Field Sampling and Selecting On-Site Analytical Methods for Explosives in Soil

EPA Pesticide Factsheets

The purpose of this issue paper is to provide guidance to Remedial Project Managers regarding field sampling and on-site analytical methods fordetecting and quantifying secondary explosive compounds in soils.

Common methods for fecal sample storage in field studies yield consistent signatures of individual identity in microbiome sequencing data.

PubMed

Blekhman, Ran; Tang, Karen; Archie, Elizabeth A; Barreiro, Luis B; Johnson, Zachary P; Wilson, Mark E; Kohn, Jordan; Yuan, Michael L; Gesquiere, Laurence; Grieneisen, Laura E; Tung, Jenny

2016-08-16

Field studies of wild vertebrates are frequently associated with extensive collections of banked fecal samples-unique resources for understanding ecological, behavioral, and phylogenetic effects on the gut microbiome. However, we do not understand whether sample storage methods confound the ability to investigate interindividual variation in gut microbiome profiles. Here, we extend previous work on storage methods for gut microbiome samples by comparing immediate freezing, the gold standard of preservation, to three methods commonly used in vertebrate field studies: lyophilization, storage in ethanol, and storage in RNAlater. We found that the signature of individual identity consistently outweighed storage effects: alpha diversity and beta diversity measures were significantly correlated across methods, and while samples often clustered by donor, they never clustered by storage method. Provided that all analyzed samples are stored the same way, banked fecal samples therefore appear highly suitable for investigating variation in gut microbiota. Our results open the door to a much-expanded perspective on variation in the gut microbiome across species and ecological contexts.

Anopheles sinensis mosquito insecticide resistance: comparison of three mosquito sample collection and preparation methods and mosquito age in resistance measurements.

PubMed

Xu, Tielong; Zhong, Daibin; Tang, Linhua; Chang, Xuelian; Fu, Fengyang; Yan, Guiyun; Zheng, Bin

2014-01-28

Insecticide resistance monitoring in malaria mosquitoes is essential for guiding the rational use of insecticides in vector control programs. Resistance bioassay is the first step for insecticide monitoring and it lays an important foundation for molecular examination of resistance mechanisms. In the literature, various mosquito sample collection and preparation methods have been used, but how mosquito sample collection and preparation methods affect insecticide susceptibility bioassay results is largely unknown. The objectives of this study were to determine whether mosquito sample collection and preparation methods affected bioassay results, which may cause incorrect classification of mosquito resistance status. The study was conducted in Anopheles sinensis mosquitoes in two study sites in central China. Three mosquito sample collection and preparation methods were compared for insecticide susceptibility, kdr frequencies and metabolic enzyme activities: 1) adult mosquitoes collected from the field; 2) F1 adults from field collected, blood-fed mosquitoes; and 3) adult mosquitoes reared from field collected larvae. Mosquito sample collection and preparation methods significantly affected mortality rates in the standard WHO tube resistance bioassay. Mortality rate of field-collected female adults was 10-15% higher than in mosquitoes reared from field-collected larvae and F1 adults from field collected blood-fed females. This pattern was consistent in mosquitoes from the two study sites. High kdr mutation frequency (85-95%) with L1014F allele as the predominant mutation was found in our study populations. Field-collected female adults consistently exhibited the highest monooxygenase and GST activities. The higher mortality rate observed in the field-collected female mosquitoes may have been caused by a mixture of mosquitoes of different ages, as older mosquitoes were more susceptible to deltamethrin than younger mosquitoes. Female adults reared from field-collected larvae in resistance bioassays are recommended to minimize the effect of confounding factors such as mosquito age and blood feeding status so that more reliable and reproducible mortality may be obtained.

Detection of alpha radiation in a beta radiation field

DOEpatents

Mohagheghi, Amir H.; Reese, Robert P.

2001-01-01

An apparatus and method for detecting alpha particles in the presence of high activities of beta particles utilizing an alpha spectrometer. The apparatus of the present invention utilizes a magnetic field applied around the sample in an alpha spectrometer to deflect the beta particles from the sample prior to reaching the detector, thus permitting detection of low concentrations of alpha particles. In the method of the invention, the strength of magnetic field required to adequately deflect the beta particles and permit alpha particle detection is given by an algorithm that controls the field strength as a function of sample beta energy and the distance of the sample to the detector.

Methods of analysis by the U.S. Geological Survey National Water Quality Laboratory; arsenic speciation in natural-water samples using laboratory and field methods

USGS Publications Warehouse

Garbarino, John R.; Bednar, Anthony J.; Burkhardt, Mark R.

2002-01-01

Analytical methods for the determination of arsenite [As(III)], arsenate [As(V)], dimethylarsinate (DMA), monomethylarsonate (MMA), and roxarsone in filtered natural-water samples are described. Various analytical methods can be used for the determination, depending on the arsenic species being determined. Arsenic concentration is determined by using inductively coupled plasma-mass spectrometry (ICP-MS) as an arsenic-specific detector for all methods. Laboratory-speciation methods are described that use an ion chromatographic column to separate the arsenic species; the column length, column packing, and mobile phase are dependent on the species of interest. Regardless of the separation technique, the arsenic species are introduced into plasma by eithe rpneumatic nebulization or arsine generation. Analysis times range from 2 to 8 minutes and method detection limits range from 0.1 to 0.6 microgram-arsenic per liter (ug-As/L), 10 to 60 picograms absolute (for a 100-microliter injection), depending on the arsenic species determined and the analytical method used. A field-generation specciation method also is described that uses a strong anion exchange cartridge to separate As(III) from As(V) in the field. As(III) in the eluate and the As(V) in the cartridge extract are determined by direct nebulization ICP-MS. Methylated arsenic species that also are retained on the cartridge will positively bias As(V) results without further laboratory separations. The method detection limit for field speciation is 0.3 ug-As/L. The distribution of arsenic species must be preserved in the field to eliminate changes caused by photochemical oxidation or metal oxyhydroxide precipitation. Preservation techniques, such as refrigeration, the addition of acides, or the additoin of ethylene-diaminetetraacetic acid (EDTA) and the effects of ambient light were tested. Of the preservatives evaluated, EDTA was found to work best with the laboratory- and field-speciation methods for all sample matrices tested. Storing the samples in opaque polytethylene bottles eliminated the effects of photochemical oxidation. The percentage change in As(III):As(V) ratios for an EDTA-preserved acid mine drainage (AMD) sample and ground-water sample during a 3-month period was -5 percent and +3 percent, respectively. The bias and variability of the methods were evaluated by comparing results for total arsenic and As(III), As(V), DMA, and MMA concentrations in ground water, AMD, and surface water. Seventy-one ground-water, 10 AMD, and 24 surface-water samples were analyzed. Concentrations in ground-water samples reached 720 ug-As/L for As(III) and 1080 ug-As/L for As(V); AMD samples reached 12800 ug-As/L for As(III) and 7050 ug-As/L for As(V); and surface-water samples reached 5 ug-As/L for As(III) and As(V). Inorganic arsenic species distribution in the samples ranged from 0 to 90 percent As(III). DMA and MMA were present only in surface-water samples from agricultural areas where the herbicide monosodium methylarsonate was applied; concentrations never exceeded 6 ug-As/L. Statistical analyses indicated that the difference between As(III) and As(V) concentrations for samples preserved with EDTA in opaque bottles and field-speciation results were analytically insignificant at the 95-percent confidence interval. There was no significant difference among the methods tested for total arsenic concentration. Percentage recovery for field samples spiked at 50 ug-As/L and analyzed by the laboratory-speciation method (n=2) ranged from 82 to 100 percent for As(III), 97 to 102 percent for As(V), 90 to 104 percent for DMA, and 81 to 96 percent for MMA; recoveries for samples spiked at 100 ug-As/L and analyzed by the field-speciation method ranged from 102 to 107 percent for As(III) and 105 to 106 percent for As(V). Laboratory-speciation results for Environment Canada reference material SLRS-2 closely matched reported concentrations. Laboratory-speciation metho

Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples

USGS Publications Warehouse

Pilliod, David S.; Goldberg, Caren S.; Arkle, Robert S.; Waits, Lisette P.

2013-01-01

Environmental DNA (eDNA) methods for detecting aquatic species are advancing rapidly, but with little evaluation of field protocols or precision of resulting estimates. We compared sampling results from traditional field methods with eDNA methods for two amphibians in 13 streams in central Idaho, USA. We also evaluated three water collection protocols and the influence of sampling location, time of day, and distance from animals on eDNA concentration in the water. We found no difference in detection or amount of eDNA among water collection protocols. eDNA methods had slightly higher detection rates than traditional field methods, particularly when species occurred at low densities. eDNA concentration was positively related to field-measured density, biomass, and proportion of transects occupied. Precision of eDNA-based abundance estimates increased with the amount of eDNA in the water and the number of replicate subsamples collected. eDNA concentration did not vary significantly with sample location in the stream, time of day, or distance downstream from animals. Our results further advance the implementation of eDNA methods for monitoring aquatic vertebrates in stream habitats.

Method and apparatus for telemetry adaptive bandwidth compression

NASA Technical Reports Server (NTRS)

Graham, Olin L.

1987-01-01

Methods and apparatus are provided for automatic and/or manual adaptive bandwidth compression of telemetry. An adaptive sampler samples a video signal from a scanning sensor and generates a sequence of sampled fields. Each field and range rate information from the sensor are hence sequentially transmitted to and stored in a multiple and adaptive field storage means. The field storage means then, in response to an automatic or manual control signal, transfers the stored sampled field signals to a video monitor in a form for sequential or simultaneous display of a desired number of stored signal fields. The sampling ratio of the adaptive sample, the relative proportion of available communication bandwidth allocated respectively to transmitted data and video information, and the number of fields simultaneously displayed are manually or automatically selectively adjustable in functional relationship to each other and detected range rate. In one embodiment, when relatively little or no scene motion is detected, the control signal maximizes sampling ratio and causes simultaneous display of all stored fields, thus maximizing resolution and bandwidth available for data transmission. When increased scene motion is detected, the control signal is adjusted accordingly to cause display of fewer fields. If greater resolution is desired, the control signal is adjusted to increase the sampling ratio.

FIELD SAMPLING OF RESIDUAL AVIATION GASOLINE IN SANDY SOIL

EPA Science Inventory

Two complimentary field sampling methods for the determination of residual aviation gasoline content in the contaminated capillary fringe of a fine, uniform, sandy soil were investigated. The first method featured filed extrusion of core barrels into pint size Mason jars, while ...

Protocol for collecting eDNA samples from streams [Version 2.3

Treesearch

K. J. Carim; T. Wilcox; M. K. Young; K. S. McKelvey; M. K. Schwartz

2015-01-01

Throughout the 2014 field season, we had over two dozen biologist throughout the western US collect over 300 samples for eDNA analysis with paired controls. Control samples were collected by filtering 0.5 L of distilled water. No samples had any evidence of field contamination. This method of sampling verifies the cleanliness of the field equipment, as well as the...

Sampling and analysis for radon-222 dissolved in ground water and surface water

USGS Publications Warehouse

DeWayne, Cecil L.; Gesell, T.F.

1992-01-01

Radon-222 is a naturally occurring radioactive gas in the uranium-238 decay series that has traditionally been called, simply, radon. The lung cancer risks associated with the inhalation of radon decay products have been well documented by epidemiological studies on populations of uranium miners. The realization that radon is a public health hazard has raised the need for sampling and analytical guidelines for field personnel. Several sampling and analytical methods are being used to document radon concentrations in ground water and surface water worldwide but no convenient, single set of guidelines is available. Three different sampling and analytical methods - bubbler, liquid scintillation, and field screening - are discussed in this paper. The bubbler and liquid scintillation methods have high accuracy and precision, and small analytical method detection limits of 0.2 and 10 pCi/l (picocuries per liter), respectively. The field screening method generally is used as a qualitative reconnaissance tool.

Passive Samplers for Investigations of Air Quality: Method Description, Implementation, and Comparison to Alternative Sampling Methods

EPA Science Inventory

This Paper covers the basics of passive sampler design, compares passive samplers to conventional methods of air sampling, and discusses considerations when implementing a passive sampling program. The Paper also discusses field sampling and sample analysis considerations to ensu...

Potential, velocity, and density fields from sparse and noisy redshift-distance samples - Method

NASA Technical Reports Server (NTRS)

Dekel, Avishai; Bertschinger, Edmund; Faber, Sandra M.

1990-01-01

A method for recovering the three-dimensional potential, velocity, and density fields from large-scale redshift-distance samples is described. Galaxies are taken as tracers of the velocity field, not of the mass. The density field and the initial conditions are calculated using an iterative procedure that applies the no-vorticity assumption at an initial time and uses the Zel'dovich approximation to relate initial and final positions of particles on a grid. The method is tested using a cosmological N-body simulation 'observed' at the positions of real galaxies in a redshift-distance sample, taking into account their distance measurement errors. Malmquist bias and other systematic and statistical errors are extensively explored using both analytical techniques and Monte Carlo simulations.

Low Field Squid MRI Devices, Components and Methods

NASA Technical Reports Server (NTRS)

Hahn, Inseob (Inventor); Penanen, Konstantin I. (Inventor); Eom, Byeong H. (Inventor)

2013-01-01

Low field SQUID MRI devices, components and methods are disclosed. They include a portable low field (SQUID)-based MRI instrument and a portable low field SQUID-based MRI system to be operated under a bed where a subject is adapted to be located. Also disclosed is a method of distributing wires on an image encoding coil system adapted to be used with an NMR or MRI device for analyzing a sample or subject and a second order superconducting gradiometer adapted to be used with a low field SQUID-based MRI device as a sensing component for an MRI signal related to a subject or sample.

Low Field Squid MRI Devices, Components and Methods

NASA Technical Reports Server (NTRS)

Penanen, Konstantin I. (Inventor); Eom, Byeong H. (Inventor); Hahn, Inseob (Inventor)

2014-01-01

Low field SQUID MRI devices, components and methods are disclosed. They include a portable low field (SQUID)-based MRI instrument and a portable low field SQUID-based MRI system to be operated under a bed where a subject is adapted to be located. Also disclosed is a method of distributing wires on an image encoding coil system adapted to be used with an NMR or MRI device for analyzing a sample or subject and a second order superconducting gradiometer adapted to be used with a low field SQUID-based MRI device as a sensing component for an MRI signal related to a subject or sample.

Low field SQUID MRI devices, components and methods

NASA Technical Reports Server (NTRS)

Penanen, Konstantin I. (Inventor); Eom, Byeong H. (Inventor); Hahn, Inseob (Inventor)

2011-01-01

Low field SQUID MRI devices, components and methods are disclosed. They include a portable low field (SQUID)-based MRI instrument and a portable low field SQUID-based MRI system to be operated under a bed where a subject is adapted to be located. Also disclosed is a method of distributing wires on an image encoding coil system adapted to be used with an NMR or MRI device for analyzing a sample or subject and a second order superconducting gradiometer adapted to be used with a low field SQUID-based MRI device as a sensing component for an MRI signal related to a subject or sample.

Low field SQUID MRI devices, components and methods

NASA Technical Reports Server (NTRS)

Penanen, Konstantin I. (Inventor); Eom, Byeong H (Inventor); Hahn, Inseob (Inventor)

2010-01-01

Low field SQUID MRI devices, components and methods are disclosed. They include a portable low field (SQUID)-based MRI instrument and a portable low field SQUID-based MRI system to be operated under a bed where a subject is adapted to be located. Also disclosed is a method of distributing wires on an image encoding coil system adapted to be used with an NMR or MRI device for analyzing a sample or subject and a second order superconducting gradiometer adapted to be used with a low field SQUID-based MRI device as a sensing component for an MRI signal related to a subject or sample.

Assessing five field sampling methods to monitor Yellowstone National Park's northern ungulate winter range: the advantages and disadvantages of implementing a new sampling protocol

Treesearch

Pamela G. Sikkink; Roy Renkin; Geneva Chong; Art Sikkink

2013-01-01

The five field sampling methods tested for this study differed in richness and Simpson's Index values calculated from the raw data. How much the methods differed, and which ones were most similar to each other, depended on which diversity measure and which type of data were used for comparisons. When the number of species (richness) was used as a measure of...

Methods for collection and analysis of water samples

USGS Publications Warehouse

Rainwater, Frank Hays; Thatcher, Leland Lincoln

1960-01-01

This manual contains methods used by the U.S. Geological Survey to collect, preserve, and analyze water samples. Throughout, the emphasis is on obtaining analytical results that accurately describe the chemical composition of the water in situ. Among the topics discussed are selection of sampling sites, frequency of sampling, field equipment, preservatives and fixatives, analytical techniques of water analysis, and instruments. Seventy-seven laboratory and field procedures are given for determining fifty-three water properties.

Acupuncture injection for field amplified sample stacking and glass microchip-based capillary gel electrophoresis.

PubMed

Ha, Ji Won; Hahn, Jong Hoon

2017-02-01

Acupuncture sample injection is a simple method to deliver well-defined nanoliter-scale sample plugs in PDMS microfluidic channels. This acupuncture injection method in microchip CE has several advantages, including minimization of sample consumption, the capability of serial injections of different sample solutions into the same microchannel, and the capability of injecting sample plugs into any desired position of a microchannel. Herein, we demonstrate that the simple and cost-effective acupuncture sample injection method can be used for PDMS microchip-based field amplified sample stacking in the most simplified straight channel by applying a single potential. We achieved the increase in electropherogram signals for the case of sample stacking. Furthermore, we present that microchip CGE of ΦX174 DNA-HaeⅢ digest can be performed with the acupuncture injection method on a glass microchip while minimizing sample loss and voltage control hardware. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

FC and ZFC magnetic properties of ferro-spinels (MFe2O4) prepared by solution-combustion method

NASA Astrophysics Data System (ADS)

Aravind, G.; Kumar, R. Vijaya; Nathaniyal, V.; Rambabu, T.; Ravinder, D.

2017-07-01

Magnetic ferro-spinels MFe2O4 (M= Co and Ni) prepared by citrate-gel solution combustion method using metal nitrates with low sintering temperature (500°C). From the XRD and TEM studies confirm that a nano crystalline nature of the prepared samples. Field Cooled (FC) and Zero Field Cooled (ZFC) magnetic studies of the prepared ferro-spinels are measured by using vibrating sample magnetometer (VSM). The resultant magnetization of the prepared samples as a function of an applied magnetic field 10 T was measured at two different temperatures 5 K and 310 K. Field Cooled (FC) and Zero Field Cooled (ZFC) magnetization measurements under an applied field of 100 Oe and 1000 Oe in the temperature range of 5-375 K were carried out, which shows the blocking temperature of these two samples at around 350 K.

Comparison of methods for sampling plant bugs on cotton in South Texas (2010)

USDA-ARS?s Scientific Manuscript database

A total of 26 cotton fields were sampled by experienced and inexperienced samplers at 3 growth stages using 5 methods to compare the most efficient and accurate method for sampling plant bugs in cotton. Each of the 5 methods had its own distinct advantages and disadvantages as a sampling method (too...

76 FR 3119 - Availability for Exclusive, Non-Exclusive, or Partially-Exclusive Licensing of an Invention...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-19

... Partially-Exclusive Licensing of an Invention Concerning a Urinary Field Sampling Kit for the Determination.... Provisional Patent Application Serial No. 61/458,797, entitled ``Urinary Field Sampling Kit for the... INFORMATION: The invention relates to a urinary field sampling kit and method of its use for collecting and...

A Ground Truthing Method for AVIRIS Overflights Using Canopy Absorption Spectra

NASA Technical Reports Server (NTRS)

Gamon, John A.; Serrano, Lydia; Roberts, Dar A.; Ustin, Susan L.

1996-01-01

Remote sensing for ecological field studies requires ground truthing for accurate interpretation of remote imagery. However, traditional vegetation sampling methods are time consuming and hard to relate to the scale of an AVIRIS scene. The large errors associated with manual field sampling, the contrasting formats of remote and ground data, and problems with coregistration of field sites with AVIRIS pixels can lead to difficulties in interpreting AVIRIS data. As part of a larger study of fire risk in the Santa Monica Mountains of southern California, we explored a ground-based optical method of sampling vegetation using spectrometers mounted both above and below vegetation canopies. The goal was to use optical methods to provide a rapid, consistent, and objective means of "ground truthing" that could be related both to AVIRIS imagery and to conventional ground sampling (e.g., plot harvests and pigment assays).

Modulation infrared thermometry of caloric effects at up to kHz frequencies

NASA Astrophysics Data System (ADS)

Döntgen, Jago; Rudolph, Jörg; Waske, Anja; Hägele, Daniel

2018-03-01

We present a novel non-contact method for the direct measurement of caloric effects in low volume samples. The adiabatic temperature change ΔT of a magnetocaloric sample is very sensitively determined from thermal radiation. Rapid modulation of ΔT is induced by an oscillating external magnetic field. Detection of thermal radiation with a mercury-cadmium-telluride detector allows for measurements at field frequencies exceeding 1 kHz. In contrast to thermoacoustic methods, our method can be employed in vacuum which enhances adiabatic conditions especially in the case of small volume samples. Systematic measurements of the magnetocaloric effect as a function of temperature, magnetic field amplitude, and modulation frequency give a detailed picture of the thermal behavior of the sample. Highly sensitive measurements of the magnetocaloric effect are demonstrated on a 2 mm thick sample of gadolinium and a 60 μm thick Fe80B12Nb8 ribbon.

Soil Gas Sampling

EPA Pesticide Factsheets

Field Branches Quality System and Technical Procedures: This document describes general and specific procedures, methods and considerations to be used and observed when collecting soil gas samples for field screening or laboratory analysis.

29 CFR 1926.752 - Site layout, site-specific erection plan and construction sequence.

Code of Federal Regulations, 2011 CFR

2011-07-01

... standard test method of field-cured samples, either 75 percent of the intended minimum compressive design... the basis of an appropriate ASTM standard test method of field-cured samples, either 75 percent of the intended minimum compressive design strength or sufficient strength to support the loads imposed during...

29 CFR 1926.752 - Site layout, site-specific erection plan and construction sequence.

Code of Federal Regulations, 2013 CFR

2013-07-01

... standard test method of field-cured samples, either 75 percent of the intended minimum compressive design... the basis of an appropriate ASTM standard test method of field-cured samples, either 75 percent of the intended minimum compressive design strength or sufficient strength to support the loads imposed during...

29 CFR 1926.752 - Site layout, site-specific erection plan and construction sequence.

Code of Federal Regulations, 2012 CFR

2012-07-01

... standard test method of field-cured samples, either 75 percent of the intended minimum compressive design... the basis of an appropriate ASTM standard test method of field-cured samples, either 75 percent of the intended minimum compressive design strength or sufficient strength to support the loads imposed during...

29 CFR 1926.752 - Site layout, site-specific erection plan and construction sequence.

Code of Federal Regulations, 2010 CFR

2010-07-01

... standard test method of field-cured samples, either 75 percent of the intended minimum compressive design... the basis of an appropriate ASTM standard test method of field-cured samples, either 75 percent of the intended minimum compressive design strength or sufficient strength to support the loads imposed during...

29 CFR 1926.752 - Site layout, site-specific erection plan and construction sequence.

Code of Federal Regulations, 2014 CFR

2014-07-01

... standard test method of field-cured samples, either 75 percent of the intended minimum compressive design... the basis of an appropriate ASTM standard test method of field-cured samples, either 75 percent of the intended minimum compressive design strength or sufficient strength to support the loads imposed during...

Monitoring benthic aIgal communides: A comparison of targeted and coefficient sampling methods

USGS Publications Warehouse

Edwards, Matthew S.; Tinker, M. Tim

2009-01-01

Choosing an appropriate sample unit is a fundamental decision in the design of ecological studies. While numerous methods have been developed to estimate organism abundance, they differ in cost, accuracy and precision.Using both field data and computer simulation modeling, we evaluated the costs and benefits associated with two methods commonly used to sample benthic organisms in temperate kelp forests. One of these methods, the Targeted Sampling method, relies on different sample units, each "targeted" for a specific species or group of species while the other method relies on coefficients that represent ranges of bottom cover obtained from visual esti-mates within standardized sample units. Both the field data and the computer simulations suggest that both methods yield remarkably similar estimates of organism abundance and among-site variability, although the Coefficient method slightly underestimates variability among sample units when abundances are low. In contrast, the two methods differ considerably in the effort needed to sample these communities; the Targeted Sampling requires more time and twice the personnel to complete. We conclude that the Coefficent Sampling method may be better for environmental monitoring programs where changes in mean abundance are of central concern and resources are limiting, but that the Targeted sampling methods may be better for ecological studies where quantitative relationships among species and small-scale variability in abundance are of central concern.

Characterization of YBa2Cu3O7, including critical current density Jc, by trapped magnetic field

NASA Technical Reports Server (NTRS)

Chen, In-Gann; Liu, Jianxiong; Weinstein, Roy; Lau, Kwong

1992-01-01

Spatial distributions of persistent magnetic field trapped by sintered and melt-textured ceramic-type high-temperature superconductor (HTS) samples have been studied. The trapped field can be reproduced by a model of the current consisting of two components: (1) a surface current Js and (2) a uniform volume current Jv. This Js + Jv model gives a satisfactory account of the spatial distribution of the magnetic field trapped by different types of HTS samples. The magnetic moment can be calculated, based on the Js + Jv model, and the result agrees well with that measured by standard vibrating sample magnetometer (VSM). As a consequence, Jc predicted by VSM methods agrees with Jc predicted from the Js + Jv model. The field mapping method described is also useful to reveal the granular structure of large HTS samples and regions of weak links.

Excellent field emission properties of vertically oriented CuO nanowire films

NASA Astrophysics Data System (ADS)

Feng, Long; Yan, Hui; Li, Heng; Zhang, Rukang; Li, Zhe; Chi, Rui; Yang, Shuaiyu; Ma, Yaya; Fu, Bin; Liu, Jiwen

2018-04-01

Oriented CuO nanowire films were synthesized on a large scale using simple method of direct heating copper grids in air. The field emission properties of the sample can be enhanced by improving the aspect ratio of the nanowires just through a facile method of controlling the synthesis conditions. Although the density of the nanowires is large enough, the screen effect is not an important factor in this field emission process because few nanowires sticking out above the rest. Benefiting from the unique geometrical and structural features, the CuO nanowire samples show excellent field emission (FE) properties. The FE measurements of CuO nanowire films illustrate that the sample synthesized at 500 °C for 8 h has a comparatively low turn-on field of 0.68 V/μm, a low threshold field of 1.1 V/μm, and a large field enhancement factor β of 16782 (a record high value for CuO nanostructures, to the best of our knowledge), indicating that the samples are promising candidates for field emission applications.

High-resolution nuclear magnetic resonance measurements in inhomogeneous magnetic fields: A fast two-dimensional J-resolved experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Yuqing; Cai, Shuhui; Yang, Yu

2016-03-14

High spectral resolution in nuclear magnetic resonance (NMR) is a prerequisite for achieving accurate information relevant to molecular structures and composition assignments. The continuous development of superconducting magnets guarantees strong and homogeneous static magnetic fields for satisfactory spectral resolution. However, there exist circumstances, such as measurements on biological tissues and heterogeneous chemical samples, where the field homogeneity is degraded and spectral line broadening seems inevitable. Here we propose an NMR method, named intermolecular zero-quantum coherence J-resolved spectroscopy (iZQC-JRES), to face the challenge of field inhomogeneity and obtain desired high-resolution two-dimensional J-resolved spectra with fast acquisition. Theoretical analyses for this methodmore » are given according to the intermolecular multiple-quantum coherence treatment. Experiments on (a) a simple chemical solution and (b) an aqueous solution of mixed metabolites under externally deshimmed fields, and on (c) a table grape sample with intrinsic field inhomogeneity from magnetic susceptibility variations demonstrate the feasibility and applicability of the iZQC-JRES method. The application of this method to inhomogeneous chemical and biological samples, maybe in vivo samples, appears promising.« less

Attenuation correction factors for cylindrical, disc and box geometry

NASA Astrophysics Data System (ADS)

Agarwal, Chhavi; Poi, Sanhita; Mhatre, Amol; Goswami, A.; Gathibandhe, M.

2009-08-01

In the present study, attenuation correction factors have been experimentally determined for samples having cylindrical, disc and box geometry and compared with the attenuation correction factors calculated by Hybrid Monte Carlo (HMC) method [ C. Agarwal, S. Poi, A. Goswami, M. Gathibandhe, R.A. Agrawal, Nucl. Instr. and. Meth. A 597 (2008) 198] and with the near-field and far-field formulations available in literature. It has been observed that the near-field formulae, although said to be applicable at close sample-detector geometry, does not work at very close sample-detector configuration. The advantage of the HMC method is that it is found to be valid for all sample-detector geometries.

Geostatistical Sampling Methods for Efficient Uncertainty Analysis in Flow and Transport Problems

NASA Astrophysics Data System (ADS)

Liodakis, Stylianos; Kyriakidis, Phaedon; Gaganis, Petros

2015-04-01

In hydrogeological applications involving flow and transport of in heterogeneous porous media the spatial distribution of hydraulic conductivity is often parameterized in terms of a lognormal random field based on a histogram and variogram model inferred from data and/or synthesized from relevant knowledge. Realizations of simulated conductivity fields are then generated using geostatistical simulation involving simple random (SR) sampling and are subsequently used as inputs to physically-based simulators of flow and transport in a Monte Carlo framework for evaluating the uncertainty in the spatial distribution of solute concentration due to the uncertainty in the spatial distribution of hydraulic con- ductivity [1]. Realistic uncertainty analysis, however, calls for a large number of simulated concentration fields; hence, can become expensive in terms of both time and computer re- sources. A more efficient alternative to SR sampling is Latin hypercube (LH) sampling, a special case of stratified random sampling, which yields a more representative distribution of simulated attribute values with fewer realizations [2]. Here, term representative implies realizations spanning efficiently the range of possible conductivity values corresponding to the lognormal random field. In this work we investigate the efficiency of alternative methods to classical LH sampling within the context of simulation of flow and transport in a heterogeneous porous medium. More precisely, we consider the stratified likelihood (SL) sampling method of [3], in which attribute realizations are generated using the polar simulation method by exploring the geometrical properties of the multivariate Gaussian distribution function. In addition, we propose a more efficient version of the above method, here termed minimum energy (ME) sampling, whereby a set of N representative conductivity realizations at M locations is constructed by: (i) generating a representative set of N points distributed on the surface of a M-dimensional, unit radius hyper-sphere, (ii) relocating the N points on a representative set of N hyper-spheres of different radii, and (iii) transforming the coordinates of those points to lie on N different hyper-ellipsoids spanning the multivariate Gaussian distribution. The above method is applied in a dimensionality reduction context by defining flow-controlling points over which representative sampling of hydraulic conductivity is performed, thus also accounting for the sensitivity of the flow and transport model to the input hydraulic conductivity field. The performance of the various stratified sampling methods, LH, SL, and ME, is compared to that of SR sampling in terms of reproduction of ensemble statistics of hydraulic conductivity and solute concentration for different sample sizes N (numbers of realizations). The results indicate that ME sampling constitutes an equally if not more efficient simulation method than LH and SL sampling, as it can reproduce to a similar extent statistics of the conductivity and concentration fields, yet with smaller sampling variability than SR sampling. References [1] Gutjahr A.L. and Bras R.L. Spatial variability in subsurface flow and transport: A review. Reliability Engineering & System Safety, 42, 293-316, (1993). [2] Helton J.C. and Davis F.J. Latin hypercube sampling and the propagation of uncertainty in analyses of complex systems. Reliability Engineering & System Safety, 81, 23-69, (2003). [3] Switzer P. Multiple simulation of spatial fields. In: Heuvelink G, Lemmens M (eds) Proceedings of the 4th International Symposium on Spatial Accuracy Assessment in Natural Resources and Environmental Sciences, Coronet Books Inc., pp 629?635 (2000).

General introduction for the “National Field Manual for the Collection of Water-Quality Data”

USGS Publications Warehouse

,

2018-02-28

BackgroundAs part of its mission, the U.S. Geological Survey (USGS) collects data to assess the quality of our Nation’s water resources. A high degree of reliability and standardization of these data are paramount to fulfilling this mission. Documentation of nationally accepted methods used by USGS personnel serves to maintain consistency and technical quality in data-collection activities. “The National Field Manual for the Collection of Water-Quality Data” (NFM) provides documented guidelines and protocols for USGS field personnel who collect water-quality data. The NFM provides detailed, comprehensive, and citable procedures for monitoring the quality of surface water and groundwater. Topics in the NFM include (1) methods and protocols for sampling water resources, (2) methods for processing samples for analysis of water quality, (3) methods for measuring field parameters, and (4) specialized procedures, such as sampling water for low levels of mercury and organic wastewater chemicals, measuring biological indicators, and sampling bottom sediment for chemistry. Personnel who collect water-quality data for national USGS programs and projects, including projects supported by USGS cooperative programs, are mandated to use protocols provided in the NFM per USGS Office of Water Quality Technical Memorandum 2002.13. Formal training, for example, as provided in the USGS class, “Field Water-Quality Methods for Groundwater and Surface Water,” and field apprenticeships supplement the guidance provided in the NFM and ensure that the data collected are high quality, accurate, and scientifically defensible.

Calorimetric method of ac loss measurement in a rotating magnetic field.

PubMed

Ghoshal, P K; Coombs, T A; Campbell, A M

2010-07-01

A method is described for calorimetric ac-loss measurements of high-T(c) superconductors (HTS) at 80 K. It is based on a technique used at 4.2 K for conventional superconducting wires that allows an easy loss measurement in parallel or perpendicular external field orientation. This paper focuses on ac loss measurement setup and calibration in a rotating magnetic field. This experimental setup is to demonstrate measuring loss using a temperature rise method under the influence of a rotating magnetic field. The slight temperature increase of the sample in an ac-field is used as a measure of losses. The aim is to simulate the loss in rotating machines using HTS. This is a unique technique to measure total ac loss in HTS at power frequencies. The sample is mounted on to a cold finger extended from a liquid nitrogen heat exchanger (HEX). The thermal insulation between the HEX and sample is provided by a material of low thermal conductivity, and low eddy current heating sample holder in vacuum vessel. A temperature sensor and noninductive heater have been incorporated in the sample holder allowing a rapid sample change. The main part of the data is obtained in the calorimetric measurement is used for calibration. The focus is on the accuracy and calibrations required to predict the actual ac losses in HTS. This setup has the advantage of being able to measure the total ac loss under the influence of a continuous moving field as experienced by any rotating machines.

Comparison of three sampling and analytical methods for the determination of airborne hexavalent chromium.

PubMed

Boiano, J M; Wallace, M E; Sieber, W K; Groff, J H; Wang, J; Ashley, K

2000-08-01

A field study was conducted with the goal of comparing the performance of three recently developed or modified sampling and analytical methods for the determination of airborne hexavalent chromium (Cr(VI)). The study was carried out in a hard chrome electroplating facility and in a jet engine manufacturing facility where airborne Cr(VI) was expected to be present. The analytical methods evaluated included two laboratory-based procedures (OSHA Method ID-215 and NIOSH Method 7605) and a field-portable method (NIOSH Method 7703). These three methods employ an identical sampling methodology: collection of Cr(VI)-containing aerosol on a polyvinyl chloride (PVC) filter housed in a sampling cassette, which is connected to a personal sampling pump calibrated at an appropriate flow rate. The basis of the analytical methods for all three methods involves extraction of the PVC filter in alkaline buffer solution, chemical isolation of the Cr(VI) ion, complexation of the Cr(VI) ion with 1,5-diphenylcarbazide, and spectrometric measurement of the violet chromium diphenylcarbazone complex at 540 nm. However, there are notable specific differences within the sample preparation procedures used in three methods. To assess the comparability of the three measurement protocols, a total of 20 side-by-side air samples were collected, equally divided between a chromic acid electroplating operation and a spray paint operation where water soluble forms of Cr(VI) were used. A range of Cr(VI) concentrations from 0.6 to 960 microg m(-3), with Cr(VI) mass loadings ranging from 0.4 to 32 microg, was measured at the two operations. The equivalence of the means of the log-transformed Cr(VI) concentrations obtained from the different analytical methods was compared. Based on analysis of variance (ANOVA) results, no statistically significant differences were observed between mean values measured using each of the three methods. Small but statistically significant differences were observed between results obtained from performance evaluation samples for the NIOSH field method and the OSHA laboratory method.

DNA Everywhere. A Guide for Simplified Environmental Genomic DNA Extraction Suitable for Use in Remote Areas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gabrielle N. Pecora; Francine C. Reid; Lauren M. Tom

2016-05-01

Collecting field samples from remote or geographically distant areas can be a financially and logistically challenging. With participation of a local organization where the samples are originated from, gDNA samples can be extracted from the field and shipped to a research institution for further processing and analysis. The ability to set up gDNA extraction capabilities in the field can drastically reduce cost and time when running long-term microbial studies with a large sample set. The method outlined here has developed a compact and affordable method for setting up a “laboratory” and extracting and shipping gDNA samples from anywhere in themore » world. This white paper explains the process of setting up the “laboratory”, choosing and training individuals with no prior scientific experience how to perform gDNA extractions and safe methods for shipping extracts to any research institution. All methods have been validated by the Andersen group at Lawrence Berkeley National Laboratory using the Berkeley Lab PhyloChip.« less

Calculation of susceptibility through multiple orientation sampling (COSMOS): a method for conditioning the inverse problem from measured magnetic field map to susceptibility source image in MRI.

PubMed

Liu, Tian; Spincemaille, Pascal; de Rochefort, Ludovic; Kressler, Bryan; Wang, Yi

2009-01-01

Magnetic susceptibility differs among tissues based on their contents of iron, calcium, contrast agent, and other molecular compositions. Susceptibility modifies the magnetic field detected in the MR signal phase. The determination of an arbitrary susceptibility distribution from the induced field shifts is a challenging, ill-posed inverse problem. A method called "calculation of susceptibility through multiple orientation sampling" (COSMOS) is proposed to stabilize this inverse problem. The field created by the susceptibility distribution is sampled at multiple orientations with respect to the polarization field, B(0), and the susceptibility map is reconstructed by weighted linear least squares to account for field noise and the signal void region. Numerical simulations and phantom and in vitro imaging validations demonstrated that COSMOS is a stable and precise approach to quantify a susceptibility distribution using MRI.

Magnetic irreversibility: An important amendment in the zero-field-cooling and field-cooling method

NASA Astrophysics Data System (ADS)

Teixeira Dias, Fábio; das Neves Vieira, Valdemar; Esperança Nunes, Sabrina; Pureur, Paulo; Schaf, Jacob; Fernanda Farinela da Silva, Graziele; de Paiva Gouvêa, Cristol; Wolff-Fabris, Frederik; Kampert, Erik; Obradors, Xavier; Puig, Teresa; Roa Rovira, Joan Josep

2016-02-01

The present work reports about experimental procedures to correct significant deviations of magnetization data, caused by magnetic relaxation, due to small field cycling by sample transport in the inhomogeneous applied magnetic field of commercial magnetometers. The extensively used method for measuring the magnetic irreversibility by first cooling the sample in zero field, switching on a constant applied magnetic field and measuring the magnetization M(T) while slowly warming the sample, and subsequently measuring M(T) while slowly cooling it back in the same field, is very sensitive even to small displacement of the magnetization curve. In our melt-processed YBaCuO superconducting sample we observed displacements of the irreversibility limit up to 7 K in high fields. Such displacements are detected only on confronting the magnetic irreversibility limit with other measurements, like for instance zero resistance, in which the sample remains fixed and so is not affected by such relaxation. We measured the magnetic irreversibility, Tirr(H), using a vibrating sample magnetometer (VSM) from Quantum Design. The zero resistance data, Tc0(H), were obtained using a PPMS from Quantum Design. On confronting our irreversibility lines with those of zero resistance, we observed that the Tc0(H) data fell several degrees K above the Tirr(H) data, which obviously contradicts the well known properties of superconductivity. In order to get consistent Tirr(H) data in the H-T plane, it was necessary to do a lot of additional measurements as a function of the amplitude of the sample transport and extrapolate the Tirr(H) data for each applied field to zero amplitude.

Chemicals of emerging concern in water and bottom sediment in Great Lakes areas of concern, 2010 to 2011-Collection methods, analyses methods, quality assurance, and data

USGS Publications Warehouse

Lee, Kathy E.; Langer, Susan K.; Menheer, Michael A.; Foreman, William T.; Furlong, Edward T.; Smith, Steven G.

2012-01-01

The U.S. Geological Survey (USGS) cooperated with the U.S. Environmental Protection Agency and the U.S. Fish and Wildlife Service on a study to identify the occurrence of chemicals of emerging concern (CECs) in water and bottom-sediment samples collected during 2010–11 at sites in seven areas of concern (AOCs) throughout the Great Lakes. Study sites include tributaries to the Great Lakes in AOCs located near Duluth, Minn.; Green Bay, Wis.; Roches­ter, N.Y.; Detroit, Mich.; Toledo, Ohio; Milwaukee, Wis.; and Ashtabula, Ohio. This report documents the collection meth­ods, analyses methods, quality-assurance data and analyses, and provides the data for this study. Water and bottom-sediment samples were analyzed at the USGS National Water Quality Laboratory in Denver, Colo., for a broad suite of CECs. During this study, 135 environmental and 23 field dupli­cate samples of surface water and wastewater effluent, 10 field blank water samples, and 11 field spike water samples were collected and analyzed. Sixty-one of the 69 wastewater indicator chemicals (laboratory method 4433) analyzed were detected at concentrations ranging from 0.002 to 11.2 micrograms per liter. Twenty-eight of the 48 pharmaceuticals (research method 8244) analyzed were detected at concentrations ranging from 0.0029 to 22.0 micro­grams per liter. Ten of the 20 steroid hormones and sterols analyzed (research method 4434) were detected at concentrations ranging from 0.16 to 10,000 nanograms per liter. During this study, 75 environmental, 13 field duplicate samples, and 9 field spike samples of bottom sediment were collected and analyzed for a wide variety of CECs. Forty-seven of the 57 wastewater indicator chemicals (laboratory method 5433) analyzed were detected at concentrations ranging from 0.921 to 25,800 nanograms per gram. Seventeen of the 20 steroid hormones and sterols (research method 6434) analyzed were detected at concentrations ranging from 0.006 to 8,921 nanograms per gram. Twelve of the 20 pharmaceuticals (research method 8244) analyzed were detected at concentrations ranging from 2.35 to 453.5 nanograms per gram. Six of the 11 antidepressants (research method 9008) analyzed were detected at concentrations ranging from 2.79 to 91.6 nanograms per gram.

Integral imaging based light field display with enhanced viewing resolution using holographic diffuser

NASA Astrophysics Data System (ADS)

Yan, Zhiqiang; Yan, Xingpeng; Jiang, Xiaoyu; Gao, Hui; Wen, Jun

2017-11-01

An integral imaging based light field display method is proposed by use of holographic diffuser, and enhanced viewing resolution is gained over conventional integral imaging systems. The holographic diffuser is fabricated with controlled diffusion characteristics, which interpolates the discrete light field of the reconstructed points to approximate the original light field. The viewing resolution can thus be improved and independent of the limitation imposed by Nyquist sampling frequency. An integral imaging system with low Nyquist sampling frequency is constructed, and reconstructed scenes of high viewing resolution using holographic diffuser are demonstrated, verifying the feasibility of the method.

Prediction of cyclohexane-water distribution coefficient for SAMPL5 drug-like compounds with the QMPFF3 and ARROW polarizable force fields.

PubMed

Kamath, Ganesh; Kurnikov, Igor; Fain, Boris; Leontyev, Igor; Illarionov, Alexey; Butin, Oleg; Olevanov, Michael; Pereyaslavets, Leonid

2016-11-01

We present the performance of blind predictions of water-cyclohexane distribution coefficients for 53 drug-like compounds in the SAMPL5 challenge by three methods currently in use within our group. Two of them utilize QMPFF3 and ARROW, polarizable force-fields of varying complexity, and the third uses the General Amber Force-Field (GAFF). The polarizable FF's are implemented in an in-house MD package, Arbalest. We find that when we had time to parametrize the functional groups with care (batch 0), the polarizable force-fields outperformed the non-polarizable one. Conversely, on the full set of 53 compounds, GAFF performed better than both QMPFF3 and ARROW. We also describe the torsion-restrain method we used to improve sampling of molecular conformational space and thus the overall accuracy of prediction. The SAMPL5 challenge highlighted several drawbacks of our force-fields, such as our significant systematic over-estimation of hydrophobic interactions, specifically for alkanes and aromatic rings.

Efficacy of a lead based paint XRF analyzer and a commercially available colorimetric lead test kit as qualitative field tools for determining presence of lead in religious powders.

PubMed

Shah, Manthan P; Shendell, Derek G; Meng, Qingyu; Ohman-Strickland, Pamela; Halperin, William

2018-04-23

The performances of a portable X-Ray Fluorescence (XRF) lead paint analyzer (RMD LPA-1, Protec Instrument Corp., Waltham, MA) and a commercially available colorimetric lead test kit (First Alert Lead Test Kit, eAccess Solutions, Inc., Palatine, IL) were evaluated for use by local or state health departments as potential cost-effective rapid analysis or "spot test" field techniques for tentative identification of lead content in sindoor powders. For both field-sampling methods, sensitivity, specificity and predictive values varied widely for samples containing <300,000 μg/g lead. For samples containing ≥300,000 μg/g lead, the aforementioned metrics were 100% (however, the CIs had a wide range). In addition, both field sampling methods showed clear, consistent positive readings only for samples containing ≥300,000 μg/g lead. Even samples with lead content as high as 5,110 μg/g were not positively identified by either field analysis technique. The results of this study suggest the XRF analyzer and colorimetric lead test kit cannot be used as a rapid field test for sindoor by health department inspectors.

Comparison of geochemical data obtained using four brine sampling methods at the SECARB Phase III Anthropogenic Test CO2 injection site, Citronelle Oil Field, Alabama

USGS Publications Warehouse

Conaway, Christopher; Thordsen, James J.; Manning, Michael A.; Cook, Paul J.; Trautz, Robert C.; Thomas, Burt; Kharaka, Yousif K.

2016-01-01

The chemical composition of formation water and associated gases from the lower Cretaceous Paluxy Formation was determined using four different sampling methods at a characterization well in the Citronelle Oil Field, Alabama, as part of the Southeast Regional Carbon Sequestration Partnership (SECARB) Phase III Anthropogenic Test, which is an integrated carbon capture and storage project. In this study, formation water and gas samples were obtained from well D-9-8 #2 at Citronelle using gas lift, electric submersible pump, U-tube, and a downhole vacuum sampler (VS) and subjected to both field and laboratory analyses. Field chemical analyses included electrical conductivity, dissolved sulfide concentration, alkalinity, and pH; laboratory analyses included major, minor and trace elements, dissolved carbon, volatile fatty acids, free and dissolved gas species. The formation water obtained from this well is a Na–Ca–Cl-type brine with a salinity of about 200,000 mg/L total dissolved solids. Differences were evident between sampling methodologies, particularly in pH, Fe and alkalinity. There was little gas in samples, and gas composition results were strongly influenced by sampling methods. The results of the comparison demonstrate the difficulty and importance of preserving volatile analytes in samples, with the VS and U-tube system performing most favorably in this aspect.

Syringe filtration methods for examining dissolved and colloidal trace element distributions in remote field locations

NASA Technical Reports Server (NTRS)

Shiller, Alan M.

2003-01-01

It is well-established that sampling and sample processing can easily introduce contamination into dissolved trace element samples if precautions are not taken. However, work in remote locations sometimes precludes bringing bulky clean lab equipment into the field and likewise may make timely transport of samples to the lab for processing impossible. Straightforward syringe filtration methods are described here for collecting small quantities (15 mL) of 0.45- and 0.02-microm filtered river water in an uncontaminated manner. These filtration methods take advantage of recent advances in analytical capabilities that require only small amounts of waterfor analysis of a suite of dissolved trace elements. Filter clogging and solute rejection artifacts appear to be minimal, although some adsorption of metals and organics does affect the first approximately 10 mL of water passing through the filters. Overall the methods are clean, easy to use, and provide reproducible representations of the dissolved and colloidal fractions of trace elements in river waters. Furthermore, sample processing materials can be prepared well in advance in a clean lab and transported cleanly and compactly to the field. Application of these methods is illustrated with data from remote locations in the Rocky Mountains and along the Yukon River. Evidence from field flow fractionation suggests that the 0.02-microm filters may provide a practical cutoff to distinguish metals associated with small inorganic and organic complexes from those associated with silicate and oxide colloids.

Field efficiency and bias of snag inventory methods

Treesearch

Robert S. Kenning; Mark J. Ducey; John C. Brissette; Jeffery H. Gove

2005-01-01

Snags and cavity trees are important components of forests, but can be difficult to inventory precisely and are not always included in inventories because of limited resources. We tested the application of N-tree distance sampling as a time-saving snag sampling method and compared N-tree distance sampling to fixed-area sampling and modified horizontal line sampling in...

A field study of selected U.S. Geological Survey analytical methods for measuring pesticides in filtered stream water, June - September 2012

USGS Publications Warehouse

Martin, Jeffrey D.; Norman, Julia E.; Sandstrom, Mark W.; Rose, Claire E.

2017-09-06

U.S. Geological Survey monitoring programs extensively used two analytical methods, gas chromatography/mass spectrometry and liquid chromatography/mass spectrometry, to measure pesticides in filtered water samples during 1992–2012. In October 2012, the monitoring programs began using direct aqueous-injection liquid chromatography tandem mass spectrometry as a new analytical method for pesticides. The change in analytical methods, however, has the potential to inadvertently introduce bias in analysis of datasets that span the change.A field study was designed to document performance of the new method in a variety of stream-water matrices and to quantify any potential changes in measurement bias or variability that could be attributed to changes in analytical methods. The goals of the field study were to (1) summarize performance (bias and variability of pesticide recovery) of the new method in a variety of stream-water matrices; (2) compare performance of the new method in laboratory blank water (laboratory reagent spikes) to that in a variety of stream-water matrices; (3) compare performance (analytical recovery) of the new method to that of the old methods in a variety of stream-water matrices; (4) compare pesticide detections and concentrations measured by the new method to those of the old methods in a variety of stream-water matrices; (5) compare contamination measured by field blank water samples in old and new methods; (6) summarize the variability of pesticide detections and concentrations measured by the new method in field duplicate water samples; and (7) identify matrix characteristics of environmental water samples that adversely influence the performance of the new method. Stream-water samples and a variety of field quality-control samples were collected at 48 sites in the U.S. Geological Survey monitoring networks during June–September 2012. Stream sites were located across the United States and included sites in agricultural and urban land-use settings, as well as sites on major rivers.The results of the field study identified several challenges for the analysis and interpretation of data analyzed by both old and new methods, particularly when data span the change in methods and are combined for analysis of temporal trends in water quality. The main challenges identified are large (greater than 30 percent), statistically significant differences in analytical recovery, detection capability, and (or) measured concentrations for selected pesticides. These challenges are documented and discussed, but specific guidance or statistical methods to resolve these differences in methods are beyond the scope of the report. The results of the field study indicate that the implications of the change in analytical methods must be assessed individually for each pesticide and method.Understanding the possible causes of the systematic differences in concentrations between methods that remain after recovery adjustment might be necessary to determine how to account for the differences in data analysis. Because recoveries for each method are independently determined from separate reference standards and spiking solutions, the differences might be due to an error in one of the reference standards or solutions or some other basic aspect of standard procedure in the analytical process. Further investigation of the possible causes is needed, which will lead to specific decisions on how to compensate for these differences in concentrations in data analysis. In the event that further investigations do not provide insight into the causes of systematic differences in concentrations between methods, the authors recommend continuing to collect and analyze paired environmental water samples by both old and new methods. This effort should be targeted to seasons, sites, and expected concentrations to supplement those concentrations already assessed and to compare the ongoing analytical recovery of old and new methods to those observed in the summer and fall of 2012.

Validation of DESS as a DNA Preservation Method for the Detection of Strongyloides spp. in Canine Feces.

PubMed

Beknazarova, Meruyert; Millsteed, Shelby; Robertson, Gemma; Whiley, Harriet; Ross, Kirstin

2017-06-09

Strongyloides stercoralis is a gastrointestinal parasitic nematode with a life cycle that includes free-living and parasitic forms. For both clinical (diagnostic) and environmental evaluation, it is important that we can detect Strongyloides spp. in both human and non-human fecal samples. Real-time PCR is the most feasible method for detecting the parasite in both clinical and environmental samples that have been preserved. However, one of the biggest challenges with PCR detection is DNA degradation during the postage time from rural and remote areas to the laboratory. This study included a laboratory assessment and field validation of DESS (dimethyl sulfoxide, disodium EDTA, and saturated NaCl) preservation of Strongyloides spp. DNA in fecal samples. The laboratory study investigated the capacity of 1:1 and 1:3 sample to DESS ratios to preserve Strongyloides ratti in spike canine feces. It was found that both ratios of DESS significantly prevented DNA degradation compared to the untreated sample. This method was then validated by applying it to the field-collected canine feces and detecting Strongyloides DNA using PCR. A total of 37 canine feces samples were collected and preserved in the 1:3 ratio (sample: DESS) and of these, 17 were positive for Strongyloides spp. The study shows that both 1:1 and 1:3 sample to DESS ratios were able to preserve the Strongyloides spp. DNA in canine feces samples stored at room temperature for up to 56 days. This DESS preservation method presents the most applicable and feasible method for the Strongyloides DNA preservation in field-collected feces.

Benthic macroinvertebrate field sampling effort required to ...

EPA Pesticide Factsheets

This multi-year pilot study evaluated a proposed field method for its effectiveness in the collection of a benthic macroinvertebrate sample adequate for use in the condition assessment of streams and rivers in the Neuquén Province, Argentina. A total of 13 sites, distributed across three rivers, were sampled. At each site, benthic macroinvertebrates were collected at 11 transects. Each sample was processed independently in the field and laboratory. Based on a literature review and resource considerations, the collection of 300 organisms (minimum) at each site was determined to be necessary to support a robust condition assessment, and therefore, selected as the criterion for judging the adequacy of the method. This targeted number of organisms was collected at all sites, at a minimum, when collections from all 11 transects were combined. Subsequent bootstrapping analysis of data was used to estimate whether collecting at fewer transects would reach the minimum target number of organisms for all sites. In a subset of sites, the total number of organisms frequently fell below the target when fewer than 11 transects collections were combined.Site conditions where <300 organisms might be collected are discussed. These preliminary results suggest that the proposed field method results in a sample that is adequate for robust condition assessment of the rivers and streams of interest. When data become available from a broader range of sites, the adequacy of the field

Application toward Confocal Full-Field Microscopic X-ray Absorption Near Edge Structure Spectroscopy.

PubMed

Tack, Pieter; Vekemans, Bart; Laforce, Brecht; Rudloff-Grund, Jennifer; Hernández, Willinton Y; Garrevoet, Jan; Falkenberg, Gerald; Brenker, Frank; Van Der Voort, Pascal; Vincze, Laszlo

2017-02-07

Using X-ray absorption near edge structure (XANES) spectroscopy, information on the local chemical structure and oxidation state of an element of interest can be acquired. Conventionally, this information can be obtained in a spatially resolved manner by scanning a sample through a focused X-ray beam. Recently, full-field methods have been developed to obtain direct 2D chemical state information by imaging a large sample area. These methods are usually in transmission mode, thus restricting the use to thin and transmitting samples. Here, a fluorescence method is displayed using an energy-dispersive pnCCD detector, the SLcam, characterized by measurement times far superior to what is generally applicable. Additionally, this method operates in confocal mode, thus providing direct 3D spatially resolved chemical state information from a selected subvolume of a sample, without the need of rotating a sample. The method is applied to two samples: a gold-supported magnesia catalyst (Au/MgO) and a natural diamond containing Fe-rich inclusions. Both samples provide XANES spectra that can be overlapped with reference XANES spectra, allowing this method to be used for fingerprinting and linear combination analysis of known XANES reference compounds.

Lunar paleointensities via the IRMs normalization method and the early magnetic history of the moon. [saturation remanence

NASA Technical Reports Server (NTRS)

Cisowski, S. M.; Fuller, M.

1986-01-01

A method for determining a planetary body's magnetic field environment over time is proposed. This relative paleointensity method is based on the normalization of natural remanence to saturation remanence magnetization as measured after each sample is exposed to a strong magnetic field. It is shown that this method is well suited to delineating order-of-magnitude changes in magnetizing fields.

Optical method for distance and displacement measurements of the probe-sample separation in a scanning near-field optical microscope

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santamaria, L.; Siller, H. R.; Garcia-Ortiz, C. E., E-mail: cegarcia@cicese.mx

In this work, we present an alternative optical method to determine the probe-sample separation distance in a scanning near-field optical microscope. The experimental method is based in a Lloyd’s mirror interferometer and offers a measurement precision deviation of ∼100 nm using digital image processing and numerical analysis. The technique can also be strategically combined with the characterization of piezoelectric actuators and stability evaluation of the optical system. It also opens the possibility for the development of an automatic approximation control system valid for probe-sample distances from 5 to 500 μm.

COMPARISON OF LABORATORY SUBSAMPLING METHODS OF BENTHIC SAMPLES FROM BOATABLE RIVERS USING ACTUAL AND SIMULATED COUNT DATA

EPA Science Inventory

We examined the effects of using a fixed-count subsample of 300 organisms on metric values using macroinvertebrate samples collected with 3 field sampling methods at 12 boatable river sites. For each sample, we used metrics to compare an initial fixed-count subsample of approxima...

Adaptations of the Saker-Solomons test: simple, reliable colorimetric field assays for chloroquine and its metabolites in urine.

PubMed

Mount, D L; Nahlen, B L; Patchen, L C; Churchill, F C

1989-01-01

Two field-adapted colorimetric methods for measuring the antimalarial drug chloroquine in urine are described. Both are modifications of the method of Saker and Solomons for screening urine for phencyclidine and other drugs of abuse, using the colour reagent tetrabromophenolphthalein ethyl ester. One method is semiquantitative, detecting the presence of chloroquine (Cq) and its metabolites in urine with a 1 microgram/ml detection limit; it is more sensitive and reliable than the commonly used Dill-Glazko method and is as easy to apply in the field. The second method uses a hand-held, battery-operated filter photometer to quantify Cq and its metabolites with a 2 microgram/ml detection limit and a linear range up to 8 micrograms/ml. The first method was validated in the field using a published quantitative colorimetric method and samples from a malaria study in Nigeria. The second method was validated in the laboratory against high-performance liquid chromatographic results on paired samples from the Nigerian study. Both methods may be used in remote locations where malaria is endemic and no electricity is available.

Chemicals of emerging concern in water and bottom sediment in the Great Lakes Basin, 2012: collection methods, analytical methods, quality assurance, and study data

USGS Publications Warehouse

Lee, Kathy E.; Langer, Susan K.; Menheer, Michael A.; Hansen, Donald S.; Foreman, William T.; Furlong, Edward T.; Jorgenson, Zachary G.; Choy, Steven J.; Moore, Jeremy N.; Banda, JoAnn; Gefell, Daniel J.

2015-01-01

During this study, 53 environmental samples, 4 field duplicate samples, and 8 field spike samples of bottom sediment and laboratory matrix-spike samples were analyzed for a wide variety of CECs at the USGS National Water Quality Laboratory using laboratory schedule 5433 for wastewater indicators; research method 6434 for steroid hormones, sterols, and bisphenol A; and research method 9008 for human-use pharmaceuticals and antidepressants. Forty of the 57 chemicals analyzed using laboratory schedule 5433 had detectable concentrations ranging from 1 to 49,000 micrograms per kilogram. Fourteen of the 20 chemicals analyzed using research method 6434 had detectable concentrations ranging from 0.04 to 24,940 nanograms per gram. Ten of the 20 chemicals analyzed using research method 9008 had detectable concentrations ranging from 0.59 to 197.5 micrograms per kilogram. Five of the 11 chemicals analyzed using research method 9008 had detectable concentrations ranging from 1.16 to 25.0 micrograms per kilogram.

Comparison of Adsorbed Mercury Screening Method With Cold-Vapor Atomic Absorption Spectrophotometry for Determination of Mercury in Soil

NASA Technical Reports Server (NTRS)

Easterling, Donald F.; Hovanitz, Edward S.; Street, Kenneth W.

2000-01-01

A field screening method for the determination of elemental mercury in environmental soil samples involves the thermal desorption of the mercury from the sample onto gold and then the thermal desorption from the gold to a gold-film mercury vapor analyzer. This field screening method contains a large number of conditions that could be optimized for the various types of soils encountered. In this study, the conditions were optimized for the determination of mercury in silty clay materials, and the results were comparable to the cold-vapor atomic absorption spectrophotometric method of determination. This paper discusses the benefits and disadvantages of employing the field screening method and provides the sequence of conditions that must be optimized to employ this method of determination on other soil types.

GEOSTATISTICAL SAMPLING DESIGNS FOR HAZARDOUS WASTE SITES

EPA Science Inventory

This chapter discusses field sampling design for environmental sites and hazardous waste sites with respect to random variable sampling theory, Gy's sampling theory, and geostatistical (kriging) sampling theory. The literature often presents these sampling methods as an adversari...

Uncertainty in the profitability of fertilizer management based on various sampling designs.

NASA Astrophysics Data System (ADS)

Muhammed, Shibu; Ben, Marchant; Webster, Richard; Milne, Alice; Dailey, Gordon; Whitmore, Andrew

2016-04-01

Many farmers sample their soil to measure the concentrations of plant nutrients, including phosphorus (P), so as to decide how much fertilizer to apply. Now that fertilizer can be applied at variable rates, farmers want to know whether maps of nutrient concentration made from grid samples or from field subdivisions (zones within their fields) are merited: do such maps lead to greater profit than would a single measurement on a bulked sample for each field when all costs are taken into account? We have examined the merits of grid-based and zone-based sampling strategies over single field-based averages using continuous spatial data on wheat yields at harvest in six fields in southern England and simulated concentrations of P in the soil. Features of the spatial variation in the yields provide predictions about which sampling scheme is likely to be most cost effective, but there is uncertainty associated with these predictions that must be communicated to farmers. Where variograms of the yield have large variances and long effective ranges, grid-sampling and mapping nutrients are likely to be cost-effective. Where effective ranges are short, sampling must be dense to reveal the spatial variation and may be expensive. In these circumstances variable-rate application of fertilizer is likely to be impracticable and almost certainly not cost-effective. We have explored several methods for communicating these results and found that the most effective method was using probability maps that show the likelihood of grid-based and zone-based sampling being more profitable that a field-based estimate.

Ultra-low field nuclear magnetic resonance and magnetic resonance imaging to discriminate and identify materials

DOEpatents

Matlashov, Andrei Nikolaevich; Urbaitis, Algis V.; Savukov, Igor Mykhaylovich; Espy, Michelle A.; Volegov, Petr Lvovich; Kraus, Jr., Robert Henry

2013-03-05

Method comprising obtaining an NMR measurement from a sample wherein an ultra-low field NMR system probes the sample and produces the NMR measurement and wherein a sampling temperature, prepolarizing field, and measurement field are known; detecting the NMR measurement by means of inductive coils; analyzing the NMR measurement to obtain at least one measurement feature wherein the measurement feature comprises T1, T2, T1.rho., or the frequency dependence thereof; and, searching for the at least one measurement feature within a database comprising NMR reference data for at least one material to determine if the sample comprises a material of interest.

COMPARISON OF MACROINVERTEBRATE SAMPLING METHODS FOR NONWADEABLE STREAMS

EPA Science Inventory

The bioassessment of nonwadeable streams in the United States is increasing, but methods for these systems are not as well developed as for wadeable streams. In this study, we compared six benthic macroinvertebrate field sampling methods for nonwadeable streams based on those us...

Sampling the structure and chemical order in assemblies of ferromagnetic nanoparticles by nuclear magnetic resonance

PubMed Central

Liu, Yuefeng; Luo, Jingjie; Shin, Yooleemi; Moldovan, Simona; Ersen, Ovidiu; Hébraud, Anne; Schlatter, Guy; Pham-Huu, Cuong; Meny, Christian

2016-01-01

Assemblies of nanoparticles are studied in many research fields from physics to medicine. However, as it is often difficult to produce mono-dispersed particles, investigating the key parameters enhancing their efficiency is blurred by wide size distributions. Indeed, near-field methods analyse a part of the sample that might not be representative of the full size distribution and macroscopic methods give average information including all particle sizes. Here, we introduce temperature differential ferromagnetic nuclear resonance spectra that allow sampling the crystallographic structure, the chemical composition and the chemical order of non-interacting ferromagnetic nanoparticles for specific size ranges within their size distribution. The method is applied to cobalt nanoparticles for catalysis and allows extracting the size effect from the crystallographic structure effect on their catalytic activity. It also allows sampling of the chemical composition and chemical order within the size distribution of alloyed nanoparticles and can thus be useful in many research fields. PMID:27156575

Field Detection of Citrus Huanglongbing Associated with ' Candidatus Liberibacter Asiaticus' by Recombinese Polymerase Amplification within 15 min.

PubMed

Qian, Wenjuan; Lu, Ying; Meng, Youqing; Ye, Zunzhong; Wang, Liu; Wang, Rui; Zheng, Qiqi; Wu, Hui; Wu, Jian

2018-06-06

' Candidatus Liberibacter asiaticus' (Las) is the most prevalent bacterium associated with huanglongbing, which is one of the most destructive diseases of citrus. In this paper, an extremely rapid and simple method for field detection of Las from leaf samples, based on recombinase polymerase amplification (RPA), is described. Three RPA primer pairs were designed and evaluated. RPA amplification was optimized so that it could be accomplished within 10 min. In combination with DNA crude extraction by a 50-fold dilution after 1 min of grinding in 0.5 M sodium hydroxide and visual detection via fluorescent DNA dye (positive samples display obvious green fluorescence while negative samples remain colorless), the whole detection process can be accomplished within 15 min. The sensitivity and specificity of this RPA-based method were evaluated and were proven to be equal to those of real-time PCR. The reliability of this method was also verified by analyzing field samples.

Testing the application of Teflon/quartz soil solution samplers for DOM sampling in the Critical Zone: Field and laboratory approaches

NASA Astrophysics Data System (ADS)

Dolan, E. M.; Perdrial, J. N.; Vazquez, A.; Hernández, S.; Chorover, J.

2010-12-01

Elizabeth Dolan1,2, Julia Perdrial3, Angélica Vázquez-Ortega3, Selene Hernández-Ruiz3, Jon Chorover3 1Deptartment of Soil, Environmental, and Atmospheric Science, University of Missouri. 2Biosphere 2, University of Arizona. 3Deptartment of Soil, Water, and Environmental Science, University of Arizona. Abstract: The behavior of dissolved organic matter (DOM) in soil is important to many biogeochemical processes. Extraction methods to obtain DOM from the unsaturated zone remain a current focus of research as different methods can influence the type and concentration of DOM obtained. Thus, the present comparison study involves three methods for soil solution sampling to assess their impact on DOM quantity and quality: 1) aqueous soil extracts, 2) solution yielded from laboratory installed suction cup samplers and 3) solutions from field installed suction cup samplers. All samples were analyzed for dissolved organic carbon and total nitrogen concentrations. Moreover, DOM quality was analyzed using fluorescence, UV-Vis and FTIR spectroscopies. Results indicate higher DOC values for laboratory extracted DOM: 20 mg/L for aqueous soil extracts and 31 mg/L for lab installed samplers compared to 12 mg/L for field installed samplers. Large variations in C/N ratios were also observed ranging from 1.5 in laboratory extracted DOM to 11 in field samples. Fluorescence excitation-emission matrices of DOM solutions obtained for the laboratory extraction methods showed higher intensities in regions typical for fulvic and humic acid-like materials relative to those extracted in the field. Similarly, the molar absorptivity calculated from DOC concentration normalization of UV-Vis absorbance of the laboratory-derived solutions was significantly higher as well, indicating greater aromaticity. The observed differences can be attributed to soil disturbance associated with obtaining laboratory derived solution samples. Our results indicate that laboratory extraction methods are not comparable to in-situ field soil solution extraction in terms of DOM.

