Sample records for figures 3a 3b

  1. Cryosurgery for treatment of trichiasis.

    PubMed Central

    Sullivan, J H; Beard, C; Bullock, J D

    1976-01-01

    We cryosurgically destroyed eyelashes in rabbits and applied the technique to treat 23 selected patients with trichiasis. Liquid nitrogen was sprayed on the eyelid margin by using a double, rapid-freeze, slow-thaw cycle monitored by a subcutaneous thermocouple to -30 degrees C. It was an improvement on electrolysis and a simple alternative to surgery. Images FIGURE 1 FIGURE 2 A FIGURE 2 B FIGURE 3 A FIGURE 3 B FIGURE 4 A FIGURE 4 B FIGURE 5 A FIGURE 5 B FIGURE 7 A FIGURE 7 B PMID:867626

  2. Influence of intraocular lens material and design on postoperative intracapsular cellular reactivity.

    PubMed Central

    Apple, D J

    2000-01-01

    PURPOSE: To evaluate the influence of intraocular lens (IOL) material and design on the outcome of postoperative lens epithelial cell proliferation within the capsular bag after cataract surgery. METHODS: A total of 5,079 human globes containing rigid and foldable posterior chamber IOL styles commonly implanted in the United States (n = 8) were analyzed in this study. Each globe, fixated in 10% formalin, was sectioned at the equator and analyzed using the Miyake-Apple posterior technique. The study consisted of 3 parts: First, to evaluate posterior capsule opacification (PCO); the Nd:YAG laser posterior capsulotomy rate (%) was documented and plotted on a monthly basis, creating a computerized trend line for each IOL style. Second, to evaluate anterior capsule opacification (ACO); 460 globes were processed for histologic examination. Anterior capsule fibrosis was scored from 0 to III, according to the thickness of proliferative tissue/cells on the inner surface of the anterior capsule at the capsulorhexis margin. Third, interlenticular opacification (ILO) was studied by analysis of 3 pairs of acrylic piggyback lenses that had been explanted because of opacification between their optics. Each IOL pair was processed for histologic examination, and scanning electron microscopy was performed on 1 of the lenses. RESULTS: In the first study, relatively higher Nd:YAG laser posterior capsulotomy rates (19.1% to 32.8%) were noted with the 4 oldest IOL designs in this study (2 foldable lenses, 1 3-piece polymethyl methacrylate [PMMA] design, and 1 single-piece all-PMMA design). Four modern lenses, 1 acrylic lens, and 3 silicone foldable IOL designs had Nd:YAG rates ranging from 1.3% to 14.6% (P < .0001). In the second study, mean ACO scores were highest with silicone-plate lenses (1.77 +/- 0.86 and 1.28 +/- 0.77). The lowest mean score was observed with the acrylic lens (0.51 +/- 0.52; P < .0001). In study 3, the analyses of the 3 pairs of explanted acrylic piggyback lenses showed that the opacification between them (ILO) may have different forms. CONCLUSIONS: Control of postoperative intracapsular cellular proliferation is important in avoiding 3 significant clinical complications. Postoperative lens epithelial cell proliferation is involved in the pathogenesis of PCO, ACO, and ILO, the latter being a newly described form of opacification within the capsular bag related to piggyback IOL implantation. IOL material and design are important factors influencing the outcome of these complications. Images FIGURE 1 FIGURE 2A FIGURE 2B FIGURE 3 FIGURE 4A FIGURE 4B FIGURE 5A FIGURE 5B FIGURE 5C FIGURE 5D FIGURE 5E FIGURE 5F FIGURE 5G FIGURE 5H FIGURE 6 FIGURE 7 FIGURE 8A FIGURE 8B FIGURE 9A FIGURE 9B FIGURE 10A FIGURE 10B FIGURE 10C FIGURE 10D FIGURE 10E FIGURE 10F FIGURE 10G FIGURE 10H FIGURE 11A FIGURE 11B FIGURE 12 FIGURE 13A FIGURE 13B FIGURE 14A FIGURE 14B FIGURE 15A FIGURE 15B FIGURE 16A FIGURE 16B FIGURE 17A FIGURE 17B FIGURE 18A FIGURE 18B FIGURE 18C FIGURE 18D FIGURE 18E FIGURE 19 FIGURE 20 PMID:11190028

  3. Thyroid ocular myopathy.

    PubMed Central

    Hodes, B L; Shoch, D E

    1979-01-01

    Based upon the ultrasonographic evidence of extraocular muscle abnormalities in all patients with orbitopathy and proven thyroid disease, we conclude that the basic abnormality of thyroid orbitopathy is a panmyositis and that all of the classes described by Werner are expressions of different degrees and manifestations of the same pathologic process. This thesis is supported by presentation of cases of varying severity who have in common extraocular muscle abnormalities. We believe that the process we describe acceptably explains all of the eye signs of this common orbitopathy. Images FIGURE 1 A FIGURE 1 B FIGURE 2 FIGURE 3 A FIGURE 3 B FIGURE 4 FIGURE 5 A FIGURE 5 B FIGURE 6 A FIGURE 6 B FIGURE 7 FIGURE 8 A FIGURE 8 B FIGURE 9 A FIGURE 9 B FIGURE 10 FIGURE 11 A FIGURE 11 B FIGURE 12 A FIGURE 12 B FIGURE 13 A FIGURE 13 B PMID:583536

  4. Reusable Material for Drop Tower

    DTIC Science & Technology

    2011-08-01

    R3 Buna-N Rubber ............................................................................................... 32 B-3. R5 EPDM Rubber ...Butyl Rubber . Figure B-2. R3 Buna-N Rubber . Figure B-3. R5 EPDM Rubber . Figure B-4. R6 Gel Rubber . UNCLASSIFIED 33...11 Current Drop Tower Material & Setup .......................................................... 11 Bowling Ball Rubber Material Sample Test

  5. Emergent conditional relations in a Go/No-Go procedure: figure-ground and stimulus-position compound relations.

    PubMed

    Debert, Paula; Huziwara, Edson M; Faggiani, Robson Brino; De Mathis, Maria Eugênia Simões; McIlvane, William J

    2009-09-01

    Past research has demonstrated emergent conditional relations using a go/no-go procedure with pairs of figures displayed side-by-side on a computer screen. The present study sought to extend applications of this procedure. In Experiment 1, we evaluated whether emergent conditional relations could be demonstrated when two-component stimuli were displayed in figure-ground relationships-abstract figures displayed on backgrounds of different colors. Five normally capable adults participated. During training, each two-component stimulus was presented successively. Responses emitted in the presence of some stimulus pairs (A1B1, A2B2, A3B3, B1C1, B2C2 and B3C3) were reinforced, whereas responses emitted in the presence of other pairs (A1B2, A1B3, A2B1, A2B3, A3B1, A3B2, B1C2, B1C3, B2C1, B2C3, B3C1 and B3C2) were not. During tests, new configurations (AC and CA) were presented, thus emulating structurally the matching-to-sample tests employed in typical equivalence studies. All participants showed emergent relations consistent with stimulus equivalence during testing. In Experiment 2, we systematically replicated the procedures with stimulus compounds consisting of four figures (A1, A2, C1 and C2) and two locations (left - B1 and right - B2). All 6 normally capable adults exhibited emergent stimulus-stimulus relations. Together, these experiments show that the go/no-go procedure is a potentially useful alternative for studying emergent conditional relations when matching-to-sample is procedurally cumbersome or impossible to use.

  6. Cardiac damage induced by 2-amino-3-methyl-imidazo[4,5-f]quinoline in nonhuman primates.

    PubMed Central

    Thorgeirsson, U P; Farb, A; Virmani, R; Adamson, R H

    1994-01-01

    The heterocyclic aromatic amine 2-amino-3-methylimidazo[4,5-f]quinoline (IQ) is a potent hepatocarcinogen in cynomolgus and rhesus monkeys. The finding of high cardiac IQ-DNA adduct levels prompted a histopathological study of perfusion-fixed hearts from 10 tumor-bearing monkeys chronically dosed with IQ at 10 mg/kg or 20 mg/kg 5 days per week for 48-80 months. Two monkeys dosed only with the vehicle for IQ, hydroxypropylcellulose, served as controls. All the monkeys had normal heart weights, and no abnormalities were observed upon gross inspection of the hearts. Microscopically, focal myocardial lesions were observed in 8 of 10 monkeys dosed with IQ. Light microscopic abnormalities included myocyte necrosis with or without chronic inflammatory infiltrates, interstitial fibrosis with myocyte hypertrophy or atrophy, and vasculitis. Electron microscopic findings included disruption of the mitochondrial architecture (i.e., mitochondrial swelling and clearing of matrix densities), myofibrillar loss, disorganization of the normal alignment of sarcomeres, and occasional myocytes showing nuclear hypertrophy or peripheral clumping of the nuclear chromatin. There was some correlation between the cumulative dose of IQ and the extent of the myocardial abnormalities. These findings suggest that chronic exposure to IQ can lead to myocardial damage in monkeys. Although focal and not associated with clinical evidence of heart failure, these abnormalities may represent the initial stages of IQ-induced toxic cardiomyopathy. Images Figure 1. A Figure 1. B Figure 1. C Figure 1. D Figure 2. A Figure 2. B Figure 3. A Figure 3. B Figure 3. C Figure 3. D Figure 4. A Figure 4. B Figure 5. A Figure 5. B PMID:8033851

  7. Estrogenicity of resin-based composites and sealants used in dentistry.

    PubMed Central

    Olea, N; Pulgar, R; Pérez, P; Olea-Serrano, F; Rivas, A; Novillo-Fertrell, A; Pedraza, V; Soto, A M; Sonnenschein, C

    1996-01-01

    We tested some resin-based composites used in dentistry for their estrogenic activity. A sealant based on bisphenol-A diglycidylether methacrylate (bis-GMA) increased cell yields, progesterone receptor expression, and pS2 secretion in human estrogen-target, serum-sensitive MCF7 breast cancer cells. Estrogenicity was due to bisphenol-A and bisphenol-A dimethacrylate, monomers found in the base paste of the dental sealant and identified by mass spectrometry. Samples of saliva from 18 subjects treated with 50 mg of a bis-GMA-based sealant applied on their molars were collected 1 hr before and after treatment. Bisphenol-A (range 90-931 micrograms) was identified only in saliva collected during a 1-hr period after treatment. The use of bis-GMA-based resins in dentistry, and particularly the use of sealants in children, appears to contribute to human exposure to xenoestrogens. Images Figure 1. A Figure 1. B Figure 2. Figure 3. A Figure 3. B Figure 4. A Figure 4. B Figure 5. A Figure 5. B Figure 6. A Figure 6. B Figure 7. A Figure 7. B Figure 8. Figure 9. Figure 10. PMID:8919768

  8. Multimedia Visualisation of Massive Military Datasets (Visualisation multimedia des jeux de donnees militaires massifs)

    DTIC Science & Technology

    2007-06-01

    the Los Angeles Area A-16 Figure A-5 Illustration of the Life Cycle of the Japanese Beetle A-17 Figure B-1 Knowledge Wall B-8 Figure B-2...Structure of World Trade in 1992 C-15 Figure D-1 3D Panorama Cinema at CAVI in Use D-2 Figure D-2 Holobench at CAVI D-2 Figure D-3 Virtual Studio...Illustration of the Life Cycle of the Japanese Beetle. A.6 STEPS IN ESTABLISHING A THEORY OF EFFECTIVE VISUALISATION An established theory generally

  9. Performance Analysis of Polymorphous Computing Architectures

    DTIC Science & Technology

    2001-01-01

    G H F Proc 5 : 4 : 3 11 1 Figure 3. Self-timed execution. D C B F G H E D B H EA CG...F D C B F G H E D B H EA CG F AProc 1 Proc 2 Proc 3 Proc 4 Proc 5 185 cution pattern when the application graph in Figure 2 is executed in a self...transform, a quadra- E Figure 10. Self-timed execution with first-iteration actors denoted by T. D B H E CG F D C B F G H E D B H EA CG F A 18 T T T

  10. Limbal palisades of Vogt.

    PubMed Central

    Goldberg, M F; Bron, A J

    1982-01-01

    The palisades of Vogt are distinctive normal features of the human corneoscleral limbus. Our clinical studies indicate that they are more discrete in younger and in more heavily pigmented individuals, and that they appear more regular and prominent at the lower limbus than at the upper limbus. They are seen only infrequently in the horizontal meridian. There is some symmetry (though it is not exact) from one eye to the other in the same person. The anatomy of the palisades appears to be unique for a given individual. In this respect, as well as in their microscopic anatomy, the palisades of Vogt appear comparable to fingerprints, and the term "conjunctivoglyphics" ("conjunctival carvings") or "limboglyphics" is suggested in analogy with "dermatoglyphics." The palisades of Vogt have a distinct vasculature with narrow, barely visible, arterial and venous components of radially oriented hairpin loops. Angiography reveals that these vessels leak fluorescein relatively late and only to a moderate extent. They respond to inflammation by dilatation and gross breakdown of their physiologic barrier properties. The functions of the palisades of Vogt are not known with certainty, but their interpalisadal epithelial rete ridges may serve as a repository for corneal epithelial cells. They may thus be important in both aging and diseases of the cornea. Images FIGURE 1 A FIGURE 1 B FIGURE 1 C FIGURE 2 FIGURE 3 A FIGURE 3 B FIGURE 4 FIGURE 5 A FIGURE 5 B FIGURE 6 A FIGURE 6 B FIGURE 7 A FIGURE 7 B FIGURE 8 A FIGURE 8 B FIGURE 8 C FIGURE 8 D FIGURE 9 A FIGURE 9 B FIGURE 10 A FIGURE 10 B PMID:7182957

  11. New techniques for imaging and analyzing lung tissue.

    PubMed Central

    Roggli, V L; Ingram, P; Linton, R W; Gutknecht, W F; Mastin, P; Shelburne, J D

    1984-01-01

    The recent technological revolution in the field of imaging techniques has provided pathologists and toxicologists with an expanding repertoire of analytical techniques for studying the interaction between the lung and the various exogenous materials to which it is exposed. Analytical problems requiring elemental sensitivity or specificity beyond the range of that offered by conventional scanning electron microscopy and energy dispersive X-ray analysis are particularly appropriate for the application of these newer techniques. Electron energy loss spectrometry, Auger electron spectroscopy, secondary ion mass spectrometry, and laser microprobe mass analysis each offer unique advantages in this regard, but also possess their own limitations and disadvantages. Diffraction techniques provide crystalline structural information available through no other means. Bulk chemical techniques provide useful cross-checks on the data obtained by microanalytical approaches. It is the purpose of this review to summarize the methodology of these techniques, acknowledge situations in which they have been used in addressing problems in pulmonary toxicology, and comment on the relative advantages and disadvantages of each approach. It is necessary for an investigator to weigh each of these factors when deciding which technique is best suited for any given analytical problem; often it is useful to employ a combination of two or more of the techniques discussed. It is anticipated that there will be increasing utilization of these technologies for problems in pulmonary toxicology in the decades to come. Images FIGURE 3. A FIGURE 3. B FIGURE 3. C FIGURE 3. D FIGURE 4. FIGURE 5. FIGURE 7. A FIGURE 7. B FIGURE 8. A FIGURE 8. B FIGURE 8. C FIGURE 9. A FIGURE 9. B FIGURE 10. PMID:6090115

  12. Particulate air pollution and respiratory disease in Anchorage, Alaska.

    PubMed Central

    Gordian, M E; Ozkaynak, H; Xue, J; Morris, S S; Spengler, J D

    1996-01-01

    This paper examines the associations between average daily particulate matter less than 10 microns in diameter (PM10) and temperature with daily outpatient visits for respiratory disease including asthma, bronchitis, and upper respiratory illness in Anchorage, Alaska, where there are few industrial sources of air pollution. In Anchorage, PM10 is composed primarily of earth crustal material and volcanic ash. Carbon monoxide is measured only during the winter months. The number of outpatients visits for respiratory diagnoses during the period 1 May 1992 to 1 March 1994 were derived from medical insurance claims for state and municipal employees and their dependents covered by Aetna insurance. The data were filtered to reduce seasonal trends and serial autocorrelation and adjusted for day of the week. The results show that an increase of 10 micrograms/m3 in PM10 resulted in a 3-6% increase in visits for asthma and a 1-3% increase in visits for upper respiratory diseases. Winter CO concentrations were significantly associated with bronchitis and upper respiratory illness, but not with asthma. Winter CO was highly correlated with automobile exhaust emissions. These findings are consistent with the results of previous studies of particulate pollution in other urban areas and provide evidence that the coarse fraction of PM10 may affect the health of working people. Images Figure 1. A Figure 1. B Figure 2. A Figure 2. B Figure 3. A Figure 3. B Figure 4. A Figure 4. B PMID:8919767

  13. Data Fusion

    DTIC Science & Technology

    2014-05-01

    CDiff Antibiotics) 4.5.3 Preliminary Results of Prototype 1 Figure 5: Mapped Cases of Clostridium difficile by ward over 1 year KGH C. Diff. All...Quarters Figure 6: Mapped Cases of Clostridium difficile by ward over 3 months KGH C. Diff. Q1 Figure 7: Mapped Cases of Methicillin Resistant Staph...Competing Technologies B-2 Schedule Performance Summary B-3 Cost Performance Summary Annex C Publications, Presentations, Patents Bibliography List of

  14. Recent Progress of B-Ga2O3 MOSFETs for Power Electronic Applications

    DTIC Science & Technology

    2017-03-20

    variety of group 4 elements such as Silicon, Tin , and Germanium.[2, 9] Multiple samples will be referenced throughout the text, but it should be noted...Ga2O3 channel. Fabrication steps 2-4 are used in the standard fabrication as seen in Figure 1. Figure 8a below shows a top-down SEM image of the gated...voltage of 567V. Please see reference [11] for more information. 393 Figure 8. (a) Colored SEM image of a β-Ga2O3 finFET. (b) Transfer

  15. 40 CFR Figure B-1 to Subpart B of... - Example

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 6 2012-07-01 2012-07-01 false Example B Figure B-1 to Subpart B of Part 53 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... of Automated Methods for SO2, CO, O3, and NO2 Pt. 53, Subpt. B, Fig. B-1 Figure B-1 to Subpart B of...

  16. 40 CFR Figure B-1 to Subpart B of... - Example

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 6 2013-07-01 2013-07-01 false Example B Figure B-1 to Subpart B of Part 53 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... of Automated Methods for SO2, CO, O3, and NO2 Pt. 53, Subpt. B, Fig. B-1 Figure B-1 to Subpart B of...

  17. 40 CFR Figure B-1 to Subpart B of... - Example

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 6 2014-07-01 2014-07-01 false Example B Figure B-1 to Subpart B of Part 53 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... of Automated Methods for SO2, CO, O3, and NO2 Pt. 53, Subpt. B, Fig. B-1 Figure B-1 to Subpart B of...

  18. Bietti's tapetoretinal degeneration with marginal corneal dystrophy crystalline retinopathy.

    PubMed Central

    Welch, R B

    1977-01-01

    In 1937 Bietti reported a tapetoretinal degeneration with associated corneal deposits at the limbus. The hallmark of the disease was the crystalline characteristics of the retinal spots as well as those at the corneal limbus. Bagolini and Ioli-Spade in 1968 presented a 30 year follow-up on Bietti's cases and presented six additional cases. The present report delas with this entity in Orientals, a Chinese woman and a Japanese man. Corneal and conjunctival biopsy from the female patient revelaed a lipid deposition in both fibroblasts and epithelium. The term "crystalline retinopathy" has been added to the description of this entity since it defines the most characteristic feature of the syndrome. Images FIGURE 7 A FIGURE 7 B FIGURE 1 A FIGURE 1 B FIGURE 1 C FIGURE 2 A FIGURE 2 B FIGURE 2 C FIGURE 3 FIGURE 4 A FIGURE 4 B FIGURE 5 FIGURE 6 A FIGURE 6 B FIGURE 6 C FIGURE 8 PMID:306693

  19. Molecular Mechanism of Nkx3.1 Deregulation and its Function in Murine Pten Prostate Cancer Model

    DTIC Science & Technology

    2006-09-01

    of transfected 293T cells using total protein lysate (Figure 2B, upper row in the right panel) or eGFP-sorted cells (Figure 2B, middle row in the...through an AR-dependent mechanism A: NKX3.1 regulates AR transcription and re- duces AKT phosphorylation in vitro. Total RNA and protein were...resulting in de- creased total p53 protein level (compare lanes 1 and 2 of Figure 6F). In contrast, coexpressing Nkx3.1 reduces p53- HDAC1 association

  20. Special Technology Area Review on Micro-Opto-Electro-Mechanical-Systems (MOEMS)

    DTIC Science & Technology

    1997-12-01

    Optical Interference in Night Vision Systems "* DMD Assisted Intelligent Manufacturing of ................................................... SRI...CONCEPT ......................................... p. 8 FIGURE 3(a): DMD LIGHT SWITCHES...p. 9 FIGURE 3(b): SEM PHOTOMICROGRAPHS OF DMD CHIPS ........................................ p. 9 FIGURE 4: MULTI-USER MEMS PROJECTS (MUMPS

  1. Experimental postoperative endophthalmitis.

    PubMed Central

    Forster, R K

    1992-01-01

    Various inocula of vancomycin-sensitive E faecalis (EF01), S aureus (SA02), S epidermidis (SE03), and B cereus (BC04), were intravitreally inoculated into an aphakic rabbit model with and without vancomycin, with or without vitrectomy. A summation average of the clinical response mean scores of various inocula (10(3), 10(5), 10(7) cfu) in the absence of therapy ranked these etiologic agents in the order of severity as SE03 (1.4), BC04 (1.8), EF01 (2.3), and SA02 (2.8). These favorably compared with the histopathology cavitary/noncavitary mean scores in increasing order of severity: SE03 (1.7/0.6), BC04 (1.7/0.9), EF01 (2.4/1.1), and SA02 (2.5/1.5), compared with control eyes (1.1/0.4). If the inoculum was increased to 10(7) cfu, SE03 (2.4/0.9) and BC04 (2.8/2.0) could equate EF01 and SA02. Treatment with 1 mg of vancomycin, with or without vitrectomy, did not significantly alter the overall inflammatory response to these four endophthalmitis isolates. No treatment was necessary to achieve > 99.9% killing effect by 72 hours when testing BC04, while any of the treatment modalities during 72 hours achieved 99.9% killing effect when testing SE03. No treatment modality achieved a 99.9% killing effect when testing EF01 or SA02. No single in vitro result could predict the in vivo microbiologic behavior of this model. Further research is needed to better understand the role of antiinflammatory agents, multiple drug therapy, and multiple-injection single-drug therapy with or without vitrectomy, and their impact on the inflammatory response in the aphakic model, to better treat endophthalmitis and thus improve visual prognosis. Images FIGURE 17 A FIGURE 17 B FIGURE 17 C FIGURE 18 A FIGURE 18 B FIGURE 18 C FIGURE 19 A FIGURE 19 B FIGURE 19 C FIGURE 20 A FIGURE 20 B FIGURE 20 C FIGURE 31 A FIGURE 31 B FIGURE 32 A FIGURE 32 B FIGURE 33 A FIGURE 33 B FIGURE 34 A FIGURE 34 B PMID:1494833

  2. Accumulated body burden and endogenous release of lead in employees of a lead smelter.

    PubMed Central

    Fleming, D E; Boulay, D; Richard, N S; Robin, J P; Gordon, C L; Webber, C E; Chettle, D R

    1997-01-01

    Bone lead levels for 367 active and 14 retired lead smelter workers were measured in vivo by X-ray fluorescence in May-June 1994. The bone sites of study were the tibia and calcaneus; magnitudes of concentration were used to gauge lead body burden. Whole blood lead readings from the workers generated a cumulative blood lead index (CBLI) that approximated the level of lead exposure over time. Blood lead values for 204 of the 381 workers were gathered from workers returning from a 10-month work interruption that ended in 1991; their blood level values were compared to their tibia and calcaneus lead levels. The resulting relations allowed constraints to be placed on the endogenous release of lead from bone in smelter works. Calcaneus lead levels were found to correlate strongly with those for tibia lead, and in a manner consistent with observations from other lead industry workers. Relations between bone lead concentration and CBLI demonstrated a distinctly nonlinear appearance. When the active population was divided by date of hire, a significant difference in the bone lead-CBLI slope emerged. After a correction to include the component of CBLI existing before the workers' employment at the smelter was made, this difference persisted. This implies that the transfer of lead from blood to bone in the workers has changed over time, possibly as a consequence of varying exposure conditions. Images Figure 1. A Figure 1. B Figure 2. A Figure 2. B Figure 3. A Figure 3. B Figure 4. A Figure 4. B Figure 5. Figure 6. A Figure 6. B Figure 7. Figure 8. Figure 9. A Figure 9. B PMID:9105798

  3. Neuropathy in non-freezing cold injury (trench foot).

    PubMed Central

    Irwin, M S; Sanders, R; Green, C J; Terenghi, G

    1997-01-01

    Non-freezing cold injury (trench foot) is characterized, in severe cases, by peripheral nerve damage and tissue necrosis. Controversy exists regarding the susceptibility of nerve fibre populations to injury as well as the mechanism of injury. Clinical and histological studies (n = 2) were conducted in a 40-year-old man with severe non-freezing cold injury in both feet. Clinical sensory tests, including two-point discrimination and pressure, vibration and thermal thresholds, indicated damage to large and small diameter nerves. On immunohistochemical assessment, terminal cutaneous nerve fibres within the plantar skin stained much less than in a normal control whereas staining to von Willebrand factor pointed to increased vascularity in all areas. The results indicate that all nerve populations (myelinated and unmyelinated) were damaged, possibly in a cycle of ischaemia and reperfusion. Images Figure 1 a Figure 1 b Figure 2 a Figure 2 b Figure 3 a Figure 3 b PMID:9306996

  4. Demyelination as a Target for Cell-Based Therapy of Chronic Blast-Induced Traumatic Brain Injury

    DTIC Science & Technology

    2014-10-01

    like behavior was observed in 17*3psi pressure group at day 3 (Fig. 5). Figure 5: Anxiety-like behavior following BOP exposure (*p < 0.05 at day...3, a marker of apoptosis, in the 17*3 pressure group as depicted in figure 7. 9 Figure 7: An increase in marker of apoptosis, caspase-3 was...capase-3 levels, representative images of control- 0 psi (B) and 17*3 psi pressure group (C). Arrows represents caspase-3 positive cells. 6

  5. Molecular Mechanisms of Bcl10-Mediated NF-kB Signal Transduction

    DTIC Science & Technology

    2006-03-08

    recruiting and activating the kinase, Akt , which is a critical mediator of pro-survival signals (3) (Figure 3). Figure 3. TCR-induced signaling...kinase and Akt rather than through upstream intermediates initiated by TCR ligation (34, 70). This suggests that TCR stimulation and CD28 co...P. Vito. 2004. Physical and functional interaction of CARMA1 and CARMA3 with Ikappa kinase gamma- NFkappaB essential modulator. J Biol Chem 279

  6. Xenoestrogens released from lacquer coatings in food cans.

    PubMed Central

    Brotons, J A; Olea-Serrano, M F; Villalobos, M; Pedraza, V; Olea, N

    1995-01-01

    We present data showing that some foods preserved in lacquer-coated cans and the liquid in them may acquire estrogenic activity. Hormonal activity was measured using the E-screen bioassay. The biological activity of vegetables packed in cans was a result of plastic monomers used in manufacturing the containers. The plastic monomer bisphenol-A, identified by mass spectrometry, was found as a contaminant not only in the liquid of the preserved vegetables but also in water autoclaved in the cans. The amount of bisphenol-A in the extracts accounted for all the hormonal activity measured. Although the presence of other xenoestrogens cannot be ruled out, it is apparent that all estrogenic activity in these cans was due to bisphenol-A leached from the lacquer coating. The use of plastic in food-packaging materials may require closer scrutiny to determine whether epoxy resins and polycarbonates contribute to human exposure to xenoestrogens. Images Figure 1. Figure 2. A Figure 2. B Figure 3. A Figure 3. B Figure 4. Figure 5. A Figure 5. B Figure 6. PMID:7556016

  7. A Dynamic Model of Sustainment Investment

    DTIC Science & Technology

    2015-02-01

    Sustainment System Dynamics Model 11 Figure 7: Core Structure of Sustainment Work 12 Figure 8: Bandwagon Effect Loop 13 Figure 9: Limits to Growth Loop 14...Dynamics Model sustainment capacity sustainment performance gap Bandwagon Effect R1 Limits to Growth B1 S Work Smarter B3 Work Bigger B2 desired...which is of concern primarily when using the model as a vehicle for research. Figure 8 depicts a reinforcing loop called the “ Bandwagon Effect

  8. Software Capability Evaluation (SCE) Version 2.0 Implementation Guide

    DTIC Science & Technology

    1994-02-01

    Affected By SCE B-40 Figure 3-1 SCE Usage Decision Making Criteria 3-44 Figure 3-2 Estimated SCE Labor For One Source Selection 3-53 Figure 3-3 SCE...incorporated into the source selection sponsoring organization’s technical/management team for incorporation into acquisition decisions . The SCE team...expertise, past performance, and organizational capacity in acquisition decisions . The Capability Maturity Model Basic Concepts The CMM is based on the

  9. System Synthesis for Polymorphous Computing Architectures

    DTIC Science & Technology

    2002-02-01

    G H F Proc 5 : 4 : 3 11 1 Figure 3. Self-timed execution. D C B F G H E D B H EA CG F D C B F G H E D B H EA CG F AProc 1 Proc 2...first-iteration actors denoted by T. D B H E CG F D C B F G H E D B H EA CG F A 18 T T T T Proc 3 Proc 4 Proc 5 Proc 1 Proc 2 1 T⁄ T trmin30 ture-mirror...Phase1Algo( , ) = transientReduction( ) Output T G S′ S G T S′ S S′ Figure 11. Pseudocode to find

  10. Applied Computational Fluid Dynamics in Support of Aircraft/Store Compatibility and Weapons Integration -2007 Edition

    DTIC Science & Technology

    2007-06-01

    CFD in the AFSEO The SBD, designated GBU - 39 /B, contains a 250 production environment include the requirement for rapid pound warhead, measures 6 feet...Take Off (RATO) Separation." ITEA Conference, Apr 2006. Figure 3. B-52/MOP Figure 1. GBU - 39 /B small diameter bomb computational model Figure 4. MOP

  11. Ka-band Ga-As FET noise receiver/device development

    NASA Technical Reports Server (NTRS)

    Schellenberg, J. M.; Feng, M.; Hackett, L. H.; Watkins, E. T.; Yamasaki, H.

    1982-01-01

    The development of technology for a 30 GHz low noise receiver utilizing GaAs FET devices exclusively is discussed. This program required single and dual-gate FET devices, low noise FET amplifiers, dual-gate FET mixers, and FET oscillators operating at Ka-band frequencies. A 0.25 micrometer gate FET device, developed with a minimum noise figure of 3.3 dB at 29 GHz and an associated gain of 7.4 dB, was used to fabricate a 3-stage amplifier with a minimum noise figure and associated gain of 4.4 dB and 17 dB, respectively. The 1-dB gain bandwidth of this amplifier extended from below 26.5 GHz to 30.5 GHz. A dual-gate mixer with a 2 dB conversion loss and a minimum noise figure of 10 dB at 29 GHz as well as a dielectric resonator stabilized FET oscillator at 25 GHz for the receiver L0. From these components, a hybrid microwave integrated circuit receiver was constructed which demonstrates a minimum single-side band noise figure of 4.6 dB at 29 GHz with a conversion gain of 17 dB. The output power at the 1-dB gain compression point was -5 dBm.

  12. Phagosomal pH and glass fiber dissolution in cultured nasal epithelial cells and alveolar macrophages: a preliminary study.

    PubMed Central

    Johnson, N F

    1994-01-01

    The dissolution rate of glass fibers has been shown to be pH sensitive using in vitro lung fluid simulant models. The current study investigated whether there is a difference in phagosomal pH (ppH) between rat alveolar macrophages (AM) and rat nasal epithelial cells (RNEC) and whether such a difference would influence the dissolution of glass fibers. The ppH was measured in cultured AM and RNEC using flow cytometric, fluorescence-emission rationing techniques with fluorescein-labeled, amorphous silica particles. Glass fiber dissolution was determined in AM and RNEC cultured for 3 weeks with fast dissolving glass fibers (GF-A) or slow dissolving ones (GF-B). The mean diameters of GF-A were 2.7 microns and of GF-B, 2.6 microns, the average length of both fibers was approximately 22 to 25 microns. Dissolution was monitored by measuring the length and diameter of intracellular fibers and estimating the volume, assuming a cylindrical morphology. The ppH of AM was 5.2 to 5.8, and the ppH of RNEC was 7.0 to 7.5. The GF-A dissolved more slowly in RNEC than in AM, and no dissolution was evident in either cell type with GF-B. The volume loss with GF-A after a 3-week culture with AM was 66% compared to 45% for cultured RNEC. These results are different from those obtained using in vitro lung fluid-simulant models where dissolution is faster at higher pH. This difference suggests that dissolution rates of glass fibers in AM should not be applied to the dissolution of fibers in epithelial cells. Images Figure 1. a Figure 1. b Figure 2. a Figure 2. b Figure 3. a Figure 3. b PMID:7882965

  13. Using DNA to Design Plasmonic Metamaterials with Tunable Optical Properties

    DTIC Science & Technology

    2014-01-01

    using both UV –vis spectroscopy for ensemble measurements and optical micro- spectrophotometry for individual superlattice electric fi elds at...lated data). The red-shift seen between the micro-spectropho- tometer measurements (Figure 3 b) and the UV –vis ensemble measurements (Figure 3 a...the measurements. Using UV –vis spectroscopy ( Figure 3 a), red- shifting of the superlattices’ bulk LSPR with decreased nano- particle spacing is

  14. Demyelination as a Target for Cell-Based Therapy of Chronic Blast-Induced Traumatic Brain Injury

    DTIC Science & Technology

    2014-10-01

    pressure group at day 3 (Fig. 5). 5 Figure 5: Anxiety-like behavior following BOP exposure (*p < 0.05 at day 2; #p < 0.05 at day 3; ^p=0.08 at... pressure group as depicted in figure 7. 7 Figure 7: An increase in marker of apoptosis, caspase-3 was observed at 17*3 pressure in choroid...of control- 0 psi (B) and 17*3 psi pressure group (C). Arrows represents caspase-3 positive cells. 6. Diffusion tensor imaging (DTI) (Dr. Walczak

  15. Improvement of Janus Using Pegasus 1-Meter Resolution Database With a Transputer Network

    DTIC Science & Technology

    1994-03-01

    Figure 4.9 shows the six jacks on the end of the HSI-card. Facing the back of the SPARC Station LINKO LINKI LINK2 LINK3 DOWN UP Figure 4.9: HSI-Card Link...shown in Figure 4.22. Facing the back of the Sun SPARC Station LINK0 LINKI LINK2 LINK3 DOWN UP "b Telephone Cable Facing the front of the Remote Tram...Holder LINKO LINKI LINK2 LINK3 DOWN UPI Figure 4.20: The Connection Between Sun SPARC Station and Remote Tram Holder 58 (3) Se.inu Up t• Link Speed

  16. Study on a Cavitating Hydrofoil having a Practical Blade Profile Shape.

    DTIC Science & Technology

    1980-10-31

    and punched on regular IBM cards. These cards were conveniently used as input data for data reduction. The data acquisition system also has an...FIGURE 3.4 FLOW CONFIGURATION OF DOUBLE WAKE MODEL FOR PARTIALLY CAVITATING FOIL W =+ itp B C F T w St (pI FIGURE 3.5 POTENTIAL PLANE ia W T B C F W

  17. 47 CFR 73.160 - Vertical plane radiation characteristics, f(θ).

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... significant figures shown here should not be interpreted as a limitation on the number of significant figures... electrical height: the sum of A and B; A+B. See Figure 1 of this section. EC01MR91.066 (3) For a... between H and A; H−A. See Figure 2 of this section. EC01MR91.067 (c) One of the above f(θ) formulas must...

  18. 47 CFR 73.160 - Vertical plane radiation characteristics, f(θ).

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... significant figures shown here should not be interpreted as a limitation on the number of significant figures... electrical height: the sum of A and B; A+B. See Figure 1 of this section. EC01MR91.066 (3) For a... between H and A; H−A. See Figure 2 of this section. EC01MR91.067 (c) One of the above f(θ) formulas must...

  19. 47 CFR 73.160 - Vertical plane radiation characteristics, f(θ).

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... significant figures shown here should not be interpreted as a limitation on the number of significant figures... electrical height: the sum of A and B; A+B. See Figure 1 of this section. EC01MR91.066 (3) For a... between H and A; H−A. See Figure 2 of this section. EC01MR91.067 (c) One of the above f(θ) formulas must...

  20. Orbit Transfer Rocket Engine Technology - 7.5K-LB Thrust Rocket Engine Preliminary Design

    DTIC Science & Technology

    1993-10-15

    AND SPACE ADMINISTRATION October, 1993 r W NASA-Lewis Research Center Cleveland, Ohio 44135 94-08572 Contract Nc. NAS3-23773 Task B.7 and D.5 4I3’OA4 3 ...APPROACH 1 4.0 SUMMARY OF ACCOMPLISHMENTS 2 5.0 TECHNICAL DISCUSSIONS 3 6.0 PROGRAM WORK PLAN 5 6.1 Engine Analysis 5 6.2 Component Analysis 15 6.2.1...FIGURES Page Figure 1 Advanced Engine Studv Logic Diagram 4 Figure 2 Design Point Engine Pertormance at Full Thrust & MR = 6.0 7 Figure 3 Off-Design

  1. Treatment Induced Autophagy Associated with Tumor Dormancy and Relapse

    DTIC Science & Technology

    2016-07-01

    for the autophagy gene , ATG5 (Figure 2A). Figure 2B confirms that autophagy was inhibited based on interference with the degradation of p62/SQSTM1 and...post IR (6Gy) LC.3.B GAPDH Figure 2. Silencing of autophagy in MMC cells. (A) Sh RNA mediated silencing of the autophagy gene , ATG5, in MMC cells...they sleep ? J Pharmacol Exp Ther 2012; 343(3):763-78. 9. Michaud M, Martins I, Sukkurwala AQ, Adjemian S, Ma Y, Pellegatti P, Shen S, Kepp O, Scoazec

  2. Effect of Hydration on the Mechanical Properties of Anion Exchange Membranes

    DTIC Science & Technology

    2015-01-19

    trimethylbenzyl ammonium (PFTMBA), c.) ethyl ammonium (PFEA). ...............26! Figure 3.3: a.) Full IR spectra of the 3M sulfonyl precursor, methyl...with the cation group. ............................................................................................30! Figure 3.4: IR spectra of all...is modified from a paper published in Journal of Polymer Science, Part B: Polymer Physics1 Melissa A. Vandiver2, James L. Horan3, Yuan Yang4, Emily T

  3. Developmental abnormalities of the gonad and abnormal sex hormone concentrations in juvenile alligators from contaminated and control lakes in Florida.

    PubMed Central

    Guillette, L J; Gross, T S; Masson, G R; Matter, J M; Percival, H F; Woodward, A R

    1994-01-01

    The reproductive development of alligators from a contaminated and a control lake in central Florida was examined. Lake Apopka is adjacent to an EPA Superfund site, listed due to an extensive spill of dicofol and DDT or its metabolites. These compounds can act as estrogens. Contaminants in the lake also have been derived from extensive agricultural activities around the lake that continue today and a sewage treatment facility associated with the city of Winter Garden, Florida. We examined the hypothesis that an estrogenic contaminant has caused the current failure in recruitment of alligators on Lake Apopka. Supporting data include the following: At 6 months of age, female alligators from Lake Apopka had plasma estradiol-17 beta concentrations almost two times greater than normal females from the control lake, Lake Woodruff. The Apopka females exhibited abnormal ovarian morphology with large numbers of polyovular follicles and polynuclear oocytes. Male juvenile alligators had significantly depressed plasma testosterone concentrations comparable to levels observed in normal Lake Woodruff females but more than three times lower than normal Lake Woodruff males. Additionally, males from Lake Apopka had poorly organized testes and abnormally small phalli. The differences between lakes and sexes in plasma hormone concentrations of juvenile alligators remain even after stimulation with luteinizing hormone. Our data suggest that the gonads of juveniles from Lake Apopka have been permanently modified in ovo, so that normal steroidogenesis is not possible, and thus normal sexual maturation is unlikely. Images p680-a Figure 1. Figure 2. Figure 3. A Figure 3. B Figure 3. C Figure 4. A Figure 4. B Figure 4. C Figure 4. D Figure 5. A Figure 5. B Figure 5. C PMID:7895709

  4. Noise Pollution Aspects of Barge, Railroad, and Truck Transportation,

    DTIC Science & Technology

    1975-04-01

    attenuation alone. (f) Commins, et al, conclude that: (1) a lush vegetative cover will reduce dB( A ) levels by a factor of 4.5 - 4.8dB(A) instead of 3dB...prevailed (Figure lOc). Visual evidence of how much lapse rates affect dB( A ) levels experienced at varying distances from a line source of sound is made...possible by comparing the dB( A ) levels shown in Figures 9a, b and c at varying distances that would occur based solely on geometric attenuation (Figure 11

  5. 49 CFR 571.217 - Standard No. 217; Bus emergency exits and window retention and release.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ..., and in figure 3D for a rear emergency exit door. (b) Type of motion: Upward from inside the bus and... printed volume and at www.fdsys.gov. § 571.217, Nt. Effective Date Note: At 77 FR 19136, Mar. 30, 2012, § 571.217 was amended by revising S5.3.2, S5.3.3.1(a), S5.3.3.2, S5.3.3.3, S5.4.3.1(a), and Figure 3D...

  6. Severe renal hemorrhage caused by pyelonephritis in 7 horses: clinical and ultrasonographic evaluation.

    PubMed Central

    Kisthardt, K K; Schumacher, J; Finn-Bodner, S T; Carson-Dunkerley, S; Williams, M A

    1999-01-01

    Case records of 7 horses diagnosed with pyelonephritis were reviewed to determine common features that might aid in diagnosis, treatment, and prognosis of this disease. All 7 horses had been admitted for evaluation of hematuria. During cystoscopy of 5 horses, hemorrhage was observed from one or both ureters. Renal biopsy of 1 horse, laboratory analysis of ureteral discharge of 2 horses, and renal ultrasonography of all horses indicated that pyelonephritis was the cause of hemorrhage. Sonographic renal changes included decreased length, increased echogenicity, abnormal outline, loss of corticomedullary distinction, pyelectasia, and focal hypoechoic or hyperechoic cortical defects. Renal hemorrhage in all horses eventually resolved but recurred in 4 of 5 horses that were followed long-term. Images Figure 1. Figure 2. Figure 3. Figure 4A. Figure 4B. Figure 4C. Figure 5A. Figure 5B. Figure 5C. Figure 6A. Figure 6B. Figure 7. PMID:12001337

  7. Phosphoinositide-Driven Epithelial Proliferation in Prostatic Inflammation

    DTIC Science & Technology

    2009-04-01

    IL-1β expression is localized to the urethral urothelium during development, and little or no expression is observed in the developing prostatic...ducts [Figure 3B]. By comparison, IL-1α expression is found both in the urethral urothelium and in the developing prostatic ducts [Figure 3A]. In...adult [C]. Hyperplasia was induced by E. coli for 5 days. In contrast, IL-1β [B,D] expression is localized to the urethral urothelium at P10 [B] and

  8. Film Cooling in Fuel Rich Environments

    DTIC Science & Technology

    2013-03-27

    Heat Release Analysis . . . . . . . 89 4.26 Enhanced Blue Value Photographs for Flame Length Quantification, M=2.0, φ = 1.175, Single Row, Triple Row...Photographs for Flame Length . . . . . . . . . . . . . . 105 B.1 Charts Used to Calculate Trip Height . . . . . . . . . . . . . . . . . . . . . . . 107 B...coolant and quantification of flame length . The side window is shown in Figure 3.20 with a ruler used to calibrate the images. 51 Figure 3.18: Spanwise

  9. Study of Mechano-Chemical Machining of Ceramics and the Effect on Thin Film Behavior.

    DTIC Science & Technology

    1983-01-01

    with Fe2O3 Under Various Pressures 9 7 Nomarski Micrographs of an Si N Substrate (a) Before *. and (b) After Mechanochemical Polishing 11 8 -Surface...the entire polished surface did not reveal any scratches. Figure 7 com- pares the Nomarski micrographs of an Si3 N4 substrate before (in the as...mechanochemically polished Si3N4 substrates, using an interferometric technique. The surface figure of a 2.5 x 2.5 cm Si 3N4 substrate is shown in Figure 9. This fig

  10. Crack Initiation and Growth Behavior at Corrosion Pit in 2024-T3 Aluminum Alloy

    DTIC Science & Technology

    2014-09-01

    63 Figure B.1: The crack length vs. number of cycles during fatigue testing for the 2AI-01 specimen...number of cycles during fatigue testing for the the 2AI- 02 specimen...64 Figure B.3: The crack length vs. number of cycles during fatigue testing for the 2Sl-01 specimen

  11. In-situ, Nanosecond, High Resolution TEM Instrumentation for Multi-Disciplinary Research and Education in Nanomaterials

    DTIC Science & Technology

    2014-10-30

    rotation of the tilt table (Figure 3b). A torsion spring pushes the tilt table against the push bar, so that contact is maintained (Figure 3a). The tilt...designed flexible circuit board (Figure 3a), composed of copper conductors patterned on top of vacuum-compatible kapton polymer. The flexibility of...this board is important so that it does not hinder rotation of the tilt-table. The flexible PCB extends into the hollow holder shaft, and interfaces

  12. Cargo Movement Operations System (CMOS) Preliminary Interface Design Document Increment II

    DTIC Science & Technology

    1991-02-28

    NO [ ] COMMENT DISPOSITION: ACCEPT [ ] REJECT [ ] COMMENT STATUS: OPEN [ ] CLOSED [ ] Cmnt Page Paragraph No. No. Number Comment 1. vii List of Figures Figure 3.24, METS II is listed twice. Delete the reference to page 51 here, and Figure 3.24 on page 51. 2. 52 3.30.2.1b Change "inceements" to "increments". 3. 56 3.33.2.1 Change Table ŗ.35.2.a" to 3.40.2a". 4. A-3 DAMMS-R Change "management" to "Managemn.it". 5. A-5 HOST Change "Syatem" to "System". ORIGINATOR CONTROL NUMBER: IDD-0002 PROGRAM OFFICE

  13. Phosphoinositide-Driven Epithelial Proliferation in Prostatic Inflammation

    DTIC Science & Technology

    2008-01-01

    that IL-1β expression is localized to the urethral urothelium during development, and little or no expression is observed in the developing prostatic...ducts [Figure 3B]. By comparison, IL-1α expression is found both in the urethral urothelium and in the developing prostatic ducts [Figure 3A]. In...adult [C]. Hyperplasia was induced by E. coli for 5 days. In contrast, IL-1β [B,D] expression is localized to the urethral urothelium at P10 [B] and

  14. A Simulation of the ECSS Help Desk with the Erlang a Model

    DTIC Science & Technology

    2011-03-01

    a popular distribution is the exponential distribution as shown in Figure 3. Figure 3: Exponential Distribution ( Bourke , 2001) Exponential...System Sciences, Vol 8, 235B. Bourke , P. (2001, January). Miscellaneous Functions. Retrieved January 22, 2011, from http://local.wasp.uwa.edu.au

  15. 49 CFR 571.217 - Standard No. 217; Bus emergency exits and window retention and release.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... shown in Figure 3A for a side emergency exit door, and in figure 3D for a rear emergency exit door. (b... § 571.217 see the List of CFR Sections Affected which appears in the Finding Aids section of the printed...

  16. 49 CFR 571.217 - Standard No. 217; Bus emergency exits and window retention and release.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... shown in Figure 3A for a side emergency exit door, and in figure 3D for a rear emergency exit door. (b... § 571.217 see the List of CFR Sections Affected which appears in the Finding Aids section of the printed...

  17. 10 CFR Appendix P to Subpart B of... - Uniform Test Method for Measuring the Energy Consumption of Pool Heaters

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... least three significant figures shall be reported. 4.3Off mode. 4.3.1Pool heaters with a seasonal off... significant figures shall be reported. 5.Calculations. 5.1Thermal efficiency. Calculate the thermal efficiency...

