Sample records for filter binding assay

  1. Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

    PubMed

    Johnson, G G; Geiduschek, E P

    1977-04-05

    The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

  2. A glass fiber/diethylaminoethyl double filter binding assay that measures apoptotic internucleosomal DNA fragmentation.

    PubMed

    Erusalimsky, J D; John, J; Hong, Y; Moore, M

    1996-11-15

    A filter binding assay that measures internucleosomal DNA fragmentation associated with apoptosis is described. The assay is based on a novel principle that consists of using simultaneously two kinds of glass fiber filters to harvest [3H]thymidine-prelabeled cells following their incubation with inducers of apoptosis. One filter, which is neutral, traps intact chromatin and high-molecular-weight DNA. The other filter, which is positively charged with DEAE active groups, traps low-molecular-weight DNA fragments. DNA fragmentation is quantified by measuring the radioactivity retained by each of the filters. The assay was evaluated with the histiocytic lymphoma cell line U937 and the topoisomerase inhibitors camptothecin, etoposide, and doxorubicin. These agents caused a dose-dependent decrease of radioactivity in the neutral filter and a parallel increase of radioactivity in the DEAE filter. Irradiation-induced single strand breaks and topoisomerase-mediated primary DNA damage were not detected by this method. Consistent with the detection of internucleosomal DNA fragmentation, the effects measured by this assay were prevented by the endonuclease inhibitor zinc acetate and by the metabolic inhibitor sodium azide. Results obtained using this assay were validated by observation of DNA ladders on agarose gels and by morphologic examination of apoptotic features. Evaluation of the assay in a mock screen demonstrated that the introduction of the DEAE filter increases the assay sensitivity and eliminates false positives. Thus, this assay may be used in high-throughput screening approaches to discover novel modulators of apoptosis.

  3. An Undergraduate Laboratory Experiment that Utilizes a Glass Fiber Filter Assay to Determine the Steroid Specificity and Equilibrium Binding Properties of Glucocorticoid Receptors.

    ERIC Educational Resources Information Center

    John, Nancy J.; Firestone, Gary L.

    1987-01-01

    Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…

  4. Label-Free, LC-MS-Based Assays to Quantitate Small-Molecule Antagonist Binding to the Mammalian BLT1 Receptor.

    PubMed

    Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W

    2017-08-01

    We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.

  5. Characterization of the swine adipocyte A1 adenosine receptor using an optimized assay system.

    PubMed

    Dong, Q; Schuchman, J; Carey, G B

    1994-07-01

    The radioligand binding assay of A1 adenosine receptors in adipocyte crude plasma membrane from Yucatan miniature swine was optimized by evaluating 17 factors involved in the assay. Significant effects of CHAPS, adenosine deaminase, EDTA, pre-rinsing glass fiber filters and pH were found for the binding measurements. Using the optimized procedure, [3H]8-cyclopentyl-1,3-dipropylxanthine, ([3H]-DPCPX) binding to A1 adenosine receptors in swine subcutaneous adipocyte crude plasma membrane was measured; Bmax and Kd values were 479 +/- 77 fmol/mg protein and 0.87 +/- 0.10 nM, respectively. Values for mesenteric adipose tissue from sedentary swine and subcutaneous adipose tissue from exercise-trained swine were also measured.

  6. Covalent Binding of Antibodies to Cellulose Paper Discs and Their Applications in Naked-eye Colorimetric Immunoassays.

    PubMed

    Peng, Yanfen; Gelder, Victor Van; Amaladoss, Anburaj; Patel, Kadamb Haribhai

    2016-10-21

    This report presents two methods for the covalent immobilization of capture antibodies on cellulose filter paper grade No. 1 (medium-flow filter paper) discs and grade No. 113 (fast-flow filter paper) discs. These cellulose paper discs were grafted with amine functional groups through a silane coupling technique before the antibodies were immobilized on them. Periodate oxidation and glutaraldehyde cross-linking methods were used to graft capture antibodies on the cellulose paper discs. In order to ensure the maximum binding capacity of the capture antibodies to their targets after immobilization, the effects of various concentrations of sodium periodate, glutaraldehyde, and capture antibodies on the surface of the paper discs were investigated. The antibodies that were coated on the amine-functionalized cellulose paper discs through a glutaraldehyde cross-linking agent showed enhanced binding activity to the target when compared to the periodate oxidation method. IgG (in mouse reference serum) was used as a reference target in this study to test the application of covalently immobilized antibodies through glutaraldehyde. A new paper-based, enzyme-linked immunosorbent assay (ELISA) was successfully developed and validated for the detection of IgG. This method does not require equipment, and it can detect 100 ng/ml of IgG. The fast-flow filter paper was more sensitive than the medium-flow filter paper. The incubation period of this assay was short and required small sample volumes. This naked-eye, colorimetric immunoassay can be extended to detect other targets that are identified with conventional ELISA.

  7. Radioimmunoassay of ''free thyroxin'' in dried blood spots on filter paper - preliminary observations on the effective differentiation of subjects with congenital hypothyroidism from those with subnormal thyroxin-binding globulin and normal subjects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mizuta, H.; Miyai, K.; Ichihara, K.

    1982-03-01

    In this sensitive, simple method for measuring ''free thyroxin'' (FT/sub 4/) in eluates of dried blood spots on filter paper by use of a radioimmunoassay kit (Amerlex Free T/sub 4/ RIA), the measurable range of FT/sub 4/ is 1.8 to 57 ng/L (equivalent to the concentration in serum), or 7 to 237 fg/tube. The mean coefficients of variation for within assay-within spots, within assay-between spots, and between assays were 5.3%, 5.0%, and 6.2%, respectively. FT/sub 4/ in blood spotted on filter paper is stable for at least a month when dried and kept at either -20/sup 0/C, 4/sup 0/C, roommore » temperature (about 25/sup 0/C), or 37/sup 0/C. The results for FT/sub 4/ in dried blood spots correlated closely with the free-T/sub 4/ concentration in serum (r = 0.99). The method can be used to differentiate cases of primary and secondary hypothyroidism from normal subjects and those with subnormal thyroxin-binding globulin. This method may be useful in screening for congenital hypothyroidism, because sample-retesting is not necessary.« less

  8. Simple method provides resolution of albumin, lipoprotein, free fraction, and chylomicron to enhance the utility of protein binding assays.

    PubMed

    Brockman, Adam H; Oller, Haley R; Moreau, Benoît; Kriksciukaite, Kristina; Bilodeau, Mark T

    2015-02-12

    Medicinal chemists have been encouraged in recent years to embrace high speed protein binding assays. These methods employ dialysis membranes in 96-well format or spin filters. Membrane-based methods do not separate lipoprotein binding from albumin binding and introduce interference despite membrane binding controls. Ultracentrifugation methods, in contrast, do not introduce interference if density gradients can be avoided and they resolve lipoprotein from albumin. A new generation of compact, fast ultracentrifuges facilitates the rapid and fully informative separation of plasma into albumin, albumin/fatty acid complex, lipoprotein, protein-free, and chylomicron fractions with no need of salt or sugar density gradients. We present a simple and fast ultracentrifuge method here for two platinum compounds and a taxane that otherwise bound irreversibly to dialysis membranes and which exhibited distinctive lipoprotein binding behaviors. This new generation of ultracentrifugation methods underscores a need to further discuss protein binding assessments as they relate to medicinal chemistry efforts.

  9. Diversity, Replication, Pathogenicity and Cell Biology of Crimean Congo Hemorrhagic Fever Virus

    DTIC Science & Technology

    2006-10-01

    recombinant protein produced and purified in E . coli was able to bind to ssRNA in a dot blot filter binding assay. In order to identify domains in the N...Fig. 1. RNA binding domains of the N protein of CCHFV. The depicted GST-fusion proteins were expressed in E . coli and purified using a...detected and NSm protein produced after cleavage of the glycoprotein precursor in virus infected cells. The NSm is stable and transported to the Golgi

  10. Identification of Small-Molecule Frequent Hitters of Glutathione S-Transferase-Glutathione Interaction.

    PubMed

    Brenke, Jara K; Salmina, Elena S; Ringelstetter, Larissa; Dornauer, Scarlett; Kuzikov, Maria; Rothenaigner, Ina; Schorpp, Kenji; Giehler, Fabian; Gopalakrishnan, Jay; Kieser, Arnd; Gul, Sheraz; Tetko, Igor V; Hadian, Kamyar

    2016-07-01

    In high-throughput screening (HTS) campaigns, the binding of glutathione S-transferase (GST) to glutathione (GSH) is used for detection of GST-tagged proteins in protein-protein interactions or enzyme assays. However, many false-positives, so-called frequent hitters (FH), arise that either prevent GST/GSH interaction or interfere with assay signal generation or detection. To identify GST-FH compounds, we analyzed the data of five independent AlphaScreen-based screening campaigns to classify compounds that inhibit the GST/GSH interaction. We identified 53 compounds affecting GST/GSH binding but not influencing His-tag/Ni(2+)-NTA interaction and general AlphaScreen signals. The structures of these 53 experimentally identified GST-FHs were analyzed in chemoinformatic studies to categorize substructural features that promote interference with GST/GSH binding. Here, we confirmed several existing chemoinformatic filters and more importantly extended them as well as added novel filters that specify compounds with anti-GST/GSH activity. Selected compounds were also tested using different antibody-based GST detection technologies and exhibited no interference clearly demonstrating specificity toward their GST/GSH interaction. Thus, these newly described GST-FH will further contribute to the identification of FH compounds containing promiscuous substructures. The developed filters were uploaded to the OCHEM website (http://ochem.eu) and are publicly accessible for analysis of future HTS results. © 2016 Society for Laboratory Automation and Screening.

  11. A Filter-based Surface Enhanced Raman Spectroscopic Assay for Rapid Detection of Chemical Contaminants.

    PubMed

    Gao, Siyue; Glasser, Jessica; He, Lili

    2016-02-19

    We demonstrate a method to fabricate highly sensitive surface-enhanced Raman spectroscopic (SERS) substrates using a filter syringe system that can be applied to the detection of various chemical contaminants. Silver nanoparticles (Ag NPs) are synthesized via reduction of silver nitrate by sodium citrate. Then the NPs are aggregated by sodium chloride to form nanoclusters that could be trapped in the pores of the filter membrane. A syringe is connected to the filter holder, with a filter membrane inside. By loading the nanoclusters into the syringe and passing through the membrane, the liquid goes through the membrane but not the nanoclusters, forming a SERS-active membrane. When testing the analyte, the liquid sample is loaded into the syringe and flowed through the Ag NPs coated membrane. The analyte binds and concentrates on the Ag NPs coated membrane. Then the membrane is detached from the filter holder, air dried and measured by a Raman instrument. Here we present the study of the volume effect of Ag NPs and sample on the detection sensitivity as well as the detection of 10 ppb ferbam and 1 ppm ampicillin using the developed assay.

  12. A portable measuring system for a competitive binding glucose biosensor

    NASA Astrophysics Data System (ADS)

    Colvin, Lydia E.; Means, A. Kristen; Grunlan, Melissa A.; Coté, Gerard L.

    2018-02-01

    Central to minimizing the long- and short-term complications associated with diabetes is careful monitoring and maintenance of blood glucose at normal levels. Towards replacing conventionally used finger-prick glucose testing, indwelling continuous glucose monitors (CGMs) based on amperometric electrodes have been introduced to the market. Envisioned to lead to a CGM with an increased lifetime, we report herein a fluorescently-labeled competitive binding assay contained within a hydrogel membrane whose glucose response is measured via a novel portable system. The optical system design included a laser source, bifurcated fiber, laser filter and simple fiber coupled spectrometer to obtain the change in FRET pair ratio of the assay. Glucose response of the assay in free solution was measured using this system across the physiologic range (0-200 mg/dL). The FRET pair ratio signal was seen to increase with glucose and the standard error of calibration was 22.42 mg/dL with a MARD value of 14.85%. When the assay was contained within the hydrogel membrane's central cavity and similarly analyzed, the standard error increased but the assay maintained its reversibility.

  13. Single-step colony assay for screening antibody libraries.

    PubMed

    Kato, Mieko; Hanyu, Yoshiro

    2017-08-10

    We describe a method, single-step colony assay, for simple and rapid screening of single-chain Fv fragment (scFv) libraries. Colonies of Escherichia coli expressing the scFv library are formed on a hydrophilic filter that is positioned in contact with a membrane coated with an antigen. scFv expression is triggered upon treatment of colonies with an induction reagent, following which scFvs are secreted from the cells and diffused to the antigen-coated membrane. scFvs that exhibit binding affinity for the antigen are captured by the membrane-immobilized antigen. Lastly, detection of scFv binding of the antigen on the membrane allows identification of the clones on the filter that express antigen-specific scFvs. We tested this methodology by using an anti-rabbit IgG scFv, scFv(A10B), and a rat immune scFv library. Experiments conducted using scFv(A10B) revealed that this method improves scFv expression during the colony assay. By using our method to screen an immune library of 3×10 3 scFv clones, we established several clones exhibiting affinity for the antigen. Moreover, we tested 7 other antigens, including peptides, and successfully identified positive clones. We believe that this simple procedure and controlled scFv expression of the single-step colony assay could make the antibody screening both rapid and reliable and lead to successful isolation of positive clones from antibody libraries. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Novel fabrication method of the peritoneal dialysis filter using silk fibroin with urease fixation system.

    PubMed

    Moon, Bo Mi; Choi, Myung-Jin; Sultan, Md Tipu; Yang, Jae Won; Ju, Hyung Woo; Lee, Jung Min; Park, Hyun Jung; Park, Ye Ri; Kim, Soo Hyeon; Kim, Dong Wook; Lee, Min Chae; Jeong, Ju Yeon; Lee, Ok Joo; Sung, Gun Yong; Park, Chan Hum

    2017-10-01

    During the last decade, there has been a great advance in the kidney dialysis system by wearable artificial kidney (WAK) system for end-stage renal disease patients. Uremic solute removal and water regeneration system are the most prerequisite for WAK to work properly. In this study, we designed a filtering membrane system by using immobilized urease silk fibroin filter and evaluated its comparative effectiveness with a PVDF filtering system in peritoneal dialysate regeneration system by urea removal efficacy. We evaluated this membrane's characteristic and performances by conducting SEM-EDX analyze, water-binding abilities and porosity test, removal abilities of urea, cytotoxicity assay and enzyme activity assay. Under the condition for optimization of urease, the percentage removal of urea was about 40% and 60% in 50 mg/dL urea solution by urease immobilized PVDF and silk fibroin scaffolds, respectively. The batch experimental result showed that immobilized filter removed more than 50% of urea in 50 mg/dL urea solution. In addition silk fibroin with urease filter removed 90 percent of urea in the peritoneal dialysate after 24 h filtration. We suggest that silk fibroin with urease fixation filter can be used more effectively for peritoneal dialysate regeneration system, which have hydrophilic property and prolonged enzyme activity. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 2136-2144, 2017. © 2016 Wiley Periodicals, Inc.

  15. Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.

    PubMed

    Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart

    2014-01-15

    High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter

  16. Detection of airborne Stachybotrys chartarum macrocyclic trichothecene mycotoxins on particulates smaller than conidia.

    PubMed

    Brasel, T L; Douglas, D R; Wilson, S C; Straus, D C

    2005-01-01

    Highly respirable particles (diameter, <1 microm) constitute the majority of particulate matter found in indoor air. It is hypothesized that these particles serve as carriers for toxic compounds, specifically the compounds produced by molds in water-damaged buildings. The presence of airborne Stachybotrys chartarum trichothecene mycotoxins on particles smaller than conidia (e.g., fungal fragments) was therefore investigated. Cellulose ceiling tiles with confluent Stachybotrys growth were placed in gas-drying containers through which filtered air was passed. Exiting particulates were collected by using a series of polycarbonate membrane filters with decreasing pore sizes. Scanning electron microscopy was employed to determine the presence of conidia on the filters. A competitive enzyme-linked immunosorbent assay (ELISA) specific for macrocyclic trichothecenes was used to analyze filter extracts. Cross-reactivity to various mycotoxins was examined to confirm the specificity. Statistically significant (P < 0.05) ELISA binding was observed primarily for macrocyclic trichothecenes at concentrations of 50 and 5 ng/ml and 500 pg/ml (58.4 to 83.5% inhibition). Of the remaining toxins tested, only verrucarol and diacetylverrucarol (nonmacrocyclic trichothecenes) demonstrated significant binding (18.2 and 51.7% inhibition, respectively) and then only at high concentrations. The results showed that extracts from conidium-free filters demonstrated statistically significant (P < 0.05) antibody binding that increased with sampling time (38.4 to 71.9% inhibition, representing a range of 0.5 to 4.0 ng/ml). High-performance liquid chromatography analysis suggested the presence of satratoxin H in conidium-free filter extracts. These data show that S. chartarum trichothecene mycotoxins can become airborne in association with intact conidia or smaller particles. These findings may have important implications for indoor air quality assessment.

  17. Bead mediated separation of microparticles in droplets.

    PubMed

    Wang, Sida; Sung, Ki-Joo; Lin, Xiaoxia Nina; Burns, Mark A

    2017-01-01

    Exchange of components such as particles and cells in droplets is important and highly desired in droplet microfluidic assays, and many current technologies use electrical or magnetic fields to accomplish this process. Bead-based microfluidic techniques offer an alternative approach that uses the bead's solid surface to immobilize targets like particles or biological material. In this paper, we demonstrate a bead-based technique for exchanging droplet content by separating fluorescent microparticles in a microfluidic device. The device uses posts to filter surface-functionalized beads from a droplet and re-capture the filtered beads in a new droplet. With post spacing of 7 μm, beads above 10 μm had 100% capture efficiency. We demonstrate the efficacy of this system using targeted particles that bind onto the functionalized beads and are, therefore, transferred from one solution to another in the device. Binding capacity tests performed in the bulk phase showed an average binding capacity of 5 particles to each bead. The microfluidic device successfully separated the targeted particles from the non-targeted particles with up to 98% purity and 100% yield.

  18. Bead mediated separation of microparticles in droplets

    PubMed Central

    Sung, Ki-Joo; Lin, Xiaoxia Nina; Burns, Mark A.

    2017-01-01

    Exchange of components such as particles and cells in droplets is important and highly desired in droplet microfluidic assays, and many current technologies use electrical or magnetic fields to accomplish this process. Bead-based microfluidic techniques offer an alternative approach that uses the bead’s solid surface to immobilize targets like particles or biological material. In this paper, we demonstrate a bead-based technique for exchanging droplet content by separating fluorescent microparticles in a microfluidic device. The device uses posts to filter surface-functionalized beads from a droplet and re-capture the filtered beads in a new droplet. With post spacing of 7 μm, beads above 10 μm had 100% capture efficiency. We demonstrate the efficacy of this system using targeted particles that bind onto the functionalized beads and are, therefore, transferred from one solution to another in the device. Binding capacity tests performed in the bulk phase showed an average binding capacity of 5 particles to each bead. The microfluidic device successfully separated the targeted particles from the non-targeted particles with up to 98% purity and 100% yield. PMID:28282412

  19. Functional reconstitution of rhodopsin into tubular lipid bilayers supported by nanoporous media.

    PubMed

    Soubias, Olivier; Polozov, Ivan V; Teague, Walter E; Yeliseev, Alexei A; Gawrisch, Klaus

    2006-12-26

    We report on a novel reconstitution method for G-protein-coupled receptors (GPCRs) that yields detergent-free, single, tubular membranes in porous anodic aluminum oxide (AAO) filters at concentrations sufficient for structural studies by solid-state NMR. The tubular membranes line the inner surface of pores that traverse the filters, permitting easy removal of detergents during sample preparation as well as delivery of ligands for functional studies. Reconstitution of bovine rhodopsin into AAO filters did not interfere with rhodopsin function. Photoactivation of rhodopsin in AAO pores, monitored by UV-vis spectrophotometry, was indistinguishable from rhodopsin in unsupported unilamellar liposomes. The rhodopsin in AAO pores is G-protein binding competent as shown by a [35S]GTPgammaS binding assay. The lipid-rhodopsin interaction was investigated by 2H NMR on sn-1- or sn-2-chain perdeuterated 1-stearoyl-2-docosahexaenoyl-sn-glycero-3-phospholine as a matrix lipid. Rhodopsin incorporation increased mosaic spread of bilayer orientations and contributed to spectral density of motions with correlation times in the range of nano- to microseconds, detected as a significant reduction in spin-spin relaxation times. The change in lipid chain order parameters due to interaction with rhodopsin was insignificant.

  20. Channel architecture in maltoporin: dominance studies with lamB mutations influencing maltodextrin binding provide evidence for independent selectivity filters in each subunit.

    PubMed Central

    Ferenci, T; Lee, K S

    1989-01-01

    Maltoporin trimers constitute maltodextrin-selective channels in the outer membrane of Escherichia coli. To study the organization of the maltodextrin-binding site within trimers, dominance studies were undertaken with maltoporin variants of altered binding affinity. It has been established that amino acid substitutions at three dispersed regions of the maltoporin sequence (at residues 8, 82, and 360) resulted specifically in maltodextrin-binding defects and loss of maltodextrin channel selectivity; a substitution at residue 118 increased both binding affinity and maltodextrin transport. Strains heterodiploid for lamB were constructed in which these substitutions were encoded by chromosomal and plasmid-borne genes, and the relative level of maltoporin expression from these genes was estimated. Binding assays with bacteria forming maltoporin heterotrimers were performed in order to test for complementation between binding-negative alleles, negative dominance of negative over wild-type alleles, and possible dominance of negatives over the high-affinity allele. Double mutants with mutations affecting residues 8 and 118, 82 and 118, and 118 and 360 were constructed in vitro, and the dominance properties of the mutations in cis were also tested. There was no complementation between negatives and no negative dominance in heterotrimers. The high-affinity mutation was dominant over negatives in trans but not in cis. The affinity of binding sites in heterotrimer populations was characteristic of the high-affinity allele present and uninfluenced by the negative allele. These results are consistent with the presence of three discrete binding sites in a maltoporin trimer and suggest that the selectivity filter for maltodextrins is not at the interface between the three subunits. PMID:2521623

  1. Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tully, D.B.; Hillman, D.; Herbert, E.

    1986-05-01

    Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

  2. Assay of Deoxyhypusine Synthase Activity

    PubMed Central

    Wolff, Edith C.; Lee, Seung Bum; Park, Myung Hee

    2011-01-01

    Deoxyhypusine synthase catalyzes an unusual protein modification reaction. A portion of spermidine is covalently added to one specific lysine residue of one eukaryotic protein, eIF5A (eukaryotic initiation factor 5A) to form a deoxyhypusine residue. The assay measures the incorporation of radioactivity from [1,8-3H]spermidine into the eIF5A protein. The enzyme is specific for the eIF5A precursor protein and does not work on short peptides (<50 amino acids). Optimum conditions for the reaction and four detection methods for the product, deoxyhypusine-containing eIF5A, are described in this chapter. The first, and most specific, method is the measurement of the amount of [3H]deoxyhypusine in the protein hydrolysate after its separation by ion exchange chromatography. However, this method requires some specialized equipment. The second method is counting the radioactivity in TCA-precipitated protein after thorough washing. The third method involves determining the radioactivity in the band of [3H] deoxyhypusine-containing eIF5A after separation by SDS-PAGE. The fourth method is a filter-binding assay. It is important to minimize nonspecific binding of [3H]spermidine to proteins in the assay mixture, especially for methods 2 and 4, as illustrated in a comparison figure in the chapter. PMID:21318875

  3. Protoporphyrinogen oxidase: high affinity tetrahydrophthalimide radioligand for the inhibitor/herbicide-binding site in mouse liver mitochondria.

    PubMed

    Birchfield, N B; Casida, J E

    1996-01-01

    Protoporphyrinogen oxidase (protox), the last common enzyme in heme and chlorophyll biosynthesis, is the target of several classes of herbicides acting as inhibitors in both plants and mammals. N-(4-Chloro-2-fluoro-5-(propargyloxy)phenyl)-3,4,5,6-tetrahydro phthalimide (a potent protox inhibitor referred to as THP) was synthesized as a candidate radioligand ([3H]-THP) by selective catalytic reduction of 3,6-dihydrophthalic anhydride (DHPA) with tritium gas followed by condensation in 45% yield with 4-chloro-2-fluoro-5-(propargyloxy)aniline. Insertion of tritium at the 3 and 6 carbons of DHPA as well as the expected 4 and 5 carbons resulted in high specific activity [3H]THP (92 Ci/mmol). This radioligand undergoes rapid, specific, saturable, and reversible binding to the inhibitor/herbicide binding site of the protox component of cholate-solubilized mouse liver mitochondria with an apparent Kd of 0.41 nM and Bmax of 0.40 pmol/mg of protein. In the standard assay, mouse preparation (150 micrograms of protein) and [3H]THP (0.5 nM) are incubated in 500 microL of phosphate buffer at pH 7.2 for 15 min at 25 degrees C followed by addition of ammonium sulfate and filtration with glass fiber filters. The potencies of five nitrodiphenyl ethers and two other herbicides as inhibitors of [3H]THP binding correlate well with those for inhibition of protox activity (r2 = 0.97, n = 7), thus validating the binding assay as relevant to enzyme inhibition. It is also suitable to determine in vivo block as illustrated by an approximately 50% decrease in [3H]THP binding in liver mitochondria from mice treated ip with oxyfluorfen at 4 mg/kg. This is the first report of a binding assay for protox in mammals. The high affinity and specific activity of [3H]THP facilitate quantitation of protox and therefore research on a sensitive inhibition site for porphyrin biosynthesis.

  4. Binding of endostatin to endothelial heparan sulphate shows a differential requirement for specific sulphates.

    PubMed

    Blackhall, Fiona H; Merry, Catherine L R; Lyon, Malcolm; Jayson, Gordon C; Folkman, Judah; Javaherian, Kashi; Gallagher, John T

    2003-10-01

    Endostatin is a naturally occurring proteolytic fragment of the C-terminal domain of collagen XVIII. It inhibits angiogenesis by a mechanism that appears to involve binding to HS (heparan sulphate). We have examined the molecular interaction between endostatin and HS from micro- and macrovessel endothelial cells. Two discrete panels of oligosaccharides were prepared from metabolically radiolabelled HS, using digestion with either heparinase I or III, and then examined for their endostatin affinity using a sensitive filter-binding assay. Two types of endostatin-binding regions were identified: one comprising sulphated domains of five or more disaccharides in length, enriched in 6-O-sulphate groups, and the other contained long heparinase I-resistant fragments. In the latter case, evidence from the present study suggests that the binding region encompasses a sulphated domain fragment and a transition zone of intermediate sulphation. The contribution to binding of specific O-sulphate groups was determined using selectively desulphated HS species, namely HS from Hs2st-/- mutant cells, and by comparing the compositions of endostatin-binding and non-binding oligosaccharides. The results indicate that 6-O-sulphates play a dominant role in site selectivity and 2-O-sulphates are not strictly essential.

  5. Binding of endostatin to endothelial heparan sulphate shows a differential requirement for specific sulphates.

    PubMed Central

    Blackhall, Fiona H; Merry, Catherine L R; Lyon, Malcolm; Jayson, Gordon C; Folkman, Judah; Javaherian, Kashi; Gallagher, John T

    2003-01-01

    Endostatin is a naturally occurring proteolytic fragment of the C-terminal domain of collagen XVIII. It inhibits angiogenesis by a mechanism that appears to involve binding to HS (heparan sulphate). We have examined the molecular interaction between endostatin and HS from micro- and macrovessel endothelial cells. Two discrete panels of oligosaccharides were prepared from metabolically radiolabelled HS, using digestion with either heparinase I or III, and then examined for their endostatin affinity using a sensitive filter-binding assay. Two types of endostatin-binding regions were identified: one comprising sulphated domains of five or more disaccharides in length, enriched in 6-O-sulphate groups, and the other contained long heparinase I-resistant fragments. In the latter case, evidence from the present study suggests that the binding region encompasses a sulphated domain fragment and a transition zone of intermediate sulphation. The contribution to binding of specific O-sulphate groups was determined using selectively desulphated HS species, namely HS from Hs2st-/- mutant cells, and by comparing the compositions of endostatin-binding and non-binding oligosaccharides. The results indicate that 6-O-sulphates play a dominant role in site selectivity and 2-O-sulphates are not strictly essential. PMID:12812520

  6. RNA binding and replication by the poliovirus RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oberste, M.S.

    1988-01-01

    RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to {sup 32}P-labeled ribohomopolymeric RNAs wasmore » examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K{sub a} for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 {times} 10{sup 9} M{sup {minus}1}. The polymerase binds to a subgenomic RNAs which contain the 3{prime} end of the genome with a K{sub a} similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3{prime} noncoding region.« less

  7. TATA Binding Protein Discriminates between Different Lesions on DNA, Resulting in a Transcription Decrease

    PubMed Central

    Coin, Frédéric; Frit, Philippe; Viollet, Benoit; Salles, Bernard; Egly, Jean-Marc

    1998-01-01

    DNA damage recognition by basal transcription factors follows different mechanisms. Using transcription-competition, nitrocellulose filter binding, and DNase I footprinting assays, we show that, although the general transcription factor TFIIH is able to target any kind of lesion which can be repaired by the nucleotide excision repair pathway, TATA binding protein (TBP)-TFIID is more selective in damage recognition. Only genotoxic agents which are able to induce kinked DNA structures similar to the one for the TATA box in its TBP complex are recognized. Indeed, DNase I footprinting patterns reveal that TBP protects equally 4 nucleotides upstream and 6 nucleotides downstream from the A-T (at position −29 of the noncoding strand) of the adenovirus major late promoter and from the G-G of a cisplatin-induced 1,2-d(GpG) cross-link. Together, our results may partially explain differences in transcription inhibition rates following DNA damage. PMID:9632775

  8. Selection of Inhibitor-Resistant Viral Potassium Channels Identifies a Selectivity Filter Site that Affects Barium and Amantadine Block

    PubMed Central

    Fujiwara, Yuichiro; Arrigoni, Cristina; Domigan, Courtney; Ferrara, Giuseppina; Pantoja, Carlos; Thiel, Gerhard; Moroni, Anna; Minor, Daniel L.

    2009-01-01

    Background Understanding the interactions between ion channels and blockers remains an important goal that has implications for delineating the basic mechanisms of ion channel function and for the discovery and development of ion channel directed drugs. Methodology/Principal Findings We used genetic selection methods to probe the interaction of two ion channel blockers, barium and amantadine, with the miniature viral potassium channel Kcv. Selection for Kcv mutants that were resistant to either blocker identified a mutant bearing multiple changes that was resistant to both. Implementation of a PCR shuffling and backcrossing procedure uncovered that the blocker resistance could be attributed to a single change, T63S, at a position that is likely to form the binding site for the inner ion in the selectivity filter (site 4). A combination of electrophysiological and biochemical assays revealed a distinct difference in the ability of the mutant channel to interact with the blockers. Studies of the analogous mutation in the mammalian inward rectifier Kir2.1 show that the T→S mutation affects barium block as well as the stability of the conductive state. Comparison of the effects of similar barium resistant mutations in Kcv and Kir2.1 shows that neighboring amino acids in the Kcv selectivity filter affect blocker binding. Conclusions/Significance The data support the idea that permeant ions have an integral role in stabilizing potassium channel structure, suggest that both barium and amantadine act at a similar site, and demonstrate how genetic selections can be used to map blocker binding sites and reveal mechanistic features. PMID:19834614

  9. pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein. Characterization and regulation by uridine and guanosine nucleotides

    PubMed Central

    Jørgensen, Casper Møller; Fields, Christopher J.; Chander, Preethi; Watt, Desmond; Burgner, John W.; Smith, Janet L.; Switzer, Robert L.

    2011-01-01

    Summary The PyrR protein regulates expression of pyrimidine biosynthetic (pyr) genes in many bacteria. PyrR binds to specific sites in the 5’ leader RNA of target operons and favors attenuation of transcription. Filter binding and gel mobility assays were used to characterize the binding of PyrR from Bacillus caldolyticus to RNA sequences (binding loops) from the three attenuation regions of the B. caldolyticus pyr operon. Binding of PyrR to the three binding loops and modulation of RNA binding by nucleotides was similar for all three RNAs. Apparent dissociation constants at 0° C ranged from 0.13 to 0.87 nM in the absence of effectors; dissociation constants were decreased by 3 to 12 fold by uridine nucleotides and increased by 40 to 200 fold by guanosine nucleotides. The binding data suggest that pyr operon expression is regulated by the ratio of intracellular uridine nucleotides to guanosine nucleotides; the effects of nucleoside addition to the growth medium on aspartate transcarbamylase (pyrB) levels in B. subtilis cells in vivo supported this conclusion. Analytical ultracentrifugation established that RNA binds to dimeric PyrR, even though the tetrameric form of unbound PyrR predominates in solution at the concentrations studied. PMID:18190533

  10. Marine Invertebrate Xenobiotic-Activated Nuclear Receptors: Their Application as Sensor Elements in High-Throughput Bioassays for Marine Bioactive Compounds

    PubMed Central

    Richter, Ingrid; Fidler, Andrew E.

    2014-01-01

    Developing high-throughput assays to screen marine extracts for bioactive compounds presents both conceptual and technical challenges. One major challenge is to develop assays that have well-grounded ecological and evolutionary rationales. In this review we propose that a specific group of ligand-activated transcription factors are particularly well-suited to act as sensors in such bioassays. More specifically, xenobiotic-activated nuclear receptors (XANRs) regulate transcription of genes involved in xenobiotic detoxification. XANR ligand-binding domains (LBDs) may adaptively evolve to bind those bioactive, and potentially toxic, compounds to which organisms are normally exposed to through their specific diets. A brief overview of the function and taxonomic distribution of both vertebrate and invertebrate XANRs is first provided. Proof-of-concept experiments are then described which confirm that a filter-feeding marine invertebrate XANR LBD is activated by marine bioactive compounds. We speculate that increasing access to marine invertebrate genome sequence data, in combination with the expression of functional recombinant marine invertebrate XANR LBDs, will facilitate the generation of high-throughput bioassays/biosensors of widely differing specificities, but all based on activation of XANR LBDs. Such assays may find application in screening marine extracts for bioactive compounds that could act as drug lead compounds. PMID:25421319

  11. A paper-based device for double-stranded DNA detection with Zif268

    NASA Astrophysics Data System (ADS)

    Zhang, Daohong

    2017-05-01

    Here, a small analytical device was fabricated on both nitrocellulose membrane and filter paper, for the detection of biotinylated double-stranded DNA (dsDNA) from 1 nM. Zif268 was utilized for capturing the target DNA, which was a zinc finger protein that recognized only a dsDNA with specific sequence. Therefore, this detection platform could be utilized for PCR result detection, with the well-designed primers (interpolate both biotin and Zif268 binding sequence). The result of the assay could be recorded by a camera-phone, and analyzed with software. The whole assay finished within 1 hour. Due to the easy fabrication, operation and disposal of this device, this method can be employed in point-of-care detection or on-site monitoring.