Evaluation of magnetic nanoparticle samples made from biocompatible ferucarbotran by time-correlation magnetic particle imaging reconstruction method

PubMed Central

2013-01-01

Background Molecular imaging using magnetic nanoparticles (MNPs)—magnetic particle imaging (MPI)—has attracted interest for the early diagnosis of cancer and cardiovascular disease. However, because a steep local magnetic field distribution is required to obtain a defined image, sophisticated hardware is required. Therefore, it is desirable to realize excellent image quality even with low-performance hardware. In this study, the spatial resolution of MPI was evaluated using an image reconstruction method based on the correlation information of the magnetization signal in a time domain and by applying MNP samples made from biocompatible ferucarbotran that have adjusted particle diameters. Methods The magnetization characteristics and particle diameters of four types of MNP samples made from ferucarbotran were evaluated. A numerical analysis based on our proposed method that calculates the image intensity from correlation information between the magnetization signal generated from MNPs and the system function was attempted, and the obtained image quality was compared with that using the prototype in terms of image resolution and image artifacts. Results MNP samples obtained by adjusting ferucarbotran showed superior properties to conventional ferucarbotran samples, and numerical analysis showed that the same image quality could be obtained using a gradient magnetic field generator with 0.6 times the performance. However, because image blurring was included theoretically by the proposed method, an algorithm will be required to improve performance. Conclusions MNP samples obtained by adjusting ferucarbotran showed magnetizing properties superior to conventional ferucarbotran samples, and by using such samples, comparable image quality (spatial resolution) could be obtained with a lower gradient magnetic field intensity. PMID:23734917

Method and apparatus for measuring nuclear magnetic properties

DOEpatents

Weitekamp, D.P.; Bielecki, A.; Zax, D.B.; Zilm, K.W.; Pines, A.

1987-12-01

A method for studying the chemical and structural characteristics of materials is disclosed. The method includes placement of a sample material in a high strength polarizing magnetic field to order the sample nuclei. The condition used to order the sample is then removed abruptly and the ordering of the sample allowed to evolve for a time interval. At the end of the time interval, the ordering of the sample is measured by conventional nuclear magnetic resonance techniques. 5 figs.

Method and apparatus for measuring nuclear magnetic properties

DOEpatents

Weitekamp, Daniel P.; Bielecki, Anthony; Zax, David B.; Zilm, Kurt W.; Pines, Alexander

1987-01-01

A method for studying the chemical and structural characteristics of materials is disclosed. The method includes placement of a sample material in a high strength polarizing magnetic field to order the sample nucleii. The condition used to order the sample is then removed abruptly and the ordering of the sample allowed to evolve for a time interval. At the end of the time interval, the ordering of the sample is measured by conventional nuclear magnetic resonance techniques.

Preservation Methods Differ in Fecal Microbiome Stability, Affecting Suitability for Field Studies.

PubMed

Song, Se Jin; Amir, Amnon; Metcalf, Jessica L; Amato, Katherine R; Xu, Zhenjiang Zech; Humphrey, Greg; Knight, Rob

2016-01-01

Immediate freezing at -20°C or below has been considered the gold standard for microbiome preservation, yet this approach is not feasible for many field studies, ranging from anthropology to wildlife conservation. Here we tested five methods for preserving human and dog fecal specimens for periods of up to 8 weeks, including such types of variation as freeze-thaw cycles and the high temperature fluctuations often encountered under field conditions. We found that three of the methods-95% ethanol, FTA cards, and the OMNIgene Gut kit-can preserve samples sufficiently well at ambient temperatures such that differences at 8 weeks are comparable to differences among technical replicates. However, even the worst methods, including those with no fixative, were able to reveal microbiome differences between species at 8 weeks and between individuals after a week, allowing meta-analyses of samples collected using various methods when the effect of interest is expected to be larger than interindividual variation (although use of a single method within a study is strongly recommended to reduce batch effects). Encouragingly for FTA cards, the differences caused by this method are systematic and can be detrended. As in other studies, we strongly caution against the use of 70% ethanol. The results, spanning 15 individuals and over 1,200 samples, provide our most comprehensive view to date of storage effects on stool and provide a paradigm for the future studies of other sample types that will be required to provide a global view of microbial diversity and its interaction among humans, animals, and the environment. IMPORTANCE Our study, spanning 15 individuals and over 1,200 samples, provides our most comprehensive view to date of storage and stabilization effects on stool. We tested five methods for preserving human and dog fecal specimens for periods of up to 8 weeks, including the types of variation often encountered under field conditions, such as freeze-thaw cycles and high temperature fluctuations. We show that several cost-effective methods provide excellent microbiome stability out to 8 weeks, opening up a range of field studies with humans and wildlife that would otherwise be cost-prohibitive.

New paleomagnetic constraints on the lunar magnetic field evolution

NASA Astrophysics Data System (ADS)

Lepaulard, C.; Gattacceca, J.; Weiss, B. P.

2017-12-01

In the 1970s, the first paleomagnetic analyses of lunar samples from the Apollo missions allowed a glimpse of the global evolution of the Moon's magnetic field over time, with evidence for a past dynamo activity [Fuller et Cisowski, 1987]. During the last a decade, a new set of paleomagnetic studies has provided a more refined view of the evolution of the lunar dynamo activity (chronology, intensity) [Weiss et Tikoo, 2014]. The aim of this study is to further refine the knowledge of the lunar dynamo by providing new paleomagnetic data. Based on measurements of the natural remanent magnetization of the main masses of 135 Apollo samples (mass between 50 g and 5 kg) with a portable magnetometer, we have selected nine samples for laboratory analyzes. The selected Apollo samples are: 10018, 15505, 61195 (regolith breccia); 61015 (dimict breccia); 14169 (crystalline matrix breccia); 65055 (basaltic impact melt); 12005, 12021 and 15529 (basalts). Paleointensity of the lunar magnetic fields were obtained by demagnetization by alternative field and normalization with laboratory magnetizations; as well as thermal demagnetization under controlled oxygen fugacity (Thellier-Thellier method) for selected samples. Preliminary results indicate that only three samples (10018, 15505, and 15529) possess a stable high coercivity / high temperature component of magnetization. We estimated the following paleointensities: 1.5 µT for 15505, 13 µT for 15529 (both with alternating field-based methods), and 1 µT for 10018 (thermal demagnetization with the Thellier-Thellier method). The other samples provide only an upper limit for the lunar surface field. These data will be discussed in view of the age of the samples (ages from the literature, and additional dating in progress). References :Fuller, M., and S.M. Cisowski, 1987. Lunar paleomagnetism. Geomagnetism 2, 307-455. Weiss, B.P., and S.M. Tikoo, 2014. The lunar dynamo. Science, 346, doi: 10.1126/science.1246753.

Variance of discharge estimates sampled using acoustic Doppler current profilers from moving boats

USGS Publications Warehouse

Garcia, Carlos M.; Tarrab, Leticia; Oberg, Kevin; Szupiany, Ricardo; Cantero, Mariano I.

2012-01-01

This paper presents a model for quantifying the random errors (i.e., variance) of acoustic Doppler current profiler (ADCP) discharge measurements from moving boats for different sampling times. The model focuses on the random processes in the sampled flow field and has been developed using statistical methods currently available for uncertainty analysis of velocity time series. Analysis of field data collected using ADCP from moving boats from three natural rivers of varying sizes and flow conditions shows that, even though the estimate of the integral time scale of the actual turbulent flow field is larger than the sampling interval, the integral time scale of the sampled flow field is on the order of the sampling interval. Thus, an equation for computing the variance error in discharge measurements associated with different sampling times, assuming uncorrelated flow fields is appropriate. The approach is used to help define optimal sampling strategies by choosing the exposure time required for ADCPs to accurately measure flow discharge.

Method And Apparatus For High Resolution Ex-Situ Nmr Spectroscopy

DOEpatents

Pines, Alexander; Meriles, Carlos A.; Heise, Henrike; Sakellariou, Dimitrios; Moule, Adam

2004-01-06

A method and apparatus for ex-situ nuclear magnetic resonance spectroscopy for use on samples outside the physical limits of the magnets in inhomogeneous static and radio-frequency fields. Chemical shift spectra can be resolved with the method using sequences of correlated, composite z-rotation pulses in the presence of spatially matched static and radio frequency field gradients producing nutation echoes. The amplitude of the echoes is modulated by the chemical shift interaction and an inhomogeneity free FID may be recovered by stroboscopically sampling the maxima of the echoes. In an alternative embodiment, full-passage adiabatic pulses are consecutively applied. One embodiment of the apparatus generates a static magnetic field that has a variable saddle point.

Microwave resonant and zero-field absorption study of doped magnetite prepared by a co-precipitation method.

PubMed

Aphesteguy, Juan Carlos; Jacobo, Silvia E; Lezama, Luis; Kurlyandskaya, Galina V; Schegoleva, Nina N

2014-06-19

Fe3O4 and ZnxFe3-xO4 pure and doped magnetite magnetic nanoparticles (NPs) were prepared in aqueous solution (Series A) or in a water-ethyl alcohol mixture (Series B) by the co-precipitation method. Only one ferromagnetic resonance line was observed in all cases under consideration indicating that the materials are magnetically uniform. The shortfall in the resonance fields from 3.27 kOe (for the frequency of 9.5 GHz) expected for spheres can be understood taking into account the dipolar forces, magnetoelasticity, or magnetocrystalline anisotropy. All samples show non-zero low field absorption. For Series A samples the grain size decreases with an increase of the Zn content. In this case zero field absorption does not correlate with the changes of the grain size. For Series B samples the grain size and zero field absorption behavior correlate with each other. The highest zero-field absorption corresponded to 0.2 zinc concentration in both A and B series. High zero-field absorption of Fe3O4 ferrite magnetic NPs can be interesting for biomedical applications.

MULTI-SITE FIELD EVALUATION OF CANDIDATE SAMPLERS FOR MEASURING COARSE-MODE PM

EPA Science Inventory

In response to expected changes to the National Ambient Air Quality Standards for particulate matter, comprehensive field studies were conducted to evaluate the performance of sampling methods for measuring coarse mode aerosols (i.e. PMc). Five separate PMc sampling approaches w...

A graphical method for determining the dry-depositional component of aerosol samples and their field blanks

NASA Astrophysics Data System (ADS)

Huang, Suilou; Rahn, Kenneth A.; Arimoto, Richard

During the Atmosphere/Ocean Chemistry Experiment (AEROCE), field blanks of certain elements in aerosol samples occasionally increased abruptly, always during periods of unusually high atmospheric concentrations. We hypothesized that the anomalous blanks were created by coarse aerosol entering the sampling shelters and depositing onto the blank filters. If so, samples taken nearby should have been similarly affected. To test this hypothesis, we developed a simple graphical method in which elemental masses in field blanks are plotted against elemental masses in pumped samples, and zones of proportionality between the two are sought. Data from Bermuda and Mace Head (coastal western Ireland) confirmed that depositional zones did indeed appear, but only for coarse-particle elements and only under certain conditions. Actual increases of crustal and pollution-derived elements agreed well with values predicted from settling velocities and sampling rates: blanks increased up to an order of magnitude or more but samples by less than 1%. Marine elements behaved like crustal elements in most samples but occasionally were much more enriched: blanks increased up to 30-fold and samples up to about 3%. It thus appears that when coarse-particle elements are present in high concentrations, their field blanks and samples may be measurably affected by dry deposition. Depending on the elements of interest, this dry deposition may have to be measured and the concentrations corrected.

Optical detection of Trypanosoma cruzi in blood samples for diagnosis purpose

NASA Astrophysics Data System (ADS)

Alanis, Elvio; Romero, Graciela; Alvarez, Liliana; Martinez, Carlos C.; Basombrio, Miguel A.

2004-10-01

An optical method for detection of Trypanosoma Cruzi (T. cruzi) parasites in blood samples of mice infected with Chagas disease is presented. The method is intended for use in human blood, for diagnosis purposes. A thin layer of blood infected by T. cruzi parasites, in small concentrations, is examined in an interferometric microscope in which the images of the vision field are taken by a CCD camera and temporarily stored in the memory of a host computer. The whole sample is scanned displacing the microscope plate by means of step motors driven by the computer. Several consecutive images of the same field are taken and digitally processed by means of image temporal differentiation in order to detect if a parasite is eventually present in the field. Each field of view is processed in the same fashion, until the full area of the sample is covered or until a parasite is detected, in which case an acoustical warning is activated and the corresponding image is displayed permitting the technician to corroborate the result visually. A discussion of the reliability of the method as well as a comparison with other well established techniques are presented.

(PRESENTED NAQC SAN FRANCISCO, CA) COARSE PM METHODS STUDY: STUDY DESIGN AND RESULTS

EPA Science Inventory

Comprehensive field studies were conducted to evaluate the performance of sampling methods for measuring the coarse fraction of PM10 in ambient air. Five separate sampling approaches were evaluated at each of three sampling sites. As the primary basis of comparison, a discrete ...

Comparison of field-enhanced and pressure-assisted field-enhanced sample injection techniques for the analysis of water-soluble vitamins using CZE.

PubMed

Liu, Qingqing; Liu, Yaling; Guan, Yu; Jia, Li

2009-04-01

A new online concentration method, namely pressure-assisted field-enhanced sample injection (PA-FESI), was developed and compared with FESI for the analysis of water-soluble vitamins by CZE with UV detection. In PA-FESI, negative voltage and positive pressure were simultaneously applied to initialize PA-FESI. PA-FESI uses the hydrodynamic flow generated by the positive pressure to counterbalance the reverse EOF in the capillary column during electrokinetic sample injection, which allowed a longer injection time than usual FESI mode without compromising the separation efficiency. Using the PA-FESI method, the LODs of the vitamins were at ng/mL level based on the S/N of 3 and the RSDs of migration time and peak area for each vitamin (1 microg/mL) were less than 5.1%. The developed method was applied to the analysis of water-soluble vitamins in corns.

Benthic macroinvertebrate field sampling effort required to produce a sample adequate for the assessment of rivers and streams of Neuquén Province, Argentina

EPA Science Inventory

This multi-year pilot study evaluated a proposed field method for its effectiveness in the collection of a benthic macroinvertebrate sample adequate for use in the condition assessment of streams and rivers in the Neuquén Province, Argentina. A total of 13 sites, distribut...

The inference of vector magnetic fields from polarization measurements with limited spectral resolution

NASA Technical Reports Server (NTRS)

Lites, B. W.; Skumanich, A.

1985-01-01

A method is presented for recovery of the vector magnetic field and thermodynamic parameters from polarization measurement of photospheric line profiles measured with filtergraphs. The method includes magneto-optic effects and may be utilized on data sampled at arbitrary wavelengths within the line profile. The accuracy of this method is explored through inversion of synthetic Stokes profiles subjected to varying levels of random noise, instrumental wave-length resolution, and line profile sampling. The level of error introduced by the systematic effect of profile sampling over a finite fraction of the 5 minute oscillation cycle is also investigated. The results presented here are intended to guide instrumental design and observational procedure.

Analysis of munitions constituents in groundwater using a field-portable GC-MS.

PubMed

Bednar, A J; Russell, A L; Hayes, C A; Jones, W T; Tackett, P; Splichal, D E; Georgian, T; Parker, L V; Kirgan, R A; MacMillan, D K

2012-05-01

The use of munitions constituents (MCs) at military installations can produce soil and groundwater contamination that requires periodic monitoring even after training or manufacturing activities have ceased. Traditional groundwater monitoring methods require large volumes of aqueous samples (e.g., 2-4 L) to be shipped under chain of custody, to fixed laboratories for analysis. The samples must also be packed on ice and shielded from light to minimize degradation that may occur during transport and storage. The laboratory's turn-around time for sample analysis and reporting can be as long as 45 d. This process hinders the reporting of data to customers in a timely manner; yields data that are not necessarily representative of current site conditions owing to the lag time between sample collection and reporting; and incurs significant shipping costs for samples. The current work compares a field portable Gas Chromatograph-Mass Spectrometer (GC-MS) for analysis of MCs on-site with traditional laboratory-based analysis using High Performance Liquid Chromatography with UV absorption detection. The field method provides near real-time (within ~1 h of sampling) concentrations of MCs in groundwater samples. Mass spectrometry provides reliable confirmation of MCs and a means to identify unknown compounds that are potential false positives for methods with UV and other non-selective detectors. Published by Elsevier Ltd.

Design of the sample cell in near-field surface-enhanced Raman scattering by finite difference time domain method

NASA Astrophysics Data System (ADS)

Li, Yaqin; Jian, Guoshu; Wu, Shifa

2006-11-01

The rational design of the sample cell may improve the sensitivity of surface-enhanced Raman scattering (SERS) detection in a high degree. Finite difference time domain (FDTD) simulations of the configuration of Ag film-Ag particles illuminated by plane wave and evanescent wave are performed to provide physical insight for design of the sample cell. Numerical solutions indicate that the sample cell can provide more "hot spots' and the massive field intensity enhancement occurs in these "hot spots'. More information on the nanometer character of the sample can be got because of gradient-field Raman (GFR) of evanescent wave.

Preservation Methods Differ in Fecal Microbiome Stability, Affecting Suitability for Field Studies

PubMed Central

Amir, Amnon; Metcalf, Jessica L.; Amato, Katherine R.; Xu, Zhenjiang Zech; Humphrey, Greg

2016-01-01

ABSTRACT Immediate freezing at −20°C or below has been considered the gold standard for microbiome preservation, yet this approach is not feasible for many field studies, ranging from anthropology to wildlife conservation. Here we tested five methods for preserving human and dog fecal specimens for periods of up to 8 weeks, including such types of variation as freeze-thaw cycles and the high temperature fluctuations often encountered under field conditions. We found that three of the methods—95% ethanol, FTA cards, and the OMNIgene Gut kit—can preserve samples sufficiently well at ambient temperatures such that differences at 8 weeks are comparable to differences among technical replicates. However, even the worst methods, including those with no fixative, were able to reveal microbiome differences between species at 8 weeks and between individuals after a week, allowing meta-analyses of samples collected using various methods when the effect of interest is expected to be larger than interindividual variation (although use of a single method within a study is strongly recommended to reduce batch effects). Encouragingly for FTA cards, the differences caused by this method are systematic and can be detrended. As in other studies, we strongly caution against the use of 70% ethanol. The results, spanning 15 individuals and over 1,200 samples, provide our most comprehensive view to date of storage effects on stool and provide a paradigm for the future studies of other sample types that will be required to provide a global view of microbial diversity and its interaction among humans, animals, and the environment. IMPORTANCE Our study, spanning 15 individuals and over 1,200 samples, provides our most comprehensive view to date of storage and stabilization effects on stool. We tested five methods for preserving human and dog fecal specimens for periods of up to 8 weeks, including the types of variation often encountered under field conditions, such as freeze-thaw cycles and high temperature fluctuations. We show that several cost-effective methods provide excellent microbiome stability out to 8 weeks, opening up a range of field studies with humans and wildlife that would otherwise be cost-prohibitive. PMID:27822526

A new comprehensive method for detection of livestock-related pathogenic viruses using a target enrichment system.

PubMed

Oba, Mami; Tsuchiaka, Shinobu; Omatsu, Tsutomu; Katayama, Yukie; Otomaru, Konosuke; Hirata, Teppei; Aoki, Hiroshi; Murata, Yoshiteru; Makino, Shinji; Nagai, Makoto; Mizutani, Tetsuya

2018-01-08

We tested usefulness of a target enrichment system SureSelect, a comprehensive viral nucleic acid detection method, for rapid identification of viral pathogens in feces samples of cattle, pigs and goats. This system enriches nucleic acids of target viruses in clinical/field samples by using a library of biotinylated RNAs with sequences complementary to the target viruses. The enriched nucleic acids are amplified by PCR and subjected to next generation sequencing to identify the target viruses. In many samples, SureSelect target enrichment method increased efficiencies for detection of the viruses listed in the biotinylated RNA library. Furthermore, this method enabled us to determine nearly full-length genome sequence of porcine parainfluenza virus 1 and greatly increased Breadth, a value indicating the ratio of the mapping consensus length in the reference genome, in pig samples. Our data showed usefulness of SureSelect target enrichment system for comprehensive analysis of genomic information of various viruses in field samples. Copyright © 2017 Elsevier Inc. All rights reserved.

Woodstove smoke and CO emissions: comparison of reference methods with the VIP sampler.

PubMed

Jaasma, D R; Champion, M C; Shelton, J W

1990-06-01

A new field sampler has been developed for measuring the particulate matter (PM) and carbon monoxide emissions of woodburning stoves. Particulate matter is determined by carbon balance and the workup of a sample train which is similar to a room-temperature EPA Method 5G train. A steel tank, initially evacuated, serves as the motive force for sampling and also accumulates a gas sample for post-test analysis of time-averaged stack CO and CO2 concentrations. Workup procedures can be completed within 72 hours of sampler retrieval. The system has been compared to reference methods in two laboratory test series involving six different woodburning appliances and two independent laboratories. The correlation of field sampler emission rates and reference method rates is strong.

Woodstove smoke and CO emissions: Comparison of reference methods with the VIP sampler

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jaasma, D.R.; Champion, M.C.; Shelton, J.W.

1990-06-01

A new field sampler has been developed for measuring the particulate matter (PM) and carbon monoxide emissions of woodburning stoves. Particulate matter is determined by carbon balance and the workup of a sample train which is similar to a room-temperature EPA Method 5G train. A steel tank, initially evacuated, serves as the motive force for sampling and also accumulates a gas sample for post-test analysis of time-averaged stack CO and CO{sub 2} concentrations. Workup procedures can be completed within 72 hours of sampler retrieval. The system has been compared to reference methods in two laboratory test series involving six differentmore » woodburning appliances and two independent laboratories. The correlation of field sampler emission rates and reference method rates is strong.« less

Optical Methods for Identifying Hard Clay Core Samples During Petrophysical Studies

NASA Astrophysics Data System (ADS)

Morev, A. V.; Solovyeva, A. V.; Morev, V. A.

2018-01-01

X-ray phase analysis of the general mineralogical composition of core samples from one of the West Siberian fields was performed. Electronic absorption spectra of the clay core samples with an added indicator were studied. The speed and availability of applying the two methods in petrophysical laboratories during sample preparation for standard and special studies were estimated.

Evaluation of Three Field-Based Methods for Quantifying Soil Carbon

PubMed Central

Izaurralde, Roberto C.; Rice, Charles W.; Wielopolski, Lucian; Ebinger, Michael H.; Reeves, James B.; Thomson, Allison M.; Francis, Barry; Mitra, Sudeep; Rappaport, Aaron G.; Etchevers, Jorge D.; Sayre, Kenneth D.; Govaerts, Bram; McCarty, Gregory W.

2013-01-01

Three advanced technologies to measure soil carbon (C) density (g C m−2) are deployed in the field and the results compared against those obtained by the dry combustion (DC) method. The advanced methods are: a) Laser Induced Breakdown Spectroscopy (LIBS), b) Diffuse Reflectance Fourier Transform Infrared Spectroscopy (DRIFTS), and c) Inelastic Neutron Scattering (INS). The measurements and soil samples were acquired at Beltsville, MD, USA and at Centro International para el Mejoramiento del Maíz y el Trigo (CIMMYT) at El Batán, Mexico. At Beltsville, soil samples were extracted at three depth intervals (0–5, 5–15, and 15–30 cm) and processed for analysis in the field with the LIBS and DRIFTS instruments. The INS instrument determined soil C density to a depth of 30 cm via scanning and stationary measurements. Subsequently, soil core samples were analyzed in the laboratory for soil bulk density (kg m−3), C concentration (g kg−1) by DC, and results reported as soil C density (kg m−2). Results from each technique were derived independently and contributed to a blind test against results from the reference (DC) method. A similar procedure was employed at CIMMYT in Mexico employing but only with the LIBS and DRIFTS instruments. Following conversion to common units, we found that the LIBS, DRIFTS, and INS results can be compared directly with those obtained by the DC method. The first two methods and the standard DC require soil sampling and need soil bulk density information to convert soil C concentrations to soil C densities while the INS method does not require soil sampling. We conclude that, in comparison with the DC method, the three instruments (a) showed acceptable performances although further work is needed to improve calibration techniques and (b) demonstrated their portability and their capacity to perform under field conditions. PMID:23383225

WOODSTOVE EMISSION SAMPLING METHODS COMPARABILITY ANALYSIS AND IN-SITU EVALUATION OF NEW TECHNOLOGY WOODSTOVES

EPA Science Inventory

This report compares simultaneous results from three woodstove sampling methods and evaluates particulate emission rates of conventional and Oregon-certified catalytic and noncatalytic woodstoves in six Portland, OR, houses. EPA Methods 5G and 5H and the field emission sampler (A...

Comparison of Two Methods Used to Model Shape Parameters of Pareto Distributions

USGS Publications Warehouse

Liu, C.; Charpentier, R.R.; Su, J.

2011-01-01

Two methods are compared for estimating the shape parameters of Pareto field-size (or pool-size) distributions for petroleum resource assessment. Both methods assume mature exploration in which most of the larger fields have been discovered. Both methods use the sizes of larger discovered fields to estimate the numbers and sizes of smaller fields: (1) the tail-truncated method uses a plot of field size versus size rank, and (2) the log-geometric method uses data binned in field-size classes and the ratios of adjacent bin counts. Simulation experiments were conducted using discovered oil and gas pool-size distributions from four petroleum systems in Alberta, Canada and using Pareto distributions generated by Monte Carlo simulation. The estimates of the shape parameters of the Pareto distributions, calculated by both the tail-truncated and log-geometric methods, generally stabilize where discovered pool numbers are greater than 100. However, with fewer than 100 discoveries, these estimates can vary greatly with each new discovery. The estimated shape parameters of the tail-truncated method are more stable and larger than those of the log-geometric method where the number of discovered pools is more than 100. Both methods, however, tend to underestimate the shape parameter. Monte Carlo simulation was also used to create sequences of discovered pool sizes by sampling from a Pareto distribution with a discovery process model using a defined exploration efficiency (in order to show how biased the sampling was in favor of larger fields being discovered first). A higher (more biased) exploration efficiency gives better estimates of the Pareto shape parameters. ?? 2011 International Association for Mathematical Geosciences.

A green chemometrics-assisted fluorimetric detection method for the direct and simultaneous determination of six polycyclic aromatic hydrocarbons in oil-field wastewaters

NASA Astrophysics Data System (ADS)

Gu, Hui-Wen; Zhang, Shan-Hui; Wu, Bai-Chun; Chen, Wu; Wang, Jing-Bo; Liu, Yang

2018-07-01

Oil-field wastewaters contain high level of polycyclic aromatic hydrocarbons (PAHs), which have to be analyzed to assess the environmental effects before discharge. In this work, a green fluorimetric detection method that combines excitation-emission matrix (EEM) fluorescence with parallel factor analysis (PARAFAC) algorithm was firstly developed to achieve the direct and simultaneous determination of six U.S. EPA PAHs in two different kinds of complex oil-field wastewaters. Due to the distinctive "second-order advantage", neither time-consuming sample pretreatments nor toxic organic reagents were involved in the determination. By using the environment-friendly "mathematical separation" of PARAFAC, satisfactory quantitative results and reasonable spectral profiles for six PAHs were successfully extracted from the total EEM signals of oil-field wastewaters without need of chromatographic separation. The limits of detection of six PAHs were in the range of 0.09-0.72 ng mL-1, and the average spiked recoveries were between (89.4 ± 4.8)% and (109.1 ± 5.8)%, with average relative predictive errors <2.93%. In order to further confirm the accuracy of the proposed method, the same batch oil-field wastewater samples were analyzed by the recognized GC-MS method. t-test demonstrated that no significant differences exist between the quantitative results of the two methods. Given the advantages of green, fast, low-cost and high-sensitivity, the proposed method is expected to be broadened as an appealing alternative method for multi-residue analysis of overlapped PAHs in complex wastewater samples.

Near-Field Magneto-Optical Microscope

DOEpatents

Vlasko-Vlasov, Vitalii; Welp, Ulrich; and Crabtree, George W.

2005-12-06

A device and method for mapping magnetic fields of a sample at a resolution less than the wavelength of light without altering the magnetic field of the sample is disclosed. A device having a tapered end portion with a magneto-optically active particle positioned at the distal end thereof in communication with a fiber optic for transferring incoming linearly polarized light from a source thereof to the particle and for transferring reflected light from the particle is provided. The fiber optic has a reflective material trapping light within the fiber optic and in communication with a light detector for determining the polarization of light reflected from the particle as a function of the strength and direction of the magnetic field of the sample. Linearly polarized light from the source thereof transferred to the particle positioned proximate the sample is affected by the magnetic field of the sample sensed by the particle such that the difference in polarization of light entering and leaving the particle is due to the magnetic field of the sample. Relative movement between the particle and sample enables mapping.

Near Field Magneto-Optical Microscope

DOEpatents

Vlasko-Vlasov, Vitalii K.; Welp, Ulrich; Crabtree, George W.

2005-12-06

A device and method for mapping magnetic fields of a sample at a resolution less than the wavelength of light without altering the magnetic field of the sample is disclosed. A device having a tapered end portion with a magneto-optically active particle positioned at the distal end thereof in communication with a fiber optic for transferring incoming linearly polarized light from a source thereof to the particle and for transferring reflected light from the particle is provided. The fiber optic has a reflective material trapping light within the fiber optic and in communication with a light detector for determining the polarization of light reflected from the particle as a function of the strength and direction of the magnetic field of the sample. Linearly polarized light from the source thereof transferred to the particle positioned proximate the sample is affected by the magnetic field of the sample sensed by the particle such that the difference in polarization of light entering and leaving the particle is due to the magnetic field of the sample. Relative movement between the particle and sample enables mapping.

Application of advanced sampling and analysis methods to predict the structure of adsorbed protein on a material surface

PubMed Central

Abramyan, Tigran M.; Hyde-Volpe, David L.; Stuart, Steven J.; Latour, Robert A.

2017-01-01

The use of standard molecular dynamics simulation methods to predict the interactions of a protein with a material surface have the inherent limitations of lacking the ability to determine the most likely conformations and orientations of the adsorbed protein on the surface and to determine the level of convergence attained by the simulation. In addition, standard mixing rules are typically applied to combine the nonbonded force field parameters of the solution and solid phases the system to represent interfacial behavior without validation. As a means to circumvent these problems, the authors demonstrate the application of an efficient advanced sampling method (TIGER2A) for the simulation of the adsorption of hen egg-white lysozyme on a crystalline (110) high-density polyethylene surface plane. Simulations are conducted to generate a Boltzmann-weighted ensemble of sampled states using force field parameters that were validated to represent interfacial behavior for this system. The resulting ensembles of sampled states were then analyzed using an in-house-developed cluster analysis method to predict the most probable orientations and conformations of the protein on the surface based on the amount of sampling performed, from which free energy differences between the adsorbed states were able to be calculated. In addition, by conducting two independent sets of TIGER2A simulations combined with cluster analyses, the authors demonstrate a method to estimate the degree of convergence achieved for a given amount of sampling. The results from these simulations demonstrate that these methods enable the most probable orientations and conformations of an adsorbed protein to be predicted and that the use of our validated interfacial force field parameter set provides closer agreement to available experimental results compared to using standard CHARMM force field parameterization to represent molecular behavior at the interface. PMID:28514864

Sampling methods, dispersion patterns, and fixed precision sequential sampling plans for western flower thrips (Thysanoptera: Thripidae) and cotton fleahoppers (Hemiptera: Miridae) in cotton.

PubMed

Parajulee, M N; Shrestha, R B; Leser, J F

2006-04-01

A 2-yr field study was conducted to examine the effectiveness of two sampling methods (visual and plant washing techniques) for western flower thrips, Frankliniella occidentalis (Pergande), and five sampling methods (visual, beat bucket, drop cloth, sweep net, and vacuum) for cotton fleahopper, Pseudatomoscelis seriatus (Reuter), in Texas cotton, Gossypium hirsutum (L.), and to develop sequential sampling plans for each pest. The plant washing technique gave similar results to the visual method in detecting adult thrips, but the washing technique detected significantly higher number of thrips larvae compared with the visual sampling. Visual sampling detected the highest number of fleahoppers followed by beat bucket, drop cloth, vacuum, and sweep net sampling, with no significant difference in catch efficiency between vacuum and sweep net methods. However, based on fixed precision cost reliability, the sweep net sampling was the most cost-effective method followed by vacuum, beat bucket, drop cloth, and visual sampling. Taylor's Power Law analysis revealed that the field dispersion patterns of both thrips and fleahoppers were aggregated throughout the crop growing season. For thrips management decision based on visual sampling (0.25 precision), 15 plants were estimated to be the minimum sample size when the estimated population density was one thrips per plant, whereas the minimum sample size was nine plants when thrips density approached 10 thrips per plant. The minimum visual sample size for cotton fleahoppers was 16 plants when the density was one fleahopper per plant, but the sample size decreased rapidly with an increase in fleahopper density, requiring only four plants to be sampled when the density was 10 fleahoppers per plant. Sequential sampling plans were developed and validated with independent data for both thrips and cotton fleahoppers.

Comparison of no-purge and pumped sampling methods for monitoring concentrations of ordnance-related compounds in groundwater, Camp Edwards, Massachusetts Military Reservation, Cape Cod, Massachusetts, 2009-2010

USGS Publications Warehouse

Savoie, Jennifer G.; LeBlanc, Denis R.

2012-01-01

Field tests were conducted near the Impact Area at Camp Edwards on the Massachusetts Military Reservation, Cape Cod, Massachusetts, to determine the utility of no-purge groundwater sampling for monitoring concentrations of ordnance-related explosive compounds and perchlorate in the sand and gravel aquifer. The no-purge methods included (1) a diffusion sampler constructed of rigid porous polyethylene, (2) a diffusion sampler constructed of regenerated-cellulose membrane, and (3) a tubular grab sampler (bailer) constructed of polyethylene film. In samples from 36 monitoring wells, concentrations of perchlorate (ClO4-), hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX), and octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX), the major contaminants of concern in the Impact Area, in the no-purge samples were compared to concentrations of these compounds in samples collected by low-flow pumped sampling with dedicated bladder pumps. The monitoring wells are constructed of 2- and 2.5-inch-diameter polyvinyl chloride pipe and have approximately 5- to 10-foot-long slotted screens. The no-purge samplers were left in place for 13-64 days to ensure that ambient groundwater flow had flushed the well screen and concentrations in the screen represented water in the adjacent formation. The sampling methods were compared first in six monitoring wells. Concentrations of ClO4-, RDX, and HMX in water samples collected by the three no-purge sampling methods and low-flow pumped sampling were in close agreement for all six monitoring wells. There is no evidence of a systematic bias in the concentration differences among the methods on the basis of type of sampling device, type of contaminant, or order in which the no-purge samplers were tested. A subsequent examination of vertical variations in concentrations of ClO4- in the 10-foot-long screens of six wells by using rigid porous polyethylene diffusion samplers indicated that concentrations in a given well varied by less than 15 percent and the small variations were unlikely to affect the utility of the various sampling methods. The grab sampler was selected for additional tests in 29 of the 36 monitoring wells used during the study. Concentrations of ClO4-, RDX, HMX, and other minor explosive compounds in water samples collected by using a 1-liter grab sampler and low-flow pumped sampling were in close agreement in field tests in the 29 wells. A statistical analysis based on the sign test indicated that there was no bias in the concentration differences between the methods. There also was no evidence for a systematic bias in concentration differences between the methods related to location of the monitoring wells laterally or vertically in the groundwater-flow system. Field tests in five wells also demonstrated that sample collection by using a 2-liter grab sampler and sequential bailing with the 1-liter grab sampler were options for obtaining sufficient sample volume for replicate and spiked quality assurance and control samples. The evidence from the field tests supports the conclusion that diffusion sampling with the rigid porous polyethylene and regenerated-cellulose membranes and grab sampling with the polyethylene-film samplers provide comparable data on the concentrations of ordnance-related compounds in groundwater at the MMR to that obtained by low-flow pumped sampling. These sampling methods are useful methods for monitoring these compounds at the MMR and in similar hydrogeologic environments.

Using SPMDs To Assess Natural Recovery Of PCB-Contaminated Sediments In Lake Hartwell, SC: I. A Field Test Of New In-Situ Deployment Methods

EPA Science Inventory

Results from the field testing of some innovative sampling methods developed to evaluate risk management strategies for polychlorinated biphenyl (PCB) contaminated sediments are presented. Semipermeable membrane devices (SPMDs) were combined with novel deployment methods to quan...

Recent advances in enhancing the sensitivity of electrophoresis and electrochromatography in capillaries and microchips (2014-2016).

PubMed

Breadmore, Michael C; Wuethrich, Alain; Li, Feng; Phung, Sui Ching; Kalsoom, Umme; Cabot, Joan M; Tehranirokh, Masoomeh; Shallan, Aliaa I; Abdul Keyon, Aemi S; See, Hong Heng; Dawod, Mohamed; Quirino, Joselito P

2017-01-01

One of the most cited limitations of capillary (and microchip) electrophoresis is the poor sensitivity. This review continues to update this series of biennial reviews, first published in Electrophoresis in 2007, on developments in the field of on-line/in-line concentration methods in capillaries and microchips, covering the period July 2014-June 2016. It includes developments in the field of stacking, covering all methods from field amplified sample stacking and large volume sample stacking, through to isotachophoresis, dynamic pH junction, and sweeping. Attention is also given to on-line or in-line extraction methods that have been used for electrophoresis. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The study of combining Latin Hypercube Sampling method and LU decomposition method (LULHS method) for constructing spatial random field

NASA Astrophysics Data System (ADS)

WANG, P. T.

2015-12-01

Groundwater modeling requires to assign hydrogeological properties to every numerical grid. Due to the lack of detailed information and the inherent spatial heterogeneity, geological properties can be treated as random variables. Hydrogeological property is assumed to be a multivariate distribution with spatial correlations. By sampling random numbers from a given statistical distribution and assigning a value to each grid, a random field for modeling can be completed. Therefore, statistics sampling plays an important role in the efficiency of modeling procedure. Latin Hypercube Sampling (LHS) is a stratified random sampling procedure that provides an efficient way to sample variables from their multivariate distributions. This study combines the the stratified random procedure from LHS and the simulation by using LU decomposition to form LULHS. Both conditional and unconditional simulations of LULHS were develpoed. The simulation efficiency and spatial correlation of LULHS are compared to the other three different simulation methods. The results show that for the conditional simulation and unconditional simulation, LULHS method is more efficient in terms of computational effort. Less realizations are required to achieve the required statistical accuracy and spatial correlation.

Measurement of dynamic magnetization induced by a pulsed field: Proposal for a new rock magnetism method

NASA Astrophysics Data System (ADS)

Kodama, Kazuto

2015-02-01

This study proposes a new method for measuring transient magnetization of natural samples induced by a pulsed field with duration of 11 ms using a pulse magnetizer. An experimental system was constructed, consisting of a pair of differential sensing coils connected with a high-speed digital oscilloscope for data acquisition. The data were transferred to a computer to obtain an initial magnetization curve and a descending branch of a hysteresis loop in a rapidly changing positive field. This system was tested with synthetic samples (permalloy ribbon, aluminum plate, and nickel powder) as well as two volcanic rock samples. Results from the synthetic samples showed considerable differences from those measured by a quasi-static method using a vibrating sample magnetometer (VSM). These differences were principally due to the time-dependent magnetic properties or to electromagnetic effects, such as magnetic viscosity, eddy current loss, or magnetic relaxation. Results from the natural samples showed that the transient magnetization-field curves were largely comparable to the corresponding portions of the hysteresis loops. However, the relative magnetization (scaled to the saturation magnetization) at the end of a pulse was greater than that measured by a VSM. This discrepancy, together with the occurrence of rapid exponential decay after a pulse, indicates magnetic relaxations that could be interpreted in terms of domain wall displacement. These results suggest that with further developments, the proposed technique can become a useful tool for characterizing magnetic particles contained in a variety of natural materials.

Bulk and nanocrystalline electron doped Gd0.15Ca0.85MnO3: Synthesis and magnetic characterization

NASA Astrophysics Data System (ADS)

Dhal, Lakshman; Chattarpal; Nirmala, R.; Santhosh, P. N.; Kumary, T. Geetha; Nigam, A. K.

2014-09-01

Polycrystalline Gd0.15Ca0.85MnO3 sample was prepared by solid state reaction method and nanocrystalline samples of different grain sizes of the same were prepared by sol-gel method. Phase purity and composition were verified by room temperature X-ray diffraction and SEM-EDAX analysis. Magnetization data of bulk Gd0.15Ca0.85MnO3 in 5 kOe field shows a peak at 119 K (TN) suggesting an antiferromagnetic transition. Nanocrystalline Gd0.15Ca0.85MnO3 sample ( 54 nm size) also shows a cusp at 107 K and a broad thermal hysteresis between field cooled cooling (FCC) and field cooled warming (FCW) data around this temperature. This thermal hysteresis suggests possible crystal structural transition. Field variation of magnetization of bulk Gd0.15Ca0.85MnO3 at 5 K shows a tendency to saturate, but yields a magnetic moment value of only 1.12 μB/f.u. in 70 kOe. The value of magnetization of nanocrystalline sample at 5 K in 70 kOe field is slightly larger and is 1.38 μB/f.u. which is probably due to the surface moments of the nanoparticle samples. Both the samples show Curie-Weiss-like behaviour in their paramagnetic state.

THE NEW YORK CITY URBAN DISPERSION PROGRAM MARCH 2005 FIELD STUDY: TRACER METHODS AND RESULTS.

DOE Office of Scientific and Technical Information (OSTI.GOV)

WATSON, T.B.; HEISER, J.; KALB, P.

The Urban Dispersion Program March 2005 Field Study tracer releases, sampling, and analytical methods are described in detail. There were two days where tracer releases and sampling were conducted. A total of 16.0 g of six tracers were released during the first test day or Intensive Observation Period (IOP) 1 and 15.7 g during IOP 2. Three types of sampling instruments were used in this study. Sequential air samplers, or SAS, collected six-minute samples, while Brookhaven atmospheric tracer samplers (BATS) and personal air samplers (PAS) collected thirty-minute samples. There were a total of 1300 samples resulting from the two IOPs.more » Confidence limits in the sampling and analysis method were 20% as determined from 100 duplicate samples. The sample recovery rate was 84%. The integrally averaged 6-minute samples were compared to the 30-minute samples. The agreement was found to be good in most cases. The validity of using a background tracer to calculate sample volumes was examined and also found to have a confidence level of 20%. Methods for improving sampling and analysis are discussed. The data described in this report are available as Excel files. An additional Excel file of quality assured tracer data for use in model validation efforts is also available. The file consists of extensively quality assured BATS tracer data with background concentrations subtracted.« less

A loop-mediated isothermal amplification method for a differential identification of Taenia tapeworms from human: application to a field survey.

PubMed

Nkouawa, Agathe; Sako, Yasuhito; Li, Tiaoying; Chen, Xingwang; Nakao, Minoru; Yanagida, Tetsuya; Okamoto, Munehiro; Giraudoux, Patrick; Raoul, Francis; Nakaya, Kazuhiro; Xiao, Ning; Qiu, Jiamin; Qiu, Dongchuan; Craig, Philip S; Ito, Akira

2012-12-01

In this study, we applied a loop-mediated isothermal amplification method for identification of human Taenia tapeworms in Tibetan communities in Sichuan, China. Out of 51 proglottids recovered from 35 carriers, 9, 1, and 41 samples were identified as Taenia solium, Taenia asiatica and Taenia saginata, respectively. Same results were obtained afterwards in the laboratory, except one sample. These results demonstrated that the LAMP method enabled rapid identification of parasites in the field surveys, which suggested that this method would contribute to the control of Taenia infections in endemic areas. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Field and laboratory arsenic speciation methods and their application to natural-water analysis

USGS Publications Warehouse

Bednar, A.J.; Garbarino, J.R.; Burkhardt, M.R.; Ranville, J.F.; Wildeman, T.R.

2004-01-01

The toxic and carcinogenic properties of inorganic and organic arsenic species make their determination in natural water vitally important. Determination of individual inorganic and organic arsenic species is critical because the toxicology, mobility, and adsorptivity vary substantially. Several methods for the speciation of arsenic in groundwater, surface-water, and acid mine drainage sample matrices using field and laboratory techniques are presented. The methods provide quantitative determination of arsenite [As(III)], arsenate [As(V)], monomethylarsonate (MMA), dimethylarsinate (DMA), and roxarsone in 2-8min at detection limits of less than 1??g arsenic per liter (??g AsL-1). All the methods use anion exchange chromatography to separate the arsenic species and inductively coupled plasma-mass spectrometry as an arsenic-specific detector. Different methods were needed because some sample matrices did not have all arsenic species present or were incompatible with particular high-performance liquid chromatography (HPLC) mobile phases. The bias and variability of the methods were evaluated using total arsenic, As(III), As(V), DMA, and MMA results from more than 100 surface-water, groundwater, and acid mine drainage samples, and reference materials. Concentrations in test samples were as much as 13,000??g AsL-1 for As(III) and 3700??g AsL-1 for As(V). Methylated arsenic species were less than 100??g AsL-1 and were found only in certain surface-water samples, and roxarsone was not detected in any of the water samples tested. The distribution of inorganic arsenic species in the test samples ranged from 0% to 90% As(III). Laboratory-speciation method variability for As(III), As(V), MMA, and DMA in reagent water at 0.5??g AsL-1 was 8-13% (n=7). Field-speciation method variability for As(III) and As(V) at 1??g AsL-1 in reagent water was 3-4% (n=3). ?? 2003 Elsevier Ltd. All rights reserved.

Comparison of macronutrient contents in human milk measured using mid-infrared human milk analyser in a field study vs. chemical reference methods.

PubMed

Zhu, Mei; Yang, Zhenyu; Ren, Yiping; Duan, Yifan; Gao, Huiyu; Liu, Biao; Ye, Wenhui; Wang, Jie; Yin, Shian

2017-01-01

Macronutrient contents in human milk are the common basis for estimating these nutrient requirements for both infants and lactating women. A mid-infrared human milk analyser (HMA, Miris, Sweden) was recently developed for determining macronutrient levels. The purpose of the study is to compare the accuracy and precision of HMA method with fresh milk samples in the field studies with chemical methods with frozen samples in the lab. Full breast milk was collected using electric pumps and fresh milk was analyzed in the field studies using HMA. All human milk samples were thawed and analyzed with chemical reference methods in the lab. The protein, fat and total solid levels were significantly correlated between the two methods and the correlation coefficient was 0.88, 0.93 and 0.78, respectively (p  <  0.001). The mean protein content was significantly lower and the mean fat level was significantly greater when measured using HMA method (1.0 g 100 mL -1 vs 1.2 g 100 mL -1 and 3. 7 g 100 mL -1 vs 3.2 g 100 mL -1 , respectively, p  <  0.001). Thus, linear recalibration could be used to improve mean estimation for both protein and fat. There was no significant correlation for lactose between the two methods (p  >  0.05). There was no statistically significant difference in the mean total solid concentration (12.2 g 100 mL -1 vs 12.3 g 100 mL -1 , p  >  0.05). Overall, HMA might be used to analyze macronutrients in fresh human milk with acceptable accuracy and precision after recalibrating fat and protein levels of field samples. © 2016 John Wiley & Sons Ltd.

A comprehensive comparison of perpendicular distance sampling methods for sampling downed coarse woody debris

Treesearch

Jeffrey H. Gove; Mark J. Ducey; Harry T. Valentine; Michael S. Williams

2013-01-01

Many new methods for sampling down coarse woody debris have been proposed in the last dozen or so years. One of the most promising in terms of field application, perpendicular distance sampling (PDS), has several variants that have been progressively introduced in the literature. In this study, we provide an overview of the different PDS variants and comprehensive...

Distortion correction of echo planar images applying the concept of finite rate of innovation to point spread function mapping (FRIP).

PubMed

Nunes, Rita G; Hajnal, Joseph V

2018-06-01

Point spread function (PSF) mapping enables estimating the displacement fields required for distortion correction of echo planar images. Recently, a highly accelerated approach was introduced for estimating displacements from the phase slope of under-sampled PSF mapping data. Sampling schemes with varying spacing were proposed requiring stepwise phase unwrapping. To avoid unwrapping errors, an alternative approach applying the concept of finite rate of innovation to PSF mapping (FRIP) is introduced, using a pattern search strategy to locate the PSF peak, and the two methods are compared. Fully sampled PSF data was acquired in six subjects at 3.0 T, and distortion maps were estimated after retrospective under-sampling. The two methods were compared for both previously published and newly optimized sampling patterns. Prospectively under-sampled data were also acquired. Shift maps were estimated and deviations relative to the fully sampled reference map were calculated. The best performance was achieved when using FRIP with a previously proposed sampling scheme. The two methods were comparable for the remaining schemes. The displacement field errors tended to be lower as the number of samples or their spacing increased. A robust method for estimating the position of the PSF peak has been introduced.

Development of an automated high temperature valveless injection system for on-line gas chromatography

NASA Astrophysics Data System (ADS)

Kreisberg, N. M.; Worton, D. R.; Zhao, Y.; Isaacman, G.; Goldstein, A. H.; Hering, S. V.

2014-07-01

A reliable method of sample introduction is presented for on-line gas chromatography with a special application to in-situ field portable atmospheric sampling instruments. A traditional multi-port valve is replaced with a controlled pressure switching device that offers the advantage of long term reliability and stable sample transfer efficiency. An engineering design model is presented and tested that allows customizing the interface for other applications. Flow model accuracy is within measurement accuracy (1%) when parameters are tuned for an ambient detector and 15% accurate when applied to a vacuum based detector. Laboratory comparisons made between the two methods of sample introduction using a thermal desorption aerosol gas chromatograph (TAG) show approximately three times greater reproducibility maintained over the equivalent of a week of continuous sampling. Field performance results for two versions of the valveless interface used in the in-situ instrument demonstrate minimal trending and a zero failure rate during field deployments ranging up to four weeks of continuous sampling. Extension of the VLI to dual collection cells is presented with less than 3% cell-to-cell carry-over.

Magnetic domain structure imaging near sample surface with alternating magnetic force microscopy by using AC magnetic field modulated superparamagnetic tip.

PubMed

Cao, Yongze; Nakayama, Shota; Kumar, Pawan; Zhao, Yue; Kinoshita, Yukinori; Yoshimura, Satoru; Saito, Hitoshi

2018-05-03

For magnetic domain imaging with a very high spatial resolution by magnetic force microscopy the tip-sample distance should be as small as possible. However, magnetic imaging near sample surface is very difficult with conventional MFM because the interactive forces between tip and sample includes van der Waals and electrostatic forces along with magnetic force. In this study, we proposed an alternating magnetic force microscopy (A-MFM) which extract only magnetic force near sample surface without any topographic and electrical crosstalk. In the present method, the magnetization of a FeCo-GdOx superparamagnetic tip is modulated by an external AC magnetic field in order to measure the magnetic domain structure without any perturbation from the other forces near the sample surface. Moreover, it is demonstrated that the proposed method can also measure the strength and identify the polarities of the second derivative of the perpendicular stray field from a thin-film permanent magnet with DC demagnetized state and remanent state. © 2018 IOP Publishing Ltd.

The measurement of heats of solution of high melting metallic systems in an electromagnetic levitation field. Ph.D. Thesis - Tech. Univ. Berlin - 1979

NASA Technical Reports Server (NTRS)

Frohberg, M. G.; Betz, G.

1982-01-01

A method was tested for measuring the enthalpies of mixing of liquid metallic alloying systems, involving the combination of two samples in the electromagnetic field of an induction coil. The heat of solution is calculated from the pyrometrically measured temperature effect, the heat capacity of the alloy, and the heat content of the added sample. The usefulness of the method was tested experimentally with iron-copper and niobium-silicon systems. This method should be especially applicable to high-melting alloys, for which conventional measurements have failed.

[Effect sizes, statistical power and sample sizes in "the Japanese Journal of Psychology"].

PubMed

Suzukawa, Yumi; Toyoda, Hideki

2012-04-01

This study analyzed the statistical power of research studies published in the "Japanese Journal of Psychology" in 2008 and 2009. Sample effect sizes and sample statistical powers were calculated for each statistical test and analyzed with respect to the analytical methods and the fields of the studies. The results show that in the fields like perception, cognition or learning, the effect sizes were relatively large, although the sample sizes were small. At the same time, because of the small sample sizes, some meaningful effects could not be detected. In the other fields, because of the large sample sizes, meaningless effects could be detected. This implies that researchers who could not get large enough effect sizes would use larger samples to obtain significant results.

Observation of force-detected nuclear magnetic resonance in a homogeneous field

PubMed Central

Madsen, L. A.; Leskowitz, G. M.; Weitekamp, D. P.

2004-01-01

We report the experimental realization of BOOMERANG (better observation of magnetization, enhanced resolution, and no gradient), a sensitive and general method of magnetic resonance. The prototype millimeter-scale NMR spectrometer shows signal and noise levels in agreement with the design principles. We present 1H and 19F NMR in both solid and liquid samples, including time-domain Fourier transform NMR spectroscopy, multiple-pulse echoes, and heteronuclear J spectroscopy. By measuring a 1H-19F J coupling, this last experiment accomplishes chemically specific spectroscopy with force-detected NMR. In BOOMERANG, an assembly of permanent magnets provides a homogeneous field throughout the sample, while a harmonically suspended part of the assembly, a detector, is mechanically driven by spin-dependent forces. By placing the sample in a homogeneous field, signal dephasing by diffusion in a field gradient is made negligible, enabling application to liquids, in contrast to other force-detection methods. The design appears readily scalable to μm-scale samples where it should have sensitivity advantages over inductive detection with microcoils and where it holds great promise for application of magnetic resonance in biology, chemistry, physics, and surface science. We briefly discuss extensions of the BOOMERANG method to the μm and nm scales. PMID:15326302

Survey of predators and sampling method comparison in sweet corn.

PubMed

Musser, Fred R; Nyrop, Jan P; Shelton, Anthony M

2004-02-01

Natural predation is an important component of integrated pest management that is often overlooked because it is difficult to quantify and perceived to be unreliable. To begin incorporating natural predation into sweet corn, Zea mays L., pest management, a predator survey was conducted and then three sampling methods were compared for their ability to accurately monitor the most abundant predators. A predator survey on sweet corn foliage in New York between 1999 and 2001 identified 13 species. Orius insidiosus (Say), Coleomegilla maculata (De Geer), and Harmonia axyridis (Pallas) were the most numerous predators in all years. To determine the best method for sampling adult and immature stages of these predators, comparisons were made among nondestructive field counts, destructive counts, and yellow sticky cards. Field counts were correlated with destructive counts for all populations, but field counts of small insects were biased. Sticky cards underrepresented immature populations. Yellow sticky cards were more attractive to C. maculata adults than H. axyridis adults, especially before pollen shed, making coccinellid population estimates based on sticky cards unreliable. Field counts were the most precise method for monitoring adult and immature stages of the three major predators. Future research on predicting predation of pests in sweet corn should be based on field counts of predators because these counts are accurate, have no associated supply costs, and can be made quickly.

Comparison of methods of preserving tissues for pesticide analysis

USGS Publications Warehouse

Stickel, W.H.; Stickel, L.F.; Dyrland, R.A.; Hughes, D.L.

1984-01-01

Formalin preservation, freezing, spoiling followed by freezing, and phenoxyethanol were compared in terms of concentrations of DDT, DDD, DDE, endrin, and hepatachlor epoxide measured in brain, liver and carcass of birds fed dietary dosages of pesticides and in spiked egg homogenate. Phenoxyethanol proved to be an unsatisfactory preservative; the amount of 'extractable lipid' was excessive, and measurements of concentrations in replicates were erratic. Concentrations of residues in formalin-preserved and frozen samples did not differ significantly in any tissue. Percentage lipid in brains and eggs, however, were significantly lower in formalin-preserved samples. Samples of muscle and liver that had been spoiled before freezing yielded less DDD, and muscle samples yielded more DDT than formalin-preserved samples. The authors conclude that formalin preservation is a satisfactory method for preservation of field samples and that the warming and spoiling of samples that may occur unavoidably in the field will not result in misleading analytical results.

An efficient field and laboratory workflow for plant phylotranscriptomic projects1

PubMed Central

Yang, Ya; Moore, Michael J.; Brockington, Samuel F.; Timoneda, Alfonso; Feng, Tao; Marx, Hannah E.; Walker, Joseph F.; Smith, Stephen A.

2017-01-01

Premise of the study: We describe a field and laboratory workflow developed for plant phylotranscriptomic projects that involves cryogenic tissue collection in the field, RNA extraction and quality control, and library preparation. We also make recommendations for sample curation. Methods and Results: A total of 216 frozen tissue samples of Caryophyllales and other angiosperm taxa were collected from the field or botanical gardens. RNA was extracted, stranded mRNA libraries were prepared, and libraries were sequenced on Illumina HiSeq platforms. These included difficult mucilaginous tissues such as those of Cactaceae and Droseraceae. Conclusions: Our workflow is not only cost effective (ca. $270 per sample, as of August 2016, from tissue to reads) and time efficient (less than 50 h for 10–12 samples including all laboratory work and sample curation), but also has proven robust for extraction of difficult samples such as tissues containing high levels of secondary compounds. PMID:28337391

A distance limited method for sampling downed coarse woody debris

Treesearch

Jeffrey H. Gove; Mark J. Ducey; Harry T. Valentine; Michael S. Williams

2012-01-01

A new sampling method for down coarse woody debris is proposed based on limiting the perpendicular distance from individual pieces to a randomly chosen sample point. Two approaches are presented that allow different protocols to be used to determine field measurements; estimators for each protocol are also developed. Both protocols are compared via simulation against...

Monoclonal antibodies to synthetic pyrethroids and method for detecting the same

DOEpatents

Stanker, Larry H.; Vanderlaan, Martin; Watkins, Bruce E.; Van Emon, Jeanette M.; Bigbee, Carolyn L.

1992-01-01

Methods are described for making specific monoclonal antibodies which may be used in a sensitive immunoassay for detection of synthetic pyrethroids in foods and environmental samples. Appropriate sample preparation and enzyme amplification of the immunoassay for this widely-used class of pesticides permits detection at low levels in laboratory and field tested samples.

Monoclonal antibodies to synthetic pyrethroids and method for detecting the same

DOEpatents

Stanker, L.H.; Vanderlaan, M.; Watkins, B.E.; Van Emon, J.M.; Bigbee, C.L.

1992-04-28

Methods are described for making specific monoclonal antibodies which may be used in a sensitive immunoassay for detection of synthetic pyrethroids in foods and environmental samples. Appropriate sample preparation and enzyme amplification of the immunoassay for this widely-used class of pesticides permits detection at low levels in laboratory and field tested samples. 6 figs.

[Comparison study on sampling methods of Oncomelania hupensis snail survey in marshland schistosomiasis epidemic areas in China].

PubMed

An, Zhao; Wen-Xin, Zhang; Zhong, Yao; Yu-Kuan, Ma; Qing, Liu; Hou-Lang, Duan; Yi-di, Shang

2016-06-29

To optimize and simplify the survey method of Oncomelania hupensis snail in marshland endemic region of schistosomiasis and increase the precision, efficiency and economy of the snail survey. A quadrate experimental field was selected as the subject of 50 m×50 m size in Chayegang marshland near Henghu farm in the Poyang Lake region and a whole-covered method was adopted to survey the snails. The simple random sampling, systematic sampling and stratified random sampling methods were applied to calculate the minimum sample size, relative sampling error and absolute sampling error. The minimum sample sizes of the simple random sampling, systematic sampling and stratified random sampling methods were 300, 300 and 225, respectively. The relative sampling errors of three methods were all less than 15%. The absolute sampling errors were 0.221 7, 0.302 4 and 0.047 8, respectively. The spatial stratified sampling with altitude as the stratum variable is an efficient approach of lower cost and higher precision for the snail survey.

mHealth Series: mHealth project in Zhao County, rural China – Description of objectives, field site and methods

PubMed Central

van Velthoven, Michelle Helena; Li, Ye; Wang, Wei; Du, Xiaozhen; Wu, Qiong; Chen, Li; Majeed, Azeem; Rudan, Igor; Zhang, Yanfeng; Car, Josip

2013-01-01

Background We set up a collaboration between researchers in China and the UK that aimed to explore the use of mHealth in China. This is the first paper in a series of papers on a large mHealth project part of this collaboration. This paper included the aims and objectives of the mHealth project, our field site, and the detailed methods of two studies. Field site The field site for this mHealth project was Zhao County, which lies 280 km south of Beijing in Hebei Province, China. Methods We described the methodology of two studies: (i) a mixed methods study exploring factors influencing sample size calculations for mHealth–based health surveys and (ii) a cross–over study determining validity of an mHealth text messaging data collection tool. The first study used mixed methods, both quantitative and qualitative, including: (i) two surveys with caregivers of young children, (ii) interviews with caregivers, village doctors and participants of the cross–over study, and (iii) researchers’ views. We combined data from caregivers, village doctors and researchers to provide an in–depth understanding of factors influencing sample size calculations for mHealth–based health surveys. The second study, a cross–over study, used a randomised cross–over study design to compare the traditional face–to–face survey method to the new text messaging survey method. We assessed data equivalence (intrarater agreement), the amount of information in responses, reasons for giving different responses, the response rate, characteristics of non–responders, and the error rate. Conclusions This paper described the objectives, field site and methods of a large mHealth project part of a collaboration between researchers in China and the UK. The mixed methods study evaluating factors that influence sample size calculations could help future studies with estimating reliable sample sizes. The cross–over study comparing face–to–face and text message survey data collection could help future studies with developing their mHealth tools. PMID:24363919

Micro/Nano-scale Strain Distribution Measurement from Sampling Moiré Fringes.

PubMed

Wang, Qinghua; Ri, Shien; Tsuda, Hiroshi

2017-05-23

This work describes the measurement procedure and principles of a sampling moiré technique for full-field micro/nano-scale deformation measurements. The developed technique can be performed in two ways: using the reconstructed multiplication moiré method or the spatial phase-shifting sampling moiré method. When the specimen grid pitch is around 2 pixels, 2-pixel sampling moiré fringes are generated to reconstruct a multiplication moiré pattern for a deformation measurement. Both the displacement and strain sensitivities are twice as high as in the traditional scanning moiré method in the same wide field of view. When the specimen grid pitch is around or greater than 3 pixels, multi-pixel sampling moiré fringes are generated, and a spatial phase-shifting technique is combined for a full-field deformation measurement. The strain measurement accuracy is significantly improved, and automatic batch measurement is easily achievable. Both methods can measure the two-dimensional (2D) strain distributions from a single-shot grid image without rotating the specimen or scanning lines, as in traditional moiré techniques. As examples, the 2D displacement and strain distributions, including the shear strains of two carbon fiber-reinforced plastic specimens, were measured in three-point bending tests. The proposed technique is expected to play an important role in the non-destructive quantitative evaluations of mechanical properties, crack occurrences, and residual stresses of a variety of materials.

Toward cost-efficient sampling methods

NASA Astrophysics Data System (ADS)

Luo, Peng; Li, Yongli; Wu, Chong; Zhang, Guijie

2015-09-01

The sampling method has been paid much attention in the field of complex network in general and statistical physics in particular. This paper proposes two new sampling methods based on the idea that a small part of vertices with high node degree could possess the most structure information of a complex network. The two proposed sampling methods are efficient in sampling high degree nodes so that they would be useful even if the sampling rate is low, which means cost-efficient. The first new sampling method is developed on the basis of the widely used stratified random sampling (SRS) method and the second one improves the famous snowball sampling (SBS) method. In order to demonstrate the validity and accuracy of two new sampling methods, we compare them with the existing sampling methods in three commonly used simulation networks that are scale-free network, random network, small-world network, and also in two real networks. The experimental results illustrate that the two proposed sampling methods perform much better than the existing sampling methods in terms of achieving the true network structure characteristics reflected by clustering coefficient, Bonacich centrality and average path length, especially when the sampling rate is low.

From picture to porosity of river bed material using Structure-from-Motion with Multi-View-Stereo

NASA Astrophysics Data System (ADS)

Seitz, Lydia; Haas, Christian; Noack, Markus; Wieprecht, Silke

2018-04-01

Common methods for in-situ determination of porosity of river bed material are time- and effort-consuming. Although mathematical predictors can be used for estimation, they do not adequately represent porosities. The objective of this study was to assess a new approach for the determination of porosity of frozen sediment samples. The method is based on volume determination by applying Structure-from-Motion with Multi View Stereo (SfM-MVS) to estimate a 3D volumetric model based on overlapping imagery. The method was applied on artificial sediment mixtures as well as field samples. In addition, the commonly used water replacement method was applied to determine porosities in comparison with the SfM-MVS method. We examined a range of porosities from 0.16 to 0.46 that are representative of the wide range of porosities found in rivers. SfM-MVS performed well in determining volumes of the sediment samples. A very good correlation (r = 0.998, p < 0.0001) was observed between the SfM-MVS and the water replacement method. Results further show that the water replacement method underestimated total sample volumes. A comparison with several mathematical predictors showed that for non-uniform samples the calculated porosity based on the standard deviation performed better than porosities based on the median grain size. None of the predictors were effective at estimating the porosity of the field samples.

Impact of Processing Method on Recovery of Bacteria from Wipes Used in Biological Surface Sampling

PubMed Central

Olson, Nathan D.; Filliben, James J.; Morrow, Jayne B.

2012-01-01

Environmental sampling for microbiological contaminants is a key component of hygiene monitoring and risk characterization practices utilized across diverse fields of application. However, confidence in surface sampling results, both in the field and in controlled laboratory studies, has been undermined by large variation in sampling performance results. Sources of variation include controlled parameters, such as sampling materials and processing methods, which often differ among studies, as well as random and systematic errors; however, the relative contributions of these factors remain unclear. The objective of this study was to determine the relative impacts of sample processing methods, including extraction solution and physical dissociation method (vortexing and sonication), on recovery of Gram-positive (Bacillus cereus) and Gram-negative (Burkholderia thailandensis and Escherichia coli) bacteria from directly inoculated wipes. This work showed that target organism had the largest impact on extraction efficiency and recovery precision, as measured by traditional colony counts. The physical dissociation method (PDM) had negligible impact, while the effect of the extraction solution was organism dependent. Overall, however, extraction of organisms from wipes using phosphate-buffered saline with 0.04% Tween 80 (PBST) resulted in the highest mean recovery across all three organisms. The results from this study contribute to a better understanding of the factors that influence sampling performance, which is critical to the development of efficient and reliable sampling methodologies relevant to public health and biodefense. PMID:22706055

Numerical simulations of motion-insensitive diffusion imaging based on the distant dipolar field effects.

PubMed

Lin, Tao; Sun, Huijun; Chen, Zhong; You, Rongyi; Zhong, Jianhui

2007-12-01

Diffusion weighting in MRI is commonly achieved with the pulsed-gradient spin-echo (PGSE) method. When combined with spin-warping image formation, this method often results in ghosts due to the sample's macroscopic motion. It has been shown experimentally (Kennedy and Zhong, MRM 2004;52:1-6) that these motion artifacts can be effectively eliminated by the distant dipolar field (DDF) method, which relies on the refocusing of spatially modulated transverse magnetization by the DDF within the sample itself. In this report, diffusion-weighted images (DWIs) using both DDF and PGSE methods in the presence of macroscopic sample motion were simulated. Numerical simulation results quantify the dependence of signals in DWI on several key motion parameters and demonstrate that the DDF DWIs are much less sensitive to macroscopic sample motion than the traditional PGSE DWIs. The results also show that the dipolar correlation distance (d(c)) can alter contrast in DDF DWIs. The simulated results are in good agreement with the experimental results reported previously.

Pairing field methods to improve inference in wildlife surveys while accommodating detection covariance

USGS Publications Warehouse

Clare, John; McKinney, Shawn T.; DePue, John E.; Loftin, Cynthia S.