  18. The First Example of an Organogallium Compound Containing a Ga-Te Bond: Synthesis, Properties and Molecular Structure of ((Me3CCH2)2GaTePh)2

    DTIC Science & Technology

    1989-06-12

    Government *This document has been approved for public release and sale ; its distribution is unlimited S v r DL/1113/89/1 TECHNICAL REPORT DISTRIBUTION LIST...thermal parameter defined as (4/3) (a2B(1,1) + b2B (2,2) + c 2B(3,3) + ab(cos Y)B(1,2) + ac(cos B)B(1,3) + bc(cos a)B(2,3)]. -16- Captions for Figures

  19. Alterations in protein glycosylation in PMA-differentiated U-937 cells exposed to mineral particles.

    PubMed Central

    Trabelsi, N; Greffard, A; Pairon, J C; Bignon, J; Zanetti, G; Fubini, B; Pilatte, Y

    1997-01-01

    Carbohydrate moieties of cell glycoconjugates play a pivotal role in molecular recognition phenomena involved in the regulation of most biological systems and the changes observed in cell surface carbohydrates during cell activation or differentiation frequently modulate certain cell functions. Consequently, some aspects of macrophage response to particle exposure might conceivably result from alterations in glycosylation. Therefore, the effect of mineral particles on protein glycosylation was investigated in phorbol myristate acetate (PMA)-differentiated U-937. Jacalin, a lectin specific for O-glycosylated structures, showed a global increase in O-glycosylation in particle-treated cells. In contrast, no significant modifications were observed with concanavalin A, a lectin that recognizes certain N-glycosylated structures. The sialic acid-specific lectins Sambucus nigra agglutinin and Maackia amurensis agglutinin and the galactose-specific lectin Ricinus communis agglutinin revealed a complex pattern of alterations in glycoprotein glycosylation after crystalline silica or manganese dioxide treatments. Expression of sialyl Lewis(x), a glycosylated structure implicated in leukocyte trafficking, could not be detected in control or treated cells. This finding was consistent with the decrease in sialyl Lewis(x) expression observed during PMA-induced differentiation. In conclusion, various treatments used in this study induced quantitative as well as qualitative changes in protein glycosylation. Whether these changes are due to glycosidase release or to an alteration in glycosyltransferase expression remains to be determined. The potential functional implications of these changes are currently under investigation. Images Figure 1. A Figure 1. B Figure 2. A Figure 2. B Figure 3. A Figure 3. B Figure 3. C Figure 4. PMID:9400716

  20. Conductive Polymer Blends

    DTIC Science & Technology

    1988-04-26

    FIGURES Figure 1. Schematic of the suspension copolymerization approach ................ 8 Figure 2. SEM micrograph of fracture surface near molded...micrograph of fracture surface near molded edge of sample 1430-58b.............................................................. 18 Figure 12. SEM... caprolactam . The caprolactam (11.3 g) was placed in a large tube equipped with a nitrogen inlet, and heated under nitrogen to 80*C, whereupon

  1. Systematic Investigation of Key Survival and Growth Pathways in Breast Cancer

    DTIC Science & Technology

    2011-09-01

    Bachelder, R.E., Yoon, S.O., Franci, C., de Herreros, A.G., and Mercurio , A.M. (2005). Glycogen synthase kinase-3 is an endogenous inhibitor of Snail...directly, we showed that knockdown of IRS1 or Snail1 in MCF10A-MEMO1 cells de -repressed E-cadherin synthesis (Figure 3E and 3F). Collectively, these... extract (Figure 5B). Moreover, AMOTL2 binds to both inactive AKT1 (K179M) and constitutively activated AKT1 (Myr tag fused AKT1) in the cell (Figure

  2. The Theory of Unconventional Warfare: Win, Lose, and Draw

    DTIC Science & Technology

    2008-12-01

    UNCONVENTIONAL WARFARE MODEL ...................................12 1. Planning Phase...Superiority over Time........................................................................11  Figure 3.  Unconventional Warfare Model ...superiority through the six principles of UW illustrated below in the UW model . . B. THE UNCONVENTIONAL WARFARE MODEL Figure 3. Unconventional

  3. Localization of intercellular adhesion molecule-1 (ICAM-1) in the lungs of silica-exposed mice.

    PubMed Central

    Nario, R C; Hubbard, A K

    1997-01-01

    Intercellular adhesion molecule-1 (ICAM-1) is expressed on a variety of cells including endothelial cells, alveolar epithelial cells, and alveolar macrophages. Endothelial/epithelial cell ICAM-1 participates in the migration of leukocytes out of the blood in response to pulmonary inflammation, whereas alveolar macrophage ICAM-1 may represent cell activation. Our previous studies have shown that there is increased expression of ICAM-1 in lung tissue during acute inflammation following intratracheal injection with silica particles (2 mg/mouse). This increased expression was shown to play a role, in part, in the migration of neutrophils from the circulation into the tissue parenchyma. The aim of the current work is to localize expression of ICAM-1 during acute inflammation in lungs of mice exposed to either silica or the nuisance dust, titanium dioxide. In silica-exposed mice, a significant increase in ICAM-1 was detected on day-1 and localized by immunohistochemistry to aggregates of pulmonary macrophages and to type II epithelial cells. Areas of the lung with increased ICAM-1 expression also showed increased tumor necrosis factor alpha expression. Immunocytochemical staining of bronchoalveolar lavage (BAL) cells demonstrated increased ICAM-1 expression associated with alveolar macrophages 3, 5, and 7 days following silica exposure. Finally, soluble ICAM-1 levels in the BAL fluid were significantly increased in mice exposed to silica on the same days. Titanium dioxide exposure elicited a minimal increase in expression of ICAM-1 in the lungs. These data demonstrate that exposure to the toxic particle silica specifically increases ICAM-1 expression localized to pulmonary macrophages and type II epithelial cells. Images Figure 2. B Figure 2. A Figure 2. D Figure 2. C Figure 3. A Figure 3. B Figure 5. B Figure 5. A Figure 5. C PMID:9400721

  4. Wastewater Characterization Survey, Holloman Air Force Base, New Mexico

    DTIC Science & Technology

    1992-01-01

    0.5 ɘ.5 ICompositel Grab J 21 Figure B-3 Sewage Treament Plant (STP#): STP #1 STP #2 STP #3 STP #4 The sampler was located below GN913006 GN913007...65.2 352 Benzene ug/L 0.1163.1 . 23] 27 I Compositel Grab 22 Figure B-4 Sewage Treament Plant (STP#): STP #5 STP #6 STP #7 The sampler was located

  5. Multi-Agent Framework for the Fair Division of Resources and Tasks

    DTIC Science & Technology

    2006-01-01

    144 B.1.2 Application of Shake Out Algorithm to JFK Airport Test Data.........................144 B.2 Generalization...145 Figure B–2: Available Aircraft Inventory at JFK Airport ............................................. 148 Figure B–3...Available Aircraft Inventory at JFK Airport after the first shake out ....... 148 Figure B–4: Inventory Vectors for Second and Third Shake Outs

  6. Understanding the Impact of Surface Waves on Microwave Water Level Measurements

    DTIC Science & Technology

    2008-09-01

    Design Analysis H3611, 3) Ohmart/Vega Vega Puls 62, and 4) the Sutron RLR - 0001 (The use of brand names in this paper is for the purpose of...overhead crane: (a) Ohmart/Vega Vega Puls 62, (b) Design Analysis H3611, (c) Miros SM094, (d) Sutron RLR -0001. Figure 4...Figure 5. Time series of water level fluctuations from run with sensor platform at 3m; (a) Miros SM094 (b) Sutron RLR -0001

  7. An Overview of Human Figure Modeling for Army Aviation Systems

    DTIC Science & Technology

    2010-04-01

    An Overview of Human Figure Modeling for Army Aviation Systems by Jamison S. Hicks, David B. Durbin, and Richard W. Kozycki ARL-TR-5154...April 2010 An Overview of Human Figure Modeling for Army Aviation Systems Jamison S. Hicks, David B. Durbin, and Richard W. Kozycki...TYPE Final 3. DATES COVERED (From - To) May 2009–August 2009 4. TITLE AND SUBTITLE An Overview of Human Figure Modeling for Army Aviation Systems

  8. Comparative Analyses of Multi-Pulse Phase Controlled Rectifiers in Continuous Conduction Mode with a Two-Pole LC Output Filter for Surface Ship DC Applications

    DTIC Science & Technology

    2013-03-01

    for this sub-mode, the minimum inductor current occurs at an angle 3 3t  (where 3 60    referenced to  ), as shown in Figure 13. 24...can be rewritten as    sin cos cosb b b ApA B      . (73) Grouping similar terms, yields  sin cosb b ApA B         , (74...where the fundamental frequency and each harmonic component are displayed graphically in a bar chart format as shown in Figure 25. The total current

  9. Robust Coordination of Autonomous Systems through Risk-sensitive, Model-based Programming and Execution

    DTIC Science & Technology

    2015-10-09

    loop once more, or ceasing the iteration. 3.5 Simple UAV scenario in cRMPL Figure 3.6 presents a “ Hello World” example showing how cRMPL can be used...t i m e ) (a) “ Hello World” example in cRMPL. (b) Corresponding pTPN. Figure 3.6: “ Hello World” example in cRMPL and its corresponding representa

  10. Tailoring the Systems Engineering Technical Review Implementation Within Naval Acquisition

    DTIC Science & Technology

    2017-09-01

    additional feedback regarding SETR implementations. Free Text N/A 40 B. SURVEY DATA (1) Question 1 Figure 12 provides the results to the initial...instruction. The complete set of responses provided in the free text field—”Other (please specify)”—are included in Appendix B. Figure 13. Question 2...provided in the free text field— ”Other (please specify)”—are included in Appendix B. Figure 14. Question 3 Survey Results 43 (4) Question 4

  11. Evaluation of Commercial Off-the-Shelf and Government Off-the-Shelf Microclimate Cooling Systems

    DTIC Science & Technology

    2005-08-01

    Appendix A - Request for Information (RFI) 23 Appendix B - Memorandum from Natick Soldier Center’s International Office 25 Appendix C - Cooling Power...Data Entry Forms 7 Figure 3. Evaporative Cooling Products 9 Figure 4. Passive Phase Change Product 10 Figure 5. Liquid Circulating...Microclimate Cooling System 13 Figure 6. Compressed Air Cooling Product 15 Figure 7. Vortex Tube 15 Figure 8. Active Phase

  12. PubMed Central

    Papageorges, M.; Lussier, S.; Breton, L.; Gosselin, Y.; Teuscher, E.

    1982-01-01

    A pulmonary anaplastic epithelioma in a bitch An anaplastic epithelioma of the lungs was diagnosed in a 26 month old female Airedale. The authors describe signs of bronchopneumonia and lameness involving the right fore and hind limbs. The lameness occurred following metastases to the long bones. The clinical signs, the radiological appearance, the postmortem lesions encountered with that neoplasm and differential diagnosis are discussed. ImagesFigure 1.Figure 2.Figure 3.Figure 4a,b.Figure 5.Figure 6. PMID:17422120

  13. Evaluation of Genomic Instability in the Abnormal Prostate

    DTIC Science & Technology

    2008-12-01

    Research 63, 4781-5. (24) Mehrotra, J., Varde, S., Wang, H., Chiu, H., Vargo, J., Gray , K., Nagle, R.B., Neri, J.R., Mazumder, A. (2007) Quantitative...examined. B-actin was used as the internal control (not shown). Figure 6 Figure 6. Telomere Content of samples by tissue source. The gray ...TTC GGG GTG TAG CG-6-TAMSp-3’ RassF1A Forward 5’-GCG TTG AAG TCG GGG TTC-3’ RassF1A Reverse 5’-CCC GTA CTT CGC TAA CTT TAA ACG-3’ RassF1A Probe 5

  14. Accelerators (4/5)

    ScienceCinema

    Metral, Elias

    2017-12-09

    1a) Introduction and motivation 1b) History and accelerator types 2) Transverse beam dynamics 3a) Longitudinal beam dynamics 3b) Figure of merit of a synchrotron/collider 3c) Beam control 4) Main limiting factors 5) Technical challenges Prerequisite knowledge: Previous knowledge of accelerators is not required.

  15. Accelerators (5/5)

    ScienceCinema

    None

    2018-05-16

    1a) Introduction and motivation; 1b) History and accelerator types; 2) Transverse beam dynamics; 3a) Longitudinal beam dynamics; 3b) Figure of merit of a synchrotron/collider; 3c) Beam control; 4) Main limiting factors; 5) Technical challenges Prerequisite knowledge: Previous knowledge of accelerators is not required.

  16. Research on SAW Sensor Bias Stability

    DTIC Science & Technology

    1981-10-01

    9Rockwell International MRDC4 1082 . 4AR TABLE OF CONTENTS LISTOF FGURS........................................ ge APECSLIST OF FIGURES...MRDC4 1082 . 4AR LIST OF FIGURES (continued) Figure Page 12. Theoretical behavior of resonator aging using logarithmic rate law with different B...3 180’ es Q % Rockwell International MRDC4 1082 . 4AR 3.0 TECHNICAL RESULTS During the first year of this program, the specific technical tasks were

  17. AM2 Brickwork Pattern Evaluation with Refurbished Matting

    DTIC Science & Technology

    2015-08-01

    13 2.3.1 Subgrade construction and posttest forensics...19 Figure 18. Posttest DCP data for the F...51 Figure 51. V2W, V2E (a) pretest and (b) posttest and V1-C (c) pretest and (d) posttest . ................... 51 Figure 52

  18. Involvement of transcription factor encoded by the mouse mi locus (MITF) in apoptosis of cultured mast cells induced by removal of interleukin-3.

    PubMed Central

    Tsujimura, T.; Hashimoto, K.; Morii, E.; Tunio, G. M.; Tsujino, K.; Kondo, T.; Kanakura, Y.; Kitamura, Y.

    1997-01-01

    Mast cells develop when spleen cells of mice are cultured in the medium containing interleukin (IL)-3. Cultured mast cells (CMCs) show apoptosis when they are incubated in the medium without IL-3. We obtained CMCs from tg/tg mice that did not express the transcription factor encoded by the mi gene (MITF) due to the integration of a transgene at its 5' flanking region. MITF is a member of the basic-helix-loop-helix-leucine zipper (bHLH-Zip) protein family of transcription factors. We investigated the effect of MITF on the apoptosis of CMCs after removal of IL-3. When cDNA encoding normal MITF ((+)-MITF) was introduced into tg/tg CMCs with the retroviral vector, the apoptosis of tg/tg CMCs was significantly accelerated. The mutant mi allele represents a deletion of an arginine at the basic domain of MITF. The apoptosis of tg/tg CMCs was not accelerated by the introduction of cDNA encoding mi-MITF. The overexpression of (+)-MITF was not prerequisite to the acceleration of the apoptosis, as the apoptotic process proceeded faster in +/+ CMCs than in mi/mi CMCs. The Ba/F3 lymphoid cell line is also dependent on IL-3, and Ba/F3 cells show apoptosis after removal of IL-3. The c-myc gene encodes another transcription factor of the bHLH-Zip family, and the overexpression of the c-myc gene accelerated the apoptosis of Ba/F3 cells. However, the overexpression of (+)-MITF did not accelerate the apoptosis of Ba/F3 cells. The (+)-MITF appeared to play some roles for the acceleration of the apoptosis specifically in the mast cell lineage. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:9327738

  19. Analysis of the effects of overexpression of metallothionein-I in transgenic mice on the reproductive toxicology of cadmium.

    PubMed Central

    Dalton, T; Fu, K; Enders, G C; Palmiter, R D; Andrews, G K

    1996-01-01

    Exposure to low levels of cadmium reduces fertility. In male mice spermatogenesis is highly sensitive to cadmium, whereas in females the peri-implantation period of pregnancy is sensitive. To examine the potential roles of the cadmium-binding protein, metallothionein (MT), in the reproductive toxicology of cadmium, we examined a transgenic mouse strain that overexpresses metallothionein-I (MT-I). These mice had dramatically increased steady-state levels of MT-I mRNA and MT in the testes and in the female reproductive tract during the peri-implantation period of pregnancy, and this overexpression occurred in a cell-specific and temporally regulated manner similar to that of the endogenous MT-I gene. Transgenic and control males were injected with cadmium, and the histology of the testes was examined. An injection of 7.5 mumol Cd/kg had no effect on histology of the testes in either transgenic or control mice. In contrast, an injection of 10 mumol Cd/kg caused rapid changes in the histology of the testes and resulted in pronounced testicular necrosis in both control and transgenic mice. Female transgenic and control mice were mated and then injected with cadmium (30-45 mumol Cd/kg) on the day of blastocyst implantation (day 4). In both of these groups, injection of cadmium reduced pregnancy rate, and no dramatic protection was afforded by maternal and/or embryonic overexpression of MT. Thus, overexpression of MT-I does not significantly protect against either of these cadmium-induced effects on fertility. Images Figure 1. A Figure 1. B Figure 2. A Figure 2. B Figure 2. C Figure 3. Figure 4. A Figure 4. A Figure 4. B Figure 4. B Figure 4. B Figure 4. B Figure 4. D4 Figure 4. D4 Figure 4. D6 Figure 4. D6 Figure 4. D8 Figure 5. A Figure 5. B Figure 5. C Figure 5. D Figure 5. E Figure 6. A Figure 6. B Figure 6. C Figure 6. D Figure 6. E Figure 6. F PMID:8834864

  20. Uncooled Split-off Quantum Infrared Sensors for 3-5 Micron Imaging Applications

    DTIC Science & Technology

    2012-12-20

    nonuniformity and needs to be optimized. Figure 5 (a) shows plots of Figure 3: (a) The responsivity and (b) detectivity variation with emitter...devices with larger mesa sizes than that with smaller sizes. The current nonuniformity originally results from the electric potential gradient in the...respectively. x = 0 represents the device center. The nonuniformity becomes remarkable when the temperature is increased. 5 2.3 Design of resonant

  1. Fluid Flow Characterization of High Turbulent Intensity Compressible Flow Using Particle Image Velocimetry

    DTIC Science & Technology

    2015-08-01

    completed in order to begin further experimentation. A 10 kHz Time Resolved Particle Image Velocimetry (TR-PIV) system and a 3 kHz Planer Laser ...9 2.3.2 Planar Laser Induced Fluorescence (PLIF...35 Figure 4.4: Solenoid valve (a), proportional control valve (b) and flowmeter (c) ...................................... 36 Figure 4.5

  2. Impact Ionization: Beyond the Golden Rule

    DTIC Science & Technology

    1992-01-01

    3]. Hence, the use electronic kinetic energy, H. is the phonon bath Hamil- of Monte Carlo methods combined with density matrix tonian, HA, is the...0 o5 () Wace i.a (bN w...,,,ae (W ( Ib) k- Figure 2. (a) Ionization rate in the 1 11 > direction. Figure 3. (a) Equal ionization rate curves in the k

  3. MMIC LNA based novel composite-channel Al0.3Ga0.7N/Al0.05Ga0.95N/GaNHEMTs

    NASA Astrophysics Data System (ADS)

    Cheng, Zhi-Qun; Cai, Yong; Liu, Jie; Zhou, Yu-Gang; Lau Kei, May; Chen, Kevin J.

    2007-11-01

    A microwave monolithic integrated circuit (MMIC) C-band low noise amplifier (LNA) using 1 μm-gate composite-channel Al0.3Ga0.7N/Al0.05Ga0.95N/GaN high electron mobility transistors (CC-HEMTs) has been designed, fabricated and characterized. The material structure and special channel of CC-HEMT were given and analysed. The MMIC LNA with CC-HEMT showed a noise figure of 2.4 dB, an associated gain of 12.3 dB, an input return loss of -6 dB and an output return loss of -16 dB at 6 GHz. The IIP3 of the LNA is 13 dBm at 6 GHz. The LNA with 1 μm × 100 μm device showed very high-dynamic range with decent gain and noise figure.

  4. Waste Minimization Program. Air Force Plant 6.

    DTIC Science & Technology

    1986-02-01

    coolant’s life, it can cause the formation of gummy residues on machines and parts and cause corrosion of the machine and work tools . i 3-91e 0 _ b-4 LA...2-9 3.0 Waste Minimization Program, AFP 6 3-1 3.1 Machine Coolant Waste 3-1 3.2 Engine Oil and Hydraulic Fluid Waste 3-12 3.3 Paint Sludge 3-14 3.4...Incineration 3-54 LIST OF FIGURES Figure Page 3-1 Annual Machine Coolant Use 3-5 n 3-2 oily Industrial Waste Treatment System 3-7 3-3 Schematic of Paint

  5. Adverse external ocular effects of topical ophthalmic therapy: an epidemiologic, laboratory, and clinical study.

    PubMed Central

    Wilson, F M

    1983-01-01

    New knowledge of adverse external ocular reactions to topical ophthalmic medications was obtained by means of a computerized epidemiologic study, laboratory studies, and clinical observations. Listed below are the major findings and conclusions that represent facts or concepts that were previously unknown, uncertain, misunderstood, or forgotten: The incidence of clinically important drug reactions among all cases was at least 13.09% and may have been as high as 16.02%. Among treated patients it was at least 16.26% to 19.90%. Taken together, drug reactions were the second most common external disease diagnosis. The incidence of each kind of drug reaction was determined. Toxic papillary reactions accounted for 79.10% of drug cases and 10.35% of all cases. Toxic papillary keratoconjunctivitis was the third most common single diagnosis. The following epidemiologic factors were found to be related to the development or presence of drug reactions: number and variety of treating practitioners, number of practitioners consulted, number of practitioners consulted who treated, specific ophthalmologist consulted (8.24% of ophthalmologists referred 39.55% of all drug cases and showed a tendency habitually to overtreat), number and kinds of patients' symptomatic complaints, number of medications prescribed and used, number of days of treatment, particular drugs and preservatives used (but not their strengths or vehicles), underlying (primary) diagnoses, and inaccuracy of referring ophthalmologists' diagnoses. Patients with dry eyes were especially at risk for the development of toxic papillary reactions. Among all cases, the incidence of reactions to preservatives (mainly thimerosal) in contact lens solutions was 0.39% to 1.95%, depending on whether definite or probable cases, respectively, were considered. The incidence among the 54 patients who used daily-wear lenses (excluding extended-wear therapeutic and optical contacts) was 7.41% for definite reactions and 37.04% for probable ones. Factors relating to the development of papillary contact-lens reactions were daily wear, number of days of wear, and, especially, the preservatives to which the patients were exposed. Reactions occurred more often with soft lenses than with hard ones. Of patients with drug reactions, 5.22% had two different ones simultaneously. Coexisting reactions to pharmacologically active agents were also present in 15% of patients who reacted to preservatives in contact lens solutions. The ocular tissues that were affected by each kind of drug reaction were tabulated, and the relative degrees and sequences of involvement were discussed. The frequencies with which particular drugs, physical ag Images FIGURE 2 A FIGURE 2 B FIGURE 15 A FIGURE 15 B FIGURE 1 FIGURE 3 FIGURE 4 A FIGURE 4 B FIGURE 5 A FIGURE 5 B FIGURE 5 C FIGURE 5 D FIGURE 6 A FIGURE 6 B FIGURE 6 C FIGURE 7 A FIGURE 7 B FIGURE 8 A FIGURE 8 B FIGURE 9 A FIGURE 9 B FIGURE 9 C FIGURE 9 D FIGURE 10 A FIGURE 10 B FIGURE 10 C FIGURE 10 D FIGURE 11 A FIGURE 11 B FIGURE 11 C FIGURE 11 D FIGURE 12 A FIGURE 12 B FIGURE 12 C FIGURE 12 D FIGURE 14 FIGURE 16 A FIGURE 16 B FIGURE 18 FIGURE 19 A FIGURE 19 B FIGURE 20 A FIGURE 20 B FIGURE 21 A FIGURE 21 B FIGURE 22 A FIGURE 22 B FIGURE 22 C FIGURE 23 A FIGURE 23 B FIGURE 23 C FIGURE 23 D PMID:6676985

  6. Coastal Remote Sensing Investigations. Volume 1. Marine Environment.

    DTIC Science & Technology

    1980-04-01

    and heavy growths of vegetation (mainly Thalassia ) in protected areas. The water is very clear, and extensive shallow areas exist with depths rangin...16.0 boundary of vegetated area A-2 3 5.0 Thalassia bed A-3 3 32.0 white carbonate sand B-I 5 16.5 hard, non-vegetated bottom B-2 4 30.0 white...carbonate sand B-3 3 12.5 boundary of vegetated area B-4 4 5.0 Thalassia bed C-I 3 35.0 white carbonate sand C-2 4 3.0 Thalassia bed 30 Figure

  7. CCITT Study Group XVIII Work Program 1981-1984; (Integrated Services Digital Network)

    DTIC Science & Technology

    1981-06-01

    ecitintwrste!D teaN he1B - 72 - COM VIII-No. 1-E The points lised below require particular attention in the studies, whereby acca -t should be taken of all...l I\\ I path> muldex f, fc c f3 fre’ue’o Z. -- frequency f F=ure 2 - ttput r a line .at.. a .a = ex Section (22) -79- COMl XVI-!O -E IA dB lie at...muldex fc f3 f, cf frequency -~frequency - Figure 3 -Jitter-transfer function of a line path and a muldex section Figure I4 shows the amplitude of

  8. Immunochemical Methods for Quantitation of Vitamin B6

    DTIC Science & Technology

    1981-09-30

    pANk K:E:: Z P a . LIST OF FIGURES Page Figure 1. Synthesis of N-Carboxymethylpyridoxine 15 Figure 2. Pyridoxine and N- Substituted Derivatives 16...Pyridoxine Substituted in the 3 Position 23 Figure 6. Synthesis of as -Pyridoxylformic Acid and as - 25 Pyridoxylacetic Acid Figure 7. Fluorogenic Galactosides...CH20 (Vill) (X Figure 2. Pyridoxine and N- Substituted Derivatives 16 hinder the formation of quaternary salts (Kirpal, 1910).’" We found this to be true

  9. High lead exposure and auditory sensory-neural function in Andean children.

    PubMed Central

    Counter, S A; Vahter, M; Laurell, G; Buchanan, L H; Ortega, F; Skerfving, S

    1997-01-01

    We investigated blood lead (B-Pb) and mercury (B-Hg) levels and auditory sensory-neural function in 62 Andean school children living in a Pb-contaminated area of Ecuador and 14 children in a neighboring gold mining area with no known Pb exposure. The median B-Pb level for 62 children in the Pb-exposed group was 52.6 micrograms/dl (range 9.9-110.0 micrograms/dl) compared with 6.4 micrograms/dl (range 3.9-12.0 micrograms/dl) for the children in the non-Pb exposed group; the differences were statistically significant (p < 0.001). Auditory thresholds for the Pb-exposed group were normal at the pure tone frequencies of 0.25-8 kHz over the entire range of B-Pb levels, Auditory brain stem response tests in seven children with high B-Pb levels showed normal absolute peak and interpeak latencies. The median B-Hg levels were 0.16 micrograms/dl (range 0.04-0.58 micrograms/dl) for children in the Pb-exposed group and 0.22 micrograms/dl (range 0.1-0.44 micrograms/dl) for children in the non-Pb exposed gold mining area, and showed no significant relationship to auditory function. Images Figure 1. Figure 3. A Figure 3. B PMID:9222138

  10. Bioassay of complex mixtures derived from fossil fuels.

    PubMed Central

    Bingham, E; Barkley, W

    1979-01-01

    The conversion or processing of shale, coal, or petroleum involves elevated temperatures and altered pressures, and under these conditions polynuclear aromatic hydrocarbons are likely to form. Certain compounds of this type exhibit carcinogenic activity for a variety of organ sites in experimental animals and epidemiological evidence strongly implicates their role as carcinogens in man. It is then not unexpected that many liquid fractions derived from shale and coal are carcinogenic when subjected to bioassay. Benzo(a)pyrene, [B(a)P], is frequently considered to be an indicator substance. It is clear that when a small quantity of B(a)P is present in a fraction, the fraction will exhibit carcinogenic activity in a bioassay (mouse skin). However, it does not follow that the lack of detectable B(a)P insures that the fraction will be noncarcinogenic. Several fractions have been analyzed for their content of B(a)P and then subjected to bioassay. A method for testing complex mixtures for their carcinogenic potential is described. The carcinogenic potency of these fractions are compared to petroleum fractions. Images FIGURE 1. FIGURE 2. FIGURE 3. FIGURE 4. FIGURE 5. FIGURE 6. FIGURE 7. FIGURE 8. FIGURE 9. PMID:446446

  11. Predicting Morphology of Polymers Using Mesotek+

    DTIC Science & Technology

    2010-02-01

    file is then produced for Mesotek+ to reproduce the phase behavior for an experimental system of poly (styrene-b- isoprene ) in the solvent tetradecane...theoretical code 3a and (b) experimental code 3b. .....6  Figure 3. Results from 40/60 volume styrene-b- isoprene + tetradecane using gnuplot: A...styrene volume fraction, B) isoprene volume fraction, and C) tetradecane volume fraction. The color bar to the right of each plot indicates how the

  12. High Bandwidth, Fine Resolution Deformable Mirror Design.

    DTIC Science & Technology

    1980-03-01

    Low Temperature Solders 68 B.6 Influence Function Parameters 68 APPENDIX C 19 Capacitance Measurement 69 ACCESSION for NTIS white Sectloo ODC Buff...Multilayer actuator: Dilatation versus applied electric field 10 Figure 3 - Multilayer actuator: Influence function 11 Figure 4 - Honeycomb device...bimorph 20 Figure 8 - Bimorph device: Influence function of a bimorph device which has a glass plate 0.20 cm thick 24 Figure 9 - Bimorph device

  13. Comparative Analysis of Bracket Slot Dimensions Evaluating Different Manufacturing Techniques

    DTIC Science & Technology

    2015-04-24

    Bracket 1 (Avex Suite, Opal ) .......................................... 39 Appendix B: Raw data—Bracket 2 (Victory Series, 3M...32 viii LIST OF FIGURES Figure 1: Bracket 1 (Avex Suite, Opal ) ................................................................ 10...15 Figure 7: Example of points selected using Bracket 1 (Avex Suite, Opal

  14. Assessing the Use of Game-Based Exercises in the Staff Attack-the-Network Course

    DTIC Science & Technology

    2015-06-01

    B-1 vi CONTENTS (continued) Page LIST OF FIGURES FIGURE 1. EDGE PLAYER AVATAR ...players to control an in-game avatar (see Figure 1), navigate terrain, and use vehicles, 3 equipment, and tools for a variety of social-cultural task... Avatar . Figure 2. EDGE Operational Environment. Method The basic methodology consisted of collecting pre-test and post-test knowledge

  15. [Pseudoaneurysm in the vicinity of the ascending aorta caused by contained disruption at the insertion site of a coronary artery bypass graft. A case report].

    PubMed

    Drögemüller, A; Zahn, R; Bergmeier, C; Werling, C; Isgro, F; Senges, J

    1998-08-01

    In this case report a 65-year-old patient came into the emergency ward with acute chest pain after coronary artery bypass graft operation in 1985. On routine chest X-ray in 1995 a mediastinal widening was diagnosed. The chest X-ray in 1997 (Figure 1) showed an increase of the diameter of the known mediastinal widening. Therefore a CT-scan was performed (Figures 2a and 2b). This showed an enhancement of contrast material in a contained structure, without identifying its origin. Therefore a coronary angiography was done. Here, we diagnosed a contained disruption of the aorta at the insertion site of the bypass graft at the right coronary artery. Figure 3a shows leakage of contrast material out of the aorta into the pseudoaneurysm and in Figure 3b this is demonstrated in a schematic drawing. Figure 4a shows supraselective imaging of the pseudoaneurysm, demonstrated in a schematic drawing in Figure 4b. As the chest pain could only be handled by i.v.-medication, betablocker and bed rest we decided to operate. Intra-operatively the diagnosis was confirmed (Figure 5a and 5b). Postoperatively the patient died due to cerebral ischemia. Despite the lethal outcome an operative revision appears even retrospectively justified because of the increasing size of the pseudoaneurysm in addition to new symptoms that were difficult to treat. On the other hand there are no data available in order to estimate the risk of a spontaneous course.

  16. Preparation and characterization of phosphine-tetraborane(8)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jock, C.P.; Kodama, G.

    1988-09-21

    The preparation of B/sub 4/H/sub 8/ x PH/sub 3/ by cleaving pentaborane, B/sub 5/H/sub 11/, with PH/sub 3/ is reported herein. The formation of a reaction intermediate, B/sub 5/H/sub 11/ x PH/sub 3/, which decomposes above -80/degrees/C in dichloromethane, is also reported. The /sup 11/B NMR spectrum of B/sub 4/H/sub 8/ x PH/sub 3/ indicates that the compound exists in two isomeric forms, endo and exo forms. 18 references, 3 figures, 1 table.

  17. Congential dislocation of the hip and adult low back pain: a report of three cases

    PubMed Central

    Kitchen, Robert G; Mierau, Dale; Cassidy, David; Dupuis, Pierre

    1988-01-01

    Congenital dislocation of the hip (CDH) in an adult can accompany or cause mechanical low-back pain. This in turn, can create confusion in making the proper diagnosis. The mechanical alterations caused by CDH create an added strain to the lumbosacral spine. Manipulative treatment for back pain in these patients must not subject the dislocated hips to undue torque. ImagesFigure 1Figure 2Figure 3Figure 4aFigure 4b

  18. 3D magnetotelluric inversion system with static shift correction and theoretical assessment in oil and gas exploration

    NASA Astrophysics Data System (ADS)

    Dong, H.; Kun, Z.; Zhang, L.

    2015-12-01

    This magnetotelluric (MT) system contains static shift correction and 3D inversion. The correction method is based on the data study on 3D forward modeling and field test. The static shift can be detected by the quantitative analysis of apparent parameters (apparent resistivity and impedance phase) of MT in high frequency range, and completed correction with inversion. The method is an automatic processing technology of computer with zero-cost, and avoids the additional field work and indoor processing with good results shown in Figure 1a-e. Figure 1a shows a normal model (I) without any local heterogeneity. Figure 1b shows a static-shifted model (II) with two local heterogeneous bodies (10 and 1000 ohm.m). Figure 1c is the inversion result (A) for the synthetic data generated from model I. Figure 1d is the inversion result (B) for the static-shifted data generated from model II. Figure 1e is the inversion result (C) for the static-shifted data from model II, but with static shift correction. The results show that the correction method is useful. The 3D inversion algorithm is improved base on the NLCG method of Newman & Alumbaugh (2000) and Rodi & Mackie (2001). For the algorithm, we added the frequency based parallel structure, improved the computational efficiency, reduced the memory of computer, added the topographic and marine factors, and added the constraints of geology and geophysics. So the 3D inversion could even work in PAD with high efficiency and accuracy. The application example of theoretical assessment in oil and gas exploration is shown in Figure 1f-i. The synthetic geophysical model consists of five layers (from top to downwards): shale, limestone, gas, oil, groundwater and limestone overlying a basement rock. Figure 1f-g show the 3D model and central profile. Figure 1h shows the centrel section of 3D inversion, the resultsd show a high degree of reduction in difference on the synthetic model. Figure 1i shows the seismic waveform reflects the interfaces of every layer overall, but the relative positions of the interface of the two-way travel time vary, and the interface between limestone and oil at the sides of the section is not reflected. So 3-D MT can make up for the deficiency of the seismic results such as the fake sync-phase axis and multiple waves.

  19. Male reproductive health and environmental xenoestrogens.

    PubMed Central

    Toppari, J; Larsen, J C; Christiansen, P; Giwercman, A; Grandjean, P; Guillette, L J; Jégou, B; Jensen, T K; Jouannet, P; Keiding, N; Leffers, H; McLachlan, J A; Meyer, O; Müller, J; Rajpert-De Meyts, E; Scheike, T; Sharpe, R; Sumpter, J; Skakkebaek, N E

    1996-01-01

    Male reproductive health has deteriorated in many countries during the last few decades. In the 1990s, declining semen quality has been reported from Belgium, Denmark, France, and Great Britain. The incidence of testicular cancer has increased during the same time incidences of hypospadias and cryptorchidism also appear to be increasing. Similar reproductive problems occur in many wildlife species. There are marked geographic differences in the prevalence of male reproductive disorders. While the reasons for these differences are currently unknown, both clinical and laboratory research suggest that the adverse changes may be inter-related and have a common origin in fetal life or childhood. Exposure of the male fetus to supranormal levels of estrogens, such as diethlylstilbestrol, can result in the above-mentioned reproductive defects. The growing number of reports demonstrating that common environmental contaminants and natural factors possess estrogenic activity presents the working hypothesis that the adverse trends in male reproductive health may be, at least in part, associated with exposure to estrogenic or other hormonally active (e.g., antiandrogenic) environmental chemicals during fetal and childhood development. An extensive research program is needed to understand the extent of the problem, its underlying etiology, and the development of a strategy for prevention and intervention. Images Figure 3. A Figure 3. B Figure 3. C Figure 3. D Figure 3. E Figure 3. F PMID:8880001

  20. PTM Modeling of Dredged Suspended Sediment at Proposed Polaris Point and Ship Repair Facility CVN Berthing Sites - Apra Harbor, Guam

    DTIC Science & Technology

    2017-09-01

    ADCP locations used for model calibration. ......................................................................... 12 Figure 4-3. Sample water...Example of fine sediment sample [Set d, Sample B30]. (B) Example of coarse sediment sample [Set d, sample B05...Turning Basin average sediment size distribution curve. ................................................... 21 Figure 5-5. Turning Basin average size

  1. Comparative Analysis of Multiple-Award Task Order Contracting and Its Impacts on Acquisition Reform

    DTIC Science & Technology

    2002-12-01

    24 Figure 2. DoD Improperly Directed Task Order Actions..... 49 Figure 3. Overview of the Domestic B2B Market, 1999-2003. 62 Figure 4...year 2000. The technology schedules amassed nearly $8.1 billion in sales with 60.8 percent of all activity. FSS charges agencies a one percent fee...second with $1 billion in sales . GSA manages five of the ten most lucrative contracts. The National Aeronautical Space Administration’s (NASA

  2. Inhibition on Breast Cancer Induced Bone Pain, Metastasis and Osteolysis in Nude Mice by LOVAZA and DHA Fattty Acids

    DTIC Science & Technology

    2011-10-01

    GCGGTTGTCCC/CATGGTAACAGCATTGCAGGTGC (30 cycles); mouse ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 ...follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1 FIGURE 8A 8 324bp, and GAPDH 233bp as seen in Figure 8A. Reference: Malin S, et al. (2007

  3. Factors Influencing the Microstructure and Mechanical Properties of Ultra Low Carbon Bainitic 100 Tungsten Inert Gas Multipass Weldments

    DTIC Science & Technology

    1992-09-01

    Optical macrograph of flat-etched sample 75B3-8 ........................ 30 Figure 4.15 Constitutional supercooling in alloy solidification ... alloying elements such as Mn, Mo, Ni and Cr are added to increase the strength and hardenability of the steel. However, substantial limitations on...0.9 Carbon Equivalent CE = C + Mn + Si + Ni + Cu + Cr + Mo + V 6 15 5 Figure 2.1 Graville Diagram (Blicharski et al, 1989, p.318) 3 B. ULTRA LOW

  4. Ultrastructure of the synovial membrane in seronegative inflammatory arthropathies.

    PubMed Central

    Morris, C J; Farr, M; Hollywell, C A; Hawkins, C F; Scott, D L; Walton, K W

    1983-01-01

    The ultrastructure of the synovial membrane has been studied in 6 patients with seronegative inflammatory arthropathies: Reiter's (2), Crohn's (2), Whipple's (1) and Behçet's disease (1). The most striking changes were found in the synovial B cells, many containing abnormally large mitochondria with altered cristae surrounded by fibrillar material. Similar material was present in dilated endoplasmic reticulum which was the probable source of groups of extracellular fibrillar spheroidal bodies. The B cells also contained electron dense granular lysosomes of very variable size which, in common with the abnormal mitochondria, were often associated with bundles of orientated microfilaments and large golgi complexes. Light microscopy of the synovial membrane was consistent with an inflammatory arthritis, as were the high white cell counts in the synovial fluid. Systemic activity in the patients was indicated by raised ESR and C-reactive protein (CRP). Images Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. A Figure 5. B PMID:6186810

  5. Limited proteolysis of rat liver nucleolin by endogenous proteases: effects of polyamines and histones.

    PubMed Central

    Suzuki, T; Suzuki, N; Hosoya, T

    1993-01-01

    Nucleolin is a major nucleolar phosphoprotein and is presumably involved in rDNA transcription and ribosome biosynthesis. This protein is known to be very labile and to be cleaved by endogenous proteases into many small peptides. We found that, when rat liver nucleolar suspension (Nu-1) or nucleolin-rich extract (Nu-2) was incubated under conventional conditions, polyamines and histones interacted with the nucleolin to lead to its preferential degradation to 60 kDa phosphopeptide (p60). The peptide p60 was identified as a peptide containing the N-terminal half of the nucleolin molecule, as judged from peptide-map analysis. Whereas spermine binding to the purified nucleolin was decreased by KCl concentrations above 50 mM, histones (H1, H2B and H3) were able to bind to the nucleolin in the presence of up to 300 mM KCl. A distinct difference between H1 and other histones was found in that H1 could produce p60 from nucleolin in both Nu-1 and Nu-2, whereas H2B and H3 stimulated the degradation of nucleolin to p60 only when Nu-2 was used for the source of nucleolin. A possible relationship between p60 formation and rRNA synthesis is discussed, but its exact role remains to be studied. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8424749

  6. The Theory of Special Operations

    DTIC Science & Technology

    1993-06-17

    Brigade. An avid boxer and rugby player, he earned the troops r-espect through hard work, discipline and a desir.! to make them the best commandos in the...34, 22nd September, 1943, B1 . 312 0 Figure 6-1. X-Craft ?zwpadng to Dock. (Couttusy Imperial Wair Museum) Figure6-2 Captain at Peuuowpe. 313 Figure 6-3

  7. Structure-activity relationships for xenobiotic transport substrates and inhibitory ligands of P-glycoprotein.

    PubMed Central

    Bain, L J; McLachlan, J B; LeBlanc, G A

    1997-01-01

    The multixenobiotic resistance phenotype is characterized by the reduced accumulation of xenobiotics by cells or organisms due to increased efflux of the compounds by P-glycoprotein (P-gp) or related transporters. An extensive xenobiotic database, consisting primarily of pesticides, was utilized in this study to identify molecular characteristics that render a xenobiotic susceptible to transport by or inhibition of P-gp. Transport substrates were differentiated by several molecular size/shape parameters, lipophilicity, and hydrogen bonding potential. Electrostatic features differentiated inhibitory ligands from compounds not catagorized as transport substrates and that did no interact with P-gp. A two-tiered system was developed using the derived structure-activity relationships to identify P-gp transport substrates and inhibitory ligands. Prediction accuracy of the approach was 82%. We then validated the system using six additional pesticides of which tow were predicted to be P-gp inhibitors and four were predicted to be noninteractors, based upon the structure-activity analyses. Experimental determinations using cells transfected with the human MDR1 gene demonstrated that five of the six pesticides were properly catagorized by the structure-activity analyses (83% accuracy). Finally, structure-activity analyses revealed that among P-gp inhibitors, relative inhibitory potency can be predicted based upon the surface area or volume of the compound. These results demonstrate that P-gp transport substrates and inhibitory ligands can be distinguished using molecular characteristics. Molecular characteristics of transport substrates suggest that P-gp may function in the elimination of hydroxylated metabolites of xenobiotics. Images Figure 1. A Figure 1. B Figure 1. C Figure 1. D Figure 1. E Figure 1. F Figure 1. G Figure 1. H Figure 2. Figure 2. Figure 2. Figure 2. Figure 2. Figure 2. Figure 3. A Figure 3. B PMID:9347896

  8. A 20 GHz low noise, low cost receiver for digital satellite communication system, ground terminal applications

    NASA Technical Reports Server (NTRS)

    Allen, Glen

    1988-01-01

    A 45 month effort for the development of a 20 GHz, low-noise, low-cost receiver for digital, satellite communication system, ground terminal applications is discussed. Six proof-of-concept receivers were built in two lots of three each. Performance was generally consistent between the two lots. Except for overall noise figure, parameters were within or very close to specification. While noise figure was specified as 3.5 dB, typical performance was measured at 3.0 to 5.5 dB, over the full temperature range of minus 30 C to plus 75 C.

  9. Integrated Information Support System (IISS). Volume 4. IISS System. Part 1. System Requirements Document

    DTIC Science & Technology

    1990-09-30

    audit trail for unauthorized entries. B.6.3.3 Manage CDM Resources B.6.3.3.1 Measure CDM Performance 1. Keep running log of CDM accesses by user types...SYSTEM SPPCIFIA OMA8MSTRTO Figure B-12. System Administrator Role B-3 1 SRD620340000 30 September 1990 4. Audit IISS hardware performance (LAN...SRD620340000 30 September 1990 7. Assist IISS service specifier and application specifier in implementing standards recommendation. 8. Perform audit of IISS

  10. U.S. Navy Wire-Rope Handbook. Volume 1. Design and Engineering of Wire-Rope Systems

    DTIC Science & Technology

    1976-01-01

    by " braiding " or "weaving" one rope end into another. Splices may be made at the end of a single rope after forming a loop (an eye splice) or between...rags, large pieces of old hemp rope and fire hose are other popular types of chafing gear for semi-fixed position ropes (see Figure 7-3(b)). 7.4. LINKS...Figure 7-3. Chafing Gear 7-6 Links 7.4. SWOOD PLANK FIRE HOSE ., ’ _APPLY GREASE CANJVAS, LEATHER, COPPER (b) For Semi-Fixed Position Ropes lo- Figcre

  11. Synthesis of New Inorganic and Organometallic Materials.

    DTIC Science & Technology

    1981-04-23

    15. 16. & 17 . Distribution Statement Approved for public release; distribution unlimited. 18. Supplementary, Note’s’ 19. Key Words .. t rganometallic...CarbametallIaboranes 12 2. Activation of Acetylenes and Olefins by Metal Complexes 16 (a) Nickel 16 (b) Molybdenum 17 (c) Platinum 24 3. Fluorocarbon...Figure 9).3 - CO / Pt -. . . Pt 4Ph ’ / C-Fe C C C0 0 oc-( I C- Co FIGURE 9. Possible mode for conversion C’,p - h 3 of the anion into the metal

  12. The influence of sex and empathy on putting oneself in the shoes of others.

    PubMed

    Mohr, Christine; Rowe, Angela C; Blanke, Olaf

    2010-05-01

    We tested whether putting oneself in the shoes of others is easier for women, possibly as a function of individuals' empathy levels, and whether any sex difference might be modulated by the sex of presented figures. Participants (N=100, 50 women) imagined (a) being in the spatial position of front-facing and back-facing female and male figures (third person perspective (3PP) task) and (b) that the figures were their own mirror reflections (first person perspective (1PP) task). After mentally taking the figure's position, individuals decided whether the indicated hand of the figure would be their own left or right hand. Contrary to our hypothesis, results from the 3PP-task showed higher rotational costs for women than men, suggesting that mental rotation rather than social strategies had been employed. However, faster responding by women with higher empathy scores would appear to indicate that some women engaged social perspective taking strategies irrespective of the figures' position. Figures' sex was relevant to task performance as higher rotational costs were observed for male figures in the 3PP-task for both sexes and for female figures in the 1PP-task for women. We argue that these latter findings indicate that performance was facilitated and/or inhibited towards figures associated with specific social and emotional implications.

  13. Patterns of B-lymphocyte gene expression elicited by lipopolysaccharide mitogen.

    PubMed Central

    Janossy, G; Snajdr, J; Simak-Ellis, M

    1976-01-01

    When large proportions of B lymphocytes from the murine spleen are stimulated in vitro by bacterial lipopolysaccharide (LPS) B lymphoblasts with small amounts of intracellular immunoglobulin (Ig) and plasmablasts with large amounts of intracellular Ig concomitantly proliferate. It is likely that B lymphocytes are heterogeneous and LPS activates B cells to express their predetermined functional capacity since bromodeoxyuridine does not inhibit the initiation of Ig synthesis in plasmablasts, and Ig synthesis starts before these cells complete their first mitosis. The results suggest that LPS is a potent polyclonal activator (of a B-cell subset) but it is not a differentiation factor in the sense that it is unable to determine whether its target cell develops extensive endoplasmic reticulum or follows a different pathway. The results do not exclude that modulation of B cells' genetic programming might take place during T cell-dependent B-lymphocyte activation. The observed B-cell heterogeneity offers a possible explanation for the concomitant emergence of B memory cells and antibody producers during the early phase of immune responses in vivo. Images Figure 3 Figure 5 Figure 7 Figure 8 PMID:1088414

  14. Alloying-Element Loss during High-Temperature Processing of a Nickel-Base Superalloy (Preprint)

    DTIC Science & Technology

    2013-01-01

    precipitates, and the fine white/gray particles are carbides and borides . ............................................. 23 Figure 2. Aluminum...comparable size, and submicron carbides and borides . A fifteen-minute heat treatment at the subsolvus temperature used in the present work (i.e...precipitates, and ~0.3 volume pct. of carbides and borides with an average diameter of ~0.3 m (Figure 1) [5, 6]. B. Procedures To establish the

  15. Laser Diagnostics for Reacting Flows

    DTIC Science & Technology

    2010-01-11

    noise characteristics of the diagnostic will be in the shot - noise limit , a fundamental limit of the LIF signal intensity... noise related to the discrete nature of photons. In the shot - noise limit , the fluctuation detection limit can be predicted using nVP B S f f  1...detection limit was shot - noise limited . Figure 2.2.3 illustrates the fluctuation detection limits for line LIF imaging. Figure 2.2.3a

  16. Microfabricated 3D Scaffolds for Tissue Engineering Applications

    DTIC Science & Technology

    2005-01-01

    coated layers as sacrificial material for subsequent SU-8 layers (Figure 5b). (a) (b) Figure 5. Four-level SU-8 structure realized with a single...connective tissue progenitor cells on micro-textured polydimethylsiloxane surfaces. Journal of Biomedical Materials Research 2002; 62:499-506. 7. Ratner BD...Applications DISTRIBUTION: Approved for public release, distribution unlimited This paper is part of the following report: TITLE: Materials Research Society

  17. Mastocytosis presenting as a skeletal disorder.

    PubMed Central

    Delsignore, J. L.; Dvoretsky, P. M.; Hicks, D. G.; O'Keefe, R. J.; Rosier, R. N.

    1996-01-01

    Mastocytosis is a rare disease of mast-cell proliferation with involvement of the reticuloendothelial systems including skin, bone, gastrointestinal tract, liver, lungs, spleen, and lymph nodes. Systemic mastocytosis is characterized by a combination of symptoms that relate to the mast cells' release of vasoactive substances, such as histamine. These symptoms include urticaria pigmentosa, flushing, syncope with hypotension, headaches, nausea, vomiting, diarrhea, and occasional bronchospasm. The diagnosis of mastocytosis is typically based on the presence of the characteristic extraosseus manifestations. A well recognized roentgenographic feature seen in 70-75% of patients with mastocytosis is diffuse osteolysis and osteosclerosis, affecting primarily the axial skeleton and the ends of the long bones. Rarely, the bony involvement consists of generalized osteoporosis, which may lead to pathologic fracture, or solitary lesions (mastocytomas) which may cause symptoms of localized pain. Four patients with previously diagnosed systemic mastocytosis had unusual skeletal lesions. Clinical and laboratory evaluation of these patients eventually led to the correct diagnosis of systemic mastocytosis. We report these four cases to emphasize the need for thorough evaluation of unusual musculoskeletal findings in association with extraosseus symptoms that are characteristic of mastocytosis. Knowledge of a wide differential diagnosis of unusual skeletal lesions should include systemic mastosytosis. Images Figure 1 Figure 2 Figure 3A Figure 3B Figure 4 Figure 5A Figure 5B-5C Figure 6 PMID:9129284

  18. Single-Use Sensor Strips for Reliable Field Analysis of Gunshot Residue

    DTIC Science & Technology

    2013-10-13

    3    List of Figures Fig. 1. Cyclic square-wave voltammogram at the bare GCE for a mixture of trace metals and explosives constituents of GSR: 3...variables obtained after CVA analysis of the GSR samples according to (B) exposure level or (C) 3-class response mode. Samples in (B) correspond to...to (A) exposure level or (B) 3-class response mode. Samples correspond to the same controls outlined in Fig. 6. Fig. 8. Score plot of the

  19. Modular Bioconjugates to Study Herceptin Resistance: A Structural and Functional Approach

    DTIC Science & Technology

    2015-10-01

    MS2 capsid (Figure 3a on page 1593 of Appendix A). Furthermore, a Kd was determined for our construct that indicated that these constructs maintain...their binding affinity upon attachment to the capsid (Figure 3b,c on page 1593 of Appendix A). Furthermore, live-cell confocal microscopy clearly...1590−1596 1593 parameters to be measured simultaneously.45 This number represents a dramatic increase over traditional fluorescence- based flow

  20. Metastic Progression of Breast Cancer by Allelic Loss on Chromosome 18q21

    DTIC Science & Technology

    2006-03-01

    Smad5 Smad2 Smad3 Smad8 Smad6 Samd7 MH1 Linker MH2 S1 S2 S3 Smad4 Smad1, Smad5 Samd2, Smad3 ,Smad8 Smad6,Smad7 ?? ?? A. B. Figure 1...homologous amino acid sequences at their N- and C- terminal regions (MH1 and MH2 respectively), which are separated by a highly divergent linker region...cancers (Figure 2). NB 2 3 4 5 6 7 8 9 10 11 12 13 14 Smad8α Smad8β Smad8γ Smad3α Smad3 β NB 1 2 3 4 5

  1. Abnormalities in Human Brain Creatine Metabolism in Gulf War Illness Probed with MRS

    DTIC Science & Technology

    2013-10-01

    spectra under these conditions (see Figure 1 below). 4_1, TR = 2 s, NSA = 320, duration = 10:48, rms B1 = 2.35 μT 7 5_1, TR = 3s, NSA ...216, duration = 10:57, rms B1 = 1.92 μT 6_1, TR = 2 s, NSA = 320, duration = 10:48, rms B1 = 2.35 μT Figure 1. 08/09/13 3T6594 31P ISIS MRS...coil (after repair). TR = 4 s and NSA = 144, duration = 9:44, TE = min (0.10 ms), 2 disdacqs, SW = 3000 Hz, 2048 data points zero-filled to 4096

  2. Registered Report: COT drives resistance to RAF inhibition through MAP kinase pathway reactivation.

    PubMed

    Sharma, Vidhu; Young, Lisa; Cavadas, Miguel; Owen, Kate

    2016-03-21

    The Reproducibility Project: Cancer Biology seeks to address growing concerns about reproducibility in scientific research by conducting replications of selected experiments from a number of high-profile papers in the field of cancer biology. The papers, which were published between 2010 and 2012, were selected on the basis of citations and Altmetric scores (Errington et al., 2014). This Registered Report describes the proposed replication plan of key experiments from "COT drives resistance to RAF inhibition through MAPK pathway reactivation" by Johannessen and colleagues, published in Nature in 2010 (Johannessen et al., 2010). The key experiments to be replicated are those reported in Figures 3B, 3D-E, 3I, and 4E-F. In Figures 3B, D-E, RPMI-7951 and OUMS023 cells were reported to exhibit robust ERK/MEK activity concomitant with reduced growth sensitivity in the presence of the BRAF inhibitor PLX4720. MAP3K8 (COT/TPL2) directly regulated MEK/ERK phosphorylation, as the treatment of RPMI-7951 cells with a MAP3K8 kinase inhibitor resulted in a dose-dependent suppression of MEK/ERK activity (Figure 3I). In contrast, MAP3K8-deficient A375 cells remained sensitive to BRAF inhibition, exhibiting reduced growth and MEK/ERK activity during inhibitor treatment. To determine if RAF and MEK inhibitors together can overcome single-agent resistance, MAP3K8-expressing A375 cells treated with PLX4720 along with MEK inhibitors significantly inhibited both cell viability and ERK activation compared to treatment with PLX4720 alone, as reported in Figures 4E-F. The Reproducibility Project: Cancer Biology is collaboration between the Center for Open Science and Science Exchange and the results of the replications will be published in eLife.

