Science.gov

Sample records for factor-1 alpha hif-1alpha

  1. Transplantation of neural stem cells expressing hypoxia-inducible factor-1alpha (HIF-1alpha) improves behavioral recovery in a rat stroke model.

    PubMed

    Wu, Wanfu; Chen, Xiu; Hu, Changlin; Li, Jinfang; Yu, Zhen; Cai, Wenqin

    2010-01-01

    We explored the possibility that hypoxia-inducible factor-1alpha (HIF-1alpha) might contribute to the therapeutic effect of neural stem cell (NSC) transplantation in cerebral ischemia. The relative efficacy of modified NSC to promote behavioral recovery was investigated in a rat model of stroke induced by a transient middle cerebral artery occlusion (MCAO). A recombinant adenovirus (Ad-HIF-1alpha) was engineered to express HIF-1alpha. Control NSC infected with control adenovirus (NSC-Ad), recombinant adenovirus Ad-HIF-1alpha, or NSC infected by Ad-HIF-1alpha (NSC-Ad-HIF-1alpha), were used for intraventricular transplantion into rat brain 24 hours after MCAO. Neurological deficits were assessed over 4 weeks using the modified neurological severity scale (NSS) score. Long-term in vivo expression of HIF-1alpha was demonstrated by Western blotting and immunocytochemistry, and derivatives of nestin-positive transplanted cells contributed to both neuronal (neurofilament-positive) and astroglial (glial fibrillary acidic protein-positive) lineages. All animals showed functional improvement. Improvement was accelerated in animals receiving either NSC-Ad or Ad-HIF-1alpha, while improvement at all times between 7 days and 28 days post MCAO was significantly greater in animals transplanted with NSC-Ad-HIF-1alpha than for other treated animals. NSC-Ad-HIF-1alpha cells also increased the number of factor VIII-positive cells in the region of ischemic injury, indicating that HIF-1alpha expression can promote angiogenesis. Gene-modified NSC expressing HIF-1alpha have therapeutic potential in ischemic stroke.

  2. Inhibition of GSK3beta by indirubins restores HIF-1alpha accumulation under prolonged periods of hypoxia/anoxia.

    PubMed

    Schnitzer, Steffen E; Schmid, Tobias; Zhou, Jie; Eisenbrand, Gerhard; Brüne, Bernhard

    2005-01-17

    Hypoxia inducible factor 1 is regulated by the appearance of the HIF-1alpha subunit. HIF-1alpha is subjected to proteasomal destruction or enhanced protein translation, which requires the phosphatidylinositol 3-kinase (PI3K)/Akt pathway. We investigated how PI3K/Akt and glycogen synthase kinase 3beta (GSK3beta) affect HIF-1alpha in human RKO cells under prolonged periods of severe hypoxia/anoxia. 16- to 32-h lasting incubations attenuated Akt activity and decreased HIF-1alpha protein. This was reproduced by blocking PI3K with LY294002. GSK3beta inhibition by indirubins circumvented the effect of hypoxia/anoxia or LY294002 on HIF-1alpha. Ruling stability regulation of HIF-1alpha protein and/or enhanced transcription of HIF-1alpha mRNA via GSK3beta inhibition out is suggestive for translational modulation of HIF-1alpha under the influence of GSK3beta.

  3. Flavonoids induce HIF-1alpha but impair its nuclear accumulation and activity.

    PubMed

    Triantafyllou, Anastasia; Mylonis, Ilias; Simos, George; Bonanou, Sophia; Tsakalof, Andreas

    2008-02-15

    Hypoxia-inducible factor-1alpha (HIF-1alpha) is the regulatory subunit of the transcription factor HIF-1, which is highly involved in the pathology of diseases associated with tissue hypoxia. In this study we investigated the ability of plant flavonoids to induce HIF-1alpha and regulate HIF-1 transcriptional activity in HeLa cells. We demonstrate for the first time that the flavonoids baicalein, luteolin and fisetin, as well as the previously investigated quercetin, induce HIF-1alpha under normal oxygen pressure, whereas kaempferol, taxifolin, and rutin are inactive. We further reveal that the capability of flavonoids to bind efficiently intracellular iron and their lipophilicity are essential for HIF-1alpha induction. Despite the ability of flavonoids to stabilize HIF-1alpha, the transcriptional activity of HIF-1 induced by flavonoids was significantly lower than that observed with the iron chelator and known HIF-1 inducer, desferrioxamine (DFO). Furthermore, when cells in which HIF-1 had been induced by DFO were also treated with flavonoids, the transcriptional activity of HIF-1 was strongly impaired without simultaneous reduction in HIF-1alpha protein levels. Localization of HIF-1alpha by immuno- and direct fluorescence microscopy and in vitro phosphorylation assays suggest that flavonoids inhibit HIF-1 activity by impairing the MAPK-dependent phosphorylation of HIF-1alpha, thereby decreasing its nuclear accumulation.

  4. Castration Therapy of Prostate Cancer Results in Downregulation of HIF-1{alpha} Levels

    SciTech Connect

    Al-Ubaidi, Firas L.T.; Schultz, Niklas; Egevad, Lars; Granfors, Torvald; Helleday, Thomas

    2012-03-01

    Background and Purpose: Neoadjuvant androgen deprivation in combination with radiotherapy of prostate cancer is used to improve radioresponsiveness and local tumor control. Currently, the underlying mechanism is not well understood. Because hypoxia causes resistance to radiotherapy, we wanted to test whether castration affects the degree of hypoxia in prostate cancer. Methods and Materials: In 14 patients with locally advanced prostate cancer, six to 12 prostatic needle core biopsy specimens were taken prior to castration therapy. Bilateral orchidectomy was performed in 7 patients, and 7 were treated with a GnRH-agonist (leuprorelin). After castrationm two to four prostatic core biopsy specimens were taken, and the level of hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) in cancer was determined by immunofluorescence. Results: Among biopsy specimens taken before castration, strong HIF-1{alpha} expression (mean intensity above 30) was shown in 5 patients, weak expression (mean intensity 10-30) in 3 patients, and background levels of HIF-1{alpha} (mean intensity 0-10) in 6 patients. Downregulation of HIF-1{alpha} expression after castration was observed in all 5 patients with strong HIF-1{alpha} precastration expression. HIF-1{alpha} expression was also reduced in 2 of 3 patients with weak HIF-1{alpha} precastration expression. Conclusions: Our data suggest that neoadjuvant castration decreases tumor cell hypoxia in prostate cancer, which may explain increased radiosensitivity after castration.

  5. KNK437, abrogates hypoxia-induced radioresistance by dual targeting of the AKT and HIF-1{alpha} survival pathways

    SciTech Connect

    Oommen, Deepu; Prise, Kevin M.

    2012-05-11

    Highlights: Black-Right-Pointing-Pointer KNK437, a benzylidene lactam compound, is a novel radiosensitizer. Black-Right-Pointing-Pointer KNK437 inhibits AKT signaling and abrogates the accumulation of HIF-1{alpha} under hypoxia. Black-Right-Pointing-Pointer KNK437 abrogates hypoxia induced resistance to radiation. -- Abstract: KNK437 is a benzylidene lactam compound known to inhibit stress-induced synthesis of heat shock proteins (HSPs). HSPs promote radioresistance and play a major role in stabilizing hypoxia inducible factor-1{alpha} (HIF-1{alpha}). HIF-1{alpha} is widely responsible for tumor resistance to radiation under hypoxic conditions. We hypothesized that KNK437 sensitizes cancer cells to radiation and overrides hypoxia-induced radioresistance via destabilizing HIF-1{alpha}. Treatment of human cancer cells MDA-MB-231 and T98G with KNK437 sensitized them to ionizing radiation (IR). Surprisingly, IR did not induce HSPs in these cell lines. As hypothesized, KNK437 abrogated the accumulation of HIF-1{alpha} in hypoxic cells. However, there was no induction of HSPs under hypoxic conditions. Moreover, the proteosome inhibitor MG132 did not restore HIF-1{alpha} levels in KNK437-treated cells. This suggested that the absence of HIF-1{alpha} in hypoxic cells was not due to the enhanced protein degradation. HIF-1{alpha} is mainly regulated at the level of post-transcription and AKT is known to modulate the translation of HIF-1{alpha} mRNA. Interestingly, pre-treatment of cells with KNK437 inhibited AKT signaling. Furthermore, down regulation of AKT by siRNA abrogated HIF-1{alpha} levels under hypoxia. Interestingly, KNK437 reduced cell survival in hypoxic conditions and inhibited hypoxia-induced resistance to radiation. Taken together, these data suggest that KNK437 is an effective radiosensitizer that targets multiple pro-survival stress response pathways.

  6. HIF-1alpha involvement in low temperature and anoxia survival by a freeze tolerant insect.

    PubMed

    Morin, Pier; McMullen, David C; Storey, Kenneth B

    2005-12-01

    Winter survival for many insect species relies on the ability to endure the freezing of extracellular body fluids. Because freezing impedes oxygen delivery to tissues, one component of natural freeze tolerance is a well-developed anoxia/ischemia resistance. The present study explores the responses of the hypoxia-inducible factor-1alpha (HIF-1alpha) to cold, freezing and anoxia exposures in the freeze tolerant goldenrod gall fly larva, Eurosta solidaginis. Reverse transcription-PCR was used to quantify hif-1alpha transcript levels; transcripts were significantly elevated by approximately 70% in chilled (3 ( composite function)C), frozen (-16 ( composite function)C) and thawed (returned to 3 ( composite function)C) insects, compared with 15 ( composite function)C controls. Transcripts also rose by approximately 3-fold in insects given anoxia exposure under a nitrogen gas atmosphere. Cold and freezing exposure also elevated HIF-1alpha protein content in the larvae and HIF-1alpha levels increased over the winter months in insects sampled from an outdoor population; levels peaked in February at 2.1-fold higher than in September. A partial sequence of HIF-1alpha that covers the bHLH and PAS domains of the protein was obtained from E. solidaginis and sequence analysis revealed that this segment shared 62% identity overall with Drosophila melanogaster HIF-1alpha and higher percent identities within specific domains: 76% within the bHLH domain and 70% within the PAS domain. The data provide the first documentation of a potential role for HIF-1 in regulating the expression of genes that can aid freezing survival in a cold-hardy animal.

  7. HIF-1{alpha} is necessary to support gluconeogenesis during liver regeneration

    SciTech Connect

    Tajima, Toshihide; Goda, Nobuhito; Fujiki, Natsuko; Hishiki, Takako; Nishiyama, Yasumasa; Senoo-Matsuda, Nanami; Shimazu, Motohide; Soga, Tomoyoshi; Yoshimura, Yasunori; Johnson, Randall S.; Suematsu, Makoto

    2009-10-02

    Coordinated recovery of hepatic glucose metabolism is prerequisite for normal liver regeneration. To examine roles of hypoxia inducible factor-1{alpha} (HIF-1{alpha}) for hepatic glucose homeostasis during the reparative process, we inactivated the gene in hepatocytes in vivo. Following partial hepatectomy (PH), recovery of residual liver weight was initially retarded in the mutant mice by down-regulation of hepatocyte proliferation, but occurred comparably between the mutant and control mice at 72 h after PH. At this time point, the mutant mice showed lowered blood glucose levels with enhanced accumulation of glycogen in the liver. The mutant mice exhibited impairment of hepatic gluconeogenesis as assessed by alanine tolerance test. This appeared to result from reduced expression of PGK-1 and PEPCK since 3-PG, PEP and malate were accumulated to greater extents in the regenerated liver. In conclusion, these findings provide evidence for roles of HIF-1{alpha} in the regulation of gluconeogenesis under liver regeneration.

  8. Induction of the nuclear factor HIF-1{alpha} in acetaminophen toxicity: Evidence for oxidative stress

    SciTech Connect

    James, Laura P. . E-mail: jameslaurap@uams.edu; Donahower, Brian; Burke, Angela S.; McCullough, Sandra; Hinson, Jack A.

    2006-04-28

    Hypoxia inducible factor (HIF) controls the transcription of genes involved in angiogenesis, erythropoiesis, glycolysis, and cell survival. HIF-1{alpha} levels are a critical determinant of HIF activity. The induction of HIF-1{alpha} was examined in the livers of mice treated with a toxic dose of APAP (300 mg/kg IP) and sacrificed at 1, 2, 4, 8, and 12 h. HIF-1{alpha} was induced at 1-12 h and induction occurred prior to the onset of toxicity. Pre-treatment of mice with N-acetylcysteine (1200 mg/kg IP) prevented toxicity and HIF-1{alpha} induction. In further studies, hepatocyte suspensions were incubated with APAP (1 mM) in the presence of an oxygen atmosphere. HIF-1{alpha} was induced at 1 h, prior to the onset of toxicity. Inclusion of cyclosporine A (10 {mu}M), an inhibitor of mitochondrial permeability transition, oxidative stress, and toxicity, prevented the induction of HIF-1{alpha}. Thus, HIF-1{alpha} is induced before APAP toxicity and can occur under non-hypoxic conditions. The data suggest a role for oxidative stress in the induction of HIF-1{alpha} in APAP toxicity.

  9. Inhibition of HIF-1{alpha} activity by BP-1 ameliorates adjuvant induced arthritis in rats

    SciTech Connect

    Shankar, J.; Thippegowda, P.B.; Kanum, S.A.

    2009-09-18

    Rheumatoid arthritis (RA) is a chronic inflammatory, angiogenic disease. Inflamed synovitis is a hallmark of RA which is hypoxic in nature. Vascular endothelial growth factor (VEGF), one of the key regulators of angiogenesis, is overexpressed in the pathogenesis of RA. VEGF expression is regulated by hypoxia-inducible factor-1{alpha} (HIF-1{alpha}), a master regulator of homeostasis which plays a pivotal role in hypoxia-induced angiogenesis. In this study we show that synthetic benzophenone analogue, 2-benzoyl-phenoxy acetamide (BP-1) can act as a novel anti-arthritic agent in an experimental adjuvant induced arthritis (AIA) rat model by targeting VEGF and HIF-1{alpha}. BP-1 administered hypoxic endothelial cells and arthritic animals clearly showed down regulation of VEGF expression. Further, BP-1 inhibits nuclear translocation of HIF-1{alpha}, which in turn suppresses transcription of the VEGF gene. These results suggest a further possible clinical application of the BP-1 derivative as an anti-arthritic agent in association with conventional chemotherapeutic agents.

  10. NF-{kappa}B suppresses HIF-1{alpha} response by competing for P300 binding

    SciTech Connect

    Mendonca, Daniela B.S.; Mendonca, Gustavo; Aragao, Francisco J.L.; Cooper, Lyndon F.

    2011-01-28

    Research highlights: {yields} p65 completely blocked HIF-1{alpha} activity at the HRE on different cell lines. {yields} p65 caused minor changes in HIF-1{alpha} and HIF-1{alpha} target genes mRNA expression. {yields} p65 reduced transcription of VEGF promoter. {yields} p65 competes with HIF-1{alpha} for p300. -- Abstract: Hypoxia has emerged as a key determinant of osteogenesis. HIF-1{alpha} is the transcription factor mediating hypoxia responses that include induction of VEGF and related bone induction. Inflammatory signals antagonize bone repair via the NF-{kappa}B pathway. The present investigation explored the functional relationship of hypoxia (HIF-1{alpha} function) and inflammatory signaling (NF-{kappa}B) in stem like and osteoprogenitor cell lines. The potential interaction between HIF-1{alpha} and NF-{kappa}B signaling was explored by co-transfection studies in hFOB with p65, HIF-1{alpha} and 9x-HRE-luc or HIF-1{alpha} target genes reporter plasmids. Nuclear cross-talk was directly tested using the mammalian Gal4/VP16 two-hybrid, and confirmed by co-immunoprecipitation/western blotting assays. The results show that inflammatory stimulation (TNF-{alpha} treatment) causes a marked inhibition of HIF-1{alpha} function at the HRE in all cell lines studied. Also, co-transfection with p65 expression vector leads to reduced hVEGFp transcription after DFO-induced hypoxia. However, TNF-{alpha} treatment had little effect on HIF-1{alpha} mRNA levels. The functional interaction of Gal4-HIF-1{alpha} and VP16-p300 fusion proteins is effectively blocked by expression of p65 in a dose dependent manner. It was concluded that NF-{kappa}B-mediated inflammatory signaling is able to block HIF-1{alpha} transactivation at HRE-encoding genes by direct competition for p300 binding at the promoter. Inflammation may influence the stem cell niche and tissue regeneration by influencing cellular responses to hypoxia.

  11. Design and synthesis of a series of novel pyrazolopyridines as HIF-1alpha prolyl hydroxylase inhibitors.

    PubMed

    Warshakoon, Namal C; Wu, Shengde; Boyer, Angelique; Kawamoto, Richard; Renock, Sean; Xu, Kevin; Pokross, Matthew; Evdokimov, Artem G; Zhou, Songtao; Winter, Carol; Walter, Richard; Mekel, Marlene

    2006-11-01

    Recently resolved X-ray crystal structure of HIF-1alpha prolyl hydroxylase was used to design and develop a novel series of pyrazolopyridines as potent HIF-1alpha prolyl hydroxylase inhibitors. The activity of these compounds was determined in a human EGLN-1 assay. Structure-based design aided in optimizing the potency of the initial lead (2, IC(50) of 11 microM) to a potent (11l, 190 nM) EGLN-1 inhibitor. Several of these analogs were potent VEGF inducers in a cell-based assay. These pyrazolopyridines were also effective in stabilizing HIF-1alpha.

  12. P70S6K 1 regulation of angiogenesis through VEGF and HIF-1{alpha} expression

    SciTech Connect

    Bian, Chuan-Xiu; Shi, Zhumei; Meng, Qiao; Jiang, Yue; Liu, Ling-Zhi; Jiang, Bing-Hua

    2010-07-30

    Research highlights: {yields} P70S6K1 regulates VEGF expression; {yields} P70S6K1 induces transcriptional activation through HIF-1{alpha} binding site; {yields} P70S6K1 regulates HIF-1{alpha}, but not HIF-1{beta} protein expression; {yields} P70S6K1 mediates tumor growth and angiogenesis through HIF-1{alpha} and VEGF expression. -- Abstract: The 70 kDa ribosomal S6 kinase 1 (p70S6K1), a downstream target of phosphoinositide 3-kinase (PI3K) and ERK mitogen-activated protein kinase (MAPK), is an important regulator of cell cycle progression, and cell proliferation. Recent studies indicated an important role of p70S6K1 in PTEN-negative and AKT-overexpressing tumors. However, the mechanism of p70S6K1 in tumor angiogenesis remains to be elucidated. In this study, we specifically inhibited p70S6K1 activity in ovarian cancer cells using vector-based small interfering RNA (siRNA) against p70S6K1. We found that knockdown of p70S6K1 significantly decreased VEGF protein expression and VEGF transcriptional activation through the HIF-1{alpha} binding site at its enhancer region. The expression of p70S6K1 siRNA specifically inhibited HIF-1{alpha}, but not HIF-1{beta} protein expression. We also found that p70S6K1 down-regulation inhibited ovarian tumor growth and angiogenesis, and decreased cell proliferation and levels of VEGF and HIF-1{alpha} expression in tumor tissues. Our results suggest that p70S6K1 is required for tumor growth and angiogenesis through HIF-1{alpha} and VEGF expression, providing a molecular mechanism of human ovarian cancer mediated by p70S6K1 signaling.

  13. Acetaminophen hepatotoxicity and HIF-1{alpha} induction in acetaminophen toxicity in mice occurs without hypoxia

    SciTech Connect

    Chaudhuri, Shubhra; McCullough, Sandra S.; Hennings, Leah; Letzig, Lynda; Simpson, Pippa M.; Hinson, Jack A.; James, Laura P.

    2011-05-01

    HIF-1{alpha} is a nuclear factor important in the transcription of genes controlling angiogenesis including vascular endothelial growth factor (VEGF). Both hypoxia and oxidative stress are known mechanisms for the induction of HIF-1{alpha}. Oxidative stress and mitochondrial permeability transition (MPT) are mechanistically important in acetaminophen (APAP) toxicity in the mouse. MPT may occur as a result of oxidative stress and leads to a large increase in oxidative stress. We previously reported the induction of HIF-1{alpha} in mice with APAP toxicity and have shown that VEGF is important in hepatocyte regeneration following APAP toxicity. The following study was performed to examine the relative contribution of hypoxia versus oxidative stress to the induction of HIF-1{alpha} in APAP toxicity in the mouse. Time course studies using the hypoxia marker pimonidazole showed no staining for pimonidazole at 1 or 2 h in B6C3F1 mice treated with APAP. Staining for pimonidazole was present in the midzonal to periportal regions at 4, 8, 24 and 48 h and no staining was observed in centrilobular hepatocytes, the sites of the toxicity. Subsequent studies with the MPT inhibitor cyclosporine A showed that cyclosporine A (CYC; 10 mg/kg) reduced HIF-1{alpha} induction in APAP treated mice at 1 and 4 h and did not inhibit the metabolism of APAP (depletion of hepatic non-protein sulfhydryls and hepatic protein adduct levels). The data suggest that HIF-1{alpha} induction in the early stages of APAP toxicity is secondary to oxidative stress via a mechanism involving MPT. In addition, APAP toxicity is not mediated by a hypoxia mechanism.

  14. [Rat cardiomyocyte remodeling after neonatal cryptosporidiosis. II. Elongation, excessive polyploidization and HIF-1alpha overexpression].

    PubMed

    Anatskaia, O V; Sidorenko, N V; Matveev, I V; Kropotov, A V; Vinogradov, A E

    2012-01-01

    Retrospective epidemyological studies evidence that infant diseases leave survivors with an increased susceptibility to cardiovascular diseases in later life. At the same time, the mechanisms of this link remain poorly understood. Based on medical statistics reporting that infectious gastroenteritis is the most common cause of maladies in babies, infants and children, we analysed the effects of moderate cryptosporidial gastroenteritis on the heart and ventricular cardiomyocyte remodelling in rats of the first month of life. The disease was challenged by a worldwide human protozoic pathogen Cryptosporidium parvum (Apicomplexa, Sporozoa). The main symptoms manifested in the growth retardation moderate diarrhea. Using real-time PCR, cytophotometry, confocal microscopy and image analysis, we indicated that cryptosporidiosis was associated, with the atrophy heart and the elongation, narrowing, protein content decrease and hyperpolyploidization of cardiomyocytes and the moderate overexpression of hypoxia inducible factor 1alpha (HIF-1alpha) mRNA. Cardiomyocyte shape remodeling and heart atrophy presented in all age groups. The severity of these changes, hovewer, declined gradually from younger to older groups. In contrast, hyperpolyploidization and HIF-1alpha mRNA overexpression were registered mainly among animals aged between 6 and 13 days, and were barely detected and non-significant in older age groups. In the rat the time period covering 6-13 days after birth is known to coincide with the intensive cardiomyocyte polyploidization and the switch from proliferation to hypertrophy. Thus, our data indicate that neonatal cryptosporidiosis may be potential cardiovascular diseases risk factor and that one of the critical time windows for the growing heart covers the time period when cardiomyocyte undergo polyploidization. PMID:23074852

  15. P70S6K 1 regulation of angiogenesis through VEGF and HIF-1alpha expression.

    PubMed

    Bian, Chuan-Xiu; Shi, Zhumei; Meng, Qiao; Jiang, Yue; Liu, Ling-Zhi; Jiang, Bing-Hua

    2010-07-30

    The 70kDa ribosomal S6 kinase 1 (p70S6K1), a downstream target of phosphoinositide 3-kinase (PI3K) and ERK mitogen-activated protein kinase (MAPK), is an important regulator of cell cycle progression, and cell proliferation. Recent studies indicated an important role of p70S6K1 in PTEN-negative and AKT-overexpressing tumors. However, the mechanism of p70S6K1 in tumor angiogenesis remains to be elucidated. In this study, we specifically inhibited p70S6K1 activity in ovarian cancer cells using vector-based small interfering RNA (siRNA) against p70S6K1. We found that knockdown of p70S6K1 significantly decreased VEGF protein expression and VEGF transcriptional activation through the HIF-1alpha binding site at its enhancer region. The expression of p70S6K1 siRNA specifically inhibited HIF-1alpha, but not HIF-1beta protein expression. We also found that p70S6K1 down-regulation inhibited ovarian tumor growth and angiogenesis, and decreased cell proliferation and levels of VEGF and HIF-1alpha expression in tumor tissues. Our results suggest that p70S6K1 is required for tumor growth and angiogenesis through HIF-1alpha and VEGF expression, providing a molecular mechanism of human ovarian cancer mediated by p70S6K1 signaling.

  16. Separate necdin domains bind ARNT2 and HIF1{alpha} and repress transcription

    SciTech Connect

    Friedman, Eitan R.; Fan Chenming

    2007-11-09

    PWS is caused by the loss of expression of a set of maternally imprinted genes including NECDIN (NDN). NDN is expressed in post-mitotic neurons and plays an essential role in PWS as mouse models lacking only the Ndn gene mimic aspects of this disease. Patients haploid for SIM1 develop a PW-like syndrome. Here, we report that NDN directly interacts with ARNT2, a bHLH-PAS protein and dimer partner for SIM1. We also found that NDN can interact with HIF1{alpha}. We showed that NDN can repress transcriptional activation mediated by ARNT2:SIM1 as well as ARNT2:HIF1{alpha}. The N-terminal 115 residues of NDN are sufficient for interaction with the bHLH domains of ARNT2 or HIF1{alpha} but not for transcriptional repression. Using GAL4-NDN fusion proteins, we determined that NDN possesses multiple repression domains. We thus propose that NDN regulates neuronal function and hypoxic response by regulating the activities of the ARNT2:SIM1 and ARNT2:HIF1{alpha} dimers, respectively.

  17. Extended ischemia prevents HIF1alpha degradation at reoxygenation by impairing prolyl-hydroxylation: role of Krebs cycle metabolites.

    PubMed

    Serra-Pérez, Anna; Planas, Anna M; Núñez-O'Mara, Analía; Berra, Edurne; García-Villoria, Judit; Ribes, Antònia; Santalucía, Tomàs

    2010-06-11

    Hypoxia-inducible factor (HIF) is a heterodimeric transcription factor that activates the cellular response to hypoxia. The HIF1alpha subunit is constantly synthesized and degraded under normoxia, but degradation is rapidly inhibited when oxygen levels drop. Oxygen-dependent hydroxylation by prolyl-4-hydroxylases (PHD) mediates HIF1alpha proteasome degradation. Brain ischemia limits the availability not only of oxygen but also of glucose. We hypothesized that this circumstance could have a modulating effect on HIF. We assessed the separate involvement of oxygen and glucose in HIF1alpha regulation in differentiated neuroblastoma cells subjected to ischemia. We report higher transcriptional activity and HIF1alpha expression under oxygen deprivation in the presence of glucose (OD), than in its absence (oxygen and glucose deprivation, OGD). Unexpectedly, HIF1alpha was not degraded at reoxygenation after an episode of OGD. This was not due to impairment of proteasome function, but was associated with lower HIF1alpha hydroxylation. Krebs cycle metabolites fumarate and succinate are known inhibitors of PHD, while alpha-ketoglutarate is a co-substrate of the reaction. Lack of HIF1alpha degradation in the presence of oxygen was accompanied by a very low alpha-ketoglutarate/fumarate ratio. Furthermore, treatment with a fumarate analogue prevented HIF1alpha degradation under normoxia. In all, our data suggest that postischemic metabolic alterations in Krebs cycle metabolites impair HIF1alpha degradation in the presence of oxygen by decreasing its hydroxylation, and highlight the involvement of metabolic pathways in HIF1alpha regulation besides the well known effects of oxygen.

  18. Noscapine inhibits hypoxia-mediated HIF-1alpha expression andangiogenesis in vitro: a novel function for an old drug.

    PubMed

    Newcomb, Elizabeth W; Lukyanov, Yevgeniy; Schnee, Tona; Ali, M Aktar; Lan, Li; Zagzag, David

    2006-05-01

    Overexpression of hypoxia-inducible factor-1 (HIF-1) is a common feature in solid malignancies related to oxygen deficiency. Since increased HIF-1 expression correlates with advanced disease stage, increased angiogenesis and poor prognosis, HIF-1 and its signaling pathway have become targets for cancer chemotherapy. In this study, we identified noscapine to be a novel small molecule inhibitor of the HIF-1 pathway based on its structure-function relation-ships with HIF-1 pathway inhibitors belonging to the benzylisoquinoline class of plant metabolites and/or to microtubule binding agents. We demonstrate that noscapine treatment of human glioma U87MG and T98G cell lines exposed to the hypoxic mimetic agent, CoCl2, inhibits hypoxia-mediated HIF-1alpha expression and transcriptional activity as measured by decreased secretion of VEGF, a HIF-1 target gene. Inhibition of hypoxia-mediated HIF-1alpha expression was due, in part, to its ability to inhibit accumulation of HIF-1alpha in the nucleus and target it for degradation via the proteasome. One mechanism of action of microtubule binding agents is their antiangiogenic activity associated with disruption of endothelial tubule formation. We show that noscapine has similar properties in vitro. Thus, noscapine may possess novel antiangiogenic activity associated with two broad mechanisms of action: first, by decreasing HIF-1alpha expression in hypoxic tumor cells, upregulation of target genes, such as VEGF, would be decreased concomitant with its associated angiogenic activity; second, by inhibiting endothelial cells from forming blood vessels in response to VEGF stimulation, it may limit the process of neo-vascularization, correlating with antitumor activity in vivo. For more than 75 years, noscapine has traditionally been used as an oral cough suppressant with no known toxic side effects in man. Thus, the studies reported here have found a novel function for an old drug. Given its low toxicity profile, its demonstrated

  19. Overexpression of Intrinsic Hypoxia Markers HIF1{alpha} and CA-IX Predict for Local Recurrence in Stage T1-T2 Glottic Laryngeal Carcinoma Treated With Radiotherapy

    SciTech Connect

    Schrijvers, M.L.; Laan, B.F.A.M. van der; Bock, G.H. de; Pattje, W.J.; Mastik, M.F.; Menkema, L.; Langendijk, J.A.; Kluin, P.M.; Schuuring, E.; Wal, J.E. van der

    2008-09-01

    Purpose: To examine the prognostic value of three endogenous hypoxia markers (hypoxia inducible factor 1 {alpha} subunit [HIF1{alpha}], carbonic anhydrase IX [CA-IX], and glucose transporter type 1 [GLUT-1]) on the clinical outcome in patients with early-stage glottic carcinoma primarily treated with radiotherapy (RT) and to determine the predictive hypoxic profile to choose the optimal treatment of early-stage laryngeal carcinoma. Methods and Materials: Immunohistochemistry for HIF1{alpha}, CA-IX, and GLUT-1 was performed on formalin-fixed, paraffin-embedded, pretreatment tissue samples of 91 glottic squamous cell carcinoma specimens. The patient group consisted only of those with early-stage (T1-T2) glottic carcinoma, and all patients were treated with RT only. Relative tumor staining was scored on the tissue samples. Receiver operating curve analysis was performed to determine the optimal cutoff value for each tumor marker. Cox regression analyses for the variables HIF1{alpha}, CA-IX, GLUT-1, gender, age, hemoglobin level, T category, N category, tobacco use, and alcohol use were performed with local control and overall survival as endpoints. Results: HIF1{alpha} overexpression in early-stage glottic carcinoma correlated significantly with worse local control (hazard ratio [HR], 3.05; p = 0.021) and overall survival (HR, 2.92; p = 0.016). CA-IX overexpression correlated significantly with worse local control (HR, 2.93; p = 0.020). GLUT-1 overexpression did not show any correlation with the clinical outcome parameters. Tumors with a nonhypoxic profile (defined as low HIF1{alpha} and low CA-IX expression) had significantly better local control (HR, 6.32; p 0.013). Conclusion: The results of our study have shown that early-stage glottic laryngeal carcinomas with low HIF1{alpha} and CA-IX expression are highly curable with RT. For this group, RT is a good treatment option. For tumors with HIF1{alpha} or CA-IX overexpression, hypoxic modification before RT or primary

  20. Structure-based design, synthesis, and SAR evaluation of a new series of 8-hydroxyquinolines as HIF-1alpha prolyl hydroxylase inhibitors.

    PubMed

    Warshakoon, Namal C; Wu, Shengde; Boyer, Angelique; Kawamoto, Richard; Sheville, Justin; Renock, Sean; Xu, Kevin; Pokross, Matthew; Zhou, Songtao; Winter, Carol; Walter, Richard; Mekel, Marlene; Evdokimov, Artem G

    2006-11-01

    A new series of potent 8-hydroxyquinolines was designed based on the newly resolved X-ray crystal structure of EGLN-1. Both alkyl and aryl 8-hydroxyquinoline-7-carboxyamides were good HIF-1alpha prolyl hydroxylase (EGLN) inhibitors. In subsequent VEGF induction assays, these exhibited potent VEGF activity. In addition, this class of compounds did show the ability to stabilize HIF-1alpha.

  1. SU-C-303-02: Correlating Metabolic Response to Radiation Therapy with HIF-1alpha Expression

    SciTech Connect

    Campos, D; Peeters, W; Nickel, K; Eliceiri, K; Kimple, R; Van Der Kogel, A; Kissick, M

    2015-06-15

    Purpose: To understand radiation induced alterations in cellular metabolism which could be used to assess treatment or normal tissue response to aid in patient-specific adaptive radiotherapy. This work aims to compare the metabolic response of two head and neck cell lines, one malignant (UM-SCC-22B) and one benign (Normal Oral Keratinocyte), to ionizing radiation. Responses are compared to alterations in HIF-1alpha expression. These dynamics can potentially serve as biomarkers in assessing treatment response allowing for patient-specific adaptive radiotherapy. Methods: Measurements of metabolism and HIF-1alpha expression were taken before and X minutes after a 10 Gy dose of radiation delivered via an orthovoltage x-ray source. In vitro changes in metabolic activity were measured via fluorescence lifetime imaging (FLIM) to assess the mean lifetime of NADH autofluorescence following a dose of 10 Gy. HIF-1alpha expression was measured via immunohistochemical staining of in vitro treated cells and expression was quantified using the FIJI software package. Results: FLIM demonstrated a decrease in the mean fluorescence lifetime of NADH by 100 ps following 10 Gy indicating a shift towards glycolytic pathways for malignant cells; whereas this benign cell line showed little change in metabolic signature. Immunohistochemical analysis showed significant changes in HIF-1alpha expression in response to 10 Gy of radiation that correlate to metabolic profiles. Conclusion: Radiation induces significant changes in metabolic activity and HIF-1alpha expression. These alterations occur on time scales approximating the duration of common radiation treatments (approximately tens of minutes). Further understanding these dynamics has important implications with regard to improvement of therapy and biomarkers of treatment response.

  2. Accumulation of Krebs cycle intermediates and over-expression of HIF1alpha in tumours which result from germline FH and SDH mutations.

    PubMed

    Pollard, P J; Brière, J J; Alam, N A; Barwell, J; Barclay, E; Wortham, N C; Hunt, T; Mitchell, M; Olpin, S; Moat, S J; Hargreaves, I P; Heales, S J; Chung, Y L; Griffiths, J R; Dalgleish, A; McGrath, J A; Gleeson, M J; Hodgson, S V; Poulsom, R; Rustin, P; Tomlinson, I P M

    2005-08-01

    The nuclear-encoded Krebs cycle enzymes, fumarate hydratase (FH) and succinate dehydrogenase (SDHB, -C and -D), act as tumour suppressors. Germline mutations in FH predispose individuals to leiomyomas and renal cell cancer (HLRCC), whereas mutations in SDH cause paragangliomas and phaeochromocytomas (HPGL). In this study, we have shown that FH-deficient cells and tumours accumulate fumarate and, to a lesser extent, succinate. SDH-deficient tumours principally accumulate succinate. In situ analyses showed that these tumours also have over-expression of hypoxia-inducible factor 1alpha (HIF1alpha), activation of HIF1alphatargets (such as vascular endothelial growth factor) and high microvessel density. We found no evidence of increased reactive oxygen species in our cells. Our data provide in vivo evidence to support the hypothesis that increased succinate and/or fumarate causes stabilization of HIF1alpha a plausible mechanism, inhibition of HIF prolyl hydroxylases, has previously been suggested by in vitro studies. The basic mechanism of tumorigenesis in HPGL and HLRCC is likely to be pseudo-hypoxic drive, just as it is in von Hippel-Lindau syndrome.

  3. The effects of HIF-1alpha on gene expression profiles of NCI-H446 human small cell lung cancer cells

    PubMed Central

    2009-01-01

    Background Gene targeted therapy refers to any therapy focused on one of the many biological features of the tumor. Such features are mediated by specific genes that are involved in tumor metastasis, recurrence, poor response to chemotherapy and others. Hypoxia is an important pathognomonic feature of many malignant tumors including SCLC (small cell lung cancer). HIF-1alpha, which is induced by hypoxia, is the most important regulatory factor of many specific genes that can influence the biological features of tumors. Methods In this study, we tried to elucidate the changes in gene expression profiles of SCLC NCI-H446 cells mediated by HIF-1alpha. According to different treatments of cells, three experimental pairwise comparisons were designed: hypoxia group vs. control group, Ad5-HIF-1alpha group vs. Ad5 group, and Ad5-siHIF-1 alpha group Vs Ad5 group. Results Results from the analysis of gene expression profiles indicated that there were 65 genes upregulated and 28 genes downregulated more than two-fold in all three experimental pairwise comparisons. These genes were involved in transport, signal-transduction, cell adhesion/motility, growth factor/cytokines, transcription, inflammatory response, metabolic process, in addition to others. SOCS1, IGFBP5, IL-6 and STAT3 were also upregulated at protein level. SOCS1 could significantly induce apoptosis and suppress growth of NCI-H446 cells but HIF-1alpha could induce growth and suppress apoptosis. Conclusions Through this research, we are trying to find novel functional genes that are mediated by HIF-1alpha and provide the theoretical basis for new therapeutic targets. HIF-1 alpha maybe upregulate the expression of SOCS1 through mediation of STAT3 and IL-6. In addition, SOCS1 could significantly induce apoptosis and suppress growth of NCI-H446 cells. This was contrary to HIF-1alpha and it indicated that there might be an antagonism effect between HIF-1alpha and SOCS1 on regulating growth and apoptosis of NCI-H446

  4. Increased size of solid organs in patients with Chuvash polycythemia and in mice with altered expression of HIF-1alpha and HIF-2alpha.

    PubMed

    Yoon, Donghoon; Okhotin, David V; Kim, Bumjun; Okhotina, Yulia; Okhotin, Daniel J; Miasnikova, Galina Y; Sergueeva, Adelina I; Polyakova, Lydia A; Maslow, Alexei; Lee, Yonggu; Semenza, Gregg L; Prchal, Josef T; Gordeuk, Victor R

    2010-05-01

    Chuvash polycythemia, the first hereditary disease associated with dysregulated oxygen-sensing to be recognized, is characterized by a homozygous germ-line loss-of-function mutation of the VHL gene (VHL(R200W)) resulting in elevated hypoxia inducible factor (HIF)-1alpha and HIF-2alpha levels, increased red cell mass and propensity to thrombosis. Organ volume is determined by the size and number of cells, and the underlying molecular control mechanisms are not fully elucidated. Work from several groups has demonstrated that the proliferation of cells is regulated in opposite directions by HIF-1alpha and HIF-2alpha. HIF-1alpha inhibits cell proliferation by displacing MYC from the promoter of the gene encoding the cyclin-dependent kinase inhibitor, p21(Cip1), thereby inducing its expression. In contrast, HIF-2alpha promotes MYC activity and cell proliferation. Here we report that the volumes of liver, spleen, and kidneys relative to body mass were larger in 30 individuals with Chuvash polycythemia than in 30 matched Chuvash controls. In Hif1a(+/-) mice, which are heterozygous for a null (knockout) allele at the locus encoding HIF-1alpha, hepatic HIF-2alpha mRNA was increased (2-fold) and the mass of the liver was increased, compared with wild-type littermates, without significant difference in cell volume. Hepatic p21(Cip1) mRNA levels were 9.5-fold lower in Hif1a(+/-) mice compared with wild-type littermates. These data suggest that, in addition to increased red cell mass, the sizes of liver, spleen, and kidneys are increased in Chuvash polycythemia. At least in the liver, this phenotype may result from increased HIF-2alpha and decreased p21(Cip1) levels leading to increased hepatocyte proliferation. PMID:20140661

  5. Low-dose radiation pretreatment improves survival of human ceiling culture-derived proliferative adipocytes (ccdPAs) under hypoxia via HIF-1 alpha and MMP-2 induction

    SciTech Connect

    Adachi, Naoki; Kubota, Yoshitaka; Kosaka, Kentarou; Akita, Shinsuke; Sasahara, Yoshitarou; Kira, Tomoe; Kuroda, Masayuki; Mitsukawa, Nobuyuki; Bujo, Hideaki; Satoh, Kaneshige

    2015-08-07

    Poor survival is a major problem of adipocyte transplantation. We previously reported that VEGF and MMPs secreted from transplanted adipocytes are essential for angiogenesis and adipogenesis. Pretreatment with low-dose (5 Gy) radiation (LDR) increased VEGF, MMP-2, and HIF-1 alpha mRNA expression in human ceiling culture-derived proliferative adipocytes (hccdPAs). Gene expression after LDR differed between adipose-derived stem cells (hASCs) and hccdPAs. Pretreatment with LDR improved the survival of hccdPAs under hypoxia, which is inevitable in the early stages after transplantation. Upregulation of VEGF and MMP-2 after LDR in hccdPAs is mediated by HIF-1 alpha expression. Our results suggest that pretreatment with LDR may improve adipocyte graft survival in a clinical setting through upregulation of VEGF and MMP-2 via HIF-1 alpha. - Highlights: • Ceiling culture-derived proliferative adipocytes (ccdPAs) react to radiation. • Low-dose radiation (LDR) pretreatment improves survival of ccdPAs under hypoxia. • Gene expression after LDR differs between ccdPAs and adipose-derived stem cells. • LDR-induced increase in MMP-2 and VEGF is dependent on HIF-1 alpha induction. • LDR pretreatment may improve the adipocyte graft survival rate in clinical settings.

  6. HIF-1alpha Deficiency Attenuates the Cardiomyogenesis of Mouse Embryonic Stem Cells

    PubMed Central

    Kudová, Jana; Procházková, Jiřina; Vašiček, Ondřej; Perečko, Tomáš; Sedláčková, Miroslava; Pešl, Martin; Pacherník, Jiří

    2016-01-01

    Cardiac cell formation, cardiomyogenesis, is critically dependent on oxygen availability. It is known that hypoxia, a reduced oxygen level, modulates the in vitro differentiation of pluripotent cells into cardiomyocytes via hypoxia inducible factor-1alpha (HIF-1α)-dependent mechanisms. However, the direct impact of HIF-1α deficiency on the formation and maturation of cardiac-like cells derived from mouse embryonic stem cells (mESC) in vitro remains to be elucidated. In the present study, we demonstrated that HIF-1α deficiency significantly altered the quality and quantity of mESC-derived cardiomyocytes. It was accompanied with lower mRNA and protein levels of cardiac cell specific markers (myosin heavy chains 6 and 7) and with a decreasing percentage of myosin heavy chain α and β, and cardiac troponin T-positive cells. As to structural aspects of the differentiated cardiomyocytes, the localization of contractile proteins (cardiac troponin T, myosin heavy chain α and β) and the organization of myofibrils were also different. Simultaneously, HIF-1α deficiency was associated with a lower percentage of beating embryoid bodies. Interestingly, an observed alteration in the in vitro differentiation scheme of HIF-1α deficient cells was accompanied with significantly lower expression of the endodermal marker (hepatic nuclear factor 4 alpha). These findings thus suggest that HIF-1α deficiency attenuates spontaneous cardiomyogenesis through the negative regulation of endoderm development in mESC differentiating in vitro. PMID:27355368

  7. HIF1alpha synergizes with glucocorticoids to promote BFU-E progenitor self-renewal.

    PubMed

    Flygare, Johan; Rayon Estrada, Violeta; Shin, Chanseok; Gupta, Sumeet; Lodish, Harvey F

    2011-03-24

    With the aim of finding small molecules that stimulate erythropoiesis earlier than erythropoietin and that enhance erythroid colony-forming unit (CFU-E) production, we studied the mechanism by which glucocorticoids increase CFU-E formation. Using erythroid burst-forming unit (BFU-E) and CFU-E progenitors purified by a new technique, we demonstrate that glucocorticoids stimulate the earliest (BFU-E) progenitors to undergo limited self-renewal, which increases formation of CFU-E cells > 20-fold. Interestingly, glucocorticoids induce expression of genes in BFU-E cells that contain promoter regions highly enriched for hypoxia-induced factor 1α (HIF1α) binding sites. This suggests activation of HIF1α may enhance or replace the effect of glucocorticoids on BFU-E self-renewal. Indeed, HIF1α activation by a prolyl hydroxylase inhibitor (PHI) synergizes with glucocorticoids and enhances production of CFU-Es 170-fold. Because PHIs are able to increase erythroblast production at very low concentrations of glucocorticoids, PHI-induced stimulation of BFU-E progenitors thus represents a conceptually new therapeutic window for treating erythropoietin-resistant anemia.

  8. HIF-1-alpha links mitochondrial perturbation to the dynamic acquisition of breast cancer tumorigenicity

    PubMed Central

    Kuo, Ching-Ying; Cheng, Chun-Ting; Hou, Peifeng; Lin, Yi-Pei; Ma, Huimin; Chung, Yiyin; Chi, Kevin; Chen, Yuan; Li, Wei; Kung, Hsing-Jien; Ann, David K.

    2016-01-01

    Up-regulation of hypoxia-inducible factor-1α (HIF-1α), even in normoxia, is a common feature of solid malignancies. However, the mechanisms of increased HIF-1α abundance, and its role in regulating breast cancer plasticity are not fully understood. We have previously demonstrated that dimethyl-2-ketoglutarate (DKG), a widely used cell membrane-permeable α-ketoglutarate (α-KG) analogue, transiently stabilizes HIF-1α by inhibiting prolyl hydroxylase 2. Here, we report that breast cancer tumorigenicity can be acquired through prolonged treatment with DKG. Our results indicate that, in response to prolonged DKG treatment, mitochondrial respiration becomes uncoupled, leading to the accumulation of succinate and fumarate in breast cancer cells. Further, we found that an early increase in the oxygen flux rate was accompanied by a delayed enhancement of glycolysis. Together, our results indicate that these events trigger a dynamic enrichment for cells with pluripotent/stem-like cell markers and tumorsphere-forming capacity. Moreover, DKG-mediated metabolic reprogramming results in HIF-1α induction and reductive carboxylation pathway activation. Both HIF-1α accumulation and the tumor-promoting metabolic state are required for DKG-promoted tumor repopulation capacity in vivo. Our data suggest that mitochondrial adaptation to DKG elevates the ratio of succinate or fumarate to α-KG, which in turn stabilizes HIF-1α and reprograms breast cancer cells into a stem-like state. Therefore, our results demonstrate that metabolic regulation, with succinate and/or fumarate accumulation, governs the dynamic transition of breast cancer tumorigenic states and we suggest that HIF-1α is indispensable for breast cancer tumorigenicity. PMID:27058900

  9. The role and regulation of hypoxia-inducible factor-1alpha expression in brain development and neonatal hypoxic-ischemic brain injury.

    PubMed

    Fan, Xiyong; Heijnen, Cobi J; van der Kooij, Michael A; Groenendaal, Floris; van Bel, Frank

    2009-12-11

    During neonatal hypoxic-ischemic brain injury, activation of transcription of a series of genes is induced to stimulate erythropoiesis, anti-apoptosis, apoptosis, necrosis and angiogenesis. A key factor mediating these gene transcriptions is hypoxia-inducible factor-1alpha (HIF-1alpha). During hypoxia, HIF-1alpha protein is stabilized and heterodimerizes with HIF-1beta to form HIF-1, subsequently regulating the expression of target genes. HIF-1alpha participates in early brain development and proliferation of neuronal precursor cells. Under pathological conditions, HIF-1alpha is known to play an important role in neonatal hypoxic-ischemic brain injury: on the one hand, HIF-1alpha has neuroprotective effects whereas it can also have neurotoxic effects. HIF-1alpha regulates the transcription of erythropoietin (EPO), which induces several pathways associated with neuroprotection. HIF-1alpha also promotes the expression of vascular endothelial cell growth factor (VEGF), which is related to neovascularization in hypoxic-ischemic brain areas. In addition, HIF-1alpha has an anti-apoptotic effect by increasing the expression of anti-apoptotic factors such as EPO during mild hypoxia. The neurotoxic effects of HIF-1alpha are represented by its participation in the apoptotic process by increasing the stability of the tumor suppressor protein p53 during severe hypoxia. Moreover, HIF-1alpha plays a role in cell necrosis, by interacting with calcium and calpain. HIF-1alpha can also exacerbate brain edema via increasing the permeability of the blood-brain barrier (BBB). Given these properties, HIF-1alpha has both neuroprotective and neurotoxic effects after hypoxia-ischemia. These events are cell type specific and related to the severity of hypoxia. Unravelling of the complex functions of HIF-1alpha may be important when designing neuroprotective therapies for hypoxic-ischemic brain injury.

  10. Baltic salmon (Salmo salar) yolk-sac fry mortality is associated with disturbances in the function of hypoxia-inducible transcription factor (HIF-1alpha) and consecutive gene expression.

    PubMed

    Vuori, Kristiina A M; Soitamo, Arto; Vuorinen, Pekka J; Nikinmaa, Mikko

    2004-07-14

    Baltic salmon (Salmo salar) suffer from abnormally high yolk-sac fry mortality designated as M74-syndrome. In 1990s, 25-80% of salmon females, which ascended rivers to spawn, produced yolk-sac fry suffering from the syndrome. Symptoms of M74-affected fry include neurological disturbances, impaired vascular development and abnormal haemorrhages. The latter symptoms are observed in mammalian embryos if the function of hypoxia inducible transcription factor (HIF-1alpha), its dimerization partner aryl hydrocarbon nuclear translocator (ARNT) or target gene vascular endothelial growth factor (VEGF) is disturbed. To study the possible involvement of HIF-1alpha and its target gene VEGF in the development of the syndrome, we collected healthy and M74-affected wild Baltic salmon yolk-sac fry and analyzed HIF-1alpha mRNA and protein expression, HIF-1alpha DNA-binding, target gene VEGF protein expression, and blood vessel density in both groups at different stages of yolk-sac fry development. In addition, since Baltic salmon females contain organochlorine contaminants, which have been suggested to be the cause of M74 syndrome via the aryl hydrocarbon receptor (AhR)-dependent gene expression pathway, we studied AhR protein expression, AhR DNA-binding and target gene CYP1A protein expression. Since the parents of both healthy and M74-affected wild fry will have experienced the organochlorine load from the Baltic Sea, hatchery-reared fry were included in the studies as an additional control. The results show that the vascular defects observed in fry suffering from M74 are associated with reduced DNA-binding activity of HIF-1alpha and subsequent downregulation of its target gene vascular endothelial growth factor (VEGF). In addition, also AhR function is decreased in diseased fry making it unlikely that symptoms of M74-affected fry would be caused by an upregulation of xenobiotically induced AhR-dependent gene expression pathway.

  11. Association Between HIF-1 Alpha Gene Polymorphisms and Response in Patients Undergoing Neoadjuvant Chemotherapy for Locally Advanced Cervical Cancer.

    PubMed

    Chen, Qing; Tian, Wei-Jie; Huang, Miao-Ling; Liu, Chang-Hao; Yao, Ting-Ting; Guan, Mei-Mei

    2016-01-01

    BACKGROUND The aim of the study was to assess whether HIF-1α polymorphisms have an effect on the response to chemotherapy of locally advanced cervical cancer (LACC) patients treated with platinum-based neoadjuvant chemotherapy (NACT) and radical surgery. MATERIAL AND METHODS We conducted a retrospective study in 162 LACC patients. Hypoxia-inducible factor 1α C1772T and G1790A genetic polymorphisms were ascertained using direct sequencing methods. RESULTS The C1772T polymorphism was significantly related to response to chemotherapy (P=0.002), and there was an increased chance of treatment response in patients with the C/C genotype (OR=4.7; 95% CI: 1.67-13.49; P=0.004). The C1772T polymorphism was also associated with poor tumor grade (adjusted OR, 2.98; 95% CI: 1.08-8.13; P=0.037). However, The G1790A polymorphism was not associated with response (P>0.05). CONCLUSIONS The C1772T polymorphism was significantly related to response to chemotherapy and poor tumor grade. Our results may help to better manage individual patients and to improve clinical decision making regarding use of NACT. PMID:27593081

  12. Association Between HIF-1 Alpha Gene Polymorphisms and Response in Patients Undergoing Neoadjuvant Chemotherapy for Locally Advanced Cervical Cancer

    PubMed Central

    Chen, Qing; Tian, Wei-Jie; Huang, Miao-Ling; Liu, Chang-Hao; Yao, Ting-Ting; Guan, Mei-Mei

    2016-01-01

    Background The aim of the study was to assess whether HIF-1α polymorphisms have an effect on the response to chemotherapy of locally advanced cervical cancer (LACC) patients treated with platinum-based neoadjuvant chemotherapy (NACT) and radical surgery. Material/Methods We conducted a retrospective study in 162 LACC patients. Hypoxia-inducible factor 1α C1772T and G1790A genetic polymorphisms were ascertained using direct sequencing methods. Results The C1772T polymorphism was significantly related to response to chemotherapy (P=0.002), and there was an increased chance of treatment response in patients with the C/C genotype (OR=4.7; 95% CI: 1.67–13.49; P=0.004). The C1772T polymorphism was also associated with poor tumor grade (adjusted OR, 2.98; 95% CI: 1.08–8.13; P=0.037). However, The G1790A polymorphism was not associated with response (P>0.05). Conclusions The C1772T polymorphism was significantly related to response to chemotherapy and poor tumor grade. Our results may help to better manage individual patients and to improve clinical decision making regarding use of NACT. PMID:27593081

  13. Anti-tumor efficacy of BEZ235 is complemented by its anti-angiogenic effects via downregulation of PI3K-mTOR-HIF1alpha signaling in HER2-defined breast cancers

    PubMed Central

    Dey, Nandini; Sun, Yuliang; Carlson, Jennifer H; Wu, Hui; Lin, Xiaoqian; Leyland-Jones, Brian; De, Pradip

    2016-01-01

    Activation of the PI3K-mTOR pathway via HER2: HER3-mediated signaling in HER2+ breast cancers pose one of the major threats towards the success of trastuzumab. First, trastuzumab cannot perturb survival/proliferative signals following HER2: HER3 heterodimerization in HER2+ tumor cells. Second, trastuzumab treatment has been reported to cause drug-mediated resistance in over 50% of HER2+ breast cancers. We have reported that treatment with an anti-angiogenic drug imparted a significant anti-tumor advantage when combined with trastuzumab plus pertuzumab in the trastuzumab-resistant model of HER2+ breast cancers (PMID: 23959459). The very fact as revealed by our study that an inclusion of anti-angiogenic drug conferred a significant anti-tumor advantage when combined with dual anti-HER2 therapy clearly indicated a critical and indispensable role of angiogenesis in these tumors. Hence, we hypothesized that BEZ235 a dual PI3K/mTOR inhibitor will have an effect on the tumor as well as the angiogenic stromal compartments. In vitro and in vivo efficacy of BEZ235 was determined in HER2+ trastuzumab-sensitive, trastuzumab-resistant and HER2 amplified/PIK3CA mutated cell lines. BEZ235 alone and in combination with trastuzumab was tested on the tumor as well as stromal compartments. AKT-mTOR signal was suppressed following BEZ235 treatment in a concentration and time-dependent manner. AnnexinV, cl-CASPASE3, SURVIVIN and p-FOXO1 indicated that BEZ235-induced cell death occurred predominantly via an apoptotic pathway. Heregulin-induced HIF1α synthesis was also significantly decreased. Oncoprint data (cBioPortal) representing PAM50 Her2 enriched tumors (TCGA, Nature 2012) and Her2-positive breast tumors (TCGA, cell 2015) showed 91.4% genetic alterations and 79.2% genetic alterations in a set of four genes comprised of PIK3CA, ERBB2, VEGFA and HIF1alpha. The co-occurrence of HIF1alpha with VEGFA in PAM50 Her2 enriched tumors (TCGA, Nature 2012) and the co-occurrence of HIF1alpha

  14. Reduction of hypoxia-induced transcription through the repression of hypoxia-inducible factor-1alpha/aryl hydrocarbon receptor nuclear translocator DNA binding by the 90-kDa heat-shock protein inhibitor radicicol.

    PubMed

    Hur, Eunseon; Kim, Hong-Hee; Choi, Su Mi; Kim, Jin Hee; Yim, Sujin; Kwon, Ho Jeong; Choi, Youngyeon; Kim, Dae Kyong; Lee, Mi-Ock; Park, Hyunsung

    2002-11-01

    Under low oxygen tension, cells increase the transcription of specific genes involved in angiogenesis, erythropoiesis, and glycolysis. Hypoxia-induced gene expression depends primarily on stabilization of the alpha subunit of hypoxia-inducible factor-1 (HIF-1alpha), which acts as a heterodimeric trans-activator with the nuclear protein known as the aryl hydrocarbon receptor nuclear translocator (Arnt). The resulting heterodimer (HIF-1alpha/Arnt) interacts specifically with the hypoxia-responsive element (HRE), thereby increasing transcription of the genes under HRE control. Our results indicate that the 90-kDa heat-shock protein (Hsp90) inhibitor radicicol reduces the hypoxia-induced expression of both endogenous vascular endothelial growth factor (VEGF) and HRE-driven reporter plasmids. Radicicol treatment (0.5 microg/ml) does not significantly change the stability of the HIF-1alpha protein and does not inhibit the nuclear localization of HIF-1alpha. However, this dose of radicicol significantly reduces HRE binding by the HIF-1alpha/Arnt heterodimer. Our results, the first to show that radicicol specifically inhibits the interaction between the HIF-1alpha/Arnt heterodimer and HRE, suggest that Hsp90 modulates the conformation of the HIF-1alpha/Arnt heterodimer, making it suitable for interaction with HRE. Furthermore, we demonstrate that radicicol reduces hypoxia-induced VEGF expression to decrease hypoxia-induced angiogenesis.

  15. Andrographolide down-regulates hypoxia-inducible factor-1{alpha} in human non-small cell lung cancer A549 cells

    SciTech Connect

    Lin, Hui-Hsuan; Tsai, Chia-Wen; Chou, Fen-Pi; Wang, Chau-Jong; Hsuan, Shu-Wen; Wang, Cheng-Kun; Chen, Jing-Hsien

    2011-02-01

    Andrographolide (Andro), a diterpenoid lactone isolated from a traditional herbal medicine Andrographis paniculata, is known to possess multiple pharmacological activities. In our previous study, Andro had been shown to inhibit non-small cell lung cancer (NSCLC) A549 cell migration and invasion via down-regulation of phosphatidylinositol 3-kinase (PI3K)/Akt signaling pathway. Here we demonstrated that Andro inhibited the expression of hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) in A549 cells. HIF-1{alpha} plays an important role in tumor growth, angiogenesis and lymph node metastasis of NSCLC. The Andro-induced decrease of cellular protein level of HIF-1{alpha} was correlated with a rapid ubiquitin-dependent degradation of HIF-1{alpha}, and was accompanied by increased expressions of hydroxyl-HIF-1{alpha} and prolyl hydroxylase (PHD2), and a later decrease of vascular endothelial growth factor (VEGF) upon the treatment of Andro. The Andro-inhibited VEGF expression appeared to be a consequence of HIF-1{alpha} inactivation, because its DNA binding activity was suppressed by Andro. Molecular data showed that all these effects of Andro might be mediated via TGF{beta}1/PHD2/HIF-1{alpha} pathway, as demonstrated by the transfection of TGF{beta}1 overexpression vector and PHD2 siRNA, and the usage of a pharmacological MG132 inhibitor. Furthermore, we elucidated the involvement of Andro in HIF-1{alpha} transduced VEGF expression in A549 cells and other NSCLC cell lines. In conclusion, these results highlighted the potential effects of Andro, which may be developed as a chemotherapeutic or an anti-angiogenesis agent for NSCLC in the future.

  16. Romance of the three kingdoms: RORgammat allies with HIF1alpha against FoxP3 in regulating T cell metabolism and differentiation.

    PubMed

    Tsun, Andy; Chen, Zuojia; Li, Bin

    2011-10-01

    Regulatory T (Treg) cells play an essential role in immune homeostasis by controlling the function of various immune effector cells, including RAR-related orphan receptor gammat(+) (RORγt(+)) T helper 17 (Th17) cells. Foekhead box P(3) (FoxP(3)) is the master regulator of Treg cell function, while RORγt is the key transcription factor for the induction of the interleukin (IL)-17 family of cytokines during Th17 cell differentiation. FoxP3 can directly interact with and negatively regulate the function of RORγt, to determine the balance between induced Treg (iTreg) and Th17 cell polarization. Two recent independent studies from the Pan and Chi Labs have shown how hypoxia-inducible factor 1 alpha (HIF1α) is able to tip the balance of T cell differentiation toward the Th17 lineage by responding to the local changes in metabolic shift or an increase in proinflammatory mediators in the microenvironment. By allying with HIF1α, RORγt wins the fight against FoxP3 and Treg cell commitment.

  17. Romance of the three kingdoms: RORgammat allies with HIF1alpha against FoxP3 in regulating T cell metabolism and differentiation.

    PubMed

    Tsun, Andy; Chen, Zuojia; Li, Bin

    2011-10-01

    Regulatory T (Treg) cells play an essential role in immune homeostasis by controlling the function of various immune effector cells, including RAR-related orphan receptor gammat(+) (RORγt(+)) T helper 17 (Th17) cells. Foekhead box P(3) (FoxP(3)) is the master regulator of Treg cell function, while RORγt is the key transcription factor for the induction of the interleukin (IL)-17 family of cytokines during Th17 cell differentiation. FoxP3 can directly interact with and negatively regulate the function of RORγt, to determine the balance between induced Treg (iTreg) and Th17 cell polarization. Two recent independent studies from the Pan and Chi Labs have shown how hypoxia-inducible factor 1 alpha (HIF1α) is able to tip the balance of T cell differentiation toward the Th17 lineage by responding to the local changes in metabolic shift or an increase in proinflammatory mediators in the microenvironment. By allying with HIF1α, RORγt wins the fight against FoxP3 and Treg cell commitment. PMID:22058032

  18. Interaction of the human cytomegalovirus particle with the host cell induces hypoxia-inducible factor 1 alpha

    SciTech Connect

    McFarlane, Steven; Nicholl, Mary Jane; Sutherland, Jane S.; Preston, Chris M.

    2011-05-25

    The cellular protein hypoxia-inducible factor 1 alpha (HIF-1{alpha}) was induced after infection of human fibroblasts with human cytomegalovirus (HCMV). HCMV irradiated with ultraviolet light (uv-HCMV) also elicited the effect, demonstrating that the response was provoked by interaction of the infecting virion with the cell and that viral gene expression was not required. Although induction of HIF-1{alpha} was initiated by an early event, accumulation of the protein was not detected until 9 hours post infection, with levels increasing thereafter. Infection with uv-HCMV resulted in increased abundance of HIF-1{alpha}-specific RNA, indicating stimulation of transcription. In addition, greater phosphorylation of the protein kinase Akt was observed, and the activity of this enzyme was required for induction of HIF-1{alpha} to occur. HIF-1{alpha} controls the expression of many cellular gene products; therefore the findings reveal new ways in which interaction of the HCMV particle with the host cell may cause significant alterations to cellular physiology.

  19. HIF-1alpha response to hypoxia is functionally separated from the glucocorticoid stress response in the in vitro regenerating human skeletal muscle.

    PubMed

    Pirkmajer, Sergej; Filipovic, Dragana; Mars, Tomaz; Mis, Katarina; Grubic, Zoran

    2010-12-01

    Injury of skeletal muscle is followed by muscle regeneration in which new muscle tissue is formed from the proliferating mononuclear myoblasts, and by systemic response to stress that exposes proliferating myoblasts to increased glucocorticoid (GC) concentration. Because of its various causes, hypoxia is a frequent condition affecting skeletal muscle, and therefore both processes, which importantly determine the outcome of the injury, often proceed under hypoxic conditions. It is therefore important to identify and characterize in proliferating human myoblasts: 1) response to hypoxia which is generally organized by hypoxia-inducible factor-1α (HIF-1α); 2) response to GCs which is mediated through the isoforms of glucocorticoid receptors (GRs) and 11β-hydroxysteroid dehydrogenases (11β-HSDs), and 3) the response to GCs under the hypoxic conditions and the influence of this combination on the factors controlling myoblast proliferation. Using real-time PCR, Western blotting, and HIF-1α small-interfering RNA silencing, we demonstrated that cultured human myoblasts possess both, the HIF-1α-based response to hypoxia, and the GC response system composed of GRα and types 1 and 2 11β-HSDs. However, using combined dexamethasone and hypoxia treatments, we demonstrated that these two systems operate practically without mutual interactions. A seemingly surprising separation of the two systems that both organize response to hypoxic stress can be explained on the evolutionary basis: the phylogenetically older HIF-1α response is a protection at the cellular level, whereas the GC stress response protects the organism as a whole. This necessitates actions, like downregulation of IL-6 secretion and vascular endothelial growth factor, that might not be of direct benefit for the affected myoblasts.

  20. Correlation of Hypoxia-Inducible Factor 1{alpha} with Angiogenesis in Liver Tumors After Transcatheter Arterial Embolization in an Animal Model

    SciTech Connect

    Liang Bin; Zheng Chuansheng Feng, Gan-Sheng; Wu Hanping; Wang Yong; Zhao Hui; Qian Jun; Liang Huimin

    2010-08-15

    This study sought to determine the expression of hypoxia-inducible factor 1{alpha} (HIF-1{alpha}) and its relation to angiogenesis in liver tumors after transcatheter arterial embolization (TAE) in an animal model. A total of 20 New Zealand White rabbits were implanted with VX2 tumor in liver. TAE-treated group animals (n = 10) received TAE with polyvinyl alcohol particles. Control group animals (n = 10) received sham embolization with distilled water. Six hours or 3 days after TAE, animals were humanely killed, and tumor samples were collected. Immunohistochemical staining was performed to evaluate HIF-1{alpha} and vascular endothelial growth factor (VEGF) protein expression and microvessel density (MVD). Real-time polymerase chain reaction was performed to examine VEGF mRNA levels. The levels of HIF-1{alpha} protein were significantly higher in TAE-treated tumors than those in the control tumors (P = 0.001). HIF-1{alpha} protein was expressed in viable tumor cells that were located predominantly at the periphery of necrotic tumor regions. The levels of VEGF protein and mRNA, and mean MVD were significantly increased in TAE-treated tumors compared with the control tumors (P = 0.001, 0.000, and 0.001, respectively). HIF-1{alpha} protein level was significantly correlated with VEGF mRNA (r = 0.612, P = 0.004) and protein (r = 0.554, P = 0.011), and MVD (r = 0.683, P = 0.001). We conclude that HIF-1{alpha} is overexpressed in VX2 tumors treated with TAE as a result of intratumoral hypoxia generated by the procedure and involved in activation of the TAE-associated tumor angiogenesis. HIF-1{alpha} might represent a promising therapeutic target for antiangiogenesis in combination with TAE against liver tumors.

  1. Hypoxia in Tumor Angiogenesis and Metastasis: Evaluation of VEGF and MMP Over-expression and Down-Regulation of HIF-1alpha with RNAi in Hypoxic Tumor Cells

    NASA Astrophysics Data System (ADS)

    Shah, Shruti

    Background: As tumor mass grows beyond a few millimeters in diameter, the angiogenic "switch" is turned on leading to recruitment of blood vessels from surrounding artery and veins. However, the tumor mass is poorly perfused and there are pockets of hypoxia or lower oxygen concentrations relative to normal tissue. Hypoxia-inducing factor-1a (HIF-1a), a transcription factor, is activated when the oxygen concentration is low. Upon activation of HIF-1a, a number of other genes also turn on that allows the tumor to become more aggressive and resistant to therapy. Purpose: The main objectives of this study were to evaluate the effect of hypoxia-induced HIF-1a followed by over-expression of angiogenic and metastatic markers in tumor cells and down-regulation of HIF-1a using nanoparticle-delivered RNA interference therapy. Methods: Human ovarian (SKOV3) and breast (MDA-MB-231) adenocarcinoma cells were incubated under normoxic and hypoxic conditions. Following hypoxia treatment of the cells, HIF-1α, vascular endothelial growth factor (VEGF), matrix metalloproteinase 2 (MMP-2), and MMP-9 expression was analyzed qualitatively and quantitatively. For intracellular delivery of HIF-1a gene silencing small interfering RNA (siRNA), type B gelatin nanoparticles were fabricated using the solvent displacement method and the surface was modified with poly(ethylene glycol) (PEG, Mol. wt. 2kDa). Cellular uptake and distribution of the nanoparticles was observed with Cy3-siRNA loaded, FITC-conjugated gelatin nanoparticles. Cytotoxicity of the nanoparticle formulations was evaluated in both the cell lines. siRNA was transfected in the gelatin nanoparticles under hypoxic conditions. Total cellular protein and RNA were extracted for analysis of HIF1a, VEGF, MMP-2 and MMP-9 expression. Results: MDA-MB-231 and SKOV3 cells show increased expression of HIF1a under hypoxic conditions compared to baseline levels at normoxic conditions. ELISA and western blots of VEGF, MMP-2 and MMP-9 appear to

  2. Endothelial monocyte activating polypeptide-II modulates endothelial cell responses by degrading hypoxia-inducible factor-1alpha through interaction with PSMA7, a component of the proteasome

    SciTech Connect

    Tandle, Anita T.; Calvani, Maura; Uranchimeg, Badarch; Zahavi, David; Melillo, Giovanni; Libutti, Steven K.

    2009-07-01

    The majority of human tumors are angiogenesis dependent. Understanding the specific mechanisms that contribute to angiogenesis may offer the best approach to develop therapies to inhibit angiogenesis in cancer. Endothelial monocyte activating polypeptide-II (EMAP-II) is an anti-angiogenic cytokine with potent effects on endothelial cells (ECs). It inhibits EC proliferation and cord formation, and it suppresses primary and metastatic tumor growth in-vivo. However, very little is known about the molecular mechanisms behind the anti-angiogenic activity of EMAP-II. In the present study, we explored the molecular mechanism behind the anti-angiogenic activity exerted by this protein on ECs. Our results demonstrate that EMAP-II binds to the cell surface {alpha}5{beta}1 integrin receptor. The cell surface binding of EMAP-II results in its internalization into the cytoplasmic compartment where it interacts with its cytoplasmic partner PSMA7, a component of the proteasome degradation pathway. This interaction increases hypoxia-inducible factor 1-alpha (HIF-1{alpha}) degradation under hypoxic conditions. The degradation results in the inhibition of HIF-1{alpha} mediated transcriptional activity as well as HIF-1{alpha} mediated angiogenic sprouting of ECs. HIF-1{alpha} plays a critical role in angiogenesis by activating a variety of angiogenic growth factors. Our results suggest that one of the major anti-angiogenic functions of EMAP-II is exerted through its inhibition of the HIF-1{alpha} activities.

  3. Prognostic Significance of Tumor Hypoxia Inducible Factor-1{alpha} Expression for Outcome After Radiotherapy in Oropharyngeal Cancer

    SciTech Connect

    Silva, Priyamal; Slevin, Nick J.; Sloan, Philip; Valentine, Helen; Cresswell, Jo; Ryder, David; Price, Patricia; Homer, Jarrod J.; West, Catharine

    2008-12-01

    Purpose: Head-and-neck squamous cell carcinoma (HNSCC) represents a heterogeneous group of patients in terms of subsite, treatment, and biology. Currently most management decisions are based on clinical parameters with little appreciation of patient differences in underlying tumor biology. We investigated the prognostic significance of clinicopathologic features and tumor hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) expression in a homogeneous series of patients who underwent radiotherapy. Methods and Materials: An audit identified 133 consecutive patients with histologically proven squamous cell carcinoma of the tonsil or tongue base. All patients received primary radiotherapy between 1996 and 2001. Tumor HIF-1{alpha} expression was examined in 79 patients. Results: Features associated with poor locoregional control were low Hb level (p = 0.05) and advancing T (p = 0.008), N (p = 0.03), and disease (p = 0.008) stage. HIF-1{alpha} expression was a more significant adverse prognostic factor in the tonsil (hazard ratio [HR], 23.1; 95% confidence interval [CI]. 3.04-176.7) than the tongue-base tumor (HR, 2.86; 95% CI, 1.14-7.19) group (p = 0.03, test for interaction). High tumor HIF-1{alpha} expression was associated with low blood Hb levels (p = 0.03). In a multivariate analysis HIF-1{alpha} expression retained prognostic significance for locoregional control (HR, 7.10; 95% CI, 3.07-16.43) and cancer-specific survival (HR, 9.19; 95% CI, 3.90-21.6). Conclusions: There are significant differences in radiation therapy outcome within a homogeneous subsite of the oropharynx related to molecular marker expression. The work highlights the importance of studying homogeneous groups of patients in HNSCC, and the complex interrelationships between tumor biology and clinicopathologic factors. The establishment of tumor-type specific markers would represent a major advance in this area.

  4. Immunohistochemical detection of osteopontin in advanced head-and-neck cancer: Prognostic role and correlation with oxygen electrode measurements, hypoxia-inducible-factor-1{alpha}-related markers, and hemoglobin levels

    SciTech Connect

    Bache, Matthias; Reddemann, Rolf; Said, Harun M.; Holzhausen, Hans-Juergen; Taubert, Helge; Becker, Axel; Kuhnt, Thomas; Haensgen, Gabriele; Dunst, Juergen; Vordermark, Dirk . E-mail: vordermark_d@klinik.uni-wuerzburg.de

    2006-12-01

    Purpose: The tumor-associated glycoprotein osteopontin (OPN) is discussed as a plasma marker of tumor hypoxia. However, the association of immunohistochemical OPN expression in tumor sections with tumor oxygenation parameters (HF5, median pO{sub 2}), the hypoxia-related markers hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) and carbonic anhydrase IX (CAIX), or hemoglobin and systemic vascular endothelial growth factor (VEGF) levels has not been investigated. Methods and Materials: Tumor tissue sections of 34 patients with advanced head-and-neck cancer treated with radiotherapy were assessed by immunochemistry for the expression of OPN, HIF-1{alpha}, and CA IX. Relationship of OPN expression with tumor oxygenation parameters (HF5, median pO{sub 2}), HIF-1{alpha} and CA IX expression, hemoglobin and serum VEGF level, and clinical parameters was studied. Results: Bivariate analysis showed a significant correlation of positive OPN staining with low hemoglobin level (p = 0.02), high HIF-1{alpha} expression (p = 0.02), and high serum vascular endothelial growth factor level (p = 0.02) for advanced head-and-neck cancer. Furthermore, considering the 31 Stage IV patients, the median pO{sub 2} correlated significantly with the OPN expression (p = 0.02). OPN expression alone had only a small impact on prognosis. However, in a univariate Cox proportional hazard regression model, the expression of either OPN or HIF-1{alpha} or CA IX was associated with a 4.1-fold increased risk of death (p = 0.02) compared with negativity of all three markers. Conclusion: Osteopontin expression detected immunohistochemically is associated with oxygenation parameters in advanced head-and-neck cancer. When the results of OPN, HIF-1{alpha}, and CA IX immunohistochemistry are combined into a hypoxic profile, a strong and statistically significant impact on overall survival is found.