2017-01-01

It is common to use multiple field sampling methods when implementing wildlife surveys to compare method efficacy or cost efficiency, integrate distinct pieces of information provided by separate methods, or evaluate method-specific biases and misclassification error. Existing models that combine information from multiple field methods or sampling devices permit rigorous comparison of method-specific detection parameters, enable estimation of additional parameters such as false-positive detection probability, and improve occurrence or abundance estimates, but with the assumption that the separate sampling methods produce detections independently of one another. This assumption is tenuous if methods are paired or deployed in close proximity simultaneously, a common practice that reduces the additional effort required to implement multiple methods and reduces the risk that differences between method-specific detection parameters are confounded by other environmental factors. We develop occupancy and spatial capture–recapture models that permit covariance between the detections produced by different methods, use simulation to compare estimator performance of the new models to models assuming independence, and provide an empirical application based on American marten (Martes americana) surveys using paired remote cameras, hair catches, and snow tracking. Simulation results indicate existing models that assume that methods independently detect organisms produce biased parameter estimates and substantially understate estimate uncertainty when this assumption is violated, while our reformulated models are robust to either methodological independence or covariance. Empirical results suggested that remote cameras and snow tracking had comparable probability of detecting present martens, but that snow tracking also produced false-positive marten detections that could potentially substantially bias distribution estimates if not corrected for. Remote cameras detected marten individuals more readily than passive hair catches. Inability to photographically distinguish individual sex did not appear to induce negative bias in camera density estimates; instead, hair catches appeared to produce detection competition between individuals that may have been a source of negative bias. Our model reformulations broaden the range of circumstances in which analyses incorporating multiple sources of information can be robustly used, and our empirical results demonstrate that using multiple field-methods can enhance inferences regarding ecological parameters of interest and improve understanding of how reliably survey methods sample these parameters.

Numerical study of ultra-low field nuclear magnetic resonance relaxometry utilizing a single axis magnetometer for signal detection.

PubMed

Vogel, Michael W; Vegh, Viktor; Reutens, David C

2013-05-01

This paper investigates optimal placement of a localized single-axis magnetometer for ultralow field (ULF) relaxometry in view of various sample shapes and sizes. The authors used finite element method for the numerical analysis to determine the sample magnetic field environment and evaluate the optimal location of the single-axis magnetometer. Given the different samples, the authors analysed the magnetic field distribution around the sample and determined the optimal orientation and possible positions of the sensor to maximize signal strength, that is, the power of the free induction decay. The authors demonstrate that a glass vial with flat bottom and 10 ml volume is the best structure to achieve the highest signal out of samples studied. This paper demonstrates the importance of taking into account the combined effects of sensor configuration and sample parameters for signal generation prior to designing and constructing ULF systems with a single-axis magnetometer. Through numerical simulations the authors were able to optimize structural parameters, such as sample shape and size, sensor orientation and location, to maximize the measured signal in ultralow field relaxometry.

Development of an automated high-temperature valveless injection system for online gas chromatography

NASA Astrophysics Data System (ADS)

Kreisberg, N. M.; Worton, D. R.; Zhao, Y.; Isaacman, G.; Goldstein, A. H.; Hering, S. V.

2014-12-01

A reliable method of sample introduction is presented for online gas chromatography with a special application to in situ field portable atmospheric sampling instruments. A traditional multi-port valve is replaced with a valveless sample introduction interface that offers the advantage of long-term reliability and stable sample transfer efficiency. An engineering design model is presented and tested that allows customizing this pressure-switching-based device for other applications. Flow model accuracy is within measurement accuracy (1%) when parameters are tuned for an ambient-pressure detector and 15% accurate when applied to a vacuum-based detector. Laboratory comparisons made between the two methods of sample introduction using a thermal desorption aerosol gas chromatograph (TAG) show that the new interface has approximately 3 times greater reproducibility maintained over the equivalent of a week of continuous sampling. Field performance results for two versions of the valveless interface used in the in situ instrument demonstrate typically less than 2% week-1 response trending and a zero failure rate during field deployments ranging up to 4 weeks of continuous sampling. Extension of the valveless interface to dual collection cells is presented with less than 3% cell-to-cell carryover.

Development of an automated high-temperature valveless injection system for online gas chromatography

DOE PAGES

Kreisberg, N. M.; Worton, D. R.; Zhao, Y.; ...

2014-12-12

A reliable method of sample introduction is presented for online gas chromatography with a special application to in situ field portable atmospheric sampling instruments. A traditional multi-port valve is replaced with a valveless sample introduction interface that offers the advantage of long-term reliability and stable sample transfer efficiency. An engineering design model is presented and tested that allows customizing this pressure-switching-based device for other applications. Flow model accuracy is within measurement accuracy (1%) when parameters are tuned for an ambient-pressure detector and 15% accurate when applied to a vacuum-based detector. Laboratory comparisons made between the two methods of sample introductionmore » using a thermal desorption aerosol gas chromatograph (TAG) show that the new interface has approximately 3 times greater reproducibility maintained over the equivalent of a week of continuous sampling. Field performance results for two versions of the valveless interface used in the in situ instrument demonstrate typically less than 2% week -1 response trending and a zero failure rate during field deployments ranging up to 4 weeks of continuous sampling. Extension of the valveless interface to dual collection cells is presented with less than 3% cell-to-cell carryover.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kreisberg, N. M.; Worton, D. R.; Zhao, Y.

A reliable method of sample introduction is presented for online gas chromatography with a special application to in situ field portable atmospheric sampling instruments. A traditional multi-port valve is replaced with a valveless sample introduction interface that offers the advantage of long-term reliability and stable sample transfer efficiency. An engineering design model is presented and tested that allows customizing this pressure-switching-based device for other applications. Flow model accuracy is within measurement accuracy (1%) when parameters are tuned for an ambient-pressure detector and 15% accurate when applied to a vacuum-based detector. Laboratory comparisons made between the two methods of sample introductionmore » using a thermal desorption aerosol gas chromatograph (TAG) show that the new interface has approximately 3 times greater reproducibility maintained over the equivalent of a week of continuous sampling. Field performance results for two versions of the valveless interface used in the in situ instrument demonstrate typically less than 2% week -1 response trending and a zero failure rate during field deployments ranging up to 4 weeks of continuous sampling. Extension of the valveless interface to dual collection cells is presented with less than 3% cell-to-cell carryover.« less

A cryopreservation method for Pasteurella multocida from wetland samples

USGS Publications Warehouse

Moore, Melody K.; Shadduck, D.J.; Goldberg, Diana R.; Samuel, M.D.

1998-01-01

A cryopreservation method and improved isolation techniques for detection of Pasteurella multocida from wetland samples were developed. Wetland water samples were collected in the field, diluted in dimethyl sulfoxide (DMSO, final concentration 10%), and frozen at -180 C in a liquid nitrogen vapor shipper. Frozen samples were transported to the laboratory where they were subsequently thawed and processed in Pasteurella multocida selective broth (PMSB) to isolate P. multocida. This method allowed for consistent isolation of 2 to 18 organisms/ml from water seeded with known concentrations of P. multocida. The method compared favorably with the standard mouse inoculation method and allowed for preservation of the samples until they could be processed in the laboratory.

Field test comparison of an autocorrelation technique for determining grain size using a digital 'beachball' camera versus traditional methods

USGS Publications Warehouse

Barnard, P.L.; Rubin, D.M.; Harney, J.; Mustain, N.

2007-01-01

This extensive field test of an autocorrelation technique for determining grain size from digital images was conducted using a digital bed-sediment camera, or 'beachball' camera. Using 205 sediment samples and >1200 images from a variety of beaches on the west coast of the US, grain size ranging from sand to granules was measured from field samples using both the autocorrelation technique developed by Rubin [Rubin, D.M., 2004. A simple autocorrelation algorithm for determining grain size from digital images of sediment. Journal of Sedimentary Research, 74(1): 160-165.] and traditional methods (i.e. settling tube analysis, sieving, and point counts). To test the accuracy of the digital-image grain size algorithm, we compared results with manual point counts of an extensive image data set in the Santa Barbara littoral cell. Grain sizes calculated using the autocorrelation algorithm were highly correlated with the point counts of the same images (r2 = 0.93; n = 79) and had an error of only 1%. Comparisons of calculated grain sizes and grain sizes measured from grab samples demonstrated that the autocorrelation technique works well on high-energy dissipative beaches with well-sorted sediment such as in the Pacific Northwest (r2 ??? 0.92; n = 115). On less dissipative, more poorly sorted beaches such as Ocean Beach in San Francisco, results were not as good (r2 ??? 0.70; n = 67; within 3% accuracy). Because the algorithm works well compared with point counts of the same image, the poorer correlation with grab samples must be a result of actual spatial and vertical variability of sediment in the field; closer agreement between grain size in the images and grain size of grab samples can be achieved by increasing the sampling volume of the images (taking more images, distributed over a volume comparable to that of a grab sample). In all field tests the autocorrelation method was able to predict the mean and median grain size with ???96% accuracy, which is more than adequate for the majority of sedimentological applications, especially considering that the autocorrelation technique is estimated to be at least 100 times faster than traditional methods.

Evaluation of volatile organic compound (VOC) blank data and application of study reporting levels to groundwater data collected for the California GAMA Priority Basin Project, May 2004 through September 2010

USGS Publications Warehouse

Fram, Miranda S.; Olsen, Lisa D.; Belitz, Kenneth

2012-01-01

Volatile organic compounds (VOCs) were analyzed in quality-control samples collected for the California Groundwater Ambient Monitoring and Assessment (GAMA) Program Priority Basin Project. From May 2004 through September 2010, a total of 2,026 groundwater samples, 211 field blanks, and 109 source-solution blanks were collected and analyzed for concentrations of 85 VOCs. Results from analyses of these field and source-solution blanks and of 2,411 laboratory instrument blanks during the same time period were used to assess the quality of data for the 2,026 groundwater samples. Eighteen VOCs were detected in field blanks or source-solution blanks: acetone, benzene, bromodichloromethane, 2-butanone, carbon disulfide, chloroform, 1,1-dichloroethene, dichloromethane, ethylbenzene, tetrachloroethene, styrene, tetrahydrofuran, toluene, trichloroethene, trichlorofluoromethane, 1,2,4-trimethylbenzene, m- and p-xylenes, and o-xylene. The objective of the evaluation of the VOC-blank data was to determine if study reporting levels (SRLs) were needed for any of the VOCs detected in blanks to ensure the quality of the data from groundwater samples. An SRL is equivalent to a raised reporting level that is used in place of the reporting level used by the analyzing laboratory [long‑term method detection level (LT-MDL) or laboratory reporting level (LRL)] to reduce the probability of reporting false-positive detections. Evaluation of VOC-blank data was done in three stages: (1) identification of a set of representative quality‑control field blanks (QCFBs) to be used for calculation of SRLs and identification of VOCs amenable to the SRL approach, (2) evaluation of potential sources of contamination to blanks and groundwater samples by VOCs detected in field blanks, and (3) selection of appropriate SRLs from among four potential SRLs for VOCs detected in field blanks and application of those SRLs to the groundwater data. An important conclusion from this study is that to ensure the quality of the data from groundwater samples, it was necessary to apply different methods of determining SRLs from field blank data to different VOCs, rather than use the same method for all VOCs. Four potential SRL values were defined by using three approaches: two values were defined by using a binomial probability method based on one-sided, nonparametric upper confidence limits, one was defined as equal to the maximum concentration detected in the field blanks, and one was defined as equal to the maximum laboratory method detection level used during the period when samples were collected for the project. The differences in detection frequencies and concentrations among different types of blanks (laboratory instrument blanks, source-solution blanks, and field blanks collected with three different sampling equipment configurations) and groundwater samples were used to infer the sources and mechanisms of contamination for each VOC detection in field blanks. Other chemical data for the groundwater samples (oxidation-reduction state, co-occurrence of VOCs, groundwater age) and ancillary information about the well sites (land use, presence of known sources of contamination) were used to evaluate whether the patterns of detections of VOCs in groundwater samples before and after application of potential SRLs were plausible. On this basis, the appropriate SRL was selected for each VOC that was determined to require an SRL. The SRLs for ethylbenzene [0.06 microgram per liter (μg/L)], m- and p-xylenes (0.33 μg/L), o-xylene (0.12 μg/L), toluene (0.69 μg/L), and 1,2,4-trimethylbenzene (0.56 μg/L) corresponded to the highest concentrations detected in the QCFBs and were selected because they resulted in the most censoring of groundwater data. Comparisons of hydrocarbon ratios in groundwater samples and blanks and comparisons between detection frequencies of the five hydrocarbons in groundwater samples and different types of blanks suggested three dominant sources of contamination that affected groundwater samples and blanks: (1) ethylbenzene, m- and p-xylenes, o-xylene, and toluene from fuel or exhaust components sorbed onto sampling lines, (2) toluene from vials and the source blank water, and (3) 1,2,4-trimethylbenzene from materials used for collection of samples for radon-222 analysis.

Soil Sampling Operating Procedure

EPA Pesticide Factsheets

EPA Region 4 Science and Ecosystem Support Division (SESD) document that describes general and specific procedures, methods, and considerations when collecting soil samples for field screening or laboratory analysis.

Sediment Sampling Operating Procedure

EPA Pesticide Factsheets

EPA Region 4 Science and Ecosystem Support Division (SESD) document that describes general and specific procedures, methods, and considerations when collecting sediment samples for field screening or laboratory analysis.

The Preparation of Gelatine-Embedded Soil and Litter Sections and Their Application to Some Soil Ecological Studies.

ERIC Educational Resources Information Center

Anderson, J. M.

1978-01-01

A method is described for preparing large gelatine-embedded soil sections for ecological studies. Sampling methods reduce structural disturbance of the samples to a minimum and include freezing the samples in the field to kill soil invertebrates in their natural microhabitats. Projects are suggested for upper secondary school students. (Author/BB)

Thermal Desorption Capability Development for Enhanced On-site Health Risk Assessment: HAPSITE (registered trademark) ER Passive Sampling in the Field

DTIC Science & Technology

2015-06-07

Field-Portable Gas Chromatograph-Mass Spectrometer.” Forensic Toxicol, 2006, 24, 17-22. Smith, P. “Person-Portable Gas Chromatography : Rapid Temperature...bench-top Gas Chromatograph-Mass Spectrometer (GC-MS) system (ISQ). Nine sites were sampled and analyzed for compounds using Environmental Protection...extraction methods for Liquid Chromatography -MS (LC- MS). Additionally, TD is approximately 1000X more sensitive, requires minimal sample preparation

Differences in results of analyses of concurrent and split stream-water samples collected and analyzed by the US Geological Survey and the Illinois Environmental Protection Agency, 1985-91

USGS Publications Warehouse

Melching, C.S.; Coupe, R.H.

1995-01-01

During water years 1985-91, the U.S. Geological Survey (USGS) and the Illinois Environmental Protection Agency (IEPA) cooperated in the collection and analysis of concurrent and split stream-water samples from selected sites in Illinois. Concurrent samples were collected independently by field personnel from each agency at the same time and sent to the IEPA laboratory, whereas the split samples were collected by USGS field personnel and divided into aliquots that were sent to each agency's laboratory for analysis. The water-quality data from these programs were examined by means of the Wilcoxon signed ranks test to identify statistically significant differences between results of the USGS and IEPA analyses. The data sets for constituents and properties identified by the Wilcoxon test as having significant differences were further examined by use of the paired t-test, mean relative percentage difference, and scattergrams to determine if the differences were important. Of the 63 constituents and properties in the concurrent-sample analysis, differences in only 2 (pH and ammonia) were statistically significant and large enough to concern water-quality engineers and planners. Of the 27 constituents and properties in the split-sample analysis, differences in 9 (turbidity, dissolved potassium, ammonia, total phosphorus, dissolved aluminum, dissolved barium, dissolved iron, dissolved manganese, and dissolved nickel) were statistically significant and large enough to con- cern water-quality engineers and planners. The differences in concentration between pairs of the concurrent samples were compared to the precision of the laboratory or field method used. The differences in concentration between pairs of the concurrent samples were compared to the precision of the laboratory or field method used. The differences in concentration between paris of split samples were compared to the precision of the laboratory method used and the interlaboratory precision of measuring a given concentration or property. Consideration of method precision indicated that differences between concurrent samples were insignificant for all concentrations and properties except pH, and that differences between split samples were significant for all concentrations and properties. Consideration of interlaboratory precision indicated that the differences between the split samples were not unusually large. The results for the split samples illustrate the difficulty in obtaining comparable and accurate water-quality data.

Detection of cocaine in cargo containers by high-volume vapor sampling: field test at Port of Miami

NASA Astrophysics Data System (ADS)

Neudorfl, Pavel; Hupe, Michael; Pilon, Pierre; Lawrence, Andre H.; Drolet, Gerry; Su, Chih-Wu; Rigdon, Stephen W.; Kunz, Terry D.; Ulwick, Syd; Hoglund, David E.; Wingo, Jeff J.; Demirgian, Jack C.; Shier, Patrick

1997-02-01

The use of marine containers is a well known smuggling method for large shipments of drugs. Such containers present an ideal method of smuggling as the examination method is time consuming, difficult and expensive for the importing community. At present, various methods are being studied for screening containers which would allow to rapidly distinguish between innocent and suspicious cargo. Air sampling is one such method. Air is withdrawn for the inside of containers and analyzed for telltale vapors uniquely associated with the drug. The attractive feature of the technique is that the containers could be sampled without destuffing and opening, since air could be conveniently withdrawn via ventilation ducts. In the present paper, the development of air sampling methodology for the detection of cocaine hydrochloride will be discussed, and the results from a recent field test will be presented. The results indicated that vapors of cocaine and its decomposition product, ecgonidine methyl ester, could serve as sensitive indicators of the presence of the drug in the containers.

Field sampling and data analysis methods for development of ecological land classifications: an application on the Manistee National Forest.

Treesearch

George E. Host; Carl W. Ramm; Eunice A. Padley; Kurt S. Pregitzer; James B. Hart; David T. Cleland

1992-01-01

Presents technical documentation for development of an Ecological Classification System for the Manistee National Forest in northwest Lower Michigan, and suggests procedures applicable to other ecological land classification projects. Includes discussion of sampling design, field data collection, data summarization and analyses, development of classification units,...

RIVERINE ASSESSMENT USING MACROINVERTEBRATES: ALL METHODS ARE NOT CREATED EQUAL

EPA Science Inventory

In 1999, we compared six benthic macroinvertebrate field sampling methods for nonwadeable streams based on those developed for three major programs (EMAP-SW, NAWQA, and Ohio EPA), at each of sixty sites across four tributaries to the Ohio River. Water chemistry samples and physi...

NHEXAS PHASE I MARYLAND STUDY--STANDARD OPERATING PROCEDURE FOR TRAINING OF FIELD TECHNICIANS (G07)

EPA Science Inventory

The purpose of this SOP is to describe the method used for training field technicians. The SOP outlines the responsibilities of the Field Technician (FT) and the Field Coordination Center Supervisor (FCC-S) before, during, and after sampling at residences, and the training syste...

CTEPP STANDARD OPERATING PROCEDURE FOR HANDLING MISSING SAMPLES AND DATA (SOP-2.24)

EPA Science Inventory

This SOP describes the method for handling missing samples or data. Missing samples or data will be identified as soon as possible during field sampling. It provides guidance to collect the missing sample or data and document the reason for the missing sample or data.

High-resolution quantitative determination of dielectric function by using scattering scanning near-field optical microscopy

PubMed Central

Tranca, D. E.; Stanciu, S. G.; Hristu, R.; Stoichita, C.; Tofail, S. A. M.; Stanciu, G. A.

2015-01-01

A new method for high-resolution quantitative measurement of the dielectric function by using scattering scanning near-field optical microscopy (s-SNOM) is presented. The method is based on a calibration procedure that uses the s-SNOM oscillating dipole model of the probe-sample interaction and quantitative s-SNOM measurements. The nanoscale capabilities of the method have the potential to enable novel applications in various fields such as nano-electronics, nano-photonics, biology or medicine. PMID:26138665

Sex Ratio and Abundance Fluctuations of Sarcosaprophagous Calyptratae (Diptera): Field Evaluation of Two Sampling Techniques.

PubMed

Mulieri, P R; Olea, M S; Patitucci, L D; Battán-Horenstein, M

2018-06-07

Abundance of sarcosaprophagous Calyptratae species was monitored by using baited traps and active captures with hand net. Analysis of field data collected in three protected areas in the Valdivian temperate forest of South America (Lanín National Park, Lago Puelo National Park, and Los Alerces National Park) indicated that bottle traps baited with putrescine is a reliable method to estimate local abundance of sarcosaprophagous species by comparison to the active capture method. Also, we describe and compare general patterns of sex bias for four dominant species: Sarconesia magellanica (Le Guillou), Calliphora vicina Robineau-Desvoidy, Microcerella spinigena (Rondani), and Oxysarcodexia varia (Walker). From these analyses, it can be concluded that abundance fluctuations of flies showed significant relationship between the sampling methods. This study showed that besides the expected interspecific differences in trapping efficiency, there are acute intraspecific differences of sex ratios between sampling methods.

Wastewater Sampling Methodologies and Flow Measurement Techniques.

ERIC Educational Resources Information Center

Harris, Daniel J.; Keffer, William J.

This document provides a ready source of information about water/wastewater sampling activities using various commercial sampling and flow measurement devices. The report consolidates the findings and summarizes the activities, experiences, sampling methods, and field measurement techniques conducted by the Environmental Protection Agency (EPA),…

A beam hardening and dispersion correction for x-ray dark-field radiography.

PubMed

Pelzer, Georg; Anton, Gisela; Horn, Florian; Rieger, Jens; Ritter, André; Wandner, Johannes; Weber, Thomas; Michel, Thilo

2016-06-01

X-ray dark-field imaging promises information on the small angle scattering properties even of large samples. However, the dark-field image is correlated with the object's attenuation and phase-shift if a polychromatic x-ray spectrum is used. A method to remove part of these correlations is proposed. The experimental setup for image acquisition was modeled in a wave-field simulation to quantify the dark-field signals originating solely from a material's attenuation and phase-shift. A calibration matrix was simulated for ICRU46 breast tissue. Using the simulated data, a dark-field image of a human mastectomy sample was corrected for the finger print of attenuation- and phase-image. Comparing the simulated, attenuation-based dark-field values to a phantom measurement, a good agreement was found. Applying the proposed method to mammographic dark-field data, a reduction of the dark-field background and anatomical noise was achieved. The contrast between microcalcifications and their surrounding background was increased. The authors show that the influence of and dispersion can be quantified by simulation and, thus, measured image data can be corrected. The simulation allows to determine the corresponding dark-field artifacts for a wide range of setup parameters, like tube-voltage and filtration. The application of the proposed method to mammographic dark-field data shows an increase in contrast compared to the original image, which might simplify a further image-based diagnosis.

Apparatus and method for measuring critical current properties of a coated conductor

DOEpatents

Mueller, Fred M [Los Alamos, NM; Haenisch, Jens [Dresden, DE

2012-07-24

The transverse critical-current uniformity in a superconducting tape was determined using a magnetic knife apparatus. A critical current I.sub.c distribution and transverse critical current density J.sub.c distribution in YBCO coated conductors was measured nondestructively with high resolution using a magnetic knife apparatus. The method utilizes the strong depression of J.sub.c in applied magnetic fields. A narrow region of low, including zero, magnetic field in a surrounding higher field is moved transversely across a sample of coated conductor. This reveals the critical current density distribution. A Fourier series inversion process was used to determine the transverse J.sub.c distribution in the sample.

Sparse magnetic resonance imaging reconstruction using the bregman iteration

NASA Astrophysics Data System (ADS)

Lee, Dong-Hoon; Hong, Cheol-Pyo; Lee, Man-Woo

2013-01-01

Magnetic resonance imaging (MRI) reconstruction needs many samples that are sequentially sampled by using phase encoding gradients in a MRI system. It is directly connected to the scan time for the MRI system and takes a long time. Therefore, many researchers have studied ways to reduce the scan time, especially, compressed sensing (CS), which is used for sparse images and reconstruction for fewer sampling datasets when the k-space is not fully sampled. Recently, an iterative technique based on the bregman method was developed for denoising. The bregman iteration method improves on total variation (TV) regularization by gradually recovering the fine-scale structures that are usually lost in TV regularization. In this study, we studied sparse sampling image reconstruction using the bregman iteration for a low-field MRI system to improve its temporal resolution and to validate its usefulness. The image was obtained with a 0.32 T MRI scanner (Magfinder II, SCIMEDIX, Korea) with a phantom and an in-vivo human brain in a head coil. We applied random k-space sampling, and we determined the sampling ratios by using half the fully sampled k-space. The bregman iteration was used to generate the final images based on the reduced data. We also calculated the root-mean-square-error (RMSE) values from error images that were obtained using various numbers of bregman iterations. Our reconstructed images using the bregman iteration for sparse sampling images showed good results compared with the original images. Moreover, the RMSE values showed that the sparse reconstructed phantom and the human images converged to the original images. We confirmed the feasibility of sparse sampling image reconstruction methods using the bregman iteration with a low-field MRI system and obtained good results. Although our results used half the sampling ratio, this method will be helpful in increasing the temporal resolution at low-field MRI systems.

Soil Gas Sampling Operating Procedure

EPA Pesticide Factsheets

EPA Region 4 Science and Ecosystem Support Division (SESD) document that describes general and specific procedures, methods, and considerations when collecting soil gas samples for field screening or laboratory analysis.

How to deal with multiple binding poses in alchemical relative protein-ligand binding free energy calculations.

PubMed

Kaus, Joseph W; Harder, Edward; Lin, Teng; Abel, Robert; McCammon, J Andrew; Wang, Lingle

2015-06-09

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges.

How To Deal with Multiple Binding Poses in Alchemical Relative Protein–Ligand Binding Free Energy Calculations

PubMed Central

2016-01-01

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges. PMID:26085821

Evaluation of field sampling and preservation methods for strontium-90 in ground water at the Idaho National Engineering Laboratory, Idaho

USGS Publications Warehouse

Cecil, L.D.; Knobel, L.L.; Wegner, S.J.; Moore, L.L.

1989-01-01

Water from four wells completed in the Snake River Plain aquifer was sampled as part of the U.S. Geological Survey 's quality assurance program to evaluate the effect of filtration and preservation methods on strontium-90 concentrations in groundwater at the Idaho National Engineering Laboratory. Water from each well was filtered through either a 0.45-micrometer membrane or a 0.1-micrometer membrane filter; unfiltered samples also were collected. Two sets of filtered and two sets of unfiltered samples was preserved in the field with reagent-grade hydrochloric acid and the other set of samples was not acidified. For water from wells with strontium-90 concentrations at or above the reporting level, 94% or more of the strontium-90 is in true solution or in colloidal particles smaller than 0.1 micrometer. These results suggest that within-laboratory reproducibility for strontium-90 in groundwater at the INEL is not significantly affected by changes in filtration and preservation methods used for sample collections. (USGS)

Evaluation of field sampling and preservation methods for strontium-90 in ground water at the Idaho National Engineering Laboratory, Idaho

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cecil, L.D.; Knobel, L.L.; Wegner, S.J.

1989-01-01

Water from four wells completed in the Snake River Plain aquifer was sampled as part of the US Geological Survey's quality assurance program to evaluate the effect of filtration and preservation methods on strontium-90 concentrations in groundwater at the Idaho National Engineering Laboratory. Water from each well was filtered through either a 0.45-micrometer membrane or a 0.1-micrometer membrane filter; unfiltered samples also were collected. Two sets of filtered and two sets of unfiltered samples was preserved in the field with reagent-grade hydrochloric acid and the other set of samples was not acidified. For water from wells with strontium-90 concentrations atmore » or above the reporting level, 94% or more of the strontium-90 is in true solution or in colloidal particles smaller than 0.1 micrometer. These results suggest that within-laboratory reproducibility for strontium-90 in groundwater at the INEL is not significantly affected by changes in filtration and preservation methods used for sample collections. 13 refs., 2 figs., 6 tabs.« less

Developing a methodology for the inverse estimation of root architectural parameters from field based sampling schemes

NASA Astrophysics Data System (ADS)

Morandage, Shehan; Schnepf, Andrea; Vanderborght, Jan; Javaux, Mathieu; Leitner, Daniel; Laloy, Eric; Vereecken, Harry

2017-04-01

Root traits are increasingly important in breading of new crop varieties. E.g., longer and fewer lateral roots are suggested to improve drought resistance of wheat. Thus, detailed root architectural parameters are important. However, classical field sampling of roots only provides more aggregated information such as root length density (coring), root counts per area (trenches) or root arrival curves at certain depths (rhizotubes). We investigate the possibility of obtaining the information about root system architecture of plants using field based classical root sampling schemes, based on sensitivity analysis and inverse parameter estimation. This methodology was developed based on a virtual experiment where a root architectural model was used to simulate root system development in a field, parameterized for winter wheat. This information provided the ground truth which is normally unknown in a real field experiment. The three sampling schemes coring, trenching, and rhizotubes where virtually applied to and aggregated information computed. Morris OAT global sensitivity analysis method was then performed to determine the most sensitive parameters of root architecture model for the three different sampling methods. The estimated means and the standard deviation of elementary effects of a total number of 37 parameters were evaluated. Upper and lower bounds of the parameters were obtained based on literature and published data of winter wheat root architectural parameters. Root length density profiles of coring, arrival curve characteristics observed in rhizotubes, and root counts in grids of trench profile method were evaluated statistically to investigate the influence of each parameter using five different error functions. Number of branches, insertion angle inter-nodal distance, and elongation rates are the most sensitive parameters and the parameter sensitivity varies slightly with the depth. Most parameters and their interaction with the other parameters show highly nonlinear effect to the model output. The most sensitive parameters will be subject to inverse estimation from the virtual field sampling data using DREAMzs algorithm. The estimated parameters can then be compared with the ground truth in order to determine the suitability of the sampling schemes to identify specific traits or parameters of the root growth model.

Formaldehyde: a comparative evaluation of four monitoring methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coyne, L.B.; Cook, R.E.; Mann, J.R.

1985-10-01

The performances of four formaldehyde monitoring devices were compared in a series of laboratory and field experiments. The devices evaluated included the DuPont C-60 formaldehyde badge, the SKC impregnated charcoal tube, an impinger/polarographic method and the MDA Lion formaldemeter. The major evaluation parameters included: concentration range, effects of humidity, sample storage, air velocity, accuracy, precision, interferences from methanol, styrene, 1,3-butadiene, sulfur dioxide and dimethylamine. Based on favorable performances in the laboratory and field, each device was useful for monitoring formaldehyde in the industrial work environment; however, these devices were not evaluated for residential exposure assessment. The impinger/polarographic method had amore » sensitivity of 0.06 ppm, based on a 20-liter air sample volume, and accurately determined the short-term excursion limit (STEL). It was useful for area monitoring but was not very practical for time-weighted average (TWA) personal monitoring measurements. The DuPont badge had a sensitivity of 2.8 ppm-hr and accurately and simply determined TWA exposures. It was not sensitive enough to measure STEL exposures, however, and positive interferences resulted if 1,3-butadiene was present. The SKC impregnated charcoal tube measured both TWA and STEL concentrations and had a sensitivity of 0.06 ppm based on a 25-liter air sample volume. Lightweight and simple to use, the MDA Lion formaldemeter had a sensitivity of 0.2 ppm. It had the advantage of giving an instantaneous reading in the field; however, it must be used with caution because it responded to many interferences. The method of choice depended on the type of sampling required, field conditions encountered during sampling and an understanding of the limitations of each monitoring device.« less

SEM technique for imaging and measuring electronic transport in nanocomposites based on electric field induced contrast

DOEpatents

Jesse, Stephen [Knoxville, TN; Geohegan, David B [Knoxville, TN; Guillorn, Michael [Brooktondale, NY

2009-02-17

Methods and apparatus are described for SEM imaging and measuring electronic transport in nanocomposites based on electric field induced contrast. A method includes mounting a sample onto a sample holder, the sample including a sample material; wire bonding leads from the sample holder onto the sample; placing the sample holder in a vacuum chamber of a scanning electron microscope; connecting leads from the sample holder to a power source located outside the vacuum chamber; controlling secondary electron emission from the sample by applying a predetermined voltage to the sample through the leads; and generating an image of the secondary electron emission from the sample. An apparatus includes a sample holder for a scanning electron microscope having an electrical interconnect and leads on top of the sample holder electrically connected to the electrical interconnect; a power source and a controller connected to the electrical interconnect for applying voltage to the sample holder to control the secondary electron emission from a sample mounted on the sample holder; and a computer coupled to a secondary electron detector to generate images of the secondary electron emission from the sample.

Design and evaluation of a field study on the contamination of selected volatile organic compounds and wastewater-indicator compounds in blanks and groundwater samples

USGS Publications Warehouse

Thiros, Susan A.; Bender, David A.; Mueller, David K.; Rose, Donna L.; Olsen, Lisa D.; Martin, Jeffrey D.; Bernard, Bruce; Zogorski, John S.

2011-01-01

The Field Contamination Study (FCS) was designed to determine the field processes that tend to result in clean field blanks and to identify potential sources of contamination to blanks collected in the field from selected volatile organic compounds (VOCs) and wastewater-indicator compounds (WICs). The VOCs and WICs analyzed in the FCS were detected in blanks collected by the U.S. Geological Survey (USGS) National Water-Quality Assessment (NAWQA) Program during 1996–2008 and 2002–08, respectively. To minimize the number of variables, the study required ordering of supplies just before sampling, storage of supplies and equipment in clean areas, and use of adequate amounts of purge-and-trap volatile-grade methanol and volatile pesticide-grade blank water (VPBW) to clean sampling equipment and to collect field blanks.Blanks and groundwater samples were collected during 2008–09 at 16 sites, which were a mix of water-supply and monitoring wells, located in 9 States. Five different sample types were collected for the FCS at each site: (1) a source-solution blank collected at the USGS National Water Quality Laboratory (NWQL) using laboratory-purged VPBW, (2) source-solution blanks collected in the field using laboratory-purged VPBW, (3) source-solution blanks collected in the field using field-purged VPBW, (4) a field blank collected using field-purged VPBW, and (5) a groundwater sample collected from a well. The source-solution blank and field-blank analyses were used to identify, quantify, and document extrinsic contamination and to help determine the sources and causes of data-quality problems that can affect groundwater samples.Concentrations of compounds detected in FCS analyses were quantified and results were stored in the USGS National Water Information System database after meeting rigorous identification and quantification criteria. The study also utilized information provided by laboratory analysts about evidence indicating the presence of selected compounds, using less rigorous identification criteria than is required for reporting data to the National Water Information System database. For the FCS, these data are considered adequate to indicate "evidence of presence," and were used only for diagnostic purposes. Evidence of VOCs and WICs at low concentrations near or less than the long-term method detection level can indicate a contamination problem that could affect future datasets if method detection levels were ever to be lowered.

A new cation-exchange method for accurate field speciation of hexavalent chromium

USGS Publications Warehouse

Ball, J.W.; McCleskey, R. Blaine

2003-01-01

A new method for field speciation of Cr(VI) has been developed to meet present stringent regulatory standards and to overcome the limitations of existing methods. The method consists of passing a water sample through strong acid cation-exchange resin at the field site, where Cr(III) is retained while Cr(VI) passes into the effluent and is preserved for later determination. The method is simple, rapid, portable, and accurate, and makes use of readily available, inexpensive materials. Cr(VI) concentrations are determined later in the laboratory using any elemental analysis instrument sufficiently sensitive to measure the Cr(VI) concentrations of interest. The new method allows measurement of Cr(VI) concentrations as low as 0.05 ??g 1-1, storage of samples for at least several weeks prior to analysis, and use of readily available analytical instrumentation. Cr(VI) can be separated from Cr(III) between pH 2 and 11 at Cr(III)/Cr(VI) concentration ratios as high as 1000. The new method has demonstrated excellent comparability with two commonly used methods, the Hach Company direct colorimetric method and USEPA method 218.6. The new method is superior to the Hach direct colorimetric method owing to its relative sensitivity and simplicity. The new method is superior to USEPA method 218.6 in the presence of Fe(II) concentrations up to 1 mg 1-1 and Fe(III) concentrations up to 10 mg 1-1. Time stability of preserved samples is a significant advantage over the 24-h time constraint specified for USEPA method 218.6.

COMPARISON OF USEPA FIELD SAMPLING METHODS FOR BENTHIC MACROINVERTEBRATE STUDIES

EPA Science Inventory

Two U.S. Environmental Protection Agency (USEPA) macroinvertebrate sampling protocols were compared in the Mid-Atlantic Highlands region. The Environmental Monitoring and Assessment Program (EMAP) wadeable streams protocol results in a single composite sample from nine transects...

Comparing hair-morphology and molecular methods to identify fecal samples from Neotropical felids

PubMed Central

Alberts, Carlos C.; Saranholi, Bruno H.; Frei, Fernando; Galetti, Pedro M.

2017-01-01

To avoid certain problems encountered with more-traditional and invasive methods in behavioral-ecology studies of mammalian predators, such as felids, molecular approaches have been employed to identify feces found in the field. However, this method requires a complete molecular biology laboratory, and usually also requires very fresh fecal samples to avoid DNA degradation. Both conditions are normally absent in the field. To address these difficulties, identification based on morphological characters (length, color, banding, scales and medullar patterns) of hairs found in feces could be employed as an alternative. In this study we constructed a morphological identification key for guard hairs of eight Neotropical felids (jaguar, oncilla, Geoffroy’s cat, margay, ocelot, Pampas cat, puma and jaguarundi) and compared its efficiency to that of a molecular identification method, using the ATP6 region as a marker. For this molecular approach, we simulated some field conditions by postponing sample-conservation procedures. A blind test of the identification key obtained a nearly 70% overall success rate, which we considered equivalent to or better than the results of some molecular methods (probably due to DNA degradation) found in other studies. The jaguar, puma and jaguarundi could be unequivocally discriminated from any other Neotropical felid. On a scale ranging from inadequate to excellent, the key proved poor only for the margay, with only 30% of its hairs successfully identified using this key; and have intermediate success rates for the remaining species, the oncilla, Geoffroy’s cat, ocelot and Pampas cat, were intermediate. Complementary information about the known distributions of felid populations may be necessary to substantially improve the results obtained with the key. Our own molecular results were even better, since all blind-tested samples were correctly identified. Part of these identifications were made from samples kept in suboptimal conditions, with some samples remaining outdoors for up to seven days, simulating conditions in the field. It appears that both methods can be used, depending on the available laboratory facilities and on the expected results. PMID:28880947

Field Equipment Cleaning and Decontamination

EPA Pesticide Factsheets

EPA Region 4 Science and Ecosystem Support Division (SESD), Nov. 1, 2007, document describes general and specific procedures, methods and considerations when cleaning and decontaminating sampling equipment during the course of field investigations.

Comparison of a real-time PCR method with a culture method for the detection of Salmonella enterica serotype enteritidis in naturally contaminated environmental samples from integrated poultry houses.

PubMed

Lungu, Bwalya; Waltman, W Douglas; Berghaus, Roy D; Hofacre, Charles L

2012-04-01

Conventional culture methods have traditionally been considered the "gold standard" for the isolation and identification of foodborne bacterial pathogens. However, culture methods are labor-intensive and time-consuming. A Salmonella enterica serotype Enteritidis-specific real-time PCR assay that recently received interim approval by the National Poultry Improvement Plan for the detection of Salmonella Enteritidis was evaluated against a culture method that had also received interim National Poultry Improvement Plan approval for the analysis of environmental samples from integrated poultry houses. The method was validated with 422 field samples collected by either the boot sock or drag swab method. The samples were cultured by selective enrichment in tetrathionate broth followed by transfer onto a modified semisolid Rappaport-Vassiliadis medium and then plating onto brilliant green with novobiocin and xylose lysine brilliant Tergitol 4 plates. One-milliliter aliquots of the selective enrichment broths from each sample were collected for DNA extraction by the commercial PrepSEQ nucleic acid extraction assay and analysis by the Salmonella Enteritidis-specific real-time PCR assay. The real-time PCR assay detected no significant differences between the boot sock and drag swab samples. In contrast, the culture method detected a significantly higher number of positive samples from boot socks. The diagnostic sensitivity of the real-time PCR assay for the field samples was significantly higher than that of the culture method. The kappa value obtained was 0.46, indicating moderate agreement between the real-time PCR assay and the culture method. In addition, the real-time PCR method had a turnaround time of 2 days compared with 4 to 8 days for the culture method. The higher sensitivity as well as the reduction in time and labor makes this real-time PCR assay an excellent alternative to conventional culture methods for diagnostic purposes, surveillance, and research studies to improve food safety.

Spatial analysis of the distribution of Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) and losses in maize crop productivity using geostatistics.

PubMed

Farias, Paulo R S; Barbosa, José C; Busoli, Antonio C; Overal, William L; Miranda, Vicente S; Ribeiro, Susane M

2008-01-01

The fall armyworm, Spodoptera frugiperda (J.E. Smith), is one of the chief pests of maize in the Americas. The study of its spatial distribution is fundamental for designing correct control strategies, improving sampling methods, determining actual and potential crop losses, and adopting precise agricultural techniques. In São Paulo state, Brazil, a maize field was sampled at weekly intervals, from germination through harvest, for caterpillar densities, using quadrates. In each of 200 quadrates, 10 plants were sampled per week. Harvest weights were obtained in the field for each quadrate, and ear diameters and lengths were also sampled (15 ears per quadrate) and used to estimate potential productivity of the quadrate. Geostatistical analyses of caterpillar densities showed greatest ranges for small caterpillars when semivariograms were adjusted for a spherical model that showed greatest fit. As the caterpillars developed in the field, their spatial distribution became increasingly random, as shown by a model adjusted to a straight line, indicating a lack of spatial dependence among samples. Harvest weight and ear length followed the spherical model, indicating the existence of spatial variability of the production parameters in the maize field. Geostatistics shows promise for the application of precise methods in the integrated control of pests.

Accelerated Molecular Dynamics Simulations with the AMOEBA Polarizable Force Field on Graphics Processing Units

PubMed Central

2013-01-01

The accelerated molecular dynamics (aMD) method has recently been shown to enhance the sampling of biomolecules in molecular dynamics (MD) simulations, often by several orders of magnitude. Here, we describe an implementation of the aMD method for the OpenMM application layer that takes full advantage of graphics processing units (GPUs) computing. The aMD method is shown to work in combination with the AMOEBA polarizable force field (AMOEBA-aMD), allowing the simulation of long time-scale events with a polarizable force field. Benchmarks are provided to show that the AMOEBA-aMD method is efficiently implemented and produces accurate results in its standard parametrization. For the BPTI protein, we demonstrate that the protein structure described with AMOEBA remains stable even on the extended time scales accessed at high levels of accelerations. For the DNA repair metalloenzyme endonuclease IV, we show that the use of the AMOEBA force field is a significant improvement over fixed charged models for describing the enzyme active-site. The new AMOEBA-aMD method is publicly available (http://wiki.simtk.org/openmm/VirtualRepository) and promises to be interesting for studying complex systems that can benefit from both the use of a polarizable force field and enhanced sampling. PMID:24634618

Circular Samples as Objects for Magnetic Resonance Imaging - Mathematical Simulation, Experimental Results

NASA Astrophysics Data System (ADS)

Frollo, Ivan; Krafčík, Andrej; Andris, Peter; Přibil, Jiří; Dermek, Tomáš

2015-12-01

Circular samples are the frequent objects of "in-vitro" investigation using imaging method based on magnetic resonance principles. The goal of our investigation is imaging of thin planar layers without using the slide selection procedure, thus only 2D imaging or imaging of selected layers of samples in circular vessels, eppendorf tubes,.. compulsorily using procedure "slide selection". In spite of that the standard imaging methods was used, some specificity arise when mathematical modeling of these procedure is introduced. In the paper several mathematical models were presented that were compared with real experimental results. Circular magnetic samples were placed into the homogenous magnetic field of a low field imager based on nuclear magnetic resonance. For experimental verification an MRI 0.178 Tesla ESAOTE Opera imager was used.

Comparison of DNA preservation methods for environmental bacterial community samples

USGS Publications Warehouse

Gray, Michael A.; Pratte, Zoe A.; Kellogg, Christina A.

2013-01-01

Field collections of environmental samples, for example corals, for molecular microbial analyses present distinct challenges. The lack of laboratory facilities in remote locations is common, and preservation of microbial community DNA for later study is critical. A particular challenge is keeping samples frozen in transit. Five nucleic acid preservation methods that do not require cold storage were compared for effectiveness over time and ease of use. Mixed microbial communities of known composition were created and preserved by DNAgard™, RNAlater®, DMSO–EDTA–salt (DESS), FTA® cards, and FTA Elute® cards. Automated ribosomal intergenic spacer analysis and clone libraries were used to detect specific changes in the faux communities over weeks and months of storage. A previously known bias in FTA® cards that results in lower recovery of pure cultures of Gram-positive bacteria was also detected in mixed community samples. There appears to be a uniform bias across all five preservation methods against microorganisms with high G + C DNA. Overall, the liquid-based preservatives (DNAgard™, RNAlater®, and DESS) outperformed the card-based methods. No single liquid method clearly outperformed the others, leaving method choice to be based on experimental design, field facilities, shipping constraints, and allowable cost.

FIELD OPERATIONS AND METHODS FOR MEASURING THE ECOLOGICAL CONDITION OF NON-WADEABLE RIVERS AND STREAMS

EPA Science Inventory

The methods and instructions for field operations presented in this manual for surveys of non-wadeable streams and rivers were developed and tested based on 55 sample sites in the Mid-Atlantic region and 53 sites in an Oregon study during two years of pilot and demonstration proj...

Compendium of selected methods for sampling and analysis at geothermal facilities

NASA Astrophysics Data System (ADS)

Kindle, C. H.; Pool, K. H.; Ludwick, J. D.; Robertson, D. E.

1984-06-01

An independent study of the field has resulted in a compilation of the best methods for sampling, preservation and analysis of potential pollutants from geothermally fueled electric power plants. These methods are selected as the most usable over the range of application commonly experienced in the various geothermal plant sample locations. In addition to plant and well piping, techniques for sampling cooling towers, ambient gases, solids, surface and subsurface waters are described. Emphasis is placed on the use of sampling proves to extract samples from heterogeneous flows. Certain sampling points, constituents and phases of plant operation are more amenable to quality assurance improvement in the emission measurements than others and are so identified.

Magnetostriction measurement by four probe method

NASA Astrophysics Data System (ADS)

Dange, S. N.; Radha, S.

2018-04-01

The present paper describes the design and setting up of an indigenouslydevelopedmagnetostriction(MS) measurement setup using four probe method atroom temperature.A standard strain gauge is pasted with a special glue on the sample and its change in resistance with applied magnetic field is measured using KeithleyNanovoltmeter and Current source. An electromagnet with field upto 1.2 tesla is used to source the magnetic field. The sample is placed between the magnet poles using self designed and developed wooden probe stand, capable of moving in three mutually perpendicular directions. The nanovoltmeter and current source are interfaced with PC using RS232 serial interface. A software has been developed in for logging and processing of data. Proper optimization of measurement has been done through software to reduce the noise due to thermal emf and electromagnetic induction. The data acquired for some standard magnetic samples are presented. The sensitivity of the setup is 1microstrain with an error in measurement upto 5%.

Surface Flashover of Semiconductors: A Fundamental Study

DTIC Science & Technology

1993-06-16

surface electric fields for a number of samples with aluminum and gold contacts. Effects of processing varia- tions such as anneal method (rapid thermal...more uniform pre- breakdown surface fields. 3. Various contact materials and processing methods were used to determine effects on flashover...diffusion depths determined by this method were generally consistent with the estimated depths. 2-4 In order to characterize better the diffused layers

Rapid assessment of rice seed availability for wildlife in harvested fields

USGS Publications Warehouse

Halstead, B.J.; Miller, M.R.; Casazza, Michael L.; Coates, P.S.; Farinha, M.A.; Benjamin, Gustafson K.; Yee, J.L.; Fleskes, J.P.

2011-01-01

Rice seed remaining in commercial fields after harvest (waste rice) is a critical food resource for wintering waterfowl in rice-growing regions of North America. Accurate and precise estimates of the seed mass density of waste rice are essential for planning waterfowl wintering habitat extents and management. In the Sacramento Valley of California, USA, the existing method for obtaining estimates of availability of waste rice in harvested fields produces relatively precise estimates, but the labor-, time-, and machineryintensive process is not practical for routine assessments needed to examine long-term trends in waste rice availability. We tested several experimental methods designed to rapidly derive estimates that would not be burdened with disadvantages of the existing method. We first conducted a simulation study of the efficiency of each method and then conducted field tests. For each approach, methods did not vary in root mean squared error, although some methods did exhibit bias for both simulations and field tests. Methods also varied substantially in the time to conduct each sample and in the number of samples required to detect a standard trend. Overall, modified line-intercept methods performed well for estimating the density of rice seeds. Waste rice in the straw, although not measured directly, can be accounted for by a positive relationship with density of rice on the ground. Rapid assessment of food availability is a useful tool to help waterfowl managers establish and implement wetland restoration and agricultural habitat-enhancement goals for wintering waterfowl. ?? 2011 The Wildlife Society.

Chapter A5. Processing of Water Samples

USGS Publications Warehouse

Wilde, Franceska D.; Radtke, Dean B.; Gibs, Jacob; Iwatsubo, Rick T.

1999-01-01

The National Field Manual for the Collection of Water-Quality Data (National Field Manual) describes protocols and provides guidelines for U.S. Geological Survey (USGS) personnel who collect data used to assess the quality of the Nation's surface-water and ground-water resources. This chapter addresses methods to be used in processing water samples to be analyzed for inorganic and organic chemical substances, including the bottling of composite, pumped, and bailed samples and subsamples; sample filtration; solid-phase extraction for pesticide analyses; sample preservation; and sample handling and shipping. Each chapter of the National Field Manual is published separately and revised periodically. Newly published and revised chapters will be announced on the USGS Home Page on the World Wide Web under 'New Publications of the U.S. Geological Survey.' The URL for this page is http:/ /water.usgs.gov/lookup/get?newpubs.

Manuals Used in the National Aquatic Resource Surveys

EPA Pesticide Factsheets

Various manuals are used to communicate the methods and guidelines for the National Aquatic Resource Surveys. The Field Operations Manual: outlines the field protocols that crews will utilize to sample sites.

Field matric potential sensor

DOEpatents

Hubbell, Joel M.; Sisson, James B.

2001-01-01

A method of determining matric potential of a sample, the method comprising placing the sample in a container, the container having an opening; and contacting the sample with a tensiometer via the opening. An apparatus for determining matric potential of a sample, the apparatus comprising a housing configured to receive a sample; a portable matric potential sensing device extending into the housing and having a porous member; and a wall closing the housing to insulate the sample and at least a portion of the matric potential sensing device including the porous member.

Chapter A5. Section 6.1.F. Wastewater, Pharmaceutical, and Antibiotic Compounds

USGS Publications Warehouse

Lewis, Michael Edward; Zaugg, Steven D.

2003-01-01

The USGS differentiates between samples collected for analysis of wastewater compounds and those collected for analysis of pharmaceutical and antibiotic compounds, based on the analytical schedule for the laboratory method. Currently, only the wastewater laboratory method for field-filtered samples (SH1433) is an approved, routine (production) method. (The unfiltered wastewater method LC 8033 also is available but requires a proposal for custom analysis.) At this time, analysis of samples for pharmaceutical and antibiotic compounds is confined to research studies and is available only on a custom basis.

FIELD COLLECTION METHODS USED IN THE EPA NATIONAL EXPOSURE RESEARCH LABORATORY HUMAN EXPOSURE MEASUREMENT PROGRAM TO EVALUATE CHILDREN'S AGGREGATE EXPOSURE TO PESTICIDES: A TUTORIAL

EPA Science Inventory

A tutorial on the field sampling equipment used to collect multimedia samples.

We conduct observational human exposure measurement studies in order to understand what chemicals people come into contact with, at what levels, what the sources of those chemicals are, and wher...

An Undergraduate Field Experiment for Measuring Exposure to Environmental Tobacco Smoke in Indoor Environments

NASA Astrophysics Data System (ADS)

Marsella, Adam M.; Huang, Jiping; Ellis, David A.; Mabury, Scott A.

1999-12-01

An undergraduate field experiment is described for the measurement of nicotine and various carbonyl compounds arising from environmental tobacco smoke. Students are introduced to practical techniques in HPLC-UV and GC-NPD. Also introduced are current methods in personal air sampling using small and portable field sampling pumps. Carbonyls (formaldehyde, acetaldehyde, acrolein, and acetone) are sampled with silica solid-phase extraction cartridges impregnated with 2,4-dinitrophenylhydrazine, eluted, and analyzed by HPLC-UV (360-380 nm). Nicotine is sampled using XAD-2 cartridges, extracted, and analyzed by GC-NPD. Students gain an appreciation for the problems associated with measuring ubiquitous pollutants such as formaldehyde, as well as the issue of chromatographic peak resolution when trying to resolve closely eluting peaks. By allowing the students to formulate their own hypothesis and sampling scheme, critical thinking and problem solving are developed in addition to analysis skills. As an experiment in analytical environmental chemistry, this laboratory introduces the application of field sampling and analysis techniques to the undergraduate lab.

Analysis of the Magnetic Field Influence on the Rheological Properties of Healthy Persons Blood

PubMed Central

Nawrocka-Bogusz, Honorata

2013-01-01

The influence of magnetic field on whole blood rheological properties remains a weakly known phenomenon. An in vitro analysis of the magnetic field influence on the rheological properties of healthy persons blood is presented in this work. The study was performed on blood samples taken from 25 healthy nonsmoking persons and included comparative analysis of the results of both the standard rotary method (flow curve measurement) and the oscillatory method known also as the mechanical dynamic analysis, performed before and after exposition of blood samples to magnetic field. The principle of the oscillatory technique lies in determining the amplitude and phase of the oscillations of the studied sample subjected to action of a harmonic force of controlled amplitude and frequency. The flow curve measurement involved determining the shear rate dependence of blood viscosity. The viscoelastic properties of the blood samples were analyzed in terms of complex blood viscosity. All the measurements have been performed by means of the Contraves LS40 rheometer. The data obtained from the flow curve measurements complemented by hematocrit and plasma viscosity measurements have been analyzed using the rheological model of Quemada. No significant changes of the studied rheological parameters have been found. PMID:24078918

Putting Biology Students Out to Grass: the Nettlecombe Experiment After Thirteen Years.

ERIC Educational Resources Information Center

Crothers, J. H.; Lucas, A. M.

1982-01-01

The importance of examining both the natural history of organisms being investigated and numerical data from long-term field experiments is illustrated by describing a long-running field experiment at an English Field Study Council Centre. Sample results are discussed and alternative methods of using field studies in biology instruction are…

Voltammetric determination of arsenic in high iron and manganese groundwaters.

PubMed

Gibbon-Walsh, Kristoff; Salaün, Pascal; Uroic, M Kalle; Feldmann, Joerg; McArthur, John M; van den Berg, Constant M G

2011-09-15

Determination of the speciation of arsenic in groundwaters, using cathodic stripping voltammetry (CSV), is severely hampered by high levels of iron and manganese. Experiments showed that the interference is eliminated by addition of EDTA, making it possible to determine the arsenic speciation on-site by CSV. This work presents the CSV method to determine As(III) in high-iron or -manganese groundwaters in the field with only minor sample treatment. The method was field-tested in West-Bengal (India) on a series of groundwater samples. Total arsenic was subsequently determined after acidification to pH 1 by anodic stripping voltammetry (ASV). Comparative measurements by ICP-MS as reference method for total As, and by HPLC for its speciation, were used to corroborate the field data in stored samples. Most of the arsenic (78±0.02%) was found to occur as inorganic As(III) in the freshly collected waters, in accordance with previous studies. The data shows that the modified on-site CSV method for As(III) is a good measure of water contamination with As. The EDTA was also found to be effective in stabilising the arsenic speciation for longterm sample storage at room temperature. Without sample preservation, in water exposed to air and sunlight, the As(III) was found to become oxidised to As(V), and Fe(II) oxidised to Fe(III), removing the As(V) by adsorption on precipitating Fe(III)-hydroxides within a few hours. Copyright © 2011 Elsevier B.V. All rights reserved.

System and method for liquid extraction electrospray-assisted sample transfer to solution for chemical analysis

DOEpatents

Kertesz, Vilmos; Van Berkel, Gary J.

2016-07-12

A system for sampling a surface includes a surface sampling probe comprising a solvent liquid supply conduit and a distal end, and a sample collector for suspending a sample collection liquid adjacent to the distal end of the probe. A first electrode provides a first voltage to solvent liquid at the distal end of the probe. The first voltage produces a field sufficient to generate electrospray plume at the distal end of the probe. A second electrode provides a second voltage and is positioned to produce a plume-directing field sufficient to direct the electrospray droplets and ions to the suspended sample collection liquid. The second voltage is less than the first voltage in absolute value. A voltage supply system supplies the voltages to the first electrode and the second electrode. The first electrode can apply the first voltage directly to the solvent liquid. A method for sampling for a surface is also disclosed.

Field and laboratory data describing physical and chemical characteristics of metal-contaminated flood-plain deposits downstream from Lead, west-central South Dakota

USGS Publications Warehouse

Marron, D.C.

1988-01-01

Samples from metal-contaminated flood-plain sediments at 9 sites downstream from Lead, in west-central South Dakota, were collected during the summers of 1985-87 to characterize aspects of the sedimentology, chemistry, and geometry of a deposit that resulted from the discharge of a large volume of mining wastes into a river system. Field and laboratory data include stratigraphic descriptions, chemical contents and grain-size distributions of samples, and surveyed flood-plain positions of samples. This report describes sampling-site locations, and methods of sample collection and preservation, and subsequent laboratory analysis. Field and laboratory data are presented in 4 figures and 11 tables in the ' Supplemental Data ' section at the back of the report. (USGS)

Acoustic levitation methods for density measurements

NASA Technical Reports Server (NTRS)

Trinh, E. H.; Hsu, C. J.

1986-01-01

The capability of ultrasonic levitators operating in air to perform density measurements has been demonstrated. The remote determination of the density of ordinary liquids as well as low density solid metals can be carried out using levitated samples with size on the order of a few millimeters and at a frequency of 20 kHz. Two basic methods may be used. The first one is derived from a previously known technique developed for acoustic levitation in liquid media, and is based on the static equilibrium position of levitated samples in the earth's gravitational field. The second approach relies on the dynamic interaction between a levitated sample and the acoustic field. The first technique appears more accurate (1 percent uncertainty), but the latter method is directly applicable to a near gravity-free environment such as that found in space.

Rapid and sensitive determination of tellurium in soil and plant samples by sector-field inductively coupled plasma mass spectrometry.

PubMed

Yang, Guosheng; Zheng, Jian; Tagami, Keiko; Uchida, Shigeo

2013-11-15

In this work, we report a rapid and highly sensitive analytical method for the determination of tellurium in soil and plant samples using sector field inductively coupled plasma mass spectrometry (SF-ICP-MS). Soil and plant samples were digested using Aqua regia. After appropriate dilution, Te in soil and plant samples was directly analyzed without any separation and preconcentration. This simple sample preparation approach avoided to a maximum extent any contamination and loss of Te prior to the analysis. The developed analytical method was validated by the analysis of soil/sediment and plant reference materials. Satisfactory detection limits of 0.17 ng g(-1) for soil and 0.02 ng g(-1) for plant samples were achieved, which meant that the developed method was applicable to studying the soil-to-plant transfer factor of Te. Our work represents for the first time that data on the soil-to-plant transfer factor of Te were obtained for Japanese samples which can be used for the estimation of internal radiation dose of radioactive tellurium due to the Fukushima Daiichi Nuclear Power Plant accident. Copyright © 2013 Elsevier B.V. All rights reserved.

Recent archaeomagnetic studies in Slovakia: Comparison of methodological approaches

NASA Astrophysics Data System (ADS)

Kubišová, Lenka

2016-03-01

We review the recent archaeomagnetic studies carried out on the territory of Slovakia, focusing on the comparison of methodological approaches, discussing pros and cons of the individual applied methods from the perspective of our experience. The most widely used methods for the determination of intensity and direction of the archaeomegnetic field by demagnetisation of the sample material are the alternating field (AF) demagnetisation and the Thellier double heating method. These methods are used not only for archaeomagnetic studies but also help to solve some geological problems. The two methods were applied to samples collected recently at several sites of Slovakia, where archaeological prospection invoked by earthwork or reconstruction work of developing projects demanded archaeomagnetic dating. Then we discuss advantages and weaknesses of the investigated methods from different perspectives based on several examples and our recent experience.

Monitoring sea lamprey pheromones and their degradation using rapid stream-side extraction coupled with UPLC-MS/MS

USGS Publications Warehouse

Wang, Huiyong; Johnson, Nicholas; Bernardy, Jeffrey; Hubert, Terry; Li, Weiming

2013-01-01

Pheromones guide adult sea lamprey (Petromyzon marinus) to suitable spawning streams and mates, and therefore, when quantified, can be used to assess population size and guide management. Here, we present an efficient sample preparation method where 100 mL of river water was spiked with deuterated pheromone as an internal standard and underwent rapid field-based SPE and elution in the field. The combination of field extraction with laboratory UPLC-MS/MS reduced the sample consumption from 1 to 0.1 L, decreased the sample process time from more than 1 h to 10 min, and increased the precision and accuracy. The sensitivity was improved more than one order of magnitude compared with the previous method. The influences of experimental conditions were assessed to optimize the separation and peak shapes. The analytical method has been validated by studies of stability, selectivity, precision, and linearity and by the determination of the limits of detection and quantification. The method was used to quantify pheromone concentration from five streams tributary to Lake Ontario and to estimate that the environmental half-life of 3kPZS is about 26 h.

Field Degassing as a New Sampling Method for 14C Analyses in Old Groundwater

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokochi, Reika; Bernier, Ryan; Purtschert, Roland

Radiocarbon ( 14C) activity in groundwater can be used to determine subsurface residence time up to ~40 kyr, providing crucial information on dynamic properties of groundwater and on paleoclimate. However, commonly applied sampling methods for dissolved inorganic carbon (DIC- 14C) are prone to low level of modern atmospheric contamination, resulting in underestimation of groundwater ages that cluster around 30–40 kyr. We extract CO 2 gas from groundwater using a device originally developed for studies of noble gas radionuclides. Carbon is collected in the gas phase, eliminating the possibility of fostering microbial activities and aqueous chemical reactions during sample storage. Thismore » method collects CO 2- 14C and radiokrypton ( 81Kr and 85Kr) samples simultaneously. The presence of any shorter-lived 85Kr is used to evaluate the degree of atmospheric contamination during sampling or mixing of young groundwater. Most groundwater samples showed lower CO 2- 14C activities than those of DIC- 14C, presumably due to the absence of atmospheric contamination. Samples with 81Kr age exceeding 150 kyr have no detectable CO 2- 14C except where mixing sources of young groundwater is suspected. Furthermore these field data serve as confirmations for the reliability of the newly presented sample collection and CO 2- 14C method, and for the outstanding roles of radiokrypton isotopes in characterizing old groundwater.« less

Field Degassing as a New Sampling Method for 14C Analyses in Old Groundwater

DOE PAGES

Yokochi, Reika; Bernier, Ryan; Purtschert, Roland; ...

2017-09-07

Radiocarbon ( 14C) activity in groundwater can be used to determine subsurface residence time up to ~40 kyr, providing crucial information on dynamic properties of groundwater and on paleoclimate. However, commonly applied sampling methods for dissolved inorganic carbon (DIC- 14C) are prone to low level of modern atmospheric contamination, resulting in underestimation of groundwater ages that cluster around 30–40 kyr. We extract CO 2 gas from groundwater using a device originally developed for studies of noble gas radionuclides. Carbon is collected in the gas phase, eliminating the possibility of fostering microbial activities and aqueous chemical reactions during sample storage. Thismore » method collects CO 2- 14C and radiokrypton ( 81Kr and 85Kr) samples simultaneously. The presence of any shorter-lived 85Kr is used to evaluate the degree of atmospheric contamination during sampling or mixing of young groundwater. Most groundwater samples showed lower CO 2- 14C activities than those of DIC- 14C, presumably due to the absence of atmospheric contamination. Samples with 81Kr age exceeding 150 kyr have no detectable CO 2- 14C except where mixing sources of young groundwater is suspected. Furthermore these field data serve as confirmations for the reliability of the newly presented sample collection and CO 2- 14C method, and for the outstanding roles of radiokrypton isotopes in characterizing old groundwater.« less

Hand-Held Refractometer-Based Measurement and Excess Permittivity Analysis Method for Detection of Diesel Oils Adulterated by Kerosene in Field Conditions

PubMed Central

Peiponen, Kai-Erik

2018-01-01

Adulteration of fuels is a major problem, especially in developing and third world countries. One such case is the adulteration of diesel oil by kerosene. This problem contributes to air pollution, which leads to other far-reaching adverse effects, such as climate change. The objective of this study was to develop a relatively easy measurement method based on an inexpensive, handheld Abbe refractometer for the detection of adulteration and estimation of the ascending order of the amount of kerosene present in adulterated samples in field conditions. We achieved this by increasing the volume of pure diesel sample in the adulterated diesel oil, and measuring the trend of refractive index change, and next, exploiting the true and ideal permittivities of the binary mixture. The permittivity can be obtained with the aid of the measured refractive index of a liquid. Due to the molecular interactions, the true and ideal permittivities of diesel–kerosene binary liquid mixture have a mismatch which can be used to screen for adulterated diesel oils. The difference between the true and the ideal permittivity is the so-called excess permittivity. We first investigated a training set of diesel oils in laboratory in Finland, using the accurate table model Abbe refractometer and depicting the behavior of the excess permittivity of the mixture of diesel oil and kerosene. Then, we measured same samples in the laboratory using a handheld refractometer. Finally, preliminary field measurements using the handheld device were performed in Tanzania to assess the accuracy and possibility of applying the suggested method in field conditions. We herein show that it is not only possible to detect even relatively low adulteration levels of diesel in kerosene—namely, 5%, 10%, and 15%—but also it is possible to monitor the ascending order of adulteration for different adulterated diesel samples. We propose that the method of increasing the volume of an unknown (suspected) diesel oil sample by adding a known authentic diesel sample and monitoring excess permittivity is useful for the screening of adulterated diesel oil in field measurement conditions. PMID:29758004

Hand-Held Refractometer-Based Measurement and Excess Permittivity Analysis Method for Detection of Diesel Oils Adulterated by Kerosene in Field Conditions.

PubMed

Kanyathare, Boniphace; Peiponen, Kai-Erik

2018-05-14

Adulteration of fuels is a major problem, especially in developing and third world countries. One such case is the adulteration of diesel oil by kerosene. This problem contributes to air pollution, which leads to other far-reaching adverse effects, such as climate change. The objective of this study was to develop a relatively easy measurement method based on an inexpensive, handheld Abbe refractometer for the detection of adulteration and estimation of the ascending order of the amount of kerosene present in adulterated samples in field conditions. We achieved this by increasing the volume of pure diesel sample in the adulterated diesel oil, and measuring the trend of refractive index change, and next, exploiting the true and ideal permittivities of the binary mixture. The permittivity can be obtained with the aid of the measured refractive index of a liquid. Due to the molecular interactions, the true and ideal permittivities of diesel⁻kerosene binary liquid mixture have a mismatch which can be used to screen for adulterated diesel oils. The difference between the true and the ideal permittivity is the so-called excess permittivity. We first investigated a training set of diesel oils in laboratory in Finland, using the accurate table model Abbe refractometer and depicting the behavior of the excess permittivity of the mixture of diesel oil and kerosene. Then, we measured same samples in the laboratory using a handheld refractometer. Finally, preliminary field measurements using the handheld device were performed in Tanzania to assess the accuracy and possibility of applying the suggested method in field conditions. We herein show that it is not only possible to detect even relatively low adulteration levels of diesel in kerosene-namely, 5%, 10%, and 15%-but also it is possible to monitor the ascending order of adulteration for different adulterated diesel samples. We propose that the method of increasing the volume of an unknown (suspected) diesel oil sample by adding a known authentic diesel sample and monitoring excess permittivity is useful for the screening of adulterated diesel oil in field measurement conditions.

Field Methods and Sample Collection Techniques for the Surveillance of West Nile Virus in Avian Hosts.