  12. An improved filter elution and cell culture assay procedure for evaluating public groundwater systems for culturable enteroviruses.

    PubMed

    Dahling, Daniel R

    2002-01-01

    Large-scale virus studies of groundwater systems require practical and sensitive procedures for both sample processing and viral assay. Filter adsorption-elution procedures have traditionally been used to process large-volume water samples for viruses. In this study, five filter elution procedures using cartridge filters were evaluated for their effectiveness in processing samples. Of the five procedures tested, the third method, which incorporated two separate beef extract elutions (one being an overnight filter immersion in beef extract), recovered 95% of seeded poliovirus compared with recoveries of 36 to 70% for the other methods. For viral enumeration, an expanded roller bottle quantal assay was evaluated using seeded poliovirus. This cytopathic-based method was considerably more sensitive than the standard plaque assay method. The roller bottle system was more economical than the plaque assay for the evaluation of comparable samples. Using roller bottles required less time and manipulation than the plaque procedure and greatly facilitated the examination of large numbers of samples. The combination of the improved filter elution procedure and the roller bottle assay for viral analysis makes large-scale virus studies of groundwater systems practical. This procedure was subsequently field tested during a groundwater study in which large-volume samples (exceeding 800 L) were processed through the filters.

  13. Critical ligand binding reagent preparation/selection: when specificity depends on reagents.

    PubMed

    Rup, Bonita; O'Hara, Denise

    2007-05-11

    Throughout the life cycle of biopharmaceutical products, bioanalytical support is provided using ligand binding assays to measure the drug product for pharmacokinetic, pharmacodynamic, and immunogenicity studies. The specificity and selectivity of these ligand binding assays are highly dependent on the ligand binding reagents. Thus the selection, characterization, and management processes for ligand binding reagents are crucial to successful assay development and application. This report describes process considerations for selection and characterization of ligand binding reagents that are integral parts of the different phases of assay development. Changes in expression, purification, modification, and storage of the ligand binding reagents may have a profound effect on the ligand binding assay performance. Thus long-term management of the critical ligand binding assay reagents is addressed including suggested characterization criteria that allow ligand binding reagents to be used in as consistent a manner as possible. Examples of challenges related to the selection, modification, and characterization of ligand binding reagents are included.

  14. Analysis of Ethylene Receptors: Ethylene-Binding Assays.

    PubMed

    Binder, Brad M; Schaller, G Eric

    2017-01-01

    Plant ethylene receptors bind ethylene with high affinity. Most of the characterization of ethylene binding to the receptors has been carried out using a radioligand-binding assay on functional receptors expressed in yeast. In this chapter, we describe methods for expressing ethylene receptors in yeast and conducting ethylene-binding assays on intact yeast and yeast membranes. The ethylene-binding assays can be modified to analyze ethylene binding to intact plants and other organisms as well as membranes isolated from any biological source.

  15. Monoclonal antibodies to human vitamin D-binding protein.

    PubMed Central

    Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F

    1985-01-01

    Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035

  16. Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giulliani, S. E.; Frank, A. E.; Collart, F. R.

    2008-12-08

    We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

  17. Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.

    PubMed

    Schuller, Marion; Höfner, Georg; Wanner, Klaus T

    2017-10-09

    MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Comparison of functional assays used in the clinical development of a placental malaria vaccine.

    PubMed

    Pehrson, Caroline; Heno, Kristine K; Adams, Yvonne; Resende, Mafalda; Mathiesen, Line; Soegaard, Max; de Jongh, Willem A; Theander, Thor G; Salanti, Ali; Nielsen, Morten A

    2017-01-23

    Malaria in pregnancy is associated with significant morbidity in pregnant women and their offspring. Plasmodium falciparum infected erythrocytes (IE) express VAR2CSA that mediates binding to chondroitin sulphate A (CSA) in the placenta. Two VAR2CSA-based vaccines for placental malaria are in clinical development. The purpose of this study was to evaluate the robustness and comparability of binding inhibition assays used in the clinical development of placental malaria vaccines. The ability of sera from animals immunised with different VAR2CSA constructs to inhibit IE binding to CSA was investigated in three in vitro assays using 96-well plates, petri dishes, capillary flow and an ex vivo placental perfusion assay. The inter-assay variation was not uniform between assays and ranged from above ten-fold in the flow assay to two-fold in the perfusion assay. The intra-assay variation was highest in the petri dish assay. A positive correlation between IE binding avidity and the level of binding after antibody inhibition in the petri dish assay indicate that high avidity IE binding is more difficult to inhibit. The highest binding inhibition sensitivity was found in the 96-well and petri dish assays compared to the flow and perfusion assays where binding inhibition required higher antibody titers. The inhibitory capacity of antibodies is not easily translated between assays and the high sensitivity of the 96-well and petri dish assays stresses the need for comparing serial dilutions of serum. Furthermore, IE binding avidity must be in the same range when comparing data from different days. There was an overall concordance in the capacity of antibody-mediated inhibition, when comparing the in vitro assays with the perfusion assay, which more closely represents in vivo conditions. Importantly the ID1-ID2a protein in a liposomal formulation, currently in a phase I trial, effectively induced antibodies that inhibited IE adhesion in placental tissue. Copyright © 2016. Published by Elsevier Ltd.

  19. The productive cellulase binding capacity of cellulosic substrates.

    PubMed

    Karuna, Nardrapee; Jeoh, Tina

    2017-03-01

    Cellulosic biomass is the most promising feedstock for renewable biofuel production; however, the mechanisms of the heterogeneous cellulose saccharification reaction are still unsolved. As cellulases need to bind isolated molecules of cellulose at the surface of insoluble cellulose fibrils or larger aggregated cellulose structures in order to hydrolyze glycosidic bonds, the "accessibility of cellulose to cellulases" is considered to be a reaction limiting property of cellulose. We have defined the accessibility of cellulose to cellulases as the productive binding capacity of cellulose, that is, the concentration of productive binding sites on cellulose that are accessible for binding and hydrolysis by cellulases. Productive cellulase binding to cellulose results in hydrolysis and can be quantified by measuring hydrolysis rates. In this study, we measured the productive Trichoderma reesei Cel7A (TrCel7A) binding capacity of five cellulosic substrates from different sources and processing histories. Swollen filter paper and bacterial cellulose had higher productive binding capacities of ∼6 µmol/g while filter paper, microcrystalline cellulose, and algal cellulose had lower productive binding capacities of ∼3 µmol/g. Swelling and regenerating filter paper using phosphoric acid increased the initial accessibility of the reducing ends to TrCel7A from 4 to 6 µmol/g. Moreover, this increase in initial productive binding capacity accounted in large part for the difference in the overall digestibility between filter paper and swollen filter paper. We further demonstrated that an understanding of how the productive binding capacity declines over the course of the hydrolysis reaction has the potential to predict overall saccharification time courses. Biotechnol. Bioeng. 2017;114: 533-542. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  20. Carbonic anhydrase II binds to and increases the activity of the epithelial sodium-proton exchanger, NHE3

    PubMed Central

    Krishnan, Devishree; Liu, Lei; Wiebe, Shane A.; Casey, Joseph R.; Cordat, Emmanuelle; Alexander, R. Todd

    2016-01-01

    Two-thirds of sodium filtered by the renal glomerulus is reabsorbed from the proximal tubule via a sodium/proton exchanger isoform 3 (NHE3)-dependent mechanism. Since sodium and bicarbonate reabsorption are coupled, we postulated that the molecules involved in their reabsorption [NHE3 and carbonic anhydrase II (CAII)] might physically and functionally interact. Consistent with this, CAII and NHE3 were closely associated in a renal proximal tubular cell culture model as revealed by a proximity ligation assay. Direct physical interaction was confirmed in solid-phase binding assays with immobilized CAII and C-terminal NHE3 glutathione-S-transferase fusion constructs. To assess the effect of CAII on NHE3 function, we expressed NHE3 in a proximal tubule cell line and measured NHE3 activity as the rate of intracellular pH recovery, following an acid load. NHE3-expressing cells had a significantly greater rate of intracellular pH recovery than controls. Inhibition of endogenous CAII activity with acetazolamide significantly decreased NHE3 activity, indicating that CAII activates NHE3. To ascertain whether CAII binding per se activates NHE3, we expressed NHE3 with wild-type CAII, a catalytically inactive CAII mutant (CAII-V143Y), or a mutant unable to bind other transporters (CAII-HEX). NHE3 activity increased upon wild-type CAII coexpression, but not in the presence of the CAII V143Y or HEX mutant. Together these studies support an association between CAII and NHE3 that alters the transporter’s activity. PMID:26041446

  1. Detection of respiratory viruses on air filters from aircraft.

    PubMed

    Korves, T M; Johnson, D; Jones, B W; Watson, J; Wolk, D M; Hwang, G M

    2011-09-01

    To evaluate the feasibility of identifying viruses from aircraft cabin air, we evaluated whether respiratory viruses trapped by commercial aircraft air filters can be extracted and detected using a multiplex PCR, bead-based assay. The ResPlex II assay was first tested for its ability to detect inactivated viruses applied to new filter material; all 18 applications of virus at a high concentration were detected. The ResPlex II assay was then used to test for 18 respiratory viruses on 48 used air filter samples from commercial aircraft. Three samples tested positive for viruses, and three viruses were detected: rhinovirus, influenza A and influenza B. For 33 of 48 samples, internal PCR controls performed suboptimally, suggesting sample matrix effect. In some cases, influenza and rhinovirus RNA can be detected on aircraft air filters, even more than 10 days after the filters were removed from aircraft. With protocol modifications to overcome PCR inhibition, air filter sampling and the ResPlex II assay could be used to characterize viruses in aircraft cabin air. Information about viruses in aircraft could support public health measures to reduce disease transmission within aircraft and between cities. © The MITRE corporation. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  2. The Effect of Hydraulic Loading Rate and Influent Source on the Binding Capacity of Phosphorus Filters

    PubMed Central

    Herrmann, Inga; Jourak, Amir; Hedström, Annelie; Lundström, T. Staffan; Viklander, Maria

    2013-01-01

    Sorption by active filter media can be a convenient option for phosphorus (P) removal and recovery from wastewater for on-site treatment systems. There is a need for a robust laboratory method for the investigation of filter materials to enable a reliable estimation of their longevity. The objectives of this study were to (1) investigate and (2) quantify the effect of hydraulic loading rate and influent source (secondary wastewater and synthetic phosphate solution) on P binding capacity determined in laboratory column tests and (3) to study how much time is needed for the P to react with the filter material (reaction time). To study the effects of these factors, a 22 factorial experiment with 11 filter columns was performed. The reaction time was studied in a batch experiment. Both factors significantly (α = 0.05) affected the P binding capacity negatively, but the interaction of the two factors was not significant. Increasing the loading rate from 100 to 1200 L m−2 d−1 decreased P binding capacity from 1.152 to 0.070 g kg−1 for wastewater filters and from 1.382 to 0.300 g kg−1 for phosphate solution filters. At a loading rate of 100 L m−2 d−1, the average P binding capacity of wastewater filters was 1.152 g kg−1 as opposed to 1.382 g kg−1 for phosphate solution filters. Therefore, influent source or hydraulic loading rate should be carefully controlled in the laboratory. When phosphate solution and wastewater were used, the reaction times for the filters to remove P were determined to be 5 and 15 minutes, respectively, suggesting that a short residence time is required. However, breakthrough in this study occurred unexpectedly quickly, implying that more time is needed for the P that has reacted to be physically retained in the filter. PMID:23936313

  3. Ion-binding properties of the ClC chloride selectivity filter

    PubMed Central

    Lobet, Séverine; Dutzler, Raimund

    2006-01-01

    The ClC channels are members of a large protein family of chloride (Cl−) channels and secondary active Cl− transporters. Despite their diverse functions, the transmembrane architecture within the family is conserved. Here we present a crystallographic study on the ion-binding properties of the ClC selectivity filter in the close homolog from Escherichia coli (EcClC). The ClC selectivity filter contains three ion-binding sites that bridge the extra- and intracellular solutions. The sites bind Cl− ions with mM affinity. Despite their close proximity within the filter, the three sites can be occupied simultaneously. The ion-binding properties are found conserved from the bacterial transporter EcClC to the human Cl− channel ClC-1, suggesting a close functional link between ion permeation in the channels and active transport in the transporters. In resemblance to K+ channels, ions permeate the ClC channel in a single file, with mutual repulsion between the ions fostering rapid conduction. PMID:16341087

  4. In Situ Protein Binding Assay Using Fc-Fusion Proteins.

    PubMed

    Padmanabhan, Nirmala; Siddiqui, Tabrez J

    2017-01-01

    This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.

  5. Characterization of protein--DNA interactions using surface plasmon resonance spectroscopy with various assay schemes.

    PubMed

    Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S

    2007-02-27

    Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.

  6. Potential bioactivity and association of 17β-estradiol with the dissolved and colloidal fractions of manure and soil.

    PubMed

    Chambers, Katrin B; Casey, Francis X M; Hakk, Heldur; DeSutter, Thomas M; Shappell, Nancy W

    2014-10-01

    The dissolved (DF) and colloidal fractions (CF) of soil and manure play an important role in the environmental fate and transport of steroidal estrogens. The first objective of this study was to quantify the association of 17β-estradiol (E2) with the DF and CF isolated from (i) liquid swine manure (LSM), (ii) a soil:water mixture (soil), and (iii) a LSM:soil:water mixture (Soil+LSM). The appropriate CF and DF size fractions of the Soil, Soil+LSM, and LSM media were obtained by first filtering through a 0.45 μm filter, which provided the combined DF and CF (DF/CF). The DF/CF from the three media was spiked with carbon-14 ([(14)C]) radiolabeled E2 ([(14)C]-E2), and then ultrafiltered to isolate the CF (<0.45 μm and >1 kDa) from the DF (<1 kDa). The average recoveries of the [(14)C] associated with the DF were 67%-72%, 67%-79%, and 76%-78% for the Soil, Soil+LSM and LSM, respectively. For the CF that was retained on the 1 kDa filter, organic carbon and [(14)C]-E2 were dislodged with subsequent water rinses the Soil+LSM and LSM, but not the Soil. The second objective was to evaluate whether the E2 associated with the various fractions of the different media could still bind the estrogen receptor using an E2 receptor (17β-ER) competitor assay, which allowed E2 equivalent concentrations to be determined. The estrogen receptor assay results indicated that E2 present in the DF of the Soil and Soil+LSM solutions could still bind the estrogen receptor. Results from this study indicated that E2 preferentially associated with the DF of soil and manure, which may enhance its dissolved advective transport in surface and subsurface water. Furthermore, this study indicated that E2 associated with DF solutions in the environment could potentially induce endocrine responses through its interactions with estrogen receptor. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Interaction between the cellular protein eEF1A and the 3'-terminal stem-loop of West Nile virus genomic RNA facilitates viral minus-strand RNA synthesis.

    PubMed

    Davis, William G; Blackwell, Jerry L; Shi, Pei-Yong; Brinton, Margo A

    2007-09-01

    RNase footprinting and nitrocellulose filter binding assays were previously used to map one major and two minor binding sites for the cell protein eEF1A on the 3'(+) stem-loop (SL) RNA of West Nile virus (WNV) (3). Base substitutions in the major eEF1A binding site or adjacent areas of the 3'(+) SL were engineered into a WNV infectious clone. Mutations that decreased, as well as ones that increased, eEF1A binding in in vitro assays had a negative effect on viral growth. None of these mutations affected the efficiency of translation of the viral polyprotein from the genomic RNA, but all of the mutations that decreased in vitro eEF1A binding to the 3' SL RNA also decreased viral minus-strand RNA synthesis in transfected cells. Also, a mutation that increased the efficiency of eEF1A binding to the 3' SL RNA increased minus-strand RNA synthesis in transfected cells, which resulted in decreased synthesis of genomic RNA. These results strongly suggest that the interaction between eEF1A and the WNV 3' SL facilitates viral minus-strand synthesis. eEF1A colocalized with viral replication complexes (RC) in infected cells and antibody to eEF1A coimmunoprecipitated viral RC proteins, suggesting that eEF1A facilitates an interaction between the 3' end of the genome and the RC. eEF1A bound with similar efficiencies to the 3'-terminal SL RNAs of four divergent flaviviruses, including a tick-borne flavivirus, and colocalized with dengue virus RC in infected cells. These results suggest that eEF1A plays a similar role in RNA replication for all flaviviruses.

  8. Strategic assay deployment as a method for countering analytical bottlenecks in high throughput process development: case studies in ion exchange chromatography.

    PubMed

    Konstantinidis, Spyridon; Heldin, Eva; Chhatre, Sunil; Velayudhan, Ajoy; Titchener-Hooker, Nigel

    2012-01-01

    High throughput approaches to facilitate the development of chromatographic separations have now been adopted widely in the biopharmaceutical industry, but issues of how to reduce the associated analytical burden remain. For example, acquiring experimental data by high level factorial designs in 96 well plates can place a considerable strain upon assay capabilities, generating a bottleneck that limits significantly the speed of process characterization. This article proposes an approach designed to counter this challenge; Strategic Assay Deployment (SAD). In SAD, a set of available analytical methods is investigated to determine which set of techniques is the most appropriate to use and how best to deploy these to reduce the consumption of analytical resources while still enabling accurate and complete process characterization. The approach is demonstrated by investigating how salt concentration and pH affect the binding of green fluorescent protein from Escherichia coli homogenate to an anion exchange resin presented in a 96-well filter plate format. Compared with the deployment of routinely used analytical methods alone, the application of SAD reduced both the total assay time and total assay material consumption by at least 40% and 5%, respectively. SAD has significant utility in accelerating bioprocess development activities. Copyright © 2012 American Institute of Chemical Engineers (AIChE).

  9. International Validation of Two Human Recombinant Estrogen ...

    EPA Pesticide Factsheets

    An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay using a ligand-binding domain of the human ER. Twenty three compounds were tested in 6 laboratories for the FW assay and 5 for the CERJ assay, which included three controls (used with every run), 9 uncoded, and 14 coded chemicals across 3 subtasks. The overall goal of this validation study was to demonstrate the ability of each of the two assays to reliably classify the test chemicals as binders or non-binders. Laboratories had little trouble with the ER binders that produced a full binding curve when using either the CERI or FW assays. As is typical with all ER competitive binding assays, the weak binders proved to be more challenging. However, overall results from both the FW and CERI assays were consistent and in agreement with expected classifications regardless of the form of the hrER (i.e., full length ER versus an ER ligand binding domain) or the subtle differences in the protocols for conducting each assay. The reproducibility and accuracy for classification of chemicals as potential ER binders and non- binders using the FW and CERI hrER binding assays were comparable to that of the U.S.EPA’s existing ER binding test guideline OPPTS 890.1250, while providing an improved, highe

  10. Characterization of binding affinity of CJ-023,423 for human prostanoid EP4 receptor.

    PubMed

    Murase, Akio; Nakao, Kazunari; Takada, Junji

    2008-01-01

    In order to characterize the receptor binding pharmacology of CJ-023,423, a potent and selective EP4 antagonist, we performed a radioligand receptor binding assay under various assay conditions. An acidic (pH 6) and hypotonic buffer is a conventional, well-known buffer for prostaglandin E2 receptor binding assays. CJ-023,423 showed moderate binding affinity for human EP4 receptor under conventional buffer conditions. However, its binding affinity was greatly increased under neutral (pH 7.4) and isotonic buffer conditions. In this report, the binding mechanism between CJ-023,423 and human EP4 receptor is discussed based on the binding affinities determined under various assay conditions. Copyright 2008 S. Karger AG, Basel.

  11. Parallel Force Assay for Protein-Protein Interactions

    PubMed Central

    Aschenbrenner, Daniela; Pippig, Diana A.; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E.

    2014-01-01

    Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay. PMID:25546146

  12. Parallel force assay for protein-protein interactions.

    PubMed

    Aschenbrenner, Daniela; Pippig, Diana A; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E

    2014-01-01

    Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.

  13. Fluorescent Filter-Trap Assay for Amyloid Fibril Formation Kinetics in Complex Solutions

    PubMed Central

    2015-01-01

    Amyloid fibrils are the most distinct components of the plaques associated with various neurodegenerative diseases. Kinetic studies of amyloid fibril formation shed light on the microscopic mechanisms that underlie this process as well as the contributions of internal and external factors to the interplay between different mechanistic steps. Thioflavin T is a widely used noncovalent fluorescent probe for monitoring amyloid fibril formation; however, it may suffer from limitations due to the unspecific interactions between the dye and the additives. Here, we present the results of a filter-trap assay combined with the detection of fluorescently labeled amyloid β (Aβ) peptide. The filter-trap assay separates formed aggregates based on size, and the fluorescent label attached to Aβ allows for their detection. The times of half completion of the process (t1/2) obtained by the filter-trap assay are comparable to values from the ThT assay. High concentrations of human serum albumin (HSA) and carboxyl-modified polystyrene nanoparticles lead to an elevated ThT signal, masking a possible fibril formation event. The filter-trap assay allows fibril formation to be studied in the presence of those substances and shows that Aβ fibril formation is kinetically inhibited by HSA and that the amount of fibrils formed are reduced. In contrast, nanoparticles exhibit a dual-behavior governed by their concentration. PMID:25946560

  14. Intestinal lactoferrin receptor: presence and specificity during development

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Davidson, L.A.; Lonnerdal, B.L.

    1986-03-01

    As the major iron-binding protein in breast milk, lactoferrin (Lf) has been suggested to play a role in Fe absorption from milk. The authors previous work has validated the use of the Rhesus monkey as a model for studying this role of Lf. They have identified a specific Lf receptor on the brush border (BB) of juvenile Rhesus small intestine (s.i.) which may facilitate Fe uptake into the mucosal cell. In this study the authors examined the presence and specificity of the Lf receptor during development. BB membrane vesicles were prepared from fetal (113 d gestation), infant (3 m), andmore » adult (12 y) Rhesus s.i.; Binding assays were performed by incubating BB vesicles with 59-Fe-Lf and filtering through a 0.22 ..mu..m filter. The fetal and infant tissues were found to possess receptors with a high affinity for Lf. This early ontogeny indicates the importance of the receptor to the infant. Adult s.i. contained Lf receptors in all regions. Since the adult has no dietary intake of Lf, the receptor may play a role in Fe homeostasis via biliary Lf excretion or may simply continue to be expressed throughout life. The receptors were examined for their affinity for purified bovine Lf and human transferrin, both of which are similar in structure to Lf. No binding was found for either, demonstrating the specificity of the receptor for Lf. The presence of the Lf receptor in fetal tissue and its specificity for Lf implies it is essential for adequate Fe nutrition of the suckling infant.« less

  15. Interaction mechanisms between organic UV filters and bovine serum albumin as determined by comprehensive spectroscopy exploration and molecular docking.

    PubMed

    Ao, Junjie; Gao, Li; Yuan, Tao; Jiang, Gaofeng

    2015-01-01

    Organic UV filters are a group of emerging PPCP (pharmaceuticals and personal care products) contaminants. Current information is insufficient to understand the in vivo processes and health risks of organic UV filters in humans. The interaction mechanism of UV filters with serum albumin provides critical information for the health risk assessment of these active ingredients in sunscreen products. This study investigates the interaction mechanisms of five commonly used UV filters (2-hydroxy-4-methoxybenzophenone, BP-3; 2-ethylhexyl 4-methoxycinnamate, EHMC; 4-methylbenzylidene camphor, 4-MBC; methoxydibenzoylmethane, BDM; homosalate, HMS) with bovine serum albumin (BSA) by spectroscopic measurements of fluorescence, circular dichroism (CD), competitive binding experiments and molecular docking. Our results indicated that the fluorescence of BSA was quenched by these UV filters through a static quenching mechanism. The values of the binding constant (Ka) ranged from (0.78±0.02)×10(3) to (1.29±0.01)×10(5) L mol(-1). Further exploration by synchronous fluorescence and CD showed that the conformation of BSA was demonstrably changed in the presence of these organic UV filters. It was confirmed that the UV filters can disrupt the α-helical stability of BSA. Moreover, the results of molecular docking revealed that the UV filter molecule is located in site II (sub-domain IIIA) of BSA, which was further confirmed by the results of competitive binding experiments. In addition, binding occurred mainly through hydrogen bonding and hydrophobic interaction. This study raises critical concerns regarding the transportation, distribution and toxicity effects of organic UV filters in human body. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Screening and characterization of a Annenix A2 binding aptamer that inhibits the proliferation of myeloma cells.

    PubMed

    Zhou, Weihua; Zhang, Yibin; Zeng, Yayue; Peng, Minyuan; Li, Hui; Sun, Shuming; Ma, Bianying; Wang, Yanpeng; Ye, Mao; Liu, Jing

    2018-06-12

    Multiple myeloma (MM) is a malignant plasma cell disease and is considered incurable. Annexin A2 (ANXA2) is closely related to the proliferation and adhesion of MM. Using protein-SELEX, we performed a screen for aptamers that bind GST-ANXA2 from a library, and GST protein was used for negative selection. The enrichment of the ssDNA pool was monitored by filter-binding assay during selection. After nine rounds of screening and high-throughput sequencing, we obtained six candidate aptamers that bind to the ANXA2 protein. The affinities of the candidate aptamers for ANXA2 were determined by ELONA. Binding of aptamer wh6 to the ANXA2 protein and to the MM cell was verified by aptamer pulldown experiment and flow cytometry, respectively. Aptamer wh6 binds the ANXA2 protein with good stability and has a dissociation constant in the nanomolar range. The binding specificity of aptamer wh6 was confirmed in vivo in nude mouse xenografts with MM cells and with MM bone marrow aspirates. Furthermore, aptamer wh6 can block MM cell adhesion to ANXA2 and block the proliferation of MM cells induced by ANXA2. In summary, wh6 can be considered a promising candidate tool for MM diagnosis and treatment. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  17. Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

    PubMed

    Mouw, M; Pintel, D J

    1998-11-10

    GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

  18. Characterization of the cation-binding capacity of a potassium-adsorption filter used in red blood cell transfusion.

    PubMed

    Suzuki, Takao; Muto, Shigeaki; Miyata, Yukio; Maeda, Takao; Odate, Takayuki; Shimanaka, Kimio; Kusano, Eiji

    2015-06-01

    A K(+) -adsorption filter was developed to exchange K(+) in the supernatant of stored irradiated red blood cells with Na(+) . To date, however, the filter's adsorption capacity for K(+) has not been fully evaluated. Therefore, we characterized the cation-binding capacity of this filter. Artificial solutions containing various cations were continuously passed through the filter in 30 mL of sodium polystyrene sulfonate at 10 mL/min using an infusion pump at room temperature. The cation concentrations were measured before and during filtration. When a single solution containing K(+) , Li(+) , H(+) , Mg(2+) , Ca(2+) , or Al(3+) was continuously passed through the filter, the filter adsorbed K(+) and the other cations in exchange for Na(+) in direct proportion to the valence number. The order of affinity for cation adsorption to the filter was Ca(2+) >Mg(2+) >K(+) >H(+) >Li(+) . In K(+) -saturated conditions, the filter also adsorbed Na(+) . After complete adsorption of these cations on the filter, their concentration in the effluent increased in a sigmoidal manner over time. Cations that were bound to the filter were released if a second cation was passed through the filter, despite the different affinities of the two cations. The ability of the filter to bind cations, especially K(+) , should be helpful when it is used for red blood cell transfusion at the bedside. The filter may also be useful to gain a better understanding of the pharmacological properties of sodium polystyrene sulfonate. © 2015 The Authors. Therapeutic Apheresis and Dialysis © 2015 International Society for Apheresis.

  19. International Validation of Two Human Recombinant Estrogen Receptor (ERa) Binding Assays

    EPA Science Inventory

    An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay...

  20. Adaptive Focused Acoustics (AFA) Improves the Performance of Microtiter Plate ELISAs.

    PubMed

    Green, David J; Rudd, Edwin A; Laugharn, James A

    2014-08-01

    We investigated the use of Adaptive Focused Acoustics (AFA) technology to improve the performance of microtiter plate enzyme-linked immunosorbent assays (ELISAs). Experiments were performed with commercially available AFA instrumentation and off-the-shelf 96-well microtiter plate sandwich ELISAs. AFA was applied over a range of acoustic energies, temperatures, and durations to the antigen/antibody binding step of an ELISA for measuring HIV-1 p24 in tissue culture samples. AFA-mediated antigen/antibody binding was enhanced up to 2-fold over passive binding at comparable temperatures and was superior or comparable at low temperature (8-10 °C) to passive binding at 37 °C. Lower nonspecific binding (NSB), lower inter- and intra-assay coefficients of variation (CVs), higher Z' factors, and lower limits of detection (LODs) were measured in AFA-mediated assays compared with conventional passive binding. In a more limited study, AFA enhancement of antigen/antibody binding and lower NSB was measured in an ELISA for measuring IGFBP-3 in human plasma. We conclude from this study that application of AFA to antigen/antibody binding steps in microtiter plate ELISAs can enhance key assay performance parameters, particularly Z' factors and LODs. These features render AFA-mediated binding assays potentially more useful in applications such as high-throughput screening and in vitro diagnostics than assays processed with conventional passive antigen/antibody binding steps. © 2014 Society for Laboratory Automation and Screening.

  1. Integrated Summary Report: Validation of Two Binding Assays ...

    EPA Pesticide Factsheets

    This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (hrERα), to identify chemicals that may impact estrogen signaling through binding to the ER. The purpose of the ISR is to support the peer review of the findings obtained during the validation process.The two assays evaluated during this validation process are: The Freyberger-Wilson Assay (FW) using a full length human ER, and The Chemical Evaluation and Research Institute (CERI) Assay using a ligand-binding domain of the human ER.The two assays are mechanistically and functionally similar in that each measures the ability of a test chemical to competitively inhibit binding of [3H]17β-estradiol to the human recombinant ER. The essential elements of the FW and the CERI assays were developed at the laboratories of Bayer Pharma AG, Wuppertal, Germany (Freyberger et al., 2010) and CERI, Tokyo, Japan (Akahori et al., 2008), respectively.The ER competitive binding assay has long been in use, and is a well characterized approach, but historically uses rodent or other animal tissues as a source of the ER. Validation of the FW and CERI assays using human recombinant estrogen receptors ( subtype) will provide an updated alternative for the Agency’s current test guideline (OPPTS 89

  2. Detection of biotin in individual sea urchin oocytes using a bioluminescence binding assay.

    PubMed

    Feltus, A; Grosvenor, A L; Conover, R C; Anderson, K W; Daunert, S

    2001-04-01

    The ability to detect biomolecules in single cells is important in order to fully understand the processes by which many biochemical events occur. To that end, we have developed a bioluminescence binding assay capable of measuring the intracellular biotin content of individual cells. The assay depends on competition between an aequorin-biotin conjugate (AEQ-biotin) and free biotin within the oocytes for binding sites on the protein avidin. The assay is performed by microinjecting each component into the oocytes and following the resulting bioluminescence within the oocyte upon triggering of aequorin. Results obtained using sea urchin oocytes show that the assay performed within the cells behaves in a manner consistent with assay theory. Using the assay, the individual biotin content of the oocytes is an average of approximately 20 amol. To our knowledge, this is the first reported multicomponent binding assay to be performed inside an intact single cell.

  3. Ion-binding properties of a K+ channel selectivity filter in different conformations.

    PubMed

    Liu, Shian; Focke, Paul J; Matulef, Kimberly; Bian, Xuelin; Moënne-Loccoz, Pierre; Valiyaveetil, Francis I; Lockless, Steve W

    2015-12-08

    K(+) channels are membrane proteins that selectively conduct K(+) ions across lipid bilayers. Many voltage-gated K(+) (KV) channels contain two gates, one at the bundle crossing on the intracellular side of the membrane and another in the selectivity filter. The gate at the bundle crossing is responsible for channel opening in response to a voltage stimulus, whereas the gate at the selectivity filter is responsible for C-type inactivation. Together, these regions determine when the channel conducts ions. The K(+) channel from Streptomyces lividians (KcsA) undergoes an inactivation process that is functionally similar to KV channels, which has led to its use as a practical system to study inactivation. Crystal structures of KcsA channels with an open intracellular gate revealed a selectivity filter in a constricted conformation similar to the structure observed in closed KcsA containing only Na(+) or low [K(+)]. However, recent work using a semisynthetic channel that is unable to adopt a constricted filter but inactivates like WT channels challenges this idea. In this study, we measured the equilibrium ion-binding properties of channels with conductive, inactivated, and constricted filters using isothermal titration calorimetry (ITC). EPR spectroscopy was used to determine the state of the intracellular gate of the channel, which we found can depend on the presence or absence of a lipid bilayer. Overall, we discovered that K(+) ion binding to channels with an inactivated or conductive selectivity filter is different from K(+) ion binding to channels with a constricted filter, suggesting that the structures of these channels are different.