  5. p300 relieves p53-evoked transcriptional repression of hypoxia-inducible factor-1 (HIF-1).

    PubMed

    Schmid, Tobias; Zhou, Jie; Köhl, Roman; Brüne, Bernhard

    2004-05-15

    HIF-1 (hypoxia-inducible factor-1), a heterodimeric transcription factor comprising HIF-1alpha and HIF-1beta subunits, serves as a key regulator of metabolic adaptation to hypoxia. HIF-1 activity largely increases during hypoxia by attenuating pVHL (von Hippel-Lindau protein)-dependent ubiquitination and subsequent 26 S-proteasomal degradation of HIF-1alpha. Besides HIF-1, the transcription factor and tumour suppressor p53 accumulates and is activated under conditions of prolonged/severe hypoxia. Recently, the interaction between p53 and HIF-1alpha was reported to evoke HIF-1alpha degradation. Destruction of HIF-1alpha by p53 was corroborated in the present study by using pVHL-deficient RCC4 (renal carcinoma) cells, supporting the notion of a pVHL-independent degradation process. In addition, low p53 expression repressed HIF-1 transactivation without affecting HIF-1alpha protein amount. Establishing that p53-evoked inhibition of HIF-1 reporter activity was relieved upon co-transfection of p300 suggested competition between p53 and HIF-1 for limiting amounts of the shared co-activator p300. This assumption was confirmed by showing competitive binding of in vitro transcription/translation-generated p53 and HIF-1alpha to the CH1 domain of p300 in vitro. We conclude that low p53 expression attenuates HIF-1 transactivation by competing for p300, whereas high p53 expression destroys the HIF-1alpha protein and thereby eliminates HIF-1 reporter activity. Thus once p53 becomes activated under conditions of severe hypoxia/anoxia, it contributes to terminating HIF-1 responses.

  6. Hyperinsulinemia may boost both hematocrit and iron absorption by up-regulating activity of hypoxia-inducible factor-1alpha.

    PubMed

    McCarty, M F

    2003-01-01

    There is growing evidence that increases in both hematocrit and body iron stores are components of the insulin resistance syndrome. The ability of insulin and of IGF-I - whose effective activity is increased in the context of insulin resistance - to boost activity of the transcription factor hypoxia-inducible factor-1alpha (HIF-1alpha), may be at least partially responsible for this association. HIF-1alpha, which functions physiologically as a detector of both hypoxia and iron-deficiency, promotes synthesis of erythropoietin, and may also mediate the up-regulatory impact of hypoxia on intestinal iron absorption. Insulin/IGF-I may also influence erythropoiesis more directly, as they are growth factors for developing reticulocytes. Conversely, the activation of HIF-1alpha associated with iron deficiency may be responsible for the increased glucose tolerance noted in iron-deficient animals; HIF-1alpha promotes efficient glucose uptake and glycolysis - a sensible adaptation to hypoxia - by inducing increased synthesis of glucose transporters and glycolytic enzymes. Recent reports that phlebotomy can increase the efficiency of muscle glucose uptake in lean healthy omnivores are intriguing and require further confirmation. Whether increased iron stores contribute to the elevated vascular risk associated with insulin resistance is doubtful, inasmuch as most prospective studies fail to correlate serum ferritin or transferrin saturation with subsequent vascular events. However, current data are reasonably consistent with the possibility that moderately elevated iron stores are associated with increased overall risk for cancer - and for colorectal cancer in particular; free iron may play a catalytic role in 'spontaneous' mutagenesis. Thus, iron excess may mediate at least some of the increased cancer risk associated with insulin resistance and heme-rich diets. People who are insulin resistant can minimize any health risk associated with iron overload by avoiding heme

  7. Hypoxia-inducible factor-1 {alpha} expression predicts superior survival in patients with diffuse large B-cell lymphoma treated with R-CHOP.

    PubMed

    Evens, Andrew M; Sehn, Laurie H; Farinha, Pedro; Nelson, Beverly P; Raji, Adekunle; Lu, Yi; Brakman, Adam; Parimi, Vamsi; Winter, Jane N; Schumacker, Paul T; Gascoyne, Randy D; Gordon, Leo I

    2010-02-20

    PURPOSE Hypoxia-inducible factor (HIF) controls the expression of genes in response to hypoxia, as well as a wide range of other cellular processes. We previously showed constitutive stabilization of HIF-1alpha in the majority of patients with diffuse large B-cell lymphoma (DLBCL). To our knowledge, the prognostic significance of HIF in lymphoma has never been investigated. PATIENTS AND METHODS We studied the immunohistochemical protein expression of HIF-1alpha on tissue microarrays from 153 patients with DLBCL treated in sequential cohorts with cyclophosphamide, doxorubicin, oncovin, and prednisone (CHOP) or rituximab-CHOP (R-CHOP) from 1999 to 2002. Results were correlated with patient outcome. Results Median follow-up for all patients was 80 months. Among all patients, HIF-1alpha was expressed in 62% of germinal center and 59% of non-germinal center patients. With HIF-1alpha analyzed as a dependent variable, there were no survival differences in CHOP-treated patients. In the R-CHOP group, however, HIF-1alpha protein expression correlated with significantly improved progression-free survival (PFS) and overall survival (OS). Five-year PFS for HIF-1alpha-positive patients was 71% v 43% for HIF-1alpha-negative patients (P = .0187), whereas 5-year OS was 75% and 54%, respectively (P = .025). In multivariate analysis with International Prognostic Index criteria, HIF-1alpha remained a significant predictor for PFS (P = .026) and OS (P = .043). Compared with other biomarkers, HIF-1alpha correlated only with BCL6 (P = .004). In terms of gene expression, we found several common gene associations of HIF-1alpha and the stromal-1 signature with genes predominantly involved in regulation of the extracellular matrix (eg, BGN, COL1A2, COL5A1, and PLOD2). CONCLUSION The expression of HIF-1alpha protein is an important independent favorable prognostic factor for survival in patients with DLBCL treated with R-CHOP. PMID:20048181

  8. Activation of the hypoxia-inducible factor-1 in overloaded temporomandibular joint, and induction of osteoclastogenesis.

    PubMed

    Shirakura, Maya; Tanimoto, Keiji; Eguchi, Hidetaka; Miyauchi, Mutsumi; Nakamura, Hideaki; Hiyama, Keiko; Tanimoto, Kotaro; Tanaka, Eiji; Takata, Takashi; Tanne, Kazuo

    2010-03-19

    Vascular endothelial growth factor (Vegf) was previously shown to be expressed specifically in the condylar cartilage of temporomandibular joint-osteoarthritis (TMJ-OA) model rats. Here we demonstrate for the first time that hypoxia-inducible factor-1alpha (Hif-1alpha) is activated in mature chondrocytes of temporomandibular joint-osteoarthritis (TMJ-OA) model rat by mechanical overload, and that activated Hif-1 in chondrocytes can induce osteoclastogenesis via repression of osteoprotegerin (Opg) expression. In rat TMJs, degeneration of the condylar cartilage became prominent in proportion to the duration of overloading. Hif-1alpha expression was observed specifically in mature and hypertrophic chondrocytes, and Hif-1alpha-positivity, level of Vegf expression, and tartrate-resistant acid phosphatase (TRAP)-positive cell numbers all increased in the same manner. When ATDC5 cells induced differentiation by insulin were cultured under hypoxia, Hif-1alpha induction was observed in mature stage, but not in immature stage. Inductions of Hif-1-target genes showed a similar expression pattern. In addition, expression of Opg decreased in hypoxia, and Hif-1alpha played a role, in part, in its regulation. PMID:20171183

  9. Signal transduction in hypoxic cells: inducible nuclear translocation and recruitment of the CBP/p300 coactivator by the hypoxia-inducible factor-1alpha.

    PubMed

    Kallio, P J; Okamoto, K; O'Brien, S; Carrero, P; Makino, Y; Tanaka, H; Poellinger, L

    1998-11-16

    In response to decreased cellular oxygen concentrations the basic helix-loop-helix (bHLH)/PAS (Per, Arnt, Sim) hypoxia-inducible transcription factor, HIF-1alpha, mediates activation of networks of target genes involved in angiogenesis, erythropoiesis and glycolysis. Here we demonstrate that the mechanism of activation of HIF-1alpha is a multi-step process which includes hypoxia-dependent nuclear import and activation (derepression) of the transactivation domain, resulting in recruitment of the CREB-binding protein (CBP)/p300 coactivator. Inducible nuclear accumulation was shown to be dependent on a nuclear localization signal (NLS) within the C-terminal end of HIF-1alpha which also harbors the hypoxia-inducible transactivation domain. Nuclear import of HIF-1alpha was inhibited by either deletion or a single amino acid substitution within the NLS sequence motif and, within the context of the full-length protein, these mutations also resulted in inhibition of the transactivation activity of HIF-1alpha and recruitment of CBP. However, nuclear localization per se was not sufficient for transcriptional activation, since fusion of HIF-1alpha to the heterologous GAL4 DNA-binding domain generated a protein which showed constitutive nuclear localization but required hypoxic stimuli for function as a CBP-dependent transcription factor. Thus, hypoxia-inducible nuclear import and transactivation by recruitment of CBP can be functionally separated from one another and play critical roles in signal transduction by HIF-1alpha.

  10. Protein arginine methyltransferase 5 is an essential component of the hypoxia-inducible factor 1 signaling pathway

    SciTech Connect

    Lim, Ji-Hong; Choi, Yong-Joon; Cho, Chung-Hyun

    2012-02-10

    Highlights: Black-Right-Pointing-Pointer HIF-1{alpha} is expressed PRMT5-dependently in hypoxic cancer cells. Black-Right-Pointing-Pointer The HIF-1 regulation of hypoxia-induced genes is attenuated in PRMT5-knocked-down cells. Black-Right-Pointing-Pointer The de novo synthesis of HIF-1{alpha} depends on PRMT5. Black-Right-Pointing-Pointer PRMT5 is involved in the HIF-1{alpha} translation initiated by 5 Prime UTR of HIF-1{alpha} mRNA. -- Abstract: Protein arginine methyltransferase 5 (PRMT5) is an enzyme that transfers one or two methyl groups to the arginine residues of histones or non-histone proteins, and that plays critical roles in cellular processes as diverse as receptor signaling and gene expression. Furthermore, PRMT5 is highly expressed in tumors, where it may be associated with tumor growth. Although much research has been conducted on PRMT5, little is known regarding its role in adaption to hypoxia. As hypoxia-inducible factor 1 (HIF-1) is a key player in hypoxic response, we examined the possible involvement of PRMT5 in the HIF-1 signaling pathway. Of the siRNAs targeting PRMT1-8, only PRMT5 siRNA attenuated the hypoxic induction of HIF-1{alpha} in A549 cells, and this result was reproducible in all three cancer cell lines examined. PRMT5 knock-down also repressed the promoter activities and the transcript levels of HIF-1-governed genes. Mechanistically, de novo synthesis of HIF-1{alpha} protein was reduced in PRMT5-knocked-down A549 cells, and this was rescued by PRMT5 restoration. In contrast, HIF-1{alpha} transcription, RNA processing, and protein stability were unaffected by PRMT5 knock-down. Furthermore, PRMT5 was found to be essential for the HIF-1{alpha} translation initiated by the 5 Prime UTR of HIF-1{alpha} mRNA. Given our results and previous reports, we believe that PRMT5 probably promotes tumor growth by stimulating cell proliferation and by participating in the construction of a tumor-favorable microenvironment via HIF-1 activation.

  11. Heat acclimation increases hypoxia-inducible factor 1alpha and erythropoietin receptor expression: implication for neuroprotection after closed head injury in mice.

    PubMed

    Shein, Na'ama A; Horowitz, Michal; Alexandrovich, Alexander G; Tsenter, Jeanna; Shohami, Esther

    2005-11-01

    Experimental evidence indicates that long-term exposure to moderately high ambient temperature (heat acclimation, HA) mediates cross-tolerance to various types of subsequently applied stress. The transcriptional activator hypoxia-inducible factor 1 (HIF-1) has been implicated in playing a critical role in HA. It also regulates the expression of Erythropoietin (Epo), whose neuroprotective effects have been shown in a variety of brain injuries. The aim of the present study was to examine whether HA exerts a beneficial effect on the outcome of closed head injury (CHI) in mice and to explore the possible involvement of HIF-1 and Epo in this process. Heat acclimated mice and matched normothermic controls were subjected to CHI or sham surgery. Postinjury motor and cognitive parameters of acclimated mice were compared with those of controls. Mice were killed at various time points after injury or sham surgery and brain levels of HIF-1alpha, the inducible subunit of HIF-1, Epo, and the specific erythropoietin receptor (EpoR) were analyzed by Western immunoblotting. Motor and cognitive functions of acclimated mice were significantly better than those of controls. Heat acclimation was found to induce a significant increase in expression of nuclear HIF-1alpha and EpoR. The EpoR/Epo ratio was also significantly higher in acclimated mice as compared with controls. Nuclear HIF-1alpha and EpoR were higher in the acclimated group at 4 h after injury as well. The improved outcome of acclimated mice taken together with the basal and postinjury upregulation of the examined proteins suggests the involvement of this pathway in HA-induced neuroprotection.

  12. A novel thiol compound, N-acetylcysteine amide, attenuates allergic airway disease by regulating activation of NF-kappaB and hypoxia-inducible factor-1alpha.

    PubMed

    Lee, Kyung Sun; Kim, So Ri; Park, Hee Sun; Park, Seoung Ju; Min, Kyung Hoon; Lee, Ka Young; Choe, Yeong Hun; Hong, Sang Hyun; Han, Hyo Jin; Lee, Young Rae; Kim, Jong Suk; Atlas, Daphne; Lee, Yong Chul

    2007-12-31

    Reactive oxygen species (ROS) play an important role in the pathogenesis of airway inflammation and hyperresponsiveness. Recent studies have demonstrated that antioxidants are able to reduce airway inflammation and hyperreactivity in animal models of allergic airway disease. A newly developed antioxidant, small molecular weight thiol compound, N-acetylcysteine amide (AD4) has been shown to increase cellular levels of glutathione and to attenuate oxidative stress related disorders such as Alzheimer's disease, Parkinson's disease, and multiple sclerosis. However, the effects of AD4 on allergic airway disease such as asthma are unknown. We used ovalbumin (OVA)-inhaled mice to evaluate the role of AD4 in allergic airway disease. In this study with OVA-inhaled mice, the increased ROS generation, the increased levels of Th2 cytokines and VEGF, the increased vascular permeability, the increased mucus production, and the increased airway resistance in the lungs were significantly reduced by the administration of AD4. We also found that the administration of AD4 decreased the increases of the NF-kappaB and hypoxia-inducible factor-1alpha (HIF-1alpha) levels in nuclear protein extracts of lung tissues after OVA inhalation. These results suggest that AD4 attenuates airway inflammation and hyperresponsiveness by regulating activation of NF-kappaB and HIF-1alpha as well as reducing ROS generation in allergic airway disease. PMID:18160846

  13. A novel thiol compound, N-acetylcysteine amide, attenuates allergic airway disease by regulating activation of NF-kappaB and hypoxia-inducible factor-1alpha.

    PubMed

    Lee, Kyung Sun; Kim, So Ri; Park, Hee Sun; Park, Seoung Ju; Min, Kyung Hoon; Lee, Ka Young; Choe, Yeong Hun; Hong, Sang Hyun; Han, Hyo Jin; Lee, Young Rae; Kim, Jong Suk; Atlas, Daphne; Lee, Yong Chul

    2007-12-31

    Reactive oxygen species (ROS) play an important role in the pathogenesis of airway inflammation and hyperresponsiveness. Recent studies have demonstrated that antioxidants are able to reduce airway inflammation and hyperreactivity in animal models of allergic airway disease. A newly developed antioxidant, small molecular weight thiol compound, N-acetylcysteine amide (AD4) has been shown to increase cellular levels of glutathione and to attenuate oxidative stress related disorders such as Alzheimer's disease, Parkinson's disease, and multiple sclerosis. However, the effects of AD4 on allergic airway disease such as asthma are unknown. We used ovalbumin (OVA)-inhaled mice to evaluate the role of AD4 in allergic airway disease. In this study with OVA-inhaled mice, the increased ROS generation, the increased levels of Th2 cytokines and VEGF, the increased vascular permeability, the increased mucus production, and the increased airway resistance in the lungs were significantly reduced by the administration of AD4. We also found that the administration of AD4 decreased the increases of the NF-kappaB and hypoxia-inducible factor-1alpha (HIF-1alpha) levels in nuclear protein extracts of lung tissues after OVA inhalation. These results suggest that AD4 attenuates airway inflammation and hyperresponsiveness by regulating activation of NF-kappaB and HIF-1alpha as well as reducing ROS generation in allergic airway disease.

  14. Role of hypoxia-inducible transcription factors 1alpha and 2alpha in the regulation of plasminogen activator inhibitor-1 expression in a human trophoblast cell line.

    PubMed

    Meade, E S; Ma, Y Y; Guller, S

    2007-10-01

    The plasminogen activator inhibitors (PAIs) play critical roles in regulating hemostatic and invasive functions of trophoblasts through suppression of plasmin-dependent fibrinolysis and extracellular matrix degradation. The expression of PAI-1 is increased under hypoxic conditions, although the mechanism remains incompletely understood. In the current study we used HTR-8/SVneo cells, a first trimester extravillous trophoblast cell line, and siRNA technology to examine the role of hypoxia-inducible transcription factors (HIFs)-1alpha and -2alpha in the regulation of PAI-1 expression. Using serum-containing and serum-free media culture media it was initially noted that levels of PAI-1, but not PAI-2 protein, were markedly induced by hypoxic (2-3% oxygen) treatment. Under hypoxic conditions, Western blotting revealed that the presence of siRNAs to HIF-1alpha and HIF-2alpha suppressed expression of their respective proteins, whereas treatment with non-targeting and cyclophilin B siRNAs did not. Importantly, incubation with siRNA to HIF-1alpha or HIF-2alpha alone reduced PAI-1 protein levels to a similar extent, with the combined treatment inducing a more profound effect. The presence of HIF siRNAs reduced levels of PAI-1 mRNA as measured by quantitative real-time PCR, indicating that HIF-1alpha and HIF-2 alpha regulate PAI-1 expression at a transcriptional level. These results indicate that both HIF-1alpha and HIF-2alpha play important and similar roles in hypoxia-mediated stimulation of PAI-1 expression in HTR-8/SVneo cells. Our findings provide insight into the physiological regulation of trophoblast PAI-1 expression in early pregnancy when placental oxygen levels are low, as well as a mechanism for over-expression of placental PAI-1 noted in pregnancies with preeclampsia.

  15. Hypoxia-inducible factor 1 mediates hypoxia-induced cardiomyocyte lipid accumulation by reducing the DNA binding activity of peroxisome proliferator-activated receptor {alpha}/retinoid X receptor

    SciTech Connect

    Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.; Akita, Geoffrey Y.; Cheng, Seng H.; Gregory, Richard J.; Jiang Canwen

    2007-12-21

    In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferase I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.

  16. Role of hypoxia-inducible factor 1{alpha} in modulating cobalt-induced lung inflammation.

    PubMed

    Saini, Yogesh; Kim, Kyung Y; Lewandowski, Ryan; Bramble, Lori A; Harkema, Jack R; Lapres, John J

    2010-02-01

    Hypoxia plays an important role in development, cellular homeostasis, and pathological conditions, such as cancer and stroke. There is also growing evidence that hypoxia is an important modulator of the inflammatory process. Hypoxia-inducible factors (HIFs) are a family of proteins that regulate the cellular response to oxygen deficit, and loss of HIFs impairs inflammatory cell function. There is little known, however, about the role of epithelial-derived HIF signaling in modulating inflammation. Cobalt is capable of eliciting an allergic response and promoting HIF signaling. To characterize the inflammatory function of epithelial-derived HIF in response to inhaled cobalt, a conditional lung-specific HIF1alpha, the most ubiquitously expressed HIF, deletion mouse, was created. Control mice showed classic signs of metal-induced injury following cobalt exposure, including fibrosis and neutrophil infiltration. In contrast, HIF1alpha-deficient mice displayed a Th2 response that resembled asthma, including increased eosinophilic infiltration, mucus cell metaplasia, and chitinase-like protein expression. The results suggest that epithelial-derived HIF signaling has a critical role in establishing a tissue's inflammatory response, and compromised HIF1alpha signaling biases the tissue towards a Th2-mediated reaction. PMID:19915160

  17. Role of hypoxia-inducible factor-{alpha} in hepatitis-B-virus X protein-mediated MDR1 activation

    SciTech Connect

    Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook . E-mail: kwkang@chosun.ac.kr

    2007-06-01

    The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) and induced the nuclear translocation of C/EBP{beta}. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1{alpha} siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1{alpha} activation, and suggest HIF-1{alpha} for the therapeutic target of HBV-mediated chemoresistance.

  18. Terpenoid tetrahydroisoquinoline alkaloids emetine, klugine, and isocephaeline inhibit the activation of hypoxia-inducible factor-1 in breast tumor cells.

    PubMed

    Zhou, Yu-Dong; Kim, Yong-Pil; Mohammed, Kaleem Asjad; Jones, Deborah K; Muhammad, Ilias; Dunbar, D Chuck; Nagle, Dale G

    2005-06-01

    Klugine (1), isocephaeline (2), and emetine (4) inhibited hypoxia-inducible factor-1 (HIF-1) activation by hypoxia in T47D breast tumor cells (IC(50) values 0.2, 1.1, and 0.11 muM, respectively). Compounds 1, 2, and 4 inhibited both hypoxia- and iron chelator-induced HIF-1 activation by blocking HIF-1alpha protein accumulation. PMID:15974627

  19. HIF1-Alpha Expression Predicts Survival of Patients with Squamous Cell Carcinoma of the Oral Cavity

    PubMed Central

    dos Santos, Marcelo; Mercante, Ana Maria da Cunha; Louro, Iúri Drumond; Gonçalves, Antônio José; de Carvalho, Marcos Brasilino; da Silva, Eloiza Helena Tajara; da Silva, Adriana Madeira Álvares

    2012-01-01

    Background Oral squamous cell carcinoma is an important cause of death and morbidity wordwide and effective prognostic markers are still to be discovered. HIF1α protein is associated with hypoxia response and neovascularization, essential conditions for solid tumors survival. The relationship between HIF1α expression, tumor progression and treatment response in head and neck cancer is still poorly understood. Patients and Methods In this study, we investigated HIF1α expression by immunohistochemistry in tissue microarrays and its relationship with clinical findings, histopathological results and survival of 66 patients with squamous cell carcinoma of the lower mouth. Results Our results demonstrated that high HIF1α expression is associated with local disease-free survival, independently from the choice of treatment. Furthermore, high expression of HIF1α in patients treated with postoperative radiotherapy was associated with survival, therefore being a novel prognostic marker in squamous cell carcinoma of the mouth. Additionally, our results showed that MVD was associated with HIF1α expression and local disease relapse. Conclusion These findings suggest that HIF1α expression can be used as a prognostic marker and predictor of postoperative radiotherapy response, helping the oncologist choose the best treatment for each patient. PMID:23028863

  20. The novel hypoxic cytotoxin, TX-2098 has antitumor effect in pancreatic cancer; possible mechanism through inhibiting VEGF and hypoxia inducible factor-1{alpha} targeted gene expression

    SciTech Connect

    Miyake, Kotaro; Nishioka, Masanori; Imura, Satoru; Batmunkh, Erdenebulgan; Uto, Yoshihiro; Nagasawa, Hideko; Hori, Hitoshi; Shimada, Mitsuo

    2012-08-01

    Tumor hypoxia has been considered to be a potential therapeutic target, because hypoxia is a common feature of solid tumors and is associated with their malignant phenotype. In the present study, we investigated the antitumor effect of a novel hypoxic cytotoxin, 3-[2-hydroxyethyl(methyl)amino]-2-quinoxalinecarbonitrile 1,4-dioxide (TX-2098) in inhibiting the expression of hypoxia inducible factor-1{alpha} (HIF-1{alpha}), and consequently vascular endothelial cell growth factor (VEGF) expression in pancreatic cancer. The antitumor effects of TX-2098 under hypoxia were tested against various human pancreatic cancer cell lines using WST-8 assay. VEGF protein induced pancreatic cancer was determined on cell-free supernatant by ELISA. Moreover, nude mice bearing subcutaneously (s.c.) or orthotopically implanted human SUIT-2 were treated with TX-2098. Tumor volume, survival and expression of HIF-1 and associated molecules were evaluated in treatment versus control groups. In vitro, TX-2098 inhibited the proliferation of various pancreatic cancer cell lines. In s.c model, tumors from nude mice injected with pancreatic cancer cells and treated with TX-2098 showed significant reductions in volume (P < 0.01 versus control). Quantitative real-time reverse transcription-PCR analysis revealed that TX-2098 significantly inhibited mRNA expression of the HIF-1 associated molecules, VEGF, glucose transporter 1 and Aldolase A (P < 0.01 versus control). These treatments also prolong the survival in orthotopic models. These results suggest that the effect of TX-2098 in pancreatic cancer might be correlated with the expression of VEGF and HIF-1 targeted molecules. -- Highlights: Black-Right-Pointing-Pointer We designed and synthesized novel hypoxic cytoxin, TX-2098. Black-Right-Pointing-Pointer TX-2098 inhibited the proliferation of human pancreatic cancer cells than TPZ. Black-Right-Pointing-Pointer TX-2098 reduced VEGF protein level than TPZ. Black-Right-Pointing-Pointer TX-2098

  1. Dexamethasone impairs hypoxia-inducible factor-1 function

    SciTech Connect

    Wagner, A.E.; Huck, G.; Stiehl, D.P.; Jelkmann, W.; Hellwig-Buergel, T.

    2008-07-25

    Hypoxia-inducible factor-1 (HIF-1) is a heterodimeric transcription-factor composed of {alpha}- and {beta}-subunits. HIF-1 is not only necessary for the cellular adaptation to hypoxia, but it is also involved in inflammatory processes and wound healing. Glucocorticoids (GC) are therapeutically used to suppress inflammatory responses. Herein, we investigated whether GC modulate HIF-1 function using GC receptor (GR) possessing (HepG2) and GR deficient (Hep3B) human hepatoma cell cultures as model systems. Dexamethasone (DEX) treatment increased HIF-1{alpha} levels in the cytosol of HepG2 cells, while nuclear HIF-1{alpha} levels and HIF-1 DNA-binding was reduced. In addition, DEX dose-dependently lowered the hypoxia-induced luciferase activity in a reporter gene system. DEX suppressed the hypoxic stimulation of the expression of the HIF-1 target gene VEGF (vascular endothelial growth factor) in HepG2 cultures. DEX did not reduce hypoxically induced luciferase activity in HRB5 cells, a Hep3B derivative lacking GR. Transient expression of the GR in HRB5 cells restored the susceptibility to DEX. Our study discloses the inhibitory action of GC on HIF-1 dependent gene expression, which may be important with respect to the impaired wound healing in DEX-treated patients.

  2. Vitexin reduces hypoxia-ischemia neonatal brain injury by the inhibition of HIF-1alpha in a rat pup model.

    PubMed

    Min, Jia-Wei; Hu, Jiang-Jian; He, Miao; Sanchez, Russell M; Huang, Wen-Xian; Liu, Yu-Qiang; Bsoul, Najeeb Bassam; Han, Song; Yin, Jun; Liu, Wan-Hong; He, Xiao-Hua; Peng, Bi-Wen

    2015-12-01

    Previous studies have demonstrated that the early suppression of HIF-1α after hypoxia-ischemia (HI) injury provides neuroprotection. Vitexin (5, 7, 4-trihydroxyflavone-8-glucoside), an HIF-1α inhibitor, is a c-glycosylated flavone that has been identified in medicinal plants. Therefore, we hypothesized that treatment with vitexin would protect against HI brain injury. Newborn rat pups were subjected to unilateral carotid artery ligation followed by 2.5 h of hypoxia (8% O2 at 37 °C). Vitexin (30, 45 or 60 mg/kg) was administered intraperitoneally at 5 min or 3 h after HI. Vitexin, administered 5 min after HI, was neuroprotective as seen by decreased infarct volume evaluated at 48 h post-HI. This neuroprotection was removed when vitexin was administered 3 h after HI. Neuronal cell death, blood-brain barrier (BBB) integrity, brain edema, HIF-1α and VEGF protein levels were evaluated using a combination of Nissl staining, IgG staining, brain water content, immunohistochemistry and Western blot at 24 and 48 h after HI. The long-term effects of vitexin were evaluated by brain atrophy measurement, Nissl staining and neurobehavioral tests. Vitexin (45 mg/kg) ameliorated brain edema, BBB disruption and neuronal cell death; Upregulation of HIF-1α by dimethyloxalylglycine (DMOG) increased the BBB permeability and brain edema compared to HI alone. Vitexin attenuated the increase in HIF-1α and VEGF. Vitexin also had long-term effects of protecting against the loss of ipsilateral brain and improveing neurobehavioral outcomes. In conclusion, our data indicate early HIF-1α inhibition with vitexin provides both acute and long-term neuroprotection in the developing brain after neonatal HI injury. PMID:26187393

  3. Hypoxia reduces constitutive and TNF-{alpha}-induced expression of monocyte chemoattractant protein-1 in human proximal renal tubular cells

    SciTech Connect

    Li Xuan; Kimura, Hideki . E-mail: hkimura@fmsrsa.fukui-med.ac.jp; Hirota, Kiichi; Sugimoto, Hidehiro; Yoshida, Haruyoshi

    2005-10-07

    Chronic hypoxia has been reported to be associated with macrophage infiltration in progressive forms of kidney disease. Here, we investigated the regulatory effects of hypoxia on constitutive and TNF-{alpha}-stimulated expression of monocyte chemoattractant protein-1 (MCP-1) in cultured human proximal renal tubular cells (HPTECs). Hypoxia reduced constitutive MCP-1 expression at the mRNA and protein levels in a time-dependent fashion for up to 48 h. Hypoxia also inhibited MCP-1 up-regulation by TNF-{alpha}. Treatment with actinomycin D showed that hypoxic down-regulation of MCP-1 expression resulted mainly from a decrease in the transcription but not the mRNA stability. Immunoblot and immunofluorescence analyses revealed that treatment with hypoxia or an iron chelator, desferrioxamine, induced nuclear accumulation of hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) in HPTECs. Desferrioxamine mimicked hypoxia in the reduction of MCP-1 expression. However, overexpression of a dominant negative form of HIF-1{alpha} did not abolish the hypoxia-induced reduction of MCP-1 expression in HPTECs. These results suggest that hypoxia is an important negative regulator of monocyte chemotaxis to the renal inflamed interstitium, by reducing MCP-1 expression partly via hypoxia-activated signals other than the HIF-1 pathway.

  4. Hypoxia inducible factor-1 alpha and multiple myeloma

    PubMed Central

    Tiwary, Bhupendra Nath

    2016-01-01

    Rapid tumor growth creates a state of hypoxia in the tumor microenvironment and results in release of hypoxia inducible factor-1 alpha (HiF-1α) in the local milieu. Hypoxia inducible factor activity is deregulated in many human cancers, especially those that are highly hypoxic. In multiple myeloma (MM) in initial stages of disease establishment, the hypoxic bone marrow microenvironment supports the initial survival and growth of the myeloma cells. Hypoxic tumour cells are usually resistant to radiotherapy and most conventional chemotherapeutic agents, rendering them highly aggressive and metastatic. Therefore, HIF is an attractive, although challenging, therapeutic target in MM directly or indirectly in recent years. PMID:26900575

  5. Anticancer clinical utility of the apurinic/apyrimidinic endonuclease/redox factor-1 (APE/Ref-1).

    PubMed

    Zhang, Ying; Wang, Jian

    2010-03-01

    Apurinic/apyrimidinic endonuclease/redox factor-1 (APE/Ref-1), as a type of multifunctional protein, plays an essential role in the base excision repair (BER) pathway, which is responsible for the repair of DNA caused by oxidative and alkylation damage. As importantly, APE/Ref-1 also functions as a redox factor maintaining transcription factors in an active reduced state. APE/Ref-1 stimulates the DNA-binding activity of numerous transcription factors that are involved in cancer promotion and progression, such as AP-1 (Fos/Jun), NF-kappaB, HIF-1alpha, p53, and others. Based on the structures and functions of APE1/Ref-1, we will provide an overview of its activities and explore the budding clinical use of this protein as a target in cancer treatment, and propose that APE/Ref-1 has a great potential for application in clinical research.

  6. HIF1-alpha functions as a tumor promoter in cancer associated fibroblasts, and as a tumor suppressor in breast cancer cells

    PubMed Central

    Chiavarina, Barbara; Whitaker-Menezes, Diana; Migneco, Gemma; Martinez-Outschoorn, Ubaldo E; Pavlides, Stephanos; Howell, Anthony; Tanowitz, Herbert B; Casimiro, Mathew C; Wang, Chenguang; Pestell, Richard G; Grieshaber, Philip; Caro, Jaime

    2010-01-01

    Our recent studies have mechanistically implicated a loss of stromal Cav-1 expression and HIF1α-activation in driving the cancer-associated fibroblast phenotype, through the paracrine production of nutrients via autophagy and aerobic glycolysis. However, it remains unknown if HIF1α-activation is sufficient to confer the cancer-associated fibroblast phenotype. To test this hypothesis directly, we stably-expressed activated HIF1α in fibroblasts and then examined their ability to promote tumor growth using a xenograft model employing human breast cancer cells (MDA-MB-231). Fibroblasts harboring activated HIF1α showed a dramatic reduction in Cav-1 levels and a shift towards aerobic glycolysis, as evidenced by a loss of mitochondrial activity, and an increase in lactate production. Activated HIF1α also induced BNIP3 and BNIP3L expression, markers for the autophagic destruction of mitochondria. Most importantly, fibroblasts expressing activated HIF1α increased tumor mass by ∼2-fold and tumor volume by ∼3-fold, without a significant increase in tumor angiogenesis. In this context, HIF1α also induced an increase in the lymph node metastasis of cancer cells. Similar results were obtained by driving NFκB activation in fibroblasts, another inducer of autophagy. Thus, activated HIF1α is sufficient to functionally confer the cancer-associated fibroblast phenotype. It is also known that HIF1α expression is required for the induction of autophagy in cancer cells. As such, we next directly expressed activated HIF1α in MDA-MB-231 cells and assessed its effect on tumor growth via xenograft analysis. Surprisingly, activated HIF1α in cancer cells dramatically suppressed tumor growth, resulting in a 2-fold reduction in tumor mass and a three-fold reduction in tumor volume. We conclude that HIF1α activation in different cell types can either promote or repress tumorigenesis. Based on these studies, we suggest that autophagy in cancer-associated fibroblasts promotes tumor growth via the paracrine production of recycled nutrients, which can directly “feed” cancer cells. Conversely, autophagy in cancer cells represses tumor growth via their “self-digestion.” Thus, we should consider that the activities of various known oncogenes and tumor-suppressors may be compartment and cell-type specific, and are not necessarily an intrinsic property of the molecule itself. As such, other “classic” oncogenes and tumor suppressors will have to be re-evaluated to determine their compartment specific effects on tumor growth and metastasis. Lastly, our results provide direct experimental support for the recently proposed “autophagic tumor stroma model of cancer.” PMID:20864819

  7. The neurohormone orexin stimulates hypoxia-inducible factor-1 activity.

    PubMed

    Sikder, Devanjan; Kodadek, Thomas

    2007-11-15

    Orexin A and Orexin B (also known as hypocretins) are neuropeptides that bind two related G-coupled protein receptors (OXR1 and OXR2) and thus induce wakefulness, food consumption, and locomotion. Conversely, deletion of the orexin gene in mice produces a condition similar to canine and human narcolepsy. Despite the central importance of the orexin system in regulating wakefulness and feeding behavior, little is known about the downstream signaling mechanisms that achieve these effects. In this study, genomics techniques are used to probe this question and reveal that orexin activates the hypoxia-inducible factor 1 (HIF-1), a heterodimeric transcription factor whose pathogenic role in stimulating angiogenesis in hypoxic tumors has been the focus of intense investigation. Orexin-stimulated HIF-1 activity is due to both increased HIF-1alpha gene transcription and a down-regulation of von Hippel-Lindau (VHL), the E3 ubiquitin ligase that mediates the turnover of HIF-1 via the ubiquitin-proteasome pathway. Orexin-mediated activation of HIF-1 results in increased glucose uptake and higher glycolytic activity, as expected from studies of hypoxic cells. However, orexin receptor-expressing cells somehow override the HIF-1-mediated preference for funneling pyruvate into anaerobic glycolysis and instead favor ATP production through the tricarboxylic acid cycle and oxidative phosphorylation. These findings implicate HIF-1 as an important transcription factor in the hormone-mediated regulation of hunger and wakefulness.

  8. Hypoxia-induced expression of RTEF-1 (related transcriptional enhancer factor-1) in endothelial cells is independent of HIF-1 (hypoxia-inducible factor-1)

    SciTech Connect

    Zhang, Cuili; Song, Q.H.; Li, Jian; Tian, Ye

    2009-04-10

    Related transcriptional enhancer factor-1 (RTEF-1) plays an important role in transcriptional regulation of angiogenic genes in hypoxic endothelial cells. The mechanisms involved in the induction of RTEF-1 expression in hypoxia are poorly understood. In bovine aortic endothelial cells (BAEC) subjected to hypoxia, Western blot and quantitative PCR analysis revealed that RTEF-1 protein and mRNA levels were significantly increased by hypoxia. To address the potential role of the hypoxia-inducible factor-1 (HIF-1) in RTEF-1 induction, a hepatoma cell line deficient in HIF-1 (c4) and a control HIF-1 positive cell line (vT{l_brace}2{r_brace}) were exposed to hypoxia. We report that RTEF-1 protein expression assessed by either Western blotting or immunofluorescence was increased in both cell lines. This demonstrates that HIF-1 is not required for RTEF-1 upregulation by hypoxia. Conversely, RTEF-1 appeared to regulate the expression of HIF-1: HIF-1{alpha} promoter activity was increased (3.6-fold) by RTEF-1 overexpression in BAEC. Furthermore, RTEF-1 enhanced BAEC proliferation and tubule formation; these were inhibited by RTEF-1 knockdown with siRNA. We propose that RTEF-1, acting via HIF-1, is a key regulator of angiogenesis in response to hypoxia.

  9. Bundling of actin filaments by elongation factor 1 alpha inhibits polymerization at filament ends

    PubMed Central

    1996-01-01

    Elongation factor 1 alpha (EF1 alpha) is an abundant protein that binds aminoacyl-tRNA and ribosomes in a GTP-dependent manner. EF1 alpha also interacts with the cytoskeleton by binding and bundling actin filaments and microtubules. In this report, the effect of purified EF1 alpha on actin polymerization and depolymerization is examined. At molar ratios present in the cytosol, EF1 alpha significantly blocks both polymerization and depolymerization of actin filaments and increases the final extent of actin polymer, while at high molar ratios to actin, EF1 alpha nucleates actin polymerization. Although EF1 alpha binds actin monomer, this monomer-binding activity does not explain the effects of EF1 alpha on actin polymerization at physiological molar ratios. The mechanism for the inhibition of polymerization is related to the actin-bundling activity of EF1 alpha. Both ends of the actin filament are inhibited for polymerization and both bundling and the inhibition of actin polymerization are affected by pH within the same physiological range; at high pH both bundling and the inhibition of actin polymerization are reduced. Additionally, it is seen that the binding of aminoacyl-tRNA to EF1 alpha releases EF1 alpha's inhibiting effect on actin polymerization. These data demonstrate that EF1 alpha can alter the assembly of F-actin, a filamentous scaffold on which non- membrane-associated protein translation may be occurring in vivo. PMID:8947553

  10. Trypanosoma cruzi elongation factor 1-alpha: nuclear localization in parasites undergoing apoptosis.

    PubMed

    Billaut-Mulot, O; Fernandez-Gomez, R; Loyens, M; Ouaissi, A

    1996-09-26

    The cloning and sequencing of the gene coding for Trypanosoma cruzi elongation factor 1 alpha (TcEF-1 alpha) was performed by screening a T. cruzi genomic library with a probe obtained through the polymerase chain reaction (PCR) amplification of T. cruzi DNA using two oligonucleotides deduced from the sequence of T. brucei EF-1 alpha. Southern blot analysis of T. cruzi digested genomic DNA and Northern blot hybridized with the labeled probe revealed that one copy of TcEF-1 alpha exist in the genome of the parasite. Indirect immunofluorescence technique using anti-EF-1 alpha antibodies and epimastigotes harvested after different days of in vitro culture showed that EF-1 alpha is localised in the cytoplasm of the parasites from the exponential growth phase. Surprisingly, during the stationary phase (ageing parasites), EF-1 alpha was found in the nucleus. Furthermore, treatment of parasites with the antibiotic drug geneticin (G418) which induces the death of epimastigotes by apoptosis showed selective localization of EF-1 alpha in the nucleus of dying parasites. This observation supports the notion already reported in the case of mammalian cells that EF-1 alpha could participate in the transcription processes and possibly in the case of T. cruzi, in the expression regulation of genes involved in the control of cell death. The possible transfection and genomic manipulation of T. cruzi may provide a model to study the role of TcEF-1 alpha in this phenomenon. PMID:8863724

  11. Elongation factor 1 alpha concentration is highly correlated with the lysine content of maize endosperm.

    PubMed Central

    Habben, J E; Moro, G L; Hunter, B G; Hamaker, B R; Larkins, B A

    1995-01-01

    Lysine is the most limiting essential amino acid in cereals, and for many years plant breeders have attempted to increase its concentration to improve the nutritional quality of these grains. The opaque2 mutation in maize doubles the lysine content in the endosperm, but the mechanism by which this occurs is unknown. We show that elongation factor 1 alpha (EF-1 alpha) is overexpressed in opaque2 endosperm compared with its normal counterpart and that there is a highly significant correlation between EF-1 alpha concentration and the total lysine content of the endosperm. This relationship is also true for two other cereals, sorghum and barley. It appears that genetic selection for genotypes with a high concentration of EF-1 alpha can significantly improve the nutritional quality of maize and other cereals. Images Fig. 1 Fig. 2 PMID:7567989

  12. Expression of elongation factor-1 alpha and S1 in young and old human skeletal muscle.

    PubMed

    Welle, S; Thornton, C; Bhatt, K; Krym, M

    1997-09-01

    Previous research has indicated that reduced expression of elongation factor-1 alpha (EF-1 alpha) may be an important determinant of the reduced rate of protein synthesis in senescent animals and cultured cells. The present study examined whether expression of EF-1 alpha or S1, a homologous protein found exclusively in postmitotic tissues, is reduced in senescent human skeletal muscle. Muscle biopsies were obtained from the vastus lateralis muscles of healthy young (22-31 yr old) and old (61-74 yr old) subjects. As reported previously, myofibrillar protein synthesis was approximately 40% slower in the older muscle (p < .001) as determined by incorporation of a stable isotope. Immunoblotting revealed no difference in the concentration of EF-1 alpha + S1 between younger and older muscle. RT-PCR assays indicated that S1 mRNA was much more abundant than EF-1 alpha mRNA in muscles of both age groups, with no reduction in either EF-1 alpha or S1 mRNA abundance in older muscles. We conclude that expression of EF-1 alpha and S1 is not diminished in older muscles and does not explain the age-related slowing of protein synthesis in human skeletal muscle. However, we cannot exclude the possibility that the activity of these proteins declines during senescence due to post-translational modifications. PMID:9310071

  13. In situ assessment of mRNA accessibility in heterogeneous tissue samples using elongation factor-1 alpha (EF-1 alpha).

    PubMed

    Gruber, A D; Levine, R A

    1997-05-01

    Elongation factor-1 alpha (EF-1 alpha) is an evolutionarily highly conserved universal cofactor of protein synthesis in all living cells. In this study, its use as a positive control in situ hybridization assays for specific detection of mRNA sequences was evaluated. Northern blot analysis of various non-neoplastic and neoplastic cultured cells of different stages of confluence, cell shape, and cell cycle status revealed that EF-1 alpha had a lower and more homogeneous expression than did beta-actin. In situ hybridization assays using digoxigenin-labeled riboprobes for the detection of EF-1 alpha mRNA in routinely formalin-fixed, paraffin-embedded tissue sections showed that EF-1 alpha is a suitable positive control in all types of cells. However, variation of protease pretreatments demonstrated distinct and sometimes mutually exclusive digestion conditions for different cell types within the same tissue sample. Our results indicate that detection of EF-1 alpha mRNA is an appropriate internal standard for in situ hybridization assays and that it is useful to control artifacts such as false negatives caused by inappropriate protease pretreatments. The observed variability of optimal protease pretreatments for different cell types within the same tissue section strengthens the importance of a positive control in in situ hybridization assays.

  14. Phylogeny of the Glomerales and Diversisporales (fungi: Glomeromycota) from actin and elongation factor 1-alpha sequences.

    PubMed

    Helgason, Thorunn; Watson, Irene J; Young, J Peter W

    2003-12-01

    The arbuscular mycorrhizal (AM) fungi have been elevated to the phylum Glomeromycota based on a ribosomal gene phylogeny. In order to test this phylogeny, we amplified and sequenced small subunit ribosomal RNA (SSUrRNA), actin and elongation factor 1 (EF1)-alpha gene fragments from single spores of Acaulospora laevis, Glomus caledonium, Gigaspora margarita, and Scutellospora dipurpurescens. Sequence variation within and among spores of an isolate was low except for SSUrRNA in S. dipurpurescens, and the actin amino acid sequence was more conserved than that of EF1-alpha. The AM fungal sequences were more similar to one another than to any other fungal group. Joint phylogenetic analysis of the actin and EF1-alpha sequences suggested that the sister group to the AM fungi was a Zygomycete order, the Mortierellales.

  15. Genes for the dimerization cofactor of hepatocyte nuclear factor-1[alpha] (DCOH) are on human and murine chromsomes 10

    SciTech Connect

    Milatovich, A.; Mendel, D.B.; Crabtree, G.R.; Francke, U. )

    1993-04-01

    Hepatocyte nuclear factor-1[alpha] (HNF-1[alpha]; gene symbol, TCF1) forms dimers with itself as well as with HNF-1[beta] and regulates the expression of several liver-specific genes. Recently, a dimerization cofactor of hepatocyte nuclear factor-1[alpha], called DCOH, has been identified. Here, the authors report the chromosomal localization of the genes for this cofactor to chromosomes 10 in both humans and mice by Southern blot analyses of somatic cell hybrids. 25 refs., 1 fig., 2 tabs.

  16. Blastocystis elongation factor-1alpha: genomic organization, taxonomy and phylogenetic relationships.

    PubMed

    Ho, L C; Armiugam, A; Jeyaseelan, K; Yap, E H; Singh, M

    2000-08-01

    The elongation factor-1 alpha (EF-1alpha) is a highly conserved ubiquitous protein that is involved in translation and is desirable for use in phylogenetic studies on Blastocystis, an enigmatic intestinal parasite with a contentious taxonomic position. In the present study, a PCR product (BEalpha) that codes for a major part of the coding region of the EF-lalpha protein was amplified. Genome walking experiments together with cloning were implemented to elucidate the 5' and 3' ends of the EF-1alpha gene of the human isolate, Blastocystis hominis C. The genomic organization and the potential transcription factor binding sites of the 5' end of B. hominis C EF-1alpha were identified. A comparative study on the deduced amino acid sequences of BEalpha of 13 Blastocystis isolates from various hosts was done to evaluate the phylogenetic relationship among the species. A phylogenetic reconstruction analysis with other eukaryotic EF-1alpha sequences was carried out to trace the phylogenetic position of Blastocystis among eukaryotic organisms. PMID:11085233

  17. Sequence-based identification of Japanese Armillaria species using the elongation factor-1 alpha gene.

    PubMed

    Hasegawa, Eri; Ota, Yuko; Hattori, Tsutomu; Kikuchi, Taisei

    2010-01-01

    We analyzed the sequences of three DNA regions-the translation elongation factor-1 alpha (EF-1 alpha) gene and the internal transcribed spacer (ITS) and intergenic spacer (IGS) regions of ribosomal DNA-to compare their accuracy in identifying species of Japanese Armillaria. We studied 49 isolates of eight Armillaria species, A. mellea, A. ostoyae, A. nabsnona, A. cepistipes, A. gallica, A. sinapina, A. tabescens and the biological species Nagasawa E (Nag. E). Phylogenetic analyses of the ITS and IGS data helped in identifying A. mellea, A. ostoyae, A. nabsnona, A. tabescens and Nag. E but could not be used to identify A. gallica, A. cepistipes and A. sinapina. Nevertheless our analysis showed that the EF-1 alpha gene was clearly different in the eight examined species. Restriction fragment length polymorphisms (RFLP) of the IGS-1 region could be used to distinguish most species, but the RFLP profiles of some isolates of A. cepistipes and A. sinapina were the same even with four different restriction enzymes. In conclusion, among the techniques examined in this study, analyzing the EF-1 alpha sequence was found to be the most suitable method for identifying different species of Japanese Armillaria. PMID:20648756

  18. Identification of Tetrahymena 14-nm filament-associated protein as elongation factor 1 alpha.

    PubMed

    Kurasawa, Y; Numata, O; Katoh, M; Hirano, H; Chiba, J; Watanabe, Y

    1992-11-01

    Tetrahymena 14-nm filament-forming protein has dual functions as a citrate synthase in mitochondria and as a cytoskeletal protein involved in oral morphogenesis and in pronuclear behavior during conjugation. By immunoblotting using monoclonal and polyclonal antibodies following two-dimensional gel electrophoresis, we demonstrated that the 14-nm filament protein fraction contained two 49-kDa proteins whose isoelectric points were 8.0 and 9.0; a monoclonal antibody (MAb) 26B4 and a polyclonal antibody 49KI reacted only to a pI 8.0 protein, while two other MAbs, 11B6 and 11B8, reacted only to a pI 9.0 protein. From the N-terminal amino acid sequences, the pI 8.0 protein was identified as the previously reported 14-nm filament-forming protein/citrate synthase, but the pI 9.0 protein N-terminal sequence had no similarity with that of the pI 8.0 protein. The pI 9.0 protein is considered to be a 14-nm filament-associated protein since the pI 9.0 protein copurifies with the pI 8.0 protein during two cycles of an assembly and disassembly purification protocol. Cloning and sequencing the pI 9.0 protein gene from a Tetrahymena pyriformis cDNA library, we identified the pI 9.0 protein as elongation factor 1 alpha (EF-1 alpha) based on it sharing 73-76% sequence identity with EF-1 alpha from several species. PMID:1385189

  19. Upregulation of NAD(P)H oxidase 1 in hypoxia activates hypoxia-inducible factor 1 via increase in reactive oxygen species.

    PubMed

    Goyal, Parag; Weissmann, Norbert; Grimminger, Friedrich; Hegel, Cornelia; Bader, Lucius; Rose, Frank; Fink, Ludger; Ghofrani, Hossein A; Schermuly, Ralph T; Schmidt, Harald H H W; Seeger, Werner; Hänze, Jörg

    2004-05-15

    Hypoxia sensing and related signaling events, including activation of hypoxia-inducible factor 1 (HIF-1), represent key features in cell physiology and lung function. Using cultured A549 cells, we investigated the role of NAD(P)H oxidase 1 (Nox1), suggested to be a subunit of a low-output NAD(P)H oxidase complex, in hypoxia signaling. Nox1 expression was detected on both the mRNA and protein levels. Upregulation of Nox1 mRNA and protein occurred during hypoxia, accompanied by enhanced reactive oxygen species (ROS) generation. A549 cells, which were transfected with a Nox1 expression vector, revealed an increase in ROS generation accompanied by activation of HIF-1-dependent target gene expression (heme oxygenase 1 mRNA, hypoxia-responsive-element reporter gene activity). In A549 cells stably overexpressing Nox1, accumulation of HIF-1alpha in normoxia and an additional increase in hypoxia were noted. Interference with ROS metabolism by the flavoprotein inhibitor diphenylene iodonium (DPI) and catalase inhibited HIF-1 induction. This suggests that H2O2 links Nox1 and HIF-1 activation. We conclude that hypoxic upregulation of Nox1 and subsequently augmented ROS generation may activate HIF-1-dependent pathways.

  20. Hypoxia-mediated down-regulation of Bid and Bax in tumors occurs via hypoxia-inducible factor 1-dependent and -independent mechanisms and contributes to drug resistance.

    PubMed

    Erler, Janine T; Cawthorne, Christopher J; Williams, Kaye J; Koritzinsky, Marianne; Wouters, Bradley G; Wilson, Clare; Miller, Crispin; Demonacos, Costas; Stratford, Ian J; Dive, Caroline

    2004-04-01

    Solid tumors with disorganized, insufficient blood supply contain hypoxic cells that are resistant to radiotherapy and chemotherapy. Drug resistance, an obstacle to curative treatment of solid tumors, can occur via suppression of apoptosis, a process controlled by pro- and antiapoptotic members of the Bcl-2 protein family. Oxygen deprivation of human colon cancer cells in vitro provoked decreased mRNA and protein levels of proapoptotic Bid and Bad. Hypoxia-inducible factor 1 (HIF-1) was dispensable for the down-regulation of Bad but required for that of Bid, consistent with the binding of HIF-1alpha to a hypoxia-responsive element (positions -8484 to -8475) in the bid promoter. Oxygen deprivation resulted in proteosome-independent decreased expression of Bax in vitro, consistent with a reduction in global translation efficiency. The physiological relevance of Bid and Bax down-regulation was confirmed in tumors in vivo. Oxygen deprivation resulted in decreased drug-induced apoptosis and clonogenic resistance to agents with different mechanisms of action. The contribution of Bid and/or Bax down-regulation to drug responsiveness was demonstrated by the relative resistance of normoxic cells that had no or reduced expression of Bid and/or Bax and by the finding that forced expression of Bid in hypoxic cells resulted in increased sensitivity to the topoisomerase II inhibitor etoposide.

  1. Hypoxia-induced cell death and changes in hypoxia-inducible factor-1 activity in PC12 cells upon exposure to nerve growth factor.

    PubMed

    Charlier, Nico; Leclere, Norbert; Felderhoff, Ursula; Heldt, Julia; Kietzmann, Thomas; Obladen, Michael; Gross, Johann

    2002-07-15

    The transcription factor hypoxia-inducible factor-1 (HIF-1) strongly contributes to the expression of adaptive genes under hypoxic conditions. In addition, HIF-1 has been implicated in the regulation of delayed neuronal cell death. Suspension-grown and adherent PC12 cells treated with NGF were used as an experimental model for studying the relationship between hypoxia-induced cell death and activation of HIF-1. Cell damage was assessed by flow cytometry of double-stained (Annexin V and propidiumiodide) cells, and by analysis of the overall death parameters LDH and mitochondrial dehydrogenase. In parallel, cells were transfected with a control and a three-hypoxia-responsive-elements (HRE)-containing vector and HIF-1-driven luciferase activity was determined. Exposure of NGF-treated PC12 cells to hypoxia resulted in a higher cell death rate when compared to untreated controls. PC12 cells exposed for 2 days to NGF exhibited a decrease of HIF-1 activity up to a factor of ten. This decrease may contribute to the enhanced hypoxia-induced cell death via reduced expression of HIF-1alpha-regulated genes responsible for adaptation to hypoxia, like those for glucose transport proteins and enzymes of the glycolytic chain. The decrease in HIF-1 activity and the increase in hypoxia sensitivity may suggest that NGF act as an hierarchically organized signaling molecule.

  2. Elongation factor-1 alpha is a selective regulator of growth factor withdrawal and ER stress-induced apoptosis.

    PubMed

    Talapatra, S; Wagner, J D O; Thompson, C B

    2002-08-01

    To identify genes that contribute to apoptotic resistance, IL-3 dependent hematopoietic cells were transfected with a cDNA expression library and subjected to growth factor withdrawal. Transfected cells were enriched for survivors over two successive rounds of IL-3 withdrawal and reconstitution, resulting in the identification of a full-length elongation factor 1 alpha (EF-1alpha) cDNA. Ectopic EF-1alpha expression conferred protection from growth factor withdrawal and agents that induce endoplasmic reticulum stress, but not from nuclear damage or death receptor signaling. Overexpression of EF-1alpha did not lead to growth factor independent cell proliferation or global alterations in protein levels or rates of synthesis. These findings suggest that overexpression of EF-1alpha results in selective resistance to apoptosis induced by growth factor withdrawal and ER stress. PMID:12107828

  3. Hypoxia Inducible Factor 1 Alpha Is Expressed in Germ Cells throughout the Murine Life Cycle

    PubMed Central

    Gardner, Lauren H.; Mathews, Juanita; Yamazaki, Yuki; Allsopp, Richard C.

    2016-01-01

    Pluripotent stem cells of the early embryo, and germ line cells, are essential to ensure uncompromised development to adulthood as well as species propagation, respectively. Recently, the transcription factor hypoxia inducible factor 1 alpha (Hif1α) has been shown to have important roles in embryonic stem cells; in particular, regulation of conversion to glycolytic metabolism and, as we have shown, maintenance of functional levels of telomerase. In the present study, we sought to assess whether Hif1α was also expressed in the primitive cells of the murine embryo. We observed expression of Hif1α in pre-implantation embryos, specifically the 2-cell stage, morula, and blastocyst. Robust Hif1α expression was also observed in male and female primordial germ cells. We subsequently assessed whether Hif1α was expressed in adult male and female germ cells. In the testis, Hif1α was robustly expressed in spermatogonial cells, in both juvenile (6-week old) and adult (3-month old) males. In the ovaries, Hif1α was expressed in mature oocytes from adult females, as assessed both in situ and in individual oocytes flushed from super-ovulated females. Analysis of Hif1α transcript levels indicates a mechanism of regulation during early development that involves stockpiling of Hif1α protein in mature oocytes, presumably to provide protection from hypoxic stress until the gene is re-activated at the blastocyst stage. Together, these observations show that Hif1α is expressed throughout the life-cycle, including both the male and female germ line, and point to an important role for Hif1α in early progenitor cells. PMID:27148974

  4. Wortmannin influences hypoxia-inducible factor-1 alpha expression and glycolysis in esophageal carcinoma cells

    PubMed Central

    Zeng, Ling; Zhou, Hai-Yun; Tang, Na-Na; Zhang, Wei-Feng; He, Gui-Jun; Hao, Bo; Feng, Ya-Dong; Zhu, Hong

    2016-01-01

    AIM: To investigate the influence of phosphatidylinositol-3-kinase protein kinase B (PI3K/AKT)-HIF-1α signaling pathway on glycolysis in esophageal carcinoma cells under hypoxia. METHODS: Esophageal carcinoma cell lines Eca109 and TE13 were cultured under hypoxia environment, and the protein, mRNA and activity levels of hypoxia inducible factor-1 alpha (HIF-1α), glucose transporter 1, hexokinase-II, phosphofructokinase 2 and lactate dehydrogenase-A were determined. Supernatant lactic acid concentrations were also detected. The PI3K/AKT signaling pathway was then inhibited with wortmannin, and the effects of hypoxia on the expression or activities of HIF-1α, associated glycolytic enzymes and lactic acid concentrations were observed. Esophageal carcinoma cells were then transfected with interference plasmid with HIF-1α-targeting siRNA to assess impact of the high expression of HIF-1α on glycolysis. RESULTS: HIF-1α is highly expressed in the esophageal carcinoma cell lines tested, and with decreasing levels of oxygen, the expression of HIF-1α and the associated glycolytic enzymes and the extracellular lactic acid concentration were enhanced in the esophageal carcinoma cell lines Eca109 and TE13. In both normoxia and hypoxic conditions, the level of glycolytic enzymes and the secretion of lactic acid were both reduced by wortmannin. The expression and activities of glycolytic enzymes and the lactic acid concentration in cells were reduced by inhibiting HIF-1α, especially the decreasing level of glycolysis was significant under hypoxic conditions. CONCLUSION: The PI3K/AKT pathway and HIF-1α are both involved in the process of glycolysis in esophageal cancer cells. PMID:27239113

  5. Interaction of plant chimeric calcium/calmodulin-dependent protein kinase with a homolog of eukaryotic elongation factor-1alpha

    NASA Technical Reports Server (NTRS)

    Wang, W.; Poovaiah, B. W.

    1999-01-01

    A chimeric Ca2+/calmodulin-dependent protein kinase (CCaMK) was previously cloned and characterized in this laboratory. To investigate the biological functions of CCaMK, the yeast two-hybrid system was used to isolate genes encoding proteins that interact with CCaMK. One of the cDNA clones obtained from the screening (LlEF-1alpha1) has high similarity with the eukaryotic elongation factor-1alpha (EF-1alpha). CCaMK phosphorylated LlEF-1alpha1 in a Ca2+/calmodulin-dependent manner. The phosphorylation site for CCaMK (Thr-257) was identified by site-directed mutagenesis. Interestingly, Thr-257 is located in the putative tRNA-binding region of LlEF-1alpha1. An isoform of Ca2+-dependent protein kinase (CDPK) phosphorylated multiple sites of LlEF-1alpha1 in a Ca2+-dependent but calmodulin-independent manner. Unlike CDPK, CCaMK phosphorylated only one site, and this site is different from CDPK phosphorylation sites. This suggests that the phosphorylation of EF-1alpha by these two kinases may have different functional significance. Although the phosphorylation of LlEF-1alpha1 by CCaMK is Ca2+/calmodulin-dependent, in vitro binding assays revealed that CCaMK binds to LlEF-1alpha1 in a Ca2+-independent manner. This was further substantiated by coimmunoprecipitation of CCaMK and EF-1alpha using the protein extract from lily anthers. Dissociation of CCaMK from EF-1alpha by Ca2+ and phosphorylation of EF-1alpha by CCaMK in a Ca2+/calmodulin-dependent manner suggests that these interactions may play a role in regulating the biological functions of EF-1alpha.

  6. Functional properties of an isolated. cap alpha beta. heterodimeric human placenta insulin-like growth factor 1 receptor complex

    SciTech Connect

    Feltz, S.M.; Swanson, M.L.; Wemmie, J.A.; Pessin, J.E.

    1988-05-03

    Treatment of human placenta membranes at pH 8.5 in the presence of 2.0 mM dithiothreitol (DTT) for 5 min, followed by the simultaneous removal of the DTT and pH adjustment of pH 7.6, resulted in the formation of a functional ..cap alpha beta.. heterodimeric insulin-like growth factor 1 (IGF-1) receptor complex from the native ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric disulfide-linked state. The membrane-bound ..cap alpha beta.. heterodimeric complex displayed similar curvilinear /sup 125/I-IGF-1 equilibrium binding compared to the ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric complex. /sup 125/I-IGF-1 binding to both the isolated ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric and ..cap alpha beta.. heterodimeric complexes demonstrated a marked straightening of the Scatchard plots, compared to the placenta membrane-bound IGF-1 receptors, with a 2-fold increase in the high-affinity binding component. IGF-1 stimulation of IGF-1 receptor autophosphorylation indicated that the ligand-dependent activation of ..cap alpha beta.. heterodimeric protein kinase activity occurred concomitant with the reassociation into a covalent ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric state. These data demonstrate that (i) a combination of alkaline pH and DTT treatment of human placenta membranes results in the formation of an ..cap alpha beta.. heterodimeric IGF-1 receptor complex, (ii) unlike the insulin receptor, high-affinity homogeneous IGF-1 binding occurs in both the ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric and ..cap alpha beta.. heterodimeric complexes, and (iii) IGF-1-dependent autophosphorylation of the ..cap alpha beta.. heterodimeric IGF-1 receptor complex correlates wit an IGF-1 dependent covalent reassociation into an ..cap alpha../sub 2/..beta../sub 2/ heterotetrameric disulfide-linked state.

  7. Identification of the sites in the eukaryotic elongation factor 1 alpha involved in the binding of elongation factor 1 beta and aminoacyl-tRNA.

    PubMed

    van Damme, H T; Amons, R; Möller, W

    1992-08-01

    In this article we report the identification of the sites which are involved in the binding of the GDP-exchange factor EF-1 beta and aminoacyl tRNA to the alpha-subunit of the eukaryotic elongation factor 1 (EF-1) from Artemia. For this purpose the polypeptide chain of EF-1 alpha, having 461 amino acid residues, was proteolytically cleaved into large fragments by distinct proteases. Under well defined conditions, a mixture of two large fragments, free from intact EF-1 alpha and with molecular masses of 37 kDa and 43 kDa, was obtained. The 37-kDa and 43-kDa fragments comprise the residues 129-461 and 69-461, respectively. However, in aqueous solution and under non-denaturing conditions, the mixture still contained a short amino-terminal peptide, encompassing the residues 1-36, that remained tightly bound. The ability of the mixture of the 37+43-kDa fragments, including this amino-terminal peptide 1-36, to bind GDP or to facilitate aminoacyl tRNA binding to salt-washed ribosomes was severely reduced, compared to intact EF-1 alpha. However, both of these complexes were able to bind to the GDP-exchange-stimulating subunit EF-1 beta. A 30-kDa fragment, comprising the residues 1-287, was generated after treatment of the protein with endoproteinase Glu-C. This fragment contained the complete guanine nucleotide binding pocket. Although it was able to bind GDP and to transport aminoacyl tRNA to the ribosome, no affinity towards EF-1 beta was observed. We propose that the guanine-nucleotide-exchange stimulation by EF-1 beta is induced through binding of this factor to the carboxy-terminal part of EF-1 alpha. As a result, a decreased susceptibility towards trypsin of the guanine-nucleotide-binding pocket of EF-1 alpha, especially in the region of its presumed effector loop is induced. PMID:1499548

  8. Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha.

    PubMed

    Yuan, Yong; Hilliard, George; Ferguson, Tsuneo; Millhorn, David E

    2003-05-01

    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element. The alpha-subunits of the HIF transcription factors are degraded by proteasomal pathways during normoxia but are stabilized under hypoxic conditions. The von Hippel-Lindau protein (pVHL) mediates the ubiquitination and rapid degradation of HIF-alpha (including HIF-1alpha and HIF-2alpha). Post-translational hydroxylation of a proline residue in the oxygen-dependent degradation (ODD) domain of HIF-alpha is required for the interaction between HIF and VHL. It has previously been established that cobalt mimics hypoxia and causes accumulation of HIF-1alpha and HIF-2alpha. However, little is known about the mechanism by which this occurs. In an earlier study, we demonstrated that cobalt binds directly to the ODD domain of HIF-2alpha. Here we provide the first evidence that cobalt inhibits pVHL binding to HIF-alpha even when HIF-alpha is hydroxylated. Deletion of 17 amino acids within the ODD domain of HIF-2alpha that are required for pVHL binding prevented the binding of cobalt and stabilized HIF-2alpha during normoxia. These findings show that cobalt mimics hypoxia, at least in part, by occupying the VHL-binding domain of HIF-alpha and thereby preventing the degradation of HIF-alpha. PMID:12606543

  9. Sequences of elongation factors-1 alpha and -1 gamma and stimulation by juvenile hormone in Locusta migratoria.

    PubMed

    Zhou, S; Zhang, J; Fam, M D; Wyatt, G R; Walker, V K

    2002-11-01

    Two cDNAs encoding the alpha and gamma subunits of translation elongation factor-1 (EF-1) have been cloned and sequenced from the African migratory locust, Locusta migratoria. Southern blotting and real-time PCR analyses indicated that these sequences represent single copy genes. Comparison with sequences from other species indicated greater conservation for EF-1 alpha than for EF-1 gamma. The developmental profiles for EF-1 alpha and -1 gamma mRNA expression in the fat body paralleled reported changes in the hemolymph juvenile hormone (JH) titer in the fifth instar and were elevated during early reproductive maturation in the female adult. In maturing adults, there was a greater accumulation of EF-1 alpha and -1 gamma transcripts in females than in males. The levels of both transcripts were greatly increased by an enriched diet, previously shown to elevate JH titers and accelerate vitellogenin production. Treating JH-deprived adult females with the JH analog, methoprene, resulted in more than doubling of transcript levels of both genes, supporting the hypothesis that JH could stimulate the accumulation of LmEF-1 alpha and -1 gamma transcripts. We suggest that production of elongation factors, increased by JH, may contribute to the massive protein synthesis required for egg production. PMID:12530224

  10. Myeloid derived hypoxia inducible factor 1-alpha is required for protection against pulmonary Aspergillus fumigatus infection.

    PubMed

    Shepardson, Kelly M; Jhingran, Anupam; Caffrey, Alayna; Obar, Joshua J; Suratt, Benjamin T; Berwin, Brent L; Hohl, Tobias M; Cramer, Robert A

    2014-09-01

    Hypoxia inducible factor 1α (HIF1α) is the mammalian transcriptional factor that controls metabolism, survival, and innate immunity in response to inflammation and low oxygen. Previous work established that generation of hypoxic microenvironments occurs within the lung during infection with the human fungal pathogen Aspergillus fumigatus. Here we demonstrate that A. fumigatus stabilizes HIF1α protein early after pulmonary challenge that is inhibited by treatment of mice with the steroid triamcinolone. Utilizing myeloid deficient HIF1α mice, we observed that HIF1α is required for survival and fungal clearance early following pulmonary challenge with A. fumigatus. Unlike previously reported research with bacterial pathogens, HIF1α deficient neutrophils and macrophages were surprisingly not defective in fungal conidial killing. The increase in susceptibility of the myeloid deficient HIF1α mice to A. fumigatus was in part due to decreased early production of the chemokine CXCL1 (KC) and increased neutrophil apoptosis at the site of infection, resulting in decreased neutrophil numbers in the lung. Addition of recombinant CXCL1 restored neutrophil survival and numbers, murine survival, and fungal clearance. These results suggest that there are unique HIF1α mediated mechanisms employed by the host for protection and defense against fungal pathogen growth and invasion in the lung. Additionally, this work supports the strategy of exploring HIF1α as a therapeutic target in specific immunosuppressed populations with fungal infections.

  11. Myeloid Derived Hypoxia Inducible Factor 1-alpha Is Required for Protection against Pulmonary Aspergillus fumigatus Infection

    PubMed Central

    Shepardson, Kelly M.; Jhingran, Anupam; Caffrey, Alayna; Obar, Joshua J.; Suratt, Benjamin T.; Berwin, Brent L.; Hohl, Tobias M.; Cramer, Robert A.

    2014-01-01

    Hypoxia inducible factor 1α (HIF1α) is the mammalian transcriptional factor that controls metabolism, survival, and innate immunity in response to inflammation and low oxygen. Previous work established that generation of hypoxic microenvironments occurs within the lung during infection with the human fungal pathogen Aspergillus fumigatus. Here we demonstrate that A. fumigatus stabilizes HIF1α protein early after pulmonary challenge that is inhibited by treatment of mice with the steroid triamcinolone. Utilizing myeloid deficient HIF1α mice, we observed that HIF1α is required for survival and fungal clearance early following pulmonary challenge with A. fumigatus. Unlike previously reported research with bacterial pathogens, HIF1α deficient neutrophils and macrophages were surprisingly not defective in fungal conidial killing. The increase in susceptibility of the myeloid deficient HIF1α mice to A. fumigatus was in part due to decreased early production of the chemokine CXCL1 (KC) and increased neutrophil apoptosis at the site of infection, resulting in decreased neutrophil numbers in the lung. Addition of recombinant CXCL1 restored neutrophil survival and numbers, murine survival, and fungal clearance. These results suggest that there are unique HIF1α mediated mechanisms employed by the host for protection and defense against fungal pathogen growth and invasion in the lung. Additionally, this work supports the strategy of exploring HIF1α as a therapeutic target in specific immunosuppressed populations with fungal infections. PMID:25255025

  12. Organization and nucleotide sequence of a gene cluster comprising the translation elongation factor 1 alpha, ribosomal protein S10 and tRNA(Ala) from Halobacterium halobium.

