing gene expression is by the epigenetic modification of the promoter regions by DNA methylation that results in gene silencing. The decrease in ERα mRNA expression during development is accompanied by an increase in promoter methylation. Another example of regulation of ERα gene expression in the adult cortex is the changes that occur following neuronal injury. Many animal studies have demonstrated that the endogenous estrogen, 17β-estradiol, is neuroprotective. Specifically, low levels of estradiol protect the cortex from neuronal death following middle cerebral artery occlusion (MCAO). In females, this protection is mediated through an ERα-dependent mechanism. ERα expression is rapidly increased following MCAO in females, but not in males. This increase is accompanied by a decrease in methylation of the promoter suggesting a return to the developmental program of gene expression within neurons. Taken together, during development and in adulthood, regulation of ERα gene expression in the

  1. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.

    1995-10-10

    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  2. Selenium regulates gene expression for estrogen sulfotransferase and alpha 2U-globulin in rat liver.

    PubMed

    Yang, Q; Christensen, M J

    1998-03-01

    Dietary intake of the essential trace element selenium (Se) regulates expression of genes for selenoproteins and certain non-Se-containing proteins. However, these proteins do not account for all of Se's biological effects. The objective of this work was to identify additional genes whose expression is regulated by Se. Identification of these genes may reveal new functions for Se or define mechanisms for its biological effects. Weanling male Sprague-Dawley rats were fed a Torula yeast-based Se-deficient basal diet or the same diet supplemented with 0.5 mg Se/kg diet as sodium selenite for 13 weeks. Total RNA was used as template for RNA fingerprinting. Two differentially expressed cDNA fragments were identified and cloned. The first had 99% nucleotide identity with rat liver estrogen sulfotransferase (EST) isoform-6. The second had 99% nucleotide sequence identity with rat liver alpha 2u-globulin. The mRNA levels for both were markedly reduced in Se deficiency. Laser densitometry showed that EST mRNA in Se deficiency was 7.3% of that in Se-adequate rat liver. The level of alpha 2u-globulin mRNA in Se-deficient rat liver was only 12.6% of that in Se-adequate rat liver. These results indicate that dietary Se may play a role in steroid hormone metabolism in rat liver.

  3. The extent to which immunity, apoptosis and detoxification gene expression interact with 17 alpha-methyltestosterone.

    PubMed

    Abo-Al-Ela, Haitham G; El-Nahas, Abeer F; Mahmoud, Shawky; Ibrahim, Essam M

    2017-01-01

    Innate immunity is the first line of defence against invasion by foreign pathogens. One widely used synthetic androgen for the production of all-male fish, particularly commercially valuable Nile tilapia, Oreochromis niloticus, is 17 alpha-methyltestosterone (MT). The present study investigates the effect of MT on innate immunity, cellular apoptosis and detoxification and the mortality rate, during and after the feeding of fry with 0-, 40-and 60-mg MT/kg. Expression analysis was completed on interleukin 1 beta (il1β), interleukin 8 (il8), tumour necrosis factor alpha (tnfα), CXC2- and CC-chemokines, interferon (ifn), myxovirus resistance (mx), toll-like receptor 7 (tlr7), immunoglobulin M heavy chain (IgM heavy chain), vitellogenin (vtg), cellular apoptosis susceptibility (cas) and glutathione S-transferase α1 (gstα1). Expression analysis revealed that MT had a significant impact on these genes, and this impact varied from induction to repression during and after the treatment. Linear regression analysis showed a significant association between the majority of the tested gene transcript levels and mortality rates on the 7(th) and 21(st) days of hormonal treatment and 2 weeks following hormonal cessation. The results are thoroughly discussed in this article. This is the first report concerning the hazardous effect of MT on a series of genes involved in immunity, apoptosis and detoxification in the Nile tilapia fry.

  4. Regulation of the Mycobacterium tuberculosis hypoxic response gene encoding alpha -crystallin.

    PubMed

    Sherman, D R; Voskuil, M; Schnappinger, D; Liao, R; Harrell, M I; Schoolnik, G K

    2001-06-19

    Unlike many pathogens that are overtly toxic to their hosts, the primary virulence determinant of Mycobacterium tuberculosis appears to be its ability to persist for years or decades within humans in a clinically latent state. Since early in the 20th century latency has been linked to hypoxic conditions within the host, but the response of M. tuberculosis to a hypoxic signal remains poorly characterized. The M. tuberculosis alpha-crystallin (acr) gene is powerfully and rapidly induced at reduced oxygen tensions, providing us with a means to identify regulators of the hypoxic response. Using a whole genome microarray, we identified >100 genes whose expression is rapidly altered by defined hypoxic conditions. Numerous genes involved in biosynthesis and aerobic metabolism are repressed, whereas a high proportion of the induced genes have no known function. Among the induced genes is an apparent operon that includes the putative two-component response regulator pair Rv3133c/Rv3132c. When we interrupted expression of this operon by targeted disruption of the upstream gene Rv3134c, the hypoxic regulation of acr was eliminated. These results suggest a possible role for Rv3132c/3133c/3134c in mycobacterial latency.

  5. Neural regulation of muscle acetylcholine receptor epsilon- and alpha- subunit gene promoters in transgenic mice

    PubMed Central

    1993-01-01

    The effects of denervation were investigated in mice with transgenes containing promoter elements from the muscle acetylcholine receptor epsilon- and alpha-subunit genes. The promoter sequences were coupled to a nuclear localization signal-beta-galactosidase fusion gene (nlacZ) as a reporter. While many postsynaptic specializations form in the embryo, expression of the epsilon subunit is induced during the first two postnatal weeks. When muscles were denervated at birth, before the onset of epsilon expression, epsilon nlacZ still appeared at the former synaptic sites on schedule. This result suggests that the nerve leaves a localized "trace" in the muscle that can continue to regulate transcription. An additional finding was that epsilon nlacZ expression was much stronger in denervated than in intact muscles. This suggests that the epsilon promoter is similar to the other subunits in containing elements that are activated on cessation of neural activity. However, even after denervation, epsilon nlacZ expression was always confined to the synaptic region whereas alpha nlacZ expression increased in nuclei along the entire length of the fiber. This suggests that while the epsilon gene is similar in its activity dependence to other subunit genes, it is unique in that local nerve-derived signals are essential for its expression. Consequently, inactivity enhances epsilon expression only in synaptic nuclei where such signals are present, but enhances expression throughout the muscle fiber. Truncations and an internal deletion of the epsilon promoter indicate that cis-elements essential for the response to synaptic signals are contained within 280 bp of the transcription start site. In contrast to these results in young animals, denervation in older animals leads to an unexpected reduction in nlacZ activity. However, mRNA measurements indicated that transgene expression was increased in these animals. This discordance between nlacZ mRNA and enzyme activity, demonstrates a

  6. PU.1 (Spi-1) and C/EBP alpha regulate expression of the granulocyte-macrophage colony-stimulating factor receptor alpha gene.

    PubMed Central

    Hohaus, S; Petrovick, M S; Voso, M T; Sun, Z; Zhang, D E; Tenen, D G

    1995-01-01

    Growth factor receptors play an important role in hematopoiesis. In order to further understand the mechanisms directing the expression of these key regulators of hematopoiesis, we initiated a study investigating the transcription factors activating the expression of the granulocyte-macrophage colony-stimulating factor (GM-CSF) receptor alpha gene. Here, we demonstrate that the human GM-CSF receptor alpha promoter directs reporter gene activity in a tissue-specific fashion in myelomonocytic cells, which correlates with its expression pattern as analyzed by reverse transcription PCR. The GM-CSF receptor alpha promoter contains an important functional site between positions -53 and -41 as identified by deletion analysis of reporter constructs. We show that the myeloid and B cell transcription factor PU.1 binds specifically to this site. Furthermore, we demonstrate that a CCAAT site located upstream of the PU.1 site between positions -70 and -54 is involved in positive-negative regulation of the GM-CSF receptor alpha promoter activity. C/EBP alpha is the major CCAAT/enhancer-binding protein (C/EBP) form binding to this site in nuclear extracts of U937 cells. Point mutations of either the PU.1 site or the C/EBP site that abolish the binding of the respective factors result in a significant decrease of GM-CSF receptor alpha promoter activity in myelomonocytic cells only. Furthermore, we demonstrate that in myeloid and B cell extracts, PU.1 forms a novel, specific, more slowly migrating complex (PU-SF) when binding the GM-CSF receptor alpha promoter PU.1 site. This is the first demonstration of a specific interaction with PU.1 on a myeloid PU.1 binding site. The novel complex is distinct from that described previously as binding to B cell enhancer sites and can be formed by addition of PU.1 to extracts from certain nonmyeloid cell types which do not express PU.1, including T cells and epithelial cells, but not from erythroid cells. Furthermore, we demonstrate that the PU

  7. Molecular study of the 5 {alpha}-reductase type 2 gene in three European families with 5 {alpha}-reductase deficiency

    SciTech Connect

    Boudon, C.; Lumbroso, S.; Lobaccaro, J.M. ||

    1995-07-01

    The molecular basis of 5{alpha}-reductase (5{alpha}R) deficiency was investigated in four patients from three European families. In the French family, the first patient was raised as a female, and gonadectomy was performed before puberty. The second sibling, also raised as female, differed in that gonadal removal was performed after the onset of pubertal masculinization. The other two patients, both from Polish families, developed masculinization of external genitalia during puberty. All patients developed a female sexual identity. In all cases, no known consanguinity or family history of 5{alpha}R deficiency was reported. The genomic DNAs of the patients were sequenced after polymerase chain reaction amplification of the five exons of the 5{alpha}R type 2 gene. We found two homozygous mutations responsible for gutamine to arginine and histidine to arginine substitution in families 1 and 3, respectively. In family 2, we found a heterozygous mutation responsible for an asparagine to serine substitution at position 193. The glutamine/arginine 126 mutation in the French family was previously reported in a Creole ethnic group, and the Polish histidine/arginine 231 mutation was previously reported in a patient from Chicago, Moreover, all of the mutations created new restriction sites, which were used to determine the kindred carrier status in the three families. Because 5{alpha}R deficiency is known to be heterogenous disease in terms of clinical and biochemical expression, our data suggest that molecular biology analysis of the type 2 gene could be an essential step in diagnosing 5{alpha}R deficiency. 22 refs., 3 figs., 1 tab.

  8. Analysis and expression of the alpha-expansin and beta-expansin gene families in maize

    NASA Technical Reports Server (NTRS)

    Wu, Y.; Meeley, R. B.; Cosgrove, D. J.

    2001-01-01

    Expansins comprise a multigene family of proteins in maize (Zea mays). We isolated and characterized 13 different maize expansin cDNAs, five of which are alpha-expansins and eight of which are beta-expansins. This paper presents an analysis of these 13 expansins, as well as an expression analysis by northern blotting with materials from young and mature maize plants. Some expansins were expressed in restricted regions, such as the beta-expansins ExpB1 (specifically expressed in maize pollen) and ExpB4 (expressed principally in young husks). Other expansins such as alpha-expansin Exp1 and beta-expansin ExpB2 were expressed in several organs. The expression of yet a third group was not detected in the selected organs and tissues. An analysis of expansin sequences from the maize expressed sequence tag collection is also presented. Our results indicate that expansin genes may have general, overlapping expression in some instances, whereas in other cases the expression may be highly specific and limited to a single organ or cell type. In contrast to the situation in Arabidopsis, beta-expansins in maize seem to be more numerous and more highly expressed than are alpha-expansins. The results support the concept that beta-expansins multiplied and evolved special functions in the grasses.

  9. [Cloning of Clostridium perfringens alpha-toxin gene and extracellular expression in Escherichia coli].

    PubMed

    Inoue, Masaharu; Kikuchi, Maho; Komoriya, Tomoe; Watanabe, Kunitomo; Kouno, Hideki

    2007-01-01

    Clostridium perfringens (C. perfringens) is a Gram-positive bacterial pathogen that widely propagets in the soil and the gastrointestinal tract of human and animals. This bacteria causes food poisoning, gas gangrene and other various range of infectious diseases. But there is no standard diagnosis method of C. perfringens. In order to develop a new type of immunoassay for clinical purpose, we studied expression and extracellular secretion of recombinant alpha-toxin having enzyme activity in E. coli expression system. Cloning was carried out after PCR amplification from C. perfringens GAI 94074 which was clinical isolate. Three kinds of fragment were cloned using pET100/D-TOPO vector. These fragments coded for ribosome binding site, signal peptide, and alpha-toxin gene respectively. Recombinant pET100 plasmid transformed into TOP 10 cells and the obtained plasmids were transformed into BL21 (DE3) cells. Then, the transformants were induced expression with IPTG. In conclusion, we successfully cloned, expressed and exteracellular secreted C. perfringens alpha-toxin containing signal peptide. Biologically, the obtained recombinant protein was positive for phospholipase C activity.

  10. Identification of a lens-specific regulatory region (LSR) of the murine alpha B-crystallin gene.

    PubMed

    Gopal-Srivastava, R; Piatigorsky, J

    1994-04-11

    Previous studies have shown that the -661/+44 sequence of the murine alpha B-crystallin gene contains a muscle-preferred enhancer (-426/-257) and can drive the bacterial chloramphenicol acetyltransferase (CAT) gene in the lens, skeletal muscle and heart of transgenic mice. Here we show that transgenic mice carrying a truncated -164/+44 fragment of the alpha B-crystallin gene fused to the CAT gene expressed exclusively in the lens; by contrast mice carrying a -426/+44 fragment of the alpha B gene fused to CAT expressed highly in the lens, skeletal muscle and heart, and slightly in the lung, brain, kidney, spleen and liver. DNase I protection experiments indicated that the -147/-118 sequence is protected by nuclear proteins from alpha TN4-1 lens cell line, but not by nuclear proteins from myotubes of the C2C12 cell line. Site directed mutagenesis of this sequence decreased promoter activity in transiently-transfected lens cells, consistent with this sequence being a lens-specific regulatory region (LSR). We conclude that the -426/-257 enhancer is required for expression in skeletal muscle, heart and possibly other tissues, and that the -164/+44 sequence of the alpha B-crystallin gene is sufficient for expression in the lens of transgenic mice.

  11. A role for the Rho-p160 Rho coiled-coil kinase axis in the chemokine stromal cell-derived factor-1alpha-induced lymphocyte actomyosin and microtubular organization and chemotaxis.

    PubMed

    Vicente-Manzanares, Miguel; Cabrero, José Román; Rey, Mercedes; Pérez-Martínez, Manuel; Ursa, Angeles; Itoh, Kazuyuki; Sánchez-Madrid, Francisco

    2002-01-01

    The possible involvement of the Rho-p160ROCK (Rho coiled-coil kinase) pathway in the signaling induced by the chemokine Stromal cell-derived factor (SDF)-1alpha has been studied in human PBL. SDF-1alpha induced activation of RhoA, but not that of Rac. RhoA activation was followed by p160ROCK activation mediated by RhoA, which led to myosin light chain (MLC) phosphorylation, which was dependent on RhoA and p160ROCK activities. The kinetics of MLC activation was similar to that of RhoA and p160ROCK. The role of this cascade in overall cell morphology and functional responses to the chemokine was examined employing different chemical inhibitors. Inhibition of either RhoA or p160ROCK did not block SDF-1alpha-induced short-term actin polymerization, but induced the formation of long spikes arising from the cell body, which were found to be microtubule based. This morphological change was associated with an increase in microtubule instability, which argues for an active microtubule polymerization in the formation of these spikes. Inhibition of the Rho-p160ROCK-MLC kinase signaling cascade at different steps blocked lymphocyte migration and the chemotaxis induced by SDF-1alpha. Our results indicate that the Rho-p160ROCK axis plays a pivotal role in the control of the cell shape as a step before lymphocyte migration toward a chemotactic gradient.

  12. Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor alpha gene promoter

    PubMed Central

    1993-01-01

    Tumor necrosis factor alpha (TNF-alpha), a cytokine with pleiotropic biological effects, is produced by a variety of cell types in response to induction by diverse stimuli. In this paper, TNF-alpha mRNA is shown to be highly induced in a murine T cell clone by stimulation with T cell receptor (TCR) ligands or by calcium ionophores alone. Induction is rapid, does not require de novo protein synthesis, and is completely blocked by the immunosuppressant cyclosporin A (CsA). We have identified a human TNF-alpha promoter element, kappa 3, which plays a key role in the calcium-mediated inducibility and CsA sensitivity of the gene. In electrophoretic mobility shift assays, an oligonucleotide containing kappa 3 forms two DNA protein complexes with proteins that are present in extracts from unstimulated T cells. These complexes appear in nuclear extracts only after T cell stimulation. Induction of the inducible nuclear complexes is rapid, independent of protein synthesis, and blocked by CsA, and thus, exactly parallels the induction of TNF-alpha mRNA by TCR ligands or by calcium ionophore. Our studies indicate that the kappa 3 binding factor resembles the preexisting component of nuclear factor of activated T cells. Thus, the TNF-alpha gene is an immediate early gene in activated T cells and provides a new model system in which to study CsA-sensitive gene induction in activated T cells. PMID:8376940

  13. Nucleotide sequence of the leukotoxin gene from Actinobacillus actinomycetemcomitans: homology to the alpha-hemolysin/leukotoxin gene family.

    PubMed Central

    Kraig, E; Dailey, T; Kolodrubetz, D

    1990-01-01

    The leukotoxin produced by Actinobacillus actinomycetemcomitans has been implicated in the etiology of localized juvenile periodontitis. To initiate a genetic analysis into the role of this protein in disease, we have cloned its gene, lktA. We now present the complete nucleotide sequence of the lktA gene from A. actinomycetemcomitans. When the deduced amino acid sequence of the leukotoxin protein was compared with those of other proteins, it was found to be homologous to the leukotoxin from Pasteurella haemolytica and to the alpha-hemolysins from Escherichia coli and Actinobacillus pleuropneumoniae. Each alignment showed at least 42% identity. As in the other organisms, the lktA gene of A. actinomycetemcomitans was linked to another gene, lktC, which is thought to be involved in the activation of the leukotoxin. The predicted LktC protein was related to the leukotoxin/hemolysin C proteins from the other bacteria, since they shared a minimum of 49% amino acid identity. Surprisingly, although actinobacillus species are more closely related to pasteurellae than to members of the family Enterobacteriaciae, LktA and LktC from A. actinomycetemcomitans shared significantly greater sequence identity with the E. coli alpha-hemolysin proteins than with the P. haemolytica leukotoxin proteins. Despite the overall homology to the other leukotoxin/hemolysin proteins, the LktA protein from A. actinomycetemcomitans has several unique properties. Most strikingly, it is a very basic protein with a calculated pI of 9.7; the other toxins have estimated pIs around 6.2. The unusual features of the A. actinomycetemcomitans protein are discussed in light of the different species and target-cell specificities of the hemolysins and the leukotoxins. Images PMID:2318535

  14. Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

    SciTech Connect

    Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko; Osumi, Takashi

    2008-04-11

    Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, the perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.

  15. Cloning, sequencing, and expression of the gene coding for the human platelet. cap alpha. /sub 2/-adrenergic receptor

    SciTech Connect

    Kobilka, B.K.; Matsui, H.; Kobilka, T.S.; Yang-Feng, T.L.; Francke, U.; Caron, M.G.; Lefkowitz, R.J.; Regan, J.W.

    1987-10-30

    The gene for the human platelet ..cap alpha../sub 2/-adrenergic receptor has been cloned with oligonucleotides corresponding to the partial amino acid sequence of the purified receptor. The identity of this gene has been confirmed by the binding of ..cap alpha../sub 2/-adrenergic ligands to the cloned receptor expressed in Xenopus laevis oocytes. The deduced amino acid sequence is most similar to the recently cloned human ..beta../sub 2/- and ..beta../sub 1/-adrenergic receptors; however, similarities to the muscarinic cholinergic receptors are also evident. Two related genes have been identified by low stringency Southern blot analysis. These genes may represent additional ..cap alpha../sub 2/-adrenergic receptor subtypes.

  16. Analysis of the promoter region and the N-propeptide domain of the human pro alpha 2(I) collagen gene.

    PubMed Central

    Dickson, L A; de Wet, W; Di Liberto, M; Weil, D; Ramirez, F

    1985-01-01

    We have located the exon coding for the start site of transcription of the human pro alpha 2(I) collagen gene. Comparison with the homologous region of other fibrillar collagen genes has confirmed the existence of a consensus sequence (CATGTCTA-n-TAGACATG) capable of forming a hairpin secondary structure possibly involved in the regulation of collagen biosynthesis. Sequence comparison of the chromosomal regions at the 5' end of the pro alpha 1(I) and pro alpha 2(I) collagen genes failed to identify unique DNA elements potentially mediating common regulatory signals. Sequencing of four exons coding for the N-terminal propeptide has determined most of its structure and it has implied the existence of smaller coding units similar to the 11 and 18 bp exons originally described in the avian gene. Images PMID:4011429

  17. A microRNA embedded AAV alpha-synuclein gene silencing vector for dopaminergic neurons

    PubMed Central

    Han, Ye; Khodr, Christina E.; Sapru, Mohan K.; Pedapati, Jyothi; Bohn, Martha C.

    2011-01-01

    Alpha-synuclein (SNCA), an abundantly expressed presynaptic protein, is implicated in Parkinson disease (PD). Since over-expression of human SNCA (hSNCA) leads to death of dopaminergic (DA) neurons in human, rodent and fly brain, hSNCA gene silencing may reduce levels of toxic forms of SNCA and ameliorate degeneration of DA neurons in PD. To begin to develop a gene therapy for PD based on hSNCA gene silencing, two AAV gene silencing vectors were designed, and tested for efficiency and specificity of silencing, as well as toxicity in vitro. The same hSNCA silencing sequence (shRNA) was used in both vectors, but in one vector, the shRNA was embedded in a microRNA backbone and driven by a pol II promoter, and in the other the shRNA was not embedded in a microRNA and was driven by a pol III promoter. Both vectors silenced hSNCA to the same extent in 293T cells transfected with hSNCA. In DA PC12 cells, neither vector decreased expression of rat SNCA, tyrosine hydroxylase (TH), dopamine transporter (DAT) or the vesicular monoamine transporter (VMAT). However, the mir30 embedded vector was significantly less toxic to both PC12 and SH-SY5Y cells. Our in vitro data suggest that this miRNA-embedded silencing vector may be ideal for chronic in vivo SNCA gene silencing in DA neurons. PMID:21338582

  18. Genetically essential and nonessential alpha-tubulin genes specify functionally interchangeable proteins.

    PubMed Central

    Schatz, P J; Solomon, F; Botstein, D

    1986-01-01

    Microtubules in yeast are essential components of the mitotic and meiotic spindles and are essential for nuclear movement during cell division and mating. The relative importance in these processes of the two divergent alpha-tubulin genes of the budding yeast Saccharomyces cerevisiae, TUB1 and TUB3, was examined through the construction of null mutations and by increasing their copy number on chromosomes and on plasmids. Experiments with null alleles of TUB3 showed that TUB3 was not essential for mitosis, meiosis, or mating. Null alleles of TUB3, however, did cause several phenotypes, including hypersensitivity to the antimicrotubule drug benomyl and poor spore viability. On the other hand, the TUB1 gene was essential for growth of normal haploid cells. Even in diploids heterozygous for a TUB1 null allele, several dominant phenotypes were evident, including slow growth and poor sporulation. This functional difference between the two genes is apparently due to different levels of expression, because extra copies of either gene could suppress the defects caused by a null mutation in the other. We conclude that in spite of the 10% divergence between the products of the two genes, there is no essential qualitative functional difference between them. Images PMID:3540600

  19. Preferential expression of an alpha-tubulin gene of Arabidopsis in pollen.

    PubMed Central

    Carpenter, J L; Ploense, S E; Snustad, D P; Silflow, C D

    1992-01-01

    The pool of tubulin protein in tissues of Arabidopsis is provided by the expression of multiple alpha-tubulin (TUA) and beta-tubulin genes. Whereas most tubulin genes are expressed in many tissues, previous evidence suggested that the TUA1 gene might be expressed primarily in pollen. We now report a detailed analysis of TUA1 expression during Arabidopsis development. In RNA from tissues of dissected flowers, TUA1 transcripts were detected only in stamens and mature pollen. Chimeric genes containing TUA1 5' flanking DNA fused to the beta-glucuronidase (GUS) coding region were used to create transgenic Arabidopsis plants. Plants containing a chimeric gene with 533 bp of 5' flanking sequence were analyzed by histochemical assay to localize GUS expression within the plant. The blue product of GUS enzyme activity accumulated very rapidly in postmitotic pollen grains. Much lower levels of GUS activity were detected in anthers with uninucleate pollen grains, in flower receptacles, and in a few vegetative tissues. Analysis of 5' deletions of the TUA1 promoter suggested that 97 bp of 5' flanking DNA is sufficient to drive GUS expression in pollen and young anthers, whereas at least 380 bp is required to detect GUS expression in the receptacle. Examination of the TUA1 promoter sequence revealed several motifs that are repeated within the TUA1 promoter and are similar to sequences in other pollen-specific promoters. PMID:1498610

  20. Human DNA polymerase alpha gene: sequences controlling expression in cycling and serum-stimulated cells.

    PubMed Central

    Pearson, B E; Nasheuer, H P; Wang, T S

    1991-01-01

    We have investigated the DNA polymerase alpha promoter sequence requirements for the expression of a heterologous gene in actively cycling cells and following serum addition to serum-deprived cells. An 11.4-kb genomic clone that spans the 5' end of this gene and includes 1.62 kb of sequence upstream from the translation start site was isolated. The transcription start site was mapped at 46 +/- 1 nucleotides upstream from the translation start site. The upstream sequence is GC rich and lacks a TATA sequence but has a CCAAT sequence on the opposite strand. Analysis of a set of deletion constructs in transient transfection assays demonstrated that efficient expression of the reporter in cycling cells requires 248 bp of sequence upstream from the cap site. Clustered within these 248 nucleotides are sequences similar to consensus sequences for Sp1-, Ap1-, Ap2-, and E2F-binding sites. The CCAAT sequence and the potential E2F- and Ap1-binding sites are shown to be protected from DNase I digestion by partially purified nuclear proteins. The DNA polymerase alpha promoter can confer upon the reporter an appropriate, late response to serum addition. No single sequence element could be shown to confer serum inducibility. Rather, multiple sequence elements appear to mediate the full serum response. Images PMID:2005899

  1. Identification and characterization of the alpha-acetolactate synthase gene from Lactococcus lactis subsp. lactis biovar diacetylactis.

    PubMed Central

    Marugg, J D; Goelling, D; Stahl, U; Ledeboer, A M; Toonen, M Y; Verhue, W M; Verrips, C T

    1994-01-01

    The conversion of 3-13C-labelled pyruvate in an acetoin-producing clone from a Lactococcus lactis subsp. lactis biovar diacetylactis strain DSM 20384 plasmid bank in Escherichia coli was studied by 13C nuclear magnetic resonance analysis. The results showed that alpha-acetolactate was the first metabolic product formed from pyruvate, whereas acetoin appeared at a much slower rate and reached only low concentrations. This alpha-acetolactate production shows that the cells express the gene for alpha-acetolactate synthase (als). Nucleotide sequence analysis identified an open reading frame encoding a protein of 554 amino acids. The deduced amino acid sequence exhibits extensive similarities to those of known alpha-acetolactate synthases from both prokaryotes and eukaryotes. The als gene is expressed on a monocistronic transcriptional unit, which is transcribed from a promoter located just upstream of the coding region. Images PMID:8017926

  2. A complete alpha1,3-galactosyltransferase gene is present in the human genome and partially transcribed.

    PubMed

    Lantéri, Marion; Giordanengo, Valérie; Vidal, Frédérique; Gaudray, Patrick; Lefebvre, Jean-Claude

    2002-12-01

    The synthesis of Galalpha1-3Gal-terminated oligosaccharides (alpha-Gal) epitopes has been interrupted during the course of evolution, starting with Old World primates. Partial sequences similar to the alpha1,3-galactosyltransferase (alpha1,3GalT) gene, which governs the synthesis of alpha-Gal epitopes, have been detected in the human genome and were found to correspond to pseudogenes. We completed the sequence of the human alpha1,3GalT pseudogene present on chromosome 9 and found it to be organized like the murine alpha1,3GalT gene. In human cell lines and several normal and tumor tissues we detected truncated transcripts corresponding to this pseudogene. Considering these mRNAs, translation of an open reading frame containing the first four translated exons but missing the two catalytic exons could predict a truncated alpha1,3GalT polypeptide that should be enzymatically inactive. We show that transcription of human alpha1,3GalT is prematurely terminated at the level of a strong transcriptional stop signal in the middle of intron VII. We were able to reproduce this effect in vitro by subcloning the implicated DNA region upstream from a reporter cDNA. The premature transcriptional arrest of human alpha1,3-GalT gene leads to an ectopic splicing event and to the connection of a short intronic sequence downstream from translated exons. Finally, we show that these truncated transcripts are overexpressed in cell lines with modifications of O-glycans.