  4. Development of binding assays in microfabricated picoliter vials: an assay for biotin.

    PubMed

    Grosvenor, A L; Feltus, A; Conover, R C; Daunert, S; Anderson, K W

    2000-06-01

    A homogeneous binding assay for the detection of biotin in picoliter vials was developed using the photoprotein aequorin as the label. The binding assay was based on the competition of free biotin with biotinylated aequorin (AEQ-biotin) for avidin. A sequential protocol was used, and modification of the assay to reduce the number of steps was examined. Results showed that detection limits on the order of 10(-14) mol of biotin were possible. Reducing the number of steps provided similar detection limits but only if the amount of avidin used was decreased. These binding assays based on picoliter volumes have potential applications in a variety of fields, including microanalysis and single-cell analysis, where the amount of sample is limited. In addition, these assays are suitable for the high-throughput screening of biopharmaceuticals.

  5. Impact of SPR biosensor assay configuration on antibody: Neonatal Fc receptor binding data

    PubMed Central

    Wang, Xiangdan; McKay, Patrick; Dutina, George; Hass, Philip E.; Nijem, Ihsan; Allison, David; Cowan, Kyra J.; Lin, Kevin; Quarmby, Valerie; Yang, Jihong

    2017-01-01

    ABSTRACT Binding interactions with the neonatal Fc receptor (FcRn) are one determinant of pharmacokinetic properties of recombinant human monoclonal antibody (rhumAb) therapeutics, and a conserved binding motif in the crystallizable fragment (Fc) region of IgG molecules interacts with FcRn. Surface plasmon resonance (SPR) biosensor assays are often used to characterize interactions between FcRn and rhumAb therapeutics. In such assays, generally either the rhumAb (format 1) or the FcRn protein (format 2) is immobilized on a biosensor chip. However, because evidence suggests that, in some cases, the variable domains of a rhumAb may also affect FcRn binding, we evaluated the effect of SPR assay configuration on binding data. We sought to assess FcRn binding properties of 2 rhumAbs (rhumAb1 and rhumAb2) to FcRn proteins using these 2 biosensor assay formats. The two rhumAbs have greater than 99% sequence identity in the Fc domain but differ in their Fab regions. rhumAb2 contains a positively charged patch in the variable domain that is absent in rhumAb1. Our results showed that binding of rhumAb1 to FcRn was independent of biosensor assay configuration, while binding of rhumAb2 to FcRn was highly SPR assay configuration dependent. Further investigations revealed that the format dependency of rhumAb2-FcRn binding is linked to the basic residues that form a positively charged patch in the variable domain of rhumAb2. Our work highlights the importance of analyzing rhumAb-FcRn binding interactions using 2 alternate SPR biosensor assay configurations. This approach may also provide a simple way to identify the potential for non-Fc-driven FcRn binding interactions in otherwise typical IgGs. PMID:28001487

  6. Development of an image analysis screen for estrogen receptor alpha (ERα) ligands through measurement of nuclear translocation dynamics.

    PubMed

    Dull, Angie; Goncharova, Ekaterina; Hager, Gordon; McMahon, James B

    2010-11-01

    We have developed a robust high-content assay to screen for novel estrogen receptor alpha (ERα) agonists and antagonists by quantitation of cytoplasmic to nuclear translocation of an estrogen receptor chimera in 384-well plates. The screen utilizes a green fluorescent protein tagged-glucocorticoid/estrogen receptor (GFP-GRER) chimera which consisted of the N-terminus of the glucocorticoid receptor fused to the human ER ligand binding domain. The GFP-GRER exhibited cytoplasmic localization in the absence of ERα ligands, and translocated to the nucleus in response to stimulation with ERα agonists or antagonists. The BD Pathway 435 imaging system was used for image acquisition, analysis of translocation dynamics, and cytotoxicity measurements. The assay was validated with known ERα agonists and antagonists, and the Library of Pharmacologically Active Compounds (LOPAC 1280). Additionally, screening of crude natural product extracts demonstrated the robustness of the assay, and the ability to quantitate the effects of toxicity on nuclear translocation dynamics. The GFP-GRER nuclear translocation assay was very robust, with z' values >0.7, CVs <5%, and has been validated with known ER ligands, and inclusion of cytotoxicity filters will facilitate screening of natural product extracts. This assay has been developed for future primary screening of synthetic, pure natural products, and natural product extracts libraries available at the National Cancer Institute at Frederick. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations

    PubMed Central

    Bentley, Marvin; Decker, Helena; Luisi, Julie

    2015-01-01

    Identifying the proteins that regulate vesicle trafficking is a fundamental problem in cell biology. In this paper, we introduce a new assay that involves the expression of an FKBP12-rapamycin–binding domain–tagged candidate vesicle-binding protein, which can be inducibly linked to dynein or kinesin. Vesicles can be labeled by any convenient method. If the candidate protein binds the labeled vesicles, addition of the linker drug results in a predictable, highly distinctive change in vesicle localization. This assay generates robust and easily interpretable results that provide direct experimental evidence of binding between a candidate protein and the vesicle population of interest. We used this approach to compare the binding of Kinesin-3 family members with different endosomal populations. We found that KIF13A and KIF13B bind preferentially to early endosomes and that KIF1A and KIF1Bβ bind preferentially to late endosomes and lysosomes. This assay may have broad utility for identifying the trafficking proteins that bind to different vesicle populations. PMID:25624392

  8. Evaluation of ecotoxicological effects of benzophenone UV filters: Luminescent bacteria toxicity, genotoxicity and hormonal activity.

    PubMed

    Zhang, Qiuya; Ma, Xiaoyan; Dzakpasu, Mawuli; Wang, Xiaochang C

    2017-08-01

    The widespread use of organic ultraviolet (UV) filters in personal care products raises concerns about their potentially hazardous effects on human and ecosystem health. In this study, the toxicities of four commonly used benzophenones (BPs) UV filters including benzophenone (BP), 2-Hydroxybenzophenone (2HB), 2-Hydroxy-4-methoxybenzophenone (BP3), and 2-Hydroxy-4-methoxybenzophenone-5-sulfonicacid (BP4) in water were assayed in vitro using Vibrio fischeri, SOS/umu assay, and yeast estrogen screen (YES) assay, as well as in vivo using zebrafish larvae. The results showed that the luminescent bacteria toxicity, expressed as logEC 50 , increased with the lipophilicity (logKow) of BPs UV filters. Especially, since 2HB, BP3 and BP4 had different substituent groups, namely -OH, -OCH 3 and -SO 3 H, respectively, these substituent functional groups had a major contribution to the lipophilicity and acute toxicity of these BPs. Similar tendency was observed for the genotoxicity, expressed as the value of induction ratio=1.5. Moreover, all the target BPs UV filters showed estrogenic activity, but no significant influences of lipophilicity on the estrogenicity were observed, with BP3 having the weakest estrogenic efficiency in vitro. Although BP3 displayed no noticeable adverse effects in any in vitro assays, multiple hormonal activities were observed in zebrafish larvae including estrogenicity, anti-estrogenicity and anti-androgenicity by regulating the expression of target genes. The results indicated potential hazardous effects of BPs UV filters and the importance of the combination of toxicological evaluation methods including in vitro and in vivo assays. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Predicting changes in cardiac myocyte contractility during early drug discovery with in vitro assays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morton, M.J., E-mail: michael.morton@astrazeneca.com; Armstrong, D.; Abi Gerges, N.

    2014-09-01

    Cardiovascular-related adverse drug effects are a major concern for the pharmaceutical industry. Activity of an investigational drug at the L-type calcium channel could manifest in a number of ways, including changes in cardiac contractility. The aim of this study was to define which of the two assay technologies – radioligand-binding or automated electrophysiology – was most predictive of contractility effects in an in vitro myocyte contractility assay. The activity of reference and proprietary compounds at the L-type calcium channel was measured by radioligand-binding assays, conventional patch-clamp, automated electrophysiology, and by measurement of contractility in canine isolated cardiac myocytes. Activity inmore » the radioligand-binding assay at the L-type Ca channel phenylalkylamine binding site was most predictive of an inotropic effect in the canine cardiac myocyte assay. The sensitivity was 73%, specificity 83% and predictivity 78%. The radioligand-binding assay may be run at a single test concentration and potency estimated. The least predictive assay was automated electrophysiology which showed a significant bias when compared with other assay formats. Given the importance of the L-type calcium channel, not just in cardiac function, but also in other organ systems, a screening strategy emerges whereby single concentration ligand-binding can be performed early in the discovery process with sufficient predictivity, throughput and turnaround time to influence chemical design and address a significant safety-related liability, at relatively low cost. - Highlights: • The L-type calcium channel is a significant safety liability during drug discovery. • Radioligand-binding to the L-type calcium channel can be measured in vitro. • The assay can be run at a single test concentration as part of a screening cascade. • This measurement is highly predictive of changes in cardiac myocyte contractility.« less

  10. Synthesis and characterization of time-resolved fluorescence probes for evaluation of competitive binding to melanocortin receptors.

    PubMed

    Alleti, Ramesh; Vagner, Josef; Dehigaspitiya, Dilani Chathurika; Moberg, Valerie E; Elshan, N G R D; Tafreshi, Narges K; Brabez, Nabila; Weber, Craig S; Lynch, Ronald M; Hruby, Victor J; Gillies, Robert J; Morse, David L; Mash, Eugene A

    2013-09-01

    Probes for use in time-resolved fluorescence competitive binding assays at melanocortin receptors based on the parental ligands MSH(4), MSH(7), and NDP-α-MSH were prepared by solid phase synthesis methods, purified, and characterized. The saturation binding of these probes was studied using HEK-293 cells engineered to overexpress the human melanocortin 4 receptor (hMC4R) as well as the human cholecystokinin 2 receptor (hCCK2R). The ratios of non-specific binding to total binding approached unity at high concentrations for each probe. At low probe concentrations, receptor-mediated binding and uptake was discernable, and so probe concentrations were kept as low as possible in determining Kd values. The Eu-DTPA-PEGO-MSH(4) probe exhibited low specific binding relative to non-specific binding, even at low nanomolar concentrations, and was deemed unsuitable for use in competition binding assays. The Eu-DTPA-PEGO probes based on MSH(7) and NDP-α-MSH exhibited Kd values of 27±3.9nM and 4.2±0.48nM, respectively, for binding with hMC4R. These probes were employed in competitive binding assays to characterize the interactions of hMC4R with monovalent and divalent MSH(4), MSH(7), and NDP-α-MSH constructs derived from squalene. Results from assays with both probes reflected only statistical enhancements, suggesting improper ligand spacing on the squalene scaffold for the divalent constructs. The Ki values from competitive binding assays that employed the MSH(7)-based probe were generally lower than the Ki values obtained when the probe based on NDP-α-MSH was employed, which is consistent with the greater potency of the latter probe. The probe based on MSH(7) was also competed with monovalent, divalent, and trivalent MSH(4) constructs that previously demonstrated multivalent binding in competitive binding assays against a variant of the probe based on NDP-α-MSH. Results from these assays confirm multivalent binding, but suggest a more modest increase in avidity for these MSH(4) constructs than was previously reported. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Filter and method of fabricating

    DOEpatents

    Janney, Mark A.

    2006-02-14

    A method of making a filter includes the steps of: providing a substrate having a porous surface; applying to the porous surface a coating of dry powder comprising particles to form a filter preform; and heating the filter preform to bind the substrate and the particles together to form a filter.

  12. Conversion of a Capture ELISA to a Luminex xMAP Assay using a Multiplex Antibody Screening Method

    PubMed Central

    Baker, Harold N.; Murphy, Robin; Lopez, Erica; Garcia, Carlos

    2012-01-01

    The enzyme-linked immunosorbent assay (ELISA) has long been the primary tool for detection of analytes of interest in biological samples for both life science research and clinical diagnostics. However, ELISA has limitations. It is typically performed in a 96-well microplate, and the wells are coated with capture antibody, requiring a relatively large amount of sample to capture an antigen of interest . The large surface area of the wells and the hydrophobic binding of capture antibody can also lead to non-specific binding and increased background. Additionally, most ELISAs rely upon enzyme-mediated amplification of signal in order to achieve reasonable sensitivity. Such amplification is not always linear and can thus skew results. In the past 15 years, a new technology has emerged that offers the benefits of the ELISA, but also enables higher throughput, increased flexibility, reduced sample volume, and lower cost, with a similar workflow 1, 2. Luminex xMAP Technology is a microsphere (bead) array platform enabling both monoplex and multiplex assays that can be applied to both protein and nucleic acid applications 3-5. The beads have the capture antibody covalently immobilized on a smaller surface area, requiring less capture antibody and smaller sample volumes, compared to ELISA, and non-specific binding is significantly reduced. Smaller sample volumes are important when working with limiting samples such as cerebrospinal fluid, synovial fluid, etc. 6. Multiplexing the assay further reduces sample volume requirements, enabling multiple results from a single sample. Recent improvements by Luminex include: the new MAGPIX system, a smaller, less expensive, easier-to-use analyzer; Low-Concentration Magnetic MagPlex Microspheres which eliminate the need for expensive filter plates and come in a working concentration better suited for assay development and low-throughput applications; and the xMAP Antibody Coupling (AbC) Kit, which includes a protocol, reagents, and consumables necessary for coupling beads to the capture antibody of interest. (See Materials section for a detailed list of kit contents.) In this experiment, we convert a pre-optimized ELISA assay for TNF-alpha cytokine to the xMAP platform and compare the performance of the two methods 7-11. TNF-alpha is a biomarker used in the measurement of inflammatory responses in patients with autoimmune disorders. We begin by coupling four candidate capture antibodies to four different microsphere sets or regions. When mixed together, these four sets allow for the simultaneous testing of all four candidates with four separate detection antibodies to determine the best antibody pair, saving reagents, sample and time. Two xMAP assays are then constructed with the two most optimal antibody pairs and their performance is compared to that of the original ELISA assay in regards to signal strength, dynamic range, and sensitivity. PMID:22806215

  13. Competition-based cellular peptide binding assays for 13 prevalent HLA class I alleles using fluorescein-labeled synthetic peptides.

    PubMed

    Kessler, Jan H; Mommaas, Bregje; Mutis, Tuna; Huijbers, Ivo; Vissers, Debby; Benckhuijsen, Willemien E; Schreuder, Geziena M Th; Offringa, Rienk; Goulmy, Els; Melief, Cornelis J M; van der Burg, Sjoerd H; Drijfhout, Jan W

    2003-02-01

    We report the development, validation, and application of competition-based peptide binding assays for 13 prevalent human leukocyte antigen (HLA) class I alleles. The assays are based on peptide binding to HLA molecules on living cells carrying the particular allele. Competition for binding between the test peptide of interest and a fluorescein-labeled HLA class I binding peptide is used as read out. The use of cell membrane-bound HLA class I molecules circumvents the need for laborious biochemical purification of these molecules in soluble form. Previously, we have applied this principle for HLA-A2 and HLA-A3. We now describe the assays for HLA-A1, HLA-A11, HLA-A24, HLA-A68, HLA-B7, HLA-B8, HLA-B14, HLA-B35, HLA-B60, HLA-B61, and HLA-B62. Together with HLA-A2 and HLA-A3, these alleles cover more than 95% of the Caucasian population. Several allele-specific parameters were determined for each assay. Using these assays, we identified novel HLA class I high-affinity binding peptides from HIVpol, p53, PRAME, and minor histocompatibility antigen HA-1. Thus these convenient and accurate peptide-binding assays will be useful for the identification of putative cytotoxic T lymphocyte epitopes presented on a diverse array of HLA class I molecules.

  14. Quantitatively and Kinetically Identifying Binding Motifs of Amelogenin Proteins to Mineral Crystals Through Biochemical and Spectroscopic Assays

    PubMed Central

    Zhu, Li; Hwang, Peter; Witkowska, H. Ewa; Liu, Haichuan; Li, Wu

    2014-01-01

    Tooth enamel is the hardest tissue in vertebrate animals. Consisting of millions of carbonated hydroxyapatite crystals, this highly mineralized tissue develops from a protein matrix in which amelogenin is the predominant component. The enamel matrix proteins are eventually and completely degraded and removed by proteinases to form mineral-enriched tooth enamel. Identification of the apatite-binding motifs in amelogenin is critical for understanding the amelogenin–crystal interactions and amelogenin–proteinases interactions during tooth enamel biomineralization. A stepwise strategy is introduced to kinetically and quantitatively identify the crystal-binding motifs in amelogenin, including a peptide screening assay, a competitive adsorption assay, and a kinetic-binding assay using amelogenin and gene-engineered amelogenin mutants. A modified enzyme-linked immunosorbent assay on crystal surfaces is also applied to compare binding amounts of amelogenin and its mutants on different planes of apatite crystals. We describe the detailed protocols for these assays and provide the considerations for these experiments in this chapter. PMID:24188774

  15. Localization and characterization of the calsequestrin-binding domain of triadin 1. Evidence for a charged beta-strand in mediating the protein-protein interaction.

    PubMed

    Kobayashi, Y M; Alseikhan, B A; Jones, L R

    2000-06-09

    Triadin is an integral membrane protein of the junctional sarcoplasmic reticulum that binds to the high capacity Ca(2+)-binding protein calsequestrin and anchors it to the ryanodine receptor. The lumenal domain of triadin contains multiple repeats of alternating lysine and glutamic acid residues, which have been defined as KEKE motifs and have been proposed to promote protein associations. Here we identified the specific residues of triadin responsible for binding to calsequestrin by mutational analysis of triadin 1, the major cardiac isoform. A series of deletional fusion proteins of triadin 1 was generated, and by using metabolically labeled calsequestrin in filter-overlay assays, the calsequestrin-binding domain of triadin 1 was localized to a single KEKE motif comprised of 25 amino acids. Alanine mutagenesis within this motif demonstrated that the critical amino acids of triadin binding to calsequestrin are the even-numbered residues Lys(210), Lys(212), Glu(214), Lys(216), Gly(218), Gln(220), Lys(222), and Lys(224). Replacement of the odd-numbered residues within this motif by alanine had no effect on calsequestrin binding to triadin. The results suggest a model in which residues 210-224 of triadin form a beta-strand, with the even-numbered residues in the strand interacting with charged residues of calsequestrin, stabilizing a "polar zipper" that links the two proteins together. This small, highly charged beta-strand of triadin may tether calsequestrin to the junctional face membrane, allowing calsequestrin to sequester Ca(2+) in the vicinity of the ryanodine receptor during Ca(2+) uptake and Ca(2+) release.

  16. Interaction of Berberine derivative with protein POT1 affect telomere function in cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, Nannan; Chen, Siqi; Ma, Yan

    Highlights: Black-Right-Pointing-Pointer The protein POT1 plays an important role in telomere protection. Black-Right-Pointing-Pointer Functional POT1 was overexpressed in Escherichia coli for the first time, and purified. Black-Right-Pointing-Pointer Compound Sysu-00692 was found to be the first POT1-binding ligand. Black-Right-Pointing-Pointer Sysu-00692 could interfere with the binding activity of POT1 in vivo. Black-Right-Pointing-Pointer Sysu-00692 had inhibition on telomerase and cell proliferation. -- Abstract: The protein POT1 plays an important role in telomere protection, which is related with telomere elongation and cell immortality. The protein has been recognized as a promising drug target for cancer treatment. In the present study, we cloned, overexpressed inmore » Escherichia coli for the first time, and purified recombinant human POT1. The protein was proved to be active through filter binding assay, FRET and CD experiments. In the initial screening for protein binding ligands using SPR, compound Sysu-00692 was found to bind well with the POT1, which was confirmed with EMSA. Its in vivo activity study showed that compound Sysu-00692 could interfere with the binding between human POT1 and the telomeric DNA through chromatin immunoprecipitation. Besides, the compound showed mild inhibition on telomerase and cell proliferation. As we know, compound Sysu-00692 is the first reported POT1-binding ligand, which could serve as a lead compound for further improvement. This work offered a potentially new approach for drug design for the treatment of cancers.« less

  17. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  18. Avoiding false positives and optimizing identification of true ...

    EPA Pesticide Factsheets

    The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented from screening 94 chemicals from 54 chemical groups for estrogen receptor (ER) activation in a competitive rainbow trout ER (rtER) binding assay and a trout liver slice vitellogenin mRNA expression assay. Results from true competitive agonists and antagonists, and inactive chemicals with little or no indication of ER binding or gene activation were easily interpreted. However, results for numerous industrial chemicals were more challenging to interpret, including chemicals with: (1) apparent competitive binding curves but no gene activation, (2) apparent binding and gene inhibition with evidence of either cytotoxicity or changes in assay media pH, (3) apparent binding but non-competitive gene inhibition of unknown cause, or (4) no rtER binding and gene inhibition not due to competitive ER interaction but due to toxicity, pH change, or some unknown cause. The use of endpoints such as toxicity, pH, precipitate formation, and determination of inhibitor dissociation constants (Ki) for interpreting the results of antagonism and binding assays for diverse chemicals is presented. Of the 94 chemicals tested for antagonism only two, tamoxifen and ICI-182,780, were found to be true competitive

  19. A novel BRET-based binding assay for interaction studies of relaxin family peptide receptor 3 with its ligands.

    PubMed

    Wang, Jia-Hui; Shao, Xiao-Xia; Hu, Meng-Jun; Wei, Dian; Liu, Ya-Li; Xu, Zeng-Guang; Guo, Zhan-Yun

    2017-05-01

    Relaxin family peptide receptor 3 (RXFP3) is an A-class G protein-coupled receptor that is implicated in the regulation of food intake and stress response upon activation by its cognate agonist relaxin-3. To study its interaction with various ligands, we developed a novel bioluminescence resonance energy transfer (BRET)-based binding assay using the brightest NanoLuc as an energy donor and a newly developed cyan-excitable orange fluorescent protein (CyOFP) as an energy acceptor. An engineered CyOFP without intrinsic cysteine residues but with an introduced cysteine at the C-terminus was overexpressed in Escherichia coli and chemically conjugated to the A-chain N-terminus of an easily labeled chimeric R3/I5 peptide via an intermolecular disulfide linkage. After the CyOFP-conjugated R3/I5 bound to a shortened human RXFP3 (removal of 33 N-terminal residues) fused with the NanoLuc reporter at the N-terminus, high BRET signals were detected. Saturation binding and real-time binding assays demonstrated that this BRET pair retained high binding affinity with fast association/dissociation. Using this BRET pair, binding potencies of various ligands with RXFP3 were conveniently measured through competition binding assays. Thus, the novel BRET-based binding assay facilitates interaction studies of RXFP3 with various ligands. The engineered CyOFP without intrinsic cysteine residues may also be applied to other BRET-based binding assays in future studies.

  20. Development of a Surface Plasmon Resonance Assay for the Characterization of Small-Molecule Binding Kinetics and Mechanism of Binding to Kynurenine 3-Monooxygenase.

    PubMed

    Poda, Suresh B; Kobayashi, Masakazu; Nachane, Ruta; Menon, Veena; Gandhi, Adarsh S; Budac, David P; Li, Guiying; Campbell, Brian M; Tagmose, Lena

    2015-10-01

    Kynurenine 3-monooxygenase (KMO), a pivotal enzyme in the kynurenine pathway, was identified as a potential therapeutic target for treating neurodegenerative and psychiatric disorders. In this article, we describe a surface plasmon resonance (SPR) assay that delivers both kinetics and the mechanism of binding (MoB) data, enabling a detailed characterization of KMO inhibitors for the enzyme in real time. SPR assay development included optimization of the protein construct and the buffer conditions. The stability and inhibitor binding activity of the immobilized KMO were significantly improved when the experiments were performed at 10°C using a buffer containing 0.05% n-dodecyl-β-d-maltoside (DDM) as the detergent. The KD values of the known KMO inhibitors (UPF648 and RO61-8048) from the SPR assay were in good accordance with the biochemical LC/MS/MS assay. Also, the SPR assay was able to differentiate the binding kinetics (k(a) and k(d)) of the selected unknown KMO inhibitors. For example, the inhibitors that showed comparable IC50 values in the LC/MS/MS assay displayed differences in their residence time (τ = 1/k(d)) in the SPR assay. To better define the MoB of the inhibitors to KMO, an SPR-based competition assay was developed, which demonstrated that both UPF648 and RO61-8048 bound to the substrate-binding site. These results demonstrate the potential of the SPR assay for characterizing the affinity, the kinetics, and the MoB profiles of the KMO inhibitors.

  1. Method And Apparatus For Detecting Chemical Binding

    DOEpatents

    Warner, Benjamin P.; Havrilla, George J.; Miller, Thomasin C.; Wells, Cyndi A.

    2005-02-22

    The method for screening binding between a target binder and potential pharmaceutical chemicals involves sending a solution (preferably an aqueous solution) of the target binder through a conduit to a size exclusion filter, the target binder being too large to pass through the size exclusion filter, and then sending a solution of one or more potential pharmaceutical chemicals (preferably an aqueous solution) through the same conduit to the size exclusion filter after target binder has collected on the filter. The potential pharmaceutical chemicals are small enough to pass through the filter. Afterwards, x-rays are sent from an x-ray source to the size exclusion filter, and if the potential pharmaceutical chemicals form a complex with the target binder, the complex produces an x-ray fluorescence signal having an intensity that indicates that a complex has formed.

  2. Method and apparatus for detecting chemical binding

    DOEpatents

    Warner, Benjamin P [Los Alamos, NM; Havrilla, George J [Los Alamos, NM; Miller, Thomasin C [Los Alamos, NM; Wells, Cyndi A [Los Alamos, NM

    2007-07-10

    The method for screening binding between a target binder and potential pharmaceutical chemicals involves sending a solution (preferably an aqueous solution) of the target binder through a conduit to a size exclusion filter, the target binder being too large to pass through the size exclusion filter, and then sending a solution of one or more potential pharmaceutical chemicals (preferably an aqueous solution) through the same conduit to the size exclusion filter after target binder has collected on the filter. The potential pharmaceutical chemicals are small enough to pass through the filter. Afterwards, x-rays are sent from an x-ray source to the size exclusion filter, and if the potential pharmaceutical chemicals form a complex with the target binder, the complex produces an x-ray fluorescence signal having an intensity that indicates that a complex has formed.

  3. Insecticidal and insect-repellent activities of essential oils from Verbenaceae and Anacardiaceae against Rhizopertha dominica.

    PubMed

    Benzi, Verónica S; Murrayb, Ana P; Ferrero, Adriana A

    2009-09-01

    Essential oils extracted from leaves of Aloysia polystachya and A. citriodora (Verbenaceae) and from leaves and fruits of Schinus molle var. areira (Anacardiaceae) were tested for their repellent and toxic activities against adults of Rhizopertha dominica (Coleoptera: Bostrichidae). Topical application and filter paper assays were employed for contact toxicity studies; filter paper impregnation was also used for fumigant and repellent assays. In topical tests A. polystachya was as effective as S. molle leaves. In the case of repellent assays, A. citriodora was the most effective oil based on the class scale. A. polystachya was the most toxic plant on contact toxicity by filter paper assay (LC50 26.6 mg/cm2). Fumigant toxicity was only evaluated with fruits and leaves of S. molle, and no significant differences were found between them. Published data are included to compare the fumigant toxicity of S. molle with that of A. citridora and A. polystachya.

  4. Evaluation of potential endocrine activity of 2,4-dichlorophenoxyacetic acid using in vitro assays.

    PubMed

    Coady, Katherine K; Kan, H Lynn; Schisler, Melissa R; Gollapudi, B Bhaskar; Neal, Barbara; Williams, Amy; LeBaron, Matthew J

    2014-08-01

    The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) was evaluated in five in vitro screening assays to assess the potential for interaction with the androgen, estrogen and steroidogenesis pathways in the endocrine system. The assays were conducted to meet the requirements of the in vitro component of Tier 1 of the United States Environmental Protection Agency's Endocrine Disruptor Screening Program (EDSP), and included assays for estrogen receptor (ER) binding (rat uterine cytosol ER binding assay), ER-mediated transcriptional activation (HeLa-9903-ERα transactivation assay), androgen receptor (AR) binding (rat prostate cytosol AR binding assay), aromatase enzymatic activity inhibition (recombinant human CYP19 aromatase inhibition assay), and interference with steroidogenesis (H295R steroidogenesis assay). Results from these five assays demonstrated that 2,4-D does not have the potential to interact in vitro with the estrogen, androgen, or steroidogenesis pathways. These in vitro data are consistent with a corresponding lack of endocrine effects observed in apical in vivo animal studies, and thus provide important supporting data valuable in a comprehensive weight of evidence evaluation indicating a low potential of 2,4-D to interact with the endocrine system. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. A novel bench-scale column assay to investigate site-specific nitrification biokinetics in biological rapid sand filters.

    PubMed

    Tatari, K; Smets, B F; Albrechtsen, H-J

    2013-10-15

    A bench-scale assay was developed to obtain site-specific nitrification biokinetic information from biological rapid sand filters employed in groundwater treatment. The experimental set-up uses granular material subsampled from a full-scale filter, packed in a column, and operated with controlled and continuous hydraulic and ammonium loading. Flowrates and flow recirculation around the column are chosen to mimic full-scale hydrodynamic conditions, and minimize axial gradients. A reference ammonium loading rate is calculated based on the average loading experienced in the active zone of the full-scale filter. Effluent concentrations of ammonium are analyzed when the bench-scale column is subject to reference loading, from which removal rates are calculated. Subsequently, removal rates above the reference loading are measured by imposing short-term loading variations. A critical loading rate corresponding to the maximum removal rate can be inferred. The assay was successfully applied to characterize biokinetic behavior from a test rapid sand filter; removal rates at reference loading matched those observed from full-scale observations, while a maximum removal capacity of 6.9 g NH4(+)-N/m(3) packed sand/h could easily be determined at 7.5 g NH4(+)-N/m(3) packed sand/h. This assay, with conditions reflecting full-scale observations, and where the biological activity is subject to minimal physical disturbance, provides a simple and fast, yet powerful tool to gain insight in nitrification kinetics in rapid sand filters. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Application of the novel bioluminescent ligand-receptor binding assay to relaxin-RXFP1 system for interaction studies.

    PubMed

    Wu, Qing-Ping; Zhang, Lei; Shao, Xiao-Xia; Wang, Jia-Hui; Gao, Yu; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun

    2016-04-01

    Relaxin is a prototype of the relaxin family peptide hormones and plays important biological functions by binding and activating the G protein-coupled receptor RXFP1. To study their interactions, in the present work, we applied the newly developed bioluminescent ligand-receptor binding assay to the relaxin-RXFP1 system. First, a fully active easily labeled relaxin, in which three Lys residues of human relaxin-2 were replaced by Arg, was prepared through overexpression of a single-chain precursor in Pichia pastoris and in vitro enzymatic maturation. Thereafter, the B-chain N-terminus of the easily labeled relaxin was chemically cross-linked with a C-terminal cysteine residue of an engineered NanoLuc through a disulfide linkage. Receptor-binding assays demonstrated that the NanoLuc-conjugated relaxin retained high binding affinity with the receptor RXFP1 (K d = 1.11 ± 0.08 nM, n = 3) and was able to sensitively monitor binding of a variety of ligands with RXFP1. Using the novel bioluminescent binding assay, we demonstrated that three highly conserved B-chain Arg residues of relaxin-3 had distinct contributions to binding of the receptor RXFP1. In summary, our present work provides a novel bioluminescent ligand-receptor binding assay for the relaxin-RXFP1 system to facilitate their interaction studies, such as characterization of relaxin analogues or screening novel agonists or antagonists of RXFP1.

  7. Water washable stainless steel HEPA filter

    DOEpatents

    Phillips, Terrance D.

    2001-01-01

    The invention is a high efficiency particulate (HEPA) filter apparatus and system, and method for assaying particulates. The HEPA filter provides for capture of 99.99% or greater of particulates from a gas stream, with collection of particulates on the surface of the filter media. The invention provides a filter system that can be cleaned and regenerated in situ.

  8. HPV binding assay to Laminin-332/integrin α6β4 on human keratinocytes.

    PubMed

    Brendle, Sarah A; Christensen, Neil D

    2015-01-01

    Human papillomaviruses (HPVs) have been shown to bind to Laminin-332 (Ln-332) on the extracellular matrix (ECM) secreted by human keratinocytes. The assay described here is an important tool to study HPV receptor binding to the ECM. The assay can also be modified to study the receptors required for HPV infection and for binding to tissues. We previously showed that Ln-332 is essential for the binding of HPV11 to human keratinocytes and that infectious entry of HPV11 requires α6β4 integrin for the transfer of HPV11 from ECM to host cells (Culp et al., J Virol 80:8940-8950, 2006). We also demonstrated that several of the high-risk HPV types (16, 18, 31 and 45) bind to Ln-332 and/or other components of the ECM in vitro (Broutian et al., J Gen Virol 91:531-540, 2010). The exact binding and internalization mechanism(s) for HPV are still under investigation. A better understanding of these mechanisms will aid in the design of therapeutics against HPVs and ultimately help prevent many cancers. In this chapter, we describe the HPV binding assay to Ln-332/integrin α6β4 on human keratinocytes (ECM). We also present data and suggestions for modifying the assay for testing the specificity of HPV for receptors (by blocking receptors) and binding to human tissues (basement membrane, BM) in order to study binding mechanisms.