    PubMed

    Fujita, T; Itoh, T

    1995-09-01

    Lambda EMBL clone containing a gene cluster coding for the translation elongation factor 1alpha, ribosomal protein S10 and tRNA(ala) was identified in a genomic library for the halophilic archaebacterium Halobacterium halobium using a PCR probe amplified by two oligonucleotide primers for conserved amino acid sequences of the elongation factor 1 alpha family. The gene coding for elongation factor EF-2 was also found 4.3kb upstream from the 5'end of the elongation factor 1 alpha by hybridization analysis using a DNA fragment specific for EF-2 from Halobacterium halobium [1]. Halobacterial and eukaryotic elongation factor 1 alpha homologues are very similar in sequence and in length and appear to be more closely related to each other than to the eubacterial protein. PMID:8653072

  13. The Role of Hypoxia Inducible Factor-1 Alpha in Bypassing Oncogene-Induced Senescence

    PubMed Central

    Kilic Eren, Mehtap; Tabor, Vedrana

    2014-01-01

    Oncogene induced senescence (OIS) is a sustained anti-proliferative response acutely induced in primary cells via activation of mitogenic oncogenes such as Ras/BRAF. This mechanism acts as an initial barrier preventing normal cells transformation into malignant cell. Besides oncogenic activation and DNA damage response (DDR), senescence is modulated by a plethora of other factors, and one of the most important one is oxygen tension of the tissue. The aim of this study was to determine the impact of hypoxia on RasV12-induced senescence in human diploid fibroblasts (HDFs). We showed here that hypoxia prevents execution of oncogene induced senescence (OIS), through a strong down-regulation of senescence hallmarks, such as SA- β-galactosidase, H3K9me3, HP1γ, p53, p21CIP1 and p16INK4a in association with induction of hypoxia inducible factor-1α (HIF-1α). In addition, hypoxia also decreased marks of H-RasV12-induced DDR in both cell lines through down-regulation of ATM/ATR, Chk1 and Chk2 phosphorylation as well as decreased γ-H2AX positivity. Utilizing shRNA system targeting HIF-1α we show that HIF-1α is directly involved in down regulation of p53 and its target p21CIP1 but not p16INK4a. In line with this finding we found that knock down of HIF-1α leads to a strong induction of apoptotic response, but not restoration of senescence in Ras expressing HDFs in hypoxia. This indicates that HIF-1α is an important player in early steps of tumorigenesis, leading to suppression of senescence through its negative regulation of p53 and p21CIP1. In our work we describe a mechanism through which hypoxia and specifically HIF-1α preclude cells from maintaining senescence-driven anti proliferative response. These findings indicate the possible mechanism through which hypoxic environment helps premalignant cells to evade impingement of cellular failsafe pathways. PMID:24984035

  14. Chemokines, macrophage inflammatory protein-2 and stromal cell-derived factor-1{alpha}, suppress amyloid {beta}-induced neurotoxicity

    SciTech Connect

    Raman, Dayanidhi; Milatovic, Snjezana-Zaja; Milatovic, Dejan; Fan, Guo-Huang; Richmond, Ann

    2011-11-15

    Alzheimer's disease (AD) is characterized by a progressive cognitive decline and accumulation of neurotoxic oligomeric peptides amyloid-{beta} (A{beta}). Although the molecular events are not entirely known, it has become evident that inflammation, environmental and other risk factors may play a causal, disruptive and/or protective role in the development of AD. The present study investigated the ability of the chemokines, macrophage inflammatory protein-2 (MIP-2) and stromal cell-derived factor-1{alpha} (SDF-1{alpha}), the respective ligands for chemokine receptors CXCR2 and CXCR4, to suppress A{beta}-induced neurotoxicity in vitro and in vivo. Pretreatment with MIP-2 or SDF-1{alpha} significantly protected neurons from A{beta}-induced dendritic regression and apoptosis in vitro through activation of Akt, ERK1/2 and maintenance of metalloproteinase ADAM17 especially with SDF-1{alpha}. Intra-cerebroventricular (ICV) injection of A{beta} led to reduction in dendritic length and spine density of pyramidal neurons in the CA1 area of the hippocampus and increased oxidative damage 24 h following the exposure. The A{beta}-induced morphometric changes of neurons and increase in biomarkers of oxidative damage, F{sub 2}-isoprostanes, were significantly inhibited by pretreatment with the chemokines MIP-2 or SDF-1{alpha}. Additionally, MIP-2 or SDF-1{alpha} was able to suppress the aberrant mislocalization of p21-activated kinase (PAK), one of the proteins involved in the maintenance of dendritic spines. Furthermore, MIP-2 also protected neurons against A{beta} neurotoxicity in CXCR2-/- mice, potentially through observed up regulation of CXCR1 mRNA. Understanding the neuroprotective potential of chemokines is crucial in defining the role for their employment during the early stages of neurodegeneration. -- Research highlights: Black-Right-Pointing-Pointer Neuroprotective ability of the chemokines MIP2 and CXCL12 against A{beta} toxicity. Black-Right-Pointing-Pointer MIP-2 or

  15. Murine elongation factor 1 alpha (EF-1 alpha) is posttranslationally modified by novel amide-linked ethanolamine-phosphoglycerol moieties. Addition of ethanolamine-phosphoglycerol to specific glutamic acid residues on EF-1 alpha

    SciTech Connect

    Whiteheart, S.W.; Shenbagamurthi, P.; Chen, L.; Cotter, R.J.; Hart, G.W. )

    1989-08-25

    Elongation Factor 1 alpha (EF-1 alpha), an important eukaryotic translation factor, transports charged aminoacyl-tRNA from the cytosol to the ribosomes during poly-peptide synthesis. Metabolic radiolabeling with ({sup 3}H) ethanolamine shows that, in all cells examined, EF-1 alpha is the major radiolabeled protein. Radiolabeled EF-1 alpha has an apparent Mr = 53,000 and a basic isoelectric point. It is cytosolic and does not contain N-linked oligosaccharides. Trypsin digestion of murine EF-1 alpha generated two major ({sup 3}H)ethanolamine-labeled peptides. Three peptides were sequenced and were identical to two distinct regions of the human EF-1 alpha protein. Blank sequencing cycles coinciding with glutamic acid in the human cDNA-derived sequence were also found to release ({sup 3}H)ethanolamine, and compositional analysis of these peptides confirmed the presence of glutamic acid. Dansylation analysis demonstrates that the amine group of the ethanolamine is blocked. These results indicate that EF-1 alpha is posttranslationally modified by the covalent attachment of ethanolamine via an amide bond to at least two specific glutamic acid residues (Glu-301 and Glu-374). The hydroxyl group of the attached ethanolamine was shown by mass spectrometry and compositional analysis, to be further modified by the addition of a phosphoglycerol unit. This novel posttranslational modification may represent an important alteration of EF-1 alpha, comparable to the regulatory effects of posttranslational methylation of EF-1 alpha lysine residues.

  16. Stromal cell-derived factor-1{alpha} (SDF-1{alpha}/CXCL12) stimulates ovarian cancer cell growth through the EGF receptor transactivation

    SciTech Connect

    Porcile, Carola; Bajetto, Adriana . E-mail: bajetto@cba.unige.it; Barbieri, Federica; Barbero, Simone; Bonavia, Rudy; Biglieri, Marianna; Pirani, Paolo; Florio, Tullio . E-mail: florio@cba.unige.it; Schettini, Gennaro

    2005-08-15

    Ovarian cancer (OC) is the leading cause of death in gynecologic diseases in which there is evidence for a complex chemokine network. Chemokines are a family of proteins that play an important role in tumor progression influencing cell proliferation, angiogenic/angiostatic processes, cell migration and metastasis, and, finally, regulating the immune cells recruitment into the tumor mass. We previously demonstrated that astrocytes and glioblastoma cells express both the chemokine receptor CXCR4 and its ligand stromal cell-derived factor-1 (SDF-1), and that SDF-1{alpha} treatment induced cell proliferation, supporting the hypothesis that chemokines may play an important role in tumor cells' growth in vitro. In the present study, we report that CXCR4 and SDF-1 are expressed in OC cell lines. We demonstrate that SDF-1{alpha} induces a dose-dependent proliferation in OC cells, by the specific interaction with CXCR4 and a biphasic activation of ERK1/2 and Akt kinases. Our results further indicate that CXCR4 activation induces EGF receptor (EGFR) phosphorylation that in turn was linked to the downstream intracellular kinases activation, ERK1/2 and Akt. In addition, we provide evidence for cytoplasmic tyrosine kinase (c-Src) involvement in the SDF-1/CXCR4-EGFR transactivation. These results suggest a possible important 'cross-talk' between SDF-1/CXCR4 and EGFR intracellular pathways that may link signals of cell proliferation in ovarian cancer.

  17. Stromal cell-derived factor-1 alpha (SDF-1α) improves neural recovery after spinal cord contusion in rats.

    PubMed

    Zendedel, Adib; Nobakht, Maliheh; Bakhtiyari, Mehrdad; Beyer, Cordian; Kipp, Markus; Baazm, Maryam; Joghataie, Mohammad Taghi

    2012-09-14

    Stromal cell-derived factor-1 alpha (SDF-1α) is an important cytokine, implicated in the control of stem cell trafficking and bone marrow-derived stem cell mobilization. Generally, SDF-1α regulates multiple physiological processes such as embryonic development and organ homeostasis. There is also good evidence that SDF-1α and its receptor CXCR4(1) are key regulators of neurorepair processes after brain ischemia and spinal cord injury. In this study, we investigated the influence of chronic intrathecal delivery of SDF-1α after spinal cord contusion. After contusion T9, male Wistar rats at the age of 12 weeks were intrathecally treated with SDF-1α in different doses (100, 500 and 1000 ng/ml) via an osmotic pump for 28 days. Thereafter, animals were subjected to an open field locomotor test. Behavioral scores were significantly higher in SDF-1α treated animals compared to placebo-treated groups. In addition, we evaluated histopathological changes in the spinal cord in the presence or absence of SDF-1α. Chronic delivery of SDF-1α decreased numbers of apoptotic cells, boosted astroglia and microglia response, induced angiogenesis, and potentiated the number of proliferating cells in a dose-dependent manner. These results clearly indicate an improved functional CNS long-term recovery after spinal cord injury. This behavioral restoration was paralleled by a reduction of apoptosis and changes in neuroinflammatory cells.

  18. Transcriptional up-regulation of inhibitory PAS domain protein gene expression by hypoxia-inducible factor 1 (HIF-1): a negative feedback regulatory circuit in HIF-1-mediated signaling in hypoxic cells.

    PubMed

    Makino, Yuichi; Uenishi, Rie; Okamoto, Kensaku; Isoe, Tsubasa; Hosono, Osamu; Tanaka, Hirotoshi; Kanopka, Arvydas; Poellinger, Lorenz; Haneda, Masakazu; Morimoto, Chikao

    2007-05-11

    The inhibitory PAS (Per/Arnt/Sim) domain protein (IPAS), a dominant negative regulator of hypoxia-inducible transcription factors (HIFs), is potentially implicated in negative regulation of angiogenesis in such tissues as the avascular cornea of the eye. We have previously shown IPAS mRNA expression is up-regulated in hypoxic tissues, which at least in part involves hypoxia-dependent alternative splicing of the transcripts from the IPAS/HIF-3alpha locus. In the present study, we demonstrate that a hypoxia-driven transcriptional mechanism also plays a role in augmentation of IPAS gene expression. Isolation and analyses of the promoter region flanking to the first exon of IPAS gene revealed a functional hypoxia response element at position -834 to -799, whereas the sequence upstream of the HIF-3alpha first exon scarcely responded to hypoxic stimuli. A transient transfection experiment demonstrated that HIF-1alpha mediates IPAS promoter activation via the functional hypoxia response element under hypoxic conditions and that a constitutively active form of HIF-1alpha is sufficient for induction of the promoter in normoxic cells. Moreover, chromatin immunoprecipitation and electrophoretic mobility shift assays showed binding of the HIF-1 complex to the element in a hypoxia-dependent manner. Taken together, HIF-1 directly up-regulates IPAS gene expression through a mechanism distinct from RNA splicing, providing a further level of negative feedback gene regulation in adaptive responses to hypoxic/ischemic conditions. PMID:17355974

  19. Role of hypoxia-inducible factor-1 in transcriptional activation of ceruloplasmin by iron deficiency

    NASA Technical Reports Server (NTRS)

    Mukhopadhyay, C. K.; Mazumder, B.; Fox, P. L.

    2000-01-01

    A role of the copper protein ceruloplasmin (Cp) in iron metabolism is suggested by its ferroxidase activity and by the tissue iron overload in hereditary Cp deficiency patients. In addition, plasma Cp increases markedly in several conditions of anemia, e.g. iron deficiency, hemorrhage, renal failure, sickle cell disease, pregnancy, and inflammation. However, little is known about the cellular and molecular mechanism(s) involved. We have reported that iron chelators increase Cp mRNA expression and protein synthesis in human hepatocarcinoma HepG2 cells. Furthermore, we have shown that the increase in Cp mRNA is due to increased rate of transcription. We here report the results of new studies designed to elucidate the molecular mechanism underlying transcriptional activation of Cp by iron deficiency. The 5'-flanking region of the Cp gene was cloned from a human genomic library. A 4774-base pair segment of the Cp promoter/enhancer driving a luciferase reporter was transfected into HepG2 or Hep3B cells. Iron deficiency or hypoxia increased luciferase activity by 5-10-fold compared with untreated cells. Examination of the sequence showed three pairs of consensus hypoxia-responsive elements (HREs). Deletion and mutation analysis showed that a single HRE was necessary and sufficient for gene activation. The involvement of hypoxia-inducible factor-1 (HIF-1) was shown by gel-shift and supershift experiments that showed HIF-1alpha and HIF-1beta binding to a radiolabeled oligonucleotide containing the Cp promoter HRE. Furthermore, iron deficiency (and hypoxia) did not activate Cp gene expression in Hepa c4 hepatoma cells deficient in HIF-1beta, as shown functionally by the inactivity of a transfected Cp promoter-luciferase construct and by the failure of HIF-1 to bind the Cp HRE in nuclear extracts from these cells. These results are consistent with in vivo findings that iron deficiency increases plasma Cp and provides a molecular mechanism that may help to understand these

  20. Role of hypoxia-inducible factor-1 in transcriptional activation of ceruloplasmin by iron deficiency.

    PubMed

    Mukhopadhyay, C K; Mazumder, B; Fox, P L

    2000-07-14

    A role of the copper protein ceruloplasmin (Cp) in iron metabolism is suggested by its ferroxidase activity and by the tissue iron overload in hereditary Cp deficiency patients. In addition, plasma Cp increases markedly in several conditions of anemia, e.g. iron deficiency, hemorrhage, renal failure, sickle cell disease, pregnancy, and inflammation. However, little is known about the cellular and molecular mechanism(s) involved. We have reported that iron chelators increase Cp mRNA expression and protein synthesis in human hepatocarcinoma HepG2 cells. Furthermore, we have shown that the increase in Cp mRNA is due to increased rate of transcription. We here report the results of new studies designed to elucidate the molecular mechanism underlying transcriptional activation of Cp by iron deficiency. The 5'-flanking region of the Cp gene was cloned from a human genomic library. A 4774-base pair segment of the Cp promoter/enhancer driving a luciferase reporter was transfected into HepG2 or Hep3B cells. Iron deficiency or hypoxia increased luciferase activity by 5-10-fold compared with untreated cells. Examination of the sequence showed three pairs of consensus hypoxia-responsive elements (HREs). Deletion and mutation analysis showed that a single HRE was necessary and sufficient for gene activation. The involvement of hypoxia-inducible factor-1 (HIF-1) was shown by gel-shift and supershift experiments that showed HIF-1alpha and HIF-1beta binding to a radiolabeled oligonucleotide containing the Cp promoter HRE. Furthermore, iron deficiency (and hypoxia) did not activate Cp gene expression in Hepa c4 hepatoma cells deficient in HIF-1beta, as shown functionally by the inactivity of a transfected Cp promoter-luciferase construct and by the failure of HIF-1 to bind the Cp HRE in nuclear extracts from these cells. These results are consistent with in vivo findings that iron deficiency increases plasma Cp and provides a molecular mechanism that may help to understand these

  1. The nucleotide sequence of the gene coding for the elongation factor 1 alpha in Sulfolobus solfataricus. Homology of the product with related proteins.

    PubMed

    Arcari, P; Gallo, M; Ianniciello, G; Dello Russo, A; Bocchini, V

    1994-04-01

    The cloning and sequencing of the gene coding for the archaebacterial elongation factor 1 alpha (aEF-1 alpha) was performed by screening a Sulfolobus solfataricus genomic library using a probe constructed from the eptapeptide KNMITGA that is conserved in all the EF-1 alpha/EF-Tu known so far. The isolated recombinant phage contained the part of the aEF-1 alpha gene from amino acids 1 to 171. The other part (amino acids 162-435) was obtained through the amplification of the S. solfataricus DNA by PCR. The codon usage by the aEF-1 alpha gene showed a preference for triplets ending in A and/or T. This behavior was almost identical to that of the S. acidocaldarius EF-1 alpha gene but differed greatly from that of EF-1 alpha/EF-Tu genes in other archaebacteria eukaryotes and eubacteria. The translated protein is made of 435 amino acid residues and contains sequence motifs for the binding of GTP, tRNA and ribosome. Alignments of aEF-1 alpha with several EF-1 alpha/EF-Tu revealed that aEF-1 alpha is more similar to its eukaryotic than to its eubacterial counterparts. PMID:8148382

  2. Carrot and stick: HIF-alpha engages c-Myc in hypoxic adaptation.

    PubMed

    Huang, L E

    2008-04-01

    The past decade of research on hypoxic responses has provided a considerable understanding of how cells respond to hypoxic stress at the molecular level, thanks to the identification and molecular cloning of the hypoxia-inducible transcription factor, HIF-1alpha. Numerous target genes have since been identified to account for various aspects of the hypoxic response, including angiogenesis and glycolysis. Yet, fundamental questions remain regarding the mechanisms by which hypoxia controls cell proliferation, genetic instability, mitochondrial biogenesis, and oxidative respiration in cancer cells. Although the proto-oncoprotein c-Myc appears to be the diametrical opposite of HIF-1alpha in most of these processes, recent studies indicate that c-Myc is an integral part of the HIF-alpha-c-Myc molecular pathway in the hypoxic response. It has been shown that HIF-alpha engages with Myc by various mechanisms to achieve oxygen homeostasis for cell survival. This article focuses on the intricate roles of c-Myc in the hypoxic response, discusses various mechanisms controlling c-Myc activity by HIF-alpha for the regulation of hypoxia-responsive genes, and emphasizing the outcome of gene expression apparently dependent upon hypoxic conditions, cellular context, and gene promoter.

  3. Polymorphisms in the hypoxia-inducible factor 1 alpha gene in Mexican patients with preeclampsia: A case-control study

    PubMed Central

    2011-01-01

    Background Although the etiology of preeclampsia is still unclear, recent work suggests that changes in circulating angiogenic factors play a key role in its pathogenesis. In the trophoblast of women with preeclampsia, hypoxia-inducible factor 1 alpha (HIF-1α) is over-expressed, and induces the expression of non-angiogenic factors and inhibitors of trophoblast differentiation. This observation prompted the study of HIF-1α and its relation to preeclampsia. It has been described that the C1772T (P582S) and G1790A (A588T) polymorphisms of the HIF1A gene have significantly greater transcriptional activity, correlated with an increased expression of their proteins, than the wild-type sequence. In this work, we studied whether either or both HIF1A variants contribute to preeclampsia susceptibility. Results Genomic DNA was isolated from 150 preeclamptic and 105 healthy pregnant women. Exon 12 of the HIF1A gene was amplified by PCR, and the genotypes of HIF1A were determined by DNA sequencing. In preeclamptic women and controls, the frequencies of the T allele for C1772T were 4.3 vs. 4.8%, and the frequencies of the A allele for G1790A were 0.0 vs. 0.5%, respectively. No significant differences were found between groups. Conclusion The frequency of the C1772T and G1790A polymorphisms of the HIF1A gene is very low, and neither polymorphism is associated with the development of preeclampsia in the Mexican population. PMID:21414224

  4. Localization of S1 and elongation factor-1 alpha mRNA in rat brain and liver by non-radioactive in situ hybridization.

    PubMed

    Lee, S; Stollar, E; Wang, E

    1993-07-01

    Elongation factor-1 alpha (EF-1 alpha) is a ubiquitous, highly conserved protein that functions in peptide elongation during mRNA translation. We recently reported that, as do lower species, mammals also contain a second EF-1 alpha-like gene (S1). Unlike EF-1 alpha, which is present in all tissues, S1 mRNA is detected only in brain, heart, and muscle by Northern analysis and RNAse protection assays. In this report we present the identification of S1 and EF-1 alpha messages by non-radioactive in situ hybridization in brain and liver. We show that with this technique we can detected S1 mRNA only in certain cells in brain, mostly neurons; on the other hand, EF-1 alpha is present in all cell types that we have studied so far. We demonstrate that although EF-1 alpha mRNA can be detected in S1-negative cells it is also present in high abundance in S1-positive cells. The results presented here correlate with our previous finding that mammalian species contain a tissue-specific EF-1 alpha-like gene, S1. The presence of a second EF-1 alpha-like transcript within fully differentiated cells suggests a novel cell type-specific gene expression whose function may be related to the permanent growth-arrested state of cells in brain, heart, and muscle. PMID:8515051

  5. Hepatocyte nuclear factor-1alpha is required for expression but dispensable for histone acetylation of the lactase-phlorizin hydrolase gene in vivo.

    PubMed

    Bosse, Tjalling; van Wering, Herbert M; Gielen, Marieke; Dowling, Lauren N; Fialkovich, John J; Piaseckyj, Christina M; Gonzalez, Frank J; Akiyama, Taro E; Montgomery, Robert K; Grand, Richard J; Krasinski, Stephen D

    2006-05-01

    Hepatocyte nuclear factor-1alpha (HNF-1alpha) is a modified homeodomain-containing transcription factor that has been implicated in the regulation of intestinal genes. To define the importance and underlying mechanism of HNF-1alpha for the regulation of intestinal gene expression in vivo, we analyzed the expression of the intestinal differentiation markers and putative HNF-1alpha targets lactase-phlorizin hydrolase (LPH) and sucrase-isomaltase (SI) in hnf1alpha null mice. We found that in adult jejunum, LPH mRNA in hnf1alpha(-/-) mice was reduced 95% compared with wild-type controls (P < 0.01, n = 4), whereas SI mRNA was virtually identical to that in wild-type mice. Furthermore, SI mRNA abundance was unchanged in the absence of HNF-1alpha along the length of the adult mouse small intestine as well as in newborn jejunum. We found that HNF-1alpha occupies the promoters of both the LPH and SI genes in vivo. However, in contrast to liver and pancreas, where HNF-1alpha regulates target genes by recruitment of histone acetyl transferase activity to the promoter, the histone acetylation state of the LPH and SI promoters was not affected by the presence or absence of HNF-1alpha. Finally, we showed that a subset of hypothesized intestinal target genes is regulated by HNF-1alpha in vivo and that this regulation occurs in a defined tissue-specific and developmental context. These data indicate that HNF-1alpha is an activator of a subset of intestinal genes and induces these genes through an alternative mechanism in which it is dispensable for chromatin remodeling.

  6. Physical interaction between GATA-5 and hepatocyte nuclear factor-1alpha results in synergistic activation of the human lactase-phlorizin hydrolase promoter.

    PubMed

    van Wering, Herbert M; Huibregtse, Inge L; van der Zwan, Sanne M; de Bie, Maartje S; Dowling, Lauren N; Boudreau, Francois; Rings, Edmond H H M; Grand, Richard J; Krasinski, Stephen D

    2002-08-01

    GATA-4, -5, and -6 zinc finger and hepatocyte nuclear factor-1alpha (HNF-1alpha) homeodomain transcription factors are expressed in the intestinal epithelium and synergistically activate the promoter of intestinal genes. Here, we demonstrate that GATA-5 and HNF-1alpha physically associate both in vivo and in vitro and that this interaction is necessary for cooperative activation of the lactase-phlorizin hydrolase promoter. Furthermore, physical association is mediated by the C-terminal zinc finger of GATA factors and the homeodomain of HNF-1alpha. Deletion of HNF-1alpha activation domains or interruption of HNF-1-binding sites in the lactase-phlorizin hydrolase promoter resulted in a complete loss of cooperativity, whereas deletion of GATA-5 activation domains or interruption of GATA-binding sites resulted in a reduction, but not an elimination, of cooperativity. We hypothesize that GATA/HNF-1alpha cooperativity is mediated by HNF-1alpha through its activation domains, which are oriented for high levels of activation through binding to DNA and physical association with GATA factors. These data suggest a paradigm whereby intestine-specific gene expression is regulated by unique interactions among tissue-restricted transcription factors coexpressed in the intestine. Parallel mechanisms in other tissues as well as in Drosophila suggest that zinc finger/homeodomain interactions are an efficient pathway of cooperative activation of gene transcription that has been conserved throughout evolution.

  7. Functional defect of truncated hepatocyte nuclear factor-1{alpha} (G554fsX556) associated with maturity-onset diabetes of the young

    SciTech Connect

    Kooptiwut, Suwattanee; Sujjitjoon, Jatuporn; Plengvidhya, Nattachet; Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapapron; Semprasert, Namoiy; Furuta, Hiroto; Nanjo, Kishio; Banchuin, Napatawn; Yenchitsomanus, Pa-thai

    2009-05-22

    A novel frameshift mutation attributable to 14-nucleotide insertion in hepatocyte nuclear factor-1{alpha} (HNF-1{alpha}) encoding a truncated HNF-1{alpha} (G554fsX556) with 76-amino acid deletion at its carboxyl terminus was identified in a Thai family with maturity-onset diabetes of the young (MODY). The wild-type and mutant HNF-1{alpha} proteins were expressed by in vitro transcription and translation (TNT) assay and by transfection in HeLa cells. The wild-type and mutant HNF-1{alpha} could similarly bind to human glucose-transporter 2 (GLUT2) promoter examined by electrophoretic mobility shift assay (EMSA). However, the transactivation activities of mutant HNF-1{alpha} on human GLUT2 and rat L-type pyruvate kinase (L-PK) promoters in HeLa cells determined by luciferase reporter assay were reduced to approximately 55-60% of the wild-type protein. These results suggested that the functional defect of novel truncated HNF-1{alpha} (G554fsX556) on the transactivation of its target-gene promoters would account for the {beta}-cell dysfunction associated with the pathogenesis of MODY.

  8. Non-penetrance in a MODY 3 family with a mutation in the hepatic nuclear factor 1alpha gene: implications for predictive testing.

    PubMed

    Miedzybrodzka, Z; Hattersley, A T; Ellard, S; Pearson, D; de Silva, D; Harvey, R; Haites, N

    1999-09-01

    The most common cause of maturity-onset diabetes of the young (MODY) is a mutation in the hepatic nuclear factor 1alpha (HNF1alpha) gene (MODY3). We describe a family in which a missense mutation causing a Thr-Ile substitution at codon 620 has been found in all affected members. The mutation is not fully penetrant as two family members aged 87 and 46 have the mutation but do not have diabetes. The severity and age of diagnosis of diabetes varies widely within the family, and most presented over the age of 25. HNF1alpha mutation screening should be considered in any family with autosomal dominant inheritance of diabetes where one member has presented with diabetes before the age of 25. Predictive testing is now possible within the majority of MODY families, and is of clinical benefit, but the possibility of non-penetrance should be addressed during counselling and interpretation of results. PMID:10482964

  9. Stromal derived growth factor-1alpha as a beacon for stem cell homing in development and injury.

    PubMed

    Claps, Christopher M; Corcoran, Kelly E; Cho, Kyung Jin; Rameshwar, Pranela

    2005-10-01

    This review extrapolates the functions of SDF-1alpha and its receptor, CXCR4, as regulators of hematopoietic stem cells and discusses their potential roles in the development and regeneration of tissues. The discussion focuses on the repair of neural tissues while parallels are made with bone marrow hematopoietic stem cells. Overall, the organization links the basic biology of SDF-1alpha and CXCR4 to topics in medicine and show how any disease processes involving the SDF-1alpha-CXCR4 system could be central points in medicine. Discussions focused on potential therapies for SDF-1 and CXCR4 in clinical disorders. Breast and prostate cancers are selected as examples of solid tumors while leukemia is discussed as an example of hematological malignancies. Diffuse macular edema is discussed as potential therapy for a non-malignant disease.

  10. A Xenopus laevis gene encoding EF-1 alpha S, the somatic form of elongation factor 1 alpha: sequence, structure, and identification of regulatory elements required for embryonic transcription.

    PubMed

    Johnson, A D; Krieg, P A

    1995-01-01

    Transcription of the Xenopus laevis EF-1 alpha S gene commences at the mid-blastula stage of embryonic development and then continues constitutively in all somatic tissues. The EF-1 alpha S promoter is extremely active in the early Xenopus embryo where EF-1 alpha S transcripts account for as much as 40% of all new polyadenylated transcripts. We have isolated the Xenopus EF-1 alpha S gene and used microinjection techniques to identify promoter elements responsible for embryonic transcription. These in vivo expression studies have identified an enhancer fragment, located approximately 4.4 kb upstream of the transcription start site, that is required for maximum expression from the EF-1 alpha S promoter. The enhancer fragment contains both an octamer and a G/C box sequence, but mutation studies indicate that the octamer plays no significant role in regulation of EF-1 alpha S expression in the embryo. The presence of a G/C element in the enhancer and of multiple G/C boxes in the proximal promoter region suggests that the G/C box binding protein, Sp1, plays a major role in the developmental regulation of EF-1 alpha S promoter activity. PMID:8565334

  11. Phylogenetic position of symbiotic protist Dinenympha [correction of Dinemympha] exilis in the hindgut of the termite Reticulitermes speratus inferred from the protein phylogeny of elongation factor 1 alpha.

    PubMed

    Moriya, S; Ohkuma, M; Kudo, T

    1998-04-14

    The phylogenetic position of the symbiotic oxymonad Dinenympha exilis, found in the hindgut of the lower termite Reticulitermes speratus, was determined by analysis of translation elongation factor 1 alpha (EF-1 alpha). cDNA corresponding to a major part of the amino acid coding region of EF-1 alpha mRNA was amplified by the reverse transcription polymerase chain reaction (RT-PCR) method from total mRNA of termite hindgut microorganisms without cultivation. The product was cloned into a plasmid vector, pGEM-T, and the clones were isolated and sequenced. One of the EF-1 alpha clones isolated was assigned to the protist D. exilis by whole-cell in-situ hybridization using a specific oligonucleotide probe with enzymatic signal amplification. The deduced amino acid sequence was aligned with those of other eukaryotic and archaeabacterial EF-1 alpha s, and the phylogenetic relationships among early branching eukaryotes were inferred by using the distance matrix method and the maximum parsimony method. The phylogenetic analysis indicated that the D. exilis offshoot occurred before mitochondria-containing organisms and D. exilis branched out after the diplomonads clade. These results indicate that the oxymonad D. exilis is one of the early branching organisms and suggest that the oxymonads form a lineage independent of other early branching organisms. PMID:9573371

  12. Messenger RNA transcripts of the hepatocyte nuclear factor-1alpha gene containing premature termination codons are subject to nonsense-mediated decay.

    PubMed

    Harries, Lorna W; Hattersley, Andrew T; Ellard, Sian

    2004-02-01

    Mutations in the hepatocyte nuclear factor-1alpha (HNF-1a) gene cause maturity-onset diabetes of the young (MODY). Approximately 30% of these mutations generate mRNA transcripts harboring premature termination codons (PTCs). Degradation of such transcripts by the nonsense-mediated decay (NMD) pathway has been reported for many genes. To determine whether PTC mutant transcripts of the HNF-1alpha gene elicit NMD, we have developed a novel quantitative RT-PCR assay. We performed quantification of ectopically expressed mutant transcripts relative to normal transcripts in lymphoblastoid cell lines using a coding single nucleotide polymorphism (cSNP) as a marker. The nonsense mutations R171X, I414G415ATCG-->CCA, and P291fsinsC showed reduced mutant mRNA expression to 40% (P = 0.009), <0.01% (P alpha PTC mutations may be subject to NMD. Mutations that result in significant reduction of protein levels due to NMD will not have dominant-negative activity in vivo. Haploinsufficiency is therefore likely to be the most important mutational mechanism of HNF-1alpha mutations causing MODY. PMID:14747304

  13. Methylation-dependent regulation of hypoxia inducible factor-1 alpha gene expression by the transcription factor Kaiso.

    PubMed

    Pierre, Christina C; Longo, Joseph; Bassey-Archibong, Blessing I; Hallett, Robin M; Milosavljevic, Snezana; Beatty, Laura; Hassell, John A; Daniel, Juliet M

    2015-12-01

    Low oxygen tension (hypoxia) is a common characteristic of solid tumors and strongly correlates with poor prognosis and resistance to treatment. In response to hypoxia, cells initiate a cascade of transcriptional events regulated by the hypoxia inducible factor-1 (HIF-1) heterodimer. Since the oxygen-sensitive HIF-1α subunit is stabilized during hypoxia, it functions as the regulatory subunit of the protein. To date, while the mechanisms governing HIF-1α protein stabilization and function have been well studied, those governing HIF1A gene expression are not fully understood. However, recent studies have suggested that methylation of a HIF-1 binding site in the HIF1A promoter prevents its autoregulation. Here we report that the POZ-ZF transcription factor Kaiso modulates HIF1A gene expression by binding to the methylated HIF1A promoter in a region proximal to the autoregulatory HIF-1 binding site. Interestingly, Kaiso's regulation of HIF1A occurs primarily during hypoxia, which is consistent with the finding that Kaiso protein levels peak after 4 h of hypoxic incubation and return to normoxic levels after 24 h. Our data thus support a role for Kaiso in fine-tuning HIF1A gene expression after extended periods of hypoxia.

  14. Hypoxia inducible factor 1 alpha down-regulates type i collagen through Sp3 transcription factor in human chondrocytes.

    PubMed

    Duval, Elise; Bouyoucef, Mouloud; Leclercq, Sylvain; Baugé, Catherine; Boumédiene, Karim

    2016-09-01

    Cartilage engineering is one challenging issue in regenerative medicine. Low oxygen tension or hypoxia inducible factor-1 (HIF-1α) gene therapy are promising strategies in the field of cartilage repair. Previously, we showed that hypoxia and its mediator HIF-1 regulate matrix genes expression (collagens and aggrecan). Here, we investigated the molecular mechanism involved in the regulation of type I collagen (COL1A1) by HIF-1 in human articular chondrocytes. We show that HIF-1α reduces COL1A1 transcription, through a distal promoter (-2300 to -1816 bp upstream transcription initiation site), containing two GC boxes that bind Sp transcription factors (Sp1/Sp3). Sp1 acts as a positive regulator but is not induced by HIF-1. COL1A1 inhibition caused by HIF-1 implies only Sp3, which accumulates and competes Sp1 binding on COL1A1 promoter. Additionally, Sp3 ectopic expression inhibits COL1A1, while Sp3 knockdown counteracts the downregulation of COL1A1 induced by HIF-1. In conclusion, we established a new regulatory model of COL1A1 regulation by HIF-1, and bring out its relationship with Sp3 transcription factor. In a fundamental level, these findings give insights in the mechanisms controlling COL1A1 gene expression. This may be helpful to improve strategies to impair type I collagen expression during chondrocyte differentiation for cartilage engineering. © 2016 IUBMB Life, 68(9):756-763, 2016. PMID:27521280

  15. A DC-81-indole conjugate agent suppresses melanoma A375 cell migration partially via interrupting VEGF production and stromal cell-derived factor-1{alpha}-mediated signaling

    SciTech Connect

    Hsieh, Ming-Chu; Hu, Wan-Ping; Yu, Hsin-Su; Wu, Wen-Chuan; Chang, Long-Sen; Kao, Ying-Hsien; Wang, Jeh-Jeng

    2011-09-01

    Pyrrolo[2,1-c][1,4]benzodiazepine (PBD) chemicals are antitumor antibiotics inhibiting nucleic acid synthesis. An indole carboxylate-PBD hybrid with six-carbon spacer structure (IN6CPBD) has been previously demonstrated to induce melanoma cell apoptosis and reduce metastasis in mouse lungs. This study aimed at investigating the efficacy of the other hybrid compound with four-carbon spacer (IN4CPBD) and elucidating its anti-metastatic mechanism. Human melanoma A375 cells with IN4CPBD treatment underwent cytotoxicity and apoptosis-associated assays. Transwell migration assay, Western blotting, and ELISA were used for mechanistic study. IN4CPBD exhibited potent melanoma cytotoxicity through interrupting G1/S cell cycle progression, increasing DNA fragmentation and hypodipoidic DNA contents, and reducing mitochondrial membrane potential. Caspase activity elevation suggested that both intrinsic and extrinsic pathways were involved in IN4CPBD-induced melanoma apoptosis. IN4CPBD up-regulated p53 and p21, thereby concomitantly derailing the equilibrium between Bcl-2 and Bax levels. Transwell migration assay demonstrated that stromal cell-derived factor-1{alpha} (SDF-1{alpha}) stimulated A375 cell motility, while kinase inhibitors treatment confirmed that Rho/ROCK, Akt, ERK1/2, and p38 MAPK pathways were involved in SDF-1{alpha}-enhanced melanoma migration. IN4CPBD not only abolished the SDF-1{alpha}-enhanced chemotactic motility but also suppressed constitutive MMP-9 and VEGF expression. Mechanistically, IN4CPBD down-regulated Akt, ERK1/2, and p38 MAPK total proteins and MYPT1 phosphorylation. In conclusion, beyond the fact that IN4CPBD induces melanoma cell apoptosis at cytotoxic dose, the interruption in the VEGF expression and the SDF-1{alpha}-related signaling at cytostatic dose may partially constitute the rationale for its in vivo anti-metastatic potency. - Research Highlights: > A novel carboxylate-PBD hybrid as anti-melanoma drug. > IN4CPBD interrupts melanoma cell

  16. Molecular characterization of hypoxia and hypoxia-inducible factor 1 alpha (HIF-1α) from Taiwan voles (Microtus kikuchii).

    PubMed

    Jiang, Yi-Fan; Chou, Chung-Hsi; Lin, En-Chung; Chiu, Chih-Hsien

    2011-02-01

    Hypoxia-inducible factor 1 (HIF-1) is a transcription factor that senses and adapts cells to hypoxic environmental conditions. HIF-1 is composed of an oxygen-regulated α subunit (HIF-1α) and a constitutively expressed β subunit (HIF-1β). Taiwan voles (Microtus kikuchii) are an endemic species in Taiwan, found only in mountainous areas greater than 2000m above sea level. In this study, the full-length HIF-1α cDNA was cloned and sequenced from liver tissues of Taiwan voles. We found that HIF-1α of Taiwan voles had high sequence similarity to HIF-1α of other species. Sequence alignment of HIF-1α functional domains indicated basic helix-loop-helix (bHLH), PER-ARNT-SIM (PAS) and C-terminal transactivation (TAD-C) domains were conserved among species, but sequence variations were found between the oxygen-dependent degradation domains (ODDD). To measure Taiwan vole HIF-1α responses to hypoxia, animals were challenged with cobalt chloride, and HIF-1α mRNA and protein expression in brain, lung, heart, liver, kidney, and muscle was assessed by quantitative RT-PCR and Western blot analysis. Upon induction of hypoxic stress with cobalt chloride, an increase in HIF-1α mRNA levels was detected in lung, heart, kidney, and muscle tissue. In contrast, protein expression levels showed greater variation between individual animals. These results suggest that the regulation of HIF-1α may be important to the Taiwan vole under cobalt chloride treatments. But more details regarding the evolutionary effect of environmental pressure on HIF-1α primary sequence, HIF-1α function and regulation in Taiwan voles remain to be identified.

  17. The distribution of Elongation Factor-1 Alpha (EF-1alpha), Elongation Factor-Like (EFL), and a non-canonical genetic code in the ulvophyceae: discrete genetic characters support a consistent phylogenetic framework.

    PubMed

    Gile, Gillian H; Novis, Philip M; Cragg, David S; Zuccarello, Giuseppe C; Keeling, Patrick J

    2009-01-01

    The systematics of the green algal class Ulvophyceae have been difficult to resolve with ultrastructural and molecular phylogenetic analyses. Therefore, we investigated relationships among ulvophycean orders by determining the distribution of two discrete genetic characters previously identified only in the order Dasycladales. First, Acetabularia acetabulum uses the core translation GTPase Elongation Factor 1alpha (EF-1alpha) while most Chlorophyta instead possess the related GTPase Elongation Factor-Like (EFL). Second, the nuclear genomes of dasycladaleans A. acetabulum and Batophora oerstedii use a rare non-canonical genetic code in which the canonical termination codons TAA and TAG instead encode glutamine. Representatives of Ulvales and Ulotrichales were found to encode EFL, while Caulerpales, Dasycladales, Siphonocladales, and Ignatius tetrasporus were found to encode EF-1alpha, in congruence with the two major lineages previously proposed for the Ulvophyceae. The EF-1alpha of I. tetrasporus supports its relationship with Caulerpales/Dasycladales/Siphonocladales, in agreement with ultrastructural evidence, but contrary to certain small subunit rRNA analyses that place it with Ulvales/Ulotrichales. The same non-canonical genetic code previously described in A. acetabulum was observed in EF-1alpha sequences from Parvocaulis pusillus (Dasycladales), Chaetomorpha coliformis, and Cladophora cf. crinalis (Siphonocladales), whereas Caulerpales use the universal code. This supports a sister relationship between Siphonocladales and Dasycladales and further refines our understanding of ulvophycean phylogeny.

  18. Assignment of human elongation factor 1{alpha} genes: EEF1A maps to chromosome 6q14 and EEF1A2 to 20q13.3

    SciTech Connect

    Lund, A.; Clark, B.; Knudsen, S.M.

    1996-09-01

    The human elongation factor 1 {alpha} gene family consists of at least 2 actively transcribed genes, EEF1A and EEF1A2, and more than 18 homologous loci. EEF1A2 is expressed ubiquitously, and both of them can function in translation. An EEF1A cDNA probe has previously been shown to cross-hybridize with several human chromosomes, but the location of the functional gene has not been established. We have mapped the functional EEF1A gene to 6q14 by combined fluorescence in situ hybridization (FISH) and PCR analysis of a somatic cell hybrid panel and mapped EEF1A2 to 20q13.3 by FISH. In addition, the 11 strongest cross-hybridizing loci (EEF1AL2-EEF1AL13) were mapped by FISH to 12p12, 9q34, 7p15-p21, 19q13, 3q26-q27, 7q33-q35, 1p13-p22, 2q12-q14, 5p12-q11, 1q31-q32, and Xq21. 17 refs., 1 fig., 1 tab.

  19. In Vivo Therapeutic Silencing of Hypoxia-Inducible Factor 1 Alpha (HIF-1α) Using Single-Walled Carbon Nanotubes Noncovalently Coated with siRNA

    PubMed Central

    Bartholomeusz, Geoffrey; Cherukuri, Paul; Kingston, John; Cognet, Laurent; Lemos, Robert; Leeuw, Tonya K.; Gumbiner-Russo, Laura; Weisman, R. Bruce; Powis, Garth

    2009-01-01

    A new approach is described for delivering small interfering RNA (siRNA) into cancer cells by noncovalently complexing unmodified siRNA with pristine single-walled carbon nanotubes (SWCNTs). The complexes were prepared by simple sonication of pristine SWCNTs in a solution of siRNA, which then served both as the cargo and as the suspending agent for the SWCNTs. When complexes containing siRNA targeted to hypoxia-inducible factor 1 alpha (HIF-1α) were added to cells growing in serum containing culture media, there was strong specific inhibition of cellular HIF-1α activity. The ability to obtain a biological response to SWCNT/siRNA complexes was seen in a wide variety of cancer cell types. Moreover, intratumoral administration of SWCNT-HIF-1α siRNA complexes in mice bearing MiaPaCa-2/HRE tumors significantly inhibited the activity of tumor HIF-1α. As elevated levels of HIF-1α are found in many human cancers and are associated with resistance to therapy and decreased patient survival, these results imply that SWCNT/siRNA complexes may have value as therapeutic agents. PMID:20052401

  20. Hypoxia-inducible factor 1 alpha is required for the tumourigenic and aggressive phenotype associated with Rab25 expression in ovarian cancer

    PubMed Central

    Gomez-Roman, Natividad; Sahasrabudhe, Neha Mohan; McGregor, Fiona; Chalmers, Anthony J.; Cassidy, Jim; Plumb, Jane

    2016-01-01

    The small GTPase Rab25 has been functionally linked to tumour progression and aggressiveness in ovarian cancer and promotes invasion in three-dimensional environments. This type of migration has been shown to require the expression of the hypoxia-inducible factor 1 alpha (HIF-1α). In this report we demonstrate that Rab25 regulates HIF-1α protein expression in an oxygen independent manner in a panel of cancer cell lines. Regulation of HIF-1α protein expression by Rab25 did not require transcriptional upregulation, but was dependent on de novo protein synthesis through the Erbb2/ERK1/2 and p70S6K/mTOR pathways. Rab25 expression induced HIF-1 transcriptional activity, increased cisplatin resistance, and conferred intraperitoneal growth to the A2780 cell line in immunocompromised mice. Targeting HIF1 activity by silencing HIF-1β re-sensitised cells to cisplatin in vitro and reduced tumour formation of A2780-Rab25 expressing cells in vivo in a mouse ovarian peritoneal carcinomatosis model. Similar effects on cisplatin resistance in vitro and intraperitoneal tumourigenesis in vivo were obtained after HIF1b knockdown in the ovarian cancer cell line SKOV3, which expresses endogenous Rab25 and HIF-1α at atmospheric oxygen concentrations. Our results suggest that Rab25 tumourigenic potential and chemoresistance relies on HIF1 activity in aggressive and metastatic ovarian cancer. Targeting HIF-1 activity may potentially be effective either alone or in combination with standard chemotherapy for aggressive metastatic ovarian cancer. PMID:26967059

  1. Digoxin and ouabain induce P-glycoprotein by activating calmodulin kinase II and hypoxia-inducible factor-1alpha in human colon cancer cells

    SciTech Connect

    Riganti, Chiara

    2009-11-01

    Digoxin and ouabain are cardioactive glycosides, which inhibit the Na{sup +}/K{sup +}-ATPase pump and in this way they increase the intracellular concentration of cytosolic calcium ([Ca{sup ++}]{sub i}). They are also strong inducers of the P-glycoprotein (Pgp), a transmembrane transporter which extrudes several drugs, including anticancer agents like doxorubicin. An increased amount of Pgp limits the absorption of drugs through epithelial cells, thus inducing resistance to chemotherapy. The mechanism by which cardioactive glycosides increase Pgp is not known and in this work we investigated whether digoxin and ouabain elicited the expression of Pgp with a calcium-driven mechanism. In human colon cancer HT29 cells both glycosides increased the [Ca{sup ++}]{sub i} and this event was dependent on the calcium influx via the Na{sup +}/Ca{sup ++} exchanger. The increased [Ca{sup ++}]{sub i} enhanced the activity of the calmodulin kinase II enzyme, which in turn activated the transcription factor hypoxia-inducible factor-1alpha. This one was responsible for the increased expression of Pgp, which actively extruded doxorubicin from the cells and significantly reduced the pro-apoptotic effect of the drug. All the effects of glycosides were prevented by inhibiting the Na{sup +}/Ca{sup ++} exchanger or the calmodulin kinase II. This work clarified the molecular mechanisms by which digoxin and oubain induce Pgp and pointed out that the administration of cardioactive glycosides may widely affect the absorption of drugs in colon epithelia. Moreover, our results suggest that the efficacy of chemotherapeutic agent substrates of Pgp may be strongly reduced in patients taking digoxin.

  2. Overexpression of hypoxia-inducible factor 1 alpha impacts FoxP3 levels in mycosis fungoides--cutaneous T-cell lymphoma: clinical implications.

    PubMed

    Alcántara-Hernández, M; Torres-Zárate, C; Pérez-Montesinos, G; Jurado-Santacruz, F; Domínguez-Gómez, M A; Peniche-Castellanos, A; Ferat-Osorio, E; Neri, N; Nambo, M J; Alvarado-Cabrero, I; Moreno-Lafont, M; Huerta-Yepez, S; Bonifaz, L C

    2014-05-01

    Mycosis fungoides (MF) is the most common variant of primary cutaneous T-cell lymphoma, and decreased forkhead box P3 (FoxP3) expression has been reported in MF late stages. Hypoxia-inducible factor 1 alpha (HIF-1α) may regulate FoxP3 expression; however, it is unknown whether HIF-1α is expressed in the CD4(+) T cells of MF patients and how it could affect the expression of FoxP3. Therefore, we evaluated the expression of HIF-1α and FoxP3 in CD4(+) T cells obtained from the skin lesions of MF patients. We found increased cell proliferation and an increase in CD4(+) T cells with an aberrant phenotype among early stage MF patients. HIF-1α was overexpressed in these CD4(+) T cells. In addition, we found a decrease in the percentage of FoxP3(+) cells both in the skin of MF patients, when compared with control skin samples, and with disease progression. In addition, a negative correlation was established between HIF-1α and FoxP3 expression. Skin HIF-1α expression in MF patients correlated with the extent of the affected area and increased with the disease progression. Finally, we showed that ex vivo inhibition of HIF-1α degradation increases the percentage of FoxP3(+) T cells in skin lesions. Our results suggest that overexpression of HIF-1α affects the levels of FoxP3 in MF patients, which could have relevant implications in terms of disease outcome.

  3. Immunohistochemical Detection of Changes in Tumor Hypoxia

    SciTech Connect

    Russell, James Carlin, Sean; Burke, Sean A.; Wen Bixiu; Yang, Kwang Mo; Ling, C. Clifton

    2009-03-15

    Purpose: Although hypoxia is a known prognostic factor, its effect will be modified by the rate of reoxygenation and the extent to which the cells are acutely hypoxic. We tested the ability of exogenous and endogenous markers to detect reoxygenation in a xenograft model. Our technique might be applicable to stored patient samples. Methods and Materials: The human colorectal carcinoma line, HT29, was grown in nude mice. Changes in tumor hypoxia were examined by injection of pimonidazole, followed 24 hours later by EF5. Cryosections were stained for these markers and for carbonic anhydrase IX (CAIX) and hypoxia-inducible factor 1{alpha} (HIF1{alpha}). Tumor hypoxia was artificially manipulated by carbogen exposure. Results: In unstressed tumors, all four markers showed very similar spatial distributions. After carbogen treatment, pimonidazole and EF5 could detect decreased hypoxia. HIF1{alpha} staining was also decreased relative to CAIX, although the effect was less pronounced than for EF5. Control tumors displayed small regions that had undergone spontaneous changes in tumor hypoxia, as judged by pimonidazole relative to EF5; most of these changes were reflected by CAIX and HIF1{alpha}. Conclusion: HIF1{alpha} can be compared with either CAIX or a previously administered nitroimidazole to provide an estimate of reoxygenation.

  4. Follicular development and expression of nuclear respiratory factor-1 and peroxisome proliferator-activated receptor γ coactivator-1 alpha in ovaries of fetal and neonatal doelings.

    PubMed

    Zhou, Z; Wan, Y; Zhang, Y; Wang, Z; Jia, R; Fan, Y; Nie, H; Ying, S; Huang, P; Wang, F

    2012-11-01

    In livestock, the ovarian reserve of follicles is established during the fetal stage. However, at least two-thirds of the oocytes present in the reserve die because of apoptosis before birth. Notably, mitochondria have been reported to play a crucial role in the fate (life/death) of oocytes. In this study, mitochondrial regulators nuclear respiratory factor-1 (NRF-1) and PPAR γ coactivator-1 alpha (PGC-1α) were examined during this period of follicle development to investigate their effects on follicular development and apoptosis. Fetal and neonatal Capra haimen were used, ranging in age from 60 d postcoitum (dpc) to 30 d postpartum (dpp). Our data demonstrated that egg nests were the earliest recognizable gamete cells in ovaries of fetal and neonatal doelings. Proportions of egg nests decreased from 92.68 to 25.08% whereas single follicles increased from 7.32 to 74.92% between 60 and 120 dpc. Subsequently, between 90 and 120 dpc, the proportion of primordial follicles increased from 9.98 to 61.56% (P < 0.01). However, it did not change between 1 and 30 dpp (P = 0.12). The proportion of primary follicles increased from 1.23 to 37.93% between 90 dpc to 1 dpp (P = 0.01) but did not change between 1 and 30 dpp (P = 0.11). Meanwhile, proportions of secondary and tertiary follicles increased in an age-dependent manner. In addition, results of this study suggested that NRF-1 and PGC-1α proteins are mainly localized in germ cells of egg nests, cytoplasm of oocytes, and granulosa cells of follicles ranging from primordial to tertiary follicles. The transcript abundance of NRF-1 mRNA was up-regulated in 60-dpc-old ovaries compared with 1-dpp-old ovaries (P < 0.05), but the PGC-1α mRNA expression pattern did not change (P = 0.05). Nevertheless, the number of terminal deoxynucleotidyltransferase UTP nick-end labeling (TUNEL) positive cells and caspase-3 activity in 60-dpc-old ovaries was less than those in 1-dpp-old ovaries (P < 0.01, P = 0.01). In conclusion, our results

  5. Expression of hypoxia-inducible factor 1 alpha and oligodendrocyte lineage gene-1 in cultured brain slices after oxygen-glucose deprivation☆

    PubMed Central

    Cui, Hong; Han, Weijuan; Yang, Lijun; Chang, Yanzhong

    2013-01-01

    Oligodendrocyte lineage gene-1 expressed in oligodendrocytes may trigger the repair of neuronal myelin impairment, and play a crucial role in myelin repair. Hypoxia-inducible factor 1α, a transcription factor, is of great significance in premature infants with hypoxic-ischemic brain damage. There is little evidence of direct regulatory effects of hypoxia-inducible factor 1α on oligodendrocyte lineage gene-1. In this study, brain slices of Sprague-Dawley rats were cultured and subjected to oxygen-glucose deprivation. Then, slices were transfected with hypoxia-inducible factor 1α or oligodendrocyte lineage gene-1. The expression levels of hypoxia-inducible factor 1α and oligodendrocyte lineage gene-1 were significantly up-regulated in rat brains prior to transfection, as detected by immunohistochemical staining. Eight hours after transfection of slices with hypoxia-inducible factor 1α, oligodendrocyte lineage gene-1 expression was upregulated, and reached a peak 24 hours after transfection. Oligodendrocyte lineage gene-1 transfection induced no significant differences in hypoxia-inducible factor 1α levels in rat brain tissues with oxygen-glucose deprivation. These experimental findings indicate that hypoxia-inducible factor 1α can regulate oligodendrocyte lineage gene-1 expression in hypoxic brain tissue, thus repairing the neural impairment. PMID:25206673

  6. Hypoxia-inducible factor 2alpha binds to cobalt in vitro.

    PubMed

    Yuan, Y; Beitner-Johnson, D; Millhorn, D E

    2001-11-01

    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element (HRE). The alpha subunit of the HIF transcription factors is degraded by proteasome pathways during normoxia, but stabilized under hypoxic conditions. It has previously been established that cobalt causes accumulation of HIF-2alpha and HIF-1alpha. However, little is known about the mechanism by which cobalt mimics hypoxia and stabilizes these transcription factors. We show here that cobalt binds directly to HIF-2alpha in vitro with a high affinity and in an oxygen-dependent manner. We found that HIF-2alpha, which had been stabilized with a proteasome inhibitor, could bind to cobalt, whereas hypoxia-stabilized HIF-2alpha could not. Mutations within the oxygen-dependent degradation domain of HIF-2alpha prevented cobalt binding and led to accumulation of HIF-2alpha during normoxia. This suggests that transition metal such as iron may play a role in regulation of HIF-2alpha in vivo. PMID:11688986

  7. Transcriptional repression of Na-K-2Cl cotransporter NKCC1 by hypoxia-inducible factor-1.

    PubMed

    Ibla, Juan C; Khoury, Joseph; Kong, Tianqing; Robinson, Andreas; Colgan, Sean P

    2006-08-01

    Tissue edema is commonly associated with hypoxia. Generally, such episodes of fluid accumulation are self-limiting. At present, little is known about mechanisms to compensate excessive fluid transport. Here we describe an adaptive mechanism to dampen fluid loss during hypoxia. Initial studies confirmed previous observations of attenuated electrogenic Cl- secretion after epithelial hypoxia. A screen of known ion transporters in Cl- -secreting epithelia revealed selective downregulation of Na-K-2Cl cotransporter NKCC1 mRNA, protein, and function. Subsequent studies identified transcriptional repression of NKCC1 mediated by hypoxia-inducible factor (HIF). Chromatin immunoprecipitation analysis identified a functional HIF binding site oriented on the antisense strand of genomic DNA downstream of the transcription start site corresponding to the NKCC1 5'-untranslated region. Additional in vivo studies using conditional Hif1a-null mice revealed that the loss of HIF-1alpha in Cl- -secreting epithelia results in a loss of NKCC1 repression. These studies describe a novel regulatory pathway for NKCC1 transcriptional repression by hypoxia. These results suggest that HIF-dependent repression of epithelial NKCC1 may provide a compensatory mechanism to prevent excessive fluid loss during hypoxia. PMID:16571862

  8. Biosynthetic incorporation of [3H]ethanolamine into protein synthesis elongation factor 1 alpha reveals a new post-translational protein modification.

    PubMed

    Rosenberry, T L; Krall, J A; Dever, T E; Haas, R; Louvard, D; Merrick, W C

    1989-05-01

    Biosynthetic incorporation of [3H]ethanolamine into proteins was assessed in the human erythroleukemia cell line K562. A single predominant labeled protein of about 50 kDa was observed following electrophoresis of cell extracts on polyacrylamide gels in the presence of sodium dodecyl sulfate. Subcellular fractionation showed this protein to distribute similarly to a 46-kDa [3H]ethanolamine-labeled protein reported previously (Tisdale, E. J., and Tartakoff, A. M. (1988) J. Biol. Chem. 263, 8244-8252). In particular, the protein was enriched in cytosolic and microsomal fractions relative to plasma membrane and thus did not appear to correspond to the class of proteins with glycoinositol phospholipid anchors, the only post-translational protein modification involving ethanolamine that had been described previously. Two-dimensional polyacrylamide gel analysis involving isoelectric focusing followed by electrophoresis in sodium dodecyl sulfate indicated that the protein was very basic, and nitrocellulose blots of one- and two-dimensional gels subjected to 3H autoradiography and immunostaining with antisera to purified rabbit elongation factor (EF) 1 alpha revealed that the protein was EF-1 alpha. Copurification of rabbit EF-1 alpha and the [3H]ethanolamine-labeled protein from K562 cells further supported this identification. Analysis of tryptic fragments produced from the copurified proteins by reverse-phase high pressure liquid chromatography showed two radiolabeled peptides. Amino acid analysis demonstrated 1 residue of ethanolamine in each peptide, and peptide sequencing revealed that the ethanolamine-containing component(s) was attached to Glu301 and Glu374 in the EF-1 alpha protein sequence deduced from a human EF-1 alpha cDNA. These data confirm a new class of post-translational protein modifications involving ethanolamine. PMID:2708357

  9. Diversification of the microtubule system in the early stage of eukaryote evolution: elongation factor 1 alpha and alpha-tubulin protein phylogeny of termite symbiotic oxymonad and hypermastigote protists.

    PubMed

    Moriya, S; Tanaka, K; Ohkuma, M; Sugano, S; Kudo, T

    2001-01-01

    The symbiotic protists of the lower termite have been regarded as a model of early-branched eukaryotes because of their simple cellular systems and morphological features. However, cultivation of these symbiotic protists is very difficult. For this reason, these interesting protists have not been well characterized in terms of their molecular biology. In research on these organisms which have not yet been cultivated, we developed a method for retrieving specific genes from a small number of cells, through micromanipulation without axenic cultivation, and we obtained EF-1 alpha and alpha-tubulin genes from members of the Hypermastigida--the parabasalid protist Trichonympha agilis and the oxymonad protists Pyrsonympha grandis and Dinenympha exilis--from the termite Reticulitermes speratus gut community. Results of phylogenetic analysis of the amino acid sequences of both proteins, EF-1 alpha and alpha-tubulin, indicate that the hypermastigid, parabasalid, and oxymonad protists do not share a close common ancestor. In addition, although the EF-1 alpha phylogeny indicates that these two groups of protists branched at an early stage of eukaryotic evolution, the alpha-tubulin phylogeny indicates that these protists can be assigned to two diversified clades. As shown in a recent investigation of alpha-tubulin phylogeny, eukaryotic organisms can be divided into three classes: an animal--parabasalids clade, a plant--protists clade, and the diplomonads. In this study, we show that parabasalids, including hypermastigids, can be classified as belonging to the animal--parabasalids clade and the early-branching eukaryote oxymonads can be classified as belonging to the plant--protists clade. Our findings suggest that these protists have a cellular microtubule system that has diverged considerably, and it seems that such divergence of the microtubule system occurred in the earliest stage of eukaryotic evolution.

  10. A novel role for 3, 4-dichloropropionanilide (DCPA) in the inhibition of prostate cancer cell migration, proliferation, and hypoxia-inducible factor 1alpha expression

    PubMed Central

    Jiang, Bing-Hua; Liu, Ling-Zhi; Schafer, Rosana; Flynn, Daniel C; Barnett, John B

    2006-01-01

    Background The amide class compound, 3, 4-dichloropropionanilide (DCPA) is known to affect multiple signaling pathways in lymphocyte and macrophage including the inhibition of NF-κB ability. However, little is known about the effect of DCPA in cancer cells. Hypoxia-inducible factor 1 (HIF-1) regulates the expression of many genes including vascular endothelial growth factor (VEGF), heme oxygenase 1, inducible nitric oxide synthase, aldolase, enolase, and lactate dehydrogenase A. HIF-1 expression is associated with tumorigenesis and angiogenesis. Methods We used Transwell assay to study cell migration, and used immunoblotting to study specific protein expression in the cells. Results In this report, we demonstrate that DCPA inhibited the migration and proliferation of DU145 and PC-3 prostate cancer cells induced by serum, insulin, and insulin-like growth factor I (IGF-I). We found that DCPA inhibited HIF-1 expression in a subunit-specific manner in these cancer cell lines induced by serum and growth factors, and decreased HIF-1α expression by affecting its protein stability. Conclusion DCPA can inhibit prostate cancer cell migration, proliferation, and HIF-1α expression, suggesting that DCPA could be potentially used for therapeutic purpose for prostate cancer in the future. PMID:16884534

  11. Asymmetric dimethyl arginine induces pulmonary vascular dysfunction via activation of signal transducer and activator of transcription 3 and stabilization of hypoxia-inducible factor 1-alpha.

    PubMed

    Pekarova, Michaela; Koudelka, Adolf; Kolarova, Hana; Ambrozova, Gabriela; Klinke, Anna; Cerna, Anna; Kadlec, Jaroslav; Trundova, Maria; Sindlerova Svihalkova, Lenka; Kuchta, Radek; Kuchtova, Zdenka; Lojek, Antonin; Kubala, Lukas

    2015-10-01

    Pulmonary hypertension (PH), associated with imbalance in vasoactive mediators and massive remodeling of pulmonary vasculature, represents a serious health complication. Despite the progress in treatment, PH patients typically have poor prognoses with severely affected quality of life. Asymmetric dimethyl arginine (ADMA), endogenous inhibitor of endothelial nitric oxide synthase (eNOS), also represents one of the critical regulators of pulmonary vascular functions. The present study describes a novel mechanism of ADMA-induced dysfunction in human pulmonary endothelial and smooth muscle cells. The effect of ADMA was compared with well-established model of hypoxia-induced pulmonary vascular dysfunction. It was discovered for the first time that ADMA induced the activation of signal transducer and activator of transcription 3 (STAT3) and stabilization of hypoxia inducible factor 1α (HIF-1α) in both types of cells, associated with drastic alternations in normal cellular functions (e.g., nitric oxide production, cell proliferation/Ca(2+) concentration, production of pro-inflammatory mediators, and expression of eNOS, DDAH1, and ICAM-1). Additionally, ADMA significantly enhanced the hypoxia-mediated increase in the signaling cascades. In summary, increased ADMA may lead to manifestation of PH phenotype in human endothelial and smooth muscle cells via the STAT3/HIF-1α cascade. Therefore this signaling pathway represents the potential pathway for future clinical interventions in PH. PMID:26091577

  12. Temporal expression of the human alcohol dehydrogenase gene family during liver development correlates with differential promoter activation by hepatocyte nuclear factor 1, CCAAT/enhancer-binding protein alpha, liver activator protein, and D-element-binding protein.

    PubMed Central

    van Ooij, C; Snyder, R C; Paeper, B W; Duester, G

    1992-01-01

    The human class I alcohol dehydrogenase (ADH) gene family consists of ADH1, ADH2, and ADH3, which are sequentially activated in early fetal, late fetal, and postnatal liver, respectively. Analysis of ADH promoters revealed differential activation by several factors previously shown to control liver transcription. In cotransfection assays, the ADH1 promoter, but not the ADH2 or ADH3 promoter, was shown to respond to hepatocyte nuclear factor 1 (HNF-1), which has previously been shown to regulate transcription in early liver development. The ADH2 promoter, but not the ADH1 or ADH3 promoter, was shown to respond to CCAAT/enhancer-binding protein alpha (C/EBP alpha), a transcription factor particularly active during late fetal liver and early postnatal liver development. The ADH1, ADH2, and ADH3 promoters all responded to the liver transcription factors liver activator protein (LAP) and D-element-binding protein (DBP), which are most active in postnatal liver. For all three promoters, the activation by LAP or DBP was higher than that seen by HNF-1 or C/EBP alpha, and a significant synergism between C/EBP alpha and LAP was noticed for the ADH2 and ADH3 promoters when both factors were simultaneously cotransfected. A hierarchy of ADH promoter responsiveness to C/EBP alpha and LAP homo- and heterodimers is suggested. In all three ADH genes, LAP bound to the same four sites previously reported for C/EBP alpha (i.e., -160, -120, -40, and -20 bp), but DBP bound strongly only to the site located at -40 bp relative to the transcriptional start. Mutational analysis of ADH2 indicated that the -40 bp element accounts for most of the promoter regulation by the bZIP factors analyzed. These studies suggest that HNF-1 and C/EBP alpha help establish ADH gene family transcription in fetal liver and that LAP and DBP help maintain high-level ADH gene family transcription in postnatal liver. Images PMID:1620113

  13. High Nuclear Hypoxia-Inducible Factor 1 Alpha Expression Is a Predictor of Distant Recurrence in Patients With Resected Pancreatic Adenocarcinoma

    SciTech Connect

    Colbert, Lauren E.; Fisher, Sarah B.; Balci, Serdar; Saka, Burcu; Chen, Zhengjia; Kim, Sungjin; El-Rayes, Bassel F.; Adsay, N. Volkan; Maithel, Shishir K.; Landry, Jerome C.; and others

    2015-03-01

    Purpose: To evaluate nuclear hypoxia-inducible factor 1α (HIF-1α) expression as a prognostic factor for distant recurrence (DR) and local recurrence (LR) after pancreatic adenocarcinoma resection. Methods and Materials: Tissue specimens were collected from 98 patients with pancreatic adenocarcinoma who underwent resection without neoadjuvant therapy between January 2000 and December 2011. Local recurrence was defined as radiographic or pathologic evidence of progressive disease in the pancreas, pancreatic bed, or associated nodal regions. Distant recurrence was defined as radiographically or pathologically confirmed recurrent disease in other sites. Immunohistochemical staining was performed and scored by an independent pathologist blinded to patient outcomes. High HIF-1α overall expression score was defined as high percentage and intensity staining and thus score >1.33. Univariate analysis was performed for HIF-1α score with LR alone and with DR. Multivariate logistic regression was used to determine predictors of LR and DR. Results: Median follow-up time for all patients was 16.3 months. Eight patients (8%) demonstrated isolated LR, 26 patients (26.5%) had isolated DR, and 13 patients had both LR and DR. Fifty-three patients (54%) had high HIF-1α expression, and 45 patients (46%) had low HIF-1α expression. High HIF-1α expression was significantly associated with DR (P=.03), and low HIF-1α expression was significantly associated with isolated LR (P=.03). On multivariate logistic regression analysis, high HIF-1α was the only significant predictor of DR (odds ratio 2.46 [95% confidence interval 1.06-5.72]; P=.03). In patients with a known recurrence, an HIF-1α score ≥2.5 demonstrated a specificity of 100% for DR. Conclusions: High HIF-1α expression is a significant predictor of distant failure versus isolated local failure in patients undergoing resection of pancreatic adenocarcinoma. Expression of HIF-1α may have utility in determining candidates for

  14. Irradiation-Induced Regulation of Plasminogen Activator Inhibitor Type-1 and Vascular Endothelial Growth Factor in Six Human Squamous Cell Carcinoma Lines of the Head and Neck

    SciTech Connect

    Artman, Tuuli; Schilling, Daniela; Multhoff, Gabriele

    2010-02-01

    Purpose: It has been shown that plasminogen activator inhibitor type-1 (PAI-1) and vascular endothelial growth factor (VEGF) are involved in neo-angiogenesis. The aim of this study was to investigate the irradiation-induced regulation of PAI-1 and VEGF in squamous cell carcinomas of the head and neck (SCCHN) cell lines of varying radiation sensitivity. Methods and Materials: Six cell lines derived from SCCHN were investigated in vitro. The colorimetric AlamarBlue assay was used to detect metabolic activity of cell lines during irradiation as a surrogate marker for radiation sensitivity. PAI-1 and VEGF secretion levels were measured by enzyme-linked immunosorbent assay 24, 48, and 72 h after irradiation with 0, 2, 6, and 10 Gy. The direct radioprotective effect of exogenous PAI-1 was measured using the clonogenic assay. For regulation studies, transforming growth factor-beta1 (TGF-beta1), hypoxia-inducible factor-1alpha (HIF-1alpha), hypoxia-inducible factor-2alpha (HIF-2alpha), or both HIF-1alpha and HIF-2alpha were downregulated using siRNA. Results: Although baseline levels varied greatly, irradiation led to a comparable dose-dependent increase in PAI-1 and VEGF secretion in all six cell lines. Addition of exogenous stable PAI-1 to the low PAI-1-expressing cell lines, XF354 and FaDu, did not lead to a radioprotective effect. Downregulation of TGF-beta1 significantly decreased VEGF secretion in radiation-sensitive XF354 cells, and downregulation of HIF-1alpha and HIF-2alpha reduced PAI-1 and VEGF secretion in radiation-resistant SAS cells. Conclusions: Irradiation dose-dependently increased PAI-1 and VEGF secretion in all SCCHN cell lines tested regardless of their basal levels and radiation sensitivity. In addition, TGF-beta1 and HIF-1alpha could be partly responsible for VEGF and PAI-1 upregulation after irradiation.

  15. In vitro and in vivo characterization of a dual-function green fluorescent protein--HSV1-thymidine kinase reporter gene driven by the human elongation factor 1 alpha promoter.

    PubMed

    Luker, Gary D; Luker, Kathryn E; Sharma, Vijay; Pica, Christina M; Dahlheimer, Julie L; Ocheskey, Joe A; Fahrner, Timothy J; Milbrandt, Jeffrey; Piwnica-Worms, David

    2002-01-01

    Toward the goal of monitoring activity of native mammalian promoters with molecular imaging techniques, we stably transfected DU145 prostate carcinoma cells with a fusion construct of enhanced green fluorescent protein (EGFP) and wild-type herpes simplex virus-1 thymidine kinase (HSV1-TK) as a reporter gene driven by the promoter for human elongation factor 1 alpha (EF-1 alpha-EGFP-TK). Using this model system, expression of EGFP was quantified by flow cytometry and fluorescence microscopy, while the HSV1-TK component of the reporter was quantified with 8-[3H]ganciclovir (8-[3H]GCV). As analyzed by flow cytometry, passage of EGFP-TK-DU145 transfected cells (ETK) in vitro resulted in populations of cells with high and low expression of EGFP over time. High and low ETK cells retained 23-fold and 5-fold more GCV, respectively, than control. While differences in uptake and retention of GCV corresponded to relative expression of the reporter gene in each subpopulation of cells as determined by both flow cytometry (EGFP) and quantitative RT-PCR, the correlation was not linear. Furthermore, in high ETK cells, net retention of various radiolabeled nucleoside analogues varied; the rank order was 8-[3H]GCV < 9-(4-fluoro-3-hydroxymethylbutyl)guanine ([18F]FHBG) approximately 8-[3H]penciclovir (8-[3H]PCV) < 2'-fluoro-2'-deoxy-5-iodouracil-beta-D-arabinofuranoside (2-[14C]FIAU). Xenograft tumors of ETK cells in vivo accumulated 2.5-fold more 8-[3H]GCV per gram of tissue and showed greater fluorescence from EGFP than control DU145 cells, demonstrating that the reporter gene functioned in vivo. These data extend previous reports by showing that a human promoter can be detected in vitro and in vivo with a dual-function reporter exploiting optical and radiotracer techniques. PMID:12920846

  16. Gene expression in the Andes; relevance to neurology at sea level.

    PubMed

    Appenzeller, Otto; Minko, Tamara; Pozharov, Vitaly; Bonfichi, Maurizio; Malcovati, Luca; Gamboa, Jorge; Bernardi, Luciano

    2003-03-15

    Chronic mountain sickness (CMS), a maladaptation syndrome to chronic hypoxia, occurs in the Andes. Gene expression differences in Andeans could explain adaptation and maladaptation to hypoxia, both of which are relevant to neurology at sea level. Expression of genes responsive to cellular oxygen concentration, hypoxia-inducible factor-1alpha (HIF-1alpha), three splicing variants of vascular endothelial growth factor (VEGF) and von Hippel-Lindau protein (pVHL) was measured by reverse transcription polymerase chain reaction (RT-PCR) in 12 Cerro de Pasco (CP) (altitude 4338 m) natives and 15 CMS patients in CP. Thirteen high altitude natives living in Lima and five Lima natives were sea level controls. A CMS score (CMS-sc) was assigned clinically. Expression was related to the clinical assessment. High expression of HIF-1alpha and VEGF-121 was found in CMS (P<0.001). Samples from CP had higher expression than those from Lima (P<0.001). Expression of HIF-1alpha and VEGF-121 was related to age (P<0.001); adjusting for age did not abolish the group effect. Higher CMS-sc was related to expression independent of age (P<0.001). VEGF-165 and -189 were expressed only in CMS. Birth altitude had no effect on gene expression. pVHL was not quantifiable.HIF-1alpha and VEGF-121 participate in adaptation to hypoxia. The high levels may explain blood vessel proliferation in Andeans and hold lessons for patients at sea level. VEGF-165 expression suggests that it contributes to preservation of neuronal function in human chronic hypoxia. VHL mutations may mark those destined to develop neural crest tumors which are common in the Andes.

  17. Defining the anatomical localisation of subsets of the murine mononuclear phagocyte system using integrin alpha X (Itgax, CD11c) and colony stimulating factor 1 receptor (Csf1r, CD115) expression fails to discriminate dendritic cells from macrophages.

    PubMed

    Bradford, Barry M; Sester, David P; Hume, David A; Mabbott, Neil A

    2011-11-01

    The murine mononuclear phagocyte (MNP) system comprises a diverse population of cells, including monocytes, dendritic cells (DC) and macrophages. Derived from the myeloid haematopoietic lineage, this group of cells express a variety of well characterized surface markers. Expression of the integrin alpha X (Itgax, CD11c) is commonly used to identify classical DC, and similarly expression of colony stimulating factor 1 receptor (Csf1r, CD115) to identify macrophages. We have characterized the expression of these markers using a variety of transgenic mouse models. We confirmed previous observations of Itgax expression in anatomically defined subsets of MNPs in secondary lymphoid organs, including all MNPs identified within the germinal centres. The majority of MNPs in the intestinal lamina propria and lung express Itgax. All mucosal Itgax expressing cells also express Csf1r suggesting Csf1-dependent haematopoietic derivation. This double-positive population included germinal centre MNPs. These data reveal that Itgax expression alone does not specifically define classical DC. These results suggest more cautious interpretation of Itgax-dependent experimentation and direct equation with uniquely DC-mediated activities, particularly in the functioning of non-lymphoid MNPs within the intestinal lamina propria.

