Sample records for figure 8a figure

  1. Thyroid ocular myopathy.

    PubMed Central

    Hodes, B L; Shoch, D E

    1979-01-01

    Based upon the ultrasonographic evidence of extraocular muscle abnormalities in all patients with orbitopathy and proven thyroid disease, we conclude that the basic abnormality of thyroid orbitopathy is a panmyositis and that all of the classes described by Werner are expressions of different degrees and manifestations of the same pathologic process. This thesis is supported by presentation of cases of varying severity who have in common extraocular muscle abnormalities. We believe that the process we describe acceptably explains all of the eye signs of this common orbitopathy. Images FIGURE 1 A FIGURE 1 B FIGURE 2 FIGURE 3 A FIGURE 3 B FIGURE 4 FIGURE 5 A FIGURE 5 B FIGURE 6 A FIGURE 6 B FIGURE 7 FIGURE 8 A FIGURE 8 B FIGURE 9 A FIGURE 9 B FIGURE 10 FIGURE 11 A FIGURE 11 B FIGURE 12 A FIGURE 12 B FIGURE 13 A FIGURE 13 B PMID:583536

  2. Limbal palisades of Vogt.

    PubMed Central

    Goldberg, M F; Bron, A J

    1982-01-01

    The palisades of Vogt are distinctive normal features of the human corneoscleral limbus. Our clinical studies indicate that they are more discrete in younger and in more heavily pigmented individuals, and that they appear more regular and prominent at the lower limbus than at the upper limbus. They are seen only infrequently in the horizontal meridian. There is some symmetry (though it is not exact) from one eye to the other in the same person. The anatomy of the palisades appears to be unique for a given individual. In this respect, as well as in their microscopic anatomy, the palisades of Vogt appear comparable to fingerprints, and the term "conjunctivoglyphics" ("conjunctival carvings") or "limboglyphics" is suggested in analogy with "dermatoglyphics." The palisades of Vogt have a distinct vasculature with narrow, barely visible, arterial and venous components of radially oriented hairpin loops. Angiography reveals that these vessels leak fluorescein relatively late and only to a moderate extent. They respond to inflammation by dilatation and gross breakdown of their physiologic barrier properties. The functions of the palisades of Vogt are not known with certainty, but their interpalisadal epithelial rete ridges may serve as a repository for corneal epithelial cells. They may thus be important in both aging and diseases of the cornea. Images FIGURE 1 A FIGURE 1 B FIGURE 1 C FIGURE 2 FIGURE 3 A FIGURE 3 B FIGURE 4 FIGURE 5 A FIGURE 5 B FIGURE 6 A FIGURE 6 B FIGURE 7 A FIGURE 7 B FIGURE 8 A FIGURE 8 B FIGURE 8 C FIGURE 8 D FIGURE 9 A FIGURE 9 B FIGURE 10 A FIGURE 10 B PMID:7182957

  3. Improving Quality Using Architecture Fault Analysis with Confidence Arguments

    DTIC Science & Technology

    2015-03-01

    CMU/SEI-2015-TR-006 | SOFTWARE ENGINEERING INSTITUTE | CARNEGIE MELLON UNIVERSITY iii List of Figures Figure 1: Architecture-Centric...Requirements Decomposition 5 Figure 2: A System and Its Interface with Its Environment 6 Figure 3: AADL Graphical Symbols 8 Figure 4: Textual AADL Example...8 Figure 5: Textual AADL Error Model Example 9 Figure 6: Potential Hazard Sources in the Feedback Control Loop [Leveson 2012] 11 Figure 7

  4. Elastic-Plastic Fracture Mechanics Analysis of Small Cracks

    DTIC Science & Technology

    1982-09-01

    by the plastic zone size (Eq. (6)), LEM and the elastic-plastic fracture mechanics ( EPFM ) results in Figure 4 can be displayed as in Figure 5. The...8d). Figure 8a shows the growth of a crack for LEFM conditions while Figures 8b, c, and d include EPFM considerations as illustrated in Figure 7. The

  5. The Development of Barrier Materials for Flexible Aircraft Engine Containers

    DTIC Science & Technology

    1977-05-01

    niif ^»imi,ii ^WMM 1 i...ÄWMHWÜippHI ■" ’ " ■ " -" I—i»*f^^ MM^Mimai ^m t Figure 7. Figure 8. Figure 9 . Figure 10. Figure 11. Figure 12. Figure 13. Figure 14. Figure...Evaluation Program 8 Barrier Material Test Data 9 iv % •■■~v’ ■ ■Ä’ ■" mam --"■- ——,«. ms"-- «r MlMiafhf^ - ■"’ ^-g^aaa--^-^^"’^-’

  6. Influence of intraocular lens material and design on postoperative intracapsular cellular reactivity.

    PubMed Central

    Apple, D J

    2000-01-01

    PURPOSE: To evaluate the influence of intraocular lens (IOL) material and design on the outcome of postoperative lens epithelial cell proliferation within the capsular bag after cataract surgery. METHODS: A total of 5,079 human globes containing rigid and foldable posterior chamber IOL styles commonly implanted in the United States (n = 8) were analyzed in this study. Each globe, fixated in 10% formalin, was sectioned at the equator and analyzed using the Miyake-Apple posterior technique. The study consisted of 3 parts: First, to evaluate posterior capsule opacification (PCO); the Nd:YAG laser posterior capsulotomy rate (%) was documented and plotted on a monthly basis, creating a computerized trend line for each IOL style. Second, to evaluate anterior capsule opacification (ACO); 460 globes were processed for histologic examination. Anterior capsule fibrosis was scored from 0 to III, according to the thickness of proliferative tissue/cells on the inner surface of the anterior capsule at the capsulorhexis margin. Third, interlenticular opacification (ILO) was studied by analysis of 3 pairs of acrylic piggyback lenses that had been explanted because of opacification between their optics. Each IOL pair was processed for histologic examination, and scanning electron microscopy was performed on 1 of the lenses. RESULTS: In the first study, relatively higher Nd:YAG laser posterior capsulotomy rates (19.1% to 32.8%) were noted with the 4 oldest IOL designs in this study (2 foldable lenses, 1 3-piece polymethyl methacrylate [PMMA] design, and 1 single-piece all-PMMA design). Four modern lenses, 1 acrylic lens, and 3 silicone foldable IOL designs had Nd:YAG rates ranging from 1.3% to 14.6% (P < .0001). In the second study, mean ACO scores were highest with silicone-plate lenses (1.77 +/- 0.86 and 1.28 +/- 0.77). The lowest mean score was observed with the acrylic lens (0.51 +/- 0.52; P < .0001). In study 3, the analyses of the 3 pairs of explanted acrylic piggyback lenses showed that the opacification between them (ILO) may have different forms. CONCLUSIONS: Control of postoperative intracapsular cellular proliferation is important in avoiding 3 significant clinical complications. Postoperative lens epithelial cell proliferation is involved in the pathogenesis of PCO, ACO, and ILO, the latter being a newly described form of opacification within the capsular bag related to piggyback IOL implantation. IOL material and design are important factors influencing the outcome of these complications. Images FIGURE 1 FIGURE 2A FIGURE 2B FIGURE 3 FIGURE 4A FIGURE 4B FIGURE 5A FIGURE 5B FIGURE 5C FIGURE 5D FIGURE 5E FIGURE 5F FIGURE 5G FIGURE 5H FIGURE 6 FIGURE 7 FIGURE 8A FIGURE 8B FIGURE 9A FIGURE 9B FIGURE 10A FIGURE 10B FIGURE 10C FIGURE 10D FIGURE 10E FIGURE 10F FIGURE 10G FIGURE 10H FIGURE 11A FIGURE 11B FIGURE 12 FIGURE 13A FIGURE 13B FIGURE 14A FIGURE 14B FIGURE 15A FIGURE 15B FIGURE 16A FIGURE 16B FIGURE 17A FIGURE 17B FIGURE 18A FIGURE 18B FIGURE 18C FIGURE 18D FIGURE 18E FIGURE 19 FIGURE 20 PMID:11190028

  7. Naval Postgraduate School Anechoic Chamber Evaluation

    DTIC Science & Technology

    2004-09-01

    6 Figure 6. Reflection of a ray tube at a planar interface. (After Ref. [2].)..........................8 Figure 7. Diffracted ray ...geometry and the Keller cone. (From Ref. [2].) .........................9 Figure 8. Ray -fixed coordinate system. (From Ref. [2...10 Figure 9. Singly and doubly diffracted rays . (From Ref. [2].) ........................................11 Figure 10

  8. The Department of Obstetrics and Gynecology at Yale: the first one hundred fifty years, from Nathan Smith to Lee Buxton.

    PubMed Central

    Kohorn, E. I.

    1993-01-01

    The persons who directed the academic teaching of women's health at Yale Medical School are presented by biographical sketches recounting their achievements and some of the difficulties they encountered. Three who provided particular catalysis were Nathan Smith, Herbert Thoms, and Lee Buxton. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 PMID:8303913

  9. Anaerobic orbital cellulitis: a clinical and experimental study.

    PubMed Central

    Jedrzynski, M S; Bullock, J D; McGuire, T W; Elder, B L; Bullock, J D

    1991-01-01

    In this article we have reviewed the clinical and bacteriologic aspects of anaerobic orbital cellulitis and have presented six patients to illustrate these points. Physicians who treat patients with orbital cellulitis should have a high index of suspicion for possible instances involving anaerobes, so that appropriate management can be started early. To investigate this problem further, we created an animal model of anaerobic orbital cellulitis. This model may be useful in future studies of the pathogenesis and treatment of this serious and often devastating disease. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 PMID:1808813

  10. Mechanisms of Injury in Automobile Crashes

    PubMed Central

    Huelke, Donald F.

    1972-01-01

    The only way to determine the causes of injury in automobile collisions is through examination of data collected in detailed investigation of crashes. Such data were gathered from a ten-year study of collisions that caused injury to the occupants of the cars. In a comparison of injuries in the newer model automobiles—vehicles equipped with the safety features—with those in older model cars not equipped with the present-day occupant protection devices, significant reduction in injury severity was noted. ImagesFigure 1.Figure 2.Figure 3.Figure 4.Figure 5.Figure 6.Figure 7.Figure 8.Figure 9.Figure 10.Figure 11.Figure 12.Figure 13.Figure 14.Figure 15.Figure 16.Figure 17. PMID:5059662

  11. Applications of Adaptive Learning Controller to Synthetic Aperture Radar.

    DTIC Science & Technology

    1985-02-01

    FIGURE 37. Location of Two Sub- Phase Histories to be Utilized in Estimating Misfocus Coefficients A and C . . . A8 FIGURES 38.-94. ALC Learning Curves ...FIGURES (Concl uded) FIGURE 23. ALC Learning Curve .... .................. ... 45 .- " FIGURE 24. ALC Learning Curve ......... ................. 47 FIGURE...25. ALC Learning Curve .... .................. ... 48 FIGURE 26. ALC Learning Curve ....... .... ... .... 50 FIGURE 27. ALC Learning Curve

  12. Adverse external ocular effects of topical ophthalmic therapy: an epidemiologic, laboratory, and clinical study.

    PubMed Central

    Wilson, F M

    1983-01-01

    New knowledge of adverse external ocular reactions to topical ophthalmic medications was obtained by means of a computerized epidemiologic study, laboratory studies, and clinical observations. Listed below are the major findings and conclusions that represent facts or concepts that were previously unknown, uncertain, misunderstood, or forgotten: The incidence of clinically important drug reactions among all cases was at least 13.09% and may have been as high as 16.02%. Among treated patients it was at least 16.26% to 19.90%. Taken together, drug reactions were the second most common external disease diagnosis. The incidence of each kind of drug reaction was determined. Toxic papillary reactions accounted for 79.10% of drug cases and 10.35% of all cases. Toxic papillary keratoconjunctivitis was the third most common single diagnosis. The following epidemiologic factors were found to be related to the development or presence of drug reactions: number and variety of treating practitioners, number of practitioners consulted, number of practitioners consulted who treated, specific ophthalmologist consulted (8.24% of ophthalmologists referred 39.55% of all drug cases and showed a tendency habitually to overtreat), number and kinds of patients' symptomatic complaints, number of medications prescribed and used, number of days of treatment, particular drugs and preservatives used (but not their strengths or vehicles), underlying (primary) diagnoses, and inaccuracy of referring ophthalmologists' diagnoses. Patients with dry eyes were especially at risk for the development of toxic papillary reactions. Among all cases, the incidence of reactions to preservatives (mainly thimerosal) in contact lens solutions was 0.39% to 1.95%, depending on whether definite or probable cases, respectively, were considered. The incidence among the 54 patients who used daily-wear lenses (excluding extended-wear therapeutic and optical contacts) was 7.41% for definite reactions and 37.04% for probable ones. Factors relating to the development of papillary contact-lens reactions were daily wear, number of days of wear, and, especially, the preservatives to which the patients were exposed. Reactions occurred more often with soft lenses than with hard ones. Of patients with drug reactions, 5.22% had two different ones simultaneously. Coexisting reactions to pharmacologically active agents were also present in 15% of patients who reacted to preservatives in contact lens solutions. The ocular tissues that were affected by each kind of drug reaction were tabulated, and the relative degrees and sequences of involvement were discussed. The frequencies with which particular drugs, physical ag Images FIGURE 2 A FIGURE 2 B FIGURE 15 A FIGURE 15 B FIGURE 1 FIGURE 3 FIGURE 4 A FIGURE 4 B FIGURE 5 A FIGURE 5 B FIGURE 5 C FIGURE 5 D FIGURE 6 A FIGURE 6 B FIGURE 6 C FIGURE 7 A FIGURE 7 B FIGURE 8 A FIGURE 8 B FIGURE 9 A FIGURE 9 B FIGURE 9 C FIGURE 9 D FIGURE 10 A FIGURE 10 B FIGURE 10 C FIGURE 10 D FIGURE 11 A FIGURE 11 B FIGURE 11 C FIGURE 11 D FIGURE 12 A FIGURE 12 B FIGURE 12 C FIGURE 12 D FIGURE 14 FIGURE 16 A FIGURE 16 B FIGURE 18 FIGURE 19 A FIGURE 19 B FIGURE 20 A FIGURE 20 B FIGURE 21 A FIGURE 21 B FIGURE 22 A FIGURE 22 B FIGURE 22 C FIGURE 23 A FIGURE 23 B FIGURE 23 C FIGURE 23 D PMID:6676985

  13. Early chiropractic education in Oregon

    PubMed Central

    Keating, Joseph C

    2002-01-01

    Chiropractic education in the northwestern United States has its origins in the Marsh School & Cure in 1904. Most of the early schools were located in Portland, Oregon, including the D.D. Palmer College of Chiropractic (1908-1910), and several of these had merged by 1912 or 1913 to form the Pacific Chiropractic College, forerunner of today's Western States College. The latter was organized as a non-profit institution during the Great Depression, and struggled not only to survive but to create a higher standard. The early broad-scope of chiropractic training in the state probably encouraged the liberal scope of practice enjoyed in Oregon to this day. ImagesFigure 2Figure 3Figure 4Figure 6Figure 7Figure 8Figure 9Figure 11Figure 12Figure 13Figure 14Figure 15Figure 16Figure 18Figure 19Figure 20Figure 21Figure 22Figure 24

  14. 9-D polarized proton transport in the MEIC figure 8 collider ring - first steps

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meot, F.; Morozov, V. S.

    2015-05-03

    Spin tracking studies in the MEIC figure-8 collider ion ring are presented, based on a very preliminary design of the lattice. They provide numerical illustrations of some of the aspects of the figure-8 concept, including spin-rotator based spin control, and lay out the path towards a complete spin tracking simulation of a figure-8 ring.

  15. 9-D polarized proton transport in the MEIC figure-8 collider ring: first steps

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meot, F.; Thomas Jefferson National Accelerator Facility; Morozov, V. S.

    2014-10-24

    Spin tracking studies in the MEIC figure-8 collider ion ring are presented, based on a very preliminary design of the lattice. They provide numerical illustrations of some of the aspects of the figure-8 concept, including spin-rotator based spin control, and lay out the path towards a complete spin tracking simulation of a figure-8 ring.

  16. Common Pediatric Urological Disorders

    PubMed Central

    Robson, Wm. Lane M.; Leung, Alexander K.C.; Boag, Graham S.

    1991-01-01

    The clinical and radiological presentations of 12 pediatric urological disorders are described. The described disorders include pyelonephritis, vesicoureteral reflux, ureteropelvic obstruction, ureterovesical obstruction, ectopic ureterocele, posterior urethral valves, multicystic dysplastic kidney, polycystic kidney disease, ectopic kidney, staghorn calculi, urethral diverticulum, and urethral meatal stenosis. ImagesFigure 1-2Figure 3Figure 3Figure 4Figure 5Figure 6-7Figure 8-9Figure 10Figure 11-12 PMID:21229068

  17. Adamantinoma — Histogenesis and Differentiation from the Periodontal Fibromatous Epulis and Squamous Cell Carcinoma

    PubMed Central

    Mills, J. H. L.; Lewis, R. J.

    1981-01-01

    Six cases of oral adamantinoma, four in dogs, two in cats, are described. This is a rare tumor which arises from vestigial layers of the dental laminae in the gingiva, particularly of the mandible. Care must be exercised in not confusing this locally aggressive lesion with the much more common squamous cell carcinoma. ImagesFigure 1.Figure 2.Figure 3.Figure 4.Figure 5.Figure 6.Figure 7.Figure 8.Figure 9. PMID:7248887

  18. Characterization of Small DC Brushed and Brushless Motors

    DTIC Science & Technology

    2013-03-01

    8 Figure 6. Torque vs. RPM for a SS7 -1.7-1 brushed motor...9 Figure 7. Efficiency vs. motor power output for SS7 -1.7-1 brushed motor...10 Figure 8. Efficiency vs. RPM for SS7 -1.7-1 brushed motor. ........................................................10 Figure 9

  19. A method for volume determination of the orbit and its contents by high resolution axial tomography and quantitative digital image analysis.

    PubMed Central

    Cooper, W C

    1985-01-01

    The various congenital and acquired conditions which alter orbital volume are reviewed. Previous investigative work to determine orbital capacity is summarized. Since these studies were confined to postmortem evaluations, the need for a technique to measure orbital volume in the living state is presented. A method for volume determination of the orbit and its contents by high-resolution axial tomography and quantitative digital image analysis is reported. This procedure has proven to be accurate (the discrepancy between direct and computed measurements ranged from 0.2% to 4%) and reproducible (greater than 98%). The application of this method to representative clinical problems is presented and discussed. The establishment of a diagnostic system versatile enough to expand the usefulness of computerized axial tomography and polytomography should add a new dimension to ophthalmic investigation and treatment. Images FIGURE 8 FIGURE 9 FIGURE 10 A FIGURE 10 B FIGURE 11 A FIGURE 11 B FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20 FIGURE 21 FIGURE 22 FIGURE 23 FIGURE 24 FIGURE 25 FIGURE 26 A FIGURE 26 B FIGURE 27 FIGURE 28 FIGURE 29 FIGURE 30 FIGURE 31 FIGURE 32 PMID:3938582

  20. Experimental postoperative endophthalmitis.

    PubMed Central

    Forster, R K

    1992-01-01

    Various inocula of vancomycin-sensitive E faecalis (EF01), S aureus (SA02), S epidermidis (SE03), and B cereus (BC04), were intravitreally inoculated into an aphakic rabbit model with and without vancomycin, with or without vitrectomy. A summation average of the clinical response mean scores of various inocula (10(3), 10(5), 10(7) cfu) in the absence of therapy ranked these etiologic agents in the order of severity as SE03 (1.4), BC04 (1.8), EF01 (2.3), and SA02 (2.8). These favorably compared with the histopathology cavitary/noncavitary mean scores in increasing order of severity: SE03 (1.7/0.6), BC04 (1.7/0.9), EF01 (2.4/1.1), and SA02 (2.5/1.5), compared with control eyes (1.1/0.4). If the inoculum was increased to 10(7) cfu, SE03 (2.4/0.9) and BC04 (2.8/2.0) could equate EF01 and SA02. Treatment with 1 mg of vancomycin, with or without vitrectomy, did not significantly alter the overall inflammatory response to these four endophthalmitis isolates. No treatment was necessary to achieve > 99.9% killing effect by 72 hours when testing BC04, while any of the treatment modalities during 72 hours achieved 99.9% killing effect when testing SE03. No treatment modality achieved a 99.9% killing effect when testing EF01 or SA02. No single in vitro result could predict the in vivo microbiologic behavior of this model. Further research is needed to better understand the role of antiinflammatory agents, multiple drug therapy, and multiple-injection single-drug therapy with or without vitrectomy, and their impact on the inflammatory response in the aphakic model, to better treat endophthalmitis and thus improve visual prognosis. Images FIGURE 17 A FIGURE 17 B FIGURE 17 C FIGURE 18 A FIGURE 18 B FIGURE 18 C FIGURE 19 A FIGURE 19 B FIGURE 19 C FIGURE 20 A FIGURE 20 B FIGURE 20 C FIGURE 31 A FIGURE 31 B FIGURE 32 A FIGURE 32 B FIGURE 33 A FIGURE 33 B FIGURE 34 A FIGURE 34 B PMID:1494833

  1. A biophysical model for defibrillation of cardiac tissue.

    PubMed Central

    Keener, J P; Panfilov, A V

    1996-01-01

    We propose a new model for electrical activity of cardiac tissue that incorporates the effects of cellular microstructure. As such, this model provides insight into the mechanism of direct stimulation and defibrillation of cardiac tissue after injection of large currents. To illustrate the usefulness of the model, numerical stimulations are used to show the difference between successful and unsuccessful defibrillation of large pieces of tissue. Images FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 PMID:8874007

  2. Design of a Prototype Autonomous Amphibious WHEGS(Trademark) Robot for Surf-Zone Operations

    DTIC Science & Technology

    2005-06-01

    Control Loop ........................................................................ 9 Figure 7. Physical Layout (without GPS bracket ...12 Figure 8. Side View showing GPS Bracket ........................................................ 13 Figure 9...without GPS bracket ) 13 Figure 8. Side View showing GPS Bracket 1. Body Construction The design of the robot body for this thesis was made to

  3. Bietti's tapetoretinal degeneration with marginal corneal dystrophy crystalline retinopathy.

    PubMed Central

    Welch, R B

    1977-01-01

    In 1937 Bietti reported a tapetoretinal degeneration with associated corneal deposits at the limbus. The hallmark of the disease was the crystalline characteristics of the retinal spots as well as those at the corneal limbus. Bagolini and Ioli-Spade in 1968 presented a 30 year follow-up on Bietti's cases and presented six additional cases. The present report delas with this entity in Orientals, a Chinese woman and a Japanese man. Corneal and conjunctival biopsy from the female patient revelaed a lipid deposition in both fibroblasts and epithelium. The term "crystalline retinopathy" has been added to the description of this entity since it defines the most characteristic feature of the syndrome. Images FIGURE 7 A FIGURE 7 B FIGURE 1 A FIGURE 1 B FIGURE 1 C FIGURE 2 A FIGURE 2 B FIGURE 2 C FIGURE 3 FIGURE 4 A FIGURE 4 B FIGURE 5 FIGURE 6 A FIGURE 6 B FIGURE 6 C FIGURE 8 PMID:306693

  4. Implementing Compstat Principles Into Critical Infrastructure Protection And Improvement

    DTIC Science & Technology

    2016-12-01

    1 C. HYPOTHESIS............................................................................................8 D. RESEARCH DESIGN ...39 Figure 7. Pavement Life Cycle, Conditions, and Costs.............................................40 Figure 8. Travel Modes, Pre- and Post...52 Figure 13. Aerial Image of Bay Terrace Section of Staten Island ..............................54 Figure 14. Department of Design and

  5. New techniques for imaging and analyzing lung tissue.

    PubMed Central

    Roggli, V L; Ingram, P; Linton, R W; Gutknecht, W F; Mastin, P; Shelburne, J D

    1984-01-01

    The recent technological revolution in the field of imaging techniques has provided pathologists and toxicologists with an expanding repertoire of analytical techniques for studying the interaction between the lung and the various exogenous materials to which it is exposed. Analytical problems requiring elemental sensitivity or specificity beyond the range of that offered by conventional scanning electron microscopy and energy dispersive X-ray analysis are particularly appropriate for the application of these newer techniques. Electron energy loss spectrometry, Auger electron spectroscopy, secondary ion mass spectrometry, and laser microprobe mass analysis each offer unique advantages in this regard, but also possess their own limitations and disadvantages. Diffraction techniques provide crystalline structural information available through no other means. Bulk chemical techniques provide useful cross-checks on the data obtained by microanalytical approaches. It is the purpose of this review to summarize the methodology of these techniques, acknowledge situations in which they have been used in addressing problems in pulmonary toxicology, and comment on the relative advantages and disadvantages of each approach. It is necessary for an investigator to weigh each of these factors when deciding which technique is best suited for any given analytical problem; often it is useful to employ a combination of two or more of the techniques discussed. It is anticipated that there will be increasing utilization of these technologies for problems in pulmonary toxicology in the decades to come. Images FIGURE 3. A FIGURE 3. B FIGURE 3. C FIGURE 3. D FIGURE 4. FIGURE 5. FIGURE 7. A FIGURE 7. B FIGURE 8. A FIGURE 8. B FIGURE 8. C FIGURE 9. A FIGURE 9. B FIGURE 10. PMID:6090115

  6. Standard Methodology for Assessment of Range of Motion While Wearing Body Armor

    DTIC Science & Technology

    2013-09-30

    8 Figure 14: Meter stick (with close up...the tester to place against the measurement scale. A variety of rulers, meter sticks (Figure 14), and T square rulers (Figure 15) were used as well...All rulers and meter sticks had cm and mm marks on them. Figure 12: 20 cm block Figure 13: Measuring block Figure 14: Meter stick

  7. How ultrasound first came to new England.

    PubMed Central

    Kohorn, Ernest I.

    2003-01-01

    Diagnostic ultrasound came to Yale in the 1960s and was first developed in Glasgow and London. This story tells us that ultrasound was well-established in the Department of Obstetrics and Gynecology at Yale University School of Medicine in the Yale-New Haven Hospital by 1970. By then it had caught up with the pioneers in New York, Denver, and even Glasgow. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:15482653

  8. Feline congenital erythropoietic porphyria associated with severe anemia and renal disease. Clinical, morphologic, and biochemical studies.

    PubMed Central

    Giddens, W. E.; Labbe, R. F.; Swango, L. J.; Padgett, G. A.

    1975-01-01

    A feline erythropoietic porphyria was studied in an affected female Siamese cat and 2 male offspring. The principal elevated porphyrins were Type I isomers of uroporphyrin and coproporphyrin; the porphyrin precursors, porphobilinogen and sigma-aminolevulinic acid, were also detected. Porphyrins were present in the blood and in all the viscera, teeth, bones, and excreta. There was severe macrocytic hypochromic anemia, hepatomegaly, splenomegaly, and uremia associated with a renal disease characterized by mesangial hypercellularity and proliferation (resulting in narrowing of glomerular capillaries) and ischemic tubular injury. There was thickening of tubular basement membranes and tubular epithelial lipidosis, degeneration, and necrosis. Electron microscopic studies of bone marrow and kidney revealed the presence of membrane-enclosed lamellar bodies 150 to 1000 nm in diameter in cytoplasmic and extracellular locations. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 PMID:1231563

  9. Manipulative management of the temporomandibular joint pain-dysfunction syndrome: a report of two cases

    PubMed Central

    Nykoliation, J. W.; Cassidy, J. D.

    1984-01-01

    The temporomandibular pain-dysfunction syndrome (TMJ-PDS) is a frequent but often unappreciated cause of head, neck, and facial pain. Information regarding its etiology, pathophysiology, diagnosis, and treatment is fragmentary, and often reflects an approach influenced by the background specialty of the involved practitioner. Current treatment is often multidisciplinary, involving the use of various dental splints in conjunction with physiotherapy, psychotherapy, and analgesic medication. This paper suggests that chiropractic manipulation to the temporomandibular joints (TMJ) may be an effective approach to treatment of TJM-PDS. Illustrative cases are presented. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6Figure 6Figure 7Figure 8Figure 9

  10. 76 FR 78329 - Noise Exposure Map Notice; Martin County Airport, Stuart, FL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-16

    ...- 7 Total and Night Utilization Rates, Helicopter Aircraft; Figure 4-4 Jet Arrival Flight Tracks ; Figure 4-5 Jet Departure Flight Tracks; Figure 4-6 Propeller Arrival Flight Tracks; Figure 4-7 Propeller Departure Flight Tracks; Figure 4-8 Helicopter Arrival Flight Tracks; Figure 4-9 Helicopter Departure Flight...

  11. Estrogenicity of resin-based composites and sealants used in dentistry.

    PubMed Central

    Olea, N; Pulgar, R; Pérez, P; Olea-Serrano, F; Rivas, A; Novillo-Fertrell, A; Pedraza, V; Soto, A M; Sonnenschein, C

    1996-01-01

    We tested some resin-based composites used in dentistry for their estrogenic activity. A sealant based on bisphenol-A diglycidylether methacrylate (bis-GMA) increased cell yields, progesterone receptor expression, and pS2 secretion in human estrogen-target, serum-sensitive MCF7 breast cancer cells. Estrogenicity was due to bisphenol-A and bisphenol-A dimethacrylate, monomers found in the base paste of the dental sealant and identified by mass spectrometry. Samples of saliva from 18 subjects treated with 50 mg of a bis-GMA-based sealant applied on their molars were collected 1 hr before and after treatment. Bisphenol-A (range 90-931 micrograms) was identified only in saliva collected during a 1-hr period after treatment. The use of bis-GMA-based resins in dentistry, and particularly the use of sealants in children, appears to contribute to human exposure to xenoestrogens. Images Figure 1. A Figure 1. B Figure 2. Figure 3. A Figure 3. B Figure 4. A Figure 4. B Figure 5. A Figure 5. B Figure 6. A Figure 6. B Figure 7. A Figure 7. B Figure 8. Figure 9. Figure 10. PMID:8919768

  12. Supernova Cosmology Project

    Science.gov Websites

    universe. PDF Top panel only of previous Hubble diagram Figure 6 PDF Figure 8 Confidence regions for Omega_Mass vs Omega_Lambda PDF Figure 8 with results from CMB and galaxy cluster data added. PDF Figure 12 Joint measurements of Omega_Mass and w assuming a flat universe and w constant in time. PDF These slides

  13. Inherent Contrast in Magnetic Resonance Imaging and the Potential for Contrast Enhancement

    PubMed Central

    Brasch, Robert C.

    1985-01-01

    Magnetic resonance (MR) imaging is emerging as a powerful new diagnostic tool valued for its apparent lack of adverse effects. The excellent inherent contrast between biologic tissues and fluids afforded by MR imaging is one of the foremost characteristics of this technique and depends on physicochemical properties such as hydrogen density and T1 and T2 relaxation rates, on magnetic field strength and on operator-chosen factors for acquiring the MR imaging signal. Pharmaceutical contrast-enhancing agents shorten the MR imaging process and improve sensitivity and diagnostic accuracy. ImagesFigure 1.Figure 2.Figure 3.Figure 4.Figure 5.Figure 6.Figure 8.Figure 9.Figure 10.Figure 11. PMID:2992172

  14. The mechanism of T-cell mediated cytotoxicity. VI. T-cell projections and their role in target cell killing.

    PubMed Central

    Sanderson, C J; Glauert, A M

    1979-01-01

    Electron micrographs of material fixed during the first 10 min of a T-cell cytotoxic system showed T-cell projections and T-cell burrowing into target cells. These observations were made possible by using a system with a very high rate of killing. The projections vary in shape and size, and can push deeply into the target cell, distorting organelles in their path, including the nucleus. The projections contain fine fibrillar material, to the exclusion of organelles. They push the target cell membrane in front of them to form pockets approximating to the shape of the projection. Areas of close contact occur between the projections and the target cell membrane, particularly at the leading edges. The likelihood that these projections develop as a result of contact with specific antigen, and are involved in the cytotoxic mechanism is discussed. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 PMID:311336

  15. Evaluation of Commercial Off-the-Shelf and Government Off-the-Shelf Microclimate Cooling Systems

    DTIC Science & Technology

    2005-08-01

    Appendix A - Request for Information (RFI) 23 Appendix B - Memorandum from Natick Soldier Center’s International Office 25 Appendix C - Cooling Power...Data Entry Forms 7 Figure 3. Evaporative Cooling Products 9 Figure 4. Passive Phase Change Product 10 Figure 5. Liquid Circulating...Microclimate Cooling System 13 Figure 6. Compressed Air Cooling Product 15 Figure 7. Vortex Tube 15 Figure 8. Active Phase

  16. A historical perspective of thirteen unheralded contributors to medicodental progress.

    PubMed Central

    Dummett, C. O.

    1989-01-01

    Brief highlights of the careers of 13 Afro-American dentists have been presented. Their professional lives demonstrated both a commitment to the advancement of dentistry and a dedication to the betterment of humanity. Of the 13, three spent their professional lives exclusively in dental education, research, and public health. The remaining 10 were dental clinicians who served patients with competence, care, and concern. Additionally, they contributed to dentistry's image and progress by improving medicodental relations, pioneering in university dental education, engaging in philanthropy, qualifying for dental specialties, exerting leadership in dental professional organizations, integrating dentistry in hospital care, solving community health problems, and participating in all aspects of dental journalism. A sizable portion of their energies was expended in enhancing the quality of life in their communities and the nation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 PMID:2651678

  17. Intraluminal fibrosis in interstitial lung disorders.

    PubMed Central

    Basset, F.; Ferrans, V. J.; Soler, P.; Takemura, T.; Fukuda, Y.; Crystal, R. G.

    1986-01-01

    The histopathologic and ultrastructural features of intraluminal organizing and fibrotic changes were studied in open lung biopsies and autopsy specimens from 373 patients with interstitial lung disorders, including hypersensitivity pneumonitis (n = 44), idiopathic pulmonary fibrosis (n = 92), collagen-vascular diseases (n = 20), chronic eosinophilic pneumonia (n = 10), pulmonary histiocytosis X (n-90), pulmonary sarcoidosis (n = 62), pneumoconioses (n = 25), Legionnaire's disease (n = 5), drug- and toxin-induced pneumonitis (n = 4), radiation-induced pneumonitis (n = 2), lymphangioleiomyomatosis (n = 11), and chronic organizing pneumonia of unknown cause (n = 8). Three patterns of intraluminal organization and fibrosis were recognized: 1) intraluminal buds, which partially filled the alveoli, alveolar ducts and/or distal bronchioles; 2) obliterative changes, in which loose connective tissue masses obliterated the lumens of alveoli, alveolar ducts or distal bronchioles, and 3) mural incorporation of previously intraluminal connective tissue masses, which fused with alveolar, alveolar ductal, or bronchiolar structures and frequently became reepithelialized. All three patterns had common morphologic features, suggesting that, regardless of their severity, they resulted from a common pathogenetic mechanism, ie, the migration of activated connective tissue cells, through defects in the epithelial lining and its basement membrane, from the interstitial into the intraluminal compartment. Intraluminal buds were observed most frequently in hypersensitivity pneumonitis, chronic eosinophilic pneumonia, and organizing pneumonia of unknown cause. Mural incorporation and, to a lesser extent, obliterative changes were observed in most interstitial disorders and were very prominent in idiopathic pulmonary fibrosis. Mural incorporation and obliterative changes play an important role in pulmonary remodeling, especially when several adjacent alveoli and/or other air spaces are involved. Under these circumstances, intraluminal organization can mediate the fusion of adjacent alveolar structures by intraluminal connective tissue. Images Figure 15 Figure 9 Figure 10 Figure 16 Figure 17 Figure 1 Figure 2 Figure 3 Figure 4 Figure 18 Figure 5 Figure 6 Figure 7 Figure 8 Figure 19 Figure 20 Figure 11 Figure 12 Figure 13 Figure 14 PMID:3953768

  18. A Malaysian Experience with Animal Disease

    PubMed Central

    Little, P. B.

    1979-01-01

    The report summarizes a one year period of investigation of death losses in West Malaysian livestock. Lesions and etiological agents are mentioned for cattle, sheep, goats, swine, poultry and companion animals as well as some miscellaneous species. Special observations related to a common paramphistome induced hepatic biliary infestation in cattle, a serious malignant head catarrh outbreak in which possible cattle to cow aerosol transmission occurred. Trismus observed in some cattle with malignant head catarrh was associated with arteriolitis and ganglioneuritis of the V cranial nerve. Parasitic, bacterial, viral toxic and neoplastic diseases are recorded in the various species. The occurrence of fatal chronic fluorosis in laboratory guinea pigs and cerebral nematodiasis in a Thoroughbred racehorse are documented. ImagesFigure 1.FIGURE 2.FIGURE 3.FIGURE 4.FIGURE 5.FIGURE 6.FIGURE 7.FIGURE 8.FIGURE 9.FIGURE 10.FIGURE 11. PMID:761153

  19. Retinal and optic nerve atrophy induced by intravitreous vincristine in the primate.

    PubMed Central

    Green, W R

    1975-01-01

    Vincristine is known to be toxic to neural tissue, where it is thought to react with microtubules and impair axonal transport. Intravitreous vincristing-induced changes of the retina have been reported to be reversible after 10 micrograms. In the present study, the effects of 0.01 to 100 micrograms of intravitreous vincristine in monkeys were studied ophthalmoscopically and by light microscopy and electron microscopy. Retinal degeneration and optic atrophy were evident ophthalmoscopically in two to three weeks. Morphological changes included swelling of retinal neurons, loss of organelles and microtubules and accumulation of fibrillar-granular material. Progression of effects, with plasma membrane rupture and cell death, was observed with all doses of 0.1 micrograms and higher. The retina and optic nerve of monkeys appear to be more sensitive to intravitreous vincristine than are the same structures in certain lower animals. Images FIGURE 10 FIGURE 18 FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 19 FIGURE 20 PMID:813350

  20. Effects of 8-aminoquinolines on the ultrastructural morphology of Pneumocystis carinii.

    PubMed Central

    Goheen, M. P.; Bartlett, M. S.; Shaw, M. M.; Queener, S. F.; Smith, J. W.

    1993-01-01

    Primaquine and other 8-aminoquinolines are effective against Pneumocystis carinii in culture and animal models but the way(s) in which they affect P. carinii are not known. This study used transmission electron microscopy to observe early effects of 8-aminoquinolines on P. carinii grown with human embryonic lung fibroblasts in microcarrier suspension culture. The 8-aminoquinolines evaluated were primaquine and Walter Reed Army Institute for Research (WR) compounds WR6026, WR238605 and WR242511. Samples of P. carinii were taken at 0, 3, 6, 12, 24 and 48 hours from culture flasks containing selected concentrations of the drugs. Time matched samples from a parallel culture without drug served as controls. All the 8-aminoquinolines produced similar morphologic alterations of the internal structure of P. carinii. Initially, dilatation of the nuclear envelopes and membranous arrays arising from the reticular system were observed. Later, more organisms displayed large arrays of smooth membranous material often presenting a concentric membranous pattern. Subsequently, cellular organization was lost resulting in necrosis. At concentrations tested WR242511 appeared to be the most effective, producing alterations in many trophozoites after 6 hours of exposure; WR6026 appeared to be the least effective with some organisms unaffected after 48 hours. The changes observed are consistent with damage to the reticular system of P. carinii, which might be caused by oxidation by the 8-aminoquinolines or their metabolites. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:8398811

  1. Lightweight Passive Microclimate Cooling Device

    DTIC Science & Technology

    1993-03-01

    rabrication. No consideration was given to weight. We have examined alternate methods of construction of the backpack and cylinder assembly and thin...13 Figure 7. Water Adsorption on Magnesium Chloride ........... 14 Figure 8. Cylinder Assembly ................................ 20...Figure 9. Backpack Assembly ............................... 21 Figure 10. Unwrapped Vest ................................... 22 Figure 11. Adsorption

  2. A Challenge for Micro and Mini UAV: The Sensor Problem

    DTIC Science & Technology

    2005-05-01

    pressure airspeed sensors on one single circuit board (Figure 8). Figure 8: Autopilot. The Quadcopter The fourth and final MAV is a quad-copter with...UNCLASSIFIED/UNLIMITED Figure 9: Quadcopter MAV. Figure 10: Loopshaping Diagram. The IMU contains 3 MEMS gyros. These form the rotational sensors Gx...flapping wings) and even by insects (vibrating wings). Once in operation, they will be extremely discrete, making it very difficult to distinct

  3. The connective tissue component of the caprine arthritis-encephalitis syndrome.

    PubMed Central

    Crawford, T. B.; Adams, D. S.; Sande, R. D.; Gorham, J. R.; Henson, J. B.

    1980-01-01

    The gross and microscopic connective tissue lesions in 12 goats with caprine arthritis-encephalitis (CAE) are described, including those from which a virus (CAEV) was isolated. Lesions were most often associated with synovial-lined structures including joints, tendon sheaths, and bursae, and were typified by synovial cell proliferations, subsynovial mononuclear cell infiltration, the presence of fibrin, fibrinous concretions, necrosis, and mineralization. Extrasynovial lesions were located in kidneys, vessels, and brain. The inflammatory infiltrates in these organs were predominantly mononuclear. Amyloid was also found in liver, spleen, and kidney. Microbiologic techniques failed to demonstrate any bacteria, mycoplasma, or chlamydia in the lesions. Images Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 1 Figure 2 Figure 3 Figure 4 PMID:7406019

  4. Geologic Controls of Sand Boil Formation at Buck Chute, Mississippi

    DTIC Science & Technology

    2017-06-30

    12 Figure 6. 1915 MRC hydrographic survey of Buck Chute (Modified from MRC 1975, sheet 48). ............ 13 Figure 7. 1926 MRC...hydrographic survey of Buck Chute (Modified from MRC 1975, sheet 48). ............ 14 Figure 8. Diagram of the evolution of the Mississippi River...library). .................... 17 Figure 11. AGI SuperSting 8 ERT survey equipment

  5. Transitional Cell Carcinoma of the Urinary Bladder in a Beluga Whale (Delphinapterus leucas)

    PubMed Central

    Martineau, D.; Lagacé, A.; Massé, R.; Morin, M.; Béland, P.

    1985-01-01

    A transitional cell carcinoma of the urinary bladder was found in a beluga whale stranded in the St. Lawrence middle estuary. Various organs of this animal were submitted to high resolution gas chromatography coupled with mass spectrometry analysis. High frequency of urinary bladder cancer in the human population of the same area and the presence of carcinogenic compounds in the marine environment of this animal are discussed. Concurrent isolation of Edwardsiella tarda from various organs of this whale is also reported. ImagesFigure 1.Figure 2.Figure 3.Figure 4.Figure 5.Figure 6.Figure 7.Figure 8. PMID:17422578

  6. Expression of Osmotin-Like Genes in the Halophyte Atriplex nummularia L. 1

    PubMed Central

    Casas, Ana M.; Nelson, Donald E.; Raghothama, Kashchandra G.; D'Urzo, Matilde Paino; Singh, Narendra K.; Bressan, Ray A.; Hasegawa, Paul M.

    1992-01-01

    A peptide (molecular mass 50 kilodaltons) that is immunologically related to tobacco osmotin was detected in cells of the halophyte Atriplex nummularia. This protein was constitutively expressed in both unadapted and NaCl-adapted cells. A predominant osmotin-like peptide (molecular mass 24 kilodaltons) was also found in culture media after cell growth. Two unique A. nummularia cDNA clones, pA8 and pA9, encoding osmotin-like proteins have been isolated. The pA8 and pA9 inserts are 952 and 792 base pairs and encode peptides of 222 and 224 amino acids, respectively. The peptide deduced from pA8 has a molecular mass of 23,808 daltons and theoretical isoelectric point of 8.31, whereas the peptide derived from pA9 has a molecular mass of 23,827 daltons and an isoelectric point of 6.88. Unique transcripts were detected by the inserts of the cDNA clones, two (1.2 and 1.0 kilobases) by pA8 and one (0.9 kilobase) by pA9. The pA8 transcripts were constitutively accumulated in unadapted and NaCl-adapted cells, whereas the mRNA levels were up-regulated by abscisic acid treatment. The level of pA9 mRNA was induced by NaCl treatment and increased in cells as a function of NaCl adaptation. Southern analysis of the genomic DNA indicated the presence of osmotin-like multigene families in A. nummularia. ImagesFigure 1Figure 2Figure 3Figure 4Figure 6Figure 7Figure 8Figure 9 PMID:16668870

  7. Spontaneous pituitary tumors in the Wistar/Furth/Ico rat strain. An animal model of human prolactin adenoma.

    PubMed Central

    Trouillas, J.; Girod, C.; Claustrat, B.; Curé, M.; Dubois, M. P.

    1982-01-01

    Twenty-three spontaneous pituitary tumors in 58 rats of Wistar/Furth/Ico strain were studied. The incidence is 38% in rats older than 10 months; it rises with age, with a maximum at 28-32 months (68.7%) and is higher in females (71.4%) than in males (35%) over 17 months. Light-microscopic and immunocytochemical studies revealed 20 prolactinomas in 19 rats (19/58, 32.7%) and 3 spongiocytic nonimmunostaining adenomas (3/58, 5.2%). The prolactinoma is often hemorrhagic. The cells, often arranged in sheets and agranular, are mostly positive with anti-rat prolactin (rPRL) serum. They have few polymorph granules and a well-developed rough endoplasmic reticulum. In the spongiocytic adenoma, the cells are arranged in cords. Their cytoplasm is slightly vacuolated. In prolactinoma-bearing rats, the mean plasma PRL value was 213 +/- 72.5 microgram/1 (SEM) (N = 15 +/- 1.8 microgram/1 [SEM]). A linear correlation was found between the logarithm of the tumoral pituitary weight or of the tumor size and the logarithm of the prolactinemia. Because of the analogies between these rat prolactinomas and 57 human prolactinomas, the Wistar/Furth/Ico rat strain is considered as a good animal model. Images Figure 14 Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 12 Figure 13 PMID:7124908

  8. Orthodontics

    PubMed Central

    Hemrend, Bernard; Altuna, Gurkan; Tompson, Bryan

    1989-01-01

    The authors of this article offer an introduction to the field of orthodontics. They present the latest advances in orthodontic appliances and some of the possible consequences of orthodontic treatment. They discuss a number of cases and offer examples of some of the more common problems that the orthodontist is asked to treat. Such cases include severe Class II, division 1 malocclusion, surgical orthodontics, “long-face” syndrome, adult orthodontics-TMJ-periodontics, late adult growth, and post-retention changes. Practical information useful to the physician who encounters patient with these disorders is balanced with good research data to support the various claims. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6Figure 7Figure 8Figure 9 PMID:21249042

  9. Micromechanical Sensor for the Spectral Decomposition of Acoustic Signals

    DTIC Science & Technology

    2012-02-01

    8 Figure 2.2: Reverse Ballistic Air Gun ................................................................................. 9 Figure 2.3: A MEMS...Schematic of the Sensor including Sensor-to-Sensor Parasitic .................... 177 Figure 5.9: Schematic of Laser Machined Sensor...178 Figure 5.10: Laser Machined Sensor Mode 1

  10. A Dynamic Model of Sustainment Investment

    DTIC Science & Technology

    2015-02-01

    Sustainment System Dynamics Model 11 Figure 7: Core Structure of Sustainment Work 12 Figure 8: Bandwagon Effect Loop 13 Figure 9: Limits to Growth Loop 14...Dynamics Model sustainment capacity sustainment performance gap Bandwagon Effect R1 Limits to Growth B1 S Work Smarter B3 Work Bigger B2 desired...which is of concern primarily when using the model as a vehicle for research. Figure 8 depicts a reinforcing loop called the “ Bandwagon Effect

  11. Multisensor Modeling Underwater with Uncertain Information

    DTIC Science & Technology

    1988-07-01

    133 Figure 6.4: Sidescan geometry artifacts ................................ 133 Figure 6.5: Sea MARC I intensity map of Clipperton ...area ................. 136 Figure 6.6: Sea MARC I intensity map of Clipperton area (from Kasiens et al.). .. 137 Figure 6.7: Sea Beam contour map of... Clipperton area .................... 138 Figure 6.8: Sea Beam contour map of Clipperton area (from Gallo ei al.) ....... 139 Figure 6.9: Sea Beam

  12. Neurobehavioral presentations of brain neoplasms.

    PubMed Central

    Filley, C M; Kleinschmidt-DeMasters, B K

    1995-01-01

    We studied 8 patients with frontal or temporolimbic neoplasms who had psychiatric presentations to clarify diagnostic criteria for distinguishing psychiatric disease from structural brain lesions and to examine brain-behavior relationships associated with cerebral neoplasms using modern neuroimaging techniques. Medical records were retrospectively reviewed for evidence of neurobehavioral and neurologic manifestations, tumor histologic features, and the results of treatment. Clinical presentations were correlated with tumor location as determined by computed tomography and magnetic resonance imaging. Patients with frontal lobe tumors presented with abulia, personality change, or depression, whereas those with temporolimbic tumors had auditory and visual hallucinations, mania, panic attacks, or amnesia. After treatment, neurobehavioral syndromes abated or resolved in 7 of 8 patients. We recommend that any patient 40 years of age or older with a change in mental state, cognitive or emotional, should have neuroimaging of the brain. Any patient with a psychiatric presentation who has specific neurobehavioral or neurologic findings or an unexpectedly poor response to psychopharmacologic treatment should also have brain imaging. These case reports extend and update observations on the importance of frontal and temporolimbic systems in the pathogenesis of neurobehavioral disorders. Images Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. Figure 6. Figure 7. Figure 8. PMID:7667978

  13. 50 CFR Figure 8 to Part 679 - Aleutian Islands Chinook Salmon Savings Area

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Aleutian Islands Chinook Salmon Savings Area 8 Figure 8 to Part 679 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL... ECONOMIC ZONE OFF ALASKA Pt. 679, Fig. 8 Figure 8 to Part 679—Aleutian Islands Chinook Salmon Savings Area...

  14. 50 CFR Figure 8 to Part 679 - Aleutian Islands Chinook Salmon Savings Area

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 11 2011-10-01 2011-10-01 false Aleutian Islands Chinook Salmon Savings Area 8 Figure 8 to Part 679 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL... ECONOMIC ZONE OFF ALASKA Pt. 679, Fig. 8 Figure 8 to Part 679—Aleutian Islands Chinook Salmon Savings Area...

  15. The ultrastructure of conjunctival melanocytic tumors.

    PubMed Central

    Jakobiec, F A

    1984-01-01

    The ultrastructure of conjunctival melanocytic lesions in 49 patients was evaluated to find significant differences between benign and malignant cells. The patients studied included 9 with benign epithelial (racial) melanosis, 2 with pigmented squamous cell papillomas, 16 with conjunctival nevi, 18 with primary acquired melanosis, and 11 with invasive nodules of malignant melanoma. In benign epithelial melanosis, dendritic melanocytes were situated along the basement membrane region of the conjunctival epithelium, with one basilar dendritic melanocyte lodged among every five or six basilar keratinocytes. The dendritic melanocytes extended arborizing cellular processes between the basilar and among the suprabasilar keratinocytes, which manifested considerable uptake of melanin granules into their cytoplasm. The benign dendritic melanocytes possessed nuclei with clumped heterochromatin at the nuclear membrane, small, tightly wound nucleoli, and large, elongated, fully melaninized melanin granules. In two patients with benign hyperplasia of the dendritic melanocytes, occasional dendritic melanocytes were located in a suprabasilar position, but were always separated from each other by keratinocytes or their processes. In the two black patients with benign pigmented squamous papillomas, the benign dendritic melanocytes were located hapharzardly at all levels of the acanthotic epithelium and not just along the basement membrane region. Melanin uptake by the proliferating keratinocytes was minimal. In benign melanocytic nevi of the conjunctiva, nevus cells within the intraepithelial junctional nests displayed a more rounded cellular configuration; short villi and broader cellular processes suggestive of abortive dendrites were found. The nuclear chromatin pattern was clumped at the nuclear membrane, but the nucleoli were somewhat larger than those of benign dendritic melanocytes in epithelial melanosis. The melanosomes were smaller and rounder than those in dendritic melanocytes and exhibited more haphazard arrangements of the melanofilaments, which were only partially melaninized. Mitochondria were more numerous than in dendritic melanocytes, and monoribosomes predominated over polyribosomes. Cytoplasmic filaments were inconspicuous. Cells in the immediate subepithelial connective tissue zone had features identical to those of the cells within the junctional nests. Smaller, lymphocytoid cells with less numerous and more rudimentary melanosomes were found in the middle and deeper portions of the lesions.(ABSTRACT TRUNCATED AT 400 WORDS) Images FIGURE 21 FIGURE 22 FIGURE 42 FIGURE 67 FIGURE 1 FIGURE 62 FIGURE 26 FIGURE 29 FIGURE 37 FIGURE 11 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20 FIGURE 23 FIGURE 24 FIGURE 25 FIGURE 27 FIGURE 28 FIGURE 30 FIGURE 31 FIGURE 32 FIGURE 33 FIGURE 34 FIGURE 35 FIGURE 36 FIGURE 38 FIGURE 39 FIGURE 40 FIGURE 41 FIGURE 43 FIGURE 44 FIGURE 45 FIGURE 46 FIGURE 47 FIGURE 48 FIGURE 49 FIGURE 50 FIGURE 51 FIGURE 52 FIGURE 53 FIGURE 54 FIGURE 55 FIGURE 56 FIGURE 57 FIGURE 58 FIGURE 59 FIGURE 60 FIGURE 61 FIGURE 63 FIGURE 64 FIGURE 65 FIGURE 66 FIGURE 68 FIGURE 69 FIGURE 70 FIGURE 71 FIGURE 72 FIGURE 73 FIGURE 74 FIGURE 75 FIGURE 76 FIGURE 77 FIGURE 78 FIGURE 79 FIGURE 80 FIGURE 81 FIGURE 82 FIGURE 83 FIGURE 84 FIGURE 85 FIGURE 86 FIGURE 87 FIGURE 88 FIGURE 89 PMID:6398936

  16. Back-pressure Effect on Shock-Train Location in a Scramjet Engine Isolator

    DTIC Science & Technology

    2010-03-01

    valves .......................................................................................... 57 Side project: making an actuator stand...21 Figure 8. Main manual shut off valve ...................................................................................22 Figure 9 . A small...characteristic about this wind tunnel. With Mach 1.8 nozzle, prior to test runs, the upstream regulator pressure valve (Figure 9 ) was set at

  17. Myocardial diseases of animals.

    PubMed Central

    Van Vleet, J. F.; Ferrans, V. J.