PubMed

Wheeler, Sarah S; Boyce, Walter M; Reisen, William K

2016-01-01

Avian hosts play an important role in the spread, maintenance, and amplification of West Nile virus (WNV). Avian susceptibility to WNV varies from species to species thus surveillance efforts can focus both on birds that survive infection and those that succumb. Here we describe methods for the collection and sampling of live birds for WNV antibodies or viremia, and methods for the sampling of dead birds. Target species and study design considerations are discussed.

MACRO- MICRO-PURGE SOIL GAS SAMPLING METHODS FOR THE COLLECTION OF CONTAMINANT VAPORS

EPA Science Inventory

Purging influence on soil gas concentrations for volatile organic compounds (VOCs), as affected by sampling tube inner diameter and sampling depth (i.e., dead-space purge volume), was evaluated at different field sites. A macro-purge sampling system consisted of a standard hollo...

Electrofracturing test system and method of determining material characteristics of electrofractured material samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bauer, Stephen J.; Glover, Steven F.; Pfeifle, Tom

A device for electrofracturing a material sample and analyzing the material sample is disclosed. The device simulates an in situ electrofracturing environment so as to obtain electrofractured material characteristics representative of field applications while allowing permeability testing of the fractured sample under in situ conditions.

Wave field restoration using three-dimensional Fourier filtering method.

PubMed

Kawasaki, T; Takai, Y; Ikuta, T; Shimizu, R

2001-11-01

A wave field restoration method in transmission electron microscopy (TEM) was mathematically derived based on a three-dimensional (3D) image formation theory. Wave field restoration using this method together with spherical aberration correction was experimentally confirmed in through-focus images of amorphous tungsten thin film, and the resolution of the reconstructed phase image was successfully improved from the Scherzer resolution limit to the information limit. In an application of this method to a crystalline sample, the surface structure of Au(110) was observed in a profile-imaging mode. The processed phase image showed quantitatively the atomic relaxation of the topmost layer.

Scalable hierarchical PDE sampler for generating spatially correlated random fields using nonmatching meshes: Scalable hierarchical PDE sampler using nonmatching meshes

DOE PAGES

Osborn, Sarah; Zulian, Patrick; Benson, Thomas; ...

2018-01-30

This work describes a domain embedding technique between two nonmatching meshes used for generating realizations of spatially correlated random fields with applications to large-scale sampling-based uncertainty quantification. The goal is to apply the multilevel Monte Carlo (MLMC) method for the quantification of output uncertainties of PDEs with random input coefficients on general and unstructured computational domains. We propose a highly scalable, hierarchical sampling method to generate realizations of a Gaussian random field on a given unstructured mesh by solving a reaction–diffusion PDE with a stochastic right-hand side. The stochastic PDE is discretized using the mixed finite element method on anmore » embedded domain with a structured mesh, and then, the solution is projected onto the unstructured mesh. This work describes implementation details on how to efficiently transfer data from the structured and unstructured meshes at coarse levels, assuming that this can be done efficiently on the finest level. We investigate the efficiency and parallel scalability of the technique for the scalable generation of Gaussian random fields in three dimensions. An application of the MLMC method is presented for quantifying uncertainties of subsurface flow problems. Here, we demonstrate the scalability of the sampling method with nonmatching mesh embedding, coupled with a parallel forward model problem solver, for large-scale 3D MLMC simulations with up to 1.9·109 unknowns.« less

Scalable hierarchical PDE sampler for generating spatially correlated random fields using nonmatching meshes: Scalable hierarchical PDE sampler using nonmatching meshes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osborn, Sarah; Zulian, Patrick; Benson, Thomas

This work describes a domain embedding technique between two nonmatching meshes used for generating realizations of spatially correlated random fields with applications to large-scale sampling-based uncertainty quantification. The goal is to apply the multilevel Monte Carlo (MLMC) method for the quantification of output uncertainties of PDEs with random input coefficients on general and unstructured computational domains. We propose a highly scalable, hierarchical sampling method to generate realizations of a Gaussian random field on a given unstructured mesh by solving a reaction–diffusion PDE with a stochastic right-hand side. The stochastic PDE is discretized using the mixed finite element method on anmore » embedded domain with a structured mesh, and then, the solution is projected onto the unstructured mesh. This work describes implementation details on how to efficiently transfer data from the structured and unstructured meshes at coarse levels, assuming that this can be done efficiently on the finest level. We investigate the efficiency and parallel scalability of the technique for the scalable generation of Gaussian random fields in three dimensions. An application of the MLMC method is presented for quantifying uncertainties of subsurface flow problems. Here, we demonstrate the scalability of the sampling method with nonmatching mesh embedding, coupled with a parallel forward model problem solver, for large-scale 3D MLMC simulations with up to 1.9·109 unknowns.« less

Hydration Free Energy from Orthogonal Space Random Walk and Polarizable Force Field.

PubMed

Abella, Jayvee R; Cheng, Sara Y; Wang, Qiantao; Yang, Wei; Ren, Pengyu

2014-07-08

The orthogonal space random walk (OSRW) method has shown enhanced sampling efficiency in free energy calculations from previous studies. In this study, the implementation of OSRW in accordance with the polarizable AMOEBA force field in TINKER molecular modeling software package is discussed and subsequently applied to the hydration free energy calculation of 20 small organic molecules, among which 15 are positively charged and five are neutral. The calculated hydration free energies of these molecules are compared with the results obtained from the Bennett acceptance ratio method using the same force field, and overall an excellent agreement is obtained. The convergence and the efficiency of the OSRW are also discussed and compared with BAR. Combining enhanced sampling techniques such as OSRW with polarizable force fields is very promising for achieving both accuracy and efficiency in general free energy calculations.

Field substitution of nonresponders can maintain sample size and structure without altering survey estimates-the experience of the Italian behavioral risk factors surveillance system (PASSI).

PubMed

Baldissera, Sandro; Ferrante, Gianluigi; Quarchioni, Elisa; Minardi, Valentina; Possenti, Valentina; Carrozzi, Giuliano; Masocco, Maria; Salmaso, Stefania

2014-04-01

Field substitution of nonrespondents can be used to maintain the planned sample size and structure in surveys but may introduce additional bias. Sample weighting is suggested as the preferable alternative; however, limited empirical evidence exists comparing the two methods. We wanted to assess the impact of substitution on surveillance results using data from Progressi delle Aziende Sanitarie per la Salute in Italia-Progress by Local Health Units towards a Healthier Italy (PASSI). PASSI is conducted by Local Health Units (LHUs) through telephone interviews of stratified random samples of residents. Nonrespondents are replaced with substitutes randomly preselected in the same LHU stratum. We compared the weighted estimates obtained in the original PASSI sample (used as a reference) and in the substitutes' sample. The differences were evaluated using a Wald test. In 2011, 50,697 units were selected: 37,252 were from the original sample and 13,445 were substitutes; 37,162 persons were interviewed. The initially planned size and demographic composition were restored. No significant differences in the estimates between the original and the substitutes' sample were found. In our experience, field substitution is an acceptable method for dealing with nonresponse, maintaining the characteristics of the original sample without affecting the results. This evidence can support appropriate decisions about planning and implementing a surveillance system. Copyright © 2014 Elsevier Inc. All rights reserved.

Evaluation of field sampling and preservation methods for strontium-90 in ground water at the Idaho National Engineering Laboratory, Idaho

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cecil, L.D.; Knobel, L.L.; Wegner, S.J.

1989-09-01

From 1952 to 1988, about 140 curies of strontium-90 have been discharged in liquid waste to disposal ponds and wells at the INEL (Idaho National Engineering Laboratory). The US Geological Survey routinely samples ground water from the Snake River Plain aquifer and from discontinuous perched-water zones for selected radionuclides, major and minor ions, and chemical and physical characteristics. Water samples for strontium-90 analyses collected in the field are unfiltered and preserved to an approximate 2-percent solution with reagent-grade hydrochloric acid. Water from four wells completed in the Snake River Plain aquifer was sampled as part of the US Geological Survey'smore » quality-assurance program to evaluate the effect of filtration and preservation methods on strontium-90 concentrations in ground water at the INEL. The wells were selected for sampling on the basis of historical concentrations of strontium-90 in ground water. Water from each well was filtered through either a 0.45- or a 0.1-micrometer membrane filter; unfiltered samples also were collected. Two sets of filtered and two sets of unfiltered water samples were collected at each well. One set of water samples was preserved in the field to an approximate 2-percent solution with reagent-grade hydrochloric acid and the other set of samples was not acidified. 13 refs., 2 figs., 6 tabs.« less

Soil Sampling Techniques For Alabama Grain Fields

NASA Technical Reports Server (NTRS)

Thompson, A. N.; Shaw, J. N.; Mask, P. L.; Touchton, J. T.; Rickman, D.

2003-01-01

Characterizing the spatial variability of nutrients facilitates precision soil sampling. Questions exist regarding the best technique for directed soil sampling based on a priori knowledge of soil and crop patterns. The objective of this study was to evaluate zone delineation techniques for Alabama grain fields to determine which method best minimized the soil test variability. Site one (25.8 ha) and site three (20.0 ha) were located in the Tennessee Valley region, and site two (24.2 ha) was located in the Coastal Plain region of Alabama. Tennessee Valley soils ranged from well drained Rhodic and Typic Paleudults to somewhat poorly drained Aquic Paleudults and Fluventic Dystrudepts. Coastal Plain s o i l s ranged from coarse-loamy Rhodic Kandiudults to loamy Arenic Kandiudults. Soils were sampled by grid soil sampling methods (grid sizes of 0.40 ha and 1 ha) consisting of: 1) twenty composited cores collected randomly throughout each grid (grid-cell sampling) and, 2) six composited cores collected randomly from a -3x3 m area at the center of each grid (grid-point sampling). Zones were established from 1) an Order 1 Soil Survey, 2) corn (Zea mays L.) yield maps, and 3) airborne remote sensing images. All soil properties were moderately to strongly spatially dependent as per semivariogram analyses. Differences in grid-point and grid-cell soil test values suggested grid-point sampling does not accurately represent grid values. Zones created by soil survey, yield data, and remote sensing images displayed lower coefficient of variations (8CV) for soil test values than overall field values, suggesting these techniques group soil test variability. However, few differences were observed between the three zone delineation techniques. Results suggest directed sampling using zone delineation techniques outlined in this paper would result in more efficient soil sampling for these Alabama grain fields.

Combined target factor analysis and Bayesian soft-classification of interference-contaminated samples: forensic fire debris analysis.

PubMed

Williams, Mary R; Sigman, Michael E; Lewis, Jennifer; Pitan, Kelly McHugh

2012-10-10

A bayesian soft classification method combined with target factor analysis (TFA) is described and tested for the analysis of fire debris data. The method relies on analysis of the average mass spectrum across the chromatographic profile (i.e., the total ion spectrum, TIS) from multiple samples taken from a single fire scene. A library of TIS from reference ignitable liquids with assigned ASTM classification is used as the target factors in TFA. The class-conditional distributions of correlations between the target and predicted factors for each ASTM class are represented by kernel functions and analyzed by bayesian decision theory. The soft classification approach assists in assessing the probability that ignitable liquid residue from a specific ASTM E1618 class, is present in a set of samples from a single fire scene, even in the presence of unspecified background contributions from pyrolysis products. The method is demonstrated with sample data sets and then tested on laboratory-scale burn data and large-scale field test burns. The overall performance achieved in laboratory and field test of the method is approximately 80% correct classification of fire debris samples. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Dual-dimensional microscopy: real-time in vivo three-dimensional observation method using high-resolution light-field microscopy and light-field display.

PubMed

Kim, Jonghyun; Moon, Seokil; Jeong, Youngmo; Jang, Changwon; Kim, Youngmin; Lee, Byoungho

2018-06-01

Here, we present dual-dimensional microscopy that captures both two-dimensional (2-D) and light-field images of an in-vivo sample simultaneously, synthesizes an upsampled light-field image in real time, and visualizes it with a computational light-field display system in real time. Compared with conventional light-field microscopy, the additional 2-D image greatly enhances the lateral resolution at the native object plane up to the diffraction limit and compensates for the image degradation at the native object plane. The whole process from capturing to displaying is done in real time with the parallel computation algorithm, which enables the observation of the sample's three-dimensional (3-D) movement and direct interaction with the in-vivo sample. We demonstrate a real-time 3-D interactive experiment with Caenorhabditis elegans. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).

Comparison of sampling and test methods for determining asphalt content and moisture correction in asphalt concrete mixtures.

DOT National Transportation Integrated Search

1985-03-01

The purpose of this report is to identify the difference, if any, in AASHTO and OSHD test procedures and results. This report addresses the effect of the size of samples taken in the field and evaluates the methods of determining the moisture content...

The students' intentions and satisfaction with the field of study and university

PubMed Central

NOORAFSHAN, ALI; POURAHMAD, SAEEDEH; SAGHEB, MOHAMMAD MAHDI; DEHGHANI NAZHVANI, ALI; DEHSHAHRI, ALI; ABDOLLAHI, MANIJEH; MOHEBBI, ZEYNAB; KESHTKARAN, ZAHRA; AHMADI, AFSANEH; KAVOUSIPOUR, SOMAYEH; FARAHMAND, FARIBA; KHORRAMI, HAMID REZA; SOLTANI, ROBABEH; KARBALAY DOUST, SAIED

2014-01-01

Introduction: The present study aimed to find an appropriate method to inform senior high school students to correctly select their academic field of study and their intentions. Methods: This is a descriptive-analytic and cross-sectional study. A verified questionnaire was given to a total of 2600 students selected by stratified random sampling method (ten different colleges and entrance year from the 1st to 4th are considered as the strata). The position of the present field of study (major) among the list of the fields in the entrance exam was asked. The students’ methods of familiarity with different fields of study in Shiraz University of Medical Sciences (SUMS), the reasons for their selection, the students’ motivation and insistence on studying in the same field and university were asked in the questionnaire. Data were analyzed using independent two samples t-test, Analysis of Variance (ANOVA) and Chi-Square test. Results: The most significant references for university field selection were high school teachers, the students' parents and the adjacency of university to one's living place. Also, the results revealed the good reputation of SUMS in the first year and its downward trend during the following years. 59.4% of the 1st year students were satisfied with their field of study and SUMS. 31.8% were satisfied with the university but not with their fields of study. 6.4% were dissatisfied with the university but not with their fields of study. 2% of the students were dissatisfied with both their fields of study and university. Dissatisfaction with SUMS and field of study increased little by little so that the results obtained among the students who had entered the university earlier (in the 4th year of their study) showed nearly 16.3% dissatisfaction with both the university and the study fields.   Conclusion: The methods for introducing the university are recommended to be revised. PMID:25512943

The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots.

PubMed

Schwartz, Alanna; Baidjoe, Amrish; Rosenthal, Philip J; Dorsey, Grant; Bousema, Teun; Greenhouse, Bryan

2015-05-01

Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We investigated the effects of storage conditions, length of storage, and DNA extraction methods on amplification via three PCR-based assays using field samples and laboratory controls. Samples stored as DBS for 2 or more years at ambient temperature showed a significant loss of sensitivity that increased with time; after 10 years only 10% samples with parasite densities > 1,000 parasites/μL were detectable by nested polymerase chain reaction (PCR). Conversely, DBS and extracted DNA stored at -20°C showed no loss of sensitivity with time. Samples with low parasite densities amplified more successfully with saponin/Chelex compared with spin-column-based extraction, though the latter method performed better on samples with higher parasite densities stored for 2 years at ambient temperature. DNA extracted via both methods was stable after 20 freeze-thaw cycles. Our results suggest that DBS should be stored at -20°C or extracted immediately, especially if anticipating 2 or more years of storage. © The American Society of Tropical Medicine and Hygiene.

The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

PubMed Central

Schwartz, Alanna; Baidjoe, Amrish; Rosenthal, Philip J.; Dorsey, Grant; Bousema, Teun; Greenhouse, Bryan

2015-01-01

Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We investigated the effects of storage conditions, length of storage, and DNA extraction methods on amplification via three PCR-based assays using field samples and laboratory controls. Samples stored as DBS for 2 or more years at ambient temperature showed a significant loss of sensitivity that increased with time; after 10 years only 10% samples with parasite densities > 1,000 parasites/μL were detectable by nested polymerase chain reaction (PCR). Conversely, DBS and extracted DNA stored at −20°C showed no loss of sensitivity with time. Samples with low parasite densities amplified more successfully with saponin/Chelex compared with spin-column-based extraction, though the latter method performed better on samples with higher parasite densities stored for 2 years at ambient temperature. DNA extracted via both methods was stable after 20 freeze-thaw cycles. Our results suggest that DBS should be stored at −20°C or extracted immediately, especially if anticipating 2 or more years of storage. PMID:25758652

Differentiation of organic and non-organic winter wheat cultivars from a controlled field trial by crystallization patterns.

PubMed

Kahl, Johannes; Busscher, Nicolaas; Mergardt, Gaby; Mäder, Paul; Torp, Torfinn; Ploeger, Angelika

2015-01-01

There is a need for authentication tools in order to verify the existing certification system. Recently, markers for analytical authentication of organic products were evaluated. Herein, crystallization with additives was described as an interesting fingerprint approach which needs further evidence, based on a standardized method and well-documented sample origin. The fingerprint of wheat cultivars from a controlled field trial is generated from structure analysis variables of crystal patterns. Method performance was tested on factors such as crystallization chamber, day of experiment and region of interest of the patterns. Two different organic treatments and two different treatments of the non-organic regime can be grouped together in each of three consecutive seasons. When the k-nearest-neighbor classification method was applied, approximately 84% of Runal samples and 95% of Titlis samples were classified correctly into organic and non-organic origin using cross-validation. Crystallization with additive offers an interesting complementary fingerprint method for organic wheat samples. When the method is applied to winter wheat from the DOK trial, organic and non-organic treated samples can be differentiated significantly based on pattern recognition. Therefore crystallization with additives seems to be a promising tool in organic wheat authentication. © 2014 Society of Chemical Industry.

Water Quality & Pollutant Source Monitoring: Field and Laboratory Procedures. Training Manual.

ERIC Educational Resources Information Center

Office of Water Program Operations (EPA), Cincinnati, OH. National Training and Operational Technology Center.

This training manual presents material on techniques and instrumentation used to develop data in field monitoring programs and related laboratory operations concerned with water quality and pollution monitoring. Topics include: collection and handling of samples; bacteriological, biological, and chemical field and laboratory methods; field…

Methods and devices for high-throughput dielectrophoretic concentration

DOEpatents

Simmons, Blake A.; Cummings, Eric B.; Fiechtner, Gregory J.; Fintschenko, Yolanda; McGraw, Gregory J.; Salmi, Allen

2010-02-23

Disclosed herein are methods and devices for assaying and concentrating analytes in a fluid sample using dielectrophoresis. As disclosed, the methods and devices utilize substrates having a plurality of pores through which analytes can be selectively prevented from passing, or inhibited, on application of an appropriate electric field waveform. The pores of the substrate produce nonuniform electric field having local extrema located near the pores. These nonuniform fields drive dielectrophoresis, which produces the inhibition. Arrangements of electrodes and porous substrates support continuous, bulk, multi-dimensional, and staged selective concentration.

Extreme Material Physical Properties and Measurements above 100 tesla

NASA Astrophysics Data System (ADS)

Mielke, Charles

2011-03-01

The National High Magnetic Field Laboratory (NHMFL) Pulsed Field Facility (PFF) at Los Alamos National Laboratory (LANL) offers extreme environments of ultra high magnetic fields above 100 tesla by use of the Single Turn method as well as fields approaching 100 tesla with more complex methods. The challenge of metrology in the extreme magnetic field generating devices is complicated by the millions of amperes of current and tens of thousands of volts that are required to deliver the pulsed power needed for field generation. Methods of detecting physical properties of materials are essential parts of the science that seeks to understand and eventually control the fundamental functionality of materials in extreme environments. De-coupling the signal of the sample from the electro-magnetic interference associated with the magnet system is required to make these state-of-the-art magnetic fields useful to scientists studying materials in high magnetic fields. The cutting edge methods that are being used as well as methods in development will be presented with recent results in Graphene and High-Tc superconductors along with the methods and challenges. National Science Foundation DMR-Award 0654118.

Evaluation of FTA cards as a laboratory and field sampling device for the detection of foot-and-mouth disease virus and serotyping by RT-PCR and real-time RT-PCR.

PubMed

Muthukrishnan, Madhanmohan; Singanallur, Nagendrakumar B; Ralla, Kumar; Villuppanoor, Srinivasan A

2008-08-01

Foot-and-mouth disease virus (FMDV) samples transported to the laboratory from far and inaccessible areas for serodiagnosis pose a major problem in a tropical country like India, where there is maximum temperature fluctuation. Inadequate storage methods lead to spoilage of FMDV samples collected from clinically positive animals in the field. Such samples are declared as non-typeable by the typing laboratories with the consequent loss of valuable epidemiological data. The present study evaluated the usefulness of FTA Classic Cards for the collection, shipment, storage and identification of the FMDV genome by RT-PCR and real-time RT-PCR. The stability of the viral RNA, the absence of infectivity and ease of processing the sample for molecular methods make the FTA cards a useful option for transport of FMDV genome for identification and serotyping. The method can be used routinely for FMDV research as it is economical and the cards can be transported easily in envelopes by regular document transport methods. Live virus cannot be isolated from samples collected in FTA cards, which is a limitation. This property can be viewed as an advantage as it limits the risk of transmission of live virus.

Operating characteristics of full count and binomial sampling plans for green peach aphid (Hemiptera: Aphididae) in potato.

PubMed

Kabaluk, J Todd; Binns, Michael R; Vernon, Robert S

2006-06-01

Counts of green peach aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae), in potato, Solanum tuberosum L., fields were used to evaluate the performance of the sampling plan from a pest management company. The counts were further used to develop a binomial sampling method, and both full count and binomial plans were evaluated using operating characteristic curves. Taylor's power law provided a good fit of the data (r2 = 0.95), with the relationship between the variance (s2) and mean (m) as ln(s2) = 1.81(+/- 0.02) + 1.55(+/- 0.01) ln(m). A binomial sampling method was developed using the empirical model ln(m) = c + dln(-ln(1 - P(T))), to which the data fit well for tally numbers (T) of 0, 1, 3, 5, 7, and 10. Although T = 3 was considered the most reasonable given its operating characteristics and presumed ease of classification above or below critical densities (i.e., action thresholds) of one and 10 M. persicae per leaf, the full count method is shown to be superior. The mean number of sample sites per field visit by the pest management company was 42 +/- 19, with more than one-half (54%) of the field visits involving sampling 31-50 sample sites, which was acceptable in the context of operating characteristic curves for a critical density of 10 M. persicae per leaf. Based on operating characteristics, actual sample sizes used by the pest management company can be reduced by at least 50%, on average, for a critical density of 10 M. persicae per leaf. For a critical density of one M. persicae per leaf used to avert the spread of potato leaf roll virus, sample sizes from 50 to 100 were considered more suitable.

Surveying immigrants without sampling frames - evaluating the success of alternative field methods.

PubMed

Reichel, David; Morales, Laura

2017-01-01

This paper evaluates the sampling methods of an international survey, the Immigrant Citizens Survey, which aimed at surveying immigrants from outside the European Union (EU) in 15 cities in seven EU countries. In five countries, no sample frame was available for the target population. Consequently, alternative ways to obtain a representative sample had to be found. In three countries 'location sampling' was employed, while in two countries traditional methods were used with adaptations to reach the target population. The paper assesses the main methodological challenges of carrying out a survey among a group of immigrants for whom no sampling frame exists. The samples of the survey in these five countries are compared to results of official statistics in order to assess the accuracy of the samples obtained through the different sampling methods. It can be shown that alternative sampling methods can provide meaningful results in terms of core demographic characteristics although some estimates differ to some extent from the census results.

Pairing field methods to improve inference in wildlife surveys while accommodating detection covariance.

PubMed

Clare, John; McKinney, Shawn T; DePue, John E; Loftin, Cynthia S

2017-10-01

It is common to use multiple field sampling methods when implementing wildlife surveys to compare method efficacy or cost efficiency, integrate distinct pieces of information provided by separate methods, or evaluate method-specific biases and misclassification error. Existing models that combine information from multiple field methods or sampling devices permit rigorous comparison of method-specific detection parameters, enable estimation of additional parameters such as false-positive detection probability, and improve occurrence or abundance estimates, but with the assumption that the separate sampling methods produce detections independently of one another. This assumption is tenuous if methods are paired or deployed in close proximity simultaneously, a common practice that reduces the additional effort required to implement multiple methods and reduces the risk that differences between method-specific detection parameters are confounded by other environmental factors. We develop occupancy and spatial capture-recapture models that permit covariance between the detections produced by different methods, use simulation to compare estimator performance of the new models to models assuming independence, and provide an empirical application based on American marten (Martes americana) surveys using paired remote cameras, hair catches, and snow tracking. Simulation results indicate existing models that assume that methods independently detect organisms produce biased parameter estimates and substantially understate estimate uncertainty when this assumption is violated, while our reformulated models are robust to either methodological independence or covariance. Empirical results suggested that remote cameras and snow tracking had comparable probability of detecting present martens, but that snow tracking also produced false-positive marten detections that could potentially substantially bias distribution estimates if not corrected for. Remote cameras detected marten individuals more readily than passive hair catches. Inability to photographically distinguish individual sex did not appear to induce negative bias in camera density estimates; instead, hair catches appeared to produce detection competition between individuals that may have been a source of negative bias. Our model reformulations broaden the range of circumstances in which analyses incorporating multiple sources of information can be robustly used, and our empirical results demonstrate that using multiple field-methods can enhance inferences regarding ecological parameters of interest and improve understanding of how reliably survey methods sample these parameters. © 2017 by the Ecological Society of America.

Study on Measuring the Viscosity of Lubricating Oil by Viscometer Based on Hele - Shaw Principle

NASA Astrophysics Data System (ADS)

Li, Longfei

2017-12-01

In order to explore the method of accurately measuring the viscosity value of oil samples using the viscometer based on Hele-Shaw principle, three different measurement methods are designed in the laboratory, and the statistical characteristics of the measured values are compared, in order to get the best measurement method. The results show that the oil sample to be measured is placed in the magnetic field formed by the magnet, and the oil sample can be sucked from the same distance from the magnet. The viscosity value of the sample can be measured accurately.

Improved Compressive Sensing of Natural Scenes Using Localized Random Sampling

PubMed Central

Barranca, Victor J.; Kovačič, Gregor; Zhou, Douglas; Cai, David

2016-01-01

Compressive sensing (CS) theory demonstrates that by using uniformly-random sampling, rather than uniformly-spaced sampling, higher quality image reconstructions are often achievable. Considering that the structure of sampling protocols has such a profound impact on the quality of image reconstructions, we formulate a new sampling scheme motivated by physiological receptive field structure, localized random sampling, which yields significantly improved CS image reconstructions. For each set of localized image measurements, our sampling method first randomly selects an image pixel and then measures its nearby pixels with probability depending on their distance from the initially selected pixel. We compare the uniformly-random and localized random sampling methods over a large space of sampling parameters, and show that, for the optimal parameter choices, higher quality image reconstructions can be consistently obtained by using localized random sampling. In addition, we argue that the localized random CS optimal parameter choice is stable with respect to diverse natural images, and scales with the number of samples used for reconstruction. We expect that the localized random sampling protocol helps to explain the evolutionarily advantageous nature of receptive field structure in visual systems and suggests several future research areas in CS theory and its application to brain imaging. PMID:27555464

Development and application of variable angle internal reflection Raman spectroscopy for vibrationally specific depth-profiling of polymer thin films

NASA Astrophysics Data System (ADS)

Fontaine, Norman Henry

1997-10-01

Techniques which can be used to obtain depth-resolved information on the thermodynamics at polymer-polymer and polymer-wall interfaces, and of small molecule diffusion in polymers, are of particular interest to industry. Optical methods which are sensitive to molecular vibrations (such as internal reflection Raman spectroscopy) are advantageous because they can non- destructively probe molecular content, orientation, and polarity of the local environment in a sample. However, while optical internal reflection depth-profiling methods have been reported, they have never progressed beyond the demonstration stage. In this work, the theory and methodology of internal reflection spectroscopy are developed and optimized into a rigorous field-controlled spectroscopic technique. A novel asymmetric internal reflection element (IRE) is introduced which traps back-reflections, allowing precise evanescent and standing wave probe-field control in the sample for all angles of incidence. It is demonstrated that a Gaussian laser beam will best approximate an infinite homogeneous plane wave when the IRE/sample interface lies in the paraxial-Fraunhofer region (far- field) of the beam path. Calibration methods are presented, sources of systematic errors are identified, and the angular resolution limit (ARL) is introduced as a measure of the field control developed in a sample by any internal reflection method. A general model of Raman scattering and photon detection from multi-layer thin films is developed. A new and generalized operator based transfer matrix method is developed and applied to electromagnetic field and diffusion computations in multi-layer systems. Total internal reflection spectroscopy is extended to include sub-critical angles of incidence, where resonant field enhancements generate large and selective amplification of the probe-field intensity within the layers of the sample. Fitting these resonances to the model spectral intensities allows unique determination of the location of buried interfaces in micron-sized polymer multi-layers with nanometer scale precision and the refractive indices of the layers with precision of /Delta n/approx/pm 0.0001. The Raman active molecular content of each optically distinct layer of the film is determinable simultaneously with the optical properties. Resonant mode VAIRRS studies of poly(methyl methacrylate) films spun-cast from toluene and then dried under ambient conditions have shown evidence for toluene diffusion concurrent with a rotationally hindered relaxation of oriented ester side groups about the polymer backbone. Low temperature annealing (≈87oC) has shown evidence that this hindered rotational relaxation may be reversible. VAIRRS study of a polystyrene/poly(methyl methacrylate) bi-layer has detected evidence for toluene diffusion across the buried polymer-polymer interface.

Environmental DNA as a Tool for Inventory and Monitoring of Aquatic Vertebrates

DTIC Science & Technology

2017-07-01

geomorphic calculations and description of each reach. Methods Channel Surveys We initially selected reaches based on access and visual indicators...WA 99164 I-2 Environmental DNA lab protocol: designing species-specific qPCR assays Species-specific surveys should use quantitative polymerase...to traditional field sampling with respect to sensitivity, detection probabilities, and cost efficiency. Compared to field surveys , eDNA sampling

Deposition Uniformity of Coal Dust on Filters and Its Effect on the Accuracy of FTIR Analyses for Silica.

PubMed

Miller, Arthur L; Drake, Pamela L; Murphy, Nathaniel C; Cauda, Emanuele G; LeBouf, Ryan F; Markevicius, Gediminas

Miners are exposed to silica-bearing dust which can lead to silicosis, a potentially fatal lung disease. Currently, airborne silica is measured by collecting filter samples and sending them to a laboratory for analysis. Since this may take weeks, a field method is needed to inform decisions aimed at reducing exposures. This study investigates a field-portable Fourier transform infrared (FTIR) method for end-of-shift (EOS) measurement of silica on filter samples. Since the method entails localized analyses, spatial uniformity of dust deposition can affect accuracy and repeatability. The study, therefore, assesses the influence of radial deposition uniformity on the accuracy of the method. Using laboratory-generated Minusil and coal dusts and three different types of sampling systems, multiple sets of filter samples were prepared. All samples were collected in pairs to create parallel sets for training and validation. Silica was measured by FTIR at nine locations across the face of each filter and the data analyzed using a multiple regression analysis technique that compared various models for predicting silica mass on the filters using different numbers of "analysis shots." It was shown that deposition uniformity is independent of particle type (kaolin vs. silica), which suggests the role of aerodynamic separation is negligible. Results also reflected the correlation between the location and number of shots versus the predictive accuracy of the models. The coefficient of variation (CV) for the models when predicting mass of validation samples was 4%-51% depending on the number of points analyzed and the type of sampler used, which affected the uniformity of radial deposition on the filters. It was shown that using a single shot at the center of the filter yielded predictivity adequate for a field method, (93% return, CV approximately 15%) for samples collected with 3-piece cassettes.

A technique for measuring petal gloss, with examples from the Namaqualand flora.

PubMed

Whitney, Heather M; Rands, Sean A; Elton, Nick J; Ellis, Allan G

2012-01-01

The degree of floral gloss varies between species. However, little is known about this distinctive floral trait, even though it could be a key feature of floral biotic and abiotic interactions. One reason for the absence of knowledge is the lack of a simple, repeatable method of gloss measurement that can be used in the field to study floral gloss. A protocol is described for measuring gloss in petal samples collected in the field, using a glossmeter. Repeatability of the technique is assessed. We demonstrate a simple yet highly accurate and repeatable method that can easily be implemented in the field. We also highlight the huge variety of glossiness found within flowers and between species in a sample of spring-blooming flowers collected in Namaqualand, South Africa. We discuss the potential uses of this method and its applications for furthering studies in plant-pollinator interactions. We also discuss the potential functions of gloss in flowers.

Environmental Sampling & Analytical Methods (ESAM) Program - Home

EPA Pesticide Factsheets

ESAM is a comprehensive program to facilitate a coordinated response to a chemical, radiochemical, biotoxin or pathogen contamination incident focusing on sample collection, processing, and analysis to provide quality results to the field.

National-scale crop type mapping and area estimation using multi-resolution remote sensing and field survey

NASA Astrophysics Data System (ADS)

Song, X. P.; Potapov, P.; Adusei, B.; King, L.; Khan, A.; Krylov, A.; Di Bella, C. M.; Pickens, A. H.; Stehman, S. V.; Hansen, M.

2016-12-01

Reliable and timely information on agricultural production is essential for ensuring world food security. Freely available medium-resolution satellite data (e.g. Landsat, Sentinel) offer the possibility of improved global agriculture monitoring. Here we develop and test a method for estimating in-season crop acreage using a probability sample of field visits and producing wall-to-wall crop type maps at national scales. The method is first illustrated for soybean cultivated area in the US for 2015. A stratified, two-stage cluster sampling design was used to collect field data to estimate national soybean area. The field-based estimate employed historical soybean extent maps from the U.S. Department of Agriculture (USDA) Cropland Data Layer to delineate and stratify U.S. soybean growing regions. The estimated 2015 U.S. soybean cultivated area based on the field sample was 341,000 km2 with a standard error of 23,000 km2. This result is 1.0% lower than USDA's 2015 June survey estimate and 1.9% higher than USDA's 2016 January estimate. Our area estimate was derived in early September, about 2 months ahead of harvest. To map soybean cover, the Landsat image archive for the year 2015 growing season was processed using an active learning approach. Overall accuracy of the soybean map was 84%. The field-based sample estimated area was then used to calibrate the map such that the soybean acreage of the map derived through pixel counting matched the sample-based area estimate. The strength of the sample-based area estimation lies in the stratified design that takes advantage of the spatially explicit cropland layers to construct the strata. The success of the mapping was built upon an automated system which transforms Landsat images into standardized time-series metrics. The developed method produces reliable and timely information on soybean area in a cost-effective way and could be implemented in an operational mode. The approach has also been applied for other crops in other regions, such as winter wheat in Pakistan, soybean in Argentina and soybean in the entire South America. Similar levels of accuracy and timeliness were achieved as in the US.

A novel in-situ method for real-time monitoring of gas transport in soil

NASA Astrophysics Data System (ADS)

Laemmel, Thomas; Maier, Martin; Schack-Kirchner, Helmer; Lang, Friederike

2017-04-01

Gas exchange between soil and atmosphere is important for the biogeochemistry of soils. Gas transport in soil is commonly assumed to be governed by molecular diffusion and is usually described by the soil gas diffusion coefficient DS characterizing the ability of the soil to "transport passively" gas through the soil. One way to determine DS is sampling soil cores in the field and measuring DS in the lab. Unfortunately this method is destructive and laborious. Moreover, a few previous field studies identified other gas transport processes in soil to significantly enhance the diffusive gas transport. However, until now, no method is available to measure gas transport in situ in the soil. We developed a novel method to monitor gas transport in soil in situ. The method includes a custom made gas sampling device, the continuous injection of an inert tracer gas and inverse gas transport modelling in the soil. The gas sampling device has several sampling depths and can be easily installed into a vertical hole drilled by an auger, which allows for fast installation of the system. Helium (He) as inert tracer gas was injected continuously at the lower end of the device. The resulting steady state distribution of He was used to deduce the depth profile of DS. Gas transport in the soil surrounding the gas-sampling-device/soil system was modeled using the Finite Element Modeling program COMSOL . We tested our new method both in the lab and during two short field studies and compared the results with a reference method using soil cores. DS profiles obtained by our in-situ method were consistent with DS profiles determined based on soil core analyses. During a longer monitoring field campaign, typical soil-moisture effects upon gas diffusivity such as an increase during a drying period or a decrease after rain could be observed consistently. Under windy conditions we additionally measured for the first time the direct enhancement of gas transport in soil due to wind-induced pressure-pumping which could increase the effective DS up to 30% in the topsoil. Our novel monitoring method can be quickly and easily installed and allows for monitoring continuously soil gas transport over a long time. It allows monitoring physical modifications of soil gas diffusivity due to rain events or evaporation but it also allows studying non-diffusive gas transport processes in the soil.

Refraction-based X-ray Computed Tomography for Biomedical Purpose Using Dark Field Imaging Method

NASA Astrophysics Data System (ADS)

Sunaguchi, Naoki; Yuasa, Tetsuya; Huo, Qingkai; Ichihara, Shu; Ando, Masami

We have proposed a tomographic x-ray imaging system using DFI (dark field imaging) optics along with a data-processing method to extract information on refraction from the measured intensities, and a reconstruction algorithm to reconstruct a refractive-index field from the projections generated from the extracted refraction information. The DFI imaging system consists of a tandem optical system of Bragg- and Laue-case crystals, a positioning device system for a sample, and two CCD (charge coupled device) cameras. Then, we developed a software code to simulate the data-acquisition, data-processing, and reconstruction methods to investigate the feasibility of the proposed methods. Finally, in order to demonstrate its efficacy, we imaged a sample with DCIS (ductal carcinoma in situ) excised from a breast cancer patient using a system constructed at the vertical wiggler beamline BL-14C in KEK-PF. Its CT images depicted a variety of fine histological structures, such as milk ducts, duct walls, secretions, adipose and fibrous tissue. They correlate well with histological sections.

Use of the polymerase chain reaction to directly detect malaria parasites in blood samples from the Venezuelan Amazon.

PubMed

Laserson, K F; Petralanda, I; Hamlin, D M; Almera, R; Fuentes, M; Carrasquel, A; Barker, R H

1994-02-01

We have examined the reproducibility, sensitivity, and specificity of detecting Plasmodium falciparum using the polymerase chain reaction (PCR) and the species-specific probe pPF14 under field conditions in the Venezuelan Amazon. Up to eight samples were field collected from each of 48 consenting Amerindians presenting with symptoms of malaria. Sample processing and analysis was performed at the Centro Amazonico para la Investigacion y Control de Enfermedades Tropicales Simon Bolivar. A total of 229 samples from 48 patients were analyzed by PCR methods using four different P. falciparum-specific probes. One P. vivax-specific probe and by conventional microscopy. Samples in which results from PCR and microscopy differed were reanalyzed at a higher sensitivity by microscopy. Results suggest that microscopy-negative, PCR-positive samples are true positives, and that microscopy-positive and PCR-negative samples are true negatives. The sensitivity of the DNA probe/PCR method was 78% and its specificity was 97%. The positive predictive value of the PCR method was 88%, and the negative predictive value was 95%. Through the analysis of multiple blood samples from each individual, the DNA probe/PCR methodology was found to have an inherent reproducibility that was highly statistically significant.

Optimal tumor sampling for immunostaining of biomarkers in breast carcinoma

PubMed Central

2011-01-01

Introduction Biomarkers, such as Estrogen Receptor, are used to determine therapy and prognosis in breast carcinoma. Immunostaining assays of biomarker expression have a high rate of inaccuracy; for example, estimates are as high as 20% for Estrogen Receptor. Biomarkers have been shown to be heterogeneously expressed in breast tumors and this heterogeneity may contribute to the inaccuracy of immunostaining assays. Currently, no evidence-based standards exist for the amount of tumor that must be sampled in order to correct for biomarker heterogeneity. The aim of this study was to determine the optimal number of 20X fields that are necessary to estimate a representative measurement of expression in a whole tissue section for selected biomarkers: ER, HER-2, AKT, ERK, S6K1, GAPDH, Cytokeratin, and MAP-Tau. Methods Two collections of whole tissue sections of breast carcinoma were immunostained for biomarkers. Expression was quantified using the Automated Quantitative Analysis (AQUA) method of quantitative immunofluorescence. Simulated sampling of various numbers of fields (ranging from one to thirty five) was performed for each marker. The optimal number was selected for each marker via resampling techniques and minimization of prediction error over an independent test set. Results The optimal number of 20X fields varied by biomarker, ranging between three to fourteen fields. More heterogeneous markers, such as MAP-Tau protein, required a larger sample of 20X fields to produce representative measurement. Conclusions The optimal number of 20X fields that must be sampled to produce a representative measurement of biomarker expression varies by marker with more heterogeneous markers requiring a larger number. The clinical implication of these findings is that breast biopsies consisting of a small number of fields may be inadequate to represent whole tumor biomarker expression for many markers. Additionally, for biomarkers newly introduced into clinical use, especially if therapeutic response is dictated by level of expression, the optimal size of tissue sample must be determined on a marker-by-marker basis. PMID:21592345

Spatial capture-recapture

USGS Publications Warehouse

Royle, J. Andrew; Chandler, Richard B.; Sollmann, Rahel; Gardner, Beth

2013-01-01

Spatial Capture-Recapture provides a revolutionary extension of traditional capture-recapture methods for studying animal populations using data from live trapping, camera trapping, DNA sampling, acoustic sampling, and related field methods. This book is a conceptual and methodological synthesis of spatial capture-recapture modeling. As a comprehensive how-to manual, this reference contains detailed examples of a wide range of relevant spatial capture-recapture models for inference about population size and spatial and temporal variation in demographic parameters. Practicing field biologists studying animal populations will find this book to be a useful resource, as will graduate students and professionals in ecology, conservation biology, and fisheries and wildlife management.

Highly sensitive mode mapping of whispering-gallery modes by scanning thermocouple-probe microscopy.

PubMed

Klein, Angela E; Schmidt, Carsten; Liebsch, Mattes; Janunts, Norik; Dobynde, Mikhail; Tünnermann, Andreas; Pertsch, Thomas

2014-03-01

We propose a method for mapping optical near-fields with the help of a thermocouple scanning-probe microscope tip. As the tip scans the sample surface, its apex is heated by light absorption, generating a thermovoltage. The thermovoltage map represents the intensity distribution of light at the sample surface. The measurement technique has been employed to map optical whispering-gallery modes in fused silica microdisk resonators operating at near-infrared wavelengths. The method could potentially be employed for near-field imaging of a variety of systems in the near-infrared and visible spectral range.

A 3-D Coupled CFD-DSMC Solution Method With Application to the Mars Sample Return Orbiter

NASA Technical Reports Server (NTRS)

Glass, Christopher E.; Gnoffo, Peter A.

2000-01-01

A method to obtain coupled Computational Fluid Dynamics-Direct Simulation Monte Carlo (CFD-DSMC), 3-D flow field solutions for highly blunt bodies at low incidence is presented and applied to one concept of the Mars Sample Return Orbiter vehicle as a demonstration of the technique. CFD is used to solve the high-density blunt forebody flow defining an inflow boundary condition for a DSMC solution of the afterbody wake flow. By combining the two techniques in flow regions where most applicable, the entire mixed flow field is modeled in an appropriate manner.

For geological investigations with airborne thermal infrared multispectral images: Transfer of calibration from laboratory spectrometer to TIMS as alternative for removing atmospheric effects

NASA Technical Reports Server (NTRS)

Edgett, Kenneth S.; Anderson, Donald L.

1995-01-01

This paper describes an empirical method to correct TIMS (Thermal Infrared Multispectral Scanner) data for atmospheric effects by transferring calibration from a laboratory thermal emission spectrometer to the TIMS multispectral image. The method does so by comparing the laboratory spectra of samples gathered in the field with TIMS 6-point spectra for pixels at the location of field sampling sites. The transference of calibration also makes it possible to use spectra from the laboratory as endmembers in unmixing studies of TIMS data.

Evaluation of membrane filter field monitors for microbiological air sampling

NASA Technical Reports Server (NTRS)

Fields, N. D.; Oxborrow, G. S.; Puleo, J. R.; Herring, C. M.

1974-01-01

Due to area constraints encountered in assembly and testing areas of spacecraft, the membrane filter field monitor (MF) and the National Aeronautics and Space Administration-accepted Reyniers slit air sampler were compared for recovery of airborne microbial contamination. The intramural air in a microbiological laboratory area and a clean room environment used for the assembly and testing of the Apollo spacecraft was studied. A significantly higher number of microorganisms was recovered by the Reyniers sampler. A high degree of consistency between the two sampling methods was shown by a regression analysis, with a correlation coefficient of 0.93. The MF samplers detected 79% of the concentration measured by the Reyniers slit samplers. The types of microorganisms identified from both sampling methods were similar.

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

PubMed

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

ESTIMATING SAMPLE REQUIREMENTS FOR FIELD EVALUATIONS OF PESTICIDE LEACHING

EPA Science Inventory

A method is presented for estimating the number of samples needed to evaluate pesticide leaching threats to ground water at a desired level of precision. Sample size projections are based on desired precision (exhibited as relative tolerable error), level of confidence (90 or 95%...

Recovering the full velocity and density fields from large-scale redshift-distance samples

NASA Technical Reports Server (NTRS)

Bertschinger, Edmund; Dekel, Avishai

1989-01-01

A new method for extracting the large-scale three-dimensional velocity and mass density fields from measurements of the radial peculiar velocities is presented. Galaxies are assumed to trace the velocity field rather than the mass. The key assumption made is that the Lagrangian velocity field has negligible vorticity, as might be expected from perturbations that grew by gravitational instability. By applying the method to cosmological N-body simulations, it is demonstrated that it accurately reconstructs the velocity field. This technique promises a direct determination of the mass density field and the initial conditions for the formation of large-scale structure from galaxy peculiar velocity surveys.

Field analyses of (238)U and (226)Ra in two uranium mill tailings piles from Niger using portable HPGe detector.

PubMed

Déjeant, Adrien; Bourva, Ludovic; Sia, Radia; Galoisy, Laurence; Calas, Georges; Phrommavanh, Vannapha; Descostes, Michael

2014-11-01

The radioactivities of (238)U and (226)Ra in mill tailings from the U mines of COMINAK and SOMAÏR in Niger were measured and quantified using a portable High-Purity Germanium (HPGe) detector. The (238)U and (226)Ra activities were measured under field conditions on drilling cores with 600s measurements and without any sample preparation. Field results were compared with those obtained by Inductive Coupled Plasma Atomic Emission Spectroscopy (ICP-AES) and emanometry techniques. This comparison indicates that gamma-ray absorption by such geological samples does not cause significant deviations. This work shows the feasibility of using portable HPGe detector in the field as a preliminary method to observe variations of radionuclides concentration with the aim of identifying samples of interest. The HPGe is particularly useful for samples with strong secular disequilibrium such as mill tailings. Copyright © 2014 Elsevier Ltd. All rights reserved.

Photo ion spectrometer

DOEpatents

Gruen, Dieter M.; Young, Charles E.; Pellin, Michael J.

1989-01-01

A method and apparatus for extracting for quantitative analysis ions of selected atomic components of a sample. A lens system is configured to provide a slowly diminishing field region for a volume containing the selected atomic components, enabling accurate energy analysis of ions generated in the slowly diminishing field region. The lens system also enables focusing on a sample of a charged particle beam, such as an ion beam, along a path length perpendicular to the sample and extraction of the charged particles along a path length also perpendicular to the sample. Improvement of signal to noise ratio is achieved by laser excitation of ions to selected autoionization states before carrying out quantitative analysis. Accurate energy analysis of energetic charged particles is assured by using a preselected resistive thick film configuration disposed on an insulator substrate for generating predetermined electric field boundary conditions to achieve for analysis the required electric field potential. The spectrometer also is applicable in the fields of SIMS, ISS and electron spectroscopy.

Photo ion spectrometer

DOEpatents

Gruen, D.M.; Young, C.E.; Pellin, M.J.

1989-08-08

A method and apparatus are described for extracting for quantitative analysis ions of selected atomic components of a sample. A lens system is configured to provide a slowly diminishing field region for a volume containing the selected atomic components, enabling accurate energy analysis of ions generated in the slowly diminishing field region. The lens system also enables focusing on a sample of a charged particle beam, such as an ion beam, along a path length perpendicular to the sample and extraction of the charged particles along a path length also perpendicular to the sample. Improvement of signal to noise ratio is achieved by laser excitation of ions to selected auto-ionization states before carrying out quantitative analysis. Accurate energy analysis of energetic charged particles is assured by using a preselected resistive thick film configuration disposed on an insulator substrate for generating predetermined electric field boundary conditions to achieve for analysis the required electric field potential. The spectrometer also is applicable in the fields of SIMS, ISS and electron spectroscopy. 8 figs.

Mounting Thin Samples For Electrical Measurements

NASA Technical Reports Server (NTRS)

Matus, L. G.; Summers, R. L.

1988-01-01

New method for mounting thin sample for electrical measurements involves use of vacuum chuck to hold a ceramic mounting plate, which holds sample. Contacts on mounting plate establish electrical connection to sample. Used to make electrical measurements over temperature range from 77 to 1,000 K and does not introduce distortions into magnetic field during Hall measurements.

A simplified protocol for molecular identification of Eimeria species in field samples.

PubMed

Haug, Anita; Thebo, Per; Mattsson, Jens G

2007-05-15

This study aimed to find a fast, sensitive and efficient protocol for molecular identification of chicken Eimeria spp. in field samples. Various methods for each of the three steps of the protocol were evaluated: oocyst wall rupturing methods, DNA extraction methods, and identification of species-specific DNA sequences by PCR. We then compared and evaluated five complete protocols. Three series of oocyst suspensions of known number of oocysts from Eimeria mitis, Eimeria praecox, Eimeria maxima and Eimeria tenella were prepared and ground using glass beads or mini-pestle. DNA was extracted from ruptured oocysts using commercial systems (GeneReleaser, Qiagen Stoolkit and Prepman) or phenol-chloroform DNA extraction, followed by identification of species-specific ITS-1 sequences by optimised single species PCR assays. The Stoolkit and Prepman protocols showed insufficient repeatability, and the former was also expensive and relatively time-consuming. In contrast, both the GeneReleaser protocol and phenol-chloroform protocols were robust and sensitive, detecting less than 0.4 oocysts of each species per PCR. Finally, we evaluated our new protocol on 68 coccidia positive field samples. Our data suggests that rupturing the oocysts by mini-pestle grinding, preparing the DNA with GeneReleaser, followed by optimised single species PCR assays, makes a robust and sensitive procedure for identifying chicken Eimeria species in field samples. Importantly, it also provides minimal hands-on-time in the pre-PCR process, lower contamination risk and no handling of toxic chemicals.

Near-field radiative heat transfer in scanning thermal microscopy computed with the boundary element method

NASA Astrophysics Data System (ADS)

Nguyen, K. L.; Merchiers, O.; Chapuis, P.-O.

2017-11-01

We compute the near-field radiative heat transfer between a hot AFM tip and a cold substrate. This contribution to the tip-sample heat transfer in Scanning Thermal Microscopy is often overlooked, despite its leading role when the tip is out of contact. For dielectrics, we provide power levels exchanged as a function of the tip-sample distance in vacuum and spatial maps of the heat flux deposited into the sample which indicate the near-contact spatial resolution. The results are compared to analytical expressions of the Proximity Flux Approximation. The numerical results are obtained by means of the Boundary Element Method (BEM) implemented in the SCUFF-EM software, and require first a thorough convergence analysis of the progressive implementation of this method to the thermal emission by a sphere, the radiative transfer between two spheres, and the radiative exchange between a sphere and a finite substrate.

Direct-current arc and alternating-current spark emission spectrographic field methods for the semiquantitative analysis of geologic materials

USGS Publications Warehouse

Grimes, D.J.; Marranzino, A.P.

1968-01-01

Two spectrographic methods are used in mobile field laboratories of the U. S. Geological Survey. In the direct-current arc method, the ground sample is mixed with graphite powder, packed into an electrode crater, and burned to completion. Thirty elements are determined. In the spark method, the sample, ground to pass a 150-mesh screen, is digested in hydrofluoric acid followed by evaporation to dryness and dissolution in aqua regia. The solution is fed into the spark gap by means of a rotating-disk electrode arrangement and is excited with an alternating-current spark discharge. Fourteen elements are determined. In both techniques, light is recorded on Spectrum Analysis No. 1, 35-millimeter film, and the spectra are compared visually with those of standard films.

A Field-Based Cleaning Protocol for Sampling Devices Used in Life-Detection Studies

NASA Astrophysics Data System (ADS)

Eigenbrode, Jennifer; Benning, Liane G.; Maule, Jake; Wainwright, Norm; Steele, Andrew; Amundsen, Hans E. F.

2009-06-01

Analytical approaches to extant and extinct life detection involve molecular detection often at trace levels. Thus, removal of biological materials and other organic molecules from the surfaces of devices used for sampling is essential for ascertaining meaningful results. Organic decontamination to levels consistent with null values on life-detection instruments is particularly challenging at remote field locations where Mars analog field investigations are carried out. Here, we present a seven-step, multi-reagent decontamination method that can be applied to sampling devices while in the field. In situ lipopolysaccharide detection via low-level endotoxin assays and molecular detection via gas chromatography-mass spectrometry were used to test the effectiveness of the decontamination protocol for sampling of glacial ice with a coring device and for sampling of sediments with a rover scoop during deployment at Arctic Mars-analog sites in Svalbard, Norway. Our results indicate that the protocols and detection technique sufficiently remove and detect low levels of molecular constituents necessary for life-detection tests.

A field-based cleaning protocol for sampling devices used in life-detection studies.

PubMed

Eigenbrode, Jennifer; Benning, Liane G; Maule, Jake; Wainwright, Norm; Steele, Andrew; Amundsen, Hans E F

2009-06-01

Analytical approaches to extant and extinct life detection involve molecular detection often at trace levels. Thus, removal of biological materials and other organic molecules from the surfaces of devices used for sampling is essential for ascertaining meaningful results. Organic decontamination to levels consistent with null values on life-detection instruments is particularly challenging at remote field locations where Mars analog field investigations are carried out. Here, we present a seven-step, multi-reagent decontamination method that can be applied to sampling devices while in the field. In situ lipopolysaccharide detection via low-level endotoxin assays and molecular detection via gas chromatography-mass spectrometry were used to test the effectiveness of the decontamination protocol for sampling of glacial ice with a coring device and for sampling of sediments with a rover scoop during deployment at Arctic Mars-analog sites in Svalbard, Norway. Our results indicate that the protocols and detection technique sufficiently remove and detect low levels of molecular constituents necessary for life-detection tests.

Quantification of in-contact probe-sample electrostatic forces with dynamic atomic force microscopy.

PubMed

Balke, Nina; Jesse, Stephen; Carmichael, Ben; Okatan, M Baris; Kravchenko, Ivan I; Kalinin, Sergei V; Tselev, Alexander

2017-01-04

Atomic force microscopy (AFM) methods utilizing resonant mechanical vibrations of cantilevers in contact with a sample surface have shown sensitivities as high as few picometers for detecting surface displacements. Such a high sensitivity is harnessed in several AFM imaging modes. Here, we demonstrate a cantilever-resonance-based method to quantify electrostatic forces on a probe in the probe-sample junction in the presence of a surface potential or when a bias voltage is applied to the AFM probe. We find that the electrostatic forces acting on the probe tip apex can produce signals equivalent to a few pm of surface displacement. In combination with modeling, the measurements of the force were used to access the strength of the electrical field at the probe tip apex in contact with a sample. We find an evidence that the electric field strength in the junction can reach ca. 1 V nm -1 at a bias voltage of a few volts and is limited by non-ideality of the tip-sample contact. This field is sufficiently strong to significantly influence material states and kinetic processes through charge injection, Maxwell stress, shifts of phase equilibria, and reduction of energy barriers for activated processes. Besides, the results provide a baseline for accounting for the effects of local electrostatic forces in electromechanical AFM measurements as well as offer additional means to probe ionic mobility and field-induced phenomena in solids.

Field-based Evaluation of a Novel SPME-GC-MS Method for Investigation of Below-ground Interaction between Brassica Roots and Larvae of Cabbage Root Fly, Delia radicum L.

PubMed

Deasy, William; Shepherd, Tom; Alexander, Colin J; Birch, A Nicholas E; Evans, K Andrew

2016-11-01

Collection of volatiles from plant roots poses technical challenges due to difficulties accessing the soil environment without damaging the roots. To validate a new non-invasive method for passive sampling of root volatiles in situ, from plants grown under field conditions, using solid phase micro-extraction (SPME). SPME fibres were inserted into perforated polytetrafluoroethene (PTFE) tubes positioned in the soil next to broccoli plants for collection of root volatiles pre- and post-infestation with Delia radicum larvae. After sample analysis by gas chromatography-mass spectrometry (GC-MS), principal component analysis (PCA) was applied to determine differences in the profiles of volatiles between samples. GC-MS analysis revealed that this method can detect temporal changes in root volatiles emitted before and after Delia radicum damage. PCA showed that samples collected pre- and post-infestation were compositionally different due to the presence of root volatiles induced by D. radicum feeding. Sulphur containing compounds, in particular, accounted for the differences observed. Root volatiles emission patterns post-infestation are thought to follow the feeding and developmental progress of larvae. This study shows that volatiles released by broccoli roots can be collected in situ using SPME fibres within perforated PTFE tubes under field conditions. Plants damaged by Delia radicum larvae could be distinguished from plants sampled pre-infestation and soil controls on the basis of larval feeding-induced sulphur-containing volatiles. These results show that this new method is a powerful tool for non-invasive sampling of root volatiles below-ground. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

A new in-situ method to determine the apparent gas diffusion coefficient of soils

NASA Astrophysics Data System (ADS)

Laemmel, Thomas; Paulus, Sinikka; Schack-Kirchner, Helmer; Maier, Martin

2015-04-01

Soil aeration is an important factor for the biological activity in the soil and soil respiration. Generally, gas exchange between soil and atmosphere is assumed to be governed by diffusion and Fick's Law is used to describe the fluxes in the soil. The "apparent soil gas diffusion coefficient" represents the proportional factor between the flux and the gas concentration gradient in the soil and reflects the ability of the soil to "transport passively" gases through the soil. One common way to determine this coefficient is to take core samples in the field and determine it in the lab. Unfortunately this method is destructive and needs laborious field work and can only reflect a small fraction of the whole soil. As a consequence insecurity about the resulting effective diffusivity on the profile scale must remain. We developed a new in-situ method using new gas sampling device, tracer gas and inverse soil gas modelling. The gas sampling device contains several sampling depths and can be easily installed into vertical holes of an auger, which allows for fast installation of the system. At the lower end of the device inert tracer gas is injected continuously. The tracer gas diffuses into the surrounding soil. The resulting distribution of the tracer gas concentrations is used to deduce the diffusivity profile of the soil. For Finite Element Modeling of the gas sampling device/soil system the program COMSOL is used. We will present the results of a field campaign comparing the new in-situ method with lab measurements on soil cores. The new sampling pole has several interesting advantages: it can be used in-situ and over a long time; so it allows following modifications of diffusion coefficients in interaction with rain but also vegetation cycle and wind.

Wide-field fluorescence diffuse optical tomography with epi-illumination of sinusoidal pattern

NASA Astrophysics Data System (ADS)

Li, Tongxin; Gao, Feng; Chen, Weiting; Qi, Caixia; Yan, Panpan; Zhao, Huijuan

2017-02-01

We present a wide-field fluorescence tomography with epi-illumination of sinusoidal pattern. In this scheme, a DMD projector is employed as a spatial light modulator to generate independently wide-field sinusoidal illumination patterns at varying spatial frequencies on a sample, and then the emitted photons at the sample surface were captured with a EM-CCD camera. This method results in a significantly reduced number of the optical field measurements as compared to the point-source-scanning ones and thereby achieves a fast data acquisition that is desired for a dynamic imaging application. Fluorescence yield images are reconstructed using the normalized-Born formulated inversion of the diffusion model. Experimental reconstructions are presented on a phantom embedding the fluorescent targets and compared for a combination of the multiply frequencies. The results validate the ability of the method to determine the target relative depth and quantification with an increasing accuracy.

Comparison of DNA preservation methods for environmental bacterial community samples.

PubMed

Gray, Michael A; Pratte, Zoe A; Kellogg, Christina A

2013-02-01

Field collections of environmental samples, for example corals, for molecular microbial analyses present distinct challenges. The lack of laboratory facilities in remote locations is common, and preservation of microbial community DNA for later study is critical. A particular challenge is keeping samples frozen in transit. Five nucleic acid preservation methods that do not require cold storage were compared for effectiveness over time and ease of use. Mixed microbial communities of known composition were created and preserved by DNAgard(™), RNAlater(®), DMSO-EDTA-salt (DESS), FTA(®) cards, and FTA Elute(®) cards. Automated ribosomal intergenic spacer analysis and clone libraries were used to detect specific changes in the faux communities over weeks and months of storage. A previously known bias in FTA(®) cards that results in lower recovery of pure cultures of Gram-positive bacteria was also detected in mixed community samples. There appears to be a uniform bias across all five preservation methods against microorganisms with high G + C DNA. Overall, the liquid-based preservatives (DNAgard(™), RNAlater(®), and DESS) outperformed the card-based methods. No single liquid method clearly outperformed the others, leaving method choice to be based on experimental design, field facilities, shipping constraints, and allowable cost. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

The PneuCarriage Project: A Multi-Centre Comparative Study to Identify the Best Serotyping Methods for Examining Pneumococcal Carriage in Vaccine Evaluation Studies

PubMed Central

Satzke, Catherine; Dunne, Eileen M.; Porter, Barbara D.; Klugman, Keith P.; Mulholland, E. Kim

2015-01-01

Background The pneumococcus is a diverse pathogen whose primary niche is the nasopharynx. Over 90 different serotypes exist, and nasopharyngeal carriage of multiple serotypes is common. Understanding pneumococcal carriage is essential for evaluating the impact of pneumococcal vaccines. Traditional serotyping methods are cumbersome and insufficient for detecting multiple serotype carriage, and there are few data comparing the new methods that have been developed over the past decade. We established the PneuCarriage project, a large, international multi-centre study dedicated to the identification of the best pneumococcal serotyping methods for carriage studies. Methods and Findings Reference sample sets were distributed to 15 research groups for blinded testing. Twenty pneumococcal serotyping methods were used to test 81 laboratory-prepared (spiked) samples. The five top-performing methods were used to test 260 nasopharyngeal (field) samples collected from children in six high-burden countries. Sensitivity and positive predictive value (PPV) were determined for the test methods and the reference method (traditional serotyping of >100 colonies from each sample). For the alternate serotyping methods, the overall sensitivity ranged from 1% to 99% (reference method 98%), and PPV from 8% to 100% (reference method 100%), when testing the spiked samples. Fifteen methods had ≥70% sensitivity to detect the dominant (major) serotype, whilst only eight methods had ≥70% sensitivity to detect minor serotypes. For the field samples, the overall sensitivity ranged from 74.2% to 95.8% (reference method 93.8%), and PPV from 82.2% to 96.4% (reference method 99.6%). The microarray had the highest sensitivity (95.8%) and high PPV (93.7%). The major limitation of this study is that not all of the available alternative serotyping methods were included. Conclusions Most methods were able to detect the dominant serotype in a sample, but many performed poorly in detecting the minor serotype populations. Microarray with a culture amplification step was the top-performing method. Results from this comprehensive evaluation will inform future vaccine evaluation and impact studies, particularly in low-income settings, where pneumococcal disease burden remains high. PMID:26575033

Surface Sampling Collection and Culture Methods for Escherichia coli in Household Environments with High Fecal Contamination

PubMed Central

Kosek, Margaret N.; Schwab, Kellogg J.

2017-01-01

Empiric quantification of environmental fecal contamination is an important step toward understanding the impact that water, sanitation, and hygiene interventions have on reducing enteric infections. There is a need to standardize the methods used for surface sampling in field studies that examine fecal contamination in low-income settings. The dry cloth method presented in this manuscript improves upon the more commonly used swabbing technique that has been shown in the literature to have a low sampling efficiency. The recovery efficiency of a dry electrostatic cloth sampling method was evaluated using Escherichia coli and then applied to household surfaces in Iquitos, Peru, where there is high fecal contamination and enteric infection. Side-by-side measurements were taken from various floor locations within a household at the same time over a three-month period to compare for consistency of quantification of E. coli bacteria. The dry cloth sampling method in the laboratory setting showed 105% (95% Confidence Interval: 98%, 113%) E. coli recovery efficiency off of the cloths. The field application demonstrated strong agreement of side-by-side results (Pearson correlation coefficient for dirt surfaces was 0.83 (p < 0.0001) and 0.91 (p < 0.0001) for cement surfaces) and moderate agreement for results between entrance and kitchen samples (Pearson (0.53, p < 0.0001) and weighted Kappa statistic (0.54, p < 0.0001)). Our findings suggest that this method can be utilized in households with high bacterial loads using either continuous (quantitative) or categorical (semi-quantitative) data. The standardization of this low-cost, dry electrostatic cloth sampling method can be used to measure differences between households in intervention and non-intervention arms of randomized trials. PMID:28829392

Surface Sampling Collection and Culture Methods for Escherichia coli in Household Environments with High Fecal Contamination.

PubMed

Exum, Natalie G; Kosek, Margaret N; Davis, Meghan F; Schwab, Kellogg J

2017-08-22

Empiric quantification of environmental fecal contamination is an important step toward understanding the impact that water, sanitation, and hygiene interventions have on reducing enteric infections. There is a need to standardize the methods used for surface sampling in field studies that examine fecal contamination in low-income settings. The dry cloth method presented in this manuscript improves upon the more commonly used swabbing technique that has been shown in the literature to have a low sampling efficiency. The recovery efficiency of a dry electrostatic cloth sampling method was evaluated using Escherichia coli and then applied to household surfaces in Iquitos, Peru, where there is high fecal contamination and enteric infection. Side-by-side measurements were taken from various floor locations within a household at the same time over a three-month period to compare for consistency of quantification of E. coli bacteria. The dry cloth sampling method in the laboratory setting showed 105% (95% Confidence Interval: 98%, 113%) E. coli recovery efficiency off of the cloths. The field application demonstrated strong agreement of side-by-side results (Pearson correlation coefficient for dirt surfaces was 0.83 ( p < 0.0001) and 0.91 ( p < 0.0001) for cement surfaces) and moderate agreement for results between entrance and kitchen samples (Pearson (0.53, p < 0.0001) and weighted Kappa statistic (0.54, p < 0.0001)). Our findings suggest that this method can be utilized in households with high bacterial loads using either continuous (quantitative) or categorical (semi-quantitative) data. The standardization of this low-cost, dry electrostatic cloth sampling method can be used to measure differences between households in intervention and non-intervention arms of randomized trials.

RANKED SET SAMPLING FOR ECOLOGICAL RESEARCH: ACCOUNTING FOR THE TOTAL COSTS OF SAMPLING

EPA Science Inventory

Researchers aim to design environmental studies that optimize precision and allow for generalization of results, while keeping the costs of associated field and laboratory work at a reasonable level. Ranked set sampling is one method to potentially increase precision and reduce ...

Singular values behaviour optimization in the diagnosis of feed misalignments in radioastronomical reflectors

NASA Astrophysics Data System (ADS)

Capozzoli, Amedeo; Curcio, Claudio; Liseno, Angelo; Savarese, Salvatore; Schipani, Pietro

2016-07-01

The communication presents an innovative method for the diagnosis of reflector antennas in radio astronomical applications. The approach is based on the optimization of the number and the distribution of the far field sampling points exploited to retrieve the antenna status in terms of feed misalignments, this to drastically reduce the time length of the measurement process and minimize the effects of variable environmental conditions and simplifying the tracking process of the source. The feed misplacement is modeled in terms of an aberration function of the aperture field. The relationship between the unknowns and the far field pattern samples is linearized thanks to a Principal Component Analysis. The number and the position of the field samples are then determined by optimizing the Singular Values behaviour of the relevant operator.