  9. A novel assay to identify the trafficking proteins that bind to specific vesicle populations

    PubMed Central

    Bentley, Marvin; Banker, Gary

    2016-01-01

    Here we describe a method capable of identifying interactions between candidate trafficking proteins and a defined vesicle population in intact cells. The assay involves the expression of an FKBP12-rapamycin–binding domain (FRB)–tagged candidate vesicle-binding protein that can be inducibly linked to an FKBP-tagged molecular motor. If the FRB-tagged candidate protein binds the labeled vesicles, then linking the FRB and FKBP domains recruits motors to the vesicles and causes a predictable, highly distinctive change in vesicle trafficking. We describe two versions of the assay: a general protocol for use in cells with a typical microtubule-organizing center and a specialized protocol designed to detect protein-vesicle interactions in cultured neurons. We have successfully used this assay to identify kinesins and Rabs that bind to a variety of different vesicle populations. In principle, this assay could be used to investigate interactions between any category of vesicle trafficking proteins and any vesicle population that can be specifically labeled. PMID:26621371

  10. Discovery of novel dual inhibitors against Mdm2 and Mdmx proteins by in silico approaches and binding assay.

    PubMed

    Golestanian, Sahand; Sharifi, Amirhossein; Popowicz, Grzegorz M; Azizian, Homa; Foroumadi, Alireza; Szwagierczak, Aleksandra; Holak, Tad A; Amanlou, Massoud

    2016-01-15

    The p53 protein, also called guardian of the genome, has a key role in cell cycle regulation. It is activated under stressful circumstances, such as DNA damage which results in permanent arrest or cell death. The protein is disabled in several types of human cancer due to over-expression of the two regulators, Mdm2 and Mdmx. As a result, inhibiting Mdm subtypes could reactivate p53 and bring about a promising therapeutic strategy in cancers. Here a structure-based pharmacophore search and docking simulation are presented in order to filter our in-house library which contains 1035 compounds to find novel scaffolds that inhibit Mdm2 and Mdmx concomitantly. Afterwards, fluorescence polarization binding assay was used to obtain inhibition constant of final compounds. Thirty two ligands were introduced to bioassay as a result of in-silico methods. Twelve of them inhibit both proteins with almost balanced Ki value ranging from 18 to 162μM for Mdm2 and 18 to 233μM for Mdmx. It was observed that all compounds fill Phe19 and Trp23 pockets of Mdm2/x binding sites and form a hydrogen bond with Trp23 pocket's neighbor amino acids in a manner similar to p53 protein. Additionally, it was concluded that Trp23 pocket of Mdmx has a bigger hydrophobic volume comparing with the one of Mdm2. Three structure-activity relationship patterns are supposed which one of them presents usefulness features and can be used in future studies. This study presents first qualitative SAR for dual inhibitors against Mdm2/x. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Interactions of trace metals with hydrogels and filter membranes used in DET and DGT techniques.

    PubMed

    Garmo, Oyvind A; Davison, William; Zhang, Hao

    2008-08-01

    Equilibrium partitioning of trace metals between bulk solution and hydrogels/filter was studied. Under some conditions, trace metal concentrations were higher in the hydrogels or filter membranes compared to bulk solution (enrichment). In synthetic soft water, enrichment of cationic trace metals in polyacrylamide hydrogels decreased with increasing trace metal concentration. Enrichment was little affected by Ca and Mg in the concentration range typically encountered in natural freshwaters, indicating high affinity but low capacity binding of trace metals to solid structure in polyacrylamide gels. The apparent binding strength decreased in the sequence: Cu > Pb > Ni approximately to Cd approximately to Co and a low concentration of cationic Cu eliminated enrichment of weakly binding trace metal cations. The polyacrylamide gels also had an affinity for fulvic acid and/or its trace metal complexes. Enrichment of cationic Cd in agarose gel and hydrophilic polyethersulfone filter was independent of concentration (10 nM to 5 microM) but decreased with increasing Ca/ Mg concentration and ionic strength, suggesting that it is mainly due to electrostatic interactions. However, Cu and Pb were enriched even after equilibration in seawater, indicating that these metals additionally bind to sites within the agarose gel and filter. Compared to the polyacrylamide gels, agarose gel had a lower affinity for metal-fulvic complexes. Potential biases in measurements made with the diffusive equilibration in thin-films (DET) technique, identified by this work, are discussed.

  12. Nonlinear spatio-temporal filtering of dynamic PET data using a four-dimensional Gaussian filter and expectation-maximization deconvolution

    NASA Astrophysics Data System (ADS)

    Floberg, J. M.; Holden, J. E.

    2013-02-01

    We introduce a method for denoising dynamic PET data, spatio-temporal expectation-maximization (STEM) filtering, that combines four-dimensional Gaussian filtering with EM deconvolution. The initial Gaussian filter suppresses noise at a broad range of spatial and temporal frequencies and EM deconvolution quickly restores the frequencies most important to the signal. We aim to demonstrate that STEM filtering can improve variance in both individual time frames and in parametric images without introducing significant bias. We evaluate STEM filtering with a dynamic phantom study, and with simulated and human dynamic PET studies of a tracer with reversible binding behaviour, [C-11]raclopride, and a tracer with irreversible binding behaviour, [F-18]FDOPA. STEM filtering is compared to a number of established three and four-dimensional denoising methods. STEM filtering provides substantial improvements in variance in both individual time frames and in parametric images generated with a number of kinetic analysis techniques while introducing little bias. STEM filtering does bias early frames, but this does not affect quantitative parameter estimates. STEM filtering is shown to be superior to the other simple denoising methods studied. STEM filtering is a simple and effective denoising method that could be valuable for a wide range of dynamic PET applications.

  13. Lectin binding assays for in-process monitoring of sialylation in protein production.

    PubMed

    Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong

    2010-07-01

    Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.

  14. Dye-binding assays for evaluation of the effects of small molecule inhibitors on amyloid (aβ) self-assembly.

    PubMed

    Jameson, Laramie P; Smith, Nicholas W; Dzyuba, Sergei V

    2012-11-21

    Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors' potential toward Aβ peptides, species involved in Alzheimer's disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays.

  15. Dye-Binding Assays for Evaluation of the Effects of Small Molecule Inhibitors on Amyloid (Aβ) Self-Assembly

    PubMed Central

    2012-01-01

    Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors’ potential toward Aβ peptides, species involved in Alzheimer’s disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays. PMID:23173064

  16. Flow cytometer measurement of binding assays

    DOEpatents

    Saunders, George C.

    1987-01-01

    A method of measuring the result of a binding assay that does not require separation of fluorescent smaller particles is disclosed. In a competitive binding assay the smaller fluorescent particles coated with antigen compete with antigen in the sample being analyzed for available binding sites on larger particles. In a sandwich assay, the smaller, fluorescent spheres coated with antibody attach themselves to molecules containing antigen that are attached to larger spheres coated with the same antibody. The separation of unattached, fluorescent smaller particles is made unnecessary by only counting the fluorescent events triggered by the laser of a flow cytometer when the event is caused by a particle with a light scatter measurement within a certain range corresponding to the presence of larger particles.

  17. Biotunable Nanoplasmonic Filter on Few-Layer MoS2 for Rapid and Highly Sensitive Cytokine Optoelectronic Immunosensing.

    PubMed

    Park, Younggeun; Ryu, Byunghoon; Oh, Bo-Ram; Song, Yujing; Liang, Xiaogan; Kurabayashi, Katsuo

    2017-06-27

    Monitoring of the time-varying immune status of a diseased host often requires rapid and sensitive detection of cytokines. Metallic nanoparticle-based localized surface plasmon resonance (LSPR) biosensors hold promise to meet this clinical need by permitting label-free detection of target biomolecules. These biosensors, however, continue to suffer from relatively low sensitivity as compared to conventional immunoassay methods that involve labeling processes. Their response speeds also need to be further improved to enable rapid cytokine quantification for critical care in a timely manner. In this paper, we report an immunobiosensing device integrating a biotunable nanoplasmonic optical filter and a highly sensitive few-layer molybdenum disulfide (MoS 2 ) photoconductive component, which can serve as a generic device platform to meet the need of rapid cytokine detection with high sensitivity. The nanoplasmonic filter consists of anticytokine antibody-conjugated gold nanoparticles on a SiO 2 thin layer that is placed 170 μm above a few-layer MoS 2 photoconductive flake device. The principle of the biosensor operation is based on tuning the delivery of incident light to the few-layer MoS 2 photoconductive flake thorough the nanoplasmonic filter by means of biomolecular surface binding-induced LSPR shifts. The tuning is dependent on cytokine concentration on the nanoplasmonic filter and optoelectronically detected by the few-layer MoS 2 device. Using the developed optoelectronic biosensor, we have demonstrated label-free detection of IL-1β, a pro-inflammatory cytokine, with a detection limit as low as 250 fg/mL (14 fM), a large dynamic range of 10 6 , and a short assay time of 10 min. The presented biosensing approach could be further developed and generalized for point-of-care diagnosis, wearable bio/chemical sensing, and environmental monitoring.

  18. A High-Throughput TNP-ATP Displacement Assay for Screening Inhibitors of ATP-Binding in Bacterial Histidine Kinases

    PubMed Central

    Guarnieri, Michael T.; Blagg, Brian S. J.

    2011-01-01

    Abstract Bacterial histidine kinases (HK) are members of the GHKL superfamily, which share a unique adenosine triphosphate (ATP)-binding Bergerat fold. Our previous studies have shown that Gyrase, Hsp90, MutL (GHL) inhibitors bind to the ATP-binding pocket of HK and may provide lead compounds for the design of novel antibiotics targeting these kinases. In this article, we developed a competition assay using the fluorescent ATP analog, 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate. The method can be used for high-throughput screening of compound libraries targeting HKs or other ATP-binding proteins. We utilized the assay to screen a library of GHL inhibitors targeting the bacterial HK PhoQ, and discuss the applications of the 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate competition assay beyond GHKL inhibitor screening. PMID:21050069

  19. Concerted application of LC-MS and ligand binding assays to better understand exposure of a large molecule drug.

    PubMed

    Xu, Weifeng; Jiang, Hao; Titsch, Craig; Gadkari, Snaehal; Batog, Alicja; Wang, Bonnie; Hippeli, Lauren; Yamamoto, Brent; Chadwick, Kristina; Wheeler, Jennifer; Thompson, Chris; Stahl, James; Willett, Scott; DeSilva, Binodh S; Myler, Heather; Dodge, Robert W; Pillutla, Renuka C

    2018-06-20

    A ligand-binding assay (LBA) was used to measure exposure of PRM-151, the recombinant form of human pentraxin-2 (PTX-2), a complex pentamer with multiple binding partners. However, the assay showed a lack of dose-dependent exposure in select preclinical species and it could not differentiate the infused PRM-151 from the endogenous PTX-2 in nonhuman primates. Instead of assessing interference from its multiple binding partners, which could be time consuming and laborious, a LC-MS assay avoid of these interference was implemented to measure 'total' drug without the use of immunoaffinity capture reagents. The resultant LC-MS data confirmed the original data and the lack of dose-dependent exposure is now understood to be due to the multiple and diverse targets and functions and resultant complex biodistribution rather than an assay artifact.

  20. Evaluation of OASIS QSAR Models Using ToxCast™ in Vitro Estrogen and Androgen Receptor Binding Data and Application in an Integrated Endocrine Screening Approach

    PubMed Central

    Bhhatarai, Barun; Wilson, Daniel M.; Price, Paul S.; Marty, Sue; Parks, Amanda K.; Carney, Edward

    2016-01-01

    Background: Integrative testing strategies (ITSs) for potential endocrine activity can use tiered in silico and in vitro models. Each component of an ITS should be thoroughly assessed. Objectives: We used the data from three in vitro ToxCast™ binding assays to assess OASIS, a quantitative structure-activity relationship (QSAR) platform covering both estrogen receptor (ER) and androgen receptor (AR) binding. For stronger binders (described here as AC50 < 1 μM), we also examined the relationship of QSAR predictions of ER or AR binding to the results from 18 ER and 10 AR transactivation assays, 72 ER-binding reference compounds, and the in vivo uterotrophic assay. Methods: NovaScreen binding assay data for ER (human, bovine, and mouse) and AR (human, chimpanzee, and rat) were used to assess the sensitivity, specificity, concordance, and applicability domain of two OASIS QSAR models. The binding strength relative to the QSAR-predicted binding strength was examined for the ER data. The relationship of QSAR predictions of binding to transactivation- and pathway-based assays, as well as to in vivo uterotrophic responses, was examined. Results: The QSAR models had both high sensitivity (> 75%) and specificity (> 86%) for ER as well as both high sensitivity (92–100%) and specificity (70–81%) for AR. For compounds within the domains of the ER and AR QSAR models that bound with AC50 < 1 μM, the QSAR models accurately predicted the binding for the parent compounds. The parent compounds were active in all transactivation assays where metabolism was incorporated and, except for those compounds known to require metabolism to manifest activity, all assay platforms where metabolism was not incorporated. Compounds in-domain and predicted to bind by the ER QSAR model that were positive in ToxCast™ ER binding at AC50 < 1 μM were active in the uterotrophic assay. Conclusions: We used the extensive ToxCast™ HTS binding data set to show that OASIS ER and AR QSAR models had high sensitivity and specificity when compounds were in-domain of the models. Based on this research, we recommend a tiered screening approach wherein a) QSAR is used to identify compounds in-domain of the ER or AR binding models and predicted to bind; b) those compounds are screened in vitro to assess binding potency; and c) the stronger binders (AC50 < 1 μM) are screened in vivo. This scheme prioritizes compounds for integrative testing and risk assessment. Importantly, compounds that are not in-domain, that are predicted either not to bind or to bind weakly, that are not active in in vitro, that require metabolism to manifest activity, or for which in vivo AR testing is in order, need to be assessed differently. Citation: Bhhatarai B, Wilson DM, Price PS, Marty S, Parks AK, Carney E. 2016. Evaluation of OASIS QSAR models using ToxCast™ in vitro estrogen and androgen receptor binding data and application in an integrated endocrine screening approach. Environ Health Perspect 124:1453–1461; http://dx.doi.org/10.1289/EHP184 PMID:27152837

  1. Residual gravimetric method to measure nebulizer output.

    PubMed

    Vecellio None, Laurent; Grimbert, Daniel; Bordenave, Joelle; Benoit, Guy; Furet, Yves; Fauroux, Brigitte; Boissinot, Eric; De Monte, Michele; Lemarié, Etienne; Diot, Patrice

    2004-01-01

    The aim of this study was to assess a residual gravimetric method based on weighing dry filters to measure the aerosol output of nebulizers. This residual gravimetric method was compared to assay methods based on spectrophotometric measurement of terbutaline (Bricanyl, Astra Zeneca, France), high-performance liquid chromatography (HPLC) measurement of tobramycin (Tobi, Chiron, U.S.A.), and electrochemical measurements of NaF (as defined by the European standard). Two breath-enhanced jet nebulizers, one standard jet nebulizer, and one ultrasonic nebulizer were tested. Output produced by the residual gravimetric method was calculated by weighing the filters both before and after aerosol collection and by filter drying corrected by the proportion of drug contained in total solute mass. Output produced by the electrochemical, spectrophotometric, and HPLC methods was determined after assaying the drug extraction filter. The results demonstrated a strong correlation between the residual gravimetric method (x axis) and assay methods (y axis) in terms of drug mass output (y = 1.00 x -0.02, r(2) = 0.99, n = 27). We conclude that a residual gravimetric method based on dry filters, when validated for a particular agent, is an accurate way of measuring aerosol output.

  2. Optical microwell assay of membrane transport kinetics.

    PubMed

    Kiskin, Nikolai I; Siebrasse, Jan P; Peters, Reiner

    2003-10-01

    In optical single transporter recording, membranes are firmly attached to flat solid substrates containing small wells or test compartments (TC). Transport of fluorescent molecules through TC-spanning membrane patches is induced by solution change and recorded by confocal microscopy. Previously, track-etched membrane filters were used to create solid substrates containing populations of randomly distributed TCs. In this study the possibilities offered by orderly TC arrays as created by laser microdrilling were explored. A theoretical framework was developed taking the convolution of membrane transport, solution change, and diffusion into account. The optical properties of orderly TC arrays were studied and the kinetics of solution change measured. Export and import through the nuclear pore complex (NPC) was analyzed in isolated envelopes of Xenopus oocyte nuclei. In accordance with previous reports nuclear transport receptor NTF2, which binds directly to NPC proteins, was found to be translocated much faster than "inert" molecules of similar size. Unexpectedly, NXT1, a homolog of NTF2 reportedly unable to bind to NPC proteins directly, was translocated as fast as NTF2. Thus, microstructured TC arrays were shown to provide optical single transporter recording with a new basis.

  3. A structure-based approach to ligand discovery for 2C-methyl-D-erythritol-2,4-cyclodiphosphate synthase: a target for antimicrobial therapy.

    PubMed

    Ramsden, Nicola L; Buetow, Lori; Dawson, Alice; Kemp, Lauris A; Ulaganathan, Venkatsubramanian; Brenk, Ruth; Klebe, Gerhard; Hunter, William N

    2009-04-23

    The nonmevalonate route to isoprenoid biosynthesis is essential in Gram-negative bacteria and apicomplexan parasites. The enzymes of this pathway are absent from mammals, contributing to their appeal as chemotherapeutic targets. One enzyme, 2C-methyl-d-erythritol-2,4-cyclodiphosphate synthase (IspF), has been validated as a target by genetic approaches in bacteria. Virtual screening against Escherichia coli IspF (EcIspF) was performed by combining a hierarchical filtering methodology with molecular docking. Docked compounds were inspected and 10 selected for experimental validation. A surface plasmon resonance assay was developed and two weak ligands identified. Crystal structures of EcIspF complexes were determined to support rational ligand development. Cytosine analogues and Zn(2+)-binding moieties were characterized. One of the putative Zn(2+)-binding compounds gave the lowest measured K(D) to date (1.92 +/- 0.18 muM). These data provide a framework for the development of IspF inhibitors to generate lead compounds of therapeutic potential against microbial pathogens.

  4. Glucocorticoid receptor ligand binding in monocytic cells using a microplate assay.

    PubMed

    Jansen, J; Uitdehaag, B; Koper, J W; van Den Berg, T K

    1999-01-01

    Glucocorticoids have profound effects on macrophage function and are widely used as anti-inflammatory drugs. Glucocorticoids receptor (GR) ligand binding capacity is a major determinant of cellular glucocorticoid sensitivity. The number and affinity of GR can be measured in a whole cell binding assay using (3)H-dexamethasone. Here, we describe a rapid and simple microplate assay for GR measurement using the human promonocytic cell line THP-1. Copyright 2000 S. Karger AG, Basel.

  5. MUTAGENICITY OF TEFLON-COATED GLASS FIBER FILTERS: A POTENTIAL PROBLEM AND SOLUTIONS

    EPA Science Inventory

    Teflon-coated glass fiber filters, used in studies of airborne particulate matter, were tested for mutagenic activity using the Salmonella/mammalian-microsome (Ames) assay. For each sample, eight blank filters were simultaneously extracted with dichloromethane (DCM), and the extr...

  6. Characterization of the Group A Streptococcus Mga Virulence Regulator Reveals a Role for the C-terminal Region in Oligomerization and Transcriptional Activation

    PubMed Central

    Hondorp, Elise R.; Hou, Sherry C.; Hempstead, Andrew D.; Hause, Lara L.; Beckett, Dorothy M.; McIver, Kevin S.

    2012-01-01

    The Group A Streptococcus (GAS) is a strict human pathogen that causes a broad spectrum of illnesses. One of the key regulators of virulence in GAS is the transcriptional activator Mga, which coordinates the early stages of infection. Although the targets of Mga have been well characterized, basic biochemical analyses have been limited due to difficulties in obtaining purified protein. In this study, high-level purification of soluble Mga was achieved, enabling the first detailed characterization of the protein. Fluorescence titrations coupled with filter-binding assays indicate that Mga binds cognate DNA with nanomolar affinity. Gel filtration analyses, analytical ultracentrifugation, and co-immunoprecipitation experiments demonstrate that Mga forms oligomers in solution. Moreover, the ability of the protein to oligomerize in solution was found to correlate with transcriptional activation; DNA binding appears to be necessary but insufficient for full activity. Truncation analyses reveal that the uncharacterized C-terminal region of Mga, possessing similarity to phosphotransferase system EIIB proteins, plays a critical role in oligomerization and in vivo activity. Mga from a divergent serotype was found to behave similarly, suggesting that this study describes a general mechanism for Mga regulation of target virulence genes within GAS and provides insight into related regulators in other Gram-positive pathogens. PMID:22468267

  7. Screening of synthetic and natural product databases: Identification of novel androgens and antiandrogens.

    PubMed

    Bobach, Claudia; Tennstedt, Stephanie; Palberg, Kristin; Denkert, Annika; Brandt, Wolfgang; de Meijere, Armin; Seliger, Barbara; Wessjohann, Ludger A

    2015-01-27

    The androgen receptor is an important pharmaceutical target for a variety of diseases. This paper presents an in silico/in vitro screening procedure to identify new androgen receptor ligands. The two-step virtual screening procedure uses a three-dimensional pharmacophore model and a docking/scoring routine. About 39,000 filtered compounds were docked with PLANTS and scored by Chemplp. Subsequent to virtual screening, 94 compounds, including 28 steroidal and 66 nonsteroidal compounds, were tested by an androgen receptor fluorescence polarization ligand displacement assay. As a result, 30 compounds were identified that show a relative binding affinity of more than 50% in comparison to 100 nM dihydrotestosterone and were classified as androgen receptor binders. For 11 androgen receptor binders of interest IC50 and Ki values were determined. The compound with the highest affinity exhibits a Ki value of 10.8 nM. Subsequent testing of the 11 compounds in a PC-3 and LNCaP multi readout proliferation assay provides insights into the potential mode of action. Further steroid receptor ligand displacement assays and docking studies on estrogen receptors α and β, glucocorticoid receptor, and progesterone receptor gave information about the specificity of the 11 most active compounds. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  8. Homogeneous bioluminescence competitive binding assay for folate based on a coupled glucose-6-phosphate dehydrogenase--bacterial luciferase enzyme system.

    PubMed

    Huang, W; Feltus, A; Witkowski, A; Daunert, S

    1996-05-01

    A homogeneous bioluminescence competitive binding assay for folate was developed by using a coupled enzyme system of glucose-6-phosphate dehydrogenase (G6PDH) and bacterial luciferase. A highly substituted G6PDH-folate conjugate was prepared by employing an N-hydroxysuccinimide/carbodiimide method. Folate binding protein inhibits the activity of the conjugate. In the presence of folate, there is a competition between folate and the G6PDH-folate conjugate for the binding site of the folate binding protein, and the activity of the conjugate is recovered. Thus, the concentration of folate can be related to the activity of the G6PDH-folate conjugate, which is directly related to the bioluminescence produced by the coupled enzyme reaction. Using this assay, dose-response curves with a detection limit of 2.5 x 10(-8) M folate were obtained, which is an improvement of an order of magnitude with respect to an assay that monitors G6PDH activity spectrophotometrically. The assay was validated using vitamin tablets and a cell culture medium.

  9. Avoiding false positives and optimizing identification of true negatives in estrogen receptor binding and agonist/antagonist assays

    EPA Science Inventory

    The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented fr...

  10. Integrated Summary Report: Validation of Two Binding Assays Using Human Recombinant Estrogen Receptor Alpha (hrERa)

    EPA Science Inventory

    This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (h...

  11. Initial steps of inactivation at the K+ channel selectivity filter

    PubMed Central

    Thomson, Andrew S.; Heer, Florian T.; Smith, Frank J.; Hendron, Eunan; Bernèche, Simon; Rothberg, Brad S.

    2014-01-01

    K+ efflux through K+ channels can be controlled by C-type inactivation, which is thought to arise from a conformational change near the channel’s selectivity filter. Inactivation is modulated by ion binding near the selectivity filter; however, the molecular forces that initiate inactivation remain unclear. We probe these driving forces by electrophysiology and molecular simulation of MthK, a prototypical K+ channel. Either Mg2+ or Ca2+ can reduce K+ efflux through MthK channels. However, Ca2+, but not Mg2+, can enhance entry to the inactivated state. Molecular simulations illustrate that, in the MthK pore, Ca2+ ions can partially dehydrate, enabling selective accessibility of Ca2+ to a site at the entry to the selectivity filter. Ca2+ binding at the site interacts with K+ ions in the selectivity filter, facilitating a conformational change within the filter and subsequent inactivation. These results support an ionic mechanism that precedes changes in channel conformation to initiate inactivation. PMID:24733889

  12. AN ALTERNATIVE ELUENT TO BEEF EXTRACT FOR ELUTING POLIOVIRUS FROM ELECTROPOSITIVE FILTERS

    EPA Science Inventory

    Traditional methods for enteric virus removal from waters involve filtering the water through a positively charged filter followed by elution with beef extract, second step concentration by flocculation, and assay in cell culture. Two of the problems associated with this method ...

  13. Nuisance Compounds, PAINS Filters, and Dark Chemical Matter in the GSK HTS Collection.

    PubMed

    Chakravorty, Subhas J; Chan, James; Greenwood, Marie Nicole; Popa-Burke, Ioana; Remlinger, Katja S; Pickett, Stephen D; Green, Darren V S; Fillmore, Martin C; Dean, Tony W; Luengo, Juan I; Macarrón, Ricardo

    2018-07-01

    High-throughput screening (HTS) hits include compounds with undesirable properties. Many filters have been described to identify such hits. Notably, pan-assay interference compounds (PAINS) has been adopted by the community as the standard term to refer to such filters, and very useful guidelines have been adopted by the American Chemical Society (ACS) and subsequently triggered a healthy scientific debate about the pitfalls of draconian use of filters. Using an inhibitory frequency index, we have analyzed in detail the promiscuity profile of the whole GlaxoSmithKline (GSK) HTS collection comprising more than 2 million unique compounds that have been tested in hundreds of screening assays. We provide a comprehensive analysis of many previously published filters and newly described classes of nuisance structures that may serve as a useful source of empirical information to guide the design or growth of HTS collections and hit triaging strategies.

  14. Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

    PubMed

    Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

    2018-06-01

    To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

  15. Technical note: improved methodology for analyses of acid detergent fiber and acid detergent lignin.

    PubMed

    Raffrenato, E; Van Amburgh, M E

    2011-07-01

    The objective of this study was to evaluate the methodology of the acid detergent lignin (ADL) assay in an effort to evaluate particle loss, improve repeatability, and decrease variation within and among samples. The original ADL method relied on asbestos as a filtering aid, but that was removed in 1989 with the mandate from the Environmental Protection Agency to eliminate asbestos in the environment. Furthermore, recent work on fiber methodology indicated that pore size in the Gooch sintered glass crucible (40-60 μm) was too large to trap all of the small particles associated with neutral detergent fiber (NDF) and acid detergent fiber (ADF). Thus, any loss of ADF could potentially result in a loss of ADL. Sixty forages including conventional and brown midrib corn silages, alfalfa silages and hays, mature grasses, early vegetative grasses, and 9 feces samples, were analyzed sequentially for ADF and ADL as outlined in the 1973 procedure of Van Soest except for the use of the asbestos fiber. A glass microfiber filter with a 1.5-μm pore size was chosen as a filtering aid because it met the criteria required by the assay: glass, heat resistant, acid resistant, chemically inert, and hydrophobic. To compare with the current ADF and ADL assays, the assays were conducted with either no filter or the glass filter inserted into crucibles, rinsed with acetone, and then according to the 1973 procedure of Van Soest. The samples analyzed covered a range from 18.11 to 55.79% ADF and from 0.96 to 9.94% ADL on a dry matter (DM) basis. With the use of the filter, the mean ADF values increased 4.2% and mean ADL values increased 18.9%. Overall, both ADF and ADL values were greater with the use of the glass microfiber filter than without, indicating that as the type of sample analyzed changed, use of the Gooch crucible without the filtering aid results in particle loss. The adoption of the use of a small pore size (1.5 μm) glass microfiber filter to improve filtration and recovery of ADF and ADL and to reduce variation in the ADL assay is recommended, especially when sintered glass bottom crucibles are used. These differences in recovery and repeatability have implications for other fiber and lignin methods, as well as for estimating the potential changes in digestibility of fibrous feeds and feed quality. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Beyond conventional dose-response curves: Sensorgram comparison in SPR allows single concentration activity and similarity assessment.

    PubMed

    Gassner, C; Karlsson, R; Lipsmeier, F; Moelleken, J

    2018-05-30

    Previously we have introduced two SPR-based assay principles (dual-binding assay and bridging assay), which allow the determination of two out of three possible interaction parameters for bispecific molecules within one assay setup: two individual interactions to both targets, and/or one simultaneous/overall interaction, which potentially reflects the inter-dependency of both individual binding events. However, activity and similarity are determined by comparing report points over a concentration range, which also mirrors the way data is generated by conventional ELISA-based methods So far, binding kinetics have not been specifically considered in generic approaches for activity assessment. Here, we introduce an improved slope-ratio model which, together with a sensorgram comparison based similarity assessment, allows the development of a detailed, USP-conformal ligand binding assay using only a single sample concentration. We compare this novel analysis method to the usual concentration-range approach for both SPR-based assay principles and discuss its impact on data quality and increased sample throughput. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

    USGS Publications Warehouse

    Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

    2007-01-01

    The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

  18. A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

    PubMed

    Banasik, Michał; Sachadyn, Paweł

    2016-09-01

    A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

  19. A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

    PubMed Central

    Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

    2017-01-01

    Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

  20. A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva† †Electronic supplementary information (ESI) available: Optimization of Mg2+ and ATMND concentrations for our CBSA-based ATMND-binding assay; ATMND-reported calibration curve for CBSA-5325 at various cocaine concentrations; ATMND binding affinity for the cocaine-assembled CBSA-5325; K D of 38-GC and different 38-GC mutants for cocaine as characterized by ITC; stem length effects on cocaine-induced CBSA assembly; spectra of CBSA-5335-based fluorescence detection of cocaine in 1× binding buffer; characterization of cocaine binding affinity of CBSA-5335 and PSA using ITC; fluorescence detection of cocaine in saliva with our fluorophore/quencher modified CBSA-5335; calibration curve of our CBSA-5335-based fluorophore/quencher assay in 1× binding buffer and 10% saliva at cocaine concentrations ranging from 0 to 10 μM; bias and precision of the CBSA-5335-based fluorophore/quencher assay; comparison of amplification-free split-aptamer assays for cocaine detection; sequence ID and DNA sequences used in this work. See DOI: 10.1039/c6sc01833e Click here for additional data file.

    PubMed Central

    Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui

    2017-01-01

    Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples. PMID:28451157

  1. A region rich in aspartic acid, arginine, tyrosine, and glycine (DRYG) mediates eukaryotic initiation factor 4B (eIF4B) self-association and interaction with eIF3.

    PubMed Central

    Méthot, N; Song, M S; Sonenberg, N

    1996-01-01

    The binding of mRNA to the ribosome is mediated by eukaryotic initiation factors eukaryotic initiation factor 4F (eIF4F), eIF4B, eIF4A, and eIF3, eIF4F binds to the mRNA cap structure and, in combination with eIF4B, is believed to unwind the secondary structure in the 5' untranslated region to facilitate ribosome binding. eIF3 associates with the 40S ribosomal subunit prior to mRNA binding. eIF4B copurifies with eIF3 and eIF4F through several purification steps, suggesting the involvement of a multisubunit complex during translation initiation. To understand the mechanism by which eIF4B promotes 40S ribosome binding to the mRNA, we studied its interactions with partner proteins by using a filter overlay (protein-protein [far Western]) assay and the two-hybrid system. In this report, we show that eIF4B self-associates and also interacts directly with the p170 subunit of eIF3. A region rich in aspartic acid, arginine, tyrosine, and glycine, termed the DRYG domain, is sufficient for self-association of eIF4B, both in vitro and in vivo, and for interaction with the p170 subunit of eIF3. These experiments suggest that eIF4B participates in mRNA-ribosome binding by acting as an intermediary between the mRNA and eIF3, via a direct interaction with the p170 subunit of eIF3. PMID:8816444

  2. Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.

    PubMed

    Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong

    2006-07-07

    We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.

  3. Highly variable sensitivity of five binding and two bio-assays for TSH-receptor antibodies.

    PubMed

    Diana, T; Wüster, C; Kanitz, M; Kahaly, G J

    2016-10-01

    TSH-receptor (TSHR) antibodies (Ab) can be measured with binding or bio-assays. Sensitivity and specificity of five binding and two bio-assays were compared. TSHR-blocking (TBAb) and TSHR-stimulating (TSAb) Ab were measured with reporter bio-assays. Blocking activity was defined as percent inhibition of luciferase expression relative to induction with bTSH alone. TSAb was reported as percentage of specimen-to-reference ratio (SRR%). TSHR-binding inhibitory immunoglobulins (TBII) were measured with Kronus, Dynex, Kryptor, Cobas, and Immulite. Sixty patients with Graves' disease (GD), 20 with Hashimoto's thyroiditis (HT), and 20 healthy controls (C) were included. C tested negative in all assays (specificity 100 %) while all 60 hyperthyroid GD patients tested positive in the TSAb bio-assay (sensitivity 100 %). Among these 60 GD patients, 20 had low TSAb positivity (SRR% 140-279), but were TBII positive in only 20 (100 %), 7 (35 %), 9 (45 %), 11 (55 %), and 18 (90 %) using the Kronus, Dynex, Kryptor, Cobas, and Immulite, respectively. In 20 moderate TSAb-positive (SRR% 280-420) patients, TBII tested positive in 20 (100 %), 14 (70 %), 13 (65 %), 16 (80 %), and 19 (95 %), respectively. The high (SRR% > 420) TSAb-positive patients were all TBII positive. All 20 hypothyroid HT patients tested TBAb positive (sensitivity 100 %) in the bio-assay while they tested TBII positive in 20 (100 %), 18 (90 %), 20, 20, and 18, respectively. Results obtained with two luminometers correlated for TSAb positive (r = 0.99, p < 0.001), TBAb positive (r = 0.88, p < 0.001), and C (r = 0.86, p < 0.001). None of the binding assays differentiated between TSAb and TBAb. Sensitivity is highly variable between binding and bio-assays for TSHR-Abs.

  4. Detection of E. coli O157:H7 in complex matrices under varying flow parameters with a robotic fluorometric assay system

    NASA Astrophysics Data System (ADS)

    Leskinen, Stephaney D.; Schlemmer, Sarah M.; Kearns, Elizabeth A.; Lim, Daniel V.

    2009-02-01

    The development of rapid assays for detection of microbial pathogens in complex matrices is needed to protect public health due to continued outbreaks of disease from contaminated foods and water. An Escherichia coli O157:H7 detection assay was designed using a robotic, fluorometric assay system. The system integrates optics, fluidics, robotics and software for the detection of foodborne pathogens or toxins in as many as four samples simultaneously. It utilizes disposable fiber optic waveguides coated with biotinylated antibodies for capture of target analytes from complex sample matrices. Computer-controlled rotation of sample cups allows complete contact between the sample and the waveguide. Detection occurs via binding of a fluorophore-labeled antibody to the captured target, which leads to an increase in the fluorescence signal. Assays are completed within twenty-five minutes. Sample matrices included buffer, retentate (material recovered from the filter of the Automated Concentration System (ACS) following hollow fiber ultrafiltration), spinach wash and ground beef. The matrices were spiked with E. coli O157:H7 (103-105 cells/ml) and the limits of detection were determined. The effect of sample rotation on assay sensitivity was also examined. Rotation parameters for each sample matrix included 10 ml with rotation, 5 ml with rotation and 0.1 ml without rotation. Detection occurred at 104 cells/ml in buffer and spinach wash and at 105 cells/ml in retentate and ground beef. Detection was greater for rotated samples in each matrix except ground beef. Enhanced detection of E. coli from large, rotated volumes of complex matrices was confirmed.