    1986-01-01

    In this review we have attempted a comprehensive compilation of the cardiac morphologic changes that occur in spontaneous and experimental myocardial diseases of animals. Our coverage addresses diseases of mammals and birds and includes these diseases found in both domesticated and wild animals. A similar review of the myocardial diseases in this broad range of animal species has not been attempted previously. We have summarized and illustrated the gross, microscopic, and ultrastructural alterations for these myocardial diseases; and, whenever possible, we have reviewed their biochemical pathogenesis. We have arranged the myocardial diseases for presentation and discussion according to an etiologic classification with seven categories. These include a group of idiopathic or primary cardiomyopathies recognized in man (hypertrophic, dilated, and restrictive types) and a large group of secondary cardiomyopathies with known causes, such as inherited tendency; nutritional deficiency; toxicity; physical injury and shock; endocrine disorders, and myocarditides of viral, bacterial, and protozoal causation. Considerable overlap exists between each of the etiologic groups in the spectrum of pathologic alterations seen in the myocardium. These include various degenerative changes, myocyte necrosis, and inflammatory lesions. However, some diseases show rather characteristic myocardial alterations such as vacuolar degeneration in anthracycline cardiotoxicity, myofibrillar lysis in furazolidone cardiotoxicity, calcification in calcinosis of mice, glycogen accumulation in the glycogenoses, lipofuscinosis in cattle, fatty degeneration in erucic acid cardiotoxicity, myofiber disarray in hypertrophic cardiomyopathy, and lymphocytic inflammation with inclusion bodies in canine parvoviral myocarditis. The myocardial diseases represent the largest group in the spectrum of spontaneous cardiac diseases of animals. Pericardial and endocardial diseases and congential cardiac diseases are seen less frequently; and, in contrast to man, coronary artery disease and myocardial ischemia are rather infrequent in animals. The present review shows clearly that the spectrum of myocardial diseases in animals is enlarging and that many newly recognized diseases are emerging and assuming considerable importance. For example, various heritable cardiomyopathies have recently been described in the KK mouse, cattle, and rats. Increasingly recognized myocardial diseases include cardiomyopathies in cats, dogs, and birds; anthracycline cardiotoxicity; furazolidone cardiotoxicity; ionophore cardiotoxicity; myocardial damage associated with central nervous system injuries; myocardial hypertrophy in Images Figure 1 Figure 2 Figure 45 Figure 46 Figure 47 Figure 48 Figure 61 Figure 62 Figure 63 Figure 64 Figure 79 Figure 75 Figure 76 Figure 77 Figure 78 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 Figure 18 Figure 19 Figure 20 Figure 21 Figure 22 Figure 23 Figure 24 Figure 25 Figure 26 Figure 27 Figure 28 Figure 29 & 30 Figure 31 Figure 32 Figure 33 Figure 34 Figure 35 Figure 36 Figure 37 Figure 38 Figure 39 Figure 40 Figure 41 Figure 42 Figure 43 Figure 44 Figure 49 Figure 50 Figure 51 Figure 52 Figure 53 Figure 54 Figure 55 Figure 56 Figure 57 Figure 58 Figure 59 Figure 60 Figure 65 Figure 66 Figure 67 Figure 68 Figure 69 Figure 70 Figure 71 & 72 Figure 73 & 74 PMID:3524254

  18. Multimedia Visualisation of Massive Military Datasets (Visualisation multimedia des jeux de donnees militaires massifs)

    DTIC Science & Technology

    2007-06-01

    the Los Angeles Area A-16 Figure A-5 Illustration of the Life Cycle of the Japanese Beetle A-17 Figure B-1 Knowledge Wall B-8 Figure B-2...Structure of World Trade in 1992 C-15 Figure D-1 3D Panorama Cinema at CAVI in Use D-2 Figure D-2 Holobench at CAVI D-2 Figure D-3 Virtual Studio...Illustration of the Life Cycle of the Japanese Beetle. A.6 STEPS IN ESTABLISHING A THEORY OF EFFECTIVE VISUALISATION An established theory generally

  19. Technical Feasibility of Loitering Lighter-Than-Air Near-Space Maneuvering Vehicles

    DTIC Science & Technology

    2005-03-01

    one year [7]. NASA’s superpressure design consists of a pumpkin shaped balloon (Figure 8) to minimize envelope material stresses. Figure 8: NASA...Figure 12: Turbojet Engine In addition to the pure turbojet engine, the basic gas turbine core is also used to power turboprop and turbofan

  20. Comprehensive Monitoring Program: Final Air Quality Data Assessment Report for FY90, Version 3.1 Volume 3

    DTIC Science & Technology

    1991-09-01

    Monitoring Stations Figure 4.1-1 X /Q Dispersion for Phase I Figure 4.1-2 X /Q Dispersion for Phase 2-Stage 1 Figure 4.1-3 X /Q Dispersion for Phase 2...Stage 2 Fp Figure 4.1-4 X /Q Dispersion for Phase 3 Figure 4.1-5 X /Q Dispersion for Phase 4 • Figure 4.1-6 Sources of Regulated Pollutants in RMA...Arsenic Results by Phase "Figure 4.4-7 Cadmium Results by Phase Figure 4.4-8 X /Q Dispersion and Basin F Metals for 9/6/88 * Figure 4.4-9 X /Q Dispersion

  1. Optimizing Flight Schedules by an Automated Decision Support System

    DTIC Science & Technology

    2014-03-01

    18 Figure 5-Equation-1 of Grading Pilot-Mission Matches ( Yavuz , 2010) .......................... 22 Figure 6-Equation...2 of Grading Pilot-Mission Matches ( Yavuz , 2010) .......................... 22 Figure 7-Implementation of GRASP ( Yavuz , 2010...23 Figure 8-Overall Process ( Yavuz , 2010

  2. Ellipticus CW Illumination System

    DTIC Science & Technology

    2012-08-07

    two ferrites were chosen: Manganese Zinc #77 (low frequency) and Nickel Zinc #43 (mid frequency) [7]. He then tried various combinations of...3 Figure 4. 20m Ellipticus Design with Balun and Ferrites ...8 Figure 10. Details of the Ferrite Bead Assembly ...........................................................................8 Figure 11

  3. Advanced Coats' disease.

    PubMed Central

    Haik, B G

    1991-01-01

    Advanced Coats' disease and retinoblastoma can both present with the triad of a retinal detachment, the appearance of a subretinal mass, and dilated retinal vessels. Thus, even the most experienced observer may not be able to differentiate these entities on ophthalmoscopic findings alone. Coats' disease is the most common reason for which eyes are enucleated with the misdiagnosis of retinoblastoma. Ultrasonography is the auxiliary diagnostic test most easily incorporated into the clinical examination, and can be utilized repeatedly without biologic tissue hazard. Ultrasonically identifiable features allowing differentiation between Coats' disease and retinoblastoma include the topography and character of retinal detachment and presence or absence of subretinal calcifications. Ultrasonography is of lesser use in poorly calcified retinoblastoma and in detecting optic nerve or extraocular extension in heavily calcified retinoblastoma. CT is perhaps the single most valuable test because of its ability to: (a) delineate intraocular morphology, (b) quantify subretinal densities, (c) identify vascularities within the subretinal space through the use of contrast enhancement, and (d) detected associated orbital or intracranial abnormalities. Optimal computed tomographic studies, however, require multiple thin slices both before and after contrast introduction and expose the child to low levels of radiation if studies are repeated periodically. MR imaging is valuable for its multiplanar imaging capabilities, its superior contrast resolution, and its ability to provide insights into the biochemical structure and composition of tissues. It is limited in its ability to detect calcium, which is the mainstay of ultrasonic and CT differentiation. Aqueous LDH and isoenzyme levels were not valuable in distinguishing between Coats' disease and retinoblastoma. The value of aqueous NSE levels in the differentiation of advanced Coats' disease and exophytic retinoblastoma deserves further study. Specimens from patients with intraocular hemorrhage should be viewed cautiously, since erythrocytes contain high levels of enolase. Analysis of subretinal aspirates is an extremely accurate method of confirming the diagnosis of Coats' disease. The key diagnostic findings are the presence of cholesterol crystals and pigment-laden macrophages and the absence of tumor cells on fresh preparations. The technique should be reserved for patients where retinoblastoma has been ruled out by all noninvasive means and massive subretinal drainage is anticipated. The natural progression in advanced Coats' disease is toward the development of a blind, painful eye. Spontaneous regression does rarely occur, and some eyes quietly progress to a phthisical state.(ABSTRACT TRUNCATED AT 400 WORDS) Images FIGURE 2 FIGURE 3 FIGURE 4 A FIGURE 4 B FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20 FIGURE 21 FIGURE 22 FIGURE 23 FIGURE 24 FIGURE 25 FIGURE 26 FIGURE 27 FIGURE 28 FIGURE 29 FIGURE 30 FIGURE 31 FIGURE 32 FIGURE 33 FIGURE 34 A FIGURE 34 B FIGURE 35 FIGURE 36 FIGURE 38 FIGURE 39 FIGURE 41 FIGURE 42 FIGURE 43 FIGURE 44 FIGURE 45 FIGURE 46 A FIGURE 46 B FIGURE 47 A FIGURE 47 B FIGURE 48 A FIGURE 48 B FIGURE 49 FIGURE 50 FIGURE 51 FIGURE 52 FIGURE 54 FIGURE 54 (cont.) FIGURE 55 FIGURE 57 FIGURE 58 FIGURE 59 FIGURE 60 FIGURE 61 FIGURE 62 FIGURE 63 FIGURE 64 FIGURE 65 FIGURE 66 A FIGURE 66 B FIGURE 67 A FIGURE 67 B PMID:1808814

  4. Conductive Polymer Blends

    DTIC Science & Technology

    1988-04-26

    FIGURES Figure 1. Schematic of the suspension copolymerization approach ................ 8 Figure 2. SEM micrograph of fracture surface near molded...micrograph of fracture surface near molded edge of sample 1430-58b.............................................................. 18 Figure 12. SEM... caprolactam . The caprolactam (11.3 g) was placed in a large tube equipped with a nitrogen inlet, and heated under nitrogen to 80*C, whereupon

  5. Expression of alveolar type II cell markers in acinar adenocarcinomas and adenoid cystic carcinomas arising from segmental bronchi. A study in a heterotopic bronchogenic carcinoma model in dogs.

    PubMed Central

    TenHave-Opbroek, A. A.; Hammond, W. G.; Benfield, J. R.; Teplitz, R. L.; Dijkman, J. H.

    1993-01-01

    The type II alveolar epithelial cell is one of two pluripotential stem cell phenotypes in normal mammalian lung morphogenesis; cells manifesting this phenotype have been found to constitute bronchioloalveolar regions of canine adenocarcinomas. We now studied type II cell expression in canine acinar adenocarcinomas and adenoid cystic (bronchial gland) carcinomas, using the same bronchogenic carcinoma model (subcutaneous bronchial autografts treated with 3-methylcholanthrene). Distinctive features of type II cells are the approximately cuboid cell shape, large and roundish nucleus, immunofluorescent staining of the cytoplasm for the surfactant protein SP-A, and presence of multilamellar bodies or their precursory forms. Cells with these type II cell characteristics were found in the basal epithelial layer of all tumor lesions and in upper layers as far as the lumen, singly or in clusters; they were also found in early invasive carcinomatous lesions but not in bronchial glands or bronchial epithelium before carcinogen exposure. Immunoblots of tumor homogenates showed reactive proteins within size classes of SP-A (28 to 36 kd) or its dimeric form (56 to 72 kd). These findings and those previously reported are consistent with the concept that chemical carcinogenesis in the adult bronchial epithelium may lead to type II cell carcinomas of varying glandular (acinar, adenoidcystic or bronchioloalveolar) growth patterns. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 Figure 18 Figure 19 Figure 20 Figure 21 Figure 22 PMID:8386445

  6. Process for Refining and Validating a Finite Element Model of an Experimental High-Altitude, Long-Endurance (HALE) Aircraft

    DTIC Science & Technology

    2011-06-01

    7 Figure 4. Helios flying near the Hawaiian islands of Niihau and Lehua [15] ................... 8 Figure 5. Plan view of ERAST Program aircraft...Figure 4. Helios flying near the Hawaiian islands of Niihau and Lehua [15] 9 Figure 5. Plan view of ERAST Program aircraft

  7. Restriction of the anti-bovine serum albumin response in rabbits immunized with Micrococcus lysodeikticus.

    PubMed Central

    De Baetselier, P; Hamers-Casterman, C; Van der Loo, W; Hamers, R

    1977-01-01

    Rabbits capable of producing antibodies of restricted heterogeneity in response to Micrococcus lysodeikticus are equally capable of producing antibodies of restricted heterogeneity to bovine serum albumin. These antibodies are produced when animals are simultaneously injected with micrococcus and BSA and their specificity is restricted to a small number of epitopes. These results suggest that micrococcal vaccines can induce the restriction of heterogeneity in antibodies raised against totally unrelated antigens. Images Figure 4 Figure 5 Figure 2 Figure 6 Figure 7 Figure 8 PMID:71263

  8. 16 CFR Figure 8 to Part 1633 - Jig for Setting Mattresses and Foundation Sides in Same Plane

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 2 2014-01-01 2014-01-01 false Jig for Setting Mattresses and Foundation Sides in Same Plane 8 Figure 8 to Part 1633 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 8 Figure 8 to Part 1633—Jig for Setting Mattresses and Foundation Sides in Same Plane ER15MR06.007 ...

  9. 16 CFR Figure 8 to Part 1633 - Jig for Setting Mattresses and Foundation Sides in Same Plane

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 2 2013-01-01 2013-01-01 false Jig for Setting Mattresses and Foundation Sides in Same Plane 8 Figure 8 to Part 1633 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 8 Figure 8 to Part 1633—Jig for Setting Mattresses and Foundation Sides in Same Plane   ER15MR06.007 ...

  10. 16 CFR Figure 8 to Part 1633 - Jig for Setting Mattresses and Foundation Sides in Same Plane

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 2 2012-01-01 2012-01-01 false Jig for Setting Mattresses and Foundation Sides in Same Plane 8 Figure 8 to Part 1633 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 8 Figure 8 to Part 1633—Jig for Setting Mattresses and Foundation Sides in Same Plane ER15MR06.007 ...

  11. 16 CFR Figure 8 to Part 1633 - Jig for Setting Mattresses and Foundation Sides in Same Plane

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 2 2011-01-01 2011-01-01 false Jig for Setting Mattresses and Foundation Sides in Same Plane 8 Figure 8 to Part 1633 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 8 Figure 8 to Part 1633—Jig for Setting Mattresses and Foundation Sides in Same Plane ER15MR06.007 ...

  12. 16 CFR Figure 8 to Part 1633 - Jig for Setting Mattresses and Foundation Sides in Same Plane

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Jig for Setting Mattresses and Foundation Sides in Same Plane 8 Figure 8 to Part 1633 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 8 Figure 8 to Part 1633—Jig for Setting Mattresses and Foundation Sides in Same Plane ER15MR06.007 ...

  13. Development and Implementation of a Scramjet Cycle Analysis Code with a Finite-Rate-Chemistry Combustion Model for Use on a Personal Computer

    DTIC Science & Technology

    1993-12-01

    2 3 9 V List of Fi-ures Figure 1 - Functional...Block Diagram of a Scramjet ........................................ 9 Figure 2 - ’Corrected’ Specific Impulse of Hydrogen-Oxygen Rocket ............. 35...38 Figure 8 - Schematic of Northam/Anderson Mixing Model ............................ 39 Figure 9 - Pressure-Area

  14. Response of the macaque nasal epithelium to ambient levels of ozone. A morphologic and morphometric study of the transitional and respiratory epithelium.

    PubMed Central

    Harkema, J. R.; Plopper, C. G.; Hyde, D. M.; St George, J. A.; Wilson, D. W.; Dungworth, D. L.

    1987-01-01

    Although ozone (O3)-induced bronchiolitis has been morphologically characterized, effects of O3 on the upper respiratory tract have not been thoroughly investigated. The purpose of this study was to determine whether exposures to ambient levels of O3 induce lesions in the nasal mucosa. Bonnet monkeys were exposed to 0.00, 0.15, or 0.30 ppm O3 for 6 or 90 days, 8 hours/day. After exposure, nasal mucosa was processed for light and electron microscopy. Quantitative changes were evident in the nasal transitional and respiratory epithelium. At 6 or 90 days of exposure to 0.15 or 0.30 ppm O3 lesions consisted of ciliated cell necrosis, shortened cilia, and secretory cell hyperplasia. Inflammatory cell influx was only present at 6 days of exposure. Ultrastructural changes in goblet cells were evident at 90 days. Ambient levels of O3 can induce significant nasal epithelial lesions, which may compromise upper respiratory defense mechanisms. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:3605312

  15. Navigation of a Satellite Cluster with Realistic Dynamics

    DTIC Science & Technology

    1991-12-01

    20 2.2.1 Dynamics ( Clohessy - Wiltshire Equations) ............ 21 2.2.2 Iterated, Extended Kalman Filter.................26 iv I1l...8 Figure 4. Point mass and Clohessy - Wiltshire orbits (10 orbits) .......... 16 Figure 5. Real dynamics and Clohessy - Wiltshire orbits (10...filter ..... 31 Figure 8. Comparison of the Clohessy - Wiltshire and truth model solutions

  16. Analysis of the effects of overexpression of metallothionein-I in transgenic mice on the reproductive toxicology of cadmium.

    PubMed Central

    Dalton, T; Fu, K; Enders, G C; Palmiter, R D; Andrews, G K

    1996-01-01

    Exposure to low levels of cadmium reduces fertility. In male mice spermatogenesis is highly sensitive to cadmium, whereas in females the peri-implantation period of pregnancy is sensitive. To examine the potential roles of the cadmium-binding protein, metallothionein (MT), in the reproductive toxicology of cadmium, we examined a transgenic mouse strain that overexpresses metallothionein-I (MT-I). These mice had dramatically increased steady-state levels of MT-I mRNA and MT in the testes and in the female reproductive tract during the peri-implantation period of pregnancy, and this overexpression occurred in a cell-specific and temporally regulated manner similar to that of the endogenous MT-I gene. Transgenic and control males were injected with cadmium, and the histology of the testes was examined. An injection of 7.5 mumol Cd/kg had no effect on histology of the testes in either transgenic or control mice. In contrast, an injection of 10 mumol Cd/kg caused rapid changes in the histology of the testes and resulted in pronounced testicular necrosis in both control and transgenic mice. Female transgenic and control mice were mated and then injected with cadmium (30-45 mumol Cd/kg) on the day of blastocyst implantation (day 4). In both of these groups, injection of cadmium reduced pregnancy rate, and no dramatic protection was afforded by maternal and/or embryonic overexpression of MT. Thus, overexpression of MT-I does not significantly protect against either of these cadmium-induced effects on fertility. Images Figure 1. A Figure 1. B Figure 2. A Figure 2. B Figure 2. C Figure 3. Figure 4. A Figure 4. A Figure 4. B Figure 4. B Figure 4. B Figure 4. B Figure 4. D4 Figure 4. D4 Figure 4. D6 Figure 4. D6 Figure 4. D8 Figure 5. A Figure 5. B Figure 5. C Figure 5. D Figure 5. E Figure 6. A Figure 6. B Figure 6. C Figure 6. D Figure 6. E Figure 6. F PMID:8834864

  17. Joint Operation Planning and Execution

    DTIC Science & Technology

    1992-03-01

    Review Force Cargo Category Record ............. 261 Review Cargo Details ........................... 262 Tailor Force Record...shown. Tailor Force Cargo, Figure 7.11, is displayed. 261 <Xmit> to accept the update as shown. Tailor Force Cargo, Figure 7.11, is displayed. To review...8217 ZARZS TUNSA P 4S IAP DI’J ENTER FFPN,NPINPF!N,LP/,NPA3E ,. 2,ENr. Figure 12.8 GEOFILE Display After reviewing Figure 12.8, navigate back to the GEOFILE

  18. Design Considerations for Gun Propellant Climatic Storage Chambers.

    DTIC Science & Technology

    1982-11-01

    Schematic diagram of thermal element 5 4. Prototype Lhermal element 6 5. Power control circuit diagram 7 6. Power control module 7 7. Temperature...plates. Each plate is powered through a triac and temperature control circuit as shown in figure 5. Figure 6 is a photograph of an assembled power control...SHEATER PLATES Figure 5. Power control circuit diagram 4 f Figure 6. Power control module WSR.L-0295-TR -8- Figure 7. Temperature control module 9 -WSRL

  19. Degradation Modeling of Polyurea Pavement Markings

    DTIC Science & Technology

    2011-03-01

    34 Highly Reflective Elements ( HRE ) Model...Figure 4-6: Initial HRE Model Residuals ......................................................................... 36 Figure 4-7: HRE Model...Histogram .................................................................................. 38 Figure 4-8: HRE Model Residuals

  20. Clinical Development of Gamitrinib, a Novel Mitochondrial-Targeted Small Molecule Hsp90 Inhibitor

    DTIC Science & Technology

    2014-09-01

    Leu, Ile degradation COMT FTSJ2 RDH14LDHA LDHB Figure 1 | Mitochondrial Hsp90 proteome. (a) LN229 cells were treated with vehicle (Control) or non...metabolism (Yoshida et al., 2013).Cell Reports 8, 671–677, August 7, 2014 ª2014 The Authors 671 Figure 1. Characterization of TRAP-1/ Mice (A) Map of...weight (Figure 1D) and organ (liver, spleen)672 Cell Reports 8, 671–677, August 7, 2014 ª2014 The Authorshyperplasia (Figure S1A), decreased chronic

  1. Optimum Component Design in N-Stage Series Systems to Maximize the Reliability Under Budget Constraint

    DTIC Science & Technology

    2003-03-01

    27 2.8.5 Marginal Analysis Method...Figure 11 Improved Configuration of Figure 10; Increases Basic System Reliability..... 26 Figure 12 Example of marginal analysis ...View of Main Book of Software ............................................................... 51 Figure 20 The View of Data Worksheet

  2. Implementation of Policies to Bridge the Gap Between Police Officer Line of Duty Deaths and Agency Resiliency

    DTIC Science & Technology

    2015-12-01

    by Year and Category..................................... 3 Figure 2. Map of Florida...16 Figure 3. Map of St. Petersburg................................................................... 17 Figure 4. Method of Line of... Map of Eastern United States ....................................................... 32 Figure 8. Virginia State Police Division Map

  3. Ultrastructural characteristics of carcinogen-induced nondysplastic changes in tracheal epithelium.

    PubMed Central

    Klein-Szanto, A. J.; Topping, D. C.; Heckman, C. A.; Nettesheim, P.

    1980-01-01

    Nondysplastic hypotrophic and metaplastic epithelial alterations induced by dimethylbenz(a)anthracene in isogenic tracheal transplants were studied by light and electron microscopy 3--24 months after cessation of a 4-week carcinogen exposure. Hypotrophic epithelium observed at all time points was characterized by the presence of nonciliated cells that adopted either cuboidal or squamous shapes, forming simple or bistratified epithelia. Most of these cells, as well as some metaplastic cells, exhibited features of mucin-secreting cells. The metaplastic epithelia showed nonkeratinizing squamous metaplasia, closely related to transitional metaplasia, and keratinizing squamous metaplasia, which presented either an atrophic or an acanthotic epithelium. Although many of these epithelia showed morphologic features of normal stratified epithelia, several nonkeratinizing squamous metaplasias and acanthotic keratinizing squamous metaplasias exhibited some irregularities, probably representing very early atypical ultrastructural features (ie, perinuclear concentration of tonofilament bundles, the presence of dark and clear basal epithelial cells, interruptions and alterations of the basal lamina). These features were not observed in a group of early squamous metaplasias studied for comparative purposes 2 weeks after cessation of dimethylbenz(a)anthracene exposure, which were characterized by a combination of degenerative phenomena and increased cell proliferation. Images Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 14 Figure 15 Figure 6 Figure 7 PMID:6766047

  4. Roentgen Examination of Soft Tissues of the Pelvis

    PubMed Central

    Noonan, Charles D.

    1964-01-01

    With meticulous preparation of the patient and with careful technique, the soft tissues of the pelvis are identifiable in most cases. Search should be made for the traces of abnormal pelvic structures on plain-film studies. Once the normal is recognized, any variations are easily identified. The fundamental differences between various radiologic densities—air, fat, fluid, muscle, calcium, bone and metal—should be observed. Special procedures can be used to enhance the contrasts after adequate evaluation of the simplest and, on many occasions, the invaluable, plain-film study of the soft tissues of the pelvis. ImagesFigure 2.Figure 3.Figure 3.Figure 4.Figure 5.Figure 6.Figure 7.Figure 8. PMID:14232160

  5. Mammary gland neoplasia in long-term rodent studies.

    PubMed Central

    Russo, I H; Russo, J

    1996-01-01

    Breast cancer, the most frequent spontaneous malignancy diagnosed in women in the western world, is continuously increasing in incidence in industrialized nations. Although breast cancer develops in women as the result of a combination of external and endogenous factors such as exposure to ionizing radiation, diet, socioeconomic status, and endocrinologic, familial, or genetic factors, no specific etiologic agent(s) or the mechanisms responsible of the disease has been identified as yet. Thus, experimental models that exhibit the same complex interactions are needed for testing various mechanisms and for assessing the carcinogenic potential of given chemicals. Rodent mammary carcinomas represent such a model to a great extent because, in these species, mammary cancer is a multistep complex process that can be induced by either chemicals, radiation, viruses, or genetic factors. Long-term studies in rodent models have been particularly useful for dissecting the initiation, promotion, and progression steps of carcinogenesis. The susceptibility of the rodent mammary gland to develop neoplasms has made this organ a unique target for testing the carcinogenic potential of specific genotoxic chemicals and environmental agents. Mammary tumors induced by indirect- or direct-acting carcinogens such as 7, 12-dimethlbenz(a)anthracene or N-methyl-N-nitrosourea are, in general, hormone dependent adenocarcinomas whose incidence, number of tumors per animal, tumor latency, and tumor type are influenced by the age, reproductive history, and endocarinologic milieu of the host at the time of carcinogen exposure. Rodent models are informative in the absence of human data. They have provided valuable information on the dose and route of administration to be used and optimal host conditions for eliciting maximal tumorigenic response. Studies of the influence of normal gland development on the pathogenesis of chemically induced mammary carcinomas have clarified the role of differentiation in cancer initiation. Comparative studies with the development of the human breast and the pathogenesis of breast cancer have contributed to validate rodent-to-human extrapolations. However, it has not been definitively established what type of information is necessary for human risk assessment, whether currently toxicity testing methodologies are sufficient for fulfilling those needs, or whether treatment-induced tumorigenic responses in rodents are predictive of potential human risk. An alternative to the traditional bioassays are mechanism-based toxicology and molecular and cellular approaches, combined with comparative in vitro systems. These approaches might allow the rapid screen of chemicals for setting priorities for further studies to determine the dose-response relationship for chemical effects at low doses, to assess effects other than mutagenesis and/or tumorigenesis, or to establish qualitative and quantitative relationships of biomarkers to toxic effects. Until there is enough information on the predictive value of mechanism-based toxicology for risk assessment, this approach should be used in conjunction with and validated by the traditional in vivo long-term bioassays. Images Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. Figure 6. Figure 7. A Figure 7. B Figure 8. A Figure 8. B Figure 9. Figure 10. Figure 11. Figure 12. Figure 13. Figure 14. Figure 15. Figure 16. Figure 17. Figure 18. Figure 19. Figure 20. Figure 21. Figure 22. Figure 23. Figure 24. Figure 25. Figure 26. PMID:8899375

  6. Carbon Dioxide Sensor Technology.

    DTIC Science & Technology

    1983-04-01

    Piezoelectric Crystals .................... .50 Previous Efforts ....... .................... 50 Estimated Sensor Characteristics...with Respect to the Detection of Carbon Dioxide Table 7. Piezoelectric Crystal Coatings and Performance Data. .. ...53-55 Table 8. Summnary of...3,999,122) Figure 8. Enlarged View of an Individual Quartz Resonator .. .. ... 51 Figure 9. Glass Gas-Tight Piezoelectric Crystal , Side View......57 *Figure

  7. The development of the trabecular meshwork and its abnormality in primary infantile glaucoma.

    PubMed Central

    Anderson, D R

    1981-01-01

    Tissue from ten eyes with infantile glaucoma and from 40 normal eyes of fetuses and infants without glaucoma were examined by light and electron microscopy. In normal development, the corneoscleral coat grows faster than the uveal tract during the last trimester, leading to a posterior migration of the ciliary body attachment from Schwalbe's line (5th month) to the scleral spur (9th month), and then to a location behind the scleral spur (postnatally). In infantile glaucoma, the insertion of the anterior ciliary body and iris overlaps the trabecular meshwork, similar to the late fetal position. The trabecular sheets are perforated, and there is no membrane over the surface of the trabecular meshwork. The trabecular beams are thicker than in normal infant eyes. There is both histologic and clinical evidence of traction on the iris root exerted by the thickened trabecular beams. These findings suggest that in congenital glaucoma the thickened beams had prevented the normal posterior migration of the ciliary body and iris root. This traction may compact the thickened trabecular beams, obstructing aqueous humor outflow. Release of the traction by an incision (goniotomy or trabeculotomy) of the thickened meshwork may relieve the obstruction. Of uncertain pathological significance is that there are no vacuoles in the endothelium of Schlemm's canal and there is a broad layer of collagen and amorphous material in the juxtacanalicular connective tissue. The ciliary processes are elongated inward, as if they were pulled by zonular traction (perhaps created by an enlarging diameter of the limbus with a fixed lens diameter). Images FIGURE 7 FIGURE 8 FIGURE 10 FIGURE 11 FIGURE 20 A FIGURE 20 B FIGURE 1 FIGURE 3 FIGURE 4 A FIGURE 4 B FIGURE 5 A FIGURE 5 B FIGURE 6 FIGURE 9 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 PMID:7342408

  8. Conceptual Architecture to Measure the Effects of Subauroral Polarization Streams on Radar Operations

    DTIC Science & Technology

    2016-09-01

    5 2.1 Chapter Overview ...................................................................................................5 2.2 Solar ...65 viii List of Figures Page Figure 1. A Solar Eruption (NASA...7 Figure 3. Solar Wind Energy Transfer (Goldstein, 2005) ................................................. 8

  9. 32 CFR Appendix - Figures 4 through 8 to Subpart F of Part 651

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 32 National Defense 4 2011-07-01 2011-07-01 false Figures 4 through 8 to Subpart F of Part 651 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY (CONTINUED) ENVIRONMENTAL QUALITY ENVIRONMENTAL ANALYSIS OF ARMY ACTIONS (AR 200-2) Environmental Impact Statement Existing EISs. Pt. 651, Subpt. F, Figs. Figures 4 through 8 to...

  10. Moving Up the CMMI Capability and Maturity Levels Using Simulation

    DTIC Science & Technology

    2008-01-01

    Alternative Process Tools, Including NPV and ROI 6 Figure 3: Top-Level View of the Full Life-Cycle Version of the IEEE 12207 PSIM, Including IV&V Layer 19...Figure 4: Screenshot of the Incremental Version Model 19 Figure 5: IEEE 12207 PSIM Showing the Top-Level Life-Cycle Phases 22 Figure 6: IEEE 12207 ...Software Detailed Design for the IEEE 12207 Life- Cycle Process 24 Figure 8: Incremental Life Cycle PSIM Configured for a Specific Project Using SEPG

  11. Familial canine dermatomyositis. Initial characterization of the cutaneous and muscular lesions.

    PubMed Central

    Hargis, A. M.; Haupt, K. H.; Hegreberg, G. A.; Prieur, D. J.; Moore, M. P.

    1984-01-01

    Familial canine dermatomyositis is a recently identified disease of collie dogs that resembles human juvenile dermatomyositis. The lesions in the skin and muscles obtained by biopsy from two litters of dogs were characterized for the purpose of determining the similarity of the lesions to those of human dermatomyositis. The cutaneous lesions began between 7 and 11 weeks of age and were present on the face, lips, ears, and skin over bony prominences of the limbs, feet, sternum, and tip of the tail. Histologically the cutaneous lesions frequently consisted of vesicles, pustules, and ulcers on the lips, face, and ears. Neutrophils, lymphocytes, mast cells, and macrophages were present throughout the dermis. Neutrophils and lymphocytes were also present in and around vessels. Between 13 and 19 weeks of age generalized muscle atrophy was noted. The muscle lesions consisted of interstitial lymphocyte, plasma cell, macrophage, and neutrophil accumulation; myofiber degeneration, regeneration, and atrophy; and fibrosis. Perivascular neutrophils, lymphocytes, and plasma cells were also seen. Histologically, the lesions resembled those present in human juvenile dermatomyositis; and these observations, coupled with clinical, immunologic, and clinical pathologic observations presented elsewhere, suggest that familial canine dermatomyositis is an appropriate and potentially useful model for human juvenile dermatomyositis. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 PMID:6465285

  12. Mission Capability Gains from Multi-Mode Propulsion Thrust Variations on a Variety Spacecraft Orbital Maneuvers

    DTIC Science & Technology

    2011-03-01

    Geocentric -Equatorial Reference Frame2 ....................................................................... 31  Figure 8: Perifocal and Geocentric ...67  Figure 25: Mission 3 Geocentric Equatorial Reference Frame ...................................................... 69  Figure 26: Mission 3...Coordinate system, the Geocentric -Equatorial Reference frame and the reference frame depicted on one another is shown below. The following figures are from

  13. A FORTRAN Computer Program to Perform Goodness of Fit Testing on Empirical Data.

    DTIC Science & Technology

    1979-06-01

    11 9. Mesokurtic Shape ....... ................. 1210. Platykurtic Shape ..... .. ................ 12 11. Leptokurtic Shape...distribution is platykurtic and if K is greater than 3, the distribution is described as leptokurtic. Figures 9, 10, and 11 illustrate mesokurtic... platykurtic , and leptokurtic shapes (8). Figure 9 Figure 10 Figure 11 Mesokurtic Shape Platykurtic Shape Leptokurtic Shape The population parameters for

  14. Dwarfism in Alaskan malamutes: a disease resembling metaphyseal dysplasia in human beings.

    PubMed Central

    Sande, R. D.; Alexander, J. E.; Spencer, G. R.; Padgett, G. A.; Davis, W. C.

    1982-01-01

    In a study of 300 Alaskan Malamutes, dwarfism was shown to be an autosomal recessive inherited disease with complete penetrance that resulted in disturbed endochondral bone formation. Osseous growth disturbance was manifest at the metaphyses of tubular bones. Clinical and radiographic changes were very similar to those of rickets, although appositional bone formation rates were normal. Serum calcium, phosphorus, and alkaline phosphatase were within normal limits. Urinary excretion of calcium, phosphate, and amino acids were normal. Excess matrix was formed in the zone of cartilage cell proliferation, and the matrix persisted in the growth plate. Normal stresses resulted in microfractures in the metaphyses with subsequent interference of vascular penetration into the zone of degenerated cartilage cells. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:7065114

  15. Temporal morphologic changes in human colorectal carcinomas following xenografting.

    PubMed Central

    Barkla, D. H.; Tutton, P. J.

    1983-01-01

    The temporal morphologic changes of human colorectal carcinomas following xenografting into immunosuppressed mice were investigated by the use of light and transmission electron microscopy. The results show that colorectal carcinomas undergo a series of morphologic changes during the initial 30-day period following transplantation. During the initial 1-5-day period the majority of tumor cells die, and during the following 5-10-day period the necrotic debris created during the 1-5-day period is removed by host-supplied inflammatory cells. Only small groups of peripherally placed tumor cells survived at the end of the first 10 days. During the 10-20-day period the tumor cell populations of xenografts were reestablished by a morphologically heterogeneous population of tumor cells, and during the 20-30 day period consolidation of this process continued and some xenografts showed macroscopic evidence of growth. The authors hypothesize that human colorectal carcinomas, like the antecedent epithelium, contain subpopulations of undifferentiated cells that give rise to populations of more-differentiated cells. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 PMID:6829710

  16. Analysis of the Effect of Historical Cultural Changes Relative to the Development of Affordability Excursions to Existing Parametric Cost Models

    DTIC Science & Technology

    1988-09-30

    DISTRiUTIONWtAVAu.ASiUTY OF REPORT 2b. DECLASSIFICATON I DOW’NGRADING SCHEDULE 4. PERFORMING ORGANIZATION REPORT NUMBER(S) S. MONITORING ORGANIZATION...REPORT NUMBER(S) 6a. NAME OF PERFORMING ORGANIZATION 6b. OFFICE SYMBOL 7a. NAME OF MONITORING ORGANIZATION WCW Associates, Inc. Battel le 6c. ADDRESS...Cycle Figure 8-6 Induced Change k Figure 8-7 The Culture- Performance Relationship Figure 8-8 Culture-Productivity Bridge vi Preface Our cultural

  17. Toxicity and carcinogenicity of potassium bromate--a new renal carcinogen.

    PubMed Central

    Kurokawa, Y; Maekawa, A; Takahashi, M; Hayashi, Y

    1990-01-01

    Potassium bromate (KBrO3) is an oxidizing agent that has been used as a food additive, mainly in the bread-making process. Although adverse effects are not evident in animals fed bread-based diets made from flour treated with KBrO3, the agent is carcinogenic in rats and nephrotoxic in both man and experimental animals when given orally. It has been demonstrated that KBrO3 induces renal cell tumors, mesotheliomas of the peritoneum, and follicular cell tumors of the thyroid. In addition, experiments aimed at elucidating the mode of carcinogenic action have revealed that KBrO3 is a complete carcinogen, possessing both initiating and promoting activities for rat renal tumorigenesis. However, the potential seems to be weak in mice and hamsters. In contrast to its weak mutagenic activity in microbial assays, KBrO3 showed relatively strong potential inducing chromosome aberrations both in vitro and in vivo. Glutathione and cysteine degrade KBrO3 in vitro; in turn, the KBrO3 has inhibitory effects on inducing lipid peroxidation in the rat kidney. Active oxygen radicals generated from KBrO3 were implicated in its toxic and carcinogenic effects, especially because KBrO3 produced 8-hydroxydeoxyguanosine in the rat kidney. A wide range of data from applications of various analytical methods are now available for risk assessment purposes. Images FIGURE 1. FIGURE 2. FIGURE 5. FIGURE 6. FIGURE 7. FIGURE 8. FIGURE 9. FIGURE 10. FIGURE 11. FIGURE 12. PMID:2269236

  18. 50 CFR Figure 1 to Part 640 - Figure 1 to Part 640

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Figure 1 to Part 640 1 Figure 1 to Part 640 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE SPINY LOBSTER FISHERY OF THE GULF OF MEXICO AND SOUTH ATLANTIC Pt. 640...

  19. The image and advocacy of public health in American caricature and cartoons from 1860 to 1900.

    PubMed Central

    Hansen, B

    1997-01-01

    The decades just before and after the founding of the American Public Health Association in 1872 saw an efflorescence of political cartooning and caricature in national-circulation weeklies. Part of the political and social critique that cartoonists and their editors provided the public focused on needs or opportunities for preventing illness and accidents. This paper presents a small selection of editorial cartoons that agitated in support of public health activities over 4 decades. The goals are to illustrate several concerns that rose to national prominence in that era, to examine the kinds of imagery that newspapers and magazine editors offered their readers, and to observe how frequently the public was encouraged to see politicians and commercial interests as responsible for preventable health problems. This discussion focuses exclusively on propagandistic images, leaving aside the reportorial depictions of events in the news and the neutral illustrations of methods and machines in scientific and technical publications. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 PMID:9366637

  20. SAREX 2007 Search Event Data Analysis

    DTIC Science & Technology

    2009-02-01

    Figure B-6: Target 5 - Floater - View A........................................................................................ 32 Figure B-7: Target 5... Floater - View B........................................................................................ 32 Figure B-8: Target 6 - Debris field...orange floating debris NO 5 (53°, 8.680’),(-60°, 29.270’) Floater (dummy with blue swim suit) NO 6 (53°, 4.170’),(-60°, 19.230’) Parts of plane NO 7

  1. High Bandwidth, Fine Resolution Deformable Mirror Design.

    DTIC Science & Technology

    1980-03-01

    Low Temperature Solders 68 B.6 Influence Function Parameters 68 APPENDIX C 19 Capacitance Measurement 69 ACCESSION for NTIS white Sectloo ODC Buff...Multilayer actuator: Dilatation versus applied electric field 10 Figure 3 - Multilayer actuator: Influence function 11 Figure 4 - Honeycomb device...bimorph 20 Figure 8 - Bimorph device: Influence function of a bimorph device which has a glass plate 0.20 cm thick 24 Figure 9 - Bimorph device

  2. The fine structure of intracranial neoplasms induced by the inoculation of avian sarcoma virus in neonatal and adult rats.

    PubMed Central

    Copeland, D. D.; Talley, F. A.; Bigner, D. D.

    1976-01-01

    Groups of F-344 rats were inoculated with the Bratislava-77 strain of avian sarcoma virus (B-77 ASV) within 24 hours of birth, at 9 days of age, or between 97 and 119 days of age. Intracranial tumors developed in each age group. Multiple tumors with mixed histologic patterns developed in rats inoculated at 1 or 9 days of age. Solitary tumors with a uniform histologic pattern developed in rats inoculated as adults. On the basis of light and electron microscopic study, the majority of tumors in each age group were classified as astrocytomas and divided into either poorly differentiated, gemistocytic, pilocytic, or polymorphic varieties. The polymorphic astrocytomas were most common among neonatally inoculated rats, while the pilocytic astrocytomas were most common among rats inoculated as adults. Ultrastructural characteristics of astrocytes, including gap junctions and 7- to 9-nm filaments, were present in the majority of tumors in each age groups. Astrocytomas induced in adult rats were remarkable for the presence of extensive basement membrane alone the astrocytic cell surfaces. Intracytoplasmic virus-like particles (R particles) were common in the tumor cells. These virus-like particles are morphologically distinct from C-type B-77 ASV, and no morphologic evidence of C-type virus replication was observed in any of the tumors. Images Figure 16 Figure 17 Figure 1 Figure 2 Figure 18 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 PMID:179328

  3. The avian respiratory system: a unique model for studies of respiratory toxicosis and for monitoring air quality.

    PubMed Central

    Brown, R E; Brain, J D; Wang, N

    1997-01-01

    There are many distinct differences (morphologic, physiologic, and mechanical) between the bird's lung-air-sac respiratory system and the mammalian bronchoalveolar lung. In this paper, we review the physiology of the avian respiratory system with attention to those mechanisms that may lead to significantly different results, relative to those in mammals, following exposure to toxic gases and airborne particulates. We suggest that these differences can be productively exploited to further our understanding of the basic mechanisms of inhalant toxicology (gases and particulates). The large mass-specific gas uptake by the avian respiratory system, at rest and especially during exercise, could be exploited as a sensitive monitor of air quality. Birds have much to offer in our understanding of respiratory toxicology, but that expectation can only be realized by investigating, in a wide variety of avian taxa, the pathophysiologic interactions of a broad range of inhaled toxicants on the bird's unique respiratory system. Images p188-a Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. A Figure 5. B Figure 5. C Figure 6. Figure 7. Figure 8. PMID:9105794

  4. Meteorological Instrumentation Support for an Adverse Weather Test Facility

    DTIC Science & Technology

    1991-05-01

    pressure sensor 12 8 Sling psychrometer 12 9 Relative humidity graph 13 10 Relative humidity graph 13 FIGURES (cont) Page 11 Cooled mirror dewpoint...80 -80 -50 -50 -32 .32 WET BULB DRY BULB Figure 8. Sling psychrometer 12 40 -. w 0 ARYBULAI TEMPERATURE Figure 1. Relative humidity graph 3013 L

  5. Open Component Portability Infrastructure (OPENCPI)

    DTIC Science & Technology

    2013-03-01

    8 Figure 2. C Function vs . OpenCL Kernel...10 Figure 3. OpenCL vs . OpenCPI Layering...difference between a simple C function and the analogous OpenCL kernel. Figure 2. C Function vs . OpenCL Kernel These existing example OpenCL

  6. Modeling the Thermosphere as a Driven-Dissipative Thermodynamic System

    DTIC Science & Technology

    2013-03-01

    8 Figure 2: Illustration of the geocentric solar magnetospheric coordinate system............15 Figure 3: Diagram of the...magnetic field in the z direction, Bz and the length of time Bz is in the negative z direction. The z direction is defined by Geocentric Solar...Magnetospheric (GSM) coordinates shown in Figure 2. Figure 2: Illustration of the geocentric solar magnetospheric (GSM) coordinate system. The origin is

  7. Towards a Low-Cost Quadrotor Research Platform

    DTIC Science & Technology

    2010-03-01

    FIGURES Figure 1. Quadrotor schematic showing rotor direction of rotation (From [2])................3 Figure 2. Toy quadrotor: Walkera UFO (from...Some examples are the Walkera UFO #5, Walkera UFO #8, Dragonfly, and Alien Air Jump Jet. Figure 2. Toy quadrotor: Walkera UFO (from Walkera...the X- UFO made by Silverlit Electronics used small mechanical gyros. These were relatively cheap due to low-cost labor, but suffered from mechanical

  8. Biofuels: An Alternative to U.S. Air Force Petroleum Fuel Dependency

    DTIC Science & Technology

    2007-12-01

    Ethanol Production 1999-2012 11 Figure 6. Reducing the Cost of Cellulosic Ethanol Production 12 Figure 7. Biodiesel Production Process ...14 Figure 8. Biodiesel Production Capacity, 1999 to 2005 15 Figure 9. Jet Fuel From Algae Process 17...the goal of this biofuels program is to develop an affordable biodiesel alternative production process that will achieve a 60 percent greater energy

  9. Northeast Artificial Intelligence Consortium Annual Report for 1987. Volume 7. Parallel, Structural, and Optimal Techniques in Vision

    DTIC Science & Technology

    1989-03-01

    Toys, is a model of the dinosaur Tyrannosaurus Rex . This particular test case is characterized by sharply discontinuous depths varying over a wide...are not shown in these figures). 7B-C-13 Figure 7: T. Rex Scene - Figure 8: T. Rex Scene - Left Image of Tinker Right Image Toy Object (j 1/’.) C...8217: Figure 9: T. Rex Scene - Figure 10: T. Rex Scene - Connected Contours Extracted Connected Contours Extracted from Left Image from Right Image 7B-C-14 400

  10. PubMed Central

    Robin, S.; Bonneau, N. H.; Breton, L.; Vandoren, P.

    1982-01-01

    Cubitus-curvus in a bitch This paper presents a case of cubitus-curvus seen in a five month old female crossbreed dog. There is a description of the clinical and radiological aspects of the case and the corrective surgery is also well described. Special attention was given to the normal anatomy and physiology of the growth plates and to the traumas that can affect these structures. Finally, there is an explanation of the pathogeny of the cubitus-curvus. In our case, the evolution was favorable and the healing of the condition was complete. ImagesFigures 1 et 2.Figures 3 et 4.Figures 5 et 6.Figures 7, 8 et 9.Figures 10 et 11.Figures 12 et 13. PMID:17422108

  11. Shape space figure-8 solution of three body problem with two equal masses

    NASA Astrophysics Data System (ADS)

    Yu, Guowei

    2017-06-01

    In a preprint by Montgomery (https://people.ucsc.edu/~rmont/Nbdy.html), the author attempted to prove the existence of a shape space figure-8 solution of the Newtonian three body problem with two equal masses (it looks like a figure 8 in the shape space, which is different from the famous figure-8 solution with three equal masses (Chenciner and Montgomery 2000 Ann. Math. 152 881-901)). Unfortunately there is an error in the proof and the problem is still open. Consider the α-homogeneous Newton-type potential, 1/rα, using action minimization method, we prove the existence of this solution, for α \\in (1, 2) ; for α=1 (the Newtonian potential), an extra condition is required, which unfortunately seems hard to verify at this moment.

  12. Effects of sulfite on the uptake and binding of benzo[a]pyrene diol epoxide in cultured murine respiratory epithelial cells.

    PubMed Central

    Green, J L; Jones, B C; Reed, G A

    1994-01-01

    Sulfur dioxide (SO2) may act as a cocarcinogen with benzo[a]pyrene (BaP) in the respiratory tract. We have modeled this effect by examining the interactions of 7r,8t-dihydroxy-9t,10t-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (anti-BPDE) with sulfite, the physiological form of SO2, in a murine respiratory epithelial cell line (C10). We exposed C10 cells to [3H]-anti-BPDE and determined the effects of 1 and 10 mM sulfite on the uptake and subcellular localization of labeled products. Autoradiographic analysis showed that sulfite doubled the nuclear localization of anti-BPDE-derived materials after a 4-hr incubation period. The net nuclear localization of anti-BPDE-derived materials was not affected by sulfite during the first 60 min, but nuclear localization continued to increase in the sulfite-containing incubations throughout the 4-hr incubation period. Little increase in nuclear localization of anti-BPDE-derived material was noted in the incubations without sulfite after 60 min. Subcellular fractionation was performed to determine the amount of label associated with cytosolic and nuclear fractions and to determine covalent binding to protein and DNA. Sulfite produced a modest increase in the amount of [3H]-anti-BPDE-derived products bound to protein; however, binding to nuclear DNA increased by more than 200% with 10 mM sulfite. Analysis of the supernatants from the cytosolic and nuclear fractions of cells exposed to anti-BPDE and sulfite demonstrated the presence of 7r,8t,9t-trihydroxy-7,8,9,10-tetrahydrobenzo[a]pyrene-10c-su lfonate (BPT-10-sulfonate). [3H]-BPT-10-sulfonate was unable to enter C10 cells, suggesting that it is formed intracellularly.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 1. Figure 2. Figure 3. Figure 3. Figure 3. Figure 3. Figure 3. Figure 3. Figure 4. PMID:8033853

  13. Scar remodeling after strabismus surgery.

    PubMed Central

    Ludwig, I H

    1999-01-01

    PURPOSE: Patients with overcorrected strabismus (and several patients with undercorrection after extraocular muscle resection) underwent exploration of previously operated muscles, with the intention of advancing their tendons to prevent the need for surgery on additional muscles. Unexpectedly, it was found that, in many cases, an elongated scar segment of variable length was interposed between the muscle and its insertion site on the sclera. Laboratory investigations were carried out to elucidate the underlying mechanism(s) and to create an animal model of the disorder. METHODS: Lengthened scars were repaired on 198 muscles during 134 procedures performed on 123 patients. The scars consisted of amorphous connective tissue interposed between the globe and normal tendon. Repair was accomplished by excision of the scar and reattachment of the muscle to sclera, using absorbable sutures in 64 cases and nonabsorbable sutures in 70 cases. Histopathologic examination was performed on 82 clinical specimens, and tissue culture studies were performed on 7 specimens. To develop an animal model, 10 New Zealand white rabbits underwent bilateral superior rectus resection. Half of the eyes received sub-Tenon's injections of collagenase over the operative site during weeks 2, 3, 5, and 6 postoperatively; the other half received saline solution injections on the same schedule. At 10 weeks, half the sites were studied histologically, and the other half underwent collagen creep analysis. In a second study, the use of absorbable versus nonabsorbable sutures was compared in the rabbit model. RESULTS: In the clinical cases, the mean length of the elongated scar segments was 4.2 mm. A total of 105 of the 134 repair procedures were judged successful. Thirty-one procedures resulted in recurrence of the original overcorrection; 7 of these had documented restretches. Factors that distinguished patients with stretched scars from patients with classic slipped muscles included minimal or no limitation of versions, less separation of the tendons from sclera, and thicker appearance of the scar segments. The use of nonabsorbable sutures in the repair procedure reduced the recurrence rate. Histologic examination of the clinical stretched scar specimens showed dense connective tissue that was less well organized compared with normal tendon. In the tissue culture studies, cells cultured from the stretched scar specimens grew rapidly and were irregularly shaped. A high-molecular-weight protein was identified in the culture medium. By contrast, cells cultured from normal tendon (controls) grew more slowly and regularly, stopped growing at 4 days, and produced less total protein than cultured stretched scar specimens. In the animal model studies, the collagenase-treated sites showed elongated scars with increased collagen between the muscle and the sclera, as well as increased collagen creep rates, compared with the saline-treated controls. The use of nonabsorbable sutures in collagenase-treated animal model surgery sites was associated with shorter, thicker scars compared with similar sites sutured with absorbable sutures. CONCLUSIONS: A lengthened or stretched, remodeled scar between an operated muscle tendon and sclera is a common occurrence and is a factor contributing to the variability of outcome after strabismus repair, even years later. This abnormality may be revealed by careful exploration of previously operated muscles. Definitive repair requires firm reattachment of tendon to sclera with nonabsorbable suture support. Images FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20 FIGURE 21 FIGURE 22 FIGURE 23 FIGURE 24 FIGURE 25 FIGURE 26 FIGURE 27 FIGURE 28 FIGURE 29 FIGURE 30 FIGURE 31 FIGURE 32 FIGURE 33 FIGURE 34 FIGURE 35 FIGURE 36 FIGURE 37 FIGURE 38 FIGURE 39 FIGURE 40 FIGURE 41 FIGURE 42 FIGURE 43 FIGURE 44 FIGURE 45 FIGURE 46 FIGURE 52 FIGURE 53 FIGURE 54 FIGURE 55 FIGURE 58 FIGURE 59 FIGURE 60 FIGURE 61 FIGURE 62 FIGURE 63 FIGURE 64 PMID:10703142

  14. Proliferative and morphologic changes in rat colon following bypass surgery.

    PubMed Central

    Barkla, D. H.; Tutton, P. J.

    1985-01-01

    In this study the proliferative and morphologic changes that occur in the colon of normal and dimethylhydrazine-treated rats following surgical bypass of the middle third of the colon are reported. Proliferative changes were measured by estimating accumulated mitotic indexes following vinblastine treatment and morphologic changes were observed with the use of light microscopy and scanning electron microscopy. Data were collected on Days 0, 7, 14, 30, and 72 after surgery. The results show that surgical bypass produces contrasting effects in the segments proximal to and distal to the suture line. In the proximal segment there was morphologic evidence of hyperplasia, although proliferative activity was unchanged except for an increase at 7 days in normal rats. In the distal segment there was a long-lived increase in the mitotic index, although morphologic changes were not seen. The results for DMH-treated rats were similar to those in normal rats. Groups of isolated dysplastic epithelial cells were often seen in the submucosa adjacent to sutures up to 72 days after surgery. Increased lymphoid infiltration was seen in segments proximal to but not distal to the suture line. It is hypothesized that the different responses of the proximal and distal segments may be related to the different embryologic origins of those segments. It is also hypothesized that the seeding of the submucosa with epithelial cells during suturing may be a factor in tumor recurrence. Images Figure 19 Figure 20 Figure 21 Figure 22 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 Figure 18 PMID:4014432

  15. 16 CFR Figures 2 and 3 to Part 1512 - Handlebar Stem Loading and Entrance 8 Observation Angles

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Handlebar Stem Loading and Entrance 8 Observation Angles 2 Figures 2 and 3 to Part 1512 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL HAZARDOUS SUBSTANCES ACT REGULATIONS REQUIREMENTS FOR BICYCLES Pt. 1512, Figs. 2 and 3 Figures 2...

  16. 16 CFR Figures 2 and 3 to Part 1512 - Handlebar Stem Loading and Entrance 8 Observation Angles

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 2 2011-01-01 2011-01-01 false Handlebar Stem Loading and Entrance 8 Observation Angles 2 Figures 2 and 3 to Part 1512 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL HAZARDOUS SUBSTANCES ACT REGULATIONS REQUIREMENTS FOR BICYCLES Pt. 1512, Figs. 2 and 3 Figures 2...

  17. Myocardial changes in acute Trypanosoma cruzi infection. Ultrastructural evidence of immune damage and the role of microangiopathy.

    PubMed Central

    Andrade, Z. A.; Andrade, S. G.; Correa, R.; Sadigursky, M.; Ferrans, V. J.

    1994-01-01

    Histological and ultrastructural studies of the hearts of dogs sacrificed 18 to 26 days after intraperitoneal inoculation with 4 x 10(5) blood forms of the 12 SF strain of Trypanosoma cruzi/kg of body weight disclosed myocarditis characterized by parasitic invasion of some myocytes, damage and necrosis of nonparasitized myocytes, and interstitial infiltration by mononuclear cells. Nonparasitized myocytes showed alterations ranging from mild edema to severe myocytolysis. These changes often were accompanied by contacts of myocytes with lymphocytes (both granular and agranular) and macrophages. These contacts were characterized by focal loss of the myocyte basement membrane and close approximation of the plasma membranes of the two cells. Contacts between lymphocytes and capillary endothelial cells were also frequent. Platelet aggregates and fibrin microthrombi were observed in some capillaries. Our findings suggest that immune effector cells play a major role in the pathogenesis of the myocyte damage and the microangiopathy in acute Chagas' disease. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 PMID:8203476

  18. Microwave energy fixation for electron microscopy.

    PubMed Central

    Login, G. R.; Dvorak, A. M.

    1985-01-01

    We have demonstrated that microwave energy (MW) can be used in conjunction with chemical cross-linking agents in order to rapidly fix cell suspensions and tissue blocks for electron microscopy in 7-9 seconds. The optimal MW fixation method involved immersing tissues up to 1 cu cm in dilute aldehyde fixation and immediately irradiating the specimens in a conventional microwave oven for 9 seconds to 50 C. Ultrastructural preservation of samples irradiated by MW energy was comparable to that of the control samples immersed in aldehyde fixative for 2 hours at 25 C. Stereologic analysis showed that tissue blocks fixed by the MW fixation method did not cause organelles such as liver mitochondria and salivary gland granules to shrink or to swell. Potential applications for this new fixation technology include the investigation of rapid intracellular processes (eg, vesicular transport) and preservation of proteins that are difficult to demonstrate with routine fixation methods (eg, antigens and enzymes). Images Figure 4 Figure 5 Figure 2 Figure 3 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 PMID:3927740

  19. Arctic Region Policy: Information Sharing Model Options

    DTIC Science & Technology

    2010-09-01

    8 Figure 5. 2004 Arctic Maritime Activity (From Treadwell, 2009, p. 48) .............. 10 Figure 6. Explorer Stuck in the Antarctic (From New...been a Titanic situation, such as what happened to the cruise ship EXPLORER in the Antarctic in November 2007 as shown in Figure 6 (Browley & 11...without detection. Figure 6. Explorer Stuck in the Antarctic (From New York Times, 2007) The EXPLORER story and different scenarios presented

  20. Special Technology Area Review on Micro-Opto-Electro-Mechanical-Systems (MOEMS)

    DTIC Science & Technology

    1997-12-01

    Optical Interference in Night Vision Systems "* DMD Assisted Intelligent Manufacturing of ................................................... SRI...CONCEPT ......................................... p. 8 FIGURE 3(a): DMD LIGHT SWITCHES...p. 9 FIGURE 3(b): SEM PHOTOMICROGRAPHS OF DMD CHIPS ........................................ p. 9 FIGURE 4: MULTI-USER MEMS PROJECTS (MUMPS

  1. Network Monitoring for Web-Based Threats

    DTIC Science & Technology

    2011-02-01

    string to access files or folders that were not intended (see Figure 4-1). http://example.com/getUserProfile.jsp?item=../../../../etc/ passwd Figure...applied to vulnerable fields within a cookie (see Figure 4-2). Cookie: USER=1826cc8f:PSTYLE=../../../../etc/ passwd Figure 4-2: Path Traversal...further privileges. − For example, http://host/cgi- bin/lame.cgi?file=../../../../etc/ passwd • %00 requests − This is the hexadecimal value of a

  2. Sequential recognition of the pre-mRNA branch point by U2AF65 and a novel spliceosome-associated 28-kDa protein.

    PubMed Central

    Gaur, R K; Valcárcel, J; Green, M R

    1995-01-01

    Splicing of pre-mRNAs occurs via a lariat intermediate in which an intronic adenosine, embedded within a branch point sequence, forms a 2',5'-phosphodiester bond (RNA branch) with the 5' end of the intron. How the branch point is recognized and activated remains largely unknown. Using site-specific photochemical cross-linking, we have identified two proteins that specifically interact with the branch point during the splicing reaction. U2AF65, an essential splicing factor that binds to the adjacent polypyrimidine tract, crosslinks to the branch point at the earliest stage of spliceosome formation in an ATP-independent manner. A novel 28-kDa protein, which is a constituent of the mature spliceosome, contacts the branch point after the first catalytic step. Our results indicate that the branch point is sequentially recognized by distinct splicing factors in the course of the splicing reaction. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 PMID:7493318

  3. Trauma on the Isle of Man.

    PubMed Central

    Hackney, R G; Varley, G; Stevens, D; Green, A

    1993-01-01

    The Isle of Man Tourist Trophy motorcycle races remain one of the most popular venues for motorcycle races. This is despite the reduced status of the event. The reason for the loss of world championship and formula one status is the nature of the road racing circuit itself. The twisting narrow roads are only closed to the public at certain times during the practice and race weeks. Motorcycling visitors to the event attempt to emulate their heroes on machines capable of high speeds. Casualties from both visitors and racers are dealt with efficiently by an expanded medical service. This includes the use of an aeromedical evacuation helicopter. Casualties from the visitors exceeded those from the racers themselves during the period reported. Images Figure 1 Figure 2 Figure 4 Figure 3 Figure 5 Figure 6 Figure 7 Figure 8 PMID:8457818

  4. Voltammetry and Coulometry with Immersed Thin Layer Electrodes. Part 2. Practical Considerations and Experimental Results.