Variability of pesticide residues in eggplant units collected from a field trial and marketplaces in Greece.

PubMed

Prodhan, Mohammad Dalower Hossain; Papadakis, Emmanouil-Nikolaos; Papadopoulou-Mourkidou, Euphemia

2018-04-01

Variability of pesticide residues among food items is very important when assessing the risks and food safety for the consumers. Therefore, the present study was undertaken to estimate the unit-to-unit residue variability factors for eggplant. In total, 120 samples from a trial field and 142 samples from different marketplaces in Thessaloniki, Greece, were collected to estimate the variability of pesticide residues in eggplant units. They were extracted by the QuEChERS method and the residues were determined by LC-MS/MS. For the field samples, the unit-to-unit variability factors (VFs) obtained for cypermethrin and deltamethrin residues were 2.54 and 2.51, respectively. The mean residue levels of both pesticides were higher in the composite samples than in the individual samples. The average VFs for the marketplace samples was 3.89. The eggplant units exposed to pesticides were higher in residues than the non-exposed units. The variability factors obtained in the marketplace samples were higher than those in the samples collected from the field trial. A default VF value of 3 for field trials is appropriate for use when assessing the acute dietary intake but a VF for the marketplace samples should be reconsidered with a larger data. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

A fast field-cycling device for high-resolution NMR: Design and application to spin relaxation and hyperpolarization experiments

NASA Astrophysics Data System (ADS)

Kiryutin, Alexey S.; Pravdivtsev, Andrey N.; Ivanov, Konstantin L.; Grishin, Yuri A.; Vieth, Hans-Martin; Yurkovskaya, Alexandra V.

2016-02-01

A device for performing fast magnetic field-cycling NMR experiments is described. A key feature of this setup is that it combines fast switching of the external magnetic field and high-resolution NMR detection. The field-cycling method is based on precise mechanical positioning of the NMR probe with the mounted sample in the inhomogeneous fringe field of the spectrometer magnet. The device enables field variation over several decades (from 100 μT up to 7 T) within less than 0.3 s; progress in NMR probe design provides NMR linewidths of about 10-3 ppm. The experimental method is very versatile and enables site-specific studies of spin relaxation (NMRD, LLSs) and spin hyperpolarization (DNP, CIDNP, and SABRE) at variable magnetic field and at variable temperature. Experimental examples of such studies are demonstrated; advantages of the experimental method are described and existing challenges in the field are outlined.

The PneuCarriage Project: A Multi-Centre Comparative Study to Identify the Best Serotyping Methods for Examining Pneumococcal Carriage in Vaccine Evaluation Studies.

PubMed

Satzke, Catherine; Dunne, Eileen M; Porter, Barbara D; Klugman, Keith P; Mulholland, E Kim

2015-11-01

The pneumococcus is a diverse pathogen whose primary niche is the nasopharynx. Over 90 different serotypes exist, and nasopharyngeal carriage of multiple serotypes is common. Understanding pneumococcal carriage is essential for evaluating the impact of pneumococcal vaccines. Traditional serotyping methods are cumbersome and insufficient for detecting multiple serotype carriage, and there are few data comparing the new methods that have been developed over the past decade. We established the PneuCarriage project, a large, international multi-centre study dedicated to the identification of the best pneumococcal serotyping methods for carriage studies. Reference sample sets were distributed to 15 research groups for blinded testing. Twenty pneumococcal serotyping methods were used to test 81 laboratory-prepared (spiked) samples. The five top-performing methods were used to test 260 nasopharyngeal (field) samples collected from children in six high-burden countries. Sensitivity and positive predictive value (PPV) were determined for the test methods and the reference method (traditional serotyping of >100 colonies from each sample). For the alternate serotyping methods, the overall sensitivity ranged from 1% to 99% (reference method 98%), and PPV from 8% to 100% (reference method 100%), when testing the spiked samples. Fifteen methods had ≥70% sensitivity to detect the dominant (major) serotype, whilst only eight methods had ≥70% sensitivity to detect minor serotypes. For the field samples, the overall sensitivity ranged from 74.2% to 95.8% (reference method 93.8%), and PPV from 82.2% to 96.4% (reference method 99.6%). The microarray had the highest sensitivity (95.8%) and high PPV (93.7%). The major limitation of this study is that not all of the available alternative serotyping methods were included. Most methods were able to detect the dominant serotype in a sample, but many performed poorly in detecting the minor serotype populations. Microarray with a culture amplification step was the top-performing method. Results from this comprehensive evaluation will inform future vaccine evaluation and impact studies, particularly in low-income settings, where pneumococcal disease burden remains high.

Analysis of the herbicide diuron, three diuron degradates, and six neonicotinoid insecticides in water-Method details and application to two Georgia streams

USGS Publications Warehouse

Hladik, Michelle; Calhoun, Daniel L.

2012-01-01

A method for the determination of the widely used herbicide diuron, three degradates of diuron, and six neonicotinoid insecticides in environmental water samples is described. Filtered water samples were extracted by using solid-phase extraction (SPE) with no additional cleanup steps. Quantification of the pesticides from the extracted water samples was done by using liquid chromatography with tandem mass spectrometry (LC/MS/MS). Recoveries in test water samples fortified at 20 nanograms per liter (ng/L) for each compound ranged from 75 to 97 percent; relative standard deviations ranged from 5 to 10 percent. Method detection limits (MDLs) in water ranged from 3.0 to 6.2 ng/L using LC/MS/MS. The method was applied to water samples from two streams in Georgia, Sope Creek and the Chattahoochee River. Diuron and 3,4-dichloroaniline (3,4-DCA) were detected in 100 and 80 percent, respectively, of the samples from the Chattahoochee River, whereas Sope creek had detection frequencies of 15 percent for diuron and 31 percent for 3,4-DCA. Detection frequencies for the neonicotinoid insecticide, imidacloprid, were 60 percent for the Chattahoochee River and 85 percent for Sope Creek. Field matrix-spike recoveries for each compound, when averaged over four water samples, ranged from 79 to 100 percent. The average percentage difference between replicate pairs for all compounds detected in the field samples was 10.1 (± 4.5) percent.

Hybrid Optimal Design of the Eco-Hydrological Wireless Sensor Network in the Middle Reach of the Heihe River Basin, China

PubMed Central

Kang, Jian; Li, Xin; Jin, Rui; Ge, Yong; Wang, Jinfeng; Wang, Jianghao

2014-01-01

The eco-hydrological wireless sensor network (EHWSN) in the middle reaches of the Heihe River Basin in China is designed to capture the spatial and temporal variability and to estimate the ground truth for validating the remote sensing productions. However, there is no available prior information about a target variable. To meet both requirements, a hybrid model-based sampling method without any spatial autocorrelation assumptions is developed to optimize the distribution of EHWSN nodes based on geostatistics. This hybrid model incorporates two sub-criteria: one for the variogram modeling to represent the variability, another for improving the spatial prediction to evaluate remote sensing productions. The reasonability of the optimized EHWSN is validated from representativeness, the variogram modeling and the spatial accuracy through using 15 types of simulation fields generated with the unconditional geostatistical stochastic simulation. The sampling design shows good representativeness; variograms estimated by samples have less than 3% mean error relative to true variograms. Then, fields at multiple scales are predicted. As the scale increases, estimated fields have higher similarities to simulation fields at block sizes exceeding 240 m. The validations prove that this hybrid sampling method is effective for both objectives when we do not know the characteristics of an optimized variables. PMID:25317762

Hybrid optimal design of the eco-hydrological wireless sensor network in the middle reach of the Heihe River Basin, China.

PubMed

Kang, Jian; Li, Xin; Jin, Rui; Ge, Yong; Wang, Jinfeng; Wang, Jianghao

2014-10-14

The eco-hydrological wireless sensor network (EHWSN) in the middle reaches of the Heihe River Basin in China is designed to capture the spatial and temporal variability and to estimate the ground truth for validating the remote sensing productions. However, there is no available prior information about a target variable. To meet both requirements, a hybrid model-based sampling method without any spatial autocorrelation assumptions is developed to optimize the distribution of EHWSN nodes based on geostatistics. This hybrid model incorporates two sub-criteria: one for the variogram modeling to represent the variability, another for improving the spatial prediction to evaluate remote sensing productions. The reasonability of the optimized EHWSN is validated from representativeness, the variogram modeling and the spatial accuracy through using 15 types of simulation fields generated with the unconditional geostatistical stochastic simulation. The sampling design shows good representativeness; variograms estimated by samples have less than 3% mean error relative to true variograms. Then, fields at multiple scales are predicted. As the scale increases, estimated fields have higher similarities to simulation fields at block sizes exceeding 240 m. The validations prove that this hybrid sampling method is effective for both objectives when we do not know the characteristics of an optimized variables.

Development of improved space sampling strategies for ocean chemical properties: Total carbon dioxide and dissolved nitrate

NASA Technical Reports Server (NTRS)

Goyet, Catherine; Davis, Daniel; Peltzer, Edward T.; Brewer, Peter G.

1995-01-01

Large-scale ocean observing programs such as the Joint Global Ocean Flux Study (JGOFS) and the World Ocean Circulation Experiment (WOCE) today, must face the problem of designing an adequate sampling strategy. For ocean chemical variables, the goals and observing technologies are quite different from ocean physical variables (temperature, salinity, pressure). We have recently acquired data on the ocean CO2 properties on WOCE cruises P16c and P17c that are sufficiently dense to test for sampling redundancy. We use linear and quadratic interpolation methods on the sampled field to investigate what is the minimum number of samples required to define the deep ocean total inorganic carbon (TCO2) field within the limits of experimental accuracy (+/- 4 micromol/kg). Within the limits of current measurements, these lines were oversampled in the deep ocean. Should the precision of the measurement be improved, then a denser sampling pattern may be desirable in the future. This approach rationalizes the efficient use of resources for field work and for estimating gridded (TCO2) fields needed to constrain geochemical models.

Sodium and potassium content of 24 h urinary collections: a comparison between field- and laboratory-based analysers.

PubMed

Yin, Xuejun; Neal, Bruce; Tian, Maoyi; Li, Zhifang; Petersen, Kristina; Komatsu, Yuichiro; Feng, Xiangxian; Wu, Yangfeng

2018-04-01

Measurement of mean population Na and K intakes typically uses laboratory-based assays, which can add significant logistical burden and costs. A valid field-based measurement method would be a significant advance. In the current study, we used 24 h urine samples to compare estimates of Na, K and Na:K ratio based upon assays done using the field-based Horiba twin meter v. laboratory-based methods. The performance of the Horiba twin meter was determined by comparing field-based estimates of mean Na and K against those obtained using laboratory-based methods. The reported 95 % limits of agreement of Bland-Altman plots were calculated based on a regression approach for non-uniform differences. The 24 h urine samples were collected as part of an ongoing study being done in rural China. One hundred and sixty-six complete 24 h urine samples were qualified for estimating 24 h urinary Na and K excretion. Mean Na and K excretion were estimated as 170·4 and 37·4 mmol/d, respectively, using the meter-based assays; and 193·4 and 43·8 mmol/d, respectively, using the laboratory-based assays. There was excellent relative reliability (intraclass correlation coefficient) for both Na (0·986) and K (0·986). Bland-Altman plots showed moderate-to-good agreement between the two methods. Na and K intake estimations were moderately underestimated using assays based upon the Horiba twin meter. Compared with standard laboratory-based methods, the portable device was more practical and convenient.

Calculating binding free energies of host-guest systems using the AMOEBA polarizable force field.

PubMed

Bell, David R; Qi, Rui; Jing, Zhifeng; Xiang, Jin Yu; Mejias, Christopher; Schnieders, Michael J; Ponder, Jay W; Ren, Pengyu

2016-11-09

Molecular recognition is of paramount interest in many applications. Here we investigate a series of host-guest systems previously used in the SAMPL4 blind challenge by using molecular simulations and the AMOEBA polarizable force field. The free energy results computed by Bennett's acceptance ratio (BAR) method using the AMOEBA polarizable force field ranked favorably among the entries submitted to the SAMPL4 host-guest competition [Muddana, et al., J. Comput.-Aided Mol. Des., 2014, 28, 305-317]. In this work we conduct an in-depth analysis of the AMOEBA force field host-guest binding thermodynamics by using both BAR and the orthogonal space random walk (OSRW) methods. The binding entropy-enthalpy contributions are analyzed for each host-guest system. For systems of inordinate binding entropy-enthalpy values, we further examine the hydrogen bonding patterns and configurational entropy contribution. The binding mechanism of this series of host-guest systems varies from ligand to ligand, driven by enthalpy and/or entropy changes. Convergence of BAR and OSRW binding free energy methods is discussed. Ultimately, this work illustrates the value of molecular modelling and advanced force fields for the exploration and interpretation of binding thermodynamics.

Apparatus and method for radioactive waste screening

DOEpatents

Akers, Douglas W.; Roybal, Lyle G.; Salomon, Hopi; Williams, Charles Leroy

2012-09-04

An apparatus and method relating to screening radioactive waste are disclosed for ensuring that at least one calculated parameter for the measurement data of a sample falls within a range between an upper limit and a lower limit prior to the sample being packaged for disposal. The apparatus includes a radiation detector configured for detecting radioactivity and radionuclide content of the of the sample of radioactive waste and generating measurement data in response thereto, and a collimator including at least one aperture to direct a field of view of the radiation detector. The method includes measuring a radioactive content of a sample, and calculating one or more parameters from the radioactive content of the sample.

Repeatability and validity of a field kit for estimation of cholinesterase in whole blood.

PubMed Central

London, L; Thompson, M L; Sacks, S; Fuller, B; Bachmann, O M; Myers, J E

1995-01-01

OBJECTIVES--To evaluate a spectrophotometric field kit (Test-Mate-OP) for repeatability and validity in comparison with reference laboratory methods and to model its anticipated sensitivity and specificity based on these findings. METHODS--76 farm workers between the age of 20 and 55, of whom 30 were pesticide applicators exposed to a range of organophosphates in the preceding 10 days, had blood taken for plasma cholinesterase (PCE) and erythrocyte cholinesterase (ECE) measurement by field kit or laboratory methods. Paired blinded duplicate samples were taken from subgroups in the sample to assess repeatability of laboratory and field kit methods. Field kits were also used to test venous blood in one subgroup. The variance obtained for the field kit tests was then applied to two hypothetical scenarios that used published action guidelines to model the kit's sensitivity and specificity. RESULTS--Repeatability for PCE was much poorer and for ECE slightly poorer than that of laboratory measures. A substantial upward bias for field kit ECE relative to laboratory measurements was found. Sensitivity of the kit to a 40% drop in PCE was 67%, whereas that for ECE was 89%. Specificity of the kit with no change in mean of the population was 100% for ECE and 91% for PCE. CONCLUSION--Field kit ECE estimation seems to be sufficiently repeatable for surveillance activities, whereas PCE does not. Repeatability of both tests seems to be too low for use in epidemiological dose-response investigations. Further research is indicated to characterise the upward bias in ECE estimation on the kit. PMID:7697143

Detecting and enumerating soil-transmitted helminth eggs in soil: New method development and results from field testing in Kenya and Bangladesh.

PubMed

Steinbaum, Lauren; Kwong, Laura H; Ercumen, Ayse; Negash, Makeda S; Lovely, Amira J; Njenga, Sammy M; Boehm, Alexandria B; Pickering, Amy J; Nelson, Kara L

2017-04-01

Globally, about 1.5 billion people are infected with at least one species of soil-transmitted helminth (STH). Soil is a critical environmental reservoir of STH, yet there is no standard method for detecting STH eggs in soil. We developed a field method for enumerating STH eggs in soil and tested the method in Bangladesh and Kenya. The US Environmental Protection Agency (EPA) method for enumerating Ascaris eggs in biosolids was modified through a series of recovery efficiency experiments; we seeded soil samples with a known number of Ascaris suum eggs and assessed the effect of protocol modifications on egg recovery. We found the use of 1% 7X as a surfactant compared to 0.1% Tween 80 significantly improved recovery efficiency (two-sided t-test, t = 5.03, p = 0.007) while other protocol modifications-including different agitation and flotation methods-did not have a significant impact. Soil texture affected the egg recovery efficiency; sandy samples resulted in higher recovery compared to loamy samples processed using the same method (two-sided t-test, t = 2.56, p = 0.083). We documented a recovery efficiency of 73% for the final improved method using loamy soil in the lab. To field test the improved method, we processed soil samples from 100 households in Bangladesh and 100 households in Kenya from June to November 2015. The prevalence of any STH (Ascaris, Trichuris or hookworm) egg in soil was 78% in Bangladesh and 37% in Kenya. The median concentration of STH eggs in soil in positive samples was 0.59 eggs/g dry soil in Bangladesh and 0.15 eggs/g dry soil in Kenya. The prevalence of STH eggs in soil was significantly higher in Bangladesh than Kenya (chi-square, χ2 = 34.39, p < 0.001) as was the concentration (Mann-Whitney, z = 7.10, p < 0.001). This new method allows for detecting STH eggs in soil in low-resource settings and could be used for standardizing soil STH detection globally.

System and method for non-destructive evaluation of surface characteristics of a magnetic material

DOEpatents

Jiles, David C.; Sipahi, Levent B.

1994-05-17

A system and a related method for non-destructive evaluation of the surface characteristics of a magnetic material. The sample is excited by an alternating magnetic field. The field frequency, amplitude and offset are controlled according to a predetermined protocol. The Barkhausen response of the sample is detected for the various fields and offsets and is analyzed. The system produces information relating to the frequency content, the amplitude content, the average or RMS energy content, as well as count rate information, for each of the Barkhausen responses at each of the excitation levels applied during the protocol. That information provides a contiguous body of data, heretofore unavailable, which can be analyzed to deduce information about the surface characteristics of the material at various depths below the surface.

Comparability between various field and laboratory wood-stove emission-measurement methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCrillis, R.C.; Jaasma, D.R.

1991-01-01

The paper compares various field and laboratory woodstove emission measurement methods. In 1988, the U.S. EPA promulgated performance standards for residential wood heaters (woodstoves). Over the past several years, a number of field studies have been undertaken to determine the actual level of emission reduction achieved by new technology woodstoves in everyday use. The studies have required the development and use of particulate and gaseous emission sampling equipment compatible with operation in private homes. Since woodstoves are tested for certification in the laboratory using EPA Methods 5G and 5H, it is of interest to determine the correlation between these regulatorymore » methods and the inhouse equipment. Two inhouse sampling systems have been used most widely: one is an intermittent, pump-driven particulate sampler that collects particulate and condensible organics on a filter and organic adsorbent resin; and the other uses an evacuated cylinder as the motive force and particulate and condensible organics are collected in a condenser and dual filter. Both samplers can operate unattended for 1-week periods. A large number of tests have been run comparing Methods 5G and 5H to both samplers. The paper presents these comparison data and determines the relationships between regulations and field samplers.« less

Electric shielding films for biased TEM samples and their application to in situ electron holography.

PubMed

Nomura, Yuki; Yamamoto, Kazuo; Hirayama, Tsukasa; Saitoh, Koh

2018-06-01

We developed a novel sample preparation method for transmission electron microscopy (TEM) to suppress superfluous electric fields leaked from biased TEM samples. In this method, a thin TEM sample is first coated with an insulating amorphous aluminum oxide (AlOx) film with a thickness of about 20 nm. Then, the sample is coated with a conductive amorphous carbon film with a thickness of about 10 nm, and the film is grounded. This technique was applied to a model sample of a metal electrode/Li-ion-conductive-solid-electrolyte/metal electrode for biasing electron holography. We found that AlOx film with a thickness of 10 nm has a large withstand voltage of about 8 V and that double layers of AlOx and carbon act as a 'nano-shield' to suppress 99% of the electric fields outside of the sample. We also found an asymmetry potential distribution between high and low potential electrodes in biased solid-electrolyte, indicating different accumulation behaviors of lithium-ions (Li+) and lithium-ion vacancies (VLi-) in the biased solid-electrolyte.

Rapid wide-field Mueller matrix polarimetry imaging based on four photoelastic modulators with no moving parts.

PubMed

Alali, Sanaz; Gribble, Adam; Vitkin, I Alex

2016-03-01

A new polarimetry method is demonstrated to image the entire Mueller matrix of a turbid sample using four photoelastic modulators (PEMs) and a charge coupled device (CCD) camera, with no moving parts. Accurate wide-field imaging is enabled with a field-programmable gate array (FPGA) optical gating technique and an evolutionary algorithm (EA) that optimizes imaging times. This technique accurately and rapidly measured the Mueller matrices of air, polarization elements, and turbid phantoms. The system should prove advantageous for Mueller matrix analysis of turbid samples (e.g., biological tissues) over large fields of view, in less than a second.

Asymmetrical flow field-flow fractionation for human serum albumin based nanoparticle characterisation and a deeper insight into particle formation processes.

PubMed

John, C; Langer, K

2014-06-13

Nanoparticles used as drug delivery systems are of growing interest in the pharmaceutical field. Understanding the behaviour and effects of nanosystems in the human body is dependent on comprehensive characterisation of the systems especially with regard to size and size distribution. Asymmetrical flow field-flow fractionation (AF4) is a promising method for this challenge as this technique enables chromatographic separation of particles and solute molecules according to their respective size. Within this study AF4 was used for the characterisation of human serum albumin (HSA) based nanoparticles. In a first part, the most important aspects of method development like the choice of cross flow rate, focusing and the increase of sample concentration via outlet stream splitting on the sample separation were evaluated. Sample fractionation was controlled by inline-coupling of a dynamic light scattering detector (DLS, Zetasizer) and was confirmed by DLS batch mode measurements. In a second part the applicability of field-flow fractionation for characterisation of the HSA particle formation process by a desolvation method was evaluated. A time dependent particle formation was observed which was controlled by the amount of desolvating agent. Furthermore, field-flow fractionation in combination with in-line dynamic light scattering was used to monitor the increase of particle diameter during PEGylation of the resulting HSA nanoparticles. The separation of nanoparticles from dissolved polyethylene glycol (PEG) could successfully be used for determination of the particles' PEGylation degree. Copyright © 2014 Elsevier B.V. All rights reserved.

Vacuum lamination approach to fabrication of high-performance single-crystal organic field-effect transistors.

PubMed

Yi, H T; Chen, Y; Czelen, K; Podzorov, V

2011-12-22

A novel vacuum lamination approach to fabrication of high-performance single-crystal organic field-effect transistors has been developed. The non-destructive nature of this method allows a direct comparison of field-effect mobilities achieved with various gate dielectrics using the same single-crystal sample. The method also allows gating delicate systems, such as n -type crystals and SAM-coated surfaces, without perturbation. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

3D nanoscale imaging of the yeast, Schizosaccharomyces pombe, by full-field transmission X-ray microscopy at 5.4 keV.

PubMed

Chen, Jie; Yang, Yunhao; Zhang, Xiaobo; Andrews, Joy C; Pianetta, Piero; Guan, Yong; Liu, Gang; Xiong, Ying; Wu, Ziyu; Tian, Yangchao

2010-07-01

Three-dimensional (3D) nanoscale structures of the fission yeast, Schizosaccharomyces pombe, can be obtained by full-field transmission hard X-ray microscopy with 30 nm resolution using synchrotron radiation sources. Sample preparation is relatively simple and the samples are portable across various imaging environments, allowing for high-throughput sample screening. The yeast cells were fixed and double-stained with Reynold's lead citrate and uranyl acetate. We performed both absorption contrast and Zernike phase contrast imaging on these cells in order to test this method. The membranes, nucleus, and subcellular organelles of the cells were clearly visualized using absorption contrast mode. The X-ray images of the cells could be used to study the spatial distributions of the organelles in the cells. These results show unique structural information, demonstrating that hard X-ray microscopy is a complementary method for imaging and analyzing biological samples.

[Recent advances in sample preparation methods of plant hormones].

PubMed

Wu, Qian; Wang, Lus; Wu, Dapeng; Duan, Chunfeng; Guan, Yafeng

2014-04-01

Plant hormones are a group of naturally occurring trace substances which play a crucial role in controlling the plant development, growth and environment response. With the development of the chromatography and mass spectroscopy technique, chromatographic analytical method has become a widely used way for plant hormone analysis. Among the steps of chromatographic analysis, sample preparation is undoubtedly the most vital one. Thus, a highly selective and efficient sample preparation method is critical for accurate identification and quantification of phytohormones. For the three major kinds of plant hormones including acidic plant hormones & basic plant hormones, brassinosteroids and plant polypeptides, the sample preparation methods are reviewed in sequence especially the recently developed methods. The review includes novel methods, devices, extractive materials and derivative reagents for sample preparation of phytohormones analysis. Especially, some related works of our group are included. At last, the future developments in this field are also prospected.

MULTI-SITE PERFORMANCE EVALUATIONS OF CANDIDATE METHODOLOGIES FOR DETERMINING COARSE PARTICULATE MATTER (PMC) CONCENTRATIONS

EPA Science Inventory

Comprehensive field studies were conducted to evaluate the performance of sampling methods for measuring the coarse fraction of PM10 in ambient air. Five separate sampling approaches were evaluated at each of three sampling sites. As the primary basis of comparison, a discret...

MULTI-SITE EVALUATIONS OF CANDIDATE METHODOLOGIES FOR DETERMINING COARSE PARTICULATE MATTER (PMC) CONCENTRATIONS

EPA Science Inventory

Comprehensive field studies were conducted to evaluate the performance of sampling methods for measuring the coarse fraction of PM10 in ambient air. Five separate sampling approaches were evaluated at each of three sampling sites. As the primary basis of comparison, a discret...

MULTI-SITE EVALUATIONS OF CANDIDATE METHODOLOGIES FOR DETERMINING COARSE PARTICULATE MATTER (PMC) CONCENTRATIONS

EPA Science Inventory

Comprehensive field studies were conducted to evaluate the performance of sampling methods for measuring the coarse fraction of PM10 in ambient air. Five separate sampling approaches were evaluated at each of three sampling sites. As the primary basis of comparison, a discrete ...

Measurement of Nanoplasmonic Field Enhancement with Ultrafast Photoemission.

PubMed

Rácz, Péter; Pápa, Zsuzsanna; Márton, István; Budai, Judit; Wróbel, Piotr; Stefaniuk, Tomasz; Prietl, Christine; Krenn, Joachim R; Dombi, Péter

2017-02-08

Probing nanooptical near-fields is a major challenge in plasmonics. Here, we demonstrate an experimental method utilizing ultrafast photoemission from plasmonic nanostructures that is capable of probing the maximum nanoplasmonic field enhancement in any metallic surface environment. Directly measured field enhancement values for various samples are in good agreement with detailed finite-difference time-domain simulations. These results establish ultrafast plasmonic photoelectrons as versatile probes for nanoplasmonic near-fields.

Subaperture correlation based digital adaptive optics for full field optical coherence tomography.

PubMed

Kumar, Abhishek; Drexler, Wolfgang; Leitgeb, Rainer A

2013-05-06

This paper proposes a sub-aperture correlation based numerical phase correction method for interferometric full field imaging systems provided the complex object field information can be extracted. This method corrects for the wavefront aberration at the pupil/ Fourier transform plane without the need of any adaptive optics, spatial light modulators (SLM) and additional cameras. We show that this method does not require the knowledge of any system parameters. In the simulation study, we consider a full field swept source OCT (FF SSOCT) system to show the working principle of the algorithm. Experimental results are presented for a technical and biological sample to demonstrate the proof of the principle.

Scattering-type scanning near-field optical microscopy with low-repetition-rate pulsed light source through phase-domain sampling

PubMed Central

Wang, Haomin; Wang, Le; Xu, Xiaoji G.

2016-01-01

Scattering-type scanning near-field optical microscopy (s-SNOM) allows spectroscopic imaging with spatial resolution below the diffraction limit. With suitable light sources, s-SNOM is instrumental in numerous discoveries at the nanoscale. So far, the light sources have been limited to continuous wave or high-repetition-rate pulsed lasers. Low-repetition-rate pulsed sources cannot be used, due to the limitation of the lock-in detection mechanism that is required for current s-SNOM techniques. Here, we report a near-field signal extraction method that enables low-repetition-rate pulsed light sources. The method correlates scattering signals from pulses with the mechanical phases of the oscillating s-SNOM probe to obtain near-field signal, by-passing the apparent restriction imposed by the Nyquist–Shannon sampling theorem on the repetition rate. The method shall enable s-SNOM with low-repetition-rate pulses with high-peak-powers, such as femtosecond laser amplifiers, to facilitate investigations of strong light–matter interactions and nonlinear processes at the nanoscale. PMID:27748360

Applicability of ELISA-based Determination of Pesticides for Groundwater Quality Monitoring

NASA Astrophysics Data System (ADS)

Tsuchihara, Takeo; Yoshimoto, Shuhei; Ishida, Satoshi; Imaizumi, Masayuki

The principals and procedures of ELISA (Enzyme-linked Immunosorbent Assay)-based determination of pesticides (Fenitrothion) in environmental samples were reviewed, and the applicability of the ELISA method for groundwater quality monitoring were validated through the experimental tracer tests in soil columns and the field test in Okinoerabu Island. The test results showed that the ELISA method could be useful not only for screening but also for quantitative analysis of pesticides. In the experimental tracer tests in soil columns, the retardation of pesticides leaching compared with conservative tracers were observed. In the field test, the contamination of the pesticide was detected in groundwater samples in Okinoerabu Island, even though the targeted pesticide was considered to be applied to the upland field 4 months ago. In order to investigate the transport and fate of pesticides in groundwater taking into account retardation from the field to groundwater table and the residue in groundwater, continuous observations of pesticides in groundwater are in a strong need, and the ELISA method is applicable to the long-term quality groundwater monitoring.

Development of a molecular method for testing the effectiveness of UV systems on-site.

PubMed

Nizri, Limor; Vaizel-Ohayon, Dalit; Ben-Amram, Hila; Sharaby, Yehonatan; Halpern, Malka; Mamane, Hadas

2017-12-15

We established a molecular method for quantifying ultraviolet (UV) disinfection efficacy using total bacterial DNA in a water sample. To evaluate UV damage to the DNA, we developed the "DNA damage" factor, which is a novel cultivation-independent approach that reveals UV-exposure efficiency by applying a simple PCR amplification method. The study's goal was to prove the feasibility of this method for demonstrating the efficiency of UV systems in the field using flow-through UV reactors. In laboratory-based experiments using seeded bacteria, the DNA damage tests demonstrated a good correlation between PCR products and UV dose. In the field, natural groundwater sampled before and after being subjected to the full-scale UV reactors was filtered, and the DNA extracted from the filtrate was subjected to PCR amplification for a 900-bp fragment of the 16S rRNA gene with initial DNA concentrations of 0.1 and 1 ng/μL. In both cases, the UV dose predicted and explained a significant proportion of the variance in the log inactivation ratio and DNA damage factor. Log inactivation ratio was very low, as expected in groundwater due to low initial bacterial counts, whereas the DNA damage factor was within the range of values obtained in the laboratory-based experiments. Consequently, the DNA damage factor reflected the true performance of the full-scale UV system during operational water flow by using the indigenous bacterial array present in a water sample. By applying this method, we were able to predict with high confidence, the UV reactor inactivation potential. For method validation, laboratory and field iterations are required to create a practical field calibration curve that can be used to determine the expected efficiency of the full-scale UV system in the field under actual operation. Copyright © 2017 Elsevier Ltd. All rights reserved.

Comparison of marine sampling methods for organic contaminants: Passive samplers, water extractions, and live oyster deployment.

PubMed

Raub, Kristin B; Vlahos, Penny; Whitney, Michael

2015-08-01

Laboratory and field trials evaluated the efficacy of three methods of detecting aquatic pesticide concentrations. Currently used pesticides: atrazine, metolachlor, and diazinon and legacy pesticide dieldrin were targeted. Pesticides were extracted using solid-phase extraction (SPE) of water samples, titanium plate passive samplers coated in ethylene vinyl acetate (EVA) and eastern oysters (Crassostrea viginica) as biosamplers. A laboratory study assessed the extraction efficiencies and precision of each method. Passive samplers yielded the highest precision of the three methods (RSD: 3-14% EVA plates; 19-60% oysters; and 25-56% water samples). Equilibrium partition coefficients were derived. A significant relationship was found between the concentration in oyster tissue and the ambient aquatic concentration. In the field (Housatonic River, CT (U.S.)) water sampling (n = 5) detected atrazine at 1.61-7.31 μg L(-1), oyster sampling (n = 2×15) detected dieldrin at n.d.-0.096 μg L(-1) SW and the passive samplers (n = 5×3) detected atrazine at 0.97-3.78 μg L(-1) SW and dieldrin at n.d.-0.68 μg L(-1) SW. Copyright © 2015 Elsevier Ltd. All rights reserved.

Testing paleointensity determinations on recent lava flows and scorias from Miyakejima, Japan

NASA Astrophysics Data System (ADS)

Fukuma, K.

2013-12-01

Still no consensus has been reached on paleointensity method. Even the classical Thellier method has not been fully tested on recent lava flows with known geomagnetic field intensity based on a systematic sampling scheme. In this study, Thellier method was applied for 1983, 1962 and 1940 basaltic lava flows and scorias from Miyakejima, Japan. Several vertical lava sections and quenched scorias, which are quite variable in magnetic mineralogy and grain size, provide an unparalleled opportunity to test paleointensity methods. Thellier experiments were conducted on a completely automated three-component spinner magnetometer with thermal demagnetizer 'tspin'. Specimens were heated in air, applied laboratory field was 45 microT, and pTRM checks were performed at every two heating steps. Curie points and hysteresis properties were obtained on small fragments removed from cylindrical specimens. For lava flows sigmoidal curves were commonly observed on the Arai diagrams. Especially the interior part of lava flows always revealed sigmoidal patterns and sometimes resulted in erroneously blurred behaviors. The directions after zero-field heating were not necessarily stable in the course of the Thellier experiments. It was very difficult, for the interior part, to ascertain linear segments on Arai diagrams corresponding to the geomagnetic field intensity at the eruption. Upper and lower clinker samples also generally revealed sigmoidal or upward concave curves on Arai diagrams. Neither lower nor higher temperature portions of the sigmoids or concaves gave the expected geomagnetic field intensities. However, there were two exceptional cases of lava flows giving correct field intensities: upper clinkers with relatively low unblocking temperatures (< 400 deg.C) and lower clinkers with broad unblocking temperature ranges from room temperature to 600 deg.C. A most promising target for paleointensity experiments within the volcanic rocks is scoria. Scoria samples always carry single Curie temperatures higher than 500 deg.C, and the ratios of saturation remanence to saturation magnetization (Mr/Ms) of about 0.5 are indicative of truly single-domain low-titanium titanomagnetite. Unambiguous straight lines were always observed on Arai diagrams covering broad temperature ranges like the lower clinker samples, and the gradients gave the expected field values within a few percent errors. Thellier experiments applied for the recent lava flows did not successfully recover the expected field intensity from most samples. No linear segment was recognized or incorrect paleointensity values were obtained from short segments with limited temperature ranges. In Thellier or other types of paleointensity experiments laboratory alteration is checked in details, but if a sample once passed the alteration check, the TRM/NRM ratios of any limited temperature or field ranges were accepted as reflecting paleointensity. Previously published paleointensity data from lava flows should include much of such dubious data. Generally lava flows are not suitable for paleointensity determinations in light of its large grain-size and mixed magnetic mineralogy, except for scoria and clinker.

Precipitation chemistry affected by differences in location of collection sites and storage methods

NASA Astrophysics Data System (ADS)

Mahendrappa, M. K.

An investigation was carried out to evaluate rigorously the possible differences in measured concentrations of hydrogen, nitrate and sulfate ions in 'bulk' precipitation samples that may be caused by variations in location of rain collectors, and duration and temperature of storage. Storage of precipitation samples, up to 1 month, both in the coldroom and in the field resulted in a significant reduction in the concentration of hydrogen ions. Only field storage caused a statistically significant reduction in the concentration of nitrate in the precipitation samples. Levels of sulfate ions were not found to be significantly affected by storage either in the field or in coldrooms. Samples collected from a rain gage located on a building roof were more acidic than those collected in open spaces in forests. Though all samples showed similar seasonal patterns in the concentrations of sulfate and nitrate, the individual values consistently differed from each other.

Methods for determination of low-molecular weight carbonyl compounds in the ambient atmosphere

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vairavamurthy, A.; Roberts, J.M.; Newman, L.

1991-01-01

Determination of carbonyl compounds in the ambient atmosphere is receiving increasing attention because of the critical role these compounds play in tropospheric organic chemistry. Currently, field measurements are very limited mainly because of the analytical challenges posed by trace concentrations and interferences arising from atmospheric copollutants. We review here the methods for used for determination of carbonyl compounds, from an atmospheric chemistry perspective, emphasizing the principles, advantages, and limitations. Since a large number of varied types of methods have been used specifically for determination of formaldehyde, it is considered separately from other carbonyls. It is clear that despite more thanmore » a decade of work, many problems related to sampling, interferences, and artifacts have not been resolved. Because of the increasing demand for time-series measurements in field studies, and automated method for continuous sampling and analysis of carbonyls is very much required. The widely used liquid chromatographic method based on 2,4-dinitrophenylhydrazine derivatization appears unsuitable for this purpose because of the lengthy collection times required to achieve sub-ppbv detection limits. Important issues to be considered in the development of a suitable field method and potential approaches are discussed. 155 refs., 19 figs., 5 tabs.« less

A novel microfluidic flow focusing method

PubMed Central

Jiang, Hai; Weng, Xuan; Li, Dongqing

2014-01-01

A new microfluidic method that allows hydrodynamic focusing in a microchannel with two sheath flows is demonstrated. The microchannel network consists of a T-shaped main channel and two T-shaped branch channels. The flows of the sample stream and the sheath streams in the microchannel are generated by electroosmotic flow-induced pressure gradients. In comparison with other flow focusing methods, this novel method does not expose the sample to electrical field, and does not need any external pumps, tubing, and valves. PMID:25538810

Trochoidal X-ray Vector Radiography: Directional dark-field without grating stepping

NASA Astrophysics Data System (ADS)

Sharma, Y.; Bachche, S.; Kageyama, M.; Kuribayashi, M.; Pfeiffer, F.; Lasser, T.; Momose, A.

2018-03-01

X-ray Vector Radiography (XVR) is an imaging technique that reveals the orientations of sub-pixel sized structures within a sample. Several dark-field radiographs are acquired by rotating the sample around the beam propagation direction and stepping one of the gratings to several positions for every pose of the sample in an X-ray grating interferometry setup. In this letter, we present a method of performing XVR of a continuously moving sample without the need of any grating motion. We reconstruct the orientations within a sample by analyzing the change in the background moire fringes caused by the sample moving and simultaneously rotating in plane (trochoidal trajectory) across the detector field-of-view. Avoiding the motion of gratings provides significant advantages in terms of stability and repeatability, while the continuous motion of the sample makes this kind of system adaptable for industrial applications such as the scanning of samples on a conveyor belt. Being the first step in the direction of utilizing advanced sample trajectories to replace grating motion, this work also lays the foundations for a full three dimensional reconstruction of scattering function without grating motion.

Optimization of the solvent-based dissolution method to sample volatile organic compound vapors for compound-specific isotope analysis.

PubMed

Bouchard, Daniel; Wanner, Philipp; Luo, Hong; McLoughlin, Patrick W; Henderson, James K; Pirkle, Robert J; Hunkeler, Daniel

2017-10-20

The methodology of the solvent-based dissolution method used to sample gas phase volatile organic compounds (VOC) for compound-specific isotope analysis (CSIA) was optimized to lower the method detection limits for TCE and benzene. The sampling methodology previously evaluated by [1] consists in pulling the air through a solvent to dissolve and accumulate the gaseous VOC. After the sampling process, the solvent can then be treated similarly as groundwater samples to perform routine CSIA by diluting an aliquot of the solvent into water to reach the required concentration of the targeted contaminant. Among solvents tested, tetraethylene glycol dimethyl ether (TGDE) showed the best aptitude for the method. TGDE has a great affinity with TCE and benzene, hence efficiently dissolving the compounds during their transition through the solvent. The method detection limit for TCE (5±1μg/m 3 ) and benzene (1.7±0.5μg/m 3 ) is lower when using TGDE compared to methanol, which was previously used (385μg/m 3 for TCE and 130μg/m 3 for benzene) [2]. The method detection limit refers to the minimal gas phase concentration in ambient air required to load sufficient VOC mass into TGDE to perform δ 13 C analysis. Due to a different analytical procedure, the method detection limit associated with δ 37 Cl analysis was found to be 156±6μg/m 3 for TCE. Furthermore, the experimental results validated the relationship between the gas phase TCE and the progressive accumulation of dissolved TCE in the solvent during the sampling process. Accordingly, based on the air-solvent partitioning coefficient, the sampling methodology (e.g. sampling rate, sampling duration, amount of solvent) and the final TCE concentration in the solvent, the concentration of TCE in the gas phase prevailing during the sampling event can be determined. Moreover, the possibility to analyse for TCE concentration in the solvent after sampling (or other targeted VOCs) allows the field deployment of the sampling method without the need to determine the initial gas phase TCE concentration. The simplified field deployment approach of the solvent-based dissolution method combined with the conventional analytical procedure used for groundwater samples substantially facilitates the application of CSIA to gas phase studies. Copyright © 2017 Elsevier B.V. All rights reserved.

Quality-control results for ground-water and surface-water data, Sacramento River Basin, California, National Water-Quality Assessment, 1996-1998

USGS Publications Warehouse

Munday, Cathy; Domagalski, Joseph L.

2003-01-01

Evaluating the extent that bias and variability affect the interpretation of ground- and surface-water data is necessary to meet the objectives of the National Water-Quality Assessment (NAWQA) Program. Quality-control samples used to evaluate the bias and variability include annual equipment blanks, field blanks, field matrix spikes, surrogates, and replicates. This report contains quality-control results for the constituents critical to the ground- and surface-water components of the Sacramento River Basin study unit of the NAWQA Program. A critical constituent is one that was detected frequently (more than 50 percent of the time in blank samples), was detected at amounts exceeding water-quality standards or goals, or was important for the interpretation of water-quality data. Quality-control samples were collected along with ground- and surface-water samples during the high intensity phase (cycle 1) of the Sacramento River Basin NAWQA beginning early in 1996 and ending in 1998. Ground-water field blanks indicated contamination of varying levels of significance when compared with concentrations detected in environmental ground-water samples for ammonia, dissolved organic carbon, aluminum, and copper. Concentrations of aluminum in surface-water field blanks were significant when compared with environmental samples. Field blank samples collected for pesticide and volatile organic compound analyses revealed no contamination in either ground- or surface-water samples that would effect the interpretation of environmental data, with the possible exception of the volatile organic compound trichloromethane (chloroform) in ground water. Replicate samples for ground water and surface water indicate that variability resulting from sample collection, processing, and analysis was generally low. Some of the larger maximum relative percentage differences calculated for replicate samples occurred between samples having lowest absolute concentration differences and(or) values near the reporting limit. Surrogate recoveries for pesticides analyzed by gas chromatography/mass spectrometry (GC/MS), pesticides analyzed by high performance liquid chromatography (HPLC), and volatile organic compounds in ground- and surface-water samples were within the acceptable limits of 70 to 130 percent and median recovery values between 82 and 113 percent. The recovery percentages for surrogate compounds analyzed by HPLC had the highest standard deviation, 20 percent for ground-water samples and 16 percent for surface-water samples, and the lowest median values, 82 percent for ground-water samples and 91 percent for surface-water samples. Results were consistent with the recovery results described for the analytical methods. Field matrix spike recoveries for pesticide compounds analyzed using GC/MS in ground- and surface-water samples were comparable with published recovery data. Recoveries of carbofuran, a critical constituent in ground- and surface-water studies, and desethyl atrazine, a critical constituent in the ground-water study, could not be calculated because of problems with the analytical method. Recoveries of pesticides analyzed using HPLC in ground- and surface-water samples were generally low and comparable with published recovery data. Other methodological problems for HPLC analytes included nondetection of the spike compounds and estimated values of spike concentrations. Recovery of field matrix spikes for volatile organic compounds generally were within the acceptable range, 70 and 130 percent for both ground- and surface-water samples, and median recoveries from 62 to 127 percent. High or low recoveries could be related to errors in the field, such as double spiking or using spike solution past its expiration date, rather than problems during analysis. The methodological changes in the field spike protocol during the course of the Sacramento River Basin study, which included decreasing the amount of spike solu

Faraday Shields within a Solenoidal Coil to Reduce Sample Heating: Numerical Comparison of Designs and Experimental Verification

PubMed Central

Park, BuSik; Neuberger, Thomas; Webb, Andrew G.; Bigler, Don C.; Collins, Christopher M.

2009-01-01

A comparison of methods to decrease RF power dissipation and related heating in conductive samples using passive conductors surrounding a sample in a solenoid coil is presented. Full-Maxwell finite difference time domain numerical calculations were performed to evaluate the effect of the passive conductors by calculating conservative and magnetically-induced electric field and magnetic field distributions. To validate the simulation method, experimental measurements of temperature increase were conducted using a solenoidal coil (diameter 3 mm), a saline sample (10 mM NaCl) and passive copper shielding wires (50 μm diameter). The temperature increase was 58% lower with the copper wires present for several different input powers to the coil. This was in good agreement with simulation for the same geometry, which indicated 57% lower power dissipated in the sample with conductors present. Simulations indicate that some designs should be capable of reducing temperature increase by more than 85%. PMID:19879784

Development of sampling methods for the slash pine flower thrips Gnophothrips fuscus (Morgan), (Thysanoptera: Phlaeothripidae)

Treesearch

Carl W. Fatzinger; Wayne N. Dixen

1991-01-01

Slash pine flower thrips typically destroy about 24% of the flowers (cones) present in slash pine seed orchards. The seasonal distribution and abundance of slash pine flower thrips are being investigated and methods for sampling field populations of the insect are being evaluated for potential use in integrated pest management strategies. The efficacies of several...

Maintaining a permanent plot data base for growth and yield research: Solutions to some recurring problems

Treesearch

John C. Byrne

1993-01-01

Methods for solving some recurring problems of maintaining a permanent plot data base for growth and yield reseuch are described. These methods include documenting data from diverse sampling designs, changing sampling designs, changing field procedures, and coordinating activities in the plots with the land management agency. Managing a permanent plot data base (...

FIELD METHOD COMPARISON BETWEEN PASSIVE AIR SAMPLERS AND CONTINUOUS MONITORS FOR VOLATILE ORGANIC COMPOUNDS AND NO2 IN EL PASO, TEXAS, USA

EPA Science Inventory

Passive sampling of gas-phase air toxics and criteria pollutants has become an attractive monitoring method in human exposure studies due to the relatively low sampling cost and ease of use. This study evaluates the performance of Model 3300 Ogawa(TM) Passive NO2 Samplers and 3...

Development of a robust chromatographic method for the detection of chlorophenols in cork oak forest soils.

PubMed

McLellan, Iain; Hursthouse, Andrew; Morrison, Calum; Varela, Adélia; Pereira, Cristina Silva

2014-02-01

A major concern for the cork and wine industry is 'cork taint' which is associated with chloroanisoles, the microbial degradation metabolites of chlorophenols. The use of chlorophenolic compounds as pesticides within cork forests was prohibited in 1993 in the European Union (EU) following the introduction of industry guidance. However, cork produced outside the EU is still thought to be affected and simple, robust methods for chlorophenol analysis are required for wider environmental assessment by industry and local environmental regulators. Soil samples were collected from three common-use forests in Tunisia and from one privately owned forest in Sardinia, providing examples of varied management practice and degree of human intervention. These provided challenge samples for the optimisation of a HPLC-UV detection method. It produced recoveries consistently >75% against a soil CRM (ERM-CC008) for pentachlorophenol. The optimised method, with ultraviolet (diode array) detection is able to separate and quantify 16 different chlorophenols at field concentrations greater than the limits of detection ranging from 6.5 to 191.3 μg/kg (dry weight). Application to a range of field samples demonstrated the absence of widespread contamination in forest soils at sites sampled in Sardinia and Tunisia.

Direct and indirect measurement of the magnetocaloric effect in bulk and nanostructured Ni-Mn-In Heusler alloy

NASA Astrophysics Data System (ADS)

Ghahremani, Mohammadreza; Aslani, Amir; Hosseinnia, Marjan; Bennett, Lawrence H.; Della Torre, Edward

2018-05-01

A systematic study of the magnetocaloric effect of a Ni51Mn33.4In15.6 Heusler alloy converted to nanoparticles via high energy ball-milling technique in the temperature range of 270 to 310 K has been performed. The properties of the particles were characterized by x-ray diffraction, electron microscopy, and magnetometer techniques. Isothermal magnetic field variation of magnetization exhibits field hysteresis in bulk Ni51Mn33.4In15.6 alloy across the martensitic transition which significantly lessened in the nanoparticles. The magnetocaloric effects of the bulk and nanoparticle samples were measured both with direct method, through our state of the art direct test bed apparatus with controllability over the applied fields and temperatures, as well as an indirect method through Maxwell and thermodynamic equations. In direct measurements, nanoparticle sample's critical temperature decreased by 6 K, but its magnetocaloric effect enhanced by 17% over the bulk counterpart. Additionally, when comparing the direct and indirect magnetocaloric curves, the direct method showed 14% less adiabatic temperature change in the bulk and 5% less adiabatic temperature change in the nanostructured sample.

Dating of barite and anhydrite in sea-floor hydrothermal deposits in the Okinawa Trough

NASA Astrophysics Data System (ADS)

Taisei, F.; Toyoda, S.; Uchida, A.; Ishibashi, J. I.; Totsuka, S.; Shimada, K.; Nakai, S.

2016-12-01

Dating of submarine hydrothermal activities has been an important issue in the aspect of the ore formation (Urabe, 1995) and biological systems sustained by the chemical species arising from hydrothermal activities (Macdonald et al., 1980). For this purpose, dating methods using radioactive disequilibrium such as U-Th method (e.g. You and Bickle, 1998) for sulfide, 226Ra-210Pb and 228Ra-228Th (e.g. Noguchi et al., 2011), Ra/Ba, and ESR (Electron Spin Resonance) methods for barite (Okumura et al., 2010) have been employed. In this study, firstly, we will report the first successful dating results on anhydrite using 226Ra-210Pb and 228Ra-228Th methods. The anhydrite samples were taken from the Daiyon-Yonaguni knoll field and the Hatoma knoll field and the Iheya North Knoll field of the Okinawa Trough by research cruises operated by JAMSTEC. The anhydrite crystals were physically scratched out of the samples. 226Ra, 228Ra and daughter nuclei were measured in the same samples for the ESR method by the low background gamma ray spectrometry. From the activity ratios, disequilibrium ages were obtained to be about 7.3 years by 226Ra-210Pb method, and to be 0.6-2.5 years by 228Ra-228Th method. Secondly, the ESR ages of barite taken from hydrothermal areas in the Okinawa trough range from 4.1 to 16000 years, filling the age gap of the maximum age, 150 years, of 226Ra-210Pb method and the minimum age, several thousand years of U-Th method, being the most appropriate age range to discuss the evolution of the hydrothermal systems. Interestingly, the 226Ra-210Pb and 228Ra-228Th ages for the same samples are the same or younger than the ESR ages. As for the latter samples, the reason has already been discussed (Uchida et al., 2015) as the deposits had been formed by two or more hydrothermal events. In the present paper, the disequilibrium and ESR ages will be simulated with these multiple hydrothermal events so that the differences in the ages are explained.

Detecting and enumerating soil-transmitted helminth eggs in soil: New method development and results from field testing in Kenya and Bangladesh

PubMed Central

Kwong, Laura H.; Ercumen, Ayse; Negash, Makeda S.; Lovely, Amira J.; Njenga, Sammy M.; Boehm, Alexandria B.; Pickering, Amy J.; Nelson, Kara L.

2017-01-01

Globally, about 1.5 billion people are infected with at least one species of soil-transmitted helminth (STH). Soil is a critical environmental reservoir of STH, yet there is no standard method for detecting STH eggs in soil. We developed a field method for enumerating STH eggs in soil and tested the method in Bangladesh and Kenya. The US Environmental Protection Agency (EPA) method for enumerating Ascaris eggs in biosolids was modified through a series of recovery efficiency experiments; we seeded soil samples with a known number of Ascaris suum eggs and assessed the effect of protocol modifications on egg recovery. We found the use of 1% 7X as a surfactant compared to 0.1% Tween 80 significantly improved recovery efficiency (two-sided t-test, t = 5.03, p = 0.007) while other protocol modifications—including different agitation and flotation methods—did not have a significant impact. Soil texture affected the egg recovery efficiency; sandy samples resulted in higher recovery compared to loamy samples processed using the same method (two-sided t-test, t = 2.56, p = 0.083). We documented a recovery efficiency of 73% for the final improved method using loamy soil in the lab. To field test the improved method, we processed soil samples from 100 households in Bangladesh and 100 households in Kenya from June to November 2015. The prevalence of any STH (Ascaris, Trichuris or hookworm) egg in soil was 78% in Bangladesh and 37% in Kenya. The median concentration of STH eggs in soil in positive samples was 0.59 eggs/g dry soil in Bangladesh and 0.15 eggs/g dry soil in Kenya. The prevalence of STH eggs in soil was significantly higher in Bangladesh than Kenya (chi-square, χ2 = 34.39, p < 0.001) as was the concentration (Mann-Whitney, z = 7.10, p < 0.001). This new method allows for detecting STH eggs in soil in low-resource settings and could be used for standardizing soil STH detection globally. PMID:28379956

Further studies on the problems of geomagnetic field intensity determination from archaeological baked clay materials

NASA Astrophysics Data System (ADS)

Kostadinova-Avramova, M.; Kovacheva, M.

2015-10-01

Archaeological baked clay remains provide valuable information about the geomagnetic field in historical past, but determination of the geomagnetic field characteristics, especially intensity, is often a difficult task. This study was undertaken to elucidate the reasons for unsuccessful intensity determination experiments obtained from two different Bulgarian archaeological sites (Nessebar - Early Byzantine period and Malenovo - Early Iron Age). With this aim, artificial clay samples were formed in the laboratory and investigated. The clay used for the artificial samples preparation differs according to its initial state. Nessebar clay was baked in the antiquity, but Malenovo clay was raw, taken from the clay deposit near the site. The obtained artificial samples were repeatedly heated eight times in known magnetic field to 700 °C. X-ray diffraction analyses and rock-magnetic experiments were performed to obtain information about the mineralogical content and magnetic properties of the initial and laboratory heated clays. Two different protocols were applied for the intensity determination-Coe version of Thellier and Thellier method and multispecimen parallel differential pTRM protocol. Various combinations of laboratory fields and mutual positions of the directions of laboratory field and carried thermoremanence were used in the performed Coe experiment. The obtained results indicate that the failure of this experiment is probably related to unfavourable grain sizes of the prevailing magnetic carriers combined with the chosen experimental conditions. The multispecimen parallel differential pTRM protocol in its original form gives excellent results for the artificial samples, but failed for the real samples (samples coming from previously studied kilns of Nessebar and Malenovo sites). Obviously the strong dependence of this method on the homogeneity of the used subsamples hinders its implementation in its original form for archaeomaterials. The latter are often heterogeneous due to variable heating conditions in the different parts of the archaeological structures. The study draws attention to the importance of multiple heating for the stabilization of grain size distribution in baked clay materials and the need of elucidation of this question.

Pre-Clinical Evaluation of a Real-Time PCR Assay on a Portable Instrument as a Possible Field Diagnostic Tool: Experiences from the Testing of Clinical Samples for African and Classical Swine Fever Viruses.

PubMed

Liu, L; Luo, Y; Accensi, F; Ganges, L; Rodríguez, F; Shan, H; Ståhl, K; Qiu, H-J; Belák, S

2017-10-01

African swine fever (ASF) and classical swine fever (CSF) are two highly infectious transboundary animal diseases (TADs) that are serious threats to the pig industry worldwide, including in China, the world's largest pork producer. In this study, a duplex real-time PCR assay was developed for the rapid detection and differentiation of African swine fever virus (ASFV) and classical swine fever virus (CSFV). The assay was performed on a portable, battery-powered PCR thermocycler with a low sample throughput (termed as 'T-COR4 assay'). The feasibility and reliability of the T-COR4 assay as a possible field method was investigated by testing clinical samples collected in China. When evaluated with reference materials or samples from experimental infections, the assay performed in a reliable manner, producing results comparable to those obtained from stationary PCR platforms. Of 59 clinical samples, 41 had results identical to a two-step CSFV real-time PCR assay. No ASFV was detected in these samples. The T-COR4 assay was technically easy to perform and produced results within 3 h, including sample preparation. In combination with a simple sample preparation method, the T-COR4 assay provides a new tool for the field diagnosis and differentiation of ASF and CSF, which could be of particular value in remote areas. © 2016 Blackwell Verlag GmbH.

Isothermal amplification of environmental DNA (eDNA) for direct field-based monitoring and laboratory confirmation of Dreissena sp.

PubMed

Williams, Maggie R; Stedtfeld, Robert D; Engle, Cathrine; Salach, Paul; Fakher, Umama; Stedtfeld, Tiffany; Dreelin, Erin; Stevenson, R Jan; Latimore, Jo; Hashsham, Syed A

2017-01-01

Loop-mediated isothermal amplification (LAMP) of aquatic invasive species environmental DNA (AIS eDNA) was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA) basin. The method was validated for two uses including i) direct amplification of eDNA using a hand filtration system and ii) confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels) per L for Dreissena sp.) or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i) filtered concentrate for direct amplification validation and ii) 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification), direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a portable device (Gene-Z) showed the method could be used in the field to obtain results within one hr (from sample to result). Overall, the direct amplification has the potential to simplify the eDNA-based monitoring of multiple aquatic invasive species. Additional studies are warranted to establish quantitative correlation between eDNA copy number, veliger, biomass or organismal abundance in the field.

Isothermal amplification of environmental DNA (eDNA) for direct field-based monitoring and laboratory confirmation of Dreissena sp.

PubMed Central

Stedtfeld, Robert D.; Engle, Cathrine; Salach, Paul; Fakher, Umama; Stedtfeld, Tiffany; Dreelin, Erin; Stevenson, R. Jan; Latimore, Jo; Hashsham, Syed A.

2017-01-01

Loop-mediated isothermal amplification (LAMP) of aquatic invasive species environmental DNA (AIS eDNA) was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA) basin. The method was validated for two uses including i) direct amplification of eDNA using a hand filtration system and ii) confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels) per L for Dreissena sp.) or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i) filtered concentrate for direct amplification validation and ii) 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification), direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a portable device (Gene-Z) showed the method could be used in the field to obtain results within one hr (from sample to result). Overall, the direct amplification has the potential to simplify the eDNA-based monitoring of multiple aquatic invasive species. Additional studies are warranted to establish quantitative correlation between eDNA copy number, veliger, biomass or organismal abundance in the field. PMID:29036210

Sampling protocol for monitoring abiotic and biotic characteristics of mountain ponds and lakes

USGS Publications Warehouse

Hoffman, Robert L.; Tyler, Torrey J.; Larson, Gary L.; Adams, Michael J.; Wente, Wendy; Galvan, Stephanie

2005-01-01

This document describes field techniques and procedures used for sampling mountain ponds and lakes. These techniques and procedures will be used primarily to monitor, as part of long-term programs in National Parks and other protected areas, the abiotic and biotic characteristics of naturally occurring permanent montane lentic systems up to 75 ha in surface area. However, the techniques and procedures described herein also can be used to sample temporary or ephemeral montane lentic sites. Each Standard Operating Procedure (SOP) section addresses a specific component of the limnological investigation, and describes in detail field sampling methods pertaining to parameters to be measured for each component.

Applying inventory methods to estimate aboveground biomass from satellite light detection and ranging (LiDAR) forest height data

Treesearch

Sean P. Healey; Paul L. Patterson; Sassan Saatchi; Michael A. Lefsky; Andrew J. Lister; Elizabeth A. Freeman; Gretchen G. Moisen

2012-01-01

Light Detection and Ranging (LiDAR) returns from the spaceborne Geoscience Laser Altimeter (GLAS) sensor may offer an alternative to solely field-based forest biomass sampling. Such an approach would rely upon model-based inference, which can account for the uncertainty associated with using modeled, instead of field-collected, measurements. Model-based methods have...

MULTI-SITE EVALUATIONS OF CANDIDATE METHODOLOGIES FOR DETERMINING COARSE PARTICULATE (PM 10-2.5) CONCENTRATIONS: AUGUST 2005 UPDATED REPORT REGARDING SECOND-GENERATION AND NEW PM 10-2.5 SAMPLERS

EPA Science Inventory

Multi-site field studies were conducted to evaluate the performance of sampling methods for measuring the coarse fraction of PM10 (PM10 2.5) in ambient air. The field studies involved the use of both time-integrated filter-based and direct continuous methods. Despite operationa...

Cross-talk free selective reconstruction of individual objects from multiplexed optical field data

NASA Astrophysics Data System (ADS)

Zea, Alejandro Velez; Barrera, John Fredy; Torroba, Roberto

2018-01-01

In this paper we present a data multiplexing method for simultaneous storage in a single package composed by several optical fields of tridimensional (3D) objects, and their individual cross-talk free retrieval. Optical field data are extracted from off axis Fourier holograms, and then sampled by multiplying them with random binary masks. The resulting sampled optical fields can be used to reconstruct the original objects. Sampling causes a loss of quality that can be controlled by the number of white pixels in the binary masks and by applying a padding procedure on the optical field data. This process can be performed using a different binary mask for each optical field, and then added to form a multiplexed package. With the adequate choice of sampling and padding, we can achieve a volume reduction in the multiplexed package over the addition of all individual optical fields. Moreover, the package can be multiplied by a binary mask to select a specific optical field, and after the reconstruction procedure, the corresponding 3D object is recovered without any cross-talk. We demonstrate the effectiveness of our proposal for data compression with a comparison with discrete cosine transform filtering. Experimental results confirm the validity of our proposal.

Multi-level slug tests in highly permeable formations: 2. Hydraulic conductivity identification, method verification, and field applications

USGS Publications Warehouse

Zlotnik, V.A.; McGuire, V.L.

1998-01-01

Using the developed theory and modified Springer-Gelhar (SG) model, an identification method is proposed for estimating hydraulic conductivity from multi-level slug tests. The computerized algorithm calculates hydraulic conductivity from both monotonic and oscillatory well responses obtained using a double-packer system. Field verification of the method was performed at a specially designed fully penetrating well of 0.1-m diameter with a 10-m screen in a sand and gravel alluvial aquifer (MSEA site, Shelton, Nebraska). During well installation, disturbed core samples were collected every 0.6 m using a split-spoon sampler. Vertical profiles of hydraulic conductivity were produced on the basis of grain-size analysis of the disturbed core samples. These results closely correlate with the vertical profile of horizontal hydraulic conductivity obtained by interpreting multi-level slug test responses using the modified SG model. The identification method was applied to interpret the response from 474 slug tests in 156 locations at the MSEA site. More than 60% of responses were oscillatory. The method produced a good match to experimental data for both oscillatory and monotonic responses using an automated curve matching procedure. The proposed method allowed us to drastically increase the efficiency of each well used for aquifer characterization and to process massive arrays of field data. Recommendations generalizing this experience to massive application of the proposed method are developed.Using the developed theory and modified Springer-Gelhar (SG) model, an identification method is proposed for estimating hydraulic conductivity from multi-level slug tests. The computerized algorithm calculates hydraulic conductivity from both monotonic and oscillatory well responses obtained using a double-packer system. Field verification of the method was performed at a specially designed fully penetrating well of 0.1-m diameter with a 10-m screen in a sand and gravel alluvial aquifer (MSEA site, Shelton, Nebraska). During well installation, disturbed core samples were collected every 0.6 m using a split-spoon sampler. Vertical profiles of hydraulic conductivity were produced on the basis of grain-size analysis of the disturbed core samples. These results closely correlate with the vertical profile of horizontal hydraulic conductivity obtained by interpreting multi-level slug test responses using the modified SG model. The identification method was applied to interpret the response from 474 slug tests in 156 locations at the MSEA site. More than 60% of responses were oscillatory. The method produced a good match to experimental data for both oscillatory and monotonic responses using an automated curve matching procedure. The proposed method allowed us to drastically increase the efficiency of each well used for aquifer characterization and to process massive arrays of field data. Recommendations generalizing this experience to massive application of the proposed method are developed.

Magnetic field dependence of Griffith phase and magnetocaloric effect in Ca0.85Dy0.15MnO3

NASA Astrophysics Data System (ADS)

Nag, Ripan; Sarkar, Bidyut; Pal, Sudipta

2018-03-01

Temperature and Magnetic field dependent magnetization properties of electron doped polycrystalline sample Ca0.85Dy0.15MnO3 (CDMO) prepared by solid state reaction method have been studied. The sample undergoes ferromagnetic to paramagnetic phase transition at about 111k. From the study of magnetic properties in terms of Arrot plots it is observed that the phase transition is of 2nd order. The Griffith phase behavior of the sample is suppressed with the increase of the applied magnetic field strength H. We have estimated the magnetic entropy change from experimental magnetization and temperature data. For a magnetic field change of 8000 Oe, the maximum value of magnetic entropy change arrives at a value of 1.126 J-kg-1 k-1 in this magnetocaloric material.

Real-time PCR detection of Plasmodium directly from whole blood and filter paper samples

PubMed Central

2011-01-01

Background Real-time PCR is a sensitive and specific method for the analysis of Plasmodium DNA. However, prior purification of genomic DNA from blood is necessary since PCR inhibitors and quenching of fluorophores from blood prevent efficient amplification and detection of PCR products. Methods Reagents designed to specifically overcome PCR inhibition and quenching of fluorescence were evaluated for real-time PCR amplification of Plasmodium DNA directly from blood. Whole blood from clinical samples and dried blood spots collected in the field in Colombia were tested. Results Amplification and fluorescence detection by real-time PCR were optimal with 40× SYBR® Green dye and 5% blood volume in the PCR reaction. Plasmodium DNA was detected directly from both whole blood and dried blood spots from clinical samples. The sensitivity and specificity ranged from 93-100% compared with PCR performed on purified Plasmodium DNA. Conclusions The methodology described facilitates high-throughput testing of blood samples collected in the field by fluorescence-based real-time PCR. This method can be applied to a broad range of clinical studies with the advantages of immediate sample testing, lower experimental costs and time-savings. PMID:21851640

Real-time specific surface area measurements via laser-induced breakdown spectroscopy

USGS Publications Warehouse

Washburn, Kathryn E.; Birdwell, Justin E.; Howard, James E.

2017-01-01

From healthcare to cosmetics to environmental science, the specific surface area (SSA) of micro- and mesoporous materials or products can greatly affect their chemical and physical properties. SSA results are also widely used to examine source rocks in conventional and unconventional petroleum resource plays. Despite its importance, current methods to measure SSA are often cumbersome, time-consuming, or require cryogenic consumables (e.g., liquid nitrogen). These methods are not amenable to high-throughput environments, have stringent sample preparation requirements, and are not practical for use in the field. We present a new application of laser-induced breakdown spectroscopy for rapid measurement of SSA. This study evaluates geological samples, specifically organic-rich oil shales, but the approach is expected to be applicable to many other types of materials. The method uses optical emission spectroscopy to examine laser-generated plasma and quantify the amount of argon adsorbed to a sample during an inert gas purge. The technique can accommodate a wide range of sample sizes and geometries and has the potential for field use. These advantages for SSA measurement combined with the simultaneous acquisition of composition information make this a promising new approach for characterizing geologic samples and other materials.

Evaluating a novel application of optical fibre evanescent field absorbance: rapid measurement of red colour in winegrape homogenates

NASA Astrophysics Data System (ADS)

Lye, Peter G.; Bradbury, Ronald; Lamb, David W.