  18. The dietary flavonoid kaempferol effectively inhibits HIF-1 activity and hepatoma cancer cell viability under hypoxic conditions

    SciTech Connect

    Mylonis, Ilias; Lakka, Achillia; Tsakalof, Andreas; Simos, George

    2010-07-16

    Research highlights: {yields} Kaempferol inhibits HIF-1 activity in hepatocarcinoma cells; {yields} Kaempferol causes cytoplasmic mislocalization of HIF-1{alpha} by impairing the MAPK pathway. {yields} Viability of hepatocarcinoma cells under hypoxia is reduced by kaempferol. -- Abstract: Hepatocellular carcinoma (HCC) is characterized by high mortality rates and resistance to conventional treatment. HCC tumors usually develop local hypoxia, which stimulates proliferation of cancer cells and renders them resilient to chemotherapy. Adaptation of tumor cells to the hypoxic conditions depends on the hypoxia-inducible factor 1 (HIF-1). Over-expression of its regulated HIF-1{alpha} subunit, an important target of anti-cancer therapy, is observed in many cancers including HCC and is associated with severity of tumor growth and poor patient prognosis. In this report we investigate the effect of the dietary flavonoid kaempferol on activity, expression levels and localization of HIF-1{alpha} as well as viability of human hepatoma (Huh7) cancer cells. Treatment of Huh7 cells with kaempferol under hypoxic conditions (1% oxygen) effectively inhibited HIF-1 activity in a dose-dependent manner (IC{sub 50} = 5.16 {mu}M). The mechanism of this inhibition did not involve suppression of HIF-1{alpha} protein levels but rather its mislocalization into the cytoplasm due to inactivation of p44/42 MAPK by kaempferol (IC{sub 50} = 4.75 {mu}M). Exposure of Huh7 cells to 10 {mu}{Mu} kaempferol caused significant reduction of their viability, which was remarkably more evident under hypoxic conditions. In conclusion, kaempferol, a non-toxic natural food component, inhibits both MAPK and HIF-1 activity at physiologically relevant concentrations (5-10 {mu}M) and suppresses hepatocarcinoma cell survival more efficiently under hypoxia. It has, therefore, potential as a therapeutic or chemopreventive anti-HCC agent.

  19. The potential mechanism of tiliroside-dependent inhibition of t-butylhydroperoxide-induced oxidative stress in endometrial carcinoma cells.

    PubMed

    Tomczyk, Michal; Tumanov, Aleksander; Zaniewska, Agnieszka; Surazynski, Arkadiusz

    2010-07-01

    The effects of oxidative stress on collagen and DNA biosynthesis, beta-galactosidase activity, the expression of the beta-integrin receptor, FAK, the insulin-like growth factor-I receptor (IGF-IR), the hypoxia-inducible factor-1 (HIF-1), and the mitogen-activated protein kinases (MAP/ERK(1), ERK(2)) were evaluated in human endometrial carcinoma cells. Subconfluent cells were subjected to oxidative stress with 30 microM t-butylhydroperoxide (t-BHP) for 1 h per day over the course of 5 days. It was found that oxidative stress contributed to an increase in the beta-galactosidase activity as well as to the inhibition of collagen and DNA biosynthesis. The mechanism of the process was found at the level of IGF-IR and HIF-1 alpha. An increase in the expression of HIF-1 alpha and a decrease in the expression of IGF-IR were observed in the cells subjected to oxidative stress. The role of IGF-IR signalling in the process was confirmed by an experiment showing downregulation of MAP kinases ERK(1) and ERK(2) expression in the studied cells. This phenomenon is probably responsible for the drastic inhibition of protein (up to 40 % of control) and DNA biosynthesis (up to 65 % of control) in the cells. An addition of tiliroside to the cells medium restored all parameters to the control level, including IGF-IR and HIF-1 alpha expressions. The data suggest that the antioxidative activity of tiliroside isolated from Potentilla argentea may originate at the level of IGF-IR and HIF-1 alpha signalling.

  20. Developmental study of the distribution of hypoxia-induced factor-1 alpha and microtubule-associated protein 2 in children's brainstem: comparison between controls and cases with signs of perinatal hypoxia.

    PubMed

    Coveñas, R; González-Fuentes, J; Rivas-Infante, E; Lagartos-Donate, M J; Cebada-Sánchez, S; Arroyo-Jiménez, M M; Insausti, R; Marcos, P

    2014-06-20

    Perinatal asphyxia and hypoxia are common causes of morbidity in neonates. Prenatal birth associated with hypoxemia often results in several disorders because of the lack of oxygen in the brain. Survival rates from perinatal hypoxia have improved, but appropriate treatments for recovery are still limited, with great impact on patients, their families, society in general and health systems. The aim of this work is to contribute to a better understanding of the cellular mechanisms underlying the brainstem responses to hypoxia. For this purpose, distributions of two proteins, hypoxia-inducible factor-1 alpha (HIF-1α) and microtubule-associated protein 2 (MAP-2) were analyzed in brainstems of 11 children, four of them showing neuropathological evidence of brain hypoxia. They were included in control or hypoxic groups, and then in several subgroups according to their age. Immunohistochemical labeling for these proteins revealed only cell bodies containing HIF-1α, and both cell bodies and fibers positive for MAP-2 in the children's brainstems. The distribution of HIF-1α was more restricted than that of MAP-2, and it can be suggested that the expression of HIF-1α increased with age. The distribution pattern of MAP-2 in the medulla oblongata could be more due to age-related changes than to a response to hypoxic damage, whereas in the pons several regions, such as the nucleus ambiguus or the solitary nucleus, showed different immunolabeling patterns in controls and hypoxic cases. The distribution patterns of these two proteins suggest that some brainstem regions, such as the reticular formation or the central gray, could be less affected by conditions of hypoxia.

  1. PNRC: a proline-rich nuclear receptor coregulatory protein that modulates transcriptional activation of multiple nuclear receptors including orphan receptors SF1 (steroidogenic factor 1) and ERRalpha1 (estrogen related receptor alpha-1).

    PubMed

    Zhou, D; Quach, K M; Yang, C; Lee, S Y; Pohajdak, B; Chen, S

    2000-07-01

    PNRC (proline-rich nuclear receptor coregulatory protein) was identified using bovine SF1 (steroidogenic factor 1) as the bait in a yeast two-hybrid screening of a human mammary gland cDNA expression library. PNRC is unique in that it has a molecular mass of 35 kDa, significantly smaller than most of the coregulatory proteins reported so far, and it is proline-rich. PNRC's nuclear localization was demonstrated by immunofluorescence and Western blot analyses. In the yeast two-hybrid assays, PNRC interacted with the orphan receptors SF1 and ERRalpha1 in a ligand-independent manner. PNRC was also found to interact with the ligand-binding domains of all the nuclear receptors tested including estrogen receptor (ER), androgen receptor (AR), glucocorticoid receptor (GR), progesterone receptor (PR), thyroid hormone receptor (TR), retinoic acid receptor (RAR), and retinoid X receptor (RXR) in a ligand-dependent manner. Functional AF2 domain is required for nuclear receptors to bind to PNRC. Furthermore, in vitro glutathione-S-transferase pull-down assay was performed to demonstrate a direct contact between PNRC and nuclear receptors such as SF1. Coimmunoprecipitation experiment using Hela cells that express PNRC and ER was performed to confirm the interaction of PNRC and nuclear receptors in vivo in a ligand-dependent manner. PNRC was found to function as a coactivator to enhance the transcriptional activation mediated by SF1, ERR1 (estrogen related receptor alpha-1), PR, and TR. By examining a series of deletion mutants of PNRC using the yeast two-hybrid assay, a 23-amino acid (aa) sequence in the carboxy-terminal region, aa 278-300, was shown to be critical and sufficient for the interaction with nuclear receptors. This region is proline rich and contains a SH3-binding motif, S-D-P-P-S-P-S. Results from the mutagenesis study demonstrated that the two conserved proline (P) residues in this motif are crucial for PNRC to interact with the nuclear receptors. The exact 23

  2. PI3K/Akt contributes to increased expression of Toll-like receptor 4 in macrophages exposed to hypoxic stress

    SciTech Connect

    Kim, So Young; Jeong, Eunshil; Joung, Sun Myung; Lee, Joo Young

    2012-03-16

    Highlights: Black-Right-Pointing-Pointer Hypoxic stress-induced TLR4 expression is mediated by PI3K/Akt in macrophages. Black-Right-Pointing-Pointer PI3K/Akt regulated HIF-1 activation leading to TLR4 expression. Black-Right-Pointing-Pointer p38 mitogen-activated protein kinase was not involved in TLR4 expression by hypoxic stress. Black-Right-Pointing-Pointer Sulforaphane suppressed hypoxia-mediated TLR4 expression by inhibiting PI3K/Akt. -- Abstract: Toll-like receptors (TLRs) play critical roles in triggering immune and inflammatory responses by detecting invading microbial pathogens and endogenous danger signals. Increased expression of TLR4 is implicated in aggravated inflammatory symptoms in ischemic tissue injury and chronic diseases. Results from our previous study showed that TLR4 expression was upregulated by hypoxic stress mediated by hypoxia-inducible factor-1 (HIF-1) at a transcriptional level in macrophages. In this study, we further investigated the upstream signaling pathway that contributed to the increase of TLR4 expression by hypoxic stress. Either treatment with pharmacological inhibitors of PI3K and Akt or knockdown of Akt expression by siRNA blocked the increase of TLR4 mRNA and protein levels in macrophages exposed to hypoxia and CoCl{sub 2}. Phosphorylation of Akt by hypoxic stress preceded nuclear accumulation of HIF-1{alpha}. A PI3K inhibitor (LY294002) attenuated CoCl{sub 2}-induced nuclear accumulation and transcriptional activation of HIF-1{alpha}. In addition, HIF-1{alpha}-mediated upregulation of TLR4 expression was blocked by LY294002. Furthermore, sulforaphane suppressed hypoxia- and CoCl{sub 2}-induced upregulation of TLR4 mRNA and protein by inhibiting PI3K/Akt activation and the subsequent nuclear accumulation and transcriptional activation of HIF-1{alpha}. However, p38 was not involved in HIF-1{alpha} activation and TLR4 expression induced by hypoxic stress in macrophages. Collectively, our results demonstrate that PI3K

  3. Hypoxia-Inducible Factor 2 Alpha Is Essential for Hepatic Outgrowth and Functions via the Regulation of leg1 Transcription in the Zebrafish Embryo

    PubMed Central

    Lin, Tzung-Yi; Chou, Chi-Fu; Chung, Hsin-Yu; Chiang, Chia-Yin; Li, Chung-Hao; Wu, Jen-Leih; Lin, Han-Jia; Pai, Tun-Wen; Hu, Chin-Hwa; Tzou, Wen-Shyong

    2014-01-01

    The liver plays a vital role in metabolism, detoxification, digestion, and the maintenance of homeostasis. During development, the vertebrate embryonic liver undergoes a series of morphogenic processes known as hepatogenesis. Hepatogenesis can be separated into three interrelated processes: endoderm specification, hepatoblast differentiation, and hepatic outgrowth. Throughout this process, signaling molecules and transcription factors initiate and regulate the coordination of cell proliferation, apoptosis, differentiation, intercellular adhesion, and cell migration. Hifs are already recognized to be essential in embryonic development, but their role in hepatogenesis remains unknown. Using the zebrafish embryo as a model organism, we report that the lack of Hif2-alpha but not Hif1-alpha blocks hepatic outgrowth. While Hif2-alpha is not involved in hepatoblast specification, this transcription factor regulates hepatocyte cell proliferation during hepatic outgrowth. Furthermore, we demonstrated that the lack of Hif2-alpha can reduce the expression of liver-enriched gene 1 (leg1), which encodes a secretory protein essential for hepatic outgrowth. Additionally, exogenous mRNA expression of leg1 can rescue the small liver phenotype of hif2-alpha morphants. We also showed that Hif2-alpha directly binds to the promoter region of leg1 to control leg1 expression. Interestingly, we discovered overrepresented, high-density Hif-binding sites in the potential upstream regulatory sequences of leg1 in teleosts but not in terrestrial mammals. We concluded that hif2-alpha is a key factor required for hepatic outgrowth and regulates leg1 expression in zebrafish embryos. We also proposed that the hif2-alpha-leg1 axis in liver development may have resulted from the adaptation of teleosts to their environment. PMID:25000307

  4. Hypoxia dysregulates the production of adiponectin and plasminogen activator inhibitor-1 independent of reactive oxygen species in adipocytes

    SciTech Connect

    Chen Baoying; Lam, Karen S.L.; Wang Yu; Wu Donghai; Lam, Michael C.; Shen Jiangang; Wong Laiching; Hoo, Ruby L.C.; Zhang Jialiang; Xu Aimin . E-mail: amxu@hkucc.hku.hk

    2006-03-10

    Low plasma levels of adiponectin (hypoadiponectinemia) and elevated circulating concentrations of plasminogen activator inhibitor (PAI)-1 are causally associated with obesity-related insulin resistance and cardiovascular disease. However, the mechanism that mediates the aberrant production of these two adipokines in obesity remains poorly understood. In this study, we investigated the effects of hypoxia and reactive oxygen species (ROS) on production of adiponectin and PAI-1 in 3T3-L1 adipocytes. Quantitative PCR and immunoassays showed that ambient hypoxia markedly suppressed adiponectin mRNA expression and its protein secretion, and increased PAI-1 production in mature adipocytes. Dimethyloxallyl glycine, a stabilizer of hypoxia-inducible factor 1{alpha} (HIF-1{alpha}), mimicked the hypoxia-mediated modulations of these two adipokines. Hypoxia caused a modest elevation of ROS in adipocytes. However, ablation of intracellular ROS by antioxidants failed to alleviate hypoxia-induced aberrant production of adiponectin and PAI-1. On the other hand, the antioxidants could reverse hydrogen peroxide (H{sub 2}O{sub 2})-induced dysregulation of adiponectin and PAI-1 production. H{sub 2}O{sub 2} treatment decreased the expression levels of peroxisome proliferator-activated receptor gamma (PPAR{gamma}) and CCAAT/enhancer binding protein (C/EBP{alpha}), but had no effect on HIF-1{alpha}, whereas hypoxia stabilized HIF-1{alpha} and decreased expression of C/EBP{alpha}, but not PPAR{gamma}. Taken together, these data suggest that hypoxia and ROS decrease adiponectin production and augment PAI-1 expression in adipocytes via distinct signaling pathways. These effects may contribute to hypoadiponectinemia and elevated PAI-1 levels in obesity, type 2 diabetes, and cardiovascular diseases.

  5. Down-regulation of stromal cell-derived factor-1alpha-induced T cell chemotaxis by a peptide based on the complementarity-determining region 1 of an anti-DNA autoantibody via up-regulation of TGF-beta secretion.

    PubMed

    Sela, Uri; Hershkoviz, Rami; Cahalon, Liora; Lider, Ofer; Mozes, Edna

    2005-01-01

    Systemic lupus erythematosus (SLE) can be induced in mice by immunizing them with a monoclonal human anti-DNA Ab that expresses a major Id, designated 16/6Id. In addition, a peptide based on the sequence of the CDR 1 (hCDR1) of the 16/6Id ameliorated the clinical manifestations of SLE in experimental models. In this study we examined the effects of treating mice with human complementary-determining region 1 (hCDR1) on the subsequent chemotaxis of T cells derived from 16/6Id-primed mice. First we demonstrated elevated levels of stromal cell-derived factor-1alpha (SDF-1alpha) in the sera of SLE-afflicted mice and in the sera and lymphoid tissues of 16/6Id-immunized BALB/c mice shortly after the immunization. We then found that administration of hCDR1 to 16/6Id-immunized mice specifically down-regulated SDF1alpha-induced T cell chemotaxis through fibronectin and collagen type I. This was accompanied by diminished SDF1-alpha-induced T cell adhesion and ERK phosphorylation. Treatment with hCDR1 up-regulated TGF-beta secretion, which, in turn, inhibited the murine T cell adhesion to and chemotaxis through fibronectin as well as their ERK phosphorylation. Thus, the secretion of TGF-beta after treatment of 16/6Id-immunized mice with hCDR1 plays an important role in the down-regulation of SDF-1alpha-mediated T cell activation and the interactions with extracellular matrix moieties observed in the present study. PMID:15611253

  6. Pancreatic and duodenal homeobox gene 1 (Pdx1) down-regulates hepatic transcription factor 1 alpha (HNF1α) expression during reprogramming of human hepatic cells into insulin-producing cells

    PubMed Central

    Donelan, William; Li, Shiwu; Wang, Hai; Lu, Shun; Xie, Chao; Tang, Dongqi; Chang, Lung-Ji; Yang, Li-Jun

    2015-01-01

    Ectopic expression of Pdx1 triggers rapid hepatocyte dedifferentiation by down-regulating liver-enriched transcription factors and liver-specific functional genes such as hepatic nuclear factor-1α (HNF1α), albumin, and AAT. However, the links between Pdx1 over-expression and hepatic gene down-regulation are incompletely understood. HNF1α and HNF4α are important transcription factors that establish and maintain the hepatocyte phenotype. The human HNF4α gene contains two promoters (P1 and P2) that drive expression of P1-(HNF4α 1-6) or P2-(HNF4α 7-9)-derived isoforms, which are used in different tissues and at different times during development. We hypothesized that the relative expression of HNF1α and HNF4α following ectopic Pdx1 expression may promote hepatic cell dedifferentiation and transdifferentiation toward pancreatic beta-cells. We produced lentiviruses expressing Pdx1, Pdx1-VP16, and Ngn3, along with dual-color reporter genes to indicate hepatic and pancreatic beta-cell phenotype changes. Using these PTF alone or in combinations, we demonstrated that Pdx1 not only activates specific beta-cell genes but down-regulates HNF1α. Pdx1-mediated reduction of HNF1α is accompanied by altered expression of its major activator, HNF4α isoforms, down-regulating hepatic genes ALB and AAT. Pdx1 up-regulates HNF4α via the P2 promoter. These P2-driven isoforms compete with P1-driven isoforms to suppress target gene transcription. In Huh7 cells, the AF-1 activation domain is more important for transactivation, whereas in INS1 cells, the F inhibitory domain is more important. The loss and gain of functional activity strongly suggests that Pdx1 plays a central role in reprogramming hepatocytes into beta-cells by suppressing the hepatic phenotype. PMID:26279745

  7. Unilateral Partial Nephrectomy with Warm Ischemia Results in Acute Hypoxia Inducible Factor 1-Alpha (HIF-1α) and Toll-Like Receptor 4 (TLR4) Overexpression in a Porcine Model

    PubMed Central

    Zhang, Zhiyong; Haimovich, Beatrice; Kwon, Young Suk; Lu, Tyler; Fyfe-Kirschner, Billie; Olweny, Ephrem Odoy

    2016-01-01

    Purpose Ischemia/reperfusion (I/R) during partial nephrectomy (PN) contributes to acute kidney injury (AKI), which is inaccurately assessed using existent clinical markers of renal function. We evaluated I/R-related changes in expression in hypoxia inducible factor 1α (HIF-1α) and toll-like receptor 4 (TLR4), within kidney tissue and peripheral blood leukocytes (PBL) in a porcine model of PN. Materials and Methods Three adult pigs each underwent unilateral renal hilar cross clamping for 180 min followed by a 15 min reperfusion. The contralateral kidney served as control. Biopsies of clamped kidneys were obtained at baseline (time 0), every 60 min during the hypoxic phase, and post-reperfusion. Control kidneys were biopsied once at 180 min. Peripheral blood was sampled at time 0, every 30 min during the hypoxic phase, and post-reperfusion. HIF-1α and TLR4 expression in kidney tissue and PBL were analyzed by Western blotting. I/R-related histological changes were assessed. Results Expression of HIF-1α in clamped kidneys and PBL was below detection level at baseline, rising to detectable levels after 60 min of hypoxia, and continuing to rise throughout the hypoxic and reperfusion phases. Expression of TLR-4 in clamped kidneys followed a similar trend with initial detection after 30–60 min of hypoxia. Control kidneys exhibited no change in HIF-1α or TLR-4 expression. I/R-related histologic changes were minimal, primarily mild tubular dilatation. Conclusions In a porcine model of PN, HIF-1α and TLR4 exhibited robust, I/R-related increases in expression in kidney tissue and PBL. Further studies investigating these molecules as potential markers of AKI are warranted. PMID:27149666

  8. Anticancer effect of genistein on BG-1 ovarian cancer growth induced by 17 β-estradiol or bisphenol A via the suppression of the crosstalk between estrogen receptor alpha and insulin-like growth factor-1 receptor signaling pathways

    SciTech Connect

    Hwang, Kyung-A; Park, Min-Ah; Kang, Nam-Hee; Yi, Bo-Rim; Hyun, Sang-Hwan; Jeung, Eui-Bae; Choi, Kyung-Chul

    2013-11-01

    The interaction between estrogen receptor (ER) and insulin-like growth factor-1 receptor (IGF-1R) signaling pathway plays an important role in proliferation of and resistance to endocrine therapy to estrogen dependent cancers. Estrogen (E2) upregulates the expression of components of IGF-1 system and induces the downstream of mitogenic signaling cascades via phosphorylation of insulin receptor substrate-1 (IRS-1). In the present study, we evaluated the xenoestrogenic effect of bisphenol A (BPA) and antiproliferative activity of genistein (GEN) in accordance with the influence on this crosstalk. BPA was determined to affect this crosstalk by upregulating mRNA expressions of ERα and IGF-1R and inducing phosphorylation of IRS-1 and Akt in protein level in BG-1 ovarian cancer cells as E2 did. In the mouse model xenografted with BG-1 cells, BPA significantly increased a tumor burden of mice and expressions of ERα, pIRS-1, and cyclin D1 in tumor mass compared to vehicle, indicating that BPA induces ovarian cancer growth by promoting the crosstalk between ER and IGF-1R signals. On the other hand, GEN effectively reversed estrogenicity of BPA by reversing mRNA and protein expressions of ERα, IGF-1R, pIRS-1, and pAkt induced by BPA in cellular model and also significantly decreased tumor growth and in vivo expressions of ERα, pIRS-1, and pAkt in xenografted mouse model. Also, GEN was confirmed to have an antiproliferative effect by inducing apoptotic signaling cascades. Taken together, these results suggest that GEN effectively reversed the increased proliferation of BG-1 ovarian cancer by suppressing the crosstalk between ERα and IGF-1R signaling pathways upregulated by BPA or E2.

  9. Comparative analysis of Napsin A, alpha-methylacyl-coenzyme A racemase (AMACR, P504S), and hepatocyte nuclear factor 1 beta as diagnostic markers of ovarian clear cell carcinoma: an immunohistochemical study of 279 ovarian tumours.

    PubMed

    Fadare, Oluwole; Zhao, Chengquan; Khabele, Dineo; Parkash, Vinita; Quick, Charles M; Gwin, Katja; Desouki, Mohamed M

    2015-02-01

    Napsin A and α-methylacyl-coenzyme A racemase (AMACR, P504S) have recently been described as being frequently expressed in clear cell carcinomas (CCC) of the gynecological tract. The present study was conducted to assess the test performance of these newer markers relative to the more traditional marker, hepatocyte nuclear factor 1β (HNF1β), in a large and histotypically diverse dataset. A total of 279 ovarian tumours in tissue microarrays were immunohistochemically assessed for the expression of Napsin A, AMACR and HNF1β. HNF1β, Napsin A and AMACR were expressed in 92%, 82% and 63% of 65 CCC, 7%, 1% and 1% of 101 serous carcinomas, 37%, 5.3% and 0% of 19 endometrioid carcinomas, 60%, 0% and 0% of 45 mucinous tumours, 100%, 0% and 0% of seven yolk sac tumours, and 0%, 16.7% and 16.7% of six steroid cell tumours NOS, respectively. All other tumours, including 18 adult-type granulosa cell tumours, eight dysgerminomas and nine other miscellaneous tumour types were negative for all three markers. Using a benchmark of ≥1% of tumour cells for positivity and CCC as the diagnostic end-point, the sensitivity, specificity, negative predictive value and positive predictive value of Napsin A expression were 0.82, 0.99, 0.94, and 0.98, respectively (odds ratio 439, p < 0.0001). Respective parameters were 0.92, 0.79, 0.97, and 0.58 (odds ratio 44, p < 0.0001) for HNF1β and 0.63, 0.99, 0.89, and 0.5 (odds ratio 112, p < 0.0001) for AMACR. The combination of any two positive markers, irrespective of the staining pattern of the third, significantly predicted the CCC histotype in every analytic scenario. In summary, HNF1β is highly sensitive but is suboptimally specific in isolation, whereas AMACR is highly specific but is suboptimally sensitive. Napsin A is specific but of intermediate sensitivity. Napsin A, AMACR and HNF1β are all viable markers of CCC that can be deployed as components of larger panels when CCC is a diagnostic consideration.

  10. Comparative analysis of Napsin A, alpha-methylacyl-coenzyme A racemase (AMACR, P504S), and hepatocyte nuclear factor 1 beta as diagnostic markers of ovarian clear cell carcinoma: an immunohistochemical study of 279 ovarian tumours.

    PubMed

    Fadare, Oluwole; Zhao, Chengquan; Khabele, Dineo; Parkash, Vinita; Quick, Charles M; Gwin, Katja; Desouki, Mohamed M

    2015-02-01

    Napsin A and α-methylacyl-coenzyme A racemase (AMACR, P504S) have recently been described as being frequently expressed in clear cell carcinomas (CCC) of the gynecological tract. The present study was conducted to assess the test performance of these newer markers relative to the more traditional marker, hepatocyte nuclear factor 1β (HNF1β), in a large and histotypically diverse dataset. A total of 279 ovarian tumours in tissue microarrays were immunohistochemically assessed for the expression of Napsin A, AMACR and HNF1β. HNF1β, Napsin A and AMACR were expressed in 92%, 82% and 63% of 65 CCC, 7%, 1% and 1% of 101 serous carcinomas, 37%, 5.3% and 0% of 19 endometrioid carcinomas, 60%, 0% and 0% of 45 mucinous tumours, 100%, 0% and 0% of seven yolk sac tumours, and 0%, 16.7% and 16.7% of six steroid cell tumours NOS, respectively. All other tumours, including 18 adult-type granulosa cell tumours, eight dysgerminomas and nine other miscellaneous tumour types were negative for all three markers. Using a benchmark of ≥1% of tumour cells for positivity and CCC as the diagnostic end-point, the sensitivity, specificity, negative predictive value and positive predictive value of Napsin A expression were 0.82, 0.99, 0.94, and 0.98, respectively (odds ratio 439, p < 0.0001). Respective parameters were 0.92, 0.79, 0.97, and 0.58 (odds ratio 44, p < 0.0001) for HNF1β and 0.63, 0.99, 0.89, and 0.5 (odds ratio 112, p < 0.0001) for AMACR. The combination of any two positive markers, irrespective of the staining pattern of the third, significantly predicted the CCC histotype in every analytic scenario. In summary, HNF1β is highly sensitive but is suboptimally specific in isolation, whereas AMACR is highly specific but is suboptimally sensitive. Napsin A is specific but of intermediate sensitivity. Napsin A, AMACR and HNF1β are all viable markers of CCC that can be deployed as components of larger panels when CCC is a diagnostic consideration. PMID:25551297

  11. Pyruvate dehydrogenase complex activity controls metabolic and malignant phenotype in cancer cells.

    PubMed

    McFate, Thomas; Mohyeldin, Ahmed; Lu, Huasheng; Thakar, Jay; Henriques, Jeremy; Halim, Nader D; Wu, Hong; Schell, Michael J; Tsang, Tsz Mon; Teahan, Orla; Zhou, Shaoyu; Califano, Joseph A; Jeoung, Nam Ho; Harris, Robert A; Verma, Ajay

    2008-08-15

    High lactate generation and low glucose oxidation, despite normal oxygen conditions, are commonly seen in cancer cells and tumors. Historically known as the Warburg effect, this altered metabolic phenotype has long been correlated with malignant progression and poor clinical outcome. However, the mechanistic relationship between altered glucose metabolism and malignancy remains poorly understood. Here we show that inhibition of pyruvate dehydrogenase complex (PDC) activity contributes to the Warburg metabolic and malignant phenotype in human head and neck squamous cell carcinoma. PDC inhibition occurs via enhanced expression of pyruvate dehydrogenase kinase-1 (PDK-1), which results in inhibitory phosphorylation of the pyruvate dehydrogenase alpha (PDHalpha) subunit. We also demonstrate that PDC inhibition in cancer cells is associated with normoxic stabilization of the malignancy-promoting transcription factor hypoxia-inducible factor-1alpha (HIF-1alpha) by glycolytic metabolites. Knockdown of PDK-1 via short hairpin RNA lowers PDHalpha phosphorylation, restores PDC activity, reverts the Warburg metabolic phenotype, decreases normoxic HIF-1alpha expression, lowers hypoxic cell survival, decreases invasiveness, and inhibits tumor growth. PDK-1 is an HIF-1-regulated gene, and these data suggest that the buildup of glycolytic metabolites, resulting from high PDK-1 expression, may in turn promote HIF-1 activation, thus sustaining a feed-forward loop for malignant progression. In addition to providing anabolic support for cancer cells, altered fuel metabolism thus supports a malignant phenotype. Correction of metabolic abnormalities offers unique opportunities for cancer treatment and may potentially synergize with other cancer therapies. PMID:18541534

  12. HIF-1 attenuates Ref-1 expression in endothelial cells: reversal by siRNA and inhibition of geranylgeranylation.

    PubMed

    Loboda, Agnieszka; Stachurska, Anna; Dorosz, Jerzy; Zurawski, Marek; Wegrzyn, Joanna; Kozakowska, Magdalena; Jozkowicz, Alicja; Dulak, Jozef

    2009-01-01

    Redox factor-1 (Ref-1), a multifunctional protein with DNA repairing activities, plays a cytoprotective function by post-translational redox modification of numerous transcription factors, including hypoxia inducible factor-1 (HIF-1). In the present study, activation of HIF-1 by hypoxia and dimethyloxaloylglycine (DMOG), a hypoxia mimic, diminished Ref-1 mRNA and protein expression in human microvascular endothelial cells (HMEC-1). Similarly, adenoviral delivery of the stabilized form of HIF-1alpha decreased Ref-1 mRNA and protein levels. Accordingly, HIF-1alpha siRNA abolished the hypoxia-induced inhibition of Ref-1 expression, indicating the role of HIF-1 in down-regulation of Ref-1. Also, translocation of Ref-1 from nucleus to cytoplasm after HIF-1 activation was noted. Interestingly, we observed the restoration of Ref-1 expression in hypoxia by pharmacologically relevant doses of atorvastatin. This effect was dependent on the inhibition of protein geranylgeranylation, but not farnesylation, as only the inhibitor of the former but not the latter prenylation step restored the Ref-1 expression. The regulation of Ref-1 by statins may be considered as a novel mechanism of their beneficial effects on endothelium.

  13. A non-specific effect of orally administered Escherichia coli.

    PubMed

    Gardlik, Roman

    2011-01-01

    A number of genetically modified bacteria able to deliver a therapeutic gene into target cells has already been tested. Apart from the expected effects of bacterial therapy, the therapeutic bacterial strain also mediates a non-specific effect independent of the gene to be delivered. In this regard, we have recently shown that oral administration of the bacterial strain Escherichia coli XL1-Blue via gastric gavage to rats leads to a non-specific decrease in expression of vascular endothelial growth factor (VEGF) in intestinal wall without corresponding changes in other parameters. We tried to adopt a model of intestinal ischemia and to treat the subsequent hypoxic condition using a strain carrying the effector plasmid encoding hypoxia-inducible factor 1 alpha (HIF-1alpha), as well as the helper plasmid encoding invasion and listeriolysin O. However, the model was ineffective, as obvious from macroscopic and molecular observations. We hypothesize that a competitive behavior of the administered strain in the intestinal microbiota leads to a decrease in activity of HIF-1alpha and reduction in expression of VEGF. Also, a functional disease model would be necessary for the invasion-expressing therapeutic strain to be effective. A different approach using bacterial protein delivery would possibly circumvent these bactofection-related problems.

  14. Myc post-transcriptionally induces HIF1 protein and target gene expression in normal and cancer cells

    PubMed Central

    Doe, Megan R.; Ascano, Janice; Kaur, Mandeep; Cole, Michael D.

    2012-01-01

    c-Myc is frequently overexpressed in tumors and plays an important role in the regulation of cancer metabolism. Hypoxia-inducible factor-1 (HIF1), the master regulator of the hypoxic response, enhances tumorigenesis and influences metabolism via upregulation of the glycolytic pathway and suppression of mitochondrial respiration. Together, deregulated Myc and HIF1 cooperate to lend metabolic advantages to proliferating cancer cells and contribute to the Warburg Effect. Here we show that overexpression of Myc significantly stabilizes the alpha subunit of HIF1 (HIF1alpha) under normoxic conditions and enhances HIF1alpha accumulation under hypoxic conditions in cells. Post-transcriptional regulation of HIF1α by Myc led to the induction of HIF1α gene targets. Normoxic HIF1α protein expression was also dependent on Myc. Functionally; HIF1α expression was required for Myc-induced anchorage-independent growth and cell proliferation. Myc-dependent stabilization of HIF1α involved either disruption of binding to the VHL complex or post-translational protein modifications. Taken together, our findings uncover a previously uncharacterized regulatory relationship between Myc and HIF1 that has important implications for cancer metabolism and development. PMID:22186139

  15. The Akt1-eNOS axis illustrates the specificity of kinase-substrate relationships in vivo.

    PubMed

    Schleicher, Michael; Yu, Jun; Murata, Takahisa; Derakhshan, Berhad; Atochin, Dimitriy; Qian, Li; Kashiwagi, Satoshi; Di Lorenzo, Annarita; Harrison, Kenneth D; Huang, Paul L; Sessa, William C

    2009-01-01

    Akt1 is critical for many in vivo functions; however, the cell-specific substrates responsible remain to be defined. Here, we examine the importance of endothelial nitric oxide synthase (eNOS) as an Akt1 substrate by generating Akt1-deficient mice (Akt1(-/-) mice) carrying knock-in mutations (serine to aspartate or serine to alanine substitutions) of the critical Akt1 phosphorylation site on eNOS (serine 1176) that render the enzyme "constitutively active" or "less active." The eNOS mutations did not influence several phenotypes in Akt1(-/-) mice; however, the defective postnatal angiogenesis characteristic of Akt1(-/-) mice was rescued by crossing the Akt1(-/-) mice with mice carrying the constitutively active form of eNOS, but not by crossing with mice carrying the less active eNOS mutant. This genetic rescue resulted in the stabilization of hypoxia-inducible factor 1alpha (HIF-1alpha) and increased production of HIF-1alpha-responsive genes in vivo and in vitro. Thus, Akt1 regulates angiogenesis largely through phosphorylation of eNOS and NO-dependent signaling. PMID:19654415

  16. Photoperiod-induced differential expression of angiogenesis genes in testes of adult Peromyscus leucopus.

    PubMed

    Pyter, Leah M; Hotchkiss, Andrew K; Nelson, Randy J

    2005-02-01

    Non-pathological angiogenesis in adults is rare and is largely thought to be restricted to wound healing and female reproductive cycles. Adult male rodents, however, display seasonal angiogenesis to support seasonal changes in reproductive tissue morphology. Non-tropical rodents use photoperiod (day length) to determine the time of year. During short days, the reproductive system undergoes involution and mating behaviours stop, adaptations which presumably allow energy resources to be shifted to processes necessary for winter survival. We compared the patterns of gene expression involved in angiogenesis in testes of white-footed mice (Peromyscus leucopus) following 7, 14, 21 or 34 weeks of long or short day lengths. Short days decreased body mass, reproductive tract mass and seminiferous tubule diameter. Potential genes involved in seasonal angiogenesis were screened by hybridizing testicular RNA from each group to angiogenesis-specific microarrays. Genes that were > or =6-fold different between long- and short-day testes (i.e. hypoxia-inducible factor 1alpha(Hif1alpha), plasminogen activator inhibitor 1 (Serpine1), transforming growth factor beta receptor 3 (Tgfbetar3) and tumour necrosis factor (Tnf )) were sequenced and expression differences were compared throughout gonadal regression and recrudescence using quantitative RT-PCR. Our results suggest that short days trigger expression of Hif1alpha, Serpine1, and Tgfbetar3 to inhibit angiogenesis or promote apoptosis during testicular regression, and also trigger expression of Tnf to promote angiogenesis during testicular recrudescence.

  17. Impact of Hypoxia on the Metastatic Potential of Human Prostate Cancer Cells

    SciTech Connect

    Dai Yao; Bae, Kyungmi; Siemann, Dietmar W.

    2011-10-01

    Purpose: Intratumoral hypoxia is known to be associated with radioresistance and metastasis. The present study examined the effect of acute and chronic hypoxia on the metastatic potential of prostate cancer PC-3, DU145, and LNCaP cells. Methods and Materials: Cell proliferation and clonogenicity were tested by MTT assay and colony formation assay, respectively. 'Wound-healing' and Matrigel-based chamber assays were used to monitor cell motility and invasion. Hypoxia-inducible factor 1 alpha (HIF-1{alpha}) expression was tested by Western blot, and HIF-1-target gene expression was detected by real-time polymerase chain reaction. Secretion of matrix metalloproteinases (MMPs) was determined by gelatin zymography. Results: When PC-3 cells were exposed to 1% oxygen (hypoxia) for various periods of time, chronic hypoxia ({>=}24 h) decreased cell proliferation and induced cell death. In contrast, prostate cancer cells exposed to acute hypoxia ({<=}6 h) displayed increased motility, clonogenic survival, and invasive capacity. At the molecular level, both hypoxia and anoxia transiently stabilized HIF-1{alpha}. Exposure to hypoxia also induced the early expression of MMP-2, an invasiveness-related gene. Treatment with the HIF-1 inhibitor YC-1 attenuated the acute hypoxia-induced migration, invasion, and MMP-2 activity. Conclusions: The length of oxygen deprivation strongly affected the functional behavior of all three prostate cancer cell lines. Acute hypoxia in particular was found to promote a more aggressive metastatic phenotype.

  18. The Akt1-eNOS axis illustrates the specificity of kinase-substrate relationships in vivo.

    PubMed

    Schleicher, Michael; Yu, Jun; Murata, Takahisa; Derakhshan, Berhad; Atochin, Dimitriy; Qian, Li; Kashiwagi, Satoshi; Di Lorenzo, Annarita; Harrison, Kenneth D; Huang, Paul L; Sessa, William C

    2009-08-04

    Akt1 is critical for many in vivo functions; however, the cell-specific substrates responsible remain to be defined. Here, we examine the importance of endothelial nitric oxide synthase (eNOS) as an Akt1 substrate by generating Akt1-deficient mice (Akt1(-/-) mice) carrying knock-in mutations (serine to aspartate or serine to alanine substitutions) of the critical Akt1 phosphorylation site on eNOS (serine 1176) that render the enzyme "constitutively active" or "less active." The eNOS mutations did not influence several phenotypes in Akt1(-/-) mice; however, the defective postnatal angiogenesis characteristic of Akt1(-/-) mice was rescued by crossing the Akt1(-/-) mice with mice carrying the constitutively active form of eNOS, but not by crossing with mice carrying the less active eNOS mutant. This genetic rescue resulted in the stabilization of hypoxia-inducible factor 1alpha (HIF-1alpha) and increased production of HIF-1alpha-responsive genes in vivo and in vitro. Thus, Akt1 regulates angiogenesis largely through phosphorylation of eNOS and NO-dependent signaling.

  19. Imaging of whole tumor cut sections using a novel scanning beam confocal fluorescence MACROscope

    NASA Astrophysics Data System (ADS)

    Constantinou, Paul; Vukovic, Vojislav; Haugland, Hans K.; Nicklee, Trudey; Hedley, David W.; Wilson, Brian C.

    2001-07-01

    Hypoxia caused by inadequate structure and function of the tumor vasculature has been found to negatively determine the prognosis of cancer patients. Hence, understanding the biological basis of tumor hypoxia is of significant clinical interest. To study solid tumor microenvironments in sufficient detail, large areas (several mm in diameter) need to be imaged at micrometers resolutions. We have used a novel confocal scanning laser MACROscopeTM (CSLM) capable of acquiring images over fields of view up to 2 cm X 2 cm. To demonstrate its performance, frozen sections from a cervical carcinoma xenograft were triple labeled for tissue hypoxia, blood vessels and hypoxia-inducible transcription factor 1 alpha (HIF-1(alpha) ), imaged using the CSLM and compared to images obtained using a standard epifluorescence microscope imaging system. The results indicate that the CSLM is a useful instrument for imaging tissue-based fluorescence at resolutions comparable to standard low-power microscope objectives.

  20. Plasma from human volunteers subjected to remote ischemic preconditioning protects human endothelial cells from hypoxia-induced cell damage.

    PubMed

    Weber, Nina C; Riedemann, Isabelle; Smit, Kirsten F; Zitta, Karina; van de Vondervoort, Djai; Zuurbier, Coert J; Hollmann, Markus W; Preckel, Benedikt; Albrecht, Martin

    2015-03-01

    Short repeated cycles of peripheral ischemia/reperfusion (I/R) can protect distant organs from subsequent prolonged I/R injury; a phenomenon known as remote ischemic preconditioning (RIPC). A RIPC-mediated release of humoral factors might play a key role in this protection and vascular endothelial cells are potential targets for these secreted factors. In the present study, RIPC-plasma obtained from healthy male volunteers was tested for its ability to protect human umbilical endothelial cells (HUVEC) from hypoxia-induced cell damage. 10 healthy male volunteers were subjected to a RIPC-protocol consisting of 4 × 5 min inflation/deflation of a blood pressure cuff located at the upper arm. Plasma was collected before (T0; control), directly after (T1) and 1 h after (T2) the RIPC procedure. HUVEC were subjected to 24 h hypoxia damage and simultaneously incubated with 5% of the respective RIPC-plasma. Cell damage was evaluated by lactate dehydrogenase (LDH)-measurements. Western blot experiments of hypoxia inducible factor 1 alpha (HIF1alpha), phosphorylated signal transducer and activator of transcription 5 (STAT5), protein kinase B (AKT) and extracellular signal-related kinase 1/2 (ERK-1/2) were performed. Furthermore, the concentrations of hVEGF were evaluated in the RIPC-plasma by sandwich ELISA. Hypoxia-induced cell damage was significantly reduced by plasma T1 (p = 0.02 vs T0). The protective effect of plasma T1 was accompanied by an augmentation of the intracellular HIF1alpha (p = 0.01 vs T0) and increased phosphorylation of ERK-1/2 (p = 0.03 vs T0). Phosphorylation of AKT and STAT5 remained unchanged. Analysis of the protective RIPC-plasma T1 showed significantly reduced levels of hVEGF (p = 0.01 vs T0). RIPC plasma protects endothelial cells from hypoxia-induced cell damage and humoral mediators as well as intracellular HIF1alpha may be involved.

  1. EPAS1 trans-activation during hypoxia requires p42/p44 MAPK.

    PubMed

    Conrad, P W; Freeman, T L; Beitner-Johnson, D; Millhorn, D E

    1999-11-19

    Hypoxia is a common environmental stress that regulates gene expression and cell function. A number of hypoxia-regulated transcription factors have been identified and have been shown to play critical roles in mediating cellular responses to hypoxia. One of these is the endothelial PAS-domain protein 1 (EPAS1/HIF2-alpha/HLF/HRF). This protein is 48% homologous to hypoxia-inducible factor 1-alpha (HIF1-alpha). To date, virtually nothing is known about the signaling pathways that lead to either EPAS1 or HIF1-alpha activation. Here we show that EPAS1 is phosphorylated when PC12 cells are exposed to hypoxia and that p42/p44 MAPK is a critical mediator of EPAS1 activation. Pretreatment of PC12 cells with the MEK inhibitor, PD98059, completely blocked hypoxia-induced trans-activation of a hypoxia response element (HRE) reporter gene by transfected EPAS1. Likewise, expression of a constitutively active MEK1 mimicked the effects of hypoxia on HRE reporter gene expression. However, pretreatment with PD98059 had no effect on EPAS1 phosphorylation during hypoxia, suggesting that MAPK targets other proteins that are critical for the trans-activation of EPAS1. We further show that hypoxia-induced trans-activation of EPAS1 is independent of Ras. Finally, pretreatment with calmodulin antagonists nearly completely blocked both the hypoxia-induced phosphorylation of MAPK and the EPAS1 trans-activation of HRE-Luc. These results demonstrate that the MAPK pathway is a critical mediator of EPAS1 activation and that activation of MAPK and EPAS1 occurs through a calmodulin-sensitive pathway and not through the GTPase, Ras. These results are the first to identify a specific signaling pathway involved in EPAS1 activation. PMID:10559262

  2. Gallate, the component of HIF-inducing catechins, inhibits HIF prolyl hydroxylase

    SciTech Connect

    Tsukiyama, Fuyo; Nakai, Yumi; Yoshida, Masataka; Tokuhara, Takahiro; Hirota, Kiichi; Sakai, Akiko; Hayashi, Hideyuki . E-mail: hayashi@art.osaka-med.ac.jp; Katsumata, Takahiro

    2006-12-08

    Catechins have recently been reported to increase the cellular content of the hypoxia-inducible factor (HIF)-1{alpha} within mammalian cells. These catechins have a gallate moiety as a common structure. We now report that n-propyl gallate (nPG) also increases the HIF-1{alpha} protein in the rat heart-derived H9c2 cells. The increase was dose-dependent and reached a maximum at 2-4 h after the addition of nPG to the cells. nPG did not change the HIF-1{alpha} mRNA level, showing that the increase is a posttranscriptional event. Although nPG did not inhibit the HIF prolyl hydroxylase, gallate, the hydrolysis product of nPG, inhibited the enzyme completely at submillimolar concentrations. Model building studies on the human HIF prolyl hydroxylase 2 showed that the two phenolate oxygen atoms of gallate form a chelate with the active site Fe{sup 2+}, while the carboxyl group of gallate forms a strong ionic/hydrogen bonding interaction with Arg383, explaining why nPG, which has an esterified carboxyl group, is unable to inhibit the hydroxylase. Together with the observation that gallate was detected in the H9c2 cells treated with nPG, these results suggest that nPG incorporated into the cells is hydrolyzed and the released gallate inhibits the HIF prolyl hydroxylase, thereby reducing the HIF degradation rate and increasing the HIF-1{alpha} content.

  3. Hepatocyte nuclear factor-4 prevents silencing of hepatocyte nuclear factor-1 expression in hepatoma x fibroblast cell hybrids.

    PubMed Central

    Bulla, G A

    1997-01-01

    Hepatocyte nuclear factors-1alpha (HNF1alpha) and -4 (HNF4) are components of a liver-enriched transcription activation pathway which is thought to play a critical role in hepatocyte-specific gene expression, including activation of alpha1-antitrypsin gene expression. HNF1alpha, HNF4 and alpha1-antitrypsin (alpha1AT) genes are extinguished in hepatoma/fibroblast somatic cell hybrids, suggesting that fibroblasts contain a repressor-like activity. To determine the molecular basis for silencing of these genes in cell hybrids, ectopic expression of HNF1alpha and HNF4 was used. Results show that constitutive expression of HNF4 prevents extinction of HNF1alpha gene expression in hepatoma/fibroblast hybrids. In contrast, forced HNF1alpha expression failed to prevent extinction of the HNF4 locus in cell hybrids. Likewise, the alpha1AT gene remained silent in the presence of both HNF1alpha and HNF4. These results suggest that extinction of HNF1alpha is a simple lack-of-activation phenotype, whereas extinction of HNF4 andalpha1AT loci is more complex, perhaps involving negative regulation. PMID:9171105

  4. Pleiotropic effects of Trefoil Factor 1 deficiency.

    PubMed

    Tomasetto, C; Rio, M-C

    2005-12-01

    Trefoil Factor 1 (TFF1), the first member of the trefoil factor family, is normally expressed in the stomach mucosa. Ectopic expression is also observed in various human pathological conditions, notably in numerous carcinomas and gastrointestinal acute inflammatory disorders. In vivo experimental data using TFF1-deficient mice highlight the pleiotropic functions of TFF1: (i) it is a gastric tumor suppressor gene involved in gastric ontogenesis and homeostasis; (ii) it protects gut mucosa from aggression; (iii) it participates in folding secreted proteins inside the endoplasmic reticulum. At the cellular level, it limits cell proliferation and apoptosis, and favors cell differentiation. Collectively, these data suggest that TFF1 may provide an alternative pharmacological tool for the prevention and treatment of human gastrointestinal diseases.

  5. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  6. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  7. Cloning and expression of Bombyx mori silk gland elongation factor 1gamma in Escherichia coli.

    PubMed

    Kamiie, Katsuyoshi; Nomura, Yoshitaka; Kobayashi, Satoru; Taira, Hideharu; Kobayashi, Kohmei; Yamashita, Tetsuro; Kidou, Shin-ichiro; Ejiri, Shin-ichiro

    2002-03-01

    Elongation factor 1 (EF-1) from the silk gland of Bombyx mori consists of alpha-, beta-, gamma-, and delta-subunits. EF-1alpha GTP catalyzes the binding of aminoacyl-tRNA to ribosomes concomitant with the hydrolysis of GTP. EF-1betagammadelta catalyzes the exchange of EF-1alpha-bound GDP for exogenous GTP and stimulates the EF-1alpha-dependent binding of aminoacyl-tRNA to ribosomes. EF-1gamma cDNA, which contains an open reading frame (ORF) encoding a polypeptide of 423 amino acid residues, was amplified and cloned by PCR from a silk gland cDNA library. The calculated molecular mass and predicted pI of the product were 48,388 Da and 5.84, respectively. The silk gland EF-1gamma shares 67.3% amino acid identity with Artemia salina EF-lgamma. The N-terminal domain (amino acid residues 1-211) of silk gland EF-lgamma is 29.3% identical to maize glutathione S-transferase. We demonstrated that silk gland EF-lgamma bound to glutathione Sepharose, suggesting that the N-terminal domain of EF-1gamma may have the capacity to bind to glutathione. PMID:12005049

  8. Protective Role of Selenium Compounds on the Proliferation, Apoptosis, and Angiogenesis of a Canine Breast Cancer Cell Line.

    PubMed

    Liu, Yuzhi; Li, Wenyu; Guo, Mengyao; Li, Chengye; Qiu, Changwei

    2016-01-01

    We herein examined the effects of different doses, forms, and compatibilities of selenium on a canine mammary gland tumor cell line, CTM1211, and explored the related mechanisms. Three selenium compounds, sodium selenite (SSE), methylseleninic acid (MSA), and methylselenocysteine (MSC), were selected for these experiments, and cyclophosphamide (CTX) served as a positive control. In the cell viability assay, the cell viability of each group at 48/72 h decreased significantly compared with the control group (p < 0.05), and the cell viability of the CTX + MSA group was lower than that of CTX and MSA groups (p < 0.05). Moreover, the inhibitory effect of selenium on cell proliferation was time-dependent but not concentration-dependent. In the cell apoptosis assay, the apoptosis values of each group increased significantly compared with the control group, and the apoptosis values of the CTX + MSA group increased the most significantly (p < 0.01). The protein and mRNA expression levels of vascular endothelial growth factor-alpha (VEGF-alpha), angiopoietin-2 (Ang-2), and hypoxia inducible factor-1 alpha (HIF-1 alpha) were downregulated in each group, while that of phosphatase and tensin homolog (PTEN) were upregulated (p < 0.05). In conclusion, these three selenium compounds, especially MSA, could significantly inhibit the viability and growth of the CTM1211 cell line, which is partly due to the induction of apoptosis and regulation of tumor angiogenesis.

  9. Selective inhibition of hypoxia-inducible factor (HIF) prolyl-hydroxylase 1 mediates neuroprotection against normoxic oxidative death via HIF- and CREB-independent pathways.

    PubMed

    Siddiq, Ambreena; Aminova, Leila R; Troy, Carol M; Suh, Kyungsun; Messer, Zachary; Semenza, Gregg L; Ratan, Rajiv R

    2009-07-01

    Oxidative stress contributes to tissue injury in conditions ranging from cardiovascular disease to stroke, spinal cord injury, neurodegeneration, and perhaps even aging. Yet the efficacy of antioxidants in human disease has been mixed at best. We need a better understanding of the mechanisms by which established antioxidants combat oxidative stress. Iron chelators are well established inhibitors of oxidative death in both neural and non-neural tissues, but their precise mechanism of action remains elusive. The prevailing but not completely substantiated view is that iron chelators prevent oxidative injury by suppressing Fenton chemistry and the formation of highly reactive hydroxyl radicals. Here, we show that iron chelation protects, rather unexpectedly, by inhibiting the hypoxia-inducible factor prolyl 4-hydroxylase isoform 1 (PHD1), an iron and 2-oxoglutarate-dependent dioxygenase. PHD1 and its isoforms 2 and 3 are best known for stabilizing transcriptional regulators involved in hypoxic adaptation, such as HIF-1alpha and cAMP response element-binding protein (CREB). Yet we find that global hypoxia-inducible factor (HIF)-PHD inhibition protects neurons even when HIF-1alpha and CREB are directly suppressed. Moreover, two global HIF-PHD inhibitors continued to be neuroprotective even in the presence of diminished HIF-2alpha levels, which itself increases neuronal susceptibility to oxidative stress. Finally, RNA interference to PHD1 but not isoforms PHD2 or PHD3 prevents oxidative death, independent of HIF activation. Together, these studies suggest that iron chelators can prevent normoxic oxidative neuronal death through selective inhibition of PHD1 but independent of HIF-1alpha and CREB; and that HIF-2alpha, not HIF-1alpha, regulates susceptibility to normoxic oxidative neuronal death. PMID:19587290

  10. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  11. Iron-mediated degradation of IRP2, an unexpected pathway involving a 2-oxoglutarate-dependent oxygenase activity.

    PubMed

    Wang, Jian; Chen, Guohua; Muckenthaler, Martina; Galy, Bruno; Hentze, Matthias W; Pantopoulos, Kostas

    2004-02-01

    Iron regulatory protein 2 (IRP2), a central posttranscriptional regulator of cellular and systemic iron metabolism, undergoes proteasomal degradation in iron-replete cells. The prevailing model postulates that the mechanism involves site-specific oxidation of 3 cysteine residues (C168, C174, and C178) within a 73-amino-acid (73-aa) degradation domain. By expressing wild-type and mutated versions of IRP2 in H1299 cells, we find that a C168S C174S C178S triple mutant, or a deletion mutant lacking the entire "73-aa domain," is sensitive to iron-mediated degradation, like wild-type IRP2. The antioxidants N-acetylcysteine, ascorbate, and alpha-tocopherol not only fail to stabilize IRP2 but, furthermore, promote its proteasomal degradation. The pathway for IRP2 degradation is saturable, which may explain earlier data supporting the "cysteine oxidation model," and shows remarkable similarities with the degradation of the hypoxia-inducible factor 1 alpha (HIF-1 alpha): dimethyl-oxalylglycine, a specific inhibitor of 2-oxoglutarate-dependent oxygenases, stabilizes IRP2 following the administration of iron to iron-deficient cells. Our results challenge the current model for IRP2 regulation and provide direct pharmacological evidence for the involvement of 2-oxoglutarate-dependent oxygenases in a pathway for IRP2 degradation.

  12. PI3K/Akt activity has variable cell-specific effects on expression of HIF target genes, CA9 and VEGF, in human cancer cell lines.

    PubMed

    Shafee, Norazizah; Kaluz, Stefan; Ru, Ning; Stanbridge, Eric J

    2009-09-01

    The phosphatidylinositol 3-kinase/Akt (PI3K) pathway regulates hypoxia-inducible factor (HIF) activity. Higher expression of HIF-1alpha and carbonic anhydrase IX (CAIX), a hypoxia-inducible gene, in HT10806TG fibrosarcoma cells (mutant N-ras allele), compared to derivative MCH603 cells (deleted mutant N-ras allele), correlated with increased PI3K activity. Constitutive activation of the PI3K pathway in MCH603/PI3K(act) cells increased HIF-1alpha but, surprisingly, decreased CAIX levels. The cell-type specific inhibitory effect on CAIX was confirmed at the transcriptional level whereas epigenetic modifications of CA9 were ruled out. In summary, our data do not substantiate the generalization that PI3K upregulation leads to increased HIF activity. PMID:19342157

  13. High expression of arachidonate 15-lipoxygenase and proinflammatory markers in human ischemic heart tissue

    SciTech Connect

    Magnusson, Lisa U.; Lundqvist, Annika; Asp, Julia; Synnergren, Jane; Johansson, Cecilia Thalen; Palmqvist, Lars; Jeppsson, Anders; Hulten, Lillemor Mattsson

    2012-07-27

    Highlights: Black-Right-Pointing-Pointer We found a 17-fold upregulation of ALOX15 in the ischemic heart. Black-Right-Pointing-Pointer Incubation of human muscle cells in hypoxia showed a 22-fold upregulation of ALOX15. Black-Right-Pointing-Pointer We observed increased levels of proinflammatory markers in ischemic heart tissue. Black-Right-Pointing-Pointer Suggesting a link between ischemia and inflammation in ischemic heart biopsies. -- Abstract: A common feature of the ischemic heart and atherosclerotic plaques is the presence of hypoxia (insufficient levels of oxygen in the tissue). Hypoxia has pronounced effects on almost every aspect of cell physiology, and the nuclear transcription factor hypoxia inducible factor-1{alpha} (HIF-1{alpha}) regulates adaptive responses to low concentrations of oxygen in mammalian cells. In our recent work, we observed that hypoxia increases the proinflammatory enzyme arachidonate 15-lipoxygenase (ALOX15B) in human carotid plaques. ALOX15 has recently been shown to be present in the human myocardium, but the effect of ischemia on its expression has not been investigated. Here we test the hypothesis that ischemia of the heart leads to increased expression of ALOX15, and found an almost 2-fold increase in HIF-1{alpha} mRNA expression and a 17-fold upregulation of ALOX15 mRNA expression in the ischemic heart biopsies from patients undergoing coronary bypass surgery compared with non ischemic heart tissue. To investigate the effect of low oxygen concentration on ALOX15 we incubated human vascular muscle cells in hypoxia and showed that expression of ALOX15 increased 22-fold compared with cells incubated in normoxic conditions. We also observed increased mRNA levels of proinflammatory markers in ischemic heart tissue compared with non-ischemic controls. In summary, we demonstrate increased ALOX15 in human ischemic heart biopsies. Furthermore we demonstrate that hypoxia increases ALOX15 in human muscle cells. Our results yield

  14. Insulin-like growth factor 1 treatment of MSCs attenuates inflammation and cardiac dysfunction following MI.

    PubMed

    Guo, Jun; Zheng, Dong; Li, Wen-feng; Li, Hai-rui; Zhang, Ai-dong; Li, Zi-cheng

    2014-12-01

    It has been reported that insulin-like growth factor 1 (IGF-1) promoted migration of endothelial cells and cardiac resident progenitor cells. In the previous study, we found the time-dependent and dose-dependent effects of IGF-1 treatment on the CXCR4 expression in MSCs in vitro, but it is still not clear whether IGF-1 pretreatment of MSCs may play anti-apoptotic and anti-inflammation role in myocardial infarction. In this study, we demonstrated that IGF-1-treated MSCs' transplantation attenuate cardiac dysfunction, increase the survival of engrafted cells in the ischemic heart, decrease myocardium cells apoptosis, and inhibit protein production and gene expression of inflammation cytokines tumor necrosis factor alpha (TNF-α), interleukin (IL)-1β, and IL-6. IGF-1 pretreatment of MSCs may play anti-apoptotic and anti-inflammation roles in post-myocardial infarction.

  15. 49 CFR 325.73 - Microphone distance correction factors. 1

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 5 2013-10-01 2013-10-01 false Microphone distance correction factors. 1 325.73 Section 325.73 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL REGULATIONS COMPLIANCE WITH...

  16. 49 CFR 325.73 - Microphone distance correction factors. 1

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 5 2011-10-01 2011-10-01 false Microphone distance correction factors. 1 325.73 Section 325.73 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL REGULATIONS COMPLIANCE WITH...

  17. 49 CFR 325.73 - Microphone distance correction factors. 1

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 5 2012-10-01 2012-10-01 false Microphone distance correction factors. 1 325.73 Section 325.73 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL REGULATIONS COMPLIANCE WITH...

  18. 49 CFR 325.75 - Ground surface correction factors. 1

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 5 2012-10-01 2012-10-01 false Ground surface correction factors. 1 325.75 Section 325.75 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL REGULATIONS COMPLIANCE WITH...

  19. 49 CFR 325.75 - Ground surface correction factors. 1

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 5 2011-10-01 2011-10-01 false Ground surface correction factors. 1 325.75 Section 325.75 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL REGULATIONS COMPLIANCE WITH...

  20. 49 CFR 325.75 - Ground surface correction factors. 1

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 5 2013-10-01 2013-10-01 false Ground surface correction factors. 1 325.75 Section 325.75 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL REGULATIONS COMPLIANCE WITH...

  1. 49 CFR 325.73 - Microphone distance correction factors. 1

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 5 2014-10-01 2014-10-01 false Microphone distance correction factors. 1 325.73 Section 325.73 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL REGULATIONS COMPLIANCE WITH...

  2. 49 CFR 325.75 - Ground surface correction factors. 1

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 5 2014-10-01 2014-10-01 false Ground surface correction factors. 1 325.75 Section 325.75 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL REGULATIONS COMPLIANCE WITH...

  3. 49 CFR 325.73 - Microphone distance correction factors. 1

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 49 Transportation 5 2010-10-01 2010-10-01 false Microphone distance correction factors. 1 325.73 Section 325.73 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL MOTOR CARRIER SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GENERAL REGULATIONS COMPLIANCE WITH...

  4. 49 CFR 325.75 - Ground surface correction factors. 1

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... determine whether the motor vehicle conforms to the Standards for Highway Operations, 40 CFR 202.20. (b... the motor vehicle conforms to the Standard for Operation Under Stationary Test, 40 CFR 202.21. ... 49 Transportation 5 2010-10-01 2010-10-01 false Ground surface correction factors. 1...

  5. A natural small molecule voacangine inhibits angiogenesis both in vitro and in vivo

    SciTech Connect

    Kim, Yonghyo; Jung, Hye Jin; Kwon, Ho Jeong

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Voacangine exhibits potent anti-angiogenic activity both in vitro and in vivo. Black-Right-Pointing-Pointer Voacangine inhibits tumor-induced angiogenesis by suppressing HIF-1{alpha}. Black-Right-Pointing-Pointer Voacangine could be the basis for the development of novel anti-angiogenic agents. -- Abstract: Angiogenesis, the formation of new blood vessels from pre-existing ones, plays a critical role in normal and pathological phenotypes, including solid tumor growth and metastasis. Accordingly, the development of new anti-angiogenic agents is considered an efficient strategy for the treatment of cancer and other human diseases linked with angiogenesis. We have identified voacangine, isolated from Voacanga africana, as a novel anti-angiogenic agent. Voacangine inhibits the proliferation of HUVECs at an IC{sub 50} of 18 {mu}M with no cytotoxic effects. Voacangine significantly suppressed in vitro angiogenesis, such as VEGF-induced tube formation and chemoinvasion. Moreover, the compound inhibits in vivo angiogenesis in the chorioallantoic membrane at non-toxic doses. In addition, voacangine decreased the expression levels of hypoxia inducible factor-1{alpha} and its target gene, VEGF, in a dose-dependent manner. Taken together, these results suggest that the naturally occurring compound, voacangine, is a novel anti-angiogenic compound.

  6. The class I HDAC inhibitor Romidepsin targets inflammatory breast cancer tumor emboli and synergizes with paclitaxel to inhibit metastasis.

    PubMed

    Robertson, Fredika M; Chu, Khoi; Boley, Kimberly M; Ye, Zaiming; Liu, Hui; Wright, Moishia C; Moraes, Ricardo; Zhang, Xuejun; Green, Tessa L; Barsky, Sanford H; Heise, Carla; Cristofanilli, Massimo

    2013-01-01

    Inflammatory breast cancer (IBC) is the most metastatic variant of locally advanced breast cancer. IBC has distinctive characteristics including invasion of tumor emboli into the skin and rapid disease progression. Given our previous studies suggesting that HDAC inhibitors have promise in targeting IBC, the present study revealed that the class I HDAC inhibitor Romidepsin (FK-288, Istodax; Celgene Corporation, Summit, NJ) potently induced destruction of IBC tumor emboli and lymphatic vascular architecture. associated with inhibition of vascular endothelial growth factor (VEGF) and hypoxia-inducible factor 1alpha, (HIF1alpha) proteins in the Mary-X pre-clinical model of IBC. Romidepsin treatment induced clinically relevant biomarkers in including induction of acetylated Histone 3 (Ac-H3) proteins, apoptosis, and increased p21WAF1/CIP1. Romidepsin, alone and synergistically when combined with Paclitaxel, effectively eliminated both primary tumors and metastatic lesions at multiple sites formed by the SUM149 IBC cell line. This is the first report of the ability of an HDAC inhibitor to eradicate IBC tumor emboli, to destroy the integrity of lymphatic vessel architecture and to target metastasis. Furthermore, Romidepsin, in combination with a taxane, warrants evaluation as a therapeutic strategy that may effectively target the skin involvement and rapid metastasis that are hallmarks of IBC.

  7. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  8. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  9. The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis.

    PubMed

    Ingraham, H A; Lala, D S; Ikeda, Y; Luo, X; Shen, W H; Nachtigal, M W; Abbud, R; Nilson, J H; Parker, K L

    1994-10-01

    Steroidogenic factor 1 (SF-1), an orphan nuclear receptor, regulates the enzymes that produce sex steroids, and disruption of the Ftz-F1 gene encoding SF-1 precludes adrenal and gonadal development. We now study the role of SF-1 at other levels of the hypothalamic/pituitary/gonadal axis. In Ftz-F1-disrupted mice, immunohistochemical analyses with antibodies against pituitary trophic hormones showed a selective loss of gonadotrope-specific markers, supporting the role of SF-1 in gonadotrope function. In situ hybridization analyses confirmed these results; pituitaries from Ftz-F1-disrupted mice lacked transcripts for three gonadotrope-specific markers (LH beta, FSH beta, and the receptor for gonadotropin-releasing hormone), whereas they exhibited decreased but detectable expression of the alpha-subunit of glycoprotein hormones. SF-1 transcripts in the developing mouse pituitary, which first became detectable at embryonic day 13.5-14.5, preceded the appearance of FSH beta and LH beta transcripts. In adult rat pituitary cells, SF-1 transcripts colocalized with immunoreactivity for the gonadotrope-specific LH. Finally, SF-1 interacted with a previously defined promoter element in the glycoprotein hormone alpha-subunit gene, providing a possible mechanism for the impaired gonadotropin expression in Ftz-F1-disrupted mice. These studies establish novel roles of this orphan nuclear receptor in reproductive function.

  10. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  11. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  12. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  13. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  14. The Ape-1/Ref-1 redox antagonist E3330 inhibits the growth of tumor endothelium and endothelial progenitor cells: therapeutic implications in tumor angiogenesis.

    PubMed

    Zou, Gang-Ming; Karikari, Collins; Kabe, Yasuaki; Handa, Hiroshi; Anders, Robert A; Maitra, Anirban

    2009-04-01

    The apurinic/apyrimidinic endonuclease 1/redox factor-1 (Ape-1/Ref-1) is a multi-functional protein, involved in DNA repair and the activation of redox-sensitive transcription factors. The Ape-1/Ref-1 redox domain acts as a cytoprotective element in normal endothelial cells, mitigating the deleterious effects of apoptotic stimuli through induction of survival signals. We explored the role of the Ape-1/Ref-1 redox domain in the maintenance of tumor-associated endothelium, and of endothelial progenitor cells (EPCs), which contribute to tumor angiogenesis. We demonstrate that E3330, a small molecule inhibitor of the Ape-1/Ref-1 redox domain, blocks the in vitro growth of pancreatic cancer-associated endothelial cells (PCECs) and EPCs, which is recapitulated by stable expression of a dominant-negative redox domain mutant. Further, E3330 blocks the differentiation of bone marrow-derived mesenchymal stem cells (BMSCs) into CD31(+) endothelial progeny. Exposure of PCECs to E3330 results in a reduction of H-ras expression and intracellular nitric oxide (NO) levels, as well as decreased DNA-binding activity of the hypoxia-inducible transcription factor, HIF-1alpha. E3330 also reduces secreted and intracellular vascular endothelial growth factor expression by pancreatic cancer cells, while concomitantly downregulating the cognate receptor Flk-1/KDR on PCECs. Inhibition of the Ape-1/Ref-1 redox domain with E3330 or comparable angiogenesis inhibitors might be a potent therapeutic strategy in solid tumors.

  15. The alternative medicine pawpaw and its acetogenin constituents suppress tumor angiogenesis via the HIF-1/VEGF pathway.

    PubMed

    Coothankandaswamy, Veena; Liu, Yang; Mao, Shui-Chun; Morgan, J Brian; Mahdi, Fakhri; Jekabsons, Mika B; Nagle, Dale G; Zhou, Yu-Dong

    2010-05-28

    Products that contain twig extracts of pawpaw (Asimina triloba) are widely consumed anticancer alternative medicines. Pawpaw crude extract (CE) and purified acetogenins inhibited hypoxia-inducible factor-1 (HIF-1)-mediated hypoxic signaling pathways in tumor cells. In T47D cells, pawpaw CE and the acetogenins 10-hydroxyglaucanetin (1), annonacin (2), and annonacin A (3) inhibited hypoxia-induced HIF-1 activation with IC(50) values of 0.02 microg/mL, 12 nM, 13 nM, and 31 nM, respectively. This inhibition correlates with the suppression of the hypoxic induction of HIF-1 target genes VEGF and GLUT-1. The induction of secreted VEGF protein represents a key event in hypoxia-induced tumor angiogenesis. Both the extract and the purified acetogenins blocked the angiogenesis-stimulating activity of hypoxic T47D cells in vitro. Pawpaw extract and acetogenins inhibited HIF-1 activation by blocking the hypoxic induction of nuclear HIF-1alpha protein. The inhibition of HIF-1 activation was associated with the suppression of mitochondrial respiration at complex I. Thus, the inhibition of HIF-1 activation and hypoxic tumor angiogenesis constitutes a novel mechanism of action for these anticancer alternative medicines. PMID:20423107

  16. Synergistic effects of CoCl(2) and ROCK inhibition on mesenchymal stem cell differentiation into neuron-like cells.

    PubMed

    Pacary, Emilie; Legros, Hélène; Valable, Samuel; Duchatelle, Pascal; Lecocq, Myriam; Petit, Edwige; Nicole, Olivier; Bernaudin, Myriam

    2006-07-01

    Bone-marrow-derived mesenchymal stem cells (MSCs) constitute an interesting cellular source to promote brain regeneration after neurodegenerative diseases. Recently, several studies suggested that oxygen-dependent gene expression is of crucial importance in governing the essential steps of neurogenesis such as cell proliferation, survival and differentiation. In this context, we analysed the effect of the HIF-1 (hypoxia inducible factor-1) activation-mimicking agent CoCl(2) on MSCs. CoCl(2) treatment increased the expression of the anti-proliferative gene BTG2/PC3 and decreased cyclin D1 expression. Expression of HIF-1alpha and its target genes EPO, VEGF and p21 was also upregulated. These changes were followed by inhibition of cell proliferation and morphological changes resulting in neuron-like cells, which had increased neuronal marker expression and responded to neurotransmitters. Echinomycin, a molecule inhibiting HIF-1 DNA-binding activity, blocked the CoCl(2) effect on MSCs. Additionally, by using Y-27632, we demonstrated that Rho kinase (ROCK) inhibition potentiated CoCl(2)-induced MSC differentiation in particular into dopaminergic neuron-like cells as attested by its effect on tyrosine hydroxylase expression. Altogether, these results support the ability of MSCs to differentiate into neuron-like cells in response to CoCl(2), an effect that might act, in part, through HIF-1 activation and cell-cycle arrest, and which is potentiated by inhibition of ROCK.

  17. The MAPK pathway and HIF-1 are involved in the induction of the human PAI-1 gene expression by insulin in the human hepatoma cell line HepG2.

    PubMed

    Dimova, Elitsa Y; Kietzmann, Thomas

    2006-12-01

    Enhanced levels of plasminogen activator inhibitor-1 (PAI-1) are considered to be a risk factor for pathological conditions associated with hypoxia or hyperinsulinemia. The expression of the PAI-1 gene is increased by insulin in different cells, although, the molecular mechanisms behind insulin-induced PAI-1 expression are not fully known yet. Here, we show that insulin upregulates human PAI-1 gene expression and promoter activity in HepG2 cells and that mutation of the hypoxia-responsive element (HRE)-binding hypoxia-inducible factor-1 (HIF-1) abolished the insulin effects. Mutation of E-boxes E4 and E5 abolished the insulin-dependent activation of the PAI-1 promoter only under normoxia, but did not affect it under hypoxia. Furthermore, the insulin effect was associated with activation of HIF-1alpha via mitogen-activated protein kinases (MAPKs) but not PDK1 and PKB in HepG2 cells. Furthermore, mutation of a putative FoxO1 binding site which was supposed to be involved in insulin-dependent PAI-1 gene expression influenced the insulin-dependent activation only under normoxia. Thus, insulin-dependent PAI-1 gene expression might be regulated by the action of both HIF-1 and FoxO1 transcription factors.

  18. Phthalimide neovascular factor 1 (PNF1) modulates MT1-MMP activity in human microvascular endothelial cells.

    PubMed

    Wieghaus, Kristen A; Gianchandani, Erwin P; Neal, Rebekah A; Paige, Mikell A; Brown, Milton L; Papin, Jason A; Botchwey, Edward A

    2009-07-01

    We are creating synthetic pharmaceuticals with angiogenic activity and potential to promote vascular invasion. We previously demonstrated that one of these molecules, phthalimide neovascular factor 1 (PNF1), significantly expands microvascular networks in vivo following sustained release from poly(lactic-co-glycolic acid) (PLAGA) films. In addition, to probe PNF1 mode of action, we recently applied a novel pathway-based compendium analysis to a multi-timepoint, controlled microarray data set of PNF1-treated (vs. control) human microvascular endothelial cells (HMVECs), and we identified induction of tumor necrosis factor-alpha (TNF-alpha) and, subsequently, transforming growth factor-beta (TGF-beta) signaling networks by PNF1. Here we validate this microarray data set with quantitative real-time polymerase chain reaction (RT-PCR) analysis. Subsequently, we probe this data set and identify three specific TGF-beta-induced genes with regulation by PNF1 conserved over multiple timepoints-amyloid beta (A4) precursor protein (APP), early growth response 1 (EGR-1), and matrix metalloproteinase 14 (MMP14 or MT1-MMP)-that are also implicated in angiogenesis. We further focus on MMP14 given its unique role in angiogenesis, and we validate MT1-MMP modulation by PNF1 with an in vitro fluorescence assay that demonstrates the direct effects that PNF1 exerts on functional metalloproteinase activity. We also utilize endothelial cord formation in collagen gels to show that PNF1-induced stimulation of endothelial cord network formation in vitro is in some way MT1-MMP-dependent. Ultimately, this new network analysis of our transcriptional footprint characterizing PNF1 activity 1-48 h post-supplementation in HMVECs coupled with corresponding validating experiments suggests a key set of a few specific targets that are involved in PNF1 mode of action and important for successful promotion of the neovascularization that we have observed by the drug in vivo. PMID:19326468

  19. [Effect of insulin and insulin-like growth factor-1 on vascular smooth muscle cells].