    DTIC Science & Technology

    1984-11-28

    indicated by Popov and Geske (8), are: 31 - 2e- 13 and 213 - 2e : 312 [2) N Figure 8 is a plot of the charge required for complete conversion of the -I...and D.H. Geske , J. Amer. Chem. Soc. 80, 1340 (1958). 9. F.C. Anson, Anal. Chem. 38, 54 (1966). -4.. ; ’ : /) /" ’O"- ’,, FIGURE LEGENDS Figure 1

  5. Accumulated body burden and endogenous release of lead in employees of a lead smelter.

    PubMed Central

    Fleming, D E; Boulay, D; Richard, N S; Robin, J P; Gordon, C L; Webber, C E; Chettle, D R

    1997-01-01

    Bone lead levels for 367 active and 14 retired lead smelter workers were measured in vivo by X-ray fluorescence in May-June 1994. The bone sites of study were the tibia and calcaneus; magnitudes of concentration were used to gauge lead body burden. Whole blood lead readings from the workers generated a cumulative blood lead index (CBLI) that approximated the level of lead exposure over time. Blood lead values for 204 of the 381 workers were gathered from workers returning from a 10-month work interruption that ended in 1991; their blood level values were compared to their tibia and calcaneus lead levels. The resulting relations allowed constraints to be placed on the endogenous release of lead from bone in smelter works. Calcaneus lead levels were found to correlate strongly with those for tibia lead, and in a manner consistent with observations from other lead industry workers. Relations between bone lead concentration and CBLI demonstrated a distinctly nonlinear appearance. When the active population was divided by date of hire, a significant difference in the bone lead-CBLI slope emerged. After a correction to include the component of CBLI existing before the workers' employment at the smelter was made, this difference persisted. This implies that the transfer of lead from blood to bone in the workers has changed over time, possibly as a consequence of varying exposure conditions. Images Figure 1. A Figure 1. B Figure 2. A Figure 2. B Figure 3. A Figure 3. B Figure 4. A Figure 4. B Figure 5. Figure 6. A Figure 6. B Figure 7. Figure 8. Figure 9. A Figure 9. B PMID:9105798

  6. Tumor vascularity and hematogenous metastasis in experimental murine intraocular melanoma.

    PubMed Central

    Grossniklaus, H E

    1998-01-01

    PURPOSE: The purpose of this study is to test the hypothesis that primary tumor vascularity in a murine model of intraocular melanoma positively correlates with the development and hematogenous spread of metastasis. METHODS: Forty 12-week-old C57BL6 mice were inoculated in either the anterior chamber (AC) or posterior compartment (PC) of 1 eye with 5 x 10(5) cells/microL of Queens tissue culture melanoma cells. The inoculated eye was enucleated at 2 weeks; the mice were sacrificed at 4 weeks postinoculation, and necropsies were performed. The enucleated eyes were examined for histologic and ultrastructural features, including relationship of tumor cells to tumor vascular channels, vascular pattern, and mean vascular density. RESULTS: Melanoma grew and was confined to the eye in 12 of 20 AC eyes and 10 of 20 PC eyes. Histologic and electron microscopic examination showed tumor invasion into vascular channels. Five of 12 AC tumors (42%) and 8 of 10 PC tumors (80%) metastasized. All of the AC tumors, but none of the PC tumors, that distantly metastasized also metastasized to ipsilateral cervical lymph nodes (P = .00535). There was no statistically significant difference of vascular pattern between the melanomas that did and did not metastasize to lungs in the PC group (P = .24), although there was a significant difference in the AC group (P = .02). Tumors with high-grade vascular patterns were more likely to metastasize than tumors with low-grade vascular patterns in the AC group. The mean vascular density positively correlated with the presence and number of metastases in both groups (P = .0000 and P < .001, respectively). There was no statistically significant difference of vascular pattern and mean vascular density for AC versus PC melanoma (P = .97). CONCLUSIONS: The rate of metastasis in this murine intraocular melanoma model positively correlates with primary tumor vascularity. The melanoma metastasizes via invasion of tumor vascular channels. AC melanoma also metastasizes through regional lymphatics. Images FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 PMID:10360307

  7. Expression of interleukin-8 gene in inflammatory bowel disease is related to the histological grade of active inflammation.

    PubMed Central

    Mazzucchelli, L.; Hauser, C.; Zgraggen, K.; Wagner, H.; Hess, M.; Laissue, J. A.; Mueller, C.

    1994-01-01

    Interleukin-8 (IL-8) is a potent cytokine for recruitment and activation of neutrophils. To visualize its distribution in the intestinal mucosa and to understand better its possible role in the induction and promotion of inflammatory bowel disease, expression of the IL-8 gene was analyzed in resected bowel segments of 14 patients with active Crohn's disease or ulcerative colitis. In situ hybridization with IL-8 anti-sense RNA probes revealed strong and specific signals in the histologically affected mucosa. The number of cells expressing IL-8 gene correlated with the histological grade of active inflammation. In accordance with the characteristic histological signs of active disease, IL-8-expressing cells were diffusely distributed over the entire affected mucosa in patients with ulcerative colitis, whereas in patients with Crohn's disease, IL-8-expressing cells showed a focal distribution pattern. Cells expressing IL-8 were mainly located at the base of ulcers, in inflammatory exudates on mucosal surfaces, in crypt abscesses, and at the border of fistulae. Analysis of semi-serial sections pointed to macrophages, neutrophils, and epithelial cells as possible sources of this cytokine in active inflammatory bowel disease. We consistently failed to detect IL-8 messenger RNA in the mucosa of uninvolved bowel segments and in normal-appearing control mucosa of patients with colon cancer. In contrast, tissue specimens from two patients with acute appendicitis displayed IL-8-expressing cells in the mucosa. These results support the notion that IL-8 plays and important but nonspecific role in the pathogenesis of inflammatory bowel disease and that the production of IL-8 messenger RNA is restricted to areas with histological signs of inflammatory activity and mucosal destruction. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8178948

  8. Physiological and toxicological aspects of smoke produced during the combustion of polymeric materials.

    PubMed Central

    Einhorn, I N

    1975-01-01

    Normally one expects that flame contact is the major cause of injury and death during fires. Analysis of the factors involved in numerous fires has revealed that most deaths were not due to flame contact, but were a consequence of the production of carbon monoxide, nitrogen oxides, and other combustion products, such as aldehydes, low molecular weight alcohols, hydrogen cyanide, and other noxious species. The major emphasis within the scope of this paper relates to the physiological and toxicological aspects of smoke produced during the combustion of materials. Special emphasis is directed toward laboratory procedures which have been developed to determine the qualitative and quantitative analysis of smoke, factors pertaining to smoke development, and to measure the response of laboratory animals exposed to smoke. The effects that fire retardants, incorporated into polymeric materials as a means of improving flammability characteristics, may have on smoke development, the mechanism of polymer degradation, and on the survival response of laboratory animals are also considered. Images FIGURE 1. FIGURE 2. FIGURE 3. FIGURE 4. FIGURE 5. FIGURE 6. FIGURE 7. FIGURE 8. FIGURE 9. PMID:170077

  9. Structural Studies on Varicella Zoster Virus

    DTIC Science & Technology

    1990-08-20

    TABLE OF CONTENTS INTRODUCTION 1 The VZV Genome , 8 VZV Proteins 12 VZV Transcription 14 The Structure of HSV 15 Herpesvirus Expression 16...VZV virion . . . 4 Figure 2. A drawing of the VZV nucleocapsid 6 Figure 3. A comparison of the structure of the genomes of HSV - 1 and VZV 9 Figure 4...VZV, and purified VZ virions probed with antibody against VZV IE62 (the HSV - 1 ICP4 equivalent) . . . 154 xii Figure 48. Autoradiograph of VZV IE62

  10. VizioMetrics: Mining the Scientific Visual Literature

    ERIC Educational Resources Information Center

    Lee, Po-Shen

    2017-01-01

    Scientific results are communicated visually in the literature through diagrams, visualizations, and photographs. In this thesis, we developed a figure processing pipeline to classify more than 8 million figures from PubMed Central into different figure types and study the resulting patterns of visual information as they relate to scholarly…

  11. Conceptual Study of LSTAT Integration to Robotics and Other Advanced Medical Technologies

    DTIC Science & Technology

    2004-07-31

    Robotic Manipulators............................................................................... 37 3.2.4 Digital X -ray...11 Figure 7 OEC 9800 digital x -ray system (GE Healthcare) ....................................................... 21 Figure 8 portable...digital x -ray equipment (Varian, Inc.) ........................................................... 22 Figure 9 Portable ultrasound units

  12. Shape Recognition Inputs to Figure-Ground Organization in Three-Dimensional Displays.

    ERIC Educational Resources Information Center

    Peterson, Mary A.; Gibson, Bradley S.

    1993-01-01

    Three experiments with 29 college students and 8 members of a university community demonstrate that shape recognition processes influence perceived figure-ground relationships in 3-dimensional displays when the edge between 2 potential figural regions is both a luminance contrast edge and a disparity edge. Implications for shape recognition and…

  13. Integrating UAS Flocking Operations with Formation Drag Reduction

    DTIC Science & Technology

    2014-03-01

    20   Figure 8: Close vs . Extended Formation Flight (FF) Comparison (Ning 2011, 12)......... 24   Figure 9: Basic Guidance Control...and Near Misses vs . Flock Size... vs . Longitudinal Spacing............................ 52   Figure 21: Flock Cumulative Fuel Savings vs . Distance Between Turns

  14. Cardiac damage induced by 2-amino-3-methyl-imidazo[4,5-f]quinoline in nonhuman primates.

    PubMed Central

    Thorgeirsson, U P; Farb, A; Virmani, R; Adamson, R H

    1994-01-01

    The heterocyclic aromatic amine 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) is a potent hepatocarcinogen in cynomolgus and rhesus monkeys. The finding of high cardiac IQ-DNA adduct levels prompted a histopathological study of perfusion-fixed hearts from 10 tumor-bearing monkeys chronically dosed with IQ at 10 mg/kg or 20 mg/kg 5 days per week for 48-80 months. Two monkeys dosed only with the vehicle for IQ, hydroxypropylcellulose, served as controls. All the monkeys had normal heart weights, and no abnormalities were observed upon gross inspection of the hearts. Microscopically, focal myocardial lesions were observed in 8 of 10 monkeys dosed with IQ. Light microscopic abnormalities included myocyte necrosis with or without chronic inflammatory infiltrates, interstitial fibrosis with myocyte hypertrophy or atrophy, and vasculitis. Electron microscopic findings included disruption of the mitochondrial architecture (i.e., mitochondrial swelling and clearing of matrix densities), myofibrillar loss, disorganization of the normal alignment of sarcomeres, and occasional myocytes showing nuclear hypertrophy or peripheral clumping of the nuclear chromatin. There was some correlation between the cumulative dose of IQ and the extent of the myocardial abnormalities. These findings suggest that chronic exposure to IQ can lead to myocardial damage in monkeys. Although focal and not associated with clinical evidence of heart failure, these abnormalities may represent the initial stages of IQ-induced toxic cardiomyopathy. Images Figure 1. A Figure 1. B Figure 1. C Figure 1. D Figure 2. A Figure 2. B Figure 3. A Figure 3. B Figure 3. C Figure 3. D Figure 4. A Figure 4. B Figure 5. A Figure 5. B PMID:8033851

  15. Bioassay of complex mixtures derived from fossil fuels.

    PubMed Central

    Bingham, E; Barkley, W

    1979-01-01

    The conversion or processing of shale, coal, or petroleum involves elevated temperatures and altered pressures, and under these conditions polynuclear aromatic hydrocarbons are likely to form. Certain compounds of this type exhibit carcinogenic activity for a variety of organ sites in experimental animals and epidemiological evidence strongly implicates their role as carcinogens in man. It is then not unexpected that many liquid fractions derived from shale and coal are carcinogenic when subjected to bioassay. Benzo(a)pyrene, [B(a)P], is frequently considered to be an indicator substance. It is clear that when a small quantity of B(a)P is present in a fraction, the fraction will exhibit carcinogenic activity in a bioassay (mouse skin). However, it does not follow that the lack of detectable B(a)P insures that the fraction will be noncarcinogenic. Several fractions have been analyzed for their content of B(a)P and then subjected to bioassay. A method for testing complex mixtures for their carcinogenic potential is described. The carcinogenic potency of these fractions are compared to petroleum fractions. Images FIGURE 1. FIGURE 2. FIGURE 3. FIGURE 4. FIGURE 5. FIGURE 6. FIGURE 7. FIGURE 8. FIGURE 9. PMID:446446

  16. Multisensor Modeling Underwater with Uncertain Information

    DTIC Science & Technology

    1988-09-01

    the Clipperton Zone. The data used for stochastic modeling were supplied by NECOR at the University of Rhode Island . by courtesy of Dr. Dave Gallo of...artifacts ............................. 133 Figure 6.5: Sea MARC I intensity map of Clipperton area ............... .136 Figure 6.6: Sea MARC I intensity...map of Clipperton area (from Kastens et ,11.). .. 137 Figure 6.7: Sea Beam contour map of Clipperton area .................. .138 Figure 6.8: Sea Beam

  17. Elucidation of the Molecular Mechanisms Underlying Lymph Node Metastasis in Prostate Cancer

    DTIC Science & Technology

    2005-10-01

    overexpressed (Figure 8B). This result is significant for two reasons. First, it provides a mechanistic explanation for how FOXO-1, activated by SIRT1 ...transcription (Figure 4c). This result was confirmed when we used the dominant-negative form of SIRT1 to inhibit its activity (Figure 4d). SIRT-1DN protein... activated by SIRT1 , can act to Figure 3 (a) Androgen increases the IGF-IR protein level in LNCaP. LNCaP cells were grown in the charcoal–dextran

  18. Serial nonenhancing magnetic resonance imaging scans of high grade glioblastoma multiforme.

    PubMed Central

    Moore-Stovall, J.; Venkatesh, R.

    1993-01-01

    Magnetic resonance imaging (MRI) from clinical experience has proven to be superior to all other diagnostic imaging modalities, including computed tomography (CT) in the detection of intracranial neoplasms. Although glioblastoma multiforme presents a challenge for all diagnostic imaging modalities including MRI, MRI is paramount to CT in detecting subtle abnormal water accumulation in brain tissue caused by tumor even before there is disruption of the blood brain barrier. Currently, clinical research and investigational trials on nonionic gadolinium contrast agents have proven that nonionic gadolinium HP-DO3A (ProHance) contrast agents have lower osmolality and greater stability, which make them superior compounds to gadolinium diethylenetriamine-pentacetic acid (Gd-DTPA). Therefore, the nonionic gadolinium contrasts have been safely administered more rapidly, in higher or multiple doses for contrast enhanced MRI without adverse side effects or changes in serum iron or total bilirubin, and the intensity of the area of enhancement and number of lesions detected were superior to that of Gd-DTPA (Magnevist) at the standard dose (0.1 mmol/Kg). Perhaps if the nonionic gadolinium contrast agent, ProHance, had been approved by the Food and Drug Administration (FDA) when this MRI was performed in 1990 it would have aided in providing contrast enhancement and visualization of the tumor lesion to assist in patient diagnosis and management. Magnetic resonance imaging also provides unique multiplanar capabilities that allow for optimal visualization of the temporal and occipital lobes of the brain without bone interference.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9A Figure 9B Figure 10 Figure 11 Figure 12 Figure 13 PMID:8382751

  19. Propagation of normal human epithelial cell populations using an in vivo culture system. Description and applications.

    PubMed Central

    Klein-Szanto, A. J.; Terzaghi, M.; Mirkin, L. D.; Martin, D.; Shiba, M.

    1982-01-01

    A new model using xenotransplanted human epithelia was developed for the study of toxic and carcinogenic effects of chemicals. Epithelial cells from the respiratory tract of 4 male and 3 female premature and fullterm fetuses were enzymatically removed and inoculated into deepithelialized rat tracheas. These were sealed at both ends and transplanted subcutaneously into nude mice. After 3-4 weeks, a normal mucociliary epithelium covered the tracheal lumen. At this stage the epithelial cells could be isolated again and transplanted into new denuded rat tracheas. This passaging could be repeated up to six times, each permitting an amplification factor of approximately 3. Tracheal transplants containing cells of human origin (in vivo Passages 2-4) were treated with 7,12-dimethylbenz(a)anthracene. Hyperplasias, squamous metaplasias, and dysplasias were seen 1-8 weeks after initiation of treatment, indicating that the responses of human and rodent epithelial cells to polycyclic aromatic hydrocarbons are similar. Initial experiments with skin and esophageal epithelia suggest that other covering epithelia could also be used in this fashion for evaluation of toxicants and carcinogens that are likely to come into contact with these tissues. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:6821529

  20. Congenital Dislocation of the Hip

    PubMed Central

    Specht, Elmer E.

    1976-01-01

    Congenital dislocation or subluxation of the hip (congenital acetabular dysplasia) is a complete or partial displacement of the femoral head out of the acetabulum. The physical signs essential for diagnosis are age related. In newborns the tests for instability are the most sensitive. After the neonatal period, and until the age of walking, tightness of the adductor muscles is the most reliable sign. Early diagnosis is vital for successful treatment of this partially genetically determined condition. Various therapeutic measures, ranging from abduction splinting to open reduction and osteotomy, may be required. Following diagnosis in the first month of life, the average treatment time in one recent series was only 2.3 months from initiation of therapy to attainment of a normal hip. When the diagnosis was not made until 3 to 6 months of age, ten months of treatment was required to achieve the same outcome. When the diagnosis is not made, or the treatment is not begun until after the age of 6, a normal hip will probably not develop in any patient. ImagesFigure 1.Figure 2.Figure 3.Figure 4.Figure 5.Figure 6.Figure 7.Figure 8.Figure 9. PMID:1251603

  1. Collateral Damage to Satellites from an EMP Attack

    DTIC Science & Technology

    2010-08-01

    peak dose is computed in an infinite half plane of silicon. The resulting in- plane stresses in silicon are shown in Figure VI.23. In- plane refers to...achieved by the SLAR coating 81 Figure VIII.6. Ratio of the peak in- plane compressive stress to the maximum compressive stress for the SLAR coating...82 Figure VIII.7. Maximum in- plane compressive stress in a SLAR coating on DMSP/NOAA subjected to the threat events 83 Figure VIII.8. Maximum in

  2. Data Embedding for Covert Communications, Digital Watermarking, and Information Augmentation

    DTIC Science & Technology

    2000-03-01

    proposed an image authentication algorithm based on the fragility of messages embedded in digital images using LSB encoding. In [Walt95], he proposes...Invertibility 2/ 3 SAMPLE DATA EMBEDDING TECHNIQUES 23 3.1 SPATIAL TECHNIQUES 23 LSB Encoding in Intensity Images 23 Data embedding...ATTACK 21 FIGURE 6. EFFECTS OF LSB ENCODING 25 FIGURE 7. ALGORITHM FOR EZSTEGO 28 FIGURE 8. DATA EMBEDDING IN THE FREQUENCY DOMAIN 30 FIGURE 9

  3. Brake Fluid Compatibility with Hardware

    DTIC Science & Technology

    2014-05-19

    association or emblem usage considerations. All other legal considerations are the responsibility of the author and his/her/their employer(s...10 Figure 8. Backscatter SEM Image showing Elemental Analysis Scan Locations ....................... 11 Figure 9. Surface Scan jfs9176...Elemental Analysis .................................................................... 12 Figure 10. Particle Scan jfs9177 Elemental Analysis

  4. 1995 Michigan traffic crash facts

    DOT National Transportation Integrated Search

    1996-05-01

    The 1995 traffic fatality count was 1,537, up 8.3 percent from the 1994 figure of 1,419. : Compared with 1994, injuries were up 2.9 percent and total crashes were up 5.8 percent. : These figures translated into a death rate of 1.8 per 100 million mil...

  5. Acquisition Guide for Interactive Electronic Technical Manuals

    DTIC Science & Technology

    2000-04-01

    6.1 ASCII Editors A𔄂 A.6.2 ADEPT*Editor.... Aŝ A.6.3 FrameMaker +SGML (FM+SGML) A൒ A.6.4 IADS A_n A.7 Developing and Editing...Interface A-9 Figure A-6. FrameMaker +SGML Authoring Environment A-l 1 Figure A-7. IADS Reader Aൔ Figure A-8. TechSight Viewer A_13 Figure A-9...errors should be corrected before importing an SGML-tagged file into ADEPT. A.6.3 FrameMaker +SGML (FM+SGML) FM+SGML is an Adobe System product and

  6. Pharmacological manipulation of GABA activity in nucleus subpretectalis/interstitio-pretecto-subpretectalis (SP/IPS) impairs figure-ground discrimination in pigeons: Running head: SP/IPS in figure-ground segregation.

    PubMed

    Acerbo, Martin J; Lazareva, Olga F

    2018-05-15

    Figure-ground segregation is a fundamental visual ability that allows an organism to separate an object from its background. Our earlier research has shown that nucleus rotundus (Rt), a thalamic nucleus processing visual information in pigeons, together with its inhibitory complex, nucleus subpretectalis/interstitio-pretecto-subpretectalis (SP/IPS), are critically involved in figure-ground discrimination (Acerbo et al., 2012; Scully et al., 2014). Here, we further investigated the role of SP/IPS by conducting bilateral microinjections of GABAergic receptor antagonist and agonists (bicuculline and muscimol, respectively) and non-NMDA glutamate receptor antagonist (CNQX) after the pigeons mastered figure-ground discrimination task. We used two doses of each drug (bicuculline: 0.1 mM and 0.05 mM; muscimol: 4.4 mM and 8.8 mM; CNQX: 2.15 mM and 4.6 mM) in a within-subject design, and alternated drug injections with baseline (ACSF). The order of injections was randomized across birds to reduce potential carryover effects. We found that a low dose of bicuculline produced a decrement on figure trials but not on background trials, whereas a high dose impaired performance on background trials but not on figure trials. Muscimol produced an equivalent, dose-dependent impairment on both types of trials. Finally, CNQX had no consistent effect at either dose. Together, these results further confirm our earlier hypothesis that inhibitory projections from SP to Rt modulate figure-ground discrimination, and suggest that the Rt and the SP/IPS provide a plausible substrate that could perform figure-ground segregation in avian brain. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Figure Text Extraction in Biomedical Literature

    PubMed Central

    Kim, Daehyun; Yu, Hong

    2011-01-01

    Background Figures are ubiquitous in biomedical full-text articles, and they represent important biomedical knowledge. However, the sheer volume of biomedical publications has made it necessary to develop computational approaches for accessing figures. Therefore, we are developing the Biomedical Figure Search engine (http://figuresearch.askHERMES.org) to allow bioscientists to access figures efficiently. Since text frequently appears in figures, automatically extracting such text may assist the task of mining information from figures. Little research, however, has been conducted exploring text extraction from biomedical figures. Methodology We first evaluated an off-the-shelf Optical Character Recognition (OCR) tool on its ability to extract text from figures appearing in biomedical full-text articles. We then developed a Figure Text Extraction Tool (FigTExT) to improve the performance of the OCR tool for figure text extraction through the use of three innovative components: image preprocessing, character recognition, and text correction. We first developed image preprocessing to enhance image quality and to improve text localization. Then we adapted the off-the-shelf OCR tool on the improved text localization for character recognition. Finally, we developed and evaluated a novel text correction framework by taking advantage of figure-specific lexicons. Results/Conclusions The evaluation on 382 figures (9,643 figure texts in total) randomly selected from PubMed Central full-text articles shows that FigTExT performed with 84% precision, 98% recall, and 90% F1-score for text localization and with 62.5% precision, 51.0% recall and 56.2% F1-score for figure text extraction. When limiting figure texts to those judged by domain experts to be important content, FigTExT performed with 87.3% precision, 68.8% recall, and 77% F1-score. FigTExT significantly improved the performance of the off-the-shelf OCR tool we used, which on its own performed with 36.6% precision, 19.3% recall, and 25.3% F1-score for text extraction. In addition, our results show that FigTExT can extract texts that do not appear in figure captions or other associated text, further suggesting the potential utility of FigTExT for improving figure search. PMID:21249186

  8. Figure text extraction in biomedical literature.

    PubMed

    Kim, Daehyun; Yu, Hong

    2011-01-13

    Figures are ubiquitous in biomedical full-text articles, and they represent important biomedical knowledge. However, the sheer volume of biomedical publications has made it necessary to develop computational approaches for accessing figures. Therefore, we are developing the Biomedical Figure Search engine (http://figuresearch.askHERMES.org) to allow bioscientists to access figures efficiently. Since text frequently appears in figures, automatically extracting such text may assist the task of mining information from figures. Little research, however, has been conducted exploring text extraction from biomedical figures. We first evaluated an off-the-shelf Optical Character Recognition (OCR) tool on its ability to extract text from figures appearing in biomedical full-text articles. We then developed a Figure Text Extraction Tool (FigTExT) to improve the performance of the OCR tool for figure text extraction through the use of three innovative components: image preprocessing, character recognition, and text correction. We first developed image preprocessing to enhance image quality and to improve text localization. Then we adapted the off-the-shelf OCR tool on the improved text localization for character recognition. Finally, we developed and evaluated a novel text correction framework by taking advantage of figure-specific lexicons. The evaluation on 382 figures (9,643 figure texts in total) randomly selected from PubMed Central full-text articles shows that FigTExT performed with 84% precision, 98% recall, and 90% F1-score for text localization and with 62.5% precision, 51.0% recall and 56.2% F1-score for figure text extraction. When limiting figure texts to those judged by domain experts to be important content, FigTExT performed with 87.3% precision, 68.8% recall, and 77% F1-score. FigTExT significantly improved the performance of the off-the-shelf OCR tool we used, which on its own performed with 36.6% precision, 19.3% recall, and 25.3% F1-score for text extraction. In addition, our results show that FigTExT can extract texts that do not appear in figure captions or other associated text, further suggesting the potential utility of FigTExT for improving figure search.

  9. Postmortem findings in four litters of dogs with familial canine dermatomyositis.

    PubMed Central

    Hargis, A. M.; Prieur, D. J.; Haupt, K. H.; Collier, L. L.; Evermann, J. F.; Ladiges, W. C.

    1986-01-01

    Postmortem evaluations were performed on 20 juvenile to young adult collie and collie-Labrador retriever crossbred dogs with dermatomyositis and 10 neonatal collies. Cutaneous, muscular, and vascular lesions were present in the juvenile and adult dogs and were most severe in areas of the head and distal extremities. In more severely affected dogs, lesions were more generalized, including myositis of esophageal muscle and arteritis of skin, muscle, bladder, and spermatic cord. Although viruses were not isolated from muscle, crystalline viral-like structures were present in cytoplasm of endothelial cells within skeletal muscle. The dogs with dermatitis and myositis consistently had lymphoid hyperplasia, especially of peripheral lymph nodes. More severely affected dogs were smaller than less severely affected littermates, and the more severely affected males had reduced weight of testicles and prostate glands, compared with body weight. The reduced weight of genital organs correlated positively with reduced fertility. A few lymphoid aggregates were present in or around thyroid glands of 6 of the 20 dogs. There was no histologic evidence of glomerular disease in any of the dogs. The neonatal collies had no evidence of dermatomyositis. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 PMID:3717301

  10. Comparative Analysis of Multiple-Award Task Order Contracting and Its Impacts on Acquisition Reform

    DTIC Science & Technology

    2002-12-01

    24 Figure 2. DoD Improperly Directed Task Order Actions..... 49 Figure 3. Overview of the Domestic B2B Market, 1999-2003. 62 Figure 4...year 2000. The technology schedules amassed nearly $8.1 billion in sales with 60.8 percent of all activity. FSS charges agencies a one percent fee...second with $1 billion in sales . GSA manages five of the ten most lucrative contracts. The National Aeronautical Space Administration’s (NASA

  11. Comparative analysis of tissue reactions to anesthetic solutions: histological analysis in subcutaneous tissue of rats.

    PubMed Central

    Ribeiro, Paulo Domingos; Sanches, Marcio Giampietro; Okamoto, Tetuo

    2003-01-01

    Postanesthetic pain is a relatively common complication after local anesthesia. This complication may be caused by the anesthetic technique or by the anesthetic solution used. Tissue reactions induced by the anesthetic solutions may be one of the factors resulting in pain after anesthesia. The objective of this study was to comparatively analyze tissue reactions induced by different anesthetic solutions in the subcutaneous tissue of rats. The following solutions were utilized: 2% lidocaine without vasoconstrictor; a 0.5% bupivacaine solution with 1:200,000 adrenaline; a 4% articaine solution and 2% mepivacaine, both with 1:100,000 adrenaline; and a 0.9% sodium chloride solution as a control. Sterilized absorbent paper cones packed inside polyethylene tubes were soaked in the solutions and implanted in the subcutaneous region. The sacrifice periods were 1, 2, 5, and 10 days after surgery. The specimens were prepared and stained with hematoxylin and eosin for histological analysis. The results showed that there is a difference in tissue irritability produced by the local anesthetic solutions. The results also showed that there is no relation between the concentration of the drug and the inflammatory intensity, that the mepivacaine and articaine solutions promoted less inflammatory reaction than the bupivacaine, and that the lidocaine solution produced the least intense inflammation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 PMID:14959905

  12. A Workstation for Interactive Display and Quantitative Analysis of 3-D and 4-D Biomedical Images

    PubMed Central

    Robb, R.A.; Heffeman, P.B.; Camp, J.J.; Hanson, D.P.

    1986-01-01

    The capability to extract objective and quantitatively accurate information from 3-D radiographic biomedical images has not kept pace with the capabilities to produce the images themselves. This is rather an ironic paradox, since on the one hand the new 3-D and 4-D imaging capabilities promise significant potential for providing greater specificity and sensitivity (i.e., precise objective discrimination and accurate quantitative measurement of body tissue characteristics and function) in clinical diagnostic and basic investigative imaging procedures than ever possible before, but on the other hand, the momentous advances in computer and associated electronic imaging technology which have made these 3-D imaging capabilities possible have not been concomitantly developed for full exploitation of these capabilities. Therefore, we have developed a powerful new microcomputer-based system which permits detailed investigations and evaluation of 3-D and 4-D (dynamic 3-D) biomedical images. The system comprises a special workstation to which all the information in a large 3-D image data base is accessible for rapid display, manipulation, and measurement. The system provides important capabilities for simultaneously representing and analyzing both structural and functional data and their relationships in various organs of the body. This paper provides a detailed description of this system, as well as some of the rationale, background, theoretical concepts, and practical considerations related to system implementation. ImagesFigure 5Figure 7Figure 8Figure 9Figure 10Figure 11Figure 12Figure 13Figure 14Figure 15Figure 16

  13. Microgrid Control Strategy Utlizing Thermal Energy Storage With Renewable Solar And Wind Power Generation

    DTIC Science & Technology

    2016-06-01

    13 Figure 6. Vertical Axis Wind Turbines and Photovoltaic Solar Panels ....................15 Figure 7. Solar Sunny Boy Inverter...16 Figure 8. Wind Turbine Inverters...1. Comparison of Energy Storage. Adapted from [16], [18], [19]. ................10 Table 2. DC Operating Voltage of Wind Turbine Inverters

  14. Hemochromatosis caused by excessive vitamin iron intake.

    PubMed Central

    Hennigar, G. R.; Greene, W. B.; Walker, E. M.; de Saussure, C.

    1979-01-01

    Rare cases of hemochromatosis have been reported in patients who underwent prolonged oral iron therapy for hemolytic anemia or prolonged self-treatment with iron pills. A proportionately large segment of the South African Bantu tribe, who ingest large quantities of an alcoholic beverage brewed in iron pots, are found to have the disease. Reports of health fadists developing hemochromatosis due to excessive dietary iron intake, however, are extremely rare. This report presents clinical considerations and pathologic findings in a compulsive health fadist who consumed large numbers of vitamins containing iron. Clinical findings included the development and progression of cirrhosis of the liver, bronzing of the skin, and diabetes mellitus, all consistent with a diagnosis of hemochromatosis. Light microscopy of liver biopsies taken late in the course of the disease revealed a massive buildup of iron in the hepatocytes, less in the Kupffer cells, and sparse deposition in the epithelial cells of the bile duct. Minimal periportal fibrosis was noted. Electron microscopy showed numerous pleomorphic siderosomes with varying degrees of crystallization and ferritin attached at uniform intervals to the membranes of residual bodies. Abundant free ferritin was observed in most cells. The aggregated and membrane-associated ferritin was verified by non-dispersive x-ray analysis. An additional finding, noted only by electron microscopy, was the presence of many fat-storing cells of Ito, which are thought to be involved in the onset of fibrosis. Images Figure 11 Figure 12 Figure 5 Figure 6 Figure 1 Figure 2 Figure 3 Figure 4 Figure 7 Figure 8 Figure 9 Figure 10 PMID:474711

  15. Large Drought-induced Variations in Oak Leaf Volatile Organic Compound Emissions during PINOT NOIR 2012

    EPA Pesticide Factsheets

    Leaf level oak isoprene emissions and co2/H2O exchange in the Ozarks, USABAGeron.csv is the speciated biomass displayed in Figure 1.Biomass Dry Weights.xlsx is used to convert leaf area to dry leaf biomass and is used in Figure 2.Daly Ozarks leaf ISOP.txt and MOFLUX_Isoprene Summary_refined Tcurve data.xlsx are the leaf isoprene emission rate files shown in Figure 2.Harley Aug12_Chris.xls is the leaf isoprene emission rate file shown in Figure 3.Daly Ozarks leaf.txt is the BVOC emissions file used for Figure 7 and Table 4.Drought IS.txt is the review data given in Table 2.Fig4 Aug10 2012 Harley.txt is shown in Figure 4.Fig 5 Aug14 2012 Harley.txt is shown in Figure 5.Daly Ozarks Leaf.txt is used in Fig 7.Drought IS.txt is used in Fig 8.This dataset is associated with the following publication:Geron , C., R. Daly , P. Harley, R. Rasmussen, R. Seco, A. Guenther, T. Karl, and L. Gu. Large Drought-Induced Variations in Oak Leaf Volatile Organic Compound Emissions during PINOT NOIR 2012. CHEMOSPHERE. Elsevier Science Ltd, New York, NY, USA, 146: 8-21, (2016).

  16. Constitution and behavior of follicular structures in the human anterior pituitary gland.

    PubMed Central

    Ciocca, D. R.; Puy, L. A.; Stati, A. O.

    1984-01-01

    The follicular structures present in the human pituitary gland were studied, at the light-microscopic level, using histochemical and immunocytochemical techniques. The antisera applied in the peroxidase-antiperoxidase procedure were anti-hFSH beta, anti-hLH beta, anti-hPRL, anti-hGH, anti-hTSH beta, anti-hLPH beta, anti-pACTH, and anti-hACTH. In the 10 normal pituitaries examined, follicles were always found in the three areas of the adenohypophysis. The wall of the pars distalis follicles showed the seven immunoreactive cell types studied, while follicle-stimulating hormone (FSH) and luteinizing hormone (LH) cells were the only ones present in the wall of the pars tuberalis follicles. Most of the cell types studied were also present in the wall of the intermediate area follicles, but these follicles had characteristics not found in the other two areas. They were very large, with frequent interconnections forming a three-dimensional network of anastomotic cavities, and the colloid had different histochemical affinity. None of the hormones studied could be detected by immunocytochemistry within the follicular colloid. Three of the ten pituitary adenomas examined showed numerous follicular structures. Some of the follicles in the adenomatous pituitaries were similar to those found in the normal adenohypophysis, but there were also follicles filled with only traces of colloid and numerous blood cells in the cavity, and follicles filled with neoformed connective tissue. In one of these cases, FSH/LH immunoreactive adenoma cells were seen in the wall of the follicles. The results obtained suggest that the finding of pituitary adenomas with follicular structures is not uncommon and that the follicles originate from the tumor cells. In addition, the follicles seem to have several functional stages, explaining the finding of different types of follicular formation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 PMID:6326578

  17. Immunocytochemical Studies of Neurofibrillary Tangles

    PubMed Central

    Yen, Shu-Hui C.; Gaskin, Felicia; Terry, Robert D.

    1981-01-01

    The molecular nature of neurofibrillary tangles of senile dementia of the Alzheimer type (SDAT) was studied by immunoperoxidase and immunofluorescence techniques. Five antiserums, including anti-humanbrain-2-cycle-purified-microtubule-fractions (2 × MT), anti-calf-brain-2 × MT, anti-sea-urchin-egg-tubulin, antibeef-brain-tubulin, and anti-human-brain-neurofilament(NF)-210-kilodalton(kd)-protein were tested for their binding to neurofibrillary tangles. The antihuman-2 × MT serum stained structures resembling neurofibrillary tangles, neurites of neuritic plaques, and microglialike cells in SDAT brains, but no such staining pattern was detected in normal brain sections. In neurons isolated from SDAT brains, about 40% of the tangles were labeled by the anti-human-2×MT serum with an identical pattern. Other antiserums tested did not preferentially bind tanglelike structures in tissue sections and bound to less than 5% of the tangles in isolated neurons. These results suggest that the antigenic sites of tubulin and NF proteins are not shared by neurofibrillary tangles. Different from the calf preparation, the human-2 × MT fractions contained a prominent protein band that was identical to ferritin in molecular weight and cross-reacted with anti-human-2 × MT and anti-human-ferritin serums. However, antiserums to this ferritinlike protein, or anti-ferritin, did not stain neurofibrillary tangles. Although neither the calf 2 × MT nor two other human MT fractions failed to elicit an antiserum that stained tangles, these fractions were able to remove the antihuman-2 × MT serum activity that binds to tangles. The data suggest that the protein (or proteins) that makes up neurofibrillary tangles of SDAT is present in various quantities in microtubule fractions of normal brain. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6Figure 7Figure 8Figure 9Figure 10Figure 11Figure 12Figure 13Figure 14Figure 15Figure 16 PMID:7020426

  18. Vestibulo-ocular reflex and motion sickness in figure skaters.

    PubMed

    Tanguy, Sébastien; Quarck, Gaëlle; Etard, Olivier; Gauthier, Antoine; Denise, Pierre

    2008-12-01

    In order to determine the effect of figure skating on the functional plasticity of the vestibular system, we quantified vestibulo-ocular reflex (VOR) and motion sickness (MS) intensity in 11 female figure skaters and 11 matched control subjects. Vestibular stimulation consisted of three cycles of sinusoidal rotation (0.025 Hz, +/-60 degrees /s) and two velocity steps of 60 degrees /s (acceleration 60 degrees /s(2)). Nauseogenic stimulation consisted of a constant velocity (60 degrees /s) off vertical axis rotation (OVAR) using a 15 degrees tilt angle. Subjective sickness symptoms were rated immediately after OVAR with the Pensacola diagnostic index. During sinusoidal stimulations, the skaters' VOR, as compared with that of the controls, demonstrates a gain that is 27% lower (0.44 +/- 0.12 vs. 0.58 +/- 0.10; P < 0.01) and a phase advance (10 +/- 12 degrees vs. -0.3 +/- 6.4 degrees ; P < 0.05). During velocity steps, the VOR gain is 32% lower among the skaters (0.52 +/- 0.14 vs. 0.71 +/- 0.12; P < 0.01), but there is no difference in time constant (10.8 +/- 1.8 s vs. 10.5 +/- 2.7 s; P = 0.78). Nauseogenic stimulation evokes significantly less MS in figure skaters than in control subjects (2.8 +/- 2.8 vs. 16.2 +/- 13.7; P < 0.01). Quantitative alterations in VOR parameters observed in figure skaters probably result from vestibular habituation induced by repeated unusual stimulations when practicing figure skating.

  19. Scientific Understanding of Non-Chromated Corrosion Inhibitors Function

    DTIC Science & Technology

    2013-01-01

    deposited Al - Cu thin films (left) and aged Al - Cu thin films (right). 348 Figure 7.8. Pit morphologies developed...under neat epoxy resins applied to “as- deposited ” (left) and aged Al - Cu thin films (right) at different exposure times. 349 Figure 7.9. SEM and EDS...results of “As- deposited ” Al - Cu thin film. 351 Figure 7.10. SEM and EDS results of aged Al - Cu thin films. 352 Figure 7.11. Pit

  20. Fabrication of a Mechanically Robust Carbon Nanofiber Foam

    DTIC Science & Technology

    2015-06-01

    Erlenmeyer exhaust trap utilizing zeolite and permanganate . ........................ 11   Figure 9.   Early CFF experimental mold...containing zeolite and permanganate to dilute the exhaust gases and trap unreacted ethylene prior to their release. Figure 7. MKS mass flow...controller (model MKS 647a). Figure 8. Erlenmeyer exhaust trap utilizing zeolite and permanganate . 12 c. Gas Mixture A flow of pure compressed

  1. Kinematics of red cell aspiration by fluorescence-imaged microdeformation.

    PubMed Central

    Discher, D E; Mohandas, N

    1996-01-01

    Maps of fluorescing red cell membrane components on a pipette-aspirated projection are quantitated in an effort to elucidate and unify the heterogeneous kinematics of deformation. Transient gradients of diffusing fluorescent lipid first demonstrate the fluidity of an otherwise uniform-density bilayer and corroborate a "universal" calibration scale for relative surface density. A steep but smooth and stable gradient in the densities of the skeleton components spectrin, actin, and protein 4.1 is used to estimate large elastic strains along the aspirated skeleton. The deformation fields are argued to be an unhindered response to loading in the surface normal direction. Density maps intermediate to those of the compressible skeleton and fluid bilayer are exhibited by particular transmembrane proteins (e.g., Band 3) and yield estimates for the skeleton-connected fractions. Such connected proteins appear to occupy a significant proportion of the undeformed membrane surface and can lead to steric exclusion of unconnected integral membrane proteins from regions of network condensation. Consistent with membrane repatterning kinematics in reversible deformation, final vesiculation of the projection tip produces a cell fragment concentrated in freely diffusing proteins but depleted of skeleton. Images FIGURE 1 FIGURE 2 FIGURE 4 FIGURE 5 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 PMID:8889146

  2. Development of a User-Defined Stressor in the Improved Performance Research Integration Tool (IMPRINT) for Conducting Tasks in a Moving Vehicle

    DTIC Science & Technology

    2007-03-01

    task termine if in travel la ons, visual recognitio nd information proce visual recognitio uation will yiee Δ = (0accuracy .37 * 06463) + (0.63 * 0.11...mission Figure 2. User-defined stresso err int face . 8 Figure 3. Stressor levels in IMPRINT. Figure 4. Accuracy stressor definition

  3. Eagle Nebula Flaunts its Infrared Feathers

    NASA Technical Reports Server (NTRS)

    2007-01-01

    [figure removed for brevity, see original site] Figure 1 [figure removed for brevity, see original site] [figure removed for brevity, see original site] Figure 2 Figure 3

    This set of images from NASA's Spitzer Space Telescope shows the Eagle nebula in different hues of infrared light. Each view tells a different tale. The left picture shows lots of stars and dusty structures with clarity. Dusty molecules found on Earth called polycyclic aromatic hydrocarbons produce most of the red; gas is green and stars are blue.

    The middle view is packed with drama, because it tells astronomers that a star in this region violently erupted, or went supernova, heating surrounding dust (orange). This view also reveals that the hot dust is shell shaped, another indication that a star exploded.

    The final picture highlights the contrast between the hot, supernova-heated dust (green) and the cooler dust making up the region's dusty star-forming clouds and towers (red, blue and purple).

    The left image is a composite of infrared light with the following wavelengths: 3.6 microns (blue); 4.5 microns (green); 5.8 microns (orange); and 8 microns (red). The right image includes longer infrared wavelengths, and is a composite of light of 4.5 to 8.0 microns (blue); 24 microns (green); and 70 microns (red). The middle image is made up solely of 24-micron light.

  4. Recent Progress of B-Ga2O3 MOSFETs for Power Electronic Applications

    DTIC Science & Technology

    2017-03-20

    variety of group 4 elements such as Silicon, Tin , and Germanium.[2, 9] Multiple samples will be referenced throughout the text, but it should be noted...Ga2O3 channel. Fabrication steps 2-4 are used in the standard fabrication as seen in Figure 1. Figure 8a below shows a top-down SEM image of the gated...voltage of 567V. Please see reference [11] for more information. 393 Figure 8. (a) Colored SEM image of a β-Ga2O3 finFET. (b) Transfer

  5. Erratum: ``Structure and Colors of Diffuse Emission in the Spitzer Galactic First Look Survey'' (ApJS, 154, 281 [2004])

    NASA Astrophysics Data System (ADS)

    Ingalls, James G.; Miville-Deschênes, M.-A.; Reach, William T.; Noriega-Crespo, A.; Carey, Sean J.; Boulanger, F.; Stolovy, S. R.; Padgett, Deborah L.; Burgdorf, M. J.; Fajardo-Acosta, S. B.; Glaccum, W. J.; Helou, G.; Hoard, D. W.; Karr, J.; O'Linger, J.; Rebull, L. M.; Rho, J.; Stauffer, J. R.; Wachter, S.

    2006-05-01

    We have discovered an error in the scaling of our IRAC 8 μm and MIPS 70 μm data, which affected the caption for Figure 1 and the vertical axis scales for Figure 2. The original units in the images displayed in Figure 1 were MJy sr-1 for 8 μm and μJy arcsec-2 for MIPS 24 and 70 μm. We incorrectly multiplied our IRAC data by 0.0425 (the conversion from μJy arcsec-2 to MJy sr-1), but neglected to multiply our MIPS 70 μm data by that factor. (MIPS 24 μm data were scaled correctly.) Thus, contrary to the caption of Figure 1, the gray levels for panels (a) and (b) actually range from 6.7 to 7.8 MJy sr-1, and the gray levels for panels (e) and (f) actually range from 0.85 to 20.8 MJy sr-1. The power spectra in Figure 2 should have been normalized such that the integral over the spectrum equals the mean square image surface brightness. In the original paper, however, the IRAC power spectrum was incorrectly multiplied by (0.0425)2, whereas the MIPS 70 μm spectrum should have been multiplied by this factor but was not. We correct this in a revised version of Figure 2 included here. We thank Rick Arendt for calling our attention to this error.

  6. Pulmonary and generalized lysosomal storage induced by amphiphilic drugs.

    PubMed Central

    Hruban, Z

    1984-01-01

    Administration of amphiphilic drugs to experimental animals causes formation of myelinoid bodies in many cell types, accumulation of foamy macrophages in pulmonary alveoli and pulmonary alveolar proteinosis. These changes are the result of an interaction between the drugs and phospholipids which leads to an alteration in physicochemical properties of the phospholipids. Impairment of the digestion of altered pulmonary secretions in phagosomes of macrophages results in accumulation of foam cells in pulmonary alveoli. Impairment of the metabolism of altered phospholipids removed by autophagy induces an accumulation of myelinoid bodies. The administration of amphiphilic compounds thus causes pulmonary intra-alveolar histiocytosis which is a part of a drug-induced lysosomal storage or generalized lipidosis. The accumulation of drug-lipid complexes in myelinoid bodies and in pulmonary foam cells may lead to alteration of cellular functioning and to clinical disease. Currently over 50 amphiphilic drugs are known. Unique pharmacological properties necessitate clinical use of some of these drugs. The occurrence and severity of potential clinical side effects depend on the nature of each drug, dosage and duration of treatment, simultaneous administration of other drugs and foods, individual metabolic pattern of the patient and other factors. Further studies on factors preventing and potentiating adverse effects of amphiphilic drugs are indicated. Images FIGURE 1. FIGURE 2. FIGURE 3. FIGURE 4. FIGURE 5. FIGURE 6. FIGURE 7. FIGURE 8. FIGURE 9. FIGURE 10. PMID:6376111

  7. The significance of mouse liver tumor formation for carcinogenic risk assessment: results and conclusions from a survey of ten years of testing by the agrochemical industry.

    PubMed Central

    Carmichael, N G; Enzmann, H; Pate, I; Waechter, F

    1997-01-01

    A survey was performed on the results of 138 carcinogenicity studies conducted in various mouse strains by the agrochemical industry over the period 1983-1993. Data for liver tumor incidence, liver weight, and histopathology were collected along with data on genotoxicity. Studies were judged positive or negative for liver tumor formation on the basis of apparent dose response, malignancy, and difference from historical control values using a weight of evidence approach. Thirty-seven studies were judged to be positive for liver tumorigenicity in one or both sexes. There was no evidence showing an influence of the mouse strain and the duration of the study on the proportion of positive studies. Although 8 of the chemicals tested in the 138 studies were positive in the Ames test, only one of these was judged positive for carcinogenicity. Only 6 of the 37 positive chemicals had any other reported positive genotoxicity findings. A clear relationship between hepatomegaly at 1 year after exposure and a positive tumorigenic outcome at 18 months or 2 years after exposure was demonstrated. Whereas the average relative liver weight of top dose animals was 110% of control in negative studies, it was 150% in positive studies. Likewise, very few negative studies demonstrated significant pathological findings after 1 year, whereas the majority of positive studies had significant liver pathology. The implications of these findings for extrapolation to humans are discussed. Images p1196-a Figure 1. A Figure 1. B Figure 1. C Figure 1. D Figure 2. A Figure 2. B Figure 2. C Figure 2. D Figure 3. Figure 3. Figure 4. Figure 4. PMID:9370513

  8. Forensic Analysis of Digital Image Tampering

    DTIC Science & Technology

    2004-12-01

    analysis of when each method fails, which Chapter 4 discusses. Finally, a test image containing an invisible watermark using LSB steganography is...2.2 – Example of invisible watermark using Steganography Software F5 ............. 8 Figure 2.3 – Example of copy-move image forgery [12...Figure 3.11 – Algorithm for JPEG Block Technique ....................................................... 54 Figure 3.12 – “Forged” Image with Result

  9. Hazard evaluation of chemicals that cause accumulation of alpha 2u-globulin, hyaline droplet nephropathy, and tubule neoplasia in the kidneys of male rats.

    PubMed Central

    Hard, G C; Rodgers, I S; Baetcke, K P; Richards, W L; McGaughy, R E; Valcovic, L R

    1993-01-01

    This review paper examines the relationship between chemicals inducing excessive accumulation of alpha 2u-globulin (alpha 2u-g) (CIGA) in hyaline droplets in male rat kidneys and the subsequent development of nephrotoxicity and renal tubule neoplasia in the male rat. This dose-responsive hyaline droplet accumulation distinguishes CIGA carcinogens from classical renal carcinogens. CIGA carcinogens also do not appear to react with DNA and are generally negative in short-term tests for genotoxicity, CIGA or their metabolites bind specifically, but reversibly, to male rat alpha 2u-g. The resulting complex appears to be more resistant to hydrolytic degradation in the proximal tubule than native, unbound alpha 2u-g. Single cell necrosis of the tubule epithelium, with associated granular cast formation and papillary mineralization, is followed by sustained regenerative tubule cell proliferation, foci of tubule hyperplasia in the convoluted proximal tubules, and renal tubule tumors. Although structurally similar proteins have been detected in other species, including humans, renal lesions characteristic of alpha 2u-g nephropathy have not been observed. Epidemiologic investigation has not specifically examined the CIGA hypothesis for humans. Based on cancer bioassays, hormone manipulation studies, investigations in an alpha 2u-g-deficient strain of rat, and other laboratory data, an increased proliferative response caused by chemically induced cytotoxicity appears to play a role in the development of renal tubule tumors in male rats. Thus, it is reasonable to suggest that the renal effects induced in male rats by chemicals causing alpha 2u-g accumulation are unlikely to occur in humans. Images FIGURE 1. FIGURE 2. FIGURE 3. FIGURE 4. FIGURE 5. FIGURE 6. FIGURE 7. FIGURE 8. FIGURE 9. FIGURE 10. FIGURE 11. FIGURE 12. FIGURE 13. PMID:7686485

  10. The National Shipbuilding Research Program. Update Handbook for Surface Preparation and Coatings in Tanks and Confined Areas

    DTIC Science & Technology

    2000-10-31

    cleaning method are described in Naval Ships’ Technical Manual Chapter 631. 4.6.4 Citric Acid Cleaning The citric acid cleaning system is intended to...acquisition of necessary chemicals and tools, degreasing/cleaning, paint/stripping/removal, citric acid rust removal, passivation of bare steel, and drying...Figure 9-7 Hanging Explosion -Proof Light Box • Figure 9-8 Lighting in Tank • Figure 10-1 Hazardous Waste Storage Area • Figure 10-2 Solvent

  11. 29 CFR Appendix A to Subpart W to... - Figures W-14 through W-28

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 29 Labor 8 2010-07-01 2010-07-01 false Figures W-14 through W-28 A Appendix A to Subpart W to part 1926 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION...; Overhead Protection Pt. 1926, Subpt. W, App. A Appendix A to Subpart W to part 1926—Figures W-14 through W...

  12. Cytokeratins in normal and malignant transitional epithelium. Maintenance of expression of urothelial differentiation features in transitional cell carcinomas and bladder carcinoma cell culture lines.

    PubMed Central

    Moll, R.; Achtstätter, T.; Becht, E.; Balcarova-Ständer, J.; Ittensohn, M.; Franke, W. W.

    1988-01-01

    The pattern of cytokeratins expressed in normal urothelium has been compared with that of various forms of transitional cell carcinomas (TCCs; 21 cases) and cultured bladder carcinoma cell lines, using immunolocalization and gel electrophoretic techniques. In normal urothelium, all simple-epithelium-type cytokeratins (polypeptides 7, 8, 18, 19) were detected in all cell layers, whereas antibodies to cytokeratins typical for stratified epithelia reacted with certain basal cells only or, in the case of cytokeratin 13, with cells of the basal and intermediate layers. This pattern was essentially maintained in low-grade (G1, G1/2) TCCs but was remarkably modified in G2 TCCs. In G3 TCCs simple-epithelial cytokeratins were predominant whereas the amounts of component 13 were greatly reduced. Squamous metaplasia was accompanied generally by increased or new expression of some stratified-epithelial cytokeratins. The cytokeratin patterns of cell culture lines RT-112 and RT-4 resembled those of G1 and G2 TCCs, whereas cell line T-24 was comparable to G3 carcinomas. The cell line EJ showed a markedly different pattern. The results indicate that, in the cell layers of the urothelium, the synthesis of stratification-related cytokeratins such as component 13 is inversely oriented compared with that in other stratified epithelia where these proteins are suprabasally expressed, that TCCs retain certain intrinsic cytoskeletal features of urothelium, and that different TCCs can be distinguished by their cytokeratin patterns. The potential value of these observations in histopathologic and cytologic diagnoses is discussed. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:2456018

  13. Pathogenesis of trimethyltin neuronal toxicity. Ultrastructural and cytochemical observations.

    PubMed Central

    Bouldin, T. W.; Goines, N. D.; Bagnell, R. C.; Krigman, M. R.

    1981-01-01

    The ultrastructural cytopathologic and cytochemical effects of trimethyltin (TMT) neurotoxicity were delineated in hippocampal and pyriform neurons of acutely intoxicated adult rats. TMT produced neuronal necrosis that preferentially involved hippocampal formation pyriform cortex. The first subcellular alterations were multifocal collection of dense-cored vesicles and tubules and membrane-delimited vacuoles in the cytoplasm of the perikaryon and proximal dendrite. Ultrastructural cytochemical examination revealed that the vesicles and tubules had acid phosphatase activity analagous to Golgi-associated endoplasmic reticulum (GERL). Shortly after the appearance of the GERL-like vesicles and tubules, autophagic vacuoles and polymorphic dense bodies accumulated in the neuronal cytoplasm. Some dense bodies appeared to arise from the dense-cored tubules. Neuronal necrosis was characterized by increased electron density of the cytoplasm and large, electron-dense intranuclear masses. Alterations of mitochondria and other organelles were not observed in the early stages of cell injury. No light- or electron-microscopic alterations were found in liver or kidney. Comparable subcellular alterations were observed in adult and neonatal rats chronically intoxicated with TMT. A series of other trialkyl and tricyclic tins and dimethyltin did not produce similar pathologic findings. The GERL-like accumulations are unique in neuronal cytopathology. These findings suggests that GERL and autophagy play an important role in the pathogenesis of TMT-induced neuronal injury. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 PMID:7294153

  14. 16 CFR Figure 8 to Subpart A of... - Standard Radiant Heat Energy Flux Profile

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Standard Radiant Heat Energy Flux Profile 8... PRODUCT SAFETY ACT REGULATIONS INTERIM SAFETY STANDARD FOR CELLULOSE INSULATION The Standard Pt. 1209, Subpt. A, Fig. 8 Figure 8 to Subpart A of Part 1209—Standard Radiant Heat Energy Flux Profile EC03OC91...

  15. 16 CFR Figure 8 to Subpart A of... - Standard Radiant Heat Energy Flux Profile

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 2 2011-01-01 2011-01-01 false Standard Radiant Heat Energy Flux Profile 8... PRODUCT SAFETY ACT REGULATIONS INTERIM SAFETY STANDARD FOR CELLULOSE INSULATION The Standard Pt. 1209, Subpt. A, Fig. 8 Figure 8 to Subpart A of Part 1209—Standard Radiant Heat Energy Flux Profile EC03OC91...

  16. 16 CFR Figure 8 to Subpart A of... - Standard Radiant Heat Energy Flux Profile

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 2 2013-01-01 2013-01-01 false Standard Radiant Heat Energy Flux Profile 8... PRODUCT SAFETY ACT REGULATIONS INTERIM SAFETY STANDARD FOR CELLULOSE INSULATION The Standard Pt. 1209, Subpt. A, Fig. 8 Figure 8 to Subpart A of Part 1209—Standard Radiant Heat Energy Flux Profile EC03OC91...

  17. 16 CFR Figure 8 to Subpart A of... - Standard Radiant Heat Energy Flux Profile

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 2 2012-01-01 2012-01-01 false Standard Radiant Heat Energy Flux Profile 8... PRODUCT SAFETY ACT REGULATIONS INTERIM SAFETY STANDARD FOR CELLULOSE INSULATION The Standard Pt. 1209, Subpt. A, Fig. 8 Figure 8 to Subpart A of Part 1209—Standard Radiant Heat Energy Flux Profile EC03OC91...

  18. 16 CFR Figure 8 to Subpart A of... - Standard Radiant Heat Energy Flux Profile

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 2 2014-01-01 2014-01-01 false Standard Radiant Heat Energy Flux Profile 8... PRODUCT SAFETY ACT REGULATIONS INTERIM SAFETY STANDARD FOR CELLULOSE INSULATION The Standard Pt. 1209, Subpt. A, Fig. 8 Figure 8 to Subpart A of Part 1209—Standard Radiant Heat Energy Flux Profile EC03OC91...

  19. The ocular manifestations of congenital infection: a study of the early effect and long-term outcome of maternally transmitted rubella and toxoplasmosis.