Silica optical fibres were used to measure colour (mg anthocyanin/g fresh berry weight) in samples of red wine grape homogenates via optical Fibre Evanescent Field Absorbance (FEFA). Colour measurements from 126 samples of grape homogenate were compared against the standard industry spectrophotometric reference method that involves chemical extraction and subsequent optical absorption measurements of clarified samples at 520 nm. FEFA absorbance on homogenates at 520 nm (FEFA520h) was correlated with the industry reference method measurements of colour (R2 = 0.46, n = 126). Using a simple regression equation colour could be predicted with a standard error of cross-validation (SECV) of 0.21 mg/g, with a range of 0.6 to 2.2 mg anthocyanin/g and a standard deviation of 0.33 mg/g. With a Ratio of Performance Deviation (RPD) of 1.6, the technique when utilizing only a single detection wavelength, is not robust enough to apply in a diagnostic sense, however the results do demonstrate the potential of the FEFA method as a fast and low-cost assay of colour in homogenized samples.

Double-cross hydrostatic pressure sample injection for chip CE: variable sample plug volume and minimum number of electrodes.

PubMed

Luo, Yong; Wu, Dapeng; Zeng, Shaojiang; Gai, Hongwei; Long, Zhicheng; Shen, Zheng; Dai, Zhongpeng; Qin, Jianhua; Lin, Bingcheng

2006-09-01

A novel sample injection method for chip CE was presented. This injection method uses hydrostatic pressure, generated by emptying the sample waste reservoir, for sample loading and electrokinetic force for dispensing. The injection was performed on a double-cross microchip. One cross, created by the sample and separation channels, is used for formation of a sample plug. Another cross, formed by the sample and controlling channels, is used for plug control. By varying the electric field in the controlling channel, the sample plug volume can be linearly adjusted. Hydrostatic pressure takes advantage of its ease of generation on a microfluidic chip, without any electrode or external pressure pump, thus allowing a sample injection with a minimum number of electrodes. The potential of this injection method was demonstrated by a four-separation-channel chip CE system. In this system, parallel sample separation can be achieved with only two electrodes, which is otherwise impossible with conventional injection methods. Hydrostatic pressure maintains the sample composition during the sample loading, allowing the injection to be free of injection bias.

Recruiting Drug Using Men Who Have Sex with Men in Behavioral Intervention Trials: A Comparison of Internet and Field-based Strategies

PubMed Central

Parsons, Jeffrey T.; Vial, Andrea C.; Starks, Tyrel J.; Golub, Sarit A.

2012-01-01

Although online and field-based samples of men who have sex with men (MSM) have been compared on a variety of markers, differences in drug use have not been well examined. In addition, generalization from studies comparing recruitment methods is often limited by a focus on either HIV seropositive or seronegative MSM. We compared two New York City-based samples of MSM recruited simultaneously between July 2009 and January 2010—one sample recruited in the field (n = 2402) and one sample recruited via the Internet (n = 694). All recruitment efforts targeted men without restriction on age or self-reported HIV status. Our results show marked differences in drug and alcohol use between online and field-based samples of MSM. Specifically, men surveyed online were significantly more likely to have tried a variety of drugs, including methamphetamine, cocaine, and ecstasy. Men recruited online were also more likely to report older age, HIV positive serostatus, and “never” using condoms. Internet-based recruitment was found to be more cost-effective in terms of recruitment yield than was field-based recruitment. PMID:22684657

A study: Effect of Students Peer Assisted Learning on Magnetic Field Achievement

NASA Astrophysics Data System (ADS)

Mueanploy, Wannapa

2016-04-01

This study is the case study of Physic II Course for students of Pathumwan Institute of Technology. The purpose of this study is: 1) to develop cooperative learning method of peer assisted learning (PAL), 2) to compare the learning achievement before and after studied magnetic field lesson by cooperative learning method of peer assisted learning. The population was engineering students of Pathumwan Institute of Technology (PIT’s students) who registered Physic II Course during year 2014. The sample used in this study was selected from the 72 students who passed in Physic I Course. The control groups learning magnetic fields by Traditional Method (TM) and experimental groups learning magnetic field by method of peers assisted learning. The students do pretest before the lesson and do post-test after the lesson by 20 items achievement tests of magnetic field. The post-test higher than pretest achievement significantly at 0.01 level.

Lunar Paleomagnetism: The Case for an Ancient Lunar Dynamo. (Invited)

NASA Astrophysics Data System (ADS)

Fuller, M.; Weiss, B. P.; Gattacceca, J.

2010-12-01

The failure of lunar samples to satisfy minimal criteria for classical paleointensity determinations has led to skepticism of the case for an ancient lunar dynamo. There are however practical and fundamental reasons why such experiments are doomed to failure in most lunar samples. In such methods, NRMs in successive blocking temperatures ranges are thermally demagnetized and replaced with partial thermoremanent magnetization (pTRMs) given in a known field (Thellier, 1938). A practical difficulty is that it is hard to heat lunar samples without altering them. A fundamental problem is that whereas pottery, for which these methods were designed, carries a primary (TRM) from its initial cooling and little secondary magnetization, lunar samples are likely to carry weak field isothermal remanent magnetization (IRM) and shock remanent magnetization (SRM) as secondary overprints. Thermal demagnetization does not isolate weak field IRM well. For example, on thermal demagnetization of the Apollo sample 14053.48 carrying a 2000nT TRM with a superposed 5mT IRM, the IRM persists to the Curie point obscuring the TRM. Fortunately, weak field IRM is removed by AF demagnetization to fields comparable to that in which it is acquired. Furthermore, Gattacceca et al. (2008) demonstrated that experimentally generated SRM from several GPa, like weak field IRM, is demagnetized by AF fields of between ~20 and 30 mT, leaving the pre-shock remanent magnetization essentially untouched. This agrees with our theoretical understanding of SRM, which at pressures below approximately the Hugoniot elastic limit (several GPa for most rocks) should essentially be a pressure remanent magnetization (e.g., Dunlop and Ozdemir, 1997). Unlike IRM, SRM in the range of a few GPa may carry recoverable lunar field records (Gattacceca et al., 2008). NRM in samples shocked to less than ~5 GPa, which is stable against AF demagnetization beyond the fields necessary to eliminate weak SRM (~20-30 mT), requires some other explanation. Such NRM carried by the small amount of single domain iron and iron nickel present in the samples can be very stable. The troctolite 76535 is an example of such a sample. It cooled over thousands of years, or longer, which is far too long for any possible transient fields associated with impacts and must carry a TRM like NRM. Note that despite predictions that even km sized craters may generate fields up to 0.1T at 1 crater radius, no unambiguous evidence for paleomagnetic recording of such fields over individual craters has materialized. There are numerous other candidate samples having experienced <~5 GPa carrying stable NRM, which have been analyzed, or are being presently investigated. The only other obvious source of a field to explain stable TRM in lunar rocks is that of surface lunar fields, but over the mare these are too weak to account for the NRM of mare basalts. In summary, recent advances in our understanding of SRM and reanalysis of lunar paleomagnetism lead us to conclude that lunar paleomagnetism is most easily explained by a lunar dynamo.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ogura, Toshihiko, E-mail: t-ogura@aist.go.jp

Scanning electron microscopy (SEM) has been widely used to examine biological specimens of bacteria, viruses and proteins. Until now, atmospheric and/or wet biological specimens have been examined using various atmospheric holders or special equipment involving SEM. Unfortunately, they undergo heavy radiation damage by the direct electron beam. In addition, images of unstained biological samples in water yield poor contrast. We recently developed a new analytical technology involving a frequency transmission electric-field (FTE) method based on thermionic SEM. This method is suitable for high-contrast imaging of unstained biological specimens. Our aim was to optimise the method. Here we describe a high-resolutionmore » FTE system based on field-emission SEM; it allows for imaging and nanoscale examination of various biological specimens in water without radiation damage. The spatial resolution is 8 nm, which is higher than 41 nm of the existing FTE system. Our new method can be easily utilised for examination of unstained biological specimens including bacteria, viruses and protein complexes. Furthermore, our high-resolution FTE system can be used for diverse liquid samples across a broad range of scientific fields, e.g. nanoparticles, nanotubes and organic and catalytic materials. - Highlights: • We developed a high-resolution frequency transmission electric-field (FTE) system. • High-resolution FTE system is introduced in the field-emission SEM. • The spatial resolution of high-resolution FTE method is 8 nm. • High-resolution FTE system enables observation of the intact IgM particles in water.« less

Quantification of in-contact probe-sample electrostatic forces with dynamic atomic force microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balke, Nina Wisinger; Jesse, Stephen; Carmichael, Ben D.

Here, atomic force microscopy (AFM) methods utilizing resonant mechanical vibrations of cantilevers in contact with a sample surface have shown sensitivities as high as few picometers for detecting surface displacements. Such a high sensitivity is harnessed in several AFM imaging modes. Here, we demonstrate a cantilever-resonance-based method to quantify electrostatic forces on a probe in the probe-sample junction in the presence of a surface potential or when a bias voltage is applied to the AFM probe. We find that the electrostatic forces acting on the probe tip apex can produce signals equivalent to a few pm of surface displacement. Inmore » combination with modeling, the measurements of the force were used to access the strength of the electrical field at the probe tip apex in contact with a sample. We find an evidence that the electric field strength in the junction can reach ca. 1 V nm –1 at a bias voltage of a few volts and is limited by non-ideality of the tip-sample contact. This field is sufficiently strong to significantly influence material states and kinetic processes through charge injection, Maxwell stress, shifts of phase equilibria, and reduction of energy barriers for activated processes. Besides, the results provide a baseline for accounting for the effects of local electrostatic forces in electromechanical AFM measurements as well as offer additional means to probe ionic mobility and field-induced phenomena in solids.« less

Quantification of In-Contact Probe-Sample Electrostatic Forces with Dynamic Atomic Force Microscopy.

PubMed

Balke, Nina; Jesse, Stephen; Carmichael, Ben; Okatan, M; Kravchenko, Ivan; Kalinin, Sergei; Tselev, Alexander

2016-12-13

Atomic Force Microscopy (AFM) methods utilizing resonant mechanical vibrations of cantilevers in contact with a sample surface have shown sensitivities as high as few picometers for detecting surface displacements. Such a high sensitivity is harnessed in several AFM imaging modes. Here, we demonstrate a cantilever-resonance-based method to quantify electrostatic forces on a probe in the probe-sample junction in the presence of a surface potential or when a bias voltage is applied to the AFM probe. We find that the electrostatic forces acting on the probe tip apex can produce signals equivalent to a few pm of surface displacement. In combination with modeling, the measurements of the force were used to access the strength of the electrical field at the probe tip apex in contact with a sample. We find an evidence that the electric field strength in the junction can reach ca. 1 V/nm at a bias voltage of a few volts and is limited by non-ideality of the tip-sample contact. This field is sufficiently strong to significantly influence material states and kinetic processes through charge injection, Maxwell stress, shifts of phase equilibria, and reduction of energy barriers for activated processes. Besides, the results provide a baseline for accounting for the effects of local electrostatic forces in electromechanical AFM measurements as well as offer additional means to probe ionic mobility and field-induced phenomena in solids. Copyright 2016 IOP Publishing Ltd.

Quantification of in-contact probe-sample electrostatic forces with dynamic atomic force microscopy

DOE PAGES

Balke, Nina Wisinger; Jesse, Stephen; Carmichael, Ben D.; ...

2017-01-04

Here, atomic force microscopy (AFM) methods utilizing resonant mechanical vibrations of cantilevers in contact with a sample surface have shown sensitivities as high as few picometers for detecting surface displacements. Such a high sensitivity is harnessed in several AFM imaging modes. Here, we demonstrate a cantilever-resonance-based method to quantify electrostatic forces on a probe in the probe-sample junction in the presence of a surface potential or when a bias voltage is applied to the AFM probe. We find that the electrostatic forces acting on the probe tip apex can produce signals equivalent to a few pm of surface displacement. Inmore » combination with modeling, the measurements of the force were used to access the strength of the electrical field at the probe tip apex in contact with a sample. We find an evidence that the electric field strength in the junction can reach ca. 1 V nm –1 at a bias voltage of a few volts and is limited by non-ideality of the tip-sample contact. This field is sufficiently strong to significantly influence material states and kinetic processes through charge injection, Maxwell stress, shifts of phase equilibria, and reduction of energy barriers for activated processes. Besides, the results provide a baseline for accounting for the effects of local electrostatic forces in electromechanical AFM measurements as well as offer additional means to probe ionic mobility and field-induced phenomena in solids.« less

Urban Land Cover Mapping Accuracy Assessment - A Cost-benefit Analysis Approach

NASA Astrophysics Data System (ADS)

Xiao, T.

2012-12-01

One of the most important components in urban land cover mapping is mapping accuracy assessment. Many statistical models have been developed to help design simple schemes based on both accuracy and confidence levels. It is intuitive that an increased number of samples increases the accuracy as well as the cost of an assessment. Understanding cost and sampling size is crucial in implementing efficient and effective of field data collection. Few studies have included a cost calculation component as part of the assessment. In this study, a cost-benefit sampling analysis model was created by combining sample size design and sampling cost calculation. The sampling cost included transportation cost, field data collection cost, and laboratory data analysis cost. Simple Random Sampling (SRS) and Modified Systematic Sampling (MSS) methods were used to design sample locations and to extract land cover data in ArcGIS. High resolution land cover data layers of Denver, CO and Sacramento, CA, street networks, and parcel GIS data layers were used in this study to test and verify the model. The relationship between the cost and accuracy was used to determine the effectiveness of each sample method. The results of this study can be applied to other environmental studies that require spatial sampling.

Methods for the field evaluation of quantitative G6PD diagnostics: a review.

PubMed

Ley, Benedikt; Bancone, Germana; von Seidlein, Lorenz; Thriemer, Kamala; Richards, Jack S; Domingo, Gonzalo J; Price, Ric N

2017-09-11

Individuals with glucose-6-phosphate dehydrogenase (G6PD) deficiency are at risk of severe haemolysis following the administration of 8-aminoquinoline compounds. Primaquine is the only widely available 8-aminoquinoline for the radical cure of Plasmodium vivax. Tafenoquine is under development with the potential to simplify treatment regimens, but point-of-care (PoC) tests will be needed to provide quantitative measurement of G6PD activity prior to its administration. There is currently a lack of appropriate G6PD PoC tests, but a number of new tests are in development and are likely to enter the market in the coming years. As these are implemented, they will need to be validated in field studies. This article outlines the technical details for the field evaluation of novel quantitative G6PD diagnostics such as sample handling, reference testing and statistical analysis. Field evaluation is based on the comparison of paired samples, including one sample tested by the new assay at point of care and one sample tested by the gold-standard reference method, UV spectrophotometry in an established laboratory. Samples can be collected as capillary or venous blood; the existing literature suggests that potential differences in capillary or venous blood are unlikely to affect results substantially. The collection and storage of samples is critical to ensure preservation of enzyme activity, it is recommended that samples are stored at 4 °C and testing occurs within 4 days of collection. Test results can be visually presented as scatter plot, Bland-Altman plot, and a histogram of the G6PD activity distribution of the study population. Calculating the adjusted male median allows categorizing results according to G6PD activity to calculate standard performance indicators and to perform receiver operating characteristic (ROC) analysis.

Separation and quantification of monoclonal-antibody aggregates by hollow-fiber-flow field-flow fractionation.

PubMed

Fukuda, Jun; Iwura, Takafumi; Yanagihara, Shigehiro; Kano, Kenji

2014-10-01

Hollow-fiber-flow field-flow fractionation (HF5) separates protein molecules on the basis of the difference in the diffusion coefficient, and can evaluate the aggregation ratio of proteins. However, HF5 is still a minor technique because information on the separation conditions is limited. We examined in detail the effect of different settings, including the main-flow rate, the cross-flow rate, the focus point, the injection amount, and the ionic strength of the mobile phase, on fractographic characteristics. On the basis of the results, we proposed optimized conditions of the HF5 method for quantification of monoclonal antibody in sample solutions. The HF5 method was qualified regarding the precision, accuracy, linearity of the main peak, and quantitation limit. In addition, the HF5 method was applied to non-heated Mab A and heat-induced-antibody-aggregate-containing samples to evaluate the aggregation ratio and the distribution extent. The separation performance was comparable with or better than that of conventional methods including analytical ultracentrifugation-sedimentation velocity and asymmetric-flow field-flow fractionation.

Analytical methods for determination of mycotoxins: An update (2009-2014).

PubMed

Turner, Nicholas W; Bramhmbhatt, Heli; Szabo-Vezse, Monika; Poma, Alessandro; Coker, Raymond; Piletsky, Sergey A

2015-12-11

Mycotoxins are a problematic and toxic group of small organic molecules that are produced as secondary metabolites by several fungal species that colonise crops. They lead to contamination at both the field and postharvest stages of food production with a considerable range of foodstuffs affected, from coffee and cereals, to dried fruit and spices. With wide ranging structural diversity of mycotoxins, severe toxic effects caused by these molecules and their high chemical stability the requirement for robust and effective detection methods is clear. This paper builds on our previous review and summarises the most recent advances in this field, in the years 2009-2014 inclusive. This review summarises traditional methods such as chromatographic and immunochemical techniques, as well as newer approaches such as biosensors, and optical techniques which are becoming more prevalent. A section on sampling and sample treatment has been prepared to highlight the importance of this step in the analytical methods. We close with a look at emerging technologies that will bring effective and rapid analysis out of the laboratory and into the field. Copyright © 2015 Elsevier B.V. All rights reserved.

Monitoring IACP samples and construction of a centralized data base

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walsh, D.B.; Ray, D.B.; Simonson, J.

1991-01-01

The Integrated Air Cancer Project (IACP) is a multiyear US EPA research program established to develop and evaluate methods required to identify the principal airborne carcinogens, determine emission sources, and improve the estimate of comparative human cancer risk. The first major field study designed to examine a residential wood combustion airshed was conducted in Boise, Idaho during the 1986-1987 winter heating season. The second major field study conducted in Roanoke, Virgina during the 1988-1989 was to study residential oil heating and wood combustion. Motor vehicle emissions were considered a major combustion product contributor in both airsheds. This paper describes twomore » critical components of the project. The first component is the sample custody and tracking of the samples before analysis. The second component describes the data management of the sample field data (eg. sample site, time, date, flow rate) as well as the analytical data (eg. mutagenicity, particle concentrations) for the environmental samples.« less

The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis

PubMed Central

Carranza-Rodríguez, Cristina; Pérez-Arellano, José Luis; Vicente, Belén; López-Abán, Julio; Muro, Antonio

2015-01-01

Background Urogenital schistosomiasis due to Schistosoma haematobium is a serious underestimated public health problem affecting 112 million people - particularly in sub-Saharan Africa. Microscopic examination of urine samples to detect parasite eggs still remains as definitive diagnosis. This work was focussed on developing a novel loop-mediated isothermal amplification (LAMP) assay for detection of S. haematobium DNA in human urine samples as a high-throughput, simple, accurate and affordable diagnostic tool to use in diagnosis of urogenital schistosomiasis. Methodology/Principal Findings A LAMP assay targeting a species specific sequence of S. haematobium ribosomal intergenic spacer was designed. The effectiveness of our LAMP was assessed in a number of patients´ urine samples with microscopy confirmed S. haematobium infection. For potentially large-scale application in field conditions, different DNA extraction methods, including a commercial kit, a modified NaOH extraction method and a rapid heating method were tested using small volumes of urine fractions (whole urine, supernatants and pellets). The heating of pellets from clinical samples was the most efficient method to obtain good-quality DNA detectable by LAMP. The detection limit of our LAMP was 1 fg/µL of S. haematobium DNA in urine samples. When testing all patients´ urine samples included in our study, diagnostic parameters for sensitivity and specificity were calculated for LAMP assay, 100% sensitivity (95% CI: 81.32%-100%) and 86.67% specificity (95% CI: 75.40%-94.05%), and also for microscopy detection of eggs in urine samples, 69.23% sensitivity (95% CI: 48.21% -85.63%) and 100% specificity (95% CI: 93.08%-100%). Conclusions/Significance We have developed and evaluated, for the first time, a LAMP assay for detection of S. haematobium DNA in heated pellets from patients´ urine samples using no complicated requirement procedure for DNA extraction. The procedure has been named the Rapid-Heat LAMPellet method and has the potential to be developed further as a field diagnostic tool for use in urogenital schistosomiasis-endemic areas. PMID:26230990

New Light Sources and Concepts for Electro-Optic Sampling

DTIC Science & Technology

1994-03-01

Research to improve electro - optic sampling led to the development of several high performance optical phase modulators. These phase modulators serve...method of optical pulse shape measurement was demonstrated with 3 ps time resolution, excellent power sensitivity and relative system simplicity. These experiments have opened up the field of temporal optics. Electro - optic sampling.

40 CFR 1048.515 - What are the field-testing procedures?

Code of Federal Regulations, 2010 CFR

2010-07-01

... CFR part 1065, subpart J, we describe the equipment and sampling methods for testing engines in the... specify in § 1048.101(c) for any continuous sampling period of at least 120 seconds under the following ranges of operation and operating conditions: (1) Engine operation during the emission sampling period...

Emissions from Prescribed Burning of Agricultural Fields in the Pacific Northwest

EPA Science Inventory

Prescribed burns of winter wheat stubble and Kentucky bluegrass fields in northern Idaho and eastern Washington states (U.S.A.) were sampled using ground-, aerostat-, airplane-, and laboratory-based measurement platforms to determine emission factors, compare methods, and provide...

CTEPP NC DATA QA/QC RESULTS

EPA Science Inventory

This data set contains the method performance results. This includes field blanks, method blanks, duplicate samples, analytical duplicates, matrix spikes, and surrogate recovery standards.

The Children’s Total Exposure to Persistent Pesticides and Other Persistent Pollutant (...

Further details on the applicability of Thellier paleointensity method: The effect of magnitude of laboratory field

NASA Astrophysics Data System (ADS)

Morales, Juan; Goguitchaichvili, Avto; Alva-Valdivia, Luis M.; Urrutia-Fucugauchi, Jaime

2006-06-01

Twenty years after Tanaka and Kono's pioneering contribution (Tanaka and Kono, 1984), we give some new details on the effect of applied field strength during Thellier paleointensity experiments. Special attention is paid to the relation of magnitude of laboratory field and Coe's quality factors (Coe et al., 1978). Full thermoremanent magnetizations were imparted on natural samples containing low-Ti titanomagnetites of pseudo-single domain structure in a 40-μT magnetic field from 600 °C to room temperature. The samples were subjected to the routine Thellier procedure using a wide range of applied laboratory fields. Results indicate that values of laboratory fields may be accurately reproduced within 2% of standard error. The quality factors, however, decrease when the magnitude of 'ancient' field does not match to applied laboratory fields. To cite this article: J. Morales et al., C. R. Geoscience 338 (2006).

Detecting spatial structures in throughfall data: the effect of extent, sample size, sampling design, and variogram estimation method

NASA Astrophysics Data System (ADS)

Voss, Sebastian; Zimmermann, Beate; Zimmermann, Alexander

2016-04-01

In the last three decades, an increasing number of studies analyzed spatial patterns in throughfall to investigate the consequences of rainfall redistribution for biogeochemical and hydrological processes in forests. In the majority of cases, variograms were used to characterize the spatial properties of the throughfall data. The estimation of the variogram from sample data requires an appropriate sampling scheme: most importantly, a large sample and an appropriate layout of sampling locations that often has to serve both variogram estimation and geostatistical prediction. While some recommendations on these aspects exist, they focus on Gaussian data and high ratios of the variogram range to the extent of the study area. However, many hydrological data, and throughfall data in particular, do not follow a Gaussian distribution. In this study, we examined the effect of extent, sample size, sampling design, and calculation methods on variogram estimation of throughfall data. For our investigation, we first generated non-Gaussian random fields based on throughfall data with heavy outliers. Subsequently, we sampled the fields with three extents (plots with edge lengths of 25 m, 50 m, and 100 m), four common sampling designs (two grid-based layouts, transect and random sampling), and five sample sizes (50, 100, 150, 200, 400). We then estimated the variogram parameters by method-of-moments and residual maximum likelihood. Our key findings are threefold. First, the choice of the extent has a substantial influence on the estimation of the variogram. A comparatively small ratio of the extent to the correlation length is beneficial for variogram estimation. Second, a combination of a minimum sample size of 150, a design that ensures the sampling of small distances and variogram estimation by residual maximum likelihood offers a good compromise between accuracy and efficiency. Third, studies relying on method-of-moments based variogram estimation may have to employ at least 200 sampling points for reliable variogram estimates. These suggested sample sizes exceed the numbers recommended by studies dealing with Gaussian data by up to 100 %. Given that most previous throughfall studies relied on method-of-moments variogram estimation and sample sizes << 200, our current knowledge about throughfall spatial variability stands on shaky ground.

Detecting spatial structures in throughfall data: The effect of extent, sample size, sampling design, and variogram estimation method

NASA Astrophysics Data System (ADS)

Voss, Sebastian; Zimmermann, Beate; Zimmermann, Alexander

2016-09-01

In the last decades, an increasing number of studies analyzed spatial patterns in throughfall by means of variograms. The estimation of the variogram from sample data requires an appropriate sampling scheme: most importantly, a large sample and a layout of sampling locations that often has to serve both variogram estimation and geostatistical prediction. While some recommendations on these aspects exist, they focus on Gaussian data and high ratios of the variogram range to the extent of the study area. However, many hydrological data, and throughfall data in particular, do not follow a Gaussian distribution. In this study, we examined the effect of extent, sample size, sampling design, and calculation method on variogram estimation of throughfall data. For our investigation, we first generated non-Gaussian random fields based on throughfall data with large outliers. Subsequently, we sampled the fields with three extents (plots with edge lengths of 25 m, 50 m, and 100 m), four common sampling designs (two grid-based layouts, transect and random sampling) and five sample sizes (50, 100, 150, 200, 400). We then estimated the variogram parameters by method-of-moments (non-robust and robust estimators) and residual maximum likelihood. Our key findings are threefold. First, the choice of the extent has a substantial influence on the estimation of the variogram. A comparatively small ratio of the extent to the correlation length is beneficial for variogram estimation. Second, a combination of a minimum sample size of 150, a design that ensures the sampling of small distances and variogram estimation by residual maximum likelihood offers a good compromise between accuracy and efficiency. Third, studies relying on method-of-moments based variogram estimation may have to employ at least 200 sampling points for reliable variogram estimates. These suggested sample sizes exceed the number recommended by studies dealing with Gaussian data by up to 100 %. Given that most previous throughfall studies relied on method-of-moments variogram estimation and sample sizes ≪200, currently available data are prone to large uncertainties.

Magneto-acousto-electrical tomography: a potential method for imaging current density and electrical impedance.

PubMed

Haider, S; Hrbek, A; Xu, Y

2008-06-01

Primarily this report outlines our investigation on utilizing magneto-acousto-electrical-tomography (MAET) to image the lead field current density in volume conductors. A lead field current density distribution is obtained when a current/voltage source is applied to a sample via a pair of electrodes. This is the first time a high-spatial-resolution image of current density is presented using MAET. We also compare an experimental image of current density in a sample with its corresponding numerical simulation. To image the lead field current density, rather than applying a current/voltage source directly to the sample, we place the sample in a static magnetic field and focus an ultrasonic pulse on the sample to simulate a point-like current dipole source at the focal point. Then by using electrodes we measure the voltage/current signal which, based on the reciprocity theorem, is proportional to a component of the lead field current density. In the theory section, we derive the equation relating the measured voltage to the lead field current density and the displacement velocity caused by ultrasound. The experimental data include the MAET signal and an image of the lead field current density for a thin sample. In addition, we discuss the potential improvements for MAET especially to overcome the limitation created by the observation that no signal was detected from the interior of a region having a uniform conductivity. As an auxiliary we offer a mathematical formula whereby the lead field current density may be utilized to reconstruct the distribution of the electrical impedance in a piecewise smooth object.

Characterization of fission gas bubbles in irradiated U-10Mo fuel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Casella, Andrew M.; Burkes, Douglas E.; MacFarlan, Paul J.

2017-09-01

Irradiated U-10Mo fuel samples were prepared with traditional mechanical potting and polishing methods with in a hot cell. They were then removed and imaged with an SEM located outside of a hot cell. The images were then processed with basic imaging techniques from 3 separate software packages. The results were compared and a baseline method for characterization of fission gas bubbles in the samples is proposed. It is hoped that through adoption of or comparison to this baseline method that sample characterization can be somewhat standardized across the field of post irradiated examination of metal fuels.

Field method for the determination of hexavalent chromium by ultrasonication and strong anion-exchange solid-phase extraction.

PubMed

Wang, J; Ashley, K; Marlow, D; England, E C; Carlton, G

1999-03-01

A simple, fast, sensitive, and economical field method was developed and evaluated for the determination of hexavalent chromium (CrVI) in environmental and workplace air samples. By means of ultrasonic extraction in combination with a strong anion-exchange solid-phase extraction (SAE-SPE) technique, the filtration, isolation, and determination of CrVI in the presence of trivalent chromium (CrIII) and potential interferents was achieved. The method entails (1) ultrasonication in basic ammonium buffer solution to extract CrVI from environmental matrixes; (2) SAE-SPE to separate CrVI from CrIII and interferences; (3) elution/acidification of the eluate; (4) complexation of chromium with 1,5-diphenylcarbazide; and (5) spectrophotometric determination of the colored chromium-diphenylcarbazone complex. Several critical parameters were optimized in order to effect the extraction of both soluble (K2CrO4) and insoluble (PbCrO4) forms of CrVI without inducing CrIII oxidation or CrVI reduction. The method allowed for the dissolution and purification of CrVI from environmental and workplace air sample matrixes for up to 24 samples simultaneously in less than 90 min (including ultrasonication). The results demonstrated that the method was simple, fast, quantitative, and sufficiently sensitive for the determination of occupational exposures of CrVI. The method is applicable for on-site monitoring of CrVI in environmental and industrial hygiene samples.

The role of field auditing in environmental quality assurance management.

PubMed

Claycomb, D R

2000-01-01

Environmental data quality improvement continues to focus on analytical laboratoryperformance with little, if any, attention given to improving the performance of field consultants responsible for sample collection. Many environmental professionals often assume that the primary opportunity for data error lies within the activities conducted by the laboratory. Experience in the evaluation of environmental data and project-wide quality assurance programs indicates that an often-ignored factor affecting environmental data quality is the manner in which a sample is acquired and handled in the field. If a sample is not properly collected, preserved, stored, and transported in the field, even the best laboratory practices and analytical methods cannot deliver accurate and reliable data (i.e., bad data in equals bad data out). Poor quality environmental data may result in inappropriate decisions regarding site characterization and remedial action. Field auditing is becoming an often-employed technique for examining the performance of the environmental sampling field team and how their performance may affect data quality. The field audits typically focus on: (1) verifying that field consultants adhere to project control documents (e.g., Work Plans and Standard Operating Procedures [SOPs]) during field operations; (2) providing third-party independent assurance that field procedures, quality assurance/ quality control (QA/QC)protocol, and field documentation are sufficient to produce data of satisfactory quality; (3) providing a defense in the event that field procedures are called into question; and (4) identifying ways to reduce sampling costs. Field audits are typically most effective when performed on a surprise basis; that is, the sampling contractor may be aware that a field audit will be conducted during some phase of sampling activities but is not informed of the specific day(s) that the audit will be conducted. The audit also should be conducted early on in the sampling program such that deficiencies noted during the audit can be addressed before the majority of field activities have been completed. A second audit should be performed as a follow-up to confirm that the recommended changes have been implemented. A field auditor is assigned to the project by matching, as closely as possible, the auditor's experience with the type of field activities being conducted. The auditor uses a project-specific field audit checklist developed from key information contained in project control documents. Completion of the extensive audit checklist during the audit focuses the auditor on evaluating each aspect of field activities being performed. Rather than examine field team performance after sampling, a field auditor can do so while the samples are being collected and can apply real-time corrective action as appropriate. As a result of field audits, responsible parties often observe vast improvements in their consultant's field procedures and, consequently, receive more reliable and representative field data at a lower cost. The cost savings and improved data quality that result from properly completed field audits make the field auditing process both cost-effective and functional.

Characterizing the Conformational Landscape of Flavivirus Fusion Peptides via Simulation and Experiment

PubMed Central

Marzinek, Jan K.; Lakshminarayanan, Rajamani; Goh, Eunice; Huber, Roland G.; Panzade, Sadhana; Verma, Chandra; Bond, Peter J.

2016-01-01

Conformational changes in the envelope proteins of flaviviruses help to expose the highly conserved fusion peptide (FP), a region which is critical to membrane fusion and host cell infection, and which represents a significant target for antiviral drugs and antibodies. In principle, extended timescale atomic-resolution simulations may be used to characterize the dynamics of such peptides. However, the resultant accuracy is critically dependent upon both the underlying force field and sufficient conformational sampling. In the present study, we report a comprehensive comparison of three simulation methods and four force fields comprising a total of more than 40 μs of sampling. Additionally, we describe the conformational landscape of the FP fold across all flavivirus family members. All investigated methods sampled conformations close to available X-ray structures, but exhibited differently populated ensembles. The best force field / sampling combination was sufficiently accurate to predict that the solvated peptide fold is less ordered than in the crystallographic state, which was subsequently confirmed via circular dichroism and spectrofluorometric measurements. Finally, the conformational landscape of a mutant incapable of membrane fusion was significantly shallower than wild-type variants, suggesting that dynamics should be considered when therapeutically targeting FP epitopes. PMID:26785994

Improved definition of crustal anomalies for Magsat data

NASA Technical Reports Server (NTRS)

1981-01-01

A scheme was developed for separating the portions of the magnetic field measured by the Magsat 1 satellite that arise from internal and external sources. To test this method, a set of sample coefficients were used to compute the field values along a simulated satellite orbit. This data was then used to try to recover the original coefficients. Matrix inversion and recursive least squares methods were used to solve for the input coefficients. The accuracy of the two methods are compared.

Operation Guiding Light-Scientific Program and Field Plan. The Pilot Field Experiment for NORDA Project Chemical Dynamics in Ocean Frontal Areas

DTIC Science & Technology

1985-03-01

distribution. Samples of suspended partici’lates will also be collected for later image and elemental analysis . 25 Method of analysis for particle...will be flow injection analysis . This method will allow rapid, continuous analysis of seawater nutrients. Measurements will be made at one minute...5 m intervals) as well as from the underway pumping system. Method of pigment analysis for porphyrin and carotenoid pigments will be separation by

Performance Evaluation of a Salivary Amylase Biosensor for Stress Assessment in Military Field Research.

PubMed

Peng, Henry T; Savage, Erin; Vartanian, Oshin; Smith, Shane; Rhind, Shawn G; Tenn, Catherine; Bjamason, Stephen

2016-05-01

A convenient biosensor for real-time measurement of biomarkers for in-field psychophysiological stress research and military operations is desirable. We evaluated a hand-held device for measuring salivary amylase as a stress marker in medical technicians undergoing combat casualty care training using two different modalities in operating room and field settings. Salivary amylase activity was measured by two biosensor methods: directly sampling saliva with a test strip placed under the tongue or pipetting a fixed volume of precollected saliva onto the test strip, followed by analyzing the sample on the strip using a biosensor. The two methods were compared for their accuracy and sensitivity to detect the stress response using an enzyme assay method as a standard. The measurements from the under-the-tongue method were not as consistent with those from the standard assay method as the values obtained from the pipetting method. The under-the-tongue method did not detect any significant increase in the amylase activity due to stress in the operating room (P > 0.1), in contrast to the significant increases observed using the pipetting method and assay method with a significance level less than 0.05 and 0.1, respectively. Furthermore, the under-the-tongue method showed no increased amylase activity in the field testing, while both the pipetting method and assay method showed increased amylase activity in the same group (P < 0.1). The accuracy and consistency of the biosensors need to be improved when used to directly measure salivary amylase activity under the tongue for stress assessment in military medical training. © 2015 Her Majesty the Queen in Right of Canada. Journal of Clinical Laboratory Analysis published by Wiley Periodicals, Inc. Reproduced with the permission DRDC Editorial Board.

Rock magnetic properties of dusty olivine: comparison and calibration of non-heating paleointensity methods

NASA Astrophysics Data System (ADS)

Lappe, S. L.; Harrison, R. J.; Feinberg, J. M.

2012-12-01

The mechanism of chondrule formation is an important outstanding question in cosmochemistry. Magnetic signals recorded by Fe-Ni nanoparticles in chondrules could carry clues to their origin. Recently, research in this area has focused on 'dusty olivine' in ordinary chondrites as potential carriers of pre-accretionary remanence. Dusty olivine is characterised by the presence of sub-micron Fe-Ni inclusions within the olivine host. These metal particles form via subsolidus reduction of the olivine during chondrule formation and are thought to be protected from subsequent chemical and thermal alteration by the host olivine. Three sets of synthetic dusty olivines have been produced, using natural olivine (average Ni-content of 0.3 wt%), synthetic Ni-containing olivine (0.1wt% Ni) and synthetic Ni-free olivine as starting materials. The starting materials were ground to powders, packed into a 8-27 mm3 graphite crucible, heated up to 1350°C under a pure CO gas flow and kept at this temperature for 10 minutes. After this the samples were held in fixed orientation and quenched into water in a range of known magnetic fields from 0.2 mT to 1.5 mT. We present a comparison of all non-heating methods commonly used for paleointensity determination of extraterrestrial material. All samples showed uni-directional, single-component demagnetization behaviour. Saturation REM ratio (NRM/SIRM) and REMc ratio show non-linear behaviour as function of applied field and a saturation value < 1. Using the REM' method the samples showed approximately constant REM' between 100 and 150 mT AF-field. Plotting the average values for this field range again shows non-linear behaviour and a saturation value < 1. Another approach we examined to obtain calibration curves for paleointensity determination is based on ARM measurents. We also present an analysis of a new FORC-based method of paleointensity determination applied to metallic Fe-bearing samples [1, 2]. The method uses a first-order reversal curve (FORC) diagram to generate a Preisach distribution of coercivities and interaction fields within the sample and then physically models the acquisition of TRM as function of magnetic field, temperature and time using thermal relaxation theory. The comparison of observed and calculated NRM demagnetisation spectra is adversely effected by a large population of particles in the single-vortex state. Comparison of observed and calculated REM' curves, however, yields much closer agreement in the high-coercivity SD-dominated range. Calculated values of the average REM' ratio show excellent agreement with the experimental values - including the observed non-linearity of the remanence acquisition curve - suggesting that this method has the potential to reduce the uncertainties in non-heating paleointensity methods for extraterrestrial samples. [1] AR Muxworthy and D Heslop(2011) A Preisach method for estimating absolute paleofield intensity under the constraint of using only isothermal measurements: 1. Theoretical framework. Journal of Geophysical Research, 116, B04102, doi:10.1029/2010JB007843. [2] AR Muxworthy, D Heslop, GA Paterson, and D Michalk. A Preisach method for estimating absolute paleofield intensity under the constraint of using only isothermal measurements: 2. Experimental testing. Journal of Geophysical Research, 116, B04103, doi:10.1029/2010JB007844.

New approach to estimating variability in visual field data using an image processing technique.

PubMed Central

Crabb, D P; Edgar, D F; Fitzke, F W; McNaught, A I; Wynn, H P

1995-01-01

AIMS--A new framework for evaluating pointwise sensitivity variation in computerised visual field data is demonstrated. METHODS--A measure of local spatial variability (LSV) is generated using an image processing technique. Fifty five eyes from a sample of normal and glaucomatous subjects, examined on the Humphrey field analyser (HFA), were used to illustrate the method. RESULTS--Significant correlation between LSV and conventional estimates--namely, HFA pattern standard deviation and short term fluctuation, were found. CONCLUSION--LSV is not dependent on normals' reference data or repeated threshold determinations, thus potentially reducing test time. Also, the illustrated pointwise maps of LSV could provide a method for identifying areas of fluctuation commonly found in early glaucomatous field loss. PMID:7703196

Information engineering for molecular diagnostics.

PubMed Central

Sorace, J. M.; Ritondo, M.; Canfield, K.

1994-01-01

Clinical laboratories are beginning to apply the recent advances in molecular biology to the testing of patient samples. The emerging field of Molecular Diagnostics will require a new Molecular Diagnostics Laboratory Information System which handles the data types, samples and test methods found in this field. The system must be very flexible in regards to supporting ad-hoc queries. The requirements which are shaping the developments in this field are reviewed and a data model developed. Several queries which demonstrate the data models ability to support the information needs of this area have been developed and run. These results demonstrate the ability of the purposed data model to meet the current and projected needs of this rapidly expanding field. PMID:7949937

Application of a Stir Bar Sorptive Extraction sample preparation method with HPLC for soil fungal biomass determination in soils from a detrital manipulation study.

PubMed

Beni, Áron; Lajtha, Kate; Kozma, János; Fekete, István

2017-05-01

Ergosterol is a sterol found ubiquitously in cell membranes of filamentous fungi. Although concentrations in different fungal species span the range of 2.6 to 42μg/mL of dry mass, many studies have shown a strong correlation between soil ergosterol content and fungal biomass. The analysis of ergosterol in soil therefore could be an effective tool for monitoring changes in fungal biomass under different environmental conditions. Stir Bar Sorptive Extraction (SBSE) is a new sample preparation method to extract and concentrate organic analytes from liquid samples. SBSE was here demonstrated to be a simple, fast, and cost effective method for the quantitative analysis of ergosterol from field-collected soils. Using this method we observed that soil ergosterol as a measure of fungal biomass proved to be a sensitive indicator of soil microbial dynamics that were altered by changes in plant detrital inputs to soils in a long-term field experiment. Copyright © 2017 Elsevier B.V. All rights reserved.

DEVELOPMENT AND APPLICATION OF METHODS TO ASSESS HUMAN EXPOSURE TO PESTICIDES

EPA Science Inventory

Note: this task is schedule to end September 2003. Two tasks will take its place: method development for emerging pesticides including chiral chemistry applications, and in-house laboratory operations. Field sampling methods are covered under a new task proposed this year.
<...

One-day rate measurements for estimating net nitrification potential in humid forest soils

USGS Publications Warehouse

Ross, D.S.; Fredriksen, G.; Jamison, A.E.; Wemple, B.C.; Bailey, S.W.; Shanley, J.B.; Lawrence, G.B.

2006-01-01

Measurements of net nitrification rates in forest soils have usually been performed by extended sample incubation (2-8 weeks), either in the field or in the lab. Because of disturbance effects, these measurements are only estimates of nitrification potential and shorter incubations may suffice. In three separate studies of northeastern USA forest soil surface horizons, we found that laboratory nitrification rates measured over 1 day related well to those measured over 4 weeks. Soil samples of Oa or A horizons were mixed by hand and the initial extraction of subsamples, using 2 mol L-1 KCl, occurred in the field as soon as feasible after sampling. Soils were kept near field temperature and subsampled again the following day in the laboratory. Rates measured by this method were about three times higher than the 4-week rates. Variability in measured rates was similar over either incubation period. Because NO3- concentrations were usually quite low in the field, average rates from 10 research watersheds could be estimated with only a single, 1-day extraction. Methodological studies showed that the concentration of NH4+ increased slowly during contact time with the KCl extractant and, thus, this contact time should be kept similar during the procedure. This method allows a large number of samples to be rapidly assessed. ?? 2006 Elsevier B.V. All rights reserved.

Nutrient and pesticide contamination bias estimated from field blanks collected at surface-water sites in U.S. Geological Survey Water-Quality Networks, 2002–12

USGS Publications Warehouse

Medalie, Laura; Martin, Jeffrey D.

2017-08-14

Potential contamination bias was estimated for 8 nutrient analytes and 40 pesticides in stream water collected by the U.S. Geological Survey at 147 stream sites from across the United States, and representing a variety of hydrologic conditions and site types, for water years 2002–12. This study updates previous U.S. Geological Survey evaluations of potential contamination bias for nutrients and pesticides. Contamination is potentially introduced to water samples by exposure to airborne gases and particulates, from inadequate cleaning of sampling or analytic equipment, and from inadvertent sources during sample collection, field processing, shipment, and laboratory analysis. Potential contamination bias, based on frequency and magnitude of detections in field blanks, is used to determine whether or under what conditions environmental data might need to be qualified for the interpretation of results in the context of comparisons with background levels, drinking-water standards, aquatic-life criteria or benchmarks, or human-health benchmarks. Environmental samples for which contamination bias as determined in this report applies are those from historical U.S. Geological Survey water-quality networks or programs that were collected during the same time frame and according to the same protocols and that were analyzed in the same laboratory as field blanks described in this report.Results from field blanks for ammonia, nitrite, nitrite plus nitrate, orthophosphate, and total phosphorus were partitioned by analytical method; results from the most commonly used analytical method for total phosphorus were further partitioned by date. Depending on the analytical method, 3.8, 9.2, or 26.9 percent of environmental samples, the last of these percentages pertaining to all results from 2007 through 2012, were potentially affected by ammonia contamination. Nitrite contamination potentially affected up to 2.6 percent of environmental samples collected between 2002 and 2006 and affected about 3.3 percent of samples collected between 2007 and 2012. The percentages of environmental samples collected between 2002 and 2011 that were potentially affected by nitrite plus nitrate contamination were 7.3 for samples analyzed with the low-level method and 0.4 for samples analyzed with the standard-level method. These percentages increased to 14.8 and 2.2 for samples collected in 2012 and analyzed using replacement low- and standard-level methods, respectively. The maximum potentially affected concentrations for nitrite and for nitrite plus nitrate were much less than their respective maximum contamination levels for drinking-water standards. Although contamination from particulate nitrogen can potentially affect up to 21.2 percent and that from total Kjeldahl nitrogen can affect up to 16.5 percent of environmental samples, there are no critical or background levels for these substances.For total nitrogen, orthophosphate, and total phosphorus, contamination in a small percentage of environmental samples might be consequential for comparisons relative to impairment risks or background levels. At the low ends of the respective ranges of impairment risk for these nutrients, contamination in up to 5 percent of stream samples could account for at least 23 percent of measured concentrations of total nitrogen, for at least 40 or 90 percent of concentrations of orthophosphate, depending on the analytical method, and for 31 to 76 percent of concentrations of total phosphorus, depending on the time period.Twenty-six pesticides had no detections in field blanks. Atrazine with 12 and metolachlor with 11 had the highest number of detections, mostly occurring in spring or early summer. At a 99-percent level of confidence, contamination was estimated to be no greater than the detection limit in at least 98 percent of all samples for 38 of 40 pesticides. For metolachlor and atrazine, potential contamination was no greater than 0.0053 and 0.0093 micrograms per liter in 98 percent of samples. For 11 of 14 pesticides with at least one detection, the maximum potentially affected concentration of the environmental sample was less than their respective human-health or aquatic-life benchmarks. Small percentages of environmental samples had concentrations high enough that atrazine contamination potentially could account for the entire aquatic-life benchmark for acute effects on nonvascular plants, that dieldrin contamination could account for up to 100 percent of the cancer health-based screening level, or that chlorpyrifos contamination could account for 13 or 12 percent of the concentrations in the aquatic-life benchmarks for chronic effects on invertebrates or the criterion continuous concentration for chronic effects on aquatic life.

Quantitative characterization of spin-orbit torques in Pt/Co/Pt/Co/Ta/BTO heterostructures due to the magnetization azimuthal angle dependence

NASA Astrophysics Data System (ADS)

Engel, Christian; Goolaup, Sarjoosing; Luo, Feilong; Lew, Wen Siang

2017-08-01

Substantial understanding of spin-orbit interactions in heavy-metal (HM)/ferromagnet (FM) heterostructures is crucial in developing spin-orbit torque (SOT) spintronics devices utilizing spin Hall and Rashba effects. Though the study of SOT effective field dependence on the out-of-plane magnetization angle has been relatively extensive, the understanding of in-plane magnetization angle dependence remains unknown. Here, we analytically propose a method to compute the SOT effective fields as a function of the in-plane magnetization angle using the harmonic Hall technique in perpendicular magnetic anisotropy (PMA) structures. Two different samples with PMA, a Pt /Co /Pt /Co /Ta /BaTi O3 (BTO) test sample and a Pt/Co/Pt/Co/Ta reference sample, are studied using the derived formula. Our measurements reveal that only the dampinglike field of the test sample with a BTO capping layer exhibits an in-plane magnetization angle dependence, while no angular dependence is found in the reference sample. The presence of the BTO layer in the test sample, which gives rise to a Rashba effect at the interface, is ascribed as the source of the angular dependence of the dampinglike field.

Sampling and Reconstruction of the Pupil and Electric Field for Phase Retrieval

NASA Technical Reports Server (NTRS)

Dean, Bruce; Smith, Jeffrey; Aronstein, David

2012-01-01

This technology is based on sampling considerations for a band-limited function, which has application to optical estimation generally, and to phase retrieval specifically. The analysis begins with the observation that the Fourier transform of an optical aperture function (pupil) can be implemented with minimal aliasing for Q values down to Q = 1. The sampling ratio, Q, is defined as the ratio of the sampling frequency to the band-limited cut-off frequency. The analytical results are given using a 1-d aperture function, and with the electric field defined by the band-limited sinc(x) function. Perfect reconstruction of the Fourier transform (electric field) is derived using the Whittaker-Shannon sampling theorem for 1

Computational study of the free energy landscape of the miniprotein CLN025 in explicit and implicit solvent.

PubMed

Rodriguez, Alex; Mokoema, Pol; Corcho, Francesc; Bisetty, Khrisna; Perez, Juan J

2011-02-17

The prediction capabilities of atomistic simulations of peptides are hampered by different difficulties, including the reliability of force fields, the treatment of the solvent or the adequate sampling of the conformational space. In this work, we have studied the conformational profile of the 10 residue miniprotein CLN025 known to exhibit a β-hairpin in its native state to understand the limitations of implicit methods to describe solvent effects and how these may be compensated by using different force fields. For this purpose, we carried out a thorough sampling of the conformational space of CLN025 in explicit solvent using the replica exchange molecular dynamics method as a sampling technique and compared the results with simulations of the system modeled using the analytical linearized Poisson-Boltzmann (ALPB) method with three different AMBER force fields: parm94, parm96, and parm99SB. The results show the peptide to exhibit a funnel-like free energy landscape with two minima in explicit solvent. In contrast, the higher minimum nearly disappears from the energy surface when the system is studied with an implicit representation of the solvent. Moreover, the different force fields used in combination with the ALPB method do not describe the system in the same manner. The results of this work suggest that the balance between intra- and intermolecular interactions is the cause of the differences between implicit and explicit solvent simulations in this system, stressing the role of the environment to define properly the conformational profile of a peptide in solution.

Determination of alkylbenzenesulfonate surfactants in groundwater using macroreticular resins and carbon-13 nuclear magnetic resonance spectrometry

USGS Publications Warehouse

Thurman, E.M.; Willoughby, T.; Barber, L.B.; Thorn, K.A.

1987-01-01

Alkylbenzenesulfonate surfactants were determined in groundwater at concentrations as low as 0.3 mg/L. The method uses XAD-8 resin for concentration, followed by elution with methanol, separation of anionic and nonionic surfactants by anion exchange, quantitation by titration, and identification by 13C nuclear magnetic resonance spectrometry. Laboratory standards and field samples containing straight-chain and branched-chain alkylbenzenesulfonates, sodium dodecyl sulfate, and alkylbenzene ethoxylates were studied. The XAD-8 extraction of surfactants from groundwater was completed in the field, which simplified sample preservation and reduced the cost of transporting samples.

Dual-stage trapped-flux magnet cryostat for measurements at high magnetic fields

DOEpatents

Islam, Zahirul; Das, Ritesh K.; Weinstein, Roy

2015-04-14

A method and a dual-stage trapped-flux magnet cryostat apparatus are provided for implementing enhanced measurements at high magnetic fields. The dual-stage trapped-flux magnet cryostat system includes a trapped-flux magnet (TFM). A sample, for example, a single crystal, is adjustably positioned proximate to the surface of the TFM, using a translation stage such that the distance between the sample and the surface is selectively adjusted. A cryostat is provided with a first separate thermal stage provided for cooling the TFM and with a second separate thermal stage provided for cooling sample.

Collection methods and quality assessment for Esche-richia coli, water quality, and microbial source tracking data within Tumacácori National Historical Park and the upper Santa Cruz River, Arizona, 2015-16

USGS Publications Warehouse

Paretti, Nicholas; Coes, Alissa L.; Kephart, Christopher M.; Mayo, Justine

2018-03-05

Tumacácori National Historical Park protects the culturally important Mission, San José de Tumacácori, while also managing a portion of the ecologically diverse riparian corridor of the Santa Cruz River. This report describes the methods and quality assurance procedures used in the collection of water samples for the analysis of Escherichia coli (E. coli), microbial source tracking markers, suspended sediment, water-quality parameters, turbidity, and the data collection for discharge and stage; the process for data review and approval is also described. Finally, this report provides a quantitative assessment of the quality of the E. coli, microbial source tracking, and suspended sediment data.The data-quality assessment revealed that bias attributed to field and laboratory contamination was minimal, with E. coli detections in only 3 out of 33 field blank samples analyzed. Concentrations in the field blanks were several orders of magnitude lower than environmental concentrations. The microbial source tracking (MST) field blank was below the detection limit for all MST markers analyzed. Laboratory blanks for E. coli at the USGS Arizona Water Science Center and laboratory blanks for MST markers at the USGS Ohio Water Microbiology Laboratory were all below the detection limit. Irreplicate data for E. coli and suspended sediment indicated that bias was not introduced to the data by combining samples collected using discrete sampling methods with samples collected using automatic sampling methods.The split and sequential E. coli replicate data showed consistent analytical variability and a single equation was developed to explain the variability of E. coli concentrations. An additional analysis of analytical variability for E. coli indicated analytical variability around 18 percent relative standard deviation and no trend was observed in the concentration during the processing and analysis of multiple split-replicates. Two replicate samples were collected for MST and individual markers were compared for a base flow and flood sample. For the markers found in common between the two types of samples, the relative standard deviation for the base flow sample was more than 3 times greater than the markers in the flood sample. Sequential suspended sediment replicates had a relative standard deviation of about 1.3 percent, indicating that environmental and analytical variability was minimal.A holding time review and laboratory study analysis supported the extended holding times required for this investigation. Most concentrations for flood and base-flow samples were within the theoretical variability specified in the most probable number approach suggesting that extended hold times did not overly influence the final concentrations reported.

Integrated Field Analyses of Thermal Springs

NASA Astrophysics Data System (ADS)

Shervais, K.; Young, B.; Ponce-Zepeda, M. M.; Rosove, S.

2011-12-01

A group of undergraduate researchers through the SURE internship offered by the Southern California Earthquake Center (SCEC) have examined thermal springs in southern Idaho, northern Utah as well as mud volcanoes in the Salton Sea, California. We used an integrated approach to estimate the setting and maximum temperature, including water chemistry, Ipad-based image and data-base management, microbiology, and gas analyses with a modified Giggenbach sampler.All springs were characterized using GISRoam (tmCogent3D). We are performing geothermometry calculations as well as comparisons with temperature gradient data on the results while also analyzing biological samples. Analyses include water temperature, pH, electrical conductivity, and TDS measured in the field. Each sample is sealed and chilled and delivered to a water lab within 12 hours.Temperatures are continuously monitored with the use of Solinst Levelogger Juniors. Through partnership with a local community college geology club, we receive results on a monthly basis and are able to process initial data earlier in order to evaluate data over a longer time span. The springs and mudpots contained microbial organisms which were analyzed using methods of single colony isolation, polymerase chain reaction, and DNA sequencing showing the impact of the organisms on the springs or vice versa. Soon we we will collect gas samples at sites that show signs of gas. This will be taken using a hybrid of the Giggenbach method and our own methods. Drawing gas samples has proven a challenge, however we devised a method to draw out gas samples utilizing the Giggenbach flask, transferring samples to glass blood sample tubes, replacing NaOH in the Giggenbach flask, and evacuating it in the field for multiple samples using a vacuum pump. We also use a floating platform devised to carry and lower a levelogger, to using an in-line fuel filter from a tractor in order to keep mud from contaminating the equipment.The use of raster imagery on the iPad2 has drastically changed how we plan and conduct our sampling trips. Orthoimagery onto the iPad2 is viewed with GISRoam and we use that imagery to help guide us toward points that we wish to visit. GISRoam was used to plot spatially correlated data points while in the field, estimate latitude and longitude, and record aforementioned data. A key factor to our success is up to the minute collaboration between all participants. Google's suite of services provides phone number for landowners, web site hosting, and the most crucial implementation for sharing data in real time has been the beta google Fusion Table. This spreadsheet allows for the incorporation of images, sample data and GPS location to be displayed as a kml file to be viewed in Google maps. This ability to modify and recognize data points in real time has made us more effective in the field, and in documenting progress in the lab. This workflow has enabled us to sample over 30 springs in 2 months, find 10 new springs, and estimate Tmax for 14 sites.By the end of 3 months we anticipate having water chemistry, isotope samples, gas samples, and Tmax determinations for 30 springs in the two study areas.

Depth assisted compression of full parallax light fields

NASA Astrophysics Data System (ADS)

Graziosi, Danillo B.; Alpaslan, Zahir Y.; El-Ghoroury, Hussein S.

2015-03-01

Full parallax light field displays require high pixel density and huge amounts of data. Compression is a necessary tool used by 3D display systems to cope with the high bandwidth requirements. One of the formats adopted by MPEG for 3D video coding standards is the use of multiple views with associated depth maps. Depth maps enable the coding of a reduced number of views, and are used by compression and synthesis software to reconstruct the light field. However, most of the developed coding and synthesis tools target linearly arranged cameras with small baselines. Here we propose to use the 3D video coding format for full parallax light field coding. We introduce a view selection method inspired by plenoptic sampling followed by transform-based view coding and view synthesis prediction to code residual views. We determine the minimal requirements for view sub-sampling and present the rate-distortion performance of our proposal. We also compare our method with established video compression techniques, such as H.264/AVC, H.264/MVC, and the new 3D video coding algorithm, 3DV-ATM. Our results show that our method not only has an improved rate-distortion performance, it also preserves the structure of the perceived light fields better.

CTEPP-OH DATA QA/QC RESULTS

EPA Science Inventory

This data set contains the method performance results for CTEPP-OH. This includes field blanks, method blanks, duplicate samples, analytical duplicates, matrix spikes, and surrogate recovery standards.

The Children’s Total Exposure to Persistent Pesticides and Other Persisten...

Microwave Nondestructive Evaluation of Dielectric Materials with a Metamaterial Lens

NASA Technical Reports Server (NTRS)

Shreiber, Daniel; Gupta, Mool; Cravey, Robin L.

2008-01-01

A novel microwave Nondestructive Evaluation (NDE) sensor was developed in an attempt to increase the sensitivity of the microwave NDE method for detection of defects small relative to a wavelength. The sensor was designed on the basis of a negative index material (NIM) lens. Characterization of the lens was performed to determine its resonant frequency, index of refraction, focus spot size, and optimal focusing length (for proper sample location). A sub-wavelength spot size (3 dB) of 0.48 lambda was obtained. The proof of concept for the sensor was achieved when a fiberglass sample with a 3 mm diameter through hole (perpendicular to the propagation direction of the wave) was tested. The hole was successfully detected with an 8.2 cm wavelength electromagnetic wave. This method is able to detect a defect that is 0.037 lambda. This method has certain advantages over other far field and near field microwave NDE methods currently in use.

Determination of traces of cobalt in soils: A field method

USGS Publications Warehouse

Almond, H.

1953-01-01

The growing use of geochemical prospecting methods in the search for ore deposits has led to the development of a field method for the determination of cobalt in soils. The determination is based on the fact that cobalt reacts with 2-nitroso-1-naphthol to yield a pink compound that is soluble in carbon tetrachloride. The carbon tetrachloride extract is shaken with dilute cyanide to complex interfering elements and to remove excess reagent. The cobalt content is estimated by comparing the pink color in the carbon tetrachloride with a standard series prepared from standard solutions. The cobalt 2-nitroso-1-naphtholate system in carbon tetrachloride follows Beer's law. As little as 1 p.p.m. can be determined in a 0.1-gram sample. The method is simple and fast and requires only simple equipment. More than 40 samples can be analyzed per man-day with an accuracy within 30% or better.

Multiframe super resolution reconstruction method based on light field angular images

NASA Astrophysics Data System (ADS)

Zhou, Shubo; Yuan, Yan; Su, Lijuan; Ding, Xiaomin; Wang, Jichao

2017-12-01

The plenoptic camera can directly obtain 4-dimensional light field information from a 2-dimensional sensor. However, based on the sampling theorem, the spatial resolution is greatly limited by the microlenses. In this paper, we present a method of reconstructing high-resolution images from the angular images. First, the ray tracing method is used to model the telecentric-based light field imaging process. Then, we analyze the subpixel shifts between the angular images extracted from the defocused light field data and the blur in the angular images. According to the analysis above, we construct the observation model from the ideal high-resolution image to the angular images. Applying the regularized super resolution method, we can obtain the super resolution result with a magnification ratio of 8. The results demonstrate the effectiveness of the proposed observation model.

Results of quality-control sampling of water, bed sediment, and tissue in the Western Lake Michigan Drainages study unit of the National Water-Quality Assessment Program

USGS Publications Warehouse

Fitzgerald, S.A.

1997-01-01

This report contains the quality control results of the Western Lake Michigan Drainages study unit of the National Water Quality Assessment Program. Quality control samples were collected in the same manner and contemporaneously with environmental samples during the first highintensity study phase in the unit (1992 through 1995) and amounted to approximately 15 percent of all samples collected. The accuracy and precision of hundreds of chemical analyses of surface and ground-water, bed sediment, and tissue was determined through the collection and analysis of field blanks, field replicates and splits, matrix spikes, and surrogates. Despite the several detections of analytes in the field blanks, the concentrations of most constituents in the environmental samples will likely be an order of magnitude or higher than those in the blanks. However, frequent detections, and high concentrations, of dissolved organic carbon (DOC) in several surface and ground-water blanks are probably significant with respect to commonly measured environmental concentrations, and the environmental data will have to be qualified accordingly. The precision of sampling of water on a percent basis, as determined from replicates and splits, was generally proportional to the concentration of the constituents, with constituents present in relatively high concentrations generally having less sampling variability than those with relatively low concentrations. In general, analytes with relatively high variability between replicates were present at concentrations near the reporting limit or were associated with relatively small absolute concentration differences, or both. Precision of replicates compared to that for splits in bed sediment samples was similar, thus eliminating sampling as a major source of variability in analyte concentrations. In the case the phthalates in bed sediment, contamination in either the field or laboratory could have caused the relatively large variability between replicate samples and between split samples.Variability of analyte concentrations in tissue samples was relatively low, being 29 percent or less for all constituents. Recoveries of most laboratory schedule 2001/2010 pesticide spike compounds in surfacewater samples were reasonably good. Low intrinsic method recovery resulted in relatively low recovery forp,p'-DDE, metribuzin, and propargite. In the case of propargite, decomposition with the environmental sample matrices was also indicated. Recoveries of two compounds, cyanazine and thiobencarb, might have been biased high due to interferences. The one laboratory schedule 2050/2051 field matrix pesticide spike indicated numerous operational problems with this method that biased recoveries either low or high. Recoveries of pesticides from both pesticide schedules in field spikes of ground-water samples generally were similar to those of field matrix spikes of surface- water samples. High maximum recoveries were noted for tebuthiuron, disulfoton, DCPA, and permethrin, which indicates the possible presence of interferents in the matrices for these compounds. Problems in the recoveries of pesticides on schedule 2050/2051 from ground-water samples generally were the same as those for surfacewater samples. Recoveries of VOCs in field matrix spikes were reasonable when consideration was given for the use of the micropipettor that delivered only about 80 percent on average of the nominal mass of spiked analytes. Finally, the recoveries of most surrogate compounds in surface and ground-water samples were reasonable. Problems in sample handling (for example, spillage) were likely not the cause of any of the low recoveries of spiked compounds.

La 2-xSr xCuO 4-δ superconducting samples prepared by the wet-chemical method

NASA Astrophysics Data System (ADS)

Loose, A.; Gonzalez, J. L.; Lopez, A.; Borges, H. A.; Baggio-Saitovitch, E.

2009-10-01

In this work, we report on the physical properties of good-quality polycrystalline superconducting samples of La 2-xSr xCu 1-yZn yO 4-δ ( y=0, 0.02) prepared by a wet-chemical method, focusing on the temperature dependence of the critical current. Using the wet-chemical method, we were able to produce samples with improved homogeneity compared to the solid-state method. A complete set of samples with several carrier concentrations, ranging from the underdoped (strontium concentration x≈0.05) to the highly overdoped ( x≈0.25) region, were prepared and investigated. The X-ray diffraction analysis, zero-field cooling magnetization and electrical resistivity measurements were reported on earlier. The structural parameters of the prepared samples seem to be slightly modified by the preparation method and their critical temperatures were lower than reported in the literature. The temperature dependence of the critical current was explained by a theoretical model which took the granular structure of the samples into account.

CONCEPTS AND APPROACHES FOR THE BIOASSESSMENT OF NON-WADEABLE STREAMS AND RIVERS

EPA Science Inventory

This document is intended to assist users in establishing or refining protocols, including the specific methods related to field sampling, laboratory sample processing, taxonomy, data entry, management and analysis, and final assessment and reporting. It also reviews and provide...

A novel sampling method for multiple multiscale targets from scattering amplitudes at a fixed frequency

NASA Astrophysics Data System (ADS)

Liu, Xiaodong

2017-08-01

A sampling method by using scattering amplitude is proposed for shape and location reconstruction in inverse acoustic scattering problems. Only matrix multiplication is involved in the computation, thus the novel sampling method is very easy and simple to implement. With the help of the factorization of the far field operator, we establish an inf-criterion for characterization of underlying scatterers. This result is then used to give a lower bound of the proposed indicator functional for sampling points inside the scatterers. While for the sampling points outside the scatterers, we show that the indicator functional decays like the bessel functions as the sampling point goes away from the boundary of the scatterers. We also show that the proposed indicator functional continuously depends on the scattering amplitude, this further implies that the novel sampling method is extremely stable with respect to errors in the data. Different to the classical sampling method such as the linear sampling method or the factorization method, from the numerical point of view, the novel indicator takes its maximum near the boundary of the underlying target and decays like the bessel functions as the sampling points go away from the boundary. The numerical simulations also show that the proposed sampling method can deal with multiple multiscale case, even the different components are close to each other.

Uncertainties in Air Exchange using Continuous-Injection, Long-Term Sampling Tracer-Gas Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sherman, Max H.; Walker, Iain S.; Lunden, Melissa M.

2013-12-01

The PerFluorocarbon Tracer (PFT) method is a low-cost approach commonly used for measuring air exchange in buildings using tracer gases. It is a specific application of the more general Continuous-Injection, Long-Term Sampling (CILTS) method. The technique is widely used but there has been little work on understanding the uncertainties (both precision and bias) associated with its use, particularly given that it is typically deployed by untrained or lightly trained people to minimize experimental costs. In this article we will conduct a first-principles error analysis to estimate the uncertainties and then compare that analysis to CILTS measurements that were over-sampled, throughmore » the use of multiple tracers and emitter and sampler distribution patterns, in three houses. We find that the CILTS method can have an overall uncertainty of 10-15percent in ideal circumstances, but that even in highly controlled field experiments done by trained experimenters expected uncertainties are about 20percent. In addition, there are many field conditions (such as open windows) where CILTS is not likely to provide any quantitative data. Even avoiding the worst situations of assumption violations CILTS should be considered as having a something like a ?factor of two? uncertainty for the broad field trials that it is typically used in. We provide guidance on how to deploy CILTS and design the experiment to minimize uncertainties.« less

Spatial characterization of the meltwater field from icebergs in the Weddell Sea.

PubMed

Helly, John J; Kaufmann, Ronald S; Vernet, Maria; Stephenson, Gordon R

2011-04-05

We describe the results from a spatial cyberinfrastructure developed to characterize the meltwater field around individual icebergs and integrate the results with regional- and global-scale data. During the course of the cyberinfrastructure development, it became clear that we were also building an integrated sampling planning capability across multidisciplinary teams that provided greater agility in allocating expedition resources resulting in new scientific insights. The cyberinfrastructure-enabled method is a complement to the conventional methods of hydrographic sampling in which the ship provides a static platform on a station-by-station basis. We adapted a sea-floor mapping method to more rapidly characterize the sea surface geophysically and biologically. By jointly analyzing the multisource, continuously sampled biological, chemical, and physical parameters, using Global Positioning System time as the data fusion key, this surface-mapping method enables us to examine the relationship between the meltwater field of the iceberg to the larger-scale marine ecosystem of the Southern Ocean. Through geospatial data fusion, we are able to combine very fine-scale maps of dynamic processes with more synoptic but lower-resolution data from satellite systems. Our results illustrate the importance of spatial cyberinfrastructure in the overall scientific enterprise and identify key interfaces and sources of error that require improved controls for the development of future Earth observing systems as we move into an era of peta- and exascale, data-intensive computing.