  5. Correlation of antispermatozoal antibody with infertility in immunized female rabbits using /sup 14/C-protein A in a filter radioassay

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eng, L.A.; Metz, C.B.

    1986-09-01

    The meaningful detection of antisperm antibody in immunologically infertile females has been confounded by the many methods of assay that exist. With many of these methods there is poor correlation of assay results with infertility. In this report, female rabbits were rendered partially or completely infertile by immunization with sperm fractions. A filter radioassay for antisperm antibody was developed that consists of incubating 10(7) sperm with sperm from immunized rabbits and /sup 14/C-Protein A, a long-lived and versatile indirect radiolabel for many antibodies of the IgG class. The spermatozoa are washed by rapid vacuum filtration on polycarbonate membrane filters insteadmore » of by time-consuming centrifugation. The filters with the collected spermatozoa are then counted in a liquid scintillation counter. Sera from female rabbits isoimmunized with sperm antigens show a highly significant correlation (r = -0.904; p less than 0.001) between assay results and infertility as measured by the percentage of eggs that underwent cleavage after artificial insemination.« less

  6. Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

    PubMed

    Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

    2012-09-01

    Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

  7. Homogeneous time-resolved G protein-coupled receptor-ligand binding assay based on fluorescence cross-correlation spectroscopy.

    PubMed

    Antoine, Thomas; Ott, David; Ebell, Katharina; Hansen, Kerrin; Henry, Luc; Becker, Frank; Hannus, Stefan

    2016-06-01

    G protein-coupled receptors (GPCRs) mediate many important physiological functions and are considered as one of the most successful therapeutic target classes for a wide spectrum of diseases. Drug discovery projects generally benefit from a broad range of experimental approaches for screening compound libraries and for the characterization of binding modes of drug candidates. Owing to the difficulties in solubilizing and purifying GPCRs, assay formats have been so far mainly limited to cell-based functional assays and radioligand binding assays. In this study, we used fluorescence cross-correlation spectroscopy (FCCS) to analyze the interaction of detergent-solubilized receptors to various types of GPCR ligands: endogenous peptides, small molecules, and a large surrogate antagonist represented by a blocking monoclonal antibody. Our work demonstrates the suitability of the homogeneous and time-resolved FCCS assay format for a robust, high-throughput determination of receptor-ligand binding affinities and kinetic rate constants for various therapeutically relevant GPCRs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Measurement of filter paper activities of cellulase with microplate-based assay.

    PubMed

    Yu, Xiaoxiao; Liu, Yan; Cui, Yuxiao; Cheng, Qiyue; Zhang, Zaixiao; Lu, Jia Hui; Meng, Qingfan; Teng, Lirong; Ren, Xiaodong

    2016-01-01

    It is always a challenge to determine the total cellulase activity efficiently without reducing accuracy. The most common total cellulase activity assay is the filter paper assay (FPA) established by the International Union of Pure and Applied Chemistry (IUPAC). A new procedure to measure the FPA with microplate-based assay was studied in this work, which followed the main idea of IUPAC to dilute cellulase preparation to get fixed glucose release. FPAs of six cellulase preparations were determined with the microplate-based assay. It is shown that FPAs of cellulase Youtell, RCconc, R-10, Lerkam, Yishui and Sinopharm were 67.9, 46.0, 46.1, 27.4, 7.6 and 8.0 IU/ml respectively. There was no significant difference at the 95% confidence level between the FPA determined with IUPAC and the microplate-based assay. It could be concluded that the FPA could be determined by the microplate-based assay with the same accuracy and much more efficiency compared with that by IUPAC.

  9. Measurement of filter paper activities of cellulase with microplate-based assay

    PubMed Central

    Yu, Xiaoxiao; Liu, Yan; Cui, Yuxiao; Cheng, Qiyue; Zhang, Zaixiao; Lu, Jia Hui; Meng, Qingfan; Teng, Lirong; Ren, Xiaodong

    2015-01-01

    It is always a challenge to determine the total cellulase activity efficiently without reducing accuracy. The most common total cellulase activity assay is the filter paper assay (FPA) established by the International Union of Pure and Applied Chemistry (IUPAC). A new procedure to measure the FPA with microplate-based assay was studied in this work, which followed the main idea of IUPAC to dilute cellulase preparation to get fixed glucose release. FPAs of six cellulase preparations were determined with the microplate-based assay. It is shown that FPAs of cellulase Youtell, RCconc, R-10, Lerkam, Yishui and Sinopharm were 67.9, 46.0, 46.1, 27.4, 7.6 and 8.0 IU/ml respectively. There was no significant difference at the 95% confidence level between the FPA determined with IUPAC and the microplate-based assay. It could be concluded that the FPA could be determined by the microplate-based assay with the same accuracy and much more efficiency compared with that by IUPAC. PMID:26858572

  10. Inner and Outer Coordination Shells of Mg(2+) in CorA Selectivity Filter from Molecular Dynamics Simulations.

    PubMed

    Kitjaruwankul, Sunan; Wapeesittipan, Pattama; Boonamnaj, Panisak; Sompornpisut, Pornthep

    2016-01-28

    Structural data of CorA Mg(2+) channels show that the five Gly-Met-Asn (GMN) motifs at the periplasmic loop of the pentamer structure form a molecular scaffold serving as a selectivity filter. Unfortunately, knowledge about the cation selectivity of Mg(2+) channels remains limited. Since Mg(2+) in aqueous solution has a strong first hydration shell and apparent second hydration sphere, the coordination structure of Mg(2+) in a CorA selectivity filter is expected to be different from that in bulk water. Hence, this study investigated the hydration structure and ligand coordination of Mg(2+) in a selectivity filter of CorA using molecular dynamics (MD) simulations. The simulations reveal that the inner-shell structure of Mg(2+) in the filter is not significantly different from that in aqueous solution. The major difference is the characteristic structural features of the outer shell. The GMN residues engage indirectly in the interactions with the metal ion as ligands in the second shell of Mg(2+). Loss of hydrogen bonds between inner- and outer-shell waters observed from Mg(2+) in bulk water is mostly compensated by interactions between waters in the first solvation shell and the GMN motif. Some water molecules in the second shell remain in the selectivity filter and become less mobile to support the metal binding. Removal of Mg(2+) from the divalent cation sensor sites of the protein had an impact on the structure and metal binding of the filter. From the results, it can be concluded that the GMN motif enhances the affinity of the metal binding site in the CorA selectivity filter by acting as an outer coordination ligand.

  11. Persistent Graves' hyperthyroidism despite rapid negative conversion of thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results: a case report.

    PubMed

    Ohara, Nobumasa; Kaneko, Masanori; Kitazawa, Masaru; Uemura, Yasuyuki; Minagawa, Shinichi; Miyakoshi, Masashi; Kaneko, Kenzo; Kamoi, Kyuzi

    2017-02-06

    Graves' disease is an autoimmune thyroid disorder characterized by hyperthyroidism, and patients exhibit thyroid-stimulating hormone receptor antibody. The major methods of measuring circulating thyroid-stimulating hormone receptor antibody include the thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Although the diagnostic accuracy of these assays has been improved, a minority of patients with Graves' disease test negative even on second-generation and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulins. We report a rare case of a thyroid-stimulating hormone-binding inhibitory immunoglobulin-positive patient with Graves' disease who showed rapid lowering of thyroid-stimulating hormone-binding inhibitory immunoglobulin levels following administration of the anti-thyroid drug thiamazole, but still experienced Graves' hyperthyroidism. A 45-year-old Japanese man presented with severe hyperthyroidism (serum free triiodothyronine >25.0 pg/mL; reference range 1.7 to 3.7 pg/mL) and tested weakly positive for thyroid-stimulating hormone-binding inhibitory immunoglobulins on second-generation tests (2.1 IU/L; reference range <1.0 IU/L). Within 9 months of treatment with oral thiamazole (30 mg/day), his thyroid-stimulating hormone-binding inhibitory immunoglobulin titers had normalized, but he experienced sustained hyperthyroidism for more than 8 years, requiring 15 mg/day of thiamazole to correct. During that period, he tested negative on all first-generation, second-generation, and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, but thyroid scintigraphy revealed diffuse and increased uptake, and thyroid ultrasound and color flow Doppler imaging showed typical findings of Graves' hyperthyroidism. The possible explanations for serial changes in the thyroid-stimulating hormone-binding inhibitory immunoglobulin results in our patient include the presence of thyroid-stimulating hormone receptor antibody, which is bioactive but less reactive on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, or the effect of reduced levels of circulating thyroid-stimulating hormone receptor antibody upon improvement of thyroid autoimmunity with thiamazole treatment. Physicians should keep in mind that patients with Graves' disease may show thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results that do not reflect the severity of Graves' disease or indicate the outcome of the disease, and that active Graves' disease may persist even after negative results on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Timely performance of thyroid function tests in combination with sensitive imaging tests, including thyroid ultrasound and scintigraphy, are necessary to evaluate the severity of Graves' disease and treatment efficacy.

  12. A magnetic bead-based ligand binding assay to facilitate human kynurenine 3-monooxygenase drug discovery.

    PubMed

    Wilson, Kris; Mole, Damian J; Homer, Natalie Z M; Iredale, John P; Auer, Manfred; Webster, Scott P

    2015-02-01

    Human kynurenine 3-monooxygenase (KMO) is emerging as an important drug target enzyme in a number of inflammatory and neurodegenerative disease states. Recombinant protein production of KMO, and therefore discovery of KMO ligands, is challenging due to a large membrane targeting domain at the C-terminus of the enzyme that causes stability, solubility, and purification difficulties. The purpose of our investigation was to develop a suitable screening method for targeting human KMO and other similarly challenging drug targets. Here, we report the development of a magnetic bead-based binding assay using mass spectrometry detection for human KMO protein. The assay incorporates isolation of FLAG-tagged KMO enzyme on protein A magnetic beads. The protein-bound beads are incubated with potential binding compounds before specific cleavage of the protein-compound complexes from the beads. Mass spectrometry analysis is used to identify the compounds that demonstrate specific binding affinity for the target protein. The technique was validated using known inhibitors of KMO. This assay is a robust alternative to traditional ligand-binding assays for challenging protein targets, and it overcomes specific difficulties associated with isolating human KMO. © 2014 Society for Laboratory Automation and Screening.

  13. Measuring Norfloxacin Binding to Trypsin Using a Fluorescence Quenching Assay in an Upper-Division, Integrated Laboratory Course

    ERIC Educational Resources Information Center

    Hicks, Katherine A.

    2016-01-01

    Fluorescence quenching assays are often used to measure dissociation constants that quantify the binding affinity between small molecules and proteins. In an upper-division undergraduate laboratory course, where students work on projects using a guided inquiry-based approach, a binding titration experiment at physiological pH is performed to…

  14. Complementary Spectroscopic Assays for Investigating Protein-Ligand Binding Activity: A Project for the Advanced Chemistry Laboratory

    ERIC Educational Resources Information Center

    Mascotti, David P.; Waner, Mark J.

    2010-01-01

    A protein-ligand binding, guided-inquiry laboratory project with potential application across the advanced undergraduate curriculum is described. At the heart of the project are fluorescence and spectrophotometric assays utilizing biotin-4-fluorescein and streptavidin. The use of the same stock solutions for an assay that may be examined by two…

  15. DEVELOPMENT AND CHARACTERIZATION OF A CELL LINE THAT STABLY EXPRESSES AN ESTROGEN-RESPONSIVE LUCIFERASE REPORTER FOR THE DETECTION OF ESTROGEN RECEPTOR AGONIST AND ANTAGONISTS

    EPA Science Inventory

    Screening for endocrine disrupting chemicals (EDCs) that act as estrogens or antiestrogens relies on the use of in vitro binding and gene expression assays coupled with short-term diagnostic in vivo assays. Although binding assays are useful to identify chemicals that are competi...

  16. Lipid A binding sites in membranes of macrophage tumor cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.

    1988-10-15

    Lipopolysaccharide affects a variety of eukaryotic cells and mammalian organisms. These actions are involved in the pathogenesis of Gram-negative septicemia. Many of the actions of lipopolysaccharide are believed to be caused by its active moiety, lipid A. Our laboratory has previously identified a bioactive lipid A precursor, termed lipid IVA, which can be labeled with 32P of high specific activity and purified. In this work we have used the labeled probe, 4'-32P-lipid IVA, to develop a novel assay for the specific binding of lipid IVA to whole cells. We have also demonstrated its use in a ligand blotting assay ofmore » immobilized cellular proteins. Using the whole cell assay, we show that 4'-32P-lipid IVA specifically binds to RAW 264.7 macrophage-like cultured cells. The binding is saturable, is inhibited with excess unlabeled lipid IVA, and is proteinase K-sensitive. It displays cellular and pharmacological specificity. Using the ligand blotting assay, we show that several RAW 264.7 cell proteins can bind 4'-32P-lipid IVA. The two principal binding proteins have Mr values of 31 and 95 kDa, as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fractionation studies indicate that the 31-kDa protein is enriched in the nuclear fraction and may be a histone, whereas the 95-kDa protein is enriched in the membrane fraction. The binding assays that we have developed should lead to a clearer understanding of lipid A/animal cell interactions.« less

  17. Novel Multiplexed Assay for Identifying SH2 Domain Antagonists of STAT Family Proteins

    PubMed Central

    Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

    2013-01-01

    Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z’ values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors. PMID:23977103

  18. Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

    PubMed

    Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

    2013-01-01

    Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

  19. Assessment of a recombinant androgen receptor binding assay: initial steps towards validation.

    PubMed

    Freyberger, Alexius; Weimer, Marc; Tran, Hoai-Son; Ahr, Hans-Jürgen

    2010-08-01

    Despite more than a decade of research in the field of endocrine active compounds with affinity for the androgen receptor (AR), still no validated recombinant AR binding assay is available, although recombinant AR can be obtained from several sources. With funding from the European Union (EU)-sponsored 6th framework project, ReProTect, we developed a model protocol for such an assay based on a simple AR binding assay recently developed at our institution. Important features of the protocol were the use of a rat recombinant fusion protein to thioredoxin containing both the hinge region and ligand binding domain (LBD) of the rat AR (which is identical to the human AR-LBD) and performance in a 96-well plate format. Besides two reference compounds [dihydrotestosterone (DHT), androstenedione] ten test compounds with different affinities for the AR [levonorgestrel, progesterone, prochloraz, 17alpha-methyltestosterone, flutamide, norethynodrel, o,p'-DDT, dibutylphthalate, vinclozolin, linuron] were used to explore the performance of the assay. At least three independent experiments per compound were performed. The AR binding properties of reference and test compounds were well detected, in terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using recombinant AR preparations. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.6. Our data demonstrate that the assay reliably ranked compounds with strong, weak, and no/marginal affinity for the AR with high accuracy. It avoids the manipulation and use of animals, as a recombinant protein is used and thus contributes to the 3R concept. On the whole, this assay is a promising candidate for further validation. Copyright 2009 Elsevier Inc. All rights reserved.

  20. Development and validation of an LC-ESI-MS/MS method for the quantification of D-84, reboxetine and citalopram for their use in MS Binding Assays addressing the monoamine transporters hDAT, hSERT and hNET.

    PubMed

    Neiens, Patrick; De Simone, Angela; Ramershoven, Anna; Höfner, Georg; Allmendinger, Lars; Wanner, Klaus T

    2018-03-03

    MS Binding Assays represent a label-free alternative to radioligand binding assays. In this study, we present an LC-ESI-MS/MS method for the quantification of (R,R)-4-(2-benzhydryloxyethyl)-1-(4-fluorobenzyl)piperidin-3-ol [(R,R)-D-84, (R,R)-1], (S,S)-reboxetine [(S,S)-2], and (S)-citalopram [(S)-3] employed as highly selective nonlabeled reporter ligands in MS Binding Assays addressing the dopamine [DAT, (R,R)-D-84], norepinephrine [NET, (S,S)-reboxetine] and serotonin transporter [SERT, (S)-citalopram], respectively. The developed LC-ESI-MS/MS method uses a pentafluorphenyl stationary phase in combination with a mobile phase composed of acetonitrile and ammonium formate buffer for chromatography and a triple quadrupole mass spectrometer in the multiple reaction monitoring mode for mass spectrometric detection. Quantification is based on deuterated derivatives of all three analytes serving as internal standards. The established LC-ESI-MS/MS method enables fast, robust, selective and highly sensitive quantification of all three reporter ligands in a single chromatographic run. The method was validated according to the Center for Drug Evaluation and Research (CDER) guideline for bioanalytical method validation regarding selectivity, accuracy, precision, calibration curve and sensitivity. Finally, filtration-based MS Binding Assays were performed for all three monoamine transporters based on this LC-ESI-MS/MS quantification method as read out. The affinities determined in saturation experiments for (R,R)-D-84 toward hDAT, for (S,S)-reboxetine toward hNET, and for (S)-citalopram toward hSERT, respectively, were in good accordance with results from literature, clearly demonstrating that the established MS Binding Assays have the potential to be an efficient alternative to radioligand binding assays widely used for this purpose so far. Copyright © 2018 John Wiley & Sons, Ltd.

  1. Target molecules detection by waveguiding in a photonic silicon membrane

    DOEpatents

    Letant, Sonia E [Livermore, CA; Van Buuren, Anthony [Livermore, CA; Terminello, Louis [Danville, CA; Hart, Bradley R [Brentwood, CA

    2006-12-26

    Disclosed herein is a porous silicon filter capable of binding and detecting biological and chemical target molecules in liquid or gas samples. A photonic waveguiding silicon filter with chemical and/or biological anchors covalently attached to the pore walls bind target molecules. The system uses transmission curve engineering principles to allow measurements to be made in situ and in real time to detect the presence of various target molecules and calculate the concentration of bound target.

  2. Target molecules detection by waveguiding in a photonic silicon membrane

    DOEpatents

    Letant, Sonia; Van Buuren, Anthony; Terminello, Louis

    2004-08-31

    Disclosed herein is a photonic silicon filter capable of binding and detecting biological and chemical target molecules in liquid or gas samples. A photonic waveguiding silicon filter with chemical and/or biological anchors covalently attached to the pore walls selectively bind target molecules. The system uses transmission curve engineering principles to allow measurements to be made in situ and in real time to detect the presence of various target molecules and determine the concentration of bound target.

  3. The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

    PubMed

    Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

    2003-08-29

    We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

  4. Development of rapid and sensitive high throughput pharmacologic assays for marine phycotoxins.

    PubMed

    Van Dolah, F M; Finley, E L; Haynes, B L; Doucette, G J; Moeller, P D; Ramsdell, J S

    1994-01-01

    The lack of rapid, high throughput assays is a major obstacle to many aspects of research on marine phycotoxins. Here we describe the application of microplate scintillation technology to develop high throughput assays for several classes of marine phycotoxin based on their differential pharmacologic actions. High throughput "drug discovery" format microplate receptor binding assays developed for brevetoxins/ciguatoxins and for domoic acid are described. Analysis for brevetoxins/ciguatoxins is carried out by binding competition with [3H] PbTx-3 for site 5 on the voltage dependent sodium channel in rat brain synaptosomes. Analysis of domoic acid is based on binding competition with [3H] kainic acid for the kainate/quisqualate glutamate receptor using frog brain synaptosomes. In addition, a high throughput microplate 45Ca flux assay for determination of maitotoxins is described. These microplate assays can be completed within 3 hours, have sensitivities of less than 1 ng, and can analyze dozens of samples simultaneously. The assays have been demonstrated to be useful for assessing algal toxicity and for assay-guided purification of toxins, and are applicable to the detection of biotoxins in seafood.

  5. FcUni-RLuc: an engineered Renilla luciferase with Fc binding ability and light emission activity.

    PubMed

    Farzannia, A; Roghanian, R; Zarkesh-Esfahani, S H; Nazari, M; Emamzadeh, R

    2015-03-07

    A novel and advanced Fc-binding probe – FcUni-RLuc namely – has been produced and functionally assayed for labelling IgGs. The Fc antibody binding sequence – HWRGWV – was fused to Renilla luciferase, and the purified probe was employed for bioluminescence enzyme-linked immunoabsorbance assay of Her2 positive cells.

  6. Studying the Salt Dependence of the Binding of σ70 and σ32 to Core RNA Polymerase Using Luminescence Resonance Energy Transfer

    PubMed Central

    Glaser, Bryan T.; Bergendahl, Veit; Anthony, Larry C.; Olson, Brian; Burgess, Richard R.

    2009-01-01

    The study of protein-protein interactions is becoming increasingly important for understanding the regulation of many cellular processes. The ability to quantify the strength with which two binding partners interact is desirable but the accurate determination of equilibrium binding constants is a difficult process. The use of Luminescence Resonance Energy Transfer (LRET) provides a homogeneous binding assay that can be used for the detection of protein-protein interactions. Previously, we developed an LRET assay to screen for small molecule inhibitors of the interaction of σ70 with theβ' coiled-coil fragment (amino acids 100–309). Here we describe an LRET binding assay used to monitor the interaction of E. coli σ70 and σ32 with core RNA polymerase along with the controls to verify the system. This approach generates fluorescently labeled proteins through the random labeling of lysine residues which enables the use of the LRET assay for proteins for which the creation of single cysteine mutants is not feasible. With the LRET binding assay, we are able to show that the interaction of σ70 with core RNAP is much more sensitive to NaCl than to potassium glutamate (KGlu), whereas the σ32 interaction with core RNAP is insensitive to both salts even at concentrations >500 mM. We also find that the interaction of σ32 with core RNAP is stronger than σ70 with core RNAP, under all conditions tested. This work establishes a consistent set of conditions for the comparison of the binding affinities of the E.coli sigma factors with core RNA polymerase. The examination of the importance of salt conditions in the binding of these proteins could have implications in both in vitro assay conditions and in vivo function. PMID:19649256

  7. Development of an enzyme-linked immunosorbent assay and a beta-1 adrenergic receptor-based assay for monitoring the drug atenolol.

    PubMed

    Sapir, A; Shalev, A Hariton; Skalka, N; Bronshtein, A; Altstein, M

    2013-03-01

    Two approaches for monitoring atenolol (ATL) were applied: an immunochemical assay and a competitive-binding assay, based on the interaction between ATL and its target receptor, β1 adrenergic receptor (β1AR). Polyclonal antibodies (Abs) for ATL were generated, and a highly specific microplate immunochemical assay, that is, an enzyme-linked immunosorbent assay (ELISA), for its detection was developed. The ATL ELISA exhibited I50 and limit of detection (I20) values of 0.15 ± 0.048 and 0.032 ± 0.016 ng/ml, respectively, and the Abs did not cross-react with any of the tested beta-blocker drugs. Furthermore, a human β1AR (h-β1AR) was stably expressed in Spodoptera frugiperda cells (Sf9). The receptor was employed to develop a competitive-binding assay that monitored binding of ATL in the presence of isoproteranol by quantification of secondary messenger, cyclic adenosine monophosphate (cAMP), levels in the transfected cells. The assay showed that the recombinant h-β1AR was functional, could bind the agonistic ligand isoproterenol as well as the antagonist ATL, as indicated by a dose-dependent elevation of cAMP in the presence of isoproteranol, and decrease after ATL addition. The highly efficient and sensitive ELISA and the receptor assay represent two methods suitable for efficient and cost-effective large-scale, high-throughput monitoring of ATL in environmental, agricultural, and biological samples. Copyright © 2012 SETAC.

  8. ApoHRP-based assay to measure intracellular regulatory heme.

    PubMed

    Atamna, Hani; Brahmbhatt, Marmik; Atamna, Wafa; Shanower, Gregory A; Dhahbi, Joseph M

    2015-02-01

    The majority of the heme-binding proteins possess a "heme-pocket" that stably binds to heme. Usually known as housekeeping heme-proteins, they participate in a variety of metabolic reactions (e.g., catalase). Heme also binds with lower affinity to the "Heme-Regulatory Motifs" (HRM) in specific regulatory proteins. This type of heme binding is known as exchangeable or regulatory heme (RH). Heme binding to HRM proteins regulates their function (e.g., Bach1). Although there are well-established methods for assaying total cellular heme (e.g., heme-proteins plus RH), currently there is no method available for measuring RH independent of the total heme (TH). The current study describes and validates a new method to measure intracellular RH. This method is based on the reconstitution of apo-horseradish peroxidase (apoHRP) with heme to form holoHRP. The resulting holoHRP activity is then measured with a colorimetric substrate. The results show that apoHRP specifically binds RH but not with heme from housekeeping heme-proteins. The RH assay detects intracellular RH. Furthermore, using conditions that create positive (hemin) or negative (N-methyl protoporphyrin IX) controls for heme in normal human fibroblasts (IMR90), the RH assay shows that RH is dynamic and independent of TH. We also demonstrated that short-term exposure to subcytotoxic concentrations of lead (Pb), mercury (Hg), or amyloid-β (Aβ) significantly alters intracellular RH with little effect on TH. In conclusion the RH assay is an effective assay to investigate intracellular RH concentration and demonstrates that RH represents ∼6% of total heme in IMR90 cells.

  9. Mathematical simulations for bioanalytical assay development: the (un-)necessity and (im-)possibility of free drug quantification.

    PubMed

    Staack, Roland F; Jordan, Gregor; Heinrich, Julia

    2012-02-01

    For every drug development program it needs to be discussed whether discrimination between free and total drug concentrations is required to accurately describe its pharmacokinetic behavior. This perspective describes the application of mathematical simulation approaches to guide this initial decision based on available knowledge about target biology, binding kinetics and expected drug concentrations. We provide generic calculations that can be used to estimate the necessity of free drug quantification for different drug molecules. In addition, mathematical approaches are used to simulate various assay conditions in bioanalytical ligand-binding assays: it is demonstrated that due to the noncovalent interaction between the binding partners and typical assay-related interferences in the equilibrium, a correct quantification of the free drug concentration is highly challenging and requires careful design of different assay procedure steps.

  10. Recent improvements to Binding MOAD: a resource for protein–ligand binding affinities and structures

    PubMed Central

    Ahmed, Aqeel; Smith, Richard D.; Clark, Jordan J.; Dunbar, James B.; Carlson, Heather A.

    2015-01-01

    For over 10 years, Binding MOAD (Mother of All Databases; http://www.BindingMOAD.org) has been one of the largest resources for high-quality protein–ligand complexes and associated binding affinity data. Binding MOAD has grown at the rate of 1994 complexes per year, on average. Currently, it contains 23 269 complexes and 8156 binding affinities. Our annual updates curate the data using a semi-automated literature search of the references cited within the PDB file, and we have recently upgraded our website and added new features and functionalities to better serve Binding MOAD users. In order to eliminate the legacy application server of the old platform and to accommodate new changes, the website has been completely rewritten in the LAMP (Linux, Apache, MySQL and PHP) environment. The improved user interface incorporates current third-party plugins for better visualization of protein and ligand molecules, and it provides features like sorting, filtering and filtered downloads. In addition to the field-based searching, Binding MOAD now can be searched by structural queries based on the ligand. In order to remove redundancy, Binding MOAD records are clustered in different families based on 90% sequence identity. The new Binding MOAD, with the upgraded platform, features and functionalities, is now equipped to better serve its users. PMID:25378330

  11. Multi-Laboratory Study of Five Methods for the Determination of Brevetoxins in Shellfish Tissue Extracts.

    PubMed

    Dickey, Robert W; Plakas, Steven M; Jester, Edward L E; El Said, Kathleen R; Johannessen, Jan N; Flewelling, Leanne J; Scott, Paula; Hammond, Dan G; Van Dolah, Frances M; Leighfield, Tod A; Bottein Dachraoui, Marie-Yasmine; Ramsdell, John S; Pierce, Richard H; Henry, Mike S; Poli, Mark A; Walker, Calvin; Kurtz, Jan; Naar, Jerome; Baden, Daniel G; Musser, Steve M; White, Kevin D; Truman, Penelope; Miller, Aaron; Hawryluk, Timothy P; Wekell, Marleen M; Stirling, David; Quilliam, Michael A; Lee, Jung K

    A thirteen-laboratory comparative study tested the performance of four methods as alternatives to mouse bioassay for the determination of brevetoxins in shellfish. The methods were N2a neuroblastoma cell assay, two variations of the sodium channel receptor binding assay, competitive ELISA, and LC/MS. Three to five laboratories independently performed each method using centrally prepared spiked and naturally incurred test samples. Competitive ELISA and receptor binding (96-well format) compared most favorably with mouse bioassay. Between-laboratory relative standard deviations (RSDR) ranged from 10 to 20% for ELISA and 14 to 31% for receptor binding. Within-laboratory (RSDr) ranged from 6 to 15% for ELISA, and 5 to 31% for receptor binding. Cell assay was extremely sensitive but data variation rendered it unsuitable for statistical treatment. LC/MS performed as well as ELISA on spiked test samples but was inordinately affected by lack of toxin-metabolite standards, uniform instrumental parameters, or both, on incurred test samples. The ELISA and receptor binding assay are good alternatives to mouse bioassay for the determination of brevetoxins in shellfish.

  12. Microbubble Enzyme-Linked Immunosorbent Assay for the Detection of Targeted Microbubbles in in Vitro Static Binding Assays.

    PubMed

    Wischhusen, Jennifer; Padilla, Frederic

    2017-07-01

    Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

  13. Assessment of a robust model protocol with accelerated throughput for a human recombinant full length estrogen receptor-alpha binding assay: protocol optimization and intralaboratory assay performance as initial steps towards validation.

    PubMed

    Freyberger, Alexius; Wilson, Vickie; Weimer, Marc; Tan, Shirlee; Tran, Hoai-Son; Ahr, Hans-Jürgen

    2010-08-01

    Despite about two decades of research in the field of endocrine active compounds, still no validated human recombinant (hr) estrogen receptor-alpha (ERalpha) binding assay is available, although hr-ERalpha is available from several sources. In a joint effort, US EPA and Bayer Schering Pharma with funding from the EU-sponsored 6th framework project, ReProTect, developed a model protocol for such a binding assay. Important features of this assay are the use of a full length hr-ERalpha and performance in a 96-well plate format. A full length hr-ERalpha was chosen, as it was considered to provide the most accurate and human-relevant results, whereas truncated receptors could perform differently. Besides three reference compounds [17beta-estradiol, norethynodrel, dibutylphthalate] nine test compounds with different affinities for the ERalpha [diethylstilbestrol (DES), ethynylestradiol, meso-hexestrol, equol, genistein, o,p'-DDT, nonylphenol, n-butylparaben, and corticosterone] were used to explore the performance of the assay. Three independent experiments per compound were performed on different days, and dilutions of test compounds from deep-frozen stocks, solutions of radiolabeled ligand and receptor preparation were freshly prepared for each experiment. The ERalpha binding properties of reference and test compounds were well detected. As expected dibutylphthalate and corticosterone were non-binders in this assay. In terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using a human recombinant ERalpha ligand binding domain. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.5. Our data demonstrate that the assay was robust and reliably ranked compounds with strong, weak, and no affinity for the ERalpha with high accuracy. It avoids the manipulation and use of animals, i.e., the preparation of uterine cytosol as receptor source from ovariectomized rats, as a recombinant protein is used and thus contributes to the 3R concept (reduce, replace, and refine). Furthermore, in contrast to other assays, this assay could be adjusted to an intermediate/high throughput format. On the whole, this assay is a promising candidate for further validation. Copyright 2010 Elsevier Inc. All rights reserved.

  14. Colorimetric detection with aptamer-gold nanoparticle conjugates coupled to an android-based color analysis application for use in the field.

    PubMed

    Smith, Joshua E; Griffin, Daniel K; Leny, Juliann K; Hagen, Joshua A; Chávez, Jorge L; Kelley-Loughnane, Nancy

    2014-04-01

    The feasibility of using aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design colorimetric assays for in the field detection of small molecules was investigated. An assay to detect cocaine was designed using two clones of a known cocaine-binding aptamer. The assay was based on the AuNPs difference in affinity for single-stranded DNA (non-binding) and double stranded DNA (target bound). In the first assay, a commonly used design was followed, in which the aptamer and target were incubated to allow binding followed by exposure to the AuNPs. Interactions between the non-bound analytes and the AuNPs surface resulted in a number of false positives. The assay was redesigned by incubating the AuNPs and the aptamer prior to target addition to passivate the AuNPs surface. The adsorbed aptamer was able to bind the target while preventing non-specific interactions. The assay was validated with a number of masking and cutting agents and other controlled substances showing minimal false positives. Studies to improve the assay performance in the field were performed, showing that assay activity could be preserved for up to 2 months. To facilitate the assay analysis, an android application for automatic colorimetric characterization was developed. The application was validated by challenging the assay with cocaine standards of different concentrations, and comparing the results to a conventional plate reader, showing outstanding agreement. Finally, the rapid identification of cocaine in mixtures mimicking street samples was demonstrated. This work established that Apt-AuNPs can be used to design robust assays to be used in the field. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Virtual screening filters for the design of type II p38 MAP kinase inhibitors: a fragment based library generation approach.