    PubMed

    Saneshige, S; Shigehiro, K

    1997-07-01

    Non-insulin-dependent diabetes mellitus, obesity, and essential hypertension are associated with hyperinsulinemia that results from insulin resistance and insulin has been reported to accelerate atherosclerosis. We studied the effects of insulin and insulin-like growth factor-1 (IGF-1) on the growth of porcine vascular smooth muscle cells and on the synthesis of extracellular matrix. The cells were cultured 3-8 changes of Dulbecco's modified Eagle's medium (DMEM) with 10% FCS. Subconfulent cells were put in wells 1 x 10(4) or 1 x 10(5) cells/well in DMEM with or without insulin or IGF-1. The number of cells was counted, and protein and DNA synthesis, expression of genes for collagen alpha1(1), and collagen synthesis were measured. Insulin (0, 16, and 160 nM) and IGF-1 (0, 1, 31, and 13.1 nM) increased number of cells by 50% and 40%, in a dose-dependent manner. Protein and DNA synthesis were also increased by insulin (3.8 and 3.0 times) and by IGF-1 (3.9 and 1.8 time). Collaged protein synthesis was increased 2.3-fold by IGF-1 at 13.1 nM, and insulin (16,000 nM) caused a 26.5-fold increase. Levels of collagen alpha1(1) mRNA were also increased by both insulin and IGF-1. These results suggest that insulin and IGF-1 can cause vascular hyperplasia associated with increased collagen synthesis, which indicates that insulin, IGF-1, or both may have an important role in vascular growth. PMID:9388374

  20. The roles of steroidogenic factor-1 in reproductive function.

    PubMed

    Parker, K L; Ikeda, Y; Luo, X

    1996-04-01

    The cytochrome P450 steroid hydroxylases are expressed in a tissue-specific and developmentally regulated manner, and the orphan nuclear receptor steroidogenic factor 1 (SF-1) participates in both aspects of regulated expression. SF-1 is expressed in mouse embryos from the inception of adrenal and gonadal development, suggesting that SF-1 plays important roles in their differentiation. SF-1 is also expressed in the embryonic pituitary gland and ventral diencephalon, suggesting additional roles within the hypothalamic-pituitary-steroidogenic organ axis. To examine the roles of SF-1 in vivo, we used targeted gene disruption to "knock out" the mouse gene encoding SF-1. Analyses of these knockout mice established roles of SF-1 at levels of endocrine development that include adrenal and gonadal differentiation, pituitary gonadotrope function, and formation of the ventromedial hypothalamic nucleus. These results indicate that SF-1 plays multiple roles in endocrine development that are essential for reproduction.

  1. Structural and Functional Basis of CXCL12 (stromal cell-derived factor-1 alpha) Binding to Heparin

    SciTech Connect

    Murphy,J.; Cho, Y.; Sachpatzidis, A.; Fan, C.; Hodsdon, M.; Lolis, E.

    2007-01-01

    CXCL12 (SDF-1a) and CXCR4 are critical for embryonic development and cellular migration in adults. These proteins are involved in HIV-1 infection, cancer metastasis, and WHIM disease. Sequestration and presentation of CXCL12 to CXCR4 by glycosaminoglycans (GAGs) is proposed to be important for receptor activation. Mutagenesis has identified CXCL12 residues that bind to heparin. However, the molecular details of this interaction have not yet been determined. Here we demonstrate that soluble heparin and heparan sulfate negatively affect CXCL12-mediated in vitro chemotaxis. We also show that a cluster of basic residues in the dimer interface is required for chemotaxis and is a target for inhibition by heparin. We present structural evidence for binding of an unsaturated heparin disaccharide to CXCL12 attained through solution NMR spectroscopy and x-ray crystallography. Increasing concentrations of the disaccharide altered the two-dimensional 1H-15N-HSQC spectra of CXCL12, which identified two clusters of residues. One cluster corresponds to {beta}-strands in the dimer interface. The second includes the amino-terminal loop and the a-helix. In the x-ray structure two unsaturated disaccharides are present. One is in the dimer interface with direct contacts between residues His25, Lys27, and Arg41 of CXCL12 and the heparin disaccharide. The second disaccharide contacts Ala20, Arg21, Asn30, and Lys64. This is the first x-ray structure of a CXC class chemokine in complex with glycosaminoglycans. Based on the observation of two heparin binding sites, we propose a mechanism in which GAGs bind around CXCL12 dimers as they sequester and present CXCL12 to CXCR4.

  2. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  3. Endocannabinoids participate in placental apoptosis induced by hypoxia inducible factor-1.

    PubMed

    Abán, C; Martinez, N; Carou, C; Albamonte, I; Toro, A; Seyahian, A; Franchi, A; Leguizamón, G; Trigubo, D; Damiano, A; Farina, M

    2016-10-01

    During pregnancy, apoptosis is a physiological event critical in the remodeling and aging of the placenta. Increasing evidence has pointed towards the relevance of endocannabinoids (ECs) and hypoxia as modulators of trophoblast cell death. However, the relation between these factors is still unknown. In this report, we evaluated the participation of ECs in placental apoptosis induced by cobalt chloride (CoCl2), a hypoxia mimicking agent that stabilizes the expression of hypoxia inducible factor-1 alpha (HIF-1α). We found that HIF-1α stabilization decreased FAAH mRNA and protein levels, suggesting an increase in ECs tone. Additionally, CoCl2 incubation and Met-AEA treatment reduced cell viability and increased TUNEL-positive staining in syncytiotrophoblast layer. Immunohistochemical analysis demonstrated Bax and Bcl-2 protein expression in the cytoplasm of syncytiotrophoblast. Finally, HIF-1α stabilization produced an increase in Bax/Bcl-2 ratio, activation of caspase 3 and PARP cleavage. All these changes in apoptotic parameters were reversed with AM251, a CB1 antagonist. These results demonstrate that HIF-1α may induce apoptosis in human placenta via intrinsic pathway by a mechanism that involves activation of CB1 receptor suggesting a role of the ECs in this process.

  4. Endocannabinoids participate in placental apoptosis induced by hypoxia inducible factor-1.

    PubMed

    Abán, C; Martinez, N; Carou, C; Albamonte, I; Toro, A; Seyahian, A; Franchi, A; Leguizamón, G; Trigubo, D; Damiano, A; Farina, M

    2016-10-01

    During pregnancy, apoptosis is a physiological event critical in the remodeling and aging of the placenta. Increasing evidence has pointed towards the relevance of endocannabinoids (ECs) and hypoxia as modulators of trophoblast cell death. However, the relation between these factors is still unknown. In this report, we evaluated the participation of ECs in placental apoptosis induced by cobalt chloride (CoCl2), a hypoxia mimicking agent that stabilizes the expression of hypoxia inducible factor-1 alpha (HIF-1α). We found that HIF-1α stabilization decreased FAAH mRNA and protein levels, suggesting an increase in ECs tone. Additionally, CoCl2 incubation and Met-AEA treatment reduced cell viability and increased TUNEL-positive staining in syncytiotrophoblast layer. Immunohistochemical analysis demonstrated Bax and Bcl-2 protein expression in the cytoplasm of syncytiotrophoblast. Finally, HIF-1α stabilization produced an increase in Bax/Bcl-2 ratio, activation of caspase 3 and PARP cleavage. All these changes in apoptotic parameters were reversed with AM251, a CB1 antagonist. These results demonstrate that HIF-1α may induce apoptosis in human placenta via intrinsic pathway by a mechanism that involves activation of CB1 receptor suggesting a role of the ECs in this process. PMID:27488203

  5. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  6. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  7. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  8. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  9. Central nervous system-specific knockout of steroidogenic factor 1.

    PubMed

    Kim, Ki Woo; Zhao, Liping; Parker, Keith L

    2009-03-01

    Steroidogenic factor 1 (SF-1) is a nuclear receptor that plays important roles in the hypothalamus-pituitary-steroidogenic organ axis. Global knockout studies in mice revealed the essential in vivo roles of SF-1 in the ventromedial hypothalamic (VMH) nucleus, adrenal glands, and gonads. One limitation of global SF-1 knockout mice is their early postnatal death from adrenocortical insufficiency. To overcome limitations of the global knockout mice and to delineate the roles of SF-1 in the brain, we used Cre/loxP recombination technology to genetically ablate SF-1 specifically in the central nervous system (CNS). Mice with CNS-specific knockout of SF-1 mediated by nestin-Cre showed increased anxiety-like behavior, revealing a crucial role of SF-1 in a complex behavioral phenotype. Our studies with CNS-specific SF-1 KO mice also defined roles of SF-1 in regulating the VMH expression of target genes implicated in anxiety and energy homeostasis. Therefore, this review will focus on our recent studies defining the functional roles of SF-1 in the VMH linked to anxiety and energy homeostasis.

  10. Haploinsufficiency for Steroidogenic Factor 1 Affects Maternal Behavior in Mice

    PubMed Central

    Spanic, Tanja; Grgurevic, Neza; Majdic, Gregor

    2016-01-01

    Steroidogenic factor 1 (SF-1), officially designated NR5A1, is essential for gonadal and adrenal development and for the normal structure of the ventromedial hypothalamus (VMH), as demonstrated by SF-1 knockout mice (SF-1 KO), but much less is known about the possible effects of haploinsufficiency of the SF-1 gene. In the present study, maternal behavior in SF-1 KO heterozygous mice was evaluated. Behavioral tests revealed that SF-1 KO heterozygous females have impaired maternal behavior. In comparison to wild-type (WT) females, SF-1 KO heterozygous females retrieved significantly fewer pups into their nests, latency to retrieve and crouch over the pups was longer, and their nests were lower quality. As suggested by previous studies full dosage of SF-1 gene is needed for appropriate stress response and expression of brain-derived neurotrophic factor (BDNF) in the brain, and this might present a mechanism through which maternal behavior in SF-1 KO heterozygous females is impaired. PMID:27445727

  11. Tissue-specific knockouts of steroidogenic factor 1.

    PubMed

    Zhao, Liping; Bakke, Marit; Hanley, Neil A; Majdic, Gregor; Stallings, Nancy R; Jeyasuria, Pancharatnam; Parker, Keith L

    2004-02-27

    Targeted gene disruption has produced knockout (KO) mice globally deficient in the orphan nuclear receptor steroidogenic factor 1 (SF-1). These SF-1 KO mice lacked adrenal glands and gonads, and also had impaired expression of gonadotropins in pituitary gonadotropes and marked structural abnormalities of the ventromedial hypothalamic nucleus (VMH). To define the roles of SF-1 within discrete sites of the hypothalamic-pituitary-steroidogenic organ axis, we have sought to make tissue-specific SF-1 KO mice (as reviewed here). We first used adrenal transplants to restore adrenal function in global SF-1 KO mice, providing a physiological form of a "VMH-specific" KO to study the roles of SF-1 in weight regulation. These adrenal-transplanted SF-1 KO mice became obese due to decreased locomotor activity, providing a novel model of hypothalamic obesity. Mice with a pituitary-specific KO of SF-1 mediated by the Cre-loxP recombination strategy exhibited hypogonadotropic hypogonadism, revealing essential roles of SF-1 in pituitary function in vivo. Ongoing studies seek to inactivate SF-1 in the brain or specific gonadal cell types, thereby defining its roles in development and function at these sites. In addition, we review our use of bacterial artificial chromosome transgenesis to develop a fluorescent marker for cells that express SF-1.

  12. Mitochondrial transcription termination factor 1 directs polar replication fork pausing.

    PubMed

    Shi, Yonghong; Posse, Viktor; Zhu, Xuefeng; Hyvärinen, Anne K; Jacobs, Howard T; Falkenberg, Maria; Gustafsson, Claes M

    2016-07-01

    During replication of nuclear ribosomal DNA (rDNA), clashes with the transcription apparatus can cause replication fork collapse and genomic instability. To avoid this problem, a replication fork barrier protein is situated downstream of rDNA, there preventing replication in the direction opposite rDNA transcription. A potential candidate for a similar function in mitochondria is the mitochondrial transcription termination factor 1 (MTERF1, also denoted mTERF), which binds to a sequence just downstream of the ribosomal transcription unit. Previous studies have shown that MTERF1 prevents antisense transcription over the ribosomal RNA genes, a process which we here show to be independent of the transcription elongation factor TEFM. Importantly, we now demonstrate that MTERF1 arrests mitochondrial DNA (mtDNA) replication with distinct polarity. The effect is explained by the ability of MTERF1 to act as a directional contrahelicase, blocking mtDNA unwinding by the mitochondrial helicase TWINKLE. This conclusion is also supported by in vivo evidence that MTERF1 stimulates TWINKLE pausing. We conclude that MTERF1 can direct polar replication fork arrest in mammalian mitochondria. PMID:27112570

  13. Haploinsufficiency for Steroidogenic Factor 1 Affects Maternal Behavior in Mice.

    PubMed

    Spanic, Tanja; Grgurevic, Neza; Majdic, Gregor

    2016-01-01

    Steroidogenic factor 1 (SF-1), officially designated NR5A1, is essential for gonadal and adrenal development and for the normal structure of the ventromedial hypothalamus (VMH), as demonstrated by SF-1 knockout mice (SF-1 KO), but much less is known about the possible effects of haploinsufficiency of the SF-1 gene. In the present study, maternal behavior in SF-1 KO heterozygous mice was evaluated. Behavioral tests revealed that SF-1 KO heterozygous females have impaired maternal behavior. In comparison to wild-type (WT) females, SF-1 KO heterozygous females retrieved significantly fewer pups into their nests, latency to retrieve and crouch over the pups was longer, and their nests were lower quality. As suggested by previous studies full dosage of SF-1 gene is needed for appropriate stress response and expression of brain-derived neurotrophic factor (BDNF) in the brain, and this might present a mechanism through which maternal behavior in SF-1 KO heterozygous females is impaired. PMID:27445727

  14. Molecular characterization of interferon regulatory factor 1 in Bubalus bubalis.

    PubMed

    Stafuzza, N B; Borges, M M; Amaral-Trusty, M E J

    2015-01-01

    Interferon regulatory factor 1 (IRF1) is functionally diverse in the regulation of immune response and is considered to be an important candidate gene for studying disease susceptibility in mammals. In this paper, we characterized the whole sequence of the IRF1 gene in river buffalo (Bubalus bubalis) and compared genomic and the amino acid sequences between different species. The buffalo IRF1 gene was 7099 bp long and organized into 10 exons and nine introns. Its molecular structure showed exactly the same number of exons (10) and introns (nine) in bovids, mice, horses, humans, and chickens. However, rats did not have exon 5, but had the largest exon 4, which suggests that exon 5 was incorporated into exon 4. The coding and the amino acid sequences of the gene showed that identity varied from 73 to 99% at the coding sequence level and from 61 to 100% at the amino acid level when compared with other mammals and chickens. Comparative analysis of the gene sequence between two different buffalo breeds, Murrah and Mediterranean, revealed six potential SNPs that are primarily located in the 5' and 3'UTRs. PMID:26400319

  15. The transcription of the alarmin cytokine interleukin-1 alpha is controlled by hypoxia inducible factors 1 and 2 alpha in hypoxic cells.

    PubMed

    Rider, Peleg; Kaplanov, Irena; Romzova, Marianna; Bernardis, Liora; Braiman, Alex; Voronov, Elena; Apte, Ron N

    2012-01-01

    During hypoxia, cells undergo transcriptional changes to adjust to metabolic stress, to promote cell survival, and to induce pro-angiogenic factors. Hypoxia-induced factors (HIFs) regulate these transcriptional alterations. Failure to restore oxygen levels results in cell death by necrosis. IL-1α is one of the most important mediators of sterile inflammation following hypoxia-mediated necrosis. During hypoxia, IL-1α is up-regulated and released from necrotic cells, promoting the initiation of sterile inflammation. This study examined the role of IL-1α transcription in initiation of hypoxic stress and the correlation between IL-1α transcription and HIFα factors. In an epithelial cell line cultured under hypoxic conditions, IL-1α transcription was up-regulated in a process mediated and promoted by HIFα factors. IL-1α transcription was also up-regulated in hypoxia in a fibroblast cell line, however, in these cells, HIFα factors inhibited the elevation of transcription. These data suggest that HIFα factors play a significant role in initiating sterile inflammation by controlling IL-1α transcription during hypoxia in a differential manner, depending on the cell type.

  16. The transcription of the alarmin cytokine interleukin-1 alpha is controlled by hypoxia inducible factors 1 and 2 alpha in hypoxic cells

    PubMed Central

    Rider, Peleg; Kaplanov, Irena; Romzova, Marianna; Bernardis, Liora; Braiman, Alex; Voronov, Elena; Apte, Ron N.

    2012-01-01

    During hypoxia, cells undergo transcriptional changes to adjust to metabolic stress, to promote cell survival, and to induce pro-angiogenic factors. Hypoxia-induced factors (HIFs) regulate these transcriptional alterations. Failure to restore oxygen levels results in cell death by necrosis. IL-1α is one of the most important mediators of sterile inflammation following hypoxia-mediated necrosis. During hypoxia, IL-1α is up-regulated and released from necrotic cells, promoting the initiation of sterile inflammation. This study examined the role of IL-1α transcription in initiation of hypoxic stress and the correlation between IL-1α transcription and HIFα factors. In an epithelial cell line cultured under hypoxic conditions, IL-1α transcription was up-regulated in a process mediated and promoted by HIFα factors. IL-1α transcription was also up-regulated in hypoxia in a fibroblast cell line, however, in these cells, HIFα factors inhibited the elevation of transcription. These data suggest that HIFα factors play a significant role in initiating sterile inflammation by controlling IL-1α transcription during hypoxia in a differential manner, depending on the cell type. PMID:23049530

  17. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  18. Convergent intron gains in hymenopteran elongation factor-1α.

    PubMed

    Klopfstein, Seraina; Ronquist, Fredrik

    2013-04-01

    The eukaryotic translation elongation factor-1α gene (eEF1A) has been used extensively in higher level phylogenetics of insects and other groups, despite being present in two or more copies in several taxa. Orthology assessment has relied heavily on the position of introns, but the basic assumption of low rates of intron loss and absence of convergent intron gains has not been tested thoroughly. Here, we study the evolution of eEF1A based on a broad sample of taxa in the insect order Hymenoptera. The gene is universally present in two copies - F1 and F2 - both of which apparently originated before the emergence of the order. An elevated ratio of non-synonymous versus synonymous substitutions and differences in rates of amino acid replacements between the copies suggest that they evolve independently, and phylogenetic methods clearly cluster the copies separately. The F2 copy appears to be ancient; it is orthologous with the copy known as F1 in Diptera, and is likely present in most insect orders. The hymenopteran F1 copy, which may or may not be unique to this order, apparently originated through retroposition and was originally intron free. During the evolution of the Hymenoptera, it has successively accumulated introns, at least three of which have appeared at the same position as introns in the F2 copy or in eEF1A copies in other insects. The sites of convergent intron gain are characterized by highly conserved nucleotides that strongly resemble specific intron-associated sequence motifs, so-called proto-splice sites. The significant rate of convergent intron gain renders intron-exon structure unreliable as an indicator of orthology in eEF1A, and probably also in other protein-coding genes.

  19. Hepatocyte nuclear factor 1β controls nephron tubular development.

    PubMed

    Massa, Filippo; Garbay, Serge; Bouvier, Raymonde; Sugitani, Yoshinobu; Noda, Tetsuo; Gubler, Marie-Claire; Heidet, Laurence; Pontoglio, Marco; Fischer, Evelyne

    2013-02-01

    Nephron morphogenesis is a complex process that generates blood-filtration units (glomeruli) connected to extremely long and patterned tubular structures. Hepatocyte nuclear factor 1β (HNF1β) is a divergent homeobox transcription factor that is expressed in kidney from the first steps of nephrogenesis. Mutations in HNF1B (OMIM #137920) are frequently found in patients with developmental renal pathologies, the mechanisms of which have not been completely elucidated. Here we show that inactivation of Hnf1b in the murine metanephric mesenchyme leads to a drastic tubular defect characterized by the absence of proximal, distal and Henle's loop segments. Nephrons were eventually characterized by glomeruli, with a dilated urinary space, directly connected to collecting ducts via a primitive and short tubule. In the absence of HNF1β early nephron precursors gave rise to deformed S-shaped bodies characterized by the absence of the typical bulge of epithelial cells at the bend between the mid and lower segments. The lack of this bulge eventually led to the absence of proximal tubules and Henle's loops. The expression of several genes, including Irx1, Osr2 and Pou3f3, was downregulated in the S-shaped bodies. We also observed decreased expression of Dll1 and the consequent defective activation of Notch in the prospective tubular compartment of comma- and S-shaped bodies. Our results reveal a novel hierarchical relationship between HNF1β and key genes involved in renal development. In addition, these studies define a novel structural and functional component of S-shaped bodies at the origin of tubule formation.

  20. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  1. Colony-stimulating factor 1 potentiates lung cancer bone metastasis.

    PubMed

    Hung, Jaclyn Y; Horn, Diane; Woodruff, Kathleen; Prihoda, Thomas; LeSaux, Claude; Peters, Jay; Tio, Fermin; Abboud-Werner, Sherry L

    2014-04-01

    Colony-stimulating factor 1 (CSF1) is essential for osteoclastogenesis that mediates osteolysis in metastatic tumors. Patients with lung cancer have increased CSF1 in serum and high levels are associated with poor survival. Adenocarcinomas metastasize rapidly and many patients suffer from bone metastasis. Lung cancer stem-like cells sustain tumor growth and potentiate metastasis. The purpose of this study was to determine the role of CSF1 in lung cancer bone metastasis and whether inhibition of CSF1 ameliorates the disease. Human lung adenocarcinoma A549 cells were examined in vitro for CSF1/CSF1R. A549-luc cells were injected intracardiac in NOD/SCID mice and metastasis was assessed. To determine the effect of CSF1 knockdown (KD) in A549 cells on bone metastasis, cells were stably transfected with a retroviral vector containing short-hairpin CSF1 (KD) or empty vector (CT). Results showed that A549 cells express CSF1/CSF1R; CSF1 increased their proliferation and invasion, whereas soluble CSF1R inhibited invasion. Mice injected with A549-luc cells showed osteolytic bone lesions 3.5 weeks after injection and lesions increased over 5 weeks. Tumors recapitulated adenocarcinoma morphology and showed osteoclasts along the tumor/bone interface, trabecular, and cortical bone loss. Analyses of KD cells showed decreased CSF1 protein levels, reduced colony formation in soft agar assay, and decreased fraction of stem-like cells. In CSF1KD mice, the incidence of tumor metastasis was similar to controls, although fewer CSF1KD mice had metastasis in both hind limbs. KD tumors showed reduced CSF1 expression, Ki-67+ cells, and osteoclasts. Importantly, there was a low incidence of large tumors >0.1 mm(2) in CSF1KD mice compared with control mice (10% vs 62.5%). This study established a lung osteolytic bone metastasis model that resembles human disease and suggests that CSF1 is a key determinant of cancer stem cell survival and tumor growth. Results may lead to novel strategies to

  2. Insulin-like growth factor-1 stimulation of lymphopoiesis.

    PubMed Central

    Clark, R; Strasser, J; McCabe, S; Robbins, K; Jardieu, P

    1993-01-01

    We show that treatment of adult mice with recombinant human insulin-like growth factor 1 (rhIGF-1) induces striking modifications in lymphocyte number and function. 9-mo-old male mice received rhIGF-1 (4 mg/kg per d) or its excipient by subcutaneous infusion from osmotic minipumps for 7 or 14 d. Mice were weighed daily and bled at sacrifice; the spleen and thymus were harvested and single cell suspensions were made for analysis of cell phenotype and cell number. The responses of splenocytes to mitogens (concanavalin A, lipopolysaccharide, and pokeweed mitogen), alloantigens and dinitrophenyl ovalbumin were measured. After either 7 or 14 d of treatment, rhIGF-1 had an overall whole-body anabolic effect, resulting in increased body and organ weights with prominent increases in the weight of the spleen and thymus. Furthermore, the rhIGF-1 treated mice were normoglycemic but had reduced blood urea nitrogens, again reflecting the anabolic activity of rhIGF-1. The increased spleen and thymus weights were associated with a large increase in the number of lymphocytes in both organs. In addition to an increase in T cells, specifically CD4+ T cells, a dramatic increase in splenic B cells was also observed. This increase was accompanied by an enhanced responsiveness to dinitrophenyl ovalbumin resulting in increased immunoglobulin production. However, despite the increases in cellularity, there was a decrease in the in vitro responses of spleen cells to mitogens after 7 d of rhIGF-1 treatment. In contrast, treatment with rhIGF-1 for 14 d increased both the cell number and mitogenic responses of splenocytes suggesting that some time is required for the cells populating the peripheral organs to gain mitogenic responsiveness. It is clear from these data that rhIGF-1, at doses that have whole-body anabolic activity, can expand cell number in lymphoid tissue in a normal adult mouse. These dual effects of rhIGF-1, of increasing lymphocyte number and activity, indicate that, in a

  3. Insulin-like growth factor 1 and hair growth.

    PubMed

    Su, H Y; Hickford, J G; Bickerstaffe, R; Palmer, B R

    1999-11-01

    Insulin-like growth factor 1 (IGF-1) has been identified as an important growth factor in many biological systems.[1] It shares considerable structural homology with insulin and exerts insulin-like effects on food intake and glucose metabolism. Recently it has been suggested to play a role in regulating cellular proliferation and migration during the development of hair follicles. [2,3] To exert its biological effects, the IGF-1 is required to activate cells by binding to specific cell-surface receptors. The type I IGF receptor (IGF-1R) is the only IGF receptor to have IGF-mediated signaling functions.[1] In circulation, this growth factor mediates endocrine action of growth hormone (GH) on somatic growth and is bound to specific binding proteins (BPs). The latter control IGF transport, efflux from vascular compartments and association with cell surface receptors.[4] In tissues, IGF-1 is produced by mesenchymal type cells and acts in a paracrine and autocrine fashion by binding to the IGF-1R. This binding activates the receptor tyrosine kinase (RTK) that triggers the downstream responses and finally stimulates cell division.[5] IGF-1 may therefore be able to stimulate the proliferation of hair follicle cells through cellular signaling pathways of its receptors. Local infusion of IGF-1 into sheep has been reported to be capable of stimulating protein synthesis in the skin.[6] It may also increase the production of wool keratin. Recently, transgenic mice overexpressing IGF-1 in the skin have been shown to have earlier hair follicle development than controls.[7] In addition, this growth factor plays an important role in many cell types as a survival factor to prevent cell death.[8] This anti-apoptotic function of IGF-1 may be important to the development of follicle cells as follicles undergo a growth cycle where the regressive, catagen phase is apoptosis driven. In this review, the effects of IGF-1 on follicle cell proliferation and differentiation are discussed. In

  4. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  5. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  6. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  7. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  8. Dietary soy sphingolipids suppress tumorigenesis and gene expression in 1,2-dimethylhydrazine-treated CF1 mice and ApcMin/+ mice.

    PubMed

    Symolon, Holly; Schmelz, Eva M; Dillehay, Dirck L; Merrill, Alfred H

    2004-05-01

    Dietary supplementation with milk sphingolipids inhibits colon tumorigenesis in CF1 mice treated with a colon carcinogen [1,2-dimethylhydrazine (DMH)] and in multiple intestinal neoplasia (Min) mice, which develop intestinal tumors spontaneously. Plant sphingolipids differ structurally from those of mammals [soy glucosylceramide (GlcCer) consists predominantly of a 4,8-sphingadiene backbone and alpha-hydroxy-palmitic acid], which might affect their bioactivity. Soy GlcCer was added to the AIN-76A diet (which contains <0.005% sphingolipid) to investigate whether it would also suppress tumorigenesis in these mouse models. Soy GlcCer reduced colonic cell proliferation in the upper half of the crypts in mice treated with DMH by 50 and 56% (P < 0.05) at 0.025 and 0.1% of the diet (wt/wt), respectively, and reduced the number of aberrant colonic crypt foci (an early marker of colon carcinogenesis) by 38 and 52% (P < 0.05). Min mice fed diets containing 0.025 and 0.1% (wt/wt) soy GlcCer developed 22 and 37% fewer adenomas (P < 0.05), respectively. The effects of dietary sphingolipids on gene expression in the intestinal mucosal cells of Min mice were analyzed using Affymetrix GeneChip microarrays. Soy GlcCer affected the expression of 96 genes by > or = 2-fold in a dose-dependent manner, increasing 32 and decreasing 64. Decreases in the mRNA expression of two transcription factors associated with cancer, hypoxia-induced factor 1 alpha (HIF1 alpha) and transcription factor 4 (TCF4), were confirmed by quantitative RT-PCR. In conclusion, soy GlcCer suppressed colon tumorigenesis in two mouse models; hence, plant sphingolipids warrant further investigation as inhibitors of colon cancer. Because soy contains relatively high amounts of GlcCer, sphingolipids may partially account for the anticancer benefits attributed to soy-based foods.

  9. A Novel Biomarker Panel Examining Response to Gemcitabine with or without Erlotinib for Pancreatic Cancer Therapy in NCIC Clinical Trials Group PA.3

    PubMed Central

    Shultz, David B.; Pai, Jonathan; Chiu, Wayland; Ng, Kendall; Hellendag, Madeline G.; Heestand, Gregory; Chang, Daniel T.; Tu, Dongsheng; Moore, Malcolm J.; Parulekar, Wendy R.; Koong, Albert C.

    2016-01-01

    Purpose NCIC Clinical Trials Group PA.3 was a randomized control trial that demonstrated improved overall survival (OS) in patients receiving erlotinib in addition to gemcitabine for locally advanced or metastatic pancreatic cancer. Prior to therapy, patients had plasma samples drawn for future study. We sought to identify biomarkers within these samples. Experimental Design Using the proximity ligation assay (PLA), a probe panel was built from commercially available antibodies for 35 key proteins selected from a global genetic analysis of pancreatic cancers, and used to quantify protein levels in 20 uL of patient plasma. To determine if any of these proteins levels independently associated with OS, univariate and mulitbaraible Cox models were used. In addition, we examined the associations between biomarker expression and disease stage at diagnosis using Fisher's exact test. The correlation between Erlotinib sensitivity and each biomarkers was assessed using a test of interaction between treatment and biomarker. Results and Conclusion Of the 569 eligible patients, 480 had samples available for study. Samples were randomly allocated into training (251) and validation sets (229). Among all patients, elevated levels of interleukin-8 (IL-8), carcinoembryonic antigen (CEA), hypoxia-inducible factor 1-alpha (HIF-1 alpha), and interleukin-6 were independently associated with lower OS, while IL-8, CEA, platelet-derived growth factor receptor alpha and mucin-1 were associated with metastatic disease. Patients with elevated levels of receptor tyrosine-protein kinase erbB-2 (HER2) expression had improved OS when treated with erlotinib compared to placebo. In conclusion, PLA is a powerful tool for identifying biomarkers from archived, small volume serum samples. These data may be useful to stratify patient outcomes regardless of therapeutic intervention. Trial Registration ClinicalTrials.gov NCT00040183 PMID:26808546

  10. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  11. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  12. Structural integration in hypoxia-inducible factors

    SciTech Connect

    Wu, Dalei; Potluri, Nalini; Lu, Jingping; Kim, Youngchang; Rastinejad, Fraydoon

    2015-08-20

    The hypoxia-inducible factors (HIFs) coordinate cellular adaptations to low oxygen stress by regulating transcriptional programs in erythropoiesis, angiogenesis and metabolism. These programs promote the growth and progression of many tumours, making HIFs attractive anticancer targets. Transcriptionally active HIFs consist of HIF-alpha and ARNT (also called HIF-1 beta) subunits. Here we describe crystal structures for each of mouse HIF-2 alpha-ARNT and HIF-1 alpha-ARNT heterodimers in states that include bound small molecules and their hypoxia response element. A highly integrated quaternary architecture is shared by HIF-2 alpha-ARNT and HIF-1 alpha-ARNT, wherein ARNT spirals around the outside of each HIF-alpha subunit. Five distinct pockets are observed that permit small-molecule binding, including PAS domain encapsulated sites and an interfacial cavity formed through subunit heterodimerization. The DNA-reading head rotates, extends and cooperates with a distal PAS domain to bind hypoxia response elements. HIF-alpha mutations linked to human cancers map to sensitive sites that establish DNA binding and the stability of PAS domains and pockets.

  13. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  14. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  15. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  16. Quinoxaline 1,4-dioxides: hypoxia-selective therapeutic agents.

    PubMed

    Diab-Assef, Mona; Haddadin, Makhluf J; Yared, Pierre; Assaad, Chafika; Gali-Muhtasib, Hala U

    2002-04-01

    A problem that confronts clinicians in the treatment of cancer is the resistance of hypoxic tumors to chemotherapy and radiation therapy. Thus, the development of new drugs that are toxic to hypoxic cells found in solid tumors is an important objective for effective anticancer chemotherapy. We recently showed that the heterocyclic aromatic N-oxides, quinoxaline 1,4-dioxides (QdNOs), are cytotoxic to tumor cells cultured under hypoxia. In this study, we evaluated the hypoxia-selective toxicity of four diversely substituted QdNOs and determined their effect on the expression of hypoxia inducible factor (HIF) 1alpha in the human colon cancer cell line T-84. The various QdNOs were found to possess a 50- to 100-fold greater cytotoxicity to T-84 cells cultured under hypoxia compared with oxia. Interestingly, the hypoxia cytotoxicity ratio (HCR), the ratio of equitoxic concentrations of the drug under aerobic/anoxic conditions, was highly structure related and depended on the nature of the substituents on the QdNO heterocycle. The most cytotoxic 2-benzoyl-3-phenyl-6,7-dichloro derivative of QdNO (DCQ) was potent at a dose of 1 microM with an HCR of 100 and significantly reduced the levels of HIF-1alpha transcript and protein. The 2-benzoyl-3-phenyl derivative (BPQ) had a hypoxia potency of 20 microM and an HCR of 40. By contrast, the 2-aceto-3-methyl and the 2,3-tetramethylene (TMQ) derivatives of QdNO were much less cytotoxic under hypoxia (HCRs of 8.5 and 6.5, respectively) and reduced the expression of HIF-1alpha mRNA to a much lesser extent. Because the nonchlorinated analogue BPQ did not demonstrate behavior similar to that of DCQ, we hypothesize that the C-6, C-7-chlorine of DCQ might play a significant role in the selective hypoxic cytotoxicity of the drug.

  17. Downregulation of miR-210 expression inhibits proliferation, induces apoptosis and enhances radiosensitivity in hypoxic human hepatoma cells in vitro

    SciTech Connect

    Yang, Wei; Sun, Ting; Cao, Jianping; Liu, Fenju; Tian, Ye; Zhu, Wei

    2012-05-01

    Hypoxia is a common feature of solid tumors and an important contributor to tumor radioresistance. miR-210 is the most consistently and robustly induced microRNA under hypoxia in different types of tumor cells and normal cells. In the present study, to explore the feasibility of miR-210 as an effective therapeutic target, lentiviral-mediated anti-sense miR-210 gene transfer technique was employed to downregulate miR-210 expression in hypoxic human hepatoma SMMC-7721, HepG2 and HuH7 cells, and phenotypic changes of which were analyzed. Hypoxia led to an increased hypoxia inducible factor-1{alpha} (HIF-1{alpha}) and miR-210 expression and cell arrest in the G{sub 0}/G{sub 1} phase in all cell lines. miR-210 downregulation significantly suppressed cell viability, induced cell arrest in the G{sub 0}/G{sub 1} phase, increased apoptotic rate and enhanced radiosensitivity in hypoxic human hepatoma cells. Moreover, apoptosis-inducing factor, mitochondrion-associated, 3 (AIFM3) was identified as a direct target gene of miR-210. AIFM3 downregulation by siRNA attenuated radiation induced apoptosis in miR-210 downregulated hypoxic human hepatoma cells. Taken together, these data suggest that miR-210 might be a potential therapeutic target and specific inhibition of miR-210 expression in combination with radiotherapy might be expected to exert strong anti-tumor effect on hypoxic human hepatoma cells. -- Highlights: Black-Right-Pointing-Pointer miR-210 downregulation radiosensitized hypoxic hepatoma. Black-Right-Pointing-Pointer AIFM3 was identified as a direct target gene of miR-210. Black-Right-Pointing-Pointer miR-210 might be a therapeutic target to hypoxic hepatoma.

  18. Gene expression, autonomic function and chronic hypoxia:lessons from the Andes.

    PubMed

    Appenzeller, Otto; Minko, Tamara; Qualls, Clifford; Pozharov, Vitaly; Gamboa, Jorge; Gamboa, Alfredo; Wang, Yang

    2006-06-01

    Autonomic function is altered by altitude in sojourners and natives. We hypothesized that these physiologic responses are modulated by changes in gene expression. We compared gene product levels in 20 natives of Cerro de Pasco (CP), (4338 m), 10 of which had chronic mountain sickness (CMS) established by a CMS-scoring system, with gene products in the same men after 1 h at sea level. We further compared the results with those obtained from 10 US men residing at 1500 m. We measured gene products in white cells by reverse transcription polymerase chain reaction (RT-PCR). We focused on genes important in vascular autonomic physiology, and/or activated by hypoxia; hypoxia inducible factor 1-alpha (HIF 1-alpha), 2 splicing variants of vascular endothelial growth factor (VEGF); VEGF-121, VEGF-165, and phosphoglycerate kinase 1 (PGK 1). Normal CP natives showed high expression of all genes in CP, compared to US controls. Within 1 h of arrival at sea level, they had comparable levels to US residents. In CMS, the gene products were higher in CP. Although gene products decreased in Lima in this group, they never reached US values. VEGF 121 and 165 were correlated (P<0.001). VEGF 165 was higher in CMS in CP (P=0.006), and was positively correlated with CMS-score (R=0.86, P<0.001), and negatively correlated with arterial saturation (R=-0.79, P<0.001). Our findings underscore the changes in gene expression levels in intact humans in response to environmental stress. These changes may support the physiologic alterations induced by the ambient hypoxia at altitude and impact organism survival. They also suggest therapeutic strategies for autonomic and neurodegenerative diseases at sea level.

  19. HIV-1 Vpr Modulates Macrophage Metabolic Pathways: A SILAC-Based Quantitative Analysis

    PubMed Central

    Barrero, Carlos A.; Datta, Prasun K.; Sen, Satarupa; Deshmane, Satish; Amini, Shohreh; Khalili, Kamel; Merali, Salim

    2013-01-01

    Human immunodeficiency virus type 1 encoded viral protein Vpr is essential for infection of macrophages by HIV-1. Furthermore, these macrophages are resistant to cell death and are viral reservoir. However, the impact of Vpr on the macrophage proteome is yet to be comprehended. The goal of the present study was to use a stable-isotope labeling by amino acids in cell culture (SILAC) coupled with mass spectrometry-based proteomics approach to characterize the Vpr response in macrophages. Cultured human monocytic cells, U937, were differentiated into macrophages and transduced with adenovirus construct harboring the Vpr gene. More than 600 proteins were quantified in SILAC coupled with LC-MS/MS approach, among which 136 were significantly altered upon Vpr overexpression in macrophages. Quantified proteins were selected and clustered by biological functions, pathway and network analysis using Ingenuity computational pathway analysis. The proteomic data illustrating increase in abundance of enzymes in the glycolytic pathway (pentose phosphate and pyruvate metabolism) was further validated by western blot analysis. In addition, the proteomic data demonstrate down regulation of some key mitochondrial enzymes such as glutamate dehydrogenase 2 (GLUD2), adenylate kinase 2 (AK2) and transketolase (TKT). Based on these observations we postulate that HIV-1 hijacks the macrophage glucose metabolism pathway via the Vpr-hypoxia inducible factor 1 alpha (HIF-1 alpha) axis to induce expression of hexokinase (HK), glucose-6-phosphate dehyrogenase (G6PD) and pyruvate kinase muscle type 2 (PKM2) that facilitates viral replication and biogenesis, and long-term survival of macrophages. Furthermore, dysregulation of mitochondrial glutamate metabolism in macrophages can contribute to neurodegeneration via neuroexcitotoxic mechanisms in the context of NeuroAIDS. PMID:23874603

  20. Hypoxia/ischemia promotes CXCL10 expression in cardiac microvascular endothelial cells by NFkB activation.

    PubMed

    Xia, Jing-Bo; Liu, Guang-Hui; Chen, Zhuo-Ying; Mao, Cheng-Zhou; Zhou, Deng-Cheng; Wu, Hai-Yan; Park, Kyu-Sang; Zhao, Hui; Kim, Soo-Ki; Cai, Dong-Qing; Qi, Xu-Feng

    2016-05-01

    CXCL10, the chemokine with potent chemotactic activity on immune cells and other non-immune cells expressing its receptor CXCR3, has been demonstrated to involve in myocardial infarction, which was resulted from hypoxia/ischemia. The cardiac microvascular endothelial cells (CMECs) are the first cell type which is implicated by hypoxia/ischemia. However, the potential molecular mechanism by which hypoxia/ischemia regulates the expression of CXCL10 in CMECs remains unclear. In the present study, the expression of CXCL10 was firstly examined by real-time PCR and ELISA analysis. Several potential binding sites (BS) for transcription factors including NF-kappaB (NFkB), HIF1 alpha (HIF1α) and FoxO3a were identified in the promoter region of CXCL10 gene from -2000 bp to -1 bp using bioinformatics software. Luciferase reporter gene vectors for CXCL10 promoter and for activation of above transcription factors were constructed. The activation of NFkB, hypoxia-inducible transcription factor-1 alpha (HIF-1α) and FoxO3a was also analyzed by Western blotting. It was shown that the production of CXCL10 in CMECs was significantly increased by hypoxia/ischemia treatment, in parallel with the activation of CXCL10 promoter examined by reporter gene vector system. Furthermore, transcription factors including NFkB, HIF1α and FoxO3a were activated by hypoxia/ischemia in CMECs. However, over-expression of NFkB, but not that of HIF1α or FoxO3a, significantly promoted the activation of CXCL10 promoter reporter gene. These findings indicated that CXCL10 production in CMECs was significantly increased by hypoxia/ischemia, at least in part, through activation of NFkB pathway and subsequently binding to CXCL10 promoter, finally promoted the transcription of CXCL10 gene.

  1. Nickel decreases cellular iron level and converts cytosolic aconitase to iron-regulatory protein 1 in A549 cells

    SciTech Connect

    Chen Haobin; Davidson, Todd; Singleton, Steven; Garrick, Michael D.; Costa, Max . E-mail: costam@env.med.nyu.edu

    2005-08-15

    Nickel (Ni) compounds are well-established carcinogens and are known to initiate a hypoxic response in cells via the stabilization and transactivation of hypoxia-inducible factor-1 alpha (HIF-1{alpha}). This change may be the consequence of nickel's interference with the function of several Fe(II)-dependent enzymes. In this study, the effects of soluble nickel exposure on cellular iron homeostasis were investigated. Nickel treatment decreased both mitochondrial and cytosolic aconitase (c-aconitase) activity in A549 cells. Cytosolic aconitase was converted to iron-regulatory protein 1, a form critical for the regulation of cellular iron homeostasis. The increased activity of iron-regulatory protein 1 after nickel exposure stabilized and increased transferrin receptor (Tfr) mRNA and antagonized the iron-induced ferritin light chain protein synthesis. The decrease of aconitase activity after nickel treatment reflected neither direct interference with aconitase function nor obstruction of [4Fe-4S] cluster reconstitution by nickel. Exposure of A549 cells to soluble nickel decreased total cellular iron by about 40%, a decrease that likely caused the observed decrease in aconitase activity and the increase of iron-regulatory protein 1 activity. Iron treatment reversed the effect of nickel on cytosolic aconitase and iron-regulatory protein 1. To assess the mechanism for the observed effects, human embryonic kidney (HEK) cells over expressing divalent metal transporter-1 (DMT1) were compared to A549 cells expressing only endogenous transporters for inhibition of iron uptake by nickel. The inhibition data suggest that nickel can enter via DMT1 and compete with iron for entry into the cell. This disturbance of cellular iron homeostasis by nickel may have a great impact on the ability of the cell to regulate a variety of cell functions, as well as create a state of hypoxia in cells under normal oxygen tension. These effects may be very important in how nickel exerts phenotypic

  2. Oxidant conditioning protects cartilage from mechanically induced damage.

    PubMed

    Ramakrishnan, Prem; Hecht, Benjamin A; Pedersen, Douglas R; Lavery, Matthew R; Maynard, Jerry; Buckwalter, Joseph A; Martin, James A

    2010-07-01

    Articular cartilage degeneration in osteoarthritis has been linked to abnormal mechanical stresses that are known to cause chondrocyte apoptosis and metabolic derangement in in vitro models. Evidence implicating oxidative damage as the immediate cause of these harmful effects suggests that the antioxidant defenses of chondrocytes might influence their tolerance for mechanical injury. Based on evidence that antioxidant defenses in many cell types are stimulated by moderate oxidant exposure, we hypothesized that oxidant preconditioning would reduce acute chondrocyte death and proteoglycan depletion in cartilage explants after exposure to abnormal mechanical stresses. Porcine cartilage explants were treated every 48 h with tert-butyl hydrogen peroxide (tBHP) at nonlethal concentrations (25, 100, 250, and 500 microM) for a varying number of times (one, two, or four) prior to a bout of unconfined axial compression (5 MPa, 1 Hz, 1800 cycles). When compared with untreated controls, tBHP had significant positive effects on post-compression viability, lactate production, and proteoglycan losses. Overall, the most effective regime was 100 microM tBHP applied four times. RNA analysis revealed significant effects of 100 microM tBHP on gene expression. Catalase, hypoxia-inducible factor-1alpha (HIF-1alpha), and glyceraldehyde 6-phosphate dehydrogenase (GAPDH) were significantly increased relative to untreated controls in explants treated four times with 100 microM tBHP, a regime that also resulted in a significant decrease in matrix metalloproteinase-3 (MMP-3) expression. These findings demonstrate that repeated exposure of cartilage to sublethal concentrations of peroxide can moderate the acute effects of mechanical stress, a conclusion supported by evidence of peroxide-induced changes in gene expression that could render chondrocytes more resistant to oxidative damage. PMID:20058262

  3. Insulin-like growth factor-1 potentiates platelet activation via the IRS/PI3Kalpha pathway.

    PubMed

    Hers, Ingeborg

    2007-12-15

    As insulin-like growth factor-1 (IGF-1) is present in the alpha granules of platelets and its receptor is expressed on the platelet surface, it may contribute to the amplification of platelet responses and pathogenesis of cardiovascular disease. The functional and signaling pathways that are involved in IGF-1 modulation of platelet function, however, are presently unknown. Here, I report that IGF-1 stimulation of platelets results in dose-dependent phosphorylation of the IGF receptor in the range of 1 to 100 nM. Phosphorylation of the IGF receptor is rapid and sustained, with maximal phosphorylation reached within 1 minute. Furthermore, IGF-1 stimulates tyrosine phosphorylation of insulin receptor substrate-1 (IRS-1) and IRS-2 and their association with the p85 subunit of phosphoinositide-3 kinase (PI3K). IGF-1-stimulated tyrosine phosphorylation of IRS-1 and IRS-2 and subsequent p85 binding is transient and precedes phosphorylation of protein kinase B (PKB) on Ser473. PAR-1-mediated platelet aggregation is potentiated by IGF-1 and this potentiation, together with PKB phosphorylation, is abolished by the PI3Kalpha inhibitors PI-103 and PIK-75. Importantly, the IGF receptor inhibitor NVP-AEW541 and the neutralization antibody alphaIR3 inhibit SFLLRN-stimulated aggregation, implicating IGF-1 in autocrine regulation of platelet function. These results demonstrate that IGF-1 activates the IGF receptor/IRS/PI3K/PKB pathway, and that PI3Kalpha is essential for the potentiatory effect of IGF-1 on platelet responses. PMID:17827393

  4. Insulin-like growth factor-1 potentiates platelet activation via the IRS/PI3Kalpha pathway.

    PubMed

    Hers, Ingeborg

    2007-12-15

    As insulin-like growth factor-1 (IGF-1) is present in the alpha granules of platelets and its receptor is expressed on the platelet surface, it may contribute to the amplification of platelet responses and pathogenesis of cardiovascular disease. The functional and signaling pathways that are involved in IGF-1 modulation of platelet function, however, are presently unknown. Here, I report that IGF-1 stimulation of platelets results in dose-dependent phosphorylation of the IGF receptor in the range of 1 to 100 nM. Phosphorylation of the IGF receptor is rapid and sustained, with maximal phosphorylation reached within 1 minute. Furthermore, IGF-1 stimulates tyrosine phosphorylation of insulin receptor substrate-1 (IRS-1) and IRS-2 and their association with the p85 subunit of phosphoinositide-3 kinase (PI3K). IGF-1-stimulated tyrosine phosphorylation of IRS-1 and IRS-2 and subsequent p85 binding is transient and precedes phosphorylation of protein kinase B (PKB) on Ser473. PAR-1-mediated platelet aggregation is potentiated by IGF-1 and this potentiation, together with PKB phosphorylation, is abolished by the PI3Kalpha inhibitors PI-103 and PIK-75. Importantly, the IGF receptor inhibitor NVP-AEW541 and the neutralization antibody alphaIR3 inhibit SFLLRN-stimulated aggregation, implicating IGF-1 in autocrine regulation of platelet function. These results demonstrate that IGF-1 activates the IGF receptor/IRS/PI3K/PKB pathway, and that PI3Kalpha is essential for the potentiatory effect of IGF-1 on platelet responses.

  5. Three genes for the elongation factor EF-1 alpha in Mucor racemosus.

    PubMed

    Linz, J E; Katayama, C; Sypherd, P S

    1986-02-01

    We cloned three genes from Mucor racemosus coding for protein synthesis elongation factor 1 alpha (EF-1 alpha). A 110-base-pair (bp) EF-1 alpha-specific cDNA clone was identified by hybrid-selected translation. The nucleotide sequence of the cDNA showed significant homology to a region of the Saccharomyces cerevisiae genes for EF-1 alpha (TEF1 and TEF2). The cDNA was used to isolate an 850-bp EcoRI genomic DNA fragment containing a portion of the EF-1 alpha gene. Screening of a lambda/M. racemosus genomic DNA bank with the 850-bp EcoRI probe resulted in the identification of three DNA fragments containing a common 850-bp EcoRI fragment within a short overlapping region. S1 nuclease analysis of the three EF-1 alpha DNA fragments showed that the EF-1 alpha transcript covered the short overlapping region in the clones. Restriction fragments purified from flanking regions in each clone were used to probe a HindIII digest of M. racemosus genomic DNA. Each flanking probe hybridized to one of three DNA fragments which hybridized to the 850-bp EF-1 alpha-specific probe. Nucleotide sequence data from two random "shotgun clones" of one of the three genes show good homology to two regions of S. cerevisiae TEF1. The data indicate the presence of three genes for EF-1 alpha in M. racemosus located at unique sites in the genome. PMID:2946933

  6. In vivo study of breast carcinoma radiosensitization by targeting eIF4E

    SciTech Connect

    Yang, Hua; Li, Li-Wen; Shi, Mei; Wang, Jian-Hua; Xiao, Feng; Zhou, Bin; Diao, Li-Qiong; Long, Xiao-Li; Liu, Xiao-Li; Xu, Lin

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer eIF4E is associated with the formation and progression for breast cancer. Black-Right-Pointing-Pointer pSecX-t4EBP1 can downregulated the expression of eIF4E in direct binding. Black-Right-Pointing-Pointer We transfected pSecX-t4EBP1 into a mouse xenograft model. Black-Right-Pointing-Pointer It can significantly inhibit tumor growth and enhance the radiosensitivity. Black-Right-Pointing-Pointer The possible mechanism is downregulation of HIF-1{alpha} expression. -- Abstract: Background: Eukaryotic initiation factor eIF4E, an important regulator of translation, plays a crucial role in the malignant transformation, progression and radioresistance of many human solid tumors. The overexpression of this gene has been associated with tumor formation in a wide range of human malignancies, including breast cancer. In the present study, we attempted to explore the use of eIF4E as a therapeutic target to enhance radiosensitivity for breast carcinomas in a xenograft BALB/C mice model. Materials and methods: Ninety female BALB/C mice transfected with EMT-6 cells were randomly divided into six groups: control, irradiation (IR), pSecX-t4EBP1, pSecX-t4EBP1 + irradiation, pSecX and pSecX + irradiation. At the end of the experiments, all mice were sacrificed, the xenografts were harvested to measure the tumor volume and mass, and the tumor inhibition rates were calculated. Apoptosis was detected with a flow cytometric assay. Immunohistochemistry was used to detect the expression of HIF-1{alpha}. Results: The xenografts in pSecX-t4EBP1 mice showed a significantly delayed growth and smaller tumor volume, with a higher tumor inhibition rate compared with the control and pSecX groups. A similar result was obtained in the pSecX-t4EBP1 + IR group compared with IR alone and pSecX + irradiation. The expression of HIF-1{alpha} in the tumor cells was significantly decreased, while the apoptosis index was much higher. Conclusions: pSecX-t4EBP1 can

  7. Insulin-like growth factor-1 ameliorates age-related behavioral deficits.

    PubMed

    Markowska, A L; Mooney, M; Sonntag, W E

    1998-12-01

    Insulin-like growth factor-1 has been found to be involved in the regulation of several aspects of brain metabolism, neural transmission, neural growth and differentiation. Because decreased insulin-like growth factor-1 and/or its receptors are likely to contribute to age-related abnormalities in behavior, the strategy of replacing this protein is one potential therapeutic alternative. The present study was designed to assess whether cognitive deficits with ageing may be partially overcome by increasing the availability of insulin-like growth factor-1 in the brain. Fischer-344 x Brown Norway hybrid (F1) male rats of two ages (four-months-old and 32-months-old) were preoperatively trained in behavioral tasks and subsequently implanted with osmotic minipumps to infuse the insulin-like growth factor-1 (23.5 microg/pump) or a vehicle, i.c.v. Animals were retested at two weeks and four weeks after surgery. Insulin-like growth factor-1 improved working memory in the repeated acquisition task and in the object recognition task. An improvement was also observed in the place discrimination task, which assesses reference memory. Insulin-like growth factor-1 had no effect on sensorimotor skills nor exploration, but mildly reversed some age-related deficits in emotionality. These data indicate a potentially important role for insulin-like growth factor-1 in the reversal of age-related behavioral impairments in rodents.

  8. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  9. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  10. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  11. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  12. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  13. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  14. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  15. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  16. Insulin-like growth factor 1 receptors in human breast tumour: localisation and quantification by histo-autoradiographic analysis.

    PubMed Central

    Jammes, H.; Peyrat, J. P.; Ban, E.; Vilain, M. O.; Haour, F.; Djiane, J.; Bonneterre, J.

    1992-01-01

    To assess the precise role of IGF1 in benign and malignant breast diseases, we analysed the tissular localisation, characterised, and quantified specific insulin-like growth factor 1 (IGF1) binding sites in these heterogenous tissues, using histo-autoradiographic analysis (HAA). The 125I-IGF1 binding was performed on frozen tissue sections and analysed using 3H Ultrofilm autoradiography coupled to computerised image analysis. Competitive binding experiments using unlabelled IGF1, IGF2 and insulin showed that the tissues exhibited typical type I IGF binding sites. This specificity was confirmed by the use of alpha IR-3 monoclonal antibody, as inhibitor of 125I-IGF1 binding. IGF1 binding sites were detected in 18 human primary breast cancers, 12 benign breast tumours and two normal breast tissues. Using HAA we found that the human breast carcinomas studied exhibit a specific and high binding capacity for 125I-IGF1 exclusively localised on the proliferative epithelial component. The 125I-IGF1 binding activity of benign breast tumours or normal breast tissue was significantly lower than in cancerous tissues. There was a significant correlation between IGF1-R concentrations detected with HAA and those detected with a classical biochemical method. Moreover, HAA could be useful in further detailing whether a tumour is IGF1-R positive or negative HAA appears to be a useful method for the detection of growth factor receptors, specially in small biopsy specimens. Images Figure 2 Figure 3 PMID:1323990

  17. Elevated Peritoneal Fluid TNF-α Incites Ovarian Early Growth Response Factor 1 Expression and Downstream Protease Mediators

    PubMed Central

    Birt, Julie A.; Nabli, Henda; Stilley, Julie A.; Windham, Emma A.; Frazier, Shellaine R.

    2013-01-01

    Endometriosis-associated infertility manifests itself via multiple, poorly understood mechanisms. Our goal was to characterize signaling pathways, between peritoneal endometriotic lesions and the ovary, leading to failed ovulation. Genome-wide microarray analysis comparing ovarian tissue from an in vivo endometriosis model in the rat (Endo) with controls (Sham) identified 22 differentially expressed genes, including transiently expressed early growth response factor 1 (Egr1). The Egr1 regulates gene requisites for ovulation. The Egr1 promoter is responsive to tumor necrosis factor-alpha (TNF-α) signaling. We hypothesized that altered expression of ovarian EGR1 is induced by elevated peritoneal fluid TNF-α which is upregulated by the presence of peritoneal endometriosis. Endo rats, compared to controls, had more peritoneal fluid TNF-α and quantitative, spatial differences in Egr1 mRNA and EGR1 protein localization in follicular compartments. Interactions between elevated peritoneal fluid TNF-α and overexpression of follicular Egr1/EGR1 expression may affect downstream protease pathways impeding ovulation in endometriosis. Preliminary studies identified similar patterns of EGR1 protein localization in human ovaries from women with endometriosis and compared to those without endometriosis. PMID:23427178

  18. Regulation of genes encoding steroidogenic factor-1 (SF-1) and gonadotropin subunits in the ovine pituitary gland.

    PubMed

    Baratta, M; Turzillo, A M; Arreguin-Arevalo, A; Clay, C M; Nett, T M

    2003-07-01

    Steroidogenic factor-1 (SF-1) is a transcription factor originally characterized as a mediator of gene expression in steroidogenic tissues. Studies in SF-1 knockout mice revealed that SF-1 has additional roles at multiple levels of the hypothalamic-pituitary-gonadal axis, including regulation of gene expression in pituitary gonadotropes. Specific binding sites for SF-1 have been demonstrated in several pituitary genes with essential roles in gonadotropin synthesis, including alpha subunit, LHbeta subunit, and GnRH receptor. In studies aimed at identifying physiological factors controlling pituitary expression of SF-1, GnRH has been implicated as a co-regulator of SF-1 and gonadotropin subunit genes. In both rats and ewes, elevated endogenous secretion of GnRH following ovariectomy was associated with increased amounts of SF-1 mRNA in the anterior pituitary gland. Conversely, removal of GnRH input to the pituitary gland by hypothalamic-pituitary disconnection (HPD) in ovariectomized (OVX) ewes reduced SF-1 expression. Despite these changes, however, treatment of OVX ewes with GnRH following HPD only partially restored levels of SF-1 mRNA in the pituitary gland. Therefore, it is possible that regulation of SF-1 gene expression by GnRH during the estrous cycle may involve ovarian hormones or other hypothalamic factors. Additional studies are required to further define the physiological roles of SF-1 in regulation of the hypothalamic-pituitary-gonadal axis in domestic ruminants.

  19. Molecular characterization and expression analysis of elongation factors 1A and 2 from the Pacific white shrimp, Litopenaeus vannamei.

    PubMed

    Wang, Lei; Liu, Yuan; Wang, Wei-Na; Mai, Wei-Jun; Xin, Yu; Zhou, Jun; He, Wen-Yin; Wang, An-Li; Sun, Ru-Yong

    2011-03-01

    Elongation factors (EF) are abundant cell proteins that play important roles in the metabolism of all multicellular organisms. Here we describe a functional analysis of elongation factor 1-alpha (EF1A) and elongation factor 2 (EF2), from the Pacific white shrimp, Litopenaeus vannamei. Full-length cDNAs of genes corresponding to EF1A and EF2 were obtained that were 1547 and 2729 bp long, with open reading frames encoding 461 and 846 amino acids, respectively. The deduced amino acid sequences of L. vannamei EF1A and EF2 showed high similarity with those from mice, humans, chickens and other shrimps. RT-PCR analysis indicated that mRNA transcripts of EF1A and EF2 are strongly (but differentially) expressed in haemocytes and gill tissue, and at varying levels in other examined tissues, of the shrimps. Levels of both EF1A and EF2 transcripts increased when shrimps were challenged by pH and cadmium stress, but reached maximal levels after different exposure periods. These results indicate that EF1A and EF2 may play distinct, essential roles in the repair of cellular damage induced by pH and cadmium stress. PMID:20857205

  20. Treatment with an activator of hypoxia-inducible factor 1, DMOG provides neuroprotection after traumatic brain injury.

    PubMed

    Sen, Tanusree; Sen, Nilkantha

    2016-08-01

    Traumatic brain injury (TBI) is one of the major cause of morbidity and mortality and it affects more than 1.7 million people in the USA. A couple of regenerative pathways including activation of hypoxia-inducible transcription factor 1 alpha (HIF-1α) are initiated to reduce cellular damage following TBI; however endogenous activation of these pathways is not enough to provide neuroprotection after TBI. Thus we aimed to see whether sustained activation of HIF-1α can provide neuroprotection and neurorepair following TBI. We found that chronic treatment with dimethyloxaloylglycine (DMOG) markedly increases the expression level of HIF-1α and mRNA levels of its downstream proteins such as Vascular endothelial growth factor (VEGF), Phosphoinositide-dependent kinase-1 and 4 (PDK1, PDK4) and Erythropoietin (EPO). Treatment of DMOG activates a major cell survival protein kinase Akt and reduces both cell death and lesion volume following TBI. Moreover, administration of DMOG augments cluster of differentiation 31 (CD31) staining in pericontusional cortex after TBI, which suggests that DMOG stimulates angiogenesis after TBI. Treatment with DMOG also improves both memory and motor functions after TBI. Taken together our results suggest that sustained activation of HIF-1α provides significant neuroprotection following TBI. PMID:26970014

  1. The nuclear elongation factor-1α gene: a promising marker for phylogenetic studies of Triatominae (Hemiptera: Reduviidae).

    PubMed

    Díaz, Sebastián; Triana-Chávez, Omar; Gómez-Palacio, Andrés

    2016-09-01

    Molecular systematics is a remarkable approach for understanding the taxonomic traits and allows the exploration of the inter-population dynamics of several species in the Triatominae subfamily that are involved in Trypanosoma cruzi transmission. Compared to other relevant species that transmit vector-borne diseases, such as some species of the Diptera, there are relatively few nuclear genetic markers available for systematic studies in the Triatominae subfamily. Molecular systematic studies performed on Triatominae are based on mitochondrial gene fragments and, less frequently, on nuclear ribosomal genes or spacers. Due to the fact that these markers can occasionally present problems such as nuclear mitochondrial genes (NUMTs) or intra-genomic variation for high gene copy numbers, it is necessary to use additional nuclear markers to more reliably address the molecular evolution of Triatominae. In this study, we performed phylogenetic analysis using the nuclear elongation factor-1 alpha (EF-1α) gene in individuals from 12 species belonging to the Triatomini and Rhodniini tribes. Genetic diversities and phylogenetic topologies were compared with those obtained for the mitochondrial 16S rRNA and Cytochrome b (cyt b) genes, as well as for the D2 variable region of the ribosomal 28S rRNA gene. These results indicate that the EF-1α marker exhibits an intermediate level of diversity compared to mitochondrial and nuclear ribosomal genes, and that phylogenetic analysis based on EF-1α is highly informative for resolving deep phylogenetic relationships in Triatominae, such as tribe or genera.

  2. The nuclear elongation factor-1α gene: a promising marker for phylogenetic studies of Triatominae (Hemiptera: Reduviidae).

    PubMed

    Díaz, Sebastián; Triana-Chávez, Omar; Gómez-Palacio, Andrés

    2016-09-01

    Molecular systematics is a remarkable approach for understanding the taxonomic traits and allows the exploration of the inter-population dynamics of several species in the Triatominae subfamily that are involved in Trypanosoma cruzi transmission. Compared to other relevant species that transmit vector-borne diseases, such as some species of the Diptera, there are relatively few nuclear genetic markers available for systematic studies in the Triatominae subfamily. Molecular systematic studies performed on Triatominae are based on mitochondrial gene fragments and, less frequently, on nuclear ribosomal genes or spacers. Due to the fact that these markers can occasionally present problems such as nuclear mitochondrial genes (NUMTs) or intra-genomic variation for high gene copy numbers, it is necessary to use additional nuclear markers to more reliably address the molecular evolution of Triatominae. In this study, we performed phylogenetic analysis using the nuclear elongation factor-1 alpha (EF-1α) gene in individuals from 12 species belonging to the Triatomini and Rhodniini tribes. Genetic diversities and phylogenetic topologies were compared with those obtained for the mitochondrial 16S rRNA and Cytochrome b (cyt b) genes, as well as for the D2 variable region of the ribosomal 28S rRNA gene. These results indicate that the EF-1α marker exhibits an intermediate level of diversity compared to mitochondrial and nuclear ribosomal genes, and that phylogenetic analysis based on EF-1α is highly informative for resolving deep phylogenetic relationships in Triatominae, such as tribe or genera. PMID:27268149

  3. Role of insulin, insulin-like growth factor-1, hyperglycaemic food and milk consumption in the pathogenesis of acne vulgaris.

    PubMed

    Melnik, Bodo C; Schmitz, Gerd

    2009-10-01

    It is the purpose of this viewpoint article to delineate the regulatory network of growth hormone (GH), insulin, and insulin-like growth factor-1 (IGF-1) signalling during puberty, associated hormonal changes in adrenal and gonadal androgen metabolism, and the impact of dietary factors and smoking involved in the pathogenesis of acne. The key regulator IGF-1 rises during puberty by the action of increased GH secretion and correlates well with the clinical course of acne. In acne patients, associations between serum levels of IGF-1, dehydroepiandrosterone sulphate, dihydrotestosterone, acne lesion counts and facial sebum secretion rate have been reported. IGF-1 stimulates 5alpha-reductase, adrenal and gonadal androgen synthesis, androgen receptor signal transduction, sebocyte proliferation and lipogenesis. Milk consumption results in a significant increase in insulin and IGF-1 serum levels comparable with high glycaemic food. Insulin induces hepatic IGF-1 secretion, and both hormones amplify the stimulatory effect of GH on sebocytes and augment mitogenic downstream signalling pathways of insulin receptors, IGF-1 receptor and fibroblast growth factor receptor-2b. Acne is proposed to be an IGF-1-mediated disease, modified by diets and smoking increasing insulin/IGF1-signalling. Metformin treatment, and diets low in milk protein content and glycaemic index reduce increased IGF-1 signalling. Persistent acne in adulthood with high IGF-1 levels may be considered as an indicator for increased risk of cancer, which may require appropriate dietary intervention as well as treatment with insulin-sensitizing agents.

  4. Flavonoid Compound Icariin Activates Hypoxia Inducible Factor-1α in Chondrocytes and Promotes Articular Cartilage Repair.

    PubMed

    Wang, Pengzhen; Zhang, Fengjie; He, Qiling; Wang, Jianqi; Shiu, Hoi Ting; Shu, Yinglan; Tsang, Wing Pui; Liang, Shuang; Zhao, Kai; Wan, Chao

    2016-01-01

    Articular cartilage has poor capability for repair following trauma or degenerative pathology due to avascular property, low cell density and migratory ability. Discovery of novel therapeutic approaches for articular cartilage repair remains a significant clinical need. Hypoxia is a hallmark for cartilage development and pathology. Hypoxia inducible factor-1alpha (HIF-1α) has been identified as a key mediator for chondrocytes to response to fluctuations of oxygen availability during cartilage development or repair. This suggests that HIF-1α may serve as a target for modulating chondrocyte functions. In this study, using phenotypic cellular screen assays, we identify that Icariin, an active flavonoid component from Herba Epimedii, activates HIF-1α expression in chondrocytes. We performed systemic in vitro and in vivo analysis to determine the roles of Icariin in regulation of chondrogenesis. Our results show that Icariin significantly increases hypoxia responsive element luciferase reporter activity, which is accompanied by increased accumulation and nuclear translocation of HIF-1α in murine chondrocytes. The phenotype is associated with inhibiting PHD activity through interaction between Icariin and iron ions. The upregulation of HIF-1α mRNA levels in chondrocytes persists during chondrogenic differentiation for 7 and 14 days. Icariin (10-6 M) increases the proliferation of chondrocytes or chondroprogenitors examined by MTT, BrdU incorporation or colony formation assays. Icariin enhances chondrogenic marker expression in a micromass culture including Sox9, collagen type 2 (Col2α1) and aggrecan as determined by real-time PCR and promotes extracellular matrix (ECM) synthesis indicated by Alcian blue staining. ELISA assays show dramatically increased production of aggrecan and hydroxyproline in Icariin-treated cultures at day 14 of chondrogenic differentiation as compared with the controls. Meanwhile, the expression of chondrocyte catabolic marker genes

  5. Flavonoid Compound Icariin Activates Hypoxia Inducible Factor-1α in Chondrocytes and Promotes Articular Cartilage Repair

    PubMed Central

    He, Qiling; Wang, Jianqi; Shiu, Hoi Ting; Shu, Yinglan; Tsang, Wing Pui; Liang, Shuang; Zhao, Kai; Wan, Chao

    2016-01-01

    Articular cartilage has poor capability for repair following trauma or degenerative pathology due to avascular property, low cell density and migratory ability. Discovery of novel therapeutic approaches for articular cartilage repair remains a significant clinical need. Hypoxia is a hallmark for cartilage development and pathology. Hypoxia inducible factor-1alpha (HIF-1α) has been identified as a key mediator for chondrocytes to response to fluctuations of oxygen availability during cartilage development or repair. This suggests that HIF-1α may serve as a target for modulating chondrocyte functions. In this study, using phenotypic cellular screen assays, we identify that Icariin, an active flavonoid component from Herba Epimedii, activates HIF-1α expression in chondrocytes. We performed systemic in vitro and in vivo analysis to determine the roles of Icariin in regulation of chondrogenesis. Our results show that Icariin significantly increases hypoxia responsive element luciferase reporter activity, which is accompanied by increased accumulation and nuclear translocation of HIF-1α in murine chondrocytes. The phenotype is associated with inhibiting PHD activity through interaction between Icariin and iron ions. The upregulation of HIF-1α mRNA levels in chondrocytes persists during chondrogenic differentiation for 7 and 14 days. Icariin (10−6 M) increases the proliferation of chondrocytes or chondroprogenitors examined by MTT, BrdU incorporation or colony formation assays. Icariin enhances chondrogenic marker expression in a micromass culture including Sox9, collagen type 2 (Col2α1) and aggrecan as determined by real-time PCR and promotes extracellular matrix (ECM) synthesis indicated by Alcian blue staining. ELISA assays show dramatically increased production of aggrecan and hydroxyproline in Icariin-treated cultures at day 14 of chondrogenic differentiation as compared with the controls. Meanwhile, the expression of chondrocyte catabolic marker genes

  6. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  7. Sphingosine kinase-1 is a hypoxia-regulated gene that stimulates migration of human endothelial cells

    SciTech Connect

    Schwalm, Stephanie; Doell, Frauke; Roemer, Isolde; Bubnova, Svetlana

    2008-04-18

    Sphingosine kinases (SK) catalyze the production of sphingosine-1-phosphate which in turn regulates cell responses such as proliferation and migration. Here, we show that exposure of the human endothelial cell line EA.hy 926 to hypoxia stimulates a increased SK-1, but not SK-2, mRNA, protein expression, and activity. This effect was due to stimulated SK-1 promoter activity which contains two putative hypoxia-inducible factor-responsive-elements (HRE). By deletion of one of the two HREs, hypoxia-induced promoter activation was abrogated. Furthermore, hypoxia upregulated the expression of HIF-1{alpha} and HIF-2{alpha}, and both contributed to SK-1 gene transcription as shown by selective depletion of HIF-1{alpha} or HIF-2{alpha} by siRNA. The hypoxia-stimulated SK-1 upregulation was functionally coupled to increased migration since the selective depletion of SK-1, but not of SK-2, by siRNAs abolished the migratory response. In summary, these data show that hypoxia upregulates SK-1 activity and results in an accelerated migratory capacity of endothelial cells. SK-1 may thus serve as an attractive therapeutic target to treat diseases associated with increased endothelial migration and angiogenesis such as cancer growth and progression.

  8. Retention of prolyl hydroxylase PHD2 in the cytoplasm prevents PHD2-induced anchorage-independent carcinoma cell growth

    SciTech Connect

    Jokilehto, Terhi; Hoegel, Heidi; Heikkinen, Pekka; Rantanen, Krista; Elenius, Klaus; Sundstroem, Jari; Jaakkola, Panu M.

    2010-04-15

    Cellular oxygen tension is sensed by a family of prolyl hydroxylases (PHD1-3) that regulate the degradation of hypoxia-inducible factors (HIF-1{alpha} and -2{alpha}). The PHD2 isoform is considered as the main downregulator of HIF in normoxia. Our previous results have shown that nuclear translocation of PHD2 associates with poorly differentiated tumor phenotype implying that nuclear PHD2 expression is advantageous for tumor growth. Here we show that a pool of PHD2 is shuttled between the nucleus and the cytoplasm. In line with this, accumulation of wild type PHD2 in the nucleus was detected in human colon adenocarcinomas and in cultured carcinoma cells. The PHD2 isoforms showing high nuclear expression increased anchorage-independent carcinoma cell growth. However, retention of PHD2 in the cytoplasm inhibited the anchorage-independent cell growth. A region that inhibits the nuclear localization of PHD2 was identified and the deletion of the region promoted anchorage-independent growth of carcinoma cells. Finally, the cytoplasmic PHD2, as compared with the nuclear PHD2, less efficiently downregulated HIF expression. Forced HIF-1{alpha} or -2{alpha} expression decreased and attenuation of HIF expression increased the anchorage-independent cell growth. However, hydroxylase-inactivating mutations in PHD2 had no effect on cell growth. The data imply that nuclear PHD2 localization promotes malignant cancer phenotype.

  9. Upregulation of hypoxia-inducible factors in normal and psoriatic skin.

    PubMed

    Rosenberger, Christian; Solovan, Caius; Rosenberger, Alina D; Jinping, Li; Treudler, Regina; Frei, Ulrich; Eckardt, Kai-Uwe; Brown, Lawrence F

    2007-10-01

    Angiogenesis induced by vascular endothelial growth factor (VEGF) plays an important role in psoriasis. Hypoxic adaptation is conferred through hypoxia-inducible transcription factors (HIFs). VEGF and its receptor Flt-1 are HIF target genes. Growth factors and inflammatory cytokines activate the phosphoinositol-3 kinase pathway, and via activated protein kinase B (phospho-Akt) augment HIF activity. Here, we demonstrate that the major oxygen-dependent HIF isoforms are strongly upregulated in psoriatic skin: HIF-1alpha mainly in the epidermis, in an expression pattern similar to VEGF mRNA; HIF-2alpha in both the epidermis and in capillary endothelial cells of the dermis. In contrast, normal human skin shows low expression of HIF-alpha proteins, with the exception of hair follicles, and glands, which strongly express HIF-1alpha. In normal human skin, phospho-Akt appeared in the basal epidermal layer, in hair follicles, and in dermal glands. In contrast, in psoriasis, phospho-Akt expression was low in the epidermis, but markedly enhanced in the dermal capillaries and in surrounding interstitial/inflammatory cells. Our data suggest that hypoxia initiates a potentially self-perpetuating cycle involving HIF, VEGF, and Akt activation, which could drive physiologic growth of hair follicles and skin glands. Furthermore, such a cycle may exist in psoriasis in dermal capillaries and contribute to disease progression. PMID:17495954

  10. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  11. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  12. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  13. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  14. Prognostic impact and the relevance of PTEN copy number alterations in patients with advanced colorectal cancer (CRC) receiving bevacizumab.