Spatial characterization of the meltwater field from icebergs in the Weddell Sea

PubMed Central

Helly, John J.; Kaufmann, Ronald S.; Vernet, Maria; Stephenson, Gordon R.

2011-01-01

We describe the results from a spatial cyberinfrastructure developed to characterize the meltwater field around individual icebergs and integrate the results with regional- and global-scale data. During the course of the cyberinfrastructure development, it became clear that we were also building an integrated sampling planning capability across multidisciplinary teams that provided greater agility in allocating expedition resources resulting in new scientific insights. The cyberinfrastructure-enabled method is a complement to the conventional methods of hydrographic sampling in which the ship provides a static platform on a station-by-station basis. We adapted a sea-floor mapping method to more rapidly characterize the sea surface geophysically and biologically. By jointly analyzing the multisource, continuously sampled biological, chemical, and physical parameters, using Global Positioning System time as the data fusion key, this surface-mapping method enables us to examine the relationship between the meltwater field of the iceberg to the larger-scale marine ecosystem of the Southern Ocean. Through geospatial data fusion, we are able to combine very fine-scale maps of dynamic processes with more synoptic but lower-resolution data from satellite systems. Our results illustrate the importance of spatial cyberinfrastructure in the overall scientific enterprise and identify key interfaces and sources of error that require improved controls for the development of future Earth observing systems as we move into an era of peta- and exascale, data-intensive computing. PMID:21444769

Application of the BMWP-Costa Rica biotic index in aquatic biomonitoring: sensitivity to collection method and sampling intensity.

PubMed

Gutiérrez-Fonseca, Pablo E; Lorion, Christopher M

2014-04-01

The use of aquatic macroinvertebrates as bio-indicators in water quality studies has increased considerably over the last decade in Costa Rica, and standard biomonitoring methods have now been formulated at the national level. Nevertheless, questions remain about the effectiveness of different methods of sampling freshwater benthic assemblages, and how sampling intensity may influence biomonitoring results. In this study, we compared the results of qualitative sampling using commonly applied methods with a more intensive quantitative approach at 12 sites in small, lowland streams on the southern Caribbean slope of Costa Rica. Qualitative samples were collected following the official protocol using a strainer during a set time period and macroinvertebrates were field-picked. Quantitative sampling involved collecting ten replicate Surber samples and picking out macroinvertebrates in the laboratory with a stereomicroscope. The strainer sampling method consistently yielded fewer individuals and families than quantitative samples. As a result, site scores calculated using the Biological Monitoring Working Party-Costa Rica (BMWP-CR) biotic index often differed greatly depending on the sampling method. Site water quality classifications using the BMWP-CR index differed between the two sampling methods for 11 of the 12 sites in 2005, and for 9 of the 12 sites in 2006. Sampling intensity clearly had a strong influence on BMWP-CR index scores, as well as perceived differences between reference and impacted sites. Achieving reliable and consistent biomonitoring results for lowland Costa Rican streams may demand intensive sampling and requires careful consideration of sampling methods.

Investigations of CuFeS{sub 2} semiconductor mineral from ocean rift hydrothermal vent fields by Cu NMR in a local field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matukhin, V. L.; Pogoreltsev, A. I.; Gavrilenko, A. N., E-mail: ang-2000@mail.ru

The results of investigating natural samples of chalcopyrite mineral CuFeS{sub 2} from massive oceanic sulfide ores of the Mid-Atlantic ridge by the {sup 63}Cu nuclear magnetic resonance (NMR {sup 63}Cu) in a local field at room temperature are presented. The significant width of the resonance lines found in the {sup 63}Cu NMR spectrum directly testifies to a wide distribution of local magnetic and electric fields in the investigated chalcopyrite samples. This distribution can be the consequence of an appreciable deviation of the structure of the investigated chalcopyrite samples from the stoichiometric one. The obtained results show that the pulsed {supmore » 63}Cu NMR can be an efficient method for studying the physical properties of deep-water polymetallic sulfides of the World Ocean.« less

Plasma-assisted synthesis and study of structural and magnetic properties of Fe/C core shell

NASA Astrophysics Data System (ADS)

Shinde, K. P.; Ranot, M.; Choi, C. J.; Kim, H. S.; Chung, K. C.

2017-07-01

Pure and carbon-encapsulated iron nanoparticles with an average diameter of 25 nm were synthesized by using the DC plasma arc discharge method. Fe core nanoparticles were encapsulated with carbon layer, which is acting as protection layer against both oxidation and chemical reaction. The morphology and the Fe/C core/shell structure of the nanoparticles were studied by using field emission scanning electron microscopy and transmission electron microscopy. The x-ray diffraction study showed that the α-Fe phase exists with γ-Fe as an impurity. The studied samples have been interrelated with the variation of saturation magnetization, remanent magnetization and coercive field with the amount of carbon coating. The pure α-Fe sample shows saturation magnetization = 172 emu/g, and coercive field = 150 Oe, on the other hand few layer carbon coated α-Fe sample shows saturation magnetization =169 emu/g with higher coercive field 398 Oe.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Uniform batch processing using microwaves

NASA Technical Reports Server (NTRS)

Barmatz, Martin B. (Inventor); Jackson, Henry W. (Inventor)

2000-01-01

A microwave oven and microwave heating method generates microwaves within a cavity in a predetermined mode such that there is a known region of uniform microwave field. Samples placed in the region will then be heated in a relatively identical manner. Where perturbations induced by the samples are significant, samples are arranged in a symmetrical distribution so that the cumulative perturbation at each sample location is the same.

Quantifying mineral abundances of complex mixtures by coupling spectral deconvolution of SWIR spectra (2.1-2.4 μm) and regression tree analysis

USGS Publications Warehouse

Mulder, V.L.; Plotze, Michael; de Bruin, Sytze; Schaepman, Michael E.; Mavris, C.; Kokaly, Raymond F.; Egli, Markus

2013-01-01

This paper presents a methodology for assessing mineral abundances of mixtures having more than two constituents using absorption features in the 2.1-2.4 μm wavelength region. In the first step, the absorption behaviour of mineral mixtures is parameterised by exponential Gaussian optimisation. Next, mineral abundances are predicted by regression tree analysis using these parameters as inputs. The approach is demonstrated on a range of prepared samples with known abundances of kaolinite, dioctahedral mica, smectite, calcite and quartz and on a set of field samples from Morocco. The latter contained varying quantities of other minerals, some of which did not have diagnostic absorption features in the 2.1-2.4 μm region. Cross validation showed that the prepared samples of kaolinite, dioctahedral mica, smectite and calcite were predicted with a root mean square error (RMSE) less than 9 wt.%. For the field samples, the RMSE was less than 8 wt.% for calcite, dioctahedral mica and kaolinite abundances. Smectite could not be well predicted, which was attributed to spectral variation of the cations within the dioctahedral layered smectites. Substitution of part of the quartz by chlorite at the prediction phase hardly affected the accuracy of the predicted mineral content; this suggests that the method is robust in handling the omission of minerals during the training phase. The degree of expression of absorption components was different between the field sample and the laboratory mixtures. This demonstrates that the method should be calibrated and trained on local samples. Our method allows the simultaneous quantification of more than two minerals within a complex mixture and thereby enhances the perspectives of spectral analysis for mineral abundances.

The Influence of Landscape Heterogeneity - Ground Beetles (Coleoptera: Carabidae) in Fthiotida, Central Greece

PubMed Central

2014-01-01

Abstract Pitfall traps were used to sample Carabidae in agricultural land of the Spercheios valley, Fthiotida, Central Greece. Four pairs of cultivated fields were sampled. One field of each pair was located in a heterogeneous area and the other in a more homogeneous area. Heterogeneous areas were composed of small fields. They had high percentages of non-cropped habitats and a high diversity of land use types. Homogeneous areas were composed of larger fields. They had lower percentages of non-cropped habitats and a lower diversity of land use types. One pair of fields had been planted with cotton, one with maize, one with olives and one with wheat. Altogether 28 carabid species were recorded. This paper describes the study areas, the sampling methods used and presents the data collected during the study. Neither heterogeneous nor homogeneous areas had consistently higher abundance levels, activity density levels, species richness levels or diversity levels. However, significant differences were seen in some of the comparisons between heterogeneous and homogeneous areas. PMID:24891833

Modeling gene flow distribution within conventional fields and development of a simplified sampling method to quantify adventitious GM contents in maize

PubMed Central

Melé, Enric; Nadal, Anna; Messeguer, Joaquima; Melé-Messeguer, Marina; Palaudelmàs, Montserrat; Peñas, Gisela; Piferrer, Xavier; Capellades, Gemma; Serra, Joan; Pla, Maria

2015-01-01

Genetically modified (GM) crops have been commercially grown for two decades. GM maize is one of 3 species with the highest acreage and specific events. Many countries established a mandatory labeling of products containing GM material, with thresholds for adventitious presence, to support consumers’ freedom of choice. In consequence, coexistence systems need to be introduced to facilitate commercial culture of GM and non-GM crops in the same agricultural area. On modeling adventitious GM cross-pollination distribution within maize fields, we deduced a simple equation to estimate overall GM contents (%GM) of conventional fields, irrespective of its shape and size, and with no previous information on possible GM pollen donor fields. A sampling strategy was designed and experimentally validated in 19 agricultural fields. With 9 samples, %GM quantification requires just one analytical GM determination while identification of the pollen source needs 9 additional analyses. A decision support tool is provided. PMID:26596213

Integrating Field-Based Research into the Classroom: An Environmental Sampling Exercise

ERIC Educational Resources Information Center

DeSutter, T.; Viall, E.; Rijal, I.; Murdoff, M.; Guy, A.; Pang, X.; Koltes, S.; Luciano, R.; Bai, X.; Zitnick, K.; Wang, S.; Podrebarac, F.; Casey, F.; Hopkins, D.

2010-01-01

A field-based, soil methods, and instrumentation course was developed to expose graduate students to numerous strategies for measuring soil parameters. Given the northern latitude of North Dakota State University and the rapid onset of winter, this course met once per week for the first 8 weeks of the fall semester and centered on the field as a…

Method and system for near-field spectroscopy using targeted deposition of nanoparticles

NASA Technical Reports Server (NTRS)

Anderson, Mark S. (Inventor)

2012-01-01

There is provided in one embodiment of the invention a method for analyzing a sample material using surface enhanced spectroscopy. The method comprises the steps of imaging the sample material with an atomic force microscope (AFM) to select an area of interest for analysis, depositing nanoparticles onto the area of interest with an AFM tip, illuminating the deposited nanoparticles with a spectrometer excitation beam, and disengaging the AFM tip and acquiring a localized surface enhanced spectrum. The method may further comprise the step of using the AFM tip to modulate the spectrometer excitation beam above the deposited nanoparticles to obtain improved sensitivity data and higher spatial resolution data from the sample material. The invention further comprises in one embodiment a system for analyzing a sample material using surface enhanced spectroscopy.

Wave optics theory and 3-D deconvolution for the light field microscope

PubMed Central

Broxton, Michael; Grosenick, Logan; Yang, Samuel; Cohen, Noy; Andalman, Aaron; Deisseroth, Karl; Levoy, Marc

2013-01-01

Light field microscopy is a new technique for high-speed volumetric imaging of weakly scattering or fluorescent specimens. It employs an array of microlenses to trade off spatial resolution against angular resolution, thereby allowing a 4-D light field to be captured using a single photographic exposure without the need for scanning. The recorded light field can then be used to computationally reconstruct a full volume. In this paper, we present an optical model for light field microscopy based on wave optics, instead of previously reported ray optics models. We also present a 3-D deconvolution method for light field microscopy that is able to reconstruct volumes at higher spatial resolution, and with better optical sectioning, than previously reported. To accomplish this, we take advantage of the dense spatio-angular sampling provided by a microlens array at axial positions away from the native object plane. This dense sampling permits us to decode aliasing present in the light field to reconstruct high-frequency information. We formulate our method as an inverse problem for reconstructing the 3-D volume, which we solve using a GPU-accelerated iterative algorithm. Theoretical limits on the depth-dependent lateral resolution of the reconstructed volumes are derived. We show that these limits are in good agreement with experimental results on a standard USAF 1951 resolution target. Finally, we present 3-D reconstructions of pollen grains that demonstrate the improvements in fidelity made possible by our method. PMID:24150383

Propagation-based x-ray phase contrast imaging using an iterative phase diversity technique

NASA Astrophysics Data System (ADS)

Carroll, Aidan J.; van Riessen, Grant A.; Balaur, Eugeniu; Dolbnya, Igor P.; Tran, Giang N.; Peele, Andrew G.

2018-03-01

Through the use of a phase diversity technique, we demonstrate a near-field in-line x-ray phase contrast algorithm that provides improved object reconstruction when compared to our previous iterative methods for a homogeneous sample. Like our previous methods, the new technique uses the sample refractive index distribution during the reconstruction process. The technique complements existing monochromatic and polychromatic methods and is useful in situations where experimental phase contrast data is affected by noise.

Evaluation of Urban Air Quality By Passive Sampling Technique

NASA Astrophysics Data System (ADS)

Nunes, T. V.; Miranda, A. I.; Duarte, S.; Lima, M. J.

Aveiro is a flat small city in the centre of Portugal, close to the Atlantic coast. In the last two decades an intensive development of demographic, traffic and industry growth in the region was observed which was reflected on the air quality degrada- tion. In order to evaluate the urban air quality in Aveiro, a field-monitoring network by passive sampling with high space resolution was implemented. Twenty-four field places were distributed in a area of 3x3 Km2 and ozone and NO2 concentrations were measured. The site distribution density was higher in the centre, 250x250 m2 than in periphery where a 500x500 m2 grid was used. The selection of field places took into consideration the choice criteria recommendation by United Kingdom environmental authorities, and three tubes and a blank tube for each pollutant were used at each site. The sampling system was mounted at 3m from the ground usually profiting the street lampposts. Concerning NO2 acrylic tubes were used with 85 mm of length and an in- ternal diameter of 12mm, where in one of the extremities three steel grids impregnated with a solution of TEA were placed and fixed with a polyethylene end cup (Heal et al., 1999); PFA Teflon tube with 53 mm of length and 9 mm of internal diameter and three impregnated glass filters impregnated with DPE solution fixed by a teflon end cup was used for ozone sampling (Monn and Hargartner, 1990). The passive sampling method for ozone and nitrogen dioxide was compared with continuous measurements, but the amount of measurements wasnSt enough for an accurate calibration and validation of the method. Although this constraint the field observations (June to August 2001) for these two pollutants assign interesting information about the air quality in the urban area. A krigger method of interpolation (Surfer- Golden Software-2000) was applied to field data to obtain isolines distribution of NO2 and ozone concentration for the studied area. Even the used passive sampling method has many limitations it is possi- ble to say that the NO2 concentrations were strictly related with traffic intensity and in the centre 3 to 10 times higher values were observed than the incoming air to the city; on the contrary the ozone seems to be consumed where we observe the highest NO2 concentrations. Heal, M. R.; O'Donoghue, M. A. and Cape, J. N., Overestimation of Urban Nitrogen Dioxide by Passive Sampling Tubes: a comparative exposure and model study, Atmo- spheric Environment, Vol 33, pp 513-524, 1999 Monn, Ch., Hangartner, M., Passive Sampling for Ozone, J. of Air and Waste Management Association, Vol. 40, Nz 3, 1990

2D strain mapping using scanning transmission electron microscopy Moiré interferometry and geometrical phase analysis.

PubMed

Pofelski, A; Woo, S Y; Le, B H; Liu, X; Zhao, S; Mi, Z; Löffler, S; Botton, G A

2018-04-01

A strain characterization technique based on Moiré interferometry in a scanning transmission electron microscope (STEM) and geometrical phase analysis (GPA) method is demonstrated. The deformation field is first captured in a single STEM Moiré hologram composed of multiple sets of periodic fringes (Moiré patterns) generated from the interference between the periodic scanning grating, fixing the positions of the electron probe on the sample, and the crystal structure. Applying basic principles from sampling theory, the Moiré patterns arrangement is then simulated using a STEM electron micrograph reference to convert the experimental STEM Moiré hologram into information related to the crystal lattice periodicities. The GPA method is finally applied to extract the 2D relative strain and rotation fields. The STEM Moiré interferometry enables the local information to be de-magnified to a large length scale, comparable to what can be achieved in dark-field electron holography. The STEM Moiré GPA method thus extends the conventional high-resolution STEM GPA capabilities by providing comparable quantitative 2D strain mapping with a larger field of view (up to a few microns). Copyright © 2017 Elsevier B.V. All rights reserved.

Data analysis considerations for pesticides determined by National Water Quality Laboratory schedule 2437

USGS Publications Warehouse

Shoda, Megan E.; Nowell, Lisa H.; Stone, Wesley W.; Sandstrom, Mark W.; Bexfield, Laura M.

2018-04-02

In 2013, the U.S. Geological Survey National Water Quality Laboratory (NWQL) made a new method available for the analysis of pesticides in filtered water samples: laboratory schedule 2437. Schedule 2437 is an improvement on previous analytical methods because it determines the concentrations of 225 fungicides, herbicides, insecticides, and associated degradates in one method at similar or lower concentrations than previously available methods. Additionally, the pesticides included in schedule 2437 were strategically identified in a prioritization analysis that assessed likelihood of occurrence, prevalence of use, and potential toxicity. When the NWQL reports pesticide concentrations for analytes in schedule 2437, the laboratory also provides supplemental information useful to data users for assessing method performance and understanding data quality. That supplemental information is discussed in this report, along with an initial analysis of analytical recovery of pesticides in water-quality samples analyzed by schedule 2437 during 2013–2015. A total of 523 field matrix spike samples and their paired environmental samples and 277 laboratory reagent spike samples were analyzed for this report (1,323 samples total). These samples were collected in the field as part of the U.S. Geological Survey National Water-Quality Assessment groundwater and surface-water studies and as part of the NWQL quality-control program. This report reviews how pesticide samples are processed by the NWQL, addresses how to obtain all the data necessary to interpret pesticide concentrations, explains the circumstances that result in a reporting level change or the occurrence of a raised reporting level, and describes the calculation and assessment of recovery. This report also discusses reasons why a data user might choose to exclude data in an interpretive analysis and outlines the approach used to identify the potential for decreased data quality in the assessment of method recovery. The information provided in this report is essential to understanding pesticide data determined by schedule 2437 and should be reviewed before interpretation of these data.

Field methods for sampling and storing nectar from flowers with low nectar volumes.

PubMed

Morrant, D S; Schumann, R; Petit, S

2009-02-01

Although several methods of sampling and storing floral nectar are available, little information exists on sampling and storing nectar from flowers with low nectar volumes. Methods for sampling and storing nectar from the flowers of species with low floral nectar volumes (<1 microL) were investigated using the flowers of Eucalyptus species. Sampling with microcapillary tubes, blotting up with filter paper, washing and rinsing were compared to determine masses of sugars recovered and differences in sugar ratios. Storage methods included room temperature, refrigeration and freezing treatments; the addition of antimicrobial agents benzyl alcohol or methanol to some of these treatments was also evaluated. Nectar samples were analysed using high-performance liquid chromatography and the masses of sucrose, glucose and fructose in each sample were determined. Masses of sugars varied significantly among sampling treatments, but the highest yielding methods, rinsing and washing, were not significantly different. A washing time of 1 min was as effective as one of 20 min. Storage trials showed that the sugar concentration measurements of nectar solutions changed rapidly, with the best results achieved for refrigeration with no additive (sucrose and fructose were stable for at least 2 weeks). Sugar ratios, however, remained relatively stable in most treatments and did not change significantly across 4 weeks for the methanol plus refrigerator and freezing treatments, and 2 weeks for the refrigeration treatment with no additive. Washing is recommended for nectar collection from flowers with low nectar volumes in the field (with the understanding that one wash underestimates the amounts of sugars present in a flower), as is immediate analysis of sugar mass. In view of the great variation in results depending on nectar collection and storage methods, caution should be exercised in their choice, and their accuracy should be evaluated. The use of pulsed amperometric detection, more specific than refractive index detection, may improve the accuracy of nectar sugar analysis.

Lake Shore and Littoral Habitat Structure: Precision and biological Relevance of a Field Survey Method.

EPA Science Inventory

Until recently, lake physical habitat assessment has been an underemployed tool for assessing lake and reservoir ecological condition. We outline and evaluate a rapid field sampling and analytical approach for quantifying near-shore physical habitat. We quantified the repeatabil...

New tool for getting data on the field for paleoclimate and paleoceanography data based on isotope 13C and 18O measurements

NASA Astrophysics Data System (ADS)

Mandic, M.; Stöbener, N.; Smajgl, D.

2017-12-01

For many decades different instrumental methods involving generations of the isotope ratio mass spectrometers with different periphery units for sample preparation, have provided scientifically required high precision, and high throughput of samples for varies application - from geological and hydrological to food and forensic. With this work we introduce automated measurement of δ13C and δ18O from solid carbonate samples, DIC and δ18O of water. We have demonstrated usage of a Thermo Scientific™ Delta Ray™ IRIS with URI Connect on certified reference materials and confirmed the high achievable accuracy and a precision better then <0.1‰ for both δ13C and δ18O, in the laboratory or the field with same precision and throughput of samples. With equilibration method for determination of δ18O in water samples, which we present in this work, achieved repeatability and accuracy are 0.12‰ and 0.68‰ respectively, which fulfill requirements of regulatory methods. The preparation of the samples for carbonate and DIC analysis on the Delta Ray IRIS with URI Connect is similar to the previously mentioned Gas Bench II methods. Samples are put into vials and phosphoric acid is added. The resulting sample-acid chemical reaction releases CO2 gas, which is then introduced into the Delta Ray IRIS via the Variable Volume. Three international standards of carbonate materials (NBS-18, NBS-19 and IAEA-CO-1) were analyzed. NBS-18 and NBS-19 were used as standards for calibration, and IAEA-CO-1 was treated as unknown. For water sample analysis equilibration method with 1% of CO2 in dry air was used. Test measurements and conformation of precision and accuracy of method determination δ18O in water samples were done with three lab standards, namely ANST, OCEAN 2 and HBW. All laboratory standards were previously calibrated with international reference material VSMOW2 and SLAP2 to assure accuracy of the isotopic values. The Principle of Identical Treatment was applied in sample and standard preparation, in measurement procedure, as well as in the evaluation of the results.

The microwave Hall effect measured using a waveguide tee

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coppock, J. E.; Anderson, J. R.; Johnson, W. B.

2016-03-14

This paper describes a simple microwave apparatus to measure the Hall effect in semiconductor wafers. The advantage of this technique is that it does not require contacts on the sample or the use of a resonant cavity. Our method consists of placing the semiconductor wafer into a slot cut in an X-band (8–12 GHz) waveguide series tee, injecting microwave power into the two opposite arms of the tee, and measuring the microwave output at the third arm. A magnetic field applied perpendicular to the wafer gives a microwave Hall signal that is linear in the magnetic field and which reverses phasemore » when the magnetic field is reversed. The microwave Hall signal is proportional to the semiconductor mobility, which we compare for calibration purposes with d.c. mobility measurements obtained using the van der Pauw method. We obtain the resistivity by measuring the microwave reflection coefficient of the sample. This paper presents data for silicon and germanium samples doped with boron or phosphorus. The measured mobilities ranged from 270 to 3000 cm{sup 2}/(V s).« less

BioDry: An Inexpensive, Low-Power Method to Preserve Aquatic Microbial Biomass at Room Temperature.

PubMed

Tuorto, Steven J; Brown, Chris M; Bidle, Kay D; McGuinness, Lora R; Kerkhof, Lee J

2015-01-01

This report describes BioDry (patent pending), a method for reliably preserving the biomolecules associated with aquatic microbial biomass samples, without the need of hazardous materials (e.g. liquid nitrogen, preservatives, etc.), freezing, or bulky storage/sampling equipment. Gel electrophoresis analysis of nucleic acid extracts from samples treated in the lab with the BioDry method indicated that molecular integrity was protected in samples stored at room temperature for up to 30 days. Analysis of 16S/18S rRNA genes for presence/absence and relative abundance of microorganisms using both 454-pyrosequencing and TRFLP profiling revealed statistically indistinguishable communities from control samples that were frozen in liquid nitrogen immediately after collection. Seawater and river water biomass samples collected with a portable BioDry "field unit", constructed from off-the-shelf materials and a battery-operated pumping system, also displayed high levels of community rRNA preservation, despite a slight decrease in nucleic acid recovery over the course of storage for 30 days. Functional mRNA and protein pools from the field samples were also effectively conserved with BioDry, as assessed by respective RT-PCR amplification and western blot of ribulose-1-5-bisphosphate carboxylase/oxygenase. Collectively, these results demonstrate that BioDry can adequately preserve a suite of biomolecules from aquatic biomass at ambient temperatures for up to a month, giving it great potential for high resolution sampling in remote locations or on autonomous platforms where space and power are limited.

BioDry: An Inexpensive, Low-Power Method to Preserve Aquatic Microbial Biomass at Room Temperature

PubMed Central

Tuorto, Steven J.; Brown, Chris M.; Bidle, Kay D.; McGuinness, Lora R.; Kerkhof, Lee J.

2015-01-01

This report describes BioDry (patent pending), a method for reliably preserving the biomolecules associated with aquatic microbial biomass samples, without the need of hazardous materials (e.g. liquid nitrogen, preservatives, etc.), freezing, or bulky storage/sampling equipment. Gel electrophoresis analysis of nucleic acid extracts from samples treated in the lab with the BioDry method indicated that molecular integrity was protected in samples stored at room temperature for up to 30 days. Analysis of 16S/18S rRNA genes for presence/absence and relative abundance of microorganisms using both 454-pyrosequencing and TRFLP profiling revealed statistically indistinguishable communities from control samples that were frozen in liquid nitrogen immediately after collection. Seawater and river water biomass samples collected with a portable BioDry “field unit", constructed from off-the-shelf materials and a battery-operated pumping system, also displayed high levels of community rRNA preservation, despite a slight decrease in nucleic acid recovery over the course of storage for 30 days. Functional mRNA and protein pools from the field samples were also effectively conserved with BioDry, as assessed by respective RT-PCR amplification and western blot of ribulose-1-5-bisphosphate carboxylase/oxygenase. Collectively, these results demonstrate that BioDry can adequately preserve a suite of biomolecules from aquatic biomass at ambient temperatures for up to a month, giving it great potential for high resolution sampling in remote locations or on autonomous platforms where space and power are limited. PMID:26710122

Performance of the Lot Quality Assurance Sampling Method Compared to Surveillance for Identifying Inadequately-performing Areas in Matlab, Bangladesh

PubMed Central

Hanifi, S.M.A.; Roy, Nikhil; Streatfield, P. Kim

2007-01-01

This paper compared the performance of the lot quality assurance sampling (LQAS) method in identifying inadequately-performing health work-areas with that of using health and demographic surveillance system (HDSS) data and examined the feasibility of applying the method by field-level programme supervisors. The study was carried out in Matlab, the field site of ICDDR,B, where a HDSS has been in place for over 30 years. The LQAS method was applied in 57 work-areas of community health workers in ICDDR,B-served areas in Matlab during July-September 2002. The performance of the LQAS method in identifying work-areas with adequate and inadequate coverage of various health services was compared with those of the HDSS. The health service-coverage indicators included coverage of DPT, measles, BCG vaccination, and contraceptive use. It was observed that the difference in the proportion of work-areas identified to be inadequately performing using the LQAS method with less than 30 respondents, and the HDSS was not statistically significant. The consistency between the LQAS method and the HDSS in identifying work-areas was greater for adequately-performing areas than inadequately-performing areas. It was also observed that the field managers could be trained to apply the LQAS method in monitoring their performance in reaching the target population. PMID:17615902

Performance of the lot quality assurance sampling method compared to surveillance for identifying inadequately-performing areas in Matlab, Bangladesh.

PubMed

Bhuiya, Abbas; Hanifi, S M A; Roy, Nikhil; Streatfield, P Kim

2007-03-01

This paper compared the performance of the lot quality assurance sampling (LQAS) method in identifying inadequately-performing health work-areas with that of using health and demographic surveillance system (HDSS) data and examined the feasibility of applying the method by field-level programme supervisors. The study was carried out in Matlab, the field site of ICDDR,B, where a HDSS has been in place for over 30 years. The LQAS method was applied in 57 work-areas of community health workers in ICDDR,B-served areas in Matlab during July-September 2002. The performance of the LQAS method in identifying work-areas with adequate and inadequate coverage of various health services was compared with those of the HDSS. The health service-coverage indicators included coverage of DPT, measles, BCG vaccination, and contraceptive use. It was observed that the difference in the proportion of work-areas identified to be inadequately performing using the LQAS method with less than 30 respondents, and the HDSS was not statistically significant. The consistency between the LQAS method and the HDSS in identifying work-areas was greater for adequately-performing areas than inadequately-performing areas. It was also observed that the field managers could be trained to apply the LQAS method in monitoring their performance in reaching the target population.

Differences in Movement Pattern and Detectability between Males and Females Influence How Common Sampling Methods Estimate Sex Ratio.

PubMed

Rodrigues, João Fabrício Mota; Coelho, Marco Túlio Pacheco

2016-01-01

Sampling the biodiversity is an essential step for conservation, and understanding the efficiency of sampling methods allows us to estimate the quality of our biodiversity data. Sex ratio is an important population characteristic, but until now, no study has evaluated how efficient are the sampling methods commonly used in biodiversity surveys in estimating the sex ratio of populations. We used a virtual ecologist approach to investigate whether active and passive capture methods are able to accurately sample a population's sex ratio and whether differences in movement pattern and detectability between males and females produce biased estimates of sex-ratios when using these methods. Our simulation allowed the recognition of individuals, similar to mark-recapture studies. We found that differences in both movement patterns and detectability between males and females produce biased estimates of sex ratios. However, increasing the sampling effort or the number of sampling days improves the ability of passive or active capture methods to properly sample sex ratio. Thus, prior knowledge regarding movement patterns and detectability for species is important information to guide field studies aiming to understand sex ratio related patterns.

Differences in Movement Pattern and Detectability between Males and Females Influence How Common Sampling Methods Estimate Sex Ratio

PubMed Central

Rodrigues, João Fabrício Mota; Coelho, Marco Túlio Pacheco

2016-01-01

Sampling the biodiversity is an essential step for conservation, and understanding the efficiency of sampling methods allows us to estimate the quality of our biodiversity data. Sex ratio is an important population characteristic, but until now, no study has evaluated how efficient are the sampling methods commonly used in biodiversity surveys in estimating the sex ratio of populations. We used a virtual ecologist approach to investigate whether active and passive capture methods are able to accurately sample a population’s sex ratio and whether differences in movement pattern and detectability between males and females produce biased estimates of sex-ratios when using these methods. Our simulation allowed the recognition of individuals, similar to mark-recapture studies. We found that differences in both movement patterns and detectability between males and females produce biased estimates of sex ratios. However, increasing the sampling effort or the number of sampling days improves the ability of passive or active capture methods to properly sample sex ratio. Thus, prior knowledge regarding movement patterns and detectability for species is important information to guide field studies aiming to understand sex ratio related patterns. PMID:27441554

ECONOMICS OF SAMPLE COMPOSITING AS A SCREENING TOOL IN GROUND WATER QUALITY MONITORING

EPA Science Inventory

Recent advances in high throughput/automated compositing with robotics/field-screening methods offer seldom-tapped opportunities for achieving cost-reduction in ground water quality monitoring programs. n economic framework is presented in this paper for the evaluation of sample ...

FIELD AND LABORATORY PERFORMANCE CHARACTERISTICS OF A NEW SAMPLING PROTOCOL FOR RIVERINE MACROINVERTEBRATE ASSEMBLAGES

EPA Science Inventory

Measurement and estimation of performance characteristics (i.e., precision, bias, performance range, interferences and sensitivity) are often neglected in the development and use of new biological sampling methods. However, knowledge of this information is critical in enabling p...

3D nanoscale imaging of the yeast, Schizosaccharomyces pombe, by full-field transmission x-ray microscopy at 5.4 keV

PubMed Central

Chen, Jie; Yang, Yunhao; Zhang, Xiaobo; Andrews, Joy C.; Pianetta, Piero; Guan, Yong; Liu, Gang; Xiong, Ying; Wu, Ziyu; Tian, Yangchao

2010-01-01

Three-dimensional (3D) nanoscale structures of the fission yeast, Schizosaccharomyces pombe, can be obtained by full-field transmission hard x-ray microscopy with 30 nm resolution using synchrotron radiation sources. Sample preparation is relatively simple and the samples are portable across various imaging environments, allowing for high throughput sample screening. The yeast cells were fixed and double stained with Reynold’s lead citrate and uranyl acetate. We performed both absorption contrast and Zernike phase contrast imaging on these cells in order to test this method. The membranes, nucleus and subcellular organelles of the cells were clearly visualized using absorption contrast mode. The x-ray images of the cells could be used to study the spatial distributions of the organelles in the cells. These results show unique structural information, demonstrating that hard x-ray microscopy is a complementary method for imaging and analyzing biological samples. PMID:20349228

Highly sensitive serological methods for detecting tomato yellow leaf curl virus in tomato plants and whiteflies.

PubMed

Xie, Yan; Jiao, Xiaoyang; Zhou, Xueping; Liu, Huan; Ni, Yuequn; Wu, Jianxiang

2013-05-06

Tomato yellow leaf curl virus (TYLCV) is a member of the genus Begomovirus in the family Geminiviridae, which causes severe losses in tomato production in tropic and subtropic regions. The purified TYLCV virions were used as the immunogen to produce monoclonal antibodies (MAbs) using the hybridoma technology. MAb-based dot enzyme-linked immunosorbent assay (dot-ELISA) and direct tissue blot immunoassay (DTBIA) were developed for sensitive, simple, and rapid detection of TYLCV in field tomato and whitefly (Bemisia tabaci) samples collected from TYLCV prevalent provinces in China. Using the hybridoma technology, six murine MAbs (1C4, 8D10, 6E3, 2F2, 3F4 and 4G3) against TYLCV were prepared. Using the MAb 1C4, dot-ELISA and DTBIA were then established for detecting TYLCV in field tomato and whitefly samples collected from TYLCV prevalent provinces in China. The dot-ELISA could detect TYLCV in infected tissue crude extract diluted at 1:5,120 (w/v, g mL-1), and in viruliferous whitefly homogenate diluted at 1:128 (individual whitefly/μL), respectively. Field tomato samples (n=487) and whitefly samples (n=110) from TYLCV prevalent districts in China were screened for the presence of TYLCV using the two developed methods, and the results were further confirmed by PCR and nucleotide sequencing. The survey revealed that TYLCV is widespread on tomato plants in Zhejiang, Shandong and Henan provinces in China. The developed dot-ELISA is very suitable for the routine detection of TYLCV in field tomato and whitefly samples, and the DTBIA is more suitable for the routine detection of TYLCV in large-scale tomato plant samples collected from TYLCV prevalent areas.

From pixel to voxel: a deeper view of biological tissue by 3D mass spectral imaging

PubMed Central

Ye, Hui; Greer, Tyler; Li, Lingjun

2011-01-01

Three dimensional mass spectral imaging (3D MSI) is an exciting field that grants the ability to study a broad mass range of molecular species ranging from small molecules to large proteins by creating lateral and vertical distribution maps of select compounds. Although the general premise behind 3D MSI is simple, factors such as choice of ionization method, sample handling, software considerations and many others must be taken into account for the successful design of a 3D MSI experiment. This review provides a brief overview of ionization methods, sample preparation, software types and technological advancements driving 3D MSI research of a wide range of low- to high-mass analytes. Future perspectives in this field are also provided to conclude that the positive and promises ever-growing applications in the biomedical field with continuous developments of this powerful analytical tool. PMID:21320052

Using occupancy modelling to compare environmental DNA to traditional field methods for regional-scale monitoring of an endangered aquatic species.

PubMed

Schmelzle, Molly C; Kinziger, Andrew P

2016-07-01

Environmental DNA (eDNA) monitoring approaches promise to greatly improve detection of rare, endangered and invasive species in comparison with traditional field approaches. Herein, eDNA approaches and traditional seining methods were applied at 29 research locations to compare method-specific estimates of detection and occupancy probabilities for endangered tidewater goby (Eucyclogobius newberryi). At each location, multiple paired seine hauls and water samples for eDNA analysis were taken, ranging from two to 23 samples per site, depending upon habitat size. Analysis using a multimethod occupancy modelling framework indicated that the probability of detection using eDNA was nearly double (0.74) the rate of detection for seining (0.39). The higher detection rates afforded by eDNA allowed determination of tidewater goby occupancy at two locations where they have not been previously detected and at one location considered to be locally extirpated. Additionally, eDNA concentration was positively related to tidewater goby catch per unit effort, suggesting eDNA could potentially be used as a proxy for local tidewater goby abundance. Compared to traditional field sampling, eDNA provided improved occupancy parameter estimates and can be applied to increase management efficiency across a broad spatial range and within a diversity of habitats. © 2015 John Wiley & Sons Ltd.

A novel method for preparing histology slides to integrate the teaching of gross and microscopic anatomy.

PubMed

Provo-Klimek, Judy A; Troyer, Deryl L

2002-01-01

The authors have previously reported the development of a novel technique for sampling and preparing tissue slides for routine microscopic examination, without the use of a microtome. Termed "RAMP" (Rapid Adhesive Mediated Procedure), this simple, albeit somewhat crude, technique holds promise as a method that can be used in the field by veterinary practitioners for rapid microscopic evaluations to obtain early preliminary estimates of the nature of a mass or lesion. We incorporated the use of this method into a gross anatomy course in an attempt to gauge its utility for novices in tissue sampling and histology slide preparation. By having each group of students take a tissue sample from their cadaver, the activity simulated an actual necropsy situation in which practitioners in the field might use the technique. Because students were able to follow their specimen from sampling to microscopic examination, the activity provided a valuable integration of their learning of gross and microscopic anatomy. We conducted an evaluation of the process and the resulting slides with two successive classes of students. We conclude that the RAMP method is reasonably successful in the hands of individuals not trained in tissue preparation; was well received by the students as a valuable learning tool; and could potentially yield useful histological information for practicing veterinarians. Limitations of the method are also discussed.

Novel colorimetric method overcoming phosphorus interference during trace arsenic analysis in soil solution.

PubMed

Makris, Konstantinos C; Punamiya, Pravin; Sarkar, Dibyendu; Datta, Rupali

2008-02-01

A sensitive (method detection limit, 2.0 microg As L(-1)) colorimetric determination of trace As(v) and As(iii) concentrations in the presence of soluble phosphorus (P) concentrations in soil/water extracts is presented. The proposed method modifies the malachite green method (MG) originally developed for P in soil and water. Our method relies upon the finding that As(iii) and As(v) do not develop the green color during P analysis using the MG method. When an optimum concentration of ascorbic acid (AA) is added to a sample containing up to 15 times P > As (microM) concentrations, the final sample absorbance due to P will be equal to that of As(v) molecules. The soluble As concentration can then be quantified by the concentration difference between the mixed oxyanion (As + P) absorbance (proposed method) and the MG method absorbance that measures only P. Our method is miniaturized using a 96-well microplate UV-VIS reader that utilizes minute reagent and sample volumes (120 and 200 microL sample(-1), respectively), thus, minimizing waste and offering flexibility in the field. Our method was tested in a suite of As-contaminated soils that successfully measured both As and P in soil water extracts and total digests. Mean% As recoveries ranged between 84 and 117%, corroborating data obtained with high-resolution inductively-coupled plasma mass-spectrometry. The performance of the proposed colorimetric As method was unaffected by the presence of Cu, Zn, Pb, Ni, Fe, Al, Si, and Cr in both neutral and highly-acidic (ca. pH 2) soil extracts. Data from this study provide the proof of concept towards creating a field-deployable, portable As kit.

Detection of Papaya leaf distortion mosaic virus by reverse-transcription loop-mediated isothermal amplification.

PubMed

Shen, Wentao; Tuo, Decai; Yan, Pu; Li, Xiaoying; Zhou, Peng

2014-01-01

Papaya leaf distortion mosaic virus (PLDMV) can infect transgenic papaya resistant to a related pathogen, Papaya ringspot virus (PRSV), posing a substantial threat to papaya production in China. Current detection methods, however, are unable to be used for rapid detection in the field. Here, a reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay was developed for the detection of PLDMV, using a set of four RT-LAMP primers designed based on the conserved sequence of PLDMV CP. The RT-LAMP method detected specifically PLDMV and was highly sensitive, with a detection limit of 1.32×10(-6) μg of total RNA per reaction. Indeed, the reaction was 10 times more sensitive than one-step RT-PCR, while also requiring significantly less time and equipment. The effectiveness of RT-LAMP and one-step RT-PCR in detecting the virus were compared using 90 field samples of non-transgenic papaya and 90 field samples of commercialized PRSV-resistant transgenic papaya from Hainan Island. None of the non-transgenic papaya tested positive for PLDMV using either method. In contrast, 19 of the commercialized PRSV-resistant transgenic papaya samples tested positive by RT-LAMP assay, and 6 of those tested negative by RT-PCR. Therefore, the PLDMV-specific RT-LAMP is a simple, rapid, sensitive, and cost-effective tool in the field diagnosis and control of PLDMV. Copyright © 2013 Elsevier B.V. All rights reserved.

Self-Taught Learning Based on Sparse Autoencoder for E-Nose in Wound Infection Detection

PubMed Central

He, Peilin; Jia, Pengfei; Qiao, Siqi; Duan, Shukai

2017-01-01

For an electronic nose (E-nose) in wound infection distinguishing, traditional learning methods have always needed large quantities of labeled wound infection samples, which are both limited and expensive; thus, we introduce self-taught learning combined with sparse autoencoder and radial basis function (RBF) into the field. Self-taught learning is a kind of transfer learning that can transfer knowledge from other fields to target fields, can solve such problems that labeled data (target fields) and unlabeled data (other fields) do not share the same class labels, even if they are from entirely different distribution. In our paper, we obtain numerous cheap unlabeled pollutant gas samples (benzene, formaldehyde, acetone and ethylalcohol); however, labeled wound infection samples are hard to gain. Thus, we pose self-taught learning to utilize these gas samples, obtaining a basis vector θ. Then, using the basis vector θ, we reconstruct the new representation of wound infection samples under sparsity constraint, which is the input of classifiers. We compare RBF with partial least squares discriminant analysis (PLSDA), and reach a conclusion that the performance of RBF is superior to others. We also change the dimension of our data set and the quantity of unlabeled data to search the input matrix that produces the highest accuracy. PMID:28991154

Detection of motile micro-organisms in biological samples by means of a fully automated image processing system

NASA Astrophysics Data System (ADS)

Alanis, Elvio; Romero, Graciela; Alvarez, Liliana; Martinez, Carlos C.; Hoyos, Daniel; Basombrio, Miguel A.

2001-08-01

A fully automated image processing system for detection of motile microorganism is biological samples is presented. The system is specifically calibrated for determining the concentration of Trypanosoma Cruzi parasites in blood samples of mice infected with Chagas disease. The method can be adapted for use in other biological samples. A thin layer of blood infected by T. cruzi parasites is examined in a common microscope in which the images of the vision field are taken by a CCD camera and temporarily stored in the computer memory. In a typical field, a few motile parasites are observable surrounded by blood red cells. The parasites have low contrast. Thus, they are difficult to detect visually but their great motility betrays their presence by the movement of the nearest neighbor red cells. Several consecutive images of the same field are taken, decorrelated with each other where parasites are present, and digitally processed in order to measure the number of parasites present in the field. Several fields are sequentially processed in the same fashion, displacing the sample by means of step motors driven by the computer. A direct advantage of this system is that its results are more reliable and the process is less time consuming than the current subjective evaluations made visually by technicians.

A simplified field protocol for genetic sampling of birds using buccal swabs

USGS Publications Warehouse

Vilstrup, Julia T.; Mullins, Thomas D.; Miller, Mark P.; McDearman, Will; Walters, Jeffrey R.; Haig, Susan M.

2018-01-01

DNA sampling is an essential prerequisite for conducting population genetic studies. For many years, blood sampling has been the preferred method for obtaining DNA in birds because of their nucleated red blood cells. Nonetheless, use of buccal swabs has been gaining favor because they are less invasive yet still yield adequate amounts of DNA for amplifying mitochondrial and nuclear markers; however, buccal swab protocols often include steps (e.g., extended air-drying and storage under frozen conditions) not easily adapted to field settings. Furthermore, commercial extraction kits and swabs for buccal sampling can be expensive for large population studies. We therefore developed an efficient, cost-effective, and field-friendly protocol for sampling wild birds after comparing DNA yield among 3 inexpensive buccal swab types (2 with foam tips and 1 with a cotton tip). Extraction and amplification success was high (100% and 97.2% respectively) using inexpensive generic swabs. We found foam-tipped swabs provided higher DNA yields than cotton-tipped swabs. We further determined that omitting a drying step and storing swabs in Longmire buffer increased efficiency in the field while still yielding sufficient amounts of DNA for detailed population genetic studies using mitochondrial and nuclear markers. This new field protocol allows time- and cost-effective DNA sampling of juveniles or small-bodied birds for which drawing blood may cause excessive stress to birds and technicians alike.

Application of denaturing high-performance liquid chromatography for monitoring sulfate-reducing bacteria in oil fields.

PubMed

Priha, Outi; Nyyssönen, Mari; Bomberg, Malin; Laitila, Arja; Simell, Jaakko; Kapanen, Anu; Juvonen, Riikka

2013-09-01

Sulfate-reducing bacteria (SRB) participate in microbially induced corrosion (MIC) of equipment and H2S-driven reservoir souring in oil field sites. Successful management of industrial processes requires methods that allow robust monitoring of microbial communities. This study investigated the applicability of denaturing high-performance liquid chromatography (DHPLC) targeting the dissimilatory sulfite reductase ß-subunit (dsrB) gene for monitoring SRB communities in oil field samples from the North Sea, the United States, and Brazil. Fifteen of the 28 screened samples gave a positive result in real-time PCR assays, containing 9 × 10(1) to 6 × 10(5) dsrB gene copies ml(-1). DHPLC and denaturing gradient gel electrophoresis (DGGE) community profiles of the PCR-positive samples shared an overall similarity; both methods revealed the same samples to have the lowest and highest diversity. The SRB communities were diverse, and different dsrB compositions were detected at different geographical locations. The identified dsrB gene sequences belonged to several phylogenetic groups, such as Desulfovibrio, Desulfococcus, Desulfomicrobium, Desulfobulbus, Desulfotignum, Desulfonatronovibrio, and Desulfonauticus. DHPLC showed an advantage over DGGE in that the community profiles were very reproducible from run to run, and the resolved gene fragments could be collected using an automated fraction collector and sequenced without a further purification step. DGGE, on the other hand, included casting of gradient gels, and several rounds of rerunning, excising, and reamplification of bands were needed for successful sequencing. In summary, DHPLC proved to be a suitable tool for routine monitoring of the diversity of SRB communities in oil field samples.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Jun -Sang; Ray, Atish K.; Dawson, Paul R.

A shrink-fit sample is manufactured with a Ti-8Al-1Mo-1V alloy to introduce a multiaxial residual stress field in the disk of the sample. A set of strain and orientation pole figures are measured at various locations across the disk using synchrotron high-energy X-ray diffraction. Two approaches—the traditional sin 2Ψ method and the bi-scale optimization method—are taken to determine the stresses in the disk based on the measured strain and orientation pole figures, to explore the range of solutions that are possible for the stress field within the disk. While the stress components computed using the sin 2Ψ method and the bi-scalemore » optimization method have similar trends, their magnitudes are significantly different. Lastly, it is suspected that the local texture variation in the material is the cause of this discrepancy.« less

Enhancing Important Fluctuations: Rare Events and Metadynamics from a Conceptual Viewpoint

NASA Astrophysics Data System (ADS)

Valsson, Omar; Tiwary, Pratyush; Parrinello, Michele

2016-05-01

Atomistic simulations play a central role in many fields of science. However, their usefulness is often limited by the fact that many systems are characterized by several metastable states separated by high barriers, leading to kinetic bottlenecks. Transitions between metastable states are thus rare events that occur on significantly longer timescales than one can simulate in practice. Numerous enhanced sampling methods have been introduced to alleviate this timescale problem, including methods based on identifying a few crucial order parameters or collective variables and enhancing the sampling of these variables. Metadynamics is one such method that has proven successful in a great variety of fields. Here we review the conceptual and theoretical foundations of metadynamics. As demonstrated, metadynamics is not just a practical tool but can also be considered an important development in the theory of statistical mechanics.

Single shot multi-wavelength phase retrieval with coherent modulation imaging.

PubMed

Dong, Xue; Pan, Xingchen; Liu, Cheng; Zhu, Jianqiang

2018-04-15

A single shot multi-wavelength phase retrieval method is proposed by combining common coherent modulation imaging (CMI) and a low rank mixed-state algorithm together. A radiation beam consisting of multi-wavelength is illuminated on the sample to be observed, and the exiting field is incident on a random phase plate to form speckle patterns, which is the incoherent superposition of diffraction patterns of each wavelength. The exiting complex amplitude of the sample including both the modulus and phase of each wavelength can be reconstructed simultaneously from the recorded diffraction intensity using a low rank mixed-state algorithm. The feasibility of this proposed method was verified with visible light experimentally. This proposed method not only makes CMI realizable with partially coherent illumination but also can extend its application to various traditionally unrelated fields, where several wavelengths should be considered simultaneously.

Estimation of the dilution field near a marine outfall by using effluent turbidity as an environmental tracer and comparison with dye tracer data.

PubMed

Pecly, José Otavio Goulart

2018-01-01

The alternative use of effluent turbidity to determine the dilution field of a domestic marine outfall located off the city of Rio de Janeiro was evaluated through field work comprising fluorescent dye tracer injection and tracking with simultaneous monitoring of sea water turbidity. A preliminary laboratory assessment was carried out with a sample of the outfall effluent whose turbidity was measured by the nephelometric method before and during a serial dilution process. During the field campaign, the dye tracer was monitored with field fluorometers and the turbidity was observed with an optical backscattering sensor interfaced to an OEM data acquisition system. About 4,000 samples were gathered, covering an area of 3 km × 3 km near the outfall diffusers. At the far field - where a drift towards the coastline was observed - the effluent plume was adequately labeled by the dye tracer. The turbidity plume was biased due to the high and variable background turbidity of sea water. After processing the turbidity dataset with a baseline detrending method, the plume presented high correlation with the dye tracer plume drawn on the near dilution field. However, dye tracer remains more robust than effluent turbidity.

SLEPR: A Sample-Level Enrichment-Based Pathway Ranking Method — Seeking Biological Themes through Pathway-Level Consistency

PubMed Central

Yi, Ming; Stephens, Robert M.

2008-01-01

Analysis of microarray and other high throughput data often involves identification of genes consistently up or down-regulated across samples as the first step in extraction of biological meaning. This gene-level paradigm can be limited as a result of valid sample fluctuations and biological complexities. In this report, we describe a novel method, SLEPR, which eliminates this limitation by relying on pathway-level consistencies. Our method first selects the sample-level differentiated genes from each individual sample, capturing genes missed by other analysis methods, ascertains the enrichment levels of associated pathways from each of those lists, and then ranks annotated pathways based on the consistency of enrichment levels of individual samples from both sample classes. As a proof of concept, we have used this method to analyze three public microarray datasets with a direct comparison with the GSEA method, one of the most popular pathway-level analysis methods in the field. We found that our method was able to reproduce the earlier observations with significant improvements in depth of coverage for validated or expected biological themes, but also produced additional insights that make biological sense. This new method extends existing analyses approaches and facilitates integration of different types of HTP data. PMID:18818771

Evaluation of an alternate method for sampling benthic macroinvertebrates in low-gradient streams sampled as part of the National Rivers and Streams Assessment.

PubMed

Flotemersch, Joseph E; North, Sheila; Blocksom, Karen A

2014-02-01

Benthic macroinvertebrates are sampled in streams and rivers as one of the assessment elements of the US Environmental Protection Agency's National Rivers and Streams Assessment. In a 2006 report, the recommendation was made that different yet comparable methods be evaluated for different types of streams (e.g., low gradient vs. high gradient). Consequently, a research element was added to the 2008-2009 National Rivers and Streams Assessment to conduct a side-by-side comparison of the standard macroinvertebrate sampling method with an alternate method specifically designed for low-gradient wadeable streams and rivers that focused more on stream edge habitat. Samples were collected using each method at 525 sites in five of nine aggregate ecoregions located in the conterminous USA. Methods were compared using the benthic macroinvertebrate multimetric index developed for the 2006 Wadeable Streams Assessment. Statistical analysis did not reveal any trends that would suggest the overall assessment of low-gradient streams on a regional or national scale would change if the alternate method was used rather than the standard sampling method, regardless of the gradient cutoff used to define low-gradient streams. Based on these results, the National Rivers and Streams Survey should continue to use the standard field method for sampling all streams.

Field-based random sampling without a sampling frame: control selection for a case-control study in rural Africa.

PubMed

Crampin, A C; Mwinuka, V; Malema, S S; Glynn, J R; Fine, P E

2001-01-01

Selection bias, particularly of controls, is common in case-control studies and may materially affect the results. Methods of control selection should be tailored both for the risk factors and disease under investigation and for the population being studied. We present here a control selection method devised for a case-control study of tuberculosis in rural Africa (Karonga, northern Malawi) that selects an age/sex frequency-matched random sample of the population, with a geographical distribution in proportion to the population density. We also present an audit of the selection process, and discuss the potential of this method in other settings.

Recent developments on field gas extraction and sample preparation methods for radiokrypton dating of groundwater

NASA Astrophysics Data System (ADS)

Yokochi, Reika

2016-09-01

Current and foreseen population growths will lead to an increased demand in freshwater, large quantities of which is stored as groundwater. The ventilation age is crucial to the assessment of groundwater resources, complementing the hydrological model approach based on hydrogeological parameters. Ultra-trace radioactive isotopes of Kr (81 Kr and 85 Kr) possess the ideal physical and chemical properties for groundwater dating. The recent advent of atom trap trace analyses (ATTA) has enabled determination of ultra-trace noble gas radioisotope abundances using 5-10 μ L of pure Kr. Anticipated developments will enable ATTA to analyze radiokrypton isotope abundances at high sample throughput, which necessitates simple and efficient sample preparation techniques that are adaptable to various sample chemistries. Recent developments of field gas extraction devices and simple and rapid Kr separation method at the University of Chicago are presented herein. Two field gas extraction devices optimized for different sampling conditions were recently designed and constructed, aiming at operational simplicity and portability. A newly developed Kr purification system enriches Kr by flowing a sample gas through a moderately cooled (138 K) activated charcoal column, followed by a gentle fractionating desorption. This simple process uses a single adsorbent and separates 99% of the bulk atmospheric gases from Kr without significant loss. The subsequent two stages of gas chromatographic separation and a hot Ti sponge getter further purify the Kr-enriched gas. Abundant CH4 necessitates multiple passages through one of the gas chromatographic separation columns. The presented Kr separation system has a demonstrated capability of extracting Kr with > 90% yield and 99% purity within 75 min from 1.2 to 26.8 L STP of atmospheric air with various concentrations of CH4. The apparatuses have successfully been deployed for sampling in the field and purification of groundwater samples.

Environmental Validation of Legionella Control in a VHA Facility Water System.

PubMed

Jinadatha, Chetan; Stock, Eileen M; Miller, Steve E; McCoy, William F

2018-03-01

OBJECTIVES We conducted this study to determine what sample volume, concentration, and limit of detection (LOD) are adequate for environmental validation of Legionella control. We also sought to determine whether time required to obtain culture results can be reduced compared to spread-plate culture method. We also assessed whether polymerase chain reaction (PCR) and in-field total heterotrophic aerobic bacteria (THAB) counts are reliable indicators of Legionella in water samples from buildings. DESIGN Comparative Legionella screening and diagnostics study for environmental validation of a healthcare building water system. SETTING Veterans Health Administration (VHA) facility water system in central Texas. METHODS We analyzed 50 water samples (26 hot, 24 cold) from 40 sinks and 10 showers using spread-plate cultures (International Standards Organization [ISO] 11731) on samples shipped overnight to the analytical lab. In-field, on-site cultures were obtained using the PVT (Phigenics Validation Test) culture dipslide-format sampler. A PCR assay for genus-level Legionella was performed on every sample. RESULTS No practical differences regardless of sample volume filtered were observed. Larger sample volumes yielded more detections of Legionella. No statistically significant differences at the 1 colony-forming unit (CFU)/mL or 10 CFU/mL LOD were observed. Approximately 75% less time was required when cultures were started in the field. The PCR results provided an early warning, which was confirmed by spread-plate cultures. The THAB results did not correlate with Legionella status. CONCLUSIONS For environmental validation at this facility, we confirmed that (1) 100 mL sample volumes were adequate, (2) 10× concentrations were adequate, (3) 10 CFU/mL LOD was adequate, (4) in-field cultures reliably reduced time to get results by 75%, (5) PCR provided a reliable early warning, and (6) THAB was not predictive of Legionella results. Infect Control Hosp Epidemiol 2018;39:259-266.

The Impact of Soil Sampling Errors on Variable Rate Fertilization

DOE Office of Scientific and Technical Information (OSTI.GOV)

R. L. Hoskinson; R C. Rope; L G. Blackwood

2004-07-01

Variable rate fertilization of an agricultural field is done taking into account spatial variability in the soil’s characteristics. Most often, spatial variability in the soil’s fertility is the primary characteristic used to determine the differences in fertilizers applied from one point to the next. For several years the Idaho National Engineering and Environmental Laboratory (INEEL) has been developing a Decision Support System for Agriculture (DSS4Ag) to determine the economically optimum recipe of various fertilizers to apply at each site in a field, based on existing soil fertility at the site, predicted yield of the crop that would result (and amore » predicted harvest-time market price), and the current costs and compositions of the fertilizers to be applied. Typically, soil is sampled at selected points within a field, the soil samples are analyzed in a lab, and the lab-measured soil fertility of the point samples is used for spatial interpolation, in some statistical manner, to determine the soil fertility at all other points in the field. Then a decision tool determines the fertilizers to apply at each point. Our research was conducted to measure the impact on the variable rate fertilization recipe caused by variability in the measurement of the soil’s fertility at the sampling points. The variability could be laboratory analytical errors or errors from variation in the sample collection method. The results show that for many of the fertility parameters, laboratory measurement error variance exceeds the estimated variability of the fertility measure across grid locations. These errors resulted in DSS4Ag fertilizer recipe recommended application rates that differed by up to 138 pounds of urea per acre, with half the field differing by more than 57 pounds of urea per acre. For potash the difference in application rate was up to 895 pounds per acre and over half the field differed by more than 242 pounds of potash per acre. Urea and potash differences accounted for almost 87% of the cost difference. The sum of these differences could result in a $34 per acre cost difference for the fertilization. Because of these differences, better analysis or better sampling methods may need to be done, or more samples collected, to ensure that the soil measurements are truly representative of the field’s spatial variability.« less

High-resolution NMR in magnetic fields with unknown spatiotemporal variations.

PubMed

Pelupessy, Philippe; Rennella, Enrico; Bodenhausen, Geoffrey

2009-06-26

Nuclear magnetic resonance (NMR) experiments are usually carried out in homogeneous magnetic fields. In many cases, however, high-resolution spectra are virtually impossible to obtain because of the inherent heterogeneity of the samples or living organisms under investigation, as well as the poor homogeneity of the magnets (particularly when bulky samples must be placed outside their bores). Unstable power supplies and vibrations arising from cooling can lead to field fluctuations in time as well as space. We show how high-resolution NMR spectra can be obtained in inhomogeneous fields with unknown spatiotemporal variations. Our method, based on coherence transfer between spins, can accommodate spatial inhomogeneities of at least 11 gauss per centimeter and temporal fluctuations slower than 2 hertz.

Lake shore and littoral habitat structure: a field survey method and its precision

EPA Science Inventory

Until recently, lake physical habitat assessment has been and underemployed tool for assessing lake and reservoir ecological condition. Herein, we outline and evaluate a rapid (2 persons: 1.5-3.5 h) field sampling and analytical approach for quantifying near-shore physical habit...

First report of the spiral nematode Helicotylenchus microlobus infecting soybean in North Dakota

USDA-ARS?s Scientific Manuscript database

Spiral nematodes (Helicotylenchus spp.) are common plant-parasitic nematodes in fields of many crops. In June 2015, two soil samples were collected from a soybean field in Richland County, ND. Nematodes were extracted from soil using the sugar centrifugal flotation method. Plant-parasitic nematodes ...

Effect of variable rates of daily sampling of fly larvae on decomposition and carrion insect community assembly: implications for forensic entomology field study protocols.

PubMed

Michaud, Jean-Philippe; Moreau, Gaétan

2013-07-01

Experimental protocols in forensic entomology successional field studies generally involve daily sampling of insects to document temporal changes in species composition on animal carcasses. One challenge with that method has been to adjust the sampling intensity to obtain the best representation of the community present without affecting the said community. To this date, little is known about how such investigator perturbations affect decomposition-related processes. Here, we investigated how different levels of daily sampling of fly eggs and fly larvae affected, over time, carcass decomposition rate and the carrion insect community. Results indicated that a daily sampling of <5% of the egg and larvae volumes present on a carcass, a sampling intensity believed to be consistent with current accepted practices in successional field studies, had little effect overall. Higher sampling intensities, however, slowed down carcass decomposition, affected the abundance of certain carrion insects, and caused an increase in the volume of eggs laid by dipterans. This study suggests that the carrion insect community not only has a limited resilience to recurrent perturbations but that a daily sampling intensity equal to or <5% of the egg and larvae volumes appears adequate to ensure that the system is representative of unsampled conditions. Hence we propose that this threshold be accepted as best practice in future forensic entomology successional field studies.

Acoustic levitation and manipulation for space applications

NASA Technical Reports Server (NTRS)

Wang, T. G.

1979-01-01

A wide spectrum of experiments to be performed in space in a microgravity environment require levitation and manipulation of liquid or molten samples. A novel acoustic method has been developed at JPL for controlling liquid samples without physical contacts. This method utilizes the static pressure generated by three orthogonal acoustic standing waves excited within an enclosure. Furthermore, this method will allow the sample to be rotated and/or oscillated by modifying the phase angles and/or the amplitude of the acoustic field. This technique has been proven both in our laboratory and in a microgravity environment provided by KC-135 flights. Samples placed within our chamber driven at (1,0,0), (0,1,0), and (0,0,1), modes were indeed levitated, rotated, and oscillated.

Synthesis of SiO2-coated ZnMnFe2O4 nanospheres with improved magnetic properties.

PubMed

Wang, Jun; Zhang, Kai; Zhu, Yuejin

2005-05-01

A core-shell structured composite, SiO2 coated ZnMnFe2O4 spinel ferrite nanoparticles (average diameter of approximately 80 nm), was prepared by hydrolysis of tetraethyl orthosilicate (TEOS) in the presence of ZnMnFe2O4 nanoparticles (average diameter of approximately 10 nm) synthesized by a hydrothermal method. The obtained samples were characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM), and field emission scanning electron microscopy (FESEM). The magnetic measurements were carried out on a vibrating sample magnetometer (VSM), and the measurement results indicate that the core-shell samples possess better magnetic properties at room temperature, compared with paramagnetic colloids with a magnetic core by a coprecipitation method. These core-shell nanospherical particles with self-assembly under additional magnetic fields could have potential application in biomedical systems.

Imaging samples larger than the field of view: the SLS experience

NASA Astrophysics Data System (ADS)

Vogiatzis Oikonomidis, Ioannis; Lovric, Goran; Cremona, Tiziana P.; Arcadu, Filippo; Patera, Alessandra; Schittny, Johannes C.; Stampanoni, Marco

2017-06-01

Volumetric datasets with micrometer spatial and sub-second temporal resolutions are nowadays routinely acquired using synchrotron X-ray tomographic microscopy (SRXTM). Although SRXTM technology allows the examination of multiple samples with short scan times, many specimens are larger than the field-of-view (FOV) provided by the detector. The extension of the FOV in the direction perpendicular to the rotation axis remains non-trivial. We present a method that can efficiently increase the FOV merging volumetric datasets obtained by region-of-interest tomographies in different 3D positions of the sample with a minimal amount of artefacts and with the ability to handle large amounts of data. The method has been successfully applied for the three-dimensional imaging of a small number of mouse lung acini of intact animals, where pixel sizes down to the micrometer range and short exposure times are required.

Validation of an antibody-based biosensor for rapid quantification of 2,4,6-trinitrotoluene (TNT) contamination in ground water and river water.

PubMed

Bromage, Erin S; Vadas, George G; Harvey, Ellen; Unger, Michael A; Kaattari, Stephen L

2007-10-15

Nitroaromatics are common pollutants of soil and groundwater at military installations because of their manufacture, storage, and use at these sites. Long-term monitoring of these pollutants comprise a significant percentage of restoration costs. Further, remediation activities often have to be delayed, while the samples are processed via traditional chemical assessment protocols. Here we describe a rapid (<5 min), cost-effective, accurate method using a KinExA Inline Biosensor for monitoring of 2,4,6-trinitrotoluene (TNT) in field water samples. The biosensor, which is based on KinExA technology, accurately estimated the concentration of TNT in double-blind comparisons with similar accuracy to traditional high-performance liquid chromatography(HPLC). In the assessment of field samples, the biosensor accurately predicted the concentration of TNT over the range of 1-30,000 microg/L when compared to either HPLC or quantitative gas chromatography-mass spectrometry (GC-MS). Various pre-assessment techniques were explored to examine whether field samples could be assessed untreated, without the removal of particulates or the use of solvents. In most cases, the KinExA Inline Biosensor gave a uniform assessment of TNT concentration independent of pretreatment method. This indicates that this sensor possesses significant promise for rapid, on-site assessment of TNT pollution in environmental water samples.

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

PubMed Central

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

USGS Publications Warehouse

Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

2007-01-01

The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

Electrical and magnetic properties of rock and soil

USGS Publications Warehouse

Scott, J.H.

1983-01-01

Field and laboratory measurements have been made to determine the electrical conductivity, dielectric constant, and magnetic permeability of rock and soil in areas of interest in studies of electromagnetic pulse propagation. Conductivity is determined by making field measurements of apparent resisitivity at very low frequencies (0-20 cps), and interpreting the true resistivity of layers at various depths by curve-matching methods. Interpreted resistivity values are converted to corresponding conductivity values which are assumed to be applicable at 10^2 cps, an assumption which is considered valid because the conductivity of rock and soil is nearly constant at frequencies below 10^2 cps. Conductivity is estimated at higher frequencies (up to 10^6 cps) by using statistical correlations of three parameters obtained from laboratory measurements of rock and soil samples: conductivity at 10^2 cps, frequency and conductivity measured over the range 10^2 to 10^6 cps. Conductivity may also be estimated in this frequency range by using field measurements of water content and correlations of laboratory sample measurements of the three parameters: water content, frequency, and conductivity measured over the range 10^2 to 10^6 cps. This method is less accurate because nonrandom variation of ion concentration in natural pore water introduces error. Dielectric constant is estimated in a similar manner from field-derived conductivity values applicable at 10^2 cps and statistical correlations of three parameters obtained from laboratory measurements of samples: conductivity measured at 10^2 cps, frequency, and dielectric constant measured over the frequency range 10^2 to 10^6 cps. Dielectric constant may also be estimated from field measurements of water content and correlations of laboratory sample measurements of the three parameters: water content, frequency, and dielectric constant measured from 10^2 to 10^6 cps, but again, this method is less accurate because of variation of ion concentration of pore water. Special laboratory procedures are used to measure conductivity and dielectric constant of rock and soil samples. Electrode polarization errors are minimized by using an electrode system that is electrochemically reversible-with ions in pore water.