  3. Fluorescence, polarized fluorescence, and Brewster angle microscopy of palmitic acid and lung surfactant protein B monolayers.

    PubMed Central

    Lipp, M M; Lee, K Y; Waring, A; Zasadzinski, J A

    1997-01-01

    Fluorescence, polarized fluorescence, and Brewster angle microscopy reveal that human lung surfactant protein SP-B and its amino terminus (SP-B[1-25]) alter the phase behavior of palmitic acid monolayers by inhibiting the formation of condensed phases and creating a new fluid protein-rich phase. This fluid phase forms a network that separates condensed phase domains at coexistence and persists to high surface pressures. The network changes the monolayer collapse mechanism from heterogeneous nucleation/growth and fracturing processes to a more homogeneous process through isolating individual condensed phase domains. This results in higher surface pressures at collapse, and monolayers easier to respread on expansion, factors essential to the in vivo function of lung surfactant. The network is stabilized by a low-line tension between the coexisting phases, as confirmed by the observation of extended linear domains, or "stripe" phases, and a Gouy-Chapman analysis of protein-containing monolayers. Comparison of isotherm data and observed morphologies of monolayers containing SP-B(1-25) with those containing the full SP-B sequence show that the shortened peptide retains most of the native activity of the full-length protein, which may lead to cheaper and more effective synthetic replacement formulations. Images FIGURE 1 FIGURE 3 FIGURE 4 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 PMID:9168053

  4. Integrated defense system overlaps as a disease model: with examples for multiple chemical sensitivity.

    PubMed Central

    Rowat, S C

    1998-01-01

    The central nervous, immune, and endocrine systems communicate through multiple common messengers. Over evolutionary time, what may be termed integrated defense system(s) (IDS) have developed to coordinate these communications for specific contexts; these include the stress response, acute-phase response, nonspecific immune response, immune response to antigen, kindling, tolerance, time-dependent sensitization, neurogenic switching, and traumatic dissociation (TD). These IDSs are described and their overlap is examined. Three models of disease production are generated: damage, in which IDSs function incorrectly; inadequate/inappropriate, in which IDS response is outstripped by a changing context; and evolving/learning, in which the IDS learned response to a context is deemed pathologic. Mechanisms of multiple chemical sensitivity (MCS) are developed from several IDS disease models. Model 1A is pesticide damage to the central nervous system, overlapping with body chemical burdens, TD, and chronic zinc deficiency; model 1B is benzene disruption of interleukin-1, overlapping with childhood developmental windows and hapten-antigenic spreading; and model 1C is autoimmunity to immunoglobulin-G (IgG), overlapping with spreading to other IgG-inducers, sudden spreading of inciters, and food-contaminating chemicals. Model 2A is chemical and stress overload, including comparison with the susceptibility/sensitization/triggering/spreading model; model 2B is genetic mercury allergy, overlapping with: heavy metals/zinc displacement and childhood/gestational mercury exposures; and model 3 is MCS as evolution and learning. Remarks are offered on current MCS research. Problems with clinical measurement are suggested on the basis of IDS models. Large-sample patient self-report epidemiology is described as an alternative or addition to clinical biomarker and animal testing. Images Figure 1 Figure 2 Figure 3 Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9539008

  5. ISITE: Automatic Circuit Synthesis for Double-Metal CMOS VLSI (Very Large Scale Integrated) Circuits

    DTIC Science & Technology

    1989-12-01

    rows and columns should be minimized. There are two methodologies for achieving this objective, namely, logic minimization to I I I 15 I A B C D E T...type and N-type polysilicon (Figure 2.5( b )) and interconnecting the gates with metal at a later I processing step. The two layers of aluminum available...polysiliconI ...... .. ... .. .. . .. ... .. ... .. I N polysilicon Iii~~iiiiiiii~~iiiiii (a) ( b ) 3 Figure 2.5. Controlling the Threshold Voltage in

  6. Numerical Modeling of Two-Terminal Quantum Well Devices

    DTIC Science & Technology

    1989-04-17

    transfer matrix methods . This was implemented for a perfectly symmetric resonant tunneling structure such as the one shown in figure 3. This technique has...occur for mean well widths near 0.08v or 0.09v. This situation requires further analysis . The situation for the well width of 70A, yielded low Q...WSe.4W AA L1ot. OVefol striwe Tunmelen "ers (a) (b) Figure 1: Pseudomorphic InO. 5 3 Ga 0 .4 7 As/AlA3/ InAa resonant tunneling diodes proposed in

  7. Initiation Phenomena in Pulsed Chemical Lasers

    DTIC Science & Technology

    1978-10-01

    2-3 4 Normalized Cavity llumination Contours.............. 2-5 5 Case B ....... * . . .. ... . ...... . . . .. .. . ... . 2-6 6 Nonuniformity in...improvement in illumination uniformity were obtained. Figure 6 shows the decrease in initiation nonuniformity with increasing numbers of lamps in the...Flow10 Entry and Exit < 6 4 2 10 14 18 22 26 30 34 Number of Lamps 1.0 1.4 1.8 2.2 2.6 3.0 3.4 Cavity Width/Cavity Height Figure 6. Nonuniformity in

  8. Disparate Vitamin D Activity in the Prostate of Men with African Ancestry

    DTIC Science & Technology

    2017-12-01

    Consequently, ~65% of AA men are vitamin D3 deficient compared to ~20% of EA men. The level of skin pigmentation is correlated with the extent of...of EA men. The level of skin pigmentation is correlated with the extent of African ancestry and serum vitamin D3 status. Besides vitamin D3 status...and not significantly different (Appendix A, Figure 2A). The 25D and 1,25D only correlated in the EA men, not the AA men (Appendix A, Figure 2B

  9. Data for Figures in Rainfall-induced release of microbes from manure: model development, parameter estimation, and uncertainty evaluation on small plots

    EPA Pesticide Factsheets

    ? Figure 1. Ratio of cumulative released cells to cells initially present in the manure at Week 0 as they vary by time, manure type and age, microbe, and Event (i.e., season). The 95% confidence intervals of the observed median number of cells in microbial runoff are shown as the shaded area.? Figure 2. Typical observed and simulated cumulative microbial runoff for Plots A403 and C209 with individual plot calibration.? Figure 3. Observed versus simulated microbial runoff associated with the Approach 1, adjusted for cumulative results by manure type and Event. Results accounted for counts associated with field monitoring time intervals described in Section 2.1 Field method. NS=Nash-Sutcliffe modeling efficiency, EC=E. coli, En=enterococci, FC= fecal coliforms.? Figure 4. Ratio of cumulative released cells/mass to cells/mass initially present in the aged manure by time and component (e.g., microbe) for solid manure (a) and (b), and amended, dry litter, and slurry manure (c). Solid lines (Equation (11) correspond to values in Table 3 for solid manure, and dry litter and slurry manure, respectively: (a) uses individual b values, and (b) and (c) use the combined values for b. Bounds of first and third quartiles associated with the present study??s results for cattle. Bounds of first and third quartiles associated with the present study??s results for poultry and swine. The full color versions of all figures are available in the online version of this paper, at ht

  10. Noise-figure limit of fiber-optical parametric amplifiers and wavelength converters: experimental investigation

    NASA Astrophysics Data System (ADS)

    Tang, Renyong; Voss, Paul L.; Lasri, Jacob; Devgan, Preetpaul; Kumar, Prem

    2004-10-01

    Recent theoretical work predicts that the quantum-limited noise figure of a chi(3)-based fiber-optical parametric amplifier operating as a phase-insensitive in-line amplifier or as a wavelength converter exceeds the standard 3-dB limit at high gain. The degradation of the noise figure is caused by the excess noise added by the unavoidable Raman gain and loss occurring at the signal and the converted wavelengths. We present detailed experimental evidence in support of this theory through measurements of the gain and noise-figure spectra for phase-insensitive parametric amplification and wavelength conversion in a continuous-wave amplifier made from 4.4 km of dispersion-shifted fiber. The theory is also extended to include the effect of distributed linear loss on the noise figure of such a long-length parametric amplifier and wavelength converter.

  11. Eduard Jaeger's Test-Types (Schrift-Scalen) and the historical development of vision tests.

    PubMed Central

    Runge, P E

    2000-01-01

    PURPOSE: Eduard Jaeger's original Test-Types were carefully evaluated: (1) to determine whether Jaeger had maintained a consistent standard, (2) to establish the correct Snellen equivalent for Jaeger's Test-Types, (3) to answer the question of why and how the standard was lost, and (4) to compare the visual angle of optotypes to lines of continuous text. METHODS: All original Viennese editions of Jaeger's Test-Types, as well as first generation United Kingdom (UK) and United States (US) versions, were evaluated. Data were collected objectively using a microruler with a 20X loupe and subjectively using a laser distance-measuring device. The data were analyzed using Microsoft Excel. All previous measurements of Jaeger's Test-Types, objective and subjective, collected over the past 133 years were compared to the current data and to each other. RESULTS: The correct Snellen equivalent of Jaeger's Test-Types was determined. The visual angle created from the measurement of the height of lowercase letters, without ascenders or descenders, provides an accurate method of assigning a visual angle of a line of continuous text. Comparing the typefaces used in printing first generation UK and US versions of Jaeger's Test-Types to the Viennese editions provided an explanation for the absence of a consistent standard for Jaeger's Test-Types today. CONCLUSIONS: All 10 versions of Jaeger's original Test-Types are virtually identical and established a gold standard for reading vision tests. Jaeger's standard was lost when his Test-Types were first printed in the UK and the US using local typefaces. The Jaeger standard has been re-established. Visual angles determined using continuous text are comparable to those obtained by using optotypes. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7C FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19A FIGURE 19B p409-a FIGURE 20 FIGURE 21 FIGURE 22 FIGURE 23 FIGURE 24 FIGURE 25 FIGURE 26 FIGURE 27 FIGURE 28A FIGURE 28B FIGURE 28C FIGURE 29 FIGURE 30 FIGURE 31 FIGURE 32 FIGURE 33 FIGURE 34 FIGURE 35 FIGURE 36A FIGURE 37 FIGURE 38 FIGURE 39 PMID:11190034

  12. Improvement in psoriasis with rosiglitazone in a diabetic and a nondiabetic patient.

    PubMed

    Pershadsingh, Harrihar A; Benson, Steven C; Ellis, Charles N

    2005-01-01

    The authors conducted a prospective, open-label, pilot trial of the effects of the antidiabetic thiazolidinedione (TZD) rosiglitazone in two patients with moderate to severe plaque psoriasis. Case 1: A lean, euglycemic 43-year-old nondiabetic man with a 2-year history of plaque psoriasis presented with lesions involving 10% of his body surface (Figures 1A, 1B, 1C). He had no other chronic or acute medical problems. He had previously been managed sporadically with topical triamcinolone acetonide, an intermediate-strength glucocorticoid, and was off antipsoriatic medication for 5 months. He was started on rosiglitazone p.o., 8 mg q.d. After 10 weeks on rosiglitazone, the lesions developed increased erythema, spreading, and shedding of scale (Figures 2A, 2B, 2C). After an additional 26 weeks, the lesions had largely disappeared (Figures 3A, 3B, 3C). The patient remained euglycemic throughout the study. His liver function enzymes (alanine transferase [ALT] and aspartate transferase [AST]) remained normal throughout the study: ALT, 23 IU/L; AST, 47 IU/L before treatment; ALT, 25 IU/L; AST, 33 IU/L after treatment. There were no adverse events. Case 2: An overweight 68-year-old woman (body mass index, 29 kg/m2; with a 12-year history of type 2 diabetes and 5-year history of psoriasis presented with generalized plaque psoriasis over 20% of her body, including two large, thick, silvery plaques with the texture of leather over the lower part of the back (Figure 4A). She was given rosiglitazone p.o., 4 mg b.i.d. for 24 weeks, which resulted in significant improvement in psoriasis (Figure 4B). After an additional 26 weeks on rosiglitazone, the plaques had cleared on her back (Figure 4C) and over her entire body, including scalp, ears, and posterior forearms (not shown). Her glycemic control improved (hemoglobin A1c decreased from 7.7% to 7.2%) and liver function remained normal throughout the study (ALT, 24 IU/L; AST, 14 IU/L before treatment; and ALT, 26 IU/L; AST, 15 IU/L after treatment). There were no adverse events.

  13. The significance of mouse liver tumor formation for carcinogenic risk assessment: results and conclusions from a survey of ten years of testing by the agrochemical industry.

    PubMed Central

    Carmichael, N G; Enzmann, H; Pate, I; Waechter, F

    1997-01-01

    A survey was performed on the results of 138 carcinogenicity studies conducted in various mouse strains by the agrochemical industry over the period 1983-1993. Data for liver tumor incidence, liver weight, and histopathology were collected along with data on genotoxicity. Studies were judged positive or negative for liver tumor formation on the basis of apparent dose response, malignancy, and difference from historical control values using a weight of evidence approach. Thirty-seven studies were judged to be positive for liver tumorigenicity in one or both sexes. There was no evidence showing an influence of the mouse strain and the duration of the study on the proportion of positive studies. Although 8 of the chemicals tested in the 138 studies were positive in the Ames test, only one of these was judged positive for carcinogenicity. Only 6 of the 37 positive chemicals had any other reported positive genotoxicity findings. A clear relationship between hepatomegaly at 1 year after exposure and a positive tumorigenic outcome at 18 months or 2 years after exposure was demonstrated. Whereas the average relative liver weight of top dose animals was 110% of control in negative studies, it was 150% in positive studies. Likewise, very few negative studies demonstrated significant pathological findings after 1 year, whereas the majority of positive studies had significant liver pathology. The implications of these findings for extrapolation to humans are discussed. Images p1196-a Figure 1. A Figure 1. B Figure 1. C Figure 1. D Figure 2. A Figure 2. B Figure 2. C Figure 2. D Figure 3. Figure 3. Figure 4. Figure 4. PMID:9370513

  14. Advanced Coats' disease.

    PubMed Central

    Haik, B G

    1991-01-01

    Advanced Coats' disease and retinoblastoma can both present with the triad of a retinal detachment, the appearance of a subretinal mass, and dilated retinal vessels. Thus, even the most experienced observer may not be able to differentiate these entities on ophthalmoscopic findings alone. Coats' disease is the most common reason for which eyes are enucleated with the misdiagnosis of retinoblastoma. Ultrasonography is the auxiliary diagnostic test most easily incorporated into the clinical examination, and can be utilized repeatedly without biologic tissue hazard. Ultrasonically identifiable features allowing differentiation between Coats' disease and retinoblastoma include the topography and character of retinal detachment and presence or absence of subretinal calcifications. Ultrasonography is of lesser use in poorly calcified retinoblastoma and in detecting optic nerve or extraocular extension in heavily calcified retinoblastoma. CT is perhaps the single most valuable test because of its ability to: (a) delineate intraocular morphology, (b) quantify subretinal densities, (c) identify vascularities within the subretinal space through the use of contrast enhancement, and (d) detected associated orbital or intracranial abnormalities. Optimal computed tomographic studies, however, require multiple thin slices both before and after contrast introduction and expose the child to low levels of radiation if studies are repeated periodically. MR imaging is valuable for its multiplanar imaging capabilities, its superior contrast resolution, and its ability to provide insights into the biochemical structure and composition of tissues. It is limited in its ability to detect calcium, which is the mainstay of ultrasonic and CT differentiation. Aqueous LDH and isoenzyme levels were not valuable in distinguishing between Coats' disease and retinoblastoma. The value of aqueous NSE levels in the differentiation of advanced Coats' disease and exophytic retinoblastoma deserves further study. Specimens from patients with intraocular hemorrhage should be viewed cautiously, since erythrocytes contain high levels of enolase. Analysis of subretinal aspirates is an extremely accurate method of confirming the diagnosis of Coats' disease. The key diagnostic findings are the presence of cholesterol crystals and pigment-laden macrophages and the absence of tumor cells on fresh preparations. The technique should be reserved for patients where retinoblastoma has been ruled out by all noninvasive means and massive subretinal drainage is anticipated. The natural progression in advanced Coats' disease is toward the development of a blind, painful eye. Spontaneous regression does rarely occur, and some eyes quietly progress to a phthisical state.(ABSTRACT TRUNCATED AT 400 WORDS) Images FIGURE 2 FIGURE 3 FIGURE 4 A FIGURE 4 B FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20 FIGURE 21 FIGURE 22 FIGURE 23 FIGURE 24 FIGURE 25 FIGURE 26 FIGURE 27 FIGURE 28 FIGURE 29 FIGURE 30 FIGURE 31 FIGURE 32 FIGURE 33 FIGURE 34 A FIGURE 34 B FIGURE 35 FIGURE 36 FIGURE 38 FIGURE 39 FIGURE 41 FIGURE 42 FIGURE 43 FIGURE 44 FIGURE 45 FIGURE 46 A FIGURE 46 B FIGURE 47 A FIGURE 47 B FIGURE 48 A FIGURE 48 B FIGURE 49 FIGURE 50 FIGURE 51 FIGURE 52 FIGURE 54 FIGURE 54 (cont.) FIGURE 55 FIGURE 57 FIGURE 58 FIGURE 59 FIGURE 60 FIGURE 61 FIGURE 62 FIGURE 63 FIGURE 64 FIGURE 65 FIGURE 66 A FIGURE 66 B FIGURE 67 A FIGURE 67 B PMID:1808814

  15. Immunoreactive Changes in the Hypoglossal Nucleus after Nerve Injury

    DTIC Science & Technology

    1991-07-25

    m ^ •••.•(.•>a> j T ’ — ’ . - v - ; - . • . • " _ • , . - • ’ ^ v , > ’ --•̂ T f£is:j-i&. .i.’a^i:-:5 Figure 7 30...nerve injury. A. nerve crush B. nerve transection C. nerve resection 38 ’.. i" : ^ M ^’^’- B •Jysf:^.-^^ ^ . - . ><^^ ^^-:3??jFj\\T^ Figure 10...R) 330X. 40 0^ m •s ’^ " ^ ’ Figure 11 41 both sides of the nucleus. At 20 dpo, the CGRP-IR increase in neuronal cell bodies and

  16. Elucidation of the Molecular Mechanisms Underlying Lymph Node Metastasis in Prostate Cancer

    DTIC Science & Technology

    2005-10-01

    overexpressed (Figure 8B). This result is significant for two reasons. First, it provides a mechanistic explanation for how FOXO-1, activated by SIRT1 ...transcription (Figure 4c). This result was confirmed when we used the dominant-negative form of SIRT1 to inhibit its activity (Figure 4d). SIRT-1DN protein... activated by SIRT1 , can act to Figure 3 (a) Androgen increases the IGF-IR protein level in LNCaP. LNCaP cells were grown in the charcoal–dextran

  17. Covert Half Duplex Data Link Using Radar-Embedded Communications With Various Modulation Schemes

    DTIC Science & Technology

    2017-12-01

    27 Figure 4.1 Comparison of Theoretical, Radar-Pulse-Only Matched Filter , and the Radar...CommunicationsMatched Filtered PD Curves versus SNR for RCR = 0 dB. . . . . . . . . . . . . . . . . . . . . . . . . . . 30 Figure 4.2 Comparison of Theoretical, Radar...Pulse-Only Matched Filter , and the Radar-CommunicationsMatched Filtered PD Curves versus SNR for RCR = [3, 6, 10] dB

  18. Control and Optimization of Regenerative Power Flow in 21st Century Airlifters

    DTIC Science & Technology

    2001-12-01

    Figure 3.14. 32 R,=50 Li V , Input Voltage Respose Output Voltage Response’ vaAvB< 40V AVណ t t Figure 3.14. Time domain constraints for the converter...as it will influence the rate of rise of the current pulse. In the current work, L is limited to Self -inductance of the entire assembly is found under

  19. Low Energy X-Ray Diagnostics - 1981.

    DTIC Science & Technology

    1981-01-01

    small angular aperture relative to rings in that its orbit is truly circular, the radius that for which most systems are designed to collect of turning...incorporates points from all ot 3 3 the channels in our filter-fluorescer spectrometer. The spectrometer is shown in figure b. Design Figure 2. Conversion...of the detector. spectrometer using the design of von Ramsm and a The transmission of these layers is given in (6]. The resistive-anode position

  20. HIBAL Program. Preliminary Warhead-Design. Volume II. Appendices.

    DTIC Science & Technology

    1980-09-15

    Mild Steel (iAi i018). ............. 11-2 B. SAE 4130 .. .. .. .... ...... ....... 11-3 C. SAE 4140 ......... .... .... ......... 11-3 D, SAE 4340...11-7 - Test Data for SAE 4140 Steel Frag- ments ...... ................ 11-14 Figure II-7A - 4142 ... .............. 11-15 Figure 11-8 - Test Data...included the following types of steel: SAE 1018, 4130, 4140 and 4340; 5-317 and 5-876 Carpenter tool steel; Anico HY-80 and SSS-100 steel; AISI-S7

  1. Aerostat Icing Problems.

    DTIC Science & Technology

    1983-08-01

    34.-0 " -4 to -0 ) i ’ to-0 - 0-1J :x0. tf1 0 0 * *4-0 0- - C -4- - t)0o U 4- fa -- Etot 0 In 00)- r 4- a..- - D 4- 0 41 0 --- 0). S- E4JaW 4) 4- CJ - ea... valves ). Figure B2. Icing patterns, copolymer-coated surface left, uncoated right, continuous sheet. 17 Figure B3. Icing pattern, copolymer-coated

  2. A Search for Gene Fusions/Translocations in Breast Cancer

    DTIC Science & Technology

    2012-10-01

    specific pseudogenes. 15. SUBJECT TERMS Gene fusions, sequencing, MAST,Notch 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 ...Figure 5B) as well as in in vivo intravasation and metastasis in chicken chorioallantoic mem- brane xenograft assay (Figure 5C). In contrast...m p h o b la st o id (n = 8) Pa n cr ea ti c B en ig n (n = 3) Pr o st at e B en ig n (n = 18 ) C an ce r S p ec ifi c Sample Frequency (%)0 100

  3. Safer Ski Jumps: Design of Landing Surfaces and Clothoidal In-Run Transitions

    DTIC Science & Technology

    2010-06-01

    MINIMIZATION ......................................................................................... 9 B. DETERMINATION OF SKIER VELOCITY AT TAKEOFF...Spiral Flatness, Clothoid Length, and Angle From Horizontal ..................... 68 c. Free Body Diagram of a Skier in Clothoidal Transition...1 Figure 2. Ski jump in Einsiedeln, Switzerland, from [5] ................................................ 2 Figure 3. A skier performing

  4. Combined Biology and Bioinformatics Approaches to Breast Cancer

    DTIC Science & Technology

    2006-04-01

    In these experiments, LMO4 interacted with the MH1 and linker domains of Smad3 ; no interaction was found with the MH2 domain (Figure 4b). Figure 2...transcriptional response to TGFb by interacting with Smad proteins, and that both the MH1 and linker domains of Smad3 participate in the interaction. LMO4 can...LMO4 interacts with the MH1 and linker regions of Smad proteins. (a) Full-length, 35S-labeled Smad2, Smad3 , Smad4, Smad5, and Smad8 were incubated with

  5. Final Design Documentation for the Wartime Personnel Assessment Model (WARPAM) (Version 1.0)

    DTIC Science & Technology

    1991-03-25

    Bldg 401B) Ft. Benjamin Harrison, IN 46216-5000 Accesion For DTI& NTIS CRA& I J DTIC 1A;3 A Uta,I.ou- i Justilicatluol .... . .. . By...GENERATOR FIGURE 2: WARPAN OPERATIONAL ARCHITECTURE 10 WARPAN DESIGN DOCUMENTATION WARPAM is programmed in FORTRAN 77, except for the CRC model which is...to enter directly into a specific model and utilize data currently in the system. The modular architecture of WARPAM is depicted in Figure 3

  6. Production of Jet Fuels from Coal Derived Liquids. Volume 10. Jet Fuels Production By-Products, Utility and Sulfur Emissions Control Integration Study

    DTIC Science & Technology

    1989-06-01

    FLUE GAS DESULFURIZATION EVALUATION A-1/A-2 3-1. 3 BOILER STACK EMISSION CONTROL WITH...Appendices A - BACT Flue Gas Desulfurization Evaluation B - BACT Off- Gas Refrigeration Evaluation v LIST OF FIGURES Figure Page 1. Material Balance for...2. Desulfurize the flue gases from the Riley boilers when firing with high sulfur oils or lignite. Options in this category include commercial wet

  7. Choosing Between Public and Private Providers of Depot Maintenance: A Proposed New Approach

    DTIC Science & Technology

    1997-09-01

    Appendix A Mathematical Form of the Model Appendix B Assumed Distributions for Evaluation Factors vm Contents Appendix C Trial Evaluation Workbook ...Figure 4-2. Revised Factor Scale Anchors 4-5 Figure 4-3. Workbook Display Establishing Relevance of Factor 4-5 Figure 4-4. Comparing Results of...Introduction process. To fill voids we conducted additional research in the areas of classical microeconomics , transaction cost economics, public

  8. Investigating the Use of Frequency Selective Surfaces in High Power Microwave Applications

    DTIC Science & Technology

    2010-03-01

    radar applications were proving useful during World War II. Both allies and enemies were busy figuring out how to obtain, classify and use returns from...where the powers that are entering and leaving the network are represented by P in = 1 2 [a1a ∗ 1 + a2a ∗ 2] , (3.3) P out = 1 2 [b1b ∗ 1 + b2b ∗ 2

  9. Synchronization Analysis and Simulation of a Standard IEEE 802.11G OFDM Signal

    DTIC Science & Technology

    2004-03-01

    Figure 26 Convolutional Encoder Parameters. Figure 27 Puncturing Parameters. As per Table 3, the required code rate is 3 4r = which requires...to achieve the higher data rates required by the Standard 802.11b was accomplished by using packet binary convolutional coding (PBCC). Essentially...higher data rates are achieved by using convolutional coding combined with BPSK or QPSK modulation. The data is first encoded with a rate one-half

  10. Leaders Are the Network: Applying the Kotter Model in Shaping Future Information Systems

    DTIC Science & Technology

    2010-01-01

    common operational picture (COP) ( Hinson , 2009). Figure 3 demonstrates how CID combines Link 16 and FBCB2 feeds. The CID server polls different...Link 16 Info Exchange A B C S A D S Figure 3 FBCB2-Link 16 Information Exchange. Source: Created by author based on information derived from Hinson ...31552-new-army-leader-development-strategy- released/ (accessed July 30, 2010). Hinson , Jason and Summit, Bob, “Combat Identification Server: Blue

  11. Chimeric Amino Acid Rearrangements as Immune Targets in Prostate Cancer

    DTIC Science & Technology

    2016-05-01

    plot showing gene fusions between exon boundaries Figure 3. Lum (PC141070) A B Figure 4. Recurrent fusion genes present in the TCGA intermediate and...class I restricted epitopes in 6 out of 50 patient tumors. One recurrent gene fusion encoded by the TMPRSS2:ERG type VI fusion was detected in 3...found to have high-affinity (IEDB score អ nM) MHC class I predicted epitopes. Recurrent fusions In a comparative analysis across the patient

  12. Re-Construction of Reference Population and Generating Weights by Decision Tree

    DTIC Science & Technology

    2017-07-21

    2017 Claflin University Orangeburg, SC 29115 DEFENSE EQUAL OPPORTUNITY MANAGEMENT INSTITUTE RESEARCH, DEVELOPMENT, AND STRATEGIC...Original Dataset 32 List of Figures in Appendix B Figure 1: Flow and Components of Project 20 Figure 2: Decision Tree 31 Figure 3: Effects of Weight...can compare the sample data. The dataset of this project has the reference population on unit level for group and gender, which is in red-dotted box

  13. Guided Interventions for Prostate Cancer Using 3D-Transurethral Ultrasound and MRI Fusion

    DTIC Science & Technology

    2017-06-01

    standard transrectal ultrasound (TRUS) probe, a TUUS probe, and MRI. (a) (b) Figure 2: 3D printed prostate phantom mold (a), and pelvis phantom mold...with prostate agar phantom in place (b). The TUUS phantoms were prepared using a standard recipe [ii] for the prostate and the 3D printed mold...AWARD NUMBER: W81XWH-14-1-0461 TITLE: Guided Interventions for Prostate Cancer Using 3D -Transurethral Ultrasound and MRI Fusion PRINCIPAL

  14. Development of a Graphics Based Two-Attribute Utility Assessment Program with Application to Mission Planning.

    DTIC Science & Technology

    1986-12-01

    Blackall and Mr. Zen Pryk of the Surveillance Division; Lt Greg Bandeau of the Accounting Division; and the entire Technical Library staff. I am grateful...1) PD 92 Figure 4.21 Viewpoint 6 (B1 . 00 . W 93 Figure 4.22 Viewpoint 7 (MP 1) MOOc 0.000 pe OCp 94 Figure 4.23 Viewpoint 8 (MP 1) 95 4.2.3 Utility

  15. Improved Methodology for Developing Cost Uncertainty Models for Naval Vessels

    DTIC Science & Technology

    2008-09-01

    Growth: Last 700 Years (From: Deegan , 2007b) ................13 Figure 3. Business Rules to Consider: Choosing an acceptable cost risk point...requires an understanding of consequence (From: Deegan , 2007b)...............16 Figure 4. Basic Steps in Estimating Probable Systems Cost (From: Book...her guidance and assistance in the development of this thesis. Additionally, I thank Mr. Chris Deegan , the former Director of Cost Engineering and

  16. Building a Library for Microelectronics Verification with Topological Constraints

    DTIC Science & Technology

    2017-03-01

    Tables 1d, 3b); 1-bit full adder cell (Fig. 1), respectively. Table 5. Frequency distributions for the genus of logically equivalent circuit...Figure 1 shows that switching signal pairs produces logically- equivalent topologies of the 1-bit full adder cell with three values of the genus (g = 3 [1...case], 4, 5, 6). Figure 1. Frequency distribution for logically equivalent circuit topologies of the 1-bit full adder cell (2048) in Table 1(e

  17. Biopolymers in Light Emitting Devices

    DTIC Science & Technology

    2006-09-01

    from an Alq3 layer are illustrated in Fig. 4. Red emission from the rare earth ion Eu3+ doped into the various emitter layers has also been...structure. 26 • IDRC 3.2 / A. J. Steckl Figure 4. DNA BioLEDs: (a) blue (NPB) and green ( Alq3 ) emitting devices in operation; (b) luminance

  18. Stress/Strain Ratio Effects on Fatigue Response of a SCS-6/Ti-15-3 Metal Matrix Composite at Elevated Temperature.

    DTIC Science & Technology

    1995-12-01

    consisted of a titanium alloy matrix, Figure 1. Turbine Blade Load History [19] Ti-15-3, reinforced with silicon carbide fibers, SCS-6. For this...Composite Science and Technology 1994. 19. Pernot, J. J., Crack Growth Rate Modeling of a Titanium Aluminide Alloy Under Thermal Mechanical Cycling. PhD...Appendix B: Additional Unidirectional, [0]8, Data 102 7. Bibliography 109 8. Vita 112 IV List of Fieures Figure Page 1. Turbine Blade Load

  19. Reliability Evaluation of Low Power Schottky Clamped Microcircuits.

    DTIC Science & Technology

    1980-02-01

    Temperature 52 15. 54LS191: ICC Versus Temperature 53 16. 54LS181: ICC Versus Temperature 54 17. High Temperature ...Response, Vendor A, 54LS181 56 18. High Temperature Response, Vendor B, 54LS181 57 19. High Temperature Response, Vendor A, 54LS191 58 20. High ... Temperature Response, Vendor B, 54LS191 59 21. High Temperature Response, Vendor A, 54LS251 60 3 LIST OF FIGURES (continued) Figure No. Title Page 22. High

  20. Synthesis of New High-Oxygen Carriers and Ditetrazinetetroxide (DTTO)

    DTIC Science & Technology

    2009-12-24

    undesirable halogen or other compounds which might be of damage to the environment or could cause ozone depletion. The second task was aimed at the...1 TMABH4 : 3 HDNT 1 TMABH4 : 4 HDNT /" .lit Jit /It /It Jit -SO 11 Figure 5. "B NMR spectra of [H3B(DNT)]’, [H2B(DNT)2r, [HB(DNT)3]", and [B(DNT...40-50% yield with longer time or higher temperature having little effect . The results of a series of seven experiments were quite erratic, perhaps

  1. Pseudo-Duane's retraction syndrome.

    PubMed Central

    Duane, T D; Schatz, N J; Caputo, A R

    1976-01-01

    Five patients presented with signs that were similar to but opposite from Duane's retraction syndrome. Most had a history of orbital trauma. On attempted abduction a narrowing of the palpebral fissure and retraction of the globe was observed. Diplopia with lateral gaze was present. Roentgenograms (polytomograms) showed involvement of the medial orbital wall. Forced ductuin tests were positive. Surgical repair of the fracture and release of the entrapped muscle as determined by forced duction tests and by postoperative motility led to successful results. Images FIGURE 1 A FIGURE 1 B FIGURE 2 FIGURE 3 PMID:867622

  2. Cargo Movement Operations System (CMOS) Software Requirements Specification Increment II

    DTIC Science & Technology

    1990-05-17

    NO [ ] COMMENT DISPOSITION: ACCEPT [ ] REJECT [ ] COMMENT STATUS: OPEN [ ] CLOSED [ ] Cmnt Page Paragraph No. No. Number Comment 1. 6 Table 1.2 Change SC1.4 to SC14. 2. 11 2.1.3.5 Add the following document: Preliminary Interface Design Document (IDD) for CMOS Increment I, CDRL A008, DCN: 3231 IDD *182*.01, April 9, 1990. 3. 19 3.1.19 In the "Brief Description" paragraph, line 12, hyphenate the word "off line". 4. 25 Fig. 3.2b The number ř" at the top of this figure is out of order. The preceding figure is Ŕ" and the

  3. Analysis of Non-Uniform Gain for Control of a Deformable Mirror in an Adaptive-Optics System

    DTIC Science & Technology

    2008-03-01

    Turbulence Estimator SM Path SH WFS – DM Path Figure 3.6: Primary layout. The blue boxed components is representative of the SM path, the red boxed components...layout that was developed for the majority of the experiments conducted. 3.1.5.1 Steering Mirror Path. This path, boxed in blue in Figure 3.6, is used to...Christou, T.S. Duncan, R.J. Eager, M.A. Ealey, B.L. Ellerbroek, R.Q. Fugate , G.W. Jones, R.M. Kuhns, D.J. Lee, W.H. Lowrey, M.D. Oliker, R.E. Ruane

  4. Chemically Modified Microelectrode Arrays. New Kinds of Electronic Devices.

    DTIC Science & Technology

    1987-08-05

    switching. Figure 1 shows a typical process for the fabrication of a microelectrode array consisting of eight, individually addressable Au (or Pt...S4r... -n - 2 ORGANIC CLEAN MRC SPUTTERING PHOTOLITHOGRAPHY _Suttred SI.N, & DRY ETCH _LorVO S1. 1.2 pm Figure 1. Flow chart for fabrication of...microelectrochemical devices, including polypyrrole, 14 poly(N-methylpyrrole), 14b poly(3-methylthiophene), 1 5 and polyaniline .15b,16 These materials can all be made by

  5. Reliability Test and Evaluation of MIL-M-38510 Linear Microcircuits

    DTIC Science & Technology

    1979-07-01

    KIKLMNALL V ;ILI,, IN AuAI? 0. LXCLs’.SIV. AuAI2 GROWTH DJURING BOWIN)G A. 0111N PIN I OR 3 102000 1@6 6.2 3 . B1•’• EN fITENRNAL IEA C. MIECHANICAL...JC U- 0 CDI 0 09 c C L C4 C" CA .-. 0. C IN U- Ci3 e 0. .-4 CD C5 0c oc i en 0c, O~ - LUi C. co m 0 (0F59 TABLE F8- 3 - IB VcM = OV) HISTORY OF THE...F64 Gl through G4 LIST OF FIGURES FIGURE PAGE 1 LINEAR MICROCIRCUIT TEST PROGRAM .......... ............... 3 2 ACCELERATED LIFE TEST BIAS CIRCUITS

  6. Customer exposure to MTBE, TAME, C6 alkyl methyl ethers, and benzene during gasoline refueling.

    PubMed Central

    Vainiotalo, S; Peltonen, Y; Ruonakangas, A; Pfäffli, P

    1999-01-01

    We studied customer exposure during refueling by collecting air samples from customers' breathing zone. The measurements were carried out during 4 days in summer 1996 at two Finnish self-service gasoline stations with "stage I" vapor recovery systems. The 95-RON (research octane number) gasoline contained approximately 2.7% methyl tert-butyl ether (MTBE), approximately 8.5% tert-amyl methyl ether (TAME), approximately 3.2% C6 alkyl methyl ethers (C6 AMEs), and 0.75% benzene. The individual exposure concentrations showed a wide log-normal distribution, with low exposures being the most frequent. In over 90% of the samples, the concentration of MTBE was higher (range <0.02-51 mg/m3) than that of TAME. The MTBE values were well below the short-term (15 min) threshold limits set for occupational exposure (250-360 mg/m3). At station A, the geometric mean concentrations in individual samples were 3.9 mg/m3 MTBE and 2. 2 mg/m3 TAME. The corresponding values at station B were 2.4 and 1.7 mg/m3, respectively. The average refueling (sampling) time was 63 sec at station A and 74 sec at station B. No statistically significant difference was observed in customer exposures between the two service stations. The overall geometric means (n = 167) for an adjusted 1-min refueling time were 3.3 mg/m3 MTBE and 1.9 mg/m3 TAME. Each day an integrated breathing zone sample was also collected, corresponding to an arithmetic mean of 20-21 refuelings. The overall arithmetic mean concentrations in the integrated samples (n = 8) were 0.90 mg/m3 for benzene and 0.56 mg/m3 for C6 AMEs calculated as a group. Mean MTBE concentrations in ambient air (a stationary point in the middle of the pump island) were 0.16 mg/m3 for station A and 0.07 mg/m3 for station B. The mean ambient concentrations of TAME, C6 AMEs, and benzene were 0.031 mg/m3, approximately 0.005 mg/m3, and approximately 0.01 mg/m3, respectively, at both stations. The mean wind speed was 1.4 m/sec and mean air temperature was 21 degreesC. Of the gasoline refueled during the study, 75% was 95 grade and 25% was 98/99 grade, with an oxygenate (MTBE) content of 12.2%. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:9924009

  7. Distributed Control of Robotic Networks: A Mathematical Approach to Motion Coordination Algorithms

    DTIC Science & Technology

    2008-10-27

    centered at y. The open lune associated to x, y ∈ S is B(x,dist(x, y))∩B(y,dist(x, y)). These notions are illustrated in Figure 1.1 for the Euclidean...version: October 27, 2008 DCRN October 27, 2008 Figure 1.1 Open balls (dashed lines), closed ball (solid line), and open lune for the Eu- clidean...their associated open lune (cf. Section 1.1.3) does not contain any point in P, that is, (pi, pj) ∈ EGRN(P) if pk 6∈ B(pi,dist(pi, pj))∩B(pj ,dist(pi

  8. 76 FR 15802 - Airworthiness Directives; Eurocopter France (Eurocopter) Model EC130 B4 Helicopters

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-22

    ... in insert D of Figure 5 of the EASB, and determine if it is covered with heat shrink, P/N... shown in insert D of Figure 5 or the attachment screw is not covered with heat shrink, modify the.... Figure 5 of the EASB does not show the heat shrink installed for clarity of screw head and lug detail. (3...

  9. Asia and the Science and Politics of Pandemics. 3rd Revision

    DTIC Science & Technology

    2007-04-01

    Appendix B: Speaker Bios 25 Figures Figure 1: Transmission paths of Avian Influenza 8 Figure 2: Migratory Bird Flyways 10 Introduction On...viruses from wild birds to domestic ducks and chickens. • Asia also has a sizable pig population. Pigs can act as mixing vessels for strains of...that infects birds . These viruses mutate often and can be found in other species, including domestic farm animals and humans. Some forms of the

  10. Integrated Immunotherapy for Breast Cancer

    DTIC Science & Technology

    2015-09-01

    patterns in these reconstructed co-cultured cancer cell /stromal cell 3D organoids (Figure 2). The role of mesenchymal stem cells in cancer Bone...marrow-derived mesenchymal stem cells (MSC) have been the subject of interest in solid tumor. Because of their ability to migrate to sites of inflammation...10 Figure 3. Characterization of ex-vivo expanded C57 B6 derived bone marrow mesenchymal stem cells . The cells are positive for CD44, CD140β

  11. Breast Cancer Tissue Bioreactor for Direct Interrogation and Observation of Response to Antitumor Therapies

    DTIC Science & Technology

    2012-07-01

    regulate microfluidic flow rates within the TTB, including flow channel height variation and incorporation of valves (see Figure 2 and Supplemental...cartridge. As an alternative to individual channel TURN valve -adjusted flow regulators, we investigated use of pre-fabricated microfluidic flow resistance...Small Parts, Inc. and B) Microfluidic manifolds with built-in TURN valves . Supplemental Figure S3. Simplified 2D and 3D diffusional model

  12. The Yin and the Yang of visuo-spatial neglect: a case study.

    PubMed

    Marshall, J C; Halligan, P W

    1994-09-01

    We report a patient (R.B.) who has shown gross left visuo-spatial neglect over the 3 years since he sustained a right parietal infarct. Although his neglect is severe on such tasks as line bisection, cancellation, and drawing, there are some domains of preserved perceptual performance: he can perceive subjective contours, he can use lateral symmetry as a cue to figure-ground segregation, and he benefits from some forms of global cueing. In a series of five experiments, we show that R.B. has a selective inability to analyse and copy accurately the left contours of geometric nonsense-figures. These results hold even when there is a single vertical contour (to be copied) that divides a rectangle or a circle into two sub-figures; this physically-identical boundary is copied more accurately when it is cued as the right edge of the left sub-figure than when it is cued as the left edge of the right sub-figure. These effects are not influenced by a manipulation in which R.B. is required to trace the outline of the relevant sub-figure with his finger immediately prior to drawing his copy. The results are interpreted in terms of classical Gestalt theories of figure-ground assignment. Pre-attentive (global) figure-ground parsing is basically intact; but when focal attention is demanded, only the right side of an object is coded as figure.

  13. Effects of Gender and Load on Combative Movement Performance. Volume I

    DTIC Science & Technology

    1982-02-01

    Discuss ion 49 References 51 Appendices A Clothing and Equipment Used in This Study 53 B ANOVA Summary Tables 63 b3 LIST OF FIGURES Page Figure 1...Performance Introduction This is the first of four studies on the biomechanics of load carrying behavior being carried out in the Biomechanics Laboratory at...were taken on each subject and the weights of their utility clothes , boots, and sneakers were determined and recorded. Direct measurements were made of

  14. Interpretation of Hydrographic Features Using Landsat Images,

    DTIC Science & Technology

    1981-06-01

    photograph, Western Atlantic Ocean Figure B-2. Apollo 7, Oblique 146 photograph, Gulf of California (October 13, 1968) Figure B-3. Solar elevation 147 angle...of Land,,it imagery uises the the Hotine Oblique Mercator (HOM) map low-gain Linear setting where signals projection. on all four Iiainnels 1lave...Inclination to ecliptic =23.44 ° eliminate sunglint and enhance the A = Sun’s apparent position (00 at water color is to subtract an IR vernal equinox

  15. Experimentation and Evaluation of Advanced Integrated System Concepts.

    DTIC Science & Technology

    1980-09-26

    ART). (b) Selects one of four trunk circuits from each trunk (m) Dual Modem and Loop Interface (DMLI) card. circuit card. (n) Dictation and paging...Arbitrator L Bus - Modems ET _Modems Modems Figure 4-1 Certain Telenet Processor models (see Section 4.3 for details) can be equipped with redundancy to...JMemory Bank B Memory Bank A ArbittrAto Arbitrator A t a i Interface U a Modems $ Figure 4-2 In a system with common logic redundancy all centrally

  16. The relationship among brain natriuretic peptide (BNP), cholesterol and lipoprotein.

    PubMed

    Takeuchi, Hidekazu; Sata, Masataka

    2012-01-01

    To study the relationship among brain natriuretic peptide (BNP), cholesterol and lipoprotein. A retrospective, cross-sectional study. Tokushima University Hospital area. A retrospective study of 46 patients (nine inpatients and 37 outpatients) with angina pectoris or arrhythmias who were seen at Tokushima University Hospital Cardiovascular Division and had measurements of their BNP, fatty acid and lipid profile. The average age of patients was 57±17 years, and 39% were male subjects. BNP, dihomo-γ-linolenic acid, arachidonic acid, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), apolipoproteinA1, apolipoprotein A2 (ApoA2), apolipoprotein B (ApoB), apolipoprotein C2, apolipoprotein C3, apolipoprotein E, total cholesterol (TC), triglyceride, high density lipoprotein cholesterol and low density lipoprotein cholesterol. The baseline characteristics of the patients were shown in table 1 and the data of lipoprotein were shown in table 2. Table 3 shows the relationship among BNP, cholesterol and lipoprotein. The authors found significant negative correlation between serum levels of BNP and ApoA2 (figure 1; r=-0.458, p=0.001), serum levels of BNP and ApoB (figure 2; r=-0.328, p=0.026) and serum levels of BNP and TC (figure 3; r=-0.383, p=0.010). There is a possibility that dietary EPA and DHA may modulate cardiac mitochondrial and autonomic nervous system dysfunction via fatty-acids-PPARs-PTEN-PI3K/Akt-SREBPs system and affect serum BNP levels indirectly. BNP had significant negative correlation with ApoA2, ApoB and TC. The findings suggest that increasing serum levels of ApoA2, ApoB and TC may have an effect on improving heart function. But the mechanism is presently unclear.