    PubMed

    Price, Timothy J; Hardingham, Jennifer E; Lee, Chee K; Townsend, Amanda R; Wrin, Joseph W; Wilson, Kate; Weickhardt, Andrew; Simes, Robert J; Murone, Carmel; Tebbutt, Niall C

    2013-06-01

    Loss of phosphatase and tensin homologue (PTEN) expression may be prognostic in colorectal cancer (CRC) and may have a correlation with vascular endothelial growth factor (VEGF) expression via hypoxia-inducible factor 1 (HIF-1) alpha, and the PI3K/mTOR pathways. We therefore have explored the prognostic association of PTEN loss and the potential that PTEN loss may be predictive of outcome with bevacizumab. Patients enrolled in the AGITG MAX trial, a randomized Phase III trial of capecitabine (C) +/- bevacizumab (B) (+/- mitomycin C [M]) with available tissues were analyzed for PTEN expression (loss vs. no loss) as assessed using a Taqman® copy number assay (CNA). Of the original 471 patients enrolled, tissues from 302 (64.1%) patients were analyzed. PTEN loss was observed in 38.7% of patients. There was no relationship between PTEN loss and KRAS or BRAF mutation. PTEN status was not prognostic for progression-free survival (PFS) or overall survival (OS) in multivariate analyses adjusting for other baseline factors; loss versus no loss PFS hazard ratio (HR) 0.9 (0.7-1.16), OS HR 1.04 (0.79-1.38). PTEN was not prognostic when assessed by KRAS and BRAF status. By using the comparison of C versus CB+CBM, PTEN status was not significantly predictive of the effectiveness of B for PFS or OS. PTEN status was not prognostic for survival in advanced colorectal cancer, irrespective of KRAS or BRAF status. PTEN status did not significantly predict different benefit with bevacizumb therapy.

  15. The DNA base excision repair protein Ape1/Ref-1 as a therapeutic and chemopreventive target.

    PubMed

    Fishel, Melissa L; Kelley, Mark R

    2007-01-01

    With our growing understanding of the pathways involved in cell proliferation and signaling, targeted therapies, in the treatment of cancer are entering the clinical arena. New and emerging targets are proteins involved in DNA repair pathways. Inhibition of various proteins in the DNA repair pathways sensitizes cancer cells to DNA damaging agents such as chemotherapy and/or radiation. We study the apurinic endonuclease 1/redox factor-1 (Ape1/Ref-1) and believe that its crucial function in DNA repair and reduction-oxidation or redox signaling make it an excellent target for sensitizing tumor cells to chemotherapy. Ape1/Ref-1 is an essential enzyme in the base excision repair (BER) pathway which is responsible for the repair of DNA caused by oxidative and alkylation damage. As importantly, Ape1/Ref-1 also functions as a redox factor maintaining transcription factors in an active reduced state. Ape1/Ref-1 stimulates the DNA binding activity of numerous transcription factors that are involved in cancer promotion and progression such as AP-1 (Fos/Jun), NFkappaB, HIF-1alpha, CREB, p53 and others. We will discuss what is known regarding the pharmacological targeting of the DNA repair activity, as well as the redox activity of Ape1/Ref-1, and explore the budding clinical utility of inhibition of either of these functions in cancer treatment. A brief discussion of the effect of polymorphisms in its DNA sequence is included because of Ape1/Ref-1's importance to maintenance and integrity of the genome. Experimental modification of Ape1/Ref-1 activity changes the response of cells and of organisms to DNA damaging agents, suggesting that Ape1/Ref-1 may also be a productive target of chemoprevention. In this review, we will provide an overview of Ape1/Ref-1's activities and explore the potential of this protein as a target in cancer treatment as well as its role in chemoprevention.

  16. Development of a novel fluorescent imaging probe for tumor hypoxia by use of a fusion protein with oxygen-dependent degradation domain of HIF-1α

    NASA Astrophysics Data System (ADS)

    Tanaka, Shotaro; Kizaka-Kondoh, Shinae; Harada, Hiroshi; Hiraoka, Masahiro

    2007-02-01

    More malignant tumors contain more hypoxic regions. In hypoxic tumor cells, expression of a series of hypoxiaresponsive genes related to malignant phenotype such as angiogenesis and metastasis are induced. Hypoxia-inducible factor-1 (HIF-1) is a master transcriptional activator of such genes, and thus imaging of hypoxic tumor cells where HIF-1 is active, is important in cancer therapy. We have been developing PTD-ODD fusion proteins, which contain protein transduction domain (PTD) and the VHL-mediated protein destruction motif in oxygen-dependent degradation (ODD) domain of HIF-1 alpha subunit (HIF-1α). Thus PTD-ODD fusion proteins can be delivered to any tissue in vivo through PTD function and specifically stabilized in hypoxic cells through ODD function. To investigate if PTD-ODD fusion protein can be applied to construct hypoxia-specific imaging probes, we first constructed a fluorescent probe because optical imaging enable us to evaluate a probe easily, quickly and economically in a small animal. We first construct a model fusion porein PTD-ODD-EGFP-Cy5.5 named POEC, which is PTD-ODD protein fused with EGFP for in vitro imaging and stabilization of fusion protein, and conjugated with a near-infrared dye Cy5.5. This probe is designed to be degraded in normoxic cells through the function of ODD domain and followed by quick clearance of free fluorescent dye. On the other hand, this prove is stabilized in hypoxic tumor cells and thus the dye is stayed in the cells. Between normoxic and hypoxic conditions, the difference in the clearance rate of the dye will reveals suited contrast for tumor-hypoxia imaging. The optical imaging probe has not been optimized yet but the results presented here exhibit a potential of PTD-ODD fusion protein as a hypoxia-specific imaging probe.

  17. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  18. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  19. Retinoic acid exerts dual regulatory actions on the expression and nuclear localization of interferon regulatory factor-1.

    PubMed

    Luo, Xin M; Ross, A Catharine

    2006-05-01

    Interferon regulatory factor-1 (IRF-1), a transcription factor and tumor suppressor involved in cell growth regulation and immune responses, has been shown to be induced by all-trans retinoic acid (ATRA). However, the factors controlling the cellular location and activity of IRF-1 are not well understood. In this study, we examined the expression of IRF-1 and its nuclear localization, DNA-binding activity, and target gene expression in human mammary epithelial MCF10A cells, a model of breast epithelial cell differentiation and carcinogenesis. Following initial treatment with ATRA, IRF-1 mRNA and protein were induced within 2 hrs, reached a peak (>30-fold induction) at 8 hrs, and declined afterwards. IRF-1 protein was predominantly cytoplasmic during this treatment. Although a second dose of ATRA or Am580 (a related retinoid selective for retinoic acid receptor-alpha [RARalpha]), given 16 hrs after the first dose, restimulated IRF-1 mRNA and protein levels to a similar level to that obtained by the first dose, IRF-1 was predominantly concentrated in the nucleus after restimulation. ATRA and Am580 also increased nuclear RARalpha, whereas retinoid X receptor-alpha (RXRalpha)--a dimerization partner for RARalpha, was localized to the nucleus upon second exposure to ATRA. However, ATRA and Am580 did not regulate the expression or activation of signal transducer and activator of transcription-1 (STAT-1), a transcription factor capable of inducing the expression of IRF-1, indicating an STAT-1-independent mechanism of regulation by ATRA and Am580. The increase in nuclear IRF-1 after retinoid restimulation was accompanied by enhanced binding to an IRF-E DNA response element, and elevated expression of an IRF-1 target gene, 2',5'-oligoadenylate synthetase-2. The dual effect of retinoids in increasing IRF-1 mRNA and protein and in augmenting the nuclear localization of IRF-1 protein may be essential for maximizing the tumor suppressor activity and the immunosurveillance

  20. Overexpression of gankyrin in mouse hepatocytes induces hemangioma by suppressing factor inhibiting hypoxia-inducible factor-1 (FIH-1) and activating hypoxia-inducible factor-1.

    PubMed

    Liu, Yu; Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Koike, Kazuhiko; Hirota, Kiichi; Fukumoto, Manabu; Fujita, Jun

    2013-03-01

    Gankyrin (also called p28 or PSMD10) is an oncoprotein commonly overexpressed in hepatocellular carcinomas. It consists of 7 ankyrin repeats and interacts with multiple proteins including Rb, Cdk4, MDM2 and NF-κB. To assess the oncogenic activity in vivo, we produced transgenic mice that overexpress gankyrin specifically in the hepatocytes. Unexpectedly, 5 of 7 F2 transgenic mice overexpressing hepatitis B virus X protein (HBX) promoter-driven gankyrin, and one of 3 founder mice overexpressing serum amyloid P component (SAP) promoter-driven gankyrin developed hepatic vascular neoplasms (hemangioma/hemangiosarcomas) whereas none of the wild-type mice did. Endothelial overgrowth was more frequent in the livers of diethylnitrosamine-treated transgenic mice than wild-type mice. Mouse hepatoma Hepa1-6 cells overexpressing gankyrin formed tumors with more vascularity than parental Hepa1-6 cells in the transplanted mouse skin. We found that gankyrin binds to and sequester factor inhibiting hypoxia-inducible factor-1 (FIH-1), which results in decreased interaction between FIH-1 and hypoxia-inducible factor-1α (HIF-1α) and increased activity of HIF-1 to promote VEGF production. The effects of gankyrin were more prominent under 3% O2 than 1% or 20% O2 conditions. Thus, the present study clarified, at least partly, mechanisms of vascular tumorigenesis, and suggests that gankyrin might play a physiological role in hypoxic responses besides its roles as an oncoprotein. PMID:23376718

  1. Stromal cell-derived factor-1α prevents endothelial progenitor cells senescence and enhances re-endothelialization of injured arteries via human telomerase reverse transcriptase.

    PubMed

    Shen, Xiaohua; Zhou, Yucheng; Bi, Xukun; Zhang, Jiefang; Fu, Guosheng; Zheng, Hao

    2015-08-01

    Recent studies have suggested that endothelial progenitor subpopulation (EPCs) number and activity were associated with EPCs senescence. Our previous study had shown that stromal cell-derived factor-1alpha (SDF-1α) could prevent EPCs senescence, which may be via telomerase. In this study, we further investigated the role of human telomerase reverse transcriptase (h-TERT) on the protective effect of SDF-1α against senescence. Knockdown h-TERT abrogated the protective effect of SDF-1α and abolished the effects of SDF-1α on migration and proliferation. Moreover, it inhibited EPCs recruitment. In conclusion, h-TERT served a critical role in the progress that SDF-1α prevented EPCs senescence and enhanced re-endothelialization of the injured arteries.

  2. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  3. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  4. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  5. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  6. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  7. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  8. Berberine Preconditioning Protects Neurons Against Ischemia via Sphingosine-1-Phosphate and Hypoxia-Inducible Factor-1[Formula: see text].

    PubMed

    Zhang, Qichun; Bian, Huimin; Guo, Liwei; Zhu, Huaxu

    2016-01-01

    Berberine exerts neuroprotective and modulates hypoxia inducible factor-1-alpha (HIF-1[Formula: see text]. Based on the role of HIF-1[Formula: see text] in hypoxia preconditioning and association between HIF-1[Formula: see text] and sphingosine-1-phosphate (S1P), we hypothesized that berberine preconditioning (BP) would ameliorate the cerebral injury induced by ischemia through activating the system of HIF-1[Formula: see text] and S1P. Adult male rats with middle cerebral artery occlusion (MCAO) and rat primary cortical neurons treated with oxygen and glucose deprivation (OGD) with BP at 24[Formula: see text]h (40[Formula: see text]mg/kg) and 2[Formula: see text]h (10[Formula: see text][Formula: see text]mol/L), respectively, were used to determine the neuroprotective effects. The HIF-1[Formula: see text] accumulation, and S1P metabolism were assayed in the berberine-preconditioned neurons, and the HIF-1[Formula: see text]-mediated transcriptional modulation of sphingosine kinases (Sphk) 1 and 2 was analyzed using chromatin immunoprecipitation and real-time polymerase chain reaction. BP significantly prevented cerebral ischemic injury in the MCAO rats at 24[Formula: see text]h and 72[Formula: see text]h following ischemia/reperfusion. In OGD-treated neurons, BP enhanced HIF-1[Formula: see text] accumulation with activation of PI3K/Akt, and induced S1P production by activating Sphk2 via the promotion of HIF-1[Formula: see text]-mediated Sphk2 transcription. In conclusion, BP activated endogenous neuroprotective mechanisms associated with the S1P/HIF-1 pathway and helped protect neuronal cells against hypoxia/ischemia.

  9. Colony-stimulating factor-1 plays a major role in the development of reproductive function in male mice.

    PubMed

    Cohen, P E; Hardy, M P; Pollard, J W

    1997-10-01

    Colony-stimulating factor-1 (CSF-1) is the principal regulator of cells of the mononuclear phagocytic lineage that includes monocytes, tissue macrophages, microglia, and osteoclasts. Macrophages are found throughout the reproductive tract of both males and females and have been proposed to act as regulators of fertility at several levels. Mice homozygous for the osteopetrosis mutation (csfm[op]) lack CSF-1 and, consequently, have depleted macrophage numbers. Further analysis has revealed that male csfm(op)/csfm(op) mice have reduced mating ability, low sperm numbers, and 90% lower serum testosterone levels. The present studies show that this low serum testosterone is due to reduced testicular Leydig cell steroidogenesis associated with severe ultrastructural abnormalities characterized by disrupted intracellular membrane structures. In addition, the Leydig cells from csfm(op)/ csfm(op) males have diminished amounts of the steroidogenic enzyme proteins P450 side chain cleavage, 3beta-hydroxysteroid dehydrogenase, and P450 17alpha-hydroxylase-lyase, with associated reductions in the activity of all these steroidogenic enzymes, as well as in 17beta-hydroxysteroid dehydrogenase. The CSF-1-deficient males also have reduced serum LH and disruption of the normal testosterone negative feedback response of the hypothalamus, as demonstrated by the failure to increase LH secretion in castrated males and their lack of response to exogenous testosterone. However, these males are responsive to GnRH and LH treatment. These studies have identified a novel role for CSF-1 in the development and/or regulation of the male hypothalamic-pituitary-gonadal axis.

  10. The orphan nuclear receptor, steroidogenic factor 1, regulates neuronal nitric oxide synthase gene expression in pituitary gonadotropes.

    PubMed

    Wei, Xueying; Sasaki, Masayuki; Huang, Hui; Dawson, Valina L; Dawson, Ted M

    2002-12-01

    Steroidogenic factor 1 (SF-1), an essential nuclear receptor, plays key roles in steroidogenic cell function within the adrenal cortex and gonads. It also contributes to reproductive function at all three levels of the hypothalamic-pituitary-gonadal axis. SF-1 regulates genes in the steroidogenic pathway, such as LHbeta, FSHbeta, and steroid hydroxylase. Abundant evidence suggests that nitric oxide (NO) has an important role in the control of reproduction due to its ability to control GnRH secretion from the hypothalamus and the preovulatory LH surge in pituitary gonadotropes. Recently, we cloned and characterized the promoter of mouse neuronal NO synthase (nNOS). nNOS is localized at all three levels of the hypothalamic-pituitary-gonadal axis to generate NO. We find that its major promoter resides at exon 2 in the pituitary gonadotrope alphaT3-1 cell line and that there is a nuclear hormone receptor binding site in this region, to which SF-1 can bind and regulate nNOS transcription. Mutation of the nuclear hormone receptor binding site dramatically decreases basal promoter activity and abolishes SF-1 responsiveness. A dominant negative of SF-1, in which the transactivation (AF-2) domain of SF-1 was deleted, inhibits nNOS exon 2 promoter activity. Dosage-sensitive reversal- adrenal hypoplasia congenita critical region on the X chromosome, gene 1 (DAX-1), which colocalizes and interferes with SF-1 actions in multiple cell lineages, negatively modulates SF-1 regulation of nNOS transcription. These findings demonstrate that mouse nNOS gene expression is regulated by the SF-1 gene family in pituitary gonadotropes. nNOS, a member of the cytochrome p450 gene family, could be one of the downstream effector genes, which mediates SF-1's reproductive function and developmental patterning.

  11. Plasmid-based transient human stromal cell-derived factor-1 gene transfer improves cardiac function in chronic heart failure

    PubMed Central

    Sundararaman, S; Miller, T J; Pastore, J M; Kiedrowski, M; Aras, R; Penn, M S

    2011-01-01

    We previously demonstrated that transient stromal cell-derived factor-1 alpha (SDF-1) improved cardiac function when delivered via cell therapy in ischemic cardiomyopathy at a time remote from acute myocardial infarction (MI) rats. We hypothesized that non-viral gene transfer of naked plasmid DNA-expressing hSDF-1 could similarly improve cardiac function. To optimize plasmid delivery, we tested SDF-1 and luciferase plasmids driven by the cytomegalovirus (CMV) promoter with (pCMVe) or without (pCMV) translational enhancers or α myosin heavy chain (pMHC) promoter in a rodent model of heart failure. In vivo expression of pCMVe was 10-fold greater than pCMV and pMHC expression and continued over 30 days. We directly injected rat hearts with SDF-1 plasmid 1 month after MI and assessed heart function. At 4 weeks after plasmid injection, we observed a 35.97 and 32.65% decline in fractional shortening (FS) in control (saline) animals and pMHC-hSDF1 animals, respectively, which was sustained to 8 weeks. In contrast, we observed a significant 24.97% increase in animals injected with the pCMVe-hSDF1 vector. Immunohistochemistry of cardiac tissue revealed a significant increase in vessel density in the hSDF-1-treated animals compared with control animals. Increasing SDF-1 expression promoted angiogenesis and improved cardiac function in rats with ischemic heart failure along with evidence of scar remodeling with a trend toward decreased myocardial fibrosis. These data demonstrate that stand-alone non-viral hSDF-1 gene transfer is a strategy for improving cardiac function in ischemic cardiomyopathy. PMID:21472007

  12. Serum insulin-like growth factor-1 levels in females and males in different cervical vertebral maturation stages

    PubMed Central

    Gupta, Shreya; Deoskar, Anuradha; Gupta, Puneet; Jain, Sandhya

    2015-01-01

    OBJECTIVE: The aim of this cross sectional study was to assess serum insulin-like growth factor-1 (IGF-1) levels in female and male subjects at various cervical vertebral maturation (CVM) stages. MATERIAL AND METHODS: The study sample consisted of 60 subjects, 30 females and 30 males, in the age range of 8-23 years. For all subjects, serum IGF-1 level was estimated from blood samples by means of chemiluminescence immunoassay (CLIA). CVM was assessed on lateral cephalograms using the method described by Baccetti. Serum IGF-1 level and cervical staging data of 30 female subjects were included and taken from records of a previous study. Data were analyzed by Kruska-Wallis and Mann Whitney test. Bonferroni correction was carried out and alpha value was set at 0.003. RESULTS: Peak value of serum IGF-1 was observed in cervical stages CS3 in females and CS4 in males. Differences between males and females were observed in mean values of IGF-1 at stages CS3, 4 and 5. The highest mean IGF-1 levels in males was observed in CS4 followed by CS5 and third highest in CS3; whereas in females the highest mean IGF-1 levelswas observed in CS3 followed by CS4 and third highest in CS5. Trends of IGF-1 in relation to the cervical stages also differed between males and females. The greatest mean serum IGF-1 value for both sexes was comparable, for females (397 ng/ml) values were slightly higher than in males (394.8 ng/ml). CONCLUSIONS: Males and females showed differences in IGF-1 trends and levels at different cervical stages. PMID:25992990

  13. Altered expression of hypoxia-inducible factor-1α (HIF-1α) and its regulatory genes in gastric cancer tissues.

    PubMed

    Wang, Jihan; Ni, Zhaohui; Duan, Zipeng; Wang, Guoqing; Li, Fan

    2014-01-01

    Tissue hypoxia induces reprogramming of cell metabolism and may result in normal cell transformation and cancer progression. Hypoxia-inducible factor 1-alpha (HIF-1α), the key transcription factor, plays an important role in gastric cancer development and progression. This study aimed to investigate the underlying regulatory signaling pathway in gastric cancer using gastric cancer tissue specimens. The integration of gene expression profile and transcriptional regulatory element database (TRED) was pursued to identify HIF-1α ↔ NFκB1 → BRCA1 → STAT3 ← STAT1 gene pathways and their regulated genes. The data showed that there were 82 differentially expressed genes that could be regulated by these five transcription factors in gastric cancer tissues and these genes formed 95 regulation modes, among which seven genes (MMP1, TIMP1, TLR2, FCGR3A, IRF1, FAS, and TFF3) were hub molecules that are regulated at least by two of these five transcription factors simultaneously and were associated with hypoxia, inflammation, and immune disorder. Real-Time PCR and western blot showed increasing of HIF-1α in mRNA and protein levels as well as TIMP1, TFF3 in mRNA levels in gastric cancer tissues. The data are the first study to demonstrate HIF-1α-regulated transcription factors and their corresponding network genes in gastric cancer. Further study with a larger sample size and more functional experiments is needed to confirm these data and then translate into clinical biomarker discovery and treatment strategy for gastric cancer.

  14. Altered Expression of Hypoxia-Inducible Factor-1α (HIF-1α) and Its Regulatory Genes in Gastric Cancer Tissues

    PubMed Central

    Wang, Jihan; Ni, Zhaohui; Duan, Zipeng; Wang, Guoqing; Li, Fan

    2014-01-01

    Tissue hypoxia induces reprogramming of cell metabolism and may result in normal cell transformation and cancer progression. Hypoxia-inducible factor 1-alpha (HIF-1α), the key transcription factor, plays an important role in gastric cancer development and progression. This study aimed to investigate the underlying regulatory signaling pathway in gastric cancer using gastric cancer tissue specimens. The integration of gene expression profile and transcriptional regulatory element database (TRED) was pursued to identify HIF-1α ↔ NFκB1 → BRCA1 → STAT3 ← STAT1 gene pathways and their regulated genes. The data showed that there were 82 differentially expressed genes that could be regulated by these five transcription factors in gastric cancer tissues and these genes formed 95 regulation modes, among which seven genes (MMP1, TIMP1, TLR2, FCGR3A, IRF1, FAS, and TFF3) were hub molecules that are regulated at least by two of these five transcription factors simultaneously and were associated with hypoxia, inflammation, and immune disorder. Real-Time PCR and western blot showed increasing of HIF-1α in mRNA and protein levels as well as TIMP1, TFF3 in mRNA levels in gastric cancer tissues. The data are the first study to demonstrate HIF-1α-regulated transcription factors and their corresponding network genes in gastric cancer. Further study with a larger sample size and more functional experiments is needed to confirm these data and then translate into clinical biomarker discovery and treatment strategy for gastric cancer. PMID:24927122

  15. The interactive association between heat shock factor 1 and heat shock proteins in primary myocardial cells subjected to heat stress.

    PubMed

    Tang, Shu; Chen, Hongbo; Cheng, Yanfen; Nasir, Mohammad Abdel; Kemper, Nicole; Bao, Endong

    2016-01-01

    Heat shock factor 1 (HSF1) is a heat shock transcription factor that rapidly induces heat shock gene transcription following thermal stress. In this study, we subjected primary neonatal rat myocardial cells to heat stress in vitro to create a model system for investigating the trends in expression and association between various heat shock proteins (HSPs) and HSF1 under adverse environmental conditions. After the cells were subjected to heat stress at 42˚C for different periods of time, HSP and HSF1 mRNA and protein levels were detected by qPCR and western blot analysis in the heat-stressed cells. The HSF1 expression levels significantly increased in the cells following 120 min of exposure to heat stess compared to the levels observed at the beginning of heat stress exposure. HSP90 followed a similar trend in expression to HSF1, whereas HSP70 followed an opposite trend. However, no significant changes were observed in the crystallin, alpha B (CRYAB, also known as HSP beta-5) expression levels during the 480‑min period of exposure to heat stress. The interaction between the HSPs and HSF1 was analyzed by STRING 9.1, and it was found that HSF1 interacted with HSP90 and HSP70, and that it did not play a role in regulating CRYAB expression. Based on our findings, HSP70 may suppress HSF1 in rat myocardial cells under conditions of heat stress. Furthermore, our data demonstrate that HSF1 is not the key factor for all HSPs, and this was particularly the case for CRYAB.

  16. Berberine Preconditioning Protects Neurons Against Ischemia via Sphingosine-1-Phosphate and Hypoxia-Inducible Factor-1[Formula: see text].

    PubMed

    Zhang, Qichun; Bian, Huimin; Guo, Liwei; Zhu, Huaxu

    2016-01-01

    Berberine exerts neuroprotective and modulates hypoxia inducible factor-1-alpha (HIF-1[Formula: see text]. Based on the role of HIF-1[Formula: see text] in hypoxia preconditioning and association between HIF-1[Formula: see text] and sphingosine-1-phosphate (S1P), we hypothesized that berberine preconditioning (BP) would ameliorate the cerebral injury induced by ischemia through activating the system of HIF-1[Formula: see text] and S1P. Adult male rats with middle cerebral artery occlusion (MCAO) and rat primary cortical neurons treated with oxygen and glucose deprivation (OGD) with BP at 24[Formula: see text]h (40[Formula: see text]mg/kg) and 2[Formula: see text]h (10[Formula: see text][Formula: see text]mol/L), respectively, were used to determine the neuroprotective effects. The HIF-1[Formula: see text] accumulation, and S1P metabolism were assayed in the berberine-preconditioned neurons, and the HIF-1[Formula: see text]-mediated transcriptional modulation of sphingosine kinases (Sphk) 1 and 2 was analyzed using chromatin immunoprecipitation and real-time polymerase chain reaction. BP significantly prevented cerebral ischemic injury in the MCAO rats at 24[Formula: see text]h and 72[Formula: see text]h following ischemia/reperfusion. In OGD-treated neurons, BP enhanced HIF-1[Formula: see text] accumulation with activation of PI3K/Akt, and induced S1P production by activating Sphk2 via the promotion of HIF-1[Formula: see text]-mediated Sphk2 transcription. In conclusion, BP activated endogenous neuroprotective mechanisms associated with the S1P/HIF-1 pathway and helped protect neuronal cells against hypoxia/ischemia. PMID:27430910

  17. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  18. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  19. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  20. ADP-ribosylation factor 1 controls the activation of the phosphatidylinositol 3-kinase pathway to regulate epidermal growth factor-dependent growth and migration of breast cancer cells.

    PubMed

    Boulay, Pierre-Luc; Cotton, Mathieu; Melançon, Paul; Claing, Audrey

    2008-12-26

    Activation of intracellular signaling pathways by growth factors is one of the major causes of cancer development and progression. Recent studies have demonstrated that monomeric G proteins of the Ras family are key regulators of cell proliferation, migration, and invasion. Using an invasive breast cancer cell lines, we demonstrate that the ADP-ribosylation factor 1 (ARF1), a small GTPase classically associated with the Golgi, is an important regulator of the biological effects induced by epidermal growth factor. Here, we show that this ARF isoform is activated following epidermal growth factor stimulation and that, in MDA-MB-231 cells, ARF1 is found in dynamic plasma membrane ruffles. Inhibition of endogenous ARF1 expression results in the inhibition of breast cancer cell migration and proliferation. The underlying mechanism involves the activation of the phosphatidylinositol 3-kinase pathway. Our data demonstrate that depletion of ARF1 markedly impairs the recruitment of the phosphatidylinositol 3-kinase catalytic subunit (p110alpha) to the plasma membrane, and the association of the regulatory subunit (p85alpha) to the activated receptor. These results uncover a novel molecular mechanism by which ARF1 regulates breast cancer cell growth and invasion during cancer progression.

  1. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  2. Tumor Necrosis Factor Alpha and Insulin-Like Growth Factor 1 Induced Modifications of the Gene Expression Kinetics of Differentiating Skeletal Muscle Cells

    PubMed Central

    Meyer, Swanhild U.; Krebs, Stefan; Thirion, Christian; Blum, Helmut; Krause, Sabine; Pfaffl, Michael W.

    2015-01-01

    Introduction TNF-α levels are increased during muscle wasting and chronic muscle degeneration and regeneration processes, which are characteristic for primary muscle disorders. Pathologically increased TNF-α levels have a negative effect on muscle cell differentiation efficiency, while IGF1 can have a positive effect; therefore, we intended to elucidate the impact of TNF-α and IGF1 on gene expression during the early stages of skeletal muscle cell differentiation. Methodology/Principal Findings This study presents gene expression data of the murine skeletal muscle cells PMI28 during myogenic differentiation or differentiation with TNF-α or IGF1 exposure at 0 h, 4 h, 12 h, 24 h, and 72 h after induction. Our study detected significant coregulation of gene sets involved in myoblast differentiation or in the response to TNF-α. Gene expression data revealed a time- and treatment-dependent regulation of signaling pathways, which are prominent in myogenic differentiation. We identified enrichment of pathways, which have not been specifically linked to myoblast differentiation such as doublecortin-like kinase pathway associations as well as enrichment of specific semaphorin isoforms. Moreover to the best of our knowledge, this is the first description of a specific inverse regulation of the following genes in myoblast differentiation and response to TNF-α: Aknad1, Cmbl, Sepp1, Ndst4, Tecrl, Unc13c, Spats2l, Lix1, Csdc2, Cpa1, Parm1, Serpinb2, Aspn, Fibin, Slc40a1, Nrk, and Mybpc1. We identified a gene subset (Nfkbia, Nfkb2, Mmp9, Mef2c, Gpx, and Pgam2), which is robustly regulated by TNF-α across independent myogenic differentiation studies. Conclusions This is the largest dataset revealing the impact of TNF-α or IGF1 treatment on gene expression kinetics of early in vitro skeletal myoblast differentiation. We identified novel mRNAs, which have not yet been associated with skeletal muscle differentiation or response to TNF-α. Results of this study may facilitate the understanding of transcriptomic networks underlying inhibited muscle differentiation in inflammatory diseases. PMID:26447881

  3. The pathway for IRP2 degradation involving 2-oxoglutarate-dependent oxygenase(s) does not require the E3 ubiquitin ligase activity of pVHL.

    PubMed

    Wang, Jian; Pantopoulos, Kostas

    2005-03-22

    Iron regulatory protein 2 (IRP2), a posttranscriptional regulator of iron metabolism, is subjected to iron-dependent degradation by the proteasome. Recent experiments proposed a mechanism involving 2-oxoglutarate-dependent oxygenases. Enzymes of this class, such as prolyl-4-hydroxylases, mediate the oxygen and iron-dependent degradation of the hypoxia inducible factor HIF-1alpha, which requires the E3 ubiquitin ligase activity of pVHL. Considering that the pathways for IRP2 and HIF-1alpha degradation share remarkable similarities, we investigated whether pVHL may also be involved in the degradation of IRP2. We show here that IRP2 can interact with pVHL in co-transfection/co-immunoprecipitation assays. Furthermore, pVHL is able to promote the ubiquitination and the decay of transfected IRP2. However, the iron-dependent degradation of endogenous IRP2 is not impaired in VHL-deficient cell lines, suggesting that pVHL is not a necessary component of this pathway.

  4. Mechanisms underlying PTEN regulation of vascular endothelial growth factor and angiogenesis.

    PubMed

    Gomez-Manzano, Candelaria; Fueyo, Juan; Jiang, Hong; Glass, Tricia L; Lee, Ho-Young; Hu, Min; Liu, Juinn-Lin; Jasti, Sushma L; Liu, Ta-Jen; Conrad, Charles A; Yung, W K Alfred

    2003-01-01

    Inactivation of the tumor suppressor gene PTEN and overexpression of VEGF are two of the most common events observed in high-grade malignant gliomas. The purpose of this study was to determine whether PTEN controls VEGF expression in gliomas under normoxic conditions. Transfer of PTEN to human glioma cells resulted in the transduction of a functional PTEN protein as evidenced by the upregulation of p27 and modification of the phosphorylation status of Akt. Under normoxic conditions, enzyme-linked immunosorbent assay and Northern blot analyses showed downregulation of VEGF in PTEN-treated cells. Moreover, conditioned media from PTEN-treated glioma cells significantly diminished the ability of endothelial cells to grow and migrate. Western blot assays demonstrated that, in a normoxic environment, PTEN downregulates HIF-1 alpha. Finally, promoter activity assays showed that the VEGF promoter region containing the HIF-1alpha binding site is necessary and sufficient for PTEN-mediated downregulation of VEGF. Experiments with PI3-K inhibitors and kinase assays suggested that PI3-K is mediating the effect of PTEN on VEGF, and not the p42/p48 or p38 MAP kinases. These results indicate that restoration of PTEN function in gliomas may induce therapeutic effect by downregulating VEGF. Furthermore, this close functional relationship between PTEN and VEGF suggests that a better understanding of the transduction signal regulated by PTEN might enhance the knowledge of the cause and physiology of vascular and inflammatory diseases.

  5. [Under hypoxia condition contactin-1 regulates migration of MKN45 cells through RhoA pathway].

    PubMed

    Yang, G; Song, J G; Li, Y; Gong, S P

    2015-01-01

    Recent studies have suggested that contactin-1 has a key role in cancer cell proliferation and migration, however the detailed mechanism of this process is still unclear. Here, human gastric cancer cell line MKN45 was employed. It was found that under hypoxia conditions contactin-1 mRNA and protein levels were both up-regulated by HIF-1alpha expression. Furthermore, although hypoxia increased the migration rate of MKN45 cells, contactin-1 (CNTN1) shRNA reversed this process. Meanwhile, RhoA V14 and RhoA V14N19 mutation constructs were employed, and it was found that constitutively active form of RhoA reversed the cell migration suppression induced by contactin-1 knockdown, while dominant-negative form of RhoA blocked hypoxia induced hypermigration. Apart from this, contactin-1 displayed the ability to phosphorylate the RhoA activator p115 RhoGEF. Thus, under hypoxia conditions, elevated HIF-1alpha seems to up-regulate contactin-1 expression and by this activate RhoA and facilitate migration of cancer cells. PMID:25916117

  6. Loss of Siah2 does not impact angiogenic potential of murine endothelial cells.

    PubMed

    Wong, Christina S F; Chen, Anna; Liu, Mira C P; Parker, Belinda S; Möller, Andreas

    2015-11-01

    Angiogenesis is triggered in response to hypoxia under many circumstances, from healthy cells and tissues during embryogenesis to pathological conditions like the formation of new blood vessels to supply tumours and promote invasive cancer. Siah2 has been shown to regulate the hypoxia pathway upstream of hypoxia-induced transcription factor subunit Hif-1alpha, and therefore may play an important role in angiogenesis in response to hypoxic stress in endothelial cells. This study aims to investigate the basic function of Siah2 in endothelial cells under hypoxia and to test the ability of Siah2 deficient cells to mount an angiogenic response when deprived of oxygen. We and others have previously shown that Siah2 is crucial for mediating the hypoxic response in many different cell types studied. In this study however, we describe that Siah2(-/-) endothelial cells have an intact hypoxic signalling pathway, including Hif-1alpha stabilisation and gene expression, the first report of a tissue or cell lineage in which the loss of Siah2 does not seem to impact hypoxic response signalling. In mice, the infiltration of Siah2(-/-) endothelial cells into a Matrigel plug containing a VEGF-A attractant was similar compared with wildtype endothelial cells. Ex vivo however, there was a reduced capacity of Siah2(-/-) aorta to form tubes or new vessels. Thus, we conclude that Siah2 is not essential for the hypoxic response of endothelial cells.

  7. Transcription factor HIF-1 is a necessary mediator of the pasteur effect in mammalian cells.

    PubMed

    Seagroves, T N; Ryan, H E; Lu, H; Wouters, B G; Knapp, M; Thibault, P; Laderoute, K; Johnson, R S

    2001-05-01

    The ability to respond to differential levels of oxygen is important to all respiring cells. The response to oxygen deficiency, or hypoxia, takes many forms and ranges from systemic adaptations to those that are cell autonomous. Perhaps the most ancient of the cell-autonomous adaptations to hypoxia is a metabolic one: the Pasteur effect, which includes decreased oxidative phosphorylation and an increase in anaerobic fermentation. Because anaerobic fermentation produces far less ATP than oxidative phosphorylation per molecule of glucose, increased activity of the glycolytic pathway is necessary to maintain free ATP levels in the hypoxic cell. Here, we present genetic and biochemical evidence that, in mammalian cells, this metabolic switch is regulated by the transcription factor HIF-1. As a result, cells lacking HIF-1alpha exhibit decreased growth rates during hypoxia, as well as decreased levels of lactic acid production and decreased acidosis. We show that this decrease in glycolytic capacity results in dramatically lowered free ATP levels in HIF-1alpha-deficient hypoxic cells. Thus, HIF-1 activation is an essential control element of the metabolic state during hypoxia; this requirement has important implications for the regulation of cell growth during development, angiogenesis, and vascular injury.

  8. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  9. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  10. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  11. Purification and partial sequence analysis of insulin-like growth factor-1 from bovine colostrum.

    PubMed Central

    Francis, G L; Read, L C; Ballard, F J; Bagley, C J; Upton, F M; Gravestock, P M; Wallace, J C

    1986-01-01

    Growth-promoting activity in bovine colostrum has been detected as the capacity to stimulate protein synthesis in L6 myoblasts. By using this assay as a measure of bioactivity, a growth factor has been purified to near homogeneity from centrifuged colostrum by a series of steps including acid extraction, chromatography on sulphopropyl-Sephadex, followed by adsorption to, and elution from, C18 columns using acetonitrile and propan-1-ol gradients. The purified growth factor has a low solubility at neutral and alkaline pH and has an Mr of 7800 by gel-permeation chromatography. Sequence analysis of the first 30 amino acids from the N-terminus indicated complete identity in this region with human insulin-like growth factor-1. Accordingly we conclude that the purified growth factor is bovine insulin-like growth factor-1. PMID:3954725

  12. Heat shock factor 1 prevents the reduction in thrashing due to heat shock in Caenorhabditis elegans.

    PubMed

    Furuhashi, Tsubasa; Sakamoto, Kazuichi

    2015-07-01

    Heat shock factor 1 (HSF-1) is activated by heat stress and induces the expression of heat shock proteins. However, the role of HSF-1 in thermotolerance remains unclear. We previously reported that heat stress reversibly reduces thrashing movement in Caenorhabditis elegans. In this study, we analyzed the function of HSF-1 on thermotolerance by monitoring thrashing movement. hsf-1 RNAi suppressed the restoration of thrashing reduced by heat stress. In contrast, hsf-1 knockdown cancelled prevention of movement reduction in insulin/IGF-1-like growth factor 1 receptor (daf-2) mutant, but didn't suppress thrashing restoration in daf-2 mutant. In addition, hsf-1 RNAi accelerated the reduction of thrashing in heat-shocked wild-type C. elegans. And, daf-16 KO didn't accelerate the reduction of thrashing by heat stress. Taken together, these results suggest that HSF-1 prevents the reduction of thrashing caused by heat shock.

  13. Trefoil Factor 1 Stimulates Both Pancreatic Cancer and Stellate Cells and Increases Metastasis

    PubMed Central

    Arumugam, Thiruvengadam; Brandt, Will; Ramachandran, Vijaya; Moore, Tood T.; Wang, Huamin; May, Felicity E.; Westley, Bruce R.; Hwang, Rosa F.; Logsdon, Craig D.

    2015-01-01

    Objectives Trefoil factor 1 (TFF1) is a stable secretory protein expressed widely in the gastrointestinal mucosa that is also expressed in pancreatic ductal adenocarcinoma (PDAC). In the current study, we documented the extent and timing of TFF1 expression and investigated the effects of TFF1 on PDAC cells and stellate cells, the primary cells of the PDAC stroma. Methods Trefoil factor 1 expression in pancreatic cancer tissues and cell lines was analyzed using microarray, quantitative reverse transcriptase–polymerase chain reaction, and immunohistochemistry. The effects of recombinant TFF1 on cell growth, migration, and invasion of pancreatic cancer cell lines and immortalized human pancreatic stellate cells (HPSCs) were analyzed using MTS and Matrigel-coated invasion chambers. In vivo studies were also conducted in which Mpanc-96 cells stably expressing TFF1 were implanted orthotopically into nude mice. Results Trefoil factor 1 was highly increased in preneoplastic lesions. Recombinant TFF1 stimulated motility of both cancer and HPSCs. In contrast, only HPSC cell growth was increased by TFF1. In vivo studies showed that overexpression of TFF1 in PDAC cells did not affect primary tumor growth but greatly increased metastasis. Conclusions The present data demonstrate that TFF1 influences both PDAC cells and stellate cells and stimulates metastasis. PMID:21747314

  14. Molecular targets of a human HNF1 alpha mutation responsible for pancreatic beta-cell dysfunction.

    PubMed

    Wang, H; Antinozzi, P A; Hagenfeldt, K A; Maechler, P; Wollheim, C B

    2000-08-15

    The reverse tetracycline-dependent transactivator system was employed in insulinoma INS-1 cells to achieve controlled inducible expression of hepatocyte nuclear factor-1 alpha (HNF1 alpha)-P291fsinsC, the most common mutation associated with subtype 3 of maturity-onset diabetes of the young (MODY3). Nuclear localized HNF1 alpha-P291fsinsC protein exerts its dominant-negative effects by competing with endogenous HNF1 alpha for the cognate DNA-binding site. HNF1 alpha controls multiple genes implicated in pancreatic beta-cell function and notably in metabolism- secretion coupling. In addition to reduced expression of the genes encoding insulin, glucose transporter-2, L-pyruvate kinase, aldolase B and 3-hydroxy-3-methylglutaryl coenzyme A reductase, induction of HNF1 alpha-P291fsinsC also significantly inhibits expression of mitochondrial 2-oxoglutarate dehydrogenase (OGDH) E1 subunit mRNA and protein. OGDH enzyme activity and [(14)C]pyruvate oxidation were also reduced. In contrast, the mRNA and protein levels of mitochondrial uncoupling protein-2 were dramatically increased by HNF1 alpha-P291fsinsC induction. As predicted from this altered gene expression profile, HNF1 alpha-P291fsinsC also inhibits insulin secretory responses to glucose and leucine, correlated with impaired nutrient-evoked mitochondrial ATP production and mitochondrial membrane hyperpolarization. These unprecedented results suggest the molecular mechanism of HNF1 alpha-P291fsinsC causing beta-cell dysfunction. PMID:10944108

  15. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  16. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  17. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  18. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  19. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  20. Protein phylogeny of translation elongation factor EF-1 alpha suggests microsporidians are extremely ancient eukaryotes.

    PubMed

    Kamaishi, T; Hashimoto, T; Nakamura, Y; Nakamura, F; Murata, S; Okada, N; Okamoto, K; Shimizu, M; Hasegawa, M

    1996-02-01

    Partial regions of the mRNA encoding a major part of translation elongation factor 1 alpha (EF-1 alpha) from a mitochondrion-lacking protozoan, Glugea plecoglossi, that belongs to microsporidians, were amplified by polymerase chain reaction (PCR) and their primary structures were analyzed. The deduced amino acid sequence was highly divergent from typical EF-1 alpha's of eukaryotes, although it clearly showed a eukaryotic feature when aligned with homologs of the three primary kingdoms. Maximum likelihood (ML) analyses on the basis of six different stochastic models of amino acid substitutions and a maximum parsimony (MP) analysis consistently suggest that among eukaryotic species being analyzed, G. plecoglossi is likely to represent the earliest offshoot of eukaryotes. Microsporidians might be the extremely ancient eukaryotes which have diverged before an occurrence of mitochondrial symbiosis. PMID:8919877

  1. Doxorubicin Impairs the Insulin-Like Growth Factor-1 System and Causes Insulin-Like Growth Factor-1 Resistance in Cardiomyocytes

    PubMed Central

    Fabbi, Patrizia; Spallarossa, Paolo; Garibaldi, Silvano; Barisione, Chiara; Mura, Marzia; Altieri, Paola; Rebesco, Barbara; Monti, Maria Gaia; Canepa, Marco; Ghigliotti, Giorgio; Brunelli, Claudio; Ameri, Pietro

    2015-01-01

    Background Insulin-like growth factor-1 (IGF-1) promotes the survival of cardiomyocytes by activating type 1 IGF receptor (IGF-1R). Within the myocardium, IGF-1 action is modulated by IGF binding protein-3 (IGFBP-3), which sequesters IGF-1 away from IGF-1R. Since cardiomyocyte apoptosis is implicated in anthracycline cardiotoxicity, we investigated the effects of the anthracycline, doxorubicin, on the IGF-1 system in H9c2 cardiomyocytes. Methods and Results Besides inducing apoptosis, concentrations of doxorubicin comparable to those observed in patients after bolus infusion (0.1-1 µM) caused a progressive decrease in IGF-1R and increase in IGFBP-3 expression. Exogenous IGF-1 was capable to rescue cardiomyocytes from apoptosis triggered by 0.1 and 0.5 µM, but not 1 µM doxorubicin. The loss of response to IGF-1 was paralleled by a significant reduction in IGF-1 availability and signaling, as assessed by free hormone levels in conditioned media and Akt phosphorylation in cell lysates, respectively. Doxorubicin also dose-dependently induced p53, which is known to repress the transcription of IGF1R and induce that of IGFBP3. Pre-treatment with the p53 inhibitor, pifithrin-α, prevented apoptosis and the changes in IGF-1R and IGFBP-3 elicited by doxorubicin. The decrease in IGF-1R and increase in IGFBP-3, as well as apoptosis, were also antagonized by pre-treatment with the antioxidant agents, N-acetylcysteine, dexrazoxane, and carvedilol. Conclusions Doxorubicin down-regulates IGF-1R and up-regulates IGFBP-3 via p53 and oxidative stress in H9c2 cells. This leads to resistance to IGF-1 that may contribute to doxorubicin-initiated apoptosis. Further studies are needed to confirm these findings in human cardiomyocytes and explore the possibility of manipulating the IGF-1 axis to protect against anthracycline cardiotoxicity. PMID:25955698

  2. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  3. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  4. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  5. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  6. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  7. Eukaryotic elongation factor-1α 2 knockdown inhibits hepatocarcinogenesis by suppressing PI3K/Akt/NF-κB signaling

    PubMed Central

    Qiu, Fu-Nan; Huang, Yi; Chen, Dun-Yan; Li, Feng; Wu, Yan-An; Wu, Wen-Bing; Huang, Xiao-Li

    2016-01-01

    AIM: To assess the impact of eukaryotic elongation factor 1 alpha 2 (eEF1A2) on hepatocellular carcinoma (HCC) cell proliferation, apoptosis, migration and invasion, and determine the underlying mechanisms. METHODS: eEF1A2 levels were detected in 62 HCC tissue samples and paired pericarcinomatous specimens, and the human HCC cell lines SK-HEP-1, HepG2 and BEF-7402, by real-time PCR and immunohistochemistry. Experimental groups included eEF1A2 silencing in BEL-7402 cells with lentivirus eEF1A2-shRNA (KD group) and eEF1A2 overexpression in SK-HEP-1 cells with eEF1A2 plasmid (OE group). Non-transfected cells (control group) and lentivirus-based empty vector transfected cells (NC group) were considered control groups. Cell proliferation (MTT and colony formation assays), apoptosis (Annexin V-APC assay), cell cycle (DNA ploidy assay), and migration and invasion (Transwell assays) were assessed. Protein levels of PI3K/Akt/NF-κB signaling effectors were evaluated by Western blot. RESULTS: eEF1A2 mRNA and protein levels were significantly higher in HCC cancer tissue samples than in paired pericarcinomatous and normal specimens. SK-HEP-1 cells showed lower eEF1A2 mRNA levels; HepG2 and BEL-7402 cells showed higher eEF1A2 mRNA levels, with BEL-7402 cells displaying the highest amount. Efficient eEF1A2 silencing resulted in reduced cell proliferation, migration and invasion, increased apoptosis, and induced cell cycle arrest. The PI3K/Akt/NF-κB signaling pathway was notably inhibited. Inversely, eEF1A2 overexpression resulted in promoted cell proliferation, migration and invasion. CONCLUSION: eEF1A2, highly expressed in HCC, is a potential oncogene. Its silencing significantly decreases HCC tumorigenesis, likely by inhibiting PI3K/Akt/NF-κB signaling. PMID:27122673

  8. Performance of optimized noncanonical amino acid mutagenesis systems in the absence of release factor 1.

    PubMed

    Zheng, Yunan; Lajoie, Marc J; Italia, James S; Chin, Melissa A; Church, George M; Chatterjee, Abhishek

    2016-05-24

    Site-specific incorporation of noncanonical amino acids (ncAAs) into proteins expressed in E. coli using UAG-suppression competes with termination mediated by release factor 1 (RF1). Recently, unconditional deletion of RF1 was achieved in a genomically recoded E. coli (C321), devoid of all endogenous UAG stop codons. Here we evaluate the efficiency of ncAA incorporation in this strain using optimized suppression vectors. Even though the absence of RF1 does not benefit the suppression efficiency of a single UAG codon, multi-site incorporation of a series of chemically distinct ncAAs was significantly improved. PMID:27027374

  9. Performance of optimized noncanonical amino acid mutagenesis systems in the absence of release factor 1.

    PubMed

    Zheng, Yunan; Lajoie, Marc J; Italia, James S; Chin, Melissa A; Church, George M; Chatterjee, Abhishek

    2016-05-24

    Site-specific incorporation of noncanonical amino acids (ncAAs) into proteins expressed in E. coli using UAG-suppression competes with termination mediated by release factor 1 (RF1). Recently, unconditional deletion of RF1 was achieved in a genomically recoded E. coli (C321), devoid of all endogenous UAG stop codons. Here we evaluate the efficiency of ncAA incorporation in this strain using optimized suppression vectors. Even though the absence of RF1 does not benefit the suppression efficiency of a single UAG codon, multi-site incorporation of a series of chemically distinct ncAAs was significantly improved.

  10. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  11. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  12. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  13. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  14. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  15. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  16. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  17. Colony stimulating factor 1 is an extrinsic stimulator of mouse spermatogonial stem cell self-renewal

    PubMed Central

    Oatley, Jon M.; Oatley, Melissa J.; Avarbock, Mary R.; Tobias, John W.; Brinster, Ralph L.

    2009-01-01

    Summary Self-renewal and differentiation of spermatogonial stem cells (SSCs) provide the foundation for testis homeostasis, yet mechanisms that control their functions in mammals are poorly defined. We used microarray transcript profiling to identify specific genes whose expressions are augmented in the SSC-enriched Thy1+ germ cell fraction of mouse pup testes. Comparisons of gene expression in the Thy1+ germ cell fraction with the Thy1-depleted testis cell population identified 202 genes that are expressed 10-fold or higher in Thy1+ cells. This database provided a mining tool to investigate specific characteristics of SSCs and identify novel mechanisms that potentially influence their functions. These analyses revealed that colony stimulating factor 1 receptor (Csf1r) gene expression is enriched in Thy1+ germ cells. Addition of recombinant colony stimulating factor 1 (Csf1), the specific ligand for Csf1r, to culture media significantly enhanced the self-renewal of SSCs in heterogeneous Thy1+ spermatogonial cultures over a 63-day period without affecting total germ cell expansion. In vivo, expression of Csf1 in both pre-pubertal and adult testes was localized to clusters of Leydig cells and select peritubular myoid cells. Collectively, these results identify Csf1 as an extrinsic stimulator of SSC self-renewal and implicate Leydig and myoid cells as contributors of the testicular stem cell niche in mammals. PMID:19270176

  18. Interaction of elongation factor 1 with aminoacylated brome mosaic virus and tRNA's.

    PubMed Central

    Bastin, M; Hall, T C

    1976-01-01

    Tyrosylated Brome mosaic virus RNA was found to interact with a binary complex of wheat germ, elongation factor 1 and [3H]GTP. Increasing amounts of the aminoacylated viral RNA proportionately reduced radioactivity bound to a nitrocellulose filter, as has previously been noted by others for the charged forms of tobacco mosaic virus, turnip yellow mosaic virus, and tRNA's. However, Sephadex chromatography of the products showed that instead of forming the ternary complex elongation factor-GTP-aminoacyl RNA, the viral RNA caused release of GTP from its complex with elongation factor. Acetylated tyrosyl Brome mosaic virus RNA did not react with the binary complex,and only a slight degree, if any, of stabilization of tyrosine bound to viral RNA was observed after interaction with elongation factor 1. Although such interactions are similar to the reaction of elongation factor with aminoacyl-tRNA , the release of GTP is different and accentuates the possible role for aminoacylation in transcription rather than in translation events. PMID:978788

  19. Insulin-like growth factor 1 enhances the migratory capacity of mesenchymal stem cells

    SciTech Connect

    Li, Yangxin . E-mail: Yangxin_li@yahoo.com; Yu, XiYong . E-mail: yuxycn@hotmail.com; Lin, ShuGuang; Li, XiaoHong; Zhang, Saidan; Song, Yao-Hua

    2007-05-11

    Mesenchymal stem cells (MSCs) are attractive candidates for cell based therapies. However, the mechanisms responsible for stem cell migration and homing after transplantation remain unknown. It has been shown that insulin-like growth factor-1 (IGF-1) induces proliferation and migration of some cell types, but its effects on stem cells have not been investigated. We isolated and cultured MSC from rat bone marrow, and found that IGF-1 increased the expression levels of the chemokine receptor CXCR4 (receptor for stromal cell-derived factor-1, SDF-1). Moreover, IGF-1 markedly increased the migratory response of MSC to SDF-1. The IGF-1-induced increase in MSC migration in response to SDF-1 was attenuated by PI3 kinase inhibitor (LY294002 and wortmannin) but not by mitogen-activated protein/ERK kinase inhibitor PD98059. Our data indicate that IGF-1 increases MSC migratory responses via CXCR4 chemokine receptor signaling which is PI3/Akt dependent. These findings provide a new paradigm for biological effects of IGF-1 on MSC and have implications for the development of novel stem cell therapeutic strategies.

  20. Implications of Insulin-like Growth Factor 1 Receptor Activation in Lung Cancer

    PubMed Central

    Nurwidya, Fariz; Andarini, Sita; Takahashi, Fumiyuki; Syahruddin, Elisna; Takahashi, Kazuhisa

    2016-01-01

    Insulin-like growth factor 1 receptor (IGF1R) has been intensively investigated in many preclinical studies using cell lines and animal models, and the results have provided important knowledge to help improve the understanding of cancer biology. IGF1R is highly expressed in patients with lung cancer, and high levels of circulating insulin-like growth factor 1 (IGF1), the main ligand for IGF1R, increases the risk of developing lung malignancy in the future. Several phase I clinical trials have supported the potential use of an IGF1R-targeted strategy for cancer, including lung cancer. However, the negative results from phase III studies need further attention, especially in selecting patients with specific molecular signatures, who will gain benefits from IGF1R inhibitors with minimal side effects. This review will discuss the basic concept of IGF1R in lung cancer biology, such as epithelial-mesenchymal transition (EMT) induction and cancer stem cell (CSC) maintenance, and also the clinical implications of IGF1R for lung cancer patients, such as prognostic value and cancer therapy resistance. PMID:27418865

  1. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  2. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  3. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  4. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  5. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  6. Somatomedin-1 binding protein-3: insulin-like growth factor-1 binding protein-3, insulin-like growth factor-1 carrier protein.

    PubMed

    2003-01-01

    Somatomedin-1 binding protein-3 [insulin-like growth factor-1 binding protein-3, SomatoKine] is a recombinant complex of insulin-like growth factor-1 (rhIGF-1) and binding protein-3 (IGFBP-3), which is the major circulating somatomedin (insulin-like growth factor) binding protein; binding protein-3 regulates the delivery of somatomedin-1 to target tissues. Somatomedin-1 binding protein-3 has potential as replacement therapy for somatomedin-1 which may become depleted in indications such as major surgery, organ damage/failure and traumatic injury, resulting in catabolism. It also has potential for the treatment of osteoporosis; diseases associated with protein wasting including chronic renal failure, cachexia and severe trauma; and to attenuate cardiac dysfunction in a variety of disease states, including after severe burn trauma. Combined therapy with somatomedin-1 and somatomedin-1 binding protein-3 would prolong the duration of action of somatomedin-1 and would reduce or eliminate some of the undesirable effects associated with somatomedin-1 monotherapy. Somatomedin-1 is usually linked to binding protein-3 in the normal state of the body, and particular proteases clip them apart in response to stresses and release somatomedin-1 as needed. Therefore, somatomedin-1 binding protein-3 is a self-dosing system and SomatoKine would augment the natural supply of these linked compounds. Somatomedin-1 binding protein-3 was developed by Celtrix using its proprietary recombinant protein production technology. Subsequently, Celtrix was acquired by Insmed Pharmaceuticals on June 1 2000. Insmed and Avecia, UK, have signed an agreement for the manufacturing of SomatoKine and its components, IGF-1 and binding protein-3. CGMP clinical production of SomatoKine and its components will be done in Avecia's Advanced Biologics Centre, Billingham, UK, which manufactures recombinant-based medicines and vaccines with a capacity of up to 1000 litres. In 2003, manufacturing of SomatoKine is

  7. KMUP-1 inhibits H441 lung epithelial cell growth, migration and proinflammation via increased NO/CGMP and inhibited RHO kinase/VEGF signaling pathways.

    PubMed

    Wu, B N; Chen, H Y; Liu, C P; Hsu, L Y; Chen, I J

    2011-01-01

    This study investigates whether KMUP-1 protects soluble guanylate cyclase (sGC) and inhibits vascular endothelial growth factor (VEGF) expression in lung epithelial cells in hypoxia, therapeutically targeting epithelial proinflammation. H441 cells were used as a representative epithelial cell line to examine the role of sGC and VEGF in hypoxia and the anti-proinflammatory activity of KMUP-1 in normoxia. Human H441 cells were grown in hypoxia for 24-72 h. KMUP-1 (1, 10, 100 microM) arrested cells at the G0/G1 phase of the cell cycle, reduced cell survival and migration, increased p21/p27, restored eNOS, increased soluble guanylate cyclase (sGC) and PKG and inhibited Rho kinase II (ROCK-II). KMUP-1 (0.001-0.1 microM) concentration dependently increased eNOS in normoxia and did not inhibit phosphodiesterase-5A (PDE-5A) in hypoxic cells. Hypoxia-induced factor-1alpha (HIF-1alpha) and VEGF were suppressed by KMUP-1 but not by L-NAME (100 microM). The PKG inhibitor Rp-8-CPT-cGMPS (10 microM) blunted the inhibition of ROCK-II by KMUP-1. KMUP-1 inhibited thromboxane A2-mimetic agonist U46619-induced PDE-5A, TNF-alpha (100 ng/ml)-induced iNOS, and ROCK-II and associated phospho-p38 MAPK, suggesting multiple anti-proinflammatory activities. In addition, increased p21/p27 by KMUP-1 at higher concentrations might contribute to an increased Bax/Bcl-2 and active caspase-3/procaspase-3 ratio, concomitantly causing apoptosis. KMUP-1 inhibited ROCK-II/VEGF in hypoxia, indicating its anti-neoplastic and anti-inflammatory properties. KMUP-1 inhibited TNF-alpha-induced iNOS and U46619-induced PDE-5A and phospho-p38 MAPK in normoxia, confirming its anti-proinflammatory action. KMUP-1 could be used as an anti-proinflammatory to reduce epithelial inflammation.

  8. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  9. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  10. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  11. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  12. Hypoxia-inducible factor-1α as a predictive marker in pre-eclampsia

    PubMed Central

    AKHILESH, MEENAKSHI; MAHALINGAM, VIVEKANANDA; NALLIAH, SIVALINGAM; ALI, ROSALINA MOHD; GANESALINGAM, MURALI; HALEAGRAHARA, NAGARAJA

    2013-01-01

    The aim of this study was to determine whether or not the increased levels of hypoxia-inducible factor-1α (HIF-1α) could be used to demonstrate failed placentation in pre-eclamptic mothers. Twenty pregnant females with (pre-eclampsia group) or without pre-eclampsia (control group) were included in the present study. Antenatal and post-delivery HIF-1α transcription factor levels were measured. A significant increase was observed in the HIF-1α levels in the pre- and post-natal pre-eclampsia mothers. The findings suggest that the levels of HIF-1α in the blood of mothers with pre-eclampsia decrease after delivery of the placenta. The results confirm that there is increased HIF-1α in pre-eclampsia and a steady increase in the levels of HIF-1α could be commensurate with the possibility of a patient developing pre-eclampsia at a later trimester. PMID:24648931

  13. Regulation of wound healing and fibrosis by hypoxia and hypoxia-inducible factor-1.

    PubMed

    Ruthenborg, Robin J; Ban, Jae-Jun; Wazir, Anum; Takeda, Norihiko; Kim, Jung-Whan

    2014-09-01

    Wound healing is a complex multi-step process that requires spatial and temporal orchestration of cellular and non-cellular components. Hypoxia is one of the prominent microenvironmental factors in tissue injury and wound healing. Hypoxic responses, mainly mediated by a master transcription factor of oxygen homeostasis, hypoxia-inducible factor-1 (HIF-1), have been shown to be critically involved in virtually all processes of wound healing and remodeling. Yet, mechanisms underlying hypoxic regulation of wound healing are still poorly understood. Better understanding of how the wound healing process is regulated by the hypoxic microenvironment and HIF-1 signaling pathway will provide insight into the development of a novel therapeutic strategy for impaired wound healing conditions such as diabetic wound and fibrosis. In this review, we will discuss recent studies illuminating the roles of HIF-1 in physiologic and pathologic wound repair and further, the therapeutic potentials of HIF-1 stabilization or inhibition.

  14. X-Ray structure and biophysical properties of rabbit fibroblast growth factor 1

    SciTech Connect

    Lee, Jihun; Blaber, Sachiko I.; Irsigler, Andre; Aspinwall, Eric; Blaber, Michael

    2010-01-14

    The rabbit is an important and de facto animal model in the study of ischemic disease and angiogenic therapy. Additionally, fibroblast growth factor 1 (FGF-1) is emerging as one of the most important growth factors for novel pro-angiogenic and pro-arteriogenic therapy. However, despite its significance, the fundamental biophysical properties of rabbit FGF-1, including its X-ray structure, have never been reported. Here, the cloning, crystallization, X-ray structure and determination of the biophysical properties of rabbit FGF-1 are described. The X-ray structure shows that the amino-acid differences between human and rabbit FGF-1 are solvent-exposed and therefore potentially immunogenic, while the biophysical studies identify differences in thermostability and receptor-binding affinity that distinguish rabbit FGF-1 from human FGF-1.

  15. Possible mechanisms and function of nuclear trafficking of the colony-stimulating factor-1 receptor.

    PubMed

    Rovida, Elisabetta; Dello Sbarba, Persio

    2014-10-01

    Receptor tyrosine kinases (RTK) have long being studied with respect to the "canonical" signaling. This includes ligand-induced activation of a receptor tyrosine kinase at the cell surface that leads to receptor dimerization, followed by its phosphorylation in the intracellular domain and activation. The activated receptor then recruits cytoplasmic signaling molecules including other kinases. Activation of the downstream signaling cascade frequently leads to changes in gene expression following nuclear translocation of downstream targets. However, RTK themselves may localize within the nucleus, as either full-length molecules or cleaved fragments, with or without their ligands. Significant differences in this mechanism have been reported depending on the individual RTK, cellular context or disease. Accumulating evidences indicate that the colony-stimulating factor-1 receptor (CSF-1R) may localize within the nucleus. To date, however, little is known about the mechanism of CSF-1R nuclear shuttling, as well as the functional role of nuclear CSF-1R.

  16. The roles of the nuclear receptor steroidogenic factor 1 in endocrine differentiation and development.

    PubMed

    Parker, K L; Schimmer, B P

    1996-08-01

    The orphan nuclear receptor steroidogenic factor 1 (SF-1) has emerged as a critical determinant of adrenal and gonadal differentiation, development, and function. SF-1 was initially isolated as a positive regulator of the cytochrome P450 steroid hydroxylases in the adrenal glands and gonads; developmental analyses subsequently showed that SF-1 was also expressed in the diencephalon and anterior pituitary, suggesting additional roles in endocrine function. Analyses of knockout mice deficient in SF-1 revealed multiple abnormalities, including adrenal and gonadal agenesis, male to female sex reversal of the internal genitalia, impaired gonadotrope function, and absence of the ventromedial hypothalamic nucleus. Taken together, these results implicate SF-1 as a global regulator within the hypothalamic-pituitary-gonadal axis and the adrenal cortex.

  17. The roles of steroidogenic factor 1 in endocrine development and function.

    PubMed

    Parker, K L

    1998-05-25

    The nuclear hormone receptor family--structurally-related transcriptional regulators that mediate the actions of steroid hormones, thyroid hormone, vitamin D, and retinoids--also includes orphan members that lack known activating ligands. One of these orphan receptors, steroidogenic factor 1 (SF-1), has recently been shown to play key roles in steroidogenic cell function within the adrenal cortex and gonads. SF-1 also contributes to reproductive function at all three levels of the hypothalamic-pituitary-gonadal axis. Key insights into these roles came from analyses of SF-1 knockout mice, which revealed adrenal and gonadal agenesis with consequent male-to-female sex reversal of their internal and external genitalia, impaired gonadotrope function, and agenesis of the ventromedial hypothalamic nucleus. This report reviews the data that have established SF-1 as a critical mediator of endocrine differentiation and function.

  18. The roles of steroidogenic factor 1 in endocrine development and function.

    PubMed

    Parker, K L

    1998-10-25

    The orphan nuclear receptor steroidogenic factor 1 (SF-1) was initially isolated as a key regulator of the cytochrome P450 steroid hydroxylases in adrenocortical and gonadal cells. Subsequent analyses of SF-1 knockout mice have expanded considerably our understanding of the roles that SF-1 plays in endocrine development. These SF-1 knockout mice lacked adrenal glands and gonads, with consequent male-to-female sex reversal of their internal and external genitalia. Thus, SF-1 is essential for the embryonic survival of the primary steroidogenic organs. They further exhibited impaired gonadotrope function and agenesis of the ventromedial hypothalamic nucleus, establishing that SF-1 contributes to reproductive function at all three levels of the hypothalamic-pituitary-gonadal axis. This report reviews experiments that have defined these critical roles of SF-1 in endocrine development, and highlights areas of ongoing investigation.

  19. Hypoxia inducible factor 1α expression and effects of its inhibitors in canine lymphoma

    PubMed Central

    KAMBAYASHI, Satoshi; IGASE, Masaya; KOBAYASHI, Kosuke; KIMURA, Ayana; SHIMOKAWA MIYAMA, Takako; BABA, Kenji; NOGUCHI, Shunsuke; MIZUNO, Takuya; OKUDA, Masaru

    2015-01-01

    Hypoxic conditions in various cancers are believed to relate with their malignancy, and hypoxia inducible factor-1α (HIF-1α) has been shown to be a major regulator of the response to low oxygen. In this study, we examined HIF-1α expression in canine lymphoma using cell lines and clinical samples and found that these cells expressed HIF-1α. Moreover, the HIF-1α inhibitors, echinomycin, YC-1 and 2-methoxyestradiol, suppressed the proliferation of canine lymphoma cell lines. In a xenograft model using NOD/scid mice, echinomycin treatment resulted in a dose-dependent regression of the tumor. Our results suggest that HIF-1α contributes to the proliferation and/or survival of canine lymphoma cells. Therefore, HIF-1α inhibitors may be potential agents to treat canine lymphoma. PMID:26050843

  20. Hepatocyte nuclear factor-1β: A regulator of kidney development and cystogenesis

    PubMed Central

    Singh, V.; Singla, S. K.; Jha, V.; Puri, V.; Puri, S.

    2015-01-01

    The understanding of the genomics of the renal tissue has gathered a considerable interest and is making rapid progress. The molecular mechanisms as well as the precise function of the associated molecular components toward renal pathophysiology have recently been realized. For the cystic kidney disease, the regulation of gene expression affecting epithelial cells proliferation, apoptosis as well as process of differentiation/de-differentiation represent key molecular targets. For the cystic disorders, molecular targets have been identified, which besides lending heterogeneity to cysts may also provide tools to unravel their functional importance to understand the renal tissue homeostasis. This review focuses on providing comprehensive information about the transcriptional regulatory role of hepatocyte nuclear factor-1β, a homeoprotein, as well as its interacting partners in renal tissue development and pathophysiology. PMID:25838642

  1. Nannocystin A: an Elongation Factor 1 Inhibitor from Myxobacteria with Differential Anti-Cancer Properties.

    PubMed

    Krastel, Philipp; Roggo, Silvio; Schirle, Markus; Ross, Nathan T; Perruccio, Francesca; Aspesi, Peter; Aust, Thomas; Buntin, Kathrin; Estoppey, David; Liechty, Brigitta; Mapa, Felipa; Memmert, Klaus; Miller, Howard; Pan, Xuewen; Riedl, Ralph; Thibaut, Christian; Thomas, Jason; Wagner, Trixie; Weber, Eric; Xie, Xiaobing; Schmitt, Esther K; Hoepfner, Dominic

    2015-08-24

    Cultivation of myxobacteria of the Nannocystis genus led to the isolation and structure elucidation of a class of novel cyclic lactone inhibitors of elongation factor 1. Whole genome sequence analysis and annotation enabled identification of the putative biosynthetic cluster and synthesis process. In biological assays the compounds displayed anti-fungal and cytotoxic activity. Combined genetic and proteomic approaches identified the eukaryotic translation elongation factor 1α (EF-1α) as the primary target for this compound class. Nannocystin A (1) displayed differential activity across various cancer cell lines and EEF1A1 expression levels appear to be the main differentiating factor. Biochemical and genetic evidence support an overlapping binding site of 1 with the anti-cancer compound didemnin B on EF-1α. This myxobacterial chemotype thus offers an interesting starting point for further investigations of the potential of therapeutics targeting elongation factor 1. PMID:26179970

  2. Immunohistochemical localization of redox factor-1 (Ref-1) in Alzheimer's hippocampus.

    PubMed

    Tan, Z; Sun, N; Schreiber, S S

    1998-08-24

    Redox factor-1 (Ref-1) is a dual-function protein involved in both DNA repair and transcriptional regulation. Ref-1 is modulated by cerebral ischemia and other oxidative stressors, and also regulates the DNA-binding activities of transcription factors implicated in Alzheimer's disease (AD)-related neurodegeneration. The present study examined Ref-1 expression in the AD hippocampus by immunohistochemistry. Although Ref-1 immunostaining was relatively low in control brain sections, senile plaques and other plaque-like structures in the AD brain were Ref-1-positive. Cells with increased Ref-1 immunoreactivity were also observed in regions of neuronal injury. These results suggest that Ref-1 might contribute to senile plaque formation, and that overexpression of Ref-1 in injured neurons may be part of a response to oxidative stress and an attempt to repair damaged DNA in AD.

  3. Lipase maturation factor 1: a lipase chaperone involved in lipid metabolism.

    PubMed

    Péterfy, Miklós

    2012-05-01

    Mutations in lipase maturation factor 1 (LMF1) are associated with severe hypertriglyceridemia in mice and human subjects. The underlying cause is impaired lipid clearance due to lipase deficiency. LMF1 is a chaperone of the endoplasmic reticulum (ER) and it is critically required for the post-translational activation of three vascular lipases: lipoprotein lipase (LPL), hepatic lipase (HL) and endothelial lipase (EL). As LMF1 is only required for the maturation of homodimeric, but not monomeric, lipases, it is likely involved in the assembly of inactive lipase subunits into active enzymes and/or the stabilization of active dimers. Herein, we provide an overview of current understanding of LMF1 function and propose that it may play a regulatory role in lipase activation and lipid metabolism. Further studies will be required to test this hypothesis and elucidate the full spectrum of phenotypes in combined lipase deficiency. This article is part of a Special Issue entitled Triglyceride Metabolism and Disease. PMID:22063272

  4. Genistein promotes DNA demethylation of the steroidogenic factor 1 (SF-1) promoter in endometrial stromal cells

    SciTech Connect

    Matsukura, Hiroshi; Aisaki, Ken-ichi; Igarashi, Katsuhide; Matsushima, Yuko; Kanno, Jun; Muramatsu, Masaaki; Sudo, Katsuko; Sato, Noriko

    2011-08-26

    Highlights: {yields} Genistein (GEN) is a phytoestrogen found in soy products. {yields} GEN demethylated/unsilenced the steroidogenic factor 1 gene in endometrial tissue. {yields} GEN thus altered mRNA expression in uteri of ovariectomized (OVX) mice. {yields} A high-resolution melting assay was used to screen for epigenetic change. {yields} We isolated an endometrial cell clone that was epigenetically modulated by GEN. -- Abstract: It has recently been demonstrated that genistein (GEN), a phytoestrogen in soy products, is an epigenetic modulator in various types of cells; but its effect on endometrium has not yet been determined. We investigated the effects of GEN on mouse uterine cells, in vivo and in vitro. Oral administration of GEN for 1 week induced mild proliferation of the endometrium in ovariectomized (OVX) mice, which was accompanied by the induction of steroidogenic factor 1 (SF-1) gene expression. GEN administration induced demethylation of multiple CpG sites in the SF-1 promoter; these sites are extensively methylated and thus silenced in normal endometrium. The GEN-mediated promoter demethylation occurred predominantly on the luminal side, as opposed to myometrium side, indicating that the epigenetic change was mainly shown in regenerated cells. Primary cultures of endometrial stromal cell colonies were screened for GEN-mediated alterations of DNA methylation by a high-resolution melting (HRM) method. One out of 20 colony-forming cell clones showed GEN-induced demethylation of SF-1. This clone exhibited a high proliferation capacity with continuous colony formation activity through multiple serial clonings. We propose that only a portion of endometrial cells are capable of receiving epigenetic modulation by GEN.

  5. TNF-alpha associated with extracellular matrix fibronectin provides a stop signal for chemotactically migrating T cells.