Application of an imputation method for geospatial inventory of forest structural attributes across multiple spatial scales in the Lake States, U.S.A

NASA Astrophysics Data System (ADS)

Deo, Ram K.

Credible spatial information characterizing the structure and site quality of forests is critical to sustainable forest management and planning, especially given the increasing demands and threats to forest products and services. Forest managers and planners are required to evaluate forest conditions over a broad range of scales, contingent on operational or reporting requirements. Traditionally, forest inventory estimates are generated via a design-based approach that involves generalizing sample plot measurements to characterize an unknown population across a larger area of interest. However, field plot measurements are costly and as a consequence spatial coverage is limited. Remote sensing technologies have shown remarkable success in augmenting limited sample plot data to generate stand- and landscape-level spatial predictions of forest inventory attributes. Further enhancement of forest inventory approaches that couple field measurements with cutting edge remotely sensed and geospatial datasets are essential to sustainable forest management. We evaluated a novel Random Forest based k Nearest Neighbors (RF-kNN) imputation approach to couple remote sensing and geospatial data with field inventory collected by different sampling methods to generate forest inventory information across large spatial extents. The forest inventory data collected by the FIA program of US Forest Service was integrated with optical remote sensing and other geospatial datasets to produce biomass distribution maps for a part of the Lake States and species-specific site index maps for the entire Lake State. Targeting small-area application of the state-of-art remote sensing, LiDAR (light detection and ranging) data was integrated with the field data collected by an inexpensive method, called variable plot sampling, in the Ford Forest of Michigan Tech to derive standing volume map in a cost-effective way. The outputs of the RF-kNN imputation were compared with independent validation datasets and extant map products based on different sampling and modeling strategies. The RF-kNN modeling approach was found to be very effective, especially for large-area estimation, and produced results statistically equivalent to the field observations or the estimates derived from secondary data sources. The models are useful to resource managers for operational and strategic purposes.

Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples.

PubMed

Quick, Joshua; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah C; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno R; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J

2017-06-01

Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples (i.e., without isolation and culture) remains challenging for viruses such as Zika, for which metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence-complete genomes, comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimized library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an Internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved in 1-2 d by starting with clinical samples and following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. The protocol can be used to sequence other viral genomes using the online Primal Scheme primer designer software. It is suitable for sequencing either RNA or DNA viruses in the field during outbreaks or as an inexpensive, convenient method for use in the lab.

Comparison of PCR-Based Diagnosis with Centrifuged-Based Enrichment Method for Detection of Borrelia persica in Animal Blood Samples.

PubMed

Naddaf, S R; Kishdehi, M; Siavashi, Mr

2011-01-01

The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.

Teaching General Principles and Applications of Dendrogeomorphology.

ERIC Educational Resources Information Center

Butler, David R.

1987-01-01

Tree-ring analysis in geomorphology can be incorporated into a number of undergraduate methods in order to reconstruct the history of a variety of geomorphic processes. Discusses dendrochronology, general principles of dendrogeomorphology, field sampling methods, laboratory techniques, and examples of applications. (TW)

The effect of growth temperature on the irreversibility line of MPMG YBCO bulk with Y2O3 layer

NASA Astrophysics Data System (ADS)

Kurnaz, Sedat; Çakır, Bakiye; Aydıner, Alev

2017-07-01

In this study, three kinds of YBCO samples which are named Y1040, Y1050 and Y1060 were fabricated by Melt-Powder-Melt-Growth (MPMG) method without a seed crystal. Samples seem to be single crystal. The compacted powders were located on a crucible with a buffer layer of Y2O3 to avoid liquid to spread on the furnace plate and also to support crystal growth. YBCO samples were investigated by magnetoresistivity (ρ-T) and magnetization (M-T) measurements in dc magnetic fields (parallel to c-axis) up to 5 T. Irreversibility fields (Hirr) and upper critical fields (Hc2) were obtained using 10% and 90% criteria of the normal state resistivity value from ρ-T curves. M-T measurements were carried out using the zero field cooling (ZFC) and field cooling (FC) processes to get irreversible temperature (Tirr). Fitting of the irreversibility line results to giant flux creep and vortex glass models were discussed. The results were found to be consistent with the results of the samples fabricated using a seed crystal. At the fabrication of MPMG YBCO, optimized temperature for crystal growth was determined to be around 1050-1060 °C.

Beginning Postsecondary Students Longitudinal Study First Follow-up (BPS:96/98) Field Test Report. Working Paper Series.

ERIC Educational Resources Information Center

Pratt, Daniel J.; Wine, Jennifer S.; Heuer, Ruth E.; Whitmore, Roy W.; Kelly, Janice E.; Doherty, John M.; Simpson, Joe B.; Marti, Norma

This report describes the methods and procedures used for the field test of the Beginning Postsecondary Students Longitudinal Study First Followup 1996-98 (BPS:96/98). Students in this survey were first interviewed during 1995 as part of the National Postsecondary Student Aid Study 1996 field test. The BPS:96/98 full-scale student sample includes…

Integrative Genomics and Computational Systems Medicine

DOE Office of Scientific and Technical Information (OSTI.GOV)

McDermott, Jason E.; Huang, Yufei; Zhang, Bing

The exponential growth in generation of large amounts of genomic data from biological samples has driven the emerging field of systems medicine. This field is promising because it improves our understanding of disease processes at the systems level. However, the field is still in its young stage. There exists a great need for novel computational methods and approaches to effectively utilize and integrate various omics data.

Evaluation of the Dark-Medium Objective Lens in Counting Asbestos Fibers by Phase-Contrast Microscopy

PubMed Central

Lee, Eun Gyung; Nelson, John H.; Kashon, Michael L.; Harper, Martin

2015-01-01

A Japanese round-robin study revealed that analysts who used a dark-medium (DM) objective lens reported higher fiber counts from American Industrial Hygiene Association (AIHA) Proficiency Analytical Testing (PAT) chrysotile samples than those using a standard objective lens, but the cause of this difference was not investigated at that time. The purpose of this study is to determine any major source of this difference by performing two sets of round-robin studies. For the first round-robin study, 15 AIHA PAT samples (five each of chrysotile and amosite generated by water-suspended method, and five chrysotile generated by aerosolization method) were prepared with relocatable cover slips and examined by nine laboratories. A second round-robin study was then performed with six chrysotile field sample slides by six out of nine laboratories who participated in the first round-robin study. In addition, two phase-shift test slides to check analysts’ visibility and an eight-form diatom test plate to compare resolution between the two objectives were examined. For the AIHA PAT chrysotile reference slides, use of the DM objective resulted in consistently higher fiber counts (1.45 times for all data) than the standard objective (P-value < 0.05), regardless of the filter generation (water-suspension or aerosol) method. For the AIHA PAT amosite reference and chrysotile field sample slides, the fiber counts between the two objectives were not significantly different. No statistically significant differences were observed in the visibility of blocks of the test slides between the two objectives. Also, the DM and standard objectives showed no pattern of differences in viewing the fine lines and/or dots of each species images on the eight-form diatom test plate. Among various potential factors that might affect the analysts’ performance of fiber counts, this study supports the greater contrast caused by the different phase plate absorptions as the main cause of high counts for the AIHA PAT chrysotile slides using the DM objective. The comparison of fiber count ratios (DM/standard) between the AIHA PAT chrysotile samples and chrysotile field samples indicates that there is a fraction of fibers in the PAT samples approaching the theoretical limit of visibility of the phase-contrast microscope with 3-degree phase-shift. These fibers become more clearly visible through the greater contrast from the phase plate absorption of the DM objective. However, as such fibers are not present in field samples, no difference in counts between the two objectives was observed in this study. The DM objective, therefore, could be allowed for routine fiber counting as it will maintain continuity with risk assessments based on earlier phase-contrast microscopy fiber counts from field samples. Published standard methods would need to be modified to allow a higher aperture specification for the objective. PMID:25737333

Magneto-Optic Kerr Effect in a Magnetized Electron Gun

NASA Astrophysics Data System (ADS)

Hardy, Benjamin; Grames, Joseph; CenterInjectors; Sources Team

2016-09-01

Magnetized electron sources have the potential to improve ion beam cooling efficiency. At the Gun Test Stand at Jefferson Lab, a solenoid magnet will be installed adjacent to the photogun to magnetize the electron beam. Due to the photocathode operating in a vacuum chamber, measuring and monitoring the magnetic field at the beam source location with conventional probes is impractical. The Magneto-Optical Kerr Effect (MOKE) describes the change on polarized light by reflection from a magnetized surface. The reflection from the surface may alter the polarization direction, ellipticity, or intensity, and depends linearly upon the surface magnetization of the sample. By replacing the photocathode with a magnetized sample and reflecting polarized light from the sample surface, the magnetic field at the beam source is inferred. A controlled MOKE system has been assembled to test the magnetic field. Calibration of the solenoid magnet is performed by comparing the MOKE signal with magnetic field measurements. The apparatus will provide a description of the field at electron beam source. The report summarizes the method and results of controlled tests and calibration of the MOKE sample with the solenoid magnet field measurements. This work is supported by the National Science Foundation, Research Experience for Undergraduates Award 1359026 and the Department of Energy, Laboratory Directed Research and Development Contract DE-AC05-06OR23177.

Simple LED spectrophotometer for analysis of color information.

PubMed

Kim, Ji-Sun; Kim, A-Hee; Oh, Han-Byeol; Goh, Bong-Jun; Lee, Eun-Suk; Kim, Jun-Sik; Jung, Gu-In; Baek, Jin-Young; Jun, Jae-Hoon

2015-01-01

A spectrophotometer is the basic measuring equipment essential to most research activity fields requiring samples to be measured, such as physics, biotechnology and food engineering. This paper proposes a system that is able to detect sample concentration and color information by using LED and color sensor. Purity and wavelength information can be detected by CIE diagram, and the concentration can be estimated with purity information. This method is more economical and efficient than existing spectrophotometry, and can also be used by ordinary persons. This contribution is applicable to a number of fields because it can be used as a colorimeter to detect the wavelength and purity of samples.

The effect of substrate on electric field enhancement of Tip-enhanced Raman spectroscopy (TERS)

NASA Astrophysics Data System (ADS)

Bahreini, Maryam

2018-01-01

The characterization of materials down to a few-molecule level is a key challenge in nanotechnology. Raman spectroscopy is a powerful method that provides chemical information via nondestructive vibrational fingerprinting. Unfortunately, this method suffers from signal weakness which prevents the study of small quantities. Tip-enhanced Raman spectroscopy (TERS) which combines the chemical sensitivity of Raman spectroscopy (RS) with high spatial resolution of scanning probe microscopy (SPM), provides chemical images of surfaces at the nanometer scale. In this method, irradiation of an SPM tip by a focused laser beam results in enhancement of local electric field via two reasons of localized surface plasmon resonance and lightning rod effect. This enhancement leads to the enhancement in Raman intensity from the sample surface in the vicinity of tip. In all TERS measurements, samples should be located on a substrate. In this paper, the dependence of the electric field enhancement to the substrate has been investigated. In simulations, three-dimensional finite-difference time-domain (3D-FDTD) method is used for numerical solution of Maxwell's equations. Our results show that the electric field enhancement is weak for the tip alone case. Introducing a substrate provides further electric field enhancement via near field electromagnetic dipole-dipole coupling between the tip and substrate. Since the side-illumination geometry is used for laser irradiation, the vertical component of the incident field plays a dominant role in the electric field enhancement. Therefore, the coupling effect between the tip and the substrate is the key contribution to the enhancement. For the case of silicon tip and the gold substrate, the electric field enhancement is improved considerably. There is an optimal tip size for TERS because of the competing effects of the radiation damping and the surface scattering of the tip. The results show the substrate as an effective tool for the improvement of the TERS detection sensitivity.

Comparison of mounting methods for the evaluation of fibers by phase contrast microscopy.

PubMed

Lee, Eun Gyung; Pang, Thomas W S; Nelson, John; Andrew, Mike; Harper, Martin

2011-07-01

The objectives of this study were to evaluate mounting methods for fiber examination of air sample filters by phase contrast microscopy (PCM) and to evaluate differences in fiber counts that might be due to fiber movement. Acetone/triacetin (AT) with various amounts of triacetin and acetone/Euparal (AE) where the mounting medium was placed between the cleared filter wedge and the coverslip were tested as a function of time. Field sample slides collected from a taconite iron-ore processing mill, a tremolitic talc-ore processing mill, and from around a crusher in a meta-basalt stone quarry were prepared with relocatable coverslips to revisit the same field areas on the slides. For each slide, three or four field areas were randomly selected and pictures were taken every 2 weeks to determine any sign of fiber movement over time. For 11 AT slides (named as AT-3.5) prepared with 3.5 μl of the mounting medium according to the NIOSH 7400 method, no fiber movements were detected over 59 weeks. On the other hand, AT slides prepared with larger quantities (10, 15, and 20 μl) of the mounting medium (named as AT-10) and AE slides prepared with ∼10 μl mounting medium showed fiber movement from the eighth day at the earliest. Fiber movement began earlier for the slides mounted with excess triacetin than for those mounted with Euparal. The sample slide storage method, either vertically or horizontally, did not seem to accelerate fiber movement. Additionally, two other modified methods, dimethylformamide solution/Euparal (mDE) and dimethylformamide solution/triacetin (mDT), were also prepared where the mounting medium was placed between the cleared filter wedge and the glass slide. The findings of fiber movements were similar; when 3.5 μl of triacetin was used for the mDT slides, fiber movements were not detected, while fibers on slides prepared with 10 μl triacetin (mDT-10) moved around. No fiber movements were observed for the mDE slides at any time during 59 weeks. Once fiber movement started, fibers moved over distances measured from 4 μm and up to >1000 μm within 22 weeks. However, since then, no further fiber movements have been observed in any field sample slides. Additional sample slides, two Amosite and two chrysotile, were prepared from Union for International Cancer Control (UICC) samples using the AT method with 5 μl triacetin mounting medium. Fiber movements were also observed in these samples; chrysotile fibers began to migrate in 3 weeks, while Amosite fiber movement started after 3 months. Although fiber movement was observed for the AT-10, AE, and mDT-10 sample slides, fiber counts were not significantly different from AT-3.5 and mDE samples that exhibited no fiber movement. Although fiber counts would not be significantly changed by fiber movement, the type and amount of mounting medium for sample slide preparation remains critical for issues such as quality assurance and training of analysts by revisiting the same fibers.

Effects of sampling strategy, detection probability, and independence of counts on the use of point counts

USGS Publications Warehouse

Pendleton, G.W.; Ralph, C. John; Sauer, John R.; Droege, Sam

1995-01-01

Many factors affect the use of point counts for monitoring bird populations, including sampling strategies, variation in detection rates, and independence of sample points. The most commonly used sampling plans are stratified sampling, cluster sampling, and systematic sampling. Each of these might be most useful for different objectives or field situations. Variation in detection probabilities and lack of independence among sample points can bias estimates and measures of precision. All of these factors should be con-sidered when using point count methods.

On the Ground or in the Air? A Methodological Experiment on Crop Residue Cover Measurement in Ethiopia

NASA Astrophysics Data System (ADS)

Kosmowski, Frédéric; Stevenson, James; Campbell, Jeff; Ambel, Alemayehu; Haile Tsegay, Asmelash

2017-10-01

Maintaining permanent coverage of the soil using crop residues is an important and commonly recommended practice in conservation agriculture. Measuring this practice is an essential step in improving knowledge about the adoption and impact of conservation agriculture. Different data collection methods can be implemented to capture the field level crop residue coverage for a given plot, each with its own implication on survey budget, implementation speed and respondent and interviewer burden. In this paper, six alternative methods of crop residue coverage measurement are tested among the same sample of rural households in Ethiopia. The relative accuracy of these methods are compared against a benchmark, the line-transect method. The alternative methods compared against the benchmark include: (i) interviewee (respondent) estimation; (ii) enumerator estimation visiting the field; (iii) interviewee with visual-aid without visiting the field; (iv) enumerator with visual-aid visiting the field; (v) field picture collected with a drone and analyzed with image-processing methods and (vi) satellite picture of the field analyzed with remote sensing methods. Results of the methodological experiment show that survey-based methods tend to underestimate field residue cover. When quantitative data on cover are needed, the best estimates are provided by visual-aid protocols. For categorical analysis (i.e., >30% cover or not), visual-aid protocols and remote sensing methods perform equally well. Among survey-based methods, the strongest correlates of measurement errors are total farm size, field size, distance, and slope. Results deliver a ranking of measurement options that can inform survey practitioners and researchers.

On the Ground or in the Air? A Methodological Experiment on Crop Residue Cover Measurement in Ethiopia.

PubMed

Kosmowski, Frédéric; Stevenson, James; Campbell, Jeff; Ambel, Alemayehu; Haile Tsegay, Asmelash

2017-10-01

Maintaining permanent coverage of the soil using crop residues is an important and commonly recommended practice in conservation agriculture. Measuring this practice is an essential step in improving knowledge about the adoption and impact of conservation agriculture. Different data collection methods can be implemented to capture the field level crop residue coverage for a given plot, each with its own implication on survey budget, implementation speed and respondent and interviewer burden. In this paper, six alternative methods of crop residue coverage measurement are tested among the same sample of rural households in Ethiopia. The relative accuracy of these methods are compared against a benchmark, the line-transect method. The alternative methods compared against the benchmark include: (i) interviewee (respondent) estimation; (ii) enumerator estimation visiting the field; (iii) interviewee with visual-aid without visiting the field; (iv) enumerator with visual-aid visiting the field; (v) field picture collected with a drone and analyzed with image-processing methods and (vi) satellite picture of the field analyzed with remote sensing methods. Results of the methodological experiment show that survey-based methods tend to underestimate field residue cover. When quantitative data on cover are needed, the best estimates are provided by visual-aid protocols. For categorical analysis (i.e., >30% cover or not), visual-aid protocols and remote sensing methods perform equally well. Among survey-based methods, the strongest correlates of measurement errors are total farm size, field size, distance, and slope. Results deliver a ranking of measurement options that can inform survey practitioners and researchers.

Efficiency of snake sampling methods in the Brazilian semiarid region.

PubMed

Mesquita, Paula C M D; Passos, Daniel C; Cechin, Sonia Z

2013-09-01

The choice of sampling methods is a crucial step in every field survey in herpetology. In countries where time and financial support are limited, the choice of the methods is critical. The methods used to sample snakes often lack objective criteria, and the traditional methods have apparently been more important when making the choice. Consequently researches using not-standardized methods are frequently found in the literature. We have compared four commonly used methods for sampling snake assemblages in a semiarid area in Brazil. We compared the efficacy of each method based on the cost-benefit regarding the number of individuals and species captured, time, and financial investment. We found that pitfall traps were the less effective method in all aspects that were evaluated and it was not complementary to the other methods in terms of abundance of species and assemblage structure. We conclude that methods can only be considered complementary if they are standardized to the objectives of the study. The use of pitfall traps in short-term surveys of the snake fauna in areas with shrubby vegetation and stony soil is not recommended.

Archeointensity study on baked clay samples taken from the reconstructed ancient kiln: implication for validity of the Tsunakawa-Shaw paleointensity method

NASA Astrophysics Data System (ADS)

Yamamoto, Yuhji; Torii, Masayuki; Natsuhara, Nobuyoshi

2015-05-01

In 1972, a reconstruction experiment of a kiln had been done to reproduce an excavated kiln of the seventh century in Japan. Baked clay samples were taken from the floor surface and -20 cm level, and they have been stored after determinations of the paleomagnetic directions by partial alternating field demagnetizations. We recently applied the Tsunakawa-Shaw method to the samples to assess how reliable archeointensity results are obtained from the samples. A suite of the rock magnetic experiments and the scanning electron microscope observations elucidate that dominant magnetic carriers of the floor surface samples are Ti-poor titanomagnetite grains in approximately 10 nm size with single-domain and/or super-paramagnetic states, whereas contributions of multi-domain grains seem to be relatively large for the -20-cm level samples. From the floor surface samples, six out of the eight successful results were obtained and they give an average of 47.3 μT with a standard deviation of 2.2 μT. This is fairly consistent with the in situ geomagnetic field of 46.4 μT at the time of the reconstruction. They are obtained with a built-in anisotropy correction using anhysteretic remanent magnetization and without any cooling rate corrections. In contrast, only one out of four was successful from the -20-cm level samples. It yields an archeointensity of 31.6 μT, which is inconsistent with the in situ geomagnetic field. Considering from the in situ temperature record during the firing of the kiln and the unblocking temperature spectra of the samples, the floor surface samples acquired full thermoremanent magnetizations (TRMs) as their natural remanent magnetizations whereas the -20-cm level samples only acquired partial TRMs, and these differences probably cause the difference in the archeointensity results between the two sample groups. For archeointensity researches, baked clay samples from a kiln floor are considered to be ideal materials.

Development of a method for detection and quantification of B. brongniartii and B. bassiana in soil

NASA Astrophysics Data System (ADS)

Canfora, L.; Malusà, E.; Tkaczuk, C.; Tartanus, M.; Łabanowska, B. H.; Pinzari, F.

2016-03-01

A culture independent method based on qPCR was developed for the detection and quantification of two fungal inoculants in soil. The aim was to adapt a genotyping approach based on SSR (Simple Sequence Repeat) marker to a discriminating tracing of two different species of bioinoculants in soil, after their in-field release. Two entomopathogenic fungi, Beauveria bassiana and B. brongniartii, were traced and quantified in soil samples obtained from field trials. These two fungal species were used as biological agents in Poland to control Melolontha melolontha (European cockchafer), whose larvae live in soil menacing horticultural crops. Specificity of SSR markers was verified using controls consisting of: i) soil samples containing fungal spores of B. bassiana and B. brongniartii in known dilutions; ii) the DNA of the fungal microorganisms; iii) soil samples singly inoculated with each fungus species. An initial evaluation of the protocol was performed with analyses of soil DNA and mycelial DNA. Further, the simultaneous detection and quantification of B. bassiana and B. brongniartii in soil was achieved in field samples after application of the bio-inoculants. The protocol can be considered as a relatively low cost solution for the detection, identification and traceability of fungal bio-inoculants in soil.

Development of a method for detection and quantification of B. brongniartii and B. bassiana in soil

PubMed Central

Canfora, L.; Malusà, E.; Tkaczuk, C.; Tartanus, M.; Łabanowska, B.H.; Pinzari, F.

2016-01-01

A culture independent method based on qPCR was developed for the detection and quantification of two fungal inoculants in soil. The aim was to adapt a genotyping approach based on SSR (Simple Sequence Repeat) marker to a discriminating tracing of two different species of bioinoculants in soil, after their in-field release. Two entomopathogenic fungi, Beauveria bassiana and B. brongniartii, were traced and quantified in soil samples obtained from field trials. These two fungal species were used as biological agents in Poland to control Melolontha melolontha (European cockchafer), whose larvae live in soil menacing horticultural crops. Specificity of SSR markers was verified using controls consisting of: i) soil samples containing fungal spores of B. bassiana and B. brongniartii in known dilutions; ii) the DNA of the fungal microorganisms; iii) soil samples singly inoculated with each fungus species. An initial evaluation of the protocol was performed with analyses of soil DNA and mycelial DNA. Further, the simultaneous detection and quantification of B. bassiana and B. brongniartii in soil was achieved in field samples after application of the bio-inoculants. The protocol can be considered as a relatively low cost solution for the detection, identification and traceability of fungal bio-inoculants in soil. PMID:26975931

A robust and fast method of sampling and analysis of delta13C of dissolved inorganic carbon in ground waters.

PubMed

Spötl, Christoph

2005-09-01

The stable carbon isotopic composition of dissolved inorganic carbon (delta13C(DIC)) is traditionally determined using either direct precipitation or gas evolution methods in conjunction with offline gas preparation and measurement in a dual-inlet isotope ratio mass spectrometer. A gas evolution method based on continuous-flow technology is described here, which is easy to use and robust. Water samples (100-1500 microl depending on the carbonate alkalinity) are injected into He-filled autosampler vials in the field and analysed on an automated continuous-flow gas preparation system interfaced to an isotope ratio mass spectrometer. Sample analysis time including online preparation is 10 min and overall precision is 0.1 per thousand. This method is thus fast and can easily be automated for handling large sample batches.

Field trials of line transect methods applied to estimation of desert tortoise abundance

USGS Publications Warehouse

Anderson, David R.; Burnham, Kenneth P.; Lubow, Bruce C.; Thomas, L. E. N.; Corn, Paul Stephen; Medica, Philip A.; Marlow, R.W.

2001-01-01

We examine the degree to which field observers can meet the assumptions underlying line transect sampling to monitor populations of desert tortoises (Gopherus agassizii). We present the results of 2 field trials using artificial tortoise models in 3 size classes. The trials were conducted on 2 occasions on an area south of Las Vegas, Nevada, where the density of the test population was known. In the first trials, conducted largely by experienced biologists who had been involved in tortoise surveys for many years, the density of adult tortoise models was well estimated (-3.9% bias), while the bias was higher (-20%) for subadult tortoise models. The bias for combined data was -12.0%. The bias was largely attributed to the failure to detect all tortoise models on or near the transect centerline. The second trials were conducted with a group of largely inexperienced student volunteers and used somewhat different searching methods, and the results were similar to the first trials. Estimated combined density of subadult and adult tortoise models had a negative bias (-7.3%), again attributable to failure to detect some models on or near the centerline. Experience in desert tortoise biology, either comparing the first and second trials or in the second trial with 2 experienced biologists versus 16 novices, did not have an apparent effect on the quality of the data or the accuracy of the estimates. Observer training, specific to line transect sampling, and field testing are important components of a reliable survey. Line transect sampling represents a viable method for large-scale monitoring of populations of desert tortoise; however, field protocol must be improved to assure the key assumptions are met.

Vortex focusing of ions produced in corona discharge.

PubMed

Kolomiets, Yuri N; Pervukhin, Viktor V

2013-06-15

Completeness of the ion transportation into an analytical path defines the efficiency of ionization analysis techniques. This is of particular importance for atmospheric pressure ionization sources like corona discharge, electrospray, ionization with radioactive ((3)H, (63)Ni) isotopes that produce nonuniform spatial distribution of sample ions. The available methods of sample ion focusing are either efficient at reduced pressure (~1Torr) or feature high sample losses. This paper deals with experimental research into atmospheric pressure focusing of unipolar (positive) ions using a highly swirled air stream with a well-defined vortex core. Effects of electrical fields from corona needle and inlet capillary of mass spectrometer on collection efficiency is considered. We used a corona discharge to produce an ionized unipolar sample. It is shown experimentally that with an electrical field barrier efficient transportation and focusing of an ionized sample are possible only when a metal plate restricting the stream and provided with an opening covered with a grid is used. This gives a five-fold increase of the transportation efficiency. It is shown that the electric field barrier in the vortex sampling region reduces the efficiency of remote ionized sample transportation two times. The difference in the efficiency of light ion focusing observed may be explained by a high mobility and a significant effect of the electric field barrier upon them. It is possible to conclude based on the experimental data that the presence of the field barrier narrows considerably (more than by one and half) the region of the vortex sample ion focusing. Copyright © 2013 Elsevier B.V. All rights reserved.

Field Evaluation of a High Throughput Loop Mediated Isothermal Amplification Test for the Detection of Asymptomatic Plasmodium Infections in Zanzibar

PubMed Central

Morris, Ulrika; Ding, Xavier C.; Jovel, Irina; Msellem, Mwinyi I.; Bergman, Daniel; Islam, Atiqul; Ali, Abdullah S.; Polley, Spencer; Gonzalez, Iveth J.; Mårtensson, Andreas; Björkman, Anders

2017-01-01

Background New field applicable diagnostic tools are needed for highly sensitive detection of residual malaria infections in pre-elimination settings. Field performance of a high throughput DNA extraction system for loop mediated isothermal amplification (HTP-LAMP) was therefore evaluated for detecting malaria parasites among asymptomatic individuals in Zanzibar. Methods HTP-LAMP performance was evaluated against real-time PCR on 3008 paired blood samples collected on filter papers in a community-based survey in 2015. Results The PCR and HTP-LAMP determined malaria prevalences were 1.6% (95%CI 1.3–2.4) and 0.7% (95%CI 0.4–1.1), respectively. The sensitivity of HTP-LAMP compared to PCR was 40.8% (CI95% 27.0–55.8) and the specificity was 99.9% (CI95% 99.8–100). For the PCR positive samples, there was no statistically significant difference between the geometric mean parasite densities among the HTP-LAMP positive (2.5 p/μL, range 0.2–770) and HTP-LAMP negative (1.4 p/μL, range 0.1–7) samples (p = 0.088). Two lab technicians analysed up to 282 samples per day and the HTP-LAMP method was experienced as user friendly. Conclusions Although field applicable, this high throughput format of LAMP as used here was not sensitive enough to be recommended for detection of asymptomatic low-density infections in areas like Zanzibar, approaching malaria elimination. PMID:28095434

Far-field optical imaging with subdiffraction resolution enabled by nonlinear saturation absorption

NASA Astrophysics Data System (ADS)

Ding, Chenliang; Wei, Jingsong

2016-01-01

The resolution of far-field optical imaging is required to improve beyond the Abbe limit to the subdiffraction or even the nanoscale. In this work, inspired by scanning electronic microscopy (SEM) imaging, in which carbon (or Au) thin films are usually required to be coated on the sample surface before imaging to remove the charging effect while imaging by electrons. We propose a saturation-absorption-induced far-field super-resolution optical imaging method (SAI-SRIM). In the SAI-SRIM, the carbon (or Au) layers in SEM imaging are replaced by nonlinear-saturation-absorption (NSA) thin films, which are directly coated onto the sample surfaces using advanced thin film deposition techniques. The surface fluctuant morphologies are replicated to the NSA thin films, accordingly. The coated sample surfaces are then imaged using conventional laser scanning microscopy. Consequently, the imaging resolution is greatly improved, and subdiffraction-resolved optical images are obtained theoretically and experimentally. The SAI-SRIM provides an effective and easy way to achieve far-field super-resolution optical imaging for sample surfaces with geometric fluctuant morphology characteristics.

Application of solid-phase microextraction for in vivo laboratory and field sampling of pharmaceuticals in fish.

PubMed

Zhou, Simon Ningsun; Oakes, Ken D; Servos, Mark R; Pawliszyn, Janusz

2008-08-15

Previous field studies utilizing solid-phase microextraction (SPME) predominantly focused on volatile and semivolatile compounds in air or water. Earlier in vivo sampling studies utilizing SPME were limited to the liquid matrix (blood). The present study has expanded the SPME technique to semisolid tissues under laboratory and field conditions through the investigation of both theoretical and applied experimental approaches. Pre-equilibrium extraction and desorption were performed in vivo in two separate animals. Excellent linearity was found between the amounts extracted by SPME from the muscle of living fish and the waterborne concentrations of pharmaceuticals. A simple SPME method is also described to simultaneously determine free and total analyte concentrations in living tissue. The utility of in vivo SPME sampling was evaluated in wild fish collected from a number of different river locations under varying degrees of influence from municipal wastewater effluents. Diphenhydramine and diltiazem were detected in the muscle of fish downstream of a local wastewater treatment plant. Based on this study, SPME demonstrated several important advantages such as simplicity, sensitivity, and robustness under laboratory and in vivo field sampling conditions.

Comparison of Sample and Detection Quantification Methods for Salmonella Enterica from Produce

NASA Technical Reports Server (NTRS)

Hummerick, M. P.; Khodadad, C.; Richards, J. T.; Dixit, A.; Spencer, L. M.; Larson, B.; Parrish, C., II; Birmele, M.; Wheeler, Raymond

2014-01-01

The purpose of this study was to identify and optimize fast and reliable sampling and detection methods for the identification of pathogens that may be present on produce grown in small vegetable production units on the International Space Station (ISS), thus a field setting. Microbiological testing is necessary before astronauts are allowed to consume produce grown on ISS where currently there are two vegetable production units deployed, Lada and Veggie.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dalal, M.; Mallick, A.; Mahapatra, A.S.

Highlights: • Cation distribution in tetrahedral and octahedral sites of spinel Ni{sub 0.4}Zn{sub 0.4}Co{sub 0.2}Fe{sub 2}O{sub 4}. • Structural analysis of observed X-ray diffraction pattern using Rietveld method. • Study of hyperfine behaviour using Mössbauer spectroscopy. • Static and dynamic magnetic measurements. • Correlation of cation distributions obtained from Rietveld analysis with the results of magnetic and Mössbauer effect measurements. - Abstract: Nanoparticles of Ni{sub 0.4}Zn{sub 0.4}Co{sub 0.2}Fe{sub 2}O{sub 4} are prepared by a simple co-precipitation method. The as dried sample is heat treated at 400, 500, 600, 700 and 800 °C to obtain different sizes of nanoparticles. The crystallographicmore » phase of the samples is confirmed analyzing observed X-ray diffraction (XRD) by Rietveld method. Hyperfine parameters of the samples are derived from room temperature (RT) Mössbauer spectra of the samples. Magnetic properties of the samples are investigated by static and dynamic hysteresis loops. Different magneto-crystalline parameters are calculated from the variation of magnetization with temperature (M–T curve) under zero field cooled (ZFC) and field cooled (FC) conditions of the as dried sample. The cation distribution estimated from Rietveld analysis are correlated with the results of magnetic and Mössbauer effect measurements. The observed high value of saturation magnetization (72.7 emu/g at RT) of the sample annealed at 800 °C would be interesting for applications in different electromagnetic devices.« less

A GIS-based method for household recruitment in a prospective pesticide exposure study.

PubMed

Allpress, Justine L E; Curry, Ross J; Hanchette, Carol L; Phillips, Michael J; Wilcosky, Timothy C

2008-04-30

Recent advances in GIS technology and remote sensing have provided new opportunities to collect ecologic data on agricultural pesticide exposure. Many pesticide studies have used historical or records-based data on crops and their associated pesticide applications to estimate exposure by measuring residential proximity to agricultural fields. Very few of these studies collected environmental and biological samples from study participants. One of the reasons for this is the cost of identifying participants who reside near study fields and analyzing samples obtained from them. In this paper, we present a cost-effective, GIS-based method for crop field selection and household recruitment in a prospective pesticide exposure study in a remote location. For the most part, our multi-phased approach was carried out in a research facility, but involved two brief episodes of fieldwork for ground truthing purposes. This method was developed for a larger study designed to examine the validity of indirect pesticide exposure estimates by comparing measured exposures in household dust, water and urine with records-based estimates that use crop location, residential proximity and pesticide application data. The study focused on the pesticide atrazine, a broadleaf herbicide used in corn production and one of the most widely-used pesticides in the U.S. We successfully used a combination of remotely-sensed data, GIS-based methods and fieldwork to select study fields and recruit participants in Illinois, a state with high corn production and heavy atrazine use. Our several-step process consisted of the identification of potential study fields and residential areas using aerial photography; verification of crop patterns and land use via site visits; development of a GIS-based algorithm to define recruitment areas around crop fields; acquisition of geocoded household-level data within each recruitment area from a commercial vendor; and confirmation of final participant household locations via ground truthing. The use of these procedures resulted in a sufficient sample of participants from 14 recruitment areas in seven Illinois counties. One of the challenges in pesticide research is the identification and recruitment of study participants, which is time consuming and costly, especially when the study site is in a remote location. We have demonstrated how GIS-based processes can be used to recruit participants, increase efficiency and enhance accuracy. The method that we used ultimately made it possible to collect biological samples from a specific demographic group within strictly defined exposure areas, with little advance knowledge of the location or population.

Presumptive Sources of Fecal Contamination in Four Tributaries to the New River Gorge National River, West Virginia, 2004

USGS Publications Warehouse

Mathes, Melvin V.; O'Brien, Tara L.; Strickler, Kriston M.; Hardy, Joshua J.; Schill, William B.; Lukasik, Jerzy; Scott, Troy M.; Bailey, David E.; Fenger, Terry L.

2007-01-01

Several methods were used to determine the sources of fecal contamination in water samples collected during September and October 2004 from four tributaries to the New River Gorge National River -- Arbuckle Creek, Dunloup Creek, Keeney Creek, and Wolf Creek. All four tributaries historically have had elevated levels of fecal coliform bacteria. The source-tracking methods used yielded various results, possibly because one or more methods failed. Sourcing methods used in this study included the detection of several human-specific and animal-specific biological or molecular markers, and library-dependent pulsed-field gel electrophoresis analysis that attempted to associate Escherichia coli bacteria obtained from water samples with animal sources by matching DNA-fragment banding patterns. Evaluation of the results of quality-control analysis indicated that pulsed-field gel electrophoresis analysis was unable to identify known-source bacteria isolates. Increasing the size of the known-source library did not improve the results for quality-control samples. A number of emerging methods, using markers in Enterococcus, human urine, Bacteroidetes, and host mitochondrial DNA, demonstrated some potential in associating fecal contamination with human or animal sources in a limited analysis of quality-control samples. All four of the human-specific markers were detected in water samples from Keeney Creek, a watershed with no centralized municipal wastewater-treatment facilities, thus indicating human sources of fecal contamination. The human-specific Bacteroidetes and host mitochondrial DNA markers were detected in water samples from Dunloup Creek, Wolf Creek, and to a lesser degree Arbuckle Creek. Results of analysis for wastewater compounds indicate that the September 27 sample from Arbuckle Creek contained numerous human tracer compounds likely from sewage. Dog, horse, chicken, and pig host mitochondrial DNA were detected in some of the water samples with the exception of the October 5 sample from Dunloup Creek. Cow, white-tailed deer, and Canada goose DNA were not detected in any of the samples collected from the four tributaries, despite the presence of these animals in the watersheds. Future studies with more rigorous quality-control analyses are needed to investigate the potential applicability and use of these emerging methods. Because many of the detections for the various methods could vary over time and with flow conditions, repeated sampling during both base flow and storm events would be necessary to more definitively determine the sources of fecal contamination for each watershed.

“Comprehensive emission measurements from prescribed ...

EPA Pesticide Factsheets

Simultaneous aerial- and ground-based emission sampling was conducted during prescribed burns at Eglin Air Force Base in November 2012 on a short grass/shrub field and a pine forest. Cumulative emission samples for volatile organic comounds, elemental carbon, organic carbon, chlorinated dioxins and furans, and PM2.5 and continuous samples for black carbon, particle size, and CO2 were taken. Aerial instruments were lofted using a 5 m diameter, helium-filled aerostat that was maneuvered with two remotely-controlled tethers mounted on all-terrain vehicles. A parallel set of instruments on the ground made simultaneous measurements, allowing for a comparison of ground level versus elevated measurements. Ground instruments were supplemented by additional measurements of polycyclic aromatic hydrocarbons and particle aerosol absorption and light scattering. Raw biomass was also gathered on site and tested in a laboratory combustion facility using the same array of instruments. This work compares emissions derived from aerial and ground sampling as well as field and laboratory results. This abstract will likely be the first ever prescribed burn study to compare laboratory and field emission results with results from aerial and and ground sampling. As such it will inform sampling methods for future events and determine the ability of laboratory simulations to mimic events inthe field.

[Comparative analysis between diatom nitric acid digestion method and plankton 16S rDNA PCR method].

PubMed

Han, Jun-ge; Wang, Cheng-bao; Li, Xing-biao; Fan, Yan-yan; Feng, Xiang-ping

2013-10-01

To compare and explore the application value of diatom nitric acid digestion method and plankton 16S rDNA PCR method for drowning identification. Forty drowning cases from 2010 to 2011 were collected from Department of Forensic Medicine of Wenzhou Medical University. Samples including lung, kidney, liver and field water from each case were tested with diatom nitric acid digestion method and plankton 16S rDNA PCR method, respectively. The Diatom nitric acid digestion method and plankton 16S rDNA PCR method required 20 g and 2 g of each organ, and 15 mL and 1.5 mL of field water, respectively. The inspection time and detection rate were compared between the two methods. Diatom nitric acid digestion method mainly detected two species of diatoms, Centriae and Pennatae, while plankton 16S rDNA PCR method amplified a length of 162 bp band. The average inspection time of each case of the Diatom nitric acid digestion method was (95.30 +/- 2.78) min less than (325.33 +/- 14.18) min of plankton 16S rDNA PCR method (P < 0.05). The detection rates of two methods for field water and lung were both 100%. For liver and kidney, the detection rate of plankton 16S rDNA PCR method was both 80%, higher than 40% and 30% of diatom nitric acid digestion method (P < 0.05), respectively. The laboratory testing method needs to be appropriately selected according to the specific circumstances in the forensic appraisal of drowning. Compared with diatom nitric acid digestion method, plankton 16S rDNA PCR method has practice values with such advantages as less quantity of samples, huge information and high specificity.

Magnetic enhancement and coding in mechanosynthesized Ni{sub 0.3}Zn{sub 0.7}Fe{sub 2}O{sub 4} nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Majumder, S.; Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata-700064; Dey, S.

2015-06-24

The nanosized Ni{sub 0.3}Zn{sub 0.7}Fe{sub 2}O{sub 4} (∼ 15 nm) has been synthesized by high energy ball milling of the bulk powder sample. The sample has been characterized by powder x-ray diffraction, field emission and transmission electron microscopic and dc magnetic measurement techniques. The dc magnetic measurement on the sample indicates that the sample exhibit enhancement of magnetization compared to its counterparts synthesized by chemical methods. Moreover, the system stores the memory of either decrease or increase of magnetic field enabling a magnetic coding of “0” and “1” which can be profitably used in magnetic storage and sensing devices.

Optimization of groundwater sampling approach under various hydrogeological conditions using a numerical simulation model

NASA Astrophysics Data System (ADS)

Qi, Shengqi; Hou, Deyi; Luo, Jian

2017-09-01

This study presents a numerical model based on field data to simulate groundwater flow in both the aquifer and the well-bore for the low-flow sampling method and the well-volume sampling method. The numerical model was calibrated to match well with field drawdown, and calculated flow regime in the well was used to predict the variation of dissolved oxygen (DO) concentration during the purging period. The model was then used to analyze sampling representativeness and sampling time. Site characteristics, such as aquifer hydraulic conductivity, and sampling choices, such as purging rate and screen length, were found to be significant determinants of sampling representativeness and required sampling time. Results demonstrated that: (1) DO was the most useful water quality indicator in ensuring groundwater sampling representativeness in comparison with turbidity, pH, specific conductance, oxidation reduction potential (ORP) and temperature; (2) it is not necessary to maintain a drawdown of less than 0.1 m when conducting low flow purging. However, a high purging rate in a low permeability aquifer may result in a dramatic decrease in sampling representativeness after an initial peak; (3) the presence of a short screen length may result in greater drawdown and a longer sampling time for low-flow purging. Overall, the present study suggests that this new numerical model is suitable for describing groundwater flow during the sampling process, and can be used to optimize sampling strategies under various hydrogeological conditions.

Pure phase encode magnetic field gradient monitor.

PubMed

Han, Hui; MacGregor, Rodney P; Balcom, Bruce J

2009-12-01

Numerous methods have been developed to measure MRI gradient waveforms and k-space trajectories. The most promising new strategy appears to be magnetic field monitoring with RF microprobes. Multiple RF microprobes may record the magnetic field evolution associated with a wide variety of imaging pulse sequences. The method involves exciting one or more test samples and measuring the time evolution of magnetization through the FIDs. Two critical problems remain. The gradient waveform duration is limited by the sample T(2)*, while the k-space maxima are limited by gradient dephasing. The method presented is based on pure phase encode FIDs and solves the above two problems in addition to permitting high strength gradient measurement. A small doped water phantom (1-3 mm droplet, T(1), T(2), T(2)* < 100 micros) within a microprobe is excited by a series of closely spaced broadband RF pulses each followed by FID single point acquisition. Two trial gradient waveforms have been chosen to illustrate the technique, neither of which could be measured by the conventional RF microprobe measurement. The first is an extended duration gradient waveform while the other illustrates the new method's ability to measure gradient waveforms with large net area and/or high amplitude. The new method is a point monitor with simple implementation and low cost hardware requirements.

The Far-Field Hubble Constant

NASA Astrophysics Data System (ADS)

Lauer, Tod

1995-07-01

We request deep, near-IR (F814W) WFPC2 images of five nearby Brightest Cluster Galaxies (BCG) to calibrate the BCG Hubble diagram by the Surface Brightness Fluctuation (SBF) method. Lauer & Postman (1992) show that the BCG Hubble diagram measured out to 15,000 km s^-1 is highly linear. Calibration of the Hubble diagram zeropoint by SBF will thus yield an accurate far-field measure of H_0 based on the entire volume within 15,000 km s^-1, thus circumventing any strong biases caused by local peculiar velocity fields. This method of reaching the far field is contrasted with those using distance ratios between Virgo and Coma, or any other limited sample of clusters. HST is required as the ground-based SBF method is limited to <3,000 km s^-1. The high spatial resolution of HST allows precise measurement of the SBF signal at large distances, and allows easy recognition of globular clusters, background galaxies, and dust clouds in the BCG images that must be removed prior to SBF detection. The proposing team developed the SBF method, the first BCG Hubble diagram based on a full-sky, volume-limited BCG sample, played major roles in the calibration of WFPC and WFPC2, and are conducting observations of local galaxies that will validate the SBF zeropoint (through GTO programs). This work uses the SBF method to tie both the Cepheid and Local Group giant-branch distances generated by HST to the large scale Hubble flow, which is most accurately traced by BCGs.

Deer Browse Production: Rapid Sampling and Computer-aided Analysis

Treesearch

Forest W. Stearns; Dennis L. Schweitzer; William A. Creed

1968-01-01

Describes field techniques by which winter deer-browse production can be sampled with reasonable accuracy and moderate effort; and expedites the tabulation of the browse data. The method will be useful to both land managers and scientists doing research on the habitat of the white-tailed deer.

Multimedia Sampling During The Application Of Biosolids On A Land Test Site (Presentation)

EPA Science Inventory

The goal of this research study was to evaluate air and soil sampling methods and analytical techniques for commercial land application of biosolids. Biosolids, were surface applied at agronomic rates to an agricultural field. During the period of August 2004 to January 2005, 3...

A guide to soil samplng and analysis on the National Forests of the Inland Northwest United States

Treesearch

Deb Page-Dumroese; Al Harvey; Marty Jurgensen

1995-01-01

This guide details soil collection methods, sample analysis, and data translation. It outlines what field soil scientists need to make accurate interpretations of site information. Included are instructions for sampling typical Andisols found on National Forests of the Inland Northwest United States.

RESIDENTIAL INDOOR EXPOSURES OF CHILDREN TO PESTICIDES FOLLOWING LAWN APPLICATIONS

EPA Science Inventory

Methods have been developed to estimate children's residential exposures to pesticide residues and applied in a small field study of indoor exposures resulting from the intrusion of lawn-applied herbicide into the home. Sampling methods included size-selective indoor air sampli...

Critical considerations for the application of environmental DNA methods to detect aquatic species

USGS Publications Warehouse

Goldberg, Caren S.; Turner, Cameron R.; Deiner, Kristy; Klymus, Katy E.; Thomsen, Philip Francis; Murphy, Melanie A.; Spear, Stephen F.; McKee, Anna; Oyler-McCance, Sara J.; Cornman, Robert S.; Laramie, Matthew B.; Mahon, Andrew R.; Lance, Richard F.; Pilliod, David S.; Strickler, Katherine M.; Waits, Lisette P.; Fremier, Alexander K.; Takahara, Teruhiko; Herder, Jelger E.; Taberlet, Pierre

2016-01-01

Species detection using environmental DNA (eDNA) has tremendous potential for contributing to the understanding of the ecology and conservation of aquatic species. Detecting species using eDNA methods, rather than directly sampling the organisms, can reduce impacts on sensitive species and increase the power of field surveys for rare and elusive species. The sensitivity of eDNA methods, however, requires a heightened awareness and attention to quality assurance and quality control protocols. Additionally, the interpretation of eDNA data demands careful consideration of multiple factors. As eDNA methods have grown in application, diverse approaches have been implemented to address these issues. With interest in eDNA continuing to expand, supportive guidelines for undertaking eDNA studies are greatly needed.Environmental DNA researchers from around the world have collaborated to produce this set of guidelines and considerations for implementing eDNA methods to detect aquatic macroorganisms.Critical considerations for study design include preventing contamination in the field and the laboratory, choosing appropriate sample analysis methods, validating assays, testing for sample inhibition and following minimum reporting guidelines. Critical considerations for inference include temporal and spatial processes, limits of correlation of eDNA with abundance, uncertainty of positive and negative results, and potential sources of allochthonous DNA.We present a synthesis of knowledge at this stage for application of this new and powerful detection method.

Coulomb replica-exchange method: handling electrostatic attractive and repulsive forces for biomolecules.

PubMed

Itoh, Satoru G; Okumura, Hisashi

2013-03-30

We propose a new type of the Hamiltonian replica-exchange method (REM) for molecular dynamics (MD) and Monte Carlo simulations, which we refer to as the Coulomb REM (CREM). In this method, electrostatic charge parameters in the Coulomb interactions are exchanged among replicas while temperatures are exchanged in the usual REM. By varying the atom charges, the CREM overcomes free-energy barriers and realizes more efficient sampling in the conformational space than the REM. Furthermore, this method requires only a smaller number of replicas because only the atom charges of solute molecules are used as exchanged parameters. We performed Coulomb replica-exchange MD simulations of an alanine dipeptide in explicit water solvent and compared the results with those of the conventional canonical, replica exchange, and van der Waals REMs. Two force fields of AMBER parm99 and AMBER parm99SB were used. As a result, the CREM sampled all local-minimum free-energy states more frequently than the other methods for both force fields. Moreover, the Coulomb, van der Waals, and usual REMs were applied to a fragment of an amyloid-β peptide (Aβ) in explicit water solvent to compare the sampling efficiency of these methods for a larger system. The CREM sampled structures of the Aβ fragment more efficiently than the other methods. We obtained β-helix, α-helix, 3(10)-helix, β-hairpin, and β-sheet structures as stable structures and deduced pathways of conformational transitions among these structures from a free-energy landscape. Copyright © 2012 Wiley Periodicals, Inc.

Method optimization for non-equilibrium solid phase microextraction sampling of HAPs for GC/MS analysis

NASA Astrophysics Data System (ADS)

Zawadowicz, M. A.; Del Negro, L. A.

2010-12-01

Hazardous air pollutants (HAPs) are usually present in the atmosphere at pptv-level, requiring measurements with high sensitivity and minimal contamination. Commonly used evacuated canister methods require an overhead in space, money and time that often is prohibitive to primarily-undergraduate institutions. This study optimized an analytical method based on solid-phase microextraction (SPME) of ambient gaseous matrix, which is a cost-effective technique of selective VOC extraction, accessible to an unskilled undergraduate. Several approaches to SPME extraction and sample analysis were characterized and several extraction parameters optimized. Extraction time, temperature and laminar air flow velocity around the fiber were optimized to give highest signal and efficiency. Direct, dynamic extraction of benzene from a moving air stream produced better precision (±10%) than sampling of stagnant air collected in a polymeric bag (±24%). Using a low-polarity chromatographic column in place of a standard (5%-Phenyl)-methylpolysiloxane phase decreased the benzene detection limit from 2 ppbv to 100 pptv. The developed method is simple and fast, requiring 15-20 minutes per extraction and analysis. It will be field-validated and used as a field laboratory component of various undergraduate Chemistry and Environmental Studies courses.

Forensic applications of ambient ionization mass spectrometry.

PubMed

Ifa, Demian R; Jackson, Ayanna U; Paglia, Giuseppe; Cooks, R Graham

2009-08-01

This review highlights and critically assesses forensic applications in the developing field of ambient ionization mass spectrometry. Ambient ionization methods permit the ionization of samples outside the mass spectrometer in the ordinary atmosphere, with minimal sample preparation. Several ambient ionization methods have been created since 2004 and they utilize different mechanisms to create ions for mass-spectrometric analysis. Forensic applications of these techniques--to the analysis of toxic industrial compounds, chemical warfare agents, illicit drugs and formulations, explosives, foodstuff, inks, fingerprints, and skin--are reviewed. The minimal sample pretreatment needed is illustrated with examples of analysis from complex matrices (e.g., food) on various substrates (e.g., paper). The low limits of detection achieved by most of the ambient ionization methods for compounds of forensic interest readily offer qualitative confirmation of chemical identity; in some cases quantitative data are also available. The forensic applications of ambient ionization methods are a growing research field and there are still many types of applications which remain to be explored, particularly those involving on-site analysis. Aspects of ambient ionization currently undergoing rapid development include molecular imaging and increased detection specificity through simultaneous chemical reaction and ionization by addition of appropriate chemical reagents.

Overview of the SAMPL5 host–guest challenge: Are we doing better?

PubMed Central

Yin, Jian; Henriksen, Niel M.; Slochower, David R.; Shirts, Michael R.; Chiu, Michael W.; Mobley, David L.; Gilson, Michael K.

2016-01-01

The ability to computationally predict protein-small molecule binding affinities with high accuracy would accelerate drug discovery and reduce its cost by eliminating rounds of trial-and-error synthesis and experimental evaluation of candidate ligands. As academic and industrial groups work toward this capability, there is an ongoing need for datasets that can be used to rigorously test new computational methods. Although protein–ligand data are clearly important for this purpose, their size and complexity make it difficult to obtain well-converged results and to troubleshoot computational methods. Host–guest systems offer a valuable alternative class of test cases, as they exemplify noncovalent molecular recognition but are far smaller and simpler. As a consequence, host–guest systems have been part of the prior two rounds of SAMPL prediction exercises, and they also figure in the present SAMPL5 round. In addition to being blinded, and thus avoiding biases that may arise in retrospective studies, the SAMPL challenges have the merit of focusing multiple researchers on a common set of molecular systems, so that methods may be compared and ideas exchanged. The present paper provides an overview of the host–guest component of SAMPL5, which centers on three different hosts, two octa-acids and a glycoluril-based molecular clip, and two different sets of guest molecules, in aqueous solution. A range of methods were applied, including electronic structure calculations with implicit solvent models; methods that combine empirical force fields with implicit solvent models; and explicit solvent free energy simulations. The most reliable methods tend to fall in the latter class, consistent with results in prior SAMPL rounds, but the level of accuracy is still below that sought for reliable computer-aided drug design. Advances in force field accuracy, modeling of protonation equilibria, electronic structure methods, and solvent models, hold promise for future improvements. PMID:27658802

Overview of the SAMPL5 host-guest challenge: Are we doing better?

PubMed

Yin, Jian; Henriksen, Niel M; Slochower, David R; Shirts, Michael R; Chiu, Michael W; Mobley, David L; Gilson, Michael K

2017-01-01

The ability to computationally predict protein-small molecule binding affinities with high accuracy would accelerate drug discovery and reduce its cost by eliminating rounds of trial-and-error synthesis and experimental evaluation of candidate ligands. As academic and industrial groups work toward this capability, there is an ongoing need for datasets that can be used to rigorously test new computational methods. Although protein-ligand data are clearly important for this purpose, their size and complexity make it difficult to obtain well-converged results and to troubleshoot computational methods. Host-guest systems offer a valuable alternative class of test cases, as they exemplify noncovalent molecular recognition but are far smaller and simpler. As a consequence, host-guest systems have been part of the prior two rounds of SAMPL prediction exercises, and they also figure in the present SAMPL5 round. In addition to being blinded, and thus avoiding biases that may arise in retrospective studies, the SAMPL challenges have the merit of focusing multiple researchers on a common set of molecular systems, so that methods may be compared and ideas exchanged. The present paper provides an overview of the host-guest component of SAMPL5, which centers on three different hosts, two octa-acids and a glycoluril-based molecular clip, and two different sets of guest molecules, in aqueous solution. A range of methods were applied, including electronic structure calculations with implicit solvent models; methods that combine empirical force fields with implicit solvent models; and explicit solvent free energy simulations. The most reliable methods tend to fall in the latter class, consistent with results in prior SAMPL rounds, but the level of accuracy is still below that sought for reliable computer-aided drug design. Advances in force field accuracy, modeling of protonation equilibria, electronic structure methods, and solvent models, hold promise for future improvements.

An evaluation of soil sampling for 137Cs using various field-sampling volumes.

PubMed

Nyhan, J W; White, G C; Schofield, T G; Trujillo, G

1983-05-01

The sediments from a liquid effluent receiving area at the Los Alamos National Laboratory and soils from an intensive study area in the fallout pathway of Trinity were sampled for 137Cs using 25-, 500-, 2500- and 12,500-cm3 field sampling volumes. A highly replicated sampling program was used to determine mean concentrations and inventories of 137Cs at each site, as well as estimates of spatial, aliquoting, and counting variance components of the radionuclide data. The sampling methods were also analyzed as a function of soil size fractions collected in each field sampling volume and of the total cost of the program for a given variation in the radionuclide survey results. Coefficients of variation (CV) of 137Cs inventory estimates ranged from 0.063 to 0.14 for Mortandad Canyon sediments, whereas CV values for Trinity soils were observed from 0.38 to 0.57. Spatial variance components of 137Cs concentration data were usually found to be larger than either the aliquoting or counting variance estimates and were inversely related to field sampling volume at the Trinity intensive site. Subsequent optimization studies of the sampling schemes demonstrated that each aliquot should be counted once, and that only 2-4 aliquots out of as many as 30 collected need be assayed for 137Cs. The optimization studies showed that as sample costs increased to 45 man-hours of labor per sample, the variance of the mean 137Cs concentration decreased dramatically, but decreased very little with additional labor.

A method for development of a system of identification for Appalachian coal-bearing rocks

USGS Publications Warehouse

Ferm, J.C.; Weisenfluh, G.A.; Smith, G.C.

2002-01-01

The number of observable properties of sedimentary rocks is large and numerous classifications have been proposed for describing them. Some rock classifications, however, may be disadvantageous in situations such as logging rock core during coal exploration programs, where speed and simplicity are the essence. After experimenting with a number of formats for logging rock core in the Appalachian coal fields, a method of using color photographs accompanied by a rock name and numeric code was selected. In order to generate a representative collection of rocks to be photographed, sample methods were devised to produce a representative collection, and empirically based techniques were devised to identify repeatedly recognizable rock types. A number of cores representing the stratigraphic and geographic range of the region were sampled so that every megascopically recognizable variety was included in the collection; the frequency of samples of any variety reflects the frequency with which it would be encountered during logging. In order to generate repeatedly recognizable rock classes, the samples were sorted to display variation in grain size, mineral composition, color, and sedimentary structures. Class boundaries for each property were selected on the basis of existing, widely accepted limits and the precision with which these limits could be recognized. The process of sorting the core samples demonstrated relationships between rock properties and indicated that similar methods, applied to other groups of rocks, could yield more widely applicable field classifications. ?? 2002 Elsevier Science B.V. All rights reserved.

Self-navigation of a scanning tunneling microscope tip toward a micron-sized graphene sample.

PubMed

Li, Guohong; Luican, Adina; Andrei, Eva Y

2011-07-01

We demonstrate a simple capacitance-based method to quickly and efficiently locate micron-sized conductive samples, such as graphene flakes, on insulating substrates in a scanning tunneling microscope (STM). By using edge recognition, the method is designed to locate and to identify small features when the STM tip is far above the surface, allowing for crash-free search and navigation. The method can be implemented in any STM environment, even at low temperatures and in strong magnetic field, with minimal or no hardware modifications.

Development of a field testing protocol for identifying Deepwater Horizon oil spill residues trapped near Gulf of Mexico beaches.

PubMed

Han, Yuling; Clement, T Prabhakar

2018-01-01

The Deepwater Horizon (DWH) accident, one of the largest oil spills in U.S. history, contaminated several beaches located along the Gulf of Mexico (GOM) shoreline. The residues from the spill still continue to be deposited on some of these beaches. Methods to track and monitor the fate of these residues require approaches that can differentiate the DWH residues from other types of petroleum residues. This is because, historically, the crude oil released from sources such as natural seeps and anthropogenic discharges have also deposited other types of petroleum residues on GOM beaches. Therefore, identifying the origin of these residues is critical for developing effective management strategies for monitoring the long-term environmental impacts of the DWH oil spill. Advanced fingerprinting methods that are currently used for identifying the source of oil spill residues require detailed laboratory studies, which can be cost-prohibitive. Also, most agencies typically use untrained workers or volunteers to conduct shoreline monitoring surveys and these worker will not have access to advanced laboratory facilities. Furthermore, it is impractical to routinely fingerprint large volumes of samples that are collected after a major oil spill event, such as the DWH spill. In this study, we propose a simple field testing protocol that can identify DWH oil spill residues based on their unique physical characteristics. The robustness of the method is demonstrated by testing a variety of oil spill samples, and the results are verified by characterizing the samples using advanced chemical fingerprinting methods. The verification data show that the method yields results that are consistent with the results derived from advanced fingerprinting methods. The proposed protocol is a reliable, cost-effective, practical field approach for differentiating DWH residues from other types of petroleum residues.

Development of a field testing protocol for identifying Deepwater Horizon oil spill residues trapped near Gulf of Mexico beaches

PubMed Central

Han, Yuling

2018-01-01

The Deepwater Horizon (DWH) accident, one of the largest oil spills in U.S. history, contaminated several beaches located along the Gulf of Mexico (GOM) shoreline. The residues from the spill still continue to be deposited on some of these beaches. Methods to track and monitor the fate of these residues require approaches that can differentiate the DWH residues from other types of petroleum residues. This is because, historically, the crude oil released from sources such as natural seeps and anthropogenic discharges have also deposited other types of petroleum residues on GOM beaches. Therefore, identifying the origin of these residues is critical for developing effective management strategies for monitoring the long-term environmental impacts of the DWH oil spill. Advanced fingerprinting methods that are currently used for identifying the source of oil spill residues require detailed laboratory studies, which can be cost-prohibitive. Also, most agencies typically use untrained workers or volunteers to conduct shoreline monitoring surveys and these worker will not have access to advanced laboratory facilities. Furthermore, it is impractical to routinely fingerprint large volumes of samples that are collected after a major oil spill event, such as the DWH spill. In this study, we propose a simple field testing protocol that can identify DWH oil spill residues based on their unique physical characteristics. The robustness of the method is demonstrated by testing a variety of oil spill samples, and the results are verified by characterizing the samples using advanced chemical fingerprinting methods. The verification data show that the method yields results that are consistent with the results derived from advanced fingerprinting methods. The proposed protocol is a reliable, cost-effective, practical field approach for differentiating DWH residues from other types of petroleum residues. PMID:29329313

Accurate paleointensities - the multi-method approach

NASA Astrophysics Data System (ADS)

de Groot, Lennart

2016-04-01

The accuracy of models describing rapid changes in the geomagnetic field over the past millennia critically depends on the availability of reliable paleointensity estimates. Over the past decade methods to derive paleointensities from lavas (the only recorder of the geomagnetic field that is available all over the globe and through geologic times) have seen significant improvements and various alternative techniques were proposed. The 'classical' Thellier-style approach was optimized and selection criteria were defined in the 'Standard Paleointensity Definitions' (Paterson et al, 2014). The Multispecimen approach was validated and the importance of additional tests and criteria to assess Multispecimen results must be emphasized. Recently, a non-heating, relative paleointensity technique was proposed -the pseudo-Thellier protocol- which shows great potential in both accuracy and efficiency, but currently lacks a solid theoretical underpinning. Here I present work using all three of the aforementioned paleointensity methods on suites of young lavas taken from the volcanic islands of Hawaii, La Palma, Gran Canaria, Tenerife, and Terceira. Many of the sampled cooling units are <100 years old, the actual field strength at the time of cooling is therefore reasonably well known. Rather intuitively, flows that produce coherent results from two or more different paleointensity methods yield the most accurate estimates of the paleofield. Furthermore, the results for some flows pass the selection criteria for one method, but fail in other techniques. Scrutinizing and combing all acceptable results yielded reliable paleointensity estimates for 60-70% of all sampled cooling units - an exceptionally high success rate. This 'multi-method paleointensity approach' therefore has high potential to provide the much-needed paleointensities to improve geomagnetic field models for the Holocene.

Realistic sampling of amino acid geometries for a multipolar polarizable force field

PubMed Central

Hughes, Timothy J.; Cardamone, Salvatore

2015-01-01

The Quantum Chemical Topological Force Field (QCTFF) uses the machine learning method kriging to map atomic multipole moments to the coordinates of all atoms in the molecular system. It is important that kriging operates on relevant and realistic training sets of molecular geometries. Therefore, we sampled single amino acid geometries directly from protein crystal structures stored in the Protein Databank (PDB). This sampling enhances the conformational realism (in terms of dihedral angles) of the training geometries. However, these geometries can be fraught with inaccurate bond lengths and valence angles due to artefacts of the refinement process of the X‐ray diffraction patterns, combined with experimentally invisible hydrogen atoms. This is why we developed a hybrid PDB/nonstationary normal modes (NM) sampling approach called PDB/NM. This method is superior over standard NM sampling, which captures only geometries optimized from the stationary points of single amino acids in the gas phase. Indeed, PDB/NM combines the sampling of relevant dihedral angles with chemically correct local geometries. Geometries sampled using PDB/NM were used to build kriging models for alanine and lysine, and their prediction accuracy was compared to models built from geometries sampled from three other sampling approaches. Bond length variation, as opposed to variation in dihedral angles, puts pressure on prediction accuracy, potentially lowering it. Hence, the larger coverage of dihedral angles of the PDB/NM method does not deteriorate the predictive accuracy of kriging models, compared to the NM sampling around local energetic minima used so far in the development of QCTFF. © 2015 The Authors. Journal of Computational Chemistry Published by Wiley Periodicals, Inc. PMID:26235784

Occurrence and structural characterization of gas hydrates associated with a cold vent field, offshore Vancouver Island

NASA Astrophysics Data System (ADS)

Lu, Hailong; Moudrakovski, Igor; Riedel, Michael; Spence, George; Dutrisac, Regent; Ripmeester, John; Wright, Fred; Dallimore, Scott

2005-10-01

Gas hydrate samples recovered from a cold vent field offshore Vancouver Island were studied in detail both by macroscopic observations and instrumental methods (powder X-ray diffraction method (PXRD), nuclear magnetic resonance (NMR), and Raman spectroscopy). It was found that gas hydrates were massive from 2.64 to 2.94 m below seafloor (mbsf), elongated, nodular and tabular from 4.60 to 4.81 mbsf, and vein-like from 5.48 to 5.68 mbsf, showing a trend of decreasing hydrate content with increasing depth. All samples were determined to be structure I hydrate from PXRD, NMR, and Raman spectroscopies. The hydration numbers were estimated to be 6.1 ± 0.2 on average as determined from the methane distribution over the cage sites from NMR and Raman analytical results. Estimates of conversion levels indicated that ˜78% of the water in the massive samples was hydrate, down to a low value of ˜0.4% for the pore hydrate samples. The results are compared with measurements on synthetic hydrates and samples recovered from below the permafrost on the Mallik site. Differences in methane content and lattice parameters for synthetic and natural samples are relatively minor. Additional work is needed to address the presence of minor gas components and the heterogeneity of natural hydrate samples.

EEG source localization: Sensor density and head surface coverage.

PubMed

Song, Jasmine; Davey, Colin; Poulsen, Catherine; Luu, Phan; Turovets, Sergei; Anderson, Erik; Li, Kai; Tucker, Don

2015-12-30

The accuracy of EEG source localization depends on a sufficient sampling of the surface potential field, an accurate conducting volume estimation (head model), and a suitable and well-understood inverse technique. The goal of the present study is to examine the effect of sampling density and coverage on the ability to accurately localize sources, using common linear inverse weight techniques, at different depths. Several inverse methods are examined, using the popular head conductivity. Simulation studies were employed to examine the effect of spatial sampling of the potential field at the head surface, in terms of sensor density and coverage of the inferior and superior head regions. In addition, the effects of sensor density and coverage are investigated in the source localization of epileptiform EEG. Greater sensor density improves source localization accuracy. Moreover, across all sampling density and inverse methods, adding samples on the inferior surface improves the accuracy of source estimates at all depths. More accurate source localization of EEG data can be achieved with high spatial sampling of the head surface electrodes. The most accurate source localization is obtained when the voltage surface is densely sampled over both the superior and inferior surfaces. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.