    PubMed

    Badrinarayan, Preethi; Sastry, G Narahari

    2012-04-01

    In this work, we introduce the development and application of a three-step scoring and filtering procedure for the design of type II p38 MAP kinase leads using allosteric fragments extracted from virtual screening hits. The design of the virtual screening filters is based on a thorough evaluation of docking methods, DFG-loop conformation, binding interactions and chemotype specificity of the 138 p38 MAP kinase inhibitors from Protein Data Bank bound to DFG-in and DFG-out conformations using Glide, GOLD and CDOCKER. A 40 ns molecular dynamics simulation with the apo, type I with DFG-in and type II with DFG-out forms was carried out to delineate the effects of structural variations on inhibitor binding. The designed docking-score and sub-structure filters were first tested on a dataset of 249 potent p38 MAP kinase inhibitors from seven diverse series and 18,842 kinase inhibitors from PDB, to gauge their capacity to discriminate between kinase and non-kinase inhibitors and likewise to selectively filter-in target-specific inhibitors. The designed filters were then applied in the virtual screening of a database of ten million (10⁷) compounds resulting in the identification of 100 hits. Based on their binding modes, 98 allosteric fragments were extracted from the hits and a fragment library was generated. New type II p38 MAP kinase leads were designed by tailoring the existing type I ATP site binders with allosteric fragments using a common urea linker. Target specific virtual screening filters can thus be easily developed for other kinases based on this strategy to retrieve target selective compounds. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.

    PubMed

    Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L

    1997-01-01

    Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis-acting EREs.

  17. A novel and sensitive radioreceptor assay for serum melatonin levels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tenn, C.; Niles, L.

    A simple and sensitive radioreceptor assay (RRA) has been developed to measure melatonin levels in serum. The assay is based on competition between 2-({sup 125}I)iodomelatonin (({sup 125}I)MEL) and melatonin for binding to high-affinity binding sites in chick forebrain. To measure the amount of melatonin present in a serum sample, it was extracted with dichloromethane and added to the assay medium. The percentage inhibition of radioligand binding in the presence of the extracted serum was determined and compared to the percent displacement by known amounts of melatonin in a standard curve. There was little or no cross-reactivity with other structurally relatedmore » compounds. The sensitivity of the assay is {approximately}1.5pg/0.15 mL and the intra- and inter-assay variations are approximately 8%. Since the RRA results are comparable to that of an established radioimmunoassay (RIA), it provides a sensitive and rapid alternative to the more time consuming RIA.« less

  18. Sodium and potassium competition in potassium-selective and non-selective channels

    NASA Astrophysics Data System (ADS)

    Sauer, David B.; Zeng, Weizhong; Canty, John; Lam, Yeeling; Jiang, Youxing

    2013-11-01

    Potassium channels selectively conduct K+, primarily to the exclusion of Na+, despite the fact that both ions can bind within the selectivity filter. Here we perform crystallographic titration and single-channel electrophysiology to examine the competition of Na+ and K+ binding within the filter of two NaK channel mutants; one is the potassium-selective NaK2K mutant and the other is the non-selective NaK2CNG, a CNG channel pore mimic. With high-resolution structures of these engineered NaK channel constructs, we explicitly describe the changes in K+ occupancy within the filter upon Na+ competition by anomalous diffraction. Our results demonstrate that the non-selective NaK2CNG still retains a K+-selective site at equilibrium, whereas the NaK2K channel filter maintains two high-affinity K+ sites. A double-barrier mechanism is proposed to explain K+ channel selectivity at low K+ concentrations.

  19. Expression of human peroxisome proliferator-activated receptors ligand binding domain-maltose binding protein fusion protein in Escherichia coli: a convenient and reliable method for preparing receptor for screening ligands.

    PubMed

    Li, Changqing; Tian, Mi; Yuan, Ye; Zhou, Qinxin

    2008-12-01

    Human peroxisome proliferator-activated receptors (hPPARs) are ligand-activated transcription factors and are the target for the treatment of many diseases. Screening of their ligands is mainly based on assays of ligand binding to the ligand binding domain (LBD) of hPPARs.However, such assays are difficult because of the preparation of hPPARs LBD. In order to yield functional hPPARs LBD for screening ligands, hPPARs LBD was fused with maltose-binding protein(MBP) using the pMAL-p2x expression system through the gene engineering technique. The radioligand binding assay showed that MBP did not affect ligand binding with hPPARs LBD in the fusion proteins, which means that MBP-hPPARs LBD can be used instead of hPPARs LBD in ligand screening work. The results show that the new strategy using MBP as a fusion tag for preparing hPPARs LBD for screening ligands is a convenient and reliable method. It may be used to easily obtain the other nuclear receptors.

  20. Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    de Miranda Santos, I.K.; Pereira, M.E.

    1984-09-01

    Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less

  1. Mechanisms underlying radiosensitivity : iIvestigations in xrs-5, an X-ray sensitive hamster cell line

    NASA Astrophysics Data System (ADS)

    Johnston, Peter James

    The damage caused to cells by ionising radiation is believed to center on damage to the DNA. In particular, the induction of DNA double strand breaks (DSB) have been implicated in biological end-points such as cell killing and the formation of chromosomal aberrations. The xrs-5 cell line is a mutant Chinese hamster ovary fibroblast (CHO-K1) mutant which exhibits sensitivity to ionising radiation and a number of other DNA damaging agents. This mutation, postulated to involve the hamster homologue of the human XRCC5 gene, is believed to be involved in the repair of the DSB. In addition, there are constitutive differences between the wild type and xrs cells involving the structure and function of the nucleus and higher order chromatin structures. The aims of this thesis were to study further the xrs-5 cell line and its response to DNA damage and to investigate the possible link between chromatin structure and DSB repair. By the examination of the response of xrs-5 cells to a number of DNA damaging agents and potential modulators of this response using the cytokinesis block micronucleus assay [Fenech and Morley, 1985] a possible cell cycle defect was identified in addition to elevated levels of chromosomal damage. Xrs-5 cells appeared to be partially defective in the cell cycle checkpoints involving the passage from G2 phase to mitosis. By the use of a modified neutral filter elution procedure variations in the repair of DSB were observed between xrs-5 and CHO. Conventional neutral filter elution requires harsh lysis conditions to remove higher order chromatin structures which interfere with the elution of DNA containing DSB. By lysing cells with non-ionic detergent in the presence of 2 M NaC1, histone depleted structures which retain the higher order nuclear matrix organisation, including chromatin loops, can be produced. Elution from these structures will only occur if two or more DSB lie within a single looped domain delineated by points of attachment to the nuclear matrix. Repair experiments indicate that in CHO cells repair of DSB in loops containing multiple DSB are repaired with "slow" kinetics (t1/2 = 5 hrs) whilst DSB occurring in loops containing single DSB are repaired with "fast" kinetics (t1/2 " 10 min). Xrs- 5 cells are incapable of repairing these multiply damaged loops. This work indicates that the spatial orientation of DSB in higher order structures of chromatin are a possible factor in the repair of these lesions. By construction of a mathematical model of the process of elution from chromatin loops it was possible to postulate the size of the loops to approximate to 2.5-3 Mbp. Further evidence of a potential structural defect in the chromatin of xrs-5 cells was provided by examination of the polypeptide composition and DNA binding activity of nuclear extracts. The affinity of extracted proteins for double-stranded calf-thymus DNA was measured in nuclear extracts of xrs-5 and CHO cells. There was an alteration in the DNA binding activity of salt extractable proteins from xrs-5 as measured by a filter binding assay. By the use of SDS-PAGE and the technique of South-Western blotting, it was possible to identify the approximate molecular weights of these DNA binding proteins. Differences were found in DNA binding between proteins from CHO and xrs-5 extracts of both non-irradiated and irradiated cells. Two proteins with apparent molecular weights of 32.2 and 31.8 kDa exhibited a lower DNA binding activity in xrs-5 than proteins of similar extracts from CHO. The amount of the 32.2 kDa protein was less in the xrs-5 extracts than in CHO extracts, as measured by Coomassie blue staining. The two proteins have not yet been identified but comprise a major DNA binding activity in CHO extracts obtained by detergent-free extraction procedures. This work provides circumstantial evidence that suggests these two polypeptides may form part of the histone H1 family.

  2. Ectodysplasin A in Biological Fluids and Diagnosis of Ectodermal Dysplasia.

    PubMed

    Podzus, J; Kowalczyk-Quintas, C; Schuepbach-Mallepell, S; Willen, L; Staehlin, G; Vigolo, M; Tardivel, A; Headon, D; Kirby, N; Mikkola, M L; Schneider, H; Schneider, P

    2017-02-01

    The tumor necrosis factor (TNF) family ligand ectodysplasin A (EDA) is produced as 2 full-length splice variants, EDA1 and EDA2, that bind to EDA receptor (EDAR) and X-linked EDA receptor (XEDAR/EDA2R), respectively. Inactivating mutations in Eda or Edar cause hypohidrotic ectodermal dysplasia (HED), a condition characterized by malformations of the teeth, hair and glands, with milder deficiencies affecting only the teeth. EDA acts early during the development of ectodermal appendages-as early as the embryonic placode stage-and plays a role in adult appendage function. In this study, the authors measured EDA in serum, saliva and dried blood spots. The authors detected 3- to 4-fold higher levels of circulating EDA in cord blood than in adult sera. A receptor binding-competent form of EDA1 was the main form of EDA but a minor fraction of EDA2 was also found in fetal bovine serum. Sera of EDA-deficient patients contained either background EDA levels or low levels of EDA that could not bind to recombinant EDAR. The serum of a patient with a V262F missense mutation in Eda, which caused a milder form of X-linked HED (XLHED), contained low levels of EDA capable of binding to EDAR. In 2 mildly affected carriers, intermediate levels of EDA were detected, whereas a severely affected carrier had no active EDA in the serum. Small amounts of EDA were also detectable in normal adult saliva. Finally, EDA could be measured in spots of wild-type adult or cord blood dried onto filter paper at levels significantly higher than that measured in EDA-deficient blood. Measurement of EDA levels combined with receptor-binding assays might be of relevance to aid in the diagnosis of total or partial EDA deficiencies.

  3. G-quadruplex induced stabilization by 2′-deoxy-2′-fluoro-d-arabinonucleic acids (2′F-ANA)

    PubMed Central

    Peng, Chang Geng; Damha, Masad J.

    2007-01-01

    The impact of 2′-deoxy-2′-fluoroarabinonucleotide residues (2′F-araN) on different G-quadruplexes derived from a thrombin-binding DNA aptamer d(G2T2G2TGTG2T2G2), an anti-HIV phosphorothioate aptamer PS-d(T2G4T2) and a DNA telomeric sequence d(G4T4G4) via UV thermal melting (Tm) and circular dichroism (CD) experiments has been investigated. Generally, replacement of deoxyguanosines that adopt the anti conformation (anti-guanines) with 2′F-araG can stabilize G-quartets and maintain the quadruplex conformation, while replacement of syn-guanines with 2′F-araG is not favored and results in a dramatic switch to an alternative quadruplex conformation. It was found that incorporation of 2′F-araG or T residues into a thrombin-binding DNA G-quadruplex stabilizes the complex (ΔTm up to ∼+3°C/2′F-araN modification); 2′F-araN units also increased the half-life in 10% fetal bovine serum (FBS) up to 48-fold. Two modified thrombin-binding aptamers (PG13 and PG14) show an approximately 4-fold increase in binding affinity to thrombin, as assessed via a nitrocellulose filter binding assay, both with increased thermal stability (∼1°C/2′F-ANA modification increase in Tm) and nuclease resistance (4–7-fold) as well. Therefore, the 2′-deoxy-2′-fluoro-d-arabinonucleic acid (2′F-ANA) modification is well suited to tune (and improve) the physicochemical and biological properties of naturally occurring DNA G-quartets. PMID:17636049

  4. A versatile assay for RNA-binding proteins in living cells

    PubMed Central

    Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo

    2014-01-01

    RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470

  5. Concentration Gradient Immunoassay I. A Rapid Immunoassay Based on Interdiffusion and Surface Binding in a Microchannel

    PubMed Central

    Nelson, Kjell E.; Foley, Jennifer O.; Yager, Paul

    2008-01-01

    We describe a novel microfluidic immunoassay method based on the diffusion of a small molecule analyte into a parallel-flowing stream containing cognate antibody. This interdiffusion results in a steady-state gradient of antibody binding site occupancy transverse to convective flow. In contrast to the diffusion immunoassay (Hatch et al. Nature Biotechnology,19:461−465 (2001)), this antibody occupancy gradient is interrogated by a sensor surface coated with a functional analog of the analyte. Antibodies with at least one unoccupied binding site may specifically bind to this functionalized surface, leading to a quantifiable change in surface coverage by the antibody. SPR imaging is used to probe the spatial distribution of antibody binding to the surface and, therefore, the outcome of the assay. We show that the pattern of antibody binding to the SPR sensing surface correlates with the concentration of a model analyte (phenytoin) in the sample stream. Using an inexpensive disposable microfluidic device, we demonstrate assays for phenytoin ranging in concentration from 75 to 1000 nM in phosphate buffer. At a total volumetric flow rate of 90 nL/sec, the assays are complete within 10 minutes. Inclusion of an additional flow stream on the side of the antibody stream opposite to that of the sample enables simultaneous calibration of the assay. This assay method is suitable for rapid quantitative detection of low-molecular weight analytes for point-of-care diagnostic instrumentation. PMID:17437332

  6. Automated segmentation of comet assay images using Gaussian filtering and fuzzy clustering.

    PubMed

    Sansone, Mario; Zeni, Olga; Esposito, Giovanni

    2012-05-01

    Comet assay is one of the most popular tests for the detection of DNA damage at single cell level. In this study, an algorithm for comet assay analysis has been proposed, aiming to minimize user interaction and providing reproducible measurements. The algorithm comprises two-steps: (a) comet identification via Gaussian pre-filtering and morphological operators; (b) comet segmentation via fuzzy clustering. The algorithm has been evaluated using comet images from human leukocytes treated with a commonly used DNA damaging agent. A comparison of the proposed approach with a commercial system has been performed. Results show that fuzzy segmentation can increase overall sensitivity, giving benefits in bio-monitoring studies where weak genotoxic effects are expected.

  7. Multiplex detection of protein-protein interactions using a next generation luciferase reporter.

    PubMed

    Verhoef, Lisette G G C; Mattioli, Michela; Ricci, Fernanda; Li, Yao-Cheng; Wade, Mark

    2016-02-01

    Cell-based assays of protein-protein interactions (PPIs) using split reporter proteins can be used to identify PPI agonists and antagonists. Generally, such assays measure one PPI at a time, and thus counterscreens for on-target activity must be run in parallel or at a subsequent stage; this increases both the cost and time during screening. Split luciferase systems offer advantages over those that use split fluorescent proteins (FPs). This is since split luciferase offers a greater signal:noise ratio and, unlike split FPs, the PPI can be reversed upon small molecule treatment. While multiplexed PPI assays using luciferase have been reported, they suffer from low signal:noise and require fairly complex spectral deconvolution during analysis. Furthermore, the luciferase enzymes used are large, which limits the range of PPIs that can be interrogated due to steric hindrance from the split luciferase fragments. Here, we report a multiplexed PPI assay based on split luciferases from Photinus pyralis (firefly luciferase, FLUC) and the deep-sea shrimp, Oplophorus gracilirostris (NanoLuc, NLUC). Specifically, we show that the binding of the p53 tumor suppressor to its two major negative regulators, MDM2 and MDM4, can be simultaneously measured within the same sample, without the requirement for complex filters or deconvolution. We provide chemical and genetic validation of this system using MDM2-targeted small molecules and mutagenesis, respectively. Combined with the superior signal:noise and smaller size of split NanoLuc, this multiplexed PPI assay format can be exploited to study the induction or disruption of pairwise interactions that are prominent in many cell signaling pathways. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Improved flow cytometer measurement of binding assays

    DOEpatents

    Saunders, G.C.

    1984-05-30

    The invention relates to a method of measuring binding assays carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also a known quantity of smaller particles with a coating of binder reactant. The binding reactant is the same as the binding reactant present in the sample. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number and strength of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating. (LEW)

  9. The minor house dust mite allergen Der p 13 is a fatty acid-binding protein and an activator of a TLR2-mediated innate immune response.

    PubMed

    Satitsuksanoa, P; Kennedy, M; Gilis, D; Le Mignon, M; Suratannon, N; Soh, W T; Wongpiyabovorn, J; Chatchatee, P; Vangveravong, M; Rerkpattanapipat, T; Sangasapaviliya, A; Piboonpocanun, S; Nony, E; Ruxrungtham, K; Jacquet, A

    2016-10-01

    The house dust mite (HDM) allergen Der p 13 could be a lipid-binding protein able to activate key innate signaling pathways in the initiation of the allergic response. We investigated the IgE reactivity of recombinant Der p 13 (rDer p 13), its lipid-binding activities, and its capacity to stimulate airway epithelium cells. Purified rDer p 13 was characterized by mass spectrometry, circular dichroism, fluorescence-based lipid-binding assays, and in silico structural prediction. IgE-binding activity and allergenic potential of Der p 13 were examined by ELISA, basophil degranulation assays, and in vitro airway epithelial cell activation assays. Protein modeling and biophysical analysis indicated that Der p 13 adopts a β-barrel structure with a predominately apolar pocket representing a potential binding site for hydrophobic ligands. Fluorescent lipid-binding assays confirmed that the protein is highly selective for ligands and that it binds a fatty acid with a dissociation constant typical of lipid transporter proteins. The low IgE-binding frequency (7%, n = 224) in Thai HDM-allergic patients as well as the limited propensity to activate basophil degranulation classifies Der p 13 as a minor HDM allergen. Nevertheless, the protein with its presumptively associated lipid(s) triggered the production of IL-8 and GM-CSF in respiratory epithelial cells through a TLR2-, MyD88-, NF-kB-, and MAPK-dependent signaling pathway. Although a minor allergen, Der p 13 may, through its lipid-binding capacity, play a role in the initiation of the HDM-allergic response through TLR2 activation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

    PubMed

    Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

    2015-05-15

    It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

  11. Synthesis and characterization of a Eu-DTPA-PEGO-MSH(4) derivative for evaluation of binding of multivalent molecules to melanocortin receptors.

    PubMed

    Xu, Liping; Vagner, Josef; Alleti, Ramesh; Rao, Venkataramanarao; Jagadish, Bhumasamudram; Morse, David L; Hruby, Victor J; Gillies, Robert J; Mash, Eugene A

    2010-04-15

    A labeled variant of MSH(4), a tetrapeptide that binds to the human melanocortin 4 receptor (hMC4R) with low microM affinity, was prepared by solid-phase synthesis methods, purified, and characterized. The labeled ligand, Eu-DTPA-PEGO-His-dPhe-Arg-Trp-NH(2), exhibited a K(d) for hMC4R of 9.1+/-1.4 microM, approximately 10-fold lower affinity than the parental ligand. The labeled MSH(4) derivative was employed in a competitive binding assay to characterize the interactions of hMC4R with monovalent and divalent MSH(4) constructs derived from squalene. The results were compared with results from a similar assay that employed a more potent labeled ligand, Eu-DTPA-NDP-alpha-MSH. While results from the latter assay reflected only statistical effects, results from the former assay reflected a mixture of statistical, proximity, and/or cooperative binding effects. Copyright 2010 Elsevier Ltd. All rights reserved.

  12. Screening Anti-Cancer Drugs against Tubulin using Catch-and-Release Electrospray Ionization Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Rezaei Darestani, Reza; Winter, Philip; Kitova, Elena N.; Tuszynski, Jack A.; Klassen, John S.

    2016-05-01

    Tubulin, which is the building block of microtubules, plays an important role in cell division. This critical role makes tubulin an attractive target for the development of chemotherapeutic drugs to treat cancer. Currently, there is no general binding assay for tubulin-drug interactions. The present work describes the application of the catch-and-release electrospray ionization mass spectrometry (CaR-ESI-MS) assay to investigate the binding of colchicinoid drugs to αβ-tubulin dimers extracted from porcine brain. Proof-of-concept experiments using positive (ligands with known affinities) and negative (non-binders) controls were performed to establish the reliability of the assay. The assay was then used to screen a library of seven colchicinoid analogues to test their binding to tubulin and to rank their affinities.

  13. Detection of potential (anti)progestagenic endocrine disruptors using a recombinant human progesterone receptor binding and transactivation assay.

    PubMed

    Viswanath, Gunda; Halder, Sujata; Divya, Gunda; Majumder, Chandrajeet B; Roy, Partha

    2008-11-25

    The present work describes the identification of (anti)progestin endocrine disrupting chemicals (EDC) using a two step screening system. In the first step a competitive binding assay was developed using recombinant human progesterone receptor (hPR). The tested chemicals were of various classes like insecticides, their metabolites, industrial chemicals and waste water treatment plant (WWTP) effluents. All the tested chemicals demonstrated a high affinity binding for hPR. The average IC50 values of the test chemicals were within the range of 1-25microM. In the second step of screening, a mammalian cell-based hPR transactivation assay was developed where HEK 293 cells were co-transfected with hPR and luciferase reporter gene under the control of progesterone-response element. Stimulation of the cells with progesterone resulted in about 25-fold up regulation of luciferase activity, with EC50 value of 4nM. Potent anti-progesterone, RU486, significantly inhibited progesterone-induced transactivation and non-progestagenic steroids failed to transactivate hPR till 1microM concentrations. The chemicals showing high binding affinities in competitive binding assays were then tested in transactivation assay and all of them were found to be anti-progestative except WWTP effluents. Transactivation assays using extracted water samples from five different WWTP effluents showed that it was rich in progestative compounds. The levels of induction caused by these effluents were in the range of 15-25% of induction by progesterone and they represented about 6ng/l equivalent progesterone activities. In conclusion, we demonstrated that this two step assay provides an efficient screening tool for the detection of (anti)progestative EDC in various samples.

  14. In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

    PubMed

    Machida, Kazuya

    2017-01-01

    Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

  15. Recent improvements to Binding MOAD: a resource for protein-ligand binding affinities and structures.

    PubMed

    Ahmed, Aqeel; Smith, Richard D; Clark, Jordan J; Dunbar, James B; Carlson, Heather A

    2015-01-01

    For over 10 years, Binding MOAD (Mother of All Databases; http://www.BindingMOAD.org) has been one of the largest resources for high-quality protein-ligand complexes and associated binding affinity data. Binding MOAD has grown at the rate of 1994 complexes per year, on average. Currently, it contains 23,269 complexes and 8156 binding affinities. Our annual updates curate the data using a semi-automated literature search of the references cited within the PDB file, and we have recently upgraded our website and added new features and functionalities to better serve Binding MOAD users. In order to eliminate the legacy application server of the old platform and to accommodate new changes, the website has been completely rewritten in the LAMP (Linux, Apache, MySQL and PHP) environment. The improved user interface incorporates current third-party plugins for better visualization of protein and ligand molecules, and it provides features like sorting, filtering and filtered downloads. In addition to the field-based searching, Binding MOAD now can be searched by structural queries based on the ligand. In order to remove redundancy, Binding MOAD records are clustered in different families based on 90% sequence identity. The new Binding MOAD, with the upgraded platform, features and functionalities, is now equipped to better serve its users. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Identification of Potent Chemotypes Targeting Leishmania major Using a High-Throughput, Low-Stringency, Computationally Enhanced, Small Molecule Screen

    PubMed Central

    Sharlow, Elizabeth R.; Close, David; Shun, Tongying; Leimgruber, Stephanie; Reed, Robyn; Mustata, Gabriela; Wipf, Peter; Johnson, Jacob; O'Neil, Michael; Grögl, Max; Magill, Alan J.; Lazo, John S.

    2009-01-01

    Patients with clinical manifestations of leishmaniasis, including cutaneous leishmaniasis, have limited treatment options, and existing therapies frequently have significant untoward liabilities. Rapid expansion in the diversity of available cutaneous leishmanicidal chemotypes is the initial step in finding alternative efficacious treatments. To this end, we combined a low-stringency Leishmania major promastigote growth inhibition assay with a structural computational filtering algorithm. After a rigorous assay validation process, we interrogated ∼200,000 unique compounds for L. major promastigote growth inhibition. Using iterative computational filtering of the compounds exhibiting >50% inhibition, we identified 553 structural clusters and 640 compound singletons. Secondary confirmation assays yielded 93 compounds with EC50s ≤ 1 µM, with none of the identified chemotypes being structurally similar to known leishmanicidals and most having favorable in silico predicted bioavailability characteristics. The leishmanicidal activity of a representative subset of 15 chemotypes was confirmed in two independent assay formats, and L. major parasite specificity was demonstrated by assaying against a panel of human cell lines. Thirteen chemotypes inhibited the growth of a L. major axenic amastigote-like population. Murine in vivo efficacy studies using one of the new chemotypes document inhibition of footpad lesion development. These results authenticate that low stringency, large-scale compound screening combined with computational structure filtering can rapidly expand the chemotypes targeting in vitro and in vivo Leishmania growth and viability. PMID:19888337

  17. Evaluation of hemoglobin A1c measurement from filter paper using high-performance liquid chromatography and immunoturbidimetric assay.

    PubMed

    Wu, Yonghua; Yang, Xu; Wang, Haining; Li, Zhenrong; Wang, Tiancheng

    2017-04-01

    Glycated hemoglobin (HbA 1c ) measurement from whole blood (WB) samples is inconvenient for epidemic surveillance and self-monitoring of glycemic level. We evaluated HbA 1c measurement from WB blotted on filter paper (FP), which can be easily transported to central laboratories, with high-performance liquid chromatography (HPLC) and immunoturbidimetric assay (ITA). WB was applied to Whatman filter paper. By using HPLC and WB samples as reference methods, these FP samples were evaluated on HPLC and ITA. Inter- and intra-assay variation, WB vs. FP agreement and sample stability at 20-25 °C and -70 °C were assessed by statistical analysis. Results showed that the coefficient of variation (CV, %) of FP samples for HPLC and ITA were 0.44-1.02% and 1.47-2.72%, respectively (intra-assay); 2.13-3.56% and 3.21-4.82%, respectively (inter-assay). The correlation of WB HPLC with FP analyzed using HPLC and ITA are both significant (p < 0.001). Sample stability showed that FP method up to 5 days at 20-25 °C and 5 weeks at -70 °C is accurate and reproducible. In conclusion, FP samples analyzed by HPLC and ITA can both provide an alternative to WB for HbA 1c measurement, supporting the use of FP method in epidemic surveillance and healthcare units.

  18. Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.

    PubMed

    Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S

    2014-11-01

    A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.

  19. NIP-SNAP-1 and -2 mitochondrial proteins are maintained by heat shock protein 60.

    PubMed

    Yamamoto, Soh; Okamoto, Tomoya; Ogasawara, Noriko; Hashimoto, Shin; Shiraishi, Tsukasa; Sato, Toyotaka; Yamamoto, Keisuke; Tsutsumi, Hiroyuki; Takano, Kenichi; Himi, Testuo; Itoh, Hideaki; Yokota, Shin-Ichi

    2017-02-12

    NIP-SNAP-1 and -2 are ubiquitous proteins thought to be associated with maintenance of mitochondrial function, neuronal transmission, and autophagy. However, their physiological functions remain largely unknown. To elucidate their functional importance, we screened for proteins that interact with NIP-SNAP-1 and -2, resulting in identification of HSP60 and P62/SQSTM1 as binding proteins. NIP-SNAP-1 and -2 localized in the mitochondrial inner membrane space, whereas HSP60 localized in the matrix. Native gel electrophoresis and filter trap assays revealed that human HSP60 prevented aggregation of newly synthesized NIP-SNAP-2 in an in vitro translation system. Moreover, expression levels of NIP-SNAP-1 and -2 in cells were decreased by knockdown of HSP60, but not HSP10. These findings indicate that HSP60 promotes folding and maintains the stability of NIP-SNAP-1 and -2. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Identification of a New Isoindole-2-yl Scaffold as a Qo and Qi Dual Inhibitor of Cytochrome bc 1 Complex: Virtual Screening, Synthesis, and Biochemical Assay.

    PubMed

    Azizian, Homa; Bagherzadeh, Kowsar; Shahbazi, Sophia; Sharifi, Niusha; Amanlou, Massoud

    2017-09-18

    Respiratory chain ubiquinol-cytochrome (cyt) c oxidoreductase (cyt bc 1 or complex III) has been demonstrated as a promising target for numerous antibiotics and fungicide applications. In this study, a virtual screening of NCI diversity database was carried out in order to find novel Qo/Qi cyt bc 1 complex inhibitors. Structure-based virtual screening and molecular docking methodology were employed to further screen compounds with inhibition activity against cyt bc 1 complex after extensive reliability validation protocol with cross-docking method and identification of the best score functions. Subsequently, the application of rational filtering procedure over the target database resulted in the elucidation of a novel class of cyt bc 1 complex potent inhibitors with comparable binding energies and biological activities to those of the standard inhibitor, antimycin.

  1. Microplate-based filter paper assay to measure total cellulase activity.

    PubMed

    Xiao, Zhizhuang; Storms, Reginald; Tsang, Adrian

    2004-12-30

    The standard filter paper assay (FPA) published by the International Union of Pure and Applied Chemistry (IUPAC) is widely used to determine total cellulase activity. However, the IUPAC method is not suitable for the parallel analyses of large sample numbers. We describe here a microplate-based method for assaying large sample numbers. To achieve this, we reduced the enzymatic reaction volume to 60 microl from the 1.5 ml used in the IUPAC method. The modified 60-microl format FPA can be carried out in 96-well assay plates. Statistical analyses showed that the cellulase activities of commercial cellulases from Trichoderma reesei and Aspergillus species determined with our 60-microl format FPA were not significantly different from the activities measured with the standard FPA. Our results also indicate that the 60-microl format FPA is quantitative and highly reproducible. Moreover, the addition of excess beta-glucosidase increased the sensitivity of the assay by up to 60%. 2004 Wiley Periodicals, Inc.

  2. Relative Chemical Binding Affinities for Trout and Human Estrogen Receptor Using Different Competitive Binding Assays

    EPA Science Inventory

    Rainbow trout-based assays for estrogenicity are currently being used for development of predictive models based upon quantitative structure activity relationships. A predictive model based on a single species raises the question of whether this information is valid for other spe...

  3. Integrated Model of Chemical Perturbations of a Biological PathwayUsing 18 In Vitro High Throughput Screening Assays for the Estrogen Receptor

    EPA Science Inventory

    We demonstrate a computational network model that integrates 18 in vitro, high-throughput screening assays measuring estrogen receptor (ER) binding, dimerization, chromatin binding, transcriptional activation and ER-dependent cell proliferation. The network model uses activity pa...

  4. Studies of an alpha-fetoprotein assay using dry blood-spot samples to be used for the detection of fetal neural tube defects.

    PubMed

    Wong, P Y; Mee, A V; Doran, T A

    1982-06-01

    We modified the Pharmacia serum alpha-fetoprotein (AFP) kit to enable its use with dry blood-spots on filter paper. Reference values were established for blood from 253 women in the 16th to 18th weeks of gestation. The result by the present technique in a woman with a confirmed anencephalic fetus was elevated, and in agreement with the results of AFP assays in serum and amniotic fluid. Blood AFP was stable on dried filter paper sent by mail.

  5. A practical approach to automate randomized design of experiments for ligand-binding assays.

    PubMed

    Tsoi, Jennifer; Patel, Vimal; Shih, Judy

    2014-03-01

    Design of experiments (DOE) is utilized in optimizing ligand-binding assay by modeling factor effects. To reduce the analyst's workload and error inherent with DOE, we propose the integration of automated liquid handlers to perform the randomized designs. A randomized design created from statistical software was imported into custom macro converting the design into a liquid-handler worklist to automate reagent delivery. An optimized assay was transferred to a contract research organization resulting in a successful validation. We developed a practical solution for assay optimization by integrating DOE and automation to increase assay robustness and enable successful method transfer. The flexibility of this process allows it to be applied to a variety of assay designs.

  6. Improved flow cytometer measurement of binding assays

    NASA Astrophysics Data System (ADS)

    Saunders, G. C.

    1984-05-01

    A method of measuring binding assays is carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also known quantity of smaller particles with a coating of binder reactant. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating.

  7. D2 dopaminergic and 5-HT1A serotonergic activity of 2-(1-naphthyl)ethyl- and 2-(2-naphthyl)ethyl amines.

    PubMed

    Šukalović, V; Roglić, G; Husinec, S; Kostić-Rajaćić, S; Andrić, D; Šoškić, Vukić

    2003-11-01

    Several tertiary 2-phenylethyl, 2-(1-naphthyl)ethyl and 2-(2-naphthyl)ethyl amines were synthesized and their binding affinities for dopamine D(1), D(2) and serotonin 5-HT(1A) receptors evaluated in radioligand binding assays. All compounds were inactive in D(1) dopamine radioligand binding assay. The 2-(1-naphthyl)ethyl analogues expressed a low but significant binding affinity for the D(2) and moderate one for the 5-HT(1A) receptor subtypes. Most of the remaining compounds expressed binding affinity at the 5-HT(1A) receptor subtype but were inactive in D(2) receptor binding assay. Based on these results and considering the chemical characteristics of the compounds synthesized and evaluated for dopaminergic and serotonergic activity throughout the present study it can be concluded that hydrophobic type of interaction (stacking or edge-to-face) plays a significant role in the formation of receptor-ligand complexes of 2-(1-naphthyl)ethyl amines. This structural motive can be applied to design and synthesize new, more potent dopaminergic/serotonergic ligands by slight chemical modifications.