  17. The relationship among brain natriuretic peptide (BNP), cholesterol and lipoprotein

    PubMed Central

    Takeuchi, Hidekazu; Sata, Masataka

    2012-01-01

    Objective To study the relationship among brain natriuretic peptide (BNP), cholesterol and lipoprotein. Design A retrospective, cross-sectional study. Setting Tokushima University Hospital area. Patients A retrospective study of 46 patients (nine inpatients and 37 outpatients) with angina pectoris or arrhythmias who were seen at Tokushima University Hospital Cardiovascular Division and had measurements of their BNP, fatty acid and lipid profile. The average age of patients was 57±17 years, and 39% were male subjects. Main outcome measures BNP, dihomo-γ-linolenic acid, arachidonic acid, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), apolipoproteinA1, apolipoprotein A2 (ApoA2), apolipoprotein B (ApoB), apolipoprotein C2, apolipoprotein C3, apolipoprotein E, total cholesterol (TC), triglyceride, high density lipoprotein cholesterol and low density lipoprotein cholesterol. Results The baseline characteristics of the patients were shown in table 1 and the data of lipoprotein were shown in table 2. Table 3 shows the relationship among BNP, cholesterol and lipoprotein. The authors found significant negative correlation between serum levels of BNP and ApoA2 (figure 1; r=−0.458, p=0.001), serum levels of BNP and ApoB (figure 2; r=−0.328, p=0.026) and serum levels of BNP and TC (figure 3; r=-0.383, p=0.010). There is a possibility that dietary EPA and DHA may modulate cardiac mitochondrial and autonomic nervous system dysfunction via fatty-acids-PPARs-PTEN-PI3K/Akt-SREBPs system and affect serum BNP levels indirectly. Conclusion BNP had significant negative correlation with ApoA2, ApoB and TC. The findings suggest that increasing serum levels of ApoA2, ApoB and TC may have an effect on improving heart function. But the mechanism is presently unclear. PMID:27326018

  18. Evaluation of Novel Polyunsaturated Fatty Acid Derived Lipid Mediators of Inflammation to Ameliorate the Deleterious Effects of Blast Over Pressure on Eye and Brain Visual Processing Centers in Rats

    DTIC Science & Technology

    2015-08-01

    PI under Dr. Long, proposing treatment of blast induced ocular injuries with dietary supplementation of omega-3 polyunsaturated fatty acid. However...fatty acids, arachidonic (20:4ω-6), eicospentaenoic (20:5ω-3), and docosahexaenoic (22:6ω-3) acids (see supplemental Figure B, below). Indeed, all of...to cellular apoptosis and eventual tissue fibrosis (Serhan, 2010) (see supplemental figure C, below). Thus, we felt that they were excellent drug

  19. The Influence of Atmosphere-Ocean Interaction on MJO Development and Propagation

    DTIC Science & Technology

    2013-09-30

    MJO initiation. Figure 3. Time-height cross section of COAMPS grid 3 domain-averaged (a) diabatic heating, (b) perturbation mixing ratio...moist phase. The diurnal variability of 7 precipitation and diabatic heating that can be seen in Figs. 2 and 3 is not observed in the simulation with

  20. Novel Thermoplastic Elastomers Based on Benzofulvene: Synthesis and Mechanical Properties

    DTIC Science & Technology

    2015-12-01

    NUMBER 5f. WORK UNIT NUMBER 5c. PROGRAM ELEMENT NUMBER 5b. GRANT NUMBER 5a. CONTRACT NUMBER Form Approved OMB NO. 0704-0188 3 . DATES COVERED...91  Chapter 3 : Experimental Techniques...53  Figure 1.7: S(IS`) 3 miktoarm star copolymer type TPEs

  1. A Breakdown, Application, and Evaluation of the Resiliency Analysis Support Tool (RAST) from the Operator’s Perspective

    DTIC Science & Technology

    2013-04-17

    44  3.  Pre-Crisis View— List View ..............................................................45  B.  IMPLEMENTATION OF RAST IN NEPAL —POST...íÉ=pÅÜççä= LIST OF FIGURES Figure 1.  Number of Natural Disasters Reported From 1975–2011 (EM-DAT, 2012) ....2  Figure 2.  Snapshot of RAST in the...locations of those resources, and the number of data sets that the RAST has acquired to quantify the scoring of Nepal . Figure 18 shows the Display

  2. An Assessment of the Importance of Technologies to Military Capabilities.

    DTIC Science & Technology

    1980-10-01

    64 1 . 64 1 .64 24 14 9 . 91 TnTAL. .4" .46 .4, r7., .I- 34.92 .2.1 - THT14 NIif - WFArl’N - CANG/MT’. FArTOR, WT 00 00 O ~e. DI.TCI Cl IM61T Fl...NUCLEAR STRUCTURE 6 Figure 2-4a LEVEL-BY-LEVEL DISPLAY 9 Figure 2-4b LEVEL-BY-LEVEL DISPLAY 11 1 . tii TABLES Page tTable 3-1 LIST OF TECHNOLOGIES 15...00 .00 3) rLCTR OPTC *(56) .00 .00 .00 .00 .00 .00 .00 .00 TOTAL .00 .00 .00 .00 .00 .00 .00 .00 Figure 2-4a LEVEL-BY-LEVEL DISPLAY 9 I

  3. Reducing Electroosmotic Flow Enables DNA Separations in Ultrathin Channels.

    DTIC Science & Technology

    1998-08-01

    Chemical structure of DNA bases 2 Figure 1-2: Schematic diagram of DNA base pairing 5 Figure 1-3: Schematic diagram of the capillary and the...hydrogen atoms near one of the Figure 1-1: A. Chemical structure of the DNA backbone. B. Chemical structure of DNA bases . The DNA backbone consists...of pentose sugar (deoxyribose) held together by phosphodiester bonds. The DNA bases that are derivatives of purine are adenine (A) and guanine (G

  4. Evaluation of Type II Fast Packs for Electrostatic Discharge Properties.

    DTIC Science & Technology

    1983-08-01

    34 x 8" x 1 3/4") consisting of a reclosable cushioned carrier which mates into an outer fiberboard sleeve. A cushioning insert is used consisting of a... RECLOSABLE CUSHIONED CARRIER TEST LOAD FIGURE 1: Cancel Caddy Pack * CONVOLUTED 4* CUSHIONED I FIGURE 2: Type II Fast Pack (PPP-B-1672) TYPE II FAST PACK

  5. Characterizing and Targeting Androgen Receptor Pathway-Independent Prostate Cancer

    DTIC Science & Technology

    2013-11-01

    5 6 β-tubulin PSA AR 1 2 3 4 5 6 LO H H et W t/ W t Figure 2. Somatic Selection for HSD3B1 (1245C) Encoding 3bHSD1(367T) Occurs with Resistance to...snap frozen. Hematoxylin and eosin– stained slides were used for pathologic staging (International Society of Uro - logical Pathology guidelines)9 and

  6. Hypothesis Testing of Edge Organizations: Empirically Calibrating an Organizational Model for Experimentation

    DTIC Science & Technology

    2007-06-01

    LIMITATION OF ABSTRACT Same as Report (SAR) 18. NUMBER OF PAGES 63 19a. NAME OF RESPONSIBLE PERSON a. REPORT unclassified b . ABSTRACT...section discusses previous efforts to model and compare knowledge flows between Edge and Hierarchy organizations. B ackground Individual...and Ebbinghaus, 1913), e.g.: R(t) = at- b where t is time and a and b are scalars (see Figure 2). 4 0 0.5 1 1.5 2 2.5 3 3.5 4 0 5 10 15 Delay in

  7. The development of the trabecular meshwork and its abnormality in primary infantile glaucoma.

    PubMed Central

    Anderson, D R

    1981-01-01

    Tissue from ten eyes with infantile glaucoma and from 40 normal eyes of fetuses and infants without glaucoma were examined by light and electron microscopy. In normal development, the corneoscleral coat grows faster than the uveal tract during the last trimester, leading to a posterior migration of the ciliary body attachment from Schwalbe's line (5th month) to the scleral spur (9th month), and then to a location behind the scleral spur (postnatally). In infantile glaucoma, the insertion of the anterior ciliary body and iris overlaps the trabecular meshwork, similar to the late fetal position. The trabecular sheets are perforated, and there is no membrane over the surface of the trabecular meshwork. The trabecular beams are thicker than in normal infant eyes. There is both histologic and clinical evidence of traction on the iris root exerted by the thickened trabecular beams. These findings suggest that in congenital glaucoma the thickened beams had prevented the normal posterior migration of the ciliary body and iris root. This traction may compact the thickened trabecular beams, obstructing aqueous humor outflow. Release of the traction by an incision (goniotomy or trabeculotomy) of the thickened meshwork may relieve the obstruction. Of uncertain pathological significance is that there are no vacuoles in the endothelium of Schlemm's canal and there is a broad layer of collagen and amorphous material in the juxtacanalicular connective tissue. The ciliary processes are elongated inward, as if they were pulled by zonular traction (perhaps created by an enlarging diameter of the limbus with a fixed lens diameter). Images FIGURE 7 FIGURE 8 FIGURE 10 FIGURE 11 FIGURE 20 A FIGURE 20 B FIGURE 1 FIGURE 3 FIGURE 4 A FIGURE 4 B FIGURE 5 A FIGURE 5 B FIGURE 6 FIGURE 9 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15 FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 PMID:7342408

  8. Smart Armor Conceptual Design

    DTIC Science & Technology

    1992-04-30

    Figure 111.2.16 Stress Contour After 800 Cycles With Smart Actuation... . . . . . . . . 37 Figure 111.3.1 A Schematic of an Electrostatic Micromotor ...43 Figure 111.3.2 Top and Cross-Sectional Views of a Micromotor ..... . ............ ... 44 Figure 111.3.3 Shape Memory Alloy...as a Micromotor . ... 45 Figure 111.3.4 A Typical Induced Drive Mechanism ........ .. 46 Figure 111.3.5 Ceramic Plate. . . . . ............. 47 Figure

  9. Nonlinear Optics Technology. Volume 1. Solid State Laser Technology. Phase 3

    DTIC Science & Technology

    1991-01-12

    84 Figure 5.6 Modulator diffraction efficiency as a function of peak power for several 86 RF frequencies Figure 5.7 Thermal effects in the modulator. a...far-field profile of a beam making a 87 double pass through the modulator operating with a peak power of 80 W and average power of 1.6 W. b) same...AU three shown incorporate phase conjugation to provide good beam quality. Figure 1.1a is a standard phase conjugated master oscillator power

  10. A Software Architecture for a Small Autonomous Underwater Vehicle Navigation System

    DTIC Science & Technology

    1993-06-01

    angle consistent with system accuracy objectives for the interim SANS system must be quantified. 12 DEPTH CHAC oCLIMB ANGLE HORIZONTAL DISTANCE Figure...Figure 4.1 illustrates the hardware interface. COMPUTER (ESP-8o80) D IG IT A L B I N A R GYRO SIGNAL BINARY BINARY HEADING DATA "\\DATA DEPTH /RS-232...Mode 3 of the 82C54 provides a square wave through any of the 3 counters in the 82C54. An initial count N is written to the counter control register

  11. Investigation of Optically Induced Avalanching in GaAs

    DTIC Science & Technology

    1989-06-01

    by Bovino , et al 4 to increase the hold off voltage. The button switch design of Fig. 4c has been used by several researchers5 ’ 7 to obtain the...ul Long flashover palh Figure 3b. 434 Optical Jlatlern a. Mourou Switch b. Bovino Switch c. Button Switch Figure 4. Photoconductive Switches...Technology and Devices Laboratory, ERADCOM (by L. Bovino , et. all) 4 • The deposition recipe for the contacts is 1) 50 ANi (provides contact to GaAs

  12. The Risk of Noise-Induced Hearing Loss During Simulated Dives in Canadian Forces Hyperbaric Facilities

    DTIC Science & Technology

    2012-10-01

    tte nu at io n (d B ) F Peltor F Viking F Moldex M Peltor M Viking M Moldex Figure 6 Effect of combinations...4000 6300 8000 Frequency (Hz) A tte nu at io n (d B ) Peltor NV Peltor V Viking NV Viking V Moldex NV Moldex V Figure 7 Effect of combinations of...CHAMBER 0 10 20 30 40 50 60 70 80 90 250 500 1000 2000 3150 4000 6300 8000 Frequency (Hz) A tte nu at ed L ev el (d B ) HDRF1 HDRF2 HDRF3 HDRF4

  13. We Detected Phenomena, Like Africa's Dogon, that Speak of Stellar Gravitational Neutrino Interactions

    NASA Astrophysics Data System (ADS)

    McLeod, David Matthew; McLeod, Roger David

    2009-05-01

    Stick figure equivalents of Kokopelli/Pele/Pamola/Thor/Orion/Osiris, Canis Major/Anubis/Wolf/Fox, Leo/Bird Tailed Jaguar/Beaver Tailed Mountain Lion, were detected by us. They figure heavily in the spiritual/scientific world view of many traditional societies, and their cultural respect for the information such figures convey. Scientific instruments from the past were our laboratories, and theirs. All string/stick figure equivalents may represent types of longitudinally aligned neutrino flux between certain stellar pairs. Neutrino beams from distant pulsars, quasars, or other neutrino sources, cannot penetrate these graviton-like strings. They do pass through sectors of Earth, projecting stick figures within instruments like the Watch House at America's Stonehenge, and perhaps the chamber beneath the Great Pyramid. Sirius B, as the heaviest object in ``our'' universe for the Dogon, means it shares a profound graviton-like neutrino highway to our sun, as Sirius B/A do within Canis Major. It is possibly projected by a source within the Canis Major dwarf galaxy at about 3,000 times as distant as Sirius B/A at 8.7 ly.

  14. Bilateral ethmoid sinusitis with unilateral proptosis as an initial manifestation of metastatic prostate carcinoma.

    PubMed Central

    Fortson, J. K.; Bezmalinovic, Z. L.; Moseley, D. L.

    1994-01-01

    This article presents a case of bilateral ethmoid sinusitis with unilateral proptosis as a presenting sign of an unsuspected prostate carcinoma. A 59-year-old Hispanic male presented to his primary care physician with nasal congestion and rhinitis. He was treated with antibiotics and antihistamine decongestants for 3 weeks without improvement. A trial of steroids resulted in brief improvement followed by a rapid onset of nasal obstruction with proptosis. A computed tomography scan revealed opacification of the ethmoid sinus with right proptosis. The presumptive diagnosis was orbital cellulitis secondary to chronic ethmoid sinusitis. Endoscopic sinusotomy and bilateral ethmoidectomies were performed. Biopsy results returned as metastatic adenocarcinoma, probably of prostate origin. Urological work-up and evaluation with biopsy confirmed the diagnosis of prostatic carcinoma. The patient was treated with chemotherapy and radiation therapy. He died 7 months later with disseminated disease. Images Figure 1 Figure 2 Figure 3 Figure 4A Figure 4B PMID:7861473

  15. The Effects of Truth Bias on Artifact-User Relationships: An Investigation of Factors for Improving Deception Detection in Artifact Produced Information

    DTIC Science & Technology

    1998-08-07

    Scenarios 124 APPENDIX B - Information Manipulation Descriptions 132 vi APPENDIX C - PC-III Screens 146 APPENDIX D - Discrepancy Reporting Sheet 162...in Figure 3-2. • A rtifact Truth Bias D e c e p tio n D ete ctio n A bility t Figure 3-2 - Artifact Truth Bias and Deception Detection...discrepancy recording sheet is provided in Appendix D . For each to the courses, a series of data manipulations was incorporated into the database

  16. Perceptual organization reconsidered in the light of the watercolor illusion: The problem of perception of holes and the object-hole effect.

    PubMed

    Pinna, Baingio; Tanca, Maria

    2008-05-23

    The watercolor illusion is a long-range color assimilation (coloration effect) imparting a figure-ground segregation (figural effect) across large enclosed areas (B. Pinna, 1987; B. Pinna, G. Brelstaff, & L. Spillmann, 2001; B. Pinna, L. Spillmann, & J. S. Werner, 2003; B. Pinna, J. S. Werner, & L. Spillmann, 2003). The watercolored figure has a very poorly reversible or univocal figure-ground segregation and strongly enhances the unilateral belongingness of the boundaries (E. Rubin, 1915), a principle stating that the boundaries belong only to the figure and not to the background. The figural effect determines grouping and figure-ground segregation more strongly than the well-known Gestalt principles. Under watercolor conditions both the figure and the background assume new properties becoming respectively bulging object and hole both with a 3-D volumetric appearance (object-hole effect). Our purposes were: (i) to demonstrate that the hole induced by the watercolor illusion has unique figural properties comparable to those of the object and not present in the background induced by the known figure-ground principles; (ii) to demonstrate a dissociation of the object-hole effect from the coloration one; (iii) to demonstrate that the object-hole effect depends on a new principle. This was psychophysically tested by weakening (ungrouping) the whole figural organization of the watercolor illusion, i.e. by imparting motion to only some components of a stimulus, while other components remain stationary. The results showed that (i) subjects perceived moving holes more strongly than moving figures or objects enlarging and shrinking. (ii) Paradoxically, moving holes appear more as figures than the bulging surfaces. (iii) When motion was imparted to components that while stationary were perceived as objects, their figurality is further enhanced (summation effect). (iv) When object-hole and coloration effects were dissociated no significant difference compared to illusory colored conditions was reported. Coloration can be considered independent from the object-hole effect of the watercolor illusion. The object-hole effect may depend on the "asymmetric luminance contrast principle" (B. Pinna, 2005).

  17. Production of anterior segment ischemia.

    PubMed Central

    Hiatt, R L

    1977-01-01

    Anterior segment ischemic changes can occur without detachment of any muscles. The most common cause of such ischemic changes of the anterior segment is the removal of too many rectus muscles in one operation. Twenty dog eyes and eight monkey eyes were subjected to the disinsertion and detachment of various combinations of extraocular muscles. The dogs were sacrificed at intervals from 30 to 90 days. During the observation period, they were observed for gross and slit-lamp changes. The enucleated eyes were studied microscopically for signs of ischemic and necrotic changes. Two patients who were studied, observed, and treated for anterior segment ischemia following muscle surgery are described. The changes which occur after extraocular muscle surgery are extensive and include corneal edema, cataract, chemosis, corneal changes, decreases in intraocular pressure, decreases in outflow or glaucoma, and frank necrosis. The variables which lead to this reaction are described in detail. Also, some unanswered queries, such as the duration of the reaction and the time interval of the reaction after multiple muscle operations are discussed. Images FIGURE 1 A FIGURE 1 B FIGURE 1 C FIGURE 2 A FIGURE 2 B FIGURE 2 C FIGURE 2 D FIGURE 3 FIGURE 4 PMID:418549

  18. Power and Thermal Technologies for Air and Space. Delivery Order 0003: Development of High-Performance Solid Oxide Fuel Cell (SOFC) Technology for Remote Base Applications

    DTIC Science & Technology

    2007-08-01

    In recent years, however, anode supported electrode conformations with thin film electrolytes have been heavily explored because they are capable ...further clarify relationship between interlayer morphology and cell performance will be a subject of a future study. Figure 2. SEM Images of SOFC...CPE B1B CPE B2B RB4B CPE B3B R1 R2 10 and R3, which also exhibited a constant slope over the test range, averaged 0.1 +/- 0.02 and 0.9 +/- 0.01

  19. Air bags and ocular injuries.

    PubMed Central

    Stein, J D; Jaeger, E A; Jeffers, J B

    1999-01-01

    PURPOSE: This investigation retrospectively examined ocular injuries associated with air bag deployment to gain a better appreciation of potential risk factors in motor vehicle accidents. National statistics regarding the efficacy of air bags were reviewed. METHODS: Review of the literature from 1991 to 1998 identified 44 articles describing 97 patients with air-bag-induced ocular injuries. Variables extracted from each case were age, sex, height, position in the car, eye wear, vehicle impact speed, visual acuity, and specific ocular injuries. RESULTS: Corneal abrasions occurred in 49% of occupants, hyphemas in 43%, vitreous or retinal hemorrhages in 25%, and retinal tears or detachments in 15%. The globe was ruptured in 10 patients. Patients involved in higher-speed accidents (over 30 mph) sustained a greater percentage of vitreous or retinal hemorrhages and traumatic cataracts, while those at slower speeds were more prone to retinal tears or detachments. In a subset of 14 patients with serious ocular injuries, the impact speed of 11 patients was recorded at 30 mph or less. Slower speed may be a risk factor for some ocular injuries. Occupant height was not a significant factor. National statistics confirm that air bags reduce fatalities in motor vehicle accidents. However, children sitting in the front seat without a seat belt and infants in passenger-side rear-facing car seats are at risk for fatal injury. CONCLUSION: Air bags combined with seat belts are an effective means of reducing injury and death in adults during motor vehicle accidents. However, this study has documented a wide variety of ocular injuries associated with air bag deployment. It is hoped that researchers can develop modifications that continue to save lives while minimizing additional harm. Images FIGURE 1 FIGURE 2A FIGURE 2B FIGURE 2C FIGURE 2D FIGURE 3A FIGURE 3B FIGURE 4 FIGURE 5 FIGURE 7 FIGURE 8 PMID:10703118

  20. A simplified plastic embedding and immunohistologic technique for immunophenotypic analysis of human hematopoietic and lymphoid tissues.

    PubMed Central

    Casey, T. T.; Cousar, J. B.; Collins, R. D.

    1988-01-01

    Routine fixation and paraffin embedding destroys many hematopoietic and lymphoid differentiation antigens detected by flow cytometry or frozen section immunohistochemistry. On the other hand, morphologic evaluation is difficult in flow cytometric or frozen section studies. A simplified three-step plastic embedding system using acetone-fixed tissues embedded in glycol-methacrylate (GMA) resin has been found to provide both excellent morphologic and antigenic preservation. With our system, a wide variety of antigens are detected in plastic sections without trypsinization or prolonged embedding procedures; pan-B (CD19, CD22), pan-T (CD7, CD5, CD3, CD2), T-subset (CD4, CD8, CD1, CD25) markers as well as surface immunoglobulin and markers for myeloid and mononuclear-phagocyte cells are preserved. In summary, modifications of plastic embedding techniques used in this study simplify the procedure, apparently achieve excellent antigenic preservation, and facilitate evaluation of morphologic details in relation to immunocytochemical markers. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:3282442

  1. Running the figure to the ground: figure-ground segmentation during visual search.

    PubMed

    Ralph, Brandon C W; Seli, Paul; Cheng, Vivian O Y; Solman, Grayden J F; Smilek, Daniel

    2014-04-01

    We examined how figure-ground segmentation occurs across multiple regions of a visual array during a visual search task. Stimuli consisted of arrays of black-and-white figure-ground images in which roughly half of each image depicted a meaningful object, whereas the other half constituted a less meaningful shape. The colours of the meaningful regions of the targets and distractors were either the same (congruent) or different (incongruent). We found that incongruent targets took longer to locate than congruent targets (Experiments 1, 2, and 3) and that this segmentation-congruency effect decreased when the number of search items was reduced (Experiment 2). Furthermore, an analysis of eye movements revealed that participants spent more time scrutinising the target before confirming its identity on incongruent trials than on congruent trials (Experiment 3). These findings suggest that the distractor context influences target segmentation and detection during visual search. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Real-Time Acquisition and Processing System (RTAPS) Version 1.1 Installation and User’s Manual.

    DTIC Science & Technology

    1986-08-01

    The language is incrementally compiled and procedure-oriented. It is run on an 8088 processor with 56K of available user RAM. The master board features...RTAPS/PC computers. The wiring configuration is shown in figure 10. Switch Modem Port MAC P5 or P6* 2, B4 3 B8 1%7 1 B10 *P6 recommended Figure 10. $MAC...activated switch. The AXAC output port is physically connected to the modem input on the switch. The subchannels are the labeled terminal connections

  3. Dioxinlike properties of a trichloroethylene combustion-generated aerosol.

    PubMed Central

    Villalobos, S A; Anderson, M J; Denison, M S; Hinton, D E; Tullis, K; Kennedy, I M; Jones, A D; Chang, D P; Yang, G; Kelly, P

    1996-01-01

    Conventional chemical analyses of incineration by-products identify compounds of known toxicity but often fail to indicate the presence of other chemicals that may pose health risks. In a previous report, extracts from soot aerosols formed during incomplete combustion of trichloroethylene (TCE) and pyrolysis of plastics exhibited a dioxinlike response when subjected to a keratinocyte assay. To verify this dioxinlike effect, the complete extract, its polar and nonpolar fractions, some containing primarily halogenated aromatic hydrocarbons, were evaluated for toxicity using an embryo assay, for antiestrogenicity using primary liver cell cultures, and for the ability to transform the aryl hydrocarbon receptor into its DNA binding form using liver cytosol in a gel retardation assay. Each of these assays detect dioxinlike effects. Medaka (Oryzias latipes) embryos and primary liver cell cultures of rainbow trout (Oncorhynchus mykiss) were exposed to concentrations of extract ranging from 0.05 to 45 micrograms/l. Cardiotoxicity with pericardial, yolk sac, and adjacent peritoneal edema occurred after exposure of embryos to concentrations of 7 micrograms/l or greater. These same exposure levels were associated with abnormal embryo development and, at the higher concentrations, death. Some of the fractions were toxic but none was as toxic as the whole extract. In liver cells, total cellular protein and cellular lactate dehydrogenase activity were not altered by in vitro exposure to whole extract (0.05-25 micrograms/l). However, induction of cytochrome P4501A1 protein and ethoxyresorufin O-deethylase activity occurred. In the presence of whole extract, estradiol-dependent vitellogenin synthesis was reduced. Of the fractions, only fraction 1 (nonpolar) showed a similar trend, although vitellogenin synthesis inhibition was not significant. The soot extract and fractions bound to the Ah receptor and showed a significantly positive result in the gel retardation/DNA binding test. Chemical analyses using GC-MS with detection limits for 2,3,7,8-tetrachlorodibenzo-p-dioxin and dibenzofuran in the picomole range did not show presence of these compounds. Our results indicate that other chemicals associated with TCE combustion and not originally targeted for analysis may also pose health risks through dioxinlike mechanisms. Images Figure 1. Figure 2. Figure 3. A Figure 3. B Figure 4. A Figure 4. B Figure 4. C Figure 4. D Figure 5. Figure 6. Figure 7. PMID:8841759

  4. Involvement of basic fibroblast growth factor in suramin-induced inhibition of V79/AP4 fibroblast cell proliferation.

    PubMed Central

    Bernardini, N.; Giannessi, F.; Bianchi, F.; Dolfi, A.; Lupetti, M.; Citti, L.; Danesi, R.; Del Tacca, M.

    1993-01-01

    The V79/AP4 Chinese hamster fibroblasts were densely stained with the anti-basic fibroblast growth factor (bFGF) antibody demonstrating an endogenous production of the peptide. The in vitro proliferation of these cells was stimulated by exogenous bFGF and the maximum growth (259% increase in 3H-thymidine incorporation into DNA) was reached with bFGF 10 ng ml-1. Inhibition of bFGF-mediated mitogenic pathway was obtained with a 15-mer antisense oligodeoxynucleotide targeted against bFGF mRNA and with suramin, a drug which blocks the biological activity of heparin-binding growth factors. bFGF antisense oligomer reduced the synthesis of DNA by 79.5 and 89.5% at 20 and 60 microM, respectively; this effect was reversed by the addition of exogenous bFGF to the culture medium. A short-term exposure to suramin 300 micrograms ml-1 produced a modest reduction in 3H-thymidine incorporation but suppressed the mitogenic effect of bFGF on V79/AP4 cells. In cells treated with suramin 300 micrograms ml-1 the drug concentration increased linearly over 3 days, reaching 13.15 micrograms mg-1 of protein; cell proliferation was inhibited in a dose-related manner as evaluated by the colony formation assay (IC50: 344.22 micrograms ml-1) and by the number of mitoses observed in culture. Furthermore, the drug induced ultrastructural alterations, consisting of perinuclear cisternae swelling, chromatin condensation, nucleolar segregation and cytoplasmic vacuolations. These findings demonstrated that the endogenous production of bFGF plays an important role in V79/AP4 fibroblasts proliferation, and the inhibition of bFGF-mediated mitogenic signalling with bFGF antisense oligomer or suramin is an effective mean of reducing cell growth. Images Figure 1 Figure 5 Figure 6 PMID:7685616

  5. The Role of C-SRC Activation in Prostate Tumor Progression

    DTIC Science & Technology

    2006-07-01

    cancer cell line PANC -1 and prostrate cancer cell line PC-3 (B2-fold increase relative to control in both cell lines), while the Src inhibitory PP2 blocks...at normoxia in PANC -1 and PC-3 cells, its levels significantly increase in response to hypoxia (B4.5–8-fold induction). Inhibition of endo- genous c...Src activation in PANC -1 and PC-3 cells by PP2 drastically reduced HIF-1a levels to below those levels observed at normoxia (Figure 1a). STAT3 has

  6. Visualization of Lamb Wave Interaction with a 5 mm Fatigue Crack using 1D Ultra High Frequency Laser Doppler Vibrometry

    DTIC Science & Technology

    2011-09-01

    detection of a fatigue crack via 3D LDV measurements, both in aluminum plates. All the referenced LDV/guided wave studies made use of PZT or similar...Figure 1a). (b) (a) (c) Figure 1: (a) Test specimen in MTS fatigue test machine, (b) hole with 5 mm crack, (c) PZT placement with...mm thick aluminum plates with a small (1.59 mm) center hole added to facilitate growth of a fatigue crack. One plate was left undamaged while the

  7. Zero Energy Housing for Military Installations

    DTIC Science & Technology

    2013-07-01

    data from Baseline B and ZEH A formed the basis for the water consumption analysis. 3 Conservatively assumed one more person in the home during the...23 6.2 WATER PERFORMANCE RESULTS ............................................................... 27 6.3 AIR QUALITY...Monthly hot water comparison. ............................................................................ 26 Figure 13. Monthly hot water

  8. Floating Double Deck Pier Fenders

    DTIC Science & Technology

    2011-07-01

    Center FDDP Floating Double Deck Pier FEM Finite Element Model MHP Modular Hybrid Pier NAVFAC Naval Facilities RDT&E Research, Development, Testing...4. FEM Performance of MV1000x900B Elements ........................................................ 14 Figure 4-5. Biaxial UE1200x1200E3.1 Fender...Deflection .......................................................... 15 Figure 4-6. FEM Performance of Biaxial UE Fender

  9. High pressure X-ray diffraction studies on Bi2-xSbxTe3 (x=0,1,2) materials

    NASA Astrophysics Data System (ADS)

    Jacobsen, Matthew; Kumar, Ravhi; Cornelius, Andrew

    2007-06-01

    Recently Bi2Te3 based thermoelectric materials have gained importance due to their high thermoelectric figure of merit in thin films [3]. Pressure tuning of the thermoelectric figure of merit has been reported for several materials [1],[2]. In order to investigate the bulk properties of Bi2Te3, Sb2Te3, and their solid solution in detail, we have performed structural studies up to 20 GPa. Our diffraction results show that all three compounds transform from the ambient pressure structure to a high pressure phase between 5 and 7 GPa. Details of the results will be discussed in this presentation. [1]Chen, G., Dresselhaus, M.S., Dresselhaus, G., Fleurial, J.-P., and Caillat, T. Recent developments in themoelectric materials. International Materials Reviews, 48, 45-66 (2003). [2]Rowe, D.M. CRC Handbook of Thermoelectric Materials. CRC Press, 1995. [3]Venkatasubramanian, R., Silvola, E., Colpitts, T., and O'Quinn, B. Thin-film thermoelectric devices with high room-temperature figures of merit. Nature, 413, 597-602, 2001.

  10. NASA Subsonic Jet Transport Noise Reduction Research

    DTIC Science & Technology

    2000-09-01

    optical and acoustical interference. Figure 7 shows the concept and data from the installation of arrays of Herschel- Quincke tubes in the duct...tube row 16 tube row Herschel- Quincke Tube Tube length 12.5cm d = 3.8cm L = 9.2cm 2250 2350 2450 2500...Blade passage frequency, Hz R el at iv e p o w er , d B JT15D Turbofan Engine 4 d B Figure 7. Application of Herschel- Quincke tubes for

  11. Expression of fibronectin ED-A+ and ED-B+ isoforms by human and experimental colorectal cancer. Contribution of cancer cells and tumor-associated myofibroblasts.

    PubMed Central

    Pujuguet, P.; Hammann, A.; Moutet, M.; Samuel, J. L.; Martin, F.; Martin, M.

    1996-01-01

    Alternative splicing of primary fibronectin (FN) mRNA results in the synthesis of different isoforms. ED-A+ and ED-B+ FN isoforms are absent from plasma FN and are representative of cellular FN. Their expression was studied in human and rat normal colon, in human colorectal carcinomas, and in transplanted tumors derived from a chemically-induced rat colon cancer. In normal colon, only the ED-A+ FN isoform was expressed as a thin deposit between crypt colonocytes and pericryptal myofibroblasts. Conversely, heavy ED-A+ FN deposits and lighter ED-B+ FN expression were found in the stroma of colorectal tumors in association with myofibroblasts surrounding tumor glands. Some colonic cancer cells also contained intracellular FN isoform granules and expressed FN mRNA. Tumor-associated myofibroblasts and some cancer cell lines were able to synthesize and deposit extracellular ED-A+ and ED-B+ FN in vitro. FN isoform deposition by tumor-associated myofibroblasts was not modulated by colon cancer cell-conditioned medium, but was strongly enhanced when myofibroblasts were cultured on colon cancer cell extracellular matrix or on laminin. These results show that the ED-A+ and ED-B+ FN isoforms were overexpressed in colorectal cancer. Cancer cells can deposit these FN isoforms directly and also stimulate their deposition by tumor-associated myofibroblasts. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 7 PMID:8579120

  12. Evaluation of the Use of a Bedleveler to Improve Navigability of Atchafalaya River Bar Channel Fluid Mud

    DTIC Science & Technology

    2017-08-01

    3 Channel fluid mud surveying ...density horizons (a) and the 50 Pa horizon depths (b), computed for all 10 surveys . .......................................................... 12... surveyed 11 November 2011. Red trace 1.300 g/ figure cm3 horizon surveyed 4 December 2011

  13. Molecular Layer Deposition of Hybrid Organic-Inorganic Polymer Films using Diethylzinc and Ethylene Glycol

    DTIC Science & Technology

    2009-01-01

    by the number of microdoses of DEZ or EG. Figure 4a indicates that the DEZ reaction is self-limiting and reaches Full Paper Fig. 2. In-situ FTIR...after ten DEZ microdoses . Each DEZ dose was defined by a 0.3 s exposure at 70 mTorr of partial pressure. Likewise, Figure 4b indicates that the EG...the Full Paper Fig. 4. Integrated absorbance for a) CH stretching vibrations versus number of DEZ microdoses , and b) OH stretching vibrations versus

  14. The Costs and Benefits of Pre-Planned Product Improvements for the Consolidated Automated Support System (CASS)

    DTIC Science & Technology

    1993-11-01

    ground missions and must operate effectively in both domains . Figure A-3 shows a block diagram of a modem fighter radar3 system . Technologies that are...I AUTOMATED SUPPORT SYSTEM (CASS) I i Daniel B. Levine Waynard C. Devers, Project Leader Bernard L. Retterer Howard S. Savage Clayton V. Stewart...Improvements for theI Consolidated Automated Support System (CASS) MDA 903 89C 0003 6. AUThiOR( T-B7-1095 Daniel B. Levine, Waynard C. Devers

  15. EQCM Measurements: Redox-Induced Changes in Solvent and Ion Content in Anchored Redox Monolayers of Organosulfur Compounds and Their Electrocatalysis on Gold Electrodes

    DTIC Science & Technology

    1990-08-01

    Langmuir, I. J. Am. Chem. Soc. 1917, 39, 1848-1906. b ) Blodgett, K. B . J. Am. Chem. Soc. 1935, 57, 1007-1022. c) Blinov , L. M. Russ. Chem. Rev. 1988, 52...pressure producing a polarization b ) Converse piezoelectric effect (structural deformation) caused by applying a potential across the crystal...of Ferrocenamide phenyl disulfide in: A) IM HC104, B ) IM HNO 3 , and C) iM H2 SO4 versus SSCE ....... ...... ................ s34 Figure 3.7 Study of

  16. Investigation of Co, Ni and Fe Doped II-VI Chalcogenides

    DTIC Science & Technology

    2013-01-04

    dopants to the Fe ions. Figure 4. Cobalt doped ZnSe (7×3.1×50 mm3) samples after annealing for 7 days at 950C. A B 8 Approved for public...distribution unlimited. 4.2 Cobalt doped samples ........................................................................................................77...curve for the deposition monitor used for cobalt deposition during magnetron spattering at 1000 nm; B) percentage transmission of a cobalt thin film

  17. An Archeological Overview and Management Plan for the Stratford Army Engine Plant.

    DTIC Science & Technology

    1984-02-01

    Stratford-upon-Avon, England (Bixby 1974:266). The American Shakespeare Festival Theatre and Academy, attended by hundreds of thousands of visitors...cut and fill activities (GDAs 3, 4 and 5, Table 3-1, Figure 3-1). A companion grading and contour map (Dwg. B864x2) showing cross sections through the

  18. Assessment of Governor Control Parameter Settings of a Submarine Diesel Engine

    DTIC Science & Technology

    2013-03-01

    on the mean back pressure. The amplitude was 6.25 kPa (corresponding to a significant wave height of 1.25 m ) and a period of 7.4 s . The peak-peak...was 30 kPa (corresponding to a significant wave height of 6 m ) and a period of 10.3 s . The results are shown in Figure 17 to Figure 20. Comparison of... a loss in the system. Hopka et al. [9] obtain the ‘indicated torque’ from an empirical relationship  1 2 3 4 5 ,find f cc eng out in in eng m b

  19. Aircraft Transparency Failure and Logistical Cost Analysis. Volume I. Program Summary

    DTIC Science & Technology

    1978-12-01

    Hours liv LIST OF ABBREVIATIONS (Continued) SFMC Field Maintenance Cost FMEA Failure Modes and Effect Analysis SFMS Field Maintenance Squadron FSN...3, CH-53, AND UH -1 Figure 3. Study Aircraft 10 I. 1. WINDSHIELDS 2. CANOPIES 3. WINDOWS INTERACTIVE SUPPORT SYSTEMS 1. ANTI-ICING 2. DEFOGGING 3...52,947 13,761 UH /TH-1F, 1P 73,431 73,640 Total helicopters 339,690 113,492 2.99 Bombers B-S2G 138,348 64,431 B-S2P 93,000 36,936 B-57 34,527 19,552

  20. Amplitude-integrated EEG colored according to spectral edge frequency.

    PubMed

    Kobayashi, Katsuhiro; Mimaki, Nobuyoshi; Endoh, Fumika; Inoue, Takushi; Yoshinaga, Harumi; Ohtsuka, Yoko

    2011-10-01

    To improve the interpretability of figures containing an amplitude-integrated electroencephalogram (aEEG), we devised a color scale that allows us to incorporate spectral edge frequency (SEF) information into aEEG figures. Preliminary clinical assessment of this novel technique, which we call aEEG/SEF, was performed using neonatal and early infantile seizure data. We created aEEG, color density spectral array (DSA), and aEEG/SEF figures for focal seizures recorded in seven infants. Each seizure was paired with an interictal period from the same patient. After receiving instructions on how to interpret the figures, eight test reviewers examined each of the 72 figures displaying compressed data in aEEG, DSA, or aEEG/SEF form (12 seizures and 12 corresponding interictal periods) and attempted to identify each as a seizure or otherwise. They were not provided with any information regarding the original record. The median number of correctly identified seizures, out of a total of 12, was 7 (58.3%) for aEEG figures, 8 (66.7%) for DSA figures and 10 (83.3%) for aEEG/SEF figures; the differences among these are statistically significant (p=0.011). All reviewers concluded that aEEG/SEF figures were the easiest to interpret. The aEEG/SEF data presentation technique is a valid option in aEEG recordings of seizures. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. Impact of target-to-background ratio, target size, emission scan duration, and activity on physical figures of merit for a 3D LSO-based whole body PET/CT scanner.

    PubMed

    Brambilla, M; Matheoud, R; Secco, C; Sacchetti, G; Comi, S; Rudoni, M; Carriero, A; Inglese, E

    2007-10-01

    The aim of our work is to describe the way in which physical figures of merit such as contrast-to-noise ratio (CNR) behave when varying acquisition parameters such as emission scan duration (ESD) or activity at the start of acquisition (A(acq)) that in clinical practice can be selected by the user, or object properties such as target dimensions or target-to-background (T/B) ratio, which depend uniquely on the intrinsic characteristics of the object being imaged. Figures of merit, used to characterize image quality and quantitative accuracy for a 3D-LSO based PET/CT scanner, were studied as a function of ESD and A(acq) for different target sizes and T/B ratios using a multivariate approach in a wide range of conditions approaching the ones that can be encountered in clinical practice. An annular ring of water bags of 3 cm thickness was fitted over an IEC phantom in order to obtain counting rates similar to those found in average patients. The average scatter fraction (SF) of the modified IEC phantom was similar to the mean SF measured on patients with a similar scanner. A supplemental set of micro-hollow spheres was positioned inside the phantom. The NEMA NU 2-2001 scatter phantom was positioned at the end of the IEC phantom to approximate the clinical situation of having activity that extends beyond the scanner. The phantoms were filled with a solution of water and 18F (12 kBq/mL) and the spheres with various T/B ratios of 22.5, 10.3, and 3.6. Sequential imaging was performed to acquire PET images with varying background activity concentrations of about 12, 9, 6.4, 5.3, and 3.1 kBq/mL, positioned on the linear portion of the phantom's NECR curve, well below peak NECR of 61.2 kcps that is reached at 31.8 kBq/mL. The ESD was set to 1, 2, 3, and 4 min/bed. With T/B ratios of 3.6, 10.3, and 22.5, the 13.0, 8.1, and 6.5 mm spheres were detectable for the whole ranges of background activity concentration and ESD, respectively. The ESD resulted as the most significant predictor of CNR variance, followed by T/B ratio and the cross sectional area of the given sphere. Only last comes A(acq) with a weight more than halved with respect to ESD. Thus, raising ESD seems to be much more effective than raising A(acq) in order to obtain higher CNR, which is the physical figure of merit closely related with target detectability, at least in the simple task of the signal known exactly background known exactly model.

  2. The Val192Leu mutation in the alpha-subunit of beta-hexosaminidase A is not associated with the B1-variant form of Tay-Sachs disease.

    PubMed Central

    Hou, Y.; Vavougios, G.; Hinek, A.; Wu, K. K.; Hechtman, P.; Kaplan, F.; Mahuran, D. J.

    1996-01-01

    Substitution mutations adversely affecting the alpha-subunit of beta-hexosaminidase A (alphabeta) (EC 3.2.1.52) result in Tay-Sachs disease. The majority affect the initial folding of the pro-alpha chain in the endoplasmic reticulum, resulting in its retention and degradation. A much less common occurrence is a mutation that specifically affects an "active-site" residue necessary for substrate binding and/or catalysis. In this case, hexosaminidase A is present in the lysosome, but it lacks all alpha-specific activity. This biochemical phenotype is referred to as the "B1-variant form" of Tay-Sachs disease. Kinetic analysis of suspected B1-variant mutations is complex because hexosaminidase A is heterodimeric and both subunits possess similar active sites. In this report, we examine a previously identified B1-variant mutation, alpha-Val192Leu. Chinese hamster ovary cells were permanently cotransfected with an alpha-cDNA-construct encoding the substitution and a mutant beta-cDNA (beta-Arg211Lys), encoding a beta-subunit that is inactive but normal in all other respects. We were surprised to find that the Val192Leu substitution, produced a pro-alpha chain that did not form alpha-beta dimers and was not transported to the lysosome. Finally, we reexamined the hexosaminidase activity and protein levels in the fibroblasts from the original patient. These data were also not consistent with the biochemical phenotype of the B1 variant of Tay-Sachs disease previously reported to be present. Thus, we conclude that the Val192Leu substitution does not specifically affect the alpha-active site. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:8659543

  3. B1 field-insensitive transformers for RF-safe transmission lines.

    PubMed

    Krafft, Axel; Müller, Sven; Umathum, Reiner; Semmler, Wolfhard; Bock, Michael

    2006-11-01

    Integration of transformers into transmission lines suppresses radiofrequency (RF)-induced heating. New figure-of-eight-shaped transformer coils are compared to conventional loop transformer coils to assess their signal transmission properties and safety profile. The transmission properties of figure-of-eight-shaped transformers were measured and compared to transformers with loop coils. Experiments to quantify the effect of decoupling from the B1 field of the MR system were conducted. Temperature measurements were performed to demonstrate the effective reduction of RF-induced heating. The transformers were investigated during active tracking experiments. Coupling to the B1 field was reduced by 18 dB over conventional loop-shaped transformer coils. MR images showed a significantly reduced artifact for the figure-of-eight- shaped coils generated by local flip-angle amplification. Comparable transmission properties were seen for both transformer types. Temperature measurements showed a maximal temperature increase of 30 K/3.5 K for an unsegmented/segmented cable. With a segmented transmission line a robotic assistance system could be successfully localized using active tracking. The figure-of-eight-shaped transformer design reduces both RF field coupling with the MR system and artifact sizes. Anatomical structure close to the figure-of-eight-shaped transformer may be less obscured as with loop-shaped transformers if these transformers are integrated into e.g. intravascular catheters.

  4. An Introduction to Fractals and Chaos

    DTIC Science & Technology

    1989-06-01

    figures in this report were created with programs written in Turbo Pascal 4.0 on a Zenith 248 with EGA. They are in the public domain. A figure was...upgraded both his graphics 1975, with the publication of his first and photographic equipment to pro- book in French, translated into English duce, with...spi.ce 1v.rtr!0!ts .... ....,, ,, ..... ,. -, 1 0 0.8 b 0.6 0.4 0.2 0 Figure 3. A parafita i the ield of aaus’ i’arer ;% omnics , thi t. uiac 1, .- ~VO.iil

  5. Cooled, Laminated Radial Turbine Demonstration Program.

    DTIC Science & Technology

    1981-02-01

    Cooled Exducer ........ 60 Analysis .......................... 61 Design Considerations ................. 61 Blade Inducer Region .................. 65...ILLUSTRATIONS (Contd) Figure Page 60 Region of Disk that Exceeds 0.1 Percent Creep at 73,380 rpm and Steady-State Operating Temperatures for the 5,000-Hour...105 0.95 z L- 0.90 w EFFICIENCY, 17TT)C = 0.872 I-I 0.80 30 40 go 60 7b 8b 90 160l 11 0 I NS, SPECIFIC SPEED - RPM (FT3/4)/SEC1/2 Figure 7. Specific

  6. Presque Isle Peninsula, Frie, Pennsylvania. Volume II. Appendices. Revised.

    DTIC Science & Technology

    1980-11-01

    Population Pyramid 9 c. Employment 9 d. Labor Force 9 .e. Public Facilities and Services 14 1. Transportation 14 2. Health Facilities. 14 3. Communications 14...Distribution of Shoreline Use and Overship, 3 Erie County, PA B2 Population Pyramid of Erie County 13 53 Travel Demand Curve Peak Day Good Weather 38...are also experiencing a decline in total population. 4(5) Population Pyramid B2.13 Figure B2, the population pyramid of Erie County, PA, for the years

  7. Antimicrobial 3D Porous Scaffolds Prepared by Additive Manufacturing and Breath Figures.

    PubMed

    Vargas-Alfredo, Nelson; Dorronsoro, Ane; Cortajarena, Aitziber L; Rodríguez-Hernández, Juan

    2017-10-25

    We describe herein a novel strategy for the fabrication of efficient 3D printed antibacterial scaffolds. For this purpose, both the surface topography as well as the chemical composition of 3D scaffolds fabricated by additive manufacturing were modified. The scaffolds were fabricated by fused deposition modeling (FDM) using high-impact polystyrene (HIPS) filaments. The surface of the objects was then topographically modified providing materials with porous surfaces by means of the Breath Figures approach. The strategy involves the immersion of the scaffold in a polymer solution during a precise period of time. This approach permitted the modification of the pore size varying the immersion time as well as the solution concentration. Moreover, by using polymer blend solutions of polystyrene and polystyrene-b-poly(acrylic acid) (PS 23 -b-PAA 18 ) and a quaternized polystyrene-b-poly(dimethylaminoethyl methacrylate) (PS 42 -b-PDMAEMAQ 17 ), the scaffolds were simultaneously chemically modified. The surfaces were characterized by scanning electron microscopy and infrared spectroscopy. Finally, the biological response toward bacteria was explored. Porous surfaces prepared using quaternized PDMAEMA as well as those prepared using PAA confer antimicrobial activity to the films, i.e., were able to kill on contact Staphylococcus aureus employed as model bacteria.

  8. Application of the Oriented-Eddy Collision Model to Complex Turbulent Flows

    DTIC Science & Technology

    2011-03-14

    compare with data available from Matsumoto, Nagano, and Tsuji (1991) as well as L. Le Penven, J. N. Gence, and G. Comte -Bellot (1985). This provided a...0.15 0.2 0.25 0.3 0.35 0.4 0.45 0.5 time (s) Figure 20: Comparison to data from L. Le Penven, J. N. Gence, and G. Comte ...Bellot, case A. 0.005 0.05 0.1 0.2 0.25 0.3 0.15 time (s) Figure 21: Comparison to data from L. Le Penven, J. N. Gence, and G. Comte -Bellot, case B

  9. A new BaB{sub 2}Si{sub 2}O{sub 8}:Eu{sup 2+}/Eu{sup 3+}, Tb{sup 3+} phosphor - Synthesis and photoluminescence properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saradhi, M.P.; Department of Chemistry, Indian Institute of Technology Hyderabad, Yeddumailaram, Hyderabad - 502205; Laboratoire de Cristallographie et Sciences des Materiaux, ENSICAEN, Universite de Caen, CNRS, 6 Bd Marechal Juin, F-14050 Caen

    2010-10-15

    In the present work, we have synthesized maleevite mineral phase BaB{sub 2}Si{sub 2}O{sub 8} for the first time, which is isostructural with the pekovite mineral SrB{sub 2}Si{sub 2}O{sub 8}. In these europium doped host lattices, we observed the partial reduction of Eu{sup 3+} to Eu{sup 2+} at high temperature during the synthesis in air. Tb{sup 3+} co-doping in MB{sub 2}Si{sub 2}O{sub 8}:0.01(Eu{sup 3+}/Eu{sup 2+}) [M=Sr, Ba] improves the emission properties towards white light. The emission color varies from bluish white to greenish white under UV lamp excitation when the host cation changes from Sr to Ba. - Graphical abstract: Themore » figure shows structure refinement of both MB{sub 2}Si{sub 2}O{sub 8} [M=Sr, Ba]. The structure refinement of newly synthesized phase BaB{sub 2}Si{sub 2}O{sub 8} was carried out by taking SrB{sub 2}Si{sub 2}O{sub 8} as starting structure model. Inset in the figure shows the structure projection of BaB{sub 2}Si{sub 2}O{sub 8}. The Sr{sup 2+}/Ba{sup 2+} are embedded in polyanionic network formed by corner sharing BO{sub 4}{sup 5-} and SiO{sub 4}{sup 4-} tetrahedral that intern form interconnected layers of 4 and 8 membered rings perpendicular to b-axis.« less

  10. Design and Analysis of Coordinated Bank-to-Turn (CBTT) Autopilots for Bank-to-Turn (BTT) Missiles.

    DTIC Science & Technology

    1983-12-01

    with the acceleration command shown in Figures 4.3 it was necessary to modify the antigravity command as follows to S..assure an anti-gravity bias of...and the kinematic cross-coupling of -B.P into a. Also the antigravity command coso cose is inserted into nz. This model is shown in Figure 4.1. The

  11. Magnetic Stimulation and Epilepsy

    DTIC Science & Technology

    2013-10-14

    the seizure-induced groups exhibited varying degrees of EEG activity reduction. Figure 2. The effects of TMS on penicillin-induced seizures...the EEG recording including (a) baseline (pre-penicillin injection), (b) 30-min post-penicillin injection (30min-PI), (c) 10-min post- TMS stimulation...stable conditions 55% faster, and the 5 pps TMS -treated group 78% faster. Figure 3. Maximum frequency relationships in EEG activity among the

  12. The fine structure of intracranial neoplasms induced by the inoculation of avian sarcoma virus in neonatal and adult rats.

    PubMed Central

    Copeland, D. D.; Talley, F. A.; Bigner, D. D.

    1976-01-01

    Groups of F-344 rats were inoculated with the Bratislava-77 strain of avian sarcoma virus (B-77 ASV) within 24 hours of birth, at 9 days of age, or between 97 and 119 days of age. Intracranial tumors developed in each age group. Multiple tumors with mixed histologic patterns developed in rats inoculated at 1 or 9 days of age. Solitary tumors with a uniform histologic pattern developed in rats inoculated as adults. On the basis of light and electron microscopic study, the majority of tumors in each age group were classified as astrocytomas and divided into either poorly differentiated, gemistocytic, pilocytic, or polymorphic varieties. The polymorphic astrocytomas were most common among neonatally inoculated rats, while the pilocytic astrocytomas were most common among rats inoculated as adults. Ultrastructural characteristics of astrocytes, including gap junctions and 7- to 9-nm filaments, were present in the majority of tumors in each age groups. Astrocytomas induced in adult rats were remarkable for the presence of extensive basement membrane alone the astrocytic cell surfaces. Intracytoplasmic virus-like particles (R particles) were common in the tumor cells. These virus-like particles are morphologically distinct from C-type B-77 ASV, and no morphologic evidence of C-type virus replication was observed in any of the tumors. Images Figure 16 Figure 17 Figure 1 Figure 2 Figure 18 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 PMID:179328

  13. Erratum: Correction to: Water in the Earth's Interior: Distribution and Origin

    NASA Astrophysics Data System (ADS)

    Peslier, Anne H.; Schönbächler, Maria; Busemann, Henner; Karato, Shun-Ichiro

    2017-10-01

    Correction to: Space Sci Rev DOI: 10.1007/s11214-017-0387-z This article has been corrected. Figure 3 was initially published with erroneous axis titles in Fig. 3B and 3D where the x axis should be Cpx H2O, instead of Grt H2O.

  14. Quantum Spin Gyroscope

    DTIC Science & Technology

    2015-07-15

    performing optically detected CW ESR and on-resonance Rabi nutation of the elec- tronic spins (see figure 5). We observed increased homogeneity (as...different crystal axes. Here the magnetic field applied was ∼ 100G. Right: Rabi nutations 2.3 Sensitivity In order to test the performance of this first...resonant driving, which are strongly dependent on the hyperfine interaction. 5 Fig. 6: 14N Rabi oscillations at B = 450G, B1 ≈ 3.3G in the three NV

  15. High Gravity (g) Combustion

    DTIC Science & Technology

    2006-02-01

    UNICORN (Unsteady Ignition and Combustion with Reactions) code10. Flame propagation in a tube that is 50-mm wide and 1000-mm long (similar to that...turbine engine manufacturers, estimating the primary zone space heating rate. Both combustion systems, from Company A and Company B, required a much...MBTU/atm-hr-ft3) Te m pe ra tu re R is e (K ) dP/P = 2% dP/P = 2.5% dP/P = 3% dP/P = 3.5% dP/P = 4% Company A Company B Figure 13: Heat Release Rate

  16. A Description of the Phase I Automated Terminal Services Concept

    DTIC Science & Technology

    1976-11-01

    SYSTEM FIGURE 1-2: ATS COST ELEMENTS (THOUSANDS, PER SITE ) 1-4 FIGURE 2-1: ELEMENTS FOR AUTOMATED TERMINAL SERVICE 2-2 FIGURE 2-2: ARTIST’S CONCEPTION...OF AN AUTOMATED 2-7 TERMINAL SERVICES SITE FIGURE 3-1: AUTOMATED TERMINAL SERVICES 3-3 FIGURE 3-2: ATS SERVICE REGIONS 3-5 FIGURE 3-3: RECOMMENDED...are developed (e.g., advanced control and DABS data link functions). Software and hardwa’re retrofits could be done at particular sites as system

  17. A: The Progression of a Catalytic Immune Response. B: Molecular Recognition of Anions by Silica Bound Sapphyrin

    DTIC Science & Technology

    1994-08-01

    Diels - Alder reactions (58-60), Claisen rearrangements (43-45), olefin isomerization (73), a O-elimination (74), an asymmetric ketone reduction (54...phosphorothioate hapten3 ........ 19 Figure 5. Carboxylic acid hydrolysis .................... 21 Figure 6. Reaction coordinates for antibody catalyzed ...and catalyze the reaction. Thus, it is important to design transition analogs that closely mimic the transition state in every possible chemical

  18. New Treatments for Drug-Resistant Epilepsy that Target Presynaptic Transmitter Release

    DTIC Science & Technology

    2014-05-01

    in control versus pilocarpine-treated (suffering status epilepticus ) group of animals that were injected with saline instead of levetiracetam for 1...month (Figure 1A). As previously reported we detected a significant 4.4% increase in normalized peak fluorescence in status epilepticus (SE) group...slices) (Figure A, b3). These data is consistent with our previous findings that status epilepticus induce an abnortmal increase in presynaptic

  19. Anthro-Centric Multisensory Interface for Vision Augmentation/Substitution

    DTIC Science & Technology

    2013-02-01

    for human perception of the visual environment. Figure 1: (left) Photograph of the Argus™ I and II Retinal Prosthesis System epiretinal...scleralband (a);the visualprocessing unit (b);spectacle m ounted m iniature cam era (c). Figure 3. C olour photo of A rgus II epiretinal prosthesis ...items in the environment. Alternatively, we have also implemented a touch screen mechanism that allows the user to feel the pixels under his or her

  20. Evaluation of Physiological and Psychological Impairment of Human Performance in Cold Stressed Subjects

    DTIC Science & Technology

    1993-06-05

    t 1 Cold-. 5- a) E 10- - SST 1- 5- 0 I I I " I I ŕ I 0 30 60 90 120 150 180 Time (minutes) Figure 12 Face Temperatures 35- 30- 25- -o- Warm...34• I I I I I t Or)3 0 30 60 90 120 150 :> Time (minutes) Figure 3Z-b. EMG Activity of Pectoralis Major Muscle During Rifle Shooting •" 400- w -.-- Warm...34• 350- (1)o) 300- _m_ Cold (0 o 250-> .- t -. SST S200- S150- 50- -5 0 I =

  1. Building a Dynamic Spectrum Access Smart Radio with Application to Public Safety Disaster Communications

    DTIC Science & Technology

    2009-08-13

    User Interface Master C ontroller (MC ) C ompos ite XML C onfiguration & E vents Awareness Universal  R adio F ramework US R P 802.11 B luetooth E...Bluetooth Database US R P  Database Adapters to be evaluated in Network Testbed Memory Adaptability Policy C ontrol Interoperability Figure 4.2...10 15 20 25 30 10-3 10-2 10-1 100 101 102 103 time (sec) UDP Jitter Ji tte r ( m s) 802.3 Wired 802.11 Wireless Bluetooth GNU Radio/USRP Figure

  2. Theoretical Prediction of the Heats of Formation, Densities, and Relative Sensitivities for 3,7-diamino-2,4,6,8-tetranitro-1,5-diazanaphthalene (DATNP) and 3,7-diamino-2,4,6,8-tetranitro-1,5-diazanaphthalene 1,5-N-oxide (DATNPO)

    DTIC Science & Technology

    2016-02-01

    Figures Fig. 1 Optimized structure of a) 1 and b) 2 ......................................................2 Fig. 2 Electrostatic potential map of 1...3 Electrostatic potential map of 2, without a) and with b) molecule overlay...previous report.7 For the estimation of the impact sensitivities, the electrostatic maps on the 0.001 isosurfaces were generated with the scalar range

  3. Density- and luminosity-functions for UBV-photometric discand halo-stars in SA 54, compared with earlier RGU-results in this field

    NASA Astrophysics Data System (ADS)

    Fenkart, R.; Esin-Yilmaz, F.