    PubMed Central

    O'Neill, J F

    1998-01-01

    PURPOSE: To study the spectrum of adverse ocular effects which result from maternally transmitted rubella and toxoplasma infection; further, to record the long-term visual and neurodevelopmental outcomes of these 2 major causes of fetal infection. STUDY DESIGN AND PATIENTS: A series of 55 patients with congenital infection have been studied prospectively on a long-term basis. The study group included a cohort of 34 cases with congenital rubella syndrome demonstrated by virus isolation, and 21 cases with a clinical diagnosis of congenital toxoplasmosis and serologic confirmation. All patients had specific disease-related ocular defects. Rubella patients were first identified during or following the last major rubella epidemic in 1963-1964, and some have been followed serially since that time. A separate study group of representative toxoplasmosis patients presented for examination and diagnosis at varying time periods between 1967 and 1991. OBSERVATIONS AND RESULTS: This study confirms that a broad spectrum of fetal injury may result from intrauterine infection and that both persistent and delayed-onset effects may continue or occur as late as 30 years after original infection. Many factors contribute to the varied outcome of prenatal infection, the 2 most important being the presence of maternal immunity during early gestation and the stage of gestation during which fetal exposure occurs in a nonimmune mother. RUBELLA: As a criteria of inclusion, all 34 rubella patients in this study exhibited one or more ocular defects at the time of birth or in the immediate neonatal period. Cataracts were present in 29 (85%) of the 34, of which 21 (63%) were bilateral. Microphthalmia, the next most frequent defect, was present in 28 (82%) of the 34 infants and was bilateral in 22 (65%). Glaucoma was recorded in 11 cases (29%) and presented either as a transient occurrence with early cloudy cornea in microphthalmic eyes (4 patients), as the infantile type with progressive buphthalmos (1 patient), or as a later-onset, aphakic glaucoma many months or years following cataract aspiration in 11 eyes of 6 patients. Rubella retinopathy was present in the majority of patients, although an accurate estimate of its incidence or laterality was not possible because of the frequency of cataracts and nystagmus and the difficulty in obtaining adequate fundus examination. TOXOPLASMOSIS: Twenty-one patients with congenital toxoplasmosis have been examined and followed for varying time periods, 7 for 20 years or more. The major reason for initial examination was parental awareness of an ocular deviation. Twelve children (57%) presented between the ages of 3 months and 4 years with an initial diagnosis of strabismus, 9 of whom had minor complaints or were diagnosed as part of routine examinations. All cases in this study have had evidence of retinochoroiditis, the primary ocular pathology of congenital toxoplasmosis. Two patients had chronic and recurrent inflammation with progressive vitreal traction bands, retinal detachments, and bilateral blindness. Macular lesions were always associated with central vision loss; however, over a period of years visual acuity gradually improved in several patients. Individuals with more severe ocular involvement were also afflicted with the most extensive central nervous system deficits, which occurred following exposure during the earliest weeks of gestation. CONCLUSIONS: Although congenital infection due to rubella virus has been almost completely eradicated in the United States, the long-term survivors from the prevaccination period continue to experience major complications from their early ocular and cerebral defects. They may be afflicted by the persistence of virus in their affected organs and the development of late manifestations of their congenital infection. Congenital toxoplasmosis continues to be the source of major defects for 3,000 to 4,100 infants in the United States each year; the spectrum of defects is wide and may vary from blindness and severe mental retardation to minor retinochoroidal lesions of little consequence. Effective solutions for either the prevention or treatment of congenital toxoplasmosis have not been developed in this country but are under intensive and continuing investigation. Images FIGURE 4 FIGURE 5A FIGURE 5B FIGURE 5C FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15A FIGURE 15B FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20A FIGURE 20B FIGURE 20C FIGURE 20D FIGURE 20E FIGURE 20F FIGURE 20G FIGURE 20H FIGURE 20J FIGURE 20K FIGURE 21 FIGURE 22 FIGURE 23 FIGURE 24 A FIGURE 24B FIGURE 25 FIGURE 26 FIGURE 27 FIGURE 28 FIGURE 29 FIGURE 30 FIGURE 31 FIGURE 32 PMID:10360309

  20. META II Complex Systems Design and Analysis (CODA)

    DTIC Science & Technology

    2011-08-01

    37  3.8.7  Variables, Parameters and Constraints ............................................................. 37  3.8.8  Objective...18  Figure 7: Inputs, States, Outputs and Parameters of System Requirements Specifications ......... 19...Design Rule Based on Device Parameter ....................................................... 57  Figure 35: AEE Device Design Rules (excerpt

  1. Amplitude-integrated EEG colored according to spectral edge frequency.

    PubMed

    Kobayashi, Katsuhiro; Mimaki, Nobuyoshi; Endoh, Fumika; Inoue, Takushi; Yoshinaga, Harumi; Ohtsuka, Yoko

    2011-10-01

    To improve the interpretability of figures containing an amplitude-integrated electroencephalogram (aEEG), we devised a color scale that allows us to incorporate spectral edge frequency (SEF) information into aEEG figures. Preliminary clinical assessment of this novel technique, which we call aEEG/SEF, was performed using neonatal and early infantile seizure data. We created aEEG, color density spectral array (DSA), and aEEG/SEF figures for focal seizures recorded in seven infants. Each seizure was paired with an interictal period from the same patient. After receiving instructions on how to interpret the figures, eight test reviewers examined each of the 72 figures displaying compressed data in aEEG, DSA, or aEEG/SEF form (12 seizures and 12 corresponding interictal periods) and attempted to identify each as a seizure or otherwise. They were not provided with any information regarding the original record. The median number of correctly identified seizures, out of a total of 12, was 7 (58.3%) for aEEG figures, 8 (66.7%) for DSA figures and 10 (83.3%) for aEEG/SEF figures; the differences among these are statistically significant (p=0.011). All reviewers concluded that aEEG/SEF figures were the easiest to interpret. The aEEG/SEF data presentation technique is a valid option in aEEG recordings of seizures. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Quadruple Cone Coil with improved focality than Figure-8 coil in Transcranial Magnetic Stimulation

    NASA Astrophysics Data System (ADS)

    Rastogi, Priyam; Lee, Erik G.; Hadimani, Ravi L.; Jiles, David C.

    Transcranial Magnetic Stimulation (TMS) is a non-invasive therapy which uses a time varying magnetic field to induce an electric field in the brain and to cause neuron depolarization. Magnetic coils play an important role in the TMS therapy since their coil geometry determines the focality and penetration's depth of the induced electric field in the brain. Quadruple Cone Coil (QCC) is a novel coil with an improved focality when compared to commercial Figure-8 coil. The results of this newly designed QCC coil are compared with the Figure-8 coil at two different positions of the head - vertex and dorsolateral prefrontal cortex, over the 50 anatomically realistic MRI derived head models. Parameters such as volume of stimulation, maximum electric, area of stimulation and location of maximum electric field are determined with the help of computer modelling of both coils. There is a decrease in volume of brain stimulated by 11.6 % and a modest improvement of 8 % in the location of maximum electric field due to QCC in comparison to the Figure-8 coil. The Carver Charitable Trust and The Galloway Foundation.

  3. Ion beam figuring of small optical components

    NASA Astrophysics Data System (ADS)

    Drueding, Thomas W.; Fawcett, Steven C.; Wilson, Scott R.; Bifano, Thomas G.

    1995-12-01

    Ion beam figuring provides a highly deterministic method for the final precision figuring of optical components with advantages over conventional methods. The process involves bombarding a component with a stable beam of accelerated particles that selectively removes material from the surface. Figure corrections are achieved by rastering the fixed-current beam across the workplace at appropriate, time-varying velocities. Unlike conventional methods, ion figuring is a noncontact technique and thus avoids such problems as edge rolloff effects, tool wear, and force loading of the workpiece. This work is directed toward the development of the precision ion machining system at NASA's Marshall Space Flight Center. This system is designed for processing small (approximately equals 10-cm diam) optical components. Initial experiments were successful in figuring 8-cm-diam fused silica and chemical-vapor-deposited SiC samples. The experiments, procedures, and results of figuring the sample workpieces to shallow spherical, parabolic (concave and convex), and non-axially-symmetric shapes are discussed. Several difficulties and limitations encountered with the current system are discussed. The use of a 1-cm aperture for making finer corrections on optical components is also reported.

  4. Numerical Simulation and Forecast of Equatorial Spread F Under Realistic Postsunset Conditions

    DTIC Science & Technology

    2012-01-30

    at Kwajalein Atoll (8.8◦N, 167.5◦E) [Tsunoda et al., 1979]. Figure 1 displays ALTAIR UHF (422 MHz) data for the night of April 29, 2009. ALTAIR ...perpendicular scans reflect only incoherent scatter. The top panel of Figure 1 shows ALTAIR scans made pointing perpendicular to the geomagnetic field...to be driven downward in between ascending depletions. 1 X - 22 AVEIRO ET AL.: 3-D ESF SIMULATIONS AND OBSERVATIONS Figure 1 . ALTAIR radar scans for

  5. High Density Jet Fuel Supply and Specifications

    DTIC Science & Technology

    1986-01-01

    34 • • . * , • •, " " . . • • . • , . • • "vj" , j, , • * List of Illustrations Page Figure 1 U.S. Naphthenic Crude Oil Fields 8 Figure 2 JP-8X Production from Naphthenic Crude 12 Figure...Indicates which crude oil samples were requested and obtained. The process of classifying these fields as naphthenic involves some risk, since different... fields . Table 3 shows the largest naphthenic crude oil production by far is in California (85% of naphthenic production), and particularly in the San

  6. Chemotherapy-induced alopecia in mice. Induction by cyclophosphamide, inhibition by cyclosporine A, and modulation by dexamethasone.

    PubMed Central

    Paus, R.; Handjiski, B.; Eichmüller, S.; Czarnetzki, B. M.

    1994-01-01

    We introduce cyclophosphamide-induced alopecia (CYP-IA) in C57BL-6 mice as a clinically relevant model for studying the biology of chemotherapy-induced alopecia and for developing anti-alopecia drugs. One injection of CYP to mice with all back skin follicles in anagen VI induces severe alopecia that strikingly reproduces the follicle response, recovery, and histopathology seen in human CYP-IA. CYP dose-dependently induces abnormal follicular melanogenesis and dystrophic anagen or, in more severely damaged follicles, dystrophic catagen. Both dystrophy forms are followed by an extremely shortened telogen phase, but differ in the associated hair loss and in recovery patterns, which determines hair regrowth. This follicular response to CYP can be manipulated pharmacologically: systemic cyclosporine A shifts it toward a mild form of dystrophic anagen, thus retarding CYP-IA and prolonging "primary recovery". Topical dexamethasone, in contrast, forces follicles into dystrophic catagen, which augments CYP-IA, but accelerates the regrowth of normally pigmented hair ("secondary recovery"). Images Figure 2 Figure 3 Figure 4 Figure 6 Figure 7 Figure 8 Figure 10 PMID:8160773

  7. 1992 Michigan traffic crash facts

    DOT National Transportation Integrated Search

    1994-07-19

    The 1992 traffic fatality count was 1,300, down 8.8 percent from the 1991 figure of : 1,425. Compared with 1991, injuries were down 12.6 percent and total crashes : were down 5.5 percent. These figures translated into a death rate of 1.5 per 100 : mi...

  8. From the AAPT Executive Officer

    NASA Astrophysics Data System (ADS)

    Hein, Warren

    2009-09-01

    Figure 8b in the print version of the journal is an unintended repeat of Fig. 8a. The correct version of the figure appears below and is also correct in the online version of the paper. We apologize for the error, which was introduced during the production process.

  9. Correction: Alvarado, M., et al. Towards the Development of a Low Cost Airborne Sensing System to Monitor Dust Particles after Blasting at Open-Pit Mine Sites. Sensors 2015, 15, 19667-19687.

    PubMed

    Alvarado, Miguel; Gonzalez, Felipe; Fletcher, Andrew; Doshi, Ashray

    2016-07-05

    The author wishes to change Figure 1 and Figure 3 from his paper published in Sensors [1], doi:10.3390/s150819667, website: http://www.mdpi.com/1424-8220/15/8/19667 for Figures 1 and 2 presented in this 'Correction'.[...].

  10. Masculine somatotype and hirsuteness as determinants of sexual attractiveness to women.

    PubMed

    Dixson, Alan F; Halliwell, Gayle; East, Rebecca; Wignarajah, Praveen; Anderson, Matthew J

    2003-02-01

    Five questionnaire studies asked women to rate the attractiveness of outline drawings of male figures that varied in somatotype, body proportions, symmetry, and in distribution of trunk hair. In Study 1, back-posed figures of mesomorphic (muscular) somatotypes were rated as most attractive, followed by average, ectomorphic (slim), and endomorphic (heavily built) figures by both British and Sri Lankan women. In Study 2, computer morphing of somatotypes to produce an intergraded series resulted in a graded response in terms of perceived attractiveness which mirrored the findings of Study 1. In Study 3, back-posed figures were manipulated in order to change waist-to-hip ratios (WHR) and waist-to-shoulder ratios (WSR). A WHR of 0.8-0.9 and a WSR of 0.6 were rated as most attractive and these effects were more pronounced when modeling mesomorphic figures. In Study 4, symmetric figures of a mesomorphic somatotype were rated as less attractive than a normal (asymmetric) version of the same man. Study 5 showed that presence of trunk hair had a marked, positive effect upon women's ratings of attractiveness for both mesomorphic and endomorphic male figures. Women also judged figures with trunk hair as being older and they consistently rated endomorphic figures as being older than mesomorphs. These results are consistent with effects of sexual selection upon visual signals that advertise health, physical prowess, age, and underlying endocrine condition in the human male.

  11. Analyzing the Surface Warfare Operational Effectiveness of an Offshore Patrol Vessel using Agent Based Modeling

    DTIC Science & Technology

    2012-09-01

    20 Figure 6. Marte Missile Phit – Range Profile...22 Figure 7. Exocet Missile Phit – Range Profile .................................................................22 Figure 8. Gun Phit – Range...in the OSN model. Factors like range and Phit probability plots and agent dependent factors could be directly implemented in MANA with little effort

  12. Modeling, Simulation, and Flight Test for Automatic Flight Control of the Condor Hybrid-Electric Remote Piloted Aircraft

    DTIC Science & Technology

    2012-03-01

    comprehensive explanations (Yechout, 2003), (Nelson, 1998). Figure 9: USAFA/Brandt Jet5 Aircraft Modeling Program 18 2.5.1 Dynamic Aircraft...16 2.5.1 Dynamic Aircraft Stability Modes .......................................................... 18 2.5.2 State...12 Figure 7: Body-Fixed Reference Frame ........................................................................... 13 Figure 8: Static and Dynamic

  13. 16 CFR Figure 8 to Part 1203 - Apparatus for Test of Retention System Strength

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 2 2011-01-01 2011-01-01 false Apparatus for Test of Retention System Strength 8 Figure 8 to Part 1203 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION CONSUMER PRODUCT...—Apparatus for Test of Retention System Strength ER10MR98.008 ...

  14. 16 CFR Figure 8 to Part 1203 - Apparatus for Test of Retention System Strength

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Apparatus for Test of Retention System Strength 8 Figure 8 to Part 1203 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION CONSUMER PRODUCT...—Apparatus for Test of Retention System Strength ER10MR98.008 ...

  15. Propulsion and Power Rapid Response Research and Development Support. Delivery Order 0042: Demonstration and Evaluation of Fischer-Tropsch Research Fuels for the DoD Assured Fuels Program

    DTIC Science & Technology

    2006-12-01

    7 Figure 3.1-3. Net Heat of Combustion ...No. 1 Aromatic Carbon, max ASTM D-5292 Mol % < 0.5 Sulfur, Total, Max ASTM D-5453 ppm 1 Cetane Index ASTM D-976 Report Net Heat of Combustion , min ASTM...12 /2 00 6 8/ 19 /2 00 6 8/ 26 /2 00 6 9/ 2/ 20 06 8 Figure 3.1-3. Net Heat of Combustion Trend Figure 3.1-4. Freezing Point Trend Net

  16. Evoked potential correlates of figure and ground.

    PubMed

    Landis, T; Lehmann, D; Mita, T; Skrandies, W

    1984-06-01

    Brain potentials averaged during the viewing of an alternating, positive and negative "hidden man" puzzle picture were averaged from 8 subjects before and after they learned to recognize the figure. After figure recognition in comparison to before recognition, there was significantly more evoked positivity at 64/96 ms latency, and more negativity at 224/256 ms and at 352-480 ms latency over parietal areas during the viewing of the positive picture (recognizable as face) referred to the values obtained during viewing of the negative picture (not recognizable as face). It is hypothesized that separate physiological changes might reflect learned meaningfulness of the figure (which entails increased attention) and figure extraction from ground.

  17. Comparison of two tension-band fixation materials and techniques in transverse patella fractures: a biomechanical study.

    PubMed

    Rabalais, R David; Burger, Evalina; Lu, Yun; Mansour, Alfred; Baratta, Richard V

    2008-02-01

    This study compared the biomechanical properties of 2 tension-band techniques with stainless steel wire and ultra high molecular weight polyethylene (UHMWPE) cable in a patella fracture model. Transverse patella fractures were simulated in 8 cadaver knees and fixated with figure-of-8 and parallel wire configurations in combination with Kirschner wires. Identical configurations were tested with UHMWPE cable. Specimens were mounted to a testing apparatus and the quadriceps was used to extend the knees from 90 degrees to 0 degrees; 4 knees were tested under monotonic loading, and 4 knees were tested under cyclic loading. Under monotonic loading, average fracture gap was 0.50 and 0.57 mm for steel wire and UHMWPE cable, respectively, in the figure-of-8 construct compared with 0.16 and 0.04 mm, respectively, in the parallel wire construct. Under cyclic loading, average fracture gap was 1.45 and 1.66 mm for steel wire and UHMWPE cable, respectively, in the figure-of-8 construct compared with 0.45 and 0.60 mm, respectively, in the parallel wire construct. A statistically significant effect of technique was found, with the parallel wire construct performing better than the figure-of-8 construct in both loading models. There was no effect of material or interaction. In this biomechanical model, parallel wires performed better than the figure-of-8 configuration in both loading regimens, and UHMWPE cable performed similarly to 18-gauge steel wire.

  18. Submarine Construction (Unterseebootsbau)

    DTIC Science & Technology

    1972-08-01

    PIPE FOR THE SNORKEL EXHAUST MAST 11 AIR EXIT (GENERALLY TO MAIN AIR INDUCTION LINE) 12 EXHAUST GAS INLET FROM EXHAUST GAS LINE SIDE VIEW (MAST...Electric Engine 76 Diesel Engines 79 Air Intake and Gas Exhaust Systems for the Diesel Engines 79 Diesel Fuel and Pressurized Water System 82...Lines of a Submarine ■. 31 Figure 6 - Lines of a Submersible 31 Figure 7 - Twin- Screw Stern Configurations 34 Figure 8 - Single- Screw Stern

  19. 1993 Michigan traffic crash facts

    DOT National Transportation Integrated Search

    1994-09-19

    The 1993 traffic fatality count was 1,414, up 8.8% from the 1992 figure of 1,300. : Compared with 1992, injuries were up 13.3% and total crashes were up 5.4%. These : figures translated into a death rate of 1.6 per 100 million miles of travel, up fro...

  20. Mast cell activation by group A streptococcal polysaccharide in the rat and its role in experimental arthritis.

    PubMed Central

    Dalldorf, F. G.; Anderle, S. K.; Brown, R. R.; Schwab, J. H.

    1988-01-01

    Acute edematous responses were induced in Sprague-Dawley rats by the intravenous injection of group-specific polysaccharide (PS) isolated from group A streptococci. Thirty minutes after the intravenous injection of PS there was marked degranulation of subcutaneous and periarticular mast cells in all 4 feet, carbon particle labeling of adjacent venules, and an 8-fold increase in Evans blue dye content of the extremities. This acute reaction to PS was completely blocked by pretreatment with compound 48/80, but the polyarticular relapsing arthritis following the systemic injection of an arthropathic dose of streptococcal cell wall fragments containing large, covalently bound peptidoglycan-polysaccharide (PG-PS) was not blocked. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:3041843

  1. Ultrastructural evaluation of adenocarcinomas derived from apocrine glands of the anal sac associated with hypercalcemia in dogs.

    PubMed Central

    Meuten, D. J.; Capen, C. C.; Kociba, G. J.; Chew, D. J.; Cooper, B. J.

    1982-01-01

    Adenocarcinomas derived from apocrine glands of the anal sac and associated with persistent hypercalcemia in dogs were composed of tumor cells with numerous profiles of rough endoplasmic reticulum, clusters of free ribosomes, and a prominent Golgi apparatus. Neoplastic cells contained microtubules, microfilaments, tonofibrils, and had two types of electron-dense granules. Large lysosomelike dense bodies ranged from 0.6 to 2.2 microns in diameter and had a poorly delineated limiting membrane. Small granules (150-400 nm in diameter) had a sharply delineated limiting membrane with a narrow submembranous space and a homogeneous dense core. These smaller granules usually were located near the apexes of neoplastic cells, whereas the larger granules were situated near the base of cells. Apocrine cells in glands of the anal sac from control dogs that were in the secretory phase were columnar and had large dilated profiles of rough endoplasmic reticulum. Membranes of the endoplasmic reticulum fused with the plasmalemma and appeared to secrete their product directly into the lumens of acini, characteristic of merocrine secretion. Apical blebs of electron-lucent cytoplasm pinched off from nonneoplastic aprocine cells and were released into glandular lumens. Similar electron-lucent cytoplasmic blebs were present at the apexes of tumor cells. Myoepithelial cells were present between the epithelial cells and basement membrane in normal apocrine glands and were absent in neoplasms derived from these glands. Identification of the contents of the secretory-like granules in tumor cells and characterization of the hypercalcemic factor in the plasma or tumor tissue from dogs with this syndrome will help explain the pathogenesis of hypercalcemia associated with malignancy in animals and man. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 PMID:7200729

  2. Defense Management: DOD Needs to Improve Program Management, Policy, and Testing to Enhance Ability to Field Operationally Useful Non-lethal Weapons

    DTIC Science & Technology

    2009-04-01

    through Fielding and Support 12 Figure 3: Active Denial System 2 25 Figure 4: FN-303 Less-Lethal Launching System 26 Figure 5: TASER ® X-26 27 Figure 6...System Grenades 5, 6, 8, 9, 11, 12 , 13, 14, 19, 21, 25, 26 Human Electro Muscular Incapacitation TASER ® X-26 5, 13, 14, 21 Improved Acoustic...modes Modular accessory shotgun system Provides the capability to fire lethal, non-lethal, and door- breaching 12 - gauge rounds. Future force

  3. Continued Investigation of Leakage and Power Loss Test Results for Competing Turbine Engine Seals

    DTIC Science & Technology

    2006-09-01

    Pressure-balanced design Figure 3.—Annular seal made of Inconel 625 . Note, each grid square is 6.35 mm. Figure 4.—Four-knife labyrinth...seal made of Inconel 625 . NASA/TM—2006-214420 7 Figure 5.—Brush seal with flow deflector. Figure 6.—Finger seal design. NASA/TM—2006-214420 8...thermocouples are located at the 90° and 180° positions (0° is top-dead-center). Type-K thermocouples are used and all are 157 µm, Inconel sheath, closed

  4. Volcanic activity: a review for health professionals.

    PubMed Central

    Newhall, C G; Fruchter, J S

    1986-01-01

    Volcanoes erupt magma (molten rock containing variable amounts of solid crystals, dissolved volatiles, and gas bubbles) along with pulverized pre-existing rock (ripped from the walls of the vent and conduit). The resulting volcanic rocks vary in their physical and chemical characteristics, e.g., degree of fragmentation, sizes and shapes of fragments, minerals present, ratio of crystals to glass, and major and trace elements composition. Variability in the properties of magma, and in the relative roles of magmatic volatiles and groundwater in driving an eruption, determine to a great extent the type of an eruption; variability in the type of an eruption in turn influences the physical characteristics and distribution of the eruption products. The principal volcanic hazards are: ash and larger fragments that rain down from an explosion cloud (airfall tephra and ballistic fragments); flows of hot ash, blocks, and gases down the slopes of a volcano (pyroclastic flows); "mudflows" (debris flows); lava flows; and concentrations of volcanic gases in topographic depressions. Progress in volcanology is bringing improved long- and short-range forecasts of volcanic activity, and thus more options for mitigation of hazards. Collaboration between health professionals and volcanologists helps to mitigate health hazards of volcanic activity. Images FIGURE 1 FIGURE 2 FIGURE 6a-6e FIGURE 6a-6e FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 PMID:3946726

  5. The C8-binding protein of human erythrocytes: interaction with the components of the complement-attack phase.

    PubMed Central

    Schönermark, S; Filsinger, S; Berger, B; Hänsch, G M

    1988-01-01

    C8-binding protein is an intrinsic membrane protein of the human erythrocyte. It inhibits the complement (C5b-9)-mediated lysis in a species-restricting manner. In the present study we incorporated C8bp, isolated from human erythrocytes, into sheep erythrocytes (SRBC). SRBC, normally sensitive to lysis by human C5b-9, became insensitive to lysis. Furthermore, we found that C8bp is incorporated into the membrane-attack complex C5b-9, most probably by interacting with C8, since C8bp has an affinity for C8, particularly for the C8 alpha-gamma-subunit. Antibodies to C8bp react with the C8 alpha-subunits and with C9, pointing to the possibility of a partial homology between these proteins. Images Figure 4 Figure 6 Figure 7 PMID:3366469

  6. Experimental evidence for the origin of ductal-type adenocarcinoma from the islets of Langerhans.

    PubMed Central

    Pour, P. M.; Weide, L.; Liu, G.; Kazakoff, K.; Scheetz, M.; Toshkov, I.; Ikematsu, Y.; Fienhold, M. A.; Sanger, W.

    1997-01-01

    To investigate the role of the islets of Langerhans in pancreatic carcinogenesis, freshly isolated islets from male Syrian hamsters were transplanted into the right submandibular glands of 50 female hamsters that were or were not pre-treated with streptozotocin. Thyroid gland fragments, cellulose powder, and immortal hamster pancreatic ductal cells were injected into the left submandibular gland of the same hamsters. All recipient hamsters were then treated with the potent pancreatic carcinogen N-nitrosobis(2-oxopropyl)amine weekly at a dose of 40 mg/kg of body weight for 3 weeks. Between 3 and 8 weeks later, 18 of 75 (24%) hamsters developed large ductal-type adenocarcinomas in the submandibular gland region, where islets were transplanted, but none developed tumors in the left submandibular gland. In 9 of 18 hamsters, tumors were multiple so that a total of 31 cancers were found. Eleven of these carcinomas were in the vicinity of transplanted islets, eight of which showed intra-insular ductular or cyst formation as seen in the pancreas of hamsters during pancreatic carcinogenesis. The formation of ductular structures within islets was also demonstrated in vitro. Some tumor cells in the vicinity of these islets were reactive with anti-insulin. Y chromosome message was found by polymerase chain reaction analysis in one of the three tumors examined. Also, like the induced pancreatic tumors, all three submandibular gland tumors that were examined had the mutation of the c-Ki-ras oncogene at codon 12 and all tumors expressed blood group A antigen. These and other findings strongly suggest that some components of islets, most probably stem cells, are the origin of ductal-type adenocarcinomas in this model. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:9176407

  7. Giant fibroma of the vulva

    PubMed Central

    Abasiattai, Aniekan M; Umoiyoho, Aniefiok J; Umana, Ivy N; Utuk, Ntiense M

    2010-01-01

    A 50-year-old grandmultiparous petty trader presented in the gynaecological unit of the University of Uyo Teaching Hospital with a painless groin swelling of 8 years’ duration, which had progressively increased in size. She had received several concoctions from a traditional healer who also made several incisions on her thighs and inguinal region. On examination, there were multiple scarification marks in the axilla, inguinal region and medial aspects of both thighs. There was a very huge, firm, non-tender mass involving the right vulva and measuring 40 by 35 cm (figure 1). The vaginal orifice was deviated to the left by the mass, the uterus was normal size and the adnexa were normal. She had an excision biopsy under general anaesthesia (figure 2) and the histology confirmed fibroma of the vulva (figure 3). She had an uneventful postoperative period and the wound healed well with good cosmetic results. Figure 1A huge vulva mass. Figure 2The vulva after the mass has been excised. Figure 3The histology confirming fibroma of the vulva.

  8. Comparison Between Navy and Army Implementation of SIOH and Recommendations for Navy Implementation

    DTIC Science & Technology

    2015-12-01

    8 Figure 3. NAVFAC Matrix Organization and Relationship .......................................9 Figure 4. Matrix Roles...Program DFAS Defense Finance and Accounting Service DOD Department of Defense DOH Departmental Overhead EFA Engineering Field Activity EFD...Command (NAVFAC). (2015). Concept of operations. Washington, DC: Author. p. 8 8 NAVFAC is organized both as a tiered organization, and as a matrix

  9. Multipath transport for virtual private networks

    DTIC Science & Technology

    2017-03-01

    Using a Wi - Fi and Cellular Connection . . . . . . . . . 13 Figure 2.8 OpenVPN Interaction with Kernel. Adapted from [14]. . . . . . . 17 Figure 3.1 MPTCP...to enable a client to connect to his corporate offices using a hotel Wi - Fi connection while traveling for business. Maybe a small business is...interface of the client to each interface of the server [7]. Figure 2.7 provides a simplified scenario of a MPTCP client with Wi - Fi and cellular

  10. Development of a Graphics Based Two-Attribute Utility Assessment Program with Application to Mission Planning.

    DTIC Science & Technology

    1986-12-01

    Blackall and Mr. Zen Pryk of the Surveillance Division; Lt Greg Bandeau of the Accounting Division; and the entire Technical Library staff. I am grateful...1) PD 92 Figure 4.21 Viewpoint 6 (B1 . 00 . W 93 Figure 4.22 Viewpoint 7 (MP 1) MOOc 0.000 pe OCp 94 Figure 4.23 Viewpoint 8 (MP 1) 95 4.2.3 Utility

  11. Microneedle Device Prototype

    DTIC Science & Technology

    2014-05-01

    Defense Threat Reduction Agency Research and Development Counter WMD Technologies Test Support Division 1680 Texas Street SE Kirtland AFB, NM...Device Prototype Final Report iv | List of Figures List of Figures Figure 3-1. Print screen of the STL file of a hollow microneedle design in Alibre...electrochemical characterization of gold electrode (n = 8) array with oxide dielectric defined working electrodes with 1 mM [Fe(CN)6] 3- in 0.1 M potassium

  12. Agroterrorism: Threats and Preparedness

    DTIC Science & Technology

    2006-08-25

    7 Figure 4. Concentration of Chicken Production . . . . . . . . . . . . . . . . . . . . . . . . . . 7 Figure 5. Concentration of Corn Production...million hogs. Farm sales of broilers and other meat-type chickens exceeded 8.5 billion birds.12 Agriculture in the U.S. is technologically advanced...Maryland- Virginia). The top three chicken -producing states (Georgia, Arkansas, and Alabama) produce 41% of U.S. chickens (Figure 4). CRS-7 Note:Catt le

  13. Innovative Navigation Systems to Support Digital Geophysical Mapping

    DTIC Science & Technology

    2004-02-01

    9 Figure 8. Blackhawk/ Applanix GPS/INS System.................................................................10 Figure 9. Figure-Eight Traverse...Vulcan/LaserStation Line-of-sight laser Parsons Trimble INS/GPS DGPS and inertia guidance Blackhawk Applanix INS/GPS DGPS and inertia guidance...The Applanix Positioning and Orientation System for Land Survey (POS/LS) was used for the Phase I work. The system is similar to the Parsons

  14. Today’s Crisis in Contracting

    DTIC Science & Technology

    2012-05-01

    17 .............................................................................. 57 LIST OF FIGURES Figure 1 . Response to Question 2 , Career Field...indicates the breakout of the respondent’s career field. 12 Figure 1 . Response to Question 2 , Career Field (196 answered, 9 skipped) The...What is your pay grade? If other, please indicate your pay grade. 1 ) Temp GS-12 2 ) GS-08 Fill-In Answers to Question 7 (8 responses). In your

  15. Cytologic Effects of Air Force Chemicals

    DTIC Science & Technology

    1979-08-01

    mitomycin C (MMC, Sigma), a well known bifunctional DNA alkylating agent . Figure 3 shows typical metaphase spreads of a rat lymphocyte and a rat bone...monofunctional DNA alkylating agents and well known mutagens, are shown in Figures 7 and 8, respectively. Fig- ure 9 shows the induction of micronuclei by MMC...a bifunctional alkyl - ating agent . These three chemicals serve as positive controls for the in vitro exposures. In all three figures, the general

  16. Ocular pathology in melanomatous Sinclair miniature swine.

    PubMed Central

    Feeney-Burns, L.; Burns, R. P.; Gao, C. L.

    1988-01-01

    Eyes of cutaneous melanoma-bearing miniature Sinclair swine were examined by light and electron microscopy during growth and maturation of animals. The histology of ocular depigmentation, which occurs during melanoma arrest and skin depigmentation, was studied in eyes of animals that had successful and unsuccessful tumor regression. In 12 animals one eye was removed at an early stage and the second eye at a later stage of disease or maturation. The histologic and clinical course of the ocular changes was correlated with changes in the cutaneous tumors. Animals showing rapid cutaneous tumor regression developed acute uveitis that was characterized by an influx of mononuclear cells into the stroma of the ciliary body; later this spread to the iris and choroid. In late stages the cornea sometimes developed a band of calcium precipitates beneath the basal epithelial cells (band keratopathy). Uveal melanocytes developed watery cytoplasm typical of cells with ruptured plasma membranes. Released melanin granules were taken up initially into the lysosomal compartment of mononuclear cells having the various morphologic features of lymphocytes and monocytes; later, melanin also appeared in fibrocyte lysosomes. The relationship of these processes to various cell-mediated immunity phenomena is being studied. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:3354645

  17. Chronic thromboembolic pulmonary hypertension

    PubMed Central

    Reesink, H.J.; Kloek, J.J.; Bresser, P.

    2006-01-01

    Chronic thromboembolic pulmonary hypertension (CTEPH) is a rapidly progressive and deadly disease, resulting from incomplete resolution of acute pulmonary embolism. Historically, the incidence of CTEPH was significantly underestimated but it may be as high as 3.8% following acute pulmonary embolism. Although the medical management of CTEPH may be supportive, the only curative treatment is pulmonary endarterectomy (PEA). However, a careful screening programme is mandatory to select CTEPH patients who are likely to benefit from PEA. In this review we discuss the pathophysiology, clinical and diagnostic pitfalls, surgical treatment, outcome after surgery, and the potential benefit of medical treatment in inoperable CTEPH patients. ImagesFigure 1Figure 2Figure 3Figure 4 PMID:25696637

  18. Pre-operative planning and intra-operative guidance in modern neurosurgery: a review of 300 cases.

    PubMed Central

    Wadley, J.; Dorward, N.; Kitchen, N.; Thomas, D.

    1999-01-01

    Operative neurosurgery has recently entered an exciting era of image guided surgery or neuronavigation and application of this novel technology is beginning to have a significant impact in many ways in a variety of intracranial procedures. In order to fully assess the advantages of image guided techniques over conventional planning and surgery in selected cases, detailed prospective evaluation has been carried out during the advanced development of an optically tracked neuronavigation system. Over a 2-year period, 300 operative neurosurgical procedures have been performed with the assistance of interactive image guidance, as well as the development of new software applications and hardware tools. A broad range of intracranial neurosurgical procedures were seen to benefit from image guidance, including 163 craniotomies, 53 interactive stereotactic biopsies, 7 tracked neuroendoscopies and 37 complex skull base procedures. The most common pathological diagnoses were cerebral glioma in 98 cases, meningioma in 64 and metastasis in 23. Detailed analysis of a battery of postoperative questions revealed benefits in operative planning, appreciation of anatomy, lesion location, safety of surgery and greatly enhanced surgical confidence. The authors believe that image guided surgical technology, with new developments such as those described, has a significant role to play in contemporary neurosurgery and its widespread adoption in practice will be realised in the near future. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:10615186

  19. Scientific and Engineering Studies, Compiled 1989. Signal Processing Studies

    DTIC Science & Technology

    1989-01-01

    Version W(t,f) . . . . . .......... 25 3 W(t,f) for Real Waveform s(t) ............... 25 4 Contour of WDF (72) at l/e Relative Level . . . . . . . . . 30...spectral level , (189) B Passband of filter H, figure 8 Duration of weighting v, figure 8 LFM Linear Frequency Modulation sgn(x) 1 for x > 0, -1 for x...figure 4. the area of thl parir( Iua level ellipse is 1/2 In the t.f Vifne Wher this area i *, rlt IVe! bl ty e peak height of ?[, the product Is . *ýich

  20. Simulation of Aircraft Sortie Generation Under an Autonomic Logistics System

    DTIC Science & Technology

    2016-12-01

    56 Design of Experiment...Figure 8. Pre -flight Operations ......................................................................................... 40 Figure 9. Sortie...Critical Factors and Their Associated Levels ................................................... 57 xiii Table 18. Design of Experiment

  1. Relationship of Chromosome Changes to Neoplastic Cell Transformation

    PubMed Central

    DiPaolo, Joseph A.; Popescu, Nicolae C.

    1976-01-01

    Chromosomal abnormalities are a frequent concomitant of neoplasia, and although it is tempting to relate these mutations and alterations in chromatin (DNA) function to cancer, their relationship to the initiation or progression of carcinogenesis is unknown. Mammalian cells in culture, after interacting with chemical carcinogens, often exhibit chromosome damage consisting of breaks and exchanges of chromatid material. The pattern of damage of banded metaphases indicates that negative bands are especially vulnerable to the action of chemical carcinogens, probably because of differential chromatin condensation. Damage to individual chromosomes may be random or nonrandom, depending on the species. Cell death can be correlated with chromatid alterations that occur shortly after treatment with chemical carcinogens. There is also a correlation between mutagenic and carcinogenic activity of some chemical carcinogens and the frequency of sister chromatid exchanges. The question of whether specific chromosome changes are absolutely required for neoplastic transformation cannot be answered because of conflicting data and diverse results from studies even with known carcinogens. Cell transformation may occur without any visible chromosome changes. A universal specific numerical or visible structural chromosomal alteration is not necessarily associated with chemical or viral transformation. Chromosome changes are independent of the etiologic agents: different carcinogens may produce transformation associated with the same abnormal chromosomes, but not all transformed lines invariably exhibit the same abnormality, even with the same chemical. In some species, chromosome having nucleolar organizer regions may be more frequently involved in numerical or structural deviations. Progressively growing tumors also may occur as a result of the proliferation of transformed cells without detectable chromosome changes, indicating that tumorigenicity need not be related to an imbalance of chromosome number or structure. Our studies indicate that chromosome changes are not essential for establishment of neoplasms but that karyotypic instability may result in response to selective growth pressures. ImagesFigure 2Figure 11Figure 3Figure 12Figure 4Figure 5Figure 6Figure 7Figure 8Figure 9Figure 1Figure 10 PMID:826168

  2. Inhibition on Breast Cancer Induced Bone Pain, Metastasis and Osteolysis in Nude Mice by LOVAZA and DHA Fattty Acids

    DTIC Science & Technology

    2011-10-01

    GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007

  3. New Views of a Familiar Beauty

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1

    [figure removed for brevity, see original site] [figure removed for brevity, see original site] Figure 2Figure 3Figure 4Figure 5

    This image composite compares the well-known visible-light picture of the glowing Trifid Nebula (left panel) with infrared views from NASA's Spitzer Space Telescope (remaining three panels). The Trifid Nebula is a giant star-forming cloud of gas and dust located 5,400 light-years away in the constellation Sagittarius.

    The false-color Spitzer images reveal a different side of the Trifid Nebula. Where dark lanes of dust are visible trisecting the nebula in the visible-light picture, bright regions of star-forming activity are seen in the Spitzer pictures. All together, Spitzer uncovered 30 massive embryonic stars and 120 smaller newborn stars throughout the Trifid Nebula, in both its dark lanes and luminous clouds. These stars are visible in all the Spitzer images, mainly as yellow or red spots. Embryonic stars are developing stars about to burst into existence. Ten of the 30 massive embryos discovered by Spitzer were found in four dark cores, or stellar 'incubators,' where stars are born. Astronomers using data from the Institute of Radioastronomy millimeter telescope in Spain had previously identified these cores but thought they were not quite ripe for stars. Spitzer's highly sensitive infrared eyes were able to penetrate all four cores to reveal rapidly growing embryos.

    Astronomers can actually count the individual embryos tucked inside the cores by looking closely at the Spitzer image taken by its infrared array camera (figure 4). This instrument has the highest spatial resolution of Spitzer's imaging cameras. The Spitzer image from the multiband imaging photometer (figure 5), on the other hand, specializes in detecting cooler materials. Its view highlights the relatively cool core material falling onto the Trifid's growing embryos. The middle panel is a combination of Spitzer data from both of these instruments.

    The embryos are thought to have been triggered by a massive 'type O' star, which can be seen as a white spot at the center of the nebula in all four images. Type O stars are the most massive stars, ending their brief lives in explosive supernovas. The small newborn stars probably arose at the same time as the O star, and from the same original cloud of gas and dust.

    The Spitzer infrared array camera image is a three-color composite of invisible light, showing emissions from wavelengths of 3.6 microns (blue), 4.5 microns (green), 5.8 and 8.0 microns (red). The Spitzer multiband imaging photometer image (figure 3) shows 24-micron emissions. The Spitzer mosaic image combines data from these pictures, showing light of 4.5 microns (blue), 8.0 microns (green) and 24 microns (red). The visible-light image (figure 2) is from the National Optical Astronomy Observatory, Tucson, Ariz.

  4. Critical periods of vulnerability for the developing nervous system: evidence from humans and animal models.

    PubMed Central

    Rice, D; Barone, S

    2000-01-01

    Vulnerable periods during the development of the nervous system are sensitive to environmental insults because they are dependent on the temporal and regional emergence of critical developmental processes (i.e., proliferation, migration, differentiation, synaptogenesis, myelination, and apoptosis). Evidence from numerous sources demonstrates that neural development extends from the embryonic period through adolescence. In general, the sequence of events is comparable among species, although the time scales are considerably different. Developmental exposure of animals or humans to numerous agents (e.g., X-ray irradiation, methylazoxymethanol, ethanol, lead, methyl mercury, or chlorpyrifos) demonstrates that interference with one or more of these developmental processes can lead to developmental neurotoxicity. Different behavioral domains (e.g., sensory, motor, and various cognitive functions) are subserved by different brain areas. Although there are important differences between the rodent and human brain, analogous structures can be identified. Moreover, the ontogeny of specific behaviors can be used to draw inferences regarding the maturation of specific brain structures or neural circuits in rodents and primates, including humans. Furthermore, various clinical disorders in humans (e.g., schizophrenia, dyslexia, epilepsy, and autism) may also be the result of interference with normal ontogeny of developmental processes in the nervous system. Of critical concern is the possibility that developmental exposure to neurotoxicants may result in an acceleration of age-related decline in function. This concern is compounded by the fact that developmental neurotoxicity that results in small effects can have a profound societal impact when amortized across the entire population and across the life span of humans. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 8 Figure 9 Figure 12 Figure 14 Figure 16 Figure 17 PMID:10852851

  5. Differential Deposition for Surface Figure Corrections in Grazing Incidence X-Ray Optics

    NASA Technical Reports Server (NTRS)

    Ramsey, Brian D.; Kilaru, Kiranmayee; Atkins, Carolyn; Gubarev, Mikhail V.; Broadway, David M.

    2015-01-01

    Differential deposition corrects the low- and mid- spatial-frequency deviations in the axial figure of Wolter-type grazing incidence X-ray optics. Figure deviations is one of the major contributors to the achievable angular resolution. Minimizing figure errors can significantly improve the imaging quality of X-ray optics. Material of varying thickness is selectively deposited, using DC magnetron sputtering, along the length of optic to minimize figure deviations. Custom vacuum chambers are built that can incorporate full-shell and segmented Xray optics. Metrology data of preliminary corrections on a single meridian of full-shell x-ray optics show an improvement of mid-spatial frequencies from 6.7 to 1.8 arc secs HPD. Efforts are in progress to correct a full-shell and segmented optics and to verify angular-resolution improvement with X-ray testing.

  6. Improvements in the Omni-Directional Treadmill: Summary Report and Recommendations for Future Development

    DTIC Science & Technology

    2006-10-01

    6 Figure 6. CyberStrider (Jacobus et al., 1998, page 17), contract number M67004-96-C-0027. ....7 Figure 7. Veda system...1998 and developed by Veda , Inc., uses optical tracking to locate the user within a defined volume (Lockheed Martin, 1997). The Veda System is...Figure 7. Veda system. 8 In 1993, the Naval Air Warfare Center’s Training Systems Division developed the team tactical

  7. Asia and the Science and Politics of Pandemics. 3rd Revision

    DTIC Science & Technology

    2007-04-01

    Appendix B: Speaker Bios 25 Figures Figure 1: Transmission paths of Avian Influenza 8 Figure 2: Migratory Bird Flyways 10 Introduction On...viruses from wild birds to domestic ducks and chickens. • Asia also has a sizable pig population. Pigs can act as mixing vessels for strains of...that infects birds . These viruses mutate often and can be found in other species, including domestic farm animals and humans. Some forms of the

  8. Assessment and Classification of Cognitive Decrements Associated with High Workload and Extended Work Periods in a UAV Setting

    DTIC Science & Technology

    2008-07-01

    Percentage of distracters hit for the high workload condition as a function of time-on- task...a function of time-on- task .... 8 Figure 4. Effort scores for the high workload condition as a function of time-on-task ................ 9...Figure 5. Mental demand for the high workload condition as a function of time-on-task ........... 9 Figure 6. Average power for site Oz, alpha band

  9. A Flow Visualization Study of Laminar/Turbulent Transition in a Curved Channel

    DTIC Science & Technology

    1987-03-01

    convected down- stream, to deform as shown in Figure 16. One possible arrangement of velocity vectors in the radial plane which could cause such a...Re 2231 KODAK RECORDING FEILD ASA 1,000 (f2.8, B) 10 ....... .... . . . . . . .. Figure C.33 IV-4 2100-2330 15 FEB 1987 8.0 % FLOW (rotameter) MEAN

  10. Tonoplast-Bound Protein Kinase Phosphorylates Tonoplast Intrinsic Protein 1

    PubMed Central

    Johnson, Kenneth D.; Chrispeels, Maarten J.

    1992-01-01

    Tonoplast intrinsic protein (TIP) is a member of a family of putative membrane channels found in bacteria, animals, and plants. Plants have seed-specific, vegetative/reproductive organ-specific, and water-stress-induced forms of TIP. Here, we report that the seed-specific TIP is a phosphoprotein whose phosphorylation can be monitored in vivo by allowing bean cotyledons to take up [32P]orthophosphate and in vitro by incubating purified tonoplasts with γ-labeled [32P]ATP. Characterization of the in vitro phosphorylation of TIP indicates that a membrane-bound protein kinase phosphorylates TIP in a Ca2+-dependent manner. The capacity of the isolated tonoplast membranes to phosphorylate TIP declined markedly during seed germination, and this decline occurred well before the development-mediated decrease in TIP occurs. Phosphoamino acid analysis of purified, radiolabeled TIP showed that serine is the major, if not only, phosphorylated residue, and cyanogen bromide cleavage yielded a single radioactive peptide peak on a reverse-phase high-performance liquid chromatogram. Estimation of the molecular mass of the cyanogen bromide phosphopeptide by laser desorption mass spectroscopy led to its identification as the hydrophilic N-terminal domain of TIP. The putative phosphate-accepting serine residue occurs in a consensus phosphorylation site for serine/threonine protein kinases. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:16653198

  11. Adaptive Processing of RADARSAT-1 Fine Mode Data: Ship Parameter Estimation

    DTIC Science & Technology

    2007-03-01

    53 Figure 60: D7S1, the 63 m long freighter “ Germa ” is one of the smallest ships in the data set. .. 53 Figure 61: D6S1...5 10 15 20 25 30 length [m] N um be r of s hi ps Figure 1: Length histogram of analyzed ships according to the AIS data. 8 DRDC Ottawa TM 2007...053 0 50 100 150 200 250 300 350 400 0 5 10 15 20 25 θ [°] N um be r of s hi ps Figure 2: Aspect angle histogram of analyzed ships

  12. Preparation and applicability of a test of speech perception with pictures.

    PubMed

    Souza, Laís Flavia de; Braga, Gabriela Rosito Alvarez Bernardez; Mota, Ana Lúcia Rios; Zamberlan-Amorim, Nelma Ellen; Reis, Ana Cláudia Mirândola Barbosa

    2016-01-01

    To prepare and apply support material for responses to the Speech Recognition Percentage Index (SRPI) test in children. This is a descriptive, exploratory study conducted in two phases: in the first phase, 31 speech-language pathologists (referees) prepared material composed of regular, frequently used monosyllabic and disyllabic words belonging to the vocabulary of children and figures that could represent these words; the second phase consisted in the application of this material to 30 normal-hearing children aged 2 to 4 years and 11 months. The material consisted of 25 words and six boards with six figures each. The word selection criterion adopted by the referees included the initial phoneme and real, colorful figures familiar to the children. The mean scores of the children in the SRPI test were 93% (SD ± 8%) with the support of figures and 64% (SD ± 25%) without figure support. Comparison between the results obtained with and without the support of figures showed significant difference for 15 of the 25 test words, with higher scores with the use of supporting figures. Comparison between correct and incorrect responses using the support of figures showed significant difference only for the word "dog" ("cão") (p=0.0079). There was agreement among the referees with respect to the words and figures. The SRPI test can be rapidly and easily applied, allowing evaluation and systematic monitoring of speech perception ability regardless of child verbalization capacity.

  13. Crema

    DTIC Science & Technology

    2015-08-01

    Crema FizzBuzz Program .................................................. 8 Figure 4: Hello World program written in C...11 Figure 5: Hello World program written in Crema...KLEE Coverage for " Hello , World" Program ................................................................ 14 Table 2: Qmail State-space Explosion

  14. Eduard Jaeger's Test-Types (Schrift-Scalen) and the historical development of vision tests.

    PubMed Central

    Runge, P E

    2000-01-01

    PURPOSE: Eduard Jaeger's original Test-Types were carefully evaluated: (1) to determine whether Jaeger had maintained a consistent standard, (2) to establish the correct Snellen equivalent for Jaeger's Test-Types, (3) to answer the question of why and how the standard was lost, and (4) to compare the visual angle of optotypes to lines of continuous text. METHODS: All original Viennese editions of Jaeger's Test-Types, as well as first generation United Kingdom (UK) and United States (US) versions, were evaluated. Data were collected objectively using a microruler with a 20X loupe and subjectively using a laser distance-measuring device. The data were analyzed using Microsoft Excel. All previous measurements of Jaeger's Test-Types, objective and subjective, collected over the past 133 years were compared to the current data and to each other. RESULTS: The correct Snellen equivalent of Jaeger's Test-Types was determined. The visual angle created from the measurement of the height of lowercase letters, without ascenders or descenders, provides an accurate method of assigning a visual angle of a line of continuous text. Comparing the typefaces used in printing first generation UK and US versions of Jaeger's Test-Types to the Viennese editions provided an explanation for the absence of a consistent standard for Jaeger's Test-Types today. CONCLUSIONS: All 10 versions of Jaeger's original Test-Types are virtually identical and established a gold standard for reading vision tests. Jaeger's standard was lost when his Test-Types were first printed in the UK and the US using local typefaces. The Jaeger standard has been re-established. Visual angles determined using continuous text are comparable to those obtained by using optotypes. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7C FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19A FIGURE 19B p409-a FIGURE 20 FIGURE 21 FIGURE 22 FIGURE 23 FIGURE 24 FIGURE 25 FIGURE 26 FIGURE 27 FIGURE 28A FIGURE 28B FIGURE 28C FIGURE 29 FIGURE 30 FIGURE 31 FIGURE 32 FIGURE 33 FIGURE 34 FIGURE 35 FIGURE 36A FIGURE 37 FIGURE 38 FIGURE 39 PMID:11190034

  15. Historical Temporal Shipping (HITS)

    DTIC Science & Technology

    1978-06-28

    Histogram Cells 45 El Figure 4-3 Projection of Area onto Route Perpendicular 45 Figure 4-4 Single Column Cut of Route Envelope 46ii Figure 4-5 Histogram of...Resources, "Super" Bulk Carriers, and Deepwater Port Development." Naval Postgraduate School . June 1974. 8. Gulland, J.A. "The Fish Resources of the Ocean...sailing reports from the various harbour masters. The completeness of the data thus depends in most cases upon the diligence of a single reporting source

  16. Fluorescence, polarized fluorescence, and Brewster angle microscopy of palmitic acid and lung surfactant protein B monolayers.

    PubMed Central

    Lipp, M M; Lee, K Y; Waring, A; Zasadzinski, J A

    1997-01-01

    Fluorescence, polarized fluorescence, and Brewster angle microscopy reveal that human lung surfactant protein SP-B and its amino terminus (SP-B[1-25]) alter the phase behavior of palmitic acid monolayers by inhibiting the formation of condensed phases and creating a new fluid protein-rich phase. This fluid phase forms a network that separates condensed phase domains at coexistence and persists to high surface pressures. The network changes the monolayer collapse mechanism from heterogeneous nucleation/growth and fracturing processes to a more homogeneous process through isolating individual condensed phase domains. This results in higher surface pressures at collapse, and monolayers easier to respread on expansion, factors essential to the in vivo function of lung surfactant. The network is stabilized by a low-line tension between the coexisting phases, as confirmed by the observation of extended linear domains, or "stripe" phases, and a Gouy-Chapman analysis of protein-containing monolayers. Comparison of isotherm data and observed morphologies of monolayers containing SP-B(1-25) with those containing the full SP-B sequence show that the shortened peptide retains most of the native activity of the full-length protein, which may lead to cheaper and more effective synthetic replacement formulations. Images FIGURE 1 FIGURE 3 FIGURE 4 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 PMID:9168053

  17. Differential expression of cytokeratin mRNA and protein in normal prostate, prostatic intraepithelial neoplasia, and invasive carcinoma.

    PubMed Central

    Yang, Y.; Hao, J.; Liu, X.; Dalkin, B.; Nagle, R. B.

    1997-01-01

    The expression of cytokeratin (CK) mRNA for CK5, -8, -14, -16, and -19 was investigated in normal prostate, prostatic intraepithelial neoplasia (PIN) lesions, and invasive carcinoma using in situ hybridization. Protein localization was carried out in adjacent sections using immunohistochemistry and correlated with mRNA expression. Snap-frozen human prostate samples including 22 examples of normal glands, 20 cases of PIN lesions, and 12 cases of invasive carcinoma were examined. CK5 and -14 mRNA and protein were prominently expressed only in the basal cells of normal glands and PIN lesions. CK14 mRNA was absent in the luminal cells of the most of the PIN lesions but was seen at a low level in some PIN lesions. CK14 protein was not detected in any PIN lesion, suggesting that, if the cell that makes up the PIN lesions is derived from a basal cell, CK14 translation is depressed although a low level of CK14 mRNA may persist. CK8 mRNA and protein were constitutively expressed in all epithelia of normal and abnormal prostate tissues. CK19 mRNA and protein were persistently expressed in both basal and luminal cells of the tubular portion of normal glands as well as PIN lesions, but were expressed heterogeneously in both basal and luminal cells of normal alveoli. CK16 mRNA was expressed in a similar pattern as CK19, but CK16 protein was not detected either in normal or in abnormal prostate tissues. In conclusion, the expression of CK19 in PIN lesions is similar to its tubular expression and would support an origin of PIN lesions from this structure rather than the alveolar portion of the glands. The similar cytokeratin expression between PIN lesions and invasive carcinoma further supports the concept that PIN is a precursor lesion of invasive carcinoma. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:9033282

  18. Techniques for Developing an Acquisition Strategy by Profiling Software Risks

    DTIC Science & Technology

    2006-08-01

    Drivers...................................................................................... 13 Figure 8: BMW 745Li Software... BMW 745Li, shown in Figure 8, is a good illustration of the increasing software control of hardware systems in automobiles. Among the many features...roll stabilization, dynamic brake con- trol, coded drive-away protection, an adaptive automatic transmission, and iDrive systems. This list can be

  19. Air bags and ocular injuries.

    PubMed Central

    Stein, J D; Jaeger, E A; Jeffers, J B

    1999-01-01

    PURPOSE: This investigation retrospectively examined ocular injuries associated with air bag deployment to gain a better appreciation of potential risk factors in motor vehicle accidents. National statistics regarding the efficacy of air bags were reviewed. METHODS: Review of the literature from 1991 to 1998 identified 44 articles describing 97 patients with air-bag-induced ocular injuries. Variables extracted from each case were age, sex, height, position in the car, eye wear, vehicle impact speed, visual acuity, and specific ocular injuries. RESULTS: Corneal abrasions occurred in 49% of occupants, hyphemas in 43%, vitreous or retinal hemorrhages in 25%, and retinal tears or detachments in 15%. The globe was ruptured in 10 patients. Patients involved in higher-speed accidents (over 30 mph) sustained a greater percentage of vitreous or retinal hemorrhages and traumatic cataracts, while those at slower speeds were more prone to retinal tears or detachments. In a subset of 14 patients with serious ocular injuries, the impact speed of 11 patients was recorded at 30 mph or less. Slower speed may be a risk factor for some ocular injuries. Occupant height was not a significant factor. National statistics confirm that air bags reduce fatalities in motor vehicle accidents. However, children sitting in the front seat without a seat belt and infants in passenger-side rear-facing car seats are at risk for fatal injury. CONCLUSION: Air bags combined with seat belts are an effective means of reducing injury and death in adults during motor vehicle accidents. However, this study has documented a wide variety of ocular injuries associated with air bag deployment. It is hoped that researchers can develop modifications that continue to save lives while minimizing additional harm. Images FIGURE 1 FIGURE 2A FIGURE 2B FIGURE 2C FIGURE 2D FIGURE 3A FIGURE 3B FIGURE 4 FIGURE 5 FIGURE 7 FIGURE 8 PMID:10703118

  20. Changes in surface figure due to thermal hysteresis

    NASA Astrophysics Data System (ADS)

    Jacobs, S. F.; Johnston, S. C.; Sasian, J. M.; Watson, M.; Targove, J. D.

    1987-01-01

    Thermal cycling hysteresis affects surface figure in low-expansivity mirror substrates. Zerodur, ULE, and Cer-Vit 8-in.-diameter mirrors and dilatometer samples were thermally cycled at uniform rates of 6 K/hr and 60 K/hr, and somewhat faster for nonuniform heating. Figure distortions as large as lambda/10 were observed following nonuniform heating of standard Zerodur, which was the only material exhibiting thermal hysteresis. A new experimental Zerodur appears to be free of this problem.