  8. Detection of Z DNA binding proteins in tissue culture cells.

    PubMed Central

    Leith, I R; Hay, R T; Russell, W C

    1988-01-01

    A gel electrophoresis DNA binding assay to detect Z DNA binding proteins has been developed utilising [32P] labelled poly [d(G-C)] which was converted to the Z form by incubation in 100 microM Co(NH3)6Cl3. The parameters of the assay were established using a Z DNA antibody as a model system and then applied to extracts of Hela and BHK21 cells. Using an anti-Z DNA antibody conditions were established which allowed resolution of antibody-DNA complexes and free DNA in the presence of 100 microM Co(NH3)6Cl3. The inclusion of unlabelled complementary homopolymers eliminated non-specific binding to the labelled Z-DNA probe. Competition experiments demonstrated that the assay was highly specific for double stranded non-B DNA. Application of the technique to extracts of mammalian cells demonstrated that human and hamster cells contain Z-DNA binding proteins; further characterisation by a blotting technique indicated that a 56,000 molecular weight cell protein preferentially binds Z-DNA. Images PMID:3419919

  9. Binding of environmental carcinogens to asbestos and mineral fibres.

    PubMed Central

    Harvey, G; Pagé, M; Dumas, L

    1984-01-01

    A rapid method has been developed for measuring the binding capacity of asbestos and other mineral fibres for environmental carcinogens. Benzo(alpha)pyrene (B(alpha)P), nitrosonornicotine (NNN), and N-acetyl-2-aminofluorene (NAAF) were assayed in the presence of Canadian grade 4T30 chrysotile, chrysotile A, amosite, crocidolite, glass microfibres, glasswool, attapulgite, and titanium dioxide. Chrysotile binds significantly more carcinogens than the other mineral fibres. This binding assay is reproducible with coefficients of variation of less than 8% and 6% respectively for inter and intra assay. The influence of pH was also studied, and there is good correlation between the carcinogen binding and the charge of the tested mineral fibres. The in vitro cytotoxicity on macrophage like cell line P388D1 and the haemolytic activity of various mineral fibres were also measured; a good correlation was found between the binding capacity and the cytotoxicity of tested mineral fibres on P388D1 cells. These results give some explanations for the reported synergism between exposure to asbestos and the smoking habits of workers. PMID:6331497

  10. DNA-aptamers binding aminoglycoside antibiotics.

    PubMed

    Nikolaus, Nadia; Strehlitz, Beate

    2014-02-21

    Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

  11. Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

    NASA Astrophysics Data System (ADS)

    Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

    Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

  12. SH2-PLA: a sensitive in-solution approach for quantification of modular domain binding by proximity ligation and real-time PCR.

    PubMed

    Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya

    2015-06-26

    There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein interaction assays. This feature along with short assay runtime makes this method a useful platform for the development of high throughput assays to determine modular domain-ligand interactions which could have wide-ranging applications in both basic and translational cancer research.

  13. A solid-phase assay for studying direct binding of progranulin to TNFR and progranulin antagonism of TNF/TNFR interactions.

    PubMed

    Tian, Qingyun; Zhao, Shuai; Liu, Chuanju

    2014-01-01

    The discovery that TNF receptors (TNFR) serve as the binding receptors for progranulin (PGRN) reveals the significant role of PGRN in inflammatory and autoimmune diseases, including inflammatory arthritis. Herein we describe a simple, antibody-free analytical assay, i.e., a biotin-based solid-phase binding assay, to examine the direct interaction of PGRN/TNFR and the PGRN inhibition of TNF/TNFR interactions. Briefly, a 96-well high-binding microplate is first coated with the first protein (protein A), and after blocking, the coated microplate is incubated with the biotin-labeled second protein (protein B) in the absence or presence of the third protein (protein C). Finally the streptavidin conjugated with a detecting enzyme is added, followed by a signal measurement. Also discussed in this chapter are the advantages of the strategy, key elements to obtain reliable results, and discrepancies among various PGRN proteins in view of the binding activity with TNFR.

  14. Comprehensive analysis of T cell epitope discovery strategies using 17DD yellow fever virus structural proteins and BALB/c (H2d) mice model.

    PubMed

    Maciel, Milton; Kellathur, Srinivasan N; Chikhlikar, Pryia; Dhalia, Rafael; Sidney, John; Sette, Alessandro; August, Thomas J; Marques, Ernesto T A

    2008-08-15

    Immunomics research uses in silico epitope prediction, as well as in vivo and in vitro approaches. We inoculated BALB/c (H2d) mice with 17DD yellow fever vaccine to investigate the correlations between approaches used for epitope discovery: ELISPOT assays, binding assays, and prediction software. Our results showed a good agreement between ELISPOT and binding assays, which seemed to correlate with the protein immunogenicity. PREDBALB/c prediction software partially agreed with the ELISPOT and binding assay results, but presented low specificity. The use of prediction software to exclude peptides containing no epitopes, followed by high throughput screening of the remaining peptides by ELISPOT, and the use of MHC-biding assays to characterize the MHC restrictions demonstrated to be an efficient strategy. The results allowed the characterization of 2 MHC class I and 17 class II epitopes in the envelope protein of the YF virus in BALB/c (H2d) mice.

  15. Development of binding assays for the SH2 domain of Grb7 and Grb2 using fluorescence polarization.

    PubMed

    Luzy, Jean-Philippe; Chen, Huixiong; Gril, Brunilde; Liu, Wang-Qing; Vidal, Michel; Perdereau, Dominique; Burnol, Anne-Françoise; Garbay, Christiane

    2008-02-01

    Adaptor proteins Grb7 and Grb2 have been implicated as being 2 potential therapeutic targets in several human cancers, especially those that overexpress ErbB2. These 2 proteins contain both a SH2 domain (Src homology 2) that binds to phosphorylated tyrosine residues contained within ErbB2 and other specific protein targets. Two assays based on enzyme-linked immunosorbent assay and fluorescence polarization methods have been developed and validated to find and rank inhibitors for both proteins binding to the pY(1139). Fluorescence polarization assays allowed the authors to determine quickly and reproducibly affinities of peptides from low nanomolar to high micromolar range and to compare them directly for Grb7 and Grb2. As a result, the assays have identified a known peptidomimetic Grb2 SH2 inhibitor (mAZ-pTyr-(alphaMe)pTyr-Asn-NH(2)) that exhibits the most potent affinity for the Grb7 SH2 domain described to date.

  16. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  17. Laboratory Testing for von Willebrand Disease: The Past, Present, and Future State of Play for von Willebrand Factor Assays that Measure Platelet Binding Activity, with or without Ristocetin.

    PubMed

    Just, Sarah

    2017-02-01

    von Willebrand disease (VWD) was first described nearly a century ago in 1924 by Erik Adolf von Willebrand. Diagnostic testing at the time was very limited and it was not until the mid to late 1900s that more tests became available to assist with the diagnosis and classification of VWD. Two of these tests are based on ristocetin, one being ristocetin-induced platelet aggregation (RIPA) and the other the von Willebrand factor (VWF) ristocetin cofactor assay (VWF:RCo). The VWF:RCo assay provides functional assessment of in vitro VWF binding to the platelet glycoprotein (Gp) complex, GPIb-IX-V. Despite some advancements and newer technologies utilizing the principles of the original VWF:RCo assay, the original assay is still referred to as the gold standard for measurement of VWF activity. This article will review the history of VWD diagnostic assays, including RIPA and VWF:RCo over the past 40 years, as well as the newer assays that measure platelet binding with or without ristocetin, and which have been developed with the aim to potentially replace platelet-based ristocetin-dependent assays. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

  18. Structural Transformation Detection Contributes to Screening of Behaviorally Active Compounds: Dynamic Binding Process Analysis of DhelOBP21 from Dastarcus helophoroides.

    PubMed

    Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun

    2017-12-01

    In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.

  19. Binding determinants in the interplay between porcine aminopeptidase N and enterotoxigenic Escherichia coli F4 fimbriae.

    PubMed

    Xia, Pengpeng; Quan, Guomei; Yang, Yi; Zhao, Jing; Wang, Yiting; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Jianzhong; Liu, Siguo; Zhu, Guoqiang

    2018-02-26

    The binding of F4 + enterotoxigenic Escherichia coli (ETEC) and the specific receptor on porcine intestinal epithelial cells is the initial step in F4 + ETEC infection. Porcine aminopeptidase N (APN) is a newly discovered receptor for F4 fimbriae that binds directly to FaeG adhesin, which is the major subunit of the F4 fimbriae variants F4ab, F4ac, and F4ad. We used overlapping peptide assays to map the APN-FaeG binding sites, which has facilitated in the identifying the APN-binding amino acids that are located in the same region of FaeG variants, thereby limiting the major binding regions of APN to 13 peptides. To determine the core sequence motif, a panel of FaeG peptides with point mutations and FaeG mutants were constructed. Pull-down and binding reactivity assays using piglet intestines determined that the amino acids G159 of F4ab, N209 and L212 of F4ac, and A200 of F4ad were the critical residues for APN binding of FaeG. We further show using ELISA and confocal microscopy assay that amino acids 553-568, and 652-670 of the APN comprise the linear epitope for FaeG binding in all three F4 fimbriae variants.

  20. Chemotaxis of nurse shark leukocytes.

    PubMed

    Obenauf, S D; Smith, S H

    1985-01-01

    Studies were conducted to determine the ability of leukocytes from the nurse shark to migrate in an in vitro micropore filter chemotaxis assay and to determine optimal assay conditions and suitable attractants for such an assay. A migratory response was seen with several attractants: activated rat serum, activated shark plasma, and a pool of shark complement components. Only the response to activated rat serum was chemotactic, as determined by the checkerboard assay.

  1. Substitution of synthetic chimpanzee androgen receptor for human androgen receptor in competitive binding and transcriptional activation assays for EDC screening

    EPA Science Inventory

    The potential effect of receptor-mediated endocrine modulators across species is of increasing concern. In attempts to address these concerns we are developing androgen and estrogen receptor binding assays using recombinant hormone receptors from a number of species across differ...

  2. RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

    EPA Science Inventory

    Rainbow Trout Androgen Receptor Alpha And Human Androgen Receptor: Comparisons in the COS Whole Cell Binding Assay
    Mary C. Cardon, L. Earl Gray, Jr. and Vickie S. Wilson
    U.S. Environmental Protection Agency, ORD, NHEERL, Reproductive Toxicology Division, Research Triangle...

  3. Preclinical Evaluation of [(18)F]THK-5105 Enantiomers: Effects of Chirality on Its Effectiveness as a Tau Imaging Radiotracer.

    PubMed

    Tago, Tetsuro; Furumoto, Shozo; Okamura, Nobuyuki; Harada, Ryuichi; Adachi, Hajime; Ishikawa, Yoichi; Yanai, Kazuhiko; Iwata, Ren; Kudo, Yukitsuka

    2016-04-01

    Noninvasive imaging of tau and amyloid-β pathologies would facilitate diagnosis of Alzheimer's disease (AD). Recently, we have developed [(18)F]THK-5105 for selective detection of tau pathology by positron emission tomography (PET). The purpose of this study was to clarify biological properties of optically pure [(18)F]THK-5105 enantiomers. Binding for tau aggregates in AD brain section was evaluated by autoradiography (ARG). In vitro binding assays were performed to evaluate the binding properties of enantiomers for AD brain homogenates. The pharmacokinetics in the normal mouse brains was assessed by ex vivo biodistribution assay The ARG of enantiomers showed the high accumulation of radioactivity corresponding to the distribution of tau deposits. In vitro binding assays revealed that (S)-[(18)F]THK-5105 has slower dissociation from tau than (R)-[(18)F]THK-5105. Biodistribution assays indicated that (S)-[(18)F]THK-5105 eliminated faster from the mouse brains and blood compared with (R)-[(18)F]THK-5105. (S)-[(18)F]THK-5105 could be more suitable than (R)-enantiomer for a tau imaging agent.

  4. The combination of two novel tobacco blends and filter technologies to reduce the in vitro genotoxicity and cytotoxicity of prototype cigarettes.

    PubMed

    Crooks, Ian; Scott, Ken; Dalrymple, Annette; Dillon, Debbie; Meredith, Clive

    2015-04-01

    Tobacco smoke from a combustible cigarette contains more than 6000 constituents; approximately 150 of these are identified as toxicants. Technologies that modify the tobacco blend to reduce toxicant emissions have been developed. These include tobacco sheet substitute to dilute toxicants in smoke and blend treated tobacco to reduce the levels of nitrogenous precursors and some polyphenols. Filter additives to reduce gas (vapour) phase constituents have also been developed. In this study, both tobacco blend and filter technologies were combined into an experimental cigarette and smoked to International Organisation on Standardisation and Health Canada puffing parameters. The resulting particulate matter was subjected to a battery of in vitro genotoxicity and cytotoxicity assays - the Ames test, mouse lymphoma assay, the in vitro micronucleus test and the Neutral Red Uptake assay. The results indicate that cigarettes containing toxicant reducing technologies may be developed without observing new additional genotoxic hazards as assessed by the assays specified. In addition, reductions in bacterial mutagenicity and mammalian genotoxicity of the experimental cigarette were observed relative to the control cigarettes. There were no significant differences in cytotoxicity relative to the control cigarettes. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  5. DETECTION BY PCR OF HUMAN ENTERIC VIRUSES CONCENTRATED FROM LARGE VOLUMES OF WATER

    EPA Science Inventory

    Viruses are recovered and concentrated from water by passage through a positively charged cartridge filter. Following virus elution from the cartridge filter with beef extract and concentration of the beef extract solution, viruses are usually assayed by cell culture. However...

  6. Identification of benzothiazoles as potential polyglutamine aggregation inhibitors of Huntington's disease by using an automated filter retardation assay

    PubMed Central

    Heiser, Volker; Engemann, Sabine; Bröcker, Wolfgang; Dunkel, Ilona; Boeddrich, Annett; Waelter, Stephanie; Nordhoff, Eddi; Lurz, Rudi; Schugardt, Nancy; Rautenberg, Susanne; Herhaus, Christian; Barnickel, Gerhard; Böttcher, Henning; Lehrach, Hans; Wanker, Erich E.

    2002-01-01

    Preventing the formation of insoluble polyglutamine containing protein aggregates in neurons may represent an attractive therapeutic strategy to ameliorate Huntington's disease (HD). Therefore, the ability to screen for small molecules that suppress the self-assembly of huntingtin would have potential clinical and significant research applications. We have developed an automated filter retardation assay for the rapid identification of chemical compounds that prevent HD exon 1 protein aggregation in vitro. Using this method, a total of 25 benzothiazole derivatives that inhibit huntingtin fibrillogenesis in a dose-dependent manner were discovered from a library of ≈184,000 small molecules. The results obtained by the filter assay were confirmed by immunoblotting, electron microscopy, and mass spectrometry. Furthermore, cell culture studies revealed that 2-amino-4,7-dimethyl-benzothiazol-6-ol, a chemical compound similar to riluzole, significantly inhibits HD exon 1 aggregation in vivo. These findings may provide the basis for a new therapeutic approach to prevent the accumulation of insoluble protein aggregates in Huntington's disease and related glutamine repeat disorders. PMID:12200548

  7. Functional coupling between adenosine A1 receptors and G-proteins in rat and postmortem human brain membranes determined with conventional guanosine-5'-O-(3-[35S]thio)triphosphate ([35S]GTPγS) binding or [35S]GTPγS/immunoprecipitation assay.

    PubMed

    Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A

    2018-06-01

    Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.

  8. Geraniin extracted from the rind of Nephelium lappaceum binds to dengue virus type-2 envelope protein and inhibits early stage of virus replication.

    PubMed

    Abdul Ahmad, Siti Aisyah; Palanisamy, Uma D; Tejo, Bimo A; Chew, Miaw Fang; Tham, Hong Wai; Syed Hassan, Sharifah

    2017-11-21

    The rapid rise and spread in dengue cases, together with the unavailability of safe vaccines and effective antiviral drugs, warrant the need to discover and develop novel anti-dengue treatments. In this study the antiviral activity of geraniin, extracted from the rind of Nephelium lappaceum, against dengue virus type-2 (DENV-2) was investigated. Geraniin was prepared from Nephelium lappaceum rind by reverse phase C-18 column chromatography. Cytotoxicity of geraniin towards Vero cells was evaluated using MTT assay while IC 50 value was determined by plaque reduction assay. The mode-of-action of geraniin was characterized using the virucidal, attachment, penetration and the time-of-addition assays'. Docking experiments with geraniin molecule and the DENV envelope (E) protein was also performed. Finally, recombinant E Domain III (rE-DIII) protein was produced to physiologically test the binding of geraniin to DENV-2 E-DIII protein, through ELISA competitive binding assay. Cytotoxicity assay confirmed that geraniin was not toxic to Vero cells, even at the highest concentration tested. The compound exhibited DENV-2 plaque formation inhibition, with an IC 50 of 1.75 μM. We further revealed that geraniin reduced viral infectivity and inhibited DENV-2 from attaching to the cells but had little effect on its penetration. Geraniin was observed to be most effective when added at the early stage of DENV-2 infection. Docking experiments showed that geraniin binds to DENV E protein, specifically at the DIII region, while the ELISA competitive binding assay confirmed geraniin's interaction with rE-DIII with high affinity. Geraniin from the rind of Nephelium lappaceum has antiviral activity against DENV-2. It is postulated that the compound inhibits viral attachment by binding to the E-DIII protein and interferes with the initial cell-virus interaction. Our results demonstrate that geraniin has the potential to be developed into an effective antiviral treatment, particularly for early phase dengue viral infection.

  9. Method for screening inhibitors of the toxicity of Bacillus anthracis

    DOEpatents

    Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

    2001-01-01

    The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

  10. Surface plasmon resonance as a tool for ligand-binding assay reagent characterization in bioanalysis of biotherapeutics.

    PubMed

    Duo, Jia; Bruno, JoAnne; Kozhich, Alexander; David-Brown, Donata; Luo, Linlin; Kwok, Suk; Santockyte, Rasa; Haulenbeek, Jonathan; Liu, Rong; Hamuro, Lora; Peterson, Jon E; Piccoli, Steven; DeSilva, Binodh; Pillutla, Renuka; Zhang, Yan J

    2018-04-01

    Ligand-binding assay (LBA) performance depends on quality reagents. Strategic reagent screening and characterization is critical to LBA development, optimization and validation. Application of advanced technologies expedites the reagent screening and assay development process. By evaluating surface plasmon resonance technology that offers high-throughput kinetic information, this article aims to provide perspectives on applying the surface plasmon resonance technology to strategic LBA critical reagent screening and characterization supported by a number of case studies from multiple biotherapeutic programs.

  11. A Comparison of Protein Kinases Inhibitor Screening Methods Using Both Enzymatic Activity and Binding Affinity Determination

    PubMed Central

    Rudolf, Amalie Frederikke; Skovgaard, Tine; Knapp, Stefan; Jensen, Lars Juhl; Berthelsen, Jens

    2014-01-01

    Binding assays are increasingly used as a screening method for protein kinase inhibitors; however, as yet only a weak correlation with enzymatic activity-based assays has been demonstrated. We show that the correlation between the two types of assays can be improved using more precise screening conditions. Furthermore a marked improvement in the correlation was found by using kinase constructs containing the catalytic domain in presence of additional domains or subunits. PMID:24915177

  12. Binding Assays Using Recombinant SH2 Domains: Far-Western, Pull-Down, and Fluorescence Polarization.

    PubMed

    Machida, Kazuya; Liu, Bernard

    2017-01-01

    Recognition of phosphotyrosine-containing sequences by SH2 domains confers specificity in tyrosine kinase pathways. By assessing interactions between isolated SH2 domains and their binding proteins, it is possible to gain insight into otherwise inaccessible complex cellular systems. Far-Western, pull-down, and fluorescence polarization (FP) have been frequently used for characterization of phosphotyrosine signaling. Here, we outline standard protocols for these established assays using recombinant SH2 domain, emphasizing the importance of appropriate sample preparation and assay controls.

  13. New Horizons on Molecular Pharmacology Applied to Drug Discovery: When Resonance Overcomes Radioligand Binding.

    PubMed

    Pernomian, Larissa; Gomes, Mayara Santos; Moreira, Josimar Dornelas; da Silva, Carlos Henrique Tomich de Paula; Rosa, Joaquin Maria Campos; Cardoso, Cristina Ribeiro de Barros

    2017-01-01

    One of the cornerstones of rational drug development is the measurement of molecular parameters derived from ligand-receptor interaction, which guides therapeutic windows definition. Over the last decades, radioligand binding has provided valuable contributions in this field as key method for such purposes. However, its limitations spurred the development of more exquisite techniques for determining such parameters. For instance, safety risks related to radioactivity waste, expensive and controlled disposal of radioisotopes, radiotracer separation-dependence for affinity analysis, and one-site mathematical models-based fitting of data make radioligand binding a suboptimal approach in providing measures of actual affinity conformations from ligands and G proteincoupled receptors (GPCR). Current advances on high-throughput screening (HTS) assays have markedly extended the options of sparing sensitive ways for monitoring ligand affinity. The advent of the novel bioluminescent donor NanoLuc luciferase (Nluc), engineered from Oplophorus gracilirostris luciferase, allowed fitting bioluminescence resonance energy transfer (BRET) for monitoring ligand binding. Such novel approach named Nluc-based BRET (NanoBRET) binding assay consists of a real-time homogeneous proximity assay that overcomes radioligand binding limitations but ensures the quality in affinity measurements. Here, we cover the main advantages of NanoBRET protocol and the undesirable drawbacks of radioligand binding as molecular methods that span pharmacological toolbox applied to Drug Discovery. Also, we provide a novel perspective for the application of NanoBRET technology in affinity assays for multiple-state binding mechanisms involving oligomerization and/or functional biased selectivity. This new angle was proposed based on specific biophysical criteria required for the real-time homogeneity assigned to the proximity NanoBRET protocol. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. Lipid Microarray Biosensor for Biotoxin Detection.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Anup K.; Throckmorton, Daniel J.; Moran-Mirabal, Jose C.

    2006-05-01

    We present the use of micron-sized lipid domains, patterned onto planar substrates and within microfluidic channels, to assay the binding of bacterial toxins via total internal reflection fluorescence microscopy (TIRFM). The lipid domains were patterned using a polymer lift-off technique and consisted of ganglioside-populated DSPC:cholesterol supported lipid bilayers (SLBs). Lipid patterns were formed on the substrates by vesicle fusion followed by polymer lift-off, which revealed micron-sized SLBs containing either ganglioside GT1b or GM1. The ganglioside-populated SLB arrays were then exposed to either Cholera toxin subunit B (CTB) or Tetanus toxin fragment C (TTC). Binding was assayed on planar substrates bymore » TIRFM down to 1 nM concentration for CTB and 100 nM for TTC. Apparent binding constants extracted from three different models applied to the binding curves suggest that binding of a protein to a lipid-based receptor is strongly affected by the lipid composition of the SLB and by the substrate on which the bilayer is formed. Patterning of SLBs inside microfluidic channels also allowed the preparation of lipid domains with different compositions on a single device. Arrays within microfluidic channels were used to achieve segregation and selective binding from a binary mixture of the toxin fragments in one device. The binding and segregation within the microfluidic channels was assayed with epifluorescence as proof of concept. We propose that the method used for patterning the lipid microarrays on planar substrates and within microfluidic channels can be easily adapted to proteins or nucleic acids and can be used for biosensor applications and cell stimulation assays under different flow conditions. KEYWORDS. Microarray, ganglioside, polymer lift-off, cholera toxin, tetanus toxin, TIRFM, binding constant.4« less

  15. Identification of second arginine-glycine-aspartic acid motif of ovine vitronectin as the complement C9 binding site and its implication in bacterial infection.

    PubMed

    Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi

    2017-02-01

    Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  16. Circulating Immune Complexes in Lyme Arthritis

    PubMed Central

    Hardin, John A.; Walker, Lesley C.; Steere, Allen C.; Trumble, Thomas C.; Tung, Kenneth S. K.; Williams, Ralph C.; Ruddy, Shaun; Malawista, Stephen E.

    1979-01-01

    We have found immunoglobulin (Ig) G-containing material consistent with immune complexes in the sera of patients with Lyme arthritis. It was detected in 29 of 55 sera (55%) from 31 patients by at least one of three assays: 125I-C1q binding, C1q solid phase, or Raji cell. The presence of reactive material correlated with clinical aspects of disease activity; it was found early in the illness, was most prominent in sera from the sickest patients, was infrequent during remissions, and often fluctuated in parallel with changes in clinical status. The results in the two C1q assays showed a strong positive correlation (P<0.001). They were each elevated in 45% of the sera and were usually concordant (85%). In contrast, the Raji cell assay was less frequently positive and often discordant with the C1q assays. In sucrose density gradients, putative circulating immune complexes sedimented near 19S; they, too, were detected best by the two assays based on C1q binding. An additional 7S component was found in some sera by the 125I-C1q binding assay. Serum complement was often above the range of normal in patients with mild disease and normal in patients with severe disease but did not correlate significantly with levels of circulating immune complexes. IgM and IgG rheumatoid factors were not detectable. These findings support a role for immune complexes in the pathogenesis of Lyme arthritis. Their measurement, by either the 125I-C1q binding assay or by the C1q solid phase assay, often provides a sensitive index of disease activity. Moreover, the complexes are likely sources of disease-related antigens for further study of this new disorder. PMID:429566

  17. SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

    PubMed

    Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

    2018-05-22

    Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

  18. Development of a paper-based carbon nanotube sensing microfluidic device for biological detection.

    PubMed

    Yang, Shih-I; Lei, Kin Fong; Tsai, Shiao-Wen; Hsu, Hsiao-Ting

    2013-01-01

    Carbon nanotube (CNT) has been utilized for the biological detection due to its extremely sensitive to biological molecules. A paper-based CNT sensing microfluidic device has been developed for the detection of protein, i.e., biotin-avidin, binding. We have developed a fabrication method that allows controlled deposition of bundled CNTs with well-defined dimensions to form sensors on paper. Then, polydimethyl siloxane (PDMS) was used to pattern the hydrophobic boundary on paper to form the reaction sites. The proposed fabrication method is based on vacuum filtration process with a metal mask covering on a filter paper for the definition of the dimension of sensor. The length, width, and thickness of the CNT-based sensors are readily controlled by the metal mask and the weight of the CNT powder used during the filtration process, respectively. Homogeneous deposition of CNTs with well-defined dimensions can be achieved. The CNT-based sensor on paper has been demonstrated on the detection of the protein binding. Biotin was first immobilized on the CNT's sidewall and avidin suspended solution was applied to the site. The result of the biotin-avidin binding was measured by the resistance change of the sensor, which is a label-free detection method. It showed the CNT is sensitive to the biological molecules and the proposed paper-based CNT sensing device is a possible candidate for point-of-care biosensors. Thus, electrical bio-assays on paper-based microfluidics can be realized to develop low cost, sensitive, and specific diagnostic devices.

  19. Two novel assays for the detection of haemin-binding properties of antimalarials evaluated with compounds isolated from medicinal plants.

    PubMed

    Steele, J C P; Phelps, R J; Simmonds, M S J; Warhurst, D C; Meyer, D J

    2002-07-01

    Forty-two compounds isolated from nine plants used within South America for the treatment of malaria were tested for haemin binding using two novel, rapid screening methods. The data obtained were analysed with respect to IC(50) values for in vitro toxicity to Plasmodium falciparum trophozoites. One method, a multiwell assay based on the inhibition of the interaction of haemin with glutathione (GSH), is sensitive in the 10 microM range, takes c. 1 h and is suitable for either a high throughput screen or rapid assay during natural product isolation. Of 19 compounds showing antiplasmodial activity (IC(50) < 40 microM), 16 (84%) showed >40% inhibition of GSH-haemin reaction. The sensitivity and specificity of the assay were 0.85 and 0.82, respectively. The positive predictive value was 0.81 and the negative predictive value 0.86. A more sensitive assay (0.1 microM range) is based on the reversal by haemin-binding compounds of the haemin inhibition of the L-dopachrome-methyl ester tautomerase activity of human macrophage migration inhibitory factor. This assay gives a better idea of the affinity of interaction and uses very small amounts of test compound. The log[RI(50)] of eight of the compounds that tested positive in the above assays together with those of quinine and chloroquine showed a positive correlation with log[antiplasmodial IC(50)] for strain T9-96 (r = 0.824) and strain K1 (r = 0.904). Several of the antimalarial compounds that bind haemin are isoquinolines, a class not shown previously to interact with haemin.

  20. Technological advances in diagnostic testing for von Willebrand disease: new approaches and challenges.

    PubMed

    Hayward, C P M; Moffat, K A; Graf, L

    2014-06-01

    Diagnostic tests for von Willebrand disease (VWD) are important for the assessment of VWD, which is a commonly encountered bleeding disorder worldwide. Technical innovations have been applied to improve the precision and lower limit of detection of von Willebrand factor (VWF) assays, including the ristocetin cofactor activity assay (VWF:RCo) that uses the antibiotic ristocetin to induce plasma VWF binding to glycoprotein (GP) IbIXV on target platelets. VWF-collagen-binding assays, depending on the type of collagen used, can improve the detection of forms of VWD with high molecular weight VWF multimer loss, although the best method is debatable. A number of innovations have been applied to VWF:RCo (which is commonly performed on an aggregometer), including replacing the target platelets with immobilized GPIbα, and quantification by an enzyme-linked immunosorbent assay (ELISA), immunoturbidimetric, or chemiluminescent end-point. Some common polymorphisms in the VWF gene that do not cause bleeding are associated with falsely low VWF activity by ristocetin-dependent methods. To overcome the need for ristocetin, some new VWF activity assays use gain-of-function GPIbα mutants that bind VWF without the need for ristocetin, with an improved precision and lower limit of detection than measuring VWF:RCo by aggregometry. ELISA of VWF binding to mutated GPIbα shows promise as a method to identify gain-of-function defects from type 2B VWD. The performance characteristics of many new VWF activity assays suggest that the detection of VWD, and monitoring of VWD therapy, by clinical laboratories could be improved through adopting newer generation VWF assays. © 2014 John Wiley & Sons Ltd.

  1. A rapid two dot filter assay for the detection of E. coli O157 in water samples.

    PubMed

    Kamma, Sujatha; Tang, Lily; Leung, Kelvin; Ashton, Edie; Newman, Norman; Suresh, Mavanur R

    2008-07-31

    E. coli O157:H7 is an enterohemorrhagic bacteria that cause deadly water-borne infections implicated in outbreaks of a wide spectrum of human gastrointestinal diseases. It is therefore important to have a rapid convenient, simple and sensitive range of detection of E. coli O157:H7. A new E. coli O157 MAb designated P124 was developed for ultrasensitive detection of E. coli O157 in water, apple juice and beef for routine use. A prototype filter dot assay was designed with anti-E. coli O157 MAb bound to 0.2 microm nitrocellulose filter disk as the capture antibody. A 100 ml water sample spiked with 1-50 CFU of E. coli O157 either in the presence or absence of other non-specific bacteria were filtered for capture of the pathogen on the antibody coated nitrocellulose disk. The detection of the pathogen was successfully accomplished by the same antibody both as a capture and detecting antibody as a homosandwich. In a non-enriched format, detection of E. coli was possible with a sensitivity of 2500 CFU/100 ml. Ultrasensitive detection of ~1 CFU/100 ml sample could be achieved by a prior pathogen enrichment step before the addition of the labeled antibody. The design of this diagnostic test is based on the common architecture of all bacteria, viruses and spores, namely the manifestation of repeat lipopolysaccharide epitopes on the surface. We have developed an easy-to-use two dot visual filter assay for translation into current water testing in public health laboratories to detect E. coli O157:H7. In a 5 h assay approximately 1 CFU and approximately 5 CFU of E. coli O157 could be detected in 100 ml of water or juice and lake samples respectively. This simple homosandwich enrichment strategy can also be used to detect low levels of other water-borne pathogens.

  2. A Simple Method to Quantitate IP-10 in Dried Blood and Plasma Spots

    PubMed Central

    Aabye, Martine G.; Eugen-Olsen, Jesper; Werlinrud, Anne Marie; Holm, Line Lindebo; Tuuminen, Tamara; Ravn, Pernille; Ruhwald, Morten

    2012-01-01

    Background Antigen specific release of IP-10 is an established marker for infection with M.tuberculosis. Compared to IFN-γ, IP-10 is released in 100-fold higher concentrations enabling the development of novel assays for detection. Dried blood spots are a convenient sample for high throughput newborn screening. Aim To develop a robust and sensitive ELISA-based assay for IP-10 detection in plasma, dried blood spots (DBS) and dried plasma spots (DPS); to validate the ELISA in clinically relevant samples; and to assess the performance of the assay for detection of Cytomegalovirus (CMV) and M.tuberculosis specific immune responses. Method We raised mice and rat monoclonal antibodies against human IP-10 and developed an ELISA. The assay was validated and applied to the detection of CMV and M.tuberculosis specific responses in 18 patients with immune reactivity towards M.tuberculosis and 32 healthy controls of which 22 had immune reactivity towards CMV and none towards M.tuberculosis. We compared the performance of this new assay to IFN-γ. Results The ELISA was reliable for IP-10 detection in both plasma and filter paper samples. The linear range of the ELISA was 2.5–600 pg/ml. IFN-γ was not readily detectable in DPS samples. IP-10 was stabile in filter paper samples for at least 4 weeks at 37°C. The correlation between IP-10 detected in plasma, DPS and DBS samples was excellent (r2>0.97). Conclusions This newly developed assay is reliable for IP-10 quantification in plasma, DBS and DPS samples from antigen stimulated and non-stimulated whole blood. The filter paper assays enable easy sample acquisition and transport at ambient temperature e.g. via the postal system. The system can potentially simplify diagnostic assays for M.tuberculosis and CMV infection. PMID:22761744

  3. Analysis of molecular determinants of affinity and relative efficacy of a series of R- and S-2-(dipropylamino)tetralins at the 5-HT1A serotonin receptor

    PubMed Central

    Alder, J Tracy; Hacksell, Uli; Strange, Philip G

    2003-01-01

    Factors influencing agonist affinity and relative efficacy have been studied for the 5-HT1A serotonin receptor using membranes of CHO cells expressing the human form of the receptor and a series of R-and S-2-(dipropylamino)tetralins (nonhydroxylated and monohydroxylated (5-OH, 6-OH, 7-OH, 8-OH) species). Ligand binding studies were used to determine dissociation constants for agonist binding to the 5-HT1A receptor: Ki values for agonists were determined in competition versus the binding of the agonist [3H]-8-OH DPAT. Competition data were all fitted best by a one-binding site model.Ki values for agonists were also determined in competition versus the binding of the antagonist [3H]-NAD-199. Competition data were all fitted best by a two-binding site model, and agonist affinities for the higher (Kh) and lower affinity (Kl) sites were determined. The ability of the agonists to activate the 5-HT1A receptor was determined using stimulation of [35S]-GTPγS binding. Maximal effects of agonists (Emax) and their potencies (EC50) were determined from concentration/response curves for stimulation of [35S]-GTPγS binding. Kl/Kh determined from ligand binding assays correlated with the relative efficacy (relative Emax) of agonists determined in [35S]-GTPγS binding assays. There was also a correlation between Kl/Kh and Kl/EC50 for agonists determined from ligand binding and [35S]-GTPγS binding assays. Simulations of agonist binding and effect data were performed using the Ternary Complex Model in order to assess the use of Kl/Kh for predicting the relative efficacy of agonists. PMID:12684269

  4. Comparison of Chemical Binding to Recombinant Fathead minnow and Human Estrogen Receptor alpha (ERα) in Whole Cell and Cell-Free Assay Systems.