    1983-12-01

    Space density- and luminosity-functions for the photometric halo- and disc-populations in the test-field SA 54 of the Basle Halo Program have been derived on the basis of UBV observations of the same 1377 stars used already for the corresponding RGU investigation by Fenkart (1968). The statistical method for separating the photometrically defined populations and for attributing absolute magnitudes to their members developed, described and first applied to SA 51 in RGU by Becker (1965) has been adapted for use in the UBV system. The (U-B, B- V) diagrams for consecutive intervals in apparent V-magnitude of figures 2a to f contain, contrary to what was first expected in this system, substantial numbers of stars in the < blanketing-region above and to the right of the late branch of the two-colour diagram main-sequence. The density-functions for different MVintervals within the overall interval < 3m, 7m> covered by this investigation for halo and disc are given in tables IIa and b, and plotted in figures 3 and 4, respectively. The corresponding luminosity-functions within the partial volume up to 1 kpc from the sun over the same overall MVinterval are given together with Glieses (1969) solar values for population I, in table III, and plotted in figure 5. The overall density-functions (3m ≦ MV ≦ 7m) for both populations can be and are compared with the corresponding ones (3m ≦ MG ≦ 8m) in RGU (last column in table II) in figures 6 and 7, for halo and disc, respectively. The coincidence of the density results between UBV and RGU is much better for both populations than the mean misidentification rate per system derived in section 5 would let us expect, suggesting a statistically fairly repartition of the misidentifications with respect to absolute magnitudes and distances.

  4. Teaching neuroimages: infant with glutaric aciduria type 1 presenting with infantile spasms and hypsarrhythmia.

    PubMed

    Young-Lin, Nichole; Shalev, Sarah; Glenn, Orit A; Gardner, Marisa; Lee, Chung; Wynshaw-Boris, Anthony; Gelfand, Amy A

    2013-12-10

    A 7-month-old boy with glutaric aciduria type 1 (GA1) presented with 1 week of clustered flexor spasms. Examination revealed mild axial hypotonia without encephalopathy. Video-EEG monitoring revealed hypsarrhythmia and infantile spasms (figure, A). MRI showed acute basal ganglia injury (figure, B). After 3 weeks of prednisolone treatment, 5-month follow-up showed continued resolution of hypsarrhythmia and spasms.

  5. Parallel In Situ Screening of Remediation Strategies for Improved Decision Making, Remedial Design, and Cost Savings

    DTIC Science & Technology

    2013-02-01

    November 2012 phosphorus, and vitamin B12. Additionally a reductant reacts directly with hexavalent chromium to reduce it to the trivalent state. SRS...being operated under continuous flow conditions in the laboratory. Entire assembly takes up approximately 5 sq. ft. in a fume hood. . 44 Figure 5-3...61 Figure 5-16. Hexavalent Chromium detected in ISMA effluent post in situ incubation

  6. Efficient Optical Logic, Interconnections and Processing Using Quantum Confined Structures

    DTIC Science & Technology

    1991-05-01

    No bis I With bias Ra ( b ’ OotI o lNo bias Use Il) felectro-refraicc n to phase-s’:t A- X I 3 Wavelength 3 Figure II-1. Efficient modulation in a...operation. The top (bottom) mirror of an AFP structure has an amplitude reflection coefficient of rt( b ) and power reflectivity of RT( B )=Ir0)12, viewed...and ( b ) for the case of a=O and a=ln(rb/rt), respectively. Adding (1) and (2), we obtain the total amplitude reflection rto as: -13- I Ii/V aoabl

  7. 46 CFR 57.05-3 - Limited space qualifications.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING WELDING AND BRAZING... welding or torch brazing of piping on board ship in a limited or restricted space, the space restrictions shown in connection with Figure 57.05-3(a) or (b) shall be used when welding and brazing the test joint...

  8. Evaluation of the 2-(1-Hexyloxyethyl)-2-devinyl pyropheophorbide (HPPH) mediated photodynamic therapy by macroscopic singlet oxygen modeling [J. Biophotonics 9, No. 11-12, 1344-1354 (2016)].

    PubMed

    Penjweini, Rozhin; Kim, Michele M; Liu, Baochang; Zhu, Timothy C

    2017-03-01

    In the article by R. Penjweini, M. M. Kim et al. (doi: 10.1002/jbio.201600121), published in J. Biophotonics 9, 1344-1354 (2016), the constants C 01 , C 02 , b 1 , and b 2 determined from fitting the fluorescence single value decomposition (SVD) for phantoms with different optical properties and the corresponding Figure 2(a) are not correct. This erratum is published to correct the Section 2.3 and Figure 2(a). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Information Encoding on a Pseudo Random Noise Radar Waveform

    DTIC Science & Technology

    2013-03-01

    quadrature mirror filter bank (QMFB) tree diagram [18] . . . . . . . . . . . 18 2.7 QMFB layer 3 contour plot for 7-bit barker code binary phase shift...test signal . . . . . . . . 20 2.9 Block diagram of the FFT accumulation method (FAM) time smoothing method to estimate the spectral correlation ... Samples A m pl itu de (b) Correlator output for an WGN pulse in a AWGN channel Figure 2.2: Effectiveness of correlation for SNR = -10 dB 10 2.3 Radar

  10. Lacking prognostic significance of beta 2-microglobulin, MHC class I and class II antigen expression in breast carcinomas.

    PubMed Central

    Wintzer, H. O.; Benzing, M.; von Kleist, S.

    1990-01-01

    To evaluate the impact of MHC antigen expression on the survival of patients with cancer, 77 human breast carcinomas were investigated for the expression of beta 2-microglobulin (beta 2m), HLA-A,B,C and HLA-DR. Thirty-one benign breast tumours were stained for comparison. The results for the carcinomas were related to the survival data of the cancer patients. The expression of beta 2m, HLA-A,B,C and HLA-DR was significantly lower in malignant tumours compared to the benign lesions. Whereas all benign tumours were positive for beta 2m and HLA-A,B,C and 28/31 positive for HLA-DR the following positivity rates were found in carcinomas: 74/77 for beta 2m, 57/77 for HLA-A,B,C and 10/77 for HLA-DR. The follow-up (median 45 months) of 66 cancer patients for overall survival and of 65 patients for disease-free survival revealed no influence of beta 2m, HLA-A,B,C or HLA-DR expression on the prognosis of this cancer. In conclusion, experimental data indicating the importance of MHC antigens in anti-tumour responses are not confirmed by the analysis of cancer patient survival data. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:2201398

  11. Critical Contribution of RAL GTPases to Growth and Survival of Breast Cancer Cells

    DTIC Science & Technology

    2007-04-01

    similar to the NFkB p50 dimerization domain that falls into the IPT/TIG family of protein domains (Fukai et al., 2003). Given that GTP-bound RalB and TBK1...RalB and Sec5 are required for IRF-3 but not p65 responsiveness to TLR3 activation. HBECs were cotransfected with a plasmid expressing GFP together with...RalA andSec8 were not limiting for this response (Figures 6D and 6E). Poly(I:C)-induced mobilization of p65 NFkB nuclear accumulation is independent of

  12. Computer Program Development Specification for Ada Integrated Environment: KAPSE (Kernel Ada Programming Support Environment)/Database, Type B5, B5-AIE(1).KAPSE(1).

    DTIC Science & Technology

    1982-11-12

    File 1/0 Prgram Invocation Other Access M and Control Services KAPSE/Host Interface most Operating System Peripherals/ 01 su ?eetworks 6282318-2 Figure 3...3.2.4.3.8.5 Transitory Windows The TRANSITORY flag is used to prevent permanent dependence on temporary windows created simply for focusing on a part of the...KAPSE/Tool interfaces in terms of these low-level host-independent interfaces. In addition, the KAPSE/Host interface packages prevent the application

  13. Electrostatic Discharge (ESD) Simulator Experiment (Testing of Some Switches/Relays for Application to an ESD Simulation Circuit)

    DTIC Science & Technology

    1983-10-01

    will be: V(t) = 4,100 et/RC = 4,100 e 5/100 3,900 Volts Note that failure of a device during such test will classify the device as being Class 3 of DOD...Volts) 50 mV/small div., 50 nsec 0.1 mV/small div., 50 nsec (Inverted) NU-N E U Figure 12: (Charging Voltage: +1000 Volts) Figure 13: (Charging Voltage...Ij stchari I-,, i-1)401)0 1 It (uIrllis wi th vovy rt’~dIt- e l b (’i a, Ch .11it(! 11 1~ lit u t’ ~ 0 KV vult*.ge, I’Zinge anld at hw nFgrs 3~s. it

  14. Serial nonenhancing magnetic resonance imaging scans of high grade glioblastoma multiforme.

    PubMed Central

    Moore-Stovall, J.; Venkatesh, R.

    1993-01-01

    Magnetic resonance imaging (MRI) from clinical experience has proven to be superior to all other diagnostic imaging modalities, including computed tomography (CT) in the detection of intracranial neoplasms. Although glioblastoma multiforme presents a challenge for all diagnostic imaging modalities including MRI, MRI is paramount to CT in detecting subtle abnormal water accumulation in brain tissue caused by tumor even before there is disruption of the blood brain barrier. Currently, clinical research and investigational trials on nonionic gadolinium contrast agents have proven that nonionic gadolinium HP-DO3A (ProHance) contrast agents have lower osmolality and greater stability, which make them superior compounds to gadolinium diethylenetriamine-pentacetic acid (Gd-DTPA). Therefore, the nonionic gadolinium contrasts have been safely administered more rapidly, in higher or multiple doses for contrast enhanced MRI without adverse side effects or changes in serum iron or total bilirubin, and the intensity of the area of enhancement and number of lesions detected were superior to that of Gd-DTPA (Magnevist) at the standard dose (0.1 mmol/Kg). Perhaps if the nonionic gadolinium contrast agent, ProHance, had been approved by the Food and Drug Administration (FDA) when this MRI was performed in 1990 it would have aided in providing contrast enhancement and visualization of the tumor lesion to assist in patient diagnosis and management. Magnetic resonance imaging also provides unique multiplanar capabilities that allow for optimal visualization of the temporal and occipital lobes of the brain without bone interference.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9A Figure 9B Figure 10 Figure 11 Figure 12 Figure 13 PMID:8382751

  15. A pancreatic venular defect in the BB/Wor rat.

    PubMed Central

    Majno, G.; Joris, I.; Handler, E. S.; Desemone, J.; Mordes, J. P.; Rossini, A. A.

    1987-01-01

    BB rats develop spontaneous autoimmune diabetes mellitus characterized morphologically by insulitis, an inflammatory lymphocytic infiltration of the islets of Langerhans. To investigate the role of the vascular endothelium of the pancreas in this destructive process, the authors injected diabetes-prone (DP) and diabetes-resistant (DR) BB/Wor rats as well as other nondiabetic strains of rats with Monastral blue B, a colloidal pigment that identifies leaky microvasculature. They found evidence of a venular defect limited to the pancreas that is specific to the BB rat. Light- and electron-microscopic evidence suggests that this defect is due to a population of trapped (marginating) intravascular monocytes, which may be activated by the colloidal pigment and release vasoactive mediators. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:3618725

  16. Test Methods for Telemetry Systems and Subsystems. Volume 2: Test Methods for Telemetry Radio Frequency (RF) Subsystems

    DTIC Science & Technology

    2012-09-01

    downconverters; telemetry RF preamplifiers; telemetry multicouplers; telemetry receivers 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT Same as...Continuing Engineering Education Program, George Washington University , 1994. A-5 Figure A-2. Graphical representation of intercept point...NFdb) is expressed in decibels and noise factor (nf ) in decimal units. For example, a noise figure of 3 dB corresponds to a noise factor of 2

  17. The leather ankle lacer.

    PubMed Central

    Saltzman, C. L.; Shurr, D.; Kamp, J.; Cook, T. A.

    1995-01-01

    The purpose of this study was to evaluate the efficacy of a leather ankle lacer for treating painful problems of the ankle and hindfoot. The evaluation involved patient self assessment, clinical examination and radiographic determination of the effectiveness of the ankle lacer. Overall, patients had moderate pain relief with significant but not complete restriction of motion. Based on this study and our clinical experience, we find the leather ankle lacer to be a compliant and comfortable treatment strategy for patients with painful ankle and hindfoot problems who desire some retained motion. Images Figure 1A & B Figure 2 Figure 3 PMID:7634034

  18. Exploratory Visual Analytics of a Dynamically Built Network of Nodes in a WebGL-Enabled Browser

    DTIC Science & Technology

    2014-01-01

    dimensionality reduction, feature extraction, high-dimensional data, t-distributed stochastic neighbor embedding, neighbor retrieval visualizer, visual...WebGL-enabled rendering is supported natively by browsers such as the latest Mozilla Firefox , Google Chrome, and Microsoft Internet Explorer 11. At the...appropriate names. The resultant 26-node network is displayed in a Mozilla Firefox browser in figure 2 (also see appendix B). 3 Figure 1. The

  19. Design of an NF-kB Activation-Coupled Apoptotic Molecule for Prostate Cancer Therapy

    DTIC Science & Technology

    2008-07-31

    p65-LS) hetero-dimer. We used this immunocomplex for caspase activity assay using a colorimetric caspase activity assay kit ( Biovision ). The...by a Caspase-3 colorimetric assay kit ( BioVision ). The purified Caspase-3 (10 ng) was used as a positive control in the assay. As shown in Figure...caspase-3 activity assay with a caspase-3 activity assay kit ( BioVision ). The activity of caspase-3 is in an arbitrary unit. 16 c), co-expressed

  20. Optimum ADP Support for Financial Management of Marine Corps Facilities Maintenance.

    DTIC Science & Technology

    1983-06-01

    The final results are always in danger of being less than all- inclusive as it is easy to miss some informa- tion while researching the diverse files...WORK-GENRTE-Cr5 DE 01200 SUB-DESCRIPTORS 01300 SA IS JOE BYTES 1 TO 5, 01400 SB IS JCN BYTES 6 TO 6, 01500 SC IS JCN BYTES 7 TO 8 C16CO SD IS JON...Fact 11%1011Mae teac offf I ON of f Icr riAnrrvitane Facilities peaiintiia Figure B.2 Facilities’Maintenance Department. de - 110 Figure B.3

  1. Heterocycles Based on Group III, IV, and V Elements, Precursors for Novel Glasses and Ceramics

    DTIC Science & Technology

    1990-08-01

    OF TABLES v LIST OF FIGURES vi 1. ABSTRACT 1 2. INTRODUCTION 3 3. RESULTS AND DISCUSSION 5 3.1 Synthesis and Thermolysis of Aluminum...Chloride.Hexamethyldisilazane Adduct 5 3.2 Synthesis and Reactions of Bis(trimethylsilyl)- aminoaluminum Compounds 11 3.3 Reactions of Tris[bis(trimethylsilyl)amino...Et3N.C12AIN(SiMe3 )B(NH2 )NHSiMe3 , a processible precursor to AlN.BN ceramic. Attempts at synthesis of other AlN.BN precursors and AINP systems were

  2. 16 CFR Figure 3 to Part 1508 - Figure 3 to Part 1508

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Figure 3 to Part 1508 3 Figure 3 to Part 1508 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL HAZARDOUS SUBSTANCES ACT REGULATIONS REQUIREMENTS FOR FULL-SIZE BABY CRIBS Pt. 1508, Fig. 3 Figure 3 to Part 1508 EC03OC91.063 [47 FR...

  3. 16 CFR Figure 3 to Part 1509 - Figure 3 to Part 1509

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Figure 3 to Part 1509 3 Figure 3 to Part 1509 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION FEDERAL HAZARDOUS SUBSTANCES ACT REGULATIONS REQUIREMENTS FOR NON-FULL-SIZE BABY CRIBS Pt. 1509, Fig. 3 Figure 3 to Part 1509 EC03OC91.066 [47...

  4. Before Nugent took charge: early efforts to reform chiropractic education, 1919-1941

    PubMed Central

    Keating, Joseph C

    2003-01-01

    John J. Nugent, D.C. is remembered by many as either the “Abraham Flexner of Chiropractic” or the “anti-Christ of Chiropractic.” From 1941 until his forced retirement in 1959, the Irish-born Palmer graduate was one of the most important factors in the profession's educational reforms. Yet Nugent's work as the National Chiropractic Association's (NCA's) director of research was not the beginning of the campaign to upgrade chiropractic education. This paper looks at earlier influences and events which set the stage for Nugent's campaign. Among these were the introduction of licensure for chiropractors, the self-defeating actions of B.J. Palmer, the introduction of basic science legislation, the lethargy of the schools, and the struggle for control of education between the schools, on the one hand, and the NCA and the Council of State Chiropractic Examining Boards on the other ImagesFigure 1Figure 3Figure 4Figure 5Figure 6Figure 7Figure 9Figure 10Figure 11Figure 12Figure 13Figure 14Figure 15Figure 16Figure 17Figure 18Figure 19Figure 20Figure 21Figure 22Figure 23Figure 24Figure 25Figure 26Figure 28Figure 29Figure 30Figure 31Figure 32Figure 33Figure 34Figure 35Figure 36Figure 37Figure 38

  5. Targeting Paclitaxel-Loaded Nanoparticles to Ovarian Cancer

    DTIC Science & Technology

    2010-05-01

    nanoparticle of »20 nm in aqueous solutions as determined by dynamic light scattering (2) Figure 1. Figure 1 In our studies, this new nanoparticle...Selective Integrin avb3 Antagonists. J Am Chem Soc. 1996;118:7461-72. 11. Jolimaitre P , Poirier C, Richard A, Blanpain A, Delord B, Roux D, et al...Tissue-penetrating delivery of compounds and nanoparticles into tumors. Cancer Cell. 2009;16:510-20. 15. Laakkonen P , Porkka K, Hoffman JA, Ruoslahti

  6. The avian respiratory system: a unique model for studies of respiratory toxicosis and for monitoring air quality.

    PubMed Central

    Brown, R E; Brain, J D; Wang, N

    1997-01-01

    There are many distinct differences (morphologic, physiologic, and mechanical) between the bird's lung-air-sac respiratory system and the mammalian bronchoalveolar lung. In this paper, we review the physiology of the avian respiratory system with attention to those mechanisms that may lead to significantly different results, relative to those in mammals, following exposure to toxic gases and airborne particulates. We suggest that these differences can be productively exploited to further our understanding of the basic mechanisms of inhalant toxicology (gases and particulates). The large mass-specific gas uptake by the avian respiratory system, at rest and especially during exercise, could be exploited as a sensitive monitor of air quality. Birds have much to offer in our understanding of respiratory toxicology, but that expectation can only be realized by investigating, in a wide variety of avian taxa, the pathophysiologic interactions of a broad range of inhaled toxicants on the bird's unique respiratory system. Images p188-a Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. A Figure 5. B Figure 5. C Figure 6. Figure 7. Figure 8. PMID:9105794

  7. Giant Olfactory Meningiomas

    PubMed Central

    d'Avella, Domenico; Salpietro, Francesco M.; Alafaci, Cetty; Tomasello, Francesco

    1999-01-01

    Olfactory groove meningiomas may attain surprisingly large size. The subfrontal approach is currently the route preferred by most neurosurgeons for their excision. The pterional-transsylvian route represents an alternate exposure for microsurgery of frontobasal tumors. Although this approach has been already described for olfactory meningiomas, tumors of giant size were not specifically addressed in the literature. We report the application of the pterional-transsylvian approach in six patients with giant olfactory meningiomas. This series is unique because it includes only patients with tumors exceeding 6 cm in diameter with bilateral symmetrical development. A radical removal was achieved in all patients and all of them made a full recovery. To investigate the relevance of the pterional-transsylvian approach for minimizing surgical morbidity, a magnetic resonance imaging protocol was designed to characterize even subtle postoperative frontal lobe structural changes. These changes, limited to the frontal lobe ipsilateral to exposure and localized in specific anatomical domains of the prefrontal area, included cystic degenerative alterations, parenchymal gliosis, and associated persistent white matter edema. Results from the present series strengthen the usefulness of the pterional-transsylvian approach as a safe surgical route for lesions affecting the anterior skull base, even with huge bilateral symmetrical expansion, such as giant olfactory meningiomas. ImagesFigure 1Figure 2Figure 3p26-bFigure 4p27-bFigure 5Figure 6Figure 7 PMID:17171078

  8. Hidden Markov Model as a Framework for Situational Awareness

    DTIC Science & Technology

    2008-07-01

    line of sight unlike the PIR sensor – they complement each other. Magnetic sensor (B-field sensor): We used both Fluxgate and coil magnetometers ...The former has low frequency response while the coil magnetometer provides high frequency response. A total of six sensors: three fluxgate ...Computer is turned off Figure 7: Fluxgate magnetometer output in x-axis 0 50 100 150 200 250 300 350 400 450 2.6 2.8 3 3.2 3.4 3.6 3.8 4 Time (sec

  9. Studies of Highly Excited Atoms.

    DTIC Science & Technology

    1986-04-02

    R 2 o i86 Chemical Physics Laboratory " i 0. R . Abrahamson i Vice President Physical Fciences Division ri" - c. -:OP...34 - men I IN RO U TI, .. . . . . . . . . . - .... .... o .. . . . o ......... - TI R SOPA T C LLIS OWZ.... ... . 6 ... ... oo ... .... ... .... . - A...by WA =W + 1ns- 0 (3a) and R = 1’np + ’(n-l)p (3b) .* 7_7. ’ P. z Atom 2 ’b y tom1 SA-846 1-30A FIGURE 2 GEOMETRY OF THE COLLISION OF TWO ATOMS Atom I

  10. Embedding and Publishing Interactive, 3-Dimensional, Scientific Figures in Portable Document Format (PDF) Files

    PubMed Central

    Barnes, David G.; Vidiassov, Michail; Ruthensteiner, Bernhard; Fluke, Christopher J.; Quayle, Michelle R.; McHenry, Colin R.

    2013-01-01

    With the latest release of the S2PLOT graphics library, embedding interactive, 3-dimensional (3-d) scientific figures in Adobe Portable Document Format (PDF) files is simple, and can be accomplished without commercial software. In this paper, we motivate the need for embedding 3-d figures in scholarly articles. We explain how 3-d figures can be created using the S2PLOT graphics library, exported to Product Representation Compact (PRC) format, and included as fully interactive, 3-d figures in PDF files using the movie15 LaTeX package. We present new examples of 3-d PDF figures, explain how they have been made, validate them, and comment on their advantages over traditional, static 2-dimensional (2-d) figures. With the judicious use of 3-d rather than 2-d figures, scientists can now publish, share and archive more useful, flexible and faithful representations of their study outcomes. The article you are reading does not have embedded 3-d figures. The full paper, with embedded 3-d figures, is recommended and is available as a supplementary download from PLoS ONE (File S2). PMID:24086243

  11. Embedding and publishing interactive, 3-dimensional, scientific figures in Portable Document Format (PDF) files.

    PubMed

    Barnes, David G; Vidiassov, Michail; Ruthensteiner, Bernhard; Fluke, Christopher J; Quayle, Michelle R; McHenry, Colin R

    2013-01-01

    With the latest release of the S2PLOT graphics library, embedding interactive, 3-dimensional (3-d) scientific figures in Adobe Portable Document Format (PDF) files is simple, and can be accomplished without commercial software. In this paper, we motivate the need for embedding 3-d figures in scholarly articles. We explain how 3-d figures can be created using the S2PLOT graphics library, exported to Product Representation Compact (PRC) format, and included as fully interactive, 3-d figures in PDF files using the movie15 LaTeX package. We present new examples of 3-d PDF figures, explain how they have been made, validate them, and comment on their advantages over traditional, static 2-dimensional (2-d) figures. With the judicious use of 3-d rather than 2-d figures, scientists can now publish, share and archive more useful, flexible and faithful representations of their study outcomes. The article you are reading does not have embedded 3-d figures. The full paper, with embedded 3-d figures, is recommended and is available as a supplementary download from PLoS ONE (File S2).

  12. Tools to Compare Diving-Animal Kinematics with Acoustic Behavior and Exposure

    DTIC Science & Technology

    2011-09-30

    to humpback whales; under Dr. Stephen Insley, then at the University of California at Santa Cruz , to northern fur seals (Figure 3; Insley et al...Richardson (Anchorage, Alaska) and Dr. Manuel Castellote of the National Marine Mammal Laboratory to assess applicability of the Acousonde 3B to

  13. 49 CFR Appendix B to Part 220 - Recommended Pronunciation of Numerals

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ...”should be used preceding such numbers. Numbers should be pronounced as follows: Number Spoken 0 ZERO. 1 WUN. 2 TOO. 3 THUH-REE-. 4 FO-WER. 5 FI-YIV. 6 SIX. 7 SEVEN. 8 ATE. 9 NINER. (The figure ZERO should be written as “0” to distinguish it from the letter “O”. The figure ONE should be underlined to...

  14. Expression of most matrix metalloproteinase family members in breast cancer represents a tumor-induced host response.

    PubMed Central

    Heppner, K. J.; Matrisian, L. M.; Jensen, R. A.; Rodgers, W. H.

    1996-01-01

    Matrix metalloproteinase (MMP) family members have been associated with advanced-stage cancer and contribute to tumor progression, invasion, and metastasis as determined by inhibitor studies. In situ hybridization was performed to analyze the expression and localization of all known MMPs in a series of human breast cancer biopsy specimens. Most MMPs were localized to tumor stroma, and all MMPs had very distinct expression patterns. Matrilysin was expressed by morphologically normal epithelial ducts within tumors and in tissue from reduction mammoplasties, and by epithelial-derived tumor cells. Many family members, including stromelysin-3, gelatinase A, MT-MMP, interstitial collagenase, and stromelysin-1 were localized to fibroblasts of tumor stroma of invasive cancers but in quite distinct, and generally widespread, patterns. Gelatinase B, collagenase-3, and metalloelastase expression were more focal; gelatinase B was primarily localized to endothelial cells, collagenase-3 to isolated tumor cells, and metalloelastase to cytokeratin-negative, macrophage-like cells. The MMP inhibitor, TIMP-1, was expressed in both stromal and tumor components in most tumors, and neither stromelysin-2 nor neutrophil collagenase were detected in any of the tumors. These results indicate that there is very tight and complex regulation in the expression of MMP family members in breast cancer that generally represents a host response to the tumor and emphasize the need to further evaluate differential functions for MMP family members in breast tumor progression. Images Figure 1 Figure 2 Figure 3 PMID:8686751

  15. HF Interference, Procedures and Tools (Interferences HF, procedures et outils)

    DTIC Science & Technology

    2007-06-01

    Systems 3-2 3.1.2 Medium (MV) and Low Voltage (LV) Systems 3-4 3.1.3 Access Systems 3-5 3.1.4 In-House Systems 3-7 3.1.5 Technical Characteristics...Grounded Monopole Antenna Figure 2.3-3 Low Natural Noise Measured in Germany 2-15 Figure 2.3-4 Minimum Natural Noise Measured in Germany 1985 and in...arrows) Figure 3.1.1-2 Basic BPL System 3-3 Figure 3.1.2-1 Power Line TN-C-S Network 3-5 Figure 3.1.3-1 Usual Low Voltage Electricity Distribution

  16. 40 CFR Appendix B to Subpart B of... - Standard for Recover Equipment

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... process it to ARI (Air-Conditioning and Refrigeration Institute) standard 700-93 as a minimum. It is not... equipment capability is required which shall process contaminated refrigerant samples at specific... flare male thread connection as identified in SAE J639 CFC-12 High Pressure Charging Valve Figure 2. 6.3...

  17. 40 CFR Appendix B to Subpart B of... - Standard for Recover Equipment

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... process it to ARI (Air-Conditioning and Refrigeration Institute) standard 700-93 as a minimum. It is not... equipment capability is required which shall process contaminated refrigerant samples at specific... flare male thread connection as identified in SAE J639 CFC-12 High Pressure Charging Valve Figure 2. 6.3...

  18. 40 CFR Appendix B to Subpart B of... - Standard for Recover Equipment

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... process it to ARI (Air-Conditioning and Refrigeration Institute) standard 700-93 as a minimum. It is not... equipment capability is required which shall process contaminated refrigerant samples at specific... flare male thread connection as identified in SAE J639 CFC-12 High Pressure Charging Valve Figure 2. 6.3...

  19. 40 CFR Appendix B to Subpart B of... - Standard for Recover Equipment

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... process it to ARI (Air-Conditioning and Refrigeration Institute) standard 700-93 as a minimum. It is not... equipment capability is required which shall process contaminated refrigerant samples at specific... flare male thread connection as identified in SAE J639 CFC-12 High Pressure Charging Valve Figure 2. 6.3...

  20. 40 CFR Appendix B to Subpart B of... - Standard for Recover Equipment

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... process it to ARI (Air-Conditioning and Refrigeration Institute) standard 700-93 as a minimum. It is not... equipment capability is required which shall process contaminated refrigerant samples at specific... flare male thread connection as identified in SAE J639 CFC-12 High Pressure Charging Valve Figure 2. 6.3...

  1. Effects of High Pressure on Membrane Ion Binding and Transport.

    DTIC Science & Technology

    1980-12-31

    diffusion in red cell membranes have appar- ent activation volumes of 40 ml/mol in agreement with data on liposomes, and ,6) perturbations in osmotic...Extrapolated to the Red Cell? (page 15) B. Pressure Dependence of Butanol Diffusion (page 17) C. Development of a High Pressure Stop-Flow (page 19...page 16 Figure 3 -- Pressure effect on the diffusion coefficient n-butanol in packed human red cells ................... page 18 Figure 9

  2. Exploitation of Self Organization in UAV Swarms for Optimization in Combat Environments

    DTIC Science & Technology

    2008-03-01

    behaviors and entangled hierarchy into Swarmfare [59] UAV simulation environment to include these models. • Validate this new model’s success through...Figure 4.3. The hierarchy of control emerges from the entangled hierarchy of the state relations at the simulation , swarm and rule/behaviors level...majors, major) Abstract Model Types (AMT) Figure A.1: SO Abstract Model Type Table 142 Appendix B. Simulators Comparision Name MATLAB Multi UAV MultiUAV

  3. Neurobiology of Soman

    DTIC Science & Technology

    1991-06-30

    seizures In rats. Neurosc. Let 70. 69-74. Millan, M.H., S. Patel, and B.S. Meldrum (1988). The involvement of excitatory mino acid receptors within...a marker specific to astrocytes, glial fibrillary acidic protein (GFAP). We have used this marker to demonstrate that astrocytes are activated soon...88 I I I I I I IUST OF FIGURES Figure 1. Rapid, selective induction of c-fos and glial fibrillary acidic protein (GFAP) In piriform cortex 3 (PC

  4. Tuning and Freezing Disorder in Photonic Crystals using Percolation Lithography

    DTIC Science & Technology

    2016-01-21

    The 3D photonic crystals used in this work were inverse -opal films (IOFs) made of silica, and were fabricated on silicon substrates using an...receding species become increasingly isolated defects that are homogeneously distributed in the film. Once the Figure 1. Tuning disorder in inverse -opal...angular distribution of Figure 2. Simulated evolution of disorder in inverse -opal films (IOFs) due to partial wetting and drying. (A,B) Percolation

  5. Scientific and Engineering Studies, Compiled 1989. Signal Processing Studies

    DTIC Science & Technology

    1989-01-01

    Version W(t,f) . . . . . .......... 25 3 W(t,f) for Real Waveform s(t) ............... 25 4 Contour of WDF (72) at l/e Relative Level . . . . . . . . . 30...spectral level , (189) B Passband of filter H, figure 8 Duration of weighting v, figure 8 LFM Linear Frequency Modulation sgn(x) 1 for x > 0, -1 for x...figure 4. the area of thl parir( Iua level ellipse is 1/2 In the t.f Vifne Wher this area i *, rlt IVe! bl ty e peak height of ?[, the product Is . *ýich

  6. Dissecting the Molecular Mechanism of RhoC GTPase Expression in the Normal and Malignant Breast

    DTIC Science & Technology

    2011-09-01

    and cancer. Nature reviews 2, 133-142. Valastyan, S., Reinhardt, F ., Benaich, N., Calogrias, D., Szasz, A.M., Wang, Z.C., Brock, J.E., Richardson...prostate cancer progression. Cancer cell 17, 443-454.   R ho C F IS H Normal SUM149 SUM190A Figure 1 75 75 75 0 0 0 0 200 R ea ds (R P K M ) R...RhoC A B C D Figure 3 0 5 10 15 20 25 HME MCF7 SUM149 MDA-MB-231 Fo ld E nr ic hm en t o f p 65 B in di ng p65 (-2834) p65 (-2259) p65 (-6) A B

  7. A Mouse Model for the Cloning of a Tumor Suppressor Gene Mutated in Sporadic Breast Cancer

    DTIC Science & Technology

    1997-07-01

    deletion. Figure 1 COLJA2 c-MET CFTR m ch -// 6’/- Cola-2 c-Met Cftr Ob D6MIT138 Objective 2. Analysis of the deletion allele of mouse chromosome 6...I- I I I I ; I ............. 2.88Kb - cftrexon3 % 2I IIO i M I I - hprt lox PGK-Neo-bGHpA 2 z I I III "’I I I bGHpA-Neo-PGK tox hprt 4.6 Kb 18.2...antibiotics. 16 Dr. Henry B. Skinner Figure 6 mch 6 0-0- 7 / D6MITIXX Cfbr Cre + HAT Selection m ch 6 0"-/, D6MITIXX-Cftr However, HAT resistant colonies

  8. Signal Processing and Imaging with Ultrasonic Guided Waves: Goals, Challenges and Recent Progress (Preprint)

    DTIC Science & Technology

    2012-07-01

    SHM). 3 Approved for public release; distribution unlimited. The transducers, which are Lead Zirconate Titanate ( PZT ) discs, are permanently... fatigued . Data were recorded as a function of load before the hole was drilled, after the hole was drilled, and at intervals thereafter as a function...of fatigue life. Figure 7 illustrates the effects of matched loads on a fatigue crack about 5 mm in length. Figures 7(a), (b) and (c) correspond

  9. A wideband CMOS single-ended low noise amplifier employing negative resistance technique

    NASA Astrophysics Data System (ADS)

    Guo, Benqing; Chen, Hongpeng; Wang, Xuebing; Chen, Jun; Li, Yueyue; Jin, Haiyan; Yang, Yongjun

    2018-02-01

    A wideband common-gate CMOS low noise amplifier with negative resistance technique is proposed. A novel single-ended negative resistance structure is employed to improve gain and noise of the LNA. The inductor resonating is adopted at the input stage and load stage to meet wideband matching and compensate gain roll-off at higher frequencies. Implemented in a 0.18 μm CMOS technology, the proposed LNA demonstrates in simulations a maximal gain of 16.4 dB across the 3 dB bandwidth of 0.2-3 GHz. The in-band noise figure of 3.4-4.7 dB is obtained while the IIP3 of 5.3-6.8 dBm and IIP2 of 12.5-17.2 dBm are post-simulated in the designed frequency band. The LNA core consumes a power dissipation of 3.8 mW under a 1.5 V power supply.

  10. Scientific Presentations on Superconductivity from 2002-2005

    DTIC Science & Technology

    2006-01-01

    00 Dark-field reflection, using 211 diffraction vector Bright-field transmission (2111.6nm/1236.6nm)x35, ~ 80 sec interval • 211 Density ~ 3x1011...1.8.1 2b.1.9 High Resolution SEM Figure 2b.1.9.1 Y211/YBCO film on LAO (PV43D) At 77K and at 3T magnetic feild 0 0.2 0.4 0.6 0.8 1 1.2

  11. Prevalence of human papillomavirus in middle ear carcinoma associated with chronic otitis media.

    PubMed Central

    Jin, Y. T.; Tsai, S. T.; Li, C.; Chang, K. C.; Yan, J. J.; Chao, W. Y.; Eng, H. L.; Chou, T. Y.; Wu, T. C.; Su, I. J.

    1997-01-01

    Squamous cell carcinoma of the middle ear (MESCC) is an uncommon tumor and is associated with a history of long-term chronic otitis media (COM) in most cases. Although the human papillomaviruses (HPVs) have been implicated in many human neoplasms, its role in the pathogenesis of MESCC has not been studied. Polymerase chain reaction (PCR) using consensus primers for the detection of HPV types 6, 11, 16, 18, 31, 33, 52b, and 58 was applied in screening fourteen cases of MESCC from archival material. Further subtyping was performed by restriction enzyme digestion of PCR products and by in situ hybridization method on tissue sections. Of the fourteen cases of MESCC, eleven were found to have HPV DNA. HPV-16 was detected in all positive cases. Five cases revealed both HPV-16 and -18. A history of long-term COM (> 3 years) was found in thirteen of the cases. This is the first report to localize HPV-16/18 in MESCC on both the tissue level and the molecular level. The high prevalence of HPV in COM-associated MESCC therefore provides a good model to explain the pathogenesis of chronic-inflammation-related human malignancies. Images Figure 1 Figure 2 Figure 3 Figure 5 Figure 6 Figure 4 PMID:9094989

  12. 24 CFR 3285.304 - Pier configuration.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... inches; (2) The concrete blocks must be stacked with their hollow cells aligned vertically; and (3) When... across capped-hollow block piers, as shown in Figures A and B to § 3285.306. (2) Caps must be solid...

  13. Titan Haze is Falling

    NASA Image and Video Library

    2011-05-05

    The change in Titan haze layer is illustrated in this figure, derived from data obtained by NASA Cassini spacecraft. The picture of Titan in panel a was taken on May 3, 2006, panel b was taken on April 2, 2010.

  14. Medical Surveillance Monthly Report (MSMR). Volume 3, Number 3, April 1997

    DTIC Science & Technology

    1997-04-01

    and satellite clinics. Not all sites reporting. Date of Report: 7-Apr-97 ** Other STDs: (a) Chancroid (b) Granuloma Inguinale (c) Lymphogranuloma ... Venereum (d) Syphilis unspec. (e) Syph, tertiary (f) Syph, congenital MSMRVol. 03 / No. 03 7 Active Duty Other FIGURE II. Reportable sexually...98 Lymphogranuloma Vnrm 1 3 3 5 12 Yellow fever 0 0 0 0 0 Total 2039 2044 1851 1539 7473 * Based on date of onset. Date of report: 7-Apr-97

  15. Behavior of Materials at Cold Regions Temperatures. Part 1. Program Rationale and Test Plan

    DTIC Science & Technology

    1988-07-01

    10 15 i" 0% I 0 0 0 2 3 4 5a 0 1 2 3 4 5 6 7 lf CSTRAIN (IN/INbST AI OW N V, Figure B47. Static stress vs strain curves for resilient expanded ... polystyrene foam (Resilo-Pak) , at temperature extremes (0.5, 0. 75 and 1.3 lb Ifft3 densities) (Titus 1967). so ,eSF 50 -- 8 * TEMPERATURE. K 0 so 100 is

  16. Binary Star Orbits. 3. Revisiting the Remarkable Case of Tweedledum and Tweedledee

    DTIC Science & Technology

    2010-06-11

    Observation Date 0.00 0.05 0.10 0.15 0.20 S ep ar at io n D iff er en ce FIN 332 Aa,Ab Unresolved Aa,Ab bB,aBdevlosernU bB,aB 233 NIF 1960 1970 1980 1990...2000 2010 Observation Date 0 50 100 150 200 P os iti on A ng le D iff er en ce FIN 332 Aa,Ab Unresolved Aa,Ab bB,aBdevlosernU bB,aB 233 NIF Figure

  17. Collaborative Research and Development (CR&D). Task Order 0061: Modeling Complex Structural Geometry and Process Interaction

    DTIC Science & Technology

    2008-05-01

    a Titanium and Gamma-TiAl Alloy, JOM, September 2005, 50-54 4 Chapter 1 [ref3] Caton, M.J., Jha, S.K., Larsen, J.M., Rosenberger, A.H., TMS...Figure 5: Notch 3 strain distribution at 900MPa 25 Chapter 3 Figure 6 : Notch 3 inverse pole figure of local microstructure. Figure 7: Notch 4 ...showing the local grain structure Figure 6 : Local strain distribution at 986MPa calculated from 36 Chapter 4 Figure 7: Secondary electron

  18. THRUST AUGMENTED NOZZLE (TAN) the New Paradigm for Booster Rockets

    DTIC Science & Technology

    2006-07-12

    station. The engine has to throttle to 34 percent (3X or 1020 psia) to keep from exceeding the acceleration limits. Figure 6. Baseline SSTO ...vehicle powered by seven up-sized SSME class engines. Figure 7. Baseline SSTO vehicle trajectory. With a payload fraction of 1 percent, it does not...want to invest in such a risky endeavor. American Institute of Aeronautics and Astronautics 6 B. TAN-Powered SSTO Vehicle For the Dual Fuel TAN

  19. Energy Harvesting & Recapture from Human Subjects: Dual-Stage MEMS Cantilever Energy Harvester

    DTIC Science & Technology

    2015-03-01

    15 Figure 5. (a) In-plane overlap-varying capacitive harvester, (b) In-plane gap-closing capacitive harvester, (c) Out -of-plane gap-closing...capacitive harvester, (c) Out -of-plane gap-closing capacitive harvester [1] The two-way arrows in each subpart of Figure 5 indicate the shuttle’s direction...are compatible with other wafer -based technologies. Bismuth Telluride (Bi2Te3), a common Seebeck thermoelectric material, is able to be processed

  20. Apert Syndrome: Molecularly Confirmed C.758C>G (P.Pro253Arg) in FGFR2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cha Gon, Lee, E-mail: leechagon@eulji.ac.kr

    A 5-day-old girl was referred to our clinic for evaluation of congenital malformations. She was identified with a pathogenic mutation c.758C>G (p.Pro253Arg) in FGFR2 gene using targeted exome sequencing. The de novo mutation was confirmed with Sanger sequencing in the patient and her parents. She showed occipital plagiocephaly with frontal bossing (Figure A and B). Skull frontal and lateral radiography revealed fusion of most of the sutures except coronal suture, with convolutional markings (Figure D and E). She had complete cleft palate (Figure C). Her fused bilateral hands showed type II syndactyly with complete syndactyly between the ring and themore » little fingers (Figure F1-F3). Both toes were simple syndactyly with side-to-side fusion of skin (Figure G1-)« less

  1. Design and Testing of the ARL Squeeze 4 Helical Flux Compression Generator

    DTIC Science & Technology

    2013-06-01

    armature makes contact. Centering the armature inside the coil was accomplished with three machined polyurethane (4 lb/ft3 Lastafoam)3 foam rings. A...after shrinking was ~1 mm thick. The explosive charge was comprised of a paper- reinforced phenolic cylinder filled with Comp-B explosive fill. The...backfilled with polyester resin. Foam rubber was placed between coil windings (figure 3a). All other subsequent experiments used a custom rapid-prototyped

  2. Effect of Specimen Thickness on the Creep Response of a Single Crystal Superalloy (Preprint)

    DTIC Science & Technology

    2012-01-01

    0.38mm. 3.1.2. Fractography Figure 5: SEM images of the sheet specimen of thickness 3.18mm creep tested at 760◦C/758MPa, (a) Specimen reconstructed after...with dotted rectangle in (b). To further explore the mechanism behind thickness debit effect, we performed stan- dard fractography using secondary...thickness 3.18mm ruptured after 210hours. 3.2.3. Fractography The SEM image of the reconstructed creep ruptured specimen of thickness 3.18mm is shown in

  3. Determining Optimal Evacuation Decision Policies for Disasters

    DTIC Science & Technology

    2012-03-01

    18 3.3 Calculating the Hit Probability ( Phit ) . . . . . . . . . . . . . . . . . . 20 3.4 Phit versus Vertical...23 Figure 3.13 Large Probability Matrix (Map) . . . . . . . . . . . . . . . . . . . . . 24 Figure 3.14 Particle Trajectory with Phit data...26 Figure 3.15 Phit versus Vertical Volatility . . . . . . . . . . . . . . . . . . . . . . 27 Figure 4.1 Cost-To

  4. E-band Nd 3+ amplifier based on wavelength selection in an all-solid micro-structured fiber

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dawson, Jay W.; Kiani, Leily S.; Pax, Paul H.

    Here, a Nd 3+ fiber amplifier with gain from 1376 nm to 1466 nm is demonstrated. This is enabled by a wavelength selective waveguide that suppresses amplified spontaneous emission between 850 nm and 1150 nm. It is shown that while excited state absorption (ESA) precludes net gain below 1375 nm with the exception of a small band from 1333 nm to 1350 nm, ESA diminishes steadily beyond 1375 nm allowing for the construction of an efficient fiber amplifier with a gain peak at 1400 nm and the potential for gain from 1375 nm to 1500 nm. A peak small signalmore » gain of 13.3 dB is measured at 1402 nm with a noise figure of 7.6 dB. Detailed measurements of the Nd 3+ emission and excited state absorption cross sections suggest the potential for better performance in improved fibers. Specifically, reduction of the fiber mode field diameter from 10.5 µm to 5.25 µm and reduction of the fiber background loss to <10 dB/km at 1400 nm should enable construction of an E-band fiber amplifier with a noise figure < 5 dB and a small signal gain > 20 dB over 30 nm of bandwidth. Such an amplifier would have a form factor and optical properties similar to current erbium fiber amplifiers, enabling modern fiber optic communication systems to operate in the E-band with amplifier technology similar to that employed in the C and L bands.« less

  5. E-band Nd 3+ amplifier based on wavelength selection in an all-solid micro-structured fiber

    DOE PAGES

    Dawson, Jay W.; Kiani, Leily S.; Pax, Paul H.; ...

    2017-03-13

    Here, a Nd 3+ fiber amplifier with gain from 1376 nm to 1466 nm is demonstrated. This is enabled by a wavelength selective waveguide that suppresses amplified spontaneous emission between 850 nm and 1150 nm. It is shown that while excited state absorption (ESA) precludes net gain below 1375 nm with the exception of a small band from 1333 nm to 1350 nm, ESA diminishes steadily beyond 1375 nm allowing for the construction of an efficient fiber amplifier with a gain peak at 1400 nm and the potential for gain from 1375 nm to 1500 nm. A peak small signalmore » gain of 13.3 dB is measured at 1402 nm with a noise figure of 7.6 dB. Detailed measurements of the Nd 3+ emission and excited state absorption cross sections suggest the potential for better performance in improved fibers. Specifically, reduction of the fiber mode field diameter from 10.5 µm to 5.25 µm and reduction of the fiber background loss to <10 dB/km at 1400 nm should enable construction of an E-band fiber amplifier with a noise figure < 5 dB and a small signal gain > 20 dB over 30 nm of bandwidth. Such an amplifier would have a form factor and optical properties similar to current erbium fiber amplifiers, enabling modern fiber optic communication systems to operate in the E-band with amplifier technology similar to that employed in the C and L bands.« less

  6. Highly Efficient Surface Enhanced Raman Scattering (SERS) Nanowire/Ag Composites

    DTIC Science & Technology

    2007-01-01

    nanowires are sensitive at low concen- trations, quite repeatable, and inexpensive to produce. Technical Approach: The growth of the Ga2O3 nanowires was...DNT/methanol dilutions. The Ga2O3 /Ag nanowire composite substrates are shown in Fig. 8(a). As can be seen, they consist of a dense random 3D...MATERIALS SCIENCE AND TECHNOLOGY FIGURE 8 (a) Ga2O3 core/Ag shell nanowire composite and (b) comparison of SERS signal for Mesophotonics “Klarite

  7. Synchrotron speciation data for zero-valent iron nanoparticles

    EPA Pesticide Factsheets

    This data set encompasses a complete analysis of synchrotron speciation data for 5 iron nanoparticle samples (P1, P2, P3, S1, S2, and metallic iron) to include linear combination fitting results (Table 6 and Figure 9) and ab-initio extended x-ray absorption fine structure spectroscopy fitting (Figure 10 and Table 7).Table 6: Linear combination fitting of the XAS data for the 5 commercial nZVI/ZVI products tested. Species proportions are presented as percentages. Goodness of fit is indicated by the chi^2 value.Figure 9: Normalised Fe K-edge k3-weighted EXAFS of the 5 commercial nZVI/ZVIproducts tested. Dotted lines show the best 4-component linear combination fit ofreference spectra.Figure 10: Fourier transformed radial distribution functions (RDFs) of the five samplesand an iron metal foil. The black lines in Fig. 10 represent the sample data and the reddotted curves represent the non-linear fitting results of the EXAFS data.Table 7: Coordination parameters of Fe in the samples.This dataset is associated with the following publication:Chekli, L., B. Bayatsarmadi, R. Sekine, B. Sarkar, A. Maoz Shen, K. Scheckel , W. Skinner, R. Naidu, H. Shon, E. Lombi, and E. Donner. Analytical Characterisation of Nanoscale Zero-Valent Iron: A Methodological Review. Richard P. Baldwin ANALYTICA CHIMICA ACTA. Elsevier Science Ltd, New York, NY, USA, 903: 13-35, (2016).

  8. Coupled Diffusion and Reaction Processes in Rock Matrices: Impact on Dilute Groundwater Plumes

    DTIC Science & Technology

    2015-12-28

    28 Figure 3.5.6 Plastic dish used for permanganate diffusion experiment ........................................ 32 Figure 3.6.5...Manganese profiles following permanganate experiments ................................... 78 Figure 4.4.4.3 Carbon profiles...Figure A.3 SEM images and EDS spectra of permanganate -reacted surfaces ........................... 107

  9. The ocular manifestations of congenital infection: a study of the early effect and long-term outcome of maternally transmitted rubella and toxoplasmosis.