  1. Surface figure changes due to thermal cycling hysteresis.

    PubMed

    Jacobs, S F; Johnston, S C; Sasian, J M; Watson, M; Targove, J D; Bass, D

    1987-10-15

    How does thermal cycling hysteresis affect surface figure in low expansivity mirror substrates? Zerodur, ULE, and Cer-Vit 20.3-cm (8-in.) diam mirrors and dilatometer samples were thermally cycled at 6 and 60 K/h with uniform and nonuniform heating. Figure distortions as large as lambda/10 were observed only with nonuniform heating of standard Zerodur, which was the only material exhibiting thermal hysteresis. A new experimental Zerodur appears to be free of this problem.

  2. Optimal Robust Matching of Engine Models to Test Data

    DTIC Science & Technology

    2009-02-28

    Monte Carlo process 19 Figure 7: Flowchart of SVD Calculations 22 Figure 8: Schematic Diagram of NPSS Engine Model Components 24 Figure 9: PW2037...System Simulation ( NPSS ). NPSS is an object-oriented modeling environment widely used throughout industry and the USAF. With NPSS , the engine is...34 modifiers are available for adjusting the component representations. The scripting language in NPSS allowed for easy implementation of each solution

  3. Predicting Soil Strength with Remote Sensing Data

    DTIC Science & Technology

    2010-09-01

    292/DCP1.12).....................................................................................................14 Figure 7. Left ( LWD )/Right ( LWD ...Printout) (From LWD Users Guide, 2005) ............15 Figure 8. White Calibration Panel (Pagan...18 Table 4. Trafficability Conditions..................................................................................32 Table 5. Pagan LWD

  4. A Baseline Analysis of In-Transit Shipping Time into and Through the Fifth Fleet Area of Operation With Respect to the Supply Chain Last Nautical Mile

    DTIC Science & Technology

    2011-12-01

    Figure 7. Final Delivery Methods ...................................................................................15 Figure 8. C-2 Greyhound (From USN...Delivery Methods COD aircraft are C-2 Greyhounds that can (only) deliver directly to aircraft carriers. The C-2 has a 1,300 nm range and a payload of...C-2 Greyhound (From USN, 2004a) 17 Figure 9. SH-60 Seahawk conducting VERTREP (From USN, 2004b) The MSC ships load material in Bahrain, Jebel

  5. Nerve Regeneration in vitro: Comparative Effects of Direct and Induced Current and NGF.

    DTIC Science & Technology

    1985-11-26

    four treatment groups: a control group (non-treated), a group treated with nerve growth factor (NGF) at a final concentraion of 10 nM, a group...contained 2-4 dishes per experiment; each experiment was repeated 3-4 times. Nerve growth factor (2.5s) was obtained from R. Bradshaw (Irvine, CA). Direct... growth factor , pulsed electromagnetic fields-vertical and direct current) at 3 days in vitrg are demonstrated in Figures 6- 7. Figure 8 and Figure 9

  6. Before Nugent took charge: early efforts to reform chiropractic education, 1919-1941

    PubMed Central

    Keating, Joseph C

    2003-01-01

    John J. Nugent, D.C. is remembered by many as either the “Abraham Flexner of Chiropractic” or the “anti-Christ of Chiropractic.” From 1941 until his forced retirement in 1959, the Irish-born Palmer graduate was one of the most important factors in the profession's educational reforms. Yet Nugent's work as the National Chiropractic Association's (NCA's) director of research was not the beginning of the campaign to upgrade chiropractic education. This paper looks at earlier influences and events which set the stage for Nugent's campaign. Among these were the introduction of licensure for chiropractors, the self-defeating actions of B.J. Palmer, the introduction of basic science legislation, the lethargy of the schools, and the struggle for control of education between the schools, on the one hand, and the NCA and the Council of State Chiropractic Examining Boards on the other ImagesFigure 1Figure 3Figure 4Figure 5Figure 6Figure 7Figure 9Figure 10Figure 11Figure 12Figure 13Figure 14Figure 15Figure 16Figure 17Figure 18Figure 19Figure 20Figure 21Figure 22Figure 23Figure 24Figure 25Figure 26Figure 28Figure 29Figure 30Figure 31Figure 32Figure 33Figure 34Figure 35Figure 36Figure 37Figure 38

  7. Inhibition of angiogenesis and tumor growth in the brain. Suppression of endothelial cell turnover by penicillamine and the depletion of copper, an angiogenic cofactor.

    PubMed Central

    Brem, S. S.; Zagzag, D.; Tsanaclis, A. M.; Gately, S.; Elkouby, M. P.; Brien, S. E.

    1990-01-01

    Microvascular proliferation, a hallmark of malignant brain tumors, represents an attractive target of anticancer research, especially because of the quiescent nonproliferative endothelium of the normal brain. Cerebral neoplasms sequester copper, a trace metal that modulates angiogenesis. Using a rabbit brain tumor model, normocupremic animals developed large vascularized VX2 carcinomas. By contrast, small, circumscribed, relatively avascular tumors were found in the brains of rabbits copper-depleted by diet and penicillamine treatment (CDPT). The CDPT rabbits showed a significant decrease in serum copper, copper staining of tumor cell nuclei, microvascular density, the tumor volume, endothelial cell turnover, and an increase in the vascular permeability (breakdown of the blood-brain barrier), as well as peritumoral brain edema. In non-tumor-bearing animals, CDPT did not alter the vascular permeability or the brain water content. CDPT also inhibited the intracerebral growth of the 9L gliosarcoma in F-344 rats, with a similar increase of the peritumoral vascular permeability and the brain water content. CDPT failed to inhibit tumor growth and the vascularization of the VX2 carcinoma in the thigh muscle or the metastases to the lung, findings that may reflect regional differences in the responsiveness of the endothelium, the distribution of copper, or the activity of cuproenzymes. Metabolic and pharmacologic withdrawal of copper suppresses intracerebral tumor angiogenesis; angiosuppression is a novel biologic response modifier for the in situ control of tumor growth in the brain. Images Figure 2 Figure 4 Figure 5 Figure 6 Figure 8 Figure 10 Figure 12 Figure 15 Figure 16 PMID:1700617

  8. The Design and Implementation of a Read Prediction Buffer

    DTIC Science & Technology

    1992-12-01

    City, State, and ZIP Code) 7b ADDRESS (City, State. and ZIP Code) 8a. NAME OF FUNDING /SPONSORING 8b. OFFICE SYMBOL 9 PROCUREMENT INSTRUMENT... 9 E. THESIS STRUCTURE.. . .... ............... 9 II. READ PREDICTION ALGORITHM AND BUFFER DESIGN 10 A. THE READ PREDICTION ALGORITHM...29 Figure 9 . Basic Multiplexer Cell .... .......... .. 30 Figure 10. Block Diagram Simulation Labels ......... 38 viii I. INTRODUCTION A

  9. Flutter Generator Control and Force Computer.

    DTIC Science & Technology

    1985-07-01

    exciter module 2. Mechanical load 3. Rectifier and triac 4. Overall system 5. Velocity control 6. Microprocessor 7. Operation in 1 ’g’ environment 8...amplifier Output voltage from the rectifier/ triac circuit (figure 3) is a function of the conduction angle of each triac . In a 400 Hz 3-phase system...3IIGCICI FIRING CIRCUIT FIRING CIRCUIT TO MOTOR Figure 3. Rectifier and triac _____ -=low AEL-0242-TNI Figure 4 DEMAND(V V49 -9 APIFE M O T OR

  10. 16 CFR Figures 2 and 3 to Part 1512 - Handlebar Stem Loading and Entrance 8 Observation Angles

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 2 2013-01-01 2013-01-01 false Handlebar Stem Loading and Entrance 8 Observation Angles 2 Figures 2 and 3 to Part 1512 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION... and 3 to Part 1512—Handlebar Stem Loading and Entrance 8 Observation Angles EC03OC91.071 ...

  11. 16 CFR Figures 2 and 3 to Part 1512 - Handlebar Stem Loading and Entrance 8 Observation Angles

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 2 2012-01-01 2012-01-01 false Handlebar Stem Loading and Entrance 8 Observation Angles 2 Figures 2 and 3 to Part 1512 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION... and 3 to Part 1512—Handlebar Stem Loading and Entrance 8 Observation Angles EC03OC91.071 ...

  12. 16 CFR Figures 2 and 3 to Part 1512 - Handlebar Stem Loading and Entrance 8 Observation Angles

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 2 2014-01-01 2014-01-01 false Handlebar Stem Loading and Entrance 8 Observation Angles 2 Figures 2 and 3 to Part 1512 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION... and 3 to Part 1512—Handlebar Stem Loading and Entrance 8 Observation Angles EC03OC91.071 ...

  13. Taking the Battle Upstream: Towards a Benchmarking Role for NATO

    DTIC Science & Technology

    2012-09-01

    Benchmark.........................................................................................14 Figure 8. World Bank Benchmarking Work on Quality...Search of a Benchmarking Theory for the Public Sector.” 16     Figure 8. World Bank Benchmarking Work on Quality of Governance One of the most...the Ministries of Defense in the countries in which it works ). Another interesting innovation is that for comparison purposes, McKinsey categorized

  14. Morphologic expression of glandular differentiation in the epidermoid nasal carcinomas induced by phenylglycidyl ether inhalation.

    PubMed Central

    Lee, K. P.; Schneider, P. W.; Trochimowicz, H. J.

    1983-01-01

    Charles River-CD Sprague-Dawley rats in 3 equal groups of 100 males and 100 females each were exposed to 12, 1, and 0 ppm of phenylglycidyl ether vapor for 24 months. Nasal tumors were first detected after 621 days' exposure at 12 ppm with an incidence of 11% in males and 4.4% in females. No nasal tumors were found at 1 ppm in rats exposed for 24 months. The nasal tumors, mostly epidermoid carcinomas, were derived from the respiratory epithelium and nasal glands, both of which revealed squamous metaplasia or dysplasia in the anterior nasal cavity. Most nasal tumors were confined to the anterior nasal cavity and occasionally invaded the dorsonasal bones and posterior nasal cavity. The undifferentiated glandular cells appear to differentiate to neoplastic squamous cells, because the ultrastructure of epidermoid carcinoma revealed traits of glandular cell differentiation in the neoplastic squamous cells. The features of glandular cell differentiation in the neoplastic squamous cells were intercellular or intracellular glandular lumens, secretory vesicles, mucus droplets, and intermediate cells showing both glandular and squamous differentiation. Squamous cells in the well-differentiated epidermoid carcinomas revealed abundant tonofibrils, desmosomes, glycogen particulates, and interdigitated cytoplasmic processes. These markers of squamous-cell differentiation were markedly reduced in the undifferentiated epidermoid carcinomas. The spindle-cell squamous carcinoma showed both squamous and fibroblastic-like differentiations. Some spindle cells had only fibroblastic-like differentiation, suggesting spindle-cell metaplasia of the squamous cells. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 PMID:6846500

  15. Elastic Pitch Beam Tail Rotor for LOH

    DTIC Science & Technology

    1976-07-01

    properties at Station 14.5 are EEA = 2.63 x 106 lb (Figure 7) El yy 3.12 x 106 lb-in. 2 (Figure 8) EEIxx .13 x 106 lb-in. 2 (Figure 9) Cy .52 in. (Figure...3M-1002-1014 "S" glass, f CF E 4250(7.0 x 106) = EEA 3.307 x 106 ft = 8996 psi Ftu = 220,000 psi MSt = Ftu - 220,000 1 ft 8996 MSt = 23.46 Ample 60 2...Beam truss members were centered with respect to the hub and formed seals were positioned at the outboard edges of the hub, Furane Plastics 8615 Uralane

  16. 32 CFR Appendix - Figures 4 through 8 to Subpart F of Part 651

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 32 National Defense 4 2010-07-01 2010-07-01 true Figures 4 through 8 to Subpart F of Part 651 National Defense Department of Defense (Continued) DEPARTMENT OF THE ARMY (CONTINUED) ENVIRONMENTAL QUALITY ENVIRONMENTAL ANALYSIS OF ARMY ACTIONS (AR 200-2) Environmental Impact Statement Existing EISs. Pt. 651, Subpt...

  17. Gossypol inhibition of mitosis, cyclin D1 and Rb protein in human mammary cancer cells and cyclin-D1 transfected human fibrosarcoma cells.

    PubMed Central

    Ligueros, M.; Jeoung, D.; Tang, B.; Hochhauser, D.; Reidenberg, M. M.; Sonenberg, M.

    1997-01-01

    The antiproliferative effects of gossypol on human MCF-7 mammary cancer cells and cyclin D1-transfected HT-1060 human fibrosarcoma cells were investigated by cell cycle analysis and effects on the cell cycle regulatory proteins Rb and cyclin D1. Flow cytometry of MCF-7 cells at 24 h indicated that 10 microM gossypol inhibited DNA synthesis by producing a G1/S block. Western blot analysis using anti-human Rb antibodies and anti-human cyclin D1 antibodies in MCF-7 cells and high- and low-expression cyclin D1-transfected fibrosarcoma cells indicated that, after 6 h exposure, gossypol decreased the expression levels of these proteins in a dose-dependent manner. Gossypol also decreased the ratio of phosphorylated to unphosphorylated Rb protein in human mammary cancer and fibrosarcoma cell lines. Gossypol (10 microM) treated also decreased cyclin D1-associated kinase activity on histone H1 used as a substrate in MCF-7 cells. These results suggest that gossypol might suppress growth by modulating the expression of cell cycle regulatory proteins Rb and cyclin D1 and the phosphorylation of Rb protein. Images Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:9218727

  18. Design and Experimental Results for the S406 Airfoil

    DTIC Science & Technology

    2010-08-01

    Concluded.45 46 (a) R = 0.50 × 106. Figure 14.- Comparison of theoretical and experimental section ch with transition free.aracteristics 47 (b) R...106. Figure 15.- Comparison of theoretical and experimental section ch with transition fixed.aracteristics 51 (b) R = 0.70 × 106. Figure 15...04986 4.088 .7022 .013251 −.04644 5.104 . 7845 .014147 −.04381 6.119 .8571 .015149 −.04019 7.135 .9294 .016691 −.03508 8.149 .9947 .017447 −.03106 9.162

  19. Gulf War Illnesses: DOD’s Conclusions about U.S. Troops’ Exposure Cannot be Adequately Supported

    DTIC Science & Technology

    2004-06-01

    well fires, fumes from jet fuel , fumes from burning jet fuel in tents, petroleum in drinking water, depleted uranium munitions, smoking, alcohol use...Explosive 31 Figure 6: Boundary Layer Characteristics 32 Figure 7: Three Types of Plume Geometry 33 Figure 8: The Impact of Nocturnal Jets on a...ignited by thermite grenades—alone and with the addition of diesel fuel —as well as by fused initiation of the burster explosive charge. According to

  20. Personal exposure to JP-8 jet fuel vapors and exhaust at air force bases.

    PubMed Central

    Pleil, J D; Smith, L B; Zelnick, S D

    2000-01-01

    JP-8 jet fuel (similar to commercial/international jet A-1 fuel) is the standard military fuel for all types of vehicles, including the U.S. Air Force aircraft inventory. As such, JP-8 presents the most common chemical exposure in the Air Force, particularly for flight and ground crew personnel during preflight operations and for maintenance personnel performing routine tasks. Personal exposure at an Air Force base occurs through occupational exposure for personnel involved with fuel and aircraft handling and/or through incidental exposure, primarily through inhalation of ambient fuel vapors. Because JP-8 is less volatile than its predecessor fuel (JP-4), contact with liquid fuel on skin and clothing may result in prolonged exposure. The slowly evaporating JP-8 fuel tends to linger on exposed personnel during their interaction with their previously unexposed colleagues. To begin to assess the relative exposures, we made ambient air measurements and used recently developed methods for collecting exhaled breath in special containers. We then analyzed for certain volatile marker compounds for JP-8, as well as for some aromatic hydrocarbons (especially benzene) that are related to long-term health risks. Ambient samples were collected by using compact, battery-operated, personal whole-air samplers that have recently been developed as commercial products; breath samples were collected using our single-breath canister method that uses 1-L canisters fitted with valves and small disposable breathing tubes. We collected breath samples from various groups of Air Force personnel and found a demonstrable JP-8 exposure for all subjects, ranging from slight elevations as compared to a control cohort to > 100 [mutilpe] the control values. This work suggests that further studies should be performed on specific issues to obtain pertinent exposure data. The data can be applied to assessments of health outcomes and to recommendations for changes in the use of personal protective equipment that optimize risk reduction without undue impact on a mission. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:10706522

  1. Comparison of intracerebral inoculation and osmotic blood-brain barrier disruption for delivery of adenovirus, herpesvirus, and iron oxide particles to normal rat brain.

    PubMed Central

    Muldoon, L. L.; Nilaver, G.; Kroll, R. A.; Pagel, M. A.; Breakefield, X. O.; Chiocca, E. A.; Davidson, B. L.; Weissleder, R.; Neuwelt, E. A.

    1995-01-01

    Delivery of adenovirus, herpes simplex virus (HSV), and paramagnetic monocrystalline iron oxide nanoparticles (MION) to rat brain (n = 64) was assessed after intracerebral inoculation or osmotic disruption of the blood-brain barrier (BBB). After intracerebral inoculation, the area of distribution was 7.93 +/- 0.43 mm2 (n = 9) for MION and 9.17 +/- 1.27 mm2 (n = 9) for replication-defective adenovirus. The replication-compromised HSV RH105 spread to 14.00 +/- 0.87 mm2 (n = 8), but also had a large necrotic center (3.54 +/- 0.47 mm2). No infection was detected when virus was administered intra-arterially without hyperosmotic mannitol. After osmotic BBB disruption, delivery of the viruses and MIONs was detected throughout the disrupted cerebral cortex. Positive staining was found in 4 to 845 cells/100 microns thick coronal brain section (n = 7) after adenovirus administration, and in 13 to 197 cells/section (n = 8) after HSV administration. Cells of glial morphology were more frequently stained after administration of adenovirus, whereas neuronal cells were preferentially stained after delivery of both HSV vectors and MION. In a preliminary test of vector delivery in the feline, MION was detected throughout the white matter tracts after inoculation into normal cat brain. Thus MION may be a tool for use in vivo, to monitor the delivery of virus to the central nervous system. Additionally, BBB disruption may be an effective method to globally deliver recombinant viruses to the CNS. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:7495307

  2. Cryosurgery for treatment of trichiasis.

    PubMed Central

    Sullivan, J H; Beard, C; Bullock, J D

    1976-01-01

    We cryosurgically destroyed eyelashes in rabbits and applied the technique to treat 23 selected patients with trichiasis. Liquid nitrogen was sprayed on the eyelid margin by using a double, rapid-freeze, slow-thaw cycle monitored by a subcutaneous thermocouple to -30 degrees C. It was an improvement on electrolysis and a simple alternative to surgery. Images FIGURE 1 FIGURE 2 A FIGURE 2 B FIGURE 3 A FIGURE 3 B FIGURE 4 A FIGURE 4 B FIGURE 5 A FIGURE 5 B FIGURE 7 A FIGURE 7 B PMID:867626

  3. Public figure announcements about cancer and opportunities for cancer communication: a review and research agenda.

    PubMed

    Noar, Seth M; Willoughby, Jessica Fitts; Myrick, Jessica Gall; Brown, Jennifer

    2014-01-01

    Announcements by public figures and celebrities about cancer diagnosis or death represent significant events in public life. But what are the substantive effects of such events, if any? The purpose of this article is to systematically review studies that examined the impact of public figure cancer announcements on cancer-oriented outcomes. Using comprehensive search procedures, we identified k = 19 studies that examined 11 distinct public figures. The most commonly studied public figures were Jade Goody, Kylie Minogue, Nancy Reagan, and Steve Jobs, with the most common cancers studied being breast (53%), cervical (21%), and pancreatic (21%) cancer. Most studies assessed multiple outcome variables, including behavioral outcomes (k = 15), media coverage (k = 10), information seeking (k = 8), cancer incidence (k = 3), and interpersonal communication (k = 2). Results fairly consistently indicated that cancer announcements from public figures had meaningful effects on many, if not most, of these outcome variables. While such events essentially act as naturally occurring interventions, the effects tend to be relatively short term. Gaps in this literature include few contemporary studies of high-profile public figures in the United States and a general lack of theory-based research. Directions for future research as well as implications for cancer communication and prevention are discussed.

  4. ISOLATION AND CHARACTERIZATION OF LAMELLAR BODIES AND TUBULAR MYELIN FROM RAT LUNG HOMOGENATES

    PubMed Central

    Gil, Joan; Reiss, Oscar K.

    1973-01-01

    Three surface-active fractions which differ in their morphology have been isolated from rat lung homogenates by ultracentrifugation in a discontinuous sucrose density gradient. In order of increasing density, the fractions consisted, as shown by electron microscopy, primarily of common myelin figures, lamellar bodies, and tubular myelin figures. The lipid of all three fractions contained approximately 94% polar lipids and 2% cholesterol. In the case of the common myelin figures and the lamellar bodies, the polar lipids consisted of 73% phosphatidylcholines, 9% phosphatidylserines and inositols, and 8% phosphatidylethanolamines. In the case of the tubular myelin figures, the respective percentages were 58, 19, and 5. Over 90% of the fatty acids of the lecithins of all three fractions were saturated. Electrophoresis of the proteins of the fractions in sodium dodecyl sulfate or Triton X-100 revealed that the lamellar bodies and the tubular myelin figures differed in the mobilities of their proteins. The common myelin figures, however, contained proteins from both of the other fractions. These data indicate that, whereas the lipids of the extracellular, alveolar surfactant(s) originate in the lamellar bodies, the proteins arise from another source. It is further postulated that the tubular myelin figures represent a liquid crystalline state of the alveolar surface-active lipoproteins. PMID:4726305

  5. Parasocial Interactions and Relationships in Early Adolescence

    PubMed Central

    Gleason, Tracy R.; Theran, Sally A.; Newberg, Emily M.

    2017-01-01

    Parasocial interactions and relationships, one-sided connections imagined with celebrities and media figures, are common in adolescence and might play a role in adolescent identity formation and autonomy development. We asked 151 early adolescents (Mage = 14.8 years) to identify a famous individual of whom they are fond; we examined the type of celebrities chosen and why they admired them, and the relationships imagined with these figures across the entire sample and by gender. Adolescents emphasized highly salient media figures, such as actors, for parasocial attention. While different categories of celebrities were appreciated equally for their talent and personality, actors/singers were endorsed for their attractiveness more so than other celebrity types. Most adolescents (61.1%) thought of their favorite media figures as relationship partners, and those who did reported more parasocial involvement and emotional intensity than those who did not. Gender differences emerged in that boys chose more athletes than girls and were more likely to imagine celebrities as authority figures or mentors than friends. Celebrities afforded friendship for girls, who overwhelmingly focused on actresses. Hierarchical parasocial relationships may be linked to processes of identity formation as adolescents, particularly boys, imagine media figures as role models. In contrast, egalitarian parasocial relationships might be associated with autonomy development via an imagined affiliation with an attractive and admirable media figure. PMID:28280479

  6. Noise Pollution Aspects of Barge, Railroad, and Truck Transportation,

    DTIC Science & Technology

    1975-04-01

    attenuation alone. (f) Commins, et al, conclude that: (1) a lush vegetative cover will reduce dB( A ) levels by a factor of 4.5 - 4.8dB(A) instead of 3dB...prevailed (Figure lOc). Visual evidence of how much lapse rates affect dB( A ) levels experienced at varying distances from a line source of sound is made...possible by comparing the dB( A ) levels shown in Figures 9a, b and c at varying distances that would occur based solely on geometric attenuation (Figure 11

  7. Performance Assessment of Active Hearing Protection Devices

    DTIC Science & Technology

    2015-05-08

    8 Figure 6. Placement of ATFs and free -field pressure transducer ....................................... 8 Figure 7. Pressure-time history...devices selected for this study were all equipped with a hear-thru setting designed to amplify soft sounds and conversational speech while allowing loud...duration of an impulse noise A ¼” microphone or slender probe (tapered pencil gauge) was used to measure the free - field pressure wave according to the

  8. Numerical and Experimental Evaluation of Blast Retrofit of Windows

    DTIC Science & Technology

    2013-07-18

    Retrofitting windows against blast load environments is a topic under considerable investigation. The retrofits added to existing buildings need the strength...experimentally survived the desired loading environment. Two views of the posttest vertical blind system can be seen in Figure 8. Although the vertical...vertica Figure 8: Posttest views l blind system and the connections Both the numerical and experimental systems deformed in a similar

  9. Coalition Airspace Management and Deconfliction

    DTIC Science & Technology

    2008-01-01

    and the Low- Cost Autonomous Attack System (LOCAAS). Current airspace management procedures are inadequate to deal with these types of weapons. As...drawn to this projection. 11 these spaces over a geocentric terrain removes both types of distortion and is inherently easier to understand, as...shown in Figure 8. Figure 8 - Airspaces on a Geocentric Projection - The corridor airspaces in this picture span large distances, yet on this

  10. Microfabricated 3D Scaffolds for Tissue Engineering Applications

    DTIC Science & Technology

    2005-01-01

    coated layers as sacrificial material for subsequent SU-8 layers (Figure 5b). (a) (b) Figure 5. Four-level SU-8 structure realized with a single...connective tissue progenitor cells on micro-textured polydimethylsiloxane surfaces. Journal of Biomedical Materials Research 2002; 62:499-506. 7. Ratner BD...Applications DISTRIBUTION: Approved for public release, distribution unlimited This paper is part of the following report: TITLE: Materials Research Society

  11. A Simulation of the ECSS Help Desk with the Erlang a Model

    DTIC Science & Technology

    2011-03-01

    a popular distribution is the exponential distribution as shown in Figure 3. Figure 3: Exponential Distribution ( Bourke , 2001) Exponential...System Sciences, Vol 8, 235B. Bourke , P. (2001, January). Miscellaneous Functions. Retrieved January 22, 2011, from http://local.wasp.uwa.edu.au

  12. Structural Maps of the V-17 Beta Regio Quadrangle, Venus

    NASA Technical Reports Server (NTRS)

    Basilevsky, A. t.; Head, James W.

    2008-01-01

    These represent slices of the geologic map into 7 time-stratigraphic levels whose descriptions are found in [3-6]. From older to younger they are: 1) Tessera material unit (t), 2) Densely fractured plains material unit (pdf), 3) Fractured and ridged plains material unit (pfr), 4) Tessera transitional terrain structural unit (tt), 5) Fracture belts structural unit (fb), 6) Shield plains (psh) and plains with wrinkle ridges (pwr) material units combined, and 7) Lobate (pl) and smooth (ps) plains material units combined and, approximately contemporaneous with them, the structural unit of rifted terrain (rt). Each slice shows the generalized pattern of structures typical of these units. Figures 1-7 show the seven maps and Figure 8 shows the combined map illustrating what is shown in the seven maps. To visualize the Beta Regio uplift outlines, the major structure of this area, we show the +0.5 km and +2.5 km contour lines, corresponding respectively to the base and the mid-height of the uplift. It is seen in Figures 1-2 and 4 the trends of t, pdf and tt occupy relatively small areas and their structures seen in these small windows appear rather variable and with almost no orientation heritage with time. Figure 3 shows that swarms of ridge belts trend mostly NW and go through the Beta structure with no alignment with it, suggesting that this structure did not yet exist at this time. Figure 5 shows that fracture belts align along the northern base of the Beta uplift suggesting onset of the formation of this structure. Figure 6 shows that wrinkle ridges do not show alignment with the Beta uplift suggesting that this already forming structure was not high enough to exert topographic stress in its vicinity. Figure 7 shows that the Beta uplift has Devana Chasma as an axial rift zone, suggesting a genetic link between the uplift and rifting. Figure 8 shows that structural trends in this area significantly changed with time.

  13. Predicting Software Assurance Using Quality and Reliability Measures

    DTIC Science & Technology

    2014-12-01

    errors are not found in unit testing . The rework effort to correct requirement and design problems in later phases can be as high as 300 to 1,000...Literature 31 Appendix B: Quality Cannot Be Tested In 35 Bibliography 38 CMU/SEI-2014-TN-026 | ii CMU/SEI-2014-TN-026 | iii List of Figures...Removal Densities During Development 10 Figure 8: Quality and Security-Focused Workflow 14 Figure 9: Testing Reliability Results for the Largest Project

  14. Mechanical Properties and Seawater Behavior of Nitronic 50 (22Cr-13Ni- 5Mn) Plate

    DTIC Science & Technology

    1976-01-01

    Bal - balance misc - miscellaneous cfh - cubic feet per hour mpy - mils per year c/m - cycles per minute my - millivolts CVN - Charpy V-notch No...High-Cycle Fatigue Specimens F_gure 6 - Drawings; Low-Cycle Fatigue Specimens Figure 7 - Curve; Charpy V-Notch Impact Toughness Versus Temperature...for Nitronic 50 Base Plate FiGure 8 - Curve; Charpy V-Notch Toughness Versus Tempera- ture for Nitrcnic 50 Weldments Figure 9 - Photographs; Fracture

  15. Meshfree Modeling of Munitions Penetration in Soils

    DTIC Science & Technology

    2017-04-01

    discretization ...................... 8 Figure 2. Nodal smoothing domain for the modified stabilized nonconforming nodal integration...projectile ............................................................................................... 36 Figure 17. Discretization for the...List of Acronyms DEM: discrete element methods FEM: finite element methods MSNNI: modified stabilized nonconforming nodal integration RK

  16. Effects of endocrine-disrupting contaminants on amphibian oogenesis: methoxychlor inhibits progesterone-induced maturation of Xenopus laevis oocytes in vitro.

    PubMed Central

    Pickford, D B; Morris, I D

    1999-01-01

    There is currently little evidence of pollution-induced endocrine dysfunction in amphibia, in spite of widespread concern over global declines in this ecologically diverse group. Data regarding the potential effects of endocrine-disrupting contaminants (EDCs) on reproductive function in amphibia are particularly lacking. We hypothesized that estrogenic EDCs may disrupt progesterone-induced oocyte maturation in the adult amphibian ovary, and tested this with an in vitro germinal vesicle breakdown assay using defolliculated oocytes from the African clawed frog, Xenopus laevis. While a variety of natural and synthetic estrogens and xenoestrogens were inactive in this system, the proestrogenic pesticide methoxychlor was a surprisingly potent inhibitor of progesterone-induced oocyte maturation (median inhibitive concentration, 72 nM). This inhibitory activity was specific to methoxychlor, rather than to its estrogenic contaminants or metabolites, and was not antagonized by the estrogen receptor antagonist ICI 182,780, suggesting that this activity is not estrogenic per se. The inhibitory activity of methoxychlor was dose dependent, reversible, and early acting. However, washout was unable to reverse the effect of short methoxychlor exposure, and methoxychlor did not competitively displace [3H]progesterone from a specific binding site in the oocyte plasma membrane. Therefore, methoxychlor may exert its action not directly at the site of progesterone action, but downstream on early events in maturational signaling, although the precise mechanism of action is unclear. The activity of methoxychlor in this system indicates that xenobiotics may exert endocrine-disrupting effects through interference with progestin-regulated processes and through mechanisms other than receptor antagonism. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:10090707

  17. Angular Motion of Projectiles with a Moving Internal Part.

    DTIC Science & Technology

    1977-02-01

    Ball Rotor T317 hellIntermal Projectile RingsM505 Fuze Quasi-linear Angular Motion N\\ ANSTRACT (-jCanhs si rveree side ff naeweemv end identify by...LIST OF FIGURES Figure Page 1. 20mm Shell T282E1 with Arming Ball Rotor .... .......... 20 2. Fast Mode Damping Rate for the 20mm T282E1...fuze has a spherical arming rotor in a cylindrical cavity with small but non-zero clearanc’es (Figure 1). The fourth sa.ell - the 8-inch T317 - showed

  18. Makef15: An ADCIRC Model Fort.15 Input File Creation GUI for Parameter Specification and Periodic Boundary Forcing

    DTIC Science & Technology

    2007-12-07

    is shown in the sequence of Figures 1 through 4, which were generated on a Linux platform (Fedora Core 3 and Core 6) using the Gnome (version 2.8.0...and KDE (version 3.5.7) desktop environments. Each of these figures presents a view of the GUI as it is scrolled downward one screen at a time with...number of tidal constituents desired vs . the number of selected constituents, see the error display in Figure 18). Several examples were discussed in

  19. Novel Conductive Coatings of Carbon Nanotubes: A Fundamental Study

    DTIC Science & Technology

    2008-02-29

    organic dye from parsley : Parsley leaves were chopped on fine pieces then dissolved in acetone. The mixture was stirred for 3 hours. The extract was then...sensitized solar cell made by coating pigments in an extract from parsley leaves on a nanocrystalline film of TiO 2 has been tested (Figure 6). The...4 2 0 0 2 4 6 8 10 Voltage (V) 16 Figure 6. Solar Cell 17 Figure 7. Output characteristics of a solar cell Absorbance spectrum of parsley 4.5. 4 3.5

  20. An Introduction to Fractals and Chaos

    DTIC Science & Technology

    1989-06-01

    figures in this report were created with programs written in Turbo Pascal 4.0 on a Zenith 248 with EGA. They are in the public domain. A figure was...upgraded both his graphics 1975, with the publication of his first and photographic equipment to pro- book in French, translated into English duce, with...spi.ce 1v.rtr!0!ts .... ....,, ,, ..... ,. -, 1 0 0.8 b 0.6 0.4 0.2 0 Figure 3. A parafita i the ield of aaus’ i’arer ;% omnics , thi t. uiac 1, .- ~VO.iil

  1. 50 CFR Appendix A to Part 654 - Figures

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Figures A Appendix A to Part 654 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE STONE CRAB FISHERY OF THE GULF OF MEXICO Pt. 654, App. A Appendix A to Part 654...

  2. The same molecular mechanism at the maternal meiosis I produces mono- and dicentric 8p duplications.

    PubMed Central

    Floridia, G.; Piantanida, M.; Minelli, A.; Dellavecchia, C.; Bonaglia, C.; Rossi, E.; Gimelli, G.; Croci, G.; Franchi, F.; Gilgenkrantz, S.; Grammatico, P.; Dalprá, L.; Wood, S.; Danesino, C.; Zuffardi, O.

    1996-01-01

    We studied 16 cases of 8p duplications, with a karyotype 46,XX or XY,dup(8p), associated with mental retardation, facial dysmorphisms, and brain defects. We demonstrate that these 8p rearrangements can be either dicentric (6 cases) with the second centromere at the tip of the short arm or monocentric (10 cases). The distal 8p23 region, from D8S349 to the telomere, including the defensin 1 locus, is deleted in all the cases. The region spanning from D8S252 to D8S265, at the proximal 8p23 region, is present in single copy, and the remaining part of the abnormal 8 short arm is duplicated in the dicentric cases and partially duplicated in the monocentric ones. The distal edge of the duplication always spans up to D8S552 (8p23.1), while its proximal edge includes the centromere in the dicentric cases and varies from case to case in the monocentric ones. The analysis of DNA polymorphisms indicates that the rearrangement is consistently of maternal origin. In the deleted region, only paternal alleles were present in the patient. In the duplicated region, besides one paternal allele, some loci showed two different maternal alleles, while others, which were duplicated by FISH analysis, showed only one maternal allele. We hypothesize that, at maternal meiosis I, there was abnormal pairing of chromosomes 8 followed by anomalous crossover at the regions delimited by D8S552 and D8S35 and by D8S252 and D8S349, which presumably contain inverted repeated sequences. The resulting dicentric chromosome, 8qter-8p23.1(D8S552)::8p23.1-(D8S35)-8q ter, due to the presence of two centromeres, breaks at anaphase I, generating an inverted duplicated 8p, dicentric if the breakage occurs at the centromere or monocentric if it occurs between centromeres. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8644743

  3. Study of Mechano-Chemical Machining of Ceramics and the Effect on Thin Film Behavior.

    DTIC Science & Technology

    1983-01-01

    with Fe2O3 Under Various Pressures 9 7 Nomarski Micrographs of an Si N Substrate (a) Before *. and (b) After Mechanochemical Polishing 11 8 -Surface...the entire polished surface did not reveal any scratches. Figure 7 com- pares the Nomarski micrographs of an Si3 N4 substrate before (in the as...mechanochemically polished Si3N4 substrates, using an interferometric technique. The surface figure of a 2.5 x 2.5 cm Si 3N4 substrate is shown in Figure 9. This fig

  4. A simplified plastic embedding and immunohistologic technique for immunophenotypic analysis of human hematopoietic and lymphoid tissues.

    PubMed Central

    Casey, T. T.; Cousar, J. B.; Collins, R. D.

    1988-01-01

    Routine fixation and paraffin embedding destroys many hematopoietic and lymphoid differentiation antigens detected by flow cytometry or frozen section immunohistochemistry. On the other hand, morphologic evaluation is difficult in flow cytometric or frozen section studies. A simplified three-step plastic embedding system using acetone-fixed tissues embedded in glycol-methacrylate (GMA) resin has been found to provide both excellent morphologic and antigenic preservation. With our system, a wide variety of antigens are detected in plastic sections without trypsinization or prolonged embedding procedures; pan-B (CD19, CD22), pan-T (CD7, CD5, CD3, CD2), T-subset (CD4, CD8, CD1, CD25) markers as well as surface immunoglobulin and markers for myeloid and mononuclear-phagocyte cells are preserved. In summary, modifications of plastic embedding techniques used in this study simplify the procedure, apparently achieve excellent antigenic preservation, and facilitate evaluation of morphologic details in relation to immunocytochemical markers. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:3282442

  5. 2001 Michigan traffic crash facts

    DOT National Transportation Integrated Search

    2002-06-18

    The 2001 traffic fatality count was 1,328, down 3.9 percent from the 2000 figure of 1,382. : Compared with 2000, injuries were down 7.8 percent and total crashes were down 5.7 : percent. These figures translated into a death rate of 1.4 per 100 milli...

  6. Effects of nutrition on disease and life span. I. Immune responses, cardiovascular pathology, and life span in MRL mice.

    PubMed Central

    Mark, D. A.; Alonso, D. R.; Quimby, F.; Thaler, H. T.; Kim, Y. T.; Fernandes, G.; Good, R. A.; Weksler, M. E.

    1984-01-01

    Mice of the autoimmune, lymphoproliferative strain MRL/lpr and the congenic, nonlymphoproliferative strain MRL/n were fed one of six diets from weaning on-ward. These mice were sacrificed at 3 or 5 months of age. Low fat diets resulted in lower cholesterol and higher triglyceride levels than did cholesterol-containing high-fat diets. Caloric restriction of MRL/lpr mice was associated with an increased plaque-forming cell response to trinitrophenylated polyacrylamide beads, less lymphoproliferation, and less severe glomerulonephritis. Diet did not affect the incidence of autoimmune vasculitis in MRL/lpr mice sacrificed at 5 months. MRL/lpr mice fed a low-fat, calorically restricted diet from 5 months of age to death lived longer than mice which were fed ad libitum a cholesterol-containing, high-fat diet. At death, MRL/lpr mice fed the former diet had the autoimmune vasculitis which had been evident in mice killed at 5 months, whereas mice fed the latter diet, in addition to the vasculitis, had a high incidence of atherosclerotic lesions of intrarenal and aortic branch arteries. Images Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 PMID:6333184

  7. Peliosis hepatis and sinusoidal dilation during infection by the human immunodeficiency virus (HIV). An ultrastructural study.

    PubMed Central

    Scoazec, J. Y.; Marche, C.; Girard, P. M.; Houtmann, J.; Durand-Schneider, A. M.; Saimot, A. G.; Benhamou, J. P.; Feldmann, G.

    1988-01-01

    The description of hepatic sinusoidal lesions in a significant number of acquired immunodeficiency syndrome (AIDS) patients prompted the authors to undertake an ultrastructural study of the sinusoidal barrier abnormalities during human immunodeficiency virus (HIV) infection, in order to compare these lesions with those described in other conditions and to discuss their possible origin. In a series of 29 patients with serologic evidence of HIV infection and liver abnormalities, 8 (28%) had sinusoidal lesions. Peliosis hepatis was present in 2 cases, and sinusoidal dilatation in 6. These patients were classified as follows: 3 AIDS, 4 AIDS-related complex, 1 unclassifiable. Ultrastructural lesions of the sinusoidal barrier were observed in all the cases. They closely mimicked the changes previously reported in peliotic and peliotic-like changes of various origins. A striking particularity was, however, the presence of numerous and hyperplastic sinusoidal macrophages. This work suggests that an injury of the endothelial cells, directly or indirectly related to the presence of HIV, may be incriminated in the pathogenesis of sinusoidal lesions during HIV infection. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:3354642

  8. Joshua N Haldeman, DC: the Canadian Years, 1926-1950

    PubMed Central

    Keating, Joseph C; Haldeman, Scott

    1995-01-01

    Born in 1902 to the earliest chiropractor known to practice in Canada, Joshua Norman Haldeman would develop national and international stature as a political economist, provincial and national professional leader, and sportsman/adventurer. A 1926 graduate of the Palmer School of Chiropractic, he would maintain a lifelong friendship with B.J. Palmer, and served in the late 1940s as Canada’s representative to the Board of Control of the International Chiropractors’ Association. Yet, he would also maintain strong alliances with broad-scope leaders in Canada and the United States, including the administrators of the National and Lincoln chiropractic schools. Haldeman, who would practice chiropractic in Regina for at least 15 years, was instrumental in obtaining, and is credited with composing the wording of, Saskatchewan’s 1943 Chiropractic Act. He served on the province’s first board of examiners and the provincial society’s first executive board. The following year Dr. Haldeman represented Saskatchewan in the deliberations organized by Walter Sturdy, D.C. that gave rise to the Dominion Council of Canadian Chiropractors, forerunner of today’s Canadian Chiropractic Association. As a member of the Dominion Council he fought for inclusion of chiropractors as commissioned officers during World War II, and participated in the formation of the Canadian Memorial Chiropractic College, which he subsequently served as a member of the first board of directors. Dr. Haldeman also earned a place in the political history of Canada, owing to his service as research director for Technocracy, Inc. of Canada, his national chairmanship of the Social Credit Party during the second world war, and his unsuccessful bid for the national parliament. His vocal opposition to Communism during the war briefly landed him in jail. His 1950 relocation of his family and practice to Pretoria, South Africa would open a new page in his career: once again as professional pioneer, but also as aviator and explorer. Although he died in 1974, the values he instilled in his son, Scott Haldeman, D.C., Ph.D., M.D. continue to influence the profession. ImagesFigure 1Figure 2Figure 2Figure 3Figure 4Figure 5Figure 6Figure 7Figure 8Figure 9Figure 10

  9. The ophthalmic implications of the correction of late enophthalmos following severe midfacial trauma.

    PubMed Central

    Iliff, N T

    1991-01-01

    Severe midfacial trauma presents several challenges to the reconstructive surgeon. Acute rigid fixation of the facial skeleton accompanied by bone grafting to restore the confines and volume of the orbit provide the best opportunity for acceptable aesthetic results. The severity of the trauma causes the late postoperative complication of enophthalmos. Injury to orbital structures with subsequent cicatricial change results in significant alteration in extraocular motility with resultant diplopia. There are no reports in the literature which critically evaluate the effect of late enophthalmos correction on extraocular motility, diplopia, and vision in patients who have suffered Le Fort or NOE fractures. A retrospective study is presented which reviews the results of late surgery for the correction of enophthalmos in 40 patients, all of whom had severe "impure" orbital fractures. This study addresses the following questions: (1) Can the globe effectively be repositioned?, (2) Is there a change in subjective diplopia?, (3) Does a change in extraocular motility occur, and if it does, is it predictable?, (4) Is there a risk to visual acuity? and finally, (5) Do the answers to questions 1 through 4 suggest that late surgical intervention for the correction of enophthalmos should be recommended for this patient population? During a 9-year period, 44 patients with severe diplopia trauma received surgery for enophthalmos correction. A review of 40 patients on whom 56 operations were performed is presented. Thirty-eight patients had enophthalmos and 35 had inferior displacement of the globe. Medial displacement of the globe occurred in 11 patients. Twenty-nine patients had diplopia. Six patients had vision too poor on the injured side to have diplopia. Enophthalmos was improved in 32 patients. Dystopia of the globe was improved in 31 cases. However, neither enophthalmos nor dystopia of the globe could be improved with every operation. Only 35 of the 48 operations for enophthalmos for which measurements were available produced an improvement; in 1 case the enophthalmos was thought to be worse postoperatively. Dystopia operations resulted in improvement in 40 of 48 operations; in 2 instances dystopia was worse postoperatively. Diplopia was unchanged by 33 operations, improved by 11 procedures, and worsened by 6. If patients are considered before and after their total reconstruction course, diplopia was improved in 9 of the 29 patients. In seven of these nine, diplopia was eliminated. There was no change in or production of diplopia in 19 patients, and 5 patients had worsening of their double vision.(ABSTRACT TRUNCATED AT 400 WORDS) Images FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20 FIGURE20 FIGURE 20 FIGURE 22 FIGURE 23 PMID:1808816

  10. A Calculation Method for Convective Heat and Mass Transfer in Multiply-Slotted Film-Cooling Applications.

    DTIC Science & Technology

    1980-01-01

    Transport of Heat ..... .......... 8 3. THE SOLUTION PROCEDURE ..... .. ................. 8 3.1 The Finite-Difference Grid Network ... .......... 8 3.2...The Finite-Difference Grid Network. Figure 4: The Iterative Solution Procedure used at each Streamwise Station. Figure 5: Velocity Profiles in the...the finite-difference grid in the y-direction. I is the mixing length. L is the distance in the x-direction from the injection slot entrance to the

  11. Scribe: A Document Specification Language and Its Compiler

    DTIC Science & Technology

    1980-10-01

    34" prints today’s date as "Samedi, le 13 Decembre, 1980". The template "el 8 de Marzo de 1952" prints today’s date as "el 13 de Diciembre de 1980". The...Letter spacing and kerning 20 3.12 Ligatures 24 3.1.3 Diacritical Marks 24 3.2 Lineation and Word Placement 27 3.2.1 Word Spacing and Justification 27...letterhead. 67 Figure 24 : Document format definition for CMU thesis. 68 Figure 25: Twenty basic rules for indexers, from Collison [11]. 74 Figure 26

  12. Physical and Neuropsychiatric Trauma-Wound Healing and Tissue Preservation

    DTIC Science & Technology

    2008-10-01

    Scratch No Scratch+ LOS 8 Scratch + LOS POS Treatment Paradigm 1% both 1% HS 1%FBS Note that the media which showed the least LDH reactivity...shown in Figure 3. Figure 2 Jarvis, Gary PhD W81XWH-05-2-0094 6 Effect of LOS 89i on Cell Death 0.00 0.50 1.00 1.50 2.00 2.50...e le a se 1% FBS 1% FBS & LOS Figure 3 demonstrates that treatment of C6 glioma cells with 89I LPS results in protection of the cells

  13. Medical College of Georgia Complex figures in repeated memory testing: a preliminary study of healthy young adults.

    PubMed

    Yasugi, Mina; Yamashita, Hikari

    2010-02-01

    The Medical College of Georgia Complex Figures developed as an alternate version of the Rey-Osterrieth Complex Figure for repeated assessments. The aim of this study was to examine whether serial assessment with different figures of the Medical College of Georgia Complex Figures could attenuate the practice effects. 64 volunteers (M age = 20.0 yr., SD = 1.9) from a Japanese university were randomly assigned to Same or Different figure conditions. Participants in the Same figure condition underwent repeated assessment using Figure 1 of the Medical College of Georgia Complex Figures on both trials, whereas participants in the Different figure condition received Figure 1 on first trials and the Figure 2 on second trials over a 1-mo. test-retest interval. While the Same figure condition showed significant improvements at recall, no practice effect was observed in the Different figure condition. The findings indicated that use of different figures may help attenuate practice effects in repeated testing.

  14. Optic nerve axons and acquired alterations in the appearance of the optic disc.

    PubMed Central

    Wirtschafter, J D

    1983-01-01

    The pathophysiologic events in optic nerve axons have recently been recognized as crucial to an understanding of clinically significant acquired alterations in the ophthalmoscopic appearance of the optic disc. Stasis and related abnormalities of axonal transport appear to explain most aspects of optic nerve head swelling, including optic disc drusen and retinal cottonwool spots. Loss of axoplasm and axonal death can be invoked to interpret optic disc pallor, thinning and narrowing of rim tissue, changes in the size and outline of the optic cup, laminar dots, atrophy of the retinal nerve fiber layer, and acquired demyelination and myelination of the retinal nerve fiber layer. It is speculated that the axons may also play a role in the mechanical support of the lamina cribrosa in resisting the pressure gradient across the pars scleralis of the optic nerve head. Axons and their associated glial cells may be involved in those cases where "reversibility" of cupping of the optic disc has been reported. The structure, physiology, and experimental pathologic findings of the optic nerve head have been reviewed. Many aspects concerning the final anatomic appearance of the optic nerve head have been explained. However, many questions remain concerning the intermediate mechanisms by which increased intracranial pressure retards the various components of axonal transport in papilledema and by which increased IOP causes axonal loss in glaucoma. Investigation of the molecular biology of axonal constituents and their responses to abnormalities in their physical and chemical milieu could extend our understanding of the events that result from mechanical compression and local ischemia. Moreover, we have identified a need to further explore the role of axons in the pathophysiology of optic disc cupping. Images FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 11 FIGURE 12 FIGURE 13 PMID:6203209

  15. Autonomous Control Modes and Optimized Path Guidance for Shipboard Landing in High Sea States

    DTIC Science & Technology

    2015-11-16

    a degraded visual environment, workload during the landing task begins to approach the limits of a human pilot’s capability. It is a similarly...Figure 2. Approach Trajectory ±4 ft landing error ±8 ft landing error ±12 ft landing error Flight Path -3000...heave and yaw axes. Figure 5. Open loop system generation ±4 ft landing error ±8 ft landing error ±12 ft landing error -10 -8 -6 -4 -2 0 2 4

  16. OECD in Figures, 2008

    ERIC Educational Resources Information Center

    OECD Publishing (NJ1), 2008

    2008-01-01

    "OECD in Figures" is a primary statistical source for key data on OECD countries, ranging from economic growth and employment to inflation, trade and environment. Information is presented in tabular form for: (1) Demography and Health; (2) Economy; (3) Energy; (4) Labour; (5) Science and Technology; (6) Environment; (7) Education; (8)…

  17. Army Battlefield Distribution Through the Lens of OIF: Logical Failures and the Way Ahead

    DTIC Science & Technology

    2005-02-02

    3 Historical Context of Logistics and Distribution Management Transformation...THEATER DISTRIBUTION UNITS ............................................... 66 iii TABLE OF FIGURES Figure 1. Distribution Management Center...consumer and a potential provider of logistics.8 Historical Context of Logistics and Distribution Management Transformation The critical role of

  18. Applying the Theory of Constraints to a Base Civil Engineering Operations Branch

    DTIC Science & Technology

    1991-09-01

    Figure Page 1. Typical Work Order Processing . .......... 7 2. Typical Job Order Processing . .......... 8 3. Typical Simplified In-Service Work Plan for...Customers’ Customer Request Service Planning Unit Production] Control Center Material Control Scheduling CE Shops Figure 1.. Typical Work Order Processing 7

  19. Spring-Based Helmet System Support Prototype to Address Aircrew Neck Strain

    DTIC Science & Technology

    2014-06-01

    Helicopter Squadron stationed at CFB Borden ALSE Personnel Flight Engineers Pilots 4.6 Discussion of Verification Results 4.6.1 Reduce the mass on the...the participant in the pilot’s posture. Figure 8. A simulation of Flight Engineers’ postures during landing and low flying maneuvres. Figure 9

  20. 49 CFR 572.135 - Upper and lower torso assemblies and torso flexion test procedure.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... orientation angle may not exceed 20 degrees. (8) Attach the pull cable and the load cell as shown in Figure O4. (9) Apply a tension force in the midsagittal plane to the pull cable as shown in Figure O4 at any...

  1. The Development of Peer Perception Systems in Childhood and Early Adolescence

    ERIC Educational Resources Information Center

    Barratt, Barnaby B.

    1977-01-01

    During individual interviews, each of 64 subjects, aged 8 to 14, generated a peer perception grid in which 17 supplied figures were rated on 10 individually elicited bipolar concepts. Three aspects are examined: attributional characteristics of concepts, level of differentiation between peer figures, and organizational complexity of relations…

  2. Assembly and Commissioning of Naval Postgraduate School Gas Gun for Impact Studies

    DTIC Science & Technology

    2009-12-01

    MAIN GAS GUN ASSEMBLY............................................................ 12 1. Launcher Mount Assembly...12 Figure 8. Launcher Mount Assembly [After 5].................................................... 13 Figure 9. Breech...5] The main gas gun assembly comprises of eight sub-assemblies. The assemblies are mounted onto the launcher mount assembly, where it acts as a

  3. Hygroviscoelasticity of the Human Intervertebral Disc.

    DTIC Science & Technology

    1980-07-01

    the intervertebral disc (Figures 2(a) and 2(b)). -7- 7 CERVICAL CURVE (C1 -C7 (CERVICAL LORDOSIS CURVE) THORACIC CURVE (T I- T12) $ (DORSAL KYPHOSIS...CURVE) LUMBAR CURVE (L 1-1.5 ) (LUMBAR LORDOSIS CURVE) PELVIC CURVE (SACRUM) COCCYX FIGURE 1 Lateral View of Vertebral Column *1 -8- POSTERIOR

  4. Feasibility Study of Network Operations Center Collaboration to Improve Application Layer Performance

    DTIC Science & Technology

    2009-03-01

    29 4. NetFlow , sFlow, IPFIX ..........................30 a. NetFlow ...................................30 b. sFlow...From [22])...........................................27 Figure 8. NetFlow Datagram................................31 Figure 9. Deployed CoT...sFlow Monitoring Parameters over NetFlow (From [27]).............................32 Table 6. Collaboration Methodologies Matrix..............39

  5. Ultra-High Sensitive Magnetoelectric Nanocomposite Current Sensors

    DTIC Science & Technology

    2009-12-01

    textured grains. In the sintered composite, PZT -PZN...constant increases by 50% for the moderate degree of texturing . Figure 8 shows the ME coefficient of trilayer with textured PZT – PZN as function of DC...1000 1100 d E /d H ( m V /c m .O e ) Field (Oe) NCZF - PZT - PZN ( textured ) - NCZF Figure 8: ME coefficient of the textured ME composite.

  6. Effects of Trichothecenes on Cardiac Cell Electrical Function

    DTIC Science & Technology

    1985-12-16

    toxic effects . These studies demonstrated unequivocal reversible effects of certain mycotoxins on heart cell electrical activity. Preliminary studies...muscle cells shown in Figure 8 illustrate the typical effects of trichothecene mycotoxins in canine ventricular cells. T-2 tetraol, for 3xample...false tendon cells and V ventricular muscle cells (shown in Figure 8) illustrate the typical effects of trichothecene mycotoxins in canine cardiac

  7. ION BEAM POLARIZATION DYNAMICS IN THE 8 GEV BOOSTER OF THE JLEIC PROJECT AT JLAB

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kondratenko, A. M.; Kondratenko, M. A.; Morozov, Vasiliy

    2016-05-01

    In the Jefferson Lab’s Electron-Ion Collider (JLEIC) project, an injector of polarized ions into the collider ring is a superconducting 8 GeV booster. Both figure-8 and racetrack booster versions were considered. Our analysis showed that the figure-8 ring configuration allows one to preserve the polarization of any ion species during beam acceleration using only small longitudinal field with an integral less than 0.5 Tm. In the racetrack booster, to pre-serve the polarization of ions with the exception of deu-terons, it suffices to use a solenoidal Siberian snake with a maximum field integral of 30 Tm. To preserve deuteron polarization, wemore » propose to use arc magnets for the race-track booster structure with a field ramp rate of the order of 1 T/s. We calculate deuteron and proton beam polari-zations in both the figure-8 and racetrack boosters includ-ing alignment errors of their magnetic elements using the Zgoubi code.« less

  8. Are figure legends sufficient? Evaluating the contribution of associated text to biomedical figure comprehension.

    PubMed

    Yu, Hong; Agarwal, Shashank; Johnston, Mark; Cohen, Aaron

    2009-01-06

    Biomedical scientists need to access figures to validate research facts and to formulate or to test novel research hypotheses. However, figures are difficult to comprehend without associated text (e.g., figure legend and other reference text). We are developing automated systems to extract the relevant explanatory information along with figures extracted from full text articles. Such systems could be very useful in improving figure retrieval and in reducing the workload of biomedical scientists, who otherwise have to retrieve and read the entire full-text journal article to determine which figures are relevant to their research. As a crucial step, we studied the importance of associated text in biomedical figure comprehension. Twenty subjects evaluated three figure-text combinations: figure+legend, figure+legend+title+abstract, and figure+full-text. Using a Likert scale, each subject scored each figure+text according to the extent to which the subject thought he/she understood the meaning of the figure and the confidence in providing the assigned score. Additionally, each subject entered a free text summary for each figure-text. We identified missing information using indicator words present within the text summaries. Both the Likert scores and the missing information were statistically analyzed for differences among the figure-text types. We also evaluated the quality of text summaries with the text-summarization evaluation method the ROUGE score. Our results showed statistically significant differences in figure comprehension when varying levels of text were provided. When the full-text article is not available, presenting just the figure+legend left biomedical researchers lacking 39-68% of the information about a figure as compared to having complete figure comprehension; adding the title and abstract improved the situation, but still left biomedical researchers missing 30% of the information. When the full-text article is available, figure comprehension increased to 86-97%; this indicates that researchers felt that only 3-14% of the necessary information for full figure comprehension was missing when full text was available to them. Clearly there is information in the abstract and in the full text that biomedical scientists deem important for understanding the figures that appear in full-text biomedical articles. We conclude that the texts that appear in full-text biomedical articles are useful for understanding the meaning of a figure, and an effective figure-mining system needs to unlock the information beyond figure legend. Our work provides important guidance to the figure mining systems that extract information only from figure and figure legend.