    EPA Science Inventory

    Our objectives were to assess whether binding of chemicals differs significantly between recombinant estrogen receptors from fathead minnow (fhERα) and human (hERα) and to evaluate the performance of these receptors using two different in vitro assay systems: a COS whole cell bin...

  5. RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

    EPA Science Inventory

    RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY.
    MC Cardon, PC Hartig,LE Gray, Jr. and VS Wilson.
    U.S. EPA, ORD, NHEERL, RTD, Research Triangle Park, NC, USA.
    Typically, in vitro hazard assessments for ...

  6. Measurement of Bluetongue Virus Binding to a Mammalian Cell Surface Receptor by an In Situ Immune Fluorescent Staining Technique

    USDA-ARS?s Scientific Manuscript database

    A quantifiable in situ immune fluorescent assay (IFA) was developed to measure bluetongue virus (BTV) binding to mammalian cells. The utility of the assay was demonstrated with both Chinese hamster ovary (CHO) and bovine pulmonary artery endothelial (CPAE) cells. Since heparin sulfate (HS) has been ...

  7. An innovative and highly drug-tolerant approach for detecting neutralizing antibodies directed to therapeutic antibodies.

    PubMed

    Sloan, John H; Conway, Richard G; Pottanat, Thomas G; Troutt, Jason S; Higgs, Richard E; Konrad, Robert J; Qian, Yue-Wei

    2016-10-01

    Immunogenicity testing of biotherapeutic drugs is a regulatory requirement. Herein, we describe a drug-tolerant assay for detecting neutralizing antibodies against a therapeutic antibody. Excess target of the therapeutic antibody was incorporated into the detection step of an affinity capture elution assay. Signal generated from binding of antidrug antibody (ADA) to the therapeutic antibody was compared with signal from binding of ADA to the therapeutic antibody preincubated with its target. The results demonstrated that the target blocked binding of the therapeutic antibody to neutralizing monkey ADA and to two anti-idiotypic antibodies. This highly drug-tolerant novel approach enables the detection of neutralizing antibodies and allows for one basic assay format to achieve complete characterization of ADA responses.

  8. Performance evaluation and multicentre study of a von Willebrand factor activity assay based on GPIb binding in the absence of ristocetin.

    PubMed

    Patzke, Juergen; Budde, Ulrich; Huber, Andreas; Méndez, Adriana; Muth, Heidrun; Obser, Tobias; Peerschke, Ellinor; Wilkens, Matthias; Schneppenheim, Reinhard

    2014-12-01

    The functional activity of von Willebrand factor (VWF) is most frequently measured by using the ristocetin cofactor assay (VWF:RCo). However, the method's drawbacks include unsatisfactory precision, sensitivity and availability of automated system applications. We have developed an alternative assay (INNOVANCE VWF Ac) that is based on the binding of VWF to recombinant glycoprotein Ib (GPIb). Two gain-of-function mutations were introduced into a GPIb fragment, allowing an assay format without ristocetin. Fully automated assay applications are available for the BCS/BCS XP systems and the Sysmex CS-2000i, Sysmex CA-7000, Sysmex CA-1500 and Sysmex CA-560 systems.The INNOVANCE VWF Ac assay measuring range extends from 4 to 600% VWF for all systems except the Sysmex CA-560 system. Within-device precision values were found to be between 2 and 7%. The limit of detection was below 2.2% VWF. In a study on the BCS XP system, a total number of 580 sample results yielded a correlation to the VWF:RCo assay of r equal to 0.99 (slope = 0.96). Very similar results were observed when von Willebrand disease samples type 1, 2A, 2B, 2M, 2N and 3 were investigated with the new assay and the VWF:RCo assay. The excellent performance data and comparability to VWF:RCo, together with the ease of use, led us to the conclusion that the ristocetin cofactor assay can be replaced by the new GPIb-binding assay to reliably diagnosing patients with von Willebrand disease.

  9. Dynamics of the EAG1 K+ channel selectivity filter assessed by molecular dynamics simulations.

    PubMed

    Bernsteiner, Harald; Bründl, Michael; Stary-Weinzinger, Anna

    2017-02-26

    EAG1 channels belong to the KCNH family of voltage gated potassium channels. They are expressed in several brain regions and increased expression is linked to certain cancer types. Recent cryo-EM structure determination finally revealed the structure of these channels in atomic detail, allowing computational investigations. In this study, we performed molecular dynamics simulations to investigate the ion binding sites and the dynamical behavior of the selectivity filter. Our simulations suggest that sites S2 and S4 form stable ion binding sites, while ions placed at sites S1 and S3 rapidly switched to sites S2 and S4. Further, ions tended to dissociate away from S0 within less than 20 ns, due to increased filter flexibility. This was followed by water influx from the extracellular side, leading to a widening of the filter in this region, and likely non-conductive filter configurations. Simulations with the inactivation-enhancing mutant Y464A or Na + ions lead to trapped water molecules behind the SF, suggesting that these simulations captured early conformational changes linked to C-type inactivation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease

    PubMed Central

    Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David

    2013-01-01

    The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839

  11. Antibody binding in altered gravity: implications for immunosorbent assay during space flight

    NASA Technical Reports Server (NTRS)

    Maule, Jake; Fogel, Marilyn; Steele, Andrew; Wainwright, Norman; Pierson, Duane L.; McKay, David S.

    2003-01-01

    A single antibody-incubation step of an indirect, enzyme-linked immunosorbent assay (ELISA) was performed during microgravity, Martian gravity (0.38 G) and hypergravity (1.8 G) phases of parabolic flight, onboard the NASA KC-135 aircraft. Antibody-antigen binding occurred within 15 seconds; the level of binding did not differ between microgravity, Martian gravity and 1 G (Earth's gravity) conditions. During hypergravity and 1 G, antibody binding was directly proportional to the fluid volume (per microtiter well) used for incubation; this pattern was not observed during microgravity. These effects in microgravity may be due to "fluid spread" within the chamber (observed during microgravity with digital photography), leading to greater fluid-surface contact and subsequently antibody-antigen contact. In summary, these results demonstrate that: i) ELISA antibody-incubation and washing steps can be successfully performed by human operators during microgravity, Martian gravity and hypergravity; ii) there is no significant difference in antibody binding between microgravity, Martian gravity and 1 G conditions; and iii) a smaller fluid volume/well (and therefore less antibody) was required for a given level of binding during microgravity. These conclusions indicate that reduced gravity would not present a barrier to successful operation of immunosorbent assays during spaceflight.

  12. Holotrichia oblita Midgut Proteins That Bind to Bacillus thuringiensis Cry8-Like Toxin and Assembly of the H. oblita Midgut Tissue Transcriptome

    PubMed Central

    Jiang, Jian; Huang, Ying; Shu, Changlong; Soberón, Mario; Bravo, Alejandra; Liu, Chunqing; Song, Fuping; Lai, Jinsheng

    2017-01-01

    ABSTRACT The Bacillus thuringiensis strain HBF-18 (CGMCC 2070), containing two cry genes (cry8-like and cry8Ga), is toxic to Holotrichia oblita larvae. Both Cry8-like and Cry8Ga proteins are active against this insect pest, and Cry8-like is more toxic. To analyze the characteristics of the binding of Cry8-like and Cry8Ga proteins to brush border membrane vesicles (BBMVs) in H. oblita larvae, binding assays were conducted with a fluorescent DyLight488-labeled Cry8-like toxin. The results of saturation binding assays demonstrated that Cry8-like bound specifically to binding sites on BBMVs from H. oblita, and heterologous competition assays revealed that Cry8Ga shared binding sites with Cry8-like. Furthermore, Cry8-like-binding proteins in the midgut from H. oblita larvae were identified by pulldown assays and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In addition, the H. oblita midgut transcriptome was assembled by high-throughput RNA sequencing and used for identification of Cry8-like-binding proteins. Eight Cry8-like-binding proteins were obtained from pulldown assays conducted with BBMVs. The LC-MS/MS data for these proteins were successfully matched with the H. oblita transcriptome, and BLASTX results identified five proteins as serine protease, transferrin-like, uncharacterized protein LOC658236 of Tribolium castaneum, ATPase catalytic subunit, and actin. These identified Cry8-like-binding proteins were different from those confirmed previously as receptors for Cry1A proteins in lepidopteran insect species, such as aminopeptidase, alkaline phosphatase, and cadherin. IMPORTANCE Holotrichia oblita is one of the main soil-dwelling pests in China. The larvae damage the roots of crops, resulting in significant yield reductions and economic losses. H. oblita is difficult to control, principally due to its soil-dwelling habits. In recent years, some Cry8 toxins from Bacillus thuringiensis were shown to be active against this pest. Study of the mechanism of action of these Cry8 toxins is needed for their effective use in the control of H. oblita and for their future utilization in transgenic plants. Our work provides important basic data and promotes understanding of the insecticidal mechanism of Cry8 proteins against H. oblita larvae. PMID:28389549

  13. A high-throughput fluorescence polarization assay for inhibitors of gyrase B.

    PubMed

    Glaser, Bryan T; Malerich, Jeremiah P; Duellman, Sarah J; Fong, Julie; Hutson, Christopher; Fine, Richard M; Keblansky, Boris; Tang, Mary J; Madrid, Peter B

    2011-02-01

    DNA gyrase, a type II topoisomerase that introduces negative supercoils into DNA, is a validated antibacterial drug target. The holoenzyme is composed of 2 subunits, gyrase A (GyrA) and gyrase B (GyrB), which form a functional A(2)B(2) heterotetramer required for bacterial viability. A novel fluorescence polarization (FP) assay has been developed and optimized to detect inhibitors that bind to the adenosine triphosphate (ATP) binding domain of GyrB. Guided by the crystal structure of the natural product novobiocin bound to GyrB, a novel novobiocin-Texas Red probe (Novo-TRX) was designed and synthesized for use in a high-throughput FP assay. The binding kinetics of the interaction of Novo-TRX with GyrB from Francisella tularensis has been characterized, as well as the effect of common buffer additives on the interaction. The assay was developed into a 21-µL, 384-well assay format and has been validated for use in high-throughput screening against a collection of Food and Drug Administration-approved compounds. The assay performed with an average Z' factor of 0.80 and was able to identify GyrB inhibitors from a screening library.

  14. Method for estimating protein binding capacity of polymeric systems.

    PubMed

    Sharma, Vaibhav; Blackwood, Keith A; Haddow, David; Hook, Lilian; Mason, Chris; Dye, Julian F; García-Gareta, Elena

    2015-01-01

    Composite biomaterials made from synthetic and protein-based polymers are extensively researched in tissue engineering. To successfully fabricate a protein-polymer composite, it is critical to understand how strongly the protein binds to the synthetic polymer, which occurs through protein adsorption. Currently, there is no cost-effective and simple method for characterizing this interfacial binding. To characterize this interfacial binding, we introduce a simple three-step method that involves: 1) synthetic polymer surface characterisation, 2) a quick, inexpensive and robust novel immuno-based assay that uses protein extraction compounds to characterize protein binding strength followed by 3) an in vitro 2D model of cell culture to confirm the results of the immuno-based assay. Fibrinogen, precursor of fibrin, was adsorbed (test protein) on three different polymeric surfaces: silicone, poly(acrylic acid)-coated silicone and poly(allylamine)-coated silicone. Polystyrene surface was used as a reference. Characterisation of the different surfaces revealed different chemistry and roughness. The novel immuno-based assay showed significantly stronger binding of fibrinogen to both poly(acrylic acid) and poly(allylamine) coated silicone. Finally, cell studies showed that the strength of the interaction between the protein and the polymer had an effect on cell growth. This novel immuno-based assay is a valuable tool in developing composite biomaterials of synthetic and protein-based polymers with the potential to be applied in other fields of research where protein adsorption onto surfaces plays an important role.

  15. Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

    PubMed Central

    Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna

    2016-01-01

    The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

  16. Time-Resolved Fluorescence Resonance Energy Transfer Assay for Discovery of Small-Molecule Inhibitors of Methyl-CpG Binding Domain Protein 2.

    PubMed

    Wyhs, Nicolas; Walker, David; Giovinazzo, Hugh; Yegnasubramanian, Srinivasan; Nelson, William G

    2014-08-01

    Methylated DNA binding proteins such as Methyl-CpG Binding Domain Protein 2 (MBD2) can transduce DNA methylation alterations into a repressive signal by recruiting transcriptional co-repressor complexes. Interfering with MBD2 could lead to reactivation of tumor suppressor genes and therefore represents an attractive strategy for epigenetic therapy. We developed and compared fluorescence polarization (FP) and time-resolved fluorescence resonance energy transfer (TR-FRET)-based high-throughput screening (HTS) assays to identify small-molecule inhibitors of the interaction between the methyl binding domain of MBD2 (MBD2-MBD) and methylated DNA. Although both assays performed well in 96-well format, the TR-FRET assay (Z' factor = 0.58) emerged as a superior screening strategy compared with FP (Z' factor = 0.08) when evaluated in an HTS 384-well plate format. Using TR-FRET, we screened the Sigma LOPAC library for MBD2-MBD inhibitors and identified four compounds that also validated in a dose-response series. This included two known DNA intercalators (mitoxantrone and idarubicin) among two other inhibitory compounds (NF449 and aurintricarboxylic acid). All four compounds also inhibited the binding of SP-1, a transcription factor with a GC-rich binding sequence, to a methylated oligonucleotide, demonstrating that the activity was nonspecific. Our results provide proof of principle for using TR-FRET-based HTS to identify small-molecule inhibitors of MBD2 and other DNA-protein interactions. © 2014 Society for Laboratory Automation and Screening.

  17. Assessment of the nickel-albumin binding assay for diagnosis of acute coronary syndrome.

    PubMed

    da Silva, Sandra Huber; Pereira, Renata da Silva; Hausen, Bruna dos Santos; Signor, Cristiane; Gomes, Patrícia; de Campos, Marli Matiko Anraku; Moresco, Rafael Noal

    2011-03-01

    Myocardial ischemia may alter the metal binding capacity of circulating serum albumin. Thus, the aim of this study was to describe an automated method to measure ischemia-induced alterations in the binding capacity of serum albumin for exogenous nickel, and to evaluate the diagnostic characteristics of this assay for the assessment of acute coronary syndrome (ACS) in patients presenting to the emergency room (ER) with acute chest pain. We assessed the concentrations of cardiac troponin I (cTnI), serum albumin, ischemia-modified albumin (IMA) measured by the cobalt-albumin binding assay (CABA), and by an automated nickel-albumin binding assay (NABA) in the following groups: ACS (n=63) and non-ischemic chest pain (NICP, n=26). Biochemical markers were determined in blood samples obtained from patients within 3 h of ER admission. cTnI, CABA and NABA concentrations were higher in ACS group in comparison to the NICP group. A significant correlation between NABA and CABA was observed (r=0.5387, p<0.001). Areas under the curve for CABA and NABA were 0.7289 and 0.7582, respectively. Both CABA and NABA have the ability to discriminate patients with ACS. However, NABA has a slightly higher ability to discriminate ACS compared with CABA. Patients with ACS have reduced nickel binding to human serum albumin, and NABA may have an important role as an early marker of myocardial ischemia, particularly in patients presenting to the ER with acute chest pain.

  18. Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

    PubMed

    Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

    2014-11-28

    We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Abbott ARCHITECT iPhenytoin assay versus similar assays for measuring free phenytoin concentrations.

    PubMed

    Tacker, Danyel Hermes; Robinson, Randy; Perrotta, Peter L

    2014-01-01

    To measure free phenytoin (FP) concentrations in filtered specimens using the Abbott ARCHITECT iPhenytoin assay and to compare results from this method with results from the Abbott TDx/FLx assays. We verified accuracy, analytic measurement range, and precision for FP measurements. For correlation and therapeutic interval studies, we used filtered calibrators, controls, proficiency-testing materials, and surplus clinical samples. After implementation, we determined proficiency testing results. The analytic measurement range was 2.0 to 25.0 micromol/L. Quality control materials (6.1, 12.6, and 20.1 micromol/L) provided mean (SD) recoveries of 96.1 (5.0%), 99.2 (5.0%), and 99.3 (5.7%), respectively, and coefficients of variation of 5.2%, 5.0%, and 5.8%, respectively. Clinical specimens produced mean (SD) FP recovery levels of 103.7 (10.6%) (bias, 0.1 [0.3] micromol/L). Altering the FP therapeutic range (4.0-8.0 micromol/L) was unnecessary. Proficiency testing yielded consistently acceptable results. Our accuracy, precision, and correlation results were similar for the TDx/FLx and ARCHITECT assays, which demonstrates that the ARCHITECT iPhenytoin assay is acceptable for clinical FP measurements.

  20. DNA single strand breakage, DNA adducts, and sister chromatid exchange in lymphocytes and phenanthrene and pyrene metabolites in urine of coke oven workers.

    PubMed Central

    Popp, W; Vahrenholz, C; Schell, C; Grimmer, G; Dettbarn, G; Kraus, R; Brauksiepe, A; Schmeling, B; Gutzeit, T; von Bülow, J; Norpoth, K

    1997-01-01

    OBJECTIVES: To investigate the specificity of biological monitoring variables (excretion of phenanthrene and pyrene metabolites in urine) and the usefulness of some biomarkers of effect (alkaline filter elution, 32P postlabelling assay, measurement of sister chromatid exchange) in workers exposed to polycyclic aromatic hydrocarbons (PAHs). METHODS: 29 coke oven workers and a standardised control group were investigated for frequencies of DNA single strand breakage, DNA protein cross links (alkaline filter elution assay), sister chromatid exchange, and DNA adducts (32P postlabelling assay) in lymphocytes. Phenanthrene and pyrene metabolites were measured in 24 hour urine samples. 19 different PAHs (including benzo(a)pyrene, pyrene, and phenanthrene) were measured at the workplace by personal air monitoring. The GSTT1 activity in erythrocytes and lymphocyte subpopulations in blood was also measured. RESULTS: Concentrations of phenanthrene, pyrene, and benzo(a)pyrene in air correlated well with the concentration of total PAHs in air; they could be used for comparisons of different workplaces if the emission compositions were known. The measurement of phenanthrene metabolites in urine proved to be a better biological monitoring variable than the measurement of 1-hydroxypyrene. Significantly more DNA strand breaks in lymphocytes of coke oven workers were found (alkaline filter elution assay); the DNA adduct rate was not significantly increased in workers, but correlated with exposure to PAHs in a semiquantitative manner. The number of sister chromatid exchanges was lower in coke oven workers but this was not significant; thus counting sister chromatid exchanges was not a good variable for biomonitoring of coke oven workers. Also, indications for immunotoxic influences (changes in lymphocyte subpopulations) were found. CONCLUSIONS: The measurement of phenanthrene metabolites in urine seems to be a better biological monitoring variable for exposure to PAHs than measurement of hydroxypyrene. The alkaline filter elution assay proved to be the most sensitive biomarker for genotoxic damage, whereas the postlabelling assay was the only one with some specificity for DNA alterations caused by known compounds. PMID:9155778

  1. Competitive Binding Assay for the G-Protein-Coupled Receptor 30 (GPR30) or G-Protein-Coupled Estrogen Receptor (GPER).

    PubMed

    Thekkumkara, Thomas; Snyder, Russell; Karamyan, Vardan T

    2016-01-01

    The role of 2-methoxyestradiol is becoming a major area of investigation because of its therapeutic utility, though its mechanism is not fully explored. Recent studies have identified the G-protein-coupled receptor 30 (GPR30, GPER) as a high-affinity membrane receptor for 2-methoxyestradiol. However, studies aimed at establishing the binding affinities of steroid compounds for specific targets are difficult, as the tracers are highly lipophilic and often result in nonspecific binding in lipid-rich membrane preparations with low-level target receptor expression. 2-Methoxyestradiol binding studies are essential to elucidate the underlying effects of this novel estrogen metabolite and to validate its targets; therefore, this competitive receptor-binding assay protocol was developed in order to assess the membrane receptor binding and affinity of 2-methyoxyestradiol.

  2. FRET-based binding assay between a fluorescent cAMP analogue and a cyclic nucleotide-binding domain tagged with a CFP.

    PubMed

    Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya

    2017-09-01

    The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.

  3. A dye binding method for measurement of total protein in microalgae.

    PubMed

    Servaites, Jerome C; Faeth, Julia L; Sidhu, Sukh S

    2012-02-01

    Protein is a large component of the standing biomass of algae. The total protein content of algae is difficult to measure because of the problems encountered in extracting all of the protein from the cells. Here we modified an existing protein assay to measure total protein in microalgae cells that involves little or no extraction of protein from the cells. Aliquots of fresh or pretreated cells were spotted onto filter paper strips. After drying, the strips were stained in a 0.1% (w/v) solution of the protein stain Coomassie Brilliant Blue R-250 for 16 to 24 h and then destained. The stained protein spots were cut out from the paper, and dye was eluted in 1% (w/v) sodium dodecyl sulfate (SDS). Absorbance at 600 nm was directly proportional to protein concentration. Cells that were recalcitrant to taking up the dye could be either heated at 80°C for 10 min in 1% SDS or briefly sonicated for 3 min to facilitate penetration of the dye into the cells. Total protein measured in Chlorella vulgaris using this method compared closely with that measured using the total N method. Total protein concentrations were measured successfully in 12 algal species using this dye binding method. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Identification of Novel BACE1 Inhibitors by Combination of Pharmacophore Modeling, Structure-Based Design and In Vitro Assay.

    PubMed

    Ju, Yuan; Li, Zicheng; Deng, Yong; Tong, Aiping; Zhou, Liangxue; Luo, Youfu

    2016-01-01

    The protease β-secretase plays a critical role in the synthesis of pathogenic amyloid-β in Alzheimer's disease. In this study, pharmacophore constructed from receptor-ligand complex was used to screen Chemdiv and Zinc database and the resulting hits were subjected to docking experiments using LiandFit and CDOCKER programs. Molecules with high consensus scores and good interaction patterns in docking programs were retained. Drug-likeness assay including Lipinski's rule of five and ADMET properties filters were further used to identify BACE1 inhibitor. Finally, 13 compounds with novel scaffolds were selected and, considering of the nature of relative high LogP value of many marketed AD drugs, three of them with top 3 predicted LogP value were evaluated for their IC50 values in vitro by BACE1 enzymatic activity study. We believe that compound 13 with an IC50 value of 136 µM can be a lead compound with great potential in BACE1 inhibition and increasing activity by subsequently structure modification or optimization. At the same time, we found that the interaction between the residues Asp228, Asp32 of BACE1 and ligands is significant through analyzing the binding mode of 13 candidate compounds.

  5. Microfabricated Renewable Beads-Trapping/Releasing Flow Cell for Rapid Antigen-Antibody Reaction in Chemiluminescent Immunoassay

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fu, Zhifeng; Shao, Guocheng; Wang, Jun

    2011-04-01

    A filter pillar-array microstructure was coupled with a pneumatic micro-valve to fabricate a reusable miniaturized beads-trapping/releasing flow cell, in which trapping and releasing beads can be conveniently realized by switching the micro-valve. This miniaturized device was suitable to construct automatic fluidic system for “renewable surface analysis”. The renewable surface strategy based on pneumatic micro-valve enabled capture of beads in beads chamber prior to each assay, and release of the used beads after the assay. Chemiluminescent competitive immunoassay of 3,5,6-trichloropyridinol (TCP) was performed as a model to demonstrate the application potential of this reusable miniaturized flow cell. The whole fluidic assaymore » process including beads trapping, immuno-binding, beads washing, beads releasing and signal collection could be completed in 10 min. Immunoassay of TCP using this miniaturized device showed a linear range of 0.20-70 ng/mL with a limit of detection of 0.080 ng/mL. The device had been successfully used for detection of TCP spiked in rat serum with average recovery of 97%. This investigation provides a rapid, sensitive, reusable, low-cost and automatic miniaturized device for solid-phase biochemical analysis for various purposes.« less

  6. A kinetic study of Trichoderma reesei Cel7B catalyzed cellulose hydrolysis.

    PubMed

    Song, Xiangfei; Zhang, Shujun; Wang, Yefei; Li, Jingwen; He, Chunyan; Yao, Lishan

    2016-06-01

    One prominent feature of Trichoderma reesei (Tr) endoglucanases catalyzed cellulose hydrolysis is that the reaction slows down quickly after it starts (within minutes). But the mechanism of the slowdown is not well understood. A structural model of Tr- Cel7B catalytic domain bound to cellulose was built computationally and the potentially important binding residues were identified and tested experimentally. The 13 tested mutants show different binding properties in the adsorption to phosphoric acid swollen cellulose and filter paper. Though the partitioning parameter to filter paper is about 10 times smaller than that to phosphoric acid swollen cellulose, a positive correlation is shown for two substrates. The kinetic studies show that the reactions slow down quickly for both substrates. This slowdown is not correlated to the binding constant but anticorrelated to the enzyme initial activity. The amount of reducing sugars released after 24h by Cel7B in phosphoric acid swollen cellulose, Avicel and filter paper cellulose hydrolysis is correlated with the enzyme activity against a soluble substrate p-nitrophenyl lactoside. Six of the 13 tested mutants, including N47A, N52D, S99A, N323D, S324A, and S346A, yield ∼15-35% more reducing sugars than the wild type (WT) Cel7B in phosphoric acid swollen cellulose and filter paper hydrolysis. This study reveals that the slowdown of the reaction is not due to the binding of the enzyme to cellulose. The activity of Tr- Cel7B against the insoluble substrate cellulose is determined by the enzyme's capability in hydrolyzing the soluble substrate. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Application of binding free energy calculations to prediction of binding modes and affinities of MDM2 and MDMX inhibitors.

    PubMed

    Lee, Hui Sun; Jo, Sunhwan; Lim, Hyun-Suk; Im, Wonpil

    2012-07-23

    Molecular docking is widely used to obtain binding modes and binding affinities of a molecule to a given target protein. Despite considerable efforts, however, prediction of both properties by docking remains challenging mainly due to protein's structural flexibility and inaccuracy of scoring functions. Here, an integrated approach has been developed to improve the accuracy of binding mode and affinity prediction and tested for small molecule MDM2 and MDMX antagonists. In this approach, initial candidate models selected from docking are subjected to equilibration MD simulations to further filter the models. Free energy perturbation molecular dynamics (FEP/MD) simulations are then applied to the filtered ligand models to enhance the ability in predicting the near-native ligand conformation. The calculated binding free energies for MDM2 complexes are overestimated compared to experimental measurements mainly due to the difficulties in sampling highly flexible apo-MDM2. Nonetheless, the FEP/MD binding free energy calculations are more promising for discriminating binders from nonbinders than docking scores. In particular, the comparison between the MDM2 and MDMX results suggests that apo-MDMX has lower flexibility than apo-MDM2. In addition, the FEP/MD calculations provide detailed information on the different energetic contributions to ligand binding, leading to a better understanding of the sensitivity and specificity of protein-ligand interactions.

  8. Digested wheat gluten inhibits binding between leptin and its receptor.

    PubMed

    Jönsson, Tommy; Memon, Ashfaque A; Sundquist, Kristina; Sundquist, Jan; Olsson, Stefan; Nalla, Amarnadh; Bauer, Mikael; Linse, Sara

    2015-01-20

    Leptin resistance is considered a primary risk factor for obesity. It has been hypothesized that dietary cereal grain protein could cause leptin resistance by preventing leptin from binding to its receptor. Non-degraded dietary wheat protein has been found in human serum at a mean level of 41 ng/mL. Here, we report our findings from testing whether enzymatically digested gluten from wheat prevents leptin from binding to the leptin receptor in vitro. Gluten from wheat was digested with pepsin and trypsin under physiological conditions. Pepsin and trypsin activity was removed from the gluten digest with a 10 kDa spin-filter or by heat treatment at 100°C for 30 min. Binding to the leptin receptor of leptin mixed with gluten digest at a series of concentrations was measured using surface plasmon resonance technology. Binding of the gluten digest to the leptin receptor was not detected. Spin-filtered gluten digest inhibited binding of leptin to the leptin receptor, with 50% inhibition at a gluten digest concentration of ~10 ng/mL. Heat-treated gluten digest did not inhibit leptin binding. Digested wheat gluten inhibits binding of leptin to the leptin receptor, with half-maximal inhibition at 10 ng/mL. The inhibition is significant at clinically relevant concentrations and could therefore serve as a novel pathway to investigate to understand the molecular basis of leptin resistance, obesity and associated disorders.

  9. A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva.

    PubMed

    Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui; Xiao, Yi

    2017-01-01

    Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples.

  10. Monoclonal Antibody Binding to a Surface-Exposed Epitope on Cowdria ruminantium That Is Conserved among Eight Strains

    PubMed Central

    Shompole, Sankale; Rurangirwa, Fred R.; Wambugu, Anderson; Sitienei, John; Mwangi, Duncan M.; Musoke, Anthony J.; Mahan, Suman; Wells, Clive W.; McGuire, Travis C.

    2000-01-01

    Monoclonal antibodies (MAb) binding to Cowdria ruminantium elementary bodies (EB) were identified by enzyme-linked immunosorbent assay, and surface binding of one MAb (446.15) to intact EB was determined by immunofluorescence, immunogold labeling, and transmission electron microscopy. MAb 446.15 bound an antigen of approximately 43 kDa in immunoblots of eight geographically distinct strains. The MAb did not react with Ehrlichia canis antigens or uninfected bovine endothelial cell lysate and may be useful in diagnostic assays and vaccine development. PMID:11063511

  11. JAK2 JH2 Fluorescence Polarization Assay and Crystal Structures for Complexes with Three Small Molecules.

    PubMed

    Newton, Ana S; Deiana, Luca; Puleo, David E; Cisneros, José A; Cutrona, Kara J; Schlessinger, Joseph; Jorgensen, William L

    2017-06-08

    A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as K d results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses.

  12. JAK2 JH2 Fluorescence Polarization Assay and Crystal Structures for Complexes with Three Small Molecules

    PubMed Central

    2017-01-01

    A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as Kd results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses. PMID:28626520

  13. Molecular mechanisms of lymphocyte extravasation. II. Studies of in vitro lymphocyte adherence to high endothelial venules.

    PubMed

    Braaten, B A; Spangrude, G J; Daynes, R A

    1984-07-01

    Lymphocyte migration from the blood into the lymph nodes in most species occurs across post-capillary high endothelial venules (HEV). In a previous study, we proposed that lymphocyte extravasation involves receptor-mediated binding followed by adenylate cyclase-dependent activation of lymphocyte motility. This hypothesis was, in part, based on observations of in vitro lymphocyte adherence to HEV by employing pertussigen, which is a known inhibitor of lymphocyte recirculation. In vitro lymphocyte-HEV binding requires a cold (6 degrees C) incubation step and binding is poor to nil if the assay is attempted at room (23 degrees C) or physiologic temperature. We decided to investigate why this assay is temperature restricted, because of the possibility that pertussigen or fucoidin -treated lymphocytes might interact with HEV differently at higher temperatures. We now report that O.C.T. compound (OCT), the embedding matrix generally used to cut frozen lymph node sections, is toxic to lymphocytes at temperatures above 6 degrees C. Exclusion of OCT from the assay system will allow lymphocyte-HEV binding to occur at 23 degrees C and to a lesser extent at 37 degrees C. With this modified protocol, lymphocytes treated with either pertussigen, fucoidin , or neuraminidase were tested for adherence to HEV at 23 degrees C. No essential difference in binding properties was observed from what had been reported at 6 degrees C. In contrast, trypsin-treated lymphocytes that did not bind to HEV with the standard technique at 6 degrees C did adhere to a minimal extent to HEV at 23 degrees C using the modified procedure. We also report some preliminary work, using the modified assay, on in vitro lymphocyte-HEV binding of rat, rabbit, and guinea pig lymphocytes to sections of lymph nodes from the respective species.

  14. Characterization of Lactic Acid Bacteria as Poultry Probiotic Candidates with Aflatoxin B1 Binding Activities

    NASA Astrophysics Data System (ADS)

    Damayanti, E.; Istiqomah, L.; Saragih, J. E.; Purwoko, T.; Sardjono

    2017-12-01

    Our previous studies have selected lactic acid bacteria (LAB) with antifungal activities from traditional fermented foods made from cassava (G7) and silage feed palm leaf (PDS5 and PDS3). In this study we evaluated their ability to bind aflatoxin B1 (AFB1) and probiotic characteristic. The probiotic characteristic assays of LAB consisted of resistance to acidic conditions (pH 3), gastric juice and bile salts 0.3%. We also carried out an in vitro evaluation of LAB aflatoxin binding ability in viable and non-viable cell for 24 and 48 hours of incubation. The measurement of aflatoxin content was performed by ELISA method using AgraQuant Total Aflatoxin Assay kit. The results showed that all isolates were potential as probiotics and the G7 isolate had the highest viability among other isolates in pH 3 (92.61 %) and the bile salts assay (97.71 %). The percentage of aflatoxin reduction between viable and non-viable cell from each LAB isolate were different. The highest aflatoxin reduction in viable cell assay was performed by G7 isolate (69.11 %) whereas in non-viable cell assay was performed by PDS3 isolate (73.75 %) during incubation time 48 hours. In this study, G7 isolate performed the best probiotic characteristics with the highest viability in acid pH assay, bile salt 0.3% assay and percentage of aflatoxin B1 reduction in viable cell condition. Molecular identification using 16S rRNA sequence analysis showed that G7 isolate had homology with Lactobacillus plantarum (99.9%). It was concluded that Lactobacillus plantarum G7 was potential as probiotic with aflatoxin binding activities.

  15. Flexible Label-Free Quantitative Assay for Antibodies to Influenza Virus Hemagglutinins ▿

    PubMed Central

    Carney, Paul