    PubMed Central

    O'Neill, J F

    1998-01-01

    PURPOSE: To study the spectrum of adverse ocular effects which result from maternally transmitted rubella and toxoplasma infection; further, to record the long-term visual and neurodevelopmental outcomes of these 2 major causes of fetal infection. STUDY DESIGN AND PATIENTS: A series of 55 patients with congenital infection have been studied prospectively on a long-term basis. The study group included a cohort of 34 cases with congenital rubella syndrome demonstrated by virus isolation, and 21 cases with a clinical diagnosis of congenital toxoplasmosis and serologic confirmation. All patients had specific disease-related ocular defects. Rubella patients were first identified during or following the last major rubella epidemic in 1963-1964, and some have been followed serially since that time. A separate study group of representative toxoplasmosis patients presented for examination and diagnosis at varying time periods between 1967 and 1991. OBSERVATIONS AND RESULTS: This study confirms that a broad spectrum of fetal injury may result from intrauterine infection and that both persistent and delayed-onset effects may continue or occur as late as 30 years after original infection. Many factors contribute to the varied outcome of prenatal infection, the 2 most important being the presence of maternal immunity during early gestation and the stage of gestation during which fetal exposure occurs in a nonimmune mother. RUBELLA: As a criteria of inclusion, all 34 rubella patients in this study exhibited one or more ocular defects at the time of birth or in the immediate neonatal period. Cataracts were present in 29 (85%) of the 34, of which 21 (63%) were bilateral. Microphthalmia, the next most frequent defect, was present in 28 (82%) of the 34 infants and was bilateral in 22 (65%). Glaucoma was recorded in 11 cases (29%) and presented either as a transient occurrence with early cloudy cornea in microphthalmic eyes (4 patients), as the infantile type with progressive buphthalmos (1 patient), or as a later-onset, aphakic glaucoma many months or years following cataract aspiration in 11 eyes of 6 patients. Rubella retinopathy was present in the majority of patients, although an accurate estimate of its incidence or laterality was not possible because of the frequency of cataracts and nystagmus and the difficulty in obtaining adequate fundus examination. TOXOPLASMOSIS: Twenty-one patients with congenital toxoplasmosis have been examined and followed for varying time periods, 7 for 20 years or more. The major reason for initial examination was parental awareness of an ocular deviation. Twelve children (57%) presented between the ages of 3 months and 4 years with an initial diagnosis of strabismus, 9 of whom had minor complaints or were diagnosed as part of routine examinations. All cases in this study have had evidence of retinochoroiditis, the primary ocular pathology of congenital toxoplasmosis. Two patients had chronic and recurrent inflammation with progressive vitreal traction bands, retinal detachments, and bilateral blindness. Macular lesions were always associated with central vision loss; however, over a period of years visual acuity gradually improved in several patients. Individuals with more severe ocular involvement were also afflicted with the most extensive central nervous system deficits, which occurred following exposure during the earliest weeks of gestation. CONCLUSIONS: Although congenital infection due to rubella virus has been almost completely eradicated in the United States, the long-term survivors from the prevaccination period continue to experience major complications from their early ocular and cerebral defects. They may be afflicted by the persistence of virus in their affected organs and the development of late manifestations of their congenital infection. Congenital toxoplasmosis continues to be the source of major defects for 3,000 to 4,100 infants in the United States each year; the spectrum of defects is wide and may vary from blindness and severe mental retardation to minor retinochoroidal lesions of little consequence. Effective solutions for either the prevention or treatment of congenital toxoplasmosis have not been developed in this country but are under intensive and continuing investigation. Images FIGURE 4 FIGURE 5A FIGURE 5B FIGURE 5C FIGURE 6 FIGURE 7 FIGURE 8 FIGURE 9 FIGURE 10 FIGURE 11 FIGURE 12 FIGURE 13 FIGURE 14 FIGURE 15A FIGURE 15B FIGURE 16 FIGURE 17 FIGURE 18 FIGURE 19 FIGURE 20A FIGURE 20B FIGURE 20C FIGURE 20D FIGURE 20E FIGURE 20F FIGURE 20G FIGURE 20H FIGURE 20J FIGURE 20K FIGURE 21 FIGURE 22 FIGURE 23 FIGURE 24 A FIGURE 24B FIGURE 25 FIGURE 26 FIGURE 27 FIGURE 28 FIGURE 29 FIGURE 30 FIGURE 31 FIGURE 32 PMID:10360309

  10. Actively Learning Specific Function Properties with Applications to Statistical Inference

    DTIC Science & Technology

    2007-12-01

    the columns correspond to K different simulations of the sub-matrix sample j. ( b ) Pictorial strategies sets (Y and Z) for players y (light triangle...and Z are shown in Figure 3.4( b ), where, for simplicity of illustration, we let I = K = 3 and α = 0.33. While y is free to choose any point from the...running of spectral index 0.0 α = dns/d ln( k ) b galaxy bias 0.0 – 3.0 Qnl non-linear correction 30.81 Ωk spatial curvature -1.0 – 0.9 Ωk = 1− ΩΛ − ΩM ΩT

  11. 49 CFR Appendix B to Part 220 - Recommended Pronunciation of Numerals

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...”should be used preceding such numbers. Numbers should be pronounced as follows: Number Spoken 0 ZERO. 1 WUN. 2 TOO. 3 THUH-REE-. 4 FO-WER. 5 FI-YIV. 6 SIX. 7 SEVEN. 8 ATE. 9 NINER. (The figure ZERO should... ATENINER NINER. 20.3 TOO ZERO DECIMALTHUH-REE. ...

  12. 49 CFR Appendix B to Part 220 - Recommended Pronunciation of Numerals

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...”should be used preceding such numbers. Numbers should be pronounced as follows: Number Spoken 0 ZERO. 1 WUN. 2 TOO. 3 THUH-REE-. 4 FO-WER. 5 FI-YIV. 6 SIX. 7 SEVEN. 8 ATE. 9 NINER. (The figure ZERO should... ATENINER NINER. 20.3 TOO ZERO DECIMALTHUH-REE. ...

  13. 49 CFR Appendix B to Part 220 - Recommended Pronunciation of Numerals

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ...”should be used preceding such numbers. Numbers should be pronounced as follows: Number Spoken 0 ZERO. 1 WUN. 2 TOO. 3 THUH-REE-. 4 FO-WER. 5 FI-YIV. 6 SIX. 7 SEVEN. 8 ATE. 9 NINER. (The figure ZERO should... ATENINER NINER. 20.3 TOO ZERO DECIMALTHUH-REE. ...

  14. Leveraging Crystal Anisotropy for Deterministic Growth of InAs Quantum Dots with Narrow Optical Linewidths

    DTIC Science & Technology

    2013-08-29

    similar layer thicknesses. This offset indicates that the electric field profile of our Schottky diode is different than for unpatterned samples, implying...sacrificing uniformity by further optimizing the substrate Figure 3. (a) Schematic of the Schottky diode heterostructure, indicating the patterned substrate...and negative (X−) trions are indicated . (c) Distribution of linewidths for 80 PL lines from dots grown in high density arrays such as those in Figure 2b

  15. A Novel Strategy to Inhibit Hedgehog Signaling and Control Growth of Androgen-Independent Prostate Cancer Cells

    DTIC Science & Technology

    2013-12-01

    M TIME PPC1 Volume of Spheroid Ctrl (respective media) .2% DMSO 10 uM Free Curcumin 20 uM Free Curcumin 10 uM Tagged Curcumin 20 uM Tagged... Curcumin FIGURE 6 Ctrl media 10uM FC 20uM FC 20uM TC 10uM TC 2% DMSO PC3 t0 Div 8 FIGURE 7 Phospho-p65 NFκB subunit expression decreased In

  16. Device 2F112 (F-14A WST (Weapon System Trainers)) Instructor Console Review.

    DTIC Science & Technology

    1983-12-01

    Cockpit Section-Trainee Station, b. Instructor Operator Station (OS), c. Computer System, d. Wide-Angle Visual System (WAVS), e. Auxiliary Systems. The...relationship of the three stations can be seen in Figure 1. The stations will be reviewed in greater detail in following sections. Fhe computer system...d) Printer 2) TRAINEE AREA 3) HYDRAULIC POWFR ROOM 4) ELEC. POWER/AIR COMPRESSORS 5) COMPUTER /PERIPHERAL AREA Figure 1. Device 2FI12 general layout

  17. Strategies for Dealing with the Defense Budget

    DTIC Science & Technology

    1983-08-17

    changes were computed and are shown in Tables B-3 and B-4, on pages B-66 and B-67. B.6 ACQUISITION PROGRAM TURBULENCE The purpose of this section is to...planning. The following brief overviev / of the NAVMAT study illustrates this cause of program turbulence. Figure C-13 shows the NAVMAT analytical...Inflation, Industrial Base, Life-Cycle Costs, Material Acquisition, Material Balance, Multi-year Contracting/procurement, Planning, Programming and

  18. Compendium of Post-Failure Analysis Techniques for Composite Materials.

    DTIC Science & Technology

    1987-01-01

    HHdrocarbon 285.0 Ether or alcohol 286.5 Ketone 288.0 Ester 288.8 (Ref. 5) Figure 3-37. Carbon Peak Shifts in XPS 5-B70227Rt -130 " Hydrocarbon...structure overlays composite material since neutrons are not as attenuated by metal as X-rays, and are relatively sensitive to poly - meric materials...Thermal Aging 3-18 Glass Transition Temperature Determination - 3-37 TMA Penetration Test Setup 3-19 Glass Transition Temperature Determination - 3-37 TMA

  19. Vegetation and Channel Morphology Responses to Ordinary High Water Discharge Events in Arid West Stream Channels

    DTIC Science & Technology

    2009-05-01

    a rc h a n d E n gi n e e ri n g La b o ra to ry Approved for public release; distribution is unlimited. ERDC/CRREL TR-09-5 May 2009...21 Appendix B . Aerial Imagery and Discharge Events..........................................................................22 Appendix C...3 Figure 2. The Arid West region as defined by Land Resource Regions B , C, and D

  20. Thin Robust Anion Exchange Membranes for Fuel Cell Applications

    DTIC Science & Technology

    2014-01-01

    water diffsuion. Here we use a Polyphenylene Oxide dibock polymer co-polymerized with polyvinyl benzyl trimethyl ammonium blocks ( PPO -b-PVBTMA[F...in PPO -b-PVBTMA[F-] AEM under saturated humidity environment ECS Transactions, 64 (3) 1185-1194 (2014) 1191 Conductivity of this membrane was...makes it a promising material for applications in anion exchange membrane fuel cells. Figure 5: Conductivity of PPO -b-PVBTMA[F-] under 95% Relative

  1. 49 CFR 325.77 - Computation of open site requirements-nonstandard sites.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... microphone target point is other than 50 feet (15.2 m), the test site must be an open site within a radius... microphone target point. (b) Plan view diagrams of nonstandard test sites are shown in Figures 3 and 4... (18.3 m) distance between the microphone location point and the microphone target point. (See § 325.79...

  2. 49 CFR 325.77 - Computation of open site requirements-nonstandard sites.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... microphone target point is other than 50 feet (15.2 m), the test site must be an open site within a radius... microphone target point. (b) Plan view diagrams of nonstandard test sites are shown in Figures 3 and 4... (18.3 m) distance between the microphone location point and the microphone target point. (See § 325.79...

  3. A Statistical Physics Analysis of Rock and Concrete Damage Response

    DTIC Science & Technology

    1991-05-30

    condensation after passing through a jet (Levinger et a 1988, Rayane et a 1989) or from an impacted solid by sputtering (Weiland et al 1989). The distribution of...1/3 = 8.5 a2/3 = 15 (figure 13). Fits of similar goodness were achieved to other data obtained by the above authors for Arm and by Rayane et al (1989...Holcman 1 1987 Int. J. Eng. Sc. 25 473 Rayane D, Melinon P, Cabaud B, Hoareau A, Tribollet B and Broyer M 1989 J. Chem. Phys. 90 3295 Rice 11975

  4. Environmental Impact Research Program. Doveweeds (Croton supp.) Section 7.4.2, US Army Corps of Engineers Wildlife Resources Management Manual.

    DTIC Science & Technology

    1986-07-01

    inflorescences are formed. The inflorescence is an abbre-9viated terminal raceme with pistillate flowers below staminate flowers. The 3 -IC Figure 1...Distribution and distinguishing characteristics of woolly croton (Croton capitatus): (a) flowering branch, (b) fruit, and (c) seeds 4 ovary is 3- celled ...and the capsule is 3- celled and 3-seeded except for C. monanthogynus, which is 1-seeded. When seeds mature in late fall, they are forcefully ejected

  5. Aircraft Material Fire Test Handbook

    DTIC Science & Technology

    1990-09-01

    becomes extinguished for any period that exceeds 3 sec. A circuit for a satisfactory device is sketched in Figure 5-4. 5.3.8.2 Upper Pilot Burner An...34A model 470 Series Power controller manufactured by Eurotherm, a Model 3AEV 1B IOC I Triac manufactured by General Electric Co, or equivalent have...Compartment (galley or lavatory module ) An enclosure or shell structure with access provisions, such as a waste chute opening or doors, designed for

  6. Installation Restoration Program. Phase 2. Confirmation/Quantification Stage 1 for Pease Air Force Base, New Hampshire. Volume 1.

    DTIC Science & Technology

    1987-08-01

    01 0 4 In w el4 ’ n r fl f4 r, V 0 𔃾 1" * * * - ~ m ~c- I0 1-0- Q~ 3c 3c~ AdI-. * tp~dip Eu - 4j :: .( - * -U I’ -L - UJ a. Zw a Inc., ɘ L.3. 2-3...swale ap- proximately 100 feet south of Building 222 (Figure 3-7), the Jet Engine Test cell . With the exception of VOC, all param- eters detected at 15-B

  7. Local Refinement of Analysis-Suitable T-splines

    DTIC Science & Technology

    2011-03-01

    3.2. The extension graph Intersecting T-junction extensions in an extended T-mesh Text can be visualized using an undirected graph . We call this graph ...the extension graph and denote it by E(Text). Each node in E corresponds to a single T-junction extension in Text. If two extensions in Text...intersect then an edge is drawn between the corresponding nodes in E. The extension graph for the extended T-mesh in Figure 7b is shown in Figure 8a. In this

  8. Exploring Cryogenic Focused Ion Beam Milling as a Group III-V Device Fabrication Tool

    DTIC Science & Technology

    2013-09-01

    boiling, triple , and critical points of the elements” in CRC Handbook of Chemistry and Physics, 92nd ed., Boca Raton, FL: CRC press, 2011-2012, p. 4...The most widely used ion source in FIB instruments is a gallium (Ga) liquid metal ion source (LMIS) [4]. Gallium is attractive as an ion source...Figure 3b. EDS spectra were captured at different points across the patterned region of the room temperature milled sample, as indicated in Figure 4

  9. B7-H4 as a Target for Breast Cancer Immunotherapy

    DTIC Science & Technology

    2012-06-01

    lymphoma and leukemia cell lines. CEM, Karpas 299, and TLBR -1, cell lines derived from acute T-cell lymphoblastic leukemia, large cell anaplastic...Accomplishments  Generation of human B7-H4-Fc fusion protein (antigen).  Discovery of a B7-H4 receptor on CEM, Karpas 299, and TLBR -1 cell lines...CEM Karpas 299 TLBR -1 Jurkat B7-H4R Figure 3. B7-H4 binding to human T-cell lymphoma cell lines. Red

  10. 12 CFR 8.6 - Fees for special examinations and investigations.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... multiplying that figure by 1.5 for each independent trust bank that receives a composite rating of 3 under the... bank that receives a composite UFIRS rating of 4 or 5 at such examination. (2) Trust banks affiliated... 031 and 041, Line 9 (columns A and B) and Line 10 (column B), any successor form issued by the FFIEC...

  11. 12 CFR 8.6 - Fees for special examinations and investigations.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... multiplying that figure by 1.5 for each independent trust bank that receives a composite rating of 3 under the... bank that receives a composite UFIRS rating of 4 or 5 at such examination. (2) Trust banks affiliated... 031 and 041, Line 9 (columns A and B) and Line 10 (column B), any successor form issued by the FFIEC...

  12. Phase Relations and Stability Studies in the Si3N4-SiO2-Y2O3 Pseudo- Ternary System. (6) Development of Microstructure, Strength and Fracture Toughness of Hot-Pressed Si3N4. (7) Sintering of SiC with Boron Compounds. (8).

    DTIC Science & Technology

    1976-04-01

    Analyses of Westinghouse Sij^ Starting Powder ( wt %) Al 0.08 Ag < Ü.001 B 0.001 Ca 0.016 Cr 0.01 Fe > O.i Mg 0.001 Mn 0.05 Mo < 0.003 Ni < 0.01...and atter milling, showed that the WC and plastic contamination in the milled powders were in the range of 1.5-3 wt "» and 0.7-1.5 wt0», respectively...Oxidation of I As, John Witley, New York (1966). 14 FIGURE CAPTIONS Figure 1 - Experimental phase relations in the Si NI -Si0o-Y 0 system determined

  13. Toxicity and carcinogenicity of potassium bromate--a new renal carcinogen.

    PubMed Central

    Kurokawa, Y; Maekawa, A; Takahashi, M; Hayashi, Y

    1990-01-01

    Potassium bromate (KBrO3) is an oxidizing agent that has been used as a food additive, mainly in the bread-making process. Although adverse effects are not evident in animals fed bread-based diets made from flour treated with KBrO3, the agent is carcinogenic in rats and nephrotoxic in both man and experimental animals when given orally. It has been demonstrated that KBrO3 induces renal cell tumors, mesotheliomas of the peritoneum, and follicular cell tumors of the thyroid. In addition, experiments aimed at elucidating the mode of carcinogenic action have revealed that KBrO3 is a complete carcinogen, possessing both initiating and promoting activities for rat renal tumorigenesis. However, the potential seems to be weak in mice and hamsters. In contrast to its weak mutagenic activity in microbial assays, KBrO3 showed relatively strong potential inducing chromosome aberrations both in vitro and in vivo. Glutathione and cysteine degrade KBrO3 in vitro; in turn, the KBrO3 has inhibitory effects on inducing lipid peroxidation in the rat kidney. Active oxygen radicals generated from KBrO3 were implicated in its toxic and carcinogenic effects, especially because KBrO3 produced 8-hydroxydeoxyguanosine in the rat kidney. A wide range of data from applications of various analytical methods are now available for risk assessment purposes. Images FIGURE 1. FIGURE 2. FIGURE 5. FIGURE 6. FIGURE 7. FIGURE 8. FIGURE 9. FIGURE 10. FIGURE 11. FIGURE 12. PMID:2269236

  14. A diffusely enlarged pancreas: the (un)usual suspect.

    PubMed

    Magalhães-Costa, Pedro; Brito, Maria José; Pinto-Marques, Pedro

    2016-12-01

    An 81-years-old female presented with obstructive jaundice and a non-specific clinical picture of nausea and appetite loss. Labs demonstrated a conjugated hyperbilirrubinemia (7.7 mg/dL), increased aspartate aminotransferase and alanine aminotransferase (10xULN and 8xULN, respectively), increased lactate dehydrogenase (10xULN) and serum lipase (3xULN). CA 19.9 was 342 U/mL (Ref value < 37 U/mL). There was no evidence of peripheral lymphadenopathy or hepatosplenomegaly. Imaging (Figure 1A and 1B) revealed a marked homogeneous enlargement of the pancreas (without any well-defined mass), dilation of the extra and intra-hepatic bile ducts and ascites. Endoscopic ultrasound (Figure 1C and 1D) identified an enlarged homogeneous hypoechoic pancreas, without any well-defined lesion, no dilation of the main pancreatic duct, no peripancreatic or celiac enlarged lymph nodes. A fine-needle biopsy was performed yielding, on cytological examination and cell-block technique (Figure 2A and 2B), numerous medium/large sized atypical lymphoid cells that displayed a B-cell lineage immunophenotype (Figure 2A-2F). Even though, further characterization (by flow cytometric immunophenotyping) could not be obtained, a final diagnosis of primary pancreatic lymphoma (PPL) was assumed. Primary pancreatic lymphoma is a remarkably rare tumor of the pancreas, representing approximately 0.5% of all pancreatic neoplasms and <2% of all lymphomas (1,2). A correct diagnosis is crucial because therapeutic management differs from other pancreatic malignancies (pancreatic ductal adenocarcinoma, neuroendocrine tumor and metastases) (2,3). Two morphologic patterns of PPL are recognized: a focal form (occurring in the pancreatic head in 80% of cases) and a rarer diffuse/infiltrative pattern, as depicted herein, emulating an acute/autoimmune pancreatitis (1).

  15. Determination of the Role of Estrogen Receptors and Estrogen Regulated Genes in B Cell Autoreactivity

    DTIC Science & Technology

    2011-07-01

    Betty Diamond – DOD FINAL REPORT 9 Figure 3: (A) expression of estrogen receptors ERalpha( Esr1 ) and ERbeta (Esr2) in splenic B cells and (B...Urinary 16 OH-Estradiol metabolite in BALB/c and C57BL6 mice. Esr1 0 0.05 0.1 0.15 0.2 Transit. Mature Transit. Mature Transit. Mature Transit. mature P E2

  16. Protection of Medical Equipment against Electromagnetic Pulse (EMP): phase I

    DTIC Science & Technology

    1986-06-12

    case condition. The current in the power cord path due to the EMP pin threat is computed frorn: VEMP I(RS+RBI +RB2+RL+RB3 +ZC+RB4+R+RB5 R +RB6 + RB 7...base-emitter, causing darage. 44 I NN4154 100 B-C vEMP _ 2N4401 S B-E 2N4401 270 Figure 7.5 ESA: Patient monitor path to ground. 45 7.1.3 Foot Switch...computed from: VEMP Z Rs. RB) VVBD (7.5) 1800 = l(100 25) + 50 (7.6) The resulting threat current is 14A. The rectifier diode threshold is 3.7A at f

  17. Passive Nosetip Technology (PANT) Program. Volume X. Summary of Experimental and Analytical Results

    DTIC Science & Technology

    1975-01-01

    Scallop Calorimeter Data with Sandgrain Type Calorimeter Data 3-22 4-1 Geometry for 1.5-Inch Nose Radius Camphor Model 4-3 4-2 Shape Profile History for... camphor model tested at Re. - 5.104/ft and t - 5 in the NOL hypersonic wind Tunnel Number S. (a) Run 007, Sting 2 -Graphite (b) PANT Run 204 - Camphor ...Laminar region (a) Run 006, Sting 2 -Graphite (b) PANT Run 216 - Camphor low temperature ablator Figure 2-2. Comparison of Transitional Shapes The

  18. Improving Joint Function Using Photochemical Hydrogels for Articular Surface Repair

    DTIC Science & Technology

    2015-10-01

    formulations permitted new cartilage matrix formation. The control group where isolated chondrocytes were directly encapsulated in the hydrogel... control group was consistent with the histological results showing the least amount of total GAG among the groups (Figure 3a). The cells in this group ... control , a subset group of gels without tethered growth factor was exposed to 0.3 nM (7.5 ng/mL) soluble TGF-b1. Media was changed every 3 days. Samples

  19. DHHC3 Contributions to Breast Cancer

    DTIC Science & Technology

    2014-11-01

    oligosaccharide 1,2-alpha-mannosidase MAN1B1 0.021 0.572 IPI00015954 GTP-binding protein SAR1a SAR1A 0.546 0.573 IPI00011937 Peroxiredoxin-4 PRDX4...previous report that DHHC3 itself is an integral membrane protein (10). In addition, the most significant biological processes regulated by DHHC3 are cell...motion and vesicle-mediated transport (Fig. 8), two processes important for cancer cell invasion and metastasis. Figure 7. Gene ontology

  20. Evaluation of New Technologies for Protection of Military Personnel from Filth and Biting Flies

    DTIC Science & Technology

    2007-10-01

    Page 1. INTRODUCTION 3 2. RESEACH ACCOMPLISHMENTS FOR YEAR 3: 5 A. Students 5 B. Most Recent Research Results 6 I. Wind Tunnel for Testing ...were released per arena, and morbidity (knockdown) was recorded at 2-5 h post -treatment and mortality was recorded at 24, 48, and 72 h. Field Test ...Keuls test ) 42 Figure 3-1. Laboratory and field experimental design elements. A). Laboratory arena constructed of PVC pipe. Cords

  1. A Novel Electrocardiogram Segmentation Algorithm Using a Multiple Model Adaptive Estimator

    DTIC Science & Technology

    2002-03-01

    2-5 Figure 2-3. Typical Pulse Oximeter Placement [20].....................................................2-5 Figure 2-4...the heart contracts and then decreases when the heart relaxes. The pulse oximeter is typically place on a toe, finger, or earlobe as shown in Figure...2-3. Figure 2-2. Absorption as Light Passes Through the Body [24]. Figure 2-3. Typical Pulse Oximeter Placement [19]. The pulse

  2. Aircraft Fiber-Optic Interconnect Systems Project.

    DTIC Science & Technology

    1980-08-15

    W1 • 2 Grid Grid Figure 3-2. Receiver Schematic Diagram 3-5 .. .." - ": :- ’".. ..1 -n 13-P 430.... .... 1 II ..... .l3l I..... III .... .. . 3.1.3...the bus during conflicts caused by simultaneous requests. This in turn requires that the terminals using this protocol be " smart " to avoid a "central... UART RAM 2114 1Kx4l deoder decade? 8251 Data 4 buffeer zoo B Date bus -69 z S Control bus Peripheral decocler 5100 buffer I Kxr4 to SOL;, 5 se..onds PI

  3. Electrical manipulation of glycan-phosphatidyl inositol-tethered proteins in planar supported bilayers.

    PubMed Central

    Groves, J T; Wülfing, C; Boxer, S G

    1996-01-01

    Electric fields have been used to manipulate and concentrate glycan-phosphatidyl inositol (GPI)-tethered proteins in planar supported bilayers. Naturally GPI-linked CD48, along with engineered forms of I-Ek and B7-2, in which their transmembrane domains have been genetically replaced with the GPI linkage, were studied. The proteins were labeled with fluorescently tagged antibodies, allowing the electric field-induced behavior to be followed by epifluorescence microscopy. All three protein complexes were observed to migrate toward the cathode with the B7-2 and CD48, each tethered to the membrane by a single GPI linker, moving significantly faster than the I-Ek, which has two GPI linkers. Patterns scratched into the membrane function as barriers to lateral diffusion and were used to isolate the proteins into highly concentrated corrals. All field-induced concentration profiles were completely reversible, indicating that the supported bilayer provides a stable, fluid environment in which GPI-tethered proteins can be manipulated. The ability to electrically control the spatial distribution of membrane-tethered proteins provides new opportunities for the study of biological membranes and the development of membrane-based devices. Images FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 6 PMID:8913608

  4. Adaptive and Collaborative Exploitation of 3 Dimensional Environmental Acoustics in Distributed Undersea Networks

    DTIC Science & Technology

    2015-09-30

    experiment was conducted in Broad Sound of Massachusetts Bay using the AUV Unicorn, a 147dB omnidirectional Lubell source, and an open-ended steel pipe... steel pipe target (Figure C) was dropped at an approximate local coordinate position of (x,y)=(170,155). The location was estimated using ship...position when the target was dropped, but was only accurate within 10-15m. The orientation of the target was unknown. Figure C: Open-ended steel

  5. In-situ Preparation of Polymer-Coated Zirconia Nanoparticles by Decomposition of Zirconium-Tert-Butoxide

    DTIC Science & Technology

    2003-01-01

    coated under conditions C are slightly yellow coloured. The zirconia powders collected at position 1 is white. Table I: Plasma parameters of the...pulsed) 99 1 39 40 2,5 2,5 379 400D. 2000 1000 - 20 0 40 4 140 20 [°1 Figure 2: XRD diffractrogram of zirconia powder coated with polymer Zirconia...wave nunter [crn"] Figure 3: FTIR spectra of plasma treated zirconia powders collected at position 2 (coated) prepared under A) continuous plasma B

  6. Predicting Coarse Sediment Transport from Patchy Beds in Ephemeral Channels

    DTIC Science & Technology

    2012-04-01

    ct u re s La b or at or y Brendan T. Yuill April 2012 Approved for public release; distribution is unlimited. ERDC/GSL TR-12-17 April...5  Figure 3. Photographic map of a section of the Lucky Hills channel bed without (A) and with ( B ) the...diagram of the Santa-Rita type flume looking upstream (A) and a close-up photograph of the slot-sampler looking downstream ( B

  7. Comprehensive Condition Survey and Storm Waves, Circulation, and Sedimentation Study, Dana Point Harbor, California

    DTIC Science & Technology

    2011-07-01

    Tide on January 5, 2010 Figure 3-1 CMS-Wave Model Domain and Grid System Figure 3-2 CDIP 096 Wave and NOAA 9410660 Water Levels Figure 3-3 NDBC...Figure 3-10 Scatter plot of Observed CDIP and Hindcast Significant Wave Heights Figure 3-11 Comparison of Significant Wave Heights during the Month...obtained from the Coastal Data Information Program ( CDIP ) at Dana Point (Buoy 096) as well as the predicted tides at Newport Beach, CA (Station 9410580

  8. Covalent binding of C3b to tetanus toxin: influence on uptake/internalization of antigen by antigen-specific and non-specific B cells.

    PubMed Central

    Villiers, M B; Villiers, C L; Jacquier-Sarlin, M R; Gabert, F M; Journet, A M; Colomb, M G

    1996-01-01

    Antigen opsonization by the C3b fragment of complement is a significant event in the modulation of cell-mediated immune response, but its mechanism is still largely unknown. The structural characteristics of C3b allow it to act as a bifunctional ligand between antigen and cells via their membrane C3b receptors. It was thus of interest to study the influence of the covalent link between C3b and antigen on the fixation and internalization of this antigen by antigen-presenting cells. Tetanus toxin (TT) was used as antigen, either free or covalently linked to C3b (TT-C3b). The antigen-presenting cells were TT-specific (4.2) or non-specific (BL15) Epstein-Barr virus (EBV)-transformed B cells. C3b was found to play an important role in antigen fixation and internalization by both antigen-specific and antigen non-specific cells. Covalent binding of C3b on TT (1) permitted fixation and internalization of this antigen by non-specific cells via their complement receptors; (2) enhanced antigen fixation and resulted in cross-linking between membrane immunoglobulins and complement receptors on antigen-specific cells. The consequences of covalent C3b binding to TT were analysed using antigen-specific and antigen-nonspecific cells. In both cases, a net increase in antigen fixation was observed. At the intracellular level, covalent C3b binding to TT resulted in a large TT incorporation in endosomes of nonspecific cells, similar to that observed in antigen-specific cells. Thus, C3b covalently linked to antigen enlarges the array of B-cell types capable of presenting antigen, including non-specific cells. Images Figure 2 PMID:8958046

  9. Future World of Illicit Nuclear Trade: Mitigating the Threat

    DTIC Science & Technology

    2013-07-29

    uranium with lasers that is similar to MLIS. 3 Most of the equipment, including four carbon monoxide lasers and vacuum chambers, was delivered. But...Centrifuge Facility 43 Figure 10: Centrifuge Output vs. Goods Required 44 3b Digging Deeper: Laser Enrichment of Uranium 47 Box 3...Major Foreign Assistance to Iran’s Pre-2004 Laser Enrichment Program 50 4. Key Information: The Special Challenge of the Spread of Classified 53

  10. A Workstation for Interactive Display and Quantitative Analysis of 3-D and 4-D Biomedical Images

    PubMed Central

    Robb, R.A.; Heffeman, P.B.; Camp, J.J.; Hanson, D.P.

    1986-01-01

    The capability to extract objective and quantitatively accurate information from 3-D radiographic biomedical images has not kept pace with the capabilities to produce the images themselves. This is rather an ironic paradox, since on the one hand the new 3-D and 4-D imaging capabilities promise significant potential for providing greater specificity and sensitivity (i.e., precise objective discrimination and accurate quantitative measurement of body tissue characteristics and function) in clinical diagnostic and basic investigative imaging procedures than ever possible before, but on the other hand, the momentous advances in computer and associated electronic imaging technology which have made these 3-D imaging capabilities possible have not been concomitantly developed for full exploitation of these capabilities. Therefore, we have developed a powerful new microcomputer-based system which permits detailed investigations and evaluation of 3-D and 4-D (dynamic 3-D) biomedical images. The system comprises a special workstation to which all the information in a large 3-D image data base is accessible for rapid display, manipulation, and measurement. The system provides important capabilities for simultaneously representing and analyzing both structural and functional data and their relationships in various organs of the body. This paper provides a detailed description of this system, as well as some of the rationale, background, theoretical concepts, and practical considerations related to system implementation. ImagesFigure 5Figure 7Figure 8Figure 9Figure 10Figure 11Figure 12Figure 13Figure 14Figure 15Figure 16

  11. Comparative Effectiveness of a Convection-Type and Radiation-Type Cooling Cap on a Turbosupercharger

    DTIC Science & Technology

    1946-06-01

    i176014333182-— IWTICNAIIADVISORY (x14MmTm 3’023AERONNJTICS TECHNICAL NOTE NO. 1082 C(MPARATJNE EET’ACTIVENESSOF A COHV3CTION-TYI?EAND A RADIA’EEON...Electric Company that the radiation cap has a lesser cooling effect than the N4CA TN NO. 1082 ● convection cap, other factors influence the selection of...For the convection-type cap, slots were cut h 3 , b NACA TN No. 1082 the bottom of the radiation-type cap, as indicated in figure 3, and the cooling

  12. The Polarized Multilayer Theory of Cell Water and Other Facets of the Association-Induction Hypothesis Concerning the Distribution of Ions and Other Solutes in Living Cells,

    DTIC Science & Technology

    1983-12-16

    first demonstrated cooperative K+ uptake by frog muscles (see Fig. 2 ; also Eq. 3 ), extensive confirmation of the theory of cooperative adsorption of K...8217 sz 22 UL K + 20 60 0 ) 02 04 6 08 20 4 . 2 A ATP CinCT10T/9 N TP ERATURE FIGURE 3 Plot of ATP vs. Kconcentration in rat myometrium. !:Variations...1907). 26. H. E. Roaf and E. Alderson, Biochem. J., 2 : 412 (1907). 27. B. Moore and H. E. Roaf, Biochem. J., 3 : 55 (1908). 28. B. Moore and H. E. Roaf

  13. The Spatiotemporal Characteristics of Visual Motion Priming

    DTIC Science & Technology

    1994-07-01

    859. Barden, W. (1982, June). A general-purpose I/O board for the Color Computer. BYTE Magazine, pp. 260-281. B . ->,.. H . & Levick , W. (1965). The... B y ...... . ........ Distribution I Availability Codes Avail and i or Dist Special DTIC qU(A~ry niNPETEM 3 iii ABSTRACT THE...bistable diamond, apparent motion figure 52 (after Ramachandran & Anstis, 1983). ( b ) "Streaming" and "bouncing" percepts of apparent 52 motion dot

  14. IDA Ground-Air Model 1 (IDAGAM ). Volume 3. Detailed Description of Selected Portions

    DTIC Science & Technology

    1974-10-01

    KP) BWVDS TBWVDS BPP BDPE Bfsy pbpy Fbpoy Ld rbdy • bp vbpd vkd bgd k bad frwa kd vrpa vkd vrga vk raa .cd ■ ca YBPP = YBPPDS...fkt<’> RFMF(-) Wra RMFAS(J) w WIDS(J) Mkt RMFS F1 DFEBA1 ^21 DFBA2A F22 DFBA2C F23 DFBA2B PDFBA2 F2 DFEBA2 F3 DFEBA3 DFEBA Figure 7

  15. Dual pH durability studies of man-made vitreous fiber (MMVF).

    PubMed Central

    Bauer, J F; Law, B D; Hesterberg, T W

    1994-01-01

    Dissolution of fibers in the deep lung may involve both extracellular and intracellular mechanisms. This process was modeled in vitro for each environment using an experimental flow-through system to characterize both total dissolution and specific chemical changes for three representative MMVF's: a glasswool, a slagwool, and a refractory ceramic fiber (RCF). Synthetic physiological fluids at pH 4 and at pH 7.6 were used to simulate macrophage intraphagolysosomal, and extracellular environments, respectively. Actual commercial fiber, sized to rat-respirable dimension, having an average fiber diameter of 1 micron and an average length between 15 and 25 microns, was used in the experiments. Fiber dissolution was monitored through change in chemistry of the fluid collected after percolation at a constant rate through a thin bed of sample. There are great differences in total fiber dissolution rates for the different fibers. Slagwool and RCF dissolve more rapidly at pH 4 than at pH 7.6, while the reverse is true for glasswool. Dissolution is sometimes accompanied by a noticeable change in fiber morphology or dimension, and sometimes by no change. There is strong dependency on pH, which affects not only total fiber dissolution, but also the leaching of specific chemical components. This effect is different for each type of fiber, indicating that specific fiber chemistry largely controls whether a fiber dissolves or leaches more rapidly under acidic or neutral conditions. Both total dissolution rates and calculated fiber composition changes are valuable guides to interpreting in vivo behavior of man-made vitreous fibers, and demonstrate the usefulness of in vitro acellular experiments in understanding overall fiber persistence. Images Figure 3. A Figure 3. B Figure 4. A Figure 4. B Figure 4. C PMID:7882957

  16. Grady Highway Extension (Ship Creek Crossing) Elmendorf Air Force Base and Fort Richardson, Alaska

    DTIC Science & Technology

    2005-06-01

    Washington Headquarters Services, Directorate for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington VA 22202-4302... eastern alignment (“Park Route”) upstream of the Proposed Action connecting to Fort Richardson at Fifth Street; and, use of access at Arctic Valley...Wetland A ............................................................................ 3-19 Figure 3-8 Large Ponded Area on Eastern Portion of Wetland B

  17. Bismuth-doped fibre amplifier operating between 1600 and 1800 nm

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Firstov, S V; Alyshev, S V; Riumkin, K E

    2015-12-31

    We report the first bismuth-doped fibre amplifier operating between 1600 and 1800 nm, which utilises bidirectional pumping (co-propagating and counter-propagating pump beams) by laser diodes at a wavelength of 1550 nm. The largest gain coefficient of the amplifier is 23 dB, at a wavelength of 1710 nm. It has a noise figure of 7 dB, 3-dB gain bandwidth of 40 nm and gain efficiency of 0.1 dB mW{sup -1}. (letters)

  18. Sonophoresis for Rapid Assessment of Interstitial Fluid and Drug Delivery

    DTIC Science & Technology

    2007-10-01

    sensitive indicator of local diseases, for example skin cancer, psoriasis and eczema , but also of certain systemic diseases such as cardiovascular disease...cytokine " functionality -map" that precisely represents skin’s specific diseased milieu (Fig. 2b-CI and Fig. 3a-AD and PS, 3 additional data in. Supp...yielded a unique cytokine " functionality map", which correlates with the specific diseased state (figure 2d and 3a). A striking, rapid upregulation was

  19. A Partnership Training Program in Breast Cancer Research Using Molecular Imaging Techniques

    DTIC Science & Technology

    2008-07-01

    PubMed) 2. Berlier J.E., Rothe A., Buller G., Bradford J., Gray D.R., Filanoski B.J., Telford W.G., Yue S., Liu J., Cheung C.Y., et al. Quantitative...3 3 cm3 voxel within the gray matter of the occipitoparietal lobe was established using anatomic landmarks. Pulse Sequences All experiments were...software (SAS Institute, Cary, NC, USA). RESULTS Figure 1 shows a PRESS spectrum recorded from the occipitoparietal gray matter region of a 25-year-old sub

  20. Response of the macaque nasal epithelium to ambient levels of ozone. A morphologic and morphometric study of the transitional and respiratory epithelium.

    PubMed Central

    Harkema, J. R.; Plopper, C. G.; Hyde, D. M.; St George, J. A.; Wilson, D. W.; Dungworth, D. L.

    1987-01-01

    Although ozone (O3)-induced bronchiolitis has been morphologically characterized, effects of O3 on the upper respiratory tract have not been thoroughly investigated. The purpose of this study was to determine whether exposures to ambient levels of O3 induce lesions in the nasal mucosa. Bonnet monkeys were exposed to 0.00, 0.15, or 0.30 ppm O3 for 6 or 90 days, 8 hours/day. After exposure, nasal mucosa was processed for light and electron microscopy. Quantitative changes were evident in the nasal transitional and respiratory epithelium. At 6 or 90 days of exposure to 0.15 or 0.30 ppm O3 lesions consisted of ciliated cell necrosis, shortened cilia, and secretory cell hyperplasia. Inflammatory cell influx was only present at 6 days of exposure. Ultrastructural changes in goblet cells were evident at 90 days. Ambient levels of O3 can induce significant nasal epithelial lesions, which may compromise upper respiratory defense mechanisms. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:3605312

  1. Ultralow thermal conductivity and high thermoelectric figure of merit in SnSe crystals.

    PubMed

    Zhao, Li-Dong; Lo, Shih-Han; Zhang, Yongsheng; Sun, Hui; Tan, Gangjian; Uher, Ctirad; Wolverton, C; Dravid, Vinayak P; Kanatzidis, Mercouri G

    2014-04-17

    The thermoelectric effect enables direct and reversible conversion between thermal and electrical energy, and provides a viable route for power generation from waste heat. The efficiency of thermoelectric materials is dictated by the dimensionless figure of merit, ZT (where Z is the figure of merit and T is absolute temperature), which governs the Carnot efficiency for heat conversion. Enhancements above the generally high threshold value of 2.5 have important implications for commercial deployment, especially for compounds free of Pb and Te. Here we report an unprecedented ZT of 2.6 ± 0.3 at 923 K, realized in SnSe single crystals measured along the b axis of the room-temperature orthorhombic unit cell. This material also shows a high ZT of 2.3 ± 0.3 along the c axis but a significantly reduced ZT of 0.8 ± 0.2 along the a axis. We attribute the remarkably high ZT along the b axis to the intrinsically ultralow lattice thermal conductivity in SnSe. The layered structure of SnSe derives from a distorted rock-salt structure, and features anomalously high Grüneisen parameters, which reflect the anharmonic and anisotropic bonding. We attribute the exceptionally low lattice thermal conductivity (0.23 ± 0.03 W m(-1) K(-1) at 973 K) in SnSe to the anharmonicity. These findings highlight alternative strategies to nanostructuring for achieving high thermoelectric performance.

  2. Comprehensive Monitoring Program: Final Air Quality Data Assessment Report for FY90, Version 3.1 Volume 3

    DTIC Science & Technology

    1991-09-01

    Monitoring Stations Figure 4.1-1 X /Q Dispersion for Phase I Figure 4.1-2 X /Q Dispersion for Phase 2-Stage 1 Figure 4.1-3 X /Q Dispersion for Phase 2...Stage 2 Fp Figure 4.1-4 X /Q Dispersion for Phase 3 Figure 4.1-5 X /Q Dispersion for Phase 4 • Figure 4.1-6 Sources of Regulated Pollutants in RMA...Arsenic Results by Phase "Figure 4.4-7 Cadmium Results by Phase Figure 4.4-8 X /Q Dispersion and Basin F Metals for 9/6/88 * Figure 4.4-9 X /Q Dispersion

  3. Relation of follicular dendritic reticulum cells to Reed-Sternberg cells of Hodgkin's disease with emphasis on the expression of CD21 antigen.

    PubMed Central

    Delsol, G.; Meggetto, F.; Brousset, P.; Cohen-Knafo, E.; al Saati, T.; Rochaix, P.; Gorguet, B.; Rubin, B.; Voigt, J. J.; Chittal, S.

    1993-01-01

    Based on observations of 66 cases, in which tissues were specially processed to optimize the simultaneous preservation of cell membrane antigens and morphology, we provide evidence in favor of a relationship between follicular dendritic reticulum cells (FDRC) and Reed-Sternberg (RS) cells of Hodgkin's disease (HD) other than the lymphocyte predominance subtype. RS cells were intimately related to the FDRC network (75% of cases), and the expression of CD21 antigen was frequent (41% of cases). Exclusive expression of CD21 antigen was found in 11 cases of HD, while the expression of other B-cell-associated markers (CD19, CD20, CD22) was both variable and inconsistent. The expression of T-cell antigens (CD3, CD4, CD8) was rare. Null phenotype of RS cells was observed in 27 of 66 cases (41%). Epstein-Barr virus (EBV) nucleic acids were found in 34 of 66 (51.5%) cases. Double labeling techniques showed the presence of EBV-positive RS cells within the FDRC network. A non-B-cell origin of RS cells was supported by the differential expression of EBV latent antigens in HD (latent membrane protein+, EB nuclear antigen 2-), which is unusual in EBV-driven lymphoblastoid cell lines and EBV-positive B-cell lymphomas. FDRC and RS cells are known to share morphological traits (binucleated cells), and both cell types possess Fc receptor for IgG. The hypothesis is further backed by the findings of CD15 antigen expression by occasional RS-like dysplastic FDRC in Castleman's disease (five cases), which is characterized by hyperplasia of FDRC. Whether FDRC might be the only cells involved in the conversion to RS cells by the loss or gain of antigens remains to be determined. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:7685151

  4. Measurement of the CP asymmetry in B - → D s - D 0 and B - → D - D 0 decays

    NASA Astrophysics Data System (ADS)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albicocco, P.; Albrecht, J.; Alessio, F.; Alexander, M.; Alfonso Albero, A.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Archilli, F.; d'Argent, P.; Arnau Romeu, J.; Artamonov, A.; Artuso, M.; Aslanides, E.; Atzeni, M.; Auriemma, G.; Bachmann, S.; Back, J. J.; Baker, S.; Balagura, V.; Baldini, W.; Baranov, A.; Barlow, R. J.; Barsuk, S.; Barter, W.; Baryshnikov, F.; Batozskaya, V.; Battista, V.; Bay, A.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Beiter, A.; Bel, L. J.; Beliy, N.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Beranek, S.; Berezhnoy, A.; Bernet, R.; Berninghoff, D.; Bertholet, E.; Bertolin, A.; Betancourt, C.; Betti, F.; Bettler, M. O.; van Beuzekom, M.; Bezshyiko, Ia.; Bifani, S.; Billoir, P.; Birnkraut, A.; Bizzeti, A.; Bjørn, M.; Blake, T.; Blanc, F.; Blusk, S.; Bocci, V.; Boente Garcia, O.; Boettcher, T.; Bondar, A.; Bondar, N.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Brodski, M.; Brodzicka, J.; Brundu, D.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, J.; Byczynski, W.; Cadeddu, S.; Cai, H.; Calabrese, R.; Calladine, R.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D. H.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Cattaneo, M.; Cavallero, G.; Cenci, R.; Chamont, D.; Chapman, M. G.; Charles, M.; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chen, S.; Chitic, S.-G.; Chobanova, V.; Chrzaszcz, M.; Chubykin, A.; Ciambrone, P.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coco, V.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collins, P.; Colombo, T.; Comerma-Montells, A.; Contu, A.; Coombs, G.; Coquereau, S.; Corti, G.; Corvo, M.; Costa Sobral, C. M.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A.; Cruz Torres, M.; Currie, R.; D'Ambrosio, C.; Da Cunha Marinho, F.; Da Silva, C. L.; Dall'Occo, E.; Dalseno, J.; Danilina, A.; Davis, A.; De Aguiar Francisco, O.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Serio, M.; De Simone, P.; Dean, C. T.; Decamp, D.; Del Buono, L.; Delaney, B.; Dembinski, H.-P.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Di Nezza, P.; Didenko, S.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Douglas, L.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Durante, P.; Durham, J. M.; Dutta, D.; Dzhelyadin, R.; Dziewiecki, M.; Dziurda, A.; Dzyuba, A.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, S.; Ene, A.; Escher, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fazzini, D.; Federici, L.; Fernandez, G.; Fernandez Declara, P.; Fernandez Prieto, A.; Ferrari, F.; Ferreira Lopes, L.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fini, R. A.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fontana, M.; Fontanelli, F.; Forty, R.; Franco Lima, V.; Frank, M.; Frei, C.; Fu, J.; Funk, W.; Färber, C.; Gabriel, E.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; Garcia Martin, L. M.; Garcia Plana, B.; García Pardiñas, J.; Garra Tico, J.; Garrido, L.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianí, S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gizdov, K.; Gligorov, V. V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I. V.; Gotti, C.; Govorkova, E.; Grabowski, J. P.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Greim, R.; Griffith, P.; Grillo, L.; Gruber, L.; Gruberg Cazon, B. R.; Grünberg, O.; Gushchin, E.; Guz, Yu.; Gys, T.; Göbel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hamilton, B.; Han, X.; Hancock, T. H.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Hasse, C.; Hatch, M.; He, J.; Hecker, M.; Heinicke, K.; Heister, A.; Hennessy, K.; Henry, L.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hopchev, P. H.; Hu, W.; Huang, W.; Huard, Z. C.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hutchcroft, D.; Ibis, P.; Idzik, M.; Ilten, P.; Ivshin, K.; Jacobsson, R.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Karacson, M.; Kariuki, J. M.; Karodia, S.; Kazeev, N.; Kecke, M.; Keizer, F.; Kelsey, M.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kim, K. E.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Klimkovich, T.; Koliiev, S.; Kolpin, M.; Kopecna, R.; Koppenburg, P.; Kotriakhova, S.; Kozeiha, M.; Kravchuk, L.; Kreps, M.; Kress, F.; Krokovny, P.; Krupa, W.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; Leflat, A.; Lefrançois, J.; Lefèvre, R.; Lemaitre, F.; Lenisa, P.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, P.-R.; Li, T.; Li, Z.; Liang, X.; Likhomanenko, T.; Lindner, R.; Lionetto, F.; Lisovskyi, V.; Liu, X.; Loh, D.; Loi, A.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X.; Machefert, F.; Maciuc, F.; Macko, V.; Mackowiak, P.; Maddrell-Mander, S.; Maev, O.; Maguire, K.; Maisuzenko, D.; Majewski, M. W.; Malde, S.; Malecki, B.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Marangotto, D.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marinangeli, M.; Marino, P.; Marks, J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurice, E.; Maurin, B.; Mazurov, A.; McCann, M.; McNab, A.; McNulty, R.; Mead, J. V.; Meadows, B.; Meaux, C.; Meier, F.; Meinert, N.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Millard, E.; Minard, M.-N.; Minzoni, L.; Mitzel, D. S.; Mogini, A.; Molina Rodriguez, J.; Mombächer, T.; Monroy, I. A.; Monteil, S.; Morandin, M.; Morello, G.; Morello, M. J.; Morgunova, O.; Moron, J.; Morris, A. B.; Mountain, R.; Muheim, F.; Mulder, M.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, T. D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nogay, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C. J. G.; Ossowska, A.; Otalora Goicochea, J. M.; Owen, P.; Oyanguren, A.; Pais, P. R.; Palano, A.; Palutan, M.; Panshin, G.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Parker, W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Pereima, D.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A.; Petruzzo, M.; Pietrzyk, B.; Pietrzyk, G.; Pikies, M.; Pinci, D.; Pisani, F.; Pistone, A.; Piucci, A.; Placinta, V.; Playfer, S.; Plo Casasus, M.; Polci, F.; Poli Lener, M.; Poluektov, A.; Polukhina, N.; Polyakov, I.; Polycarpo, E.; Pomery, G. J.; Ponce, S.; Popov, A.; Popov, D.; Poslavskii, S.; Potterat, C.; Price, E.; Prisciandaro, J.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Pullen, H.; Punzi, G.; Qian, W.; Qin, J.; Quagliani, R.; Quintana, B.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Ramos Pernas, M.; Rangel, M. S.; Ratnikov, F.; Raven, G.; Ravonel Salzgeber, M.; Reboud, M.; Redi, F.; Reichert, S.; dos Reis, A. C.; Remon Alepuz, C.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rinnert, K.; Robbe, P.; Robert, A.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Romero Vidal, A.; Rotondo, M.; Rudolph, M. S.; Ruf, T.; Ruiz Vidal, J.; Saborido Silva, J. J.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarpis, G.; Sarti, A.; Satriano, C.; Satta, A.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schreiner, H. F.; Schubiger, M.; Schune, M. H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sepulveda, E. S.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Siddi, B. G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Simone, S.; Skidmore, N.; Skwarnicki, T.; Smith, I. T.; Smith, M.; Soares Lavra, l.; Sokoloff, M. D.; Soler, F. J. P.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Stagni, F.; Stahl, M.; Stahl, S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stepanova, M.; Stevens, H.; Stone, S.; Storaci, B.; Stracka, S.; Stramaglia, M. E.; Straticiuc, M.; Straumann, U.; Strokov, S.; Sun, J.; Sun, L.; Swientek, K.; Syropoulos, V.; Szumlak, T.; Szymanski, M.; T'Jampens, S.; Tang, Z.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, E.; van Tilburg, J.; Tilley, M. J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Tourinho Jadallah Aoude, R.; Tournefier, E.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tully, A.; Tuning, N.; Ukleja, A.; Usachov, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagner, A.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; van Veghel, M.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Verlage, T. A.; Vernet, M.; Vesterinen, M.; Viana Barbosa, J. V.; Vieira, D.; Vieites Diaz, M.; Viemann, H.; Vilasis-Cardona, X.; Vitkovskiy, A.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Vázquez Sierra, C.; Waldi, R.; Walsh, J.; Wang, J.; Wang, M.; Wang, Y.; Wang, Z.; Ward, D. R.; Wark, H. M.; Watson, N. K.; Websdale, D.; Weiden, A.; Weisser, C.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M. R. J.; Williams, M.; Williams, T.; Wilson, F. F.; Wimberley, J.; Winn, M.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wyllie, K.; Xiao, D.; Xie, Y.; Xu, A.; Xu, M.; Xu, Q.; Xu, Z.; Xu, Z.; Yang, Z.; Yang, Z.; Yao, Y.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zarebski, K. A.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhu, X.; Zhukov, V.; Zonneveld, J. B.; Zucchelli, S.