  9. Are figure legends sufficient? Evaluating the contribution of associated text to biomedical figure comprehension

    PubMed Central

    2009-01-01

    Background Biomedical scientists need to access figures to validate research facts and to formulate or to test novel research hypotheses. However, figures are difficult to comprehend without associated text (e.g., figure legend and other reference text). We are developing automated systems to extract the relevant explanatory information along with figures extracted from full text articles. Such systems could be very useful in improving figure retrieval and in reducing the workload of biomedical scientists, who otherwise have to retrieve and read the entire full-text journal article to determine which figures are relevant to their research. As a crucial step, we studied the importance of associated text in biomedical figure comprehension. Methods Twenty subjects evaluated three figure-text combinations: figure+legend, figure+legend+title+abstract, and figure+full-text. Using a Likert scale, each subject scored each figure+text according to the extent to which the subject thought he/she understood the meaning of the figure and the confidence in providing the assigned score. Additionally, each subject entered a free text summary for each figure-text. We identified missing information using indicator words present within the text summaries. Both the Likert scores and the missing information were statistically analyzed for differences among the figure-text types. We also evaluated the quality of text summaries with the text-summarization evaluation method the ROUGE score. Results Our results showed statistically significant differences in figure comprehension when varying levels of text were provided. When the full-text article is not available, presenting just the figure+legend left biomedical researchers lacking 39–68% of the information about a figure as compared to having complete figure comprehension; adding the title and abstract improved the situation, but still left biomedical researchers missing 30% of the information. When the full-text article is available, figure comprehension increased to 86–97%; this indicates that researchers felt that only 3–14% of the necessary information for full figure comprehension was missing when full text was available to them. Clearly there is information in the abstract and in the full text that biomedical scientists deem important for understanding the figures that appear in full-text biomedical articles. Conclusion We conclude that the texts that appear in full-text biomedical articles are useful for understanding the meaning of a figure, and an effective figure-mining system needs to unlock the information beyond figure legend. Our work provides important guidance to the figure mining systems that extract information only from figure and figure legend. PMID:19126221

  10. Galaxies Gather at Great Distances

    NASA Technical Reports Server (NTRS)

    2006-01-01

    [figure removed for brevity, see original site] Distant Galaxy Cluster Infrared Survey Poster [figure removed for brevity, see original site] [figure removed for brevity, see original site] Bird's Eye View Mosaic Bird's Eye View Mosaic with Clusters [figure removed for brevity, see original site] [figure removed for brevity, see original site] [figure removed for brevity, see original site] 9.1 Billion Light-Years 8.7 Billion Light-Years 8.6 Billion Light-Years

    Astronomers have discovered nearly 300 galaxy clusters and groups, including almost 100 located 8 to 10 billion light-years away, using the space-based Spitzer Space Telescope and the ground-based Mayall 4-meter telescope at Kitt Peak National Observatory in Tucson, Ariz. The new sample represents a six-fold increase in the number of known galaxy clusters and groups at such extreme distances, and will allow astronomers to systematically study massive galaxies two-thirds of the way back to the Big Bang.

    A mosaic portraying a bird's eye view of the field in which the distant clusters were found is shown at upper left. It spans a region of sky 40 times larger than that covered by the full moon as seen from Earth. Thousands of individual images from Spitzer's infrared array camera instrument were stitched together to create this mosaic. The distant clusters are marked with orange dots.

    Close-up images of three of the distant galaxy clusters are shown in the adjoining panels. The clusters appear as a concentration of red dots near the center of each image. These images reveal the galaxies as they were over 8 billion years ago, since that's how long their light took to reach Earth and Spitzer's infrared eyes.

    These pictures are false-color composites, combining ground-based optical images captured by the Mosaic-I camera on the Mayall 4-meter telescope at Kitt Peak, with infrared pictures taken by Spitzer's infrared array camera. Blue and green represent visible light at wavelengths of 0.4 microns and 0.8 microns, respectively, while red indicates infrared light at 4.5 microns.

    Kitt Peak National Observatory is part of the National Optical Astronomy Observatory in Tuscon, Ariz.

  11. Studies of intrastromal corneal ring segments for the correction of low to moderate myopic refractive errors.

    PubMed Central

    Schanzlin, D J

    1999-01-01

    PURPOSE: Intrastromal corneal ring segments (ICRS) were investigated for safety and reliability in the correction of low to moderate myopic refractive errors. METHODS: Initially, 74 patients with spherical equivalent refractive errors between -1.00 and -4.25 diopters (D) received the ICRS in 1 eye. After 6 months, 51 of these patients received the ICRS in the contralateral eye. The total number of eyes investigated was 125. The outcome measures were uncorrected and best-corrected visual acuity, predictability and stability of the refraction, refractive astigmatism, contrast sensitivity, and endothelial cell morphology. RESULTS: The 89 eyes with 12-month follow-up showed significant improvement with uncorrected visual acuities of 20/16 or better in 37%, 20/20 or better in 62%, and 20/40 or better in 97%. Cycloplegic refraction spherical equivalents showed that 68% of the eyes were within +/- 0.50 D and 90% within +/- 1.00 D of the intended correction. Refractive stability was present by 3 months after the surgery. Only 1 patients had a loss greater than 2 lines or 10 letters of best spectacle-corrected visual acuity, but the patient's acuity was 20/20. Refractive cylinder, contrast sensitivity, and endothelial cell morphology were not adversely affected. The ICRS was removed from the eyes of 6 patients. Three removals were prompted by glare and double images occurring at night; 3 were for nonmedical reasons. All patients returned to within +/- 1.00 D of their preoperative refractive spherical equivalent, and no patients lost more than 1 line of best corrected visual acuity by 3 months after ICRS removal. CONCLUSION: The ICRS safely and reliably corrects myopic refractive errors between -1.00 and -4.50 D. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 PMID:10703146

  12. Effects of Trypanocidal Drugs on the Function of Trypanosomes.

    DTIC Science & Technology

    1978-09-01

    trtod) -Odr__primary results during this past year are: a. 7 tbihdtosriso rpnooabue T rciETO10 n T. brucel 427) in vitro as cultured infective...A 174 .I A -V. A, A’ ~ ~ hA 4 T. brucel 0--a BERENIL TRE:ATEO, 5 mg/kg 0-4 CONTROL 20.0- 10.0: 8.0- 4 .0- 0 I- 1.0 - HOURS Figure 22 t7 d **VI Figure...URIDINE INCORPORATION 14- 12- CONTROL 0 E I- I- ETHIDIUM O BROMIDE 4 6 ANTRYCIDE 2 BERENIL SURAMIN 0 10 20 30 40 50 60 MINUTES Figure 29 T. brucel

  13. Uroplakins, specific membrane proteins of urothelial umbrella cells, as histological markers of metastatic transitional cell carcinomas.

    PubMed Central

    Moll, R.; Wu, X. R.; Lin, J. H.; Sun, T. T.

    1995-01-01

    Uroplakins (UPs) Ia, Ib, II, and III, transmembrane proteins constituting the asymmetrical unit membrane of urothelial umbrella cells, are the first specific urothelial differentiation markers described. We investigated the presence and localization patterns of UPs in various human carcinomas by applying immunohistochemistry (avidin-biotin-peroxidase complex method), using rabbit antibodies against UPs II and III, to paraffin sections. Positive reactions for UP III (sometimes very focal) were noted in 14 of the 16 papillary noninvasive transitional cell carcinomas (TCCs) (88%), 29 of the 55 invasive TCCs (53%), and 23 of the 35 TCC metastases (66%). Different localization patterns of UPs could be distinguished, including superficial membrane staining like that found in normal umbrella cells (in papillary carcinoma), luminal (microluminal) membrane staining (in papillary and invasive carcinoma), and, against expectations, peripheral membrane staining (in invasive carcinoma). Non-TCC carcinomas of various origins (n = 177) were consistently negative for UPs. The presence of UPs in metastatic TCCs represents a prime example of even advanced tumor progression being compatible with the (focal) expression of highly specialized differentiation repertoires. Although of only medium-grade sensitivity, UPs do seem to be highly specific urothelial lineage markers, thus operating up interesting histodiagnostic possibilities in cases of carcinoma metastases of uncertain origin. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:7485401

  14. Nanoscale Microelectronic Circuit Development

    DTIC Science & Technology

    2011-06-17

    structure to obtain a one-hot-encoded output instead of a thermometer code …………………………………………………………………………44 Figure 37. A folded ...thermometer code Figure 37. A folded PLINCO cell. The output of the PLINCO is 8-wide, but only the left half or right half is passed on. A carry...noise figure requirements are not stringent since the GPS signal is spread spectrum coded , providing over 40 dB of processing gain and easing the

  15. Automatic Figure Ranking and User Interfacing for Intelligent Figure Search

    PubMed Central

    Yu, Hong; Liu, Feifan; Ramesh, Balaji Polepalli

    2010-01-01

    Background Figures are important experimental results that are typically reported in full-text bioscience articles. Bioscience researchers need to access figures to validate research facts and to formulate or to test novel research hypotheses. On the other hand, the sheer volume of bioscience literature has made it difficult to access figures. Therefore, we are developing an intelligent figure search engine (http://figuresearch.askhermes.org). Existing research in figure search treats each figure equally, but we introduce a novel concept of “figure ranking”: figures appearing in a full-text biomedical article can be ranked by their contribution to the knowledge discovery. Methodology/Findings We empirically validated the hypothesis of figure ranking with over 100 bioscience researchers, and then developed unsupervised natural language processing (NLP) approaches to automatically rank figures. Evaluating on a collection of 202 full-text articles in which authors have ranked the figures based on importance, our best system achieved a weighted error rate of 0.2, which is significantly better than several other baseline systems we explored. We further explored a user interfacing application in which we built novel user interfaces (UIs) incorporating figure ranking, allowing bioscience researchers to efficiently access important figures. Our evaluation results show that 92% of the bioscience researchers prefer as the top two choices the user interfaces in which the most important figures are enlarged. With our automatic figure ranking NLP system, bioscience researchers preferred the UIs in which the most important figures were predicted by our NLP system than the UIs in which the most important figures were randomly assigned. In addition, our results show that there was no statistical difference in bioscience researchers' preference in the UIs generated by automatic figure ranking and UIs by human ranking annotation. Conclusion/Significance The evaluation results conclude that automatic figure ranking and user interfacing as we reported in this study can be fully implemented in online publishing. The novel user interface integrated with the automatic figure ranking system provides a more efficient and robust way to access scientific information in the biomedical domain, which will further enhance our existing figure search engine to better facilitate accessing figures of interest for bioscientists. PMID:20949102

  16. State of the Art of Pavement Response Monitoring Systems for Roads and Airfields Symposium Held March 6-9, 1989 in West Lebanon, New Hampshire,

    DTIC Science & Technology

    1989-09-01

    the extensive fatigue Lood, 84 kn 8011 7 9 8 600 fVAIberto Reseorch Council Strain Gage 0Kyowa H-Beam Strom Gcge [ 400 Figure 2. Location of Alberta 4...2’’ was sI ightv diffherent in) tha the gauge was cemented onto an aluminium plate and protected by a resin (figure 3). Figure 4 Vertical deformation... aluminium plate was not too stiff a measure of the deflection. since it would then have functioned as a The type 2 sensor differs in that it

  17. Uninhabited Military Vehicles (UMVs): Human Factors Issues in Augmenting the Force (Vehicules Militaires sans Pilote (UMV): Questions Relatives aux Facteurs Humains lies a l’augmentation des Forces)

    DTIC Science & Technology

    2007-07-01

    engineering of a process or system that mimics biology, to investigate behaviours in robots that emulate animals such as self - healing and swarming [2...7.3.5 References 7-25 7.4 Adaptive Automation for Robotic Military Systems 7-29 7.4.1 Introduction 7-29 7.4.2 Human Performance Issues for...Figure 6-7 Integrated Display of Video, Range Readings, and Robot Representation 6-31 Figure 6-8 Representing the Pose of a Panning Camera 6-32 Figure

  18. An Analysis of Software Design Methodologies

    DTIC Science & Technology

    1979-08-01

    L[ I + C T 8L1j~j)+ T 2M •_.P and "or" symbols , and with explicit indications of iteration. For example, Figure 5a (from Bell et al, 1977...contains a structure chart with logical "and" ("&") and ."or" ("+’) symbols . Figure 5b illustrates Jacksin’s (1977) approach, in which asterisks ("*") are...is suggested. Such a data flow graph is illustrated in Figure 14. In this case, "T" is the TRANSACTION CENTER and the "(D " symbol is used to indi

  19. Cathodoluminescence and Thermoluminescence of Undoped LTB and LTB:A (A = Cu, Ag, Mn)

    DTIC Science & Technology

    2013-03-01

    operated, tabletop instrument for thermoluminescent dosimetry (TLD) measurements seen in Figure 3-8. It reads one dosimeter per loading and...the more sophisticated Riso TL/ OSL reader that Brant used at the University of Cincinnati [9]. Figure 4-12: TL data for LTB: Ag irradiated with 5

  20. Automated Ontology Alignment with Fuselets for Community of Interest (COI) Integration

    DTIC Science & Technology

    2008-09-01

    Search Example ............................................................................... 22 Figure 8 - Federated Search Example Revisited...integrating information from various sources through a single query. This is the traditional federated search problem, where the sources don’t...Figure 7 - Federated Search Example For the data sources in the graphic above, the ontologies align in a fairly straightforward manner

  1. Preliminary investigation of visual attention to human figures in photographs: potential considerations for the design of aided AAC visual scene displays.

    PubMed

    Wilkinson, Krista M; Light, Janice

    2011-12-01

    Many individuals with complex communication needs may benefit from visual aided augmentative and alternative communication systems. In visual scene displays (VSDs), language concepts are embedded into a photograph of a naturalistic event. Humans play a central role in communication development and might be important elements in VSDs. However, many VSDs omit human figures. In this study, the authors sought to describe the distribution of visual attention to humans in naturalistic scenes as compared with other elements. Nineteen college students observed 8 photographs in which a human figure appeared near 1 or more items that might be expected to compete for visual attention (such as a Christmas tree or a table loaded with food). Eye-tracking technology allowed precise recording of participants' gaze. The fixation duration over a 7-s viewing period and latency to view elements in the photograph were measured. Participants fixated on the human figures more rapidly and for longer than expected based on the size of these figures, regardless of the other elements in the scene. Human figures attract attention in a photograph even when presented alongside other attractive distracters. Results suggest that humans may be a powerful means to attract visual attention to key elements in VSDs.

  2. Exogenous spatial attention influences figure-ground assignment.

    PubMed

    Vecera, Shaun P; Flevaris, Anastasia V; Filapek, Joseph C

    2004-01-01

    In a hierarchical stage account of vision, figure-ground assignment is thought to be completed before the operation of focal spatial attention. Results of previous studies have supported this account by showing that unpredictive, exogenous spatial precues do not influence figure-ground assignment, although voluntary attention can influence figure-ground assignment. However, in these studies, attention was not summoned directly to a region in a figure-ground display. In three experiments, we addressed the relationship between figure-ground assignment and visuospatial attention. In Experiment 1, we replicated the finding that exogenous precues do not influence figure-ground assignment when they direct attention outside of a figure-ground stimulus. In Experiment 2, we demonstrated that exogenous attention can influence figure-ground assignment if it is directed to one of the regions in a figure-ground stimulus. In Experiment 3, we demonstrated that exogenous attention can influence figure-ground assignment in displays that contain a Gestalt figure-ground cue; this result suggests that figure-ground processes are not entirely completed prior to the operation of focal spatial attention. Exogenous spatial attention acts as a cue for figure-ground assignment and can affect the outcome of figure-ground processes.

  3. The Norwegian Decision-Making Process and Ways to Improve It

    DTIC Science & Technology

    2007-12-01

    Legislation and Objectives......................................... 55 c. The NPSS : General Information................................. 57 3. The...52 Figure 11. Organization chart - NPSS ..........................................................................56 Figure 12...Initially, the report was classified SECRET (NOFORN); declassified March 8, 1996, by the Storting. 5 Service’s ( NPSS ) responsibility to protect

  4. Management of Zone III Missile Injuries Involving the Carotid Artery and Cranial Nerves

    PubMed Central

    Levine, Zachary T.; Wright, Donald C.; O'Malley, Sean; Olan, Wayne J.; Sekhar, Laligam N.

    2000-01-01

    Carotid and cranial nerve injuries from zone III (high cervical/cranial base) missile injuries are rare and difficult to treat. We have treated five patients with such injuries. We present our management scheme, and compare it to the management of the same injuries in other reports. Five consecutive zone III missile injuries presented to our institution. Trauma assessment by the trauma team, followed by detailed neurological assessment and radiographs (angiogram and computed tomography) were obtained on admission. All patients presented with dysphagia and carotid artery injury with good collateral flow, documented by angiogram. Two patients had facial nerve injury, one had trigeminal nerve injury, one patient presented with tongue weakness, and one patient suffered conductive hearing loss. No patient had evidence of stroke clinically or radiographically. Carotid artery injury was managed with bypass (3 of 5) or ligation (2 of 5). Cranial nerve injuries were documented and treated aggressively with surgery if needed. All patients were discharged to home. Patients presenting with zone III missile injuries should receive an expeditious neurological exam and four-vessel angiogram after initial trauma survey and resuscitation. Bypass of the injured portion of carotid artery is a valid treatment in the hemodynamically stable patient. The unstable patient should undergo ligation to stop hemorrhage and protect against immediate risk for stroke, with the option to bypass later. Cranial nerve injuries should be pursued and aggressively treated to minimize morbidity and prevent mortality. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6Figure 7Figure 8 PMID:17171097

  5. Figure-ground representation and its decay in primary visual cortex.

    PubMed

    Strother, Lars; Lavell, Cheryl; Vilis, Tutis

    2012-04-01

    We used fMRI to study figure-ground representation and its decay in primary visual cortex (V1). Human observers viewed a motion-defined figure that gradually became camouflaged by a cluttered background after it stopped moving. V1 showed positive fMRI responses corresponding to the moving figure and negative fMRI responses corresponding to the static background. This positive-negative delineation of V1 "figure" and "background" fMRI responses defined a retinotopically organized figure-ground representation that persisted after the figure stopped moving but eventually decayed. The temporal dynamics of V1 "figure" and "background" fMRI responses differed substantially. Positive "figure" responses continued to increase for several seconds after the figure stopped moving and remained elevated after the figure had disappeared. We propose that the sustained positive V1 "figure" fMRI responses reflected both persistent figure-ground representation and sustained attention to the location of the figure after its disappearance, as did subjects' reports of persistence. The decreasing "background" fMRI responses were relatively shorter-lived and less biased by spatial attention. Our results show that the transition from a vivid figure-ground percept to its disappearance corresponds to the concurrent decay of figure enhancement and background suppression in V1, both of which play a role in form-based perceptual memory.

  6. Molecular and immunohistochemical analysis of P53 in phaeochromocytoma.

    PubMed Central

    Dahia, P. L.; Aguiar, R. C.; Tsanaclis, A. M.; Bendit, I.; Bydlowski, S. P.; Abelin, N. M.; Toledo, S. P.

    1995-01-01

    We searched for mutations of the p53 gene in 25 phaeochromocytomas using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of the entire conserved region of the gene, encompassing exons 4-8; expression of the p53 protein was assessed by immunohistochemistry. No mutations were found, while a polymorphism in codon 72 was observed. Immunohistochemistry revealed nuclear p53 overexpression in one tumour sample. We conclude that mutations of the 'hotspot' region of the p53 gene do not seem to play a role in the pathogenesis of phaeochromocytoma. Images Figure 1 Figure 2 Figure 3 PMID:7577469

  7. ACUTE HYDRONEPHROSIS MIMICKING RENAL COLIC

    PubMed Central

    Martin, Donald C.; Kaufman, Joseph J.

    1964-01-01

    Hydronephrosis may be acute, recurrent and related to ingestion of fluid. Frequently a lower polar vessel is an etiological factor. The condition is amenable to corrective operation by a variety of surgical techniques, as in the six cases here reported. ImagesFigure 1.Figure 2.Figure 3.Figure 4.Figure 5.Figure 6.Figure 7. PMID:14154288

  8. The concentration of light in the human lens.

    PubMed Central

    Merriam, J C

    1996-01-01

    PURPOSE: This thesis explores the idea that light energy, especially ultraviolet light, contributes to the unequal distribution of cataract around the world and to the development of cortical opacities. METHODS: In the first section, the thesis reviews historical concepts of the function of the lens and the nature of cataract, epidemiologic data on the global distribution of cataract, and clinical observations of the predominant location of cortical opacification. Second, computer ray tracings and geometric optics demonstrate the passage of light of varying angle of incidence within the lens. Third, two models of the human eye are used to study the refraction of light by the cornea and lens and illustrate the concentration of energy at the equatorial plane of the lens. RESULTS: Cataract prevalence increases with proximity to the earth's equator, and cortical cataract is most common in the inferior and inferonasal lens. Theoretical studies and the eye models both demonstrate that the concentration of light within the lens increases with angle of incidence, and the eye models suggest that the inferior and inferonasal lens receives significantly more energy than other sections of the lens. CONCLUSION: The prevalence of cataract and exposure to ultraviolet energy both increase with decreasing latitude. The most common location of cortical cataract in the inferonasal lens is consistent with the greater dose of light energy received by this portion of the lens. These studies suggest that the global distribution of cataract and the development of cortical cataract are at least in part dependent on the dose of ultraviolet light received by the lens. Images FIGURE 1 FIGURE 2 FIGURE 27 FIGURE 28 FIGURE 29 FIGURE 31 FIGURE 32 FIGURE 33 FIGURE 34 FIGURE 36 FIGURE 37 FIGURE 38 FIGURE 50 FIGURE 51 FIGURE 52 FIGURE 53 FIGURE 54 FIGURE 56 FIGURE 60 FIGURE 61 FIGURE 63 FIGURE 64 FIGURE 65 FIGURE 68 FIGURE 69 FIGURE 70 FIGURE 71 PMID:8981716

  9. Immediate breast reconstruction-impact on radiation management.

    PubMed Central

    Shankar, Ravi A.; Nibhanupudy, J. Rao; Sridhar, Rajagopalan; Ashton, Cori; Goldson, Alfred L.

    2003-01-01

    Breast reconstruction is an option for women undergoing modified radical mastectomy due to a diagnosis of breast cancer. In certain patients, breast reconstruction is performed by insertion of a temporary tissue expander prior to the placement of permanent breast implants. Some of these patients, following mastectomy, may require chest wall irradiation to prevent loco regional relapse. The compatibility of radiation and tissue expanders placed in the chest wall is of major concern to the radiation oncologist. Clinically undetectable changes can occur in the tissue expander during the course of radiation therapy. This can lead to radiation treatment set-up changes, variation in tissue expansion resulting in unwanted cosmesis, and deviation from the prescribed radiation dose leading to over and/or under dosing of tumor burden. At Howard University hospital, a CT scan was utilized to evaluate the status of the temporary tissue expander during radiation treatment to enable us to prevent radiation treatment related complications resulting from dosimetric discrepancies. CT images of the tissue expander were obtained through the course of treatment. To avoid a 'geographic miss' the amount of fluid injected into the tissue expander was kept constant following patient's satisfaction with the size of the breast mound. The CT scans allowed better visualization of the prosthesis and its relation to the surrounding tumor bed. This technique ensured that anatomical changes occurring during radiation treatment, if any, were minimized. Repeated dosimetry evaluations showed no changes to the prescribed dose distribution. A CT of the reconstructed breast provides an important quality control. Further studies with greater number of patients are required for confirming this impact on radiation treatment. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:12749619

  10. CGP 55398, a liposomal Ge(IV) phthalocyanine bearing two axially ligated cholesterol moieties: a new potential agent for photodynamic therapy of tumours.

    PubMed Central

    Segalla, A.; Milanesi, C.; Jori, G.; Capraro, H. G.; Isele, U.; Schieweck, K.

    1994-01-01

    Ge(IV) phthalocyanine (GePc) with two axially ligated cholesterol moieties was prepared by chemical synthesis and incorporated in a monomeric state into small unilamellar liposomes (CGP 55398). Upon photoexcitation with light wavelengths around its intense absorption peak at 680 nm, GePc shows an efficient photosensitising activity towards biological substrates through a mechanism which largely involves the intermediacy of singlet oxygen. GePc injected systemically into mice bearing an intramuscularly implanted MS-2 fibrosarcoma is quantitatively transferred to serum lipoproteins and localises in the tumour tissue with good efficiency: at 24 h post injection the GePc content in the tumour is 0.74 and 1.87 micrograms per g of tissue with a tumour/peritumoral ratio of 4.35 and 5.67 for injected doses of 0.76 and 1.52 mg kg-1 respectively. At this time the red-light irradiation of the GePc-loaded fibrosarcoma causes a fast and massive tumour necrosis involving both malignant cells and blood vessels. Images Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 PMID:8180009

  11. Stochastic Quantitative Reasoning for Autonomous Mission Planning

    DTIC Science & Technology

    2014-04-09

    points. Figure 4: Linear interpolation Table 1: Wind speed prediction information (ID:0-2 for Albany, ID:3-5 for Pittston, and ID:6-8 for JFK Airport ID...Pittston, and JFK Airport in Table 1, how can we estimate a reasonable wind speed for the current location at the current time? Figure 5: Example

  12. Model and Subcomponent Development for a Pulse-Combustor-Driven Microgenerator

    DTIC Science & Technology

    2004-08-31

    sputtering of thin magnetic and dielectric layers [4]; and mechanical lamination of polymer -coated NiFe foils [5]. Although these approaches have...photomicrograph of the fabricated device is given in Figure 4.2-6. 3d solenoid- like Cu coil EPOXY SU8 NIFE LAMINATE D CORE Figure 4.2-6 Photomicrograph

  13. New Solutions for Energy Absorbing Materials

    DTIC Science & Technology

    2012-11-01

    One can also readily plot transverse stiffness versus axial compression , shown in Figure 8, by relating the axial compression force, N, to the...displacement of 1 μm was applied at the center-top of the beam at the same time as the beam ends were subjected to varying axial compressive ...Figure 8 for varying amounts of axial compression . The results indicate a very good agreement between the analytical and FEA models. The slight

  14. Severe renal hemorrhage caused by pyelonephritis in 7 horses: clinical and ultrasonographic evaluation.

    PubMed Central

    Kisthardt, K K; Schumacher, J; Finn-Bodner, S T; Carson-Dunkerley, S; Williams, M A

    1999-01-01

    Case records of 7 horses diagnosed with pyelonephritis were reviewed to determine common features that might aid in diagnosis, treatment, and prognosis of this disease. All 7 horses had been admitted for evaluation of hematuria. During cystoscopy of 5 horses, hemorrhage was observed from one or both ureters. Renal biopsy of 1 horse, laboratory analysis of ureteral discharge of 2 horses, and renal ultrasonography of all horses indicated that pyelonephritis was the cause of hemorrhage. Sonographic renal changes included decreased length, increased echogenicity, abnormal outline, loss of corticomedullary distinction, pyelectasia, and focal hypoechoic or hyperechoic cortical defects. Renal hemorrhage in all horses eventually resolved but recurred in 4 of 5 horses that were followed long-term. Images Figure 1. Figure 2. Figure 3. Figure 4A. Figure 4B. Figure 4C. Figure 5A. Figure 5B. Figure 5C. Figure 6A. Figure 6B. Figure 7. PMID:12001337

  15. We Detected Phenomena, Like Africa's Dogon, that Speak of Stellar Gravitational Neutrino Interactions

    NASA Astrophysics Data System (ADS)

    McLeod, David Matthew; McLeod, Roger David

    2009-05-01

    Stick figure equivalents of Kokopelli/Pele/Pamola/Thor/Orion/Osiris, Canis Major/Anubis/Wolf/Fox, Leo/Bird Tailed Jaguar/Beaver Tailed Mountain Lion, were detected by us. They figure heavily in the spiritual/scientific world view of many traditional societies, and their cultural respect for the information such figures convey. Scientific instruments from the past were our laboratories, and theirs. All string/stick figure equivalents may represent types of longitudinally aligned neutrino flux between certain stellar pairs. Neutrino beams from distant pulsars, quasars, or other neutrino sources, cannot penetrate these graviton-like strings. They do pass through sectors of Earth, projecting stick figures within instruments like the Watch House at America's Stonehenge, and perhaps the chamber beneath the Great Pyramid. Sirius B, as the heaviest object in ``our'' universe for the Dogon, means it shares a profound graviton-like neutrino highway to our sun, as Sirius B/A do within Canis Major. It is possibly projected by a source within the Canis Major dwarf galaxy at about 3,000 times as distant as Sirius B/A at 8.7 ly.

  16. Temporal Progression of Visual Injury from Blast Exposure

    DTIC Science & Technology

    2013-09-01

    included the design and construction of a silencer and dump tank. The final design is shown in Figure 8. A steel barrel lined with 2” of acoustic foam...was selected as the dump tank. It surrounds a rubber barrel lined with foam composite. The steel barrel is allowed to recoil on a cart, absorbing...test. Figure 8. (Left) Inner silencer assembly completed during Q4 of Year 1. (Right) Final silencer assembly with the outer steel drum

  17. Dioxinlike properties of a trichloroethylene combustion-generated aerosol.

    PubMed Central

    Villalobos, S A; Anderson, M J; Denison, M S; Hinton, D E; Tullis, K; Kennedy, I M; Jones, A D; Chang, D P; Yang, G; Kelly, P

    1996-01-01

    Conventional chemical analyses of incineration by-products identify compounds of known toxicity but often fail to indicate the presence of other chemicals that may pose health risks. In a previous report, extracts from soot aerosols formed during incomplete combustion of trichloroethylene (TCE) and pyrolysis of plastics exhibited a dioxinlike response when subjected to a keratinocyte assay. To verify this dioxinlike effect, the complete extract, its polar and nonpolar fractions, some containing primarily halogenated aromatic hydrocarbons, were evaluated for toxicity using an embryo assay, for antiestrogenicity using primary liver cell cultures, and for the ability to transform the aryl hydrocarbon receptor into its DNA binding form using liver cytosol in a gel retardation assay. Each of these assays detect dioxinlike effects. Medaka (Oryzias latipes) embryos and primary liver cell cultures of rainbow trout (Oncorhynchus mykiss) were exposed to concentrations of extract ranging from 0.05 to 45 micrograms/l. Cardiotoxicity with pericardial, yolk sac, and adjacent peritoneal edema occurred after exposure of embryos to concentrations of 7 micrograms/l or greater. These same exposure levels were associated with abnormal embryo development and, at the higher concentrations, death. Some of the fractions were toxic but none was as toxic as the whole extract. In liver cells, total cellular protein and cellular lactate dehydrogenase activity were not altered by in vitro exposure to whole extract (0.05-25 micrograms/l). However, induction of cytochrome P4501A1 protein and ethoxyresorufin O-deethylase activity occurred. In the presence of whole extract, estradiol-dependent vitellogenin synthesis was reduced. Of the fractions, only fraction 1 (nonpolar) showed a similar trend, although vitellogenin synthesis inhibition was not significant. The soot extract and fractions bound to the Ah receptor and showed a significantly positive result in the gel retardation/DNA binding test. Chemical analyses using GC-MS with detection limits for 2,3,7,8-tetrachlorodibenzo-p-dioxin and dibenzofuran in the picomole range did not show presence of these compounds. Our results indicate that other chemicals associated with TCE combustion and not originally targeted for analysis may also pose health risks through dioxinlike mechanisms. Images Figure 1. Figure 2. Figure 3. A Figure 3. B Figure 4. A Figure 4. B Figure 4. C Figure 4. D Figure 5. Figure 6. Figure 7. PMID:8841759

  18. Induction of mortality and malformation in Xenopus laevis embryos by water sources associated with field frog deformities.

    PubMed Central

    Burkhart, J G; Helgen, J C; Fort, D J; Gallagher, K; Bowers, D; Propst, T L; Gernes, M; Magner, J; Shelby, M D; Lucier, G

    1998-01-01

    Water samples from several ponds in Minnesota were evaluated for their capacity to induce malformations in embryos of Xenopus laevis. The FETAX assay was used to assess the occurrence of malformations following a 96-hr period of exposure to water samples. These studies were conducted following reports of high incidences of malformation in natural populations of frogs in Minnesota wetlands. The purpose of these studies was to determine if a biologically active agent(s) was present in the waters and could be detected using the FETAX assay. Water samples from ponds with high incidences of frog malformations (affected sites), along with water samples from ponds with unaffected frog populations (reference sites), were studied. Initial experiments clearly showed that water from affected sites induced mortality and malformation in Xenopus embryos, while water from reference sites had little or no effect. Induction of malformation was dose dependent and highly reproducible, both with stored samples and with samples taken at different times throughout the summer. The biological activity of the samples was reduced or eliminated when samples were passed through activated carbon. Limited evidence from these samples indicates that the causal factor(s) is not an infectious organism nor are ion concentrations or metals responsible for the effects observed. Results do indicate that the water matrix has a significant effect on the severity of toxicity. Based on the FETAX results and the occurrence of frog malformations observed in the field, these studies suggest that water in the affected sites contains one or more unknown agents that induce developmental abnormalities in Xenopus. These same factors may contribute to the increased incidence of malformation in native species. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:9831545

  19. Efficacy of deep rTMS for neuropathic pain in the lower limb: a randomized, double-blind crossover trial of an H-coil and figure-8 coil.

    PubMed

    Shimizu, Takeshi; Hosomi, Koichi; Maruo, Tomoyuki; Goto, Yuko; Yokoe, Masaru; Kageyama, Yu; Shimokawa, Toshio; Yoshimine, Toshiki; Saitoh, Youichi

    2017-11-01

    OBJECTIVE Electrical motor cortex stimulation can relieve neuropathic pain (NP), but its use requires patients to undergo an invasive procedure. Repetitive transcranial magnetic stimulation (rTMS) of the primary motor cortex (M1) using a figure-8 coil can relieve NP noninvasively, but its ability to relieve lower limb pain is still limited. Deep rTMS using an H-coil can effectively stimulate deep brain regions and has been widely used for the treatment of various neurological diseases; however, there have been no clinical studies comparing the effectiveness of figure-8 coils and H-coils. This study assessed the clinical effectiveness of 5 once-daily stimulations with H-coils and figure-8 coils in patients with NP. METHODS This randomized, double-blind, 3-way crossover trial examined 18 patients with NP who sequentially received 3 types of stimulations in the M1 for 5 consecutive days; each 5-day stimulation period was followed by a 17-day follow-up period before crossing over to the next type of stimulation. During each rTMS session, patients received a 5-Hz rTMS to the M1 region corresponding to the painful lower limb. The visual analog scale (VAS) and the Japanese version of the short-form McGill Pain Questionnaire 2 (SF-MPQ2-J) were used to measure pain intensity. The primary outcome was VAS score reduction immediately after and 1 hour after intervention. RESULTS Both the VAS and SF-MPQ2-J showed significant pain improvement immediately after deep rTMS with an H-coil as compared with the sham group (p < 0.001 and p = 0.049, respectively). However, neither outcome measure showed significant pain improvement when using a figure-8 coil. The VAS also showed significant pain improvement 1 hour after deep rTMS with an H-coil (p = 0.004) but not 1 hour after rTMS using a figure-8 coil. None of the patients exhibited any serious adverse events. CONCLUSIONS The current findings suggest that the use of deep rTMS with an H-coil in the lower limb region of the M1 in patients with NP was tolerable and could provide significant short-term pain relief. Clinical trial registration no.: UMIN000010536 ( http://www.umin.ac.jp/ctr/ ).

  20. Next-Generation NATO Reference Mobility Model (NRMM) Development (Developpement de la nouvella generation du modele de mobilite de reference de l’OTAN (NRMM))

    DTIC Science & Technology

    2018-01-01

    Profile Database E-17 Attachment 2: NRMM Data Input Requirements E-25 Attachment 3: General Physics -Based Model Data Input Requirements E-28...E-15 Figure E-11 Examples of Unique Surface Types E-20 Figure E-12 Correlating Physical Testing with Simulation E-21 Figure E-13 Simplified Tire...Table 10-8 Scoring Values 10-19 Table 10-9 Accuracy – Physics -Based 10-20 Table 10-10 Accuracy – Validation Through Measurement 10-22 Table 10-11

  1. Radio Frequency Oscillator Technique for Monitoring Velocity and Structural Integrity of Projectiles during Their Exit from the Muzzle

    DTIC Science & Technology

    1981-04-01

    JAN 73 1473 EDITION OF • NOV 6S IS OBSOLETE SECURITY M^ mrm THIS PAGE (When Date Entered) UNCLASSIFIED SECURITY CLASSIFICATION OP THIS PAOKWhrn Dmtm...similar to those obtained during the laboratory simulation (Figure 5) o > Q ID < 47.5 48.5 49.5 50.5 TIME ( ms ) Figure 5, Example of the...45> ■400 VELOCITY PULSE PROJECTILE TYPE HE(TP) 12 TIME ( MS ) Figure 8. Time Series for the 75mm HE(JPl Projectile, Rd, No. 4 reference length

  2. Smart Armor Conceptual Design

    DTIC Science & Technology

    1992-04-30

    Figure 111.2.16 Stress Contour After 800 Cycles With Smart Actuation... . . . . . . . . 37 Figure 111.3.1 A Schematic of an Electrostatic Micromotor ...43 Figure 111.3.2 Top and Cross-Sectional Views of a Micromotor ..... . ............ ... 44 Figure 111.3.3 Shape Memory Alloy...as a Micromotor . ... 45 Figure 111.3.4 A Typical Induced Drive Mechanism ........ .. 46 Figure 111.3.5 Ceramic Plate. . . . . ............. 47 Figure

  3. Preliminary Investigation of the Shock-Boundary Layer Interaction in a Simulated Fan Passage

    DTIC Science & Technology

    1991-03-01

    unlimited 2b DECLASSIFICATION/DOWNGRADING SCHEDULE 4 PERFORMING ORGANIZATION REPORT NUMBER(S) 5 MONITORING ORGANIZATION REPORT NUMBER(S) 6a NAME OF...Figure 4. Vortex Generator Jets Configuration [Ref. 2] 27 Figure 5 . Cascade Geometry 28 Figure 6. Schematic of Transonic Cascade Wind Tunnel 29 Figure 7... 65 Figure A9. Test Section Top Blade 66 Figure A1O. Test Section Middle Blade 67 Figure A 11. Test Section Lower Blade 68 Figure A12. Pressure Tap

  4. Infant motivation in dental health: attitude without constant reinforcement.

    PubMed

    Teixeira Alves, Fabiana Bucholdz; Kuhn, Eunice; Bordin, Danielle; Kozlowski, Vitoldo Antonio; Raggio, Daniela Procida; Fadel, Cristina Berger

    2014-01-01

    Social factors determine the child's behavior and motivation is an important task in the teaching-learning process. This longitudinal and cross-sectional study aimed to analyze the effectiveness of a motivational activity program for oral hygiene habits formation after motivation and without constant reinforcement. The sample was constituted of 26 children (mean 6 years old) from a Public Kindergarten School in Ponta Grossa, PR, Brazil. Data were collected applying a test-chart, with figures reporting the process of dental health/illness. Some figures were considered positive to dental health (dentist/Cod 1, toothbrush/Cod 3, dentifrice/dental floss/Cod 6, fruits/vegetables/Cod 7 and tooth without caries lesion/Cod 8) and negative on dental health (sweets/Cod 2, bacteria/Cod 4, tooth with caries lesion/Cod 5). The figures presentation occurred in three different stages: First stage - figures were presented to children without previous knowledge; second stage - following the motivational presentation, and third stage - 30 days after the first contact. On the first stage, most children select good for the figures considered harmful to their teeth (Cod 2-88%; Cod 4-77% and Cod 5-65%). On the second stage, there was a lower percentage: 23% (P < 0.0001), 8% (P < 0.0001), and 23% (P = 0.0068) related to the Cod 2, 4, and 5. On the third stage, the results showed again an association with the good choice to these figures considered harmful (Cod 2-85%, Cod 4-65% and Cod 5-54%) similar the results obtained on the first stage. The motivational programs performed without constant reinforcement does not have a positive influence in changing the child's behavior related to a better dental care.

  5. Integrated null-flux suspension and multiphase propulsion system for magnetically-levitated vehicles

    DOEpatents

    Rote, D.M.; He, Jianliang; Johnson, L.R.

    1992-01-01

    This report discusses a propulsion and stabilization system comprising a series of figure 8 coils mounted vertically on the walls of the guideway to provide suspension, lateral guidance and propulsion of a magnetically levitated vehicle. This system further allows for altering the magnetic field effects by changing the relative position of the loops comprising the figure 8 coils either longitudinally and/or vertically with resulting changes in the propulsion, the vertical stability, and the suspension.

  6. Quadrennial Review of Military Compensation (7th). Compensation Structure. Major Topical Summary (MTS) 1

    DTIC Science & Technology

    1992-08-01

    professional sports franchises , fast food restaurants , or a widget factory as well as the uniformed services. The 7’ QRMC identified two additional...1990 ................. C-8 Figure C-7. Basic Pay as a Percentage of RMC, by Grade, 1991 ................... C-11 Figure C-8. Current Enlisted BAS vs ... independent survey. "* A separate but simplified system of special and incentive pays. "* Expense reimbursements. "* Other allowances and so-called fringe

  7. Relaxin protects against myocardial injury caused by ischemia and reperfusion in rat heart.

    PubMed Central

    Bani, D.; Masini, E.; Bello, M. G.; Bigazzi, M.; Sacchi, T. B.

    1998-01-01

    Myocardial injury caused by ischemia and reperfusion comes from multiple pathogenic events, including endothelial damage, neutrophil extravasation into tissue, platelet and mast cell activation, and peroxidation of cell membrane lipids, which are followed by myocardial cell alterations resulting eventually in cell necrosis. The current study was designed to test the possible cardioprotective effect of the hormone relaxin, which has been found to cause coronary vessel dilation and to inhibit platelet and mast cell activation. Ischemia (for 30 minutes) was induced in rat hearts in vivo by ligature of the left anterior descending coronary artery; reperfusion (for 60 minutes or less if the rats died before this predetermined time) was induced by removal of the ligature. Relaxin (100 ng) was given intravenously 30 minutes before ischemia. The results obtained showed that relaxin strongly reduces 1) the extension of the myocardial areas affected by ischemia-reperfusion-induced damage, 2) ventricular arrhythmias, 3) mortality, 4) myocardial neutrophil number, 5) myeloperoxidase activity, a marker of neutrophil accumulation, 6) production of malonyldialdehyde, an end product of lipid peroxidation, 7) mast cell granule release, 8) calcium overload, and 9) morphological signs of myocardial cell injury. This study shows that relaxin can be regarded as an agent with a marked cardioprotective action against ischemia-reperfusion-induced myocardial injury. Images Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 PMID:9588905

  8. Investigation of a Translatable Animal Model in Order to Understand the Etiology of Heterotopic Ossification

    DTIC Science & Technology

    2017-09-01

    dB levels that were made by the AID without attenuation, we performed this testing in a cinderblock-based room with metal ducting, cement floors and... steel -framed ceilings (Figure 7). 8 Figure 7: Image of a corner of the cinderblock room in which testing has been performed. To measure

  9. Evaluation of Type II Fast Packs for Electrostatic Discharge Properties.

    DTIC Science & Technology

    1983-08-01

    34 x 8" x 1 3/4") consisting of a reclosable cushioned carrier which mates into an outer fiberboard sleeve. A cushioning insert is used consisting of a... RECLOSABLE CUSHIONED CARRIER TEST LOAD FIGURE 1: Cancel Caddy Pack * CONVOLUTED 4* CUSHIONED I FIGURE 2: Type II Fast Pack (PPP-B-1672) TYPE II FAST PACK

  10. Immunoreactive transforming growth factor alpha is commonly present in colorectal neoplasia.

    PubMed Central

    Tanaka, S.; Imanishi, K.; Yoshihara, M.; Haruma, K.; Sumii, K.; Kajiyama, G.; Akamatsu, S.

    1991-01-01

    Surgical specimens from 19 patients with invasive colorectal cancers and 12 specimens of normal mucosa from the same patients were examined immunohistochemically for the production of the immunoreactive (IR-) transforming growth factor (TGF)-alpha and IR-epidermal growth factor (EGF) with an anti-TGF-alpha monoclonal antibody (MAb) OAL-MTG01 and anti-EGF MAb KEM-10. Immunoreactive TGF-alpha was detected in 16 (84.2%) of 19 colorectal cancers. In contrast, there was no IR-TGF-alpha in the gland cells of normal mucosa. Immunoreactive EGF was detected in 7 (36.8%) of 19 colorectal cancers and 1 (8.3%) of 12 cases of normal mucosa. The production of both IR-TGF-alpha and IR-EGF in colorectal cancer did not differ by histologic type and Dukes' stage. Immunoreactive TGF-alpha was detected at significantly higher incidence than IR-EGF in colorectal cancer. These results indicate that IR-TGF-alpha should prove valuable as a possible tumor marker in colorectal cancers, and it may be very useful in understanding the biology of colorectal cancer. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:1853928

  11. Ripples in Rocks Point to Water

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This image taken by the Mars Exploration Rover Opportunity's panoramic camera shows the rock nicknamed 'Last Chance,' which lies within the outcrop near the rover's landing site at Meridiani Planum, Mars. The image provides evidence for a geologic feature known as ripple cross-stratification. At the base of the rock, layers can be seen dipping downward to the right. The bedding that contains these dipping layers is only one to two centimeters (0.4 to 0.8 inches) thick. In the upper right corner of the rock, layers also dip to the right, but exhibit a weak 'concave-up' geometry. These two features -- the thin, cross-stratified bedding combined with the possible concave geometry -- suggest small ripples with sinuous crest lines. Although wind can produce ripples, they rarely have sinuous crest lines and never form steep, dipping layers at this small scale. The most probable explanation for these ripples is that they were formed in the presence of moving water.

    Crossbedding Evidence for Underwater Origin Interpretations of cross-lamination patterns presented as clues to this martian rock's origin under flowing water are marked on images taken by the panoramic camera and microscopic imager on NASA's Opportunity.

    [figure removed for brevity, see original site] [figure removed for brevity, see original site] Figure 1Figure 2

    The red arrows (Figure 1) point to features suggesting cross-lamination within the rock called 'Last Chance' taken at a distance of 4.5 meters (15 feet) during Opportunity's 17th sol (February 10, 2004). The inferred sets of fine layers at angles to each other (cross-laminae) are up to 1.4 centimeters (half an inch) thick. For scale, the distance between two vertical cracks in the rock is about 7 centimeters (2.8 inches). The feature indicated by the middle red arrow suggests a pattern called trough cross-lamination, likely produced when flowing water shaped sinuous ripples in underwater sediment and pushed the ripples to migrate in one direction. The direction of the ancient flow would have been either toward or away from the line of sight from this perspective. The lower and upper red arrows point to cross-lamina sets that are consistent with underwater ripples in the sediment having moved in water that was flowing left to right from this perspective.

    The yellow arrows (Figure 2) indicate places in the panoramic camera view that correlate with places in the microscope's view of the same rock.

    [figure removed for brevity, see original site] Figure 3

    The microscopic view (Figure 3) is a mosaic of some of the 152 microscopic imager frames of 'Last Chance' that Opportunity took on sols 39 and 40 (March 3 and 4, 2004).

    [figure removed for brevity, see original site] Figure 4

    Figure 4 shows cross-lamination expressed by lines that trend downward from left to right, traced with black lines in the interpretive overlay. These cross-lamination lines are consistent with dipping planes that would have formed surfaces on the down-current side of migrating ripples. Interpretive blue lines indicate boundaries between possible sets of cross-laminae.

  12. Proceedings of the Symposium of the COSPAR Satellite Beacon Group on the Geophysical Use of Satellite Beacon Observations Held at Boston University on 1- 4 June 1976

    DTIC Science & Technology

    1976-06-04

    CAL, , ,-"E - ’ :’’, EO..... : Ao GAAOEHO - - - 2 ’£ - - o- ,/ .""’ CO / 2: i i ; ’ o ,* , - /% t, ’ 2. 0 4 H 20 22 2 LOC AL’’E HL I Figure 7 Figure 8...24 0 4 S 2 LOC ~~lL TIMEASAI LOCAL T0k (bt) Figure 9 Figure 10 (233 1241 (252 1307 1334 1441 k L T 2526 2501 2449 23 76 2261 2159 AL 22 29 40 &o 105...981-1206, 1975 [2] Barrett, L. OTropospheric irregularity effects on the 360 Hartmann, G.K. MHz ATS-6 Radio Beacon". Submitted for publics- Leo , R.L

  13. 40 CFR 86.001-28 - Compliance with emission standards.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...)(iii) of this section rounded to two significant figures in accordance with the Rounding-Off Method specified in ASTM E29-90, Standard Practice for Using Significant Digits in Test Data to Determine... adjusted emission value of paragraph (b)(8)(iii) of this section rounded to two significant figures in...

  14. 40 CFR 86.001-28 - Compliance with emission standards.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...)(iii) of this section rounded to two significant figures in accordance with the Rounding-Off Method specified in ASTM E29-90, Standard Practice for Using Significant Digits in Test Data to Determine... adjusted emission value of paragraph (b)(8)(iii) of this section rounded to two significant figures in...

  15. 40 CFR 86.001-28 - Compliance with emission standards.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...)(iii) of this section rounded to two significant figures in accordance with the Rounding-Off Method specified in ASTM E29-90, Standard Practice for Using Significant Digits in Test Data to Determine... adjusted emission value of paragraph (b)(8)(iii) of this section rounded to two significant figures in...

  16. Changes in area affect figure-ground assignment in pigeons.

    PubMed

    Castro, Leyre; Lazareva, Olga F; Vecera, Shaun P; Wasserman, Edward A

    2010-03-05

    A critical cue for figure-ground assignment in humans is area: smaller regions are more likely to be perceived as figures than are larger regions. To see if pigeons are similarly sensitive to this cue, we trained birds to report whether a target appeared on a colored figure or on a differently colored background. The initial training figure was either smaller than (Experiments 1 and 2) or the same area as (Experiment 2) the background. After training, we increased or decreased the size of the figure. When the original training shape was smaller than the background, pigeons' performance improved with smaller figures (and worsened with larger figures); when the original training shape was the same area as the background, pigeons' performance worsened when they were tested with smaller figures. A smaller figural region appeared to improve the figure-ground discrimination only when size was a relevant cue in the initial discrimination.

  17. Figure-ground assignment in pigeons: evidence for a figural benefit.

    PubMed

    Lazareva, Olga E; Castro, Leyre; Vecera, Shaun P; Wasserman, Edward A

    2006-07-01

    Four pigeons discriminated whether a target spot appeared on a colored figural shape or on a differently colored background by first pecking the target and then reporting its location: on the figure or the background. We recorded three dependent variables: target detection time, choice response time, and choice accuracy. The birds were faster to detect the target, to report its location, and to learn the correct response on figure trials than on background trials. Later tests suggested that the pigeons might have attended to the figural region as a whole rather than using local properties in performing the figure-background discrimination. The location of the figural region did not affect figure-ground assignment. Finally, when 4 other pigeons had to detect and peck the target without making a choice report, no figural advantage emerged in target detection time, suggesting that the birds' attention may not have been automatically summoned to the figural region.

  18. Changes in Area Affect Figure-Ground Assignment in Pigeons

    PubMed Central

    Castro, Leyre; Lazareva, Olga F.; Vecera, Shaun P.; Wasserman, Edward A.

    2010-01-01

    A critical cue for figure-ground assignment in humans is area: Smaller regions are more likely to be perceived as figures than are larger regions. To see if pigeons are similarly sensitive to this cue, we trained birds to report whether a target appeared on a colored figure or on a differently colored background. The initial training figure was either smaller than (Experiments 1 and 2) or the same area as (Experiment 2) the background. After training, we increased or decreased the size of the figure. When the original training shape was smaller than the background, pigeons’ performance improved with smaller figures (and worsened with larger figures); when the original training shape was the same area as the background, pigeons’ performance worsened when they were tested with smaller figures. A smaller figural region appeared to improve the figure-ground discrimination only when size was a relevant cue in the initial discrimination. PMID:20060406

  19. Understanding the Impact of Bead Type on Paint and Thermoplastic Pavement Markings

    DTIC Science & Technology

    2012-03-01

    20 Figure 7: Bead Performance Over Time for Polyurea (Needham, 2011) ......................... 23 Figure 8...specifically. Research conducted at the Air Force Institute of Technology reveals that bead type does impact the degradation rate of polyurea ...Preformed tape - profiled < 1.0 8 Methyl methacrylate < 1.0 9 Thermoplastics profiled < 1.0 10 Polyurea < 1.0 11 Cold applied plastics < 1.0 12

  20. The Figure 8 Model of International Relations

    DTIC Science & Technology

    2008-05-22

    the late 1970s and the early 1980s because less developed countries borrowed heavily from commercial banks, making them extremely vulnerable to the...about world events.3 In order to better understand the international relations system, the author developed the Figure 8 Model. This model is first... countries . And poverty seemed all the more severe when compared with the incredible power available to create new wealth.36 Economic interdependence was

  1. Optimally Scheduling Basic Courses at the Defense Language Institute using Integer Programming

    DTIC Science & Technology

    2005-09-01

    DLI’s manual schedules at best can train 8%, 7% and 64%. 15. NUMBER OF PAGES 59 14. SUBJECT TERMS Operations Research, Linear Programming...class in 2006, 2007, and 2008, whereas DLI’s manual schedules at best can train 8%, 7% and 64%. vi THIS PAGE...ARABIC INSTRUTOR LEVELS .....................................25 FIGURE 2. OCS1 AND OCS2 CHINESE-MANDARIN INSTRUTOR LEVELS ............26 FIGURE 3

  2. Computational and Experimental Investigation of Contaminant Plume Response to DNAPL Source Zone Architecture and Depletion in Porous and Fractured Media

    DTIC Science & Technology

    2013-09-01

    Mass in the Rock Matrix. Table 4.8.5.1: Flow and Transport Parameters Used for TCE Dissolution Modeling in Discrete Fracture Approach. Table 4.8.5.2...represent the flow rate over time. Figure 4.8.4.5: The Profile of Estimated Diffusing TCE Front into the Rock Matrix. Figure 4.8.5.1: a) Mesh Used for TCE...fractured rocks . The work of Illman et al. (2009) motivates us to conduct a laboratory fractured rock block experiment in which a large number of pumping

  3. Temporal structure in the light response of relay cells in the dorsal lateral geniculate nucleus of the cat.

    PubMed Central

    Funke, K; Wörgötter, F

    1995-01-01

    1. The spike interval pattern during the light responses of 155 on- and 81 off-centre cells of the dorsal lateral geniculate nucleus (LGN) was studied in anaesthetized and paralysed cats by the use of a novel analysis. Temporally localized interval distributions were computed from a 100 ms time window, which was shifted along the time axis in 10 ms steps, resulting in a 90% overlap between two adjacent windows. For each step the interval distribution was computed inside the time window with 1 ms resolution, and plotted as a greyscale-coded pixel line orthogonal to the time axis. For visual stimulation, light or dark spots of different size and contrast were presented with different background illumination levels. 2. Two characteristic interval patterns were observed during the sustained response component of the cells. Mainly on-cells (77%) responded with multimodal interval distributions, resulting in elongated 'bands' in the 2-dimensional time window plots. In similar situations, the interval distributions for most (71%) off-cells were rather wide and featureless. In those cases where interval bands (i.e. multimodal interval distributions) were observed for off-cells (14%), they were always much wider than for the on-cells. This difference between the on- and off-cell population was independent of the background illumination and the contrast of the stimulus. Y on-cells also tended to produce wider interval bands than X on-cells. 3. For most stimulation situations the first interval band was centred around 6-9 ms, which has been called the fundamental interval; higher order bands are multiples thereof. The fundamental interval shifted towards larger sizes with decreasing stimulus contrast. Increasing stimulus size, on the other hand, resulted in a redistribution of the intervals into higher order bands, while at the same time the location of the fundamental interval remained largely unaffected. This was interpreted as an effect of the increasing surround inhibition at the geniculate level, by which individual retinal EPSPs were cancelled. A changing level of adaptation can result in a mixed shift/redistribution effect because of the changing stimulus contrast and changing level of tonic inhibition. 4. The occurrence of interval bands is not directly related to the shape of the autocorrelation function, which can be flat, weakly oscillatory or strongly oscillatory, regardless of the interval band pattern. 5. A simple computer model was devised to account for the observed cell behaviour. The model is highly robust against parameter variations.(ABSTRACT TRUNCATED AT 400 WORDS) Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 15 PMID:7562612

  4. A new cue to figure-ground coding: top-bottom polarity.

    PubMed

    Hulleman, Johan; Humphreys, Glyn W

    2004-11-01

    We present evidence for a new figure-ground cue: top-bottom polarity. In an explicit reporting task, participants were more likely to interpret stimuli with a wide base and a narrow top as a figure. A similar advantage for wide-based stimuli also occurred in a visual short-term memory task, where the stimuli had ambiguous figure-ground relations. Further support comes from a figural search task. Figural search is a discrimination task in which participants are set to search for a symmetric target in a display with ambiguous figure-ground organization. We show that figural search was easier when stimuli with a top-bottom polarity were placed in an orientation where they had a wide base and a narrow top, relative to when this orientation was inverted. This polarity effect was present when participants were set to use color to parse figure from ground, and it was magnified when the participants did not have any foreknowledge of the color of the symmetric target. Taken together the results suggest that top-bottom polarity influences figure-ground assignment, with wide base stimuli being preferred as a figure. In addition, the figural search task can serve as a useful procedure to examine figure-ground assignment.

  5. PRELIMINARY STUDIES OF THE GASTROINTESTINAL TRACT WITH COLLOIDAL BARIUM

    PubMed Central

    Windholz, Frank; Kaplan, Henry S.; Jones, Henry H.