    PubMed

    Franitza, S; Hershkoviz, R; Kam, N; Lichtenstein, N; Vaday, G G; Alon, R; Lider, O

    2000-09-01

    The migration of T cells into extravascular sites of inflammation is regulated by information derived from the molecular structure of the invaded tissue and from chemokine and cytokine gradients in the context of the extracellular matrix (ECM). Although recent studies have highlighted the role of particular chemoattractants in leukocyte migration, to date little is known about how specific combinations of contextual signals control the migration of leukocytes and their localization at sites of inflammation. Here we studied the interplay between a pleiotropic cytokine, TNF-alpha, and two prototypic chemoattractants, RANTES and stromal cell-derived factor-1alpha (SDF-1alpha), on human CD45RO+ T cells migrating within an ECM-like context. For this purpose, we used a newly constructed three-dimensional gel system designed to follow, in real time, the migration of individual leukocytes along chemotactic gradients in vitro. We found that TNF-alpha, which binds the ECM protein fibronectin and lacks adhesion- and migration-promoting effects of its own, can act as a proadhesive cytokine on T cells exposed to RANTES and SDF-1alpha. Furthermore, fibronectin-complexed TNF-alpha provided anchorage signals to the T cells as they moved directionally along chemoattractive gradients. This effect of TNF-alpha required an intact TNF-alpha receptor II subtype on the migrating T cells. The anchoring effect of TNF-alpha appears to be specific; IL-2, an integrin-activating proadhesive cytokine, does not transmit stoppage signals to T cell migration induced by RANTES. Thus, TNF-alpha present in the ECM at sites of inflammation may function to anchor T cells recruited to these sites by chemotactic signals. PMID:10946305

  6. Upregulation of miRNA3195 and miRNA374b Mediates the Anti-Angiogenic Properties of Melatonin in Hypoxic PC-3 Prostate Cancer Cells

    PubMed Central

    Sohn, Eun Jung; Won, Gunho; Lee, Jihyun; Lee, Sangyoon; Kim, Sung-hoon

    2015-01-01

    Recently microRNAs (miRNAs) have been attractive targets with their key roles in biological regulation through post-transcription to control mRNA stability and protein translation. Though melatonin was known as an anti-angiogenic agent, the underlying mechanism of melatonin in PC-3 prostate cancer cells under hypoxia still remains unclear. Thus, in the current study, we elucidated the important roles of miRNAs in melatonin-induced anti-angiogenic activity in hypoxic PC-3 cells. miRNA array revealed that 33 miRNAs (>2 folds) including miRNA3195 and miRNA 374b were significantly upregulated and 16 miRNAs were downregulated in melatonin-treated PC-3 cells under hypoxia compared to untreated control. Melatonin significantly attenuated the expression of hypoxia-inducible factor (HIF)-1 alpha, HIF-2 alpha and vascular endothelial growth factor (VEGF) at mRNA level in hypoxic PC-3 cells. Consistently, melatonin enhanced the expression of miRNA3195 and miRNA 374b in hypoxic PC-3 cells by qRT-PCR analysis. Of note, overexpression of miRNA3195 and miRNA374b mimics attenuated the mRNA levels of angiogenesis related genes such as HIF-1alpha, HIF-2 alpha and VEGF in PC-3 cells under hypoxia. Furthermore, overexpression of miRNA3195 and miRNA374b suppressed typical angiogenic protein VEGF at the protein level and VEGF production induced by melatonin, while antisense oligonucleotides against miRNA 3195 or miRNA 374b did not affect VEGF production induced by melatonin. Also, overexpression of miR3195 or miR374b reduced HIF-1 alpha immunofluorescent expression in hypoxic PC-3 compared to untreated control. Overall, our findings suggest that upregulation of miRNA3195 and miRNA374b mediates anti-angiogenic property induced by melatonin in hypoxic PC-3 cells. PMID:25553085

  7. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  8. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  9. Production of stromal cell-derived factor-1 (SDF-1)and expression of CXCR4 in human bone marrow endothelial cells.

    PubMed Central

    Yun, Hwan-Jung; Jo, Deog-Yeon

    2003-01-01

    This study investigated the production of stromal cell-derived factor-1 (SDF-1) and the expression of CXCR4 in human bone marrow endothelial cells (BMECs). Human BMEC cell line BMEC-1 cells expressed SDF-1 mRNA, and conditioned medium induced chemoattraction of CD34+ cells. Migration was not inhibited by pretreating the input cells with pertussis toxin, indicating that the chemoattractive activity was not dependent on SDF-1. Three-day culture of BMEC-1 and primary human BMEC cells produced 1,710+/-204 and 1,050+/-153 pg/mL SDF-1alpha, respectively, which was much less than primary human BM stromal cells (29,536+/-532 pg/ mL). By immuno-histochemistry, CXCR4 was detected in the endothelial cells lining sinusoids, arterioles, and venules in the bone marrow. However, cultured BMECs and BMEC-1 cells did not express CXCR4 on their surfaces. These results indicate that BMECs produce and release small amounts of SDF-1 and express CXCR4 in vivo only. PMID:14555820

  10. Nuclear respiratory factor 1 co-regulates AMPA glutamate receptor subunit 2 and cytochrome c oxidase: tight coupling of glutamatergic transmission and energy metabolism in neurons.

    PubMed

    Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T

    2009-03-01

    Neuronal activity, especially of the excitatory glutamatergic type, is highly dependent on energy from the oxidative pathway. We hypothesized that the coupling existed at the transcriptional level by having the same transcription factor to regulate a marker of energy metabolism, cytochrome c oxidase (COX) and an important subunit of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid glutamate receptors, GluR2 (Gria2). Nuclear respiratory factor 1 (NRF-1) was a viable candidate because it regulates all COX subunits and potentially activates Gria2. By means of in silico analysis, electrophoretic mobility shift and supershift, chromatin immunoprecipitation, and promoter mutational assays, we found that NRF-1 functionally bound to Gria2 promoter. Silencing of NRF-1 with small interference RNA prevented the depolarization-stimulated up-regulation of Gria2 and COX, and over-expression of NRF-1 rescued neurons from tetrodotoxin-induced down-regulation of Gria2 and COX transcripts. Thus, neuronal activity and energy metabolism are tightly coupled at the molecular level, and NRF-1 is a critical agent in this process.

  11. Downregulating hypoxia-inducible factor-1α expression with perfluorooctyl-bromide nanoparticles reduces early brain injury following experimental subarachnoid hemorrhage in rats

    PubMed Central

    Xu, Wei; Xu, Rui; Li, Xia; Zhang, Huan; Wang, Xin; Zhu, Ji

    2016-01-01

    The aim of the present study was to investigate the effects of perfluorooctyl-bromide (PFOB) nanoparticles on hypoxia-inducible factor 1 alpha (HIF-1α) and its downstream target genes in early brain injury (EBI) after subarachnoid hemorrhage (SAH). Healthy male Sprague Dawley rats (n=100) were randomly divided into five groups: Sham, SAH, SAH + vehicle, SAH + 5 mg/kg PFOB and SAH + 10 mg/kg PFOB. A rat model of SAH was created by endovascular perforation, and PFOB treatment (5 mg/kg or 10 mg/kg injected into the caudal vein) was initiated 1 h after SAH. All rats were subsequently sacrificed 24 h after surgery. Treatment with PFOB significantly alleviated EBI (including neurological dysfunction, brain edema, blood-brain barrier disruption (BBB), and neural cell apoptosis). In addition, it also suppressed the expression of HIF-1α, vascular endothelial growth factor (VEGF) and BNIP3 in the rat hippocampus. The effects of 10 g/kg PFOB were found to be more obvious than those of 5 g/kg PFOB. Our work demonstrated that PFOB treatment alleviated EBI after SAH, potentially through downregulation of the expression of HIF-1α and its target genes, which led to reduced cell apoptosis, BBB disruption and brain edema. PMID:27347319

  12. Beclin-1-independent autophagy positively regulates internal ribosomal entry site-dependent translation of hypoxia-inducible factor 1α under nutrient deprivation

    PubMed Central

    Wu, Ching-An; Huang, Duen-Yi; Lin, Wan-Wan

    2014-01-01

    Hypoxia has been shown to induce hypoxia-inducible factor-1alpha (HIF-1α) expression to support many cellular changes required for tumor growth and metastasis. In addition to hypoxia, nutrient deprivation is another stress condition widely existing in solid tumors due to the poor blood supply. Our data showed that nutrient deprivation induces a significant HIF-1α protein expression and potentiates the HIF-1α responses of hypoxia and CoCl2. This effect is not because of enhancement of HIF-1α stability or transcription. Rather we found it is through the cap-independent but internal ribosome entry site (IRES)-dependent translation. Notably inhibition of autophagy by si-ATG5, 3-methyladenine and chloroquine, but not si-Beclin-1, significantly reverses nutrient deprivation-induced HIF-1α responses. Furthermore, it is interesting to note the contribution of IRES activation for hypoxia-induced HIF-1α expression, however, different from nutrient starvation, si-Beclin 1 but not si-ATG5 can inhibit hypoxia-induced HIF-1α IRES activation and protein expression. Taken together, we for the first time highlight a link from alternative autophagy to cap-independent protein translation of HIF-1α under two unique stress conditions. We demonstrate Beclin 1-independent autophagy is involved to positively regulate nutrient deprivation induced-HIF-1α IRES activity and protein expression, while ATG5-independent autophagy is involved in the HIF-1 IRES activation caused by hypoxia. PMID:25115400

  13. Inhibitor of DNA Binding 1 Is Induced during Kidney Ischemia-Reperfusion and Is Critical for the Induction of Hypoxia-Inducible Factor-1α

    PubMed Central

    Wen, Dan; Zou, Yan-Fang; Gao, Yao-Hui; Zhao, Qian; Xie, Yin-Yin; Shen, Ping-Yan; Xu, Yao-Wen; Xu, Jing; Chen, Yong-Xi; Feng, Xiao-Bei; Shi, Hao; Zhang, Wen

    2016-01-01

    In this study, rat models of acute kidney injury (AKI) induced by renal ischemia-reperfusion (I/R) and HK-2 cell models of hypoxia-reoxygenation (H/R) were established to investigate the expression of inhibitor of DNA binding 1 (ID1) in AKI, and the regulation relationship between ID1 and hypoxia-inducible factor 1 alpha (HIF-1α). Through western blot, quantitative real-time PCR, immunohistochemistry, and other experiment methods, the induction of ID1 after renal I/R in vivo was observed, which was expressed mainly in renal tubular epithelial cells (TECs). ID1 expression was upregulated in in vitro H/R models at both the protein and mRNA levels. Via RNAi, it was found that ID1 induction was inhibited with silencing of HIF-1α. Moreover, the suppression of ID1 mRNA expression could lead to decreased expression and transcription of HIF-1α during hypoxia and reoxygenation. In addition, it was demonstrated that both ID1 and HIF-1α can regulate the transcription of twist. This study demonstrated that ID1 is induced in renal TECs during I/R and can regulate the transcription and expression of HIF-1α. PMID:27127787

  14. Serum and urinary insulin-like growth factor-1 and tumor necrosis factor in neonates with and without acute renal failure.

    PubMed

    Kornhauser, Carlos; Dubey, Luis-Antonio; Garay, M-Eugenia; Pérez-Luque, Elva-Leticia; Malacara, Juan-Manuel; Vargas-Origel, Arturo

    2002-05-01

    Acute renal failure (ARF) in neonates may occur after renal ischemia. Growth factors participate in the tubular regeneration process. Insulin-like growth factor-1 (IGF-1) is produced in the kidney during the recovery phase of ARF. Tumor necrosis factor-alpha (TNFalpha) may play a role in renal apoptosis. We examined serum and urinary IGF-1 and TNFalpha in neonates with or without ARF after asphyxia, in order to assess their possible use as markers of renal damage and recovery. We studied 20 full-term asphyxiated neonates, 10 with ARF and 10 without ARF, and compared them with 13 normal newborns for 7 days after birth. Blood urea, creatinine, pH, base deficit, and serum and urine IGF-1 and TNFalpha were assessed. Neonates with ARF had more-severe acidosis than patients without ARF. All patients had lower serum IGF-1 values immediately after birth than control children. Serum IGF-1 remained low in the ARF patients. The initial urinary IGF-1 was higher in all patients compared with control newborns, and remained elevated for the rest of the study only in the ARF neonates. Serum and urinary TNFalpha concentrations were similar for all healthy and diseased neonates. Measurement of serum and urinary IGF-1 levels in ARF neonates might be of additional value for clinical assessment of ARF.

  15. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  16. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  17. Intracrine prostaglandin E(2) signalling regulates hypoxia-inducible factor-1α expression through retinoic acid receptor-β.

    PubMed

    Fernández-Martínez, Ana B; Jiménez, María I Arenas; Manzano, Victoria Moreno; Lucio-Cazaña, Francisco J

    2012-12-01

    We have previously found in human renal proximal tubular HK-2 cells that hypoxia- and all-trans retinoic acid-induced hypoxia-inducible factor-1α up-regulation is accompanied by retinoic acid receptor-β up-regulation. Here we first investigated whether hypoxia-inducible factor-1α expression is dependent on retinoic acid receptor-β and our results confirmed it since (i) hypoxia-inducible factor-1α-inducing agents hypoxia, hypoxia-mimetic agent desferrioxamine, all-trans retinoic acid and interleukin-1β increased retinoic acid receptor-β expression, (ii) hypoxia-inducible factor-1α up-regulation was prevented by retinoic acid receptor-β antagonist LE-135 or siRNA retinoic acid receptor-β and (iii) there was direct binding of retinoic acid receptor-β to the retinoic acid response element in hypoxia-inducible factor-1α promoter upon treatment with all-trans retinoic acid and 16,16-dimethyl-prostaglandin E(2). Since intracellular prostaglandin E(2) mediates hypoxia-inducible factor-1α up-regulation in normoxia in HK-2 cells, we next investigated and confirmed, its role in the up-regulation of retinoic acid receptor-β in normoxia by hypoxia-inducible factor-1α-inducing agents all-trans retinoic acid, interleukin-1β and 16,16-dimethyl-prostaglandin E(2) by inhibiting cyclooxygenases, prostaglandin influx transporter or EP receptors. Interestingly, the hypoxia-induced increase in retinoic acid receptor-β expression and accumulation of hypoxia-inducible factor-1α was also blocked by the inhibitors tested. This is the first time, to our knowledge, that retinoic acid receptor-β signalling is involved in the control of the expression of transcription factor hypoxia-inducible factor-1α in both normoxia and hypoxia and that retinoic acid receptor-β expression is found to be strictly regulated by intracellular prostaglandin E(2). Given the relevance of hypoxia-inducible factor-1α in the kidney in terms of tumorigenesis, progressive renal failure, production

  18. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  19. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  20. Hybrid scaffolds of gelatin-siloxane releasing stromal derived factor-1 effective for cell recruitment.

    PubMed

    Dashnyam, Khandmaa; Perez, Roman; Lee, Eun-Jung; Yun, Ye-Rang; Jang, Jun-Hyeog; Wall, Ivan B; Kim, Hae-Won

    2014-06-01

    Scaffolds with the capacity to deliver signaling molecules are attractive for bone regeneration. Here, we developed bioactive siloxane-gelatin hybrid scaffolds via a sol gel process containing stromal derived factor-1 (SDF-1) to recruit osteoprogenitor/stem cells. The process was undertaken under room temperature aqueous conditions, which enabled therapeutic molecules to be effectively incorporated. After the sol-gel reaction and lyophilization process, well-crosslinked hybrid scaffolds were obtained with porosities of 80-90%. Dynamic mechanical analysis of the hybrid scaffolds showed significant improvement in storage modulus values (from 10 to 110 kPa) with increasing siloxane content. The protein release capacity of the scaffolds was investigated using a model protein cytochrome C (cyto C). The cyto C safely loaded onto the scaffolds exhibited, except the initial burst of 30% within a day, highly sustainable release, with approximately 70-80% of the loading amount for up to 4 weeks. Target molecule SDF-1 was loaded and released from the scaffolds, and the effects on the homing of mesenchymal stem cell were studied. Results demonstrated significant enhancement in the migration of cells to the SDF-1 loaded scaffolds. Taken together, the developed hybrid scaffolds are considered to be useful in loading and delivering signaling molecules such as SDF-1 to recruit osteoprogenitor /mesenchymal stem cells in the bone regeneration process.

  1. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism.

    PubMed

    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd

    2015-09-01

    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1.

  2. Antiviral Activity of Porcine Interferon Regulatory Factor 1 against Swine Viruses in Cell Culture.

    PubMed

    Li, Yongtao; Chang, Hongtao; Yang, Xia; Zhao, Yongxiang; Chen, Lu; Wang, Xinwei; Liu, Hongying; Wang, Chuanqing; Zhao, Jun

    2015-11-17

    Interferon regulatory factor 1 (IRF1), as an important transcription factor, is abundantly induced upon virus infections and participates in host antiviral immune responses. However, the roles of porcine IRF1 (poIRF1) in host antiviral defense remain poorly understood. In this study, we determined that poIRF1 was upregulated upon infection with viruses and distributed in nucleus in porcine PK-15 cells. Subsequently, we tested the antiviral activities of poIRF1 against several swine viruses in cells. Overexpression of poIRF1 can efficiently suppress the replication of viruses, and knockdown of poIRF1 promotes moderately viral replication. Interestingly, overexpression of poIRF1 enhances dsRNA-induced IFN-β and IFN-stimulated response element (ISRE) promoter activation, whereas knockdown of poIRF1 cannot significantly affect the activation of IFN-β promoter induced by RNA viruses. This study suggests that poIRF1 plays a significant role in cellular antiviral response against swine viruses, but might be dispensable for IFN-β induction triggered by RNA viruses in PK-15 cells. Given these results, poIRF1 plays potential roles in cellular antiviral responses against swine viruses.

  3. Autoimmune manifestations in human myelodysplasia: a positive correlation with interferon regulatory factor-1 (IRF-1) expression

    PubMed Central

    Giannouli, S; Tzoanopoulos, D; Ritis, K; Kartalis, G; Moutsopoulos, H; Voulgarelis, M

    2004-01-01

    Background: Patients with myelodysplasia may have autoimmune manifestations (AIM). Interferon regulatory factor-1 (IRF-1) is a transcription factor involved in interferon signalling, leukaemogenesis, and the development of the immune system. Objectives: To determine whether IRF-1 is implicated in the pathophysiology of AIM in myelodysplasia. Methods: 14 patients with myelodysplasia were studied, seven with AIM and seven without. Five patients with vasculitis and seven normal subjects served as controls. The expression of IRF-1 was studied in bone marrow mononuclear cells taken from patients and controls, using a relative quantitative reverse transcriptase polymerase chain reaction. Results: A 10-fold reduction in full length IRF-1 mRNA was detected in the myelodysplasia patients without AIM compared with the normal controls. In contrast, the group with AIM had increased IRF-1 transcripts, to a level almost equal to that observed in patients with vasculitis and normal controls. Conclusions: Myelodysplasia patients without IRF-1 expression had a decreased incidence of AIM. Thus the absence of IRF-1 transcription factor appears to protect against the development of autoimmunity in myelodysplasia. PMID:15082491

  4. Ghrelin Inhibition Restores Glucose Homeostasis in Hepatocyte Nuclear Factor-1α (MODY3)-Deficient Mice.

    PubMed

    Brial, François; Lussier, Carine R; Belleville, Karine; Sarret, Philippe; Boudreau, François

    2015-09-01

    Hepatocyte nuclear factor-1α (HNF1α) is a transcription factor expressed in tissues of endoderm origin. Mutations in HNF1A are associated with maturity-onset diabetes of the young 3 (MODY3). Mice deficient for Hnf1α are hyperglycemic, with their pancreatic β-cells being defective in glucose-sensing insulin secretion. The specific mechanisms involved in this defect are unclear. Gut hormones control glucose homeostasis. Our objective was to explore whether changes in these hormones play a role in glucose homeostasis in the absence of Hnf1α. An increase in ghrelin gene transcript and a decrease in glucose-dependent insulinotropic polypeptide (GIP) gene transcripts were observed in the gut of Hnf1α-null mice. These changes correlated with an increase of ghrelin and a decrease of GIP-labeled cells. Ghrelin serological levels were significantly induced in Hnf1α-null mice. Paradoxically, GIP levels were also induced in these mice. Treatment of Hnf1α-null mice with a ghrelin antagonist led to a recovery of the diabetic symptoms. We conclude that upregulation of ghrelin in the absence of Hnf1α impairs insulin secretion and can be reversed by pharmacological inhibition of ghrelin/GHS-R interaction. These observations open up on future strategies to counteract ghrelin action in a program that could become beneficial in controlling non-insulin-dependent diabetes. PMID:25979074

  5. Na+/H+ Exchanger Regulatory Factor 1 (NHERF1) Directly Regulates Osteogenesis*

    PubMed Central

    Liu, Li; Alonso, Veronica; Guo, Lida; Tourkova, Irina; Henderson, Sarah E.; Almarza, Alejandro J.; Friedman, Peter A.; Blair, Harry C.

    2012-01-01

    Bone formation requires synthesis, secretion, and mineralization of matrix. Deficiencies in these processes produce bone defects. The absence of the PDZ domain protein Na+/H+ exchange regulatory factor 1 (NHERF1) in mice, or its mutation in humans, causes osteomalacia believed to reflect renal phosphate wasting. We show that NHERF1 is expressed by mineralizing osteoblasts and organizes Na+/H+ exchangers (NHEs) and the PTH receptor. NHERF1-null mice display reduced bone formation and wide mineralizing fronts despite elimination of phosphate wasting by dietary supplementation. Bone mass was normal, reflecting coordinated reduction of bone resorption and formation. NHERF1-null bone had decreased strength, consistent with compromised matrix quality. Mesenchymal stem cells from NHERF1-null mice showed limited osteoblast differentiation but enhanced adipocyte differentiation. PTH signaling and Na+/H+ exchange were dysregulated in these cells. Osteoclast differentiation from monocytes was unaffected. Thus, NHERF1 is required for normal osteoblast differentiation and matrix synthesis. In its absence, compensatory mechanisms maintain bone mass, but bone strength is reduced. PMID:23109343

  6. Mutant hypoxia inducible factor-1α improves angiogenesis and tissue perfusion in ischemic rabbit skeletal muscle.

    PubMed

    Li, Mingyan; Liu, Cheng; Bin, Jianping; Wang, Yuegang; Chen, Jianwei; Xiu, Jiancheng; Pei, Jingxian; Lai, Yanxian; Chen, Dongdong; Fan, Caixia; Xie, Jiajia; Tao, Yu; Wu, Pingsheng

    2011-01-01

    Hypoxia-inducible factor-1α (HIF-1α) is one of the most potent angiogenic growth factors. It regulates genes involved in angiogenesis, but is inactivated rapidly by normoxia. Ad-HIF-1α-Trip was constructed by transforming Pro402, Pro564, and Asn803 in HIF-1α to alanine in order to delay degradation and create a constitutive transcriptional activator. In this study, we investigated whether Ad-HIF-1α-Trip could induce functional mature angiogenesis and the possible mechanisms involved. We found that Ad-HIF-1α-Trip increased the expression of multiple angiogenic genes in cultured HMVEC-Ls, including VEGF, PLGF, PAI-1, and PDGF. In a rabbit model of acute hind limb ischemia, Ad-HIF-1α-Trip improved tissue perfusion and collateral vessels, as measured by contrast-enhanced ultrasound (CEU), CT angiography, and vascular casting. Ad-HIF-1α-Trip also produced more histologically identifiable capillaries, which were verified by immunostaining, compared with controls. Interestingly, inhibition of CBP/p300 by curcumin prevented HIF-1α from inducing the expression of several angiogenic genes. The present study suggests that Ad-HIF-1α-Trip can induce mature angiogenesis and improve tissue perfusion in ischemic rabbit skeletal muscle. CBP/p300, which interacts with the transactivation domains of HIF-1α, is important for HIF-1α-induced transcription of angiogenic genes. PMID:20937289

  7. Regulation of cardiac autophagy by insulin-like growth factor 1.

    PubMed

    Troncoso, Rodrigo; Díaz-Elizondo, Jessica; Espinoza, Sandra P; Navarro-Marquez, Mario F; Oyarzún, Alejandra P; Riquelme, Jaime A; Garcia-Carvajal, Ivonne; Díaz-Araya, Guillermo; García, Lorena; Hill, Joseph A; Lavandero, Sergio

    2013-07-01

    Insulin-like growth factor-1 (IGF-1) signaling is a key pathway in the control of cell growth and survival. Three critical nodes in the IGF-1 signaling pathway have been described in cardiomyocytes: protein kinase Akt/mammalian target of rapamycin (mTOR), Ras/Raf/extracellular signal-regulated kinase (ERK), and phospholipase C (PLC)/inositol 1,4,5-triphosphate (InsP3 )/Ca(2+) . The Akt/mTOR and Ras/Raf/ERK signaling arms govern survival in the settings of cardiac stress and hypertrophic growth. By contrast, PLC/InsP3 /Ca(2+) functions to regulate metabolic adaptability and gene transcription. Autophagy is a catabolic process involved in protein degradation, organelle turnover, and nonselective breakdown of cytoplasmic components during nutrient starvation or stress. In the heart, autophagy is observed in a variety of human pathologies, where it can be either adaptive or maladaptive, depending on the context. We proposed the hypothesis that IGF-1 protects the heart by rescuing the mitochondrial metabolism and the energetics state, reducing cell death and controls the potentially exacerbate autophagic response to nutritional stress. In light of the importance of IGF-1 and autophagy in the heart, we review here IGF-1 signaling and autophagy regulation in the context of cardiomyocyte nutritional stress.

  8. Role of Stromal Cell-Derived Factor-1 Expression in the Injured Mouse Auditory Nerve

    PubMed Central

    Kilpatrick, Lauren A.; Zhu, Juhong; Lee, Fu-Shing; Lang, Hainan

    2014-01-01

    Objective The degeneration of hair cells and spiral ganglion neurons (SGNs) is an important pathologic process in the development of sensorineural hearing loss. In a murine model, predictable and reproducible damage to SGNs occurs through the application of ouabain to the round window. Recent evidence has shown that the chemokine stromal cell–derived factor-1 (SDF-1) is a potent chemoattractant of hematopoietic stem cells (HSCs) and provides trophic support to injured tissues during development and maturation. The hypothesis for the current study is that expression of SDF-1 plays an important role in protecting SGNs and preventing further degeneration in the setting of cochlear injury. Study Design Prospective, controlled. Setting Academic research laboratory. Subject and Methods Auditory brainstem response (ABR) and the expression of SDF-1 mRNA and protein were examined 1, 3, 7, 14, and 30 days after application of ouabain in 35 adult mice. Results Following ouabain application, real-time reverse-transcription polymerase chain reaction for SDF demonstrates increased mRNA expression following ouabain injury in nontransplanted mice. A significant increase in SDF protein expression was also observed using immunolabeling techniques and Western blot analysis. Conclusions SDF-1 expression is increased in the auditory nerve following cochlear injury. Further knowledge about the cochlear microenvironment, including SDF-1, is critical to maximizing HSC engraftment in the injured cochlea and providing a therapeutic option for sensorineural hearing loss. PMID:21947792

  9. Heat shock proteins and heat shock factor 1 in carcinogenesis and tumor development: an update

    PubMed Central

    2013-01-01

    Heat shock proteins (HSP) are a subset of the molecular chaperones, best known for their rapid and abundant induction by stress. HSP genes are activated at the transcriptional level by heat shock transcription factor 1 (HSF1). During the progression of many types of cancer, this heat shock transcriptional regulon becomes co-opted by mechanisms that are currently unclear, although evidently triggered in the emerging tumor cell. Concerted activation of HSF1 and the accumulation of HSPs then participates in many of the traits that permit the malignant phenotype. Thus cancers of many histologies exhibit activated HSF1 and increased HSP levels that may help to deter tumor suppression and evade therapy in the clinic. We review here the extensive work that has been carried out and is still in progress aimed at: (1) understanding the oncogenic mechanisms by which HSP genes are switched on, (2) determining the roles of HSF1 / HSP in malignant transformation and, (3) discovering approaches to therapy based on disrupting the influence of the HSF1 controlled transcriptome in cancer. PMID:22885793

  10. Hypoxia-Inducible Factor-1 (HIF-1): A Potential Target for Intervention in Ocular Neovascular Diseases

    PubMed Central

    Vadlapatla, Ramya Krishna; Vadlapudi, Aswani Dutt; Mitra, Ashim K.

    2015-01-01

    Constant oxygen supply is essential for proper tissue development, homeostasis and function of all eukaryotic organisms. Cellular response to reduced oxygen levels is mediated by the transcriptional regulator hypoxia-inducible factor-1 (HIF-1). It is a heterodimeric complex protein consisting of an oxygen dependent subunit (HIF-1α) and a constitutively expressed nuclear subunit (HIF-1β). In normoxic conditions, de novo synthesized cytoplasmic HIF-1α is degraded by 26S proteasome. Under hypoxic conditions, HIF-1α is stabilized, binds with HIF-1β and activates transcription of various target genes. These genes play a key role in regulating angiogenesis, cell survival, proliferation, chemotherapy, radiation resistance, invasion, metastasis, genetic instability, immortalization, immune evasion, metabolism and stem cell maintenance. This review highlights the importance of hypoxia signaling in development and progression of various vision threatening pathologies such as diabetic retinopathy, retinopathy of prematurity, age-related macular degeneration and glaucoma. Further, various inhibitors of HIF-1 pathway that may have a viable potential in the treatment of oxygen-dependent ocular diseases are also discussed. PMID:23701276

  11. The Myb-domain protein ULTRAPETALA1 INTERACTING FACTOR 1 controls floral meristem activities in Arabidopsis.

    PubMed

    Moreau, Fanny; Thévenon, Emmanuel; Blanvillain, Robert; Lopez-Vidriero, Irene; Franco-Zorrilla, Jose Manuel; Dumas, Renaud; Parcy, François; Morel, Patrice; Trehin, Christophe; Carles, Cristel C

    2016-04-01

    Higher plants continuously and iteratively produce new above-ground organs in the form of leaves, stems and flowers. These organs arise from shoot apical meristems whose homeostasis depends on coordination between self-renewal of stem cells and their differentiation into organ founder cells. This coordination is stringently controlled by the central transcription factor WUSCHEL (WUS), which is both necessary and sufficient for stem cell specification in Arabidopsis thaliana ULTRAPETALA1 (ULT1) was previously identified as a plant-specific, negative regulator of WUS expression. However, molecular mechanisms underlying this regulation remain unknown. ULT1 protein contains a SAND putative DNA-binding domain and a B-box, previously proposed as a protein interaction domain in eukaryotes. Here, we characterise a novel partner of ULT1, named ULT1 INTERACTING FACTOR 1 (UIF1), which contains a Myb domain and an EAR motif. UIF1 and ULT1 function in the same pathway for regulation of organ number in the flower. Moreover, UIF1 displays DNA-binding activity and specifically binds to WUS regulatory elements. We thus provide genetic and molecular evidence that UIF1 and ULT1 work together in floral meristem homeostasis, probably by direct repression of WUS expression. PMID:26903506

  12. Insulin-like growth factor-1 is associated with life-history variation across Mammalia

    PubMed Central

    Swanson, Eli M.; Dantzer, Ben

    2014-01-01

    Despite the diversity of mammalian life histories, persistent patterns of covariation have been identified, such as the ‘fast–slow’ axis of life-history covariation. Smaller species generally exhibit ‘faster’ life histories, developing and reproducing rapidly, but dying young. Hormonal mechanisms with pleiotropic effects may mediate such broad patterns of life-history variation. Insulin-like growth factor 1 (IGF-1) is one such mechanism because heightened IGF-1 activity is related to traits associated with faster life histories, such as increased growth and reproduction, but decreased lifespan. Using comparative methods, we show that among 41 mammalian species, increased plasma IGF-1 concentrations are associated with fast life histories and altricial reproductive patterns. Interspecific path analyses show that the effects of IGF-1 on these broad patterns of life-history variation are through its direct effects on some individual life-history traits (adult body size, growth rate, basal metabolic rate) and through its indirect effects on the remaining life-history traits. Our results suggest that the role of IGF-1 as a mechanism mediating life-history variation is conserved over the evolutionary time period defining mammalian diversification, that hormone–trait linkages can evolve as a unit, and that suites of life-history traits could be adjusted in response to selection through changes in plasma IGF-1. PMID:24619435

  13. Steroidogenic factor-1: its role in endocrine organ development and differentiation.

    PubMed

    Hammer, G D; Ingraham, H A

    1999-07-01

    The cloning of the first steroid hormone receptor over a decade ago provided vital insight into the mechanisms by which steroid hormones activate gene transcription. When bound by hormone, these receptors function as ligand-dependent transcription factors by binding to unique response elements in the promoter of specific target genes. Over 60 receptors have now been characterized in this superfamily of steroid receptors. Many receptors known as orphan receptors have been cloned by homology and have no known ligands but appear to be mediators of endocrine function in the adult and in many cases are essential developmental regulators in endocrine organogenesis. One such receptor is steroidogenic factor-1 (SF-1). While initially cloned as a transcriptional regulator of the various steroidogenic enzyme genes in the adrenal and gonad, it has become clear through genetic ablation experiments in mice that SF-1 is an essential factor in adrenal and gonadal development and for the proper functioning of the hypothalamic-pituitary-gonadal axis. In addition, these studies have revealed that SF-1 is necessary for the formation of the ventromedial nucleus of the hypothalamus. While we have learned much since the initial cloning of SF-1, the mechanisms by which SF-1 regulates these various developmental programs remain elusive. This article focuses on the characterization of SF-1 and its emerging role in endocrine homeostasis. Specific attention is placed on the mechanisms of action of this unique member of the nuclear receptor superfamily.

  14. Acetylation of steroidogenic factor 1 protein regulates its transcriptional activity and recruits the coactivator GCN5.

    PubMed

    Jacob, A L; Lund, J; Martinez, P; Hedin, L

    2001-10-01

    Steroidogenic factor-1 (SF-1) is an orphan nuclear receptor that plays an essential role in the development of the hypothalamic-pituitary-gonadal axis in both sexes. SF-1 belongs to the hormone nuclear receptor superfamily and possesses an N-terminal DNA binding domain and a C-terminal ligand binding domain. Activation function domain 2 is located C-terminal of the ligand binding domain of SF-1 and is important for the transactivation of target genes. Coactivators with histone acetyltransferase activity such as cAMP response element-binding protein-binding protein and steroid receptor coactivator 1 interact and increase SF-1-mediated transcriptional activity. In this study we demonstrate that SF-1 is acetylated in vivo. Histone acetyltransferase GCN5 acetylates SF-1 in vitro. Moreover, we found that SF-1 recruited a novel coactivator GCN5, which can be a newly identified coactivator for SF-1. Acetylation of SF-1 stimulates its transcriptional activity. Inhibition of deacetylation by trichostatin A, a histone deacetylase inhibitor, increased SF-1-mediated transactivation and stabilized and induced the nuclear export of the SF-1 protein.

  15. Steroidogenic factor 1 (SF-1) is essential for ovarian development and function.

    PubMed

    Hanley, N A; Ikeda, Y; Luo, X; Parker, K L

    2000-05-25

    The orphan nuclear receptor steroidogenic factor 1 (SF-1) was identified originally as a key regulator of the tissue-specific expression of the cytochrome P450 steroid hydroxylases. Hints at considerably broader roles for SF-1 came from analyses of its expression pattern in mouse embryos. As anticipated, SF-1 was expressed in the adrenal glands and gonads from their early stages of development. Surprisingly, SF-1 also was expressed outside of the primary steroidogenic tissues in the anterior pituitary and hypothalamus. SF-1 knockout mice dramatically confirmed its multiple essential roles in vivo. These mice lacked adrenal glands and gonads, leading to adrenocortical insufficiency and male-to-female sex reversal of their internal and external genitalia. SF-1 knockout mice also had impaired pituitary expression of gonadotropins and agenesis of the ventromedial hypothalamic nucleus (VMH), confirming roles of SF-1 at all three levels of the hypothalamic-pituitary-gonadal axis. With some focus on the ovary, this review summarizes experiments that have defined essential roles of SF-1 in endocrine development, and highlights important areas for future studies.

  16. Steroidogenic factor 1 (SF-1) is essential for endocrine development and function.

    PubMed

    Luo, X; Ikeda, Y; Lala, D; Rice, D; Wong, M; Parker, K L

    1999-01-01

    Steroidogenic factor 1 (SF-1), an orphan nuclear receptor, initially was isolated as a key regulator of the tissue-specific expression of the cytochrome P450 steroid hydroxylases. Thereafter, analyses of sites of SF-1 expression during mouse embryological development hinted at considerably expanded roles for SF-1, roles that were strikingly confirmed through the analyses of SF-1 knockout mice. These SF-1 knockout mice exhibited adrenal and gonadal agenesis, associated with male-to-female sex reversal of their internal and external genitalia and death from adrenocortical insufficiency. These findings showed unequivocally that SF-1 is essential for the embryonic survival of the primary steroidogenic organs. SF-1 knockout mice also had impaired pituitary expression of gonadotropins and agenesis of the ventromedial hypothalamic nucleus (VMH), establishing that SF-1 regulates reproductive function at all three levels of the hypothalamic-pituitary gonadal axis. This article reviews the experiments that have defined these essential roles of SF-1 in endocrine development and highlights important areas for future studies.

  17. Steroidogenic factor 1 plays multiple roles in endocrine development and function.

    PubMed

    Wong, M; Ikeda, Y; Luo, X; Caron, K M; Weber, T J; Swain, A; Schimmer, B P; Parker, K L

    1997-01-01

    The nuclear hormone receptor family comprises a group of structurally related transcriptional regulators that mediate the actions of diverse ligands, including steroid hormones, thyroid hormone, vitamin D, and retinoids. The nuclear receptor family also contains members for which activating ligands have not been identified-the orphan nuclear receptors. One of these orphan nuclear receptors, steroidogenic factor 1 (SF-1), has emerged as an essential regulator of steroidogenic cell function within the adrenal cortex and gonads; SF-1 also plays important roles in reproduction at all three levels of the hypothalamic-pituitary-gonadal axis. First identified as a tissue-specific regulator of the transcription of the cytochrome P450 steroid hydroxylases, considerably broader roles for SF-1 were revealed by genetic studies in mice lacking SF-1 due to targeted gene disruption. These SF-1-knockout mice had agenesis of their adrenal glands and gonads, male-to-female sex reversal of their internal and external genitalia, impaired gonadotrope function, and agenesis of the ventromedial hypothalamic nucleus. These studies delineated essential roles of SF-1 in regulating endocrine differentiation and function at multiple levels. Despite these insights into roles of SF-1, the precise mechanisms by which SF-1 exerts its multiple effects remain to be determined. This review highlights experiments that have established SF-1 as a pivotal determinant of endocrine differentiation and function and identifies areas in which additional studies are needed to expand our understanding of SF-1 action.

  18. Chronic ethanol feeding inhibits plasma levels of insulin-like growth factor-1

    SciTech Connect

    Sonntag, W.E.; Boyd, R.L.

    1988-01-01

    The purpose of this study was to determine whether the generalized catabolic effects of chronic ethanol may be associated with a decline in plasma of insulin-like growth factor-1 (IGF-1). Male Sprague-Dawley rats were fed a liquid diet containing 5% ethanol or pair-fed a diet made isocaloric with maltose-dextrin. Animals were maintained on this diet for either 12 days or 4.5 months. Another groups of animals were fed control diet ad libitum for 2 weeks. After 12 days of feeding, plasma concentrations of IGF-1 in ad libitum fed rats were 771 +/- 41 ng/ml which was greater than concentrations in either pair-fed or ethanol-fed rats. After 4.5 months of feeding, plasma levels of IGF-1 in ad libitum and pair-fed rats were similar to the 12 day study. However, a significant decrease in plasma levels of IGF-1 was observed in ethanol-fed animals over the 4.5 month period. Results of a similar study in rats fed a high-fat diet for 4.5 months were similar to those found with the low-fat diet.

  19. Thyroid transcription factor-1 exhibits osmosensitive transcription in brain-derived cell lines.

    PubMed

    Kim, Jae Geun; Bae, Kyung Duk; Yun, Chang Ho; Im, Hye Li; Park, Jeong Woo; Nam-Goong, Il Seong; Kim, Young Il; Lee, Byung Ju

    2008-06-01

    Thyroid transcription factor-1 (TTF-1) belongs to the Nkx family of homeodomain-containing proteins and regulates expression of several important genes in the brain. Our previous studies showed that TTF-1 plays an important role in water homeostasis in the subfornical organ of rats and is involved in cerebrospinal fluid formation by regulation of aquaporin-1 transcription in the choroid plexus. In this study, we examined changes in TTF-1 transcription in response to hypertonicity using promoter assays. TTF-1 was synthesized in several osmosensitive regions of the rat brain. TTF-1 promoter activity was diminished by treatment with hypertonic solutions in a time- and dose-dependent manner in brain-derived cell lines. Additionally, TTF-1 was involved in the regulation of angiotensinogen (Aogen) transcription under a hyperosmotic condition through specific binding domains in the Aogen promoter. These results suggest a possible role of TTF-1 in brain fluid homeostasis in response to changes in the osmotic environment. PMID:18395010

  20. Evolutionarily Conserved Binding of Translationally Controlled Tumor Protein to Eukaryotic Elongation Factor 1B*

    PubMed Central

    Wu, Huiwen; Gong, Weibin; Yao, Xingzhe; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2015-01-01

    Translationally controlled tumor protein (TCTP) is an abundant protein that is highly conserved in eukaryotes. However, its primary function is still not clear. Human TCTP interacts with the metazoan-specific eukaryotic elongation factor 1Bδ (eEF1Bδ) and inhibits its guanine nucleotide exchange factor (GEF) activity, but the structural mechanism remains unknown. The interaction between TCTP and eEF1Bδ was investigated by NMR titration, structure determination, paramagnetic relaxation enhancement, site-directed mutagenesis, isothermal titration calorimetry, and HADDOCK docking. We first demonstrated that the catalytic GEF domain of eEF1Bδ is not responsible for binding to TCTP but rather a previously unnoticed central acidic region (CAR) domain in eEF1Bδ. The mutagenesis data and the structural model of the TCTP-eEF1Bδ CAR domain complex revealed the key binding residues. These residues are highly conserved in eukaryotic TCTPs and in eEF1B GEFs, including the eukaryotically conserved eEF1Bα, implying the interaction may be conserved in all eukaryotes. Interactions were confirmed between TCTP and the eEF1Bα CAR domain for human, fission yeast, and unicellular photosynthetic microalgal proteins, suggesting that involvement in protein translation through the conserved interaction with eEF1B represents a primary function of TCTP. PMID:25635048

  1. Dexras1 links glucocorticoids to insulin-like growth factor-1 signaling in adipogenesis

    PubMed Central

    Kim, Hyo Jung; Cha, Jiyoung Y.; Seok, Jo Woon; Choi, Yoonjeong; Yoon, Bo Kyung; Choi, Hyeonjin; Yu, Jung Hwan; Song, Su Jin; Kim, Ara; Lee, Hyemin; Kim, Daeun; Han, Ji Yoon; Kim, Jae-woo

    2016-01-01

    Glucocorticoids are associated with obesity, but the underlying mechanism by which they function remains poorly understood. Previously, we showed that small G protein Dexras1 is expressed by glucocorticoids and leads to adipocyte differentiation. In this study, we explored the mechanism by which Dexras1 mediates adipogenesis and show a link to the insulin-like growth factor-1 (IGF-1) signaling pathway. Without Dexras1, the activation of MAPK and subsequent phosphorylation of CCAAT/enhancer binding protein β (C/EBPβ) is abolished, thereby inhibiting mitotic clonal expansion and further adipocyte differentiation. Dexras1 translocates to the plasma membrane upon insulin or IGF-1 treatment, for which the unique C-terminal domain (amino acids 223–276) is essential. Dexras1-dependent MAPK activation is selectively involved in the IGF-1 signaling, because another Ras protein, H-ras localized to the plasma membrane independently of insulin treatment. Moreover, neither epidermal growth factor nor other cell types shows Dexras1-dependent MAPK activation, indicating the importance of Dexras1 in IGF-1 signaling in adipogenesis. Dexras1 interacts with Shc and Raf, indicating that Dexras1-induced activation of MAPK is largely dependent on the Shc-Grb2-Raf complex. These results suggest that Dexras1 is a critical mediator of the IGF-1 signal to activate MAPK, linking glucocorticoid signaling to IGF-1 signaling in adipogenesis. PMID:27345868

  2. Inhibiting heat shock factor 1 in human cancer cells with a potent RNA aptamer.

    PubMed

    Salamanca, H Hans; Antonyak, Marc A; Cerione, Richard A; Shi, Hua; Lis, John T

    2014-01-01

    Heat shock factor 1 (HSF1) is a master regulator that coordinates chaperone protein expression to enhance cellular survival in the face of heat stress. In cancer cells, HSF1 drives a transcriptional program distinct from heat shock to promote metastasis and cell survival. Its strong association with the malignant phenotype implies that HSF1 antagonists may have general and effective utilities in cancer therapy. For this purpose, we had identified an avid RNA aptamer for HSF1 that is portable among different model organisms. Extending our previous work in yeast and Drosophila, here we report the activity of this aptamer in human cancer cell lines. When delivered into cells using a synthetic gene and strong promoter, this aptamer was able to prevent HSF1 from binding to its DNA regulation elements. At the cellular level, expression of this aptamer induced apoptosis and abolished the colony-forming capability of cancer cells. At the molecular level, it reduced chaperones and attenuated the activation of the MAPK signaling pathway. Collectively, these data demonstrate the advantage of aptamers in drug target validation and support the hypothesis that HSF1 DNA binding activity is a potential target for controlling oncogenic transformation and neoplastic growth.

  3. Steroidogenic Factor 1 Regulates Expression of the Cannabinoid Receptor 1 in the Ventromedial Hypothalamic Nucleus

    PubMed Central

    Kim, Ki Woo; Jo, Young-Hwan; Zhao, Liping; Stallings, Nancy R.; Chua, Streamson C.; Parker, Keith L.

    2008-01-01

    The nuclear receptor steroidogenic factor 1 (SF-1) plays essential roles in the development and function of the ventromedial hypothalamic nucleus (VMH). Considerable evidence links the VMH and SF-1 with the regulation of energy homeostasis. Here, we demonstrate that SF-1 colocalizes in VMH neurons with the cannabinoid receptor 1 (CB1R) and that a specific CB1R agonist modulates electrical activity of SF-1 neurons in hypothalamic slice preparations. We further show that SF-1 directly regulates CB1R gene expression via a SF-1-responsive element at −101 in its 5′-flanking region. Finally, we show that knockout mice with selective inactivation of SF-1 in the brain have decreased expression of CB1R in the region of the VMH and exhibit a blunted response to systemically administered CB1R agonists. These studies suggest that SF-1 directly regulates the expression of CB1R, which has been implicated in the regulation of energy homeostasis and anxiety-like behavior. PMID:18511494

  4. AIRAP, a New Human Heat Shock Gene Regulated by Heat Shock Factor 1*

    PubMed Central

    Rossi, Antonio; Trotta, Edoardo; Brandi, Rossella; Arisi, Ivan; Coccia, Marta; Santoro, M. Gabriella

    2010-01-01

    Heat shock factor-1 (HSF1) is the central regulator of heat-induced transcriptional responses leading to rapid expression of molecular chaperones that protect mammalian cells against proteotoxic stress. The main targets for HSF1 are specific promoter elements (HSE) located upstream of heat shock genes encoding a variety of heat shock proteins, including HSP70, HSP90, HSP27, and other proteins of the network. Herein we report that the zinc finger AN1-type domain-2a gene, also known as AIRAP, behaves as a canonical heat shock gene, whose expression is temperature-dependent and strictly controlled by HSF1. Transcription is triggered at temperatures above 40 °C in different types of human cancer and primary cells, including peripheral blood monocytes. As shown by ChIP analysis, HSF1 is recruited to the AIRAP promoter rapidly after heat treatment, with a kinetics that parallels HSP70 promoter HSF1-recruitment. In transfection experiments HSF1-silencing abolished heat-induced AIRAP promoter-driven transcription, which could be rescued by exogenous Flag-HSF1 expression. The HSF1 binding HSE sequence in the AIRAP promoter critical for heat-induced transcription was identified. Because its expression is induced at febrile temperatures in human cells, AIRAP may represent a new potential component of the protective response during fever in humans. PMID:20185824

  5. Differentiation-inducing factor-1 suppresses gene expression of cyclin D1 in tumor cells

    SciTech Connect

    Yasmin, Tania; Takahashi-Yanaga, Fumi . E-mail: yanaga@clipharm.med.kyushu-u.ac.jp; Mori, Jun; Miwa, Yoshikazu; Hirata, Masato; Watanabe, Yutaka; Morimoto, Sachio; Sasaguri, Toshiyuki

    2005-12-16

    To determine the mechanism by which differentiation-inducing factor-1 (DIF-1), a morphogen of Dictyostelium discoideum, inhibits tumor cell proliferation, we examined the effect of DIF-1 on the gene expression of cyclin D1. DIF-1 strongly reduced the expression of cyclin D1 mRNA and correspondingly decreased the amount of {beta}-catenin in HeLa cells and squamous cell carcinoma cells. DIF-1 activated glycogen synthase kinase-3{beta} (GSK-3{beta}) and inhibition of GSK-3{beta} attenuated the DIF-1-induced {beta}-catenin degradation, indicating the involvement of GSK-3{beta} in this effect. Moreover, DIF-1 reduced the activities of T-cell factor (TCF)/lymphoid enhancer factor (LEF) reporter plasmid and a reporter gene driven by the human cyclin D1 promoter. Eliminating the TCF/LEF consensus site from the cyclin D1 promoter diminished the effect of DIF-1. These results suggest that DIF-1 inhibits Wnt/{beta}-catenin signaling, resulting in the suppression of cyclin D1 promoter activity.

  6. Extracellular vimentin interacts with insulin-like growth factor 1 receptor to promote axonal growth.

    PubMed

    Shigyo, Michiko; Kuboyama, Tomoharu; Sawai, Yusuke; Tada-Umezaki, Masahito; Tohda, Chihiro

    2015-01-01

    Vimentin, an intermediate filament protein, is generally recognised as an intracellular protein. Previously, we reported that vimentin was secreted from astrocytes and promoted axonal growth. The effect of extracellular vimentin in neurons was a new finding, but its signalling pathway was unknown. In this study, we aimed to determine the signalling mechanism of extracellular vimentin that facilitates axonal growth. We first identified insulin-like growth factor 1 receptor (IGF1R) as a receptor that is highly phosphorylated by vimentin stimulation. IGF1R blockades diminished vimentin- or IGF1-induced axonal growth in cultured cortical neurons. IGF1, IGF2 and insulin were not detected in the neuron culture medium after vimentin treatment. The combined drug affinity responsive target stability method and western blotting analysis showed that vimentin and IGF1 interacted with IGF1R directly. In addition, immunoprecipitation and western blotting analyses confirmed that recombinant IGF1R bound to vimentin. The results of a molecular dynamics simulation revealed that C-terminal residues (residue number 330-407) in vimentin are the most appropriate binding sites with IGF1R. Thus, extracellular vimentin may be a novel ligand of IGF1R that promotes axonal growth in a similar manner to IGF1. Our results provide novel findings regarding the role of extracellular vimentin and IGF1R in axonal growth. PMID:26170015

  7. Expression of Redox Factor-1 in Early Injury Period After Liver Transplantation in Rat Model

    PubMed Central

    Zhang, Ping; Du, Xiaohong; Sun, Zhipeng; Xu, Lijun

    2009-01-01

    The aims of this study were to observe the relationship between injury of graft and expression of redox factor-1 (Ref-1) in early period (24 h) after liver transplantation in rat model. One hundred and fifty adult male Wister rats were randomly divided into three groups including liver transplant group, sham surgery group and untreated control group. After liver transplantation, animals were sacrificed at different time points, and the changes and significance of the expression of Ref-1 were then explored by immunohistochemistry, serology and histopathology. As compared with sham surgery group and untreated control group, the expression of Ref-1 protein in transplant group was stronger in early period after liver transplantation. With pathology analysis, lots of infiltrating inflammation cells were found around the portal veins. Hepatic tissues were injury. However, the injury in sham surgery and untreated control group were comparatively slight. The serum ALT and AST levels reached the peak at 6-12 h, and decreased significantly after 12 h. These data suggested that the degree of liver injury in earlier period after transplantation peaked at 6 h and then decreased. And Ref-1 protein induced by hepatic ischemic reperfusion injury might play a critical role in repairing the injury. PMID:19728933

  8. Mesenchymal Stem Cells with Increased Stromal Cell-Derived Factor 1 Expression Enhanced Fracture Healing

    PubMed Central

    Ho, Chih-Yuan; Hua, Jia; Coathup, Melanie; Kalia, Priya; Blunn, Gordon

    2015-01-01

    Treatment of critical size bone defects pose a challenge in orthopedics. Stem cell therapy together with cytokines has the potential to improve bone repair as they cause the migration and homing of stem cells to the defect site. However, the engraftment, participation, and recruitment of other cells within the regenerating tissue are important. To enhance stem cell involvement, this study investigated overexpression of stem cells with stromal cell-derived factor 1 (SDF-1) using an adenovirus. We hypothesized that these engineered cells would effectively increase the migration of native cells to the site of fracture, enhancing bone repair. Before implantation, we showed that SDF-1 secreted by transfected cells increased the migration of nontransfected cells. In a rat defect bone model, bone marrow mesenchymal stem cells overexpressing SDF-1 showed significantly (p=0.003) more new bone formation within the gap and less bone mineral loss at the area adjacent to the defect site during the early bone healing stage. In conclusion, SDF-1 was shown to play an important role in accelerating fracture repair and contributing to bone repair in rat models, by recruiting more host stem cells to the defect site and encouraging osteogenic differentiation and production of bone. PMID:25251779

  9. Zinc regulates a key transcriptional pathway for epileptogenesis via metal-regulatory transcription factor 1

    PubMed Central

    van Loo, Karen M. J.; Schaub, Christina; Pitsch, Julika; Kulbida, Rebecca; Opitz, Thoralf; Ekstein, Dana; Dalal, Adam; Urbach, Horst; Beck, Heinz; Yaari, Yoel; Schoch, Susanne; Becker, Albert J.

    2015-01-01

    Temporal lobe epilepsy (TLE) is the most common focal seizure disorder in adults. In many patients, transient brain insults, including status epilepticus (SE), are followed by a latent period of epileptogenesis, preceding the emergence of clinical seizures. In experimental animals, transcriptional upregulation of CaV3.2 T-type Ca2+-channels, resulting in an increased propensity for burst discharges of hippocampal neurons, is an important trigger for epileptogenesis. Here we provide evidence that the metal-regulatory transcription factor 1 (MTF1) mediates the increase of CaV3.2 mRNA and intrinsic excitability consequent to a rise in intracellular Zn2+ that is associated with SE. Adeno-associated viral (rAAV) transfer of MTF1 into murine hippocampi leads to increased CaV3.2 mRNA. Conversely, rAAV-mediated expression of a dominant-negative MTF1 abolishes SE-induced CaV3.2 mRNA upregulation and attenuates epileptogenesis. Finally, data from resected human hippocampi surgically treated for pharmacoresistant TLE support the Zn2+-MTF1-CaV3.2 cascade, thus providing new vistas for preventing and treating TLE. PMID:26498180

  10. Steroidogenic Factor 1 in the Ventromedial Nucleus of the Hypothalamus Regulates Age-Dependent Obesity.

    PubMed

    Kinyua, Ann W; Yang, Dong Joo; Chang, Inik; Kim, Ki Woo

    2016-01-01

    The ventromedial nucleus of the hypothalamus (VMH) is important for the regulation of whole body energy homeostasis and lesions in the VMH are reported to result in massive weight gain. The nuclear receptor steroidogenic factor 1 (SF-1) is a known VMH marker as it is exclusively expressed in the VMH region of the brain. SF-1 plays a critical role not only in the development of VMH but also in its physiological functions. In this study, we generated prenatal VMH-specific SF-1 KO mice and investigated age-dependent energy homeostasis regulation by SF-1. Deletion of SF-1 in the VMH resulted in dysregulated insulin and leptin homeostasis and late onset obesity due to increased food intake under normal chow and high fat diet conditions. In addition, SF-1 ablation was accompanied by a marked reduction in energy expenditure and physical activity and this effect was significantly pronounced in the aged mice. Taken together, our data indicates that SF-1 is a key component in the VMH-mediated regulation of energy homeostasis and implies that SF-1 plays a protective role against metabolic stressors including aging and high fat diet. PMID:27598259

  11. Steroidogenic Factor 1 in the Ventromedial Nucleus of the Hypothalamus Regulates Age-Dependent Obesity

    PubMed Central

    Kinyua, Ann W.; Yang, Dong Joo; Chang, Inik; Kim, Ki Woo

    2016-01-01

    The ventromedial nucleus of the hypothalamus (VMH) is important for the regulation of whole body energy homeostasis and lesions in the VMH are reported to result in massive weight gain. The nuclear receptor steroidogenic factor 1 (SF-1) is a known VMH marker as it is exclusively expressed in the VMH region of the brain. SF-1 plays a critical role not only in the development of VMH but also in its physiological functions. In this study, we generated prenatal VMH-specific SF-1 KO mice and investigated age-dependent energy homeostasis regulation by SF-1. Deletion of SF-1 in the VMH resulted in dysregulated insulin and leptin homeostasis and late onset obesity due to increased food intake under normal chow and high fat diet conditions. In addition, SF-1 ablation was accompanied by a marked reduction in energy expenditure and physical activity and this effect was significantly pronounced in the aged mice. Taken together, our data indicates that SF-1 is a key component in the VMH-mediated regulation of energy homeostasis and implies that SF-1 plays a protective role against metabolic stressors including aging and high fat diet. PMID:27598259

  12. Synthesis and Biological Evaluation of Manassantin Analogues for Hypoxia-Inducible Factor 1α Inhibition

    PubMed Central

    2015-01-01

    To cope with hypoxia, tumor cells have developed a number of adaptive mechanisms mediated by hypoxia-inducible factor 1 (HIF-1) to promote angiogenesis and cell survival. Due to significant roles of HIF-1 in the initiation, progression, metastasis, and resistance to treatment of most solid tumors, a considerable amount of effort has been made to identify HIF-1 inhibitors for treatment of cancer. Isolated from Saururus cernuus, manassantins A (1) and B (2) are potent inhibitors of HIF-1 activity. To define the structural requirements of manassantins for HIF-1 inhibition, we prepared and evaluated a series of manassantin analogues. Our SAR studies examined key regions of manassantin’s structure in order to understand the impact of these regions on biological activity and to define modifications that can lead to improved performance and drug-like properties. Our efforts identified several manassantin analogues with reduced structural complexity as potential lead compounds for further development. Analogues MA04, MA07, and MA11 down-regulated hypoxia-induced expression of the HIF-1α protein and reduced the levels of HIF-1 target genes, including cyclin-dependent kinase 6 (Cdk6) and vascular endothelial growth factor (VEGF). These findings provide an important framework to design potent and selective HIF-1α inhibitors, which is necessary to aid translation of manassantin-derived natural products to the clinic as novel therapeutics for cancers. PMID:26394152

  13. Transcription Factor Arabidopsis Activating Factor1 Integrates Carbon Starvation Responses with Trehalose Metabolism1[OPEN

    PubMed Central

    Garapati, Prashanth; Feil, Regina; Lunn, John Edward; Van Dijck, Patrick; Balazadeh, Salma; Mueller-Roeber, Bernd

    2015-01-01

    Plants respond to low carbon supply by massive reprogramming of the transcriptome and metabolome. We show here that the carbon starvation-induced NAC (for NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON) transcription factor Arabidopsis (Arabidopsis thaliana) Transcription Activation Factor1 (ATAF1) plays an important role in this physiological process. We identified TREHALASE1, the only trehalase-encoding gene in Arabidopsis, as a direct downstream target of ATAF1. Overexpression of ATAF1 activates TREHALASE1 expression and leads to reduced trehalose-6-phosphate levels and a sugar starvation metabolome. In accordance with changes in expression of starch biosynthesis- and breakdown-related genes, starch levels are generally reduced in ATAF1 overexpressors but elevated in ataf1 knockout plants. At the global transcriptome level, genes affected by ATAF1 are broadly associated with energy and carbon starvation responses. Furthermore, transcriptional responses triggered by ATAF1 largely overlap with expression patterns observed in plants starved for carbon or energy supply. Collectively, our data highlight the existence of a positively acting feedforward loop between ATAF1 expression, which is induced by carbon starvation, and the depletion of cellular carbon/energy pools that is triggered by the transcriptional regulation of downstream gene regulatory networks by ATAF1. PMID:26149570

  14. Targeting the Insulin-Like Growth Factor 1 Receptor in Ewing's Sarcoma: Reality and Expectations

    PubMed Central

    Olmos, David; Martins, Ana Sofia; Jones, Robin L.; Alam, Salma; Scurr, Michelle; Judson, Ian R.

    2011-01-01

    Ewing's sarcoma family of tumours comprises a group of very aggressive diseases that are potentially curable with multimodality treatment. Despite the undoubted success of current treatment, approximately 30% of patients will relapse and ultimately die of disease. The insulin-like growth factor 1 receptor (IGF-1R) has been implicated in the genesis, growth, proliferation, and the development of metastatic disease in Ewing's sarcoma. In addition, IGF1-R has been validated, both in vitro and in vivo, as a potential therapeutic target in Ewing's sarcoma. Phase I studies of IGF-1R monoclonal antibodies reported several radiological and clinical responses in Ewing's sarcoma patients, and initial reports of several Phase II studies suggest that about a fourth of the patients would benefit from IGF-1R monoclonal antibodies as single therapy, with approximately 10% of patients achieving objective responses. Furthermore, these therapies are well tolerated, and thus far severe toxicity has been rare. Other studies assessing IGF-1R monoclonal antibodies in combination with traditional cytotoxics or other targeted therapies are expected. Despite, the initial promising results, not all patients benefit from IGF-1R inhibition, and consequently, there is an urgent need for the identification of predictive markers of response. PMID:21647361

  15. Preadipocyte factor 1 induces pancreatic ductal cell differentiation into insulin-producing cells.

    PubMed

    Rhee, Marie; Lee, Seung-Hwan; Kim, Ji-Won; Ham, Dong-Sik; Park, Heon-Seok; Yang, Hae Kyung; Shin, Ju-Young; Cho, Jae-Hyoung; Kim, Young-Bum; Youn, Byung-Soo; Sul, Hei Sook; Yoon, Kun-Ho

    2016-01-01

    The preadipocyte factor 1 (Pref-1) is involved in the proliferation and differentiation of various precursor cells. However, the intracellular signaling pathways that control these processes and the role of Pref-1 in the pancreas remain poorly understood. Here, we showed that Pref-1 induces insulin synthesis and secretion via two independent pathways. The overexpression of Pref-1 activated MAPK signaling, which induced nucleocytoplasmic translocation of FOXO1 and PDX1 and led to the differentiation of human pancreatic ductal cells into β-like cells and an increase in insulin synthesis. Concurrently, Pref-1 activated Akt signaling and facilitated insulin secretion. A proteomics analysis identified the Rab43 GTPase-activating protein as a downstream target of Akt. A serial activation of both proteins induced various granular protein syntheses which led to enhanced glucose-stimulated insulin secretion. In a pancreatectomised diabetic animal model, exogenous Pref-1 improved glucose homeostasis by accelerating pancreatic ductal and β-cell regeneration after injury. These data establish a novel role for Pref-1, opening the possibility of applying this molecule to the treatment of diabetes. PMID:27044861

  16. The Myb-domain protein ULTRAPETALA1 INTERACTING FACTOR 1 controls floral meristem activities in Arabidopsis.

    PubMed

    Moreau, Fanny; Thévenon, Emmanuel; Blanvillain, Robert; Lopez-Vidriero, Irene; Franco-Zorrilla, Jose Manuel; Dumas, Renaud; Parcy, François; Morel, Patrice; Trehin, Christophe; Carles, Cristel C

    2016-04-01

    Higher plants continuously and iteratively produce new above-ground organs in the form of leaves, stems and flowers. These organs arise from shoot apical meristems whose homeostasis depends on coordination between self-renewal of stem cells and their differentiation into organ founder cells. This coordination is stringently controlled by the central transcription factor WUSCHEL (WUS), which is both necessary and sufficient for stem cell specification in Arabidopsis thaliana ULTRAPETALA1 (ULT1) was previously identified as a plant-specific, negative regulator of WUS expression. However, molecular mechanisms underlying this regulation remain unknown. ULT1 protein contains a SAND putative DNA-binding domain and a B-box, previously proposed as a protein interaction domain in eukaryotes. Here, we characterise a novel partner of ULT1, named ULT1 INTERACTING FACTOR 1 (UIF1), which contains a Myb domain and an EAR motif. UIF1 and ULT1 function in the same pathway for regulation of organ number in the flower. Moreover, UIF1 displays DNA-binding activity and specifically binds to WUS regulatory elements. We thus provide genetic and molecular evidence that UIF1 and ULT1 work together in floral meristem homeostasis, probably by direct repression of WUS expression.

  17. Heat Shock Factor 1 Is a Substrate for p38 Mitogen-Activated Protein Kinases

    PubMed Central

    Dayalan Naidu, Sharadha; Sutherland, Calum; Zhang, Ying; Risco, Ana; de la Vega, Laureano; Caunt, Christopher J.; Hastie, C. James; Lamont, Douglas J.; Torrente, Laura; Chowdhry, Sudhir; Benjamin, Ivor J.; Keyse, Stephen M.; Cuenda, Ana

    2016-01-01

    Heat shock factor 1 (HSF1) monitors the structural integrity of the proteome. Phosphorylation at S326 is a hallmark for HSF1 activation, but the identity of the kinase(s) phosphorylating this site has remained elusive. We show here that the dietary agent phenethyl isothiocyanate (PEITC) inhibits heat shock protein 90 (Hsp90), the main negative regulator of HSF1; activates p38 mitogen-activated protein kinase (MAPK); and increases S326 phosphorylation, trimerization, and nuclear translocation of HSF1, and the transcription of a luciferase reporter, as well as the endogenous prototypic HSF1 target Hsp70. In vitro, all members of the p38 MAPK family rapidly and stoichiometrically catalyze the S326 phosphorylation. The use of stable knockdown cell lines and inhibitors indicated that among the p38 MAPKs, p38γ is the principal isoform responsible for the phosphorylation of HSF1 at S326 in cells. A protease-mass spectrometry approach confirmed S326 phosphorylation and unexpectedly revealed that p38 MAPK also catalyzes the phosphorylation of HSF1 at S303/307, previously known repressive posttranslational modifications. Thus, we have identified p38 MAPKs as highly efficient catalysts for the phosphorylation of HSF1. Furthermore, our findings suggest that the magnitude and persistence of activation of p38 MAPK are important determinants of the extent and duration of the heat shock response. PMID:27354066

  18. Elevated serum insulin-like growth factor-1 (IGF-1) levels in women with postadolescent acne.

    PubMed

    Aizawa, H; Niimura, M

    1995-04-01

    The purpose of this study was to measure the serum levels of IGF-1 in women with postadolescent acne compared to normal controls, and evaluate the relationship of these levels to the levels of androgens, in order to investigate the possible role of IGF-1 in the pathogenesis of acne. Eighty-two female patients with acne between 20 and 25 years of age and thirty-one age-matched control women were studied. We measured the serum levels of total testosterone (T), free testosterone (FT), dihydrotestosterone (DHT), dehydroepiandrosterone sulfate (DHEA-S), and insulin-like growth factor-1 (IGF-1). The levels of IGF-1 in patients with acne (1.26 +/- 0.52 U/ml) were significantly (p < 0.001) increased over those of controls (0.96 +/- 0.32 U/ml). Of 82 acne patients, six (7%) had IGF-1 levels which exceeded the normal range, but there were no significant correlations between IGF-1 and T, FT, DHT or DHEA-S levels or between IGF-1 and acne severity. Since the measurement of serum IGF-1 levels is a convenient indicator of GH secretion, the increase of serum IGF-1 levels seen in some acne patients might reflect an increase of GH. PMID:7608381

  19. Nuclear factor 1 regulates the distal silencer of the human PIT1/GHF1 gene.

    PubMed Central

    Rajas, F; Delhase, M; De La Hoya, M; Verdood, P; Castrillo, J L; Hooghe-Peters, E L

    1998-01-01

    Here we report the characterization of 12 kb genomic DNA upstream of the human PIT1/GHF1 promoter. Different regions involved in the modulation of human PIT1/GHF1 gene expression were defined by transient transfection studies. Two regions, one proximal (-7.1/-2. 3) and one distal (-11.8/-10.9), presented an enhancer activity in pituitary cells when placed upstream of the SV40 promoter. The 0.9 kb distal region was analysed further and found to decrease the basal transcriptional activity of the human PIT1/GHF1 minimal promoter, indicating that this region behaves as a silencer for its own promoter. Three Pit-1/GHF-1-binding sites and two ubiquitous nuclear factor 1 (NF-1)-binding sites were identified by DNase I footprinting in the distal regulatory region. Deletion analysis indicated that NF-1 or NF-1-related protein(s) participate in the down-regulation of human PIT1/GHF1 gene expression by interacting with an NF-1-binding site within the distal regulatory region. PMID:9639565

  20. The central role of heat shock factor 1 in synaptic fidelity and memory consolidation.

    PubMed

    Hooper, Philip L; Durham, Heather D; Török, Zsolt; Hooper, Paul L; Crul, Tim; Vígh, László

    2016-09-01

    Networks of neuronal synapses are the fundamental basis for making and retaining memory. Reduced synapse number and quality correlates with loss of memory in dementia. Heat shock factor 1 (HSF1), the major transcription factor regulating expression of heat shock genes, plays a central role in proteostasis, in establishing and sustaining synaptic fidelity and function, and in memory consolidation. Support for this thesis is based on these observations: (1) heat shock induces improvements in synapse integrity and memory consolidation; (2) synaptic depolarization activates HSF1; (3) activation of HSF1 alone (independent of the canonical heat shock response) augments formation of essential synaptic elements-neuroligands, vesicle transport, synaptic scaffolding proteins, lipid rafts, synaptic spines, and axodendritic synapses; (4) HSF1 coalesces and activates memory receptors in the post-synaptic dendritic spine; (5) huntingtin or α-synuclein accumulation lowers HSF1 while HSF1 lowers huntingtin and α-synuclein aggregation-a potential vicious cycle; and (6) HSF1 agonists (including physical activity) can improve cognitive function in dementia models. Thus, via direct gene expression of synaptic elements, production of HSPs that assure high protein fidelity, and activation of other neuroprotective signaling pathways, HSF1 agonists could provide breakthrough therapy for dementia-associated disease.

  1. Effects of insulin-like growth factor-1 on B-cell precursor acute lymphoblastic leukemia.

    PubMed

    Yamada, Hiroyuki; Iijima, Kazutoshi; Tomita, Osamu; Taguchi, Tomoko; Miharu, Masashi; Kobayashi, Kenichiro; Okita, Hajime; Saito, Masahiro; Shimizu, Toshiaki; Kiyokawa, Nobutaka

    2013-01-01

    Insulin-like growth factor-1 (IGF-1) is known to be a major growth factor with effects on various cell types, including hematopoietic cells, as well as neoplasms, and is regulated by IGF-binding proteins (IGFBPs). In this study, we investigated the effects of IGF-1 on B-cell precursor acute lymphoblastic leukemia (BCP-ALL) cells. When the expression of IGF-1R in clinical samples of BCP-ALL was examined, five of thirty-two cases showed IGF-1R expression, whereas IGF-1R was expressed in most BCP-ALL cell lines. We observed that IGF-1 enhanced the proliferation of BCP-ALL cell lines that can be partially inhibited by IGFBP-1, -3, and -4, but not other IGFBPs. IGF-1 also partially inhibited dexamethasone-induced apoptosis, but not apoptosis mediated by VP-16 and irradiation. Interestingly, the proliferative effect of IGF-1 was partially blocked by inhibitors of MAPK and AKT, whereas the inhibition of dexamethasone-induced apoptosis was completely blocked by both inhibitors. Our data indicate that IGF-1 is involved in cell proliferation and apoptosis regulation in BCP-ALL cells. Since some BCP-ALL cases express IGF-1R, it appears to be a plausible target for prognostic evaluation and may represent a new therapeutic strategy.