    2018-05-01

    The CP asymmetry in B - → D s - D 0 and B - → D - D 0 decays is measured using LHCb data corresponding to an integrated luminosity of 3.0 fb-1, collected in pp collisions at centre-of-mass energies of 7 and 8 TeV. The results are A^{CP}({B}-\\to {D}_s-{D}^0)=(-0.4± 0.5± 0.5) and A^{CP}({B}-\\to {D}-{D}^0)=(2.3± 2.7± 0.4)% , where the first uncertainties are statistical and the second systematic. This is the first measurement of A^{CP}({B}-\\to {D}_s-{D}^0) and the most precise determination of A^{CP}({B}-\\to {D}-{D}^0) . Neither result shows evidence of CP violation. [Figure not available: see fulltext.

  5. Toward Active Control of Noise from Hot Supersonic Jets

    DTIC Science & Technology

    2012-05-14

    was developed that would allow for easy data sharing among the research teams. This format includes the acoustic data along with all calibration ...SUPERSONIC | QUARTERLY RPT. 3 ■ 1 i; ’XZ. "• Tff . w w i — r i (a) Far-Field Array Calibration (b) MHz Rate PIV Camera Setup Figure... Plenoptic camera is a similar setup to determine 3-D motion of the flow using a thick light sheet. 2.3 Update on CFD Progress In the previous interim

  6. Corrosion-Fatigue Assessment Program

    DTIC Science & Technology

    2008-03-31

    22 Figure 3.2.1-4 Deep -focus image of Specimen 598-7 – Crack 1...at Feature #2 .........................22 Figure 3.2.1-5 Deep -focus image of Specimen 598-7 – Crack 2 at Feature #5 .........................23...Figure 3.2.1-6 Deep -focus image of Specimen 598-7 – Crack 3 at Feature #3 .........................23 Figure 3.2.1-7 Deep -focus image of Specimen 598-7

  7. Profitability of Using Forecasting Techniques in the Commodities Market

    DTIC Science & Technology

    1985-12-01

    12 II. THE NATURE OF THE COMMODITIES MARKET . . . . . 13 A. FUTURES TRADING . . . . ...... . . . . . 13 B. HEDGING IN THE COMMODITIES...1984 WHEAT ........ . . . ............... . 74 j7 4’ -- S . LIST OF FIGURES 2.1 Example of a Perfect Hedge . . . . . . . . . . . . . 17 3.1 Iterative...actually results in a commodity delivery [Ref. 31. The majority of these transactions are * taken up by hedgers and speculators. B. HEDGING IN THE

  8. 16 CFR Figure 3 to Subpart A of... - Flooring Radiant Tester Schematic Side Elevation

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 2 2011-01-01 2011-01-01 false Flooring Radiant Tester Schematic Side Elevation 3 Figure 3 to Subpart A of Part 1209 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 1209, Subpt. A, Fig. 3 Figure 3 to Subpart A of Part 1209—Flooring Radiant Tester Schematic Side...

  9. 16 CFR Figure 3 to Subpart A of... - Flooring Radiant Tester Schematic Side Elevation

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 16 Commercial Practices 2 2014-01-01 2014-01-01 false Flooring Radiant Tester Schematic Side Elevation 3 Figure 3 to Subpart A of Part 1209 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 1209, Subpt. A, Fig. 3 Figure 3 to Subpart A of Part 1209—Flooring Radiant Tester Schematic Side...

  10. 16 CFR Figure 3 to Subpart A of... - Flooring Radiant Tester Schematic Side Elevation

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 16 Commercial Practices 2 2013-01-01 2013-01-01 false Flooring Radiant Tester Schematic Side Elevation 3 Figure 3 to Subpart A of Part 1209 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 1209, Subpt. A, Fig. 3 Figure 3 to Subpart A of Part 1209—Flooring Radiant Tester Schematic Side...

  11. 16 CFR Figure 3 to Subpart A of... - Flooring Radiant Tester Schematic Side Elevation

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 2 2012-01-01 2012-01-01 false Flooring Radiant Tester Schematic Side Elevation 3 Figure 3 to Subpart A of Part 1209 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 1209, Subpt. A, Fig. 3 Figure 3 to Subpart A of Part 1209—Flooring Radiant Tester Schematic Side...

  12. 16 CFR Figure 3 to Subpart A of... - Flooring Radiant Tester Schematic Side Elevation

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Flooring Radiant Tester Schematic Side Elevation 3 Figure 3 to Subpart A of Part 1209 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION.... 1209, Subpt. A, Fig. 3 Figure 3 to Subpart A of Part 1209—Flooring Radiant Tester Schematic Side...

  13. Dispersed, Decentralized and Renewable Energy Sources: Alternatives to National Vulnerability and War.

    DTIC Science & Technology

    1980-12-01

    yields. Figure 3.11-3 shcws this process. Figure 3.11-3220 METHANE FERMENTATION (ANAEROBIC DIGESTION ) A THREE STAGE PROCESS ORGANICS LCOMPOUNDS ACI DS...plant will provide electricity for about 45,000 people, and is scheduled for completion in 1982. Figure 3.12-4 illustrates a two - stage (high pressure and...condensed. The brine, after passing through the heat exchanger, is reinjected into the ground. 4 238 )- I Figure 3.124239 TWO STAGE , FLASHED STEAM POWER

  14. Determination of the Role of Estrogen Receptors and Estrogen Regulated Genes in B cell Autoreactivity. Addendum

    DTIC Science & Technology

    2012-07-01

    Betty Diamond – DOD FINAL REPORT 9 Figure 3: (A) expression of estrogen receptors ERalpha( Esr1 ) and ERbeta (Esr2) in splenic B cells and (B)Urinary...16 OH-Estradiol metabolite in BALB/c and C57BL6 mice. Esr1 0 0.05 0.1 0.15 0.2 Transit. Mature Transit. Mature Transit. Mature Transit. mature P E2 P

  15. Characterizing and Targeting Bone Marrow-Derived Inflammatory Cells in Driving the Malignancy and Progression of Childhood Astrocytic Brain Tumors

    DTIC Science & Technology

    2015-09-01

    to C57/Bl6 mice to create allograft glioma. In addition, xenograft models with human glioma cell lines are also utilized. Furthermore, we also have...of low-grade astrocytoma patients (LGA) vs glioblastoma patients (GBM). Figure 2. IHC of CD11b (infiltrated myeloid cells) on archived...paraffin embedded tumor tissue from low-grade astrocytoma patients (grade II) vs glioblastoma patients (grade IV). 6 Figure 3. Characterizing

  16. Aerolization During Boron Nanoparticle Multi-Component Fuel Group Burning Studies

    DTIC Science & Technology

    2014-02-03

    Anderson, University of Utah). …………………… 14 Figure 2. Photograph of group burning facility showing benchtop flat flame burner unit with injector nozzle ...and (B) aerosol generator. 16 Figure 6. Diagram of benchtop flat flame burner unit showing injector nozzle assembly with VOAG orifice, fuel and...translation stage, variable fuel and gas supply rates, and injector nozzles that can be configured to investigate diffusion and premixed flames (Fig. 2 & 3

  17. 40 CFR Appendix B2 to Subpart F of... - Performance of Refrigerant Recovery, Recycling, and/or Reclaim Equipment

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...'s literature. (See Figure 2.) A 6.3 mm balance line shall be connected across the test apparatus... compressor high side. A 6.3 mm access port with a valve core shall be located in the balance line for the... recovery cylinder pressure no less than specified in 6.2.2. Place the test cylinder in liquid nitrogen for...

  18. 40 CFR Appendix B2 to Subpart F of... - Performance of Refrigerant Recovery, Recycling, and/or Reclaim Equipment

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...'s literature. (See Figure 2.) A 6.3 mm balance line shall be connected across the test apparatus... compressor high side. A 6.3 mm access port with a valve core shall be located in the balance line for the... recovery cylinder pressure no less than specified in 6.2.2. Place the test cylinder in liquid nitrogen for...

  19. 40 CFR Appendix B2 to Subpart F of... - Performance of Refrigerant Recovery, Recycling, and/or Reclaim Equipment

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...'s literature. (See Figure 2.) A 6.3 mm balance line shall be connected across the test apparatus... compressor high side. A 6.3 mm access port with a valve core shall be located in the balance line for the... recovery cylinder pressure no less than specified in 6.2.2. Place the test cylinder in liquid nitrogen for...

  20. Influence of Compensating Defect Formation on the Doping Efficiency and Thermoelectric Properties of Cu2ySe1xBrx

    DTIC Science & Technology

    2015-09-24

    level spectra (Figure S3b). The relative contents of Cu to Se were determined using a Thermo- Finnigan ELEMENT2 single collector sector field...has a wide range of stoichiometric deviation (Cu2−δSe). 17,22,23 Above 410 K, the compound has an average cubic structure with Se ions forming a face...extrinsically, and a single parabolic band model can be applied to analyze the transport and predict the optimum carrier densities for a maximum figure of

  1. Color Shade Instrumentation Correlation Study: Statistical Analysis. Revision

    DTIC Science & Technology

    2011-03-01

    L* a* b* Alpha Desert Sand 503 Beta Chi Army Green 491 Delta Epsilon Iota Kappa Lambda Mu Desert Sand 503...Desert Sand 503 Epsilon Army Green 491 Iota Kappa Lambda Desert Sand 503 Mu Omega Omicron Desert Sand 503 Psi Rho...Color Tiles Figure 3-3. Correlation Matrix for a* Means of Color Tiles Alpha Beta Chi Delta Epsilon Iota Kappa Lambda Mu Omega Omicron Psi Rho

  2. Ambient Noise and Surface Wave Dissipation in the Ocean

    DTIC Science & Technology

    1993-06-21

    computed frmn a one hour wave gauge record with U10 = 8 m/s. a ) Power spectrum computed rom 1024-point FFr. used throughout this work . b) Power specttrum...this work , equations relating U and N in the form of Equation 1.3 will be referred to as WOTAN equations’. Figure 1.2 shows a figure taken from Evans et...the found that a significant proportion of the dissipated energy (up to 50%) is due to work done by the liquid in entraining air against buoyancy

  3. Ripening-Related Gene from Avocado Fruit 1

    PubMed Central

    McGarvey, Douglas J.; Sirevåg, Reidun; Christoffersen, Rolf E.

    1992-01-01

    Fruit ripening involves a series of changes in gene expression regulated by the phytohormone ethylene. AVOe3, a ripening-related gene in avocado fruit (Persea americana Mill. cv Hass), was characterized with regard to its ethylene-regulated expression. The AVOe3 mRNA and immunopositive protein were induced in mature fruit within 12 hours of propylene treatment. The AVOe3 mRNA levels reached a maximum 1 to 2 days before the ethylene climacteric, whereas the immunopositive protein continued to accumulate. RNA selected by the pAVOe3 cDNA clone encoded a polypeptide with molecular mass of 34 kilodaltons, corresponding to the molecular mass of the AVOe3 protein determined by immunoblots. The protein was soluble, remaining in solution at 100,000 gravity and eluted as a monomer on gel filtration. Because of its pattern of induction and relationship to an ethylene-related gene of tomato, the possible involvement of AVOe3 in ethylene biosynthesis is discussed. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5Figure 6 PMID:16668676

  4. Improving the Army’s Joint Platform Allocation Tool (JPAT)

    DTIC Science & Technology

    2013-09-01

    INTENTIONALLY LEFT BLANK ix LIST OF FIGURES Figure 1. Three example systems composed of platforms P1, P2, and P3, and sensors SN1, SN2 , SN3, and SN4...Figure 1. Three example systems composed of platforms P1, P2, and P3, and sensors SN1, SN2 , SN3, and SN4 (from Craparo et al., 2013) Figure 2. A

  5. Acousto-optic interaction in alpha-BaB(2)O(4)and Li(2)B(4)O(7) crystals.

    PubMed

    Martynyuk-Lototska, Irina; Mys, Oksana; Dudok, Taras; Adamiv, Volodymyr; Smirnov, Yevgen; Vlokh, Rostyslav

    2008-07-01

    Experimental studies and analysis of acousto-optic diffraction in alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals are given. Ultrasonic wave velocity, elastic compliance and stiffness coefficients, and piezo-optic and photoelastic coefficients of alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals are determined. The acousto-optic figure of merit has been estimated for different possible geometries of acousto-optic interaction. It is shown that the acousto-optic figures of merit for alpha-BaB(2)O(4) crystals reach the value M(2)=(270 +/- 70) x 10(-15) s(3)/kg for the case of interaction with the slowest ultrasonic wave. The directions of propagation and polarization of those acoustic waves are obtained on the basis of construction of acoustic slowness surfaces. The acousto-optic diffraction is experimentally studied for alpha-BaB(2)O(4) and Li(2)B(4)O(7) crystals.

  6. Civilian Availability Model.

    DTIC Science & Technology

    1991-07-01

    23 Accession For NTIS GRA&I / DTIC TAB Unannounced El Justificatio By-- _DI!A; tr 1tit Ion/ Av~h-.b111ty Codes Avrail and/or Dist p.Cq FIGURES Figure...N3 :EGM.ENTATION1 EN T;;Y ~MSTA NZ AP ZS S 7’-’AT E S A’ POTENTIAL YATS I__ _ DATA INTEGRATED TRENCS AND0 DATA EC. -NIIIA E M T NC IC AT CPS DA TA 7...Coefficient ( TIC ). For an extended discussion of these three measures, refer to Appendix A of Stone, Looper, and McGarrity, 1989. The equation

  7. Optimal Treatment of Malignant Long Bone Fracture: Influence of Method of Repair and External Beam Irradiation on the Pathway and Efficacy of Fracture Healing

    DTIC Science & Technology

    2015-10-01

    stiffness, or a partial snap with lower yield force and stiffness (Figure 4). Three dimensional micro CT analysis around fracture Figure 3. (a-b... fractures with plate fixation on both sides and irradiation on the left while the contralateral limb serves as a non-radiated internal control. The...AWARD NUMBER: W81XWH-13-1-0430 TITLE: Optimal Treatment of Malignant Long Bone Fracture : Influence of Method of Repair and External Beam

  8. Advances in High-Fidelity Multi-Physics Simulation Techniques

    DTIC Science & Technology

    2008-01-01

    predictor - corrector method is used to advance the solution in time. 33 x (m) y (m ) 0 1 2 3.00001 0 1 2 3 4 5 40 x 50 Grid 3 Figure 17: Typical...Unclassified c . THIS PAGE Unclassified 17. LIMITATION OF ABSTRACT: SAR 18. NUMBER OF PAGES 60 Datta Gaitonde 19b. TELEPHONE...advanced parallel computing platforms. The motivation to develop high-fidelity algorithms derives from considerations in various areas of current

  9. Multidimensional Time Dependent Structure and Mechanisms for Non-LTE CO2 Infrared Emissions and 4.3 Micrometers Aurora.

    DTIC Science & Technology

    1979-08-31

    fields V Z) measured by tracking a TMA release on the 3/23/73 date by Faire and Bettinger (private communication, 1976) are shown on Figure B2. The S 0(aN...CONTRACT OR GRANT NUMBER(s) J_~ B.7umer ____ 9 PERFORMING ORGANIZATION NAME AND ADDRESS I0. PROGRAM ELEMENT. PROJECT. TASK AREA A WORK UNIT NUMBERS...Defense Nuclear Agency (DNA) under Subtask T25AAXHZ639, Work Unit 04 entitled "IR Data Evaluation". * OORS ’C-nrine on rel-erse .,doe .1- - a .,rv a , I

  10. Electro-Optic Modulator Based on Organic Planar Waveguide Integrated with Prism Coupler

    NASA Technical Reports Server (NTRS)

    Sarkisov, Sergey S.

    2002-01-01

    The objectives of the project, as they were formulated in the proposal, are the following: (1) Design and development of novel electro-optic modulator using single crystalline film of highly efficient electro-optic organic material integrated with prism coupler; (2) Experimental characterization of the figures-of-merit of the modulator. It is expected to perform with an extinction ratio of 10 dB at a driving signal of 5 V; (3) Conclusions on feasibility of the modulator as an element of data communication systems of future generations. The accomplishments of the project are the following: (1) The design of the electro-optic modulator based on a single crystalline film of organic material NPP has been explored; (2) The evaluation of the figures-of-merit of the electro-optic modulator has been performed; (3) Based on the results of characterization of the figures-of-merit, the conclusion was made that the modulator based on a thin film of NPP is feasible and has a great potential of being used in optic communication with a modulation bandwidth of up to 100 GHz and a driving voltage of the order of 3 to 5 V.

  11. Generation of High-Frequency P and S Wave Radiation from Underground Explosions

    DTIC Science & Technology

    2011-12-30

    3.0 3.5 4.0 2024-T3, 1.63<tɚ.54 mm Homalite-100 Ti - 6Al - 4V , t=1.2 mm Epoxy/Graphite Fiber Composite (a) (b) Figure 3: Normalized Dynamic Stress... porosity . The gas porosity also gives some information about effects associated with the water table since water saturated rock has zero gas porosity ...medium than to the depth. Since velocity and density are strongly correlated with the gas porosity , it was not possible to determine which had the

  12. Regulatory Role of the NF-kB Pathway in Lymphangiogenesis and Breast Cancer Metastasis

    DTIC Science & Technology

    2010-07-01

    with anti - LYVE-1 and anti -VEGFR-3 or anti -Prox1 antibodies in serial sections of p50 KO and WT lungs, showing reduced lymphatic vessel density...3 protein as determined by MFI analysis of slides double-stained with anti -VEGFR-3 and anti -LYVE-1 antibodies (Figure 2). These data indicate that...expression of VEGFR-3 and LYVE-1 on liver endothelial cells compared with WT. (A) Livers of p50 KO and WT mice were double immunostained with anti -VEGFR

  13. On-Time 3D Time-Domain EMI and Tensor Magnetic Gradiometry for UXO Detection and Discrimination

    DTIC Science & Technology

    2008-06-04

    three-axis fluxgate magnetometers mounted on a tetrahedral structure as shown in figure 5.1.3.1. TMGS was intended to measure gradients of vector...manufacturer of the fluxgate magnetometers supplied specifications for each of the triaxial sensors (figure 5.3.2.25). Figure 5.3.2.25...Manufacturer’s specifications for the four triaxial fluxgate magnetometers used in the TMGS planar array. As shown previously in figure 5.3.2.4

  14. Compilation of 1988 Annual Reports of the Navy ELF (Extremely Low Frequency) Communications System Ecological Monitoring Program. Volume 2

    DTIC Science & Technology

    1989-08-01

    i3, 112-119. SW~right, R.T. & Coffin, R.B. 1984. Measuring microzopl , ’-., grazing on planktonic marine bacteria bv its impact on bacteria...activities are 3 shown for 1987 in Figure 4, along with antenna on and off times. Testing of the antenna was conducted on a 33% time rotation schedule...noticed that different observers differ slightly in their techniques for measuring 3 weights and body parts. Therefore we had all observers rotate among

  15. Granulocyte-macrophage colony-stimulating factor induces the differentiation of murine erythroleukaemia cells into dendritic cells.

    PubMed Central

    Cao, X; Zhao, Y; Yu, Y; Wang, Y; Zhang, M; Zhang, W; Wang, J

    1998-01-01

    Dendritic cells (DC) are professional antigen-presenting cells (APC) within the immune system and antigen-pulsed DC can be used as an effective vaccine for active immunotherapy of cancer. Granulocyte-macrophage colony-stimulating factor (GM-CSF) plays an important role in the generation of DC. We previously showed that GM-CSF can induce murine erythroleukaemia cells (FBL-3) to differentiate into monocyte-like cells. To develop a new vaccinating method to stimulate the host immune response to leukaemia, we further investigate whether FBL-3 cells induced by GM-CSF can differentiate into DC in the present study. After being treated with GM-CSF, FBL-3 cells expressed high levels of 33D1 and NLDC-145, which are the specific markers of DC. The expression of MHC-II, B7-1, B7-2 and vascular cell adhesion molecule-1 (VCAM-1) was up-regulated markedly; the typical morphology of DC were also observed by electron microscopy. Functionally, the GM-CSF-induced FBL-3 cells could apparently stimulate the proliferation of naive allogeneic and autologous T lymphocytes and induce the generation of specific CTL more efficiently than the wild-type FBL-3 cells. Mice immunized with GM-CSF-induced FBL-3 cells could resist the subsequent challenge with the wild-type FBL-3 cells. Collectively, these data indicate that GM-CSF differentiates murine erythroleukaemia cells into DC phenotypically, morphologically and functionally. FBL-3-derived DC can be used as a new type of vaccine. Our results may have important implications for the immunotherapy of leukaemia. Images Figure 3 Figure 4 PMID:9767469

  16. In Situ Evaluation of the Role of the Small GTPase Rac3 in Breast Cancer

    DTIC Science & Technology

    2005-07-01

    in Figure 3a, total endogenous Rae protein expression remained equal among the cell variants. However, levels of active Rae ranged from highest in the...variants. a b Whole cell lysates of variants were 00 46M 4k& Total Rac Total Cdc42 subjected to SDS-PAGE followed by M -W Active Ra [ Active Cdc42 western...blot analysis for total Rac (a) 4o1o1....0 ........GTPa. +GTPS using an anti-R ac antibody and total _+ooP [ _]+GDP Cdc42 (b) using an anti-Cdc42

  17. Raman-noise-induced noise-figure limit for chi (3) parametric amplifiers

    NASA Astrophysics Data System (ADS)

    Voss, Paul L.; Kumar, Prem

    2004-03-01

    The nonzero response time of the Kerr [chi (3)] nonlinearity determines the quantum-limited noise figure of c3 parametric amplifiers. This nonzero response time of the nonlinearity requires coupling of the parametric amplification process to a molecular-vibration phonon bath, causing the addition of excess noise through Raman gain or loss at temperatures above 0 K. The effect of this excess noise on the noise figure can be surprisingly significant. We derive analytical expressions for this quantum-limited noise figure for phase-insensitive operation of a chi (3) amplifier and show good agreement with published noise-figure measurements.

  18. Dirty Bomb Attack: Assessing New York City’s Level of Preparedness from a First Responder’s Perspective

    DTIC Science & Technology

    2006-03-01

    Preparedness.......80 Figure 3. NYC’s RDD Preparedness SWOT Analysis ...................................................82 Figure 4. The Four Hurdles...In order to properly plan for an increase in RDD preparedness, it is helpful to perform a basic SWOT analysis (Figure 3) of NYC’s first responder...3rd ed. (San Francisco: Jossey-Bass, 2004), 127. 82 Figure 3. NYC’s RDD Preparedness SWOT Analysis Four strategic issues emerge from the RDD

  19. Multifunctional receptor model for dioxin and related compound toxic action: possible thyroid hormone-responsive effector-linked site.

    PubMed Central

    McKinney, J D

    1989-01-01

    Molecular/theoretical modeling studies have revealed that thyroid hormones and toxic chlorinated aromatic hydrocarbons of environmental significance (for which dioxin or TCDD is the prototype) have similar structural properties that could be important in molecular recognition in biochemical systems. These molecular properties include a somewhat rigid, sterically accessible and polarizable aromatic ring and size-limited, hydrophobic lateral substituents, usually contained in opposite adjoining rings of a diphenyl compound. These molecular properties define the primary binding groups thought to be important in molecular recognition of both types of structures in biochemical systems. Similar molecular reactivities are supported by the demonstration of effective specific binding of thyroid hormones and chlorinated aromatic hydrocarbons with four different proteins, enzymes, or receptor preparations that are known or suspected to be involved in the expression of thyroid hormone activity. These binding interactions represent both aromatic-aromatic (stacking) and molecular cleft-type recognition processes. A multiple protein or multifunctional receptor-ligand binding mechanism model is proposed as a way of visualizing the details and possible role of both the stacking and cleft type molecular recognition factors in the expression of biological activity. The model suggests a means by which hormone-responsive effector-linked sites (possible protein-protein-DNA complexes) can maintain highly structurally specific control of hormone action. Finally, the model also provides a theoretical basis for the design and conduct of further biological experimentation on the molecular mechanism(s) of action of toxic chlorinated aromatic hydrocarbons and thyroid hormones. Images FIGURE 3. A FIGURE 3. B FIGURE 3. C FIGURE 3. D PMID:2551666

  20. Analysis of Data Acquired During Shallow Water Experiments Conducted in 2006 and 2011

    DTIC Science & Technology

    2012-07-01

    5  FIGURE 3.2.1.  THE PROPAGATION OF A TRAIN OF SOLITONS AND SOUND SPEED PROFILES ..............6  FIGURE 3.2.2.  THE EXPERIMENTAL...CONFIGURATION USED FOR THE SIMULATION STUDY ...............7  FIGURE 3.2.3.  THE RECONSTRUCTED PROFILE FOR THE SOUND SPEED WITHIN THE SOLITON FOR THE...THE SOLITON REGION ..........................................9  FIGURE 4.1.1.  SCHEMATIC OF MODAL MAPPING EXPERIMENT

  1. 16 CFR Figures 3 and 4 to Subpart... - Test Specimens

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 16 Commercial Practices 2 2011-01-01 2011-01-01 false Test Specimens 3 Figures 3 and 4 to Subpart A of Part 1201 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION CONSUMER PRODUCT SAFETY ACT... Figures 3 and 4 to Subpart A of Part 1201—Test Specimens EC03OC91.006 ...

  2. 16 CFR Figures 3 and 4 to Subpart... - Test Specimens

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Test Specimens 3 Figures 3 and 4 to Subpart A of Part 1201 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION CONSUMER PRODUCT SAFETY ACT... Figures 3 and 4 to Subpart A of Part 1201—Test Specimens EC03OC91.006 ...

  3. 16 CFR Figures 3 and 4 to Subpart... - Test Specimens

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 2 2012-01-01 2012-01-01 false Test Specimens 3 Figures 3 and 4 to Subpart A of Part 1201 Commercial Practices CONSUMER PRODUCT SAFETY COMMISSION CONSUMER PRODUCT SAFETY ACT... Figures 3 and 4 to Subpart A of Part 1201—Test Specimens EC03OC91.006 ...

  4. CHRIS: Hazard Assessment Handbook

    DTIC Science & Technology

    1977-12-12

    3.10 Vectorial Addition of Sea and Wind Currents 50 B1 Flame Length for Gases Venting Through Holes 177 B2 Equivalent...determined are: • Flame length (flame height), • Safe distance for people (away from the flame) • Safe distance for people in fire-protective clothing (away...pencil so it can be erased) Determine the flame length from Figure B1, using the venting hole diameter and the curve corresponding to the specific

  5. MAGNETIC BEHAVIOR OF FUNCTIONALLY MODIFIED SPINEL Ni0.4Ca0.6Fe2O4 NANOFERRITE

    NASA Astrophysics Data System (ADS)

    Prasad, Arun S.; Dhawan, M. S.; Dolia, S. N.; Samariya, Arvind; Reddy, V. R.; Singhal, R. K.; Predeep, P.

    2011-06-01

    The editorial board discovered that the data points in several sections of the Mossbauer spectra as given in Figs. 3(a) and 3(b) are exactly identical. This is impossible and nonphysical for the measurement of two different samples (or for that matter not even for the same sample!). The only conclusion we can draw from this figure is that some of the data is fabricated. As a result, the results and conclusions as described in the paper are unacceptable. This article is retracted from its publication in Int. J. Mod. Phys. B.

  6. XM746 Practice Fuze.

    DTIC Science & Technology

    1980-07-01

    34 t"Codes LIST OF ILLUSTRATIONS Figure No. Title Page 1 ARRADCOM XM747 ( M739 ) Practice Fuze 2 2A Cover, Spotting Charge 4 2B Cup, Spotting Charge 5 3...Plastic Practice Fuze XM746 Preliminary Design 6 4 Modified PDM739 Fuze 7 5 XM746 All Plastic Fuze 9 6 ARRADCOM XK747 ( M739 ) Practice Fuze 11 7...Assembly 18 11 Smoke Exit Relationship 19 12A XM747 MBA TiCl4 Configuration 23 12B Fuze M739 MOD F 24 13 TiCl4 Assembly 25 14 BKNO3 Assembly 26 15

  7. Assessment of induced SAR in children exposed to electromagnetic plane waves between 10 MHz and 5.6 GHz

    NASA Astrophysics Data System (ADS)

    Bakker, J. F.; Paulides, M. M.; Christ, A.; Kuster, N.; van Rhoon, G. C.

    2011-05-01

    In this corrigendum, the authors would like to report typographic errors in figures 3 and 4 and to suggest a brief amendment to section 3.1 to avoid further misunderstandings. Figures 3 and 4: the y-axis tick should read 0.1 instead of 1 in both figure 3 (top) and figure 4 (top). In figure 3 (top), the title should be changed to 'SARwb' instead of 'SARwb,max'. Section 3.1. Numerical uncertainty: the following note should be added at the end of the paragraph or as a footnote: 'In order to obtain a worst-case estimate of the numerical uncertainty (table 4), all components were considered as correlated'. The authors would like to express their sincere apologies for the errors in the manuscript.

  8. Lamb Wave Polarization Techniques for Structural Damage Localization and Quantification

    DTIC Science & Technology

    2011-11-01

    11  Figure 11. Images showing (a) fatigued aluminum dog bone specimen with 53-mm crack and (b) 3-D SLDV test...Abaqus* and a 3-D model of a plate girder. Experimental measurements using piezoelectric ( PZT ) sensors were located on the web in pulse-echo mode, and...analyzed mode conversion of T- joint with collocated PZT sensors before and after the stiffener using a 2-D simulation under plane strain assumptions

  9. Propulsion System Technology for Military Land Vehicles

    DTIC Science & Technology

    1981-08-01

    torques) to decrease specific weight and volume; and (3) hybrid transmissions using low-torque devices (electrical converters or traction drives) with a... VEICLE SPEC POMWE, bWtu FIGURE 1. Impact of vehicle specific power on weight and manufacturing cost of armored vehicles. 15 [ 𔃺!00, LCV .30 *1

  10. Microcomputers and the Electrical Engineer.

    DTIC Science & Technology

    1984-07-01

    B6 10*SIN(B4*B1I) 12 BII+B6 10*SIN(B4*812) 13 B12+B6 1O*SIN(B4*BI3) 14 B13+B6 10*SIN(B4*B14) 15 B14+B6 10*SIN(B4*BI5) 16 B15+B6 10*SIN(B4* Bl6 ) 17 B16 ...C15)),AND(D15,NOT(EI5 16 0 0 1 0 OR(AND( B16 ,NOT(C16)),AND(D16,NOT(E16 a17 0 0 0 1 OR(AND(B17,NOT(C17)),AND(D17,NOT(E17 18 0 0 0 0 OR(AND(B18,NOT(C18...NOT(E15)) 16 0 0 010 AND(AND( Bl6 ,NOT(Cl7)),AND(D16,NOT(E16)) 18 0) 0 0 0 AND(AND(B18,NOT(C18)),AND(D18,NOT(E18)) 19 Figure 3 I A IIBIJCIIDIIEII F I 1

  11. 40 CFR 86.328-79 - Leak checks.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... flows may be used to estimate the in-use flow rates. (3) The sample probe and the connection between the sample probe and valve V2 (Figure D79-1) may be excluded from the leak check. (b) Pressure side leak...

  12. 40 CFR 91.324 - Analyzer leakage check.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... flows and bypass flows may be used to estimate the in-use flow rates. (3) The sample probe and the connection between the sample probe and valve V2 (see Figure 1 in appendix B of this subpart) may be excluded...

  13. 40 CFR 91.324 - Analyzer leakage check.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... flows and bypass flows may be used to estimate the in-use flow rates. (3) The sample probe and the connection between the sample probe and valve V2 (see Figure 1 in appendix B of this subpart) may be excluded...

  14. 40 CFR 86.328-79 - Leak checks.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... flows may be used to estimate the in-use flow rates. (3) The sample probe and the connection between the sample probe and valve V2 (Figure D79-1) may be excluded from the leak check. (b) Pressure side leak...

  15. 40 CFR 86.328-79 - Leak checks.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... flows may be used to estimate the in-use flow rates. (3) The sample probe and the connection between the sample probe and valve V2 (Figure D79-1) may be excluded from the leak check. (b) Pressure side leak...

  16. 40 CFR 86.328-79 - Leak checks.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... flows may be used to estimate the in-use flow rates. (3) The sample probe and the connection between the sample probe and valve V2 (Figure D79-1) may be excluded from the leak check. (b) Pressure side leak...

  17. 40 CFR 91.324 - Analyzer leakage check.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... flows and bypass flows may be used to estimate the in-use flow rates. (3) The sample probe and the connection between the sample probe and valve V2 (see Figure 1 in appendix B of this subpart) may be excluded...

  18. 40 CFR 91.324 - Analyzer leakage check.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... flows and bypass flows may be used to estimate the in-use flow rates. (3) The sample probe and the connection between the sample probe and valve V2 (see Figure 1 in appendix B of this subpart) may be excluded...

  19. 40 CFR 91.324 - Analyzer leakage check.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... flows and bypass flows may be used to estimate the in-use flow rates. (3) The sample probe and the connection between the sample probe and valve V2 (see Figure 1 in appendix B of this subpart) may be excluded...

  20. Center for Coastline Security Technology, Year 3

    DTIC Science & Technology

    2008-05-01

    Polarization control for 3D Imaging with the Sony SRX-R105 Digital Cinema Projectors 3.4 HDMAX Camera and Sony SRX-R105 Projector Configuration for 3D...HDMAX Camera Pair Figure 3.2 Sony SRX-R105 Digital Cinema Projector Figure 3.3 Effect of camera rotation on projected overlay image. Figure 3.4...system that combines a pair of FAU’s HD-MAX video cameras with a pair of Sony SRX-R105 digital cinema projectors for stereo imaging and projection

  1. Strangeness Production in 19.6 GeV Collisions at the Relativistic Heavy Ion Collider

    DTIC Science & Technology

    2010-05-12

    Baryons Figure 1.3: Well known Mesons Figure 1.4: Phase Diagram of Nuclear Matter Figure 1.5: The author and his advisor together with MIDN 3/C...7. Conclusions and Outlook Acknowledgements 3 List of Figures Figure 1.1: Nucleus Breakdown Figure 1.2: Well known Baryons and Anti...AntiBaryon/ Baryon Ration from experiments around the globe 6 List of Symbols and Acronyms AGS – Alternating

  2. Common Pediatric Urological Disorders

    PubMed Central

    Robson, Wm. Lane M.; Leung, Alexander K.C.; Boag, Graham S.

    1991-01-01

    The clinical and radiological presentations of 12 pediatric urological disorders are described. The described disorders include pyelonephritis, vesicoureteral reflux, ureteropelvic obstruction, ureterovesical obstruction, ectopic ureterocele, posterior urethral valves, multicystic dysplastic kidney, polycystic kidney disease, ectopic kidney, staghorn calculi, urethral diverticulum, and urethral meatal stenosis. ImagesFigure 1-2Figure 3Figure 3Figure 4Figure 5Figure 6-7Figure 8-9Figure 10Figure 11-12 PMID:21229068

  3. Lift Production on Flapping and Rotary Wings at Low Reynolds Numbers

    DTIC Science & Technology

    2016-02-26

    though parameter variations were also performed. For the rotating cases, the wing was an aspect ratio 2 rectangular flat plate , and the root cutout (i.e...rectangular flat plate . 2 U (Side View) (a) 1A: Rectilinear pitch U (Side View) (b) 1B: Rectilinear surge (Top View) (Side View) (c) 2A: Rotational...0.5c φ (b) A=2 flat plate wing Figure 2: Schematic of the AVT-202 rotating wing kinematics and geometry, from Ref. 12. 3.2 Experimental Setup Rotating

  4. Structural Characterization of Atomically Thin Hexagonal Boron Nitride via Raman Spectroscopy

    DTIC Science & Technology

    2014-03-27

    thickness and the use of depth profiling to maximize spectral returns. Chapter 3 also outlines the experimental set-up and procedures related to...section. 46 Figure 4.8: Unaltered spectral return of both Site 1 (A) and Site 2 ( B ). As to be expected the relative intensity of the Raman...Dent, Modern Raman Spectroscopy : A Practical Approach. Wiley, 2006, p. 224. 59 25. A. B . Kaul, E. W . Wong, L. Epp, and B . D. Hunt, “Two

  5. Influence of Surface Roughness on the Second Order Transport of Turbulence in Non-Equilibrium Boundary Layers

    DTIC Science & Technology

    2006-10-08

    FINAL REPORT to Air Force Office of Scientific Research (AFOSR) Project Title Influence of Surface Roughness on the Second Order Transport of...large amount of research has been performed to quantify the effects of Mach number, roughness, and wall curvature on turbulent boundary layers. However...18 a) b) c) Figure 3: a) A. D. Smith high pressure storage tank. b) Morin B series actuator controlling Virgo Engineers Trunion Mounted Ball Valve. c

  6. An Architecture for Cooperative Localization in Underwater Acoustic Networks

    DTIC Science & Technology

    2015-10-24

    range. (b) Independent navigation and control system onboard Iver AUVs . The cooperative localization process is highlighted in red. Figure 1: Block...Iver2 AUVs (Fig. 3) and a topside ship. While we make spe- cific notes about this three vehicle network, the architecture is vehicle independent. 3.1...Single vehicle subsystem Each vehicle executes several processes including sensor drivers, a pose estimator (Section 2), and, in the case of the AUVs

  7. 1987 Annual Tropical Cyclone Report

    DTIC Science & Technology

    1987-01-01

    Significant Tropical Weather Adviso~~ es : issued daily, these products describe all tropical disturbances and assess their potential for further...COA3fm communicati~ estimates ofcurnmf andfmecast intensity ahiveffj%m sateC & a!hta. In tlie a.yampk,the current ‘T-number’ is 3.$ fiut the cun-ent...DEVIATION : 111 = ES : 465 Figure 5-2B. Frequeney di.s~”buticnt of th 48-hourforecast emorsin 30 nm (56 ~m) increnwttsfor dsignif~ant tropicalyclk.s in

  8. Test Excavations at the Cedar Grove Site (3LA97): A Late Caddo Farmstead on the Red River.

    DTIC Science & Technology

    1982-09-01

    trees around Maya Lake, just eastward of the Cedar Grove site (Figure 3). There appears to be some lcorrelation in this region between floodplain prairies...Press, New York. Davis, E. Mott 1970 Archaeological and historical assessment of the Red River Basin in Texas. In Archeological and historical... Archaeological Conference, Atlanta. 113 4 -- - - - - .. .. .- .. - . . . Webb, Clarence B. 1945 A second historic Caddo site at Natchitoches, Louisiana

  9. Communication Satellites 1958 to 1986

    DTIC Science & Technology

    1984-10-01

    information by tracking a ground-based beacon. The payload has redundant wideband receivers and redundant transmitters, with 230 W helix type TWTs , for...70.3, International Conference on Comrounications; ICC 󈨕 (June 1981). , and R. H. Tamashiro, "A 20 GHz 75 Watt Helix TWT for Space...WB) All solid state except TWT 10-W output Receiver 1723.3. 1726.7 MHz (NB), 1725 HHz (WB) All solid state 14-dB noise figure Antenna 2

  10. Enhancing Human-Machine System Performance by Introducing Artificial Cognition in Vehicle Guidance Work Systems

    DTIC Science & Technology

    2009-10-01

    evaluated after each mission using the NASA - TLX method [21]. Moreover, they were interviewed to be able to state problems and suggest system...France, 3 rd -4 th September 2008. [21] Sandra G. Hart & Lowell E. Staveland (1988). Development of NASA - TLX (Task Load Index): Results of...o b s e rv a b le b e h a v io u r o f C P = A C U b e h a v io u r Interpretation Figure 11: The Cognitive Process for generating knowledge

  11. Expression of hemidesmosomal and extracellular matrix proteins by normal and malignant human prostate tissue.

    PubMed Central

    Nagle, R. B.; Hao, J.; Knox, J. D.; Dalkin, B. L.; Clark, V.; Cress, A. E.

    1995-01-01

    The progression of prostate carcinoma may be influenced by the biochemical nature of the basal lamina surrounding the primary carcinoma cells. As a first step toward understanding this process, the composition and structure of the basal lamina in normal prostate, prostatic intraepithelial neoplasia, and human carcinoma were determined. In addition, a comparison was made between the attachments of the normal basal cell to its underlying basal lamina and those made by primary prostate carcinoma. The normal basal cells form both focal adhesions and hemidesmosomal-like structures as observed by transmission electron microscopy. The normal basal cells exhibited a polarized distribution of hemidesmosomal associated proteins including BP180, BP230, HD1, plectin, laminin-gamma 2(B2t), collagen VII, and the corresponding integrin laminin receptors alpha 6 beta 1 and alpha 6 beta 4. The expression and distribution pattern of these proteins were retained in the prostate intraepithelial neoplasia lesions. In contrast, the carcinoma cells uniformly lacked hemidesmosomal structures, the integrin alpha 6 beta 4, BP180, laminin-gamma 2 (B2t), and collagen VII but did express BP230 (30%), plectin, HD1 (15%), and the integrin laminin receptors alpha 3 beta 1 and alpha 6 beta 1. These results suggest that, although a detectable basal lamina structure is present in carcinoma, its composition and cellular attachments are abnormal. The loss of critical cellular attachments may play a role in influencing the progression potential of prostate carcinoma. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:7778688

  12. Regulation of Leukocyte Infiltration into Ovarian Cancer by Tumour-Stroma Interactions: A Microarray View of Cancer Microenvironment

    DTIC Science & Technology

    2006-03-01

    PTGS2 STAT1 HIF1A INHBA CXCL9 DPP4 PLAU MMP7 NOTCH3 TWIST1 A B 20 08 42 9 20 08 C M IL 1β TN Fα H ey m oo dy O V H S C C L2 IN Fγ IL 18 IL 8 IL 8+ C C...Default Interpretation) Gene List: Figure 3a (75) MultiCC15 (82) IFI35 BST2 CYR61 IL6 COL6A3 BMP4 SERPINB2 COL5A3 PODXL MAP17 FN1 NOTCH3 HOXB2 MCM6 TNF

  13. Scaling Problems for Wave Propagation in Layered Systems. Volume 1

    DTIC Science & Technology

    1989-09-01

    bore diameter. To avoid this type of damage to the barrel, a steel tubing made from an alloy steel such as 4140 or 4340 is recommended since these...Figure A-3. It is suggested that a different material be chosen for the barrel sections, if possible (such as 4140 or 4340 steel), to provide a heat...maximum pressure, and was found to have a factor of safety against shear in excess of 3. Eighteen high strength, SAE B-7, 3/4 inch-16 UNF threaded rods

  14. 2D and 3D Modeling Efforts in Fuel Film Cooling of Liquid Rocket Engines (Conference Paper with Briefing Charts)

    DTIC Science & Technology

    2017-01-12

    J =0.13%, FFC Varies (b) J =0.13%, Main chamber Varies ( c ) J ...b) J =0.13%, Main Varies ( c ) J =1.23%, FFC Varies (d) J =1.18%, Main Varies (e) J =7.89%, FFC Varies (f) J =7.34%, Main Varies Figure 8. Power Spectral...Statement A: Approved for Public Release; Distribution Unlimited. PA Clearance #16569 (a) J =0.13%, FFC Varies (b) J =0.13%, Main Varies ( c ) J =2.79%,

  15. Fiber Optic Microsensor for Receptor-Based Assays

    DTIC Science & Technology

    1988-09-01

    MONITORING ORGANIZATION ORDInc.(if applicable ) 6c. ADDRESS (CWty Sta~te, and ZIP code) 7b. ADDRESS (City, State, an~d ZIP=Cd) Nahant, MA 019081 Sa, NAME OF...yield B-PE B-phycoerythrin 545 575 2,410,000 0.98 R-PE R-phycoerythrin 565 578 11960,000 0.68 CPC C- phycocyanine 620 650 1,690,000 0.51 A-PC...efficient transfer occurred for unit magnification. Figure 3 shows the optical design. Evaluation of the instrument was done with both A- phycocyanine

  16. Flux Pinning Enhancement in YBa2Cu3O7-x Films for Coated Conductor Applications (Postprint)

    DTIC Science & Technology

    2012-02-01

    the nanocolumns with a certain constant diameter. Since BSO and YBCO are both perovskites, they tend to grow along the c - axis perpendicular to LAO ...20 0 20 40 60 80 100 YBCO+BaSnO 3 / LAO YBCO/MS-6 YBCO+BaSnO 3 /MS-6 J c /J c( h // a b ) Angle (Degs) H//C H//ab Figure 5.18 Transport current...density data of YBCO+BSO fi lm on a LaAlO 3 and a buffered metallic substrate as compared to YBCO fi lm on a metallic substrate. ( LAO = LaAlO 3 , MS

  17. Compliance Testing of Grissom AFB, Central Heating Plant Coal-Fired Boilers 3, 4 and 5 Grissom AFB, Indiana.

    DTIC Science & Technology

    1991-03-01

    common breeching and can be routed to the wet -scrubber or to a bypass stack. The scrubber is a double-alkali flue - gas desulfurization system using...air. B,,., = proportion by volume of water vapor in F, = a factor representing a ratio of the vol- the stack gas . ume of wet flue gases generated to...1 s- .- - Dtstr’, . iii i Illustrations Figure Title Page 1 View of Scrubbers and Bypass Stack 3 2 Flue Gas Flow Diagram 4 3 ORSAT Sampling Train

  18. 50 CFR Figure 3 to Part 223 - Matagorda TED

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 50 Wildlife and Fisheries 10 2012-10-01 2012-10-01 false Matagorda TED 3 Figure 3 to Part 223 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS THREATENED MARINE AND ANADROMOUS SPECIES Pt. 223, Fig. 3 Figure 3 to...

  19. 50 CFR Figure 3 to Part 223 - Matagorda TED

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 50 Wildlife and Fisheries 9 2011-10-01 2011-10-01 false Matagorda TED 3 Figure 3 to Part 223 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS THREATENED MARINE AND ANADROMOUS SPECIES Pt. 223, Fig. 3 Figure 3 to...

  20. Fatigue 󈨛. Papers presented at the International Conference on Fatigue and Fatigue Threshold (3rd) Held in Charlottesville, Virginia on June 28-July 3, 1987. Volume 2.

    DTIC Science & Technology

    1987-10-15

    Region B: max b+c 𔃼/E (2N) 2b (2) al £1 = a ,(N) + ai/ f N 2 This model was originally proposed by Smith, Watson and Topper (13) for mean stress effects...relationship such as that proposed by Forman et al . (2) can be used to predict crack growth rates in this regime: da N’ AK .. (2) =-N (i-R)K -AKc *Technologv...to the specimen given by the area under the load displacement curve, Up in Figure 1. The method of J calculation is that described by Garwood et al

  1. The SHAFT Book (Design Charts for Torsional Properties of Non-Circular Shafts)

    DTIC Science & Technology

    1980-03-01

    7870 .7906 .7944 .7864 .7903 .7968 .8048 . 7845 .7874 .7933 .8035 .8189 .7852 .7899 .7993 .8143 .8362 .7857 .7918 .8059 .8270 .8580 .7862 .7950 .8113...similar manner to equation 4): Ch h2V2f0= A(f1 +f3) +B(f2 +f4) +— (f2-f4) 2Rr - (A + B)2 f0 = h’D Eq (12) See figure A-6. 73 IRREGULAR...b2+b4) 4 1 Ch ba f k Ro b2(b2+b4) 2 b4(b2+b4) i Z2 f + r ] 1 2A_ ^ ^B_ _ Ch cb«-b4 j f ! bjbj b2b4

  2. Critical Infrastructure Rebuild Prioritization using Simulation Optimization

    DTIC Science & Technology

    2007-03-01

    23 Figure 2.9 Production by temperature and production made from a crude oil (EIA.com)24 Figure 2.10 Natural gas industry... Oil infrastructure physical layer ...................................................................... 45 Figure 3.6 Natural gas infrastructure...information layer.......................................................... 55 Figure 3.11 Oil infrastructure information layer

  3. Role of Stat3 and ErbB2 in Breast Cancer

    DTIC Science & Technology

    2012-10-01

    also activated by receptor tyrosine kinases, such as the epidermal growth factor receptor (EGFR) or platelet -derived growth factor receptor (PDGFR...cells were grown to different densities, up to 5 days post-confluence, as indicated. Detergent cell lysates were probed for Stat3-ptyr705, active Rac...and lysates probed for total cav1, cadherin 11 or tubulin as a loading control. 15 C Figure 7: Cadherin 11 and Rac1 downregulation

  4. Development and Experimental Application of International Affairs Indicators. Volume B. Supportive Research

    DTIC Science & Technology

    1974-06-01

    i INDICATORS Approaches to Early Warning The Quantitative Indicators Approach: A ... 5 Summary Indicators and Early Warning...Indicators for Early ^ Wa rning 3. Quantitative Signs of Unusual or Ominous Activity 9 13 4. Simulated Cables 25 5 . TEXSCAN...Behavior) for Czechoslovakia 1 mmmmm mmm LIST OF FIGURES vi Pa£« 1. 2. 3. 4. 5 . 6. 7. 8. 9. 10. U. 12. 13. 14. 15. 16. 17. 18

  5. Interactive Macroeconomics

    NASA Astrophysics Data System (ADS)

    Di Guilmi, Corrado; Gallegati, Mauro; Landini, Simone

    2017-04-01

    Preface; List of tables; List of figures, 1. Introduction; Part I. Methodological Notes and Tools: 2. The state space notion; 3. The master equation; Part II. Applications to HIA Based Models: 4. Financial fragility and macroeconomic dynamics I: heterogeneity and interaction; 5. Financial fragility and macroeconomic Dynamics II: learning; Part III. Conclusions: 6. Conclusive remarks; Part IV. Appendices and Complements: Appendix A: Complements to Chapter 3; Appendix B: Solving the ME to solve the ABM; Appendix C: Specifying transition rates; Index.

  6. Capstone Report on the Application, Monitoring, and Performance of Permeable Reactive Barriers for Ground-Water Remediation: Volume 1: Performance Evaluations at Two Sites

    DTIC Science & Technology

    2003-08-01

    sepiolite , Mg 4 (OH) 2 Si 6 O 15 ·H 2 O...EC050801-3-5 EC050801-3-3 EC050801-3-2 EC050801-3-1 In te n si ty degrees 2-theta In te n si ty In te n si ty downgradient edge upgradient edge In te n...400 b ic a rb o n a te , m g /L 0 2 4 6 8 10 12 14 16 si lic a , m g /L Figure 4.12 Average (± 1 s.d.) concentrations of Na, K , Ca,

  7. Prevalence of the BCR/ABL1 transcripts in Mexican patients with chronic myelogenous leukemia.

    PubMed

    Meza-Espinoza, Juan Pablo; Gutiérrez-Angulo, Melva; Vázquez-Cárdenas, Alejandra; Delgado-Lamas, José Luis; Esparza-Flores, María Amparo; González-García, Juan Ramón

    2007-01-01

    RT-PCR studies in 93 patients with chronic myelogenous leukemia from the Mexican West were done in order to know the proportion of b2a2 and b3a2 BCR/ABL1 transcripts. Forty-five patients showed the b3a2 transcript (48%), 37 (40%) displayed the b2a2 and in 11 cases (12%) both transcripts were detected. Statistical analyses showed that these figures are in accordance with two of three similar studies realized in Mexican population. Moreover, significant differences were found among Mexican people and patients from other countries, namely Ecuador, England, Italy, Poland, Japan, and Thailand. Ecuadorian patients showed differences with all the populations analyzed. These variations could be due to a different genetic background.

  8. The 30 GHz communications satellite low noise receiver

    NASA Technical Reports Server (NTRS)

    Steffek, L. J.; Smith, D. W.