    1951-01-01

    A stable colloidal suspension of barium sulfate has been developed and tested in roentgen examination of the gastrointestinal tract. The new material is rather distinctive in radiographic appearance and can usually be differentiated from simple barium-water mixtures by inspection of roentgenograms of the opacified stomach and small intestine. It usually affords a satisfactory demonstration of the mucosal folds of the stomach and duodenal bulb and is considerably more resistant to flocculation and precipitation by retained gastric secretions. In the small intestine, it has little tendency to undergo flocculation and fragmentation, and permits visualization of fine mucosal configurations with unusual clarity. Its motility is about the same as that of conventional suspensions. Air contrast colon examinations with the colloidal preparation exhibit a very uniform, opaque, and stable coating of the bowel wall and are more consistently satisfactory than when simple barium-water mixtures are used. ImagesFigure 1.Figure 1.Figure 1.Figure 1.Figure 2.Figure 2.Figure 3.Figure 4.Figure 4.Figure 5.Figure 5.Figure 6. PMID:14812347

  6. Exposure to atmospheric radon.

    PubMed Central

    Steck, D J; Field, R W; Lynch, C F

    1999-01-01

    We measured radon (222Rn) concentrations in Iowa and Minnesota and found that unusually high annual average radon concentrations occur outdoors in portions of central North America. In some areas, outdoor concentrations exceed the national average indoor radon concentration. The general spatial patterns of outdoor radon and indoor radon are similar to the spatial distribution of radon progeny in the soil. Outdoor radon exposure in this region can be a substantial fraction of an individual's total radon exposure and is highly variable across the population. Estimated lifetime effective dose equivalents for the women participants in a radon-related lung cancer study varied by a factor of two at the median dose, 8 mSv, and ranged up to 60 mSv (6 rem). Failure to include these doses can reduce the statistical power of epidemiologic studies that examine the lung cancer risk associated with residential radon exposure. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:9924007

  7. A Low-Cost, Man-Portable, Free-Space Optics Communications Device for Ethernet Applications

    DTIC Science & Technology

    2004-12-01

    ix LIST OF FIGURES Figure 1. Patent for the Photophone filed by Alexander Graham Bell and Charles S. Tainter. (From Ref. [8...Tainter patented a device they called the Photophone in 1880 (Fig. 1.) By using a series of mirrors and lenses, they were able to modulate a voice...signal on to a ray of sunlight and send it to a receiver 200 meters away [8]. In the Photophone , voice sound waves were directed on to a mirror that

  8. Ultra-precision process of CaF2 single crystal

    NASA Astrophysics Data System (ADS)

    Yin, Guoju; Li, Shengyi; Xie, Xuhui; Zhou, Lin

    2014-08-01

    This paper proposes a new chemical mechanical polishing (CMP) process method for CaF2 single crystal to get ultraprecision surface. The CMP processes are improving polishing pad and using alkaline SiO2 polishing slurry with PH=8, PH=11 two phases to polish, respectively, and the roughness can be 0.181nm Rq (10μm×10μm). The CMP process can't get high surface figure, so we use ion beam figuring (IBF) technology to obtain high surface figure. However, IBF is difficult to improve the CaF2 surface roughness. We optimize IBF process to improve surface figure and keep good surface roughness too. Different IBF incident ion energy from 400ev to 800ev does not affect on the surface roughness obviously but the depth of material removal is reverse. CaF2 single crystal can get high precision surface figure (RMS=2.251nm) and still keep ultra-smooth surface (Rq=0.207nm) by IBF when removal depth is less than 200nm. The researches above provide important information for CaF2 single crystal to realize ultra-precision manufacture.

  9. Author Correction: Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

    PubMed

    Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

    2018-04-11

    In the originally published HTML and PDF versions of this Article, gel images in Figures 7c and 8c were not prepared as per the Nature journal policy. These figure panels have now been corrected in both the PDF and HTML versions of the Article.In Fig. 7c, the lane labelled 'Ha' was inappropriately duplicated to represent the lane labelled 'Ich13'. The corrected version of Fig. 7c includes PCR-RFLP on DNA from the Ichkeul 13 line, which had been run on a separate gel. The original unprocessed gel images are provided in Supplementary Figure 1 associated with this correction, with the relevant corresponding bands denoted. A repeat experiment of the PCR-RFLP test is also presented as Supplementary Figure 2.In Fig. 8c, the image was assembled from two separate gels without clear demarcation. The corrected Fig. 8c clearly separates lanes from the two gels, and the original unprocessed gel images are provided in the Supplementary Information associated with this correction.These corrections do not alter the original meaning of the experiments, their results, their interpretation, or the conclusions of the paper. We apologize for any confusion this may have caused to the readers of Nature Communications.

  10. Figure 5 from Integrative Genomics Viewer: Visualizing Big Data | Office of Cancer Genomics

    Cancer.gov

    Split-Screen View. The split-screen view is useful for exploring relationships of genomic features that are independent of chromosomal location. Color is used here to indicate mate pairs that map to different chromosomes, chromosomes 1 and 6, suggesting a translocation event. Adapted from Figure 8; Thorvaldsdottir H et al. 2012

  11. Design, Fabrication, and Characterization of a Microelectromechanical Directional Microphone

    DTIC Science & Technology

    2011-06-01

    7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES...Figure 5.2 SOIC packaging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38 Figure 5.3 Laboratory setup...Mean Squared SOC System-On-Chip SOIC Small Outline Integrated Circuit SOIMUMPS Silicon-On-Insulator Multi-User MEMS Process SPL Sound Pressure Level

  12. Enhancing a Web Crawler with Arabic Search Capability

    DTIC Science & Technology

    2010-09-01

    7 Figure 2. Monolingual 11-point precision results. From [14]...........................................8 Figure 3. Lucene...libraries (prefixes dictionary , stems dictionary and suffixes dictionary ). If all the word elements (prefix, stem, suffix) are found in their...stemmer improved over 90% in average precision from raw retrieval. The authors concluded that stemming is very effective on Arabic IR. For monolingual

  13. Comparison of the Medical College of Georgia Complex Figures and the Rey-Osterrieth Complex Figure tests in a normal sample of Japanese university students.

    PubMed

    Yamashita, Hikari; Yasugi, Mina

    2008-08-01

    Comparability of copy and recall performance on the four figures of the Medical College of Georgia Complex Figures and the Rey-Osterrieth Complex Figure were examined using an incidental learning paradigm with 60 men and 60 women, healthy volunteers between the ages of 18 and 24 years (M = 21.5 yr., SD = 1.5) at a Japanese university. A between-subjects design was used in which each group of participants (n = 24) responded to five figures. The interrater reliability of each Georgia figure was excellent. While the five figures yielded equivalent copy scores, the Rey-Osterrieth figure had significantly lower scores than the Georgia figures at recall after 3 min. There were no significant differences between the four Georgia figures. These results are consistent with the findings of the original studies in the USA.

  14. Enhanced spatial resolution on figures versus grounds

    PubMed Central

    Hecht, Lauren N.; Cosman, Joshua D.; Vecera, Shaun P.

    2016-01-01

    Much is known about the cues that determine figure-ground assignment, but less is known about the consequences of figure-ground assignment on later visual processing. Previous work has demonstrated that regions assigned figural status are subjectively more shape-like and salient than background regions. The increase in subjective salience of figural regions could be caused by a number of processes, one of which may be enhanced perceptual processing (e.g., an enhanced neural representation) of figures relative to grounds. We explored this hypothesis by having observers perform a perceptually demanding spatial resolution task in which targets appeared either on figure or ground regions. To rule out a purely attentional account of figural salience, observers discriminated targets on the basis of a region’s color (red or green), which was equally likely to define the figure or the ground. The results of our experiments show that targets appearing on figures were discriminated more accurately than those appearing in ground regions. In addition, targets appearing on figures were discriminated better than those presented in regions considered figurally neutral, but targets appearing within ground regions were discriminated more poorly than those appearing in figurally neutral regions. Taken together, our findings suggest that when two regions share a contour, regions assigned as figure are perceptually enhanced, whereas regions assigned as grounds are perceptually suppressed. PMID:27048441

  15. Enhanced spatial resolution on figures versus grounds.

    PubMed

    Hecht, Lauren N; Cosman, Joshua D; Vecera, Shaun P

    2016-07-01

    Much is known about the cues that determine figure-ground assignment, but less is known about the consequences of figure-ground assignment on later visual processing. Previous work has demonstrated that regions assigned figural status are subjectively more shape-like and salient than background regions. The increase in subjective salience of figural regions could be caused by a number of processes, one of which may be enhanced perceptual processing (e.g., an enhanced neural representation) of figures relative to grounds. We explored this hypothesis by having observers perform a perceptually demanding spatial resolution task in which targets appeared on either figure or ground regions. To rule out a purely attentional account of figural salience, observers discriminated targets on the basis of a region's color (red or green), which was equally likely to define the figure or the ground. The results of our experiments showed that targets appearing on figures were discriminated more accurately than those appearing in ground regions. In addition, targets appearing on figures were discriminated better than those presented in regions considered figurally neutral, but targets appearing within ground regions were discriminated more poorly than those appearing in figurally neutral regions. Taken together, our findings suggest that when two regions share a contour, regions assigned as figure are perceptually enhanced, whereas regions assigned as ground are perceptually suppressed.

  16. Macrophage activation and muscle remodeling at myotendinous junctions after modifications in muscle loading.

    PubMed Central

    St Pierre, B. A.; Tidball, J. G.

    1994-01-01

    Modifications in muscle loading have been reported previously to result in increased numbers of mononucleated cells and changes in myofibril organization at myotendinous junctions (MTJs). The goals of this study were to determine the identity of those mononucleated cells and to examine the relationships between changes in their structure, location, and number with structural aspects of remodeling at MTJs experiencing modified loading. Soleus muscles from rats subjected to 10 days of hindlimb suspension were analyzed 0, 2, 4, and 7 days after return to weight bearing. Immunohistochemistry showed that ED1+, ED2+ and Ia+ macrophages were present at the MTJ and microtendon of control muscle. After reloading, ED2+ macrophages increased in number and size at MTJs and microtendons, indicating their activation. ED1+ cells showed no change in size or number whereas Ia+ cells were increased in size at day 7 of reloading. Electron microscopic observations showed that mononucleated cells near MTJs of control or suspended muscle were not highly active in protein synthesis or secretion. However, in reloaded muscle, mononucleated cells were found to be in close proximity to MTJs and to contain a high concentration of organelles associated with protein secretion. During these stages of reloading, extensive remodeling of myofibril-membrane associations occurred and nascent sarcomeres appeared in the MTJ regions of muscle fibers. Immunohistochemistry showed that during these stages of nascent sarcomere formation, there was renewed expression of developmental myosin heavy chain at MTJs, with this heavy chain appearing most prominently at the MTJ at day 7 of reloading. The activation and increased numbers of macrophages at MTJs and the close apposition of secretory cells to the MTJ membrane during remodeling lead us to propose that macrophage-derived factors may influence remodeling of MTJs in muscles experiencing modified loading. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:7992849

  17. Radionuclides in the lichen-caribou-human food chain near uranium mining operations in northern Saskatchewan, Canada.

    PubMed Central

    Thomas, P A; Gates, T E

    1999-01-01

    The richest uranium ore bodies ever discovered (Cigar Lake and McArthur River) are presently under development in northeastern Saskatchewan. This subarctic region is also home to several operating uranium mines and aboriginal communities, partly dependent upon caribou for subsistence. Because of concerns over mining impacts and the efficient transfer of airborne radionuclides through the lichen-caribou-human food chain, radionuclides were analyzed in tissues from 18 barren-ground caribou (Rangifer tarandus groenlandicus). Radionuclides included uranium (U), radium (226Ra), lead (210Pb), and polonium (210Po) from the uranium decay series; the fission product (137Cs) from fallout; and naturally occurring potassium (40K). Natural background radiation doses average 2-4 mSv/year from cosmic rays, external gamma rays, radon inhalation, and ingestion of food items. The ingestion of 210Po and 137Cs when caribou are consumed adds to these background doses. The dose increment was 0.85 mSv/year for adults who consumed 100 g of caribou meat per day and up to 1.7 mSv/year if one liver and 10 kidneys per year were also consumed. We discuss the cancer risk from these doses. Concentration ratios (CRs), relating caribou tissues to lichens or rumen (stomach) contents, were calculated to estimate food chain transfer. The CRs for caribou muscle ranged from 1 to 16% for U, 6 to 25% for 226Ra, 1 to 2% for 210Pb, 6 to 26% for 210Po, 260 to 370% for 137Cs, and 76 to 130% for 40K, with 137Cs biomagnifying by a factor of 3-4. These CRs are useful in predicting caribou meat concentrations from the lichens, measured in monitoring programs, for the future evaluation of uranium mining impacts on this critical food chain. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:10378999

  18. Stress/Strain Ratio Effects on Fatigue Response of a SCS-6/Ti-15-3 Metal Matrix Composite at Elevated Temperature.

    DTIC Science & Technology

    1995-12-01

    consisted of a titanium alloy matrix, Figure 1. Turbine Blade Load History [19] Ti-15-3, reinforced with silicon carbide fibers, SCS-6. For this...Composite Science and Technology 1994. 19. Pernot, J. J., Crack Growth Rate Modeling of a Titanium Aluminide Alloy Under Thermal Mechanical Cycling. PhD...Appendix B: Additional Unidirectional, [0]8, Data 102 7. Bibliography 109 8. Vita 112 IV List of Fieures Figure Page 1. Turbine Blade Load

  19. Demonstrating Optical Aberration Correction With a Mems Micro-Mirror Device

    DTIC Science & Technology

    1996-12-01

    intensity distributions for a corrected and uncorrected MEMS reflection. The curves have been nor- malized to the peak value of the corrected wave front...demonstration: A = 632.8 mn, f = 7 mm, and L = 203 ym. For the solid curve , s = 0, while the dashed curve shows s = 7r/L, so that the change in phase...specified for Figure 8 (see page 29), so that the figures are directly comparable. The solid curve shows an intensity distribution for 01 = 0 (no

  20. Use of Forward Scattering Particle Image Velocimetry to Quantify a Flow Field Near a Fully Submerged Tension Leg Platform in the Presence of Waves

    DTIC Science & Technology

    2012-05-01

    8217’�/_’ ________ __ � J "Q. F E -3 ¥-------���-------����------------ c( -6 ------------------------------- Time (s) -9...image). Figure 5: Corrected image (left) and vector diagram (right) - wave amplitude of 5.33cm (2.1in) (Wave Crest) ·( J 20 ·0 IS ·0 10 ·0 ( j ...34 ·-0.20 ··0 " -U J ( J Figure 8: Corrected image and vector diagram - wave amplitude of -4.83cm (-1.9in) Figure 9: Corrected image and vector

  1. AIDS-related lymphoma. Histopathology, immunophenotype, and association with Epstein-Barr virus as demonstrated by in situ nucleic acid hybridization.

    PubMed Central

    Hamilton-Dutoit, S. J.; Pallesen, G.; Franzmann, M. B.; Karkov, J.; Black, F.; Skinhøj, P.; Pedersen, C.

    1991-01-01

    To investigate the range of pathology shown by acquired immune deficiency syndrome (AIDS)-related lymphomas arising in an epidemiologically well-defined group of patients, all cases of lymphoma recognized in Danish human immunodeficiency virus (HIV)-infected individuals up to the end of 1988 were studied. Twenty-seven cases (26 high-grade non-Hodgkin's lymphoma [NHL], 1 Hodgkin's disease) were found, to give a cumulative incidence rate of 8% among Danish AIDS patients. Morphologically most NHL patients were classified into two groups: 1) high-grade tumors with a predominant population of immunoblasts, either monomorphic or more often polymorphic with plasmacytic differentiation; 2) Burkitt-type. Of 26 NHLs, 22 had a B-cell paraffin-section immunophenotype and 4 were non-B, non-T. Epstein-Barr virus (EBV) DNA was demonstrated in tumor cells of 12 of 24 cases (50%) using in situ nucleic acid hybridization with a 35S-labeled probe in paraffin sections. Epstein-Barr virus DNA was found in 65% of group 1 and 20% of group 2 tumors. This study suggests the existence of two main groups of AIDS-related lymphoma with different pathogeneses. First there are immunoblast-rich lesions, which usually are associated with EBV and morphologically resemble lymphomas described in immunosuppressed organ-transplantation patients. Second there are Burkitt-type tumors in which EBV sequences are less common and that may be pathogenetically analogous to sporadic Burkitt's lymphoma. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:1846263

  2. Wavelength Modulation Spectroscopy for Temperature and Species Concentration in the Plume of a Supersonic Nozzle (Conference Paper with Briefing Charts)

    DTIC Science & Technology

    2017-07-12

    Aλ(y)) from Figure 5 to be converted into integrated absorbance as a function of radius (A’λ(r)), by the use of an inverse Abel transform (Equation...harsh environments,” Appl. Opt., vol. 48, no. 29, p. 5546, Oct. 2009. (8) Figure 8: Radial temperature distribution from inverse Abel transform...Results – Data processing – Absorbance area – Temperature measurements o Path averaged o Abel inversion – Species Concentration 5) Conclusions and

  3. X-ray Diffraction as a Means to Assess Fatigue Performance of Shot-Peened Materials

    DTIC Science & Technology

    2012-06-01

    titanium 6 - 4 fatigue data exhibited similar trends to the 9310 steel material. Low shot- peening intensities (4A and 8A) improved fatigue performance... 6 Figure 4 ...7 Figure 4 . Residual stress and diffraction peak width data from the beta-STOA titanium 6Al-4V disks. attributed to the hardness of the

  4. Figures in clinical trial reports: current practice & scope for improvement.

    PubMed

    Pocock, Stuart J; Travison, Thomas G; Wruck, Lisa M

    2007-11-19

    Most clinical trial publications include figures, but there is little guidance on what results should be displayed as figures and how. To evaluate the current use of figures in Trial reports, and to make constructive suggestions for future practice. We surveyed all 77 reports of randomised controlled trials in five general medical journals during November 2006 to January 2007. The numbers and types of figures were determined, and then each Figure was assessed for its style, content, clarity and suitability. As a consequence, guidelines are developed for presenting figures, both in general and for each specific common type of Figure. Most trial reports contained one to three figures, mean 2.3 per article. The four main types were flow diagram, Kaplan Meier plot, Forest plot (for subgroup analyses) and repeated measures over time: these accounted for 92% of all figures published. For each type of figure there is a considerable diversity of practice in both style and content which we illustrate with selected examples of both good and bad practice. Some pointers on what to do, and what to avoid, are derived from our critical evaluation of these articles' use of figures. There is considerable scope for authors to improve their use of figures in clinical trial reports, as regards which figures to choose, their style of presentation and labelling, and their specific content. Particular improvements are needed for the four main types of figures commonly used.

  5. Effects of Trichothecenes on Cardiac Cell Electrical Function

    DTIC Science & Technology

    1985-12-13

    Figure 8 illustrate the typical effects of trichothecene mycotoxins in canine ventricular cells. T-2 tetraol, for example, reduced the total duration of...potentials from false tendon cells and ventricular muscle cells (shown in Figure 8) illustrate the typical effects of trichothecene mycotoxins in canine...the plateau (arrow) from 14 my to 4 my. Table 6 summarizes the effects of T-2 mycotoxin on the action potential parameters of false tendon cells and

  6. A century of pathology at Yale: personal reflections.

    PubMed Central

    Yesner, R.

    1998-01-01

    This history is largely about the players on the stage of the Yale Pathology Department acting out their roles as observed by the author in over a half century as a member of the department and as associate dean of the medical school. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:10527367

  7. Functional Assessment of Laser Irradiation

    DTIC Science & Technology

    1988-03-01

    1 Diagram of the Plexiglas restraint device used during laser exposure and acuity testing ........................................... 4 FIGURE 2...8 FIGURE 6 Spectral sensitivity curves for rhesus, human trichromat, and protonomalous human tested under similar...luminance, wavelength and logical means (fundoscopic or histologic verification contrast of test targets have yielded various damac of tissue damage) or can

  8. Thermoelectric properties of pressure-sintered Si(0.8)Ge(0.2) thermoelectric alloys

    NASA Technical Reports Server (NTRS)

    Vining, Cronin B.; Laskow, William; Hanson, Jack O.; Van Der Beck, Roland R.; Gorsuch, Paul D.

    1991-01-01

    The thermoelectric properties of 28 sintered Si(0.8)Ge(0.2) alloys, heavily doped with either B or P and prepared from powders with median particle sizes ranging from about 1 to over 100 microns, have been determined from 300 to 1300 K. The thermal conductivity decreases with decreasing particle size; however, the figure of merit is not significantly increased due to a compensating reduction in the electrical conductivity. The thermoelectric figure of merit is in good agreement with results of Dismukes et al. (1964) on similarly doped alloys prepared by zone-leveling techniques. The electrical and thermal conductivity are found to be sensitive to preparation procedure while the Seebeck coefficient and figure of merit are much less sensitive. The high-temperature electrical properties are consistent with charge carrier scattering by acoustic or optical phonons.

  9. Earth's field NMR; a surface moisture detector?

    NASA Astrophysics Data System (ADS)

    Fukushima, Eiichi; Altobelli, Stephen; McDowell, Andrew; Zhang, Tongsheng

    2012-10-01

    Earth's field NMR (EFNMR), being free of magnets, would be an ideal teaching medium as well as a mobile NMR technique except for its weak S/N. The common EFNMR apparatus uses a powerful prepolarization field to enhance the spin magnetization before the experiment. We introduce a coil design geared to larger but manageable samples with sufficient sensitivity without prepolarization to move EFNMR closer to routine use and to provide an inexpensive teaching tool. Our coil consists of parallel wires spread out on a plywood to form a current sheet with the current return wires separated so they will not influence the main part of the coil assembly. The sensitive region is a relatively thin region parallel to the coil and close to it. A single turn of the coil is wound to be topologically equivalent to a figure-8. The two crossing segments in the center of a figure-8 form two of the parallel wires of the flat coil. Thus, a two-turn figure-8 has four crossing wires so its topologically equivalent coil will have four parallel wires with currents in phase. Together with the excellent sensitivity, this coil offers outstanding interference rejection because of the figure-8 geometry. An example of such a coil has 328 parallel wires covering a ˜1 meter square plywood which yields a good NMR signal from 26 liters of water spread out roughly over the area of the coil in less than one minute in a nearby park.

  10. Fabrication of precision optics using an imbedded reference surface

    DOEpatents

    Folta, James A.; Spiller, Eberhard

    2005-02-01

    The figure of a substrate is very precisely measured and a figured-correcting layer is provided on the substrate. The thickness of the figure-correcting layer is locally measured and compared to the first measurement. The local measurement of the figure-correcting layer is accomplished through a variety of methods, including interferometry and fluorescence or ultrasound measurements. Adjustments in the thickness of the figure-correcting layer are made until the top of the figure-correcting layer matches a desired figure specification.

  11. Determination of the order of substrate addition to MspI DNA methyltransferase using a novel mechanism-based inhibitor.

    PubMed Central

    Taylor, C; Ford, K; Connolly, B A; Hornby, D P

    1993-01-01

    The cloning and overexpression of the MspI DNA methyltransferase as a functional fusion with glutathione S-transferase is described. The fusion enzyme retains full biological activity and has been used to investigate the interaction of substrates and inhibitors with MspI DNA methyltransferase. The fusion enzyme has been purified to homogeneity in a single step on GSH-agarose and is free from contaminating exonuclease activity. The enzyme can be photolabelled with S-adenosyl-L-methionine and the level of incorporation of label is enhanced by the presence of a nonspecific DNA duplex. In the presence of a cognate oligodeoxynucleotide, no photolabelling was observed since methyl transfer occurs instead. The inclusion of a mechanism-based inhibitor of C-5 deoxycytidine DNA methylation (an oligodeoxynucleotide containing the base 2-pyrimidinone-1-beta-D-2'-deoxyribofuranoside in the position of the deoxycytidine to which methyl addition occurs), which is thought to form a covalent interaction with the reactive cysteine of such enzymes, led to an enhancement of S-adenosyl-L-methionine photolabelling which suggests that, in contrast with results obtained with EcoRII DNA methyltransferase [Som and Friedman (1991) J. Biol. Chem. 266, 2937-2945], methylcysteine is not the photolabelled product. The implications of the results obtained with this mechanism-based inhibitor are discussed with respect to other C-5-specific DNA methyltransferases. Gel-retardation assays in the presence of cognate oligodeoxynucleotides that contain the reactive pyrimidinone base in place of the deoxycytidine target base are described. These demonstrate that most probably a stable covalent bond is formed between the methyltransferase and this oligodeoxynucleotide. However, the alternative of extremely tight non-covalent binding cannot be rigorously excluded. Furthermore, the results from these experiments indicate that the reaction mechanism proceeds in a manner similar to that of HhaI DNA methyltransferase with sequence-specific DNA binding being followed by addition of S-adenosyl-L-methionine and concomitant isomerization of the ternary complex leading to methyl transfer. S-Adenosyl-L-homocysteine appears to inhibit the reaction pathway as a result of either competition with the methyl donor and potentiation of a high-affinity interaction between the enzyme and DNA in an abortive ternary complex or through an allosteric interaction. Images Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 PMID:8484730

  12. Automated Design of Board and MCM Level Digital Systems.

    DTIC Science & Technology

    1997-10-01

    Partitioning for Multicomponent Synthesis 159 Appendix K: Resource Constrained RTL Partitioning for Synthesis of Multi- FPGA Designs 169 Appendix L...digital signal processing) ar- chitectures. These target architectures, illustrated in Figure 1, can contain application-specific ASICS, FPGAs ...synthesis tools for ASIC, FPGA and MCM synthesis (Figure 8). Multicomponent Partitioning Engine The par- titioning engine is a hierarchical partitioning

  13. Controlled Microwave-Assisted Growth of Monodisperse of Silica Nanoparticles under Acid Catalysis (Postprint)

    DTIC Science & Technology

    2012-11-26

    appear truncated with flat surfaces and have polyhedron shape, whereas particles in Figure 8b,c have smoother surfaces compared to those in Figure 7a, but...appear to be polyhedron in shape. (b, c) Spherical SiO2 NPs are observed for the larger particles. Particles imaged in b have average sizes of 163 ± 13

  14. Production of 8.4m segments for the Giant Magellan Telescope

    NASA Astrophysics Data System (ADS)

    Martin, H. M.; Allen, R. G.; Burge, J. H.; Kim, D. W.; Kingsley, J. S.; Law, K.; Lutz, R. D.; Strittmatter, P. A.; Su, P.; Tuell, M. T.; West, S. C.; Zhou, P.

    2012-09-01

    Production of segments for the Giant Magellan Telescope is well underway at the Steward Observatory Mirror Lab. We report on the completion of the first 8.4 m off-axis segment, the casting of the second segment, and preparations for manufacture of the remaining segments. The complete set of infrastructure for serial production is in place, including the casting furnace, two 8.4 m capacity grinding and polishing machines, and a 28 m test tower that incorporates four independent measurement systems. The first segment, with 14 mm p-v aspheric departure, is by some measures the most challenging astronomical mirror ever made. Its manufacture took longer than expected, but the result is an excellent figure and demonstration of valuable new systems that will support both fabrication and measurement of the remaining segments. Polishing was done with a 1.2 m stressed lap for smoothing and large-scale figuring, and a series of smaller passive rigid-conformal laps for deterministic figuring on smaller scales. The interferometric measurement produces a null wavefront with a 3-element asymmetric null corrector including a 3.8 m spherical mirror and a computer-generated hologram. In addition to this test, we relied heavily on the new SCOTS slope test with its high accuracy and dynamic range. Evaluation of the measured figure includes simulated active correction using both the 160-actuator mirror support and the alignment degrees of freedom for the off-axis segment.

  15. The reference frame of figure-ground assignment.

    PubMed

    Vecera, Shaun P

    2004-10-01

    Figure-ground assignment involves determining which visual regions are foreground figures and which are backgrounds. Although figure-ground processes provide important inputs to high-level vision, little is known about the reference frame in which the figure's features and parts are defined. Computational approaches have suggested a retinally based, viewer-centered reference frame for figure-ground assignment, but figural assignment could also be computed on the basis of environmental regularities in an environmental reference frame. The present research used a newly discovered cue, lower region, to examine the reference frame of figure-ground assignment. Possible reference frames were misaligned by changing the orientation of viewers by having them tilt their heads (Experiments 1 and 2) or turn them upside down (Experiment 3). The results of these experiments indicated that figure-ground perception followed the orientation of the viewer, suggesting a viewer-centered reference frame for figure-ground assignment.

  16. Figures in clinical trial reports: current practice & scope for improvement

    PubMed Central

    Pocock, Stuart J; Travison, Thomas G; Wruck, Lisa M

    2007-01-01

    Background Most clinical trial publications include figures, but there is little guidance on what results should be displayed as figures and how. Purpose To evaluate the current use of figures in Trial reports, and to make constructive suggestions for future practice. Methods We surveyed all 77 reports of randomised controlled trials in five general medical journals during November 2006 to January 2007. The numbers and types of figures were determined, and then each Figure was assessed for its style, content, clarity and suitability. As a consequence, guidelines are developed for presenting figures, both in general and for each specific common type of Figure. Results Most trial reports contained one to three figures, mean 2.3 per article. The four main types were flow diagram, Kaplan Meier plot, Forest plot (for subgroup analyses) and repeated measures over time: these accounted for 92% of all figures published. For each type of figure there is a considerable diversity of practice in both style and content which we illustrate with selected examples of both good and bad practice. Some pointers on what to do, and what to avoid, are derived from our critical evaluation of these articles' use of figures. Conclusion There is considerable scope for authors to improve their use of figures in clinical trial reports, as regards which figures to choose, their style of presentation and labelling, and their specific content. Particular improvements are needed for the four main types of figures commonly used. PMID:18021449

  17. Structure-activity relationships for xenobiotic transport substrates and inhibitory ligands of P-glycoprotein.

    PubMed Central

    Bain, L J; McLachlan, J B; LeBlanc, G A

    1997-01-01

    The multixenobiotic resistance phenotype is characterized by the reduced accumulation of xenobiotics by cells or organisms due to increased efflux of the compounds by P-glycoprotein (P-gp) or related transporters. An extensive xenobiotic database, consisting primarily of pesticides, was utilized in this study to identify molecular characteristics that render a xenobiotic susceptible to transport by or inhibition of P-gp. Transport substrates were differentiated by several molecular size/shape parameters, lipophilicity, and hydrogen bonding potential. Electrostatic features differentiated inhibitory ligands from compounds not catagorized as transport substrates and that did no interact with P-gp. A two-tiered system was developed using the derived structure-activity relationships to identify P-gp transport substrates and inhibitory ligands. Prediction accuracy of the approach was 82%. We then validated the system using six additional pesticides of which tow were predicted to be P-gp inhibitors and four were predicted to be noninteractors, based upon the structure-activity analyses. Experimental determinations using cells transfected with the human MDR1 gene demonstrated that five of the six pesticides were properly catagorized by the structure-activity analyses (83% accuracy). Finally, structure-activity analyses revealed that among P-gp inhibitors, relative inhibitory potency can be predicted based upon the surface area or volume of the compound. These results demonstrate that P-gp transport substrates and inhibitory ligands can be distinguished using molecular characteristics. Molecular characteristics of transport substrates suggest that P-gp may function in the elimination of hydroxylated metabolites of xenobiotics. Images Figure 1. A Figure 1. B Figure 1. C Figure 1. D Figure 1. E Figure 1. F Figure 1. G Figure 1. H Figure 2. Figure 2. Figure 2. Figure 2. Figure 2. Figure 2. Figure 3. A Figure 3. B PMID:9347896

  18. Subcellular distribution and life cycle of Epstein-Barr virus in keratinocytes of oral hairy leukoplakia.

    PubMed Central

    Rabanus, J. P.; Greenspan, D.; Petersen, V.; Leser, U.; Wolf, H.; Greenspan, J. S.

    1991-01-01

    The authors investigated the life cycle of Epstein-Barr virus (EBV) in keratinocytes of oral hairy leukoplakia by combining immunohistochemistry. DNA in situ hybridization, and lectin histochemistry with electron microscopy. Diffuse-staining components of the EBV early antigen complex (EA-D), EBV 150-kd capsid antigen (VCA), EBV membrane antigen (gp350/220), and double-stranded DNA were labeled with monoclonal antibodies. An EBV-DNA probe was used to locate EBV DNA. Wheat-germ agglutinin (WGA) was employed to distinguish Golgi-associated compartments. The authors found EBV proteins and EBV DNA only in keratinocytes with apparent viral assembly. In situ hybridization showed EBV DNA in free corelike material and in electron-dense cores of mature nucleocapsids. Monoclonal antibodies to nonspecific double-stranded DNA attached to the same structures and to marginated chromatin. Components of EA-D were dispersed throughout the nuclei but accumulated near condensed chromatin and in 'punched-out' regions of the chromatin. Epstein-Barr virus 150-kd capsid antigen was found only in the nuclei, where it appeared preferentially on mature nucleocapsids. As yet unexplained arrays of intranuclear particles that remained unlabeled with all EBV-specific probes reacted intensely with an antiserum against common papillomavirus antigen. Gp350/220 was detectable in various cellular membrane compartments and was highly concentrated on EBV envelopes in peripheral Golgi-associated secretory vesicles. It was less abundant on the extracellular EBV, indicating that viral membrane antigen partly dissociates from the mature virus. Combined lectin-binding histochemistry and electron microscopy demonstrated for the first time that EBV is processed in the Golgi apparatus, which eventually releases the virus by fusion with the plasma membrane. These results provide insight into the biologic events that occur during complete EBV replication in vivo. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:1649554

  19. [New projections for the world population to the year 2025].

    PubMed

    Srb, V

    1988-03-01

    The 1982 and 1984 population projection program of the United Nations containing estimations for the world's population for 2000-2025 had 3 variations: the median projection figure for 2000 was 6.122 billion and for 2025 8.025 billion. The respective figures of the high estimate were 6.340 and 9.088 billion, and the low estimate envisioned 5.927 and 7.358 billion people, respectively. THe corresponding rate of growth is expected to slow down from 1.67% during 1980-1985 to 1.38% during 2000- 2005, and to drop to 0.96% during 2020-2025. The rate of growth of the global population is to decrease from 37.6% during 1980-2000 to 27.4% during 2000-2020. The difference of the projections of 1982 and 1984 is only 29 million people (8.177 and 8.206, respectively). During the period 2000-2020 the population of Africa is expected to grow to make up 11.5% of the world's population, Europe would make up 10.20% and Asia 58.2%. By 2025 the respective figures would be 19.7%, 6.4%, and 55.3%. The rate of growth of 4 European regions would vary during 1980-2000 and 2000-2025: in Eastern Europe 10% and 7.3%, respectively, in Western Europe 2.0% and 0.0%, in Southern Europe 9.2% and 3.9%, and in Northern Europe 1.6% and -2.8%, respectively. The negative growth figures of the German Democratic Republic were revised from 1982 estimates to show a 2.5% and 2.4% increase during the respective periods. The slight increases (1.8% and 0.2%) projected for Hungary were reversed to zero or negative growth (0.0% and -0.8%). During these periods the growth figures for Czechoslovakia would be 8.3% and 8.0%, for Poland 14.7% and 9.2%, for Romania 15.2% and 11.4%, and for Bulgaria 7.6% and 4.6%, respectively. Life expectancy for the periods 1985-1990 and 2010-2025 is estimated at 61.1 and 70.5 years for the world, and 74.0 and 77.2 years for Europe.

  20. Investigation of Materials Processing Technology

    DTIC Science & Technology

    1993-07-01

    Figure 6: Time-temperature curves of A357 casting in Cu mold ................. 12 Figure 7: Time-temperature curves of 17 -4 casting in ceramic mold...simulation of 17 -4 ................ 17 Figure 12: IHTC from IHEAT simulation of 17 -4 casting ..................... 18 Figure 13: Temperature profiles...mold used for Ti castings .......................... 23 Figure 16: Cooling curves for a Ti casting in ceramic mold .................. 24 Figure 17

  1. Molecular and Physiological Analysis of a Heat-Shock Response in Wheat 1

    PubMed Central

    McElwain, Elizabeth F.; Spiker, Steven

    1992-01-01

    We have isolated two cDNA clones from wheat (Triticum aestivum L. var Stephens), designated WHSP16.8 and WHSP16.9, that are highly similar in sequence to the low molecular weight heat-shock protein genes previously isolated from soybean. RNA blot analysis confirms that these sequences are present in heat-shocked wheat seedlings, but not in control tissues. The WHSP16.8 and WHSP16.9 cDNAs were isolated by screening a lambda gt11 expression library with antibodies to HMGc (a chromosomal protein of wheat). Immunoblot analysis has demonstrated that the antibodies raised against HMGc also recognize a group of proteins that are induced by heat shock and have molecular weights (estimated by sodium dodecyl sulfate electrophoresis) consistent with the molecular weights of the proteins deduced from the sequences of the cDNAs. ImagesFigure 3Figure 4Figure 5 PMID:16669058

  2. Radiation Effects on the Electrical Properties of Hafnium Oxide Based MOS Capacitors

    DTIC Science & Technology

    2011-03-01

    Figures Figure Page 1. Conceptual illustration of the creation of electron-hole pairs and displacement damage in a n -type silicon metal-oxide-silicon...Illustration of the effect, in a CV plot, of oxide trapped charge for a hypothetical n -type device...8 5. Illustration of the effect, in a CV plot, of interface trapped charge for a hypothetical n -type device

  3. Common Dermatoses of Infancy

    PubMed Central

    Gora, Irv

    1986-01-01

    Within the pediatric population of their practices, family physicians frequently encounter infants with skin rashes. This article discusses several of the more common rashes of infancy: atopic dermatitis, cradle cap, diaper dermatitis and miliaria. Etiology, clinical picture and possible approaches to treatment are presented. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6Figure 7 PMID:21267297

  4. Computer Directed Training System (CDTS), User’s Manual

    DTIC Science & Technology

    1983-07-01

    lessons, together with an estimate of the time required for completion. a. BSCOl0. This lesson in BASIC ( Beginners All Purpose Symbolic Instruction Code...A2-8 FIGURESj Figure A2-1. Training Systems Manager and Training Monitors Responsibility Flowchart ...training at the site. Therefore, the TSM must be knowledgeable in the various tasks required. Figure A2-1 illustrates the position in the flowchart . These

  5. Metastic Progression of Breast Cancer by Allelic Loss on Chromosome 18q21

    DTIC Science & Technology

    2006-03-01

    Smad5 Smad2 Smad3 Smad8 Smad6 Samd7 MH1 Linker MH2 S1 S2 S3 Smad4 Smad1, Smad5 Samd2, Smad3 ,Smad8 Smad6,Smad7 ?? ?? A. B. Figure 1...homologous amino acid sequences at their N- and C- terminal regions (MH1 and MH2 respectively), which are separated by a highly divergent linker region...cancers (Figure 2). NB 2 3 4 5 6 7 8 9 10 11 12 13 14 Smad8α Smad8β Smad8γ Smad3α Smad3 β NB 1 2 3 4 5

  6. Figure-ground organization in real and subjective contours: a new ambiguous figure, some novel measures of ambiguity, and apparent distance across regions of figure and ground.

    PubMed

    Shank, M D; Walker, J T

    1989-08-01

    This study was designed to assess the effects of organization, luminance contrast, sector angle, and orientation on a new, highly ambiguous Cs-keyhole figure. Organization and contrast were the most important factors, and sector angle also influenced figure-ground relationships. There was no significant effect of orientation, nor was there any significant interaction between any of the factors. Several new measures of figure-ground organization were developed, such as ambiguity ratios based on reaction times and on ratings of the strength of perceived organizations, providing new quantitative measures of figure-ground relationships. Distances measured across figural regions appeared smaller than equal distances across the ground in the new reversible figure, and also in Rubin's classic vase-face figure presented in real and subjective contours. Inducing a perceptual set to see a particular organization in a reversible figure influenced the apparent distance across that organization. Several possible explanations of the observed effects are considered: (1) an instance of Emmert's law, based on the difference in apparent depth of figure and ground; (2) an aspect of the Müller-Lyer illusion; (3) a feature-detector model of contour attraction; (4) a natural set or predisposition to see a figure as smaller; and (5) framing effects. The first two explanations appear the most promising.

  7. Redundant colon and carcinoma of the right colon.

    PubMed Central

    Perry-Thornton, E.; Karkala, J.; Verly, G. P.; Walker, M.

    1989-01-01

    The combination of redundant colon, multiple villose, adenomas, and a colloid adenocarcinoma arising in one villous adenoma in a black man is rare. The authors report such a case. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:2545894

  8. Software Requirements Specification for an Ammunition Management System

    DTIC Science & Technology

    1986-09-01

    thesis takes the form of a software requirements specification. Such a specification, according to Pressman [Ref. 7], establishes a complete...defined by Pressman , is depicted in Figure 1.1. 11 Figure 1.1 Generalized Software Life Cycle The common thread which binds the various phases together...application of software engineering principles requires an established methodology. This methodology, according to Pressman [Ref. 8:p. 151 is an

  9. Path Planning for Reduced Identifiability of Unmanned Surface Vehicles Conducting Intelligence, Surveillance, and Reconnaissance

    DTIC Science & Technology

    2017-05-22

    angular velocity values Figure 33: Feasibility test Figure 34: Bellman’s Principle Figure 35: Bellman’s Principle validation Minimum Figure 36...Distribution of at test point for simulated ISR traffic Figure 48: PDFs of observed and ISR traffic Table 2: Adversary security states at test point #10...Figure 49: Hypothesis testing at test point #10 Figure 50: Distribution of for observed traffic Figure 51: Distribution of for ISR traffic Table 3

  10. Cutaneous basophil anaphylaxis. Immediate vasopermeability increases and anaphylactic degranulation of basophils at delayed hypersensitivity reactions challenged with additional antigen.

    PubMed Central

    Askenase, P W; Debernardo, R; Tauben, D; Kashgarian, M

    1978-01-01

    Many delayed-type reactions contain large infiltrates of basophils whose function is unknown. We have studied these cutaneous basophil hypersensitivity (CBH) reactions in guinea-pigs to ascertain whether basophils that are recruited to delayed reaction sites could be triggered for immediate reactivity. We compared 24 h CBH reactions with nearby skin for immediate hypersensitivity by challenging each site with small amounts of antigen. CBH sites had augmented immediate increases in vascular permeability detected by extravasation of Evan's blue dye. The ability to elicit this augmented anaphylactic phenomenon correlated with the local presence of basophils, and light microscopy at CBH reactions 15 min after antigen challenge showed a 50% decline in basophil counts. Electron microscopy showed that progressive anaphylactic-type degranulation of local basophils occurred within minutes following reintroduction of antigen. There was fusion of vacuoles containing granules, exocytosis of granules, and dissolution of granules, without ultrastructural disruption of cellular integrity. These results establish that basophils in CBH reactions can be triggered with soluble antigen to undergo anaphylactic degranulation, with the immediate release of vasoactive mediators. We have termed this phenomenon 'cutaneous basophil anaphylaxis'. Thus, one function of basophils at sites of delayed hypersensitivity may be to provide the potential for augmented, local, immediate anaphylactic reactivity. Images Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 PMID:721140

  11. Drilling the near cortex with elongated figure-of-8 holes to reduce the stiffness of a locking compression plate construct.

    PubMed

    Chen, Jerry Yongqiang; Zhou, Zhihong; Ang, Benjamin Fu Hong; Yew, Andy Khye Soon; Chou, Siaw Meng; Chia, Shi-Lu; Koh, Joyce Suang Bee; Howe, Tet Sen

    2015-12-01

    To compare the stiffness of locking compression plate (LCP) constructs with or without drilling the near cortex with elongated figure-of-8 holes. 24 synthetic bones were sawn to create a 10-mm gap and were fixed with a 9-hole 4.5-mm narrow LCP. In 12 bones, the near cortex of the adjacent holes to the LCP holes was drilled to create elongated figure-of-8 holes before screw insertion. The stiffness of LCP constructs under axial loading or 4-point bending was assessed by (1) dynamic quasi-physiological testing for fatigue strength, (2) quasi-static testing for stiffness, and (3) testing for absolute strength to failure. None of the 24 constructs had subcatastrophic or catastrophic failure after 10 000 cycles of fatigue loading (p=1.000). The axial stiffness reduced by 16% from 613±62 to 517±44 N/mm (p=0.012) in the case group, whereas the bending stiffness was 16±1 Nm2 in both groups (p=1.000). The maximum axial load to catastrophic failure was 1596±84 N for the control group and 1627±48 N for the case group (p=0.486), whereas the maximum bending moment to catastrophic failure was 79±12 and 80±10 Nm, respectively (p=0.919). Drilling the near cortex with elongated figure-of-8 holes reduces the axial stiffness of the LCP construct, without compromising its bending stiffness or strength.

  12. The Model Analyst’s Toolkit: Scientific Model Development, Analysis, and Validation

    DTIC Science & Technology

    2013-05-20

    Charles River’s Metronome framework. This framework is built on top of the same Equinox libraries that the popular Eclipse Development Environment uses...the names are fully visible (see Figure 8). The Metronome framework also provides functionality for undo and redo, so the user can easily correct...mistakes. Figure 8. Changing Pane sizes and layouts in the new Metronome -enhanced MAT This period, we also improved the MAT project file format so

  13. Insulation Retrofit under Low-Slope Roofs.

    DTIC Science & Technology

    1982-02-01

    Johns-Manville "Money-Clip" System 13 7 Completed "Money-Clip" Installation 14 4 8 Owens - Corning Fiberglas "Energy Miser" System 14 9 Deteriorated...lip" installationi. Figure 8. Owens - Corning Fiberglas "Energy Miser" systemn. (From The If.nvrgv,%Mise~r Sr1stenz [Owens Corningl .) 14 Figure 9...evaluating the products and systems available for upgrading the thermal prop- Johns-Manville and Owens - Corning Fiberglas each erties of low-slope roofs by

  14. The Design and Implementation of a Graphical VHDL (VHSIC Hardware Description Language) User Interface

    DTIC Science & Technology

    1988-12-01

    VHSIC Program Office appropriately summarized the motivation behind VHDL as follows: Computer -aided engineering is a nightmare of incompatible formats and... Computer Science Branch. Interactive VHDL Workstation: Program Status Review Report, 8 October 1987. Air Force Contract F33615-85-C-1862. Information Systems...Typical Program Structure .................................. 14 3 Figure 4. GVUI Top-Level SADT Diagram ............................... .24 Figure 5

  15. Procedure for Near-Simultaneous Testing

    DTIC Science & Technology

    2006-12-01

    figure 8). A commercial handgun laser sight was fitted to a body that threaded on the breech end of each Mann barrel . After an initial test shot, the...Donald J. Little Weapons and Materials Research Directorate, ARL Approved for public...ANSI Std. Z39.18 Contents List of Figures iv 1. Introduction 1 2. Barrel Mounting 3 3. Target Fixturing 3 4. Electric Initiation 3 5. Gun

  16. NPS-SCAT; Communications System Design, Test and Integration of NPS’ First CubeSat

    DTIC Science & Technology

    2010-09-01

    18 c. MHX (Primary Transceiver) Wakeup Task ...19 d. Transmit MHX (Primary Transceiver) Task .20 e. Receive MHX (Primary Transceiver...Beacon Antenna Deploy Task......................17  Figure 8.  Collect Data Task...............................19  Figure 9.  MHX Wakeup Task...to provide education while keeping scheduling and cost minimal, and maintaining a standard for building a launchable spacecraft. The CubeSat

  17. Digitizing Consumption Across the Operational Spectrum

    DTIC Science & Technology

    2014-09-01

    Figure 14.  Java -implemented Dictionary and Query: Result ............................................22  Figure 15.  Global Database Architecture...format. Figure 14 is an illustration of the query submitted in Java and the result which would be shown using the data shown in Figure 13. Figure...13. NoSQL (key, value) Dictionary Example 22 Figure 14. Java -implemented Dictionary and Query: Result While a

  18. Design of a Compact Coaxial Magnetized Plasma Gun for Magnetic Bubble Expansion Experiments

    DTIC Science & Technology

    2009-06-01

    a peak a current Igun~ 80 kA and gun voltages Vgun~1 kV utine operation at a bank voltage of 7.5 kV yiel plasm after breakdown. Typical Igun and...and D2 are power electronic diodes, SW is the dump relay and C is the bias flux capacitor bank. The SCR, controlled by a 1 kV Trigger Pulse...capacitor charging circuit is shown in Figure 8. Figure 8. Gas valve capacitor charging circuit diagram 0 kΩ. 1, D2 and D3 are power electronic

  19. Common Elements of Risk

    DTIC Science & Technology

    2006-04-01

    8 Figure 5 : Threat and Operational Risk .................................................................... 9 Figure 6: Work Process...technical note might be applied to selected risk management topics. Finally, Section 5 , “Conclusion,” completes the report by summarizing the history...addressed in Section 5 . CMU/SEI-2006-TN-014 5 So far, our discussion has focused on the conceptual aspects of risk . The next section explores risk’s

  20. Matched Filter Stochastic Background Characterization for Hyperspectral Target Detection

    DTIC Science & Technology

    2005-09-30

    and Pre- Clustering MVN Test.....................126 4.2.3 Pre- Clustering Detection Results.................................................130...4.2.4 Pre- Clustering Target Influence..................................................134 4.2.5 Statistical Distance Exclusion and Low Contrast...al, 2001] Figure 2.7 ROC Curve Comparison of RX, K-Means, and Bayesian Pre- Clustering Applied to Anomaly Detection [Ashton, 1998] Figure 2.8 ROC

  1. Special Operations Aerial Mobility Vehicle Training Syllabus

    DTIC Science & Technology

    2013-12-01

    18 Figure 11. Icon Aircraft A5 Amphibious Light-Sport Aircraft .........................................19 Figure 12... Icon Aircraft A5 Wing Fold .............................................................................19 Figure 13. Icon Aircraft A5 Off Airport...intuitive. Figure 11. Icon Aircraft A5 Amphibious Light-Sport Aircraft34 Figure 12. Icon Aircraft A5 Wing Fold35

  2. Localization of HIV-1 co-receptors CCR5 and CXCR4 in the brain of children with AIDS.

    PubMed Central

    Vallat, A. V.; De Girolami, U.; He, J.; Mhashilkar, A.; Marasco, W.; Shi, B.; Gray, F.; Bell, J.; Keohane, C.; Smith, T. W.; Gabuzda, D.

    1998-01-01

    The chemokine receptors CCR5 and CXCR4 are co-receptors together with CD4 for human immunodeficiency virus (HIV)-1 entry into target cells. Macrophage-tropic HIV-1 viruses use CCR5 as a co-receptor, whereas T-cell-line tropic viruses use CXCR4. HIV-1 infects the brain and causes a progressive encephalopathy in 20 to 30% of infected children and adults. Most of the HIV-1-infected cells in the brain are macrophages and microglia. We examined expression of CCR5 and CXCR4 in brain tissue from 20 pediatric acquired immune deficiency syndrome (AIDS) patients in relation to neuropathological consequences of HIV-1 infection. The overall frequency of CCR5-positive perivascular mononuclear cells and macrophages was increased in the brains of children with severe HIV-1 encephalitis (HIVE) compared with children with mild HIVE or non-AIDS controls, whereas the frequency of CXCR4-positive perivascular cells did not correlate with disease severity. CCR5- and CXCR4-positive macrophages and microglia were detected in inflammatory lesions in the brain of children with severe HIVE. In addition, CXCR4 was detected in a subpopulation of neurons in autopsy brain tissue and primary human brain cultures. Similar findings were demonstrated in the brain of adult AIDS patients and controls. These findings suggest that CCR5-positive mononuclear cells, macrophages, and microglia contribute to disease progression in the central nervous system of children and adults with AIDS by serving as targets for virus replication. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 8 PMID:9422534

  3. The Haw River Sites: Archaeological Investigations at Two Stratified Sites in the North Carolina Piedmont. Volume III.

    DTIC Science & Technology

    1982-04-01

    Excavation Unit 5 - Square 8 - Level 4 - Feature 12 - n - 12 (ID numbers 368-379 in Appendix 3, Table 3) Vessel II Block C - Excavation Unit 6 - Square 8...Level 4 - Feature 7 - See Figure 7.13 - n 38 (ID numbers 380-417 In Appendix 3, Table 3) OO Vessel Ill Block C - Excavation Unit 7 - Square 1 - levels...4-8 - Feature 5 - See Figure 7.12 - n - 90 (ID numbers 418-507 In Appendix 3, Table 3) Vessel IV Block C - Excavation Unit 7 - Square 1 - Levels 4-8

  4. The edge complex: implicit memory for figure assignment in shape perception.

    PubMed

    Peterson, Mary A; Enns, James T

    2005-05-01

    Viewing a stepped edge is likely to prompt the perceptual assignment of one side of the edge as figure. This study demonstrates that even a single brief glance at a novel edge gives rise to an implicit memory regarding which side was seen as figure; this edge complex enters into the figure assignment process the next time the edge is encountered, both speeding same-different judgments when the figural side is repeated and slowing these judgments when the new figural side is identical to the former ground side (Experiments 1A and 1B). These results were obtained even when the facing direction of the repeated edge was mirror reversed (Experiment 2). This study shows that implicit measures can reveal the effects of past experience on figure assignment, following a single prior exposure to a novel shape, and supports a competitive model of figure assignment in which past experience serves as one of many figural cues.

  5. Parallel temperature dependence of contracture-associated enzyme release due to anoxia, 2,4-dinitrophenol (DNP), or caffeine and the calcium paradox.

    PubMed Central

    Ganote, C. E.; Sims, M. A.

    1984-01-01

    Hypothermia during calcium-free perfusion of hearts protects them from injury caused by subsequent calcium repletion at 37 C (calcium paradox). Injury to calcium-free hearts is also associated with contracture caused by anoxia, 2,4-dinitrophenol (DNP), or caffeine. This study was done for the purpose of determining whether hypothermia during calcium-free perfusions protects hearts from contracture-associated injury. Langendorff-perfused rat hearts were studied in four experimental groups: I) Anoxia: Thirty minutes of anoxic perfusion at 37 C was followed by thirty minutes of anoxic calcium-free perfusion at 37-18 C. II) Calcium paradox: Five minutes of calcium-free perfusion at 37-18 C was followed by calcium repletion at 37 C. III, IVa) Caffeine or DNP: Five minutes of calcium-free perfusion at 37-18 C was followed by addition of 10 mM caffeine or 1 mM DNP in calcium-free medium at 37 C or, IVb) 1 mM DNP in calcium-free medium at 22 C. Injury was assessed by measurement of serial releases of creatine kinase (CK) in effluents and by cellular morphology. The results show that progressive hypothermia to 22 C during calcium-free perfusion periods produced a progressive reduction of CK release and morphologic evidence of injury due to anoxia, caffeine, or DNP, which closely paralleled protection of hearts from the calcium paradox. Protection from injury in all experimental groups was associated with preservation of sarcolemmal membrane integrity and prevention of cell separations at intercalated disk junctions. It is proposed that weakening of intercalated disks occurs during calcium-free perfusions and may be a cause of mechanical fragility of the sarcolemma. Hypothermia may protect hearts from contracture-associated injury by preserving the integrity of intercalated disk junctions during periods of extracellular calcium depletion. Images Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 PMID:6742111

  6. [Application of inner figure-of-eight suture to laparoscopic colorectal surgery].

    PubMed

    Chen, Jianjun; Zhong, Ming

    2018-03-25

    Regardless of laparoscopic or open colorectal surgeries, intestinal anastomosis is usually an important operative procedure. Even if stapler is widely used in different intestinal surgery nowadays, hand sewn suture is an indispensable procedure in clinical practice, meanwhile after stapled anastomosis, additional hand sewn suture is usually performed to ensure the safety of anastomosis. The inner figure-of-eight suture is a single layer suture technique which has been widely used in skin, tendon, rectus and uterus for quick and secure approximation. We describe our innovative application of inner figure-of-eight suture technique for intestinal anastomosis and/or reinforcement after stapled anastomosis in laparoscopic colorectal surgery. Main steps of inner figure-of-eight suture for intestinal anastomosis on posterior wall are as follows: (1) At 4 mm from cut edge of bowel, needle enters vertically from one side and courses mucosa-serosa-opposite serosa-mucosa in parallel to the entry point. (2) The needle is brought back to first entry side of bowel at 45 degree to enter the mucosa 5 mm below the first entry point and out on opposite side mucosa horizontally. (3) Both lose ends of the suture are pulled to approximate bowel edges and knots are tied on mucosal surface, in which suture line presents figure-of-eight on mucosal surface and two parallel suture lines are seen on serosal surface. When inner figure-of-eight suture is performed on anterior wall, the procedure is similar, but needle passes from serosa-mucosa-opposite mucosa-serosa and repeated to complete the inner figure-8 suture and knots are tied on serosa. The final look is two parallel sutures at 0.5 mm in between and the figure-of-eight remains inside the lumen. We did not deliberately try to invert the bowel edges, and if anastomosis is not satisfactory at final examination, simple interrupted seromuscular suture can be carried out. From 2015 till now, we have successfully completed inner figure-of-eight sutures in 38 cases receiving intestinal anastomosis reinforcement procedure and in 24 cases receiving hand sewn anastomosis. Comparison study revealed inner figure-of-eight suture presented shorter anastomotic time and less medical cost without anastomotic leakage, stump leakage or bleeding. No anastomotic stenosis was found at enteroscopy examination during follow up. We think that inner figure-of-eight suture possesses safe and simple advantages and is a manual suture technique worthy of promotion.

  7. Computer-Aided Design for Built-In-Test (CADBIT) - Software Specification. Volume 3

    DTIC Science & Technology

    1989-10-01

    CADD COMAN WIDO IO-CNURET MSL PPLYING~ TET ATEN Figur 3-13- TUTORIA FIGUR PLCMI IN CAD-NVIOMENT ON BOAR SEFTST- 1"os-rnenu, long-tur d nnnih que- list...have software package for reliability calculation A-8 LIBRARY ELEMENT DATA SHE T’" BIT TECHNIQUE: ON-BOARD ROM CATEGORY: L’ONG TUTORIA PAGE ,5 of 14

  8. Study of Laminar Flame 2-D Scalar Values at Various Fuel to Air Ratios Using an Imaging Fourier-Transform Spectrometer and 2-D CFD Analysis

    DTIC Science & Technology

    2013-03-01

    NASA- Glenn’s Chemical Equilibrium with Applications (CEA) program. UNICORN CFD predictions were in excellent agreement with CEA calculations at...49 Appendix A – UNICORN CFD Inputs and Instruction .....................................................50 Appendix B – NASA-Glenn...17 Figure 7: Schematic of UNICORN CFD card setup. ........................................................ 18 Figure 8: Averaged flame

  9. Probability of Decompression Sickness in No-Stop Air Diving

    DTIC Science & Technology

    2004-12-01

    21 Figure 10. VVal-1 8 and StandAir Models .......................................... 22 Figure 11. Comparisons for...recommendations appear in heavy boxes. Information outside the heavy boxes allows comparisons between models. The recommendations are essentially arbitrary and...N2-0 2 Saturation Dives in Humans: DCS Risk and Evidence of a Threshold," Undersea Hyperbaric Medicine, In Press. 15. S. S. Survanshi, E. D. Parker, E

  10. Characterization and Dynamic Analysis of Long-Cavity Multi-Section Gain- Levered Quantum-Dot Lasers

    DTIC Science & Technology

    2013-03-01

    test setup .................................................................... 8 Figure 5: Comparison of a Fabry – Perot and distributed feedback...for example Fabry – Perot and distributed-feedback designs), with each possessing advantages and disadvantages that will be discussed in detail in...contrast to Fabry – Perot cavities (two discrete mirrors) that result in lasing over multiple longitudinal modes supported by the cavity. Figure 5 shows

  11. Integrated Information Support System (IISS). Volume 8. User Interface Subsystem. Part 10. Graph Support System Unit Test Plan

    DTIC Science & Technology

    1990-09-30

    UTP 620344220 30 September 1990 Command Line form gfl MSG: Estructure closed apIcatic Figure 5-64b (AFTER) 5-132 UTP 620344220 30 September 1990 Command...620344220 30 September 1990 Comman Lineay form gf 1 MSG: Estructure 9 psted on workstation 1 at priority 1 applcatioo Figure 5-101a (BEFORE) 5-205 UTP

  12. Woody Biomass Conversion to JP-8 Fuels

    DTIC Science & Technology

    2014-02-15

    Fermentation of Conditioned Extract or Brownstock to Lipids SUB 5 Mixed Culture Fermentation of Mixed-sugars in Raw extract to Mixed Acids SUB 6 TDO...avoiding the need for producing clean simple sugars tluough controlled hydrolysis, and detoxification in a particular case of fermentation ...according to high temperature simulated distillation (ASTM 7169) shown in Figure 5. Figure 5: Boiling point distribution data for raw TDO

  13. F-76 Lubricity Improver Additive Evaluation

    DTIC Science & Technology

    2013-09-16

    Figure 4. NCT differential water readings of 2x maximum dosage of Additive A .............................. 8 Figure 5. NCT differential water ...to compensate for the decrease in lubricity as ultra low sulfur fuels shift into focus while still retaining the fuel’s water separability traits...specification and fit-for-purpose testing, and several of these tests focused on the effects of the additives to the fuel’s water separation

  14. Figure-ground asymmetries in the Implicit Association Test (IAT).

    PubMed

    Rothermund, K; Wentura, D

    2001-01-01

    Based on the assumption that binary classification tasks are often processed asymmetrically (figure-ground asymmetries), two experiments showed that association alone cannot account for effects observed in the Implicit Association Test (IAT). Experiment 1 (N = 16) replicated a standard version of the IAT effect using old vs. young names as target categories and good and bad words as attribute categories. However, reliable compatibility effects were also found for a modified version of the task in which neutral words vs. nonwords instead of good vs. bad words were used as attribute categories. In Experiment 2 (N = 8), a reversed IAT effect was observed after the figure-ground asymmetry in the target dimension had been inverted by a previous go/nogo detection task in which participants searched for exemplars of the category "young." The experiments support the hypothesis that figure-ground asymmetries produce compatibility effects in the IAT and suggest that IAT effects do not rely exclusively on evaluative associations between the target and attribute categories.

  15. School-age children's fears, anxiety, and human figure drawings.

    PubMed

    Carroll, M K; Ryan-Wenger, N A

    1999-01-01

    The purpose of this study was to identify the fears of school-age children and determine the relationship between fear and anxiety. A descriptive, correlational, secondary analysis study was conducted using a convenience sample of 90 children between the ages of 8 and 12 years. Each child was instructed to complete the Revised Children's Anxiety Scale and then answer questions from a structured interview. On completion, each child was instructed to draw a human figure drawing. Frequency charts and correlational statistics were used to analyze the data. Findings indicated that the most significant fears of the boys were in the categories of animals, safety, school, and supernatural phenomena, whereas girls were more fearful of natural phenomena. High correlations existed between anxiety scores and the number of fears and emotional indicators on human figure drawings. Because human figure drawings are reliable tools for assessing anxiety and fears in children, practitioners should incorporate these drawings as part of their routine assessments of fearful children.

  16. PubMed Central

    Papageorges, M.; Lussier, S.; Breton, L.; Gosselin, Y.; Teuscher, E.

    1982-01-01

    A pulmonary anaplastic epithelioma in a bitch An anaplastic epithelioma of the lungs was diagnosed in a 26 month old female Airedale. The authors describe signs of bronchopneumonia and lameness involving the right fore and hind limbs. The lameness occurred following metastases to the long bones. The clinical signs, the radiological appearance, the postmortem lesions encountered with that neoplasm and differential diagnosis are discussed. ImagesFigure 1.Figure 2.Figure 3.Figure 4a,b.Figure 5.Figure 6. PMID:17422120

  17. Human figure drawing distinguishes Alzheimer's patients: a cognitive screening test study.

    PubMed

    Stanzani Maserati, Michelangelo; D'Onofrio, Renato; Matacena, Corrado; Sambati, Luisa; Oppi, Federico; Poda, Roberto; De Matteis, Maddalena; Naldi, Ilaria; Liguori, Rocco; Capellari, Sabina

    2018-05-01

    To study human figure drawing in a group of Alzheimer's disease (AD) patients and compare it with a group of patients with mild cognitive impairment (MCI) and controls. We evaluated consecutive outpatients over a one-year period. Patients were classified as affected by AD or by MCI. All patients and controls underwent a simplified version of the human-figure drawing test and MMSE. A qualitative and quantitative analysis of all human figures was obtained. 112 AD, 100 MCI patients and 104 controls were enrolled. AD patients drew human figures poor in details and globally smaller than MCI patients and controls. Human figures drawn by MCI patients are intermediate in body height between those of the AD patients and the healthy subjects. The head-to-body ratio of human figures drawn by AD patients is greater than controls and MCI patients, while the human figure size-relative-to-page space index is significantly smaller. Body height is an independent predictor of cognitive impairment correlating with its severity and with the number of the figure's details. Human figures drawn by AD patients are different from those drawn by healthy subjects and MCI patients. Human figure drawing test is a useful tool for orienting cognitive impairment's diagnosis.

  18. Molecular analysis of the inhibition of interleukin-8 production by dexamethasone in a human fibrosarcoma cell line.

    PubMed Central

    Mukaida, N; Gussella, G L; Kasahara, T; Ko, Y; Zachariae, C O; Kawai, T; Matsushima, K

    1992-01-01

    In order to analyse the effects of glucocorticoids on interleukin-8 (IL-8) production more precisely, we examined the effects of dexamethasone on IL-8 production at the molecular level in a human fibrosarcoma cell line, 8387, which IL-1 induces to express IL-8 messenger RNA (mRNA) and to secrete IL-8. Over a wide dose range, dexamethasone inhibited IL-8 production induced by IL-1 alpha stimulation. Northern blotting analysis showed that dexamethasone also inhibited the IL-8 mRNA accumulation in a similar dose-related manner. Nuclear run-off assay revealed that dexamethasone decreased the transcription of the IL-8 gene and the degree of inhibition of transcription correlated well with the inhibition of IL-8 production, suggesting that the action of glucocorticoids is mainly at the transcriptional level. Furthermore, transfection with chloramphenicol acetyl transferase (CAT) expression vectors inserted with the 5'-deleted IL-8 gene demonstrated that the 5'-flanking region which contains the glucocorticoid response element (GRE) was mainly involved in the dexamethasone-induced repression of the IL-8 gene. These data suggest that the inhibition of the IL-8 gene transcription by glucocorticoids occurs through the interaction of the glucocorticoid receptor complex with GRE in the 5'-flanking region of the IL-8 gene. Images Figure 1 Figure 2 Figure 3 PMID:1592440

  19. Proceedings of the Annual Chemical Defense Bioscience Review (4th) Held at Aberdeen Proving Ground, Maryland on 30 May-1 June 1984

    DTIC Science & Technology

    1984-06-01

    solution of NaIO. The resulting mixture was again separated by HPLC as shown in Figure 8. The new peaks which appear at 53 end 56 min are probably the...separated by HPLC as shown in Figure 10. This Figure shows the locations of the unmodified deoxynucleosides, deoxycytidine (dCR), deoxyguanosine (dGR...was labeled with 3H-DFP as -dTe-scried in the t.ext. 333 HPLC SIZE EXCLUSION CHROMATOGRAPHY PURIFIED AChE 25_ 0 20 -- LU Cco z< C 15 UI E_0 W C&’- Z CU

  20. The role of lines and corners of geometric figures in recognition performance.

    PubMed

    Shevelev, Igor A; Kamenkovich, Viktorina M; Sharaev, George A

    2003-01-01

    A relative role of lines and corners of images of outline geometric figures in recognition performance was studied psychophysically. Probability of correct response to the shape of the whole figure (control) and figures with lines or corners masked to a different extent was compared. Increase in the extent of masking resulted in a drop of recognition performance that was significantly lower for figures without corners, than for figures without part of their lines. The whole 3D figures were recognized better than 2D ones, whereas the opposite relations were observed under conditions of masking. Significant gender difference in a recognition performance was found: men recognize entire and partly masked figures better than women. Possible mechanisms of relatively better recognition of figures with corners than with lines are discussed in connection with finding of high sensitivity of many neurons in the primary visual cortex to line crossing and branching.

  1. Advancing Discrimination Performance by Integrating an Inertial Measurement Unit with a Handheld EMI Sensor

    DTIC Science & Technology

    2012-07-01

    does not display a currently valid OMB control number. 1. REPORT DATE JUL 2012 2 . REPORT TYPE N/A 3. DATES COVERED - 4. TITLE AND SUBTITLE...bottom right). ............................................................... 5 Figure 3- 2 A standard approach to mitigating sensor positioning...within the yellow enclosure. ........................ 8 Figure 3-5 A comparison of the actual ( 2 -D motion, pen trace on paper) versus the computed

  2. Argon Laser Treatment of Strawberry Hemangioma in Infancy

    PubMed Central

    Achauer, Bruce M.; Vander Kam, Victoria M.

    1985-01-01

    Argon laser therapy is effective for removing port-wine stains and for reducing cutaneous vascular and pigmented lesions. Strawberry hemangiomas, being much thicker lesions than port-wine stains, were considered not appropriate for argon laser treatment. Using argon laser therapy in 13 cases of strawberry hemangioma, we achieved poor to dramatic results. ImagesFigure 1.Figure 2.Figure 3.Figure 4.Figure 5.Figure 6.Figure 7. PMID:4082569

  3. Abnormal electroretinogram associated with developmental brain anomalies.

    PubMed Central

    Cibis, G W; Fitzgerald, K M

    1995-01-01

    PURPOSE: We have encountered abnormal ERGs associated with optic nerve hypoplasia, macular, optic nerve and chorioretinal colobomata and developmental brain anomalies. Brain anomalies include cortical dysgenesis, lissencephaly, porencephaly, cerebellar and corpus callosum hypoplasia. We describe six exemplar cases. METHODS: Scotopic and photopic ERGs adherent to international standards were performed as well as photopic ERGs to long-duration stimuli. CT or MRI studies were also done. The ERGs were compared to age-matched normal control subjects. RESULTS: ERG changes include reduced amplitude b-waves to blue and red stimuli under scotopic testing conditions. Implicit times were often delayed. The photopic responses also showed reduced amplitude a- and b-waves with implicit time delays. The long-duration photopic ERG done in one case shows attenuation of both ON- and OFF-responses. CONCLUSIONS: Common underlying developmental genetic or environmental unifying casualties are speculated to be at fault in causing these cases of associated retinal and brain abnormalities. No single etiology is expected. Multiple potential causes acting early in embryogenesis effecting neuronal induction, migration and differentiation are theorized. These occur at a time when brain and retinal cells are sufficiently undifferentiated to be similarly effected. We call these cases examples of Brain Retina Neuroembryodysgenesis (BRNED). Homeobox and PAX genes with global neuronal developmental influences are gene candidates to unify the observed disruption of brain and retinal cell development. The ERG can provide a valuable clinical addition in understanding and ultimately classifying these disorders. Images FIGURE 1 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 PMID:8719676

  4. Hierarchical CAD Tools for Radiation Hardened Mixed Signal Electronic Circuits

    DTIC Science & Technology

    2005-01-28

    11 Figure 3: Schematic of Analog and Digital Components 12 Figure 4: Dose Rate Syntax 14 Figure 5: Single Event Effects (SEE) Syntax 15 Figure 6...Harmony-AMS simulation of a Digital Phase Locked Loop 19 Figure 10: SEE results from DPLL Simulation 20 Figure 11: Published results used for validation...analog and digital circuitry. Combining the analog and digital elements onto a single chip has several advantages, but also creates unique challenges

  5. Adaptive Long-Term Monitoring at Environmental Restoration Sites (ER-0629)

    DTIC Science & Technology

    2009-05-01

    Figures Figure 2-1 General Flowchart of Software Application Figure 2-2 Overview of the Genetic Algorithm Approach Figure 2-3 Example of a...and Model Builder) are highlighted on Figure 2-1, which is a general flowchart illustrating the application of the software. The software is applied...monitoring event (e.g., contaminant mass based on interpolation) that modeling is provided by Model Builder. 4 Figure 2-1. General Flowchart of Software

  6. Pulmonary response to polyurethane dust.

    PubMed Central

    Stemmer, K L; Bingham, E; Barkley, W

    1975-01-01

    Weanling and 9 months or older rats were exposed to particles of an aged (PUF I) or freshly prepared (PUF II) rigid polyurethane foam by intratracheal intubation. The dose was 5 mg of particles. The response of the lung tissue was examined morphologically by serial sacrifices. Inflammation and macrophage activity were the initial responses. Fibrosis developed after 6 months. Nodular scars and perifocal emphysema were seen after 12 months. Four rats had a papillary adenoma in a major bronchus after 18 months exposure to PUF II. Images FIGURE 1. FIGURE 2. FIGURE 3. FIGURE 4. FIGURE 5. FIGURE 6. FIGURE 7. PMID:1175548

  7. Enhanced Performance & Functionality of Tunable Delay Lines

    DTIC Science & Technology

    2012-08-01

    Figure 6. Experimental setup. Transmitter is capable of generating 80-Gb/s RZ-DQPSK, 40-Gb/s RZ-DPSK and 40-Gb/s RZ-OOK modulation formats. Phase...Power penalty with respect to B2B of each channel for 2-, 4-, 8-fold multicasting. (c) Pulsewidth as a function of DGD along with eye diagrams of 2...63 Figure 99. Concept. (a) A distributed optical network ; (b) NOLMs for

  8. Refractory Metal Liner Processing for M242 Medium Caliber Barrels

    DTIC Science & Technology

    2013-01-01

    3 Figure 3. Measured hoop strain as a function of axial position for first 12-in steel cylinder. ........4 Figure 4. Hoop strain...measurements as a function of axial position for the second steel cylinder (8-in and 4-in plugs...A compression load of 160,000 lb was used for the second tube in order to obtain some plastic deformation of the steel cylinder; this load gave an

  9. Oxide Evolution in ODS Steel Resulting From Friction Stir Welding

    DTIC Science & Technology

    2014-06-01

    Master’s Thesis 4 . TITLE AND SUBTITLE OXIDE EVOLUTION IN ODS STEEL RESULTING FROM FRICTION STIR WELDING 5. FUNDING NUMBERS 6 . AUTHOR(S...temperatures, from [5]. ........... 6   Figure 4 .  The phase diagram for aluminum and yttrium oxide, from [13]. ......................8  Figure 5...millimeters per minute. FSW Conditions RPM IPM MMPM Heat Index 400 7 175 2.3 300 4 100 3 200 2 50 4 400 4 100 4 300 2 50 6 400 2 50 8 500 1 25

  10. Time-Reversal Based Range Extension Technique for Ultra-Wideband (UWB) Sensors and Applications in Tactical Communications and Networking

    DTIC Science & Technology

    2009-07-16

    Frequency (MHz) Figure 3.4: CABLE SMA/SMA 24" RG-316DS. CABLE SMA PLUG-PLUG HF -.086 8" 3.1. TRANSMITTER IMPLEMENTATION 13 Length: 8.0" (203.2mm) Color...Gray RG Type: Hand Formable .086 Connector: Type SMA Male to SMA Male Features: Shielded "• JI Figure 3.5: CABLE SMA PLUG-PLUG HF -.086 8...34 . • CABLE SMA PLUG-PLUG HF -.141 8" Length: 8.0" (203.2mm) Color: Gray RG Type: Hand Formable .141 14 CHAPTER 3. 2 BY I MISO SYSTEM DEVELOPMENT

  11. A case of Churg-Strauss syndrome: tissue diagnosis established by sigmoidoscopic rectal biopsy.

    PubMed Central

    Leen, E J; Rees, P J; Sanderson, J D; Wilkinson, M L; Filipe, M I

    1996-01-01

    A case is presented of Churg-Strauss syndrome in a young man in whom the definitive diagnostic procedure was a full thickness sigmoidoscopic rectal biopsy, with submucosal sampling. Gastrointestinal changes in Churg-Strauss syndrome, a rare systemic illness characterised by asthma, blood and tissue eosinophilia, vasculitis, and granulomatous inflammation are common but poorly reported. The endoscopic and histopathological features of a case are described and emphasise the potential value of a limited sigmoidoscopy in establishing the diagnosis, when lower gastrointestinal symptoms are present. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:8801216

  12. Mid-IR Imaging of Orion BN/KL: Modeling of Physical Conditions and Energy Balance

    NASA Astrophysics Data System (ADS)

    Gezari, Daniel; Varosi, Frank; Dwek, Eli; Danchi, William; Tan, Jonathan; Okumura, Shin-Ichiro

    We have modeled two mid-infrared imaging photometry data sets to determine the spatial distribution of physical conditions in the BN/KL infrared complex. We observed the BN/KL region using the 10-m Keck I telescope and the LWS in the direct imaging mode, over a 13'' × 19'' field (Figure 1, left). We also modeled images obtained with COMICS (Kataza et al. 2000) at the 8.2-m SUBARU telescope, over a total field of view is 31'' × 41'' (Figure 1, right), in a total of nine bands: 7.8, 8.8, 9.7, 10.5, 11.7, 12.4, 18.5, 20.8 and 24.8 μm with ~1 μm bandwidth interference filters.

  13. Early Detection of Prostate Cancer

    DTIC Science & Technology

    2007-01-01

    pads and the external traces. Figure 13 shows the copper board with SMA connectors which were used to test the SH-SAW devices. The frequency...Figure 11. 3-dimensional view of the final device. Figure 12. Fabricated SH-SAW devices cut on blue tape. Figure 13. SH-SAW devices on copper board...Figure 12. Fabricated SH-SAW devices cut on blue tape. 46 Figure 13. SH-SAW devices on copper board with SMA connectors. 47 Figure 14

  14. The precision segmented reflectors: Moderate mission figure control subsystem

    NASA Technical Reports Server (NTRS)

    Sevaston, G.; Redding, D.; Lau, K.; Breckenridge, W.; Levine, B.; Nerheim, N.; Sirlin, S.; Kadogawa, H.

    1991-01-01

    A system concept for a space based segmented reflector telescope figure control subsystem is described. The concept employs a two phase architecture in which figure initialization and figure maintenance are independent functions. Figure initialization is accomplished by image sharpening using natural reference targets. Figure maintenance is performed by monitoring the relative positions and alignments of the telescope components using an optical truss. Actuation is achieved using precision positioners. Computer simulation results of figure initialization by pairwise segment coalignment/cophasing and simulated annealing are presented along with figure maintenance results using a wavefront error regulation algorithm. Both functions are shown to perform at acceptable levels for the class of submillimeter telescopes that are serving as the focus of this technology development effort. Component breadboard work as well as plans for a system testbed are discussed.

  15. Configuration Tool for the Trusted Computing Exemplar Project

    DTIC Science & Technology

    2009-12-01

    languages were examined: Microsoft .NET [8], Apple Cocoa (Objective-C) [9], wxPython [10], and Java [11]. Since every language has its pros and...languages using the criteria described above. Based on the developer’s limited experience and knowledge of Microsoft .NET and Apple Cocoa (Objective...became a tabbed panel within a separate window panel. Figure 9 depicts this evolution of the conceptual design. In Figure 9, the table column

  16. Study of the Effects of Metallurgical Factors on the Growth of Fatigue Microcracks.

    DTIC Science & Technology

    1987-11-25

    polycrystalline) yield stress. 8. The resulting model, predicated on the notion of orientation-dependent microplastic grains, predicts quantitatively the entire...Figure 5. Predicted crack growth curves for small cracks propagating from a microplastic grain into elastic-plastic, contiguous grains; Ao is defined as...or the crack tip opening *displacement, 6. Figure 5. Predicted crack growth curves for small cracks propagating from a microplastic grain into

  17. Multi-Resolution Rapid Prototyping of Vehicle Cooling Systems: Approach and Test Results

    DTIC Science & Technology

    2014-08-01

    where the A/C was working. Figure 21: Comparison model/experiment for condenser refrigerant power; heat transfer factor = 0.8 The figure...previously. To demonstrate stable interactions with a more realistic environment, we have connected the four heat exchangers (two radiators, condenser ...simulations of any vehicle (or other) cooling systems. It can be seen that the underHood heat exchangers (transaxle radiator, condenser and ICE

  18. Big River Benthos: Linking Year Round Biological Response to Altered Hydrological Regimes

    DTIC Science & Technology

    2017-04-02

    is also home to a diversity of organisms adapted to large river habitats. Macroinvertebrates have long been used as habitat/water quality indicators...substrates, but lower abundances (Figure 5). Sand was the most frequently encountered substrate (n=52, Figure 6), and comprises approximately 80% of the...June sampling represented as percentages. 8 Because sand is predominant in the LMR, habitats containing a variety of substrates, including silt

  19. CMMI Interpretive Guidance Project: What We Learned

    DTIC Science & Technology

    2004-10-01

    Figure 20: Global Issues Q1: Adequacy of CMMI.....................................................39 Figure 21: Global Issues Q4a: Leveraging Earlier...Investments................................40 Figure 22: Global Issues Q4b: Adequacy of Training, Etc.........................................40...Figure 23: Global Issues Q4c: Appraisals ................................................................41 Figure 24: Global Issues Q4d: Cost

  20. The role of shape recognition in figure/ground perception in infancy.

    PubMed

    White, Hannah; Jubran, Rachel; Heck, Alison; Chroust, Alyson; Bhatt, Ramesh S

    2018-04-30

    In this study we sought to determine whether infants, like adults, utilize previous experience to guide figure/ground processing. After familiarization to a shape, 5-month-olds preferentially attended to the side of an ambiguous figure/ground test stimulus corresponding to that shape, suggesting that they were viewing that portion as the figure. Infants' failure to exhibit this preference in a control condition in which both sides of the test stimulus were displayed as figures indicated that the results in the experimental condition were not due to a preference between two figure shapes. These findings demonstrate for the first time that figure/ground processing in infancy is sensitive to top-down influence. Thus, a critical aspect of figure/ground processing is functional early in life.

  1. Thrust Breakdown Characteristics of Conventional Propellers

    DTIC Science & Technology

    2007-09-01

    extends beyond the trailing edge of the blade . These sheets violently collapse as the blade moves out of the wake deficit produced by the hull. This...thrust breakdown, vibration, noise , erosion and blade damage. Propellers operating with enough cavitation to cause thrust breakdown can experience...7 Figure 5. Sensitivity of thrust reduction to harmonic content in wake (Prop 5491) .................. 8 Figure 6. Comparison of

  2. Map Projection Equations

    DTIC Science & Technology

    1977-03-01

    2 1.3 C’oordinate Systems ............ *............... 41 1.4 Scale . ..................................... 1.5 Classification by Feature...50 8S Conditions of Equal Area and Conformiality ..... 57 2.9 (Convergence of’the Meridians .......... 57 1.10 Rotation of’ the Coordinate System ...325 vI . ... .I l i FIGURES Figure Title Page 1.2.1 Distortion Ft’fects ............................... 3I 1.3.1 Terestral. oordinato System

  3. Synthesis, Evaluation, and Formulation Studies on New Oxidizers as Alternatives to Ammonium Perchlorate in DoD Missile Propulsion Applications

    DTIC Science & Technology

    2007-04-23

    7 oxamide (4)..................................................................................13 Figure 5—5. Direct Nitration Efforts...5—8. Acylations of FOX-7 Potassium Salt. ............................................................16 Figure 5—9. Nitration of FOX-7 Salts...Dinitramide ADNA – Ammonium di(nitramido) amine ADNDNE – diammonium di(nitramido) dinitoethylene AN – Ammonium Nitrate AP – Ammonium Perchlorate ATK

  4. 40 CFR 86.111-94 - Exhaust gas analytical system.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... hydrocarbon (THC) (hydrocarbon plus methanol in the case of methanol-fueled vehicles), methane (CH4) (for... methanol for methanol-fueled diesel-cycle vehicles) is shown as part of Figure B94-5 (or Figure B94-6... ionization detector (FID) (heated, 235 °±15 °F (113 °±8 °C) for methanol-fueled vehicles) for the...

  5. An Intelligent Hierarchical Decision Architecture for Operational Test and Evaluation

    DTIC Science & Technology

    1996-05-01

    Results .......................................... 60 3.4 CONTRIBUTION...FCM Fuzzy Cognitive Map FMEA Failure Modes and Effects Analysis HWIL Hardware-in-the-Loop IBL Increase in Break Locks xiv IDA Institute for Defense... 60 .5 .40 3 .25 0.21 0.26 Figure 8 PROD-ALL COMMFFY Compositional Method .65 . 7 5 . 60 M 0.67 Figure 9 PROD-MAX COMMFFY Compositional Method 49

  6. Proposed structure of putative glucose channel in GLUT1 facilitative glucose transporter.

    PubMed Central

    Zeng, H; Parthasarathy, R; Rampal, A L; Jung, C Y

    1996-01-01

    A family of structurally related intrinsic membrane proteins (facilitative glucose transporters) catalyzes the movement of glucose across the plasma membrane of animal cells. Evidence indicates that these proteins show a common structural motif where approximately 50% of the mass is embedded in lipid bilayer (transmembrane domain) in 12 alpha-helices (transmembrane helices; TMHs) and accommodates a water-filled channel for substrate passage (glucose channel) whose tertiary structure is currently unknown. Using recent advances in protein structure prediction algorithms we proposed here two three-dimensional structural models for the transmembrane glucose channel of GLUT1 glucose transporter. Our models emphasize the physical dimension and water accessibility of the channel, loop lengths between TMHs, the macrodipole orientation in four-helix bundle motif, and helix packing energy. Our models predict that five TMHs, either TMHs 3, 4, 7, 8, 11 (Model 1) or TMHs 2, 5, 11, 8, 7 (Model 2), line the channel, and the remaining TMHs surround these channel-lining TMHs. We discuss how our models are compatible with the experimental data obtained with this protein, and how they can be used in designing new biochemical and molecular biological experiments in elucidation of the structural basis of this important protein function. Images FIGURE 1 FIGURE 2 FIGURE 4 FIGURE 5 PMID:8770183

  7. Interaction of the Radar Waves with the Capillary Waves on the Ocean.

    DTIC Science & Technology

    1983-05-01

    30 1 I | I I , . ’ , 3 4 6 8 10 15 20 30 40506070 Wind Speed ( m/see) Figure 3.1: Comparison between theoretical and measured for vertical and...wind speed cases, say, between 8 and 10 m/sec, one would not expect such a high value of standard deviation. Figure 8.6a illustrates a sample set of...1979 - 10 o -20 -30U -40 1 U-1’AIId 11111 1 0 10 20 30 40 50 60 70 80 20 - ~downwindf 10 - W polaizan -~ frequency1 - 150Hz - 24 Sept 979 Ma 0- - 10 -2 1

  8. Two critical periods in early visual cortex during figure-ground segregation.

    PubMed

    Wokke, Martijn E; Sligte, Ilja G; Steven Scholte, H; Lamme, Victor A F

    2012-11-01

    The ability to distinguish a figure from its background is crucial for visual perception. To date, it remains unresolved where and how in the visual system different stages of figure-ground segregation emerge. Neural correlates of figure border detection have consistently been found in early visual cortex (V1/V2). However, areas V1/V2 have also been frequently associated with later stages of figure-ground segregation (such as border ownership or surface segregation). To causally link activity in early visual cortex to different stages of figure-ground segregation, we briefly disrupted activity in areas V1/V2 at various moments in time using transcranial magnetic stimulation (TMS). Prior to stimulation we presented stimuli that made it possible to differentiate between figure border detection and surface segregation. We concurrently recorded electroencephalographic (EEG) signals to examine how neural correlates of figure-ground segregation were affected by TMS. Results show that disruption of V1/V2 in an early time window (96-119 msec) affected detection of figure stimuli and affected neural correlates of figure border detection, border ownership, and surface segregation. TMS applied in a relatively late time window (236-259 msec) selectively deteriorated performance associated with surface segregation. We conclude that areas V1/V2 are not only essential in an early stage of figure-ground segregation when figure borders are detected, but subsequently causally contribute to more sophisticated stages of figure-ground segregation such as surface segregation.

  9. Deficit in figure-ground segmentation following closed head injury.

    PubMed

    Baylis, G C; Baylis, L L

    1997-08-01

    Patient CB showed a severe impairment in figure-ground segmentation following a closed head injury. Unlike normal subjects, CB was unable to parse smaller and brighter parts of stimuli as figure. Moreover, she did not show the normal effect that symmetrical regions are seen as figure, although she was able to make overt judgments of symmetry. Since she was able to attend normally to isolated objects, CB demonstrates a dissociation between figure ground segmentation and subsequent processes of attention. Despite her severe impairment in figure-ground segmentation, CB showed normal 'parallel' single feature visual search. This suggests that figure-ground segmentation is dissociable from 'preattentive' processes such as visual search.

  10. Phoenix Trenches

    NASA Technical Reports Server (NTRS)

    2008-01-01

    [figure removed for brevity, see original site] Annotated Version

    [figure removed for brevity, see original site] Left-eye view of a stereo pair [figure removed for brevity, see original site] Right-eye view of a stereo pair

    This image is a stereo, panoramic view of various trenches dug by NASA's Phoenix Mars Lander. The images that make up this panorama were taken by Phoenix's Surface Stereo Imager at about 4 p.m., local solar time at the landing site, on the 131st, Martian day, or sol, of the mission (Oct. 7, 2008).

    In figure 1, the trenches are labeled in orange and other features are labeled in blue. Figures 2 and 3 are the left- and right-eye members of a stereo pair.

    For scale, the 'Pet Donkey' trench just to the right of center is approximately 38 centimeters (15 inches) long and 31 to 34 centimeters (12 to 13 inches) wide. In addition, the rock in front of it, 'Headless,' is about 11.5 by 8.5 centimeters (4.5 by 3.3 inches), and about 5 centimeters (2 inches) tall.

    The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  11. Figuring process of potassium dihydrogen phosphate crystal using ion beam figuring technology.

    PubMed

    Li, Furen; Xie, Xuhui; Tie, Guipeng; Hu, Hao; Zhou, Lin

    2017-09-01

    Currently, ion beam figuring (IBF) technology has presented many excellent performances in figuring potassium dihydrogen phosphate (KDP) crystals, such as it is a noncontact figuring process and it does not require polishing fluid. So, it is a very clean figuring process and does not introduce any impurities. However, the ion beam energy deposited on KDP crystal will heat the KDP crystal and may generate cracks on it. So, it is difficult directly using IBF technology to figure KDP crystal, as oblique incident IBF (OI-IBF) has lower heat deposition, higher removal rate, and smoother surface roughness compared to normal incident IBF. This paper studied the process of using OI-IBF to figure KDP crystal. Removal rates and removal functions at different incident angles were first investigated. Then heat depositions on a test work piece were obtained through experiments. To validate the figuring process, a KDP crystal with a size of 200  mm×200  mm×12  mm was figured by OI-IBF. After three iterations using the OI-IBF process, the surface error decreases from the initial values with PV 1.986λ RMS 0.438λ to PV 0.215λ RMS 0.035λ. Experimental results indicate that OI-IBF is feasible and effective to figure KDP crystals.

  12. Swarm Observations: Implementing Integration Theory to Understand an Opponent Swarm

    DTIC Science & Technology

    2012-09-01

    80 Figure 14 Box counts and local dimension plots for the “Rally” scenario. .....................81 Figure...88 Figure 21 Spatial entropy over time for the “Avoid” scenario.........................................89 Figure 22 Box counts and local...96 Figure 27 Spatial entropy over time for the “Rally-integration” scenario. ......................97 Figure 28 Box counts and

  13. Behind the Power Curve: The Regular Air Force Pilots Shortages Effect on Air National Guard Fighter Squadrons

    DTIC Science & Technology

    2016-04-01

    in 2017. Recall from the previous retention section that there is nearly a 50% drop in the total AC fighter pilot inventory available to separate...8 Figure 3. Total Fighter Pilots by Year Group ...................................................................11 Figure 4...important for the Total Force to find an equitable balance and refine the forcing functions to produce, absorb, and sustain the dwindling fighter

  14. The Eleventh Quadrennial Review of Military Compensation. Main Report

    DTIC Science & Technology

    2012-06-01

    Banks are reluctant to lend money and home equities have plunged roughly 30 percent from the market peak in 2007. The unemployment rate, at 8.1...Introduction Figure 1-1. High-quality Enlistments versus Unemployment Chapter 2. Military Compensation Figure 2-1. Major Components of Military...compensation with the private sector —an understanding of which serves as a useful foundation for examining specific elements of the compensation system

  15. Nanostructured Block Copolymer Coatings for Biofouling Inhibition

    DTIC Science & Technology

    2015-06-30

    nm) High resolution vibrational sensitive images Figure 7 - The instrument provides best-in-world performance. The images are of a boron nitride...2 patents pending, publications and some trade secrets. The pure biocide has been tested by independent labs for toxicity to various mammals and...cash investments in Sylleta, which continue. In Figure 8 are the data on the toxicity of the active ingredient (biocide), which is surface tethered in

  16. Reservoir Analysis Model for Battlefield Operations

    DTIC Science & Technology

    1989-05-01

    courtesy of the Imperial War Museum; Figure 2 is used courtesy of Frederick A. Praeger, Inc.; Figures 7, 8, and 9 are used courtesy of the Society of...operational and tactical levels of war . Military commanders today are confronted with problems of unprecedented complexity that require the application of...associated with operating reservoir systems in theaters of war . Without these tools the planner stands little chance of maximizing the utilization of his water

  17. Mesenchymal Stem Cell Therapy for Nerve Regeneration and Immunomodulation after Composite Tissue Allotransplantation

    DTIC Science & Technology

    2012-08-01

    early rejection of the grafts, there was no significant functional recovery noted on electromyography or Catwalk gait analysis. However, in vitro...Figure 10: Light Microscopic Image (100X, stained with Toluidine Blue): Nerve Cross Section 5-8 mm distal to anastomosis site. Representative... images from (A) Systemic MSC therapy, (B) Local MSC therapy and (c) No treatment Control Figure 11: Sciatic Nerve Transection and Repair (6

  18. WHOI Hawaii Ocean Timeseries Station (WHOTS): WHOTS-4 2007 Mooring Turnaround Cruise Report

    DTIC Science & Technology

    2008-01-01

    a physical deterrence for pest birds and their accompanying guano deposition (Figure 7). The anti-bird wire is constructed of 316 stainless steel ...AutoIMET system installation on the Kilo Moana.................................................................8 Fig 6. WHOTS-4 mooring diagram ...buoyancy is lost. 11 Figure 6. WHOTS-4 mooring diagram . 12 b. Bird Barrier WHOTS-4 incorporates Nixalite Premium Bird Barrier Strips Model S as

  19. Directed Biosynthesis of Oriented Crystalline Cellulose for Advanced Composite Fibers

    DTIC Science & Technology

    2012-05-03

    8 growth rate Table 2. An optimized minimal salts high conductivity growth medium (named 9 Son-Matsuoka- Fructose , SMF) based on the optimized...basis for a high -conductivity medium for Acetobacter that also contained corn steep liquor. List of Figures Figure 1. Scanning electron micrographs of...bacterial cellulose production include corn steep liquor (Matsuoka et al., 1996) apples, beer wort (Brown, 1886; Herrmann, 1928), corn syrup , kale (black

  20. Experimental Investigation and Numerical Predication of a Cross-Flow Fan

    DTIC Science & Technology

    2006-12-01

    Figure 3. Combination probes and pressure tap layout .....................................................6 Figure 4. CFF_DAQ graphical user interface...properties were United Sensor Devices model USD-C-161 3 mm (1/8-inch) combination thermocouple/pressure probes, and static pressure taps . The...was applied to the three static pressure tapes at the throat of the bell-mouth and to the two exhaust duct static pressure taps . Once the data

  1. Coal-Burning Technologies Applicable to Air Force Central Heating Plants

    DTIC Science & Technology

    1989-12-01

    8 3. DESCRIPTION OF REPLACEMENT OR EXPANSION TECHNOLOGIES ........ 9 3.1.1 Shell (Fire- Tube ) Boilers ........... 9...3.1.2 Water- Tube Boilers .*.*........***.... 10 3.1.3 Packaged vs Field-Erected Construction ...... 11 3.2 STOKER FIRING ...... .. 11 3.2.1 Description...FIGURES 4 Figure Pg 1 Schematic diagram of a typical scotch shell boiler: wet-back, three-pass design ..~............... 9 2 Commnon tube patterns for

  2. Relationships between environmental organochlorine contaminant residues, plasma corticosterone concentrations, and intermediary metabolic enzyme activities in Great Lakes herring gull embryos.

    PubMed Central

    Lorenzen, A; Moon, T W; Kennedy, S W; Glen, G A

    1999-01-01

    Experiments were conducted to survey and detect differences in plasma corticosterone concentrations and intermediary metabolic enzyme activities in herring gull (Larus argentatus) embryos environmentally exposed to organochlorine contaminants in ovo. Unincubated fertile herring gull eggs were collected from an Atlantic coast control site and various Great Lakes sites in 1997 and artificially incubated in the laboratory. Liver and/or kidney tissues from approximately half of the late-stage embryos were analyzed for the activities of various intermediary metabolic enzymes known to be regulated, at least in part, by corticosteroids. Basal plasma corticosterone concentrations were determined for the remaining embryos. Yolk sacs were collected from each embryo and a subset was analyzed for organochlorine contaminants. Regression analysis of individual yolk sac organochlorine residue concentrations, or 2,3,7,8-tetrachlorodibenzo-p-dioxin equivalents (TEQs), with individual basal plasma corticosterone concentrations indicated statistically significant inverse relationships for polychlorinated dibenzo-p-dioxins/polychlorinated dibenzofurans (PCDDs/PCDFs), total polychlorinated biphenyls (PCBs), non-ortho PCBs, and TEQs. Similarly, inverse relationships were observed for the activities of two intermediary metabolic enzymes (phosphoenolpyruvate carboxykinase and malic enzyme) when regressed against PCDDs/PCDFs. Overall, these data suggest that current levels of organochlorine contamination may be affecting the hypothalamo-pituitary-adrenal axis and associated intermediary metabolic pathways in environmentally exposed herring gull embryos in the Great Lakes. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:10064546

  3. Prostatic Adenocarcinoma with Concurrent Sertoli Cell Tumor in a Dog

    PubMed Central

    Gill, C. W.

    1981-01-01

    A case of metastatic prostatic adenocarcinoma with concurrent Sertoli cell tumor is presented in an old, miniature Schnauzer dog. The prostatic neoplasm was highly anaplastic and had metastasized widely. Clinical signs were compatible with increased estrogen production. It is interesting to note that the prostatic carcinoma, usually considered to be androgen dependent, developed and metastasized, despite the presence of apparently increased estrogen levels. ImagesFigure 1.Figure 2.Figure 3.Figure 4.Figure 5.Figure 6. PMID:7340923

  4. T-Check in Technologies for Interoperability: Business Process Management in a Web Services Context

    DTIC Science & Technology

    2008-09-01

    UML Sequence Diagram) 6  Figure 3:   BPMN Diagram of the Order Processing Business Process 9  Figure 4:   T-Check Process for Technology Evaluation 10...Figure 5:  Notional System Architecture 12  Figure 6:  Flow Chart of the Order Processing Business Process 14  Figure 7:  Order Processing Activities...features. Figure 3 (created with Intalio BPMS Designer [Intalio 2008]) shows a BPMN view of the Order Processing business process that is used in the

  5. Collaborative Research and Development (CR&D). Task Order 0061: Modeling Complex Structural Geometry and Process Interaction

    DTIC Science & Technology

    2008-05-01

    a Titanium and Gamma-TiAl Alloy, JOM, September 2005, 50-54 4 Chapter 1 [ref3] Caton, M.J., Jha, S.K., Larsen, J.M., Rosenberger, A.H., TMS...Figure 5: Notch 3 strain distribution at 900MPa 25 Chapter 3 Figure 6 : Notch 3 inverse pole figure of local microstructure. Figure 7: Notch 4 ...showing the local grain structure Figure 6 : Local strain distribution at 986MPa calculated from 36 Chapter 4 Figure 7: Secondary electron

  6. Investigation of Performance Improvements Including Application of Inlet Guide Vanes to a Cross-flow Fan

    DTIC Science & Technology

    2009-09-01

    25 Figure 17. IGV Cut Out from Fluid Domain...Figure 22. Installed IGVS as Viewed from the CFF Inlet.................................................30 Figure 23. Schematic of Turbine Test Rig (TTR...44 Figure 28. Close In View of Velocity Vector Plot Near IGVS for 6IGV Model..............45 Figure 29

  7. The threshold signal:noise ratio in the perception of fragmented figures.

    PubMed

    Merkul'ev, A V; Pronin, S V; Semenov, L A; Foreman, N; Chikhman, V N; Shelepin, Yu E

    2006-01-01

    Perception thresholds were measured for fragmented outline figures (the Gollin test). A new approach to the question of the perception of incomplete images was developed. In this approach, figure fragmentation consisted of masking with multiplicative texture-like noise--this interference was termed "invisible" masking. The first series of studies established that the "similarity" between the amplitude-frequency spectra of test figures and "invisible" masks, expressed as a linear correlation coefficient, had significant effects on the recognition thresholds of these figures. The second series of experiments showed that progressing formation of the figures was accompanied by increases in the correlation between their spatial-frequency characteristics and the corresponding characteristics of the incomplete figure, while the correlation with the "invisible" mask decreased. It is suggested that the ratio of the correlation coefficients, characterizing the "similarity" of the fragmented figure with the intact figure and the "invisible" mask, corresponds to the signal:noise ratio. The psychophysical recognition threshold for figures for naive subjects not familiar with the test image alphabet was reached after the particular level of fragmentation at which this ratio was unity.

  8. Development and Testing of an Engineering Prototype for a Marine Version of the Berkeley Unexploded Ordnance Discriminator (BUD)

    DTIC Science & Technology

    2013-06-01

    on the laminated waterproof platform as shown in Figures 29 and 30. 35 Figure 29 Figure 30 36 The receiver coils, and transmitter...mounted on a flatbed trailer, transported to the Richmond Marina, and launched from the boat launch ramp, Figure 32. 37 Figure 32 Once in

  9. Ion beam figuring of high-slope surfaces based on figure error compensation algorithm.

    PubMed

    Dai, Yifan; Liao, Wenlin; Zhou, Lin; Chen, Shanyong; Xie, Xuhui

    2010-12-01

    In a deterministic figuring process, it is critical to guarantee high stability of the removal function as well as the accuracy of the dwell time solution, which directly influence the convergence of the figuring process. Hence, when figuring steep optics, the ion beam is required to keep a perpendicular incidence, and a five-axis figuring machine is typically utilized. In this paper, however, a method for high-precision figuring of high-slope optics is proposed with a linear three-axis machine, allowing for inclined beam incidence. First, the changing rule of the removal function and the normal removal rate with the incidence angle is analyzed according to the removal characteristics of ion beam figuring (IBF). Then, we propose to reduce the influence of varying removal function and projection distortion on the dwell time solution by means of figure error compensation. Consequently, the incident ion beam is allowed to keep parallel to the optical axis. Simulations and experiments are given to verify the removal analysis. Finally, a figuring experiment is conducted on a linear three-axis IBF machine, which proves the validity of the method for high-slope surfaces. It takes two iterations and about 9 min to successfully figure a fused silica sample, whose aperture is 21.3 mm and radius of curvature is 16 mm. The root-mean-square figure error of the convex surface is reduced from 13.13 to 5.86 nm.

  10. Immunochemical Methods for Quantitation of Vitamin B6

    DTIC Science & Technology

    1981-09-30

    pANk K:E:: Z P a . LIST OF FIGURES Page Figure 1. Synthesis of N-Carboxymethylpyridoxine 15 Figure 2. Pyridoxine and N- Substituted Derivatives 16...Pyridoxine Substituted in the 3 Position 23 Figure 6. Synthesis of as -Pyridoxylformic Acid and as - 25 Pyridoxylacetic Acid Figure 7. Fluorogenic Galactosides...CH20 (Vill) (X Figure 2. Pyridoxine and N- Substituted Derivatives 16 hinder the formation of quaternary salts (Kirpal, 1910).’" We found this to be true

  11. Flooding Resulting From Hurricane Isidore, Comparing Data from September 12 and 28, 2002

    NASA Technical Reports Server (NTRS)

    2002-01-01

    [figure removed for brevity, see original site] [figure removed for brevity, see original site] Figure 1: GOES-8, 0815 UT, Sep 12, 2002Figure 2: GOES-8, 0815 UT, Sep 28, 2002 [figure removed for brevity, see original site] [figure removed for brevity, see original site] Figure 3: AMSU-A channel 2, Sep 12, 2002Figure 4: AMSU-A channel 2, Sep 28, 2002 Extent of Flooding due to Hurricane Isidore revealed in images from the Atmospheric Infrared Sounding System (AIRS) on Aqua

    Tropical Storm Isidore was born in mid-September north of Venezuela. It subsequently hit Mexico's Yucatan Peninsula as a Category 3 hurricane and came ashore near New Orleans on September 26th packing winds just below hurricane strength. Around the time of September 27, the storm was downgraded to a tropical depression as the system moved into Tennessee.

    At the time the Aqua spacecraft first passed over Isidore, it was classified as a Category 3 (possibly 4) hurricane, with minimum pressure of 934 mbar, maximum sustained wind speeds of 110 knots (gusting to 135) and an eye diameter of 20 nautical miles. Isidore was later downgraded to a Tropical Storm and then a Tropical Depression as it lost energy.

    Figures 1 and 2, two images from the National Oceanic and Atmospheric Administration's Geostationary Operational Environmental Satellites show no significant weather systems over the southeastern United States on September 12 and September 28 (16 days apart). However, the microwave component of the Atmospheric Infrared Sounder Experiment on NASA's Aqua spacecraft shows a striking difference. The difference in the two microwave images (figures 3 and 4) from the AIRS Advanced Microwave Sounding Unit is primarily due to flooding after Tropical Storm Isidore. Water has a very low surface emissivity at this frequency, and that causes surface water to appear very cold (even though it is not). Land appears relatively warm (well above freezing - 273 K, even at night as seen is these images), but if there is standing water, the apparent temperature drops precipitously. Figure 4, taken just about a day after the remnants of Isidore passed over the southeast, shows heavy flooding along the Mississippi, especially in the states of Mississippi and Tennessee, but other states are also affected. The spatial resolution of the AMSU-A instrument is relatively large (each measurement spot is about 25 miles in diameter at the center of the swath), but the enormous thermal contrast in the microwave between land and water makes even small flooded areas stand out.

    [figure removed for brevity, see original site] Figure 5: Difference image, 9/12 and 9/28) The Aqua spacecraft has an exact 16-day repeat cycle, that is why the pre-Isidore image is 16 days prior to the post-Isidore image. They have exactly the same coverage, which makes it possible to obtain a difference image (figure 5). The difference image is the difference between the September 28 and September 12 images shown. In the difference image, white indicates no difference at all, green is very little difference, blue/purple indicates primarily heavy flooding. Red indicates warming likely due to warmer weather. (The straight lines on the right and left edges of the difference image are caused by slight differences between the two repeat passes of Aqua).

    The Atmospheric Infrared Sounder Experiment, with its visible, infrared, and microwave detectors, provides a three-dimensional look at Earth's weather. Working in tandem, the three instruments can make simultaneous observations all the way down to the Earth's surface, even in the presence of heavy clouds. With more than 2,000 channels sensing different regions of the atmosphere, the system creates a global, 3-D map of atmospheric temperature and humidity and provides information on clouds, greenhouse gases, and many other atmospheric phenomena. The AIRS Infrared Sounder Experiment flies onboard NASA's Aqua spacecraft and is managed by NASA's Jet Propulsion Laboratory, Pasadena, Calif., under contract to NASA. JPL is a division of the California Institute of Technology in Pasadena.

  12. Anaerobic Degradation of Marine Algae, Seagrass and Tropical Climbing Vines to Produce a Renewable Energy Source and the Analysis of Their Anaerobic Microbial Communities

    DTIC Science & Technology

    2013-01-01

    developed by the degradation of a variety of food products creating a competition for the destination of the crops harvested . To eliminate this problem it...short bacillus (Figure 33.A), a vibrio (Figure 33.B) and a long bacillus (Figure 33.C). These three morphologies were also present in other colonies...CPF4 (Figure 34). The fourth colony (CPF4) contained three morphologies: a vibrio (Figure 35.A), a possible spirochete (Figure 35.B) and a long

  13. Replacement of arginine 773 by cysteine or histidine in the human androgen receptor causes complete androgen insensitivity with different receptor phenotypes

    PubMed Central

    Prior, Lynn; Bordet, Sylvie; Trifiro, Mark A.; Mhatre, Anand; Kaufman, Morris; Pinsky, Leonard; Wrogeman, Klaus; Belsham, Denise D.; Pereira, Fred; Greenberg, Cheryl; Trapman, Jan; Brinkman, Albert O.; Chang, Chawnshang; Liao, Shutsung

    1992-01-01

    We have discovered two different point mutations in a single codon of the X-linked androgen-receptor (AR) gene in two pairs of unrelated families who have complete androgen insensitivity (resistance) associated with different AR phenotypes in their genital skin fibroblasts. One mutation is a C-to-T transition at a CpG sequence near the 5' terminus of exon 6; it changes the sense of codon 773 from arginine to cysteine, ablates specific androgen-binding activity at 37°C, and eliminates a unique KpnI site at the intron-exon boundary. The other mutation is a G-to-A transition that changes amino acid 773 to histidine and eliminates an SphI site. This mutant AR has a normal androgen-binding capacity at 37°C but has a reduced affinity for androgens and is thermolabile in their presence. Transient transfection of COS cells with cDNA expression vectors yielded little androgen-binding activity at 37°C from Arg773Cys and abundant activity with abnormal properties from Arg773His, thereby proving the pathogenicity of both sequence alterations. This conclusion coincides with the following facts about evolutionary preservation of the position homologous to Arg773 in the AR: it is occupied by Arg or lysine in the progesterone, glucocorticoid, and mineralocorticoid receptors, and it is within a 14-amino-acid region of their steroid-binding domains that share ∼85% amino acid identity. ImagesFigure 7Figure 2Figure 3Figure 5Figure 6Figure 8 PMID:1609793

  14. Figure facts: encouraging undergraduates to take a data-centered approach to reading primary literature.

    PubMed

    Round, Jennifer E; Campbell, A Malcolm

    2013-01-01

    The ability to interpret experimental data is essential to understanding and participating in the process of scientific discovery. Reading primary research articles can be a frustrating experience for undergraduate biology students because they have very little experience interpreting data. To enhance their data interpretation skills, students used a template called "Figure Facts" to assist them with primary literature-based reading assignments in an advanced cellular neuroscience course. The Figure Facts template encourages students to adopt a data-centric approach, rather than a text-based approach, to understand research articles. Specifically, Figure Facts requires students to focus on the experimental data presented in each figure and identify specific conclusions that may be drawn from those results. Students who used Figure Facts for one semester increased the amount of time they spent examining figures in a primary research article, and regular exposure to primary literature was associated with improved student performance on a data interpretation skills test. Students reported decreased frustration associated with interpreting data figures, and their opinions of the Figure Facts template were overwhelmingly positive. In this paper, we present Figure Facts for others to adopt and adapt, with reflection on its implementation and effectiveness in improving undergraduate science education.

  15. Media Independent Handover for Wireless Full Motion Video Dissemination

    DTIC Science & Technology

    2012-09-01

    ODTONE Configuration Files 51 References 63 Initial Distribution List 65 viii List of Figures Figure 2.1 MIH framework as defined by the IEEE 802.21...10 Figure 2.3 Link commands and MIH commands. From [1]. . . . . . . . . . . . . 12 Figure 2.4 Remote MIH Commands. From [1...13 Figure 2.5 Link commands. From [1]. . . . . . . . . . . . . . . . . . . . . . . . 14 Figure 2.6 MIH commands. From [1

  16. Accounting for Hydrologic State in Ground-Penetrating Radar Classification Systems

    DTIC Science & Technology

    2014-04-22

    water content as a result of infiltration processes. • Demonstrated that effective medium approximations (one-dimensional flow and ray theory...280 290 300 310 320 330 340 -5 0 5 10 15 20 (a) (b) (c) Page 8 of 32 Figure 6: a) Conceptual model of flow experiment and GPR rays showing... ray theory for GPR) for characterizing the hydrologic state of the subsurface under arbitrary water content conditions. Figure 7: Comparison of

  17. Developing a Campaign Plan to Target Centers of Gravity Within Economic Systems

    DTIC Science & Technology

    1995-05-01

    Conclusion 67 CHAPTER 7: CURRENT AND FUTURE CONCERNS 69 Decision Making and Planning 69 Conclusion 72 CHAPTER 8: CONCLUSION 73 APPENDIX A: STATISTICS 80...Terminology and Statistical Tests 80 Country Analysis 84 APPENDIX B 154 BIBLIOGRAPHY 157 VITAE 162 IV LIST OF FIGURES Figure 1. Air Campaign...This project furthers the original statistical effort and adds to this a campaign planning approach (including both systems and operational level

  18. Hydrogen peroxide changes in ischemic and reperfused heart. Cytochemistry and biochemical and X-ray microanalysis.

    PubMed Central

    Slezak, J.; Tribulova, N.; Pristacova, J.; Uhrik, B.; Thomas, T.; Khaper, N.; Kaul, N.; Singal, P. K.

    1995-01-01

    Active oxygen species including hydrogen peroxide (H2O2) play a major role in ischemia-reperfusion injury. In the present study, changes in myocardial H2O2 content as well as its subcellular distribution were examined in rat hearts subjected to ischemia-reperfusion. Isolated perfused rat hearts were made globally ischemic for 20 or 30 minutes and were reperfused for different durations. H2O2 content in these hearts was studied biochemically and changes were correlated with the recovery of function. These hearts were also analyzed for subcellular distribution of H2O2. Optimal conditions of tissue processing as well as incubation medium were established for reacting cerium chloride with H2O2 to form cerium perhydroxide, an insoluble electron-dense product. The chemical composition of these deposits was confirmed by x-ray micro-analysis. Global ischemia caused complete contractile failure in minutes and after 30 minutes of ischemia, these was a > 250% increase in the myocardial H2O2 content. Depressed contractile function recovery in the early phase of reperfusion was accompanied by approximately a 600% increase in the myocardial H2O2 content. Brief pre-fixation with low concentrations of glutaraldehyde, inhibition of alkaline phosphatase, glutathione peroxidase, and catalase, post-fixation but no post-osmication, and no counterstaining yielded the best cytochemical definition of H2O2. In normal hearts, extremely small amounts of cerium hydroperoxide precipitates were located on the endothelial cells. X-ray microanalysis confirmed the presence of cerium in the reaction product. Ischemia resulted in a stronger reaction, particularly on the sarcolemma as well as abluminal side of the endothelial cells; and upon reperfusion, cerium precipitate reaction at these sites was more intense. In the reperfused hearts, the reaction product also appeared within mitochondria between the cristae as well as on the myofibrils, but Z-lines were devoid of any precipitate. The data support a significant increase in myocardial H2O2 during both the phase of ischemia and the first few minutes of reperfusion. A stronger reaction on the sarcolemma and abluminal side of endothelial cells may also indicate enhanced H2O2 accumulation as well as vulnerability of these sites to oxidative stress injury. Images Figure 1 Figure 2 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 PMID:7677188

  19. A Computer Graphics Human Figure Application Of Biostereometrics

    NASA Astrophysics Data System (ADS)

    Fetter, William A.

    1980-07-01

    A study of improved computer graphic representation of the human figure is being conducted under a National Science Foundation grant. Special emphasis is given biostereometrics as a primary data base from which applications requiring a variety of levels of detail may be prepared. For example, a human figure represented by a single point can be very useful in overview plots of a population. A crude ten point figure can be adequate for queuing theory studies and simulated movement of groups. A one hundred point figure can usefully be animated to achieve different overall body activities including male and female figures. A one thousand point figure si-milarly animated, begins to be useful in anthropometrics and kinesiology gross body movements. Extrapolations of this order-of-magnitude approach ultimately should achieve very complex data bases and a program which automatically selects the correct level of detail for the task at hand. See Summary Figure 1.

  20. Research on the magnetorheological finishing (MRF) technology with dual polishing heads

    NASA Astrophysics Data System (ADS)

    Huang, Wen; Zhang, Yunfei; He, Jianguo; Zheng, Yongcheng; Luo, Qing; Hou, Jing; Yuan, Zhigang

    2014-08-01

    Magnetorheological finishing (MRF) is a key polishing technique capable of rapidly converging to the required surface figure. Due to the deficiency of general one-polishing-head MRF technology, a dual polishing heads MRF technology was studied and a dual polishing heads MRF machine with 8 axes was developed. The machine has the ability to manufacture large aperture optics with high figure accuracy. The large polishing head is suitable for polishing large aperture optics, controlling large spatial length's wave structures, correcting low-medium frequency errors with high removal rates. While the small polishing head has more advantages in manufacturing small aperture optics, controlling small spatial wavelength's wave structures, correcting mid-high frequency and removing nanoscale materials. Material removal characteristic and figure correction ability for each of large and small polishing head was studied. Each of two polishing heads respectively acquired stable and valid polishing removal function and ultra-precision flat sample. After a single polishing iteration using small polishing head, the figure error in 45mm diameter of a 50 mm diameter plano optics was significantly improved from 0.21λ to 0.08λ by PV (RMS 0.053λ to 0.015λ). After three polishing iterations using large polishing head , the figure error in 410mm×410mm of a 430mm×430mm large plano optics was significantly improved from 0.40λ to 0.10λ by PV (RMS 0.068λ to 0.013λ) .This results show that the dual polishing heads MRF machine not only have good material removal stability, but also excellent figure correction capability.

Top