  2. Strengthening the Skin with Topical Delivery of Keratinocyte Growth Factor-1 Using a Novel DNA Plasmid

    PubMed Central

    Dou, Chunqing; Lay, Frank; Ansari, Amir Mehdi; Rees, Donald J; Ahmed, Ali Karim; Kovbasnjuk, Olga; Matsangos, Aerielle E.; Du, Junkai; Hosseini, Sayed Mohammad; Steenbergen, Charles; Fox-Talbot, Karen; Tabor, Aaron T.; Williams, James A; Liu, Lixin; Marti, Guy P; Harmon, John W

    2014-01-01

    Fragile skin, susceptible to decubitus ulcers and incidental trauma, is a problem particularly for the elderly and for those with spinal cord injury. Here, we present a simple approach to strengthen the skin by the topical delivery of keratinocyte growth factor-1 (KGF-1) DNA. In initial feasibility studies with the novel minimalized, antibiotic-free DNA expression vector, NTC8385-VA1, the reporter genes luciferase and enhanced green fluorescent protein were delivered. Transfection was documented when luciferase expression significantly increased after transfection. Microscopic imaging of enhanced green fluorescent protein–transfected skin showed green fluorescence in hair follicles, hair shafts, and dermal and superficial epithelial cells. With KGF-1 transfection, KGF-1 mRNA level and protein production were documented with quantitative reverse transcriptase–polymerase chain reaction and immunohistochemistry, respectively. Epithelial thickness of the transfected skin in the KGF group was significantly increased compared with the control vector group (26 ± 2 versus 16 ± 4 µm) at 48 hours (P = 0.045). Dermal thickness tended to be increased in the KGF group (255 ± 36 versus 162 ± 16 µm) at 120 hours (P = 0.057). Biomechanical assessment showed that the KGF-1–treated skin was significantly stronger than control vector–transfected skin. These findings indicate that topically delivered KGF-1 DNA plasmid can increase epithelial thickness and strength, demonstrating the potential of this approach to restore compromised skin. PMID:24434934

  3. The role of hepatocyte nuclear factor 1β in disease and development.

    PubMed

    El-Khairi, R; Vallier, L

    2016-09-01

    Heterozygous mutations in the gene that encodes the transcription factor hepatocyte nuclear factor 1β (HNF1B) result in a multi-system disorder. HNF1B was initially discovered as a monogenic diabetes gene; however, renal cysts are the most frequently detected feature. Other clinical features include pancreatic hypoplasia and exocrine insufficiency, genital tract malformations, abnormal liver function, cholestasis and early-onset gout. Heterozygous mutations and complete gene deletions in HNF1B each account for approximately 50% of all cases of HNF1B-associated disease and may show autosomal dominant inheritance or arise spontaneously. There is no clear genotype-phenotype correlation indicating that haploinsufficiency is the main disease mechanism. Data from animal models suggest that HNF1B is essential for several stages of pancreas and liver development. However, mice with heterozygous mutations in HNF1B show no phenotype in contrast to the phenotype seen in humans. This suggests that mouse models do not fully replicate the features of human disease and complementary studies in human systems are necessary to determine the molecular mechanisms underlying HNF1B-associated disease. This review discusses the role of HNF1B in human and murine pancreas and liver development, summarizes the disease phenotypes and identifies areas for future investigations in HNF1B-associated diabetes and liver disease. PMID:27615128

  4. Molecular cloning, functional expression, and chromosomal localization of mouse hepatocyte nuclear factor 1.

    PubMed Central

    Kuo, C J; Conley, P B; Hsieh, C L; Francke, U; Crabtree, G R

    1990-01-01

    The homeodomain-containing transcription factor hepatocyte nuclear factor 1 (HNF-1) most likely plays an essential role during liver organogenesis by transactivating a family of greater than 15 predominantly hepatic genes. We have isolated cDNA clones encoding mouse HNF-1 and expressed them in monkey COS cells and in the human T-cell line Jurkat, producing HNF-1 DNA-binding activity as well as transactivation of reporter constructs containing multimerized HNF-1 binding sites. In addition, the HNF-1 gene was assigned by somatic cell hybrids and recombinant inbred strain mapping to mouse chromosome 5 near Bcd-1 and to human chromosome 12 region q22-qter, revealing a homologous chromosome region in these two species. The presence of HNF-1 mRNA in multiple endodermal tissues (liver, stomach, intestine) suggests that HNF-1 may constitute an early marker for endodermal, rather than hepatocyte, differentiation. Further, that HNF-1 DNA-binding and transcriptional activity can be conferred by transfecting the HNF-1 cDNA into several cell lines indicates that it is sufficient to activate transcription in the context of ubiquitously expressed factors. Images PMID:2263635

  5. Trefoil factor 1 is required for the commitment programme of mouse oxyntic epithelial progenitors

    PubMed Central

    Karam, S M; Tomasetto, C; Rio, M-C

    2004-01-01

    Background: Trefoil factor 1 (TFF1/pS2) is a major secretory product of the stomach and TFF1 knockout mice constantly develop adenomas and occasional carcinomas in the pyloric antrum. Aim: To analyse the role of TFF1 in the differentiation of gastric epithelial cell lineages using oxyntic mucosae from normal and TFF1 knockout mice. Methods: The various cell lineages were labelled using specific markers of pit, neck, parietal, and enteroendocrine cells. Patterns of TFF1, TFF2, and TFF3 expressions were defined using western blotting, immunohistochemistry, and/or immunogold electron microscopy. Results: In normal mice, starting from postnatal day 1 (P1), TFF1 and TFF2 were produced by mucus secreting cells of the developing epithelium. At P7, TFF3 expression occurred in pit and parietal cells. When oxyntic glands were compartmentalised, at P21 and in older mice, TFF1 and TFF2 were expressed in pit and neck cells, respectively, and TFF3 was no longer in parietal cells but became a feature of zymogenic cells. In TFF1 deficient mice, alteration of oxyntic epithelial differentiation became obvious at P21, showing significant amplification of pit cells at the expense of parietal cells. At the molecular level, lack of TFF1 induced dramatic inhibition of TFF2 expression and more precocious TFF3 expression. Conclusion: In the oxyntic mucosa, all three TFFs are produced in a lineage specific manner and TFF1 is essential in maintaining the normal commitment programme of epithelial progenitors. PMID:15361486

  6. Association of severe micropenis with Gly146Ala polymorphism in the gene for steroidogenic factor-1.

    PubMed

    Wada, Yuka; Okada, Michiyo; Hasegawa, Tomonobu; Ogata, Tsutomu

    2005-08-01

    Steroidogenic factor-1 (SF-1) regulates the transcription of multiple genes involved in the androgen biosynthesis, and SF-1 Gly146Ala polymorphism is known to reduce the transactivation function by approximately 20%. To examine whether the Gly146Ala polymorphism constitutes a susceptibility factor for the development of micropenis (MP), we analyzed this polymorphism in a total of 52 patients with micropenis (T-MP) consisting of 30 patients with severe MP below -2.5 SD (S-MP) and 22 patients with mild MP from -2.1 SD to -2.5 SD (M-MP), together with 115 control males. The Ala allele, the Ala/Gly genotype, and the Ala/Ala plus Ala/Gly genotype frequencies were significantly higher in the S-MP patients than in the control males, whereas the allele and the genotype frequencies were comparable between the M-MP patients and the control males. The results suggest that the SF-1 Gly146Ala polymorphism may constitute a susceptibility factor for the development of S-MP, and that M-MP can be regarded as a normal variation in terms of the polymorphism effect.

  7. Synthesis of multilayered alginate microcapsules for the sustained release of fibroblast growth factor-1

    PubMed Central

    Khanna, Omaditya; Moya, Monica L; Opara, Emmanuel C; Brey, Eric M

    2010-01-01

    Alginate microcapsules coated with a permselective poly-L-ornithine (PLO) membrane have been investigated for the encapsulation and transplantation of islets as a treatment for type 1 diabetes. The therapeutic potential of this approach could be improved through local stimulation of microvascular networks in order to meet mass transport demands of the encapsulated cells. Fibroblast growth factor-1 (FGF-1) is a potent angiogenic factor with optimal effect occurring when it is delivered in a sustained manner. In this paper, a technique is described for the generation of multilayered alginate microcapsules with an outer alginate layer that can be used for the delivery of FGF-1. The influence of alginate concentration and composition (high mannuronic acid (M) or guluronic acid (G) content) on outer layer size and stability, protein encapsulation efficiency, and release kinetics was investigated. The technique results in a stable outer layer of alginate with a mean thickness between 113–164 µm, increasing with alginate concentration and G-content. The outer layer was able to encapsulate and release FGF-1 for up to thirty days, with 1.25% of high G alginate displaying the most sustained release. The released FGF-1 retained its biologic activity in the presence of heparin, and the addition of the outer layer did not alter the permselectivity of the PLO coat. This technique could be used to generate encapsulation systems that deliver proteins to stimulate local neovascularization around encapsulated islets. PMID:20725969

  8. Hypoxia Inducible Factor 1 as a Therapeutic Target in Ischemic Stroke

    PubMed Central

    Shi, H

    2010-01-01

    In stroke research, a significant focus is to develop therapeutic strategies that prevent neuronal death and improve recovery. Yet, few successful therapeutic strategies have emerged. Hypoxia-inducible factor 1 (HIF-1) is a key regulator in hypoxia. It has been suggested to be an important player in neurological outcomes following ischemic stroke due to the functions of its downstream genes. These include genes that promote glucose metabolism, angiogenesis, erythropoiesis, and cell survival. Many lines of evidence have shown that HIF-1 is induced in ischemic brains. Importantly, it seems that HIF-1 is primarily induced in the salvageable tissue of an ischemic brain, penumbra. However, the effect of HIF-1 on neuronal tissue injuries is still debatable based on evidence from in vitro and preclinical studies. Furthermore, it is of importance to understand the mechanism of HIF-1 degradation after its induction in ischemic brain. This review provides a present understanding of the mechanism of HIF-1 induction in ischemic neurons and the potential effect of HIF-1 on ischemic brain tissue. The author also elaborates on potential therapeutic approaches through understanding of the induction mechanism and of the potential role of HIF-1 in ischemic stroke. PMID:19903149

  9. Lifestyle factors and insulin-like growth factor 1 levels among elderly men.

    PubMed

    Signorello, L B; Kuper, H; Lagiou, P; Wuu, J; Mucci, L A; Trichopoulos, D; Adami, H O

    2000-06-01

    Insulin-like growth factor 1 (IGF-1) is a potentially important determinant of disease; hence epidemiological identification of factors that influence circulating IGF-1 is merited. We therefore analysed data collected in Greece to determine the relationship between anthropometric, lifestyle and dietary variables and serum levels of IGF-1 among elderly men. We identified 51 men with prostate cancer, 50 men with benign prostatic hyperplasia, and 52 apparently healthy elderly men (controls), all matched for age (+/- 1 year). These 153 men provided blood specimens and were interviewed using a validated lifestyle and food frequency questionnaire. We performed multivariate linear regression to identify potential predictors of circulating IGF-1. After controlling for age, body mass index, smoking habits, alcohol drinking and coffee consumption, each 5 cm increase in height predicted a 13.0% increase in IGF-1 (95% CI 0.4-27.2%) among the controls and a 11.3% increase in IGF-1 (95% CI 4.5-18.6%) among the entire study group. None of the investigated dietary factors (total fat, carbohydrate, protein, dairy products, tomatoes, calcium) were strongly related to IGF-1 levels. The positive association between IGF-1 and height integrates the empirical evidence linking IGF-1 and height with prostate cancer risk.

  10. Prognostic value of peritumoral heat-shock factor-1 in patients receiving resection of hepatocellular carcinoma

    PubMed Central

    Zhang, J-B; Guo, K; Sun, H-C; Zhu, X-D; Zhang, B; Lin, Z-H; Zhang, B-H; Liu, Y-K; Ren, Z-G; Fan, J

    2013-01-01

    Background: The cross-talk of hepatocellular carcinoma (HCC) cells and abnormal metabolic signals in peritumoral microenvironment modifies our knowledge of hepatocarcinogenesis. As an indispensable modulator of various stresses, the clinical significance of heat-shock transcription factor-1 (HSF1) in HCC microenvironment has never been defined. Methods: Hepatocellular carcinoma and matched peritumoral liver tissues (n=332) were semiquantitatively analysed for HSF1 expression, followed by correlation with clinicopathological parameters (patient outcomes). Moreover, the effects of HSF1 deficiency in L02 on monocarboxylate transporter-4 (MCT4) and HCC cells' colonisation and proliferation were investigated. Results: High expression of HSF1 in peritumoral tissue but not in HCC tissue was associated with poorer overall survival (OS) and time to recurrence (TTR), especially early recurrence (ER), which was further reconfirmed in validation cohort. Multivariate analysis showed that prognostic performance of peritumoral HSF1 was independent of other clinicopathological factors (hazard ratio for OS=2.60, P=0.002, for TTR=2.52, P<0.001). Notably, downregulation of HSF1 in L02 decreased MCT4 expression significantly. The supernatant from L02-shRNA-HSF1 in hypoxia, NOT normoxia condition, inhibited HCC cell colonisation and proliferation. Moreover, the combination of peritumoral HSF1 and MCT4 was the best predictor for ER and OS. Conclusion: High peritumoral HSF1 expression can serve as a sensitive ‘readout' for high-risk HCC ER, and could be a potential metabolic intervention target following curative resection. PMID:24002609

  11. Recombination between elongation factor 1α genes from distantly related archaeal lineages

    PubMed Central

    Inagaki, Yuji; Susko, Edward; Roger, Andrew J.

    2006-01-01

    Homologous recombination (HR) and lateral gene transfer are major processes in genome evolution. The combination of the two processes, HR between genes in different species, has been documented but is thought to be restricted to very similar sequences in relatively closely related organisms. Here we report two cases of interspecific HR in the gene encoding the core translational protein translation elongation factor 1α (EF-1α) between distantly related archaeal groups. Maximum-likelihood sliding window analyses indicate that a fragment of the EF-1α gene from the archaeal lineage represented by Methanopyrus kandleri was recombined into the orthologous gene in a common ancestor of the Thermococcales. A second recombination event appears to have occurred between the EF-1α gene of the genus Methanothermobacter and its ortholog in a common ancestor of the Methanosarcinales, a distantly related euryarchaeal lineage. These findings suggest that HR occurs across a much larger evolutionary distance than generally accepted and affects highly conserved essential “informational” genes. Although difficult to detect by standard whole-gene phylogenetic analyses, interspecific HR in highly conserved genes may occur at an appreciable frequency, potentially confounding deep phylogenetic inference and hypothesis testing. PMID:16537397

  12. Expression of growth/differentiation factor 1 in the nervous system: Conservation of a bicistronic structure

    SciTech Connect

    Lee, Sejin )

    1991-05-15

    Growth/differentiation factor 1 (GDF-1) is a recently described member of the transforming growth factor {beta} superfamily isolated from a day-8.5 mouse embryo cDNA library. Northern (RNA) analysis of embryonic mRNA detected two GDF-1 transcripts (1.4 kilobases (kb) and 3.0 kb in length) displaying distinct temporal patterns of expression. Only the 3.0-kb transcript was detected in adult tissues, where its expression was restricted almost exclusively to the central nervous system. Comparison of murine and human brain cDNA sequences corresponding to the 3.0-kb transcript revealed high conservation of two nonoverlapping open reading frames with poor conservation of the intervening spacer region and the putative 5{prime} and 3{prime} untranslated sequences. By immunohistochemical analysis, the protein encoded by the downstream open reading frame (GDF-1) was detected exclusively in the brain, spinal cord, and peripheral nerves in day-14.5 mouse embryos. The upstream open reading frame encodes a protein of unknown function containing multiple putative membrane-spanning domains. These findings raise the possibility that this mRNA may give rise to two different proteins.

  13. Eukaryotic Translation Elongation Factor 1A Induces Anoikis by Triggering Cell Detachment*

    PubMed Central

    Itagaki, Keisuke; Naito, Toshihiko; Iwakiri, Ryota; Haga, Makoto; Miura, Shougo; Saito, Yohei; Owaki, Toshiyuki; Kamiya, Sadahiro; Iyoda, Takuya; Yajima, Hirofumi; Iwashita, Shintaro; Ejiri, Shin-Ichiro; Fukai, Fumio

    2012-01-01

    Anoikis, apoptosis because of loss of cell anchorage, is crucial for tissue homeostasis. Fibronectin not only provides a scaffold for cell anchorage but also harbors a cryptic antiadhesive site capable of inducing β1-integrin inactivation. In this study, this cryptic antiadhesive site is implicated in spontaneous induction of anoikis. Nontransformed fibroblasts (NIH3T3) adhering to a fibronectin substratum underwent anoikis during serum starvation culture. This anoikis was caused by proteolytic exposure of the cryptic antiadhesive site in fibronectin by matrix metalloproteinase. Eukaryotic elongation factor 1A (eEF1A) was identified as a membrane receptor for the exposed antiadhesive site. Serum starvation raised the membrane residence of eEF1A, and siRNA-based disruption of this increase rendered cells anoikis-resistant. By contrast, cells became more susceptible to anoikis in parallel with increased membrane residence of eEF1A by enforced expression. These results demonstrate that eEF1A acts as a membrane receptor for the cryptic antiadhesive site of fibronectin, which contributes to cell regulation, including anoikis, through negative regulation of cell anchorage. PMID:22399298

  14. Interferon regulatory factor-1 polymorphisms are associated with the control of Plasmodium falciparum infection

    PubMed Central

    Mangano, Valentina D; Luoni, Gaia; Rockett, Kirk A; Sirima, Bienvenu S; Konaté, Amadou; Forton, Julian; Clark, Taane; Bancone, Germana; Akha, Elham Sadighi; Kwiatkowski, Dominic P; Modiano, David

    2010-01-01

    We describe the haplotypic structure of the Interferon Regulatory Factor-1 (IRF-1) locus in two West African ethnic groups, Fulani and Mossi, that differ in their susceptibility and immune response to Plasmodium falciparum malaria. Both populations showed significant associations between IRF-1 polymorphisms and carriage of P. falciparum infection, with different patterns of association that may reflect their different haplotypic architecture. Genetic variation at this locus does not therefore account for the Fulani-specific resistance to malaria while it could contribute to parasite clearance's ability in populations living in endemic areas. We then conducted a case-control study of three haplotype-tagging Single Nucleotide Polymorphisms (htSNPs) in 370 hospitalized malaria patients (160 severe and 210 uncomplicated) and 410 healthy population controls, all from the Mossi ethnic group. All 3 htSNPs showed correlation with blood infection levels in malaria patients, and the rs10065633 polymorphism was associated with severe disease (p=0.02). These findings provide the first evidence of the involvement in malaria susceptibility of a specific locus within the 5q31 region, previously shown to be linked with P. falciparum infection levels. PMID:18200030

  15. Adequate hypoxia inducible factor 1α signaling is indispensable for bone regeneration.

    PubMed

    Stegen, Steve; Deprez, Sanne; Eelen, Guy; Torrekens, Sophie; Van Looveren, Riet; Goveia, Jermaine; Ghesquière, Bart; Carmeliet, Peter; Carmeliet, Geert

    2016-06-01

    Engineered cell-based constructs are an appealing strategy to treat large skeletal defects. However, transplanted cells are often confronted with an environment that is deprived of oxygen and nutrients. Upon hypoxia, most cell types activate hypoxia-inducible factor 1α (HIF-1α) signaling, but its importance for implanted osteoprogenitor cells during bone regeneration is not elucidated. To this end, we specifically deleted the HIF--1α isoform in periosteal progenitor cells and show that activation of HIF-1α signaling in these cells is critical for bone repair by modulating angiogenic and metabolic processes. Activation of HIF-1α is not only crucial for blood vessel invasion, by enhancing angiogenic growth factor production, but also for periosteal cell survival early after implantation, when blood vessels have not yet invaded the construct. HIF-1α signaling limits oxygen consumption to avoid accumulation of harmful ROS and preserve redox balance, and additionally induces a switch to glycolysis to prevent energetic distress. Altogether, our results indicate that the proangiogenic capacity of implanted periosteal cells is HIF-1α regulated and that metabolic adaptations mediate post-implantation cell survival. PMID:27058876

  16. Hypoxia-Inducible Factor-1 in Physiological and Pathophysiological Angiogenesis: Applications and Therapies

    PubMed Central

    Zimna, Agnieszka; Kurpisz, Maciej

    2015-01-01

    The cardiovascular system ensures the delivery of oxygen and nutrients to all cells, tissues, and organs. Under extended exposure to reduced oxygen levels, cells are able to survive through the transcriptional activation of a series of genes that participate in angiogenesis, glucose metabolism, and cell proliferation. The oxygen-sensitive transcriptional activator HIF-1 (hypoxia-inducible factor-1) is a key transcriptional mediator of the response to hypoxic conditions. The HIF-1 pathway was found to be a master regulator of angiogenesis. Whether the process is physiological or pathological, HIF-1 seems to participate in vasculature formation by synergistic correlations with other proangiogenic factors such as VEGF (vascular endothelial growth factor), PlGF (placental growth factor), or angiopoietins. Considering the important contributions of HIF-1 in angiogenesis and vasculogenesis, it should be considered a promising target for treating ischaemic diseases or cancer. In this review, we discuss the roles of HIF-1 in both physiological/pathophysiological angiogenesis and potential strategies for clinical therapy. PMID:26146622

  17. Myeloid Translocation Gene-16 Co-Repressor Promotes Degradation of Hypoxia-Inducible Factor 1

    PubMed Central

    Kumar, Parveen; Gullberg, Urban; Olsson, Inge; Ajore, Ram

    2015-01-01

    The myeloid translocation gene 16 (MTG16) co-repressor down regulates expression of multiple glycolytic genes, which are targets of the hypoxia-inducible factor 1 (HIF1) heterodimer transcription factor that is composed of oxygen-regulated labile HIF1α and stable HIF1β subunits. For this reason, we investigated whether MTG16 might regulate HIF1 negatively contributing to inhibition of glycolysis and stimulation of mitochondrial respiration. A doxycycline Tet-On system was used to control levels of MTG16 in B-lymphoblastic Raji cells. Results from co-association studies revealed MTG16 to interact with HIF1α. The co-association required intact N-terminal MTG16 residues including Nervy Homology Region 1 (NHR1). Furthermore, electrophoretic mobility shift assays demonstrated an association of MTG16 with hypoxia response elements (HREs) in PFKFB3, PFKFB4 and PDK1 promoters in-vitro. Results from chromatin immunoprecipitation assays revealed co-occupancy of these and other glycolytic gene promoters by HIF1α, HIF1β and MTG16 in agreement with possible involvement of these proteins in regulation of glycolytic target genes. In addition, MTG16 interacted with prolyl hydroxylase D2 and promoted ubiquitination and proteasomal degradation of HIF1α. Our findings broaden the area of MTG co-repressor functions and reveal MTG16 to be part of a protein complex that controls the levels of HIF1α. PMID:25974097

  18. The central role of heat shock factor 1 in synaptic fidelity and memory consolidation.

    PubMed

    Hooper, Philip L; Durham, Heather D; Török, Zsolt; Hooper, Paul L; Crul, Tim; Vígh, László

    2016-09-01

    Networks of neuronal synapses are the fundamental basis for making and retaining memory. Reduced synapse number and quality correlates with loss of memory in dementia. Heat shock factor 1 (HSF1), the major transcription factor regulating expression of heat shock genes, plays a central role in proteostasis, in establishing and sustaining synaptic fidelity and function, and in memory consolidation. Support for this thesis is based on these observations: (1) heat shock induces improvements in synapse integrity and memory consolidation; (2) synaptic depolarization activates HSF1; (3) activation of HSF1 alone (independent of the canonical heat shock response) augments formation of essential synaptic elements-neuroligands, vesicle transport, synaptic scaffolding proteins, lipid rafts, synaptic spines, and axodendritic synapses; (4) HSF1 coalesces and activates memory receptors in the post-synaptic dendritic spine; (5) huntingtin or α-synuclein accumulation lowers HSF1 while HSF1 lowers huntingtin and α-synuclein aggregation-a potential vicious cycle; and (6) HSF1 agonists (including physical activity) can improve cognitive function in dementia models. Thus, via direct gene expression of synaptic elements, production of HSPs that assure high protein fidelity, and activation of other neuroprotective signaling pathways, HSF1 agonists could provide breakthrough therapy for dementia-associated disease. PMID:27283588

  19. Colony-stimulating factor 1 regulates CTP: phosphocholine cytidylyltransferase mRNA levels.

    PubMed

    Tessner, T G; Rock, C O; Kalmar, G B; Cornell, R B; Jackowski, S

    1991-09-01

    Growth factor regulation of phosphatidylcholine (PtdCho) metabolism during the G1 stage of the cell cycle was investigated in the colony-stimulating factor 1 (CSF-1)-dependent murine macrophage cell-line BAC1.2F5. The transient removal of CSF-1 arrested the cells in G1. Incorporation of [3H]choline into PtdCho was stimulated significantly 1 h after growth factor addition to quiescent cells. Metabolic labeling experiments pointed to CTP:phosphocholine cytidylyltransferase (CT) as the rate-controlling enzyme for PtdCho biosynthesis in BAC1.2F5 cells. The amount of CT mRNA increased 4-fold within 15 min of CSF-1 addition and remained elevated for 2 h. The rise in CT mRNA levels was accompanied by a 50% increase in total CT specific activity in cell extracts within 4 h after the addition of CSF-1. CSF-1-dependent elevation of CT mRNA content was neither attenuated nor superinduced by the inhibition of protein synthesis with cycloheximide. The rate of CT mRNA turnover decreased in the presence of CSF-1 indicating that message stabilization was a key factor in determining the levels of CT mRNA. These data point to increased CT mRNA abundance as a component in growth factor-stimulated PtdCho synthesis.

  20. Serum and seminal plasma insulin-like growth factor-1 in male infertility

    PubMed Central

    Lee, Hyo Serk; Park, Yong-Seog; Lee, Joong Shik

    2016-01-01

    Objective Growth hormone and its mediator, insulin-like growth factor-1 (IGF-1), have been suggested to exert gonadotropic actions in both humans and animals. The present study was conducted to assess the relationship between serum IGF-1 concentration, seminal plasma concentration, and sperm parameter abnormalities. Methods A total of 79 men were enrolled in this study from December 2011 to July 2012 and were prospectively analyzed. Patient parameters analyzed included age, body mass index, smoking status, urological history, and fertility history. Patients were divided into four groups based on their semen parameters: normal (A, n=31), abnormal sperm motility (B, n=12), abnormal sperm morphology (C, n=20), and two or more abnormal parameters (D, n=16). Patient seminal plasma and serum IGF-1 concentrations were determined. Results Patient baseline characteristics were not significantly different between any of the groups. The serum IGF-1 levels in groups B, C, and D were significantly lower than the levels in group A; however, the seminal plasma IGF-1 levels were not significantly different between any of the groups. Conclusion Men with abnormal sperm parameters had significantly lower levels of serum IGF-1 compared with men with normal sperm parameters. Seminal plasma IGF-1 levels, however, did not differ significantly between the groups investigated here. Further investigations will be required to determine the exact mechanisms by which growth hormone and IGF-1 affect sperm quality. PMID:27358827

  1. Nuclear respiratory factor-1 and bioenergetics in tamoxifen-resistant breast cancer cells.

    PubMed

    Radde, Brandie N; Ivanova, Margarita M; Mai, Huy Xuan; Alizadeh-Rad, Negin; Piell, Kellianne; Van Hoose, Patrick; Cole, Marsha P; Muluhngwi, Penn; Kalbfleisch, Ted S; Rouchka, Eric C; Hill, Bradford G; Klinge, Carolyn M

    2016-09-10

    Acquired tamoxifen (TAM) resistance is a significant clinical problem in treating patients with estrogen receptor α (ERα)+ breast cancer. We reported that ERα increases nuclear respiratory factor-1 (NRF-1), which regulates nuclear-encoded mitochondrial gene transcription, in MCF-7 breast cancer cells and NRF-1 knockdown stimulates apoptosis. Whether NRF-1 and target gene expression is altered in endocrine resistant breast cancer cells is unknown. We measured NRF-1and metabolic features in a cell model of progressive TAM-resistance. NRF-1 and its target mitochondrial transcription factor A (TFAM) were higher in TAM-resistant LCC2 and LCC9 cells than TAM-sensitive MCF-7 cells. Using extracellular flux assays we observed that LCC1, LCC2, and LCC9 cells showed similar oxygen consumption rate (OCR), but lower mitochondrial reserve capacity which was correlated with lower Succinate Dehydrogenase Complex, Subunit B in LCC1 and LCC2 cells. Complex III activity was lower in LCC9 than MCF-7 cells. LCC1, LCC2, and LCC9 cells had higher basal extracellular acidification (ECAR), indicating higher aerobic glycolysis, relative to MCF-7 cells. Mitochondrial bioenergetic responses to estradiol and 4-hydroxytamoxifen were reduced in the endocrine-resistant cells compared to MCF-7 cells. These results suggest the acquisition of altered metabolic phenotypes in response to long term antiestrogen treatment may increase vulnerability to metabolic stress. PMID:27515002

  2. Expression profile of undifferentiated cell transcription factor 1 in normal and cancerous human epithelia

    PubMed Central

    Mouallif, Mustapha; Albert, Adelin; Zeddou, Mustapha; Ennaji, My Mustapha; Delvenne, Philippe; Guenin, Samuel

    2014-01-01

    Undifferentiated cell Transcription Factor 1 (UTF1) is a chromatin-bound protein involved in stem cell differentiation. It was initially reported to be restricted to stem cells or germinal tissues. However, recent work suggests that UTF1 is also expressed in somatic cells and that its expression may increase during carcinogenesis. To further clarify the expression profile of UTF1, we evaluated UTF1 expression levels immunohistochemically in eight normal human epithelia (from breast, prostate, endometrium, bladder, colon, oesophagus, lung and kidney) and their corresponding tumours as well as in several epithelial cell lines. We showed UTF1 staining in normal and tumour epithelial tissues, but with varying intensities according to the tissue location. In vitro analyses also revealed that UTF1 is expressed in somatic epithelial cell lines even in the absence of Oct4A and Sox2, its two main known regulators. The comparison of UTF1 levels in normal and tumoral tissues revealed significant overexpression in endometrial and prostatic adenocarcinomas, whereas lower intensity of the staining was observed in renal and colic tumours, suggesting a potential tissue-specific function of UTF1. Altogether, these results highlight a potential dual role for UTF1, acting either as an oncogene or as a tumour suppressor depending on the tissue. These findings also question its role as a specific marker for stem cells. PMID:24738751

  3. Regulation of cardiac autophagy by insulin-like growth factor 1.

    PubMed

    Troncoso, Rodrigo; Díaz-Elizondo, Jessica; Espinoza, Sandra P; Navarro-Marquez, Mario F; Oyarzún, Alejandra P; Riquelme, Jaime A; Garcia-Carvajal, Ivonne; Díaz-Araya, Guillermo; García, Lorena; Hill, Joseph A; Lavandero, Sergio

    2013-07-01

    Insulin-like growth factor-1 (IGF-1) signaling is a key pathway in the control of cell growth and survival. Three critical nodes in the IGF-1 signaling pathway have been described in cardiomyocytes: protein kinase Akt/mammalian target of rapamycin (mTOR), Ras/Raf/extracellular signal-regulated kinase (ERK), and phospholipase C (PLC)/inositol 1,4,5-triphosphate (InsP3 )/Ca(2+) . The Akt/mTOR and Ras/Raf/ERK signaling arms govern survival in the settings of cardiac stress and hypertrophic growth. By contrast, PLC/InsP3 /Ca(2+) functions to regulate metabolic adaptability and gene transcription. Autophagy is a catabolic process involved in protein degradation, organelle turnover, and nonselective breakdown of cytoplasmic components during nutrient starvation or stress. In the heart, autophagy is observed in a variety of human pathologies, where it can be either adaptive or maladaptive, depending on the context. We proposed the hypothesis that IGF-1 protects the heart by rescuing the mitochondrial metabolism and the energetics state, reducing cell death and controls the potentially exacerbate autophagic response to nutritional stress. In light of the importance of IGF-1 and autophagy in the heart, we review here IGF-1 signaling and autophagy regulation in the context of cardiomyocyte nutritional stress. PMID:23671040

  4. Uncovering the role of hypoxia inducible factor-1α in skin carcinogenesis.

    PubMed

    Nys, Kris; Maes, Hannelore; Dudek, Aleksandra Maria; Agostinis, Patrizia

    2011-08-01

    The hypoxia inducible factor-1α (HIF-1α) is a pleiotropic transcription factor typically activated in response to low oxygen tension as well as other stress factors in normoxic conditions. Upon activation HIF-1α mediates the transcriptional activation of target genes involved in a variety of processes comprising stress adaptation, metabolism, growth and invasion, but also apoptotic cell death. The molecular mechanisms, signaling pathways and downstream targets evoked by the activation of HIF-1α in epidermal cells are becoming increasingly understood and underscore the participation of HIF-1α in crucial processes including malignant transformation and cancer progression. Recent studies have implicated HIF-1α as an integral part of the multifaceted signal transduction initiated by the exposure of keratinocytes to ultraviolet radiation B (UVB), which represents the most ubiquitous hazard for human skin and the principal risk factor for skin cancer. HIF-1α activation by UVB exposure contributes to either repair or the removal of UVB-damaged keratinocytes by inducing apoptosis, thus revealing a tumor suppressor role for HIF-1α in these cells. On the other hand, the constitutive expression of HIF-1α evoked by the mild hypoxic state of the skin has been implicated as a positive factor in the transformation of normal melanocytes into malignant melanoma, one of the most aggressive types of human cancers. Here we review the uncovered and complex role of HIF-1α in skin carcinogenesis. PMID:21338656

  5. Upstream transcription factor 1 influences plasma lipid and metabolic traits in mice

    PubMed Central

    Wu, Sulin; Mar-Heyming, Rebecca; Dugum, Eric Z.; Kolaitis, Nicholas A.; Qi, Hongxiu; Pajukanta, Päivi; Castellani, Lawrence W.; Lusis, Aldons J.; Drake, Thomas A.

    2010-01-01

    Upstream transcription factor 1 (USF1) has been associated with familial combined hyperlipidemia, the metabolic syndrome, and related conditions, but the mechanisms involved are unknown. In this study, we report validation of Usf1 as a causal gene of cholesterol homeostasis, insulin sensitivity and body composition in mouse models using several complementary approaches and identify associated pathways and gene expression network modules. Over-expression of human USF1 in both transgenic mice and mice with transient liver-specific over-expression influenced metabolic trait phenotypes, including obesity, total cholesterol level, LDL/VLDL cholesterol and glucose/insulin ratio. Additional analyses of trait and hepatic gene expression data from an F2 population derived from C57BL/6J and C3H/HeJ strains in which there is a naturally occurring variation in Usf1 expression supported a causal role for Usf1 for relevant metabolic traits. Gene network and pathway analyses of the liver gene expression signatures in the F2 population and the hepatic over-expression model suggested the involvement of Usf1 in immune responses and metabolism, including an Igfbp2-centered module. In all three mouse model settings, notable sex specificity was observed, consistent with human studies showing differences in association with USF1 gene polymorphisms between sexes. PMID:19995791

  6. Hypoxia-inducible factor 1–mediated characteristic features of cancer cells for tumor radioresistance

    PubMed Central

    Harada, Hiroshi

    2016-01-01

    Tumor hypoxia has been attracting increasing attention in the fields of radiation biology and oncology since Thomlinson and Gray detected hypoxic cells in malignant solid tumors and showed that they exert a negative impact on the outcome of radiation therapy. This unfavorable influence has, at least partly, been attributed to cancer cells acquiring a radioresistant phenotype through the activation of the transcription factor, hypoxia-inducible factor 1 (HIF-1). On the other hand, accumulating evidence has recently revealed that, even though HIF-1 is recognized as an important regulator of cellular adaptive responses to hypoxia, it may not become active and induce tumor radioresistance under hypoxic conditions only. The mechanisms by which HIF-1 is activated in cancer cells not only under hypoxic conditions, but also under normoxic conditions, through cancer-specific genetic alterations and the resultant imbalance in intermediate metabolites have been summarized herein. The relevance of the HIF-1–mediated characteristic features of cancer cells, such as the production of antioxidants through reprogramming of the glucose metabolic pathway and cell cycle regulation, for tumor radioresistance has also been reviewed. PMID:26983985

  7. Glycosomal bromodomain factor 1 from Trypanosoma cruzi enhances trypomastigote cell infection and intracellular amastigote growth.

    PubMed

    Ritagliati, Carla; Villanova, Gabriela Vanina; Alonso, Victoria Lucia; Zuma, Aline Araujo; Cribb, Pamela; Motta, María Cristina Machado; Serra, Esteban Carlos

    2016-01-01

    Acetylation is a ubiquitous protein modification present in prokaryotic and eukaryotic cells that participates in the regulation of many cellular processes. The bromodomain is the only domain known to bind acetylated lysine residues. In the last few years, many bromodomain inhibitors have been developed in order to treat diseases caused by aberrant acetylation of lysine residues and have been tested as anti-parasitic drugs. In the present paper, we report the first characterization of Trypanosoma cruzi bromodomain factor 1 (TcBDF1). TcBDF1 is expressed in all life cycle stages, but it is developmentally regulated. It localizes in the glycosomes directed by a PTS2 (peroxisome-targeting signal 2) sequence. The overexpression of wild-type TcBDF1 is detrimental for epimastigotes, but it enhances the infectivity rate of trypomastigotes and the replication of amastigotes. On the other hand, the overexpression of a mutated version of TcBDF1 has no effect on epimastigotes, but it does negatively affect trypomastigotes' infection and amastigotes' replication.

  8. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  9. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  10. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  11. Upregulation of heat shock factor 1 transcription activity is associated with hepatocellular carcinoma progression.

    PubMed

    Li, Shulian; Ma, Wanli; Fei, Teng; Lou, Qiang; Zhang, Yaqin; Cui, Xiukun; Qin, Xiaoming; Zhang, Jun; Liu, Guangchao; Dong, Zheng; Ma, Yuanfang; Song, Zhengshun; Hu, Yanzhong

    2014-11-01

    Heat shock factor 1 (HSF1) is associated with tissue‑specific tumorigenesis in a number of mouse models, and has been used a as prognostic marker of cancer types, including breast and prostatic cancer. However, its role in human hepatocellular carcinoma (HCC) is not well understood. Using immunoblotting and immunohistochemical staining, it was identified that HSF1 and its serine (S) 326 phosphorylation, a biomarker of HSF1 activation, are significantly upregulated in human HCC tissues and HCC cell lines compared with their normal counterparts. Cohort analyses indicated that upregulation of the expression of HSF1 and its phospho‑S326 is significantly correlated with HCC progression, invasion and patient survival prognosis (P<0.001); however, not in the presence of a hepatitis B virus infection and the expression of alpha-fetoprotein and carcinoembryonic antigen. Knockdown of HSF1 with shRNA induced the protein expression of tumor suppressor retinoblastoma protein, resulting in attenuated plc/prf5 cell growth and colony formation in vitro. Taken together, these data markedly support that HSF1 is a potential prognostic marker and therapeutic target for the treatment of HCC.

  12. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  13. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  14. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  15. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  16. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  17. Neonatal epithelial hypoxia inducible factor-1α expression regulates the response of the lung to experimental asthma.

    PubMed

    Greenwood, Krista K; Proper, Steven P; Saini, Yogesh; Bramble, Lori A; Jackson-Humbles, Daven N; Wagner, James G; Harkema, Jack R; LaPres, John J

    2012-03-01

    Allergic airway disease is characterized by a T helper type 2 cell-mediated airway inflammation and airway hyperresponsiveness. Little is known about the role of hypoxia-mediated signaling in the progression of the disease. To address this knowledge gap, a mouse model was created in which doxycycline exposure induces the functional deletion of hypoxia inducible factor-1α from alveolar type II and Clara cells of the lung. When hypoxia inducible factor-1α deletion was induced during the early postnatal development period of the lung, the mice displayed an enhanced response to the ovalbumin model of allergic airway disease. These hypoxia inducible factor-1α-deficient mice exhibit increased cellular infiltrates, eosinophilia in the lavage fluid and parenchyma, and T helper type 2 cytokines, as compared with ovalbumin-treated control mice. Moreover, these hypoxia inducible factor-1α-deficient mice display increased airway resistance when compared with their control counterparts. Interestingly, if the loss of hypoxia inducible factor-1α was induced in early adulthood, the exacerbated phenotype was not observed. Taken together, these results suggest that epithelial hypoxia inducible factor-1α plays an important role in establishing the innate immunity of the lung and epithelial-specific deficiency in the transcription factor, during early postnatal development, increases the severity of inflammation and functional airway resistance, following ovalbumin challenge. Finally, these results might explain some of the chronic respiratory pathology observed in premature infants, especially those that receive supplemental oxygen. This early hyperoxic exposure, from normal ambient and supplemental oxygen, would presumably inhibit normal hypoxia inducible factor-1α signaling, mimicking the functional deletion described.

  18. Neonatal epithelial hypoxia inducible factor-1α expression regulates the response of the lung to experimental asthma.

    PubMed

    Greenwood, Krista K; Proper, Steven P; Saini, Yogesh; Bramble, Lori A; Jackson-Humbles, Daven N; Wagner, James G; Harkema, Jack R; LaPres, John J

    2012-03-01

    Allergic airway disease is characterized by a T helper type 2 cell-mediated airway inflammation and airway hyperresponsiveness. Little is known about the role of hypoxia-mediated signaling in the progression of the disease. To address this knowledge gap, a mouse model was created in which doxycycline exposure induces the functional deletion of hypoxia inducible factor-1α from alveolar type II and Clara cells of the lung. When hypoxia inducible factor-1α deletion was induced during the early postnatal development period of the lung, the mice displayed an enhanced response to the ovalbumin model of allergic airway disease. These hypoxia inducible factor-1α-deficient mice exhibit increased cellular infiltrates, eosinophilia in the lavage fluid and parenchyma, and T helper type 2 cytokines, as compared with ovalbumin-treated control mice. Moreover, these hypoxia inducible factor-1α-deficient mice display increased airway resistance when compared with their control counterparts. Interestingly, if the loss of hypoxia inducible factor-1α was induced in early adulthood, the exacerbated phenotype was not observed. Taken together, these results suggest that epithelial hypoxia inducible factor-1α plays an important role in establishing the innate immunity of the lung and epithelial-specific deficiency in the transcription factor, during early postnatal development, increases the severity of inflammation and functional airway resistance, following ovalbumin challenge. Finally, these results might explain some of the chronic respiratory pathology observed in premature infants, especially those that receive supplemental oxygen. This early hyperoxic exposure, from normal ambient and supplemental oxygen, would presumably inhibit normal hypoxia inducible factor-1α signaling, mimicking the functional deletion described. PMID:22180657

  19. Ketosis may promote brain macroautophagy by activating Sirt1 and hypoxia-inducible factor-1.

    PubMed

    McCarty, Mark F; DiNicolantonio, James J; O'Keefe, James H

    2015-11-01

    Ketogenic diets are markedly neuroprotective, but the basis of this effect is still poorly understood. Recent studies demonstrate that ketone bodies increase neuronal levels of hypoxia-inducible factor-1α (HIF-1α), possibly owing to succinate-mediated inhibition of prolyl hydroxylase activity. Moreover, there is reason to suspect that ketones can activate Sirt1 in neurons, in part by increasing cytoplasmic and nuclear levels of Sirt1's obligate cofactor NAD(+). Another recent study has observed reduced activity of mTORC1 in the hippocampus of rats fed a ketogenic diet - an effect plausibly attributable to Sirt1 activation. Increased activities of HIF-1 and Sirt1, and a decrease in mTORC1 activity, could be expected to collaborate in the induction of neuronal macroautophagy. Considerable evidence points to moderate up-regulation of neuronal autophagy as a rational strategy for prevention of neurodegenerative disorders; elimination of damaged mitochondria that overproduce superoxide, as well as clearance of protein aggregates that mediate neurodegeneration, presumably contribute to this protection. Hence, autophagy may mediate some of the neuroprotective benefits of ketogenic diets. Brain-permeable agents which activate AMP-activated kinase, such as metformin and berberine, as well as the Sirt1 activator nicotinamide riboside, can also boost neuronal autophagy, and may have potential for amplifying the impact of ketogenesis on this process. Since it might not be practical for most people to adhere to ketogenic diets continuously, alternative strategies are needed to harness the brain-protective potential of ketone bodies. These may include ingestion of medium-chain triglycerides or coconut oil, intermittent ketogenic dieting, and possibly the use of supplements that promote hepatic ketogenesis - notably carnitine and hydroxycitrate - in conjunction with dietary regimens characterized by long daily episodes of fasting or carbohydrate avoidance.

  20. Polymorphisms of Insulin-Like Growth Factor 1 Pathway Genes and Breast Cancer Risk

    PubMed Central

    Shi, Joy; Aronson, Kristan J.; Grundy, Anne; Kobayashi, Lindsay C.; Burstyn, Igor; Schuetz, Johanna M.; Lohrisch, Caroline A.; SenGupta, Sandip K.; Lai, Agnes S.; Brooks-Wilson, Angela; Spinelli, John J.; Richardson, Harriet

    2016-01-01

    Genetic variants of insulin-like growth factor 1 (IGF1) pathway genes have been shown to be associated with breast density and IGF1 levels and, therefore, may also influence breast cancer risk via pro-survival signaling cascades. The aim of this study was to investigate associations between IGF1 pathway single nucleotide polymorphisms (SNPs) and breast cancer risk among European and East Asian women, and potential interactions with menopausal status and breast tumor subtype. Stratified analyses of 1,037 cases and 1,050 controls from a population-based case–control study were conducted to assess associations with breast cancer for 22 SNPs across 5 IGF1 pathway genes in European and East Asian women. Odds ratios were calculated using logistic regression in additive genetic models. Polytomous logistic regression was used to assess heterogeneity by breast tumor subtype. Two SNPs of the IGF1 gene (rs1019731 and rs12821878) were associated with breast cancer risk among European women. Four highly linked IGF1 SNPs (rs2288378, rs17727841, rs7136446, and rs7956547) were modified by menopausal status among East Asian women only and associated with postmenopausal breast cancers. The association between rs2288378 and breast cancer risk was also modified by breast tumor subtype among East Asian women. Several IGF1 polymorphisms were found to be associated with breast cancer risk and some of these associations were modified by menopausal status or breast tumor subtype. Such interactions should be considered when assessing the role of these variants in breast cancer etiology. PMID:27376028

  1. Inhibition of hypoxia inducible factor 1 and topoisomerase with acriflavine sensitizes perihilar cholangiocarcinomas to photodynamic therapy

    PubMed Central

    Krekorian, Massis; Alles, Lindy K.; van Wijk, Albert C.; Mackaaij, Claire; Verheij, Joanne; van der Wal, Allard C.; van Gulik, Thomas M.; Storm, Gert; Heger, Michal

    2016-01-01

    Background: Photodynamic therapy (PDT) induces tumor cell death by oxidative stress and hypoxia but also survival signaling through activation of hypoxia-inducible factor 1 (HIF-1). Since perihilar cholangiocarcinomas are relatively recalcitrant to PDT, the aims were to (1) determine the expression levels of HIF-1-associated proteins in human perihilar cholangiocarcinomas, (2) investigate the role of HIF-1 in PDT-treated human perihilar cholangiocarcinoma cells, and (3) determine whether HIF-1 inhibition reduces survival signaling and enhances PDT efficacy. Results: Increased expression of VEGF, CD105, CD31/Ki-67, and GLUT-1 was confirmed in human perihilar cholangiocarcinomas. PDT with liposome-delivered zinc phthalocyanine caused HIF-1α stabilization in SK-ChA-1 cells and increased transcription of HIF-1α downstream genes. Acriflavine was taken up by SK-ChA-1 cells and translocated to the nucleus under hypoxic conditions. Importantly, pretreatment of SK-ChA-1 cells with acriflavine enhanced PDT efficacy via inhibition of HIF-1 and topoisomerases I and II. Methods: The expression of VEGF, CD105, CD31/Ki-67, and GLUT-1 was determined by immunohistochemistry in human perihilar cholangiocarcinomas. In addition, the response of human perihilar cholangiocarcinoma (SK-ChA-1) cells to PDT with liposome-delivered zinc phthalocyanine was investigated under both normoxic and hypoxic conditions. Acriflavine, a HIF-1α/HIF-1β dimerization inhibitor and a potential dual topoisomerase I/II inhibitor, was evaluated for its adjuvant effect on PDT efficacy. Conclusions: HIF-1, which is activated in human hilar cholangiocarcinomas, contributes to tumor cell survival following PDT in vitro. Combining PDT with acriflavine pretreatment improves PDT efficacy in cultured cells and therefore warrants further preclinical validation for therapy-recalcitrant perihilar cholangiocarcinomas. PMID:26657503

  2. Transportable, Chemical Genetic Methodology for the Small Molecule-Mediated Inhibition of Heat Shock Factor 1.

    PubMed

    Moore, Christopher L; Dewal, Mahender B; Nekongo, Emmanuel E; Santiago, Sebasthian; Lu, Nancy B; Levine, Stuart S; Shoulders, Matthew D

    2016-01-15

    Proteostasis in the cytosol is governed by the heat shock response. The master regulator of the heat shock response, heat shock factor 1 (HSF1), and key chaperones whose levels are HSF1-regulated have emerged as high-profile targets for therapeutic applications ranging from protein misfolding-related disorders to cancer. Nonetheless, a generally applicable methodology to selectively and potently inhibit endogenous HSF1 in a small molecule-dependent manner in disease model systems remains elusive. Also problematic, the administration of even highly selective chaperone inhibitors often has the side effect of activating HSF1 and thereby inducing a compensatory heat shock response. Herein, we report a ligand-regulatable, dominant negative version of HSF1 that addresses these issues. Our approach, which required engineering a new dominant negative HSF1 variant, permits dosable inhibition of endogenous HSF1 with a selective small molecule in cell-based model systems of interest. The methodology allows us to uncouple the pleiotropic effects of chaperone inhibitors and environmental toxins from the concomitantly induced compensatory heat shock response. Integration of our method with techniques to activate HSF1 enables the creation of cell lines in which the cytosolic proteostasis network can be up- or down-regulated by orthogonal small molecules. Selective, small molecule-mediated inhibition of HSF1 has distinctive implications for the proteostasis of both chaperone-dependent globular proteins and aggregation-prone intrinsically disordered proteins. Altogether, this work provides critical methods for continued exploration of the biological roles of HSF1 and the therapeutic potential of heat shock response modulation.

  3. Eukaryotic elongation factor 1 complex subunits are critical HIV-1 reverse transcription cofactors.

    PubMed

    Warren, Kylie; Wei, Ting; Li, Dongsheng; Qin, Fangyun; Warrilow, David; Lin, Min-Hsuan; Sivakumaran, Haran; Apolloni, Ann; Abbott, Catherine M; Jones, Alun; Anderson, Jenny L; Harrich, David

    2012-06-12

    Cellular proteins have been implicated as important for HIV-1 reverse transcription, but whether any are reverse transcription complex (RTC) cofactors or affect reverse transcription indirectly is unclear. Here we used protein fractionation combined with an endogenous reverse transcription assay to identify cellular proteins that stimulated late steps of reverse transcription in vitro. We identified 25 cellular proteins in an active protein fraction, and here we show that the eEF1A and eEF1G subunits of eukaryotic elongation factor 1 (eEF1) are important components of the HIV-1 RTC. eEF1A and eEF1G were identified in fractionated human T-cell lysates as reverse transcription cofactors, as their removal ablated the ability of active protein fractions to stimulate late reverse transcription in vitro. We observed that the p51 subunit of reverse transcriptase and integrase, two subunits of the RTC, coimmunoprecipitated with eEF1A and eEF1G. Moreover eEF1A and eEF1G associated with purified RTCs and colocalized with reverse transcriptase following infection of cells. Reverse transcription in cells was sharply down-regulated when eEF1A or eEF1G levels were reduced by siRNA treatment as a result of reduced levels of RTCs in treated cells. The combined evidence indicates that these eEF1 subunits are critical RTC stability cofactors required for efficient completion of reverse transcription. The identification of eEF1 subunits as unique RTC components provides a basis for further investigations of reverse transcription and trafficking of the RTC to the nucleus.

  4. Featured Article: Hypoxia-inducible factor-1α dependent nuclear entry of factor inhibiting HIF-1

    PubMed Central

    Liang, Ke; Ding, Xue-qin; Lin, Chen

    2015-01-01

    The regulation of hypoxia-inducible factor-1 (HIF-1) transcriptional activity in the nucleus is related to factor inhibiting HIF-1 (FIH-1). FIH-1 hydrolyzes asparagine at the C-terminal of HIF-1α, preventing the interaction between HIF-1α and its associated cofactors, and leading to suppressed activation of HIF-1. FIH-1 is a cytosolic protein and its entry to the nucleus has to be coordinated with HIF-1α. The present study was undertaken to examine the correlation between HIF-1α and FIH-1 in their nuclear entry. Human umbilical vein endothelial cells were treated with dimethyloxalylglycine at a final concentration of 100 µM for 4 h, resulting in an accumulation of HIF-1α and an increase of FIH-1 in the nucleus as determined by Western blot analysis. Pretreatment of the cells with copper (Cu) chelator tetraethylenepentamine at 50 µM in cultures for 24 h reduced both HIF-1α protein levels and the HIF-1α entry to the nucleus, along with decreased FIH-1 protein levels in the nucleus but no changes in the total FIH-1 protein levels in the cells. These effects were prevented by simultaneous addition of 50 µM CuSO4 with tetraethylenepentamine. Gene-silencing of HIF-1α significantly inhibited FIH-1 entry to the nucleus, but did not affect the total protein levels of FIH-1 in the cells. This work demonstrates that the nuclear entry of FIH-1 depends on HIF-1α. Cu deficiency caused a decrease of HIF-1α, leading to suppression of FIH-1 entry to the nucleus. PMID:25687434

  5. Steroidogenic factor 1 differentially regulates fetal and adult leydig cell development in male mice.

    PubMed

    Karpova, Tatiana; Ravichandiran, Kumarasamy; Insisienmay, Lovella; Rice, Daren; Agbor, Valentine; Heckert, Leslie L

    2015-10-01

    The nuclear receptor steroidogenic factor 1 (SF-1, AD4BP, NR5A1) is a key regulator of the endocrine axes and is essential for adrenal and gonad development. Partial rescue of Nr5a1(-/-) mice with an SF-1-expressing transgene caused a hypomorphic phenotype that revealed its roles in Leydig cell development. In contrast to controls, all male rescue mice (Nr5a1(-/-);tg(+/0)) showed varying signs of androgen deficiency, including spermatogenic arrest, cryptorchidism, and poor virilization. Expression of various Leydig cell markers measured by immunohistochemistry, Western blot analysis, and RT-PCR indicated fetal and adult Leydig cell development were differentially impaired. Whereas fetal Leydig cell development was delayed in Nr5a1(-/-);tg(+/0) embryos, it recovered to control levels by birth. In contrast, Sult1e1, Vcam1, and Hsd3b6 transcript levels in adult rescue testes indicated complete blockage in adult Leydig cell development. In addition, between Postnatal Days 8 and 12, peritubular cells expressing PTCH1, SF-1, and CYP11A1 were observed in control testes but not in rescue testes, indicating SF-1 is needed for either survival or differentiation of adult Leydig cell progenitors. Cultured prepubertal rat peritubular cells also expressed SF-1 and PTCH1, but Cyp11a1 was expressed only after treatment with cAMP and retinoic acid. Together, data show SF-1 is needed for proper development of fetal and adult Leydig cells but with distinct primary functions; in fetal Leydig cells, it regulates differentiation, whereas in adult Leydig cells it regulates progenitor cell formation and/or survival. PMID:26269506

  6. Mechanisms of amphibian macrophage development: characterization of the Xenopus laevis colony-stimulating factor-1 receptor.

    PubMed

    Grayfer, Leon; Edholm, Eva-Stina; Robert, Jacques

    2014-01-01

    Macrophage-lineage cells are indispensable to vertebrate homeostasis and immunity. In turn, macrophage development is largely regulated through colony-stimulating factor-1 (CSF1) binding to its cognate receptor (CSF1R). To study amphibian monopoiesis, we identified and characterized the X. laevis CSF1R cDNA transcript. Quantitative analysis revealed that CSF1R tissue gene expression increased with X. laevis development, with greatest transcript levels detected in the adult lung, spleen and liver tissues. Notably, considerable levels of CSF1R mRNA were also detected in the regressing tails of metamorphosing animals, suggesting macrophage involvement in this process, and in the adult bone marrow; corroborating the roles for this organ in Xenopus monopoiesis. Following animal infections with the ranavirus Frog Virus 3 (FV3), both tadpole and adult X. laevis exhibited increased kidney CSF1R gene expression. Conversely, while FV3-infected tadpoles increased their spleen and liver CSF1R mRNA levels, the FV3-challenged adults did not. Notably, FV3 induced elevated bone marrow CSF1R expression, and while stimulation of tadpoles with heat-killed E. coli had no transcriptional effects, bacterial stimulation of adult frogs resulted in significantly increased spleen, liver and bone marrow CSF1R expression. We produced the X. laevis CSF1R in recombinant form (rXlCSF1R) and determined, via in vitro cross-linking studies, that two molecules of rXlCSF1R bound the dimeric rXlCSF1. Finally, administration of rXlCSF1R abrogated the rXlCSF1-induced tadpole macrophage recruitment and differentiation as well as bacterial and FV3-elicited peritoneal leukocyte accumulation. This work marks a step towards garnering greater understanding of the unique mechanisms governing amphibian macrophage biology.

  7. Insulin-like growth factor-1 suppresses the Myostatin signaling pathway during myogenic differentiation

    SciTech Connect

    Retamales, A.; Zuloaga, R.; Valenzuela, C.A.; Gallardo-Escarate, C.; Molina, A.; Valdés, J.A.

    2015-08-21

    Myogenic differentiation is a complex and well-coordinated process for generating mature skeletal muscle fibers. This event is autocrine/paracrine regulated by growth factors, principally Myostatin (MSTN) and Insulin-like Growth Factor-1 (IGF-1). Myostatin, a member of the transforming growth factor-β superfamily, is a negative regulator of skeletal muscle growth in vertebrates that exerts its inhibitory function by activating Smad transcription factors. In contrast, IGF-1 promotes the differentiation of skeletal myoblasts by activating the PI3K/Akt signaling pathway. This study reports on a novel functional crosstalk between the IGF-1 and MSTN signaling pathways, as mediated through interaction between PI3K/Akt and Smad3. Stimulation of skeletal myoblasts with MSTN resulted in a transient increase in the pSmad3:Smad3 ratio and Smad-dependent transcription. Moreover, MSTN inhibited myod gene expression and myoblast fusion in an Activin receptor-like kinase/Smad3-dependent manner. Preincubation of skeletal myoblasts with IGF-1 blocked MSTN-induced Smad3 activation, promoting myod expression and myoblast differentiation. This inhibitory effect of IGF-1 on the MSTN signaling pathway was dependent on IGF-1 receptor, PI3K, and Akt activities. Finally, immunoprecipitation assay analysis determined that IGF-1 pretreatment increased Akt and Smad3 interaction. These results demonstrate that the IGF-1/PI3K/Akt pathway may inhibit MSTN signaling during myoblast differentiation, providing new insight to existing knowledge on the complex crosstalk between both growth factors. - Highlights: • IGF-1 inhibits Myostatin canonical signaling pathway through IGF-1R/PI3K/Akt pathway. • IGF-1 promotes myoblast differentiation through a direct blocking of Myostatin signaling pathway. • IGF-1 induces the interaction of Akt with Smad3 in skeletal myoblast.

  8. Stromal cell-derived factor-1 (SDF-1) as a target in liver diseases.

    PubMed

    Liepelt, Anke; Tacke, Frank

    2016-08-01

    The chemokine stromal cell-derived factor-1 (SDF-1) or CXCL12 is constitutively expressed in healthy liver. However, its expression increases following acute or chronic liver injury. Liver sinusoidal endothelial cells (LSEC), hepatic stellate cells (HSC), and malignant hepatocytes are important sources of SDF-1/CXCL12 in liver diseases. CXCL12 is able to activate two chemokine receptors with different downstream signaling pathways, CXCR4 and CXCR7. CXCR7 expression is relevant on LSEC, while HSC, mesenchymal stem cells, and tumor cells mainly respond via CXCR4. Here, we summarize recent developments in the field of liver diseases involving this chemokine and its receptors. SDF-1-dependent signaling contributes to modulating acute liver injury and subsequent tissue regeneration. By activating HSC and recruiting mesenchymal cells from bone marrow, CXCL12 can promote liver fibrosis progression, while CXCL12-CXCR7 interactions endorse proregenerative responses in chronic injury. Moreover, the SDF-1 pathway is linked to development of hepatocellular carcinoma (HCC) by promoting tumor growth, angiogenesis, and HCC metastasis. High hepatic CXCR4 expression has been suggested as a biomarker indicating poor prognosis of HCC patients. Tumor-infiltrating myeloid-derived suppressor cells (MDSC) also express CXCR4 and migrate toward CXCL12. Thus CXCL12 inhibition might not only directly block HCC growth but also modulate the tumor microenvironment (angiogenesis, MDSC), thereby sensitizing HCC patients to conventional or emerging novel cancer therapies (e.g., sorafenib, regorafenib, nivolumab, pembrolizumab). We herein summarize the current knowledge on the complex interplay between CXCL12 and CXCR4/CXCR7 in liver diseases and discuss approaches on the therapeutic targeting of these axes in hepatitis, fibrosis, and liver cancer. PMID:27313175

  9. Insulin-Like Growth Factor-1 Preserves Salivary Gland Function After Fractionated Radiation

    SciTech Connect

    Limesand, Kirsten H.; Avila, Jennifer L.; Victory, Kerton; Chang, Hui-Hua; Shin, Yoon Joo; Grundmann, Oliver; Klein, Rob R.

    2010-10-01

    Purpose: Radiotherapy for head-and-neck cancer consists of fractionated radiation treatments that cause significant damage to salivary glands leading to chronic salivary gland dysfunction with only limited prevention and treatment options currently available. This study examines the feasibility of IGF-1 in preserving salivary gland function following a fractionated radiation treatment regimen in a pre-clinical model. Methods and Materials: Mice were exposed to fractionated radiation, and salivary gland function and histological analyses of structure, apoptosis, and proliferation were evaluated. Results: In this study, we report that treatment with fractionated doses of radiation results in a significant level of apoptotic cells in FVB mice after each fraction, which is significantly decreased in transgenic mice expressing a constitutively active mutant of Akt1 (myr-Akt1). Salivary gland function is significantly reduced in FVB mice exposed to fractionated radiation; however, myr-Akt1 transgenic mice maintain salivary function under the same treatment conditions. Injection into FVB mice of recombinant insulin-like growth factor-1 (IGF-1), which activates endogenous Akt, suppressed acute apoptosis and preserved salivary gland function after fractionated doses of radiation 30 to 90 days after treatment. FVB mice exposed to fractionated radiation had significantly lower levels of proliferating cell nuclear antigen-positive salivary acinar cells 90 days after treatment, which correlated with a chronic loss of function. In contrast, FVB mice injected with IGF-1 before each radiation treatment exhibited acinar cell proliferation rates similar to those of untreated controls. Conclusion: These studies suggest that activation of IGF-1-mediated pathways before head-and-neck radiation could modulate radiation-induced salivary gland dysfunction and maintain glandular homeostasis.

  10. Expression, regulation and clinical relevance of the ATPase inhibitory factor 1 in human cancers

    PubMed Central

    Sánchez-Aragó, M; Formentini, L; Martínez-Reyes, I; García-Bermudez, J; Santacatterina, F; Sánchez-Cenizo, L; Willers, I M; Aldea, M; Nájera, L; Juarránz, Á; López, E C; Clofent, J; Navarro, C; Espinosa, E; Cuezva, J M

    2013-01-01

    Recent findings in colon cancer cells indicate that inhibition of the mitochondrial H+-adenosine triphosphate (ATP) synthase by the ATPase inhibitory factor 1 (IF1) promotes aerobic glycolysis and a reactive oxygen species (ROS)-mediated signal that enhances proliferation and cell survival. Herein, we have studied the expression, biological relevance, mechanism of regulation and potential clinical impact of IF1 in some prevalent human carcinomas. We show that IF1 is highly overexpressed in most (>90%) of the colon (n=64), lung (n=30), breast (n=129) and ovarian (n=10) carcinomas studied as assessed by different approaches in independent cohorts of cancer patients. The expression of IF1 in the corresponding normal tissues is negligible. By contrast, the endometrium, stomach and kidney show high expression of IF1 in the normal tissue revealing subtle differences by carcinogenesis. The overexpression of IF1 also promotes the activation of aerobic glycolysis and a concurrent ROS signal in mitochondria of the lung, breast and ovarian cancer cells mimicking the activity of oligomycin. IF1-mediated ROS signaling activates cell-type specific adaptive responses aimed at preventing death in these cell lines. Remarkably, regulation of IF1 expression in the colon, lung, breast and ovarian carcinomas is exerted at post-transcriptional levels. We demonstrate that IF1 is a short-lived protein (t1/2 ∼100 min) strongly implicating translation and/or protein stabilization as main drivers of metabolic reprogramming and cell survival in these human cancers. Analysis of tumor expression of IF1 in cohorts of breast and colon cancer patients revealed its relevance as a predictive marker for clinical outcome, emphasizing the high potential of IF1 as therapeutic target. PMID:23608753

  11. Expression of insulin-like growth factor-1 receptor in keloid and hypertrophic scar

    PubMed Central

    Hu, Z-C; Tang, B; Guo, D; Zhang, J; Liang, Y-Y; Ma, D; Zhu, J-Y

    2014-01-01

    Background Keloid and hypertrophic scar (HS) are two pathological forms of excessive dermal fibrosis, which are due to aberrant wound-healing responses. Accumulating evidence suggests that aberrant activity of growth factors and increased numbers of growth factor receptors play an important role in the formation of pathological scar. Aim We examined the expression level of insulin-like growth factor-1 receptor (IGF-IR) in keloid, HS and normal skin. Methods IGF-IR expression was analyzed by immunohistochemistry, real-time PCR and western blotting on tissues and fibroblasts from 30 patients, comprising 10 patients with keloid and 20 with HS (10 with immature and 10 with mature HS), and from 10 age-matched and sex-matched healthy controls. Results Immunoreactivity to IGF-IR was found in dermal fibroblasts of keloid (90%), immature HS, (80%) and mature HS (30%), but not in normal skin. There was no statistically significant difference in immunoreactivity scores between keloid and immature HS, but there was a significant difference (P < 0.01) between mature and immature HS. Real-time PCR and western blot analysis confirmed that there was high expression of IGF-IR in keloid and immature HS fibroblasts, but not in mature HS or normal skin fibroblasts. IGF-IR was expressed in the overlying epidermis, and there was no significant difference between the groups. Conclusions IGF-IR may be involved in the pathogenesis of keloid and HS. Given that IGF-IR are predominantly expressed on dermal fibroblasts, targeting of IGF-IR in fibroblasts may be of benefit to prevent scarring. PMID:25154292

  12. Emodin Decreases Hepatic Hypoxia-Inducible Factor-1[Formula: see text] by Inhibiting its Biosynthesis.

    PubMed

    Ma, Feifei; Hu, Lijuan; Yu, Ming; Wang, Feng

    2016-01-01

    Hypoxia-inducible factor-1 (HIF-1) is an [Formula: see text] dimeric transcription factor. Because HIF-1[Formula: see text] is instable with oxygen, HIF-1 is scarce in normal mammalian cells. However, HIF-1[Formula: see text] is expressed in pathological conditions such as cancer and obesity. Inhibiting HIF-1[Formula: see text] may be of therapeutic value for these pathologies. Here, we investigated whether emodin, derived from the herb of Rheum palmatum L, which is also known as Chinese rhubarb, and is native to China, regulates HIF-1[Formula: see text] expression. Male C57BL/6 mice without or with diet-induced obesity were treated with emodin for two weeks, while control mice were treated with vehicle. HIF-1[Formula: see text] expression was determined by Western blot. We found that emodin inhibited obesity-induced HIF-1[Formula: see text] expression in liver and skeletal muscle but did not regulate HIF-1[Formula: see text] expression in the kidneys or in intra-abdominal fat. In vitro, emodin inhibited HIF-1[Formula: see text] expression in human HepG2 hepatic cells and Y1 adrenocortical cells. Further, we investigated the mechanisms of HIF-1[Formula: see text] expression in emodin-treated HepG2 cells. First, we found that HIF-1[Formula: see text] had normal stability in the presence of emodin. Thus, emodin did not decrease HIF-1[Formula: see text] by stimulating its degradation. Importantly, emodin decreased the activity of the signaling pathways that led to HIF-1[Formula: see text] biosynthesis. Interestingly, emodin increased HIF-1[Formula: see text] mRNA in HepG2 cells. This may be a result of feedback in response to the emodin-induced decrease in the protein of HIF-1[Formula: see text]. In conclusion, emodin decreases hepatic HIF-1[Formula: see text] by inhibiting its biosynthesis.

  13. Nutritional and prognostic significance of insulin-like growth factor 1 in patients with liver cirrhosis.

    PubMed

    Caregaro, L; Alberino, F; Amodio, P; Merkel, C; Angeli, P; Plebani, M; Bolognesi, M; Gatta, A

    1997-03-01

    Most of the traditional parameters for nutrition assessment have important limitations in patients with chronic liver disease. Insulin-like growth factor 1 (IGF-1) has been found to be regulated by nutrition and proposed as a nutritional marker. Its nutritional significance in patients with liver cirrhosis, however, has not been investigated. Serum IGF-1 as well as traditional anthropometric, visceral, and immunologic parameters were evaluated in 64 hospitalized cirrhotics, followed up clinically for 2 y. IGF-1Z-score averaged -2.16 +/- 1.08 and inversely correlated with Child-Pugh score (P < 0.01), the most reliable composite score reflecting the severity of liver disease. IGF-1Z-score was not different in patients with or without signs of energy malnutrition, as defined by values of midarm muscle circumference (MAMC) and/or triceps skinfold (TSF) < 5th percentile. Moreover, IGF-1Z-score did not correlate with MAMC or TSF. Despite its correlation with all visceral proteins, the reduction of IGF-1 was much greater and more frequent than that of visceral proteins. Patients with IGF-1Z-score < median values (-2.5) showed lower long-term survival rates compared with patients with IGF-1Z-score > -2.5 (P < 0.01). These data indicate that serum IGF-1 is not related to energy malnutrition in cirrhotic patients, while it appears to be a good predictor of survival and an early marker of liver dysfunction. Multiple factors, most of which are related to the severity of the liver disease, may contribute to the reduction of IGF-1. This multifactorial pathogenesis probably accounts for its prognostic significance. PMID:9131676

  14. Insulin-Like Growth Factor 1, Glycation and Bone Fragility: Implications for Fracture Resistance of Bone

    PubMed Central

    Sroga, Grażyna E.; Wu, Ping-Cheng; Vashishth, Deepak

    2015-01-01

    Despite our extensive knowledge of insulin-like growth factor 1 (IGF1) action on the growing skeleton, its role in skeletal homeostasis during aging and age-related development of certain diseases is still unclear. Advanced glycation end products (AGEs) derived from glucose are implicated in osteoporosis and a number of diabetic complications. We hypothesized that because in humans and rodents IGF1 stimulates uptake of glucose (a glycation substrate) from the bloodstream in a dose-dependent manner, the decline of IGF1 could be associated with the accumulation of glycation products and the decreasing resistance of bone to fracture. To test the aforementioned hypotheses, we used human tibial posterior cortex bone samples to perform biochemical (measurement of IGF1, fluorescent AGEs and pentosidine (PEN) contents) and mechanical tests (crack initiation and propagation using compact tension specimens). Our results for the first time show a significant, age-independent association between the levels of IGF1 and AGEs. Furthermore, AGEs (fAGEs, PEN) predict propensity of bone to fracture (initiation and propagation) independently of age in human cortical bone. Based on these results we propose a model of IGF1-based regulation of bone fracture. Because IGF1 level increases postnatally up to the juvenile developmental phase and decreases thereafter with aging, we propose that IGF1 may play a protective role in young skeleton and its age-related decline leads to bone fragility and an increased fracture risk. Our results may also have important implications for current understanding of osteoporosis- and diabetes-related bone fragility as well as in the development of new diagnostic tools to screen for fragile bones. PMID:25629402

  15. Regulation of chick early B-cell factor-1 gene expression in feather development.

    PubMed

    El-Magd, Mohammed Abu; Sayed-Ahmed, Ahmed; Awad, Ashraf; Shukry, Mustafa

    2014-05-01

    The chick Ebf1 (early B-cell factor-1) gene is a member of a novel family of helix loop helix transcription factors. The expression profile, regulation and significance of this gene have been extensively studied in lymphatic, nervous, adipose and muscular tissues. However, cEbf1 expression, regulation and function in the feather of chick embryo have not yet been investigated. cEbf1 expression was first detected throughout the mesenchymal core of some few feather placodes (D7-D7.5). After feathers became mature and grew distally (D9 and D10), the mesenchymal expression of cEbf1 became confined to the caudal margin of the proximal half of all formed feather buds. Because this dynamic pattern of expression resembles that of Sonic Hedgehog (Shh) protein and bone morphogenetic protein (Bmp4) plus the crucial role of these two major signals in feather development, we hypothesized that cEbf1 expression in the feather may be regulated by Shh and Bmp4. In a feather explant culture system, Shh signals are necessary to initiate and maintain cEbf1 expression in the posterior half of the feather bud, while Bmp4 is crucial for the initial cEbf1 expression in the anterior half of the feather bud. Inhibition of Shh, not only down-regulates cEbf1, but also changes the morphology of feather buds, which become irregular and fused. This is the first study to demonstrate that cEbf1 expression in the feather bud is under the control of Shh and Bmp4 signals and that expression may play a role in the normal development of feathers.

  16. Potential regulation of GnRH gene by a steroidogenic factor-1-like protein.

    PubMed

    Corley, D R; Li, X; Lei, Z M; Rao, C V

    2000-08-01

    Steroidogenic factor-1 (SF-1) is a member of an orphan nuclear hormone receptor superfamily. It plays a critical role in the development and function of the hypothalamic-pituitary-gonadal and adrenal axis. However, whether SF-1 can regulate transcription of gonadotrophin-releasing hormone (GnRH) gene is not known. To examine this possibility, we first over-expressed SF-1 and found that it not only decreased steady state GnRH messenger ribonucleic acid (mRNA) levels but also reduced its promoter activity in GT1-7 neurons. The inhibitory effect of SF-1 was lost when the 5'-flanking region of GnRH gene containing two distal (-1479 to -1474 bp and -1059 to -1054 bp) hexamers was deleted. Gel mobility shift assays showed that GT1-7 cell nuclear extracts contained a protein that formed a specific complex with synthetic oligonucleotides containing the two distal hexamers or a consensus SF-1 binding sequence. The migration of this complex was, however, slower than the complex formed with MA-10 cell nuclear extracts which were shown to contain a 53 kDa SF-1 protein. The addition of anti-SF-1 antibody supershifted the complex formed with MA-10, but not with GT1-7 cell nuclear extracts. The same antibody, however, detected a 60 kDa protein and immunostained nuclei of GT1-7 neurons. These results are consistent with GT1-7 neurons containing an SF-1-like protein that can bind to the distal hexamer sequences in the 5'-flanking region of rat GnRH gene to inhibit its transcription.

  17. Daintain/AIF-1 (Allograft Inflammatory Factor-1) accelerates type 1 diabetes in NOD mice

    SciTech Connect

    Zhao, Yan-Ying; Huang, Xin-Yuan; Chen, Zheng-Wang

    2012-10-26

    Highlights: Black-Right-Pointing-Pointer Daintain/AIF-1 is over-expressed in the blood of NOD mice suffering from insulitis. Black-Right-Pointing-Pointer Daintain/AIF-1 stimulates white blood cell proliferation in NOD mice. Black-Right-Pointing-Pointer Daintain/AIF-1 increases blood glucose levels and triggers type 1 diabetes. Black-Right-Pointing-Pointer Daintain/AIF-1 accelerates insulitis, while its antibody prevents insulitis. Black-Right-Pointing-Pointer Daintain/AIF-1 enhances the levels of nitric oxide in the pancreases of NOD mice. -- Abstract: A large body of experimental evidence suggests that cytokines trigger pancreatic {beta}-cell death in type 1 diabetes mellitus. Daintain/AIF-1 (Allograft Inflammatory Factor-1), a specific marker for activated macrophages, is accumulated in the pancreatic islets of pre-diabetic BB rats. In the present study, we demonstrate that daintain/AIF-1 is released into blood and the levels of daintain/AIF-1 in the blood of type 1 diabetes-prone non-obese diabetic (NOD) mice suffering from insulitis are significantly higher than that in healthy NOD mice. When injected intravenously into NOD mice, daintain/AIF-1 stimulates white blood cell proliferation, increases the concentrations of blood glucose, impairs insulin expression, up-regulates nitric oxide (NO) production in pancreases and accelerates diabetes in NOD mice, while the antibody against daintain/AIF-1 delays or prevents insulitis in NOD mice. These results imply daintain/AIF-1 triggers type 1 diabetes probably via arousing immune cells activation and induction of NO production in pancreas of NOD mice.

  18. Insulin-like growth factor-1 and post-ischemic brain injury.

    PubMed

    Guan, J; Bennet, L; Gluckman, P D; Gunn, A J

    2003-08-01

    Insulin-like growth factor-1 (IGF-1) is a naturally occurring neurotrophic factor that plays an important role in promoting cell proliferation and differentiation during normal brain development and maturation. The present review examines recent evidence that endogenous IGF-1 also plays a significant role in recovery from insults such as hypoxia-ischemia and that giving additional exogenous IGF-1 can actively ameliorate damage. It is now well established that neurons and other cell types die many hours or even days after initial injury due to activation of programmed cell death pathways. IGF-1 and its binding proteins and receptors are intensely induc