  3. Dietary cholesterol fails to stimulate the human cholesterol 7alpha-hydroxylase gene (CYP7A1) in transgenic mice.

    PubMed

    Agellon, Luis B; Drover, Victor A B; Cheema, Sukhinder K; Gbaguidi, G Franck; Walsh, Annemarie

    2002-06-07

    Dietary cholesterol has been shown to have a stimulatory effect on the murine cholesterol 7alpha-hydroxylase gene (Cyp7a1), but its effect on human cholesterol 7alpha-hydroxylase gene (CYP7A1) expression in vivo is not known. A transgenic mouse strain harboring the human CYP7A1 gene and homozygous for the disrupted murine Cyp7a1 gene was created. Cholesterol feeding increased the expression of the endogenous modified Cyp7a1 allele but failed to stimulate the human CYP7A1 transgene. In transfected hepatoma cells, 25-hydroxycholesterol increased murine Cyp7a1 gene promoter activity, whereas the human CYP7A1 gene promoter was unresponsive. Electrophoretic mobility shift assays demonstrated the interaction of the liver X receptor alpha (LXRalpha): retinoid X receptor (RXR) heterodimer, a transcription factor complex that is activated by oxysterols, with the murine Cyp7a1 gene promoter, whereas no binding to the human CYP7A1 gene promoter was detected. The results demonstrate that the human CYP7A1 gene is not stimulated by dietary cholesterol in the intact animal, and this is attributable to the inability of the CYP7A1 gene promoter to interact with LXRalpha:RXR.

  4. Identification of genes that function in the TNF-alpha-mediated apoptotic pathway using randomized hybrid ribozyme libraries.

    PubMed

    Kawasaki, Hiroaki; Onuki, Reiko; Suyama, Eigo; Taira, Kazunari

    2002-04-01

    Now that the sequences of many genomes are available, methods are required for the rapid identification of functional genes. We describe here a simple system for the isolation of genes that function in the tumor necrosis factor-alpha (TNF-alpha)-mediated pathway of apoptosis, using RNA helicase-associated ribozyme libraries with randomized substrate-binding arms. Because target-site accessibility considerably limits the effective use of intracellular ribozymes, the effectiveness of a conventional ribozyme library has been low. To overcome this obstacle, we attached to ribozymes an RNA motif (poly(A)-tail) able to interact with endogenous RNA helicase(s) so that the resulting helicase-attached, hybrid ribozymes can more easily attack target sites regardless of their secondary or tertiary structures. When the phenotype of cells changes upon introduction of a ribozyme library, genes responsible for these changes may be identified by sequencing the active ribozyme clones. In the case of TNF-alpha-mediated apoptosis, when a ribozyme library was introduced into MCF-7 cells, surviving clones were completely or partially resistant to TNF-alpha-induced apoptosis. We identified many pro-apoptotic genes and partial sequences of previously uncharacterized genes using this method. Our gene discovery system should be generally applicable to the identification of functional genes in various systems.

  5. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K

    1983-01-01

    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  6. Cytotoxicity of HSVtk and hrTNF-alpha fusion genes with IRES in treatment of gastric cancer.

    PubMed

    Zhang, Jian-Hua; Wan, Ming-Xi; Pan, Bo-Rong; Yu, Bing

    2006-04-28

    The efficacy of the suicide gene therapy by using the herpes simplex virus thymidine kinase/ganciclovir (HSVtk/GCV) system for the treatment of cancer is limited because of the insufficient gene transfer and the low killing activity. To enhance the anti-tumor activity, we probed into whether recombinant retroviral expression vector PLXSN expressing both HSVtk and TNF-alpha genes could potentiate the destruction of SGC7901. The pL(tk-TNF-alpha)SN harboring HSVtk and TNF-alpha genes in sequence was constructed with a bicistronic unit including the internal ribosomal entry site, the recombinant retroviruses were transferred into SGC7901 cells by lipofectamine, and pEGFP and Western blot analysis were used to detect the expression of fusion genes in transfected SGC7901 cells, and then apoptosis of the transfected cells were detected by using the TdT-mediated dUTP nick end labeling, flow cytometric analysis and transmission electron microscopy. In vitro study, the transfected gastric cancer cells were maintained in the GCV-contained medium, to assay the cell killing effect and bystander effect. In vivo experiments, retroviral serum plasmids were transfected into tumor-bearing nude mice, to observe the changes of tumor volumes and survival of the mice. In vitro there was no significant difference of cell survival rate between the three groups. However, in vivo results showed that tk/GCV, tk-TNF-alpha/GCV and TNF-alpha could inhibit the tumor growth, and the obvious anti-tumor effect was shown in tk-TNF-alpha/GCV group, and TNF-alpha obviously enhanced the anti-tumor effect in vivo. The pathologic examination showed necrosis of the cancer in the treated groups.

  7. [Teratogenesis and gene targets of 17alpha-ethynylestradiol on embryonic development in zebrafish].

    PubMed

    Tong, Jun-Wei; Zhang, Jing-Pu; Meng, Jie

    2011-01-01

    The pharmaceutical ethynylestradiol (EE) is a potent endocrine modulator. Application enlargement of ethynylestradiol in clinics and abuse in livestock farming and fishing make it important to explore ethynylestradiol toxicological action on vertebrate embryonic development and to establish an in vivo method for EE toxicity detection efficiently and conveniently. In the present study, using a model animal zebrafish and 17alpha-ethynylestradiol as a representative compound, we have investigated EE2 teratogenicity, target tissues and target genes on zebrafish embryo. The results show that median teratogenesis concentration (TC50) of EE2 is 0.8 microg x mL(-1), and median lethal dose (LD50) is 3.3 microg x mL(-1). Targets of EE2 action were implicated in brain, eyes, heart, muscle, skeleton, pigment and viscera. Embryonic cardiac arrhythmia caused by EE2 is probably resulted from heart abnormal structure. The embryonic stage sensitive to EE2 mainly started at cleavage and last up to the organogenesis with time-accumulating effect. RT-PCR results indicate that EE2 treatment disturbed gene expression pattern at the early period of zebrafish embryonic development by suppressing transcription of gene boz that promotes brain development, upregulating genes for trunk and tail, such as ntl, spt, shh, and perturbing Nodal signal expression of TGFbeta superfamily, for example, cyc, sqt and oep. Using zebrafish, an efficient in vivo method for quick evaluation of EE toxicity on embryonic development has been developed.

  8. Cloning the mouse homologue of the human lysosomal acid {alpha}-glucosidase gene

    SciTech Connect

    Ding, J.H.; Yang, B.Z.; Liu, H.M.

    1994-09-01

    Pompe disease (GSD II) is an autosomal recessive disorder caused by a deficiency of lysosomal acid {alpha}-glucosidase (GAA). In an attempt to create a mouse model for Pompe disease, we isolated and characterized the gene encoding the mouse homologue of the human GAA. Twenty clones that extend from exon 2 to the poly(A) tail were isolated from a mouse liver cDNA library, but the remainder of the mRNA proved difficult to obtain by conventional cDNA library screening. Sequences spanning exons 1-2 were cloned by RACE from mouse liver RNA. The full-length liver GAA cDNA contains 3365 nucleotides with a coding region of 2859 nucleotides and a 394 base pair 3{prime}-nontranslated region. The deduced amino acid sequence of the mouse GAA shows 84% identity to the human GAA. Southern blot analysis demonstrated that the mouse GAA was encoded by a single copy gene. Then six bacteriophages containing DNA from the GAA gene were isolated by screening 10{sup 6} phage plaques of a mouse 129 genomic library using a mouse GAA cDNA as a probe. From one of these bacteriophages, an 11-kilobase EcoRI fragment containing exons 3 to 15 was subcloned and sequenced. Work is in progress using this genomic clone to disrupt the GAA gene in murine embryonic stem cells in order to create GSD II mice.

  9. Tumour necrosis factor-alpha gene promoter polymorphism in chronic obstructive pulmonary disease.

    PubMed

    Higham, M A; Pride, N B; Alikhan, A; Morrell, N W

    2000-02-01

    Tumour necrosis factor(TNF)-alpha levels are elevated in airways of patients with chronic obstructive pulmonary disease (COPD) and may contribute to its pathogenesis. A guanine to adenine substitution at position -308 of the TNF-alpha gene promoter (TNF1/2) has been associated with chronic bronchitis of various aetiologies in a Taiwanese population. The authors performed a study investigating association of the polymorphism with smoking-related COPD in Caucasians. Frequencies of TNF1/2 alleles in 86 Caucasians (52 males) with COPD were compared with 63 (52 males) asymptomatic smoker/exsmoker control subjects and a population control of 199 (99 males) blood donors. Genotyping was performed by the polymerase chain reaction-restriction fragment length polymorphism technique on genomic deoxyribonucleic acid (DNA) obtained from peripheral blood. There were no significant differences in TNF1/2 allele frequencies between groups: 0.85/0.15 in COPD, 0.85/0.15 in smoker control subjects, 0.83/0.17 in population control subjects. Within the COPD group there was no association of TNF1/2 alleles with indices of airflow obstruction (% predicted forced expiratory volume in one second (FEV1) and % predicted FEV1/vital capacity ratio) nor gas transfer (% predicted carbon monoxide transfer coefficient and % predicted carbon monoxide diffusing capacity of the lung). It is concluded that: 1) the tumour necrosis factor gene promoter allele does not influence the risk of developing chronic obstructive pulmonary disease in a Caucasian population of smokers; and 2) there is no association of the tumour necrosis factor gene promoter genotype with severity of airflow obstruction nor degree of emphysema in chronic obstructive pulmonary disease.

  10. Inhibition of lipopolysaccharide-induced gene expression by liver X receptor ligands in macrophages involves interference with early growth response factor 1.

    PubMed

    Guillem-Llobat, Paloma; Íñiguez, Miguel A

    2015-05-01

    Liver X receptors (LXRs) are nuclear receptors that act as ligand-dependent transcription factors forming permissive heterodimers with retinoid X receptors (RXRs). In this study we aimed to assess the effect of LXR/RXR activation on the transcriptional induction of pro-inflammatory genes including cyclooxygenase-2 (COX-2) and microsomal prostaglandin E2 synthase-1 (mPGES-1) in activated macrophages. Our study shows that LXR ligands such as oxysterols, GW3965 or TO901317, as well as RXR ligands like 9cis retinoic acid or SR11237, decreased LPS-induced expression of COX-2 and mPGES-1. Consequently, LPS-dependent PGE2 production was substantially reduced in macrophages treated with LXR/RXR ligands. The inhibitory effects of LXR/RXR activation on LPS-induced expression of COX-2 and mPGES-1 in macrophages, occurred by a mechanism involving interference with transcriptional activation of these genes. LXR/RXR activation interfered with the activity of transcription factors essential in the up-regulation of the expression of pro-inflammatory genes in these cells, such as NFκB, but also Egr-1, which had not been previously associated with LXR-mediated gene repression. As this transcription factor is involved in the regulation of a variety of genes involved in inflammatory processes, LXR and RXR-mediated interference with Egr-1 signaling could represent an important event mediating the anti-inflammatory effects of these receptors in macrophages.

  11. The ontogeny of alpha-fetoprotein gene expression in the mouse gastrointestinal tract

    PubMed Central

    1990-01-01

    The ontogeny of alpha-fetoprotein (AFP) gene expression has been examined in the fetal and adult mouse gastrointestinal tract. AFP mRNA constitutes approximately 0.1% of total mRNA in the fetal gut. The transcripts were localized by in situ hybridization to the epithelial cells lining the villi of the fetal gut. At birth, AFP mRNA declines rapidly to achieve low adult basal levels, which are not affected by different alleles of raf, a gene that determines the adult basal level of AFP mRNA in the liver. The basal level in the adult gut is the consequence of continued AFP transcription in a small number of enteroendocrine cells that are distributed infrequently on the villi. These cells were identified by double antibody staining with antibodies to chromogranin A, an enteroendocrine cell marker and AFP. Previous studies resulted in the generation of a line of transgenic mice containing an internally deleted AFP gene that was greatly overexpressed in the fetal gut. The basis for the inappropriately high level expression of the transgene was shown to be the consequence of very high levels of transcription in the epithelial cells of the villi rather than to expression in inappropriate cell types. The cis-acting DNA sequences required for expression of the AFP gene in the gut were investigated using Caco-2 cells, a human colon adenocarcinoma cell line. These experiments indicated that, with one exception, the regulatory elements required in both the promoter and enhancer regions of the gene coincided with those that are necessary for high level expression in the liver. The one exception was enhancer II, located 5 kbp of DNA upstream of the gene, which exhibited no activity in Caco-2 cells. PMID:1691194

  12. Single nucleotide polymorphisms in the insulin-like growth factor 1 (IGF1) gene are associated with growth-related traits in farmed Atlantic salmon

    PubMed Central

    Tsai, H Y; Hamilton, A; Guy, D R; Houston, R D

    2014-01-01

    Understanding the genetic basis of variation in traits related to growth and fillet quality in Atlantic salmon is of importance to the aquaculture industry. Several growth-related QTL have been identified via the application of genetic markers. The IGF1 gene is considered a highly conserved and crucial growth-regulating gene in salmonid species. However, the association between polymorphisms in the IGF1 gene and growth-related traits in Atlantic salmon is unknown. Therefore, in this study, regions of the Atlantic salmon IGF1 gene were sequenced, aligned and compared across individuals. Three SNPs were identified in the putative promoter (SNP1, g.5763G>T; GenBank no. AGKD01012745), intron 1 (SNP2, g.7292C>T; GenBank no. AGKD01012745) and intron 3 (SNP3, g.4671A>C; GenBank no. AGKD01133398) regions respectively. These SNPs were genotyped in a population of 4800 commercial Atlantic salmon with data on several weight and fillet traits measured at harvest (at approximately 3 years of age). In a mixed model, association analysis of individual SNPs, SNP1 and SNP3 were both significantly associated with several weight traits (P < 0.05). The estimated additive effect on overall harvest weight was approximately 35 and 110 g for SNPs 1 and 3 respectively. A haplotype analysis confirmed the association between genetic variation in the IGF1 gene with overall body weight (P < 0.05) and fillet component traits (P < 0.05). Our findings suggest the identified nucleotide polymorphisms of the IGF1 gene may either affect farmed Atlantic salmon growth directly or be in population-wide linkage disequilibrium with causal variation, highlighting their possible utility as candidates for marker-assisted selection in the aquaculture industry. PMID:25090910

  13. Development of a polymerase chain reaction-restriction fragment length polymorphism method for identification of the Fusarium genus using the transcription elongation factor-1α gene.

    PubMed

    Zarrin, Majid; Ganj, Farzaneh; Faramarzi, Sama

    2016-12-01

    Fusarium species are well-known plant pathogens and food contaminants that have also appeared as one of the most important groups of medically significant fungi. The sequences of the translation elongation factor (TEF)-1α gene have been broadly employed for species detection. A total of 50 strains of Fusarium spp., including environmental, clinical and reference isolates were used for the current study. The primer sets, Fu3f and Fu3r, were used to amplify an ~420-bp DNA fragment of the TEF-1α gene. Double digestion with two restriction enzymes, XhoI and SduI was used for discrimination of the Fusarium species in the TEF-1α gene fragment. Double digestion of the TEF-1α gene fragment from five clinically important Fusarium species were clearly differentiated from each other: The F. solani species complex, F. oxysporum species complex, F. verticillioides, F. proliferatum and F. fujikuroi. This method facilitates detection and enables verification of the Fusarium genus; therefore, it may be applied for disease control.

  14. Development of a polymerase chain reaction-restriction fragment length polymorphism method for identification of the Fusarium genus using the transcription elongation factor-1α gene

    PubMed Central

    Zarrin, Majid; Ganj, Farzaneh; Faramarzi, Sama

    2016-01-01

    Fusarium species are well-known plant pathogens and food contaminants that have also appeared as one of the most important groups of medically significant fungi. The sequences of the translation elongation factor (TEF)-1α gene have been broadly employed for species detection. A total of 50 strains of Fusarium spp., including environmental, clinical and reference isolates were used for the current study. The primer sets, Fu3f and Fu3r, were used to amplify an ~420-bp DNA fragment of the TEF-1α gene. Double digestion with two restriction enzymes, XhoI and SduI was used for discrimination of the Fusarium species in the TEF-1α gene fragment. Double digestion of the TEF-1α gene fragment from five clinically important Fusarium species were clearly differentiated from each other: The F. solani species complex, F. oxysporum species complex, F. verticillioides, F. proliferatum and F. fujikuroi. This method facilitates detection and enables verification of the Fusarium genus; therefore, it may be applied for disease control. PMID:28105337

  15. An alpha-amylase inhibitor gene from Phaseolus coccineus encodes a protein with potential for control of coffee berry borer (Hypothenemus hampei).

    PubMed

    de Azevedo Pereira, Railene; Nogueira Batista, João Aguiar; da Silva, Maria Cristina Mattar; Brilhante de Oliveira Neto, Osmundo; Zangrando Figueira, Edson Luiz; Valencia Jiménez, Arnubio; Grossi-de-Sa, Maria Fátima

    2006-09-01

    Plant alpha-amylase inhibitors are proteins found in several plants, and play a key role in natural defenses. In this study, a gene encoding an alpha-amylase inhibitor, named alphaAI-Pc1, was isolated from cotyledons of Phaseolus coccineus. This inhibitor has an enhanced primary structure to P. vulgaris alpha-amylase inhibitors (alpha-AI1 and alpha-AI2). The alphaAI-Pc1 gene, constructed with the PHA-L phytohemaglutinin promoter, was introduced into tobacco plants, with its expression in regenerated (T0) and progeny (T1) transformant plants monitored by PCR amplification, enzyme-linked immunosorbent assay (ELISA) and immunoblot analysis, respectively. Seed protein extracts from selected transformants reacted positively with a polyclonal antibody raised against alphaAI-1, while no reaction was observed with untransformed tobacco plants. Immunological assays showed that the alphaAI-Pc1 gene product represented up to 0.05% of total soluble proteins in T0 plants seeds. Furthermore, recombinant alphaAI-Pc1 expressed in tobacco plants was able to inhibit 65% of digestive H. hampei alpha-amylases. The data herein suggest that the protein encoded by the alphaAI-Pc1 gene has potential to be introduced into coffee plants in order to increase their resistance to the coffee berry borer.

  16. In silico characterization of the neural alpha tubulin gene promoter of the sea urchin embryo Paracentrotus lividus by phylogenetic footprinting.

    PubMed

    Ragusa, Maria Antonietta; Longo, Valeria; Emanuele, Marco; Costa, Salvatore; Gianguzza, Fabrizio

    2012-03-01

    During Paracentrotus lividus sea urchin embryo development one alpha and one beta tubulin genes are expressed specifically in the neural cells and they are early end output of the gene regulatory network that specifies the neural commitment. In this paper we have used a comparative genomics approach to identify conserved regulatory elements in the P. lividus neural alpha tubulin gene. To this purpose, we have first isolated a genomic clone containing the entire gene plus 4.5 Kb of 5' upstream sequences. Then, we have shown by gene transfer experiments that its non-coding region drives the spatio-temporal gene expression corresponding substantially to that of the endogenous gene. In addition, we have identified by genome and EST sequence analysis the S. purpuratus alpha tubulin orthologous gene and we propose a revised annotation of some tubulin family members. Moreover, by computational techniques we delineate at least three putative regulatory regions located both in the upstream region and in the first intron containing putative binding sites for Forkhead and Nkx transcription factor families.

  17. Enzymes that hydrolyze adenine nucleotides in platelets and polymorphisms in the alpha2 gene of integrin alpha2beta1 in patients with von Willebrand disease.

    PubMed

    Santos, Karen Freitas; Battisti, Vanessa; Corrêa, Maísa de Carvalho; Mann, Thaís Rapachi; Pereira, Renata da Silva; Araújo, Maria do Carmo; Brülê, Alice Odete; Schetinger, Maria Rosa Chitolina; Morsch, Vera Maria

    2010-07-01

    Von Willebrand disease (VWD) is one of the most common inherited bleeding diseases caused by a qualitative or quantitative deficiency of the von Willebrand factor (FvW). FvW is a multimeric glycoprotein synthesized by megakaryocytes and endothelial cells and it is present in the subendothelial matrix, blood plasma, platelets, and endothelium. This glycoprotein plays an important role in thrombus formation by initiating platelet adhesion to sites of injury as well as platelet aggregation. The aim of this study was to evaluate the activities of enzymes that hydrolyze adenine nucleotides in platelets, ristocetin-induced platelet aggregation (RIPA), and polymorphisms of the alpha2 gene of alpha2beta1 integrin from VWD patients. Platelet nucleoside triphosphate diphosphohydrolase (NTPDase), 5'-nucleotidase, and ecto-nucleotide pyrophosphatase/phosphodiesterase (E-NPP) activities were verified in 14 VWD patients. For RIPA determination, a final concentration of 1.25 mg/ml of ristocetin was used. Polymorphisms of the alpha2 gene were analyzed through PCR. Platelet NTPDase and E-NPP were decreased in VWD patients. 5'-Nucleotidase activity was not statistically significant between controls and VWD patients. RIPA was significantly reduced, with an allelic frequency of 78.57% for 807C in VWD patients. Our results indicated reduced platelet NTPDase and E-NPP activities which might be related to the low platelet adhesiveness. The prevalence of the 807C allele might account for the variability in bleeding in VWD.

  18. NF-E2-related factor 1 (Nrf1) serves as a novel regulator of hepatic lipid metabolism through regulation of the Lipin1 and PGC-1β genes.

    PubMed

    Hirotsu, Yosuke; Hataya, Nami; Katsuoka, Fumiki; Yamamoto, Masayuki

    2012-07-01

    Hepatic lipid metabolism is under elaborate regulation, and perturbations in this regulatory process at the transcriptional level lead to pathological conditions. NF-E2-related factor 1 (Nrf1) is a member of the cap'n'collar (CNC) transcription factor family. Hepatocyte-specific Nrf1 gene conditional-knockout mice are known to develop hepatic steatosis, but it remains unclear how Nrf1 contributes to the lipid homeostasis. Therefore, in this study we examined the gene expression profiles of Nrf1-deficient mouse livers. A pathway analysis based on the profiling results revealed that the levels of expression of the genes related to lipid metabolism, amino acid metabolism, and mitochondrial respiratory function were decreased in Nrf1-deficient mouse livers, indicating the profound effects that the Nrf1 deficiency conferred to various metabolic pathways. We discovered that the Nrf1 deficiency leads to the reduced expression of the transcriptional coactivator genes Lipin1 and PGC-1β (for peroxisome proliferator-activated receptor γ coactivator 1β). Chromatin immunoprecipitation analyses showed that Nrf1 binds to the antioxidant response elements (AREs) in regulatory regions of the Lipin1 and PGC-1β genes and the binding of Nrf1 to the AREs activates reporter gene transcription. These results thus identified Nrf1 to be a novel regulator of the Lipin1 and PGC-1β genes, providing new insights into the Nrf1 function in hepatic lipid metabolism.

  19. Spectrum of alpha-globin gene mutations among premarital Baluch couples in southeastern Iran

    PubMed Central

    Miri-Moghaddam, Ebrahim; Nikravesh, Abass; Gasemzadeh, Negin; Badaksh, Mahin; Rakhshi, Nahid

    2015-01-01

    Background: Alpha thalassemia (α-thal) is one of the most common hemoglobinopathies worldwide. The aim of this study was to investigate the spectrum of α-thal mutations among premarital Baluch couples in southeastern Iran. Subjects and Methods: We assessed 1215 individuals by multiplex gap polymerase chain reaction (gap-PCR) and amplification refractory mutation system (ARMS-PCR). Results: Of the 1215 participants with mean age of 23±5.7 years, 62.3% lived in urban areas, and the rate of consanguineous marriage was 68.1%. Five mutations were identified, the most frequent one was –α3.7 (rightward) with a frequency of 76.5%, followed by α−5 nt (16.8%), α2/ Codon 19(-G) (4%), –α4.2 (leftward)(2.4%), – –MED (0.3%) among mutated alleles of the α -globin gene. Conclusion : Knowing the alpha-genotype is helpful for genetic counseling, microcytic anemia discrimination and hemoglobinopathy prevention. PMID:26261699

  20. PPAR{alpha} does not suppress muscle-associated gene expression in brown adipocytes but does influence expression of factors that fingerprint the brown adipocyte

    SciTech Connect

    Walden, Tomas B.; Petrovic, Natasa; Nedergaard, Jan

    2010-06-25

    Brown adipocytes and myocytes develop from a common adipomyocyte precursor. PPAR{alpha} is a nuclear receptor important for lipid and glucose metabolism. It has been suggested that in brown adipose tissue, PPAR{alpha} represses the expression of muscle-associated genes, in this way potentially acting to determine cell fate in brown adipocytes. To further understand the possible role of PPAR{alpha} in these processes, we measured expression of muscle-associated genes in brown adipose tissue and brown adipocytes from PPAR{alpha}-ablated mice, including structural genes (Mylpf, Tpm2, Myl3 and MyHC), regulatory genes (myogenin, Myf5 and MyoD) and a myomir (miR-206). However, in our hands, the expression of these genes was not influenced by the presence or absence of PPAR{alpha}, nor by the PPAR{alpha} activator Wy-14,643. Similarly, the expression of genes common for mature brown adipocyte and myocytes (Tbx15, Meox2) were not affected. However, the brown adipocyte-specific regulatory genes Zic1, Lhx8 and Prdm16 were affected by PPAR{alpha}. Thus, it would not seem that PPAR{alpha} represses muscle-associated genes, but PPAR{alpha} may still play a role in the regulation of the bifurcation of the adipomyocyte precursor into a brown adipocyte or myocyte phenotype.

  1. Genetic polymorphism of estrogen receptor alpha gene in Egyptian women with type II diabetes mellitus

    PubMed Central

    Motawi, Tarek M.K.; El-Rehany, Mahmoud A.; Rizk, Sherine M.; Ramzy, Maggie M.; el-Roby, Doaa M.

    2015-01-01

    Estrogen might play an important role in type 2 diabetes mellitus pathogenesis. A number of polymorphisms have been reported in the estrogen receptor alpha gene including the XbaI and PvuII restriction enzyme polymorphisms. The aim of this study was to determine if ESRα gene polymorphisms are associated with type 2 diabetes mellitus and correlated with lipid profile. Ninety diabetic Egyptian patients were compared with forty healthy controls. ESRα genotyping of PvuII and XbaI was performed using restriction fragment length polymorphism analysis. Our study showed that there is more significant difference in the frequency of C and G polymorphic allele between patients and control groups in PvuII and XbaI respectively. Also carriers of minor C and G alleles of PvuII and XbaI gene polymorphisms were associated with increased fasting blood glucose and disturbance in lipid profile as there is an increase in total cholesterol, triglycerides and Low density lipoprotein. So findings of present study suggest the possibility that PvuII and XbaI polymorphisms in ERα are related to T2DM and with increased serum lipids among Egyptian population. PMID:26401488

  2. Estrogen receptor alpha gene amplification in breast cancer: 25 years of debate.

    PubMed

    Holst, Frederik

    2016-04-10

    Twenty-five years ago, Nembrot and colleagues reported amplification of the estrogen receptor alpha gene (ESR1) in breast cancer, initiating a broad and still ongoing scientific debate on the prevalence and clinical significance of this genetic aberration, which affects one of the most important genes in breast cancer. Since then, a multitude of studies on this topic has been published, covering a wide range of divergent results and arguments. The reported prevalence of this alteration in breast cancer ranges from 0% to 75%, suggesting that ESR1 copy number analysis is hampered by technical and interpreter issues. To date, two major issues related to ESR1 amplification remain to be conclusively addressed: (1) The extent to which abundant amounts of messenger RNA can mimic amplification in standard fluorescence in situ hybridization assays in the analysis of strongly expressed genes like ESR1, and (2) the clinical relevance of ESR1 amplification: Such relevance is strongly disputed, with data showing predictive value for response as well as for resistance of the cancer to anti-estrogen therapies, or for subsequent development of cancers in the case of precursor lesions that display amplification of ESR1. This review provides a comprehensive summary of the various views on ESR1 amplification, and highlights explanations for the contradictions and conflicting data that could inform future ESR1 research.

  3. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans

    PubMed Central

    Shahin-jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-mohammadi, Shahla

    2015-01-01

    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence. PMID:27081370

  4. The cAMP Response Element Binding protein (CREB) is activated by Insulin-like Growth Factor-1 (IGF-1) and regulates myostatin gene expression in skeletal myoblast

    SciTech Connect

    Zuloaga, R.; Fuentes, E.N.; Molina, A.; Valdés, J.A.

    2013-10-18

    Highlights: •IGF-1 induces the activation of CREB via IGF-1R/PI3K/PLC signaling pathway. •Calcium dependent signaling pathways regulate myostatin gene expression. •IGF-1 regulates myostatin gene expression via CREB transcription in skeletal myoblast. -- Abstract: Myostatin, a member of the Transforming Growth Factor beta (TGF-β) superfamily, plays an important role as a negative regulator of skeletal muscle growth and differentiation. We have previously reported that IGF-1 induces a transient myostatin mRNA expression, through the activation of the Nuclear Factor of Activated T cells (NFAT) in an IP{sub 3}/calcium-dependent manner. Here we examined the activation of CREB transcription factor as downstream targets of IGF-1 during myoblast differentiation and its role as a regulator of myostatin gene expression. In cultured skeletal myoblast, IGF-1 induced the phosphorylation and transcriptional activation of CREB via IGF-1 Receptor/Phosphatidylinositol 3-Kinase (PI3K)/Phospholipase C gamma (PLC γ), signaling pathways. Also, IGF-1 induced calcium-dependent molecules such as Calmodulin Kinase II (CaMK II), Extracellular signal-regulated Kinases (ERK), Protein Kinase C (PKC). Additionally, we examined myostatin mRNA levels and myostatin promoter activity in differentiated myoblasts stimulated with IGF-1. We found a significant increase in mRNA contents of myostatin and its reporter activity after treatment with IGF-1. The expression of myostatin in differentiated myoblast was downregulated by the transfection of siRNA–CREB and by pharmacological inhibitors of the signaling pathways involved in CREB activation. By using pharmacological and genetic approaches together these data demonstrate that IGF-1 regulates the myostatin gene expression via CREB transcription factor during muscle cell differentiation.

  5. Comparative quantification of pharmacodynamic parameters of chiral compounds (RRR- vs. all-rac-alpha tocopherol) by global gene expression profiling.

    PubMed

    Muller, Patrick Y; Netscher, Thomas; Frank, Jan; Stoecklin, Elisabeth; Rimbach, Gerald; Barella, Luca

    2005-07-01

    Pharmacologically active compounds (e.g. from the groups of pharmaceutical drugs, cofactors or vitamins) often consist of two or more stereoisomers (enantiomers or diastereoisomers) which may differ in their pharmacodynamic/kinetic, toxicological and biological properties. A well-known example is vitamin E which is predominantly administered as two different forms, one derived from natural sources (mainly soybeans), and one from production by chemical total-synthesis. While vitamin E from natural sources occurs as a single stereoisomer (RRR-alpha-tocopherol), synthetic vitamin E (all-rac-alpha-tocopherol) is an equimolar mixture of eight stereoisomers. Based on a number of animal studies it has been suggested that the biological potency of natural-source vitamin E is 1.36 greater compared to its counterpart produced by chemical synthesis. In this study, we have used the Affymetrix GeneChip technology to evaluate the feasibility of a new bio-assay where the gene regulatory activities of RRR-alpha-tocopherol and all-rac-alpha-tocopherol were quantified and compared on the genome-wide level. For this purpose, HepG2 cells were supplemented with increasing amounts of RRR- or all-rac-alpha-tocopherol for 7 days. Genes showing a dose-related induction/repression were identified by global gene expression profiling. Our findings show that RRR- and all-rac-alpha-tocopherol share an identical transcriptional activity, i.e. induce/repress the expression of the same set of genes. Based on the transcriptional dose-response data, EC50 and IC50 values were determined for each of these genes. The feasibility of calculating a "transcriptional potency factor" of RRR- vs. all-rac-e-tocopherol was evaluated by dividing the EC50/IC50 of RRR-alpha-tocopherol by the corresponding EC50/IC50 of all-rac-alpha-tocopherol for every of the vitamin E responsive genes. Using this approach we have calculated 215 single biopotency ratios. Subsequently, the mean of all potency ratios was found to be

  6. Sanfilippo syndrome type B: cDNA and gene encoding human {alpha}-N-acetylglucosaminidase

    SciTech Connect

    Zhao, H.G.; Lopez, R.; Rennecker, J.

    1994-09-01

    Deficiency of the lysosomal enzyme {alpha}-N-acetlyglucosaminidase underlies the type B Sanfilippo syndrome (MPS III B), a mucopolysaccharide storage disease with profound neurologic deterioration. We are acquiring tools to study the molecular basis of the disorder. The enzyme was purified from bovine testis; after ConA-, DEAE- and phenyl-Sepharose chromatography, it was subjected to SDS-PAGE without preheating. Of two bands of activity detected on the gel, 170 kDa and 87 kDa, the larger one, which coincided with a well-defined Coomassie blue band, was selected for sequence analysis. Degenerate 17-base oligonucleotides, corresponding to the ends of an internal 23 amino acid sequence, were used for RT-PCR of RNA from human fibroblasts. A 41-mer was synthesized from the sequence of the RT-PCR product and used to screen a human testis cDNA library. A number of cDNA inserts were isolated, all lacking the 5{prime} end and none longer than 1.7 kb. An additional 300 bp segment has been obtained by RACE. The cDNA sequence accounts for 9 of 11 peptides, allowing for species difference. Northern analysis of fibroblast RNA with a 1.5 kb cDNA probe showed the presence of a 3 kb mRNA; marked deficiency of this mRNA in two MPS III B fibroblast lines confirmed the authenticity of the cloned cDNA. While no homologous amino acid sequence has been found in a search of GenBank, the nucleotide sequence (interrupted by 4 introns) is present in a flanking region upstream of an unrelated gene on chromosome 17q11-21 (human 17{beta}-hydroxysteroid dehydrogenase). This must therefore be the chromosomal locus of the {alpha}-N-acetylglucosaminidase gene and of MPS III B.

  7. Cooperative signaling by alpha 5 beta 1 and alpha 4 beta 1 integrins regulates metalloproteinase gene expression in fibroblasts adhering to fibronectin

    PubMed Central

    1995-01-01

    Rabbit synovial fibroblasts (RSF) express basal levels of the metalloproteinases (MMP) collagenase, stromelysin-1 and 92-kD gelatinase when plated on intact fibronectin (FN), but elevated levels when plated on either the central RGD-containing cell-binding region of FN (120FN) or antibody against the alpha 5 beta 1 integrin, suggesting that domains outside 120FN may suppress the induction of MMP (Werb, Z., P. M. Tremble, O. Behrendtsen, E. Crowley, and C.H. Damsky. 1989. J. Cell Biol. 109:877-889). We therefore attempted to reconstitute the basal signaling of intact FN by plating RSF on 120FN together with domains of FN outside this region. Large COOH-terminal fragments containing both the heparin-binding and HICS domains suppressed MMP when combined with 120FN. To map the active sequences, peptides from this region and larger fragments that did, or did not, include the CS-1 portion of IIICS were tested. Only CS-1 peptide, or larger fragments containing CS-1, suppressed MMP expression induced by 120FN. In contrast, peptide V from the heparin-binding region, shown previously to stimulate focal contact formation, further enhanced MMP expression by RSF when present on the substrate with 120FN. RSF expressed alpha 4 beta 1 integrin, the receptor for CS-1, and the anti-alpha 4 mAb blocked the ability of CS-1 to suppress MMP induction by 120FN. These results show that signals modulating MMP expression and focal contact assembly are regulated independently, and that cooperative signaling by alpha 5 beta 1 and alpha 4 beta 1 integrins plays a dominant role in regulating expression of these extracellular matrix-remodeling genes in response to FN. This work demonstrates directly the modular way in which information in the extracellular matrix is detected and processed by cell surface receptors. PMID:7537277

  8. Hypoxia inducible factor-1α-mediated gene activation in the regulation of renal medullary function and salt sensitivity of blood pressure

    PubMed Central

    Li, Ningjun

    2012-01-01

    Many enzymes that produce natriuretic factors such as nitric oxide synthase (NOS), hemeoxygenase-1 (HO-1) and cyclooxygenase-2 (COX-2) are highly expressed in the renal medulla. These enzymes in the renal medulla are up-regulated in response to high salt intake. Inhibition of these enzymes within the renal medulla reduces sodium excretion and increases salt sensitivity of arterial blood pressure, indicating that these enzymes play important roles in kidney salt handling and renal adaptation to high salt challenge. However, it remains a question what mechanisms mediate the activation of these enzymes in response to high salt challenge in the renal medulla. Interestingly, these enzymes are oxygen sensitive genes and regulated by transcription factor hypoxia-inducible factor (HIF)-1α. Our recent serial studies have demonstrated that: 1) High salt intake stimulates HIF-1α-mediated gene expression, such as NOS, HO-1 and COX-2, in the renal medulla, which may augment the production of different antihypertensive factors in the renal medulla, mediating renal adaptation to high salt intake and regulating salt sensitivity of arterial blood pressure. 2) HIF prolyl-hydroxylase 2 (PHD2), an enzyme that promotes the degradation of HIF-1α, is highly expressed in renal medulla. High salt intake suppresses the expression of PHD2 in the renal medulla, which increases HIF-1α-mediated gene expressions in the renal medulla, thereby participates in the control of salt sensitivity of blood pressure. 3) The high salt-induced inhibition in PHD2 and the consequent activation of HIF-1α in the renal medulla is not observed in Dahl salt sensitive hypertensive (Dahl/ss) rats. Correction of these defects in PHD2/HIF-1α-associated molecular adaptation in the renal medulla improves sodium excretion, reduces sodium retention and attenuates saltsensitive hypertension in Dahl/ss rats. In conclusion, PHD2 regulation of HIF-1α-mediated gene activation in the renal medulla is an important

  9. Distinct functions for thyroid hormone receptors alpha and beta in brain development indicated by differential expression of receptor genes.

    PubMed Central

    Forrest, D; Hallböök, F; Persson, H; Vennström, B

    1991-01-01

    Thyroid hormones are essential for correct brain development, and since vertebrates express two thyroid hormone receptor genes (TR alpha and beta), we investigated TR gene expression during chick brain ontogenesis. In situ hybridization analyses showed that TR alpha mRNA was widely expressed from early embryonic stages, whereas TR beta was sharply induced after embryonic day 19 (E19), coinciding with the known hormone-sensitive period. Differential expression of TR mRNAs was striking in the cerebellum: TR beta mRNA was induced in white matter and granule cells after the migratory phase, suggesting a main TR beta function in late, hormone-dependent glial and neuronal maturation. In contrast, TR alpha mRNA was expressed in the earlier proliferating and migrating granule cells, and in the more mature granular and Purkinje cell layers after hatching, indicating a role for TR alpha in both immature and mature neural cells. Surprisingly, both TR genes were expressed in early cerebellar outgrowth at E9, before known hormone requirements, with TR beta mRNA restricted to the ventricular epithelium of the metencephalon and TR alpha expressed in migrating cells and the early granular layer. The results implicate TRs with distinct functions in the early embryonic brain as well as in the late phase of hormone requirement. Images PMID:1991448

  10. Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4-8- alpha/beta T cells demonstrates preferential use of several V beta genes and an invariant TCR alpha chain

    PubMed Central

    1993-01-01

    CD4-CD8- (double negative [DN]) alpha/beta T cells are a largely uncharacterized subpopulation of unknown function. To investigate whether these cells are selected to recognize particular antigens or antigen-presenting molecules, DN alpha/beta T cells were purified from the peripheral blood of five normal donors and their T cell receptor (TCR) alpha and beta chains were examined. Random cloning of TCR alpha chains by single-sided polymerase chain reaction (PCR) amplification identified an invariant rearrangement between V alpha 24 and J alpha Q, with no N region diversity, which was expressed preferentially by DN alpha/beta T cells from all donors. Random cloning also identified a precise V alpha 7.2-J alpha (IGRJa14) rearrangement, with two variable amino acids encoded in the V-J junction, which was enriched in the DN alpha/beta T cell preparations from some, but not all, donors. Analysis of TCR beta chains by quantitative PCR amplification demonstrated that the expression of four V beta gene families, V beta 2, 8, 11, and 13, was markedly increased in these DN alpha/beta T cell preparations. The expression of particular TCRs by DN alpha/beta T cells from multiple donors indicates that these cells, or at least a subpopulation of cells with this phenotype, recognize a limited spectrum of antigens and suggests that they may use nonpolymorphic antigen-presenting molecules. PMID:8391057

  11. Phenotype of a patient with a de novo mutation in the hepatocyte nuclear factor 1beta/maturity-onset diabetes of the young type 5 gene.

    PubMed

    Mayer, Christof; Böttcher, Yvonne; Kovacs, Peter; Halbritter, Jan; Stumvoll, Michael

    2008-03-01

    Mutations in the gene encoding the transcription factor hepatocyte nuclear factor (HNF) 1beta cause various phenotypes including maturity-onset diabetes of the young type 5 (MODY5) and kidney disease. We provide molecular and pathophysiologic characterization of a 23-year-old male patient with clinical presentation typical for MODY5 with renal involvement. Clinical studies (including intravenous glucose tolerance test and magnetic resonance imaging) of the patient and 5 family members in comparison with unrelated control subjects and molecular analysis of the HNF-1beta gene (direct sequencing, paternity testing, and restriction fragment length polymorphism analysis for parental mosaicism) were performed. The patient was born with low birth weight (2250 g), whereas his dizygotic twin sister was of normal weight (3500 g) and healthy. He had cystic renal dysplasia with progressive renal failure and pancreas atrophy with beta-cell dysfunction and early-onset diabetes mellitus but no family history of diabetes. Intravenous glucose tolerance test showed a markedly reduced but not absent acute insulin response compared with controls (n = 6). A mutation in the HNF-1beta gene S148L (C443T) in exon 2 within the pseudo-POU domain was identified. All other family members and the control group (n = 255) did not have the mutation, suggesting that we described a de novo mutation in HNF-1beta. Paternity was confirmed, and no signs of mosaicism in DNA analysis of both parents could be detected. Of note, the low birth weight of the patient in contrast to his healthy twin sister provides interesting support for the fetal insulin hypothesis for reduced birth weight.

  12. A single gene codes for the nicotinic acetylcholine receptor alpha-subunit in Torpedo marmorata: structural and developmental implications.

    PubMed Central

    Klarsfeld, A; Devillers-Thiéry, A; Giraudat, J; Changeux, J P

    1984-01-01

    We have used Southern blot hybridization to analyze the genomic structure encoding the alpha-subunit of the acetylcholine receptor (AChR) in Torpedo marmorata, with cDNA probes isolated from the electric organ. Four different radiolabelled probes, corresponding to various parts of the alpha-subunit mRNA, hybridized to several genomic fragments of T. marmorata DNA generated by digestion with the restriction enzymes SstI, PvuII and PstI. The same hybridization pattern was observed after washing the blots under low- or high-stringency conditions. As a check for detection sensitivity of heterologous sequences, the same probes were hybridized to PvuII-digested chicken DNA, revealing bands at low stringency which disappeared at higher stringencies. Unambiguously, two of our probes (one of them entirely within the coding region) hybridized to a single genomic fragment from T. marmorata DNA. This feature, as well as the results of an extensive study of the whole hybridization pattern, points towards the uniqueness of alpha-subunit-specific sequences in the genome of T. marmorata. Since overall more bands were found than expected from the cDNA sequence, this alpha-subunit gene must be split by several introns (at least four, possibly more). The length of this gene is at least 20 kb. The existence of a single alpha-subunit gene is consistent with the absence of chemical heterogeneity in the NH2-terminal sequence of the purified alpha-chain, and supports the view that the two alpha-chains belonging to one AChR oligomer have an identical primary structure. It also suggests that localization and stabilization of the AChR in well-defined post-synaptic areas of T. marmorata electric organ basically relies, during development, on 'epigenetic' mechanisms. Images Fig. 2. Fig. 3. Fig. 4. PMID:6323168

  13. Human fibroblast growth factor 1 gene expression in vascular smooth muscle cells is modulated via an alternate promoter in response to serum and phorbol ester.

    PubMed Central

    Chotani, M A; Payson, R A; Winkles, J A; Chiu, I M

    1995-01-01

    We have previously isolated the human FGF-1 gene in order to elucidate the molecular basis of its gene expression. The gene spans over 100 kbp and encodes multiple transcripts expressed in a tissue- and cell-specific manner. Two variants of FGF-1 mRNA (designated FGF-1.A and 1.B), which differ in their 5' untranslated region, were identified in our laboratory. Recently, two novel variants of FGF-1 mRNA (designated FGF-1.C and 1.D) have been isolated. In this study we used RNase protection assays to demonstrate expression of FGF-1.D mRNA in human fibroblasts and vascular smooth muscle cells and to show that promoter 1D has multiple transcription start sites. A single-strand nuclease-sensitive region has also been identified in the promoter 1D region that may have implications in chromatin conformation and transcriptional regulation of this promoter. Using Northern blot hybridization analyses, a previous study demonstrated a significant increase of FGF-1 mRNA levels in cultured saphenous vein smooth muscle cells in response to serum and phorbol ester. Here we confirm these results by RNase protection analysis and show that FGF-1.C mRNA is significantly increased in response to these stimuli. RNase protection assays indicate that promoter 1C has one major start site. The phorbol ester effect suggests that a protein kinase C-dependent signalling pathway may be involved in this phenomenon. Our results point to a dual promoter usage of the FGF-1 gene in vascular smooth muscle cells. Thus, normal growing cells primarily utilize promoter 1D. In contrast, quiescent cells, when exposed to serum or phorbol ester, utilize a different FGF-1 promoter, namely promoter 1C. Overall, these phenomena suggest mechanisms for increased production of FGF-1 that may play a role in inflammatory settings, wound healing, tissue repair, and neovascularization events and processes via autocrine and paracrine mechanisms. Our findings suggest that different FGF-1 promoters may respond to

  14. Role of the interferon-inducible IFI16 gene in the induction of ICAM-1 by TNF-alpha.

    PubMed

    Sponza, Simone; De Andrea, Marco; Mondini, Michele; Gugliesi, Francesca; Gariglio, Marisa; Landolfo, Santo

    2009-01-01

    The Interferon-inducible gene IFI16, a member of the HIN200 family, is activated by oxidative stress and cell density, in addition to Interferons, and it is implicated in the regulation of endothelial cell proliferation and vessel formation in vitro. We have previously shown that IFI16 is required for proinflammatory gene stimulation by IFN-gamma through the NF-kappaB complex. To examine whether IFI16 induction might be extended to other proinflammatory cytokines such as tumor necrosis factor (TNF)-alpha, we used the strategy of the RNA interference to knock down IFI16 expression, and analyze the capability of TNF-alpha to stimulate intercellular adhesion molecule-1 (ICAM-1 or CD54) expression in the absence of functional IFI16. Our studies demonstrate that IFI16 mediates ICAM-1 stimulation by TNF-alpha through the NF-kappaB pathway, thus reinforcing the role of the IFI16 molecule in the inflammation process.

  15. Functional identification of the promoter for the gene encoding the alpha subunit of calcium/calmodulin-dependent protein kinase II.

    PubMed Central

    Olson, N J; Massé, T; Suzuki, T; Chen, J; Alam, D; Kelly, P T

    1995-01-01

    To examine the expression of the alpha subunit of calcium/calmodulin-dependent protein kinase II, various 5' flanking genomic sequences were inserted into a chloramphenicol acetyltransferase (CAT) reporter plasmid and CAT enzyme activities were analyzed in transfected NB2a neuroblastoma cells and mRNA transcription was analyzed by nuclease protection assays. A core promoter was identified which contained an essential TATA element located 162 nt 5' to the transcription start site. Sequences 3' to the transcription start site, as well as 5' to the TATA element, increased levels of CAT activity in transfected cells. The alpha-subunit gene promoter displayed higher CAT activities, relative to a simian virus 40 promoter, in transfected neuronal cell lines than in nonneuronal cell lines. Results also suggested that sequence surrounding the natural alpha-gene transcription initiation site may be important for targeting transcription initiation 162 nt downstream of its TATA element. Images Fig. 1 Fig. 3 PMID:7878035

  16. Rapid renal alpha-1 antitrypsin gene induction in experimental and clinical acute kidney injury.

    PubMed

    Zager, Richard A; Johnson, Ali C M; Frostad, Kirsten B

    2014-01-01

    Alpha-1-antitrypsin (AAT) is a hepatic stress protein with protease inhibitor activity. Recent evidence indicates that ischemic or toxic injury can evoke selective changes within kidney that resemble a hepatic phenotype. Hence, we tested the following: i) Does acute kidney injury (AKI) up-regulate the normally renal silent AAT gene? ii) Does rapid urinary AAT excretion result? And iii) Can AAT's anti-protease/anti-neutrophil elastase (NE) activity protect injured proximal tubule cells? CD-1 mice were subjected to ischemic or nephrotoxic (glycerol, maleate, cisplatin) AKI. Renal functional and biochemical assessments were made 4-72 hrs later. Rapidly following injury, 5-10 fold renal cortical and isolated proximal tubule AAT mRNA and protein increases occurred. These were paralleled by rapid (>100 fold) increases in urinary AAT excretion. AKI also induced marked increases in renal cortical/isolated proximal tubule NE mRNA. However, sharp NE protein levels declines resulted, which strikingly correlated (r, -0.94) with rising AAT protein levels (reflecting NE complexing by AAT/destruction). NE addition to HK-2 cells evoked ∼95% cell death. AAT completely blocked this NE toxicity, as well as Fe induced oxidant HK-2 cell attack. Translational relevance of experimental AAT gene induction was indicated by ∼100-1000 fold urinary AAT increases in 22 AKI patients (matching urine NGAL increases). We conclude: i) AKI rapidly up-regulates the renal cortical/proximal tubule AAT gene; ii) NE gene induction also results; iii) AAT can confer cytoprotection, potentially by blocking/reducing cytotoxic NE accumulation; and iv) marked increases in urinary AAT excretion in AKI patients implies clinical relevance of the AKI- AAT induction pathway.

  17. Transgenic analysis of the thyroid-responsive elements in the alpha-cardiac myosin heavy chain gene promoter.

    PubMed

    Subramaniam, A; Gulick, J; Neumann, J; Knotts, S; Robbins, J

    1993-02-25

    The role of two putative, cis-acting thyroid hormone-responsive elements, TRE1 and TRE2, located at -129 to -149 and -102 to -120, respectively, on the murine alpha-myosin heavy chain (MHC) gene, has been investigated in transgenic mice. These motifs are present in a 4.5-kilobase fragment lying upstream of the transcriptional start site of the mouse alpha-MHC gene: this fragment directs appropriate expression of a reporter gene in transgenic mice (Subramaniam, A., Jones, W. K., Gulick, J., Wert, S., Neumann, J., and Robbins, J. (1991) J. Biol. Chem. 266, 24613-24620). Here, we independently mutate the TRE1 and TRE2 elements by base substitution. The mice were analyzed for transgene expression in different muscle and non-muscle tissues including the atria and ventricles. Normal levels of transgene expression were observed in euthyroid mice carrying a mutation in TRE1. In contrast to these results, mice in which TRE2 was mutated showed reduced levels of CAT activity in both the atria and ventricles, suggesting a previously undefined role for this element in the constitutive up-regulation of the alpha-MHC gene. In hypothyroid mice carrying either of these mutations, the complete cessation of ventricular expression of the chloramphenicol acetyltransferase transcripts that takes place in the alpha-5.5 (wild type) animals did not occur.

  18. A novel Y243S mutation in the pyruvate dehydrogenase El alpha gene subunit: correlation with thiamine pyrophosphate interaction.

    PubMed

    Benelli, C; Fouque, F; Redonnet-Vernhet, I; Malgat, M; Fontan, D; Marsac, C; Dey, R

    2002-08-01

    We identified a new Y243S mutation in the X-linked E1 alpha-PDH gene in a patient with pyruvate dehydrogenase complex (PDHc) deficiency. The activity in cultured fibroblasts was very low even in the presence of high thiamine pyrophosphate (TPP) concentrations, indicating that the defect could be due to decreased affinity of PDHc for TPP.

  19. Localization of an alpha-amanitin resistance mutation in the gene encoding the largest subunit of mouse RNA polymerase II.

    PubMed Central

    Bartolomei, M S; Corden, J L

    1987-01-01

    RNA polymerase II is inhibited by the mushroom toxin alpha-amanitin. A mouse BALB/c 3T3 cell line was selected for resistance to alpha-amanitin and characterized in detail. This cell line, designated A21, was heterozygous, possessing both amanitin-sensitive and -resistant forms of RNA polymerase II; the mutant form was 500 times more resistant to alpha-amanitin than the sensitive form. By using the wild-type mouse RNA polymerase II largest subunit (RPII215) gene (J.A. Ahearn, M.S. Bartolomei, M. L. West, and J. L. Corden, submitted for publication) as the probe, RPII215 genes were isolated from an A21 genomic DNA library. The mutant allele was identified by its ability to transfer amanitin resistance in a transfection assay. Genomic reconstructions between mutant and wild-type alleles localized the mutation to a 450-base-pair fragment that included parts of exons 14 and 15. This fragment was sequenced and compared with the wild-type sequence; a single AT-to-GC transition was detected at nucleotide 6819, corresponding to an asparagine-to-aspartate substitution at amino acid 793 of the predicted protein sequence. Knowledge of the position of the A21 mutation should facilitate the study of the mechanism of alpha-amanitin resistance. Furthermore, the A21 gene will be useful for studying the phenotype of site-directed mutations in the RPII215 gene. Images PMID:3821724

  20. T cell receptor gene usage in the response to lambda repressor cI protein. An apparent bias in the usage of a V alpha gene element

    PubMed Central

    1988-01-01

    The T cell response to the lambda repressor cI protein is directed to the same region of the protein (residues 12-26) in both BALB/c and A/J mice. A panel of T cell hybridomas specific for P12-26 in the context of either I-Ek or I-Ad have been isolated To further understand the molecular interaction between the TCR and the Ia-P12-26 complex, the primary structures of the TCR of five T cell hybridomas have been determined. Southern and Northern analyses indicate that two members of the V alpha 3 gene family are used by 13 out of 14 I-Ek-restricted T cells. Four different V beta genes are used by these T cell hybridomas, while the majority (8 out of 13) express V beta 1 in combination with the J beta 2.1 element. No clear correlation can be seen in this system between gene usage and MHC restriction. In addition, the fine specificity of I-Ek-restricted T cells to a single amino acid substitution [Phe22/His22]P12-26 is not attributed to the usage of particular V alpha and V beta elements. The V alpha 3 family gene is also used by a few I-Ad-restricted T cells. Interestingly, these I-Ad T cells share a reactivity pattern more similar to that of I-Ek- restricted T cells than other I-Ad-restricted T cells. The nonrandom selection V alpha 3 is also demonstrated by the fact that V alpha 3 is used by P12-26-specific, but not by cytochrome c- or staphylococcal nucleus-specific, I-Ek-restricted T cells. This suggests that although antigen specificity may not be accounted for by either chain of the TCR, the members of V alpha 3 genes may be selected by the antigen (P12- 26). PMID:2971753

  1. Reduction in breast cancer susceptibility due to XbaI gene polymorphism of alpha estrogen receptor gene in Jordanians

    PubMed Central

    Atoum, Manar Fayiz; Alzoughool, Foad

    2017-01-01

    Breast cancer is a global health concern among women worldwide. Estrogen receptor alpha (ERα) mediates diverse polymorphic effects in breast tissues that may relate to breast cancer susceptibility. The aim of this study was to evaluate the effect of −397 PvuII (T/C) and −351 XbaI (A/G) restriction fragment length polymorphism within intron 1 of ERα, and its effect on breast cancer susceptibility. A total of 156 women who were histopathologically diagnosed with breast cancer and 142 healthy Jordanian women were enrolled in this case–control study. Genomic DNA was extracted from whole peripheral blood, and the desired fragment was amplified using polymerase chain reaction followed by restriction digestion with PvuII and XbaI restriction enzymes. The results showed no significant association between PvuII polymorphism and breast cancer risk. However, a significant association was found between XbaI polymorphism and reduction in breast cancer risk within the “x” allele of heterozygotes (odds ratio [OR] 0.199, 95% confidence interval [CI] 0.09–0.044) and heterozygotes (OR 0.208, 95% CI 0.09–0.047). The combined analysis of PvuII and XbaI polymorphisms revealed a synergistic effect of Pp/Xx and pp/xx genotypes and a significant reduction in breast cancer risk with these genotypes. The results also showed no statistical differences among PvuII or XbaI polymorphisms based on stage, ER, progesterone receptor and expression of hormone receptor such as human epidermal growth factor receptor 2. This case–control study showed that XbaI polymorphism of alpha estrogen gene modified and reduced breast cancer susceptibility among Jordanians. PMID:28182136

  2. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  3. Structural organization, sequence, and expression of the mouse HEXA gene encoding the alpha subunit of hexosaminidase A.

    PubMed

    Wakamatsu, N; Benoit, G; Lamhonwah, A M; Zhang, Z X; Trasler, J M; Triggs-Raine, B L; Gravel, R A

    1994-11-01

    Genomic clones of the mouse HEXA gene encoding the alpha subunit of lysosomal beta-hexosaminidase A have been isolated, analyzed, and sequenced. The HEXA gene spans approximately 26 kb and consists of 14 exons and 13 introns. The 5' flanking region of the gene has three candidate GC boxes and a number of potential promoter and regulatory elements. Promoter analysis using deletion constructs of 5' flanking sequence fused to the bacterial chloramphenicol acetyltransferase (CAT) gene showed that 150 bp of 5' sequence was sufficient for expression in transfected monkey kidney COS cells. Determination of the sequence of the 5' end of the Hex alpha mRNA by an "anchor-ligation PCR" procedure showed that transcription is initiated from a cluster of sites centered -42, -32, and -21 bp from the first in-frame ATG. Northern blot analysis from 11 different tissues showed over five times the steady-state level of Hex alpha mRNA in testis as compared to that found in three different brain regions; the lowest level (about 1/3 of brain) was found in liver. Comparison of the 5' flanking sequence with that of the human HEXA gene revealed 78% identity within the first 100 bp. These data suggest that the mouse HEXA gene is controlled mainly by sequences located within 150 bp of the 5' flanking region, and we speculate that it may have a role, not only in brain and other tissues, but also in reproductive function in the adult male mouse.

  4. The skeletal muscle alpha-actin gene of channel catfish (Ictalurus punctatus) and its association with piscine specific SINE elements.

    PubMed

    Kim, S; Karsi, A; Dunham, R A; Liu, Z

    2000-07-11

    The alpha-actin gene of channel catfish (Ictalurus punctatus) was cloned and sequenced. The gene has a similar organization and exhibited a high level of sequence similarity to those from other vertebrate animals. The upstream region of the alpha-actin gene included a TATA box, a CAAT box, three E-boxes, and a CArG box. Nested deletion segments containing these transcriptional motifs were fused to the reporter gene chloramphenicol acetyl transferase (CAT). Transfection of the clones into C2C12 cells indicated that all these motifs are required for transcriptional activities. The channel catfish alpha-actin gene is associated with two distinct short interspersed repetitive elements (SINEs). The first SINE element showed high levels of sequence similarity to the zebrafish Mermaid element, while the second SINE element is not similar to the Mermaid element except for an 8bp sequence CCCCGTGC suggesting their evolutionary linkage. However, the second SINE element appeared to co-exist with the Mermaid element in most cases and therefore was designated as the Merman element. Approximately 9000 copies and 1200 copies of the Mermaid and Merman elements exist per haploid channel catfish genome, respectively. BLAST searches indicated that both the Mermaid and the Merman elements were frequently associated with gene sequences, mostly those of aquatic animals, suggesting their evolutionary origin in association with aquatic organisms and their function in shaping the evolution of genomes in aquatic animals.

  5. Relationship between iris constitution analysis and TNF-alpha gene polymorphism in hypertensives.

    PubMed

    Yoo, Chun-Sang; Hwang, Woo-Jun; Hong, Seung-Heon; Lee, Hye-Jung; Jeong, Hyun-Ja; Kim, Su-Jin; Kim, Hyung-Min; Um, Jae-Young

    2007-01-01

    Iridology is a complementary and alternative medicine that involves the diagnosis of medical conditions by noting irregularities of the pigmentation in the iris. Iris constitution has a strong hereditary component. Tumor necrosis factor-alpha (TNFalpha), a pleiotropic cytokine, has been implicated in many pathological processes including hypertension. In this paper, the relationship between iris constitution and TNFalpha gene polymorphism in those with hypertension is investigated. Eighty seven hypertensive individuals and 79 controls were classified according to iris constitution and the TNFalpha genotype of each individual determined. Compared to the controls, the frequency of the TNFalpha GA heterozygote was lower in the hypertensive group, although the statistical significance was marginal (p = 0.08). This result implies an association with resistance to the disease. In addition, the frequency of the cardio-renal connective tissue weakness type was significantly higher in the hypertensive group with the TNFalpha GG genotype, as compared to the controls (p = 0.001). An association is demonstrated among TNFalpha gene polymorphism, Koreans with hypertension, and iris constitution.

  6. Alpha-2-macroglobulin gene, oxidized low-density lipoprotein receptor-1 locus, and sporadic Alzheimer's disease.

    PubMed

    Colacicco, Anna Maria; Solfrizzi, Vincenzo; D'Introno, Alessia; Capurso, Cristiano; Kehoe, Patrick G; Seripa, Davide; Pilotto, Alberto; Santamato, Andrea; Capurso, Antonio; Panza, Francesco

    2009-09-01

    A total sample of 169 AD patients, and 264 age- and sex-matched unrelated caregivers from Apulia, southern Italy, were genotypized for alpha-2-macroglobulin (A2M) Val1000/Ile single-nucleotide polymorphism (SNP) (rs669), apolipoprotein E (APOE), and SNPs (+1073 and +1071) in the oxidized low-density lipoprotein receptor-1 (OLR1) gene on chromosome 12. A2M allele and genotype frequencies were similar between AD patients and controls, also after stratification for late onset (>/=70 years) and early onset (<70 years) or APOE varepsilon4 status. However, there was evidence in support of LD between the OLR1+1071, the OLR1+1073, and the rs669 SNPs, with T-C-A haplotype being associated with significant increased risk of AD in both the whole sample and when we stratified according to early and late onset AD subjects, with the allelic association with AD predominantly from the OLR1+1073 SNP, further supporting the role of OLR1 as a candidate risk gene for sporadic AD.

  7. Three missense variants of metabolic syndrome-related genes are associated with alpha-1 antitrypsin levels.

    PubMed

    Setoh, Kazuya; Terao, Chikashi; Muro, Shigeo; Kawaguchi, Takahisa; Tabara, Yasuharu; Takahashi, Meiko; Nakayama, Takeo; Kosugi, Shinji; Sekine, Akihiro; Yamada, Ryo; Mishima, Michiaki; Matsuda, Fumihiko

    2015-07-15

    Alpha-1 antitrypsin (AAT) encoded by SERPINA1 is an acute-phase inflammation marker, and AAT deficiency (AATD) is known as one of the common genetic disorders in European populations. However, no genetic determinants to AAT levels apart from the SERPINA gene clusters have been identified to date. Here we perform a genome-wide association study of serum AAT levels followed by a two-staged replication study recruiting a total of 9,359 Japanese community-dwelling population. Three missense variants of metabolic syndrome-related genes, namely, rs671 in ALDH2, rs1169288 in HNF1A and rs1260326 in GCKR, significantly associate with AAT levels (P≤1.5 × 10(-12)). Previous reports have shown the functional relevance of ALDH2 and HNF1A to AAT. We observe a significant interaction of rs671 and alcohol consumption on AAT levels. We confirm the association between AAT and rs2896268 in SERPINA1, which is independent of known causative variants of AATD. These findings would support various AAT functions including metabolic processes.

  8. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    PubMed

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  9. Cloning and Characterization of an alpha-amylase Gene from the Hyperthermophilic Archaeon Thermococcus Thioreducens

    NASA Technical Reports Server (NTRS)

    Bernhardsdotter, Eva C. M. J.; Pusey, Mark L.; Ng, Joseph D.; Garriott, Owen K.

    2004-01-01

    The gene encoding an extracellular alpha-amylase, TTA, from the hyperthermophilic archaeon Thermococcus thioreducens was cloned and expressed in Escherichia coli. Primary structural analysis revealed high similarity with other a-amylases from the Thermococcus and Pyrococcus genera, as well as the four highly conserved regions typical for a-amylases. The 1374 bp gene encodes a protein of 457 amino acids, of which 435 constitute the mature protein preceded by a 22 amino acid signal peptide. The molecular weight of the purified recombinant enzyme was estimated to be 43 kDa by denaturing gel electrophoresis. Maximal enzymatic activity of recombinant TTA was observed at 90 C and pH 5.5 in the absence of exogenous Ca(2+), and the enzyme was considerably stable even after incubation at 90 C for 2 hours. The thermostability at 90 and 102 C was enhanced in the presence of 5 mM Ca(2+). The extraordinarily high specific activity (about 7.4 x 10(exp 3) U/mg protein at 90 C, pH 5.5 with soluble starch as substrate) together with its low pH optimum makes this enzyme an interesting candidate for starch processing applications.

  10. Ethacrynic and alpha-lipoic acids inhibit vaccinia virus late gene expression.

    PubMed

    Spisakova, Martina; Cizek, Zdenek; Melkova, Zora

    2009-02-01

    Smallpox was declared eradicated in 1980. However recently, the need of agents effective against poxvirus infection has emerged again. In this paper, we report an original finding that two redox-modulating agents, the ethacrynic and alpha-lipoic acids (EA, LA), inhibit growth of vaccinia virus (VACV) in vitro. The effect of EA and LA was compared with those of beta-mercaptoethanol, DTT and ascorbic acid, but these agents increased VACV growth in HeLa G cells. The inhibitory effects of EA and LA on the growth of VACV were further confirmed in several cell lines of different embryonic origin, in epithelial cells, fibroblasts, macrophages and T-lymphocytes. Finally, we have analyzed the mechanism of action of the two agents. They both decreased expression of VACV late genes, as demonstrated by western blot analysis and activity of luciferase expressed under control of different VACV promoters. In contrast, they did not inhibit virus entry into the cell, expression of VACV early genes or VACV DNA synthesis. The results suggest new directions in development of drugs effective against poxvirus infection.

  11. Ancient allelism at the cytosolic chaperonin-alpha-encoding gene of the zebrafish.

    PubMed Central

    Takami, K; Figueroa, F; Mayer, W E; Klein, J

    2000-01-01

    The T-complex protein 1, TCP1, gene codes for the CCT-alpha subunit of the group II chaperonins. The gene was first described in the house mouse, in which it is closely linked to the T locus at a distance of approximately 11 cM from the Mhc. In the zebrafish, Danio rerio, in which the T homolog is linked to the class I Mhc loci, the TCP1 locus segregates independently of both the T and the Mhc loci. Despite its conservation between species, the zebrafish TCP1 locus is highly polymorphic. In a sample of 15 individuals and the screening of a cDNA library, 12 different alleles were found, and some of the allelic pairs were found to differ by up to nine nucleotides in a 275-bp-long stretch of sequence. The substitutions occur in both translated and untranslated regions, but in the former they occur predominantly at synonymous codon sites. Phylogenetically, the alleles fall into two groups distinguished also by the presence or absence of a 10-bp insertion/deletion in the 3' untranslated region. The two groups may have diverged as long as 3.5 mya, and the polymorphic differences may have accumulated by genetic drift in geographically isolated populations. PMID:10628990

  12. Anticancer effect of genistein on BG-1 ovarian cancer growth induced by 17 β-estradiol or bisphenol A via the suppression of the crosstalk between estrogen receptor alpha and insulin-like growth factor-1 receptor signaling pathways

    SciTech Connect

    Hwang, Kyung-A; Park, Min-Ah; Kang, Nam-Hee; Yi, Bo-Rim; Hyun, Sang-Hwan; Jeung, Eui-Bae; Choi, Kyung-Chul

    2013-11-01

    The interaction between estrogen receptor (ER) and insulin-like growth factor-1 receptor (IGF-1R) signaling pathway plays an important role in proliferation of and resistance to endocrine therapy to estrogen dependent cancers. Estrogen (E2) upregulates the expression of components of IGF-1 system and induces the downstream of mitogenic signaling cascades via phosphorylation of insulin receptor substrate-1 (IRS-1). In the present study, we evaluated the xenoestrogenic effect of bisphenol A (BPA) and antiproliferative activity of genistein (GEN) in accordance with the influence on this crosstalk. BPA was determined to affect this crosstalk by upregulating mRNA expressions of ERα and IGF-1R and inducing phosphorylation of IRS-1 and Akt in protein level in BG-1 ovarian cancer cells as E2 did. In the mouse model xenografted with BG-1 cells, BPA significantly increased a tumor burden of mice and expressions of ERα, pIRS-1, and cyclin D1 in tumor mass compared to vehicle, indicating that BPA induces ovarian cancer growth by promoting the crosstalk between ER and IGF-1R signals. On the other hand, GEN effectively reversed estrogenicity of BPA by reversing mRNA and protein expressions of ERα, IGF-1R, pIRS-1, and pAkt induced by BPA in cellular model and also significantly decreased tumor growth and in vivo expressions of ERα, pIRS-1, and pAkt in xenografted mouse model. Also, GEN was confirmed to have an antiproliferative effect by inducing apoptotic signaling cascades. Taken together, these results suggest that GEN effectively reversed the increased proliferation of BG-1 ovarian cancer by suppressing the crosstalk between ERα and IGF-1R signaling pathways upregulated by BPA or E2.

  13. Influences of incorporating detoxified Jatropha curcas kernel meal in common carp (Cyprinus carpio L.) diet on the expression of growth hormone- and insulin-like growth factor-1-encoding genes.

    PubMed

    Kumar, V; Khalil, W K B; Weiler, U; Becker, K

    2013-02-01

    Jatropha curcas is a drought-resistant shrub or small tree widespread all over the tropics and subtropics. The use of J. curcas (L) kernel meal in fish feed is limited owing to the presence of toxic and antinutritional constituents. In this study, it was detoxified using heat treatment and organic solvent extraction method. The detoxification process was carried out for 60 min to obtain the detoxified meal. Cyprinus carpio L. fingerlings (n = 180; avg. wt. 3.2 ± 0.07 g) were randomly distributed in five treatment groups with four replicates and fed isonitrogenous diets (crude protein 38%) for 8 weeks. The inclusion levels of the detoxified Jatropha kernel meal (DJKM) and soybean meal (SBM) were as follows: control diet was prepared with fish meal (FM) and wheat meal, without any DJKM and SBM; diets S(50) and J(50) : 50% of FM protein replaced by SBM and DJKM respectively; diets S(75) and J(75) : 75% of FM protein replaced by SBM and DJKM respectively. Highest body mass gain and insulin-like growth factor-1 (IGF-1) gene expression in brain, liver and muscle were observed for the control group, which were statistically similar to those for J(50) group and significantly (p < 0.05) higher than for all other groups, whereas growth hormone gene expression in brain, liver and muscle exhibited opposite trend. Insulin-like growth factor-1 concentration in plasma did not differ significantly among the five groups. Conclusively, growth performance was in parallel with IGF-1 gene expression and exhibited negative trend with GH gene expression.

  14. The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4{alpha}

    SciTech Connect

    Klapper, Maja . E-mail: klapper@molnut.uni-kiel.de; Boehme, Mike; Nitz, Inke; Doering, Frank

    2007-04-27

    The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. The aim of this study was to investigate the regulation of hFABP2 by the endodermal hepatocyte nuclear factor 4{alpha} (HNF-4{alpha}), involved in regulation of genes of fatty acid metabolism and differentiation. Electromobility shift assays demonstrated that HNF-4{alpha} binds at position -324 to -336 within the hFABP2 promoter. Mutation of this HNF-4 binding site abolished the luciferase reporter activity of hFABP2 in postconfluent Caco-2 cells. In HeLa cells, this mutation reduced the activation of the hFABP2 promoter by HNF-4{alpha} by about 50%. Thus, binding element at position -336/-324 essentially determines the transcriptional activity of promoter and may be important in control of hFABP2 expression by dietary lipids and differentiation. Studying genotype interactions of hFABP2 and HNF-4{alpha}, that are both candidate genes for diabetes type 2, may be a powerful approach.

  15. Gene cloning of alpha-methylserine aldolase from Variovorax paradoxus and purification and characterization of the recombinant enzyme.

    PubMed

    Nozaki, Hiroyuki; Kuroda, Shinji; Watanabe, Kunihiko; Yokozeki, Kenzo

    2008-10-01

    The alpha-methylserine aldolase gene from Variovorax paradoxus strains AJ110406, NBRC15149, and NBRC15150 was cloned and expressed in Escherichia coli. Formaldehyde release activity from alpha-methyl-L-serine was detected in the cell-free extract of E.coli expressing the gene from three strains. The recombinant enzyme from V. paradoxus NBRC15150 was purified. The Vmax and Km of the enzyme for the formaldehyde release reaction from alpha-methyl-L-serine were 1.89 micromol min(-1) mg(-1) and 1.2 mM respectively. The enzyme was also capable of catalyzing the synthesis of alpha-methyl-L-serine and alpha-ethyl-L-serine from L-alanine and L-2-aminobutyric acid respectively, accompanied by hydroxymethyl transfer from formaldehyde. The purified enzyme also catalyzed alanine racemization. It contained 1 mole of pyridoxal 5'-phosphate per mol of the enzyme subunit, and exhibited a specific spectral peak at 429 nm. With L-alanine and L-2-aminobutyric acid as substrates, the specific peak, assumed to be a result of the formation of a quinonoid intermediate, increased at 498 nm and 500 nm respectively.

  16. Differential roles of SS18-SSX fusion gene and insulin-like growth factor-1 receptor in synovial sarcoma cell growth

    SciTech Connect

    Toernkvist, Maria; Natalishvili, Natalia; Xie Yuntao; Girnita, Ada; D'Arcy, Padraig; Brodin, Bertha; Axelson, Magnus; Girnita, Leonard

    2008-04-11

    Recently we demonstrated that the synovial sarcoma specific fusion gene SS18-SSX is crucial for cyclin D1 expression and is linked to cell proliferation. In this report we explore the role of SS18-SSX and IGF-1R for their potential functions in cellular proliferation and survival in cultured synovial sarcoma cells. We found that targeting of SS18-SSX mRNA by antisense oligonucleotide treatment drastically and rapidly decreased cell proliferation but caused only a slight increase of apoptosis. The synovial sarcoma cells were confirmed to express IGF-1R, and treatment with an IGF-1R inhibitor resulted in substantially reduced cell viability by inducing apoptosis in these cells. Conversely, inhibition of the IGF-1R resulted only in a slight to moderate decrease in DNA synthesis. In conclusion, SS18-SSX and IGF-1R seem to play important but different roles in maintaining malignant growth of synovial sarcoma cells. Whereas SS18-SSX maintains cyclin D1 and cell proliferation, IGF-1R protects from apoptosis.

  17. Identification of two distinct subsets of long-term nonprogressors with divergent viral activity by stromal-derived factor 1 chemokine gene polymorphism analysis.

    PubMed

    Balotta, C; Bagnarelli, P; Corvasce, S; Mazzucchelli, R; Colombo, M C; Papagno, L; Santambrogio, S; Ridolfo, A L; Violin, M; Berlusconi, A; Velleca, R; Facchi, G; Moroni, M; Clementi, M; Galli, M

    1999-08-01

    Stromal-derived factor (SDF)-1, the natural ligand for CXCR4, is present in a common polymorphic variant defined by a G-->A transition in the 3' untranslated region of the gene. In persons infected with human immunodeficiency virus type 1 (HIV-1), the homozygous genotype (SDF1-3'A/3'A) has been postulated to interfere with the appearance of T-tropic syncytium-inducing strains. The polymorphism of SDF1 was correlated with HIV-1 phenotype, plasma viremia, and unspliced and multiply spliced specific transcripts in 158 virologically characterized HIV-1-infected patients (39 recent seroconverters, 75 typical progressors, and 44 AIDS patients) and in 42 HIV-1-infected long-term nonprogressors (LTNPs). Analysis of SDF1 allele distribution revealed that SDF1-3'A/3'A status is associated with low CD4 cell count (P=.0449) but not with a specific HIV-1 phenotype. In LTNPs, SDF1-+/+ condition defined a subset of persons with lower HIV-1 replication than in heterozygous subjects. The low viral activity in SDF1-+/+ LTNPs suggests that other factors play a major role in vivo in determining the course of HIV-1 infection.

  18. Tip-alpha (hp0596 gene product) is a highly immunogenic Helicobacter pylori protein involved in colonization of mouse gastric mucosa.

    PubMed

    Godlewska, Renata; Pawlowski, Marcin; Dzwonek, Artur; Mikula, Michal; Ostrowski, Jerzy; Drela, Nadzieja; Jagusztyn-Krynicka, Elzbieta K

    2008-03-01

    A product of the Helicobacter pylori hp0596 gene (Tip-alpha) is a highly immunogenic homodimeric protein, unique for this bacterium. Cell fractionation experiments indicate that Tip-alpha is anchored to the inner membrane. In contrast, the three-dimensional model of the protein suggests that Tip-alpha is soluble or, at least, largely exposed to the solvent. hp0596 gene knockout resulted in a significant decrease in the level of H. pylori colonization as measured by real-time PCR assay. In addition, the Tip-alpha recombinant protein was determined to stimulate macrophage to produce IL-1alpha and TNF-alpha. Both results imply that Tip-alpha is rather loosely connected to the inner membrane and potentially released during infection.

  19. Silencing of hypoxia-inducible factor-1α gene attenuates chronic ischemic renal injury in two-kidney, one-clip rats.

    PubMed

    Wang, Zhengchao; Zhu, Qing; Li, Pin-Lan; Dhaduk, Romesh; Zhang, Fan; Gehr, Todd W; Li, Ningjun

    2014-05-15

    Overactivation of hypoxia-inducible factor (HIF)-1α is implicated as a pathogenic factor in chronic kidney diseases (CKD). However, controversy exists regarding the roles of HIF-1α in CKD. Additionally, although hypoxia and HIF-1α activation are observed in various CKD and HIF-1α has been shown to stimulate fibrogenic factors, there is no direct evidence whether HIF-1α is an injurious or protective factor in chronic renal hypoxic injury. The present study determined whether knocking down the HIF-1α gene can attenuate or exaggerate kidney damage using a chronic renal ischemic model. Chronic renal ischemia was induced by unilaterally clamping the left renal artery for 3 wk in Sprague-Dawley rats. HIF-1α short hairpin (sh) RNA or control vectors were transfected into the left kidneys. Experimental groups were sham+control vector, clip+control vector, and clip+HIF-1α shRNA. Enalapril was used to normalize blood pressure 1 wk after clamping the renal artery. HIF-1α protein levels were remarkably increased in clipped kidneys, and this increase was blocked by shRNA. Morphological examination showed that HIF-1α shRNA significantly attenuated injury in clipped kidneys: glomerular injury indices were 0.71 ± 0.04, 2.50 ± 0.12, and 1.34 ± 0.11, and the percentage of globally damaged glomeruli was 0.02, 34.3 ± 5.0, and 6.3 ± 1.6 in sham, clip, and clip+shRNA groups, respectively. The protein levels of collagen and α-smooth muscle actin also dramatically increased in clipped kidneys, but this effect was blocked by HIF-1α shRNA. In conclusion, long-term overactivation of HIF-1α is a pathogenic factor in chronic renal injury associated with ischemia/hypoxia.

  20. Comparative analysis of Napsin A, alpha-methylacyl-coenzyme A racemase (AMACR, P504S), and hepatocyte nuclear factor 1 beta as diagnostic markers of ovarian clear cell carcinoma: an immunohistochemical study of 279 ovarian tumours.

    PubMed

    Fadare, Oluwole; Zhao, Chengquan; Khabele, Dineo; Parkash, Vinita; Quick, Charles M; Gwin, Katja; Desouki, Mohamed M

    2015-02-01

    Napsin A and α-methylacyl-coenzyme A racemase (AMACR, P504S) have recently been described as being frequently expressed in clear cell carcinomas (CCC) of the gynecological tract. The present study was conducted to assess the test performance of these newer markers relative to the more traditional marker, hepatocyte nuclear factor 1β (HNF1β), in a large and histotypically diverse dataset. A total of 279 ovarian tumours in tissue microarrays were immunohistochemically assessed for the expression of Napsin A, AMACR and HNF1β. HNF1β, Napsin A and AMACR were expressed in 92%, 82% and 63% of 65 CCC, 7%, 1% and 1% of 101 serous carcinomas, 37%, 5.3% and 0% of 19 endometrioid carcinomas, 60%, 0% and 0% of 45 mucinous tumours, 100%, 0% and 0% of seven yolk sac tumours, and 0%, 16.7% and 16.7% of six steroid cell tumours NOS, respectively. All other tumours, including 18 adult-type granulosa cell tumours, eight dysgerminomas and nine other miscellaneous tumour types were negative for all three markers. Using a benchmark of ≥1% of tumour cells for positivity and CCC as the diagnostic end-point, the sensitivity, specificity, negative predictive value and positive predictive value of Napsin A expression were 0.82, 0.99, 0.94, and 0.98, respectively (odds ratio 439, p < 0.0001). Respective parameters were 0.92, 0.79, 0.97, and 0.58 (odds ratio 44, p < 0.0001) for HNF1β and 0.63, 0.99, 0.89, and 0.5 (odds ratio 112, p < 0.0001) for AMACR. The combination of any two positive markers, irrespective of the staining pattern of the third, significantly predicted the CCC histotype in every analytic scenario. In summary, HNF1β is highly sensitive but is suboptimally specific in isolation, whereas AMACR is highly specific but is suboptimally sensitive. Napsin A is specific but of intermediate sensitivity. Napsin A, AMACR and HNF1β are all viable markers of CCC that can be deployed as components of larger panels when CCC is a diagnostic consideration.

  1. The inhibition of the human cholesterol 7alpha-hydroxylase gene (CYP7A1) promoter by fibrates in cultured cells is mediated via the liver x receptor alpha and peroxisome proliferator-activated receptor alpha heterodimer.

    PubMed

    Gbaguidi, G Franck; Agellon, Luis B

    2004-01-01

    In previous work, we showed that the binding of the liver x receptor alpha:peroxisome proliferator-activated receptor alpha (LXRalpha:PPARalpha) heterodimer to the murine Cyp7a1 gene promoter antagonizes the stimulatory effect of their respective ligands. In this study, we determined if LXRalpha:PPARalpha can also regulate human CYP7A1 gene promoter activity. Co-expression of LXRalpha and PPARalpha in McArdle RH7777 hepatoma cells decreased the activity of the human CYP7A1 gene promoter in response to fibrates and 25-hydroxycholesterol. In vitro, the human CYP7A1 Site I bound LXRalpha:PPARalpha, although with substantially less affinity compared with the murine Cyp7a1 Site I. The binding of LXRalpha:PPARalpha to human CYP7A1 Site I was increased in the presence of either LXRalpha or PPARalpha ligands. In HepG2 hepatoblastoma cells, fibrates and 25-hydroxycholesterol inhibited the expression of the endogenous CYP7A1 gene as well as the human CYP7A1 gene promoter when co-transfected with plasmids encoding LXRalpha and PPARalpha. However, a derivative of the human CYP7A1 gene promoter that contains a mutant form of Site I that does not bind LXRalpha:PPARalpha was not inhibited by WY 14,643 or 25-hydroxycholesterol in both McArdle RH7777 and HepG2 cells. The ligand-dependent recruitment of LXRalpha:PPARalpha heterodimer onto the human CYP7A1 Site I can explain the inhibition of the human CYP7A1 gene promoter in response to fibrates and 25-hydroxycholesterol.

  2. LMM5.1 and LMM5.4, two eukaryotic translation elongation factor 1A-like gene family members, negatively affect cell death and disease resistance in rice.

    PubMed

    Zhao, Jiying; Liu, Pengcheng; Li, Chunrong; Wang, Yanyan; Guo, Lequn; Jiang, Guanghuai; Zhai, Wenxue

    2017-02-20

    Lesion mimic mutant (LMM) genes, stimulating lesion formation in the absence of pathogens, play significant roles in immune response. In this study, we characterized a rice lesion mimic mutant, lmm5, which displayed light-dependent spontaneous lesions. Additionally, lmm5 plants exhibited enhanced resistance to all of the tested races of Magnaporthe oryzae and Xanthomonas oryzae pv. oryzae (Xoo) by increasing the expression of defense-related genes and the accumulation of hydrogen peroxide. Genetic analysis showed that the lesion mimic phenotype of lmm5 was controlled by two genes, lmm5.1 and lmm5.4, which were isolated with a map-based cloning strategy. Remarkably, LMM5.1 and LMM5.4 share a 97.4% amino acid sequence identity, and they each encode a eukaryotic translation elongation factor 1A (eEF1A)-like protein. Besides, LMM5.1 and LMM5.4 were expressed in a tissue-specific and an indica-specific manner, respectively. In addition, high-throughput mRNA sequencing analysis confirmed that the basal immunity was constitutively activated in the lmm5 mutant. Taken together, these results suggest that the homologous eEF1A-like genes, LMM5.1 and LMM5.4, negatively affect cell death and disease resistance in rice.

  3. Purification and gene cloning of alpha-methylserine aldolase from Ralstonia sp. strain AJ110405 and application of the enzyme in the synthesis of alpha-methyl-L-serine.

    PubMed

    Nozaki, Hiroyuki; Kuroda, Shinji; Watanabe, Kunihiko; Yokozeki, Kenzo

    2008-12-01

    By screening microorganisms that are capable of assimilating alpha-methyl-DL-serine, we detected alpha-methylserine aldolase in Ralstonia sp. strain AJ110405, Variovorax paradoxus AJ110406, and Bosea sp. strain AJ110407. A homogeneous form of this enzyme was purified from Ralstonia sp. strain AJ110405, and the gene encoding the enzyme was cloned and expressed in Escherichia coli. The enzyme appeared to be a homodimer consisting of identical subunits, and its molecular mass was found to be 47 kDa. It contained 0.7 to 0.8 mol of pyridoxal 5'-phosphate per mol of subunit and could catalyze the interconversion of alpha-methyl-L-serine to L-alanine and formaldehyde in the absence of tetrahydrofolate. Formaldehyde was generated from alpha-methyl-L-serine but not from alpha-methyl-D-serine, L-serine, or D-serine. Alpha-methyl-L-serine synthesis activity was detected when L-alanine was used as the substrate. In contrast, no activity was detected when D-alanine was used as the substrate. In the alpha-methyl-L-serine synthesis reaction, the enzymatic activity was inhibited by an excess amount of formaldehyde, which was one of the substrates. We used cells of E. coli as a whole-cell catalyst to express the gene encoding alpha-methylserine aldolase and effectively obtained a high yield of optically pure alpha-methyl-L-serine using L-alanine and formaldehyde.

  4. Human tumor necrosis factor-alpha gene 3' untranslated region confers inducible toxin responsiveness to homologous promoter in monocytic THP-1 cells.

    PubMed

    Seiler-Tuyns, A; Dufour, N; Spertini, F

    1999-07-30

    To better define the role of 3' untranslated region (3'UTR) on transcriptional regulation of the human tumor necrosis factor (TNF)-alpha gene, monocytic human THP-1 cells were transfected with two TNF-alpha promoter constructs spanning base pairs -1897/-1 and -1214/-1, respectively, and linked to the rabbit beta-globin gene. Quantitative globin gene expression of chimerae was measured by reverse transcription-polymerase chain reaction. A construct linking the chicken beta-actin promoter and a deleted portion of the beta-globin gene was cotransfected and used as internal standard. Unexpectedly, when THP-1 cells were stimulated with lipopolysaccharide or toxic shock syndrome toxin-1, gene regulation was hardly detected. In contrast, endogenous TNF-alpha gene regulation measured by the same reverse transcription-polymerase chain reaction procedure was vigorous. Remarkably, ligation of 3'UTR to chimeric constructs led to a drastic drop in the basal level of chimeric gene expression, resulting in a 15- to 40-fold induction of the reporter gene. Consistently, when the TNF-alpha promoter was replaced by the cytomegalovirus early immediate promoter, gene expression was also uniformly reduced but was no longer up-regulated upon stimulation with lipopolysaccharide and toxic shock syndrome toxin-1. These data provide the first line of evidence that, in addition to its role in TNF-alpha transcript stability and translation, human TNF-alpha 3'UTR also participates in modulating gene expression at the transcriptional level.

  5. Fibroblast growth factor 7 inhibits cholesterol 7{alpha}-hydroxylase gene expression in hepatocytes

    SciTech Connect

    Sun, Zhichao; Yu, Xuemei; Wu, Weibin; Jia, Dongwei; Chen, Yinle; Ji, Lingling; Liu, Xijun; Peng, Xiaomin; Li, Yintao; Yang, Lili; Ruan, Yuanyuan; Gu, Jianxin; Ren, Shifang; Zhang, Songwen

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer FGF7 strongly and rapidly down-regulates the expression of CYP7A1 in hepatocytes. Black-Right-Pointing-Pointer FGF7 suppresses the expression of CYP7A1 via FGFR2 and downstream JNK activation. Black-Right-Pointing-Pointer Blocking FGF7 abrogates HSC-induced inhibition of CYP7A1 expression in hepatocytes. -- Abstract: Cholesterol 7{alpha}-hydroxylase (CYP7A1) is the initial and rate-limiting enzyme for bile acid synthesis. Transcription of the CYP7A1 gene is regulated by bile acids, nuclear receptors and cytokines. Fibroblast growth factor 7 (FGF7) secreted from activated hepatic stellate cells (HSC) during chronic liver fibrosis regulates hepatocyte survival and liver regeneration. In the carbon tetrachloride (CCl{sub 4})-induced fibrotic mouse liver, we demonstrated that the expression of CYP7A1 was largely decreased while the expression of FGF7 was significantly increased. We further demonstrated that FGF7 inhibited CYP7A1 gene expression in hepatocytes. Knockdown study by short interfering RNA, kinase inhibition and phosphorylation assays revealed that the suppression of CYP7A1 expression by FGF7 was mediated by FGFR2 and its downstream JNK signaling cascade. The FGF7 neutralizing antibody restored CYP7A1 expression in Hep3B cells treated with conditioned medium from HSC. In summary, the data suggest that FGF7 is a novel regulator of CYP7A1 expression in hepatocytes and may prevent hepatocytes from accumulating toxic bile acids during liver injury and fibrosis.

  6. Orofacial clefts, parental cigarette smoking, and transforming growth factor-alpha gene variants

    SciTech Connect

    Shaw, G.M.; Wasserman, C.R.; O`Malley, C.D.

    1996-03-01

    Results of studies determine whether women who smoke during early pregnancy are at increased risk of delivering infants with orofacial clefts have been mixed, and recently a gene-environment interaction between maternal smoking, transforming growth factor-alpha (TGFa), and clefting has been reported. Using a large population-based case-control study, we investigated whether parental periconceptional cigarette smoking was associated with an increased risk for having offspring with orofacial clefts. We also investigated the influence of genetic variation of the TGFa locus on the relation between smoking and clefting. Parental smoking information was obtained from telephone interviews with mothers of 731 (84.7% of eligible) orofacial cleft case infants and with mothers of 734 (78.2%) nonmalformed control infants. DNA was obtained from newborn screening blood spots and genotyped for the allelic variants of TGFa. We found that risks associated with maternal smoking were most elevated for isolated cleft lip with or without cleft palate, (odds ratio 2.1 [95% confidence interval 1.3-3.6]) and for isolated cleft palate (odds ratio 2.2 [1.1-4.5]) when mothers smoked {ge} 20 cigarrettes/d. These risks for white infants ranged from 3-fold to 11-fold across phenotypic groups. Paternal smoking was not associated with clefting among the offspring of nonsmoking mothers, and passive smoke exposures were associated with at most slightly increased risks. This study offers evidence that the risk for orofacial clefting in infants may be influenced by maternal smoke exposures alone as well as in combination (gene-environment interaction) with the presence of the uncommon TGFa allele. 56 refs., 5 tabs.

  7. Genetic effects of common polymorphisms in estrogen receptor alpha gene on osteoarthritis: a meta-analysis

    PubMed Central

    Ma, Hecheng; Wu, Weiqian; Yang, Xiaodi; Liu, Jianguo; Gong, Yubao

    2015-01-01

    Objective: The estrogen receptor alpha (ESR1) gene has been implicated in the etiology of osteoarthritis (OA). However, the results are conflicting. We assessed the association of three common ESR1 polymorphisms, rs2234693, rs9340799 and rs2228480, with OA in this meta-analysis. Methods: A comprehensive search was performed to identify related studies. Pooled odds ratio (OR) with 95% confidence interval (CI) was calculated using fixed or random effects model. Results: 15 studies (7036 cases and 9669 controls) for rs2234693 polymorphism, 14 studies (3904 cases and 6991 controls) for rs9340799 and 3 studies (331 cases and 619 controls) for rs2228480 polymorphism were identified. The final results indicated that the G allele in ESR1 rs9340799 was associated with decreased OA risk (GG+GA vs. AA: OR=0.878, 95% CI=0.792-0.972, P=0.012; G vs. A: OR=0.902, 95% CI=0.836-0.975, P=0.009). The A allele in rs2228480 might be associated with increased OA risk. But no significant association of rs2234693 polymorphism with OA susceptibility was observed. Conclusions: This meta-analysis indicates rs9340799 and rs2228480 rather than rs2234693 polymorphisms are associated with the incidence of OA. Some stable associations should be further confirmed in future. PMID:26550281

  8. Immune protective effect of human alpha-1-antitrypsin gene during β cell transplantation in diabetic mice.

    PubMed

    Yang, Lu; Liao, Yu-Ting; Yang, Xiao-Fei; Reng, Li-Wei; Qi, Hui; Li, Fu-Rong

    2015-05-01

    Type 1 diabetes (T1D) is a chronic autoimmune disease in which β cells are destroyed. Islet transplantation is the most promising therapeutic treatment for T1D patients. However, allograft rejection and autoimmune reaction have been recognized as primary causes of graft loss after transplantation. Alpha-1-antitrypsin (AAT) is an important serine protease inhibitor in serum. AAT is characterized by anti-inflammation, anti-apoptosis, and induction-specific immunological tolerance. In this study, we successfully established NIT-hAAT cell lines, which are murine islet β cell lines with stable expression of human AAT (hAAT) gene. These NIT-hAAT cells were transplanted under the left kidney capsule of BALB/c diabetic mice. Interestingly, the sustained expression of hAAT in vivo can block the inflammatory cell infiltration and reduce the production of proinflammatory cytokines to effectively prevent nonspecific inflammation. Results showed that hAAT can inhibit the proliferation of lymphocytes, shift the balance between Th17 and Treg, and suppress the maturation of dendritic cells. Therefore, hAAT can serve as a beneficial immunomodulator that limits immune rejection to prolong islet allograft survival and achieve long-term successful transplant outcomes.

  9. Regulation of constitutive androstane receptor and its target genes by fasting, cAMP, hepatocyte nuclear factor alpha, and the coactivator peroxisome proliferator-activated receptor gamma coactivator-1alpha.

    PubMed

    Ding, Xunshan; Lichti, Kristin; Kim, Insook; Gonzalez, Frank J; Staudinger, Jeff L

    2006-09-08

    Animal studies reveal that fasting and caloric restriction produce increased activity of specific metabolic pathways involved in resistance to weight loss in liver. Evidence suggests that this phenomenon may in part occur through the action of the constitutive androstane receptor (CAR, NR1I3). Currently, the precise molecular mechanisms that activate CAR during fasting are unknown. We show that fasting coordinately induces expression of genes encoding peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC-1alpha), CAR, cytochrome P-450 2b10 (Cyp2b10), UDP-glucuronosyltransferase 1a1 (Ugt1a1), sulfotransferase 2a1 (Sult2a1), and organic anion-transporting polypeptide 2 (Oatp2) in liver in mice. Treatments that elevate intracellular cAMP levels also produce increased expression of these genes in cultured hepatocytes. Our data show that PGC-1alpha interaction with hepatocyte nuclear factor 4alpha (HNF4alpha, NR2A1) directly regulates CAR gene expression through a novel and evolutionarily conserved HNF4-response element (HNF4-RE) located in its proximal promoter. Expression of PGC-1alpha in cells increases CAR expression and ligand-independent CAR activity. Genetic studies reveal that hepatic expression of HNF4alpha is required to produce fasting-inducible CAR expression and activity. Taken together, our data show that fasting produces increased expression of genes encoding key metabolic enzymes and an uptake transporter protein through a network of interactions involving cAMP, PGC-1alpha, HNF4alpha, CAR, and CAR target genes in liver. Given the recent finding that mice lacking CAR exhibit a profound decrease in resistance to weight loss during extended periods of caloric restriction, our findings have important implications in the development of drugs for the treatment of obesity and related diseases.

  10. Identification of Core Alpha 1,3-Fucosyltransferase Gene From Silkworm: An Insect Popularly Used to Express Mammalian Proteins.

    PubMed

    Minagawa, Sachi; Sekiguchi, Satoshi; Nakaso, Yuzuru; Tomita, Masahiro; Takahisa, Manabu; Yasuda, Hideyo

    2015-01-01

    Silkworm has great potential as production system of recombinant mammalian proteins. When the protein products are used for medical purpose, it is required to reduce the risk of an allergy, the content of core alpha 1,3-fucosyl residue attached to the N-glycan of proteins, for example. We isolated the gene of an enzyme responsible for the transfer of core alpha 1,3-fucosyl residue, core alpha 1,3-fucosyltransferase (Fuc-T C3), from silkworm. A candidate cDNA for silkworm Fuc-T C3 was isolated as a homolog of the fruit fly enzyme gene fucTA. The gene was located on chromosome 7 of the silkworm genome and was composed of seven exons, which spanned approximately 10 kb on the genome. The coding region of the gene was 1,350 bp and encoded a 450-amino acid protein with a molecular mass of 52.2 kDa. Deduced amino acid sequence of the coding region showed one transmembrane domain in its N-terminal and typical motifs common to fucosyltransferases including Fuc-T C3s of other organisms in its C-terminal. The extract of CHO cells transfected with the cDNA showed Fuc-T C3 activity using GDP-fucose and DABS-GnGn peptide as substrates. These results showed this cDNA clone actually encodes silkworm Fuc-T C3.

  11. Genomic organization and chromosomal localization of the human and mouse genes encoding the alpha receptor component for ciliary neurotrophic factor.

    PubMed

    Valenzuela, D M; Rojas, E; Le Beau, M M; Espinosa, R; Brannan, C I; McClain, J; Masiakowski, P; Ip, N Y; Copeland, N G; Jenkins, N A

    1995-01-01

    Ciliary neurotrophic factor (CNTF) has recently been found to share receptor components with, and to be structurally related to, a family of broadly acting cytokines, including interleukin-6, leukemia inhibitory factor, and oncostatin M. However, the CNTF receptor complex also includes a CNTF-specific component known as CNTF receptor alpha (CNTFR alpha). Here we describe the molecular cloning of the human and mouse genes encoding CNTFR. We report that the human and mouse genes have an identical intron-exon structure that correlates well with the domain structure of CNTFR alpha. That is, the signal peptide and the immunoglobulin-like domain are each encoded by single exons, the cytokine receptor-like domain is distributed among 4 exons, and the C-terminal glycosyl phosphatidylinositol recognition domain is encoded by the final coding exon. The position of the introns within the cytokine receptor-like domain corresponds to those found in other members of the cytokine receptor superfamily. Confirming a recent study using radiation hybrids, we have also mapped the human CNTFR gene to chromosome band 9p13 and the mouse gene to a syntenic region of chromosome 4.

  12. Chemokine gene expression in the murine renal cell carcinoma, RENCA, following treatment in vivo with interferon-alpha and interleukin-2.

    PubMed Central

    Sonouchi, K.; Hamilton, T. A.; Tannenbaum, C. S.; Tubbs, R. R.; Bukowski, R.; Finke, J. H.

    1994-01-01

    The expression of three chemoattractant cytokine (chemokine) messenger (m)RNAs in the murine renal cell carcinoma (RENCA) from mice treated with a combination of interferon-alpha (IFN-alpha) and interleukin-2 was examined and related to tumor infiltration by inflammatory leukocytes. Using a semi-quantitative reverse transcriptase polymerase chain reaction assay, mRNAs encoding the KC, JE, and IP-10 genes were all elevated in tumor tissue from mice treated systemically with IFN-alpha/interleukin-2 for 4 days. Similarly, the mRNA for tumor necrosis factor-alpha (TNF-alpha) was also increased in tumors from treated as compared to control animals. The same tumors showed a significant increase in Mac-1+ leukocytes, which correlated well with the increase in chemokine and TNF-alpha gene expression. The renal cell carcinoma tumor itself may be responsible for the expression of chemokine genes in the tumor bed following cytokine therapy. Cultures of freshly explanted RENCA cells expressed significant levels of chemokine mRNAs when stimulated in vitro with IFN alpha, IFN gamma, and/or interleukin-2, demonstrating that this tumor cell has potential for expression of these genes in vivo. In contrast, TNF-alpha expression was not detected in cultured tumor cells. Thus TNF-alpha may be expressed by infiltrating monocytes following exposure to recombinant cytokine therapy. Images Figure 1 Figure 2 Figure 4 PMID:8160774

  13. Structure of the human gene and two rat cDNAs encoding the alpha chain of GTP-binding regulatory protein Go: two different mRNAs are generated by alternative splicing.

    PubMed Central

    Tsukamoto, T; Toyama, R; Itoh, H; Kozasa, T; Matsuoka, M; Kaziro, Y

    1991-01-01

    Go is a specific class ("other") of signal-transducing heterotrimeric GTP-binding proteins (G proteins) that is expressed in high levels in mammalian brain. We have cloned two different rat cDNAs encoding the alpha subunit of Go (Go alpha-1 and Go alpha-2) and a human Go alpha chromosomal gene. The human Go alpha gene spans more than 100 kilobases and contains 11 exons, including one noncoding exon in the 3' flanking region. The 5' flanking region is highly G + C-rich and contains five G.C boxes (Sp1 binding sites) but no TATA box. Exons 7 and 8 coding for amino acid residues 242-354 of Go alpha protein are duplicated (referred to as exons 7A, 7B, 8A, and 8B). It was found that exons 7A and 8A code for Go alpha-1, and 7B and 8B code for Go alpha-2. This indicates that two different Go alpha mRNAs may be generated by alternative splicing of a single Go alpha gene. The splice sites of the Go alpha-1 and Go alpha-2 genes are completely identical with those encoding human inhibitory G protein alpha subunits Gi2 alpha and Gi3 alpha [Itoh, H., Toyama, R., Kozasa, T., Tsukamoto, T., Matsuoka, M. & Kaziro, Y. (1988) J. Biol. Chem. 263, 6656-6664] and also transducin G protein alpha subunit Gt1 alpha [Raport, C. J., Dere, B. & Hurley, J. (1989) J. Biol. Chem. 264, 7122-7128]. Sequence homology and conservation of the exon-intron organization indicate that the genes coding for Go alpha, Gi2 alpha, Gi3 alpha, Gt1 alpha, and probably Gi1 alpha may be evolved from a common progenitor. Like Go alpha-1, Go alpha-2 is expressed mainly in brain. Images PMID:1901650

  14. Cloning and characterization of genes encoding alpha and beta subunits of glutamate-gated chloride channel protein in Cylicocyclus nassatus.

    PubMed

    Tandon, Ritesh; LePage, Keith T; Kaplan, Ray M

    2006-11-01

    The invertebrate glutamate-gated chloride channels (GluCls) are receptor molecules and targets for the avermectin-milbemycin (AM) group of anthelmintics. Mutations in GluCls are associated with ivermectin resistance in the soil dwelling nematode Caenorhabditis elegans and the parasitic nematode Cooperia oncophora. In this study, full-length cDNAs encoding alpha and beta subunits of GluCl were cloned and sequenced in Cylicocyclus nassatus, a common and important cyathostomin nematode parasite of horses. Both genes possess the sequence characteristics typical of GluCls, and phylogenetic analysis confirms that these genes are evolutionarily closely related to GluCls of other nematodes and flies. Complete coding sequences of C. nassatus GluCl-alpha and GluCl-beta were subcloned into pTL1 mammalian expression vector, and proteins were expressed in COS-7 cells. Ivermectin-binding characteristics were determined by incubating COS-7 cell membranes expressing C. nassatus GluCl-alpha and GluCl-beta proteins with [(3)H]ivermectin. In competitive binding experiments, fitting the data to a one site competition model, C. nassatus GluCl-alpha was found to bind [(3)H]ivermectin with a high amount of displaceable binding (IC(50)=208 pM). Compared to the mock-transfected COS-7 cells, the means of [(3)H]ivermectin binding were significantly different for C. nassatus GluCl-alpha and the Haemonchus contortus GluCl (HcGluCla) (p=0.018 and 0.023, respectively) but not for C. nassatus GluCl-beta (p=0.370). This is the first report of orthologs of GluCl genes and in vitro expression of an ivermectin-binding protein in a cyathostomin species. These data suggest the likelihood of a similar mechanism of action of AM drugs in these parasites, and suggest that mechanisms of resistance may also be similar.

  15. An approach for producing transgenic cloned cows by nuclear transfer of cells transfected with human alpha 1-antitrypsin gene.

    PubMed

    Jang, Goo; Bhuiyan, M M U; Jeon, Hyun Yong; Ko, Kyeong Hee; Park, Hee Jung; Kim, Min Kyu; Kim, Joung Ju; Kang, Sung Keun; Lee, Byeong Chun; Hwang, Woo Suk

    2006-06-01

    In an attempt to produce transgenic cloned cows secreting alpha 1-antitrypsin (alpha1-AT) protein into milk, bovine cumulus cells were transfected with a plasmid containing an alpha1-AT gene and green fluorescent protein (GFP) reporter gene using Fugene 6 as a lipid carrier. The GFP-expressing cells were selected and transferred into enucleated bovine oocytes. Couplets were fused, chemically activated and cultured. Developmental competence was monitored and the number of inner cell mass (ICM) and trophectoderm (TE) cells in blastocysts were counted after differential staining. The percentage of blastocysts was lower (P < 0.05) in transgenic cloned embryos compared to non-transgenic cloned embryos (23% versus 35%). No difference in the numbers of ICM and TE cells between the two groups of embryos was observed. One or two GFP-expressing blastocysts were transferred into the uterus of each recipient cow. Out of 49 recipient cows, three pregnancies were detected by non-return estrus and rectal palpation. However, the pregnancies failed to maintain to term; two fetuses were aborted at Day 60 and 150, respectively, and one fetus at Day 240. The genomic DNA from the aborted fetus was amplified by polymerase chain reaction (PCR) to investigate integration of the transgene in the fetus. The expected PCR product was sequenced and was identical to the sequence of alpha1-AT transgene. In conclusion, the present study demonstrated that developmental competence of cloned embryos derived from transgenic donor cells was lower than embryos derived from non-transfected donor cells. Although we failed to obtain a viable transgenic cloned calf, integration of alpha1-AT gene into the fetus presents the possibility of producing transgenic cloned cows by somatic cell nuclear transfer.

  16. Two bi-allelic single nucleotide polymorphisms within the promoter region of the horse tumour necrosis factor alpha gene.

    PubMed

    Matiasovic, J; Lukeszová, L; Horín, P

    2002-08-01

    Primers based on GenBank sequences within the 5' untranslated region (UTR) of the human and horse tumour necrosis factor alpha (TNF-alpha) genes were designed and used to amplify a 522-bp product. Sequencing of five clones derived from five independent PCRs obtained from three different animals of three different breeds (Old Kladruber, Akhal-Teke and Shetland Pony) revealed a high level of sequence identity to the TNF-alpha promoter regions of other species. The existing GenBank horse sequences were confirmed and extended upstream by 230 nucleotides. Based on the sequence obtained, a new horse-specific forward primer was designed to amplify a 213-bp PCR product, which was screened for polymorphism using single-strand conformation polymorphism (SSCP). Three allelic variants of the horse TNF-alpha gene were identified and sequenced (GenBank accession numbers ADF 349558-60). Two single nucleotide polymorphisms explained the existence of the three SSCP alleles detected: C/T and T/C single base pair substitutions at positions 137 and 147, respectively. Differences in allelic frequencies between Old Kladruber and Akhal-Teke breeds were observed.

  17. The Arabidopsis ETHYLENE RESPONSE FACTOR1 Regulates Abiotic Stress-Responsive Gene Expression by Binding to Different cis-Acting Elements in Response to Different Stress Signals1[W][OA

    PubMed Central

    Cheng, Mei-Chun; Liao, Po-Ming; Kuo, Wei-Wen; Lin, Tsan-Piao

    2013-01-01

    ETHYLENE RESPONSE FACTOR1 (ERF1) is an upstream component in both jasmonate (JA) and ethylene (ET) signaling and is involved in pathogen resistance. Accumulating evidence suggests that ERF1 might be related to the salt stress response through ethylene signaling. However, the specific role of ERF1 in abiotic stress and the molecular mechanism underlying the signaling cross talk still need to be elucidated. Here, we report that ERF1 was highly induced by high salinity and drought stress in Arabidopsis (Arabidopsis thaliana). The salt stress induction required both JA and ET signaling but was inhibited by abscisic acid. ERF1-overexpressing lines (35S:ERF1) were more tolerant to drought and salt stress. They also displayed constitutively smaller stomatal aperture and less transpirational water loss. Surprisingly, 35S:ERF1 also showed enhanced heat tolerance and up-regulation of heat tolerance genes compared with the wild type. Several suites of genes activated by JA, drought, salt, and heat were found in microarray analysis of 35S:ERF1. Chromatin immunoprecipitation assays found that ERF1 up-regulates specific suites of genes in response to different abiotic stresses by stress-specific binding to GCC or DRE/CRT. In response to biotic stress, ERF1 bound to GCC boxes but not DRE elements; conversely, under abiotic stress, we observed specific binding of ERF1 to DRE elements. Furthermore, ERF1 bound preferentially to only one among several GCC box or DRE/CRT elements in the promoter region of its target genes. ERF1 plays a positive role in salt, drought, and heat stress tolerance by stress-specific gene regulation, which integrates JA, ET, and abscisic acid signals. PMID:23719892

  18. Molecular cloning and characterization of CFT1, a developmentally regulated avian alpha(1,3)-fucosyltransferase gene.

    PubMed

    Lee, K P; Carlson, L M; Woodcock, J B; Ramachandra, N; Schultz, T L; Davis, T A; Lowe, J B; Thompson, C B; Larsen, R D

    1996-12-20

    Although coordinate expression of carbohydrate epitopes during development is well described, mechanisms which regulate this expression remain largely unknown. In this study we demonstrate that developing chicken B cells express the LewisX terminal oligosaccharide structure in a stage-specific manner. To examine regulation of this expression, we have cloned and expressed the chicken alpha(1,3)-fucosyltransferase gene involved in LewisX biosynthesis, naming it chicken fucosyltransferase 1 (CFT1). CFT1 is characterized by a single long open reading frame of 356 amino acids encoding a type II transmembrane glycoprotein. The domain structure and predicted amino acid sequence are highly conserved between CFT1 and mammalian FucTIV genes (52.8% and 46.3% identity to mouse and human respectively). In vitro CFT1 fucosyltransferase activity utilizes LacNAc > 3'sialyl-LacNAc acceptors with almost no utilization of other neutral type II (lactose, 2-fucosyllactose), or type I (lacto-N-biose I) acceptors. CFT1-transfected cells make cell surface LewisX (COS-7) and LewisX + VIM-2 structures (Chinese hamster ovary). CFT1 gene expression is tissue-specific and includes embryonic thymus and bursa. Furthermore, expression of the CFT1 gene and cell surface LewisX structures are closely linked during B cell development. These findings reveal the evolutionary conservation between nonmammalian and mammalian alpha(1,3)-fucosyltransferase genes and demonstrate a role for fucosyltransferase gene regulation in the developmental expression of oligosaccharide structures.

  19. An E-box/M-CAT hybrid motif and cognate binding protein(s) regulate the basal muscle-specific and cAMP-inducible expression of the rat cardiac alpha-myosin heavy chain gene.

    PubMed

    Gupta, M P; Gupta, M; Zak, R

    1994-11-25

    Expression of the cardiac myosin heavy chain (MHC) genes is regulated developmentally and by numerous epigenetic factors. Here we report the identification of a cis-regulatory element and cognate nuclear binding protein(s) responsible for cAMP-induced expression of the rat cardiac alpha-MHC gene. By Northern blot analysis, we found that, in primary cultures of fetal rat heart myocytes, the elevation of intracellular levels of cAMP results in up-regulation of alpha-MHC and down-regulation of beta-MHC mRNA expression. This effect of cAMP was dependent upon the basal level of expression of both MHC transcripts and was sensitive to cycloheximide. In transient expression analysis employing a series of alpha-MHC/CAT constructs, we identified a 31-base pair fragment located in the immediate upstream region (-71 to -40), which confers both muscle-specific and cAMP-inducible expression of the gene. Within this 31-base pair fragment there are two regions, an AT-rich portion and a hybrid motif which contains overlapping sequences of E-box and M-CAT binding sites (GGCACGTGGAATG). By substitution mutation analysis, both elements were found important for the basal muscle-specific expression; however, the cAMP-inducible expression of the gene is conferred only by the E-box/M-CAT hybrid motif (EM element). Using mobility gel shift competition assay, immunoblotting, and UV-cross-linking analyses, we found that a protein binding to the EM element is indistinguishable from the transcription enhancer factor-1 (TEF-1) in terms of sequence recognition, molecular mass, and immunoreactivity. Methylation interference and point mutation analyses indicate that, besides M-CAT sequences, center CG dinucleotides of the E-box motif CACGTG are essential for protein binding to the EM element and for its functional activity. Furthermore, our data also show that, in addition to TEF-1, another HF-1a-related factor may be recognized by the alpha-MHC gene EM element. These results are first to

  20. Nondeletional alpha-thalassemia: first description of alpha Hph alpha and alpha Nco alpha mutations in a Spanish population.

    PubMed

    Ayala, S; Colomer, D; Aymerich, M; Pujades, A; Vives-Corrons, J L

    1996-07-01

    Several different deletions underlie the molecular basis of alpha-thalassemia. The most common alpha-thalassemia determinant in Spain is the rightward deletion (-alpha 3.7). To our knowledge, however, no cases of alpha-thalassemia due to nondeletional mutations have so far been described in this particular Mediterranean area. Here, we report the existence of nondeletional forms of alpha-thalassemia in ten Spanish families. The alpha 2-globin gene was characterized in ten unrelated patients and their relatives only when the presence of deletional alpha-thalassemia was ruled out. The alpha 2-globin gene analysis was performed using the polymerase chain reaction (PCR) followed by restriction enzyme analysis or by allelespecific priming. This allowed the identification of a 5-base pair (bp) deletion at the donor site of IVS I (alpha Hph alpha) in 9 cases and the alpha 2 initiation codon mutation (alpha Nco alpha) in one case. Although these alpha 2-globin gene mutations are found in other mediterranean areas, our results demonstrate their presence in the Spanish population and suggest that the alpha Hph alpha/alpha alpha genotype is probably the most common nondeletional form of alpha-thalassemia in Spain.

  1. Identification and characterization of an alternative promoter of the human PGC-1{alpha} gene

    SciTech Connect

    Yoshioka, Toyo; Inagaki, Kenjiro; Noguchi, Tetsuya; Sakai, Mashito; Ogawa, Wataru; Hosooka, Tetsuya; Iguchi, Haruhisa; Watanabe, Eijiro; Matsuki, Yasushi; Hiramatsu, Ryuji; Kasuga, Masato

    2009-04-17

    The transcriptional regulator peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) controls mitochondrial biogenesis and energy homeostasis. Although physical exercise induces PGC-1{alpha} expression in muscle, the underlying mechanism of this effect has remained incompletely understood. We recently identified a novel muscle-enriched isoform of PGC-1{alpha} transcript (designated PGC-1{alpha}-b) that is derived from a previously unidentified first exon. We have now cloned and characterized the human PGC-1{alpha}-b promoter. The muscle-specific transcription factors MyoD and MRF4 transactivated this promoter through interaction with a proximal E-box motif. Furthermore, either forced expression of Ca{sup 2+}- and calmodulin-dependent protein kinase IV (CaMKIV), calcineurin A, or the p38 mitogen-activated protein kinase (p38 MAPK) kinase MKK6 or the intracellular accumulation of cAMP activated the PGC-1{alpha}-b promoter in cultured myoblasts through recruitment of cAMP response element (CRE)-binding protein (CREB) to a putative CRE located downstream of the E-box. Our results thus reveal a potential molecular basis for isoform-specific regulation of PGC-1{alpha} expression in contracting muscle.

  2. In vivo regulation of gene transcription by alpha- and gamma-Tocopherol in murine T lymphocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Of the 8 different analogues (alpha-, beta-, gamma-, delta-tocopherols and tocotrienols) designated as vitamin E, alpha-tocopherol (a-T) has been mostly studied, together with gamma-tocopherol (g-T) which is abundant in the US diet. We compared the effect of dietary supplementation with adequate or ...

  3. Hypoxia-inducible factor-1 facilitates cervical cancer progression in human papillomavirus type 16 transgenic mice.

    PubMed

    Lu, Zhi Hong; Wright, Jason D; Belt, Brian; Cardiff, Robert D; Arbeit, Jeffrey M

    2007-08-01

    Advanced cervical cancer remains a vexing clinical challenge despite screening programs. Many of these cancers are hypoxic, and expression of the alpha subunit of the major regulator of the hypoxic cellular response, the transcription factor hypoxia-inducible factor-1 (HIF-1), is correlated with poor prognosis. Here, we tested a functional role for HIF-1alpha in pathogenesis of cervical cancer in estrogen-treated transgenic mice. Double-transgenic (DTG) mice developed locally invasive cervical cancers 70 times larger than K14-HPV16 mice. In vivo bromodeoxyuridine incorporation was elevated in DTG cancers without a significant increase in apoptosis. HIF-1alpha gain of function did not up-regulate canonical HIF-1 targets in premalignant DTG cervices, in contrast to elevation of these targets in K14-HIF-1alpha transgenic cervices. The DTG transcriptional signature included up-regulation of mRNAs encoding cytokines and chemokines, immune signaling molecules, extracellular proteases, and cell motility factors, as well as reduced expression of cell adhesion and epithelial differentiation genes. Importantly, a set of gene markers derived from the DTG transcriptome predicted cervical cancer progression in patients. This study suggests a novel paradigm for HIF-1 function evident in multistage carcinogenesis as opposed to established malignancies, including interaction with viral oncogenes to induce multiple genomic networks in premalignancy that fosters the development of advanced cervical cancer.

  4. Hypoxia Inducible Factor-1 as a Target for Neurodegenerative Diseases

    PubMed Central

    Zhang, Ziyan; Yan, Jingqi; Chang, Yanzhong; Yan, Shirley ShiDu; Shi, Honglian

    2011-01-01

    Hypoxia inducible factor-1 (HIF-1) is a transcriptional factor responsible for cellular and tissue adaption to low oxygen tension. HIF-1, a heterodimer consisting of a constitutively expressed β subunit and an oxygen-regulated α subunit, regulates a series of genes that participate in angiogenesis, iron metabolism, glucose metabolism, and cell proliferation/survival. The activity of HIF-1 is controlled by post-translational modifications on different amino acid residues of its subunits, mainly the alpha subunit. Besides in ischemic stroke (see review [1]), emerging evidence has revealed that HIF-1 activity and expression of its down-stream genes, such as vascular endothelial growth factor and erythropoietin, are altered in a range of neurodegenerative diseases. At the same time, experimental and clinical evidence has demonstrated that regulating HIF-1 might ameliorate the cellular and tissue damage in the neurodegenerative diseases. These new findings suggest HIF-1 as a potential medicinal target for the neurodegenerative diseases. This review focuses on HIF-1α protein modifications and HIF-1’s potential neuroprotective roles in Alzheimer’s (AD), Parkinson’s (PD), Huntington’s diseases (HD), and amyotrophic lateral sclerosis (ALS). PMID:21861815

  5. An M-CAT binding factor and an RSRF-related A-rich binding factor positively regulate expression of the alpha-cardiac myosin heavy-chain gene in vivo.

    PubMed Central

    Molkentin, J D; Markham, B E

    1994-01-01

    Cardiac muscle-restricted expression of the alpha-myosin heavy-chain (alpha-MHC) gene is regulated by multiple elements in the proximal enhancer/promoter. Within this region, an M-CAT site and an A-rich site were identified as potential regulatory elements. Site-specific mutations in each site, individually, reduced activity from the wild-type promoter by approximately 85% in the adult rat heart, demonstrating that these sites were positive regulatory elements. alpha-MHC, beta-MHC, and chicken cardiac troponin T (cTnT) M-CAT sites interacted with an M-CAT-binding factor (MCBF) from rat heart nuclear extracts that was immunologically related to transcriptional enhancer factor 1, a factor that binds within the simian virus 40 enhancer. The factor that bound the A-rich region (ARF) was antigenically related to the RSRF family of proteins, ARF was distinct from myocyte-specific enhancer factor 2 (MEF-2) on the basis of DNA-binding specificity and developmental expression. Like MEF-2, ARF DNA-binding activity was present in the heart and brain; however, no ARF activity was detected in extracts from skeletal muscle or C2C12 myotubes. MCBF and ARF DNA-binding activities were developmentally regulated with peak levels in the 1- to 2-day neonatal heart. The activity of both factors increased nearly fivefold in adult rat hearts subjected to a pressure overload. By comparison, the levels of alpha-MHC binding factor 2 did not change during hypertrophy. Binding sites for MCBF and ARF are present in several genes that are upregulated during cardiac hypertrophy. Our results suggest that these factors participate in the alterations in gene expression that occur during cardiac development and hypertrophy. Images PMID:8035789

  6. A silent mutation in human alpha-A crystallin gene in patients with age-related nuclear or cortical cataract.

    PubMed

    Mynampati, Bharani K; Muthukumarappa, Thungapathra; Ghosh, Sujata; Ram, Jagat

    2017-02-01

    A cataract is a complex multifactorial disease that results from alterations in the cellular architecture, i.e. lens proteins. Genes associated with the development of lens include crystallin genes. Although crystallins are highly conserved proteins among vertebrates, a significant number of polymorphisms exist in human population. In this study, we screened for polymorphisms in crystallin alpha A (CRYAA) and alpha B (CRYAB) genes in 200 patients over 40 years of age, diagnosed with age-related cataract (ARC; nuclear and cortical cataracts). Genomic DNA was extracted from the peripheral blood. The coding regions of the CRYAA and CRYAB gene were amplified using polymerase chain reaction and subjected to restriction digestion. Restriction fragment length polymorphism (RFLP) was performed using known restriction enzymes for CRYAA and CRYAB genes. Denaturing high performance liquid chromatography and direct sequencing were performed to detect sequence variation in CRYAA gene. In silico analysis of secondary CRYAA mRNA structure was performed using CLC RNA Workbench. RFLP analysis did not show any changes in the restriction sites of CRYAA and CRYAB genes. In 6 patients (4 patients with nuclear cataract and 2 with cortical cataract), sequence analysis of the exon 1 in the CRYAA gene showed a silent single nucleotide polymorphism [D2D] (CRYAA: C to T transition). One of the patients with nuclear cataract was homozygous for this allele. The in silico analysis revealed that D2D mutation results in a compact CRYAA mRNA secondary structure, while the wild type CRYAA mRNA has a weak or loose secondary structure. D2D mutation in the CRYAA gene may be an additional risk factor for progression of ARC.

  7. Genetic mapping of the alpha-galactosidase MEL gene family on right and left telomeres of Saccharomyces cerevisiae.

    PubMed

    Naumov, G I; Naumova, E S; Louis, E J

    1995-04-30

    The alpha-galactosidase MEL2-MEL10 genes have been genetically mapped to right and left telomere regions of the following chromosomes of Saccharomyces cerevisiae: MEL2 at VII L, MEL3 at XVI L, MEL4 at XI L, MEL5 at IV L, MEL6 at XIII R, MEL7 at VI R, MEL8 at XV R, MEL9 at X R and MEL10 at XII R. A set of tester strains with URA3 inserted into individual telomeres and no MEL genes was used for mapping.

  8. Hereditary Persistence of Alpha-Fetoprotein Is Associated with the −119G>A Polymorphism in AFP Gene

    PubMed Central

    Deshpande, Neha; Chavan, Radhika; Bale, Govardhan; Avanthi, Urmila Steffie; Aslam, Mohsin; Ramchandani, Mohan; Reddy, D. Nageshwar

    2017-01-01

    Alpha-fetoprotein (AFP) is a glycoprotein that is produced by the liver and yolk sac during fetal development. Its levels are usually raised in malignant conditions. Hereditary persistence of AFP (HPAFP) is a rare benign condition with elevated levels of AFP. It is inherited in a dominant mode with complete penetrance and is usually not associated with any clinical disability. We report two individuals with elevated levels of AFP harboring the −119G>A polymorphism in the AFP gene. A genetic screening to rule out variants in the AFP gene is advised in cases with unexplained persistent AFP levels to avoid inappropriate treatment and surgical options. PMID:28286798

  9. Hereditary Persistence of Alpha-Fetoprotein Is Associated with the -119G>A Polymorphism in AFP Gene.

    PubMed

    Deshpande, Neha; Chavan, Radhika; Bale, Govardhan; Avanthi, Urmila Steffie; Aslam, Mohsin; Ramchandani, Mohan; Reddy, D Nageshwar; Ravikanth, V V

    2017-01-01

    Alpha-fetoprotein (AFP) is a glycoprotein that is produced by the liver and yolk sac during fetal development. Its levels are usually raised in malignant conditions. Hereditary persistence of AFP (HPAFP) is a rare benign condition with elevated levels of AFP. It is inherited in a dominant mode with complete penetrance and is usually not associated with any clinical disability. We report two individuals with elevated levels of AFP harboring the -119G>A polymorphism in the AFP gene. A genetic screening to rule out variants in the AFP gene is advised in cases with unexplained persistent AFP levels to avoid inappropriate treatment and surgical options.

  10. DNA sequence analysis of a mouse pro alpha 1 (I) procollagen gene: evidence for a mouse B1 element within the gene.

    PubMed Central

    Monson, J M; Friedman, J; McCarthy, B J

    1982-01-01

    In a 3.8-kilobase mouse DNA sequence encoding amino acid sequences for the pro alpha 1(I) chain of type I procollagen, 14 coding sequences were identified which specify a sequence 95% homologous to amino acid residues 568 to 963 of the bovine alpha 1(I) chain. All of these coding sequences were flanked by appropriate splice junctions following the GT/AG rule. These observations suggest, but do not prove, that this pro alpha 1(I) gene is transcriptionally active. Of the 14 coding sequences, 7 were 54 base pairs in length, whereas the remainder were higher multiples of 54 base pairs. Nonrandom utilization of codons pertained throughout all of the coding sequences showing a preference (56%) for U in the wobble position. Two of the intervening sequences encoded imperfect vestiges of coding sequences which exhibited a codon preference different from that of the pro alpha 1(I) gene proper and were not flanked by splice junctions. One intervening sequence encoded a member of the mouse B1 family of middle repetitive sequences. It was flanked by 8-base-pair direct repeats and had a truncated A-rich region, suggesting that it may be a mobile element. Within this element were sequences which could function as a RNA polymerase III split promoter. Images PMID:6298597

  11. Expression of the ctenophore Brain Factor 1 forkhead gene ortholog (ctenoBF-1) mRNA is restricted to the presumptive mouth and feeding apparatus: implications for axial organization in the Metazoa

    NASA Technical Reports Server (NTRS)

    Yamada, Atsuko; Martindale, Mark Q.

    2002-01-01

    Ctenophores are thoroughly modern animals whose ancestors are derived from a separate evolutionary branch than that of other eumetazoans. Their major longitudinal body axis is the oral-aboral axis. An apical sense organ, called the apical organ, is located at the aboral pole and contains a highly innervated statocyst and photodetecting cells. The apical organ integrates sensory information and controls the locomotory apparatus of ctenophores, the eight longitudinal rows of ctene/comb plates. In an effort to understand the developmental and evolutionary organization of axial properties of ctenophores we have isolated a forkhead gene from the Brain Factor 1 (BF-1) family. This gene, ctenoBF-1, is the first full-length nuclear gene reported from ctenophores. This makes ctenophores the most basal metazoan (to date) known to express definitive forkhead class transcription factors. Orthologs of BF-1 in vertebrates, Drosophila, and Caenorhabditis elegans are expressed in anterior neural structures. Surprisingly, in situ hybridizations with ctenoBF-1 antisense riboprobes show that this gene is not expressed in the apical organ of ctenophores. CtenoBF-1 is expressed prior to first cleavage. Transcripts become localized to the aboral pole by the 8-cell stage and are inherited by ectodermal micromeres generated from this region at the 16- and 32-cell stages. Expression in subsets of these cells persists and is seen around the edge of the blastopore (presumptive mouth) and in distinct ectodermal regions along the tentacular poles. Following gastrulation, stomodeal expression begins to fade and intense staining becomes restricted to two distinct domains in each tentacular feeding apparatus. We suggest that the apical organ is not homologous to the brain of bilaterians but that the oral pole of ctenophores corresponds to the anterior pole of bilaterian animals.

  12. A high affinity HSF-1 binding site in the 5'-untranslated region of the murine tumor necrosis factor-alpha gene is a transcriptional repressor.

    PubMed

    Singh, Ishwar S; He, Ju-Ren; Calderwood, Stuart; Hasday, Jeffrey D

    2002-02-15

    Tumor necrosis factor-alpha (TNFalpha) is a pivotal early mediator of host defenses that is essential for survival in infections. We previously reported that exposing macrophages to febrile range temperatures (FRT) (38.5-40 degrees C) markedly attenuates TNFalpha expression by causing abrupt and premature cessation of transcription. We showed that this inhibitory effect of FRT is mediated by an alternatively activated repressor form of heat shock factor 1 (HSF-1) and that a fragment of the TNFalpha gene comprising a minimal 85-nucleotide (nt) proximal promoter and the 138-nt 5'-untranslated region (UTR) was sufficient for mediating this effect. In the present study we have used an electrophoretic mobility shift assay (EMSA) to identify a high affinity binding site for HSF-1 in the 5'-UTR of the TNFalpha gene and have used a chromosome immunoprecipitation assay to show that HSF-1 binds to this region of the endogenous TNFalpha gene. Mutational inactivation of this site blocks the inhibitory effect of overexpressed HSF-1 on activity of the minimal TNFalpha promoter (-85/+138) in Raw 264.7 murine macrophages, identifying this site as an HSF-1-dependent repressor. However, the same mutation fails to block repression of a full-length (-1080/+138) TNFalpha promoter construct by HSF-1 overexpression, and HSF-1 binds to upstream sequences in the regions -1080/-845, -533/-196, and -326/-39 nt in EMSA, suggesting that additional HSF-1-dependent repressor elements are present upstream of the minimal -85-nt promoter. Furthermore, although mutation of the HSF-1 binding site in the minimal TNFalpha promoter construct abrogates HSF-1-mediated repression, the same mutation fails to abrogate repression of this construct by high levels of HSF-1 overexpression or exposure to 39.5 degrees C. This suggests that HSF-1 might repress TNFalpha transcription through redundant mechanisms, some of which might not require high affinity binding of HSF-1.

  13. SAG/ROC2/RBX2 is a HIF-1 target gene that promotes HIF-1 alpha ubiquitination and degradation.

    PubMed

    Tan, M; Gu, Q; He, H; Pamarthy, D; Semenza, G L; Sun, Y

    2008-02-28

    SAG (sensitive to apoptosis gene) or ROC2/RBX2 is the second family member of ROC1/RBX1, a component of SCF (Skp1, Cullin, F-box protein) and VCB (von Hippel-Lindau (VHL), Cullin and Elongin B/C) E3 ubiquitin ligases. SAG protected cells from hypoxia-induced apoptosis when overexpressed. We report here that SAG was subjected to hypoxia induction at the levels of mRNA and protein. Hypoxia induction of SAG was largely HIF-1alpha dependent. A consensus HIF-1-binding site, GCGTG was identified in the first intron of the SAG gene. In response to hypoxia, HIF-1 bound to this site and transactivated SAG expression. SAG transactivation required both the intact binding site in cis and HIF-1alpha in trans. On the other hand, like its family member, ROC1, SAG promoted VHL-mediated HIF-1alpha ubiquitination and degradation, which was significantly inhibited upon small interfering RNA silencing of SAG or ROC1. Furthermore, the endogenous HIF-1alpha at both basal and hypoxia-induced levels was significantly increased upon SAG silencing. Finally, SAG forms in vivo complex with Cul-5 and VHL under hypoxia condition. These results suggest an HIF-1-SAG feedback loop in response to hypoxia, as follows: hypoxia induces HIF-1 to transactivate SAG. Induced SAG then promotes HIF-1alpha ubiquitination and degradation. This feedback loop may serve as a cellular defensive mechanism to reduce potential cytotoxic effects of prolonged HIF-1 activation under hypoxia.

  14. The alpha- and beta-expansin and xyloglucan endotransglucosylase/hydrolase gene families of wheat: molecular cloning, gene expression, and EST data mining.

    PubMed

    Liu, Yong; Liu, Dongcheng; Zhang, Haiying; Gao, Hongbo; Guo, Xiaoli; Wang, Daowen; Zhang, Xiangqi; Zhang, Aimin

    2007-10-01

    Expansins and xyloglucan endotransglucosylase/hydrolases (XTHs) are families of extracellular proteins with members that have been shown to play an important role in cell wall growth. In this study, three, six, and five members of the wheat alpha-expansin (TaEXPA1 to TaEXPA3), beta-expansin (TaEXPB1 to TaEXPB6), and XTH (TaXTH1 to TaXTH5) gene families, respectively, were isolated from a dwarf wheat line. The mRNA expression analysis by real-time RT-PCR indicates that these genes display different transcription levels in different stages/organs/treatments, possibly suggesting their functional roles in the cell wall expansion process. Moreover, the comparison of the expression levels reveals that most of the expansins show lower expression than the XTHs. Finally, we present the analysis of wheat alpha- and beta-expansins and XTH families by expressed sequence tag data mining.

  15. Genomic organization of the CC chemokine mip-3alpha/CCL20/larc/exodus/SCYA20, showing gene structure, splice variants, and chromosome localization.

    PubMed

    Nelson, R T; Boyd, J; Gladue, R P; Paradis, T; Thomas, R; Cunningham, A C; Lira, P; Brissette, W H; Hayes, L; Hames, L M; Neote, K S; McColl, S R

    2001-04-01

    We describe the genomic organization of a recently identified CC chemokine, MIP3alpha/CCL20 (HGMW-approved symbol SCYA20). The MIP-3alpha/CCL20 gene was cloned and sequenced, revealing a four exon, three intron structure, and was localized by FISH analysis to 2q35-q36. Two distinct cDNAs were identified, encoding two forms of MIP-3alpha/CCL20, Ala MIP-3alpha/CCL20 and Ser MIP-3alpha/CCL20, that differ by one amino acid at the predicted signal peptide cleavage site. Examination of the sequence around the boundary of intron 1 and exon 2 showed that use of alternative splice acceptor sites could give rise to Ala MIP-3alpha/CCL20 or Ser MIP-3alpha/CCL20. Both forms of MIP-3alpha/CCL20 were chemically synthesized and tested for biological activity. Both flu antigen plus IL-2-activated CD4(+) and CD8(+) T lymphoblasts and cord blood-derived dendritic cells responded to Ser and Ala MIP-3alpha/CCL20. T lymphocytes exposed only to IL-2 responded inconsistently, while no response was detected in naive T lymphocytes, monocytes, or neutrophils. The biological activity of Ser MIP-3alpha/CCL20 and Ala MIP-3alpha/CCL20 and the tissue-specific preference of different splice acceptor sites are not yet known.

  16. Expression of the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a MAR element in transgenic mice.

    PubMed

    Burkov, I A; Serova, I A; Battulin, N R; Smirnov, A V; Babkin, I V; Andreeva, L E; Dvoryanchikov, G A; Serov, O L

    2013-10-01

    Expression of the human granulocyte-macrophage colony-stimulating factor (hGM-CSF) gene under the control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a matrix attachment region (MAR) element from the Drosophila histone 1 gene was studied in four and eight transgenic mouse lines, respectively. Of the four transgenic lines carrying the transgene without MAR, three had correct tissues-specific expression of the hGM-CSF gene in the mammary gland only and no signs of cell mosaicism. The concentration of hGM-CSF in the milk of transgenic females varied from 1.9 to 14 μg/ml. One line presented hGM-CSF in the blood serum, indicating ectopic expression. The values of secretion of hGM-CSF in milk of 6 transgenic lines carrying the transgene with MAR varied from 0.05 to 0.7 μg/ml, and two of these did not express hGM-CSF. Three of the four examined animals from lines of this group showed ectopic expression of the hGM-CSF gene, as determined by RT-PCR and immunofluorescence analyses, as well as the presence of hGM-CSF in the blood serum. Mosaic expression of the hGM-CSF gene in mammary epithelial cells was specific to all examined transgenic mice carrying the transgene with MAR but was never observed in the transgenic mice without MAR. The mosaic expression was not dependent on transgene copy number. Thus, the expected "protective or enhancer effect" from the MAR element on the hGM-CSF gene expression was not observed.

  17. Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

    SciTech Connect

    Gu Ning; Adachi, Tetsuya; Matsunaga, Tetsuro; Takeda, Jun; Tsujimoto, Gozoh; Ishihara, Akihiko; Yasuda, Koichiro; Tsuda, Kinsuke . E-mail: jinkan@tom.life.h.kyoto-u.ac.jp

    2006-08-04

    Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2 mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.

  18. Regulation of herpesvirus macromolecular synthesis: temporal order of transcription of alpha genes is not dependent on the stringency of inhibition of protein synthesis.

    PubMed Central

    Mackem, S; Roizman, B

    1981-01-01

    Operationally, alpha genes of herpes simplex virus 1 were defined on the basis of the observations that they are the earliest genes expressed in the infected cell and that the transcription, processing, accumulation of the mRNA's in the infected cell cytoplasm can take place in the presence of inhibitors of protein synthesis, such as cycloheximide. In these studies, we translated in vitro the viral mRNA's extracted from cells infected maintained in the presence of cycloheximide, emetine, or anisomycin. Inasmuch as all the major alpha proteins (no. 0, 4, 22, and 27) were translated, we conclude that the transcription of all previously defined alpha genes is independent of the stringency of inhibition of protein synthesis and that pre-alpha genes cannot be detected in such experiments. Images PMID:6270385

  19. Physical mapping of four serpin genes: alpha 1-antitrypsin, alpha 1-antichymotrypsin, corticosteroid-binding globulin, and protein C inhibitor, within a 280-kb region on chromosome I4q32.1.

    PubMed Central

    Billingsley, G D; Walter, M A; Hammond, G L; Cox, D W

    1993-01-01

    Alpha 1-antitrypsin (alpha 1AT; protease inhibitor [PI] locus), alpha 1-antichymotrypsin (alpha 1ACT; AACT locus), corticosteroid-binding globulin (CBG; CBG locus), and protein C inhibitor (PCI; PCI locus) are members of the serine protease inhibitor (serpin) superfamily. A noncoding PI-like (PIL) gene has been located 12 kb 3' of the PI gene. The PI, PIL, and AACT loci have been localized to 14q32.1, the CBG locus has been localized to 14q31-14q32.1, and PCI has been mapped to chromosome 14. Genetic linkage analysis suggests tight linkage between PI and AACT. We have used pulsed-field gel electrophoresis to generate a physical map linking these five serpin genes. The order of the genetic loci is AACT/PCI-PI-PIL-CBG, with a maximum distance of about 220 kb between the AACT/PCI and PI genes. These genes form a PI cluster at 14q32.1, similar to that of the homologous genes on murine chromosome l2. The close proximity of these genes has implications for disease-association studies. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:8381582

  20. Growth hormone-releasing hormone resistance in pseudohypoparathyroidism type ia: new evidence for imprinting of the Gs alpha gene.

    PubMed

    Mantovani, Giovanna; Maghnie, Mohamad; Weber, Giovanna; De Menis, Ernesto; Brunelli, Valeria; Cappa, Marco; Loli, Paola; Beck-Peccoz, Paolo; Spada, Anna

    2003-09-01

    Heterozygous inactivating mutations in the Gs alpha gene cause Albright's hereditary osteodystrophy. Consistent with the observation that only maternally inherited mutations lead to resistance to hormone action [pseudohypoparathyroidism type Ia (PHP Ia)], recent studies provided evidence for a predominant maternal origin of Gs alpha transcripts in endocrine organs, such as thyroid, gonad, and pituitary. The aim of this study was to investigate the presence of pituitary resistance to hypothalamic hormones acting via Gs alpha-coupled receptors in patients with PHP Ia. Six of nine patients showed an impaired GH responsiveness to GHRH plus arginine, consistent with a complete GH deficiency (GH peak from 2.6-8.6 microg/liter, normal > 16.5), and partial (GH peak 13.9 and 13.6 microg/liter) and normal responses were found in two and one patient, respectively. Accordingly, IGF-I levels were below and in the low-normal range in seven and two patients. All patients had a normal cortisol response to 1 microg ACTH test, suggesting a normal corticotroph function that was confirmed by a normal ACTH and cortisol response to CRH test in three patients. In conclusion, we report that in addition to PTH and TSH resistance, patients with PHP Ia display variable degrees of GHRH resistance, consistent with Gs alpha imprinting in human pituitary.

  1. An amino acid substitution in the pyruvate dehydrogenase E1{alpha} gene, affecting mitochondrial import of the precursor protein

    SciTech Connect

    Takakubo, F.; Thorburn, D.R.; Dahl, H.H.M.

    1995-10-01

    A mutation in the mitochondrial targeting sequence was characterized in a male patient with X chromosome-linked pyruvate dehydrogenase E1{alpha} deficiency. The mutation was a base substitution of G by C at nucleotide 134 in the mitochondrial targeting sequence of the PDHA1 gene, resulting in an arginine-to-proline substitution at codon 10 (R10P). Pyruvate dehydrogenase activity in cultured skin fibroblasts was 28% of the control value, and immunoblot analysis revealed a decreased level of pyruvate dehydrogenase E1{alpha}immunoreactivity. Chimeric constructs in which the normal and mutant pyruvate dehydrogenase E1{alpha} targeting sequences were attached to the mitochondrial matrix protein ornithine transcarbamylase were synthesized in a cell free translation system, and mitochondrial import of normal and mutant proteins was compared in vitro. The results show that ornithine transcarbamylase targeted by the mutant pyruvate dehydrogenase E1{alpha} sequence was translocated into the mitochondrial matrix at a reduced rate, suggesting that defective import is responsible for the reduced pyruvate dehydrogenase level in mitochondria. The mutation was also present in an affected brother and the mildly affected mother. The clinical presentations of this X chromosome-linked disorder in affected family members are discussed. To our knowledge, this is the first report of an amino acid substitution in a mitochondrial targeting sequence resulting in a human genetic disease. 58 refs., 5 figs., 1 tab.

  2. Identification of a cell lineage-specific gene coding for a sea urchin alpha 2(IV)-like collagen chain.

    PubMed

    Exposito, J Y; Suzuki, H; Geourjon, C; Garrone, R; Solursh, M; Ramirez, F

    1994-05-06

    We report the isolation of several overlapping cDNAs from an embryonic library of Strongylocentrotus purpuratus coding for a novel sea urchin collagen chain. The conceptual amino acid translation of the cDNAs indicated that the protein displays the structural features of a vertebrate type IV-like collagen alpha chain. In addition to a putative 31-residue signal peptide, the sea urchin molecule contains a 14-residue amino-terminal non-collagenous segment, a discontinuous 1,477-amino acid triple helical domain, and a 225-residue carboxyl-terminal domain rich in cysteines. The amino- and carboxyl-terminal non-collagenous regions of the echinoid molecule are remarkably similar to the 7 S and carboxyl-terminal non-collagenous (NC1) domains of the alpha 1 and alpha 2 chains of vertebrate type IV collagen. The sequence similarity and distinct structural features of the 7 S and NC1 domains strongly suggest that the sea urchin polypeptide is evolutionarily related to the alpha 2(IV) class of collagen chains. Finally, in situ hybridizations revealed that expression of this collagen gene is restricted to the mesenchyme cell lineage of the developing sea urchin embryo.

  3. Confirmation of mutant alpha 1 Na,K-ATPase gene and transcript in Dahl salt-sensitive/JR rats.

    PubMed

    Ruiz-Opazo, N; Barany, F; Hirayama, K; Herrera, V L

    1994-09-01

    As the sole renal Na,K-ATPase isozyme, the alpha 1 Na,K-ATPase accounts for all active transport of Na+ throughout the nephron. This role in renal Na+ reabsorption and the primacy of the kidney in hypertension pathogenesis make it a logical candidate gene for salt-sensitive genetic hypertension. An adenine (A)1079-->thymine (T) transversion, resulting in the substitution of glutamine276 with leucine and associated with decreased net 86Rb+ (K+) influx, was identified in Dahl salt-sensitive/JR rat kidney alpha 1 Na,K-ATPase cDNA. However, because a Taq polymerase chain reaction amplification-based reanalysis did not detect the mutant T1079 but rather only the wild-type A1079 alpha 1 Na,K-ATPase allele in Dahl salt-sensitive rat genomic DNA, we reexamined alpha 1 Na,K-ATPase sequences using Taq polymerase error-independent amplification-based analyses of genomic DNA (by polymerase allele-specific amplification and ligase chain reaction analysis) and kidney RNA (by mRNA-specific thermostable reverse transcriptase-polymerase chain reaction analysis). We also performed modified 3' mismatched correction analysis of genomic DNA using an exonuclease-positive thermostable DNA polymerase. All the confirmatory test results were concordant, confirming the A1079-->T transversion in the Dahl salt-sensitive alpha 1 Na,K-ATPase allele and its transcript, as well as the wild-type A1079 sequence in the Dahl salt-resistant alpha 1 Na,K-ATPase allele and its transcript. Documentation of a consistent Taq polymerase error that selectively substituted A at T1079 (sense strand) was obtained from Taq polymerase chain reaction amplification and subsequent cycle sequencing of reconfirmed known Dahl salt-sensitive/JR rat mutant T1079 alpha 1 cDNA M13 subclones. This Taq polymerase error results in the reversion of mutant sequence back to the wild-type alpha 1 Na,K-ATPase sequence. This identifies a site- and nucleotide-specific Taq polymerase misincorporation, suggesting that a structural

  4. An alpha-helical cationic antimicrobial peptide selectively modulates macrophage responses to lipopolysaccharide and directly alters macrophage gene expression.

    PubMed

    Scott, M G; Rosenberger, C M; Gold, M R; Finlay, B B; Hancock, R E

    2000-09-15

    Certain cationic antimicrobial peptides block the binding of LPS to LPS-binding protein and reduce the ability of LPS to induce the production of inflammatory mediators by macrophages. To gain a more complete understanding of how LPS activates macrophages and how cationic peptides influence this process, we have used gene array technology to profile gene expression patterns in macrophages treated with LPS in the presence or the absence of the insect-derived cationic antimicrobial peptide CEMA (cecropin-melittin hybrid). We found that CEMA selectively blocked LPS-induced gene expression in the RAW 264.7 macrophage cell line. The ability of LPS to induce the expression of >40 genes was strongly inhibited by CEMA, while LPS-induced expression of another 16 genes was relatively unaffected. In addition, CEMA itself induced the expression of a distinct set of 35 genes, including genes involved in cell adhesion and apoptosis. Thus, CEMA, a synthetic alpha-helical peptide, selectively modulates the transcriptional response of macrophages to LPS and can alter gene expression in macrophages.

  5. Role of CBP/p300 and SRC-1 in transcriptional regulation of the pulmonary surfactant protein-A (SP-A) gene by thyroid transcription factor-1 (TTF-1).

    PubMed

    Yi, Ming; Tong, Guo-Xia; Murry, Barbara; Mendelson, Carole R

    2002-01-25

    Surfactant protein-A (SP-A) gene expression is developmentally regulated in fetal lung type II cells and is enhanced by cAMP. cAMP stimulation of SP-A gene expression is mediated by protein kinase A (PKA) phosphorylation of thyroid transcription factor 1 (TTF-1), expressed selectively in developing lung epithelium. In this study, we analyzed roles of CREB-binding protein (CBP) and steroid receptor coactivator-1 (SRC-1) in TTF-1 regulation of SP-A expression. Upon differentiation of human fetal lung in culture, nuclear localization of CBP, SRC-1, and TTF-1 increased in ductular epithelium in association with type II cell differentiation and induction of SP-A expression. In transient transfections, CBP and SRC-1 acted synergistically with TTF-1 to increase SP-A promoter activity. Overexpression of PKA catalytic subunit enhanced hSP-A promoter activation by SRC-1 plus TTF-1. Adenoviral E1A overexpression reduced TTF-1 +/- SRC-1 induction of SP-A promoter activity, suggesting a role of endogenous CBP/p300. TTF-1 interacted with SRC-1 and CBP in vitro. SRC-1 immunodepletion from type II cell nuclear extracts reduced binding to the TTF-1 binding element upstream of SP-A gene. In cultured type II cells, cAMP increased TTF-1 acetylation. This suggests that cAMP-mediated TTF-1 phosphorylation facilitates interaction with CBP and SRC-1, resulting in its hyperacetylation, further enhancing TTF-1 DNA-binding and transcriptional activity.

  6. Identification and characterization of the Trichoderma harzianum gene encoding alpha-1,3-glucanase involved in streptococcal mutan degradation.

    PubMed

    Wiater, Adrian; Janczarek, Monika; Pleszczyńska, Małgorzata; Szczodrak, Janusz

    2011-01-01

    alpha-1,3-Glucanases (mutanases) are currently of great interest due to their potential use in the field of dental care. These enzymes have been reported in several bacteria, yeasts and fungi, but up to now, characterization of this family of proteins has been relatively poor. In this study, we identify and characterize a mutanase gene from Trichoderma harzianum CCM F-340. Sequence analysis, on the nucleotide and amino acid levels reveals that this alpha-1,3-glucanase is highly homologous to alpha-1,3-glucanases from T harzianum isolate CBS 243.71 and T asperellum CECT 20539. T. harzianum CCM F-340 mutanase is a 634-aa residue protein with a calculated molecular mass of 67.65 kDa, composed of two distinct, highly conserved domains (a long N-terminal catalytic domain and a short C-terminal polysaccharide-binding domain) separated by a less conserved Pro-Ser-Thr-rich linker region. The mutanase gene was expressed in an E. coli BL21 (DE3) host, under the transcriptional control of T7 promoter. The purified enzyme migrated as a band of about 68 kDa after SDS-polyacrylamide gel electrophoresis, which coincided with the predicted size based on the amino acid sequence. Our data indicate that this enzyme is highly conserved in Trichoderma and can be produced in active form in such heterologous expression system.

  7. Haploinsufficiency in the PPAR{alpha} and LDL receptor genes leads to gender- and age-specific obesity and hyperinsulinemia

    SciTech Connect

    Sugiyama, Eiko . E-mail: eikoyoko@nagano-kentan.ac.jp; Tanaka, Naoki; Nakajima, Tamie; Kamijo, Yuji; Yokoyama, Shin; Li Yufeng; Gonzalez, Frank J.; Aoyama, Toshifumi

    2006-11-17

    When preparing peroxisome proliferator-activated receptor (PPAR){alpha}:low-density lipoprotein receptor (LDLR) (-/-) double knockout mice, we unexpectedly found a unique gender- and age-specific obesity in the F1 generation, PPAR{alpha} (+/-):LDLR (+/-), even in mice fed standard chow. Body weights of the male heterozygous mice increased up to about 60 g at 75 weeks of age, then decreased by about 30 g at 100 weeks of age. More than 95% of the heterozygous mice between 35- and 75-week-olds were overweight. Of interest, the obese heterozygous mice also exhibited hyperinsulinemia correlating with moderate insulin resistance. Hepatic gene expression of LDLR was lower than expected in the heterozygous mice, particularly at 50 and 75 weeks of age. In contrast, the hepatic expression of PPAR{alpha} was higher than expected in obese heterozygous mice, but decreased in non-obese older heterozygous mice. Modulated expression of these genes may be partially associated with the onset of the hyperinsulinemia.

  8. HNF4alpha and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression.

    PubMed

    Douet, Vanessa; VanWart, Christopher M; Heller, Matthew B; Reinhard, Sabrina; Le Saux, Olivier

    2006-01-01

    Mutations in an ABC transporter gene called ABCC6 are responsible for pseudoxanthoma elasticum (PXE), a rare heritable disease characterized by elastic fiber calcification in skin, ocular and vascular tissues. The presumed function of this ABC transporter is to export metabolites from polarized cells. However, the endogenous substrate(s) are unknown and the exact relationship with elastic fibers is unclear. As ABCC6 is only expressed at high level in liver and kidneys, tissues seemingly unrelated to the PXE phenotype, we explored the transcriptional regulation of the murine Abcc6 gene to define the transcriptional signal conferring tissue specificity and to gather clues on its possible biological function. We cloned 2.9 kb of the mAbcc6 5'-flanking region and several deletion constructs linked to a luciferase reporter gene. We delineated a proximal promoter and a liver-specific enhancer region. We also demonstrated that the proximal region is a TATA-less promoter requiring an intact CCAAT-box and Sp1 binding for its basal activity. By using reporter assays and chromatin immunoprecipitations, we showed that HNF4alpha and surprisingly, NF-E2, enhanced the mAbcc6 promoter activity. The involvement of both HNF4alpha and NF-E2 in the mAbcc6 gene regulation suggests that Abcc6 might be involved in a detoxification processes related to hemoglobin or heme.

  9. Physical linkage of the human growth hormone gene cluster and the skeletal muscle sodium channel {alpha}-subunit gene (SCN4A) on chromosome 17

    SciTech Connect

    Bennani-Baiti, I.M.; Jones, B.K.; Liebhaber, S.A.; Cooke, N.E.

    1995-10-10

    The human growth hormone (GH) locus, a cluster of five genes, spans 47 kb on chromosome 17q22-q24. The skeletal muscle sodium channel {alpha}-subunit locus (SCN4A), a 32.5-kb gene, has previously been mapped to 17q23.1-q25.3. We demonstrate that both the GH gene cluster and the SCN4A gene colocalize to a single 525-kb yeast artificial chromosome (YAC) containing DNA derived from human chromosome 17. Restriction maps of two cosmids encompassing the 5{prime} terminus of the GH locus and including up to 40 kb of 5{prime}-flanking sequences demonstrate a perfect 20-kb overlap with previously published maps of the SCN4A gene. A 720-bp DNA segment, encompassing sequences 32.3 to 31.6 kb 5{prime} to GH, was sequenced and found to be identical to exon 14 of SCN4A. These data demonstrate that the SCN4A gene and the entire GH gene cluster are contained within 100 kb on chromosome 17 and are separated by only 21.5 kb. Remarkably, this physical linkage between GH and SCN4A also reveals that multiple elements critical to tissue-specific transcriptional activation of the GH gene lie within the SCN4A gene. 48 refs., 5 figs.

  10. Characterization of the lys2 gene of Acremonium chrysogenum encoding a functional alpha-aminoadipate activating and reducing enzyme.

    PubMed

    Hijarrubia, M J; Aparicio, J F; Casqueiro, J; Martín, J F

    2001-02-01

    A 5.2-kb NotI DNA fragment isolated from a genomic library of Acremonium chrysogenum by hybridization with a probe internal to the Penicillium chrysogenum lys2 gene, was able to complement an alpha-aminoadipate reductase-deficient mutant of P. chrysogenum (lysine auxotroph L-G-). Enzyme assays showed that the alpha-aminoadipate reductase activity was restored in all the transformants tested. The lys2-encoded enzyme catalyzed both the activation and reduction of alpha-aminoadipic acid to its semialdehyde, as shown by reaction of the product with p-dimethylaminobenzaldehyde. The reaction required NADPH, and was not observed in the presence of NADH. Sequence analysis revealed that the gene encodes a protein with relatively high similarity to members of the superfamily of acyladenylate-forming enzymes. The Lys2 protein contained all nine motifs that are conserved in the adenylating domain of this enzyme family, a peptidyl carrier domain, and a reduction domain. In addition, a new NADP-binding motif located at the N-terminus of the reduction domain that may form a Rossmann-like betaalphabeta-fold has been identified and found to be shared by all known Lys2 proteins. The lys2 gene was mapped to chromosome I (2.2 Mb, the smallest chromosome) of A. chrysogenum C10 (the chromosome that contains the "late" cephalosporin cluster) and is transcribed as a monocistronic 4.5-kb mRNA although at relatively low levels compared with the beta-actin gene.

  11. Construction of an alpha toxin gene knockout mutant of Clostridium perfringens type A by use of a mobile group II intron.

    PubMed

    Chen, Yue; McClane, Bruce A; Fisher, Derek J; Rood, Julian I; Gupta, Phalguni

    2005-11-01

    In developing Clostridium perfringens as a safe vaccine vector, the alpha toxin gene (plc) in the bacterial chromosome must be permanently inactivated. Disrupting genes in C. perfringens by traditional mutagenesis methods is very difficult. Therefore, we developed a new strategy using group II intron-based Target-Tron technology to inactivate the plc gene in C. perfringens ATCC 3624. Western blot analysis showed no production of alpha toxin protein in the culture supernatant of the plc mutant. Advantages of this technology, such as site specificity, relatively high frequency of insertion, and introduction of no antibiotic resistance genes into the chromosome, could facilitate construction of other C. perfringens mutants.

  12. Glucagon and cAMP inhibit cholesterol 7alpha-hydroxylase (CYP7A1) gene expression in human hepatocytes: discordant regulation of bile acid synthesis and gluconeogenesis.

    PubMed

    Song, Kwang-Hoon; Chiang, John Y L

    2006-01-01

    The gene encoding cholesterol 7alpha-hydroxylase (CYP7A1) is tightly regulated to control bile acid synthesis and maintain lipid homeostasis. Recent studies in mice suggest that bile acid synthesis is regulated by the fasted-to-fed cycle, and fasting induces CYP7A1 gene expression in parallel to the induction of peroxisome proliferators-activated receptor gamma co-activator 1alpha (PGC-1alpha) and phosphoenolpyruvate carboxykinase (PEPCK). How glucagon regulates CYP7A1 gene expression in the human liver is not clear. Here we show that glucagon and cyclic adenosine monophosphate (cAMP) strongly repressed CYP7A1 mRNA expression in human primary hepatocytes. Reporter assays confirmed that cAMP and protein kinase A (PKA) inhibited human CYP7A1 gene transcription, in contrast to their stimulation of the PEPCK gene. Mutagenesis analysis identified a PKA-responsive region located within the previously identified HNF4alpha binding site in the human CYP7A1 promoter. Glucagon and cAMP increased HNF4alpha phosphorylation and reduced the amount of HNF4alpha present in CYP7A1 chromatin. Our findings suggest that glucagon inhibited CYP7A1 gene expression via PKA phosphorylation of HNF4alpha, which lost its ability to bind the CYP7A1 gene and resulted in inhibition of human CYP7A1 gene transcription. In conclusion, this study unveils a species difference in nutrient regulation of the human and mouse CYP7A1 gene and suggests a discordant regulation of bile acid synthesis and gluconeogenesis by glucagon in human livers during fasting.

  13. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    PubMed Central

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these proteins have only limited homology, the yeast and human proteins being more related. However, regions common to all three proteins were found indicating sequences that might comprise the active site of alpha-galactosidase. PMID:3031590

  14. Inactivation of the alpha C protein antigen gene, bca, by a novel shuttle/suicide vector results in attenuation of virulence and immunity in group B Streptococcus.

    PubMed

    Li, J; Kasper, D L; Ausubel, F M; Rosner, B; Michel, J L

    1997-11-25

    The alpha C protein of group B Streptococcus (GBS) is a major surface-associated antigen. Although its role in the biology and virulence of GBS has not been defined, it is opsonic and capable of eliciting protective immunity. The alpha C protein is widely distributed among clinical isolates and is a potential protein carrier and antigen in conjugate vaccines to prevent GBS infections. The structural gene for the alpha C protein, bca, has been cloned and sequenced. The protein encoded by bca is related to a class of surface-associated proteins of gram-positive cocci involved in virulence and immunity. To investigate the potential roles of the alpha C protein, bca null mutants were generated in which the bca gene was replaced with a kanamycin resistance cassette via homologous recombination using a novel shuttle/suicide vector. Studies of lethality in neonatal mice showed that the virulence of the bca null mutants was attenuated 5- to 7-fold when compared with the isogenic wild-type strain A909. Significant differences in mortality occurred in the first 24 h, suggesting that the role of the alpha antigen is important in the initial stages of the infection. In contrast to A909, bca mutants were no longer killed by polymorphonuclear leukocytes in the presence of alpha-specific antibodies in an in vitro opsonophagocytic assay. In contrast to previous studies, alpha antigen expression does not appear to play a role in resistance to opsonophagocytosis in the absence of alpha-specific antibodies. In addition, antibodies to the alpha C protein did not passively protect neonatal mice from lethal challenge with bca mutants, suggesting that these epitopes are uniquely present within the alpha antigen as expressed from the bca gene. Therefore, the alpha C protein is important in the pathogenesis of GBS infection and is a target for protective immunity in the development of GBS vaccines.

  15. Homozygous deletion of the. alpha. - and. beta. sub 1 -interferon genes in human leukemia and derived cell lines

    SciTech Connect

    Diaz, M.O.; Ziemin, S.; Le Beau, M.M.; Pitha, P.; Smith, S.D.; Chilcote, R.R.; Rowley, J.D. )

    1988-07-01

    The loss of bands p21-22 from one chromosome 9 homologue as a consequence of a deletion of the short arm (del(9p)), unbalanced translocation, or monosomy 9 is frequently observed in the malignant cells of patients with lymphoid neoplasias, including acute lymphoblastic leukemia and non-Hodgkin lymphoma. The {alpha}- and {beta}{sub 1}-interferon genes have been assigned to this chromosome region (9p21-22). The authors now present evidence of the homozygous deletion of the interferon genes in neoplastic hematopoietic cell lines and primary leukemia cells in the presence or absence of chromosomal deletions that are detectable at the level of the light microscope. In these cell lines, the deletion of the interferon genes is accompanied by a deficiency of 5{prime}-methylthioadenosine phosphorylase, an enzyme of purine metabolism. These homozygous deletions may be associated with the loss of a tumor-suppressor gene that is involved in the development of these neoplasias. The relevant genes may be either the interferon genes themselves or a gene that has a tumor-suppressor function and is closely linked to them.

  16. Fabry disease: thirty-five mutations in the alpha-galactosidase A gene in patients with classic and variant phenotypes.

    PubMed Central

    Eng, C. M.; Ashley, G. A.; Burgert, T. S.; Enriquez, A. L.; D'Souza, M.; Desnick, R. J.

    1997-01-01

    BACKGROUND: Fabry disease, an X-linked inborn error of glycosphingolipid catabolism, results from mutations in the alpha-galactosidase A (alpha-Gal A) gene located at Xq22.1. To determine the nature and frequency of the molecular lesions causing the classical and milder variant Fabry phenotypes and for precise carrier detection, the alpha-Gal A lesions in 42 unrelated Fabry hemizygotes were determined. MATERIALS AND METHODS: Genomic DNA was isolated from affected probands and their family members. The seven alpha-galactosidase A exons and flanking intronic sequences were PCR amplified and the nucleotide sequence was determined by solid-phase direct sequencing. RESULTS: Two patients with the mild cardiac phenotype had missense mutations, I9IT and F113L, respectively. In 38 classically affected patients, 33 new mutations were identified including 20 missense (MIT, A31V, H46R, Y86C, L89P, D92Y, C94Y, A97V, R100T, Y134S, G138R, A143T, S148R, G163V, D170V, C202Y, Y216D, N263S, W287C, and N298S), two nonsense (Q386X, W399X), one splice site mutation (IVS4 + 2T-->C), and eight small exonic insertions or deletions (304del1, 613del9, 777del1, 1057del2, 1074del2, 1077del1, 1212del3, and 1094ins1), which identified exon 7 as a region prone to gene rearrangements. In addition, two unique complex rearrangements consisting of contiguous small insertions and deletions were found in exons 1 and 2 causing L45R/H46S and L120X, respectively. CONCLUSIONS: These studies further define the heterogeneity of mutations causing Fabry disease, permit precise carrier identification and prenatal diagnosis in these families, and facilitate the identification of candidates for enzyme replacement therapy. Images FIG. 2 PMID:9100224

  17. MULTIPLEX PCR ASSAY FOR DETECTION OF HUMAN SOMATOTROPIN AND INTERFERON ALPHA2b GENES IN PLANT MATERIAL.

    PubMed

    Gerasymenko, I M; Mazur, M G; Sheludko, Y V; Kuchuk, N V

    2015-01-01

    Using transgenic plants as factories for production of physiologically active human proteins arouses special concern because occasional escape of such transgenes into environment may cause health problems. Creation of plant varieties producing pharmaceutically valuable proteins should be accompanied by development of detection methods suitable for controlling the transgene behavior. Here we describe a multiplex PCR protocol for revealing of two human genes (encoding growth hormone and interferon alpha2b) that have been successfully introduced into plant genomes. The primer pair designed for detection of human growth hormone coding sequence amplifies fragments of different size from the full-length gene in the human genome and the intronless coding sequence usually used for plant transformation. Application of this primer pair may be recommended for ruling out false positive results due to sample contamination with human DNA. Such a control may be useful also in PCR analysis during establishing of transgenic plants carrying genes of human origin.

  18. Beta-globin gene cluster haplotypes and alpha-thalassemia in sickle cell disease patients from Trinidad.

    PubMed

    Jones-Lecointe, Altheia; Smith, Erskine; Romana, Marc; Gilbert, Marie-Georges; Charles, Waveney P; Saint-Martin, Christian; Kéclard, Lisiane

    2008-01-01

    In this study, we have determined the frequency of beta(S) haplotypes in 163 sickle cell disease patients from Trinidad. The alpha(3.7) globin gene deletion status was also studied with an observed gene frequency of 0.17. Among the 283 beta(S) chromosomes analyzed, the Benin haplotype was the most prevalent (61.8%) followed by Bantu (17.3%), Senegal (8.5%), Cameroon (3.5%), and Arab-Indian (3.2%), while 5.7% of them were atypical. This beta(S) haplotypes distribution differed from those previously described in other Caribbean islands (Jamaica, Guadeloupe, and Cuba), in agreement with the known involvement of the major colonial powers (Spain, France, and Great Britain) in the slave trade in Trinidad and documented an Indian origin of the beta(S) gene.

  19. Nucleotide sequence of the Klebsiella pneumoniae nifD gene and predicted amino acid sequence of the alpha-subunit of nitrogenase MoFe protein.

    PubMed Central

    Ioannidis, I; Buck, M

    1987-01-01

    The nucleotide sequence of the Klebsiella pneumoniae nifD gene is presented and together with the accompanying paper [Holland, Zilberstein, Zamir & Sussman (1987) Biochem. J. 247, 277-285] completes the sequence of the nifHDK genes encoding the nitrogenase polypeptides. The K. pneumoniae nifD gene encodes the 483-amino acid-residue nitrogenase alpha-subunit polypeptide of Mr 54156. The alpha-subunit has five strongly conserved cysteine residues at positions 63, 89, 155, 184 and 275, some occurring in a region showing both primary sequence and potential structural homology to the K. pneumoniae nitrogenase beta-subunit. A comparison with six other alpha-subunit amino acid sequences has been made, which indicates a number of potentially important domains within alpha-subunits. PMID:3322262

  20. Mutations of the human interferon alpha-2b (hIFN-α2b) gene in occupationally protracted low dose radiation exposed personnel.

    PubMed

    Shahid, Saman; Mahmood, Nasir; Chaudhry, Muhammad Nawaz; Sheikh, Shaharyar; Ahmad, Nauman

    2015-05-01

    Ionizing radiations impact human tissues by affecting the DNA bases which constitute genes. Human interferon alpha 2b gene synthesizes a protein which is an important anticancerous, immunomodulatory, anti-proliferative and antiviral protein. This study was aimed to identify interferon alpha-2b mutations as a consequence of the use of occupational chronic low dose radiation by hospital radiation exposed workers. A molecular analysis was done in which DNAs were extracted from blood samples from radiology, radiotherapy and nuclear medicine workers. The gene was amplified through polymerase chain reaction and further genetic data from sequencing results analyzed by bioinformatics tools in order to determine as to how mutations in interferon alpha 2b sequences will lead to changes in human interferon alpha-2b protein. A total of 41% gene mutations was detected among all radiation exposed workers in which higher percentage (5.4%) of base insertion mutations and 14% frameshift mutations were found in radiology workers. The chronic use of low dose of radiations by occupational workers has a significant correlation with mutational effects on interferon alpha 2b gene, further evident by depressed interferon alpha levels in serum. This can lead to depressed immunity in radiation exposed workers. Hematological profiling of this group also showed hyperimmune response in the form of lymphocytosis.

  1. Expression of human beta-hexosaminidase alpha-subunit gene (the gene defect of Tay-Sachs disease) in mouse brains upon engraftment of transduced progenitor cells.

    PubMed

    Lacorazza, H D; Flax, J D; Snyder, E Y; Jendoubi, M

    1996-04-01

    In humans, beta-hexosaminidase alpha-subunit deficiency prevents the formation of a functional beta-hexosaminidase A heterodimer resulting in the severe neurodegenerative disorder, Tay-Sachs disease. To explore the feasibility of using ex vivo gene transfer in this lysosomal storage disease, we produced ecotropic retroviruses encoding the human beta-hexosaminidase alpha-subunit cDNA and transduced multipotent neural cell lines. Transduced progenitors stably expressed and secreted high levels of biologically active beta-hexosaminidase A in vitro and cross-corrected the metabolic defect in a human Tay-Sachs fibroblasts cell line in vitro. These genetically engineered CNS progenitors were transplanted into the brains of both normal fetal and newborn mice. Engrafted brains, analyzed at various ages after transplant, produced substantial amounts of human beta-hexosaminidase alpha-subunit transcript and protein, which was enzymatically active throughout the brain at a level reported to be therapeutic in Tay-Sachs disease. These results have implications for treating neurologic diseases characterized by inherited single gene mutations.

  2. Analysis of Claviceps africana and C. sorghi from India using AFLPs, EF-1alpha gene intron 4, and beta-tubulin gene intron 3.

    PubMed

    Tooley, Paul W; Bandyopadhyay, Ranajit; Carras, Marie M; Pazoutová, Sylvie

    2006-04-01

    Isolates of Claviceps causing ergot on sorghum in India were analysed by AFLP analysis, and by analysis of DNA sequences of the EF-1alpha gene intron 4 and beta-tubulin gene intron 3 region. Of 89 isolates assayed from six states in India, four were determined to be C. sorghi, and the rest C. africana. A relatively low level of genetic diversity was observed within the Indian C. africana population. No evidence of genetic exchange between C. africana and C. sorghi was observed in either AFLP or DNA sequence analysis. Phylogenetic analysis was conducted using DNA sequences from 14 different Claviceps species. A multigene phylogeny based on the EF-1alpha gene intron 4, the beta-tubulin gene intron 3 region, and rDNA showed that C. sorghi grouped most closely with C. gigantea and C. africana. Although the Claviceps species we analysed were closely related, they colonize hosts that are taxonomically very distinct suggesting that there is no direct coevolution of Claviceps with its hosts.

  3. Transcriptional coupling of synaptic transmission and energy metabolism: role of nuclear respiratory factor 1 in co-regulating neuronal nitric oxide synthase and cytochrome c oxidase genes in neurons.

    PubMed

    Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T

    2009-10-01

    Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.

  4. Utility of the nuclear protein-coding gene, elongation factor-1 gamma (EF-1gamma), for spider systematics, emphasizing family level relationships of tarantulas and their kin (Araneae: Mygalomorphae).

    PubMed

    Ayoub, Nadia A; Garb, Jessica E; Hedin, Marshal; Hayashi, Cheryl Y

    2007-02-01

    Spider systematics has overwhelmingly relied on morphological characters to resolve higher-level phylogenetic questions. Molecular phylogenetic studies of spiders above the genus level have been rare, partly because of a paucity of characterized genes available for amplification and sequencing. Here we show the phylogenetic utility of a new molecular marker, elongation factor-1 gamma (EF-1gamma) for discerning family level relationships in the spider infraorder, Mygalomorphae. We included genomic sequences from 26 mygalomorph genera in 14 families as well as cDNA sequences from 10 families in the infraorder Araneomorphae. We found strong support for the traditional split of mygalomorphs into atypoids (Antrodiaetidae, Atypidae, and Mecicobothriidae) and non-atypoids (all other families). Some families with multiple generic representatives were found to be polyphyletic or paraphyletic, such as the Nemesiidae, Ctenizidae, and Hexathelidae. A small portion of genomic EF-1gamma that could be amplified from araneomorphs contained a short intron, suggesting that longer genomic sequences could not be amplified due to the presence of introns. This intron may be useful for intra-familial araneomorph relationships. A tentative timeline for spider evolution is proposed using the evolutionary rate of EF-1gamma, estimated to be approximately 0.22% pairwise divergence per million years based on a non-parametric smoothing method (NPRS) and fossil constraints.

  5. Upregulation of alpha-skeletal muscle actin and myosin heavy polypeptide gene products in degenerating rotator cuff muscles.

    PubMed

    Fuchs, Bruno; Zumstein, Matthias; Regenfelder, Felix; Steinmann, Patrick; Fuchs, Thomas; Husmann, Knut; Hellermann, Jens; Jost, Bernhard; Hodler, Jürg; Born, Walter; Gerber, C

    2008-07-01

    Impaired function of shoulder muscles, resulting from rotator cuff tears, is associated with abnormal deposition of fat in muscle tissue, but corresponding cellular and molecular mechanisms, likely reflected by altered gene expression profiles, are largely unknown. Here, an analysis of muscle gene expression was carried out by semiquantitative RT-PCR in total RNA extracts of supraspinatus biopsies collected from 60 patients prior to shoulder surgery. A significant increase of alpha-skeletal muscle actin (p = 0.0115) and of myosin heavy polypeptide 1 (p = 0.0147) gene transcripts was observed in parallel with progressive fat deposition in the muscle, assessed on parasagittal T1-weighted turbo-spin-echo magnetic resonance images according to Goutallier. Upregulation of alpha-skeletal muscle actin and of myosin heavy polypeptide-1 has been reported to be associated with increased muscle tissue metabolism and oxidative stress. The findings of the present study, therefore, challenge the hypothesis that increased fat deposition in rotator cuff muscle after injury reflects muscle degeneration.

  6. Alpha1-antitrypsin gene therapy modulates cellular immunity and efficiently prevents type 1 diabetes in nonobese diabetic mice.

    PubMed

    Lu, Yuanqing; Tang, Mei; Wasserfall, Clive; Kou, Zhongchen; Campbell-Thompson, Martha; Gardemann, Thomas; Crawford, James; Atkinson, Mark; Song, Sihong

    2006-06-01

    An imbalance of the immune-regulatory pathways plays an important role in the development of type 1 diabetes. Therefore, immunoregulatory and antiinflammatory strategies hold great potential for the prevention of this autoimmune disease. Studies have demonstrated that two serine proteinase inhibitors, alpha1-antitrypsin (AAT) and elafin, act as potent antiinflammatory agents. In the present study, we sought to develop an efficient gene therapy approach to prevent type 1 diabetes. Cohorts of 4-week-old female nonobese diabetic (NOD) mice were injected intramuscularly with rAAV1-CB-hAAT, rAAV1-CB-hElafin, or saline. AAV1 vector mediated sustained high levels of transgene expression, sufficient to overcome a humoral immune response against hAAT. AAT gene therapy, contrary to elafin and saline, was remarkably effective in preventing type 1 diabetes. T cell receptor spectratyping indicated that AAT gene therapy altered T cell repertoire diversity in splenocytes from NOD mice. Adoptive transfer experiments demonstrated that AAT gene therapy attenuated cellular immunity associated with beta cell destruction. This study demonstrates that AAT gene therapy attenuates cell-mediated autoimmunity, alters the T cell receptor repertoire, and efficiently prevents type 1 diabetes in the NOD mouse model. These results strongly suggest that rAAV1-mediated AAT gene therapy may be useful as a novel approach to prevent type 1 diabetes.

  7. Use of multiplex PCR and CE for gene dosage quantification and its biomedical applications for SMN, PMP22, and alpha-globin genes.

    PubMed

    Hung, Chia-Cheng; Chien, Shu-Chin; Lin, Chia-Yun; Chang, Chien-Hui; Chang, Yin-Fei; Jong, Yuh-Jyh; Hsieh, Sung-Tsang; Hsieh, Wu-Shiun; Liu, Ming S; Lin, Win-Li; Lee, Chien-Nan; Su, Yi-Ning

    2007-08-01

    Many genetic diseases are caused by the presence of point mutations, small insertions, and deletions in respective genes, and the number of diseases known to be caused by deletions and duplications involving large DNA genomes is increasing. These changes lead to underexpression or overexpression of the gene, according to changes in gene dosage. The methods for the detection of point mutations, small insertions, and deletions are well established, but the detection of larger genomic deletions or duplications is more difficult. Due to the lack of efficient and technically feasible protocols for gene dosage quantification, we describe a diagnostic protocol employing a combination of available methods. The efficient and accurate gene dosage quantification platform is combined with multiplex PCR and CE, and applied to detect dosages of several genes, including SMN, PMP22, and alpha-globin genes. The reliability of this novel methodology shows that it is a relatively speedy and low-cost procedure and a significant tool for genetic diagnosis. Its sensitivity and specificity for identifying deletion and duplication genotypes approach 100%. Moreover, once we establish this powerful system, we will further apply this technique to the rapid detection of trisomy syndromes and microdeletion syndromes, including trisomy 13, Down syndrome, DiGeorge syndrome, and others.

  8. Dynamics of 17alpha-ethynylestradiol exposure in rainbow trout (Oncorhynchus mykiss): absorption, tissue distribution, and hepatic gene expression pattern.

    PubMed

    Skillman, Ann D; Nagler, James J; Hook, Sharon E; Small, Jack A; Schultz, Irvin R

    2006-11-01

    17alpha-Ethynylestradiol (EE2) is a synthetic estrogen identified in sewage effluents. To understand better the absorption kinetics of EE2 and the induction of vitellogenin (VTG) and estrogen receptor alpha (ERalpha) mRNA, we subjected male rainbow trout (Onchorynchus mykiss) to continuous water exposures of 125 ng/L of EE2 for up to 61 d. Trout were either repetitively sampled for blood plasma or serially killed at selected time intervals. Vitellogenin, ERalpha mRNA, and EE2 were measured using enzyme-linked immunosorbent assay and using quantitative polymerase chain reaction and gas chromatography-mass spectrometry, respectively. In separate experiments, trout were exposed to EE2 for 7 d, and hepatic gene expression was assessed using a low- and high-density cDNA microarray. The EE2 was rapidly absorbed by the trout, with an apparent equilibrium at 16 h in plasma and liver. The ERalpha mRNA levels also increased rapidly, reaching near-peak levels by 48 h. In contrast, plasma levels of VTG continuously increased for 19 d. After 61 d, tissues with the highest levels of VTG were the liver, kidney, and testes. Microarray-based gene expression studies provided unexpected results. In some cases, known estrogen-responsive genes (e.g., ERalpha) were unresponsive, whereas many of the genes that have no apparent link to estrogen function or EE2 toxicity were significantly altered in expression. Of the two microarray approaches tested in the present study, the high-density array appeared to be superior because of the improved quality of the hybridization signal and the robustness of the response in terms of the number of genes identified as being EE2 responsive.

  9. n-Propyl gallate activates hypoxia-inducible factor 1 by modulating intracellular oxygen-sensing systems.

    PubMed

    Kimura, Motohide; Takabuchi, Satoshi; Tanaka, Tomoharu; Murata, Miyahiko; Nishi, Kenichiro; Oda, Seiko; Oda, Tomoyuki; Kanai, Michiyuki; Fukuda, Kazuhiko; Kizaka-Kondoh, Shinae; Adachi, Takehiko; Takabayashi, Arimichi; Semenza, Gregg L; Hirota, Kiichi

    2008-04-01

    HIF-1 (hypoxia-inducible factor 1) is a master regulator of cellular adaptive responses to hypoxia. The expression and transcriptional activity of the HIF-1alpha subunit is stringently controlled by intracellular oxygen tension through the action of prolyl and asparaginyl hydroxylases. In the present study we demonstrate that PG (n-propyl gallate) activates HIF-1 and expression of its downstream target genes under normoxic conditions in cultured cells and in mice. The stability and transcriptional activity of HIF-1alpha are increased by PG. PG treatment inhibits the interaction between HIF-1alpha and VHL (von Hippel-Lindau protein) and promotes the interaction between HIF-1alpha and p300, indicating that PG inhibits the activity of both prolyl and asparaginyl HIF-1alpha hydroxylases. We conclude that PG activates HIF-1 and enhances the resultant gene expression by directly affecting the intracellular oxygen sensing system in vitro and in vivo and that PG represents a lead compound for the development of a non-toxic activator of HIF-1.

  10. The Identification of Alpha-Synuclein as the First Parkinson Disease Gene.

    PubMed

    Nussbaum, Robert L

    2017-01-01

    In this Commentary, I describe the events that led from an NINDS-sponsored Workshop on Parkinson Disease Research in 1995, where I was asked to speak about the genetics of Parkinson disease, to the identification a mere two years later of a mutation in alpha-synuclein as the cause of autosomal dominant Parkinson disease in the Contursi kindred. I review the steps we took to first map and then find the mutation in the alpha-synuclein locus and describe the obstacles and the role of serendipity in facilitating the work. Although alpha-synuclein mutations are a rare cause of hereditary PD, the importance of this finding goes far beyond the rare families with hereditary disease because it pinpointed alpha-synuclein as a key contributor to the far more common sporadic form of Parkinson disease. This work confirms William Harvey's observation from 350 years ago that studying rarer forms of a disease is an excellent way to understand the more common forms of that disease. The identification of synuclein's role in hereditary Parkinson disease has opened new avenues of research into the pathogenesis and potential treatments of the common form of Parkinson disease that affects many millions of Americans and tens of millions of human beings worldwide.

  11. The Identification of Alpha-Synuclein as the First Parkinson Disease Gene

    PubMed Central

    Nussbaum, Robert L.

    2017-01-01

    In this Commentary, I describe the events that led from an NINDS-sponsored Workshop on Parkinson Disease Research in 1995, where I was asked to speak about the genetics of Parkinson disease, to the identification a mere two years later of a mutation in alpha-synuclein as the cause of autosomal dominant Parkinson disease in the Contursi kindred. I review the steps we took to first map and then find the mutation in the alpha-synuclein locus and describe the obstacles and the role of serendipity in facilitating the work. Although alpha-synuclein mutations are a rare cause of hereditary PD, the importance of this finding goes far beyond the rare families with hereditary disease because it pinpointed alpha-synuclein as a key contributor to the far more common sporadic form of Parkinson disease. This work confirms William Harvey’s observation from 350 years ago that studying rarer forms of a disease is an excellent way to understand the more common forms of that disease. The identification of synuclein’s role in hereditary Parkinson disease has opened new avenues of research into the pathogenesis and potential treatments of the common form of Parkinson disease that affects many millions of Americans and tens of millions of human beings worldwide. PMID:28282812

  12. Genomic footprinting: detection of putative regulatory proteins in the promoter region of the interferon alpha-1 gene in normal human tissues.

    PubMed Central

    Palmieri, M; Tovey, M G

    1990-01-01

    Dimethyl sulfate (DMS) genomic footprinting revealed the presence of putative regulatory proteins attached to specific sequences of the promoter region of the interferon (IFN) alpha-1 gene in normal human tissue. The pattern of protein-DNA interactions observed for the human alpha-1 promoter in freshly isolated human spleen cells was identical to that seen in DNA from the B-cell line Namalwa. The protein interactions involving the human IFN alpha-1 promoter spanned a region from positions -38 to -174 relative to the cap site which encompasses that part of the IFN alpha-1 promoter previously shown by deletion analysis to confer virus inducibility on the IFN alpha-1 gene. DNase I footprinting performed on isolated nuclei revealed a pattern of protein-DNA interactions for the promoter region of the IFN alpha-1 gene similar to that obtained with DMS footprinting performed on whole cells, with the appearance or disappearance of only a few additional protected nucleotides outside the region identified by the use of DMS. These results provide the first direct evidence for the presence of proteins bound in vivo to those parts of the IFN alpha-1 promoter between positions -64 and -109 previously shown by deletion analysis to confer virus inducibility on the IFN alpha-1 gene. The pattern of protein-DNA interactions observed for the IFN alpha-1 promoter after virus induction was identical to that seen before induction, in keeping with the finding that many transcriptional activators are present in both induced and uninduced cells. Images PMID:2342457

  13. Hypoxia inducible factor-1: regulation by nitric oxide in posthypoxic microvascular endothelium.

    PubMed

    Natarajan, Ramesh; Jones, Drew G; Fisher, Bernard J; Wallace, Timothy J; Ghosh, Shobha; Fowler, Alpha A

    2005-10-01

    Microvascular endothelial cells provide a critical regulatory interface between blood constituents and tissue. Hypoxia inducible factor-1 (HIF-1) is a key transcription factor required for expression of hypoxia-dependent genes. We employed a model of hypoxia and reoxygenation (H/R) using the dermal microvascular endothelial cell line HMEC-1 to examine the effects of altered oxygen concentrations on microvascular HIF-1 expression and nitric oxide (NO) formation. Hypoxia increased inducible NO synthase (iNOS) mRNA in a time-dependent manner in HMEC-1. However, endothelial NO synthase mRNA progressively declined during hypoxia. H/R promoted significant increases in cellular nitrite levels that were significantly abrogated by the specific iNOS inhibitor N6-(1-iminoethyl)-L-lysine, di hy drochloride. Exogenous NO promoted stabilization of the alpha subunit of HIF-1 and produced functional DNA binding. Exposure of HMEC-1 to H/R resulted in previously unrecognized biphasic HIF-1alpha stabilization during reoxygenation. When the iNOS gene was silenced through the use of iNOS-specific small interfering RNA, HIF-1alpha stabilization and HIF-1 activation were dramatically diminished, suggesting that inducible NOS-derived NO is a key factor sustaining HIF-1 activation during both hypoxia and reoxygenation.

  14. Physical and genetic mapping of the serpin gene cluster at 14q32.1: allelic association and a unique haplotype associated with alpha 1-antitrypsin deficiency.

    PubMed Central

    Byth, B. C.; Billingsley, G. D.; Cox, D. W.

    1994-01-01

    The alpha 1-antitrypsin (PI) gene is part of a cluster of structurally related serine protease inhibitor genes localized at chromosome 14q32.1, a cluster that includes the alpha 1-antichymotrypsin (AACT), protein C inhibitor (PCI), and corticosteroid-binding globulin (CBG) genes and the alpha 1-antitrypsin-like pseudogene (PIL). The order of the genes is refined here by genetic mapping using simple tandem repeat polymorphisms (STRPs) and by physical mapping in YACs. The order of the genes is (centromere)-CBG-PIL-PI-PCI-AACT-(telomere). Analysis of DNA haplotypes comprising STRP and RFLP markers in the serpin genes reveals considerable allelic association throughout the cluster. Furthermore, the common alpha 1-antitrypsin deficiency allele, PI*Z, has a unique DNA haplotype at the CBG, PIL, and PI loci, which extends over 60 kb in 97% of cases and in 44% of cases includes the PCI and AACT loci. This unique haplotype will be of use in examining a number of other diseases, particularly those with an inflammatory component, thought to be associated with alpha 1-antitrypsin deficiency or partial deficiency. Images Figure 1 Figure 3 PMID:7912884

  15. DNA methylation profiles in the human genes for tumor necrosis factors. alpha. and. beta. in subpopulations of leukocytes and in leukemias

    SciTech Connect

    Kochanek, S.; Radbruch, A.; Tesch, H.; Renz, D.; Doerfler, W. )

    1991-07-01

    The genomic sequencing technique has been applied to assess the state of methylation in the DNA from human leukocyte subpopulations from healthy individuals and in the DNA from several individuals with myeloid or lymphatic leukemias or non-Hodgkin lymphomas. Leukocyte populations were purified by the high-gradient magnetic cell sorting technique. In the human tumor necrosis factor {alpha} (TNF-{alpha}) gene segment between nucleotides 300 and 1150, the specific methylation profile in the DNA from human granulocytes and monocytes is maintained in three cases of myeloid leukemia. In the TNF-{beta} gene, DNA methylation is decreased in several examples of acute or chronic myeloid leukemias in comparison to normal human granulocytes or monocytes, whose DNA is almost completely methylated between nucleotides 700 and 900. In human T and B lymphocytes, the main producers of TNF-{beta}, in three instances of chronic lymphatic leukemias and two cases of non-Hodgkin lymphomas, all 5{prime}-CG-3{prime} sequences are unmethylated in this region. The DNA from the human HeLa cell line is highly methylated at all 5{prime}-CG-3{prime} sequences in the TNF-{alpha} and -{beta} genes. The TNF-{alpha} gene is transcribed in the cells of one case of acute myeloid leukemia in which the analyzed region of the TNF-{alpha} gene is completely unmethylated. The TNF-{beta} gene is not transcribed in any of the malignant cells tested.

  16. Characterization of the 5'-to-5'linked adult alpha- and beta-globin genes from three sciaenid fish species (Pseudosciaena crocea, Sciaenops ocellatus, Nibea miichthioides).

    PubMed

    Chu, Wuying; Wei, Yongwei; Qian, Ronghua; Yu, Xiameng; Yu, Lian

    2006-09-01

    Recently, we cloned the adult alpha-globin genes from large yellow croaker Pseudosciaena crocea, cuneate drum Nibea miichthioides and red drum Sciaenops ocellatus. All these alpha-globins have a unique Gly insertion at the 47th residue. In this paper, the three sciaenid globin complexes were identified and compared in detail. Linkage analysis indicated that the sciaenid alpha- and beta-globin genes were oriented head-to-head relative to each other. The sciaenid intergenic regions between the linked alpha- and beta-globin genes were the smallest in reported fish globin gene complexes to date. Classical promoter elements were condensed and the CCAAT box unstable duplication was found in these regions. The promoter function of the intergenic region from large yellow croaker was tested by transient expression of EGFP in Vero cells. We also described a method for studying luciferase reporter gene transient expression in primary fish erythrocytes. We used the method to assess the promoter strength of the three intergenic regions between the sciaenid alpha- and beta-globin genes.

  17. Preclinical study on combined chemo- and nonviral gene therapy for sensitization of melanoma using a human TNF-alpha expressing MIDGE DNA vector.

    PubMed

    Kobelt, Dennis; Aumann, Jutta; Schmidt, Manuel; Wittig, Burghardt; Fichtner, Iduna; Behrens, Diana; Lemm, Margit; Freundt, Greta; Schlag, Peter M; Walther, Wolfgang

    2014-05-01

    Nonviral gene therapy represents a realistic option for clinical application in cancer treatment. This preclinical study demonstrates the advantage of using the small-size MIDGE(®) DNA vector for improved transgene expression and therapeutic application. This is caused by significant increase in transcription efficiency, but not by increased intracellular vector copy numbers or gene transfer efficiency. We used the MIDGE-hTNF-alpha vector for high-level expression of hTNF-alpha in vitro and in vivo for a combined gene therapy and vindesine treatment in human melanoma models. The MIDGE vector mediated high-level hTNF-alpha expression leads to sensitization of melanoma cells towards vindesine. The increased efficacy of this combination is mediated by remarkable acceleration and increase of initiator caspase 8 and 9 and effector caspase 3 and 7 activation. In the therapeutic approach, the nonviral intratumoral in vivo jet-injection gene transfer of MIDGE-hTNF-alpha in combination with vindesine causes melanoma growth inhibition in association with increased apoptosis in A375 cell line or patient derived human melanoma xenotransplant (PDX) models. This study represents a proof-of-concept for an anticipated phase I clinical gene therapy trial, in which the MIDGE-hTNF-alpha vector will be used for efficient combined chemo- and nonviral gene therapy of malignant melanoma.

  18. Hb Southern Italy: coexistence of two missence mutations (the Hb Sun Prairie alpha2 130 Ala --> Pro and Hb Caserta alpha2 26 Ala --> Thr) in a single HBA2 gene.

    PubMed

    Passarello, Cristina; Giambona, Antonino; Prossomariti, Luciano; Ammirabile, Massimiliano; Pucci, Piero; Renda, Disma; Pagano, Leonilde; Maggio, Aurelio

    2008-10-01

    This study describes a new molecular condition in the alpha(2)-globin gene (HBA2) found in six unrelated families from Southern Italy (Campania and Sicily). This new double mutant form of haemoglobin is called Hb Southern Italy and originated from the coexistence of two known mutations occurring in the same globin gene, HBA2 26 G-->A (Hb Caserta) and HBA2 130 G-->C (Hb Sun Prairie). Hb Sun Prairie was originally observed in Indian patients in either the homozygous state, with severe hemolytic anemia, and in the heterozygous state with microcytosis, or in asymptomatic cases as an alpha-thalassemia carrier phenotype. Hb Caserta was observed for the first time in a Casertian family (South Italy) that displayed a slowmigrating haemoglobin upon investigation. We report the clinical phenotype and molecular study of this new double mutant form of haemoglobin in heterozygous and homozygous subjects, as well as in association with alpha degrees delectional thalassemia.

  19. Morbidity, beta S haplotype and alpha-globin gene patterns among sickle cell anemia patients in Kuwait.

    PubMed

    Adekile, A D; Haider, M Z

    1996-01-01

    Admission records of children with sickle cell anemia (SS), in the two main teaching hospitals in Kuwait, were reviewed for a 1-year period. The haplotypes of 92 beta s chromosomes (from 39 SS, 11 AS, 2 S beta-thalassemia [S beta-thal] and 1 SD individuals) were determined using an allele-specific oligonucleotide (ASO) hybridization technique, while the alpha-globin gene status of 27 SS and 33 AS individuals, i.e. 120 chromosomes, was determined with a combination of polymerase chain reaction and AS techniques. A vasooclusive crisis was the most common (60.0%) cause of hospitalization, followed by infections (20%). Hospital admissions were most common during the hottest month of the year (July). Few complications of the disease were seen among patients on follow-up; however, splenomegaly was present in 24.0%, hepatomegaly in 15.2%, gallstones in 15.2% and aseptic necrosis of the femoral head in 6.1%. Haplotype 31 (Saudi Arabia/India) is the most frequent in this community, being present in 80.4% of the chromosomes tested; Benin haplotype 19 was found in 12.0% and Bantu haplotype 20 in 6.5%. Hb F in the haplotype 31 homozygotes and heterozygotes ranged from 11.4 to 35.1% (mean 22.5 +/- 5.2%). The frequency of alpha-thal determinants in the study was 40.0%, the commonest being the -alpha 3.7-kb deletion (27.5%), the alpha 2 polyadenylation signal (AATAAA-> AATAAG) mutation (10.2%) and the IVS-I 5' end GAGGT-GAGG->GAGG pentanucleotide (5 nt) deletion (3.3%). SS patients with coexistent alpha-thal trait did not have severe recurrent infections and none had gallstones. The high frequencies of the Saudi Arabia/India beta s haplotype and alpha-thalassemia trait contribute to the mild nature of SS disease among Kuwaiti Arabs comparable to that in eastern Saudi Arabia.

  20. Proton radiation and TNF-alpha/Bax gene therapy for orthotopic C6 brain tumor in Wistar rats.

    PubMed

    Gridley, Daila S; Miller, Glen M; Luo, Xian; Cao, Jeffrey D; Timiryasova, Tatyana M; Fodor, Istvan; Slater, James M

    2004-04-01

    High-grade tumors of the brain remain virtually incurable with current therapeutic regimens, new approaches to augment existing therapies need to be explored. The major goal of this pilot study was to evaluate the feasibility of gene therapy using plasmid DNA encoding tumor necrosis factor-alpha and bax together with proton radiation in an immunocompetent animal model with orthotopic brain tumor. C6 glioma cells were stereotactically implanted into the left hemibrain of Wistar rats (day 0). On day 5, the appropriate groups received intratumoral pGL1-TNF-a and pGL1-Bax (10 microg each), parental plasmid pWS4 (20 microg), or PBS. Hemibrain proton irradiation (10 Gy, 90 MeV, single fraction) was delivered 18-20 hr later. Rats were euthanized when signs of illness appeared. In addition, a subset of animals from each group was euthanized on day 9 for immune and other assays. By day 9, 25%, 20%, and 10% of rats treated with PBS, pWS4, or pGL1-TNF-alpha/pGL1-Bax, respectively, had been euthanized due to weight loss or other signs of illness, whereas all rats treated with pGL1-TNF-alpha/pGL1-Bax + radiation or radiation alone were healthy (P<0.05). At this same time, the pGL1-TNF-alpha/pGL1-Bax + radiation group had significantly elevated lymphocyte percentages (P<0.005 or less) and a relatively high level of lymphocytic infiltrate within tumors. Although the rats treated with pGL1-TNF-alpha/pGL1-Bax had the highest levels of activated T helper (CD4+/CD71+) and T cytotoxic (CD8+/CD71+) cells, the values were not significantly different compared to the pWS4-injected control group. Splenocytes in all tumor cell-injected groups had higher mean values for DNA and protein synthesis compared to the non-tumor cell injected control group, whereas oxygen radical production by phagocytes was consistently higher in groups injected with plasmid or treated with radiation. Body, hemibrain, and spleen masses, white blood cell, red blood cell and platelet counts, hemoglobin, hematocrit

  1. Herpes simplex virus 1 activates cdc2 to recruit topoisomerase II alpha for post-DNA synthesis expression of late genes.

    PubMed

    Advani, Sunil J; Weichselbaum, Ralph R; Roizman, Bernard

    2003-04-15

    A subset (gamma(2)) of late herpes simplex virus 1 genes depends on viral DNA synthesis for its expression. For optimal expression, a small number of these genes, exemplified by U(S)11, also requires two viral proteins, the alpha protein infected cell protein (ICP) 22 and the protein kinase U(L)13. Earlier we showed that U(L)13 and ICP22 mediate the stabilization of cdc2 and the replacement of its cellular partner, cyclin B, with the viral DNA polymerase processivity factor U(L)42. Here we report that cdc2 and its new partner, U(L)42, bind a phosphorylated form of topoisomerase II alpha. The posttranslational modification of topoisomerase II alpha and its interaction with cdc2-U(L)42 proteins depend on ICP22 in infected cells. Although topoisomerase II is required for viral DNA synthesis, ICP22 is not, indicating a second function for topoisomerase II alpha. The intricate manner in which the virus recruits topoisomerase II alpha for post-DNA synthesis expression of viral genes suggests that topoisomerase II alpha also is required for untangling concatemeric DNA progeny for optimal transcription of late genes.

  2. Pathway-specific profiling identifies the NF