    1983-01-01

    A Ka-band low noise front end in proof of concept (POC) model form for ultimate spaceborne communications receiver deployment was developed. The low noise receiver consists of a 27.5 to 30.0 GHz image enhanced mixer integrated with a 3.7 to 6.2 GHz FET low noise IF amplifier and driven by a self contained 23.8 GHz phase locked local oscillator source. The measured level of receiver performance over the 27.3 to 30.0 GHz RF/3.7 to 6.2 GHz IF band includes 5.5 to 6.5 dB (typ) SSB noise figure, 20.5 + or - 1.5 dB conversion gain and +23 dBm minimum third order two tone intermodulation output intercept point.

  9. Borehole Shear Device Phase II Development.

    DTIC Science & Technology

    1982-02-01

    FIGURE 8 ITEM QUANTITY DESCRIPTION B1 1 Torque/Normal Load Transducer - First Extension Coupling. B2 1 Torque/Normal Load Transducer - Gauge Tube. B3 I...235, type RFN 7012. Supplier - Ringfeder Limited, Forum Drive, Midland Indus- trial Estate, Rugby , Warwickshire CV21 iNT, UK. FB 1 Expanding Friction...Midland Industrial Estate, Rugby , Warwickshire CV21 INT, UK. GF 2 Deep Groove Ball Bearing (upper support bearing), 80 x 100 x 10. Supplier - SKF ref

  10. Graph-Cut Methods for Grain Boundary Segmentation (Preprint)

    DTIC Science & Technology

    2011-06-01

    metals and metal alloys ) are among the strongest determinants of many material properties, such as mechanical strength or fracture resistance. In materials...cropped) Ni-based alloy image (a) using normalized cut (b) and ratio cut (c). Similar to normalized cut is the average-cut approach [11], where the...framework [2]. (a) (b) (c) Figure 3: Segmentation of a (cropped) Ni-based alloy image by optimal labeling. (a) Segmented grain bound- aries in a template

  11. A Bio-Energetic Model for North Atlantic Right Whales: Locomotion, Anatomy and Diving Behavior

    DTIC Science & Technology

    2008-01-01

    tracker was visualized with Avizo , formerly Amira, software (Mercury Computing, Inc.) (Figure 3). The particle tracker feature greatly increased our...plots in Figures 3 and 4, respectively. Figure 3. Example of a network script from Avizo that controls the manipulation and visualization

  12. Regulation of Leukocyte Infiltration into Ovarian Cancer by Tumor-Stroma Interactions, a Microarray View of Cancer Microenvironment

    DTIC Science & Technology

    2007-03-01

    HIF1A INHBA CXCL9 DPP4 PLAU MMP7 NOTCH3 TWIST1 A B 20 08 42 9 20 08 C M IL 1β TN Fα H ey m oo dy O V H S C C L2 IN Fγ IL 18 IL 8 IL 8+ C C L2 A C TA IL...Interpretation) Gene List: Figure 3a (75) MultiCC15 (82) IFI35 BST2 CYR61 IL6 COL6A3 BMP4 SERPINB2 COL5A3 PODXL MAP17 FN1 NOTCH3 HOXB2 MCM6 TNF OAS1 BAI3

  13. AIDS-related lymphoma. Histopathology, immunophenotype, and association with Epstein-Barr virus as demonstrated by in situ nucleic acid hybridization.

    PubMed Central

    Hamilton-Dutoit, S. J.; Pallesen, G.; Franzmann, M. B.; Karkov, J.; Black, F.; Skinhøj, P.; Pedersen, C.

    1991-01-01

    To investigate the range of pathology shown by acquired immune deficiency syndrome (AIDS)-related lymphomas arising in an epidemiologically well-defined group of patients, all cases of lymphoma recognized in Danish human immunodeficiency virus (HIV)-infected individuals up to the end of 1988 were studied. Twenty-seven cases (26 high-grade non-Hodgkin's lymphoma [NHL], 1 Hodgkin's disease) were found, to give a cumulative incidence rate of 8% among Danish AIDS patients. Morphologically most NHL patients were classified into two groups: 1) high-grade tumors with a predominant population of immunoblasts, either monomorphic or more often polymorphic with plasmacytic differentiation; 2) Burkitt-type. Of 26 NHLs, 22 had a B-cell paraffin-section immunophenotype and 4 were non-B, non-T. Epstein-Barr virus (EBV) DNA was demonstrated in tumor cells of 12 of 24 cases (50%) using in situ nucleic acid hybridization with a 35S-labeled probe in paraffin sections. Epstein-Barr virus DNA was found in 65% of group 1 and 20% of group 2 tumors. This study suggests the existence of two main groups of AIDS-related lymphoma with different pathogeneses. First there are immunoblast-rich lesions, which usually are associated with EBV and morphologically resemble lymphomas described in immunosuppressed organ-transplantation patients. Second there are Burkitt-type tumors in which EBV sequences are less common and that may be pathogenetically analogous to sporadic Burkitt's lymphoma. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:1846263

  14. Section I Summary

    NASA Technical Reports Server (NTRS)

    2016-01-01

    Shuttle Flight 41-C, the Solar Max Repair mission, took off on April 6, 1984 from Kennedy Space Center in Florida. As with 41-B, the dress rehearsal for this flight, launch was early in the morning. It occurred at 7:58 CST. The landing also took place at KSC the following Friday, April 13, 1984. This was Challenger's fifth flight. There were two prime EMU's and one back-up short EMU stowed for this flight in the Airlock. The two MMU's were again mounted in their Flight Support Stations in the payload bay. Figure 1 shows the EMU functional schematic while Figure 2 shows the hardware which makes up the EMU. The payload bay configuration for the MMU's appears in Figure 3.

  15. Low-cost 20-22 GHz MIC active receiver/radiometer

    NASA Technical Reports Server (NTRS)

    Mollenkopf, Steven; Katehi, Linda P. B.; Rebeiz, Gabriel M.

    1995-01-01

    A microwave integrated circuit active receiver is built and tested at 19-25 GHz. The receiver consists of a planar CPW-fed double folded-slot antenna coupled to a six-stage MESFET (metal semiconductor field effect transistors) amplifier and followed by a planar Schottky-diode detector. The folded-slot antenna on a GaAs half-space results in a wide frequency bandwidth suitable for MMIC amplifiers. The measured system performance show a video responsivity close to 1 GV/W at 20 GHz with a 3-dB bandwidth of 1500 MHz. A novel method which uses the planar video detector after the amplifier stages as an RF (radio frequency) mixer is used to measure the noise-figure of the direct detection radiometer. The system noise figure is 4.8 dB at 22 GHz. The radiometer sensitivity to a hot/cold load is 3.8 mu V/K. The measured antenna patterns show a 90% Gaussicity at 20-22 GHz. The active MIC receiver can be integrated monolithically for low-cost applications and is well suited for millimeter-wave linear imaging arrays.

  16. Unmanned Aircraft Systems (UAS): Addressing the Regulatory Issues for National Airspace System (NAS) Integration

    DTIC Science & Technology

    2009-04-01

    terms of IFR operations or passenger enplanements. The configuration of each Class B airspace area is individually tailored and consists of a surface...are serviced by a radar approach control, and that have a certain number of IFR operations or passenger enplanements. Although the configuration of...ft MSL Figure 3 depicts DoD UASs operating in their respective NAS classifications: Global Hawk Predator B Transponder See & Avoid DME IFR

  17. High pressure transport studies on Sb2Te3 and BiSbTe3

    NASA Astrophysics Data System (ADS)

    Jacobsen, Matthew; Cornelius, Andrew

    2008-03-01

    Interest regarding the abilities of thermoelectric materials has produced exciting results regarding their properties in the thin-film form [3]. However, little work has been done regarding the pressure tuning of the thermoelectric figure of merit for these materials materials. Some previous work has suggested that it would be useful to investigate this further using pressure tuning [1],[2]. Based upon this interest, facilities have been developed in our laboratory for the study of the relevant properties under high pressure up to near 20 GPa. Results of this work on Sb2Te3 and BiSbTe3 will be presented here from the use of these facilities. [1]Chen, G., Dresselhaus, M.S., Dresselhaus, G., Fleurial, J.-P., and Caillat, T. Recent developments in themoelectric materials. International Materials Reviews, 48, 45-66 (2003). [2]Rowe, D.M. CRC Handbook of Thermoelectric Materials. CRC Press, 1995. [3]Venkatasubramanian, R., Silvola, E., Colpitts, T., and O'Quinn, B. Thin-film thermoelectric devices with high room-temperature figures of merit. Nature, 413, 597-602, 2001.

  18. Geochemical Weathering in Glacial and Proglacial Environments

    NASA Astrophysics Data System (ADS)

    Tranter, M.

    2003-12-01

    It seems counterintuitive that chemical erosion in glaciated regions proceeds at rates comparable to those of temperate catchments with comparable specific runoff (Anderson et al., 1997). All the usual factors that are associated with elevated rates of chemical weathering ( Drever, 1988, 1994), such as water, soil, and vegetation, are either entirely absent or absent for much of the year. For example, glaciated regions are largely frozen for significant periods each year, the residence time of liquid water in the catchment is low ( Knight, 1999), there are thin, skeletal soils at best, and vegetation is either absent or limited ( French, 1997). Other chapters in this volume have highlighted how these factors are important in other, more temperate and tropical environments. Even so, chemical erosion rates in glaciated terrain are usually near to or greater than the continental average ( Sharp et al., 1995; Wadham et al., 1997; Hodson et al., 2000). This is because glaciated catchments usually have high specific runoff, there are high concentrations of freshly comminuted rock flour, which is typically silt sized and coated with microparticles, and adsorbed organic matter or surface precipitates that may hinder water-rock interactions are largely absent ( Tranter, 1982). In short, the rapid flow of water over fine-grained, recently crushed, reactive mineral surfaces maximizes both the potential rates of chemical weathering and chemical erosion.A range of both lab- and field-based studies of glacial chemical weathering have been undertaken, mainly on the smaller glaciers of Continental Europe (e.g., Brown et al., 1993a, b), Svalbard (e.g., Hodson et al., 2002), and North America (e.g., Anderson et al., 2000). The field-based studies typically generate hydrographs of glacier runoff, which show a characteristic diurnal cycle during summer in low latitudes ( Figure 1), and more subdued diurnal cycles at high latitudes (Figure 2 and Figure 3). The concentration of ions in solution, typically monitored by electrical conductivity, is often inverse with discharge on both a diurnal and a seasonal basis at lower latitudes, but ismore complex at higher latitudes (Figure 1, Figure 2 and Figure 3). Figure 1, Figure 2 and Figure 3 also show that the total flux of glacial solutes is usually dominated by fluxes associated with high discharge, dilute waters. The chemical weathering reactions that are inferred to occur from the field studies have been supported, in part, by controlled laboratory studies (e.g., Brown et al., 1993a). Recent stable-isotope studies have reported the key involvement of microbial processes in certain regions of the glacier bed ( Bottrell and Tranter, 2002), and these processes are yet to be incorporated in lab-based chemical weathering studies. (14K)Figure 1. (a) The temporal variation of discharge and in non-sea-salt calcium (*Ca2+) concentration in runoff from Haut Glacier d'Arolla, a small, warm-based, valley glacier in the Swiss Alps, during 1989 (Brown et al., 1993a). (b) The temporal variation in *Ca2+ flux from Haut Glacier d'Arolla during 1989. Maximum fluxes are associated with higher discharge waters. (9K)Figure 2. (a) The temporal variation of discharge (Q) and non-sea-salt *Ca2+ concentration in runoff from Manitsoq Glacier, a small outlet glacier on the SW margin of the Greenland Ice Sheet, during 1999. The glacier is warm based, but has a cold-based margin during the winter and early ablation season, so displays polythermal-based hydrological features (Skidmore et al., in preparation). (b) The temporal variation in *Ca2+ flux from Manitsoq Glacier during 1999. Maximum flux is associated with an early season "outburst" event, where longer stored subglacial water first exits the glacier. Otherwise, maximum fluxes are associated with higher discharge waters. (10K)Figure 3. (a) The temporal variation of discharge and *Ca2+ concentration in runoff from Scott Turnerbreen, a small, cold-based, valley glacier on Svalbard, during 1994 (after Hodgkins et al., 1997). (b) The temporal variation in *Ca2+ flux from Scott Turnerbreen during 1994. Maximum fluxes are associated with higher discharge waters, although the precise associations are complex. This chapter will expand on these themes, and endeavor to integrate ongoing research into a state-of-the-science review, as well as indicating the areas into which the next generation of studies are likely to proceed. It is first necessary to understand a little basic glaciology and glacier hydrology to appreciate the principal features of the different chemical weathering environments that will be described below. The following sections summarize the types of glacial environments in which water flows, their typical debris content, the relative residence time of water, and the typical reactions that occur within them.

  19. Flat supercontinuum generation pumped by amplified noise-like pulses from a figure-eight erbium-doped fiber laser

    NASA Astrophysics Data System (ADS)

    Hernández-Escobar, E.; Bello-Jiménez, M.; Pottiez, O.; Ibarra-Escamilla, B.; López-Estopier, R.; Durán-Sánchez, M.; Kuzin, E. A.; Andrés, M. V.

    2017-10-01

    The conditions to obtain noise-like pulses (NLPs) from a figure-eight fiber laser (F8L) and their application for supercontinuum (SC) generation in the anomalous dispersion regime are reported. The F8L is designed to remove the undesired low-intensity background radiation from pulse emission, generating NLPs with a 3 dB spectral bandwidth of 17.43 nm at the fundamental repetition frequency of 0.8 MHz. After amplification, NLPs reach a maximum average power of 9.2 mW and 123.32 nm spectral bandwidth. By controlling the amplifier pump power, flat SC generation is demonstrated through both a 800 m long spool of SMF-28 fiber and a piece of 5 m long highly nonlinear optical fiber. The results demonstrate a satisfactory flatness of ~3 dB over a bandwidth of ~1000 nm in the range from 1261 to 2261 nm, achieving to the best of our knowledge, one of the flattest SC generated from noise-like pulses.

  20. Design and analysis of high gain and low noise figure CMOS low noise amplifier for Q-band nano-sensor application

    NASA Astrophysics Data System (ADS)

    Suganthi, K.; Malarvizhi, S.

    2018-03-01

    A high gain, low power, low Noise figure (NF) and wide band of milli-meter Wave (mmW) circuits design at 50 GHz are used for Radio Frequency (RF) front end. The fundamental necessity of a receiver front-end includes perfect output and input impedance matching and port-to-port isolation with high gain and low noise over the entire band of interest. In this paper, a design of Cascade-Cascode CMOS LNA circuit at 50 GHz for Q-band application is proposed. The design of Low noise amplifier at 50 GHz using Agilent ADS tool with microstrip lines which provides simplicity in fabrication and less chip area. The low off-leakage current Ioff can be maintained with high K-dielectrics CMOS structure. Nano-scale electronics can be achieved with increased robustness. The design has overall gain of 11.091 dB and noise figure of 2.673 dB for the Q-band of 48.3 GHz to 51.3 GHz. Impedance matching is done by T matching network and the obtained input and output reflection coefficients are S11 = <-10 dB and S22 = <-10 dB. Compared to Silicon (Si) material, Wide Band Gap semiconductor materials used attains higher junction temperatures which is well matched to ceramics used in packaging technology, the protection and reliability also can be achieved with the electronic packaging. The reverse transmission coefficient S21 is less than -21 dB has shown that LNA has better isolation between input and output, Stability factor greater than 1 and Power is also optimized in this design. Layout is designed, power gain of 4.6 dB is achieved and area is optimized which is nearly equal to 502 740 μm2. The observed results show that the proposed Cascade-Cascode LNA design can find its suitability in future milli-meter Wave Radar application.

  1. 3D Seismic Imaging using Marchenko Methods

    NASA Astrophysics Data System (ADS)

    Lomas, A.; Curtis, A.

    2017-12-01

    Marchenko methods are novel, data driven techniques that allow seismic wavefields from sources and receivers on the Earth's surface to be redatumed to construct wavefields with sources in the subsurface - including complex multiply-reflected waves, and without the need for a complex reference model. In turn, this allows subsurface images to be constructed at any such subsurface redatuming points (image or virtual receiver points). Such images are then free of artefacts from multiply-scattered waves that usually contaminate migrated seismic images. Marchenko algorithms require as input the same information as standard migration methods: the full reflection response from sources and receivers at the Earth's surface, and an estimate of the first arriving wave between the chosen image point and the surface. The latter can be calculated using a smooth velocity model estimated using standard methods. The algorithm iteratively calculates a signal that focuses at the image point to create a virtual source at that point, and this can be used to retrieve the signal between the virtual source and the surface. A feature of these methods is that the retrieved signals are naturally decomposed into up- and down-going components. That is, we obtain both the signal that initially propagated upwards from the virtual source and arrived at the surface, separated from the signal that initially propagated downwards. Figure (a) shows a 3D subsurface model with a variable density but a constant velocity (3000m/s). Along the surface of this model (z=0) in both the x and y directions are co-located sources and receivers at 20-meter intervals. The redatumed signal in figure (b) has been calculated using Marchenko methods from a virtual source (1200m, 500m and 400m) to the surface. For comparison the true solution is given in figure (c), and shows a good match when compared to figure (b). While these 2D redatuming and imaging methods are still in their infancy having first been developed in 2012, we have extended them to 3D media and wavefields. We show that while the wavefield effects may be more complex in 3D, Marchenko methods are still valid, and 3D images that are free of multiple-related artefacts, are a realistic possibility.

  2. Hydrogen Embrittlement in 17-4PH Stainless Steel

    DTIC Science & Technology

    1982-08-01

    is observed to exhibit microplastic tearing mixed with some quasi- cleavage. When exposed to longer hydrogen charging times, specimens in the higher...Hours, (a) Central Region Illustrating Dimpled Rupture, (b) and 0-) Shell Region Near Edge Exhibiting Microplastic Tearing. 20 NTAC TP 6 3 43 (a) (b) (c...Shell Region Near Edge Exhibiting Microplastic Tearing. 21 ’JWC TP 6343 FIGURE 15. SEM Fractographv Showing Intergranular Fracture (if 17-4PH- in

  3. Using Multiple Dialog Modes in a User-System Interface to Accomodate Different Levels of User Experience: An Experimental Study.

    DTIC Science & Technology

    1986-01-01

    Chapter it Research Methodology This chapter describes the methodology and the experimental design used for this research. Prior to discussing the...50 Experimental Design ............................... 50 Task/Treatm ent ................................... 55 Task Design ...Figure 3.3 Interface Experiment Elements ............... 54 Figure 3.4 Experimental Design ....................... 55 Figure 3.5 Subject Assignment

  4. Structure-Based Design of Molecules to Reactivate Tumor-Derived p53 Mutations

    DTIC Science & Technology

    2006-06-01

    fact, approximately half of the major forms of cancer contain p53 mutations, and the vast majority of these cluster in conserved regions or “hot...structures were subjected to 5.0 ns MD simulations using the program GROMACS 3.3 (Van Der Spoel et al., 2005). The RMSD values of backbone atoms from... analysis of residue-wise RMS fluctuations, shown in Figure 3B which shows that the stabilizing effect of Tris on the p53 core domain is distributed

  5. 40 CFR 86.344-79 - Humidity calculations.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... = Web-bulb temperature (°K) B = − 12.150799 F 0 = − 8.49922(10)3 F 1 = − 7.4231865(10)3 F 2 = 96.1635147...). ER06OC93.088 Figure D79-5—Saturation Vapor Pressure Over Water (pascals) Temperature °C 0.0 0.1 0.2 0.3 0.4... = barometric pressure (Pa) H = specific humidity, (gm H2O/gm of dry air) K = 0.6220 gm H2O/gm dry air M air...

  6. 40 CFR 86.344-79 - Humidity calculations.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... = Web-bulb temperature (°K) B = − 12.150799 F 0 = − 8.49922(10)3 F 1 = − 7.4231865(10)3 F 2 = 96.1635147...). ER06OC93.088 Figure D79-5—Saturation Vapor Pressure Over Water (pascals) Temperature °C 0.0 0.1 0.2 0.3 0.4... = barometric pressure (Pa) H = specific humidity, (gm H2O/gm of dry air) K = 0.6220 gm H2O/gm dry air M air...

  7. UVB induces atypical melanocytic lesions and melanoma in human skin.

    PubMed Central

    Atillasoy, E. S.; Seykora, J. T.; Soballe, P. W.; Elenitsas, R.; Nesbit, M.; Elder, D. E.; Montone, K. T.; Sauter, E.; Herlyn, M.

    1998-01-01

    A direct causal relationship between ultraviolet (UV) light in the B range and melanoma development has not been demonstrated in humans; this study aims to establish causality. A total of 158 RAG-1 mice, grafted with human newborn foreskin, were separated into four groups and observed for a median of 10 months: 1) no treatment, 2) a single treatment with 7,12-dimethyl(a)benzanthracene (DMBA), 3) UVB irradiation at 500 J/m2 alone, three times weekly, and 4) a combination of DMBA and UVB. Twenty-three percent of 40 normal human skin grafts treated with UVB only and 38% of 48 grafts treated with the combination of DMBA and UVB developed solar lentigines within 5 to 10 months of treatment. Melanocytic hyperplasia was found in 73% of all UVB-treated xenografts. Histological melanocytic changes resembling lentigo and lentigo maligna were seen in several skin grafts treated with both DMBA and UVB. In one graft of an animal treated with a combination of DMBA and UVB, a human malignant melanoma, nodular type, developed. This experimental system demonstrates that chronic UVB irradiation with or without an initiating carcinogen can induce human melanocytic lesions, including melanoma. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:9588887

  8. Towards Development of a Field-Deployable Imaging Device for TBI

    DTIC Science & Technology

    2012-03-01

    centers such as in Germany for those studies, as well as additional medical care. This is because magnetic resonance imaging is unavailable in or near...detection of stroke in areas 283 where CAT scans and magnetic resonance imaging are not readily available or appropriate. 284 285 ACKNOWLEDGEMENTS...Task (3): MR image rodent brains. 3) UVA has performed its first round of MRI studies of CCI rats – Figures 1a,b,c. Task (4): Immunohistochemical

  9. Passive Impact Damage Detection of Fiber Glass Composite Panels

    DTIC Science & Technology

    2013-12-19

    PASSIVE IMPACT DAMAGE DETECTION OF FIBER GLASS COMPOSITE PANELS. By BRUNO ZAMORANO-SENDEROS A dissertation...COVERED 04-11-2012 to 10-12-2013 4. TITLE AND SUBTITLE PASSIVE IMPACT DAMAGE DETECTION OF FIBER GLASS COMPOSITE PANELS 5a. CONTRACT NUMBER 5b...process. .................................... 31 Figure 3-8 Sensor attached to the fiber glass fabric

  10. Environmental Mycobiome Modifiers of Inflammation and Fibrosis in Systemic Sclerosis

    DTIC Science & Technology

    2016-09-01

    Citrobacter and Vibrio , relative to controls (p = 0.019, p = 0.004, and p = 0.002, respectively; Figure 4A). Rhodotorula levels overall were not...that received either syngeneic BALB/c or allogeneic B10.D2 splenocytes two weeks prior to cell harvest (n=3 per group): A. Gating strategy for

  11. Achalasia following gastro-oesophageal reflux.

    PubMed Central

    Smart, H L; Mayberry, J F; Atkinson, M

    1986-01-01

    Five patients initially presenting with symptomatic gastro-oesophageal reflux, proven by radiology or pH monitoring, subsequently developed achalasia, confirmed by radiology and manometry, after an interval of 2-10 years. During this period dysphagia, present as a mild and intermittent symptom accompanying the initial reflux in 3 of the 5, became severe and resulted in oesophageal stasis of food in all. Three of the 5 had a demonstrable hiatal hernia. In none was reflux a troublesome symptom after Rider-Moeller dilatation or cardiomyotomy undertaken for the achalasia. Gastro-oesophageal reflux does not protect against the subsequent development of achalasia. It is suggested that the autonomic damage eventually leading to achalasia may in its initial phases cause gastro-oesophageal reflux. Images Figure 1. A Figure 1. B Figure 2. PMID:3950898

  12. A method for in vitro culture of rat Zymbal gland: use in mechanistic studies of benzene carcinogenesis in combination with 32P-postlabeling.

    PubMed Central

    Reddy, M V; Blackburn, G R; Irwin, S E; Kommineni, C; Mackerer, C R; Mehlman, M A

    1989-01-01

    Zymbal glands were excised bilaterally from the ear ducts of female Sprague-Dawley rats (three/group), minced into approximately four fragments per gland, and transferred into a microtiter plate containing 1.5 mL per well of Waymouth's tissue culture medium supplemented with fetal calf serum, hydrocortisone, insulin, and gentamicin. After addition of a test compound or solvent vehicle, plates were incubated for 6, 24, 48, or 96 hr at 37 degrees C in a humidified atmosphere of 5% CO2 in air. Tissue in culture for 6 hr was histologically indistinguishable from the freshly excised tissue, while that in culture for 24, 48, and 96 hr showed a progressive deterioration often with necrosis and/or squamous metaplasia. More pronounced deterioration was noted in samples treated with 750 or 1500 micrograms/mL of benzene. Using a nuclease P1-enhanced 32P-postlabeling assay, aromatic DNA adducts were detected in cultured Zymbal glands exposed for 48 hr to benzene and its derivatives, as well as to 7,12-dimethylbenzanthracene (DMBA) and 2-acetylaminofluorene (AAF). Benzene produced very low levels of adducts (0.5 adducts per 10(9) nucleotides), whereas its congeners produced relatively high levels of adducts (50-2000 lesions per 10(9) nucleotides), which decreased in the order benzoquinone greater than hydroquinone greater than phenol greater than benzenetriol greater than catechol. Each adduct profile overall was characteristic for the compound studied, suggesting the formation of compound-specific electrophiles. AAF and DMBA adducts were identical to those formed in vivo in animals. Our results show that the Zymbal glands are capable of metabolizing different carcinogens to DNA-reactive intermediates, a process that may be causally associated with tumor formation in vivo in this organ. Images FIGURE 3. A FIGURE 3. B FIGURE 3. C FIGURE 4. FIGURE 5. FIGURE 6. PMID:2507309

  13. Effects of sulfite on the uptake and binding of benzo[a]pyrene diol epoxide in cultured murine respiratory epithelial cells.

    PubMed Central

    Green, J L; Jones, B C; Reed, G A

    1994-01-01

    Sulfur dioxide (SO2) may act as a cocarcinogen with benzo[a]pyrene (BaP) in the respiratory tract. We have modeled this effect by examining the interactions of 7r,8t-dihydroxy-9t,10t-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (anti-BPDE) with sulfite, the physiological form of SO2, in a murine respiratory epithelial cell line (C10). We exposed C10 cells to [3H]-anti-BPDE and determined the effects of 1 and 10 mM sulfite on the uptake and subcellular localization of labeled products. Autoradiographic analysis showed that sulfite doubled the nuclear localization of anti-BPDE-derived materials after a 4-hr incubation period. The net nuclear localization of anti-BPDE-derived materials was not affected by sulfite during the first 60 min, but nuclear localization continued to increase in the sulfite-containing incubations throughout the 4-hr incubation period. Little increase in nuclear localization of anti-BPDE-derived material was noted in the incubations without sulfite after 60 min. Subcellular fractionation was performed to determine the amount of label associated with cytosolic and nuclear fractions and to determine covalent binding to protein and DNA. Sulfite produced a modest increase in the amount of [3H]-anti-BPDE-derived products bound to protein; however, binding to nuclear DNA increased by more than 200% with 10 mM sulfite. Analysis of the supernatants from the cytosolic and nuclear fractions of cells exposed to anti-BPDE and sulfite demonstrated the presence of 7r,8t,9t-trihydroxy-7,8,9,10-tetrahydrobenzo[a]pyrene-10c-su lfonate (BPT-10-sulfonate). [3H]-BPT-10-sulfonate was unable to enter C10 cells, suggesting that it is formed intracellularly.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 1. Figure 2. Figure 3. Figure 3. Figure 3. Figure 3. Figure 3. Figure 3. Figure 4. PMID:8033853

  14. Gastric MALT lymphoma and Helicobacter pylori.

    PubMed Central

    Wotherspoon, A. C.

    1996-01-01

    Primary gastric low-grade B-cell lymphomas are neoplastic mimics of mucosa associated lymphoid tissue (MALT) as exemplified by Peyer's patches in the terminal ileum. Architectural and immunophenotypic properties of the neoplastic cells suggest that they originate from MALT-derived marginal zone B-cells. Paradoxically, the normal human stomach is devoid of organized MALT within which a lymphoma can develop. Lymphoid tissue is acquired in the stomach in response to antigenic stimulation, predominantly associated with Helicobacter pylori infection. Studies of patients with low-grade MALT lymphoma have confirmed a high incidence of H. pylori infection and suggest that the infection predates neoplastic transformation. Certain morphological features of MALT lymphomas suggest that the tumor cells remain responsive to antigen drive. Given the close association between gastric MALT lymphoma and H. pylori, it is possible that this organism provides such a drive. In vitro studies have shown that the tumor cells proliferate in a T-cell-dependent way to the presence of H. pylori. Several studies have now demonstrated that eradication of the organism in patients with low-grade gastric MALT lymphoma can result in regression of the tumor. In cases with a high-grade component, the associated low-grade part may regress, but most high-grade gastric MALT lymphomas are unresponsive to this conservative therapy. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9041690

  15. Archaeological Survey of 73 Artillery Firing Points: Fort Bragg Training Area, Cumberland and Hoke Counties, North Carolina

    DTIC Science & Technology

    2006-03-01

    Figure 25. Undecorated and decorated rim sherds from 3 1HK695 52 Figure 26. Decorated porcelain cup sherds from 3 1HK695 52 Figure 27. Decorated...pressed-glass sherd and medicine/bitters bottle neck from 3 1HK695 52 Figure 28. Bisque-fired porcelain doll sherd and Prosser type buttons from 3 1HK695...quartz that varies in quality, color and crystalline structure. A single bipolar core fragment of crystal "smoky" quartz was found on the surface in

  16. 47 CFR Figure 3 to Subpart N of... - Example of Ideal EPIRB Spectrum

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 47 Telecommunication 1 2011-10-01 2011-10-01 false Example of Ideal EPIRB Spectrum 3 Figure 3 to Subpart N of Part 2 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL FREQUENCY ALLOCATIONS AND... Position Indicating Radiobeacons (EPIRBs) Pt. 2, Subpt. N, Fig. 3 Figure 3 to Subpart N of Part 2—Example...

  17. 47 CFR Figure 3 to Subpart N of... - Example of Ideal EPIRB Spectrum

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Example of Ideal EPIRB Spectrum 3 Figure 3 to Subpart N of Part 2 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL FREQUENCY ALLOCATIONS AND... Position Indicating Radiobeacons (EPIRBs) Pt. 2, Subpt. N, Fig. 3 Figure 3 to Subpart N of Part 2—Example...

  18. SU-F-J-148: A Collapsed Cone Algorithm Can Be Used for Quality Assurance for Monaco Treatment Plans for the MR-Linac

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hackett, S; Asselen, B van; Wolthaus, J

    2016-06-15

    Purpose: Treatment plans for the MR-linac, calculated in Monaco v5.19, include direct simulation of the effects of the 1.5T B{sub 0}-field. We tested the feasibility of using a collapsed-cone (CC) algorithm in Oncentra, which does not account for effects of the B{sub 0}-field, as a fast online, independent 3D check of dose calculations. Methods: Treatment plans for six patients were generated in Monaco with a 6 MV FFF beam and the B{sub 0}-field. All plans were recalculated with a CC model of the same beam. Plans for the same patients were also generated in Monaco without the B{sub 0}-field. Themore » mean dose (Dmean) and doses to 10% (D10%) and 90% (D90%) of the volume were determined, as percentages of the prescribed dose, for target volumes and OARs in each calculated dose distribution. Student’s t-tests between paired parameters from Monaco plans and corresponding CC calculations were performed. Results: Figure 1 shows an example of the difference between dose distributions calculated in Monaco, with the B{sub 0}-field, and the CC algorithm. Figure 2 shows distributions of (absolute) difference between parameters for Monaco plans, with the B{sub 0}-field, and CC calculations. The Dmean and D90% values for the CTVs and PTVs were significantly different, but differences in dose distributions arose predominantly at the edges of the target volumes. Inclusion of the B{sub 0}-field had little effect on agreement of the Dmean values, as illustrated by Figure 3, nor on agreement of the D10% and D90% values. Conclusion: Dose distributions recalculated with a CC algorithm show good agreement with those calculated with Monaco, for plans both with and without the B{sub 0}-field, indicating that the CC algorithm could be used to check online treatment planning for the MRlinac. Agreement for a wider range of treatment sites, and the feasibility of using the γ-test as a simple pass/fail criterion, will be investigated.« less

  19. Cytokine Regulation Immunoglobulin Isotype Production

    DTIC Science & Technology

    1994-11-08

    been shown to involve the activation of a newly di scovered subgroup of tyro sine kinases known as the Janus kinases (26 1 -270). Upon binding of IFN-r...indiCated reagents at dosages indiCated in Figure 1 . Culture supernatants were then harvested for determination of Ig isotype concentrations by ELISA ...Ig - immunoglobulin Iy2b - intronic gamma 2b regIOn IL - interleukin IP3 - inositol triphosphate XXlll JAK - Janus kinase LA P latency

  20. Fire Service Emergency Management Handbook

    DTIC Science & Technology

    1985-01-01

    students to survey buildings to determine the degree to which they provide protec- t on against nuclear disaster effects. TYPES OF ASSISTANCE: Training... SURVEY A-i APPENDIX B SELECTED EMERGENCY MANAGEMENT RESOURCES B-I ILLUSTRATIONS -e (Key Figures, Tables, and Charts) 1. FOUR PHASES OF CEM ACTIVITIES 2-3 2...1979 IAFC survey ,* about 28% of Fire Chiefs are also their community’s emergency preparedness directors, i.e., "the person who is primarily responsible

  1. Nucleation and Growth of Tetrataenite (FeNi) in Meteorites

    NASA Astrophysics Data System (ADS)

    Goldstein, J. I.; Williams, D. B.; Zhang, J.

    1992-07-01

    The mineral tetrataenite (ordered FeNi) has been observed in chondrites, stony irons, and iron meteorites (1). FeNi is an equilibrium phase in the Fe-Ni phase diagram (Figure 1) and orders to tetrataenite at ~320 degrees C (2). The phase forms at temperatures at or below the eutectoid temperature (~400 degrees C) where taenite (gamma) transforms to kamacite (alpha) plus FeNi (gamma"). An understanding of the formation of tetrataenite can lead to a new method for determining cooling rates at low temperatures (<400 degrees C) for all types of meteorites. In a recent study of plessite in iron meteorites (3), two transformation sequences for the formation of tetrataenite were observed. In either sequence, during the cooling process, the taenite (gamma) phase initially undergoes a diffusionless transformation to a martensite (alpha, bcc) phase without a composition change. The martensite then decomposes either above or below the eutectoid temperature (~400 degrees C) during cooling or upon subsequent reheating. During martensite decomposition above the eutectoid, the taenite (gamma) phase nucleates by the reaction alpha(sub)2 ---> alpha + gamma and grows under volume diffusion control. The Ni composition of the taenite increases continuously following the equilibrium gamma/alpha + gamma boundary while the Ni composition of the kamacite matrix decreases following the alpha/alpha + gamma phase boundary (2), see Figure 1. Below the eutectoid temperature, the precipitate composition follows the equilibrium gamma"/alpha + gamma" boundary and reaches ~52 wt% Ni, the composition of FeNi, gamma". The kamacite (alpha) matrix composition approaches ~4 to 5 wt% Ni. The ordering transformation starts at ~320 degrees C forming the tetrataenite phase. During martensite decomposition below the eutectoid temperature, FeNi should form directly by the reaction alpha2 --> alpha + gamma" (FeNi). If this transformation sequence occurs, then the composition of kamacite and tetrataenite should also be given by the alpha/alpha + gamma" and gamma"/alpha + gamma" boundaries of the Fe-Ni phase diagram (Figure 1). However, the Ni content of kamacite and tetrataenite in black plessite, which forms below 400 degrees C, is ~10 wt% in kamacite and ~57 to 60 wt% in tetrataenite, much higher than the values given by the equilibrium phase diagram (3). It has been observed experimentally (4) that the Ni composition of the gamma phase formed by martensite decomposition below 400 degrees C lies along a metastable extension of the high temperature gamma/alpha + gamma phase boundary, Figure 2. Therefore, the FeNi phase formed by alpha(sub)2 decomposition below 400 degrees C has a non-equilibrium Ni content, >50 to 56 wt%. The growth or thickening of the FeNi phase occurs by some combination of interface and diffusion control (3). References: (1) Clarke R. S. and Scott E. R. D. (1980) Amer. Mineral. 65, 624-630. (2) Reuter K. B., Williams D. B., and Goldstein J. I. (1989) Met. Trans. 20A, 719-725. (3) Zhang J., Williams D. B. and Goldstein J. I. (1992) Submitted to Geochim. Cosmochim. Acta. (4) Zhang J., Williams L). B. and Goldstein J. I. (1992) Submitted to Met. Trans. Figure 1, which in the hard copy appears here, is an Fe-Ni phase diagram (2). Figure 2, which in the hard copy appears here, shows measured FeNi composition from heat-treated alloys (4).

  2. Sea Ice Movements from Synthetic Aperture Radar

    DTIC Science & Technology

    1981-12-01

    correlating these components. B-l8 These correlations are also plotted in figure l1. 5.3.3.2 AUlications of the space correlation. The spatial...aperture radar. To appear in J. of Geophys. Res. Hastings, A. D. Jr., 1971. Surface climate of the Arctic Basin. Report ETL- TR-71-5, Earth Sciences Division...Administration Grant NA50-AA-D-00015, which was funded in part by the Global Atmospheric Research Program and the Office of Climate Dynarics, Divisic

  3. Mechanism and Therapy for the Shared Susceptibility to Migraine and Epilepsy After Traumatic Brain Injury

    DTIC Science & Technology

    2014-10-01

    developed status epilepticus (Figure 1) which continued for 3 days resulting in the animal’s death. Spontaneous recurrent seizures were recorded in 3...recording of a CCI-injured mouse in status epilepticus . Upper trace is an EEG recording of 4 h of status epilepticus while the lower traces...seizure (b) and the continuous spiking evident of status epilepticus (c). * represents movement artifact from the seizure motor activity. Although we

  4. Fuze Experimentation Facility and Fuze Industrial Facility (FEF/FIF) Construction. Final Environmental Assessment

    DTIC Science & Technology

    2011-04-01

    1-9. R esources N ot C arried Forw ard for D etailed A nalysis Legend Environmental Justice Concerns c:::J Proposed Project Area No Concerns...11 FEF/FIF C onstruction Environm ental A ssessm ent Page 3-6 Eglin A ir Force B ase, FL Final Figure 3-1. W ater R esources A t or N...Ecological A ssociations and Biological R esources A t or N ear the Proposed A ction Location Ecological Association Flatwoods Landscaped!Urban c:J

  5. Reduction of GABA/sub B/ receptor binding induced by climbing fiber degeneration in the rat cerebellum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kato, K.; Fukuda, H.

    1985-07-22

    When the rat cerebellar climbing fibers degenerated, as induced by lesioning the inferior olive with 3-acetylpyridine (3-AP), GABA/sub B/ receptor binding determined with /sup 3/H-(+/-)baclofen was reduced in the cerebellum but not in the cerebral cortex of rats. Computer analysis of saturation data revealed two components of the binding sites, and indicated that decrease of the binding in the cerebellum was due to reduction in receptor density, mainly of the high-affinity sites, the B/sub max/ of which was reduced to one-third that in the control animals. In vitro treatment with 3-AP, of the membranes prepared from either the cerebellum ormore » the cerebral cortex, induced no alteration in the binding sites, thereby indicating that the alteration of GABA/sub B/ sites induced by in vivo treatment with 3-AP is not due to a direct action of 3-AP on the receptor. GABA/sub A/ and benzodiazepine receptor binding labelled with /sup 3/H-muscimol and /sup 3/H-diazepam, respectively, in both of brain regions was not affected by destruction of the inferior olive. These results provide evidence that some of the GABA/sub B/ sites but neither GABA/sub A/ nor benzodiazepine receptors in the cerebellum are located at the climbing fiber terminals. 28 references, 4 figures, 2 tables.« less

  6. Reusable Ada Software for Command and Control Workstation Map Manipulation

    DTIC Science & Technology

    1992-06-18

    h-.. I.. b 1 .. hm . T.... ~ N -k.L A..-bt ... ~ 4.g -np ft. Figure 15. The Main Display Storyboard (final iteration) are other panels not shown which...Defense, October 1988. 18. Defense Mapping Agency, Products Catalog, Digitizing The Future, 3d ed., Department of Defense, No Date. 183 19. Deitel , H

  7. Exploitation of Full-Waveform LiDAR to Characterize / Exploit Under Canopy Targets - Foliage Penetration (FOPEN)

    DTIC Science & Technology

    2015-09-28

    Figure 3 USACE ERDC mobile measurement system with Riegl VZ‐400  laser  scanner (a) and OSU GPSVan  with targets (b...five target  materials (red: retro reflective, blue: wood, cyan: fluffy plastic, yellow: cardboard, and black:  painted   wood...and black:  painted  wood) ........................ 28  Figure 21 Waveforms shapes of in the three classes

  8. Growth and Doping of Al(x)Ga(1-x)N Films by Electron Cyclotron Resonance Assisted Molecular Beam Epitaxy

    DTIC Science & Technology

    1993-05-30

    shown in Figures 9a and 9b. The carrier concentration was computed from the measured values of the Hall coefficient, RH , using the equation n (5) eRH...The electron concentrations in Figure 1 were calculated from the expression 1 (1) eRjj where RH is the Hall constant. Equation (1) assumes electron...expressions: 2 2RH fcP + ,’dP• (2) RH = (ncp + nd/pd) 2 e 1 p 1 (3) ncelc + ndel.d where nc and nd are the concentrations of conducting carriers in the

  9. A Compendium of Solar Dish/Stirling Technology

    DTIC Science & Technology

    1994-01-01

    systems and Plataforma Solar in Almeria, Spain, with the goal being plans to produce fourteen 7.5-kWe systems for testing to test the system’s long-term...the sun is not a point source, its rays 21 Chapter 3 (a) (b) - N Mounting Ring and CollaraI/ / I/\\ I / Virtual Exit I / Target S• Entrance I 0 L...tptical \\ I Real Exit / Virtual Target \\ Aperture\\ / Cooling \\ / I Coils N - Focal - - - - " Plane 4. Figure 3-2. A secondary concentrator with side view (a

  10. T-Check in Technologies for Interoperability: Business Process Management in a Web Services Context

    DTIC Science & Technology

    2008-09-01

    UML Sequence Diagram) 6  Figure 3:   BPMN Diagram of the Order Processing Business Process 9  Figure 4:   T-Check Process for Technology Evaluation 10...Figure 5:  Notional System Architecture 12  Figure 6:  Flow Chart of the Order Processing Business Process 14  Figure 7:  Order Processing Activities...features. Figure 3 (created with Intalio BPMS Designer [Intalio 2008]) shows a BPMN view of the Order Processing business process that is used in the

  11. Suramin inhibits bFGF-induced endothelial cell proliferation and angiogenesis in the chick chorioallantoic membrane.

    PubMed Central

    Danesi, R.; Del Bianchi, S.; Soldani, P.; Campagni, A.; La Rocca, R. V.; Myers, C. E.; Paparelli, A.; Del Tacca, M.

    1993-01-01

    The effects of suramin, an inhibitor of growth factor mitogenic activity, were evaluated on basic fibroblast growth factor (bFGF)-induced proliferation of bovine aortic endothelial cells and on angiogenesis in the chorioallantoic membrane (CAM) of chick embryos. The role of bFGF gene expression in endothelial cell growth was also investigated by using an antisense oligodeoxynucleotide to bFGF. The 4-fold increase in [3H]-thymidine uptake in endothelial cells in vitro upon stimulation with 10 ng ml-1 of bFGF was inhibited by suramin 300 micrograms ml-1. bFGF antisense oligomer (10 microM) reduced [3H]-thymidine incorporation in exponentially growing cells by 76%; this effect was reversed by bFGF 10 ng ml-1. In the CAM of chick embryos suramin 50 micrograms was a more potent inhibitor of angiogenesis than the combination of heparin 60 micrograms/hydrocortisone 50 micrograms; the mean value of the area with reduced vascularity was significantly larger in suramin-treated CAMs (2.4 cm2) than in heparin/hydrocortisone (0.6 cm2), while the reduction of vascular density was similar (- 35 and - 29% compared to controls, respectively), In conclusion, the effects of treatments with bFGF and bFGF antisense oligomer demonstrate that bFGF plays a relevant role in endothelial cell proliferation and may be the target of suramin since the drug is able to suppress basal and bFGF-induced endothelial cell growth; in addition to this, suramin is a more potent angiogenesis inhibitor in the CAM than the combination of heparin/hydrocortisone. Images Figure 1 Figure 4 PMID:7692920

  12. Characterization of air contaminants formed by the interaction of lava and sea water.

    PubMed Central

    Kullman, G J; Jones, W G; Cornwell, R J; Parker, J E

    1994-01-01

    We made environmental measurements to characterize contaminants generated when basaltic lava from Hawaii's Kilauea volcano enters sea water. This interaction of lava with sea water produces large clouds of mist (LAZE). Island winds occasionally directed the LAZE toward the adjacent village of Kalapana and the Hawaii Volcanos National Park, creating health concerns. Environmental samples were taken to measure airborne concentrations of respirable dust, crystalline silica and other mineral compounds, fibers, trace metals, inorganic acids, and organic and inorganic gases. The LAZE contained quantifiable concentrations of hydrochloric acid (HCl) and hydrofluoric acid (HF); HCl was predominant. HCl and HF concentrations were highest in dense plumes of LAZE near the sea. The HCl concentration at this sampling location averaged 7.1 ppm; this exceeds the current occupational exposure ceiling of 5 ppm. HF was detected in nearly half the samples, but all concentrations were <1 ppm Sulfur dioxide was detected in one of four short-term indicator tube samples at approximately 1.5 ppm. Airborne particulates were composed largely of chloride salts (predominantly sodium chloride). Crystalline silica concentrations were below detectable limits, less than approximately 0.03 mg/m3 of air. Settled dust samples showed a predominance of glass flakes and glass fibers. Airborne fibers were detected at quantifiable levels in 1 of 11 samples. These fibers were composed largely of hydrated calcium sulfate. These findings suggest that individuals should avoid concentrated plumes of LAZE near its origin to prevent over exposure to inorganic acids, specifically HCl. Images Figure 1. Figure 2. Figure 3. Figure 4. A Figure 4. B Figure 4. C Figure 4. D PMID:8593853

  13. Examining the Statistical Rigor of Test and Evaluation Results in the Live, Virtual and Constructive Environment

    DTIC Science & Technology

    2011-06-01

    Committee Meeting. 23 June 2008. Bjorkman, Eileen A. and Frank B. Gray . “Testing in a Joint Environment 2004-2008: Findings, Conclusions and...the LVC joint test environment to evaluate system performance and joint mission effectiveness (Bjorkman and Gray 2009a). The LVC battlespace...attack (Bjorkman and Gray 2009b). Figure 3 - JTEM Methodology (Bjorkman 2008) A key INTEGRAL FIRE lesson learned was realizing the need for each

  14. Multi-Energy Processing for Novel Coating Technologies

    DTIC Science & Technology

    2014-12-18

    tungsten carbide (WC) substrate (BS-6S, Basic Carbide Corp.) with a dimension of 25.4 x 25.4 x 1.6 mm^ and a cobalt composition of 6% was placed on a...as dopant sources. (a) No NH3 + No laser (b) NH3 added, No laser (c) 10.591 ^m Figure 4.4 SEM micrographs of the diamond films deposited using...typed 37 diamond. Nitrogen was widely used as n-typed dopant . Nitrogen-containing additives in CVD diamond growth led to severe deterioration of the

  15. JPRS Report, Science & Technology, USSR: Life Sciences

    DTIC Science & Technology

    1989-03-07

    BIOORGANICHESKAYA KHIMIYA, Vol 14 No 4, Apr 88] 19 Intrinsic Fluorescence Studies on Effects of pH on Structure of Mistletoe Lectin [T. L. Bushuyeva, A. G...Figures 2; references 15: 3 Russian, 12 Western. UDC 576.8.097.29:547.962.3 Intrinsic Fluorescence Studies on Effects of pH on Structure of Mistletoe ...characteristics of the mistletoe lectin I (MLI), a molecule consisting of A (29 kD) and a B (34 kD) subunit, were used in assessing the structural

  16. Biopersistence of inhaled organic and inorganic fibers in the lungs of rats.

    PubMed Central

    Warheit, D B; Hartsky, M A; McHugh, T A; Kellar, K A

    1994-01-01

    Fiber dimension and durability are recognized as important features in influencing the development of pulmonary carcinogenic and fibrogenic effects. Using a short-term inhalation bioassay, we have studied pulmonary deposition and clearance patterns and evaluated and compared the pulmonary toxicity of two previously tested reference materials, an inhaled organic fiber, Kevlar para-aramid fibrils, and an inorganic fiber, wollastonite. Rats were exposed for 5 days to aerosols of Kevlar fibrils (900-1344 f/cc; 9-11 mg/m3) or wollastonite fibers (800 f/cc; 115 mg/m3). The lungs of exposed rats were digested to quantify dose, fiber dimensional changes over time, and clearance kinetics. The results showed that inhaled wollastonite fibers were cleared rapidly with a retention half-time of < 1 week. Mean fiber lengths decreased from 11 microns to 6 microns over a 1-month period, and fiber diameters increased from 0.5 micron to 1.0 micron in the same time. Fiber clearance studies with Kevlar showed a transient increase in the numbers of retained fibrils at 1 week postexposure, with rapid clearance of fibers thereafter, and retention half-time of 30 days. A progressive decrease in the mean lengths from 12.5 microns to 7.5 microns and mean diameters from 0.33 micron to 0.23 micron was recorded 6 months after exposure to inhaled Kevlar fibrils. The percentages of fibers > 15 microns in length decreased from 30% immediately after exposure to 5% after 6 months; the percentages of fibers in the 4 to 7 microns range increased from 25 to 55% in the same period.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 4. A Figure 4. B Figure 6. A Figure 6. B PMID:7882921

  17. Study to Investigate the Effects of Skin Friction on the Performance of Drilled Shafts in Cohesive Soils. Volumes I, II, III.

    DTIC Science & Technology

    1982-03-01

    2) after Marsland and Randolph (1977) represents the peak un- drained shear strength. Torvane tests were also run in the field on Shelby tube ...The laboratory test results were characterized in terms of: 4 a. stratigraphy; b. stress state; c. undrained, drained and residual shear strengths; d...in Figure 3 as P- 1. A Shelby tube could not be retrieved at 14-ft depth in Boring B-2. A new boring (Boring B-2A) was made 6 in. further away from

  18. 50 CFR Figure 3 to Part 223 - Matagorda TED

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Matagorda TED 3 Figure 3 to Part 223 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS THREATENED MARINE AND ANADROMOUS SPECIES Pt. 223, Fig. 3 Figure 3 to Part 223—Matagorda TED EC01JY91.047 [52...

  19. GSM Network Employment on a Man-Portable UAS

    DTIC Science & Technology

    2012-09-01

    23  Figure 12.  3D Robotics’ ArduCopter kit (From DIY Drones, 2012) ................................24  Figure 13...San Diego, CA (Figure 12) and a base kit retails for under $600.00. 24 Figure 12. 3D Robotics’ ArduCopter kit (From DIY Drones, 2012) Due to...generic until it is associated with a subscriber identity module (SIM), commonly referred to as a SIM card (Figure 17). The SIM contains the identifiers

  20. Flutter Generator Control and Force Computer.

    DTIC Science & Technology

    1985-07-01

    exciter module 2. Mechanical load 3. Rectifier and triac 4. Overall system 5. Velocity control 6. Microprocessor 7. Operation in 1 ’g’ environment 8...amplifier Output voltage from the rectifier/ triac circuit (figure 3) is a function of the conduction angle of each triac . In a 400 Hz 3-phase system...3IIGCICI FIRING CIRCUIT FIRING CIRCUIT TO MOTOR Figure 3. Rectifier and triac _____ -=low AEL-0242-TNI Figure 4 DEMAND(V V49 -9 APIFE M O T OR

Some links on this page may take you to non-federal websites. Their policies may differ from this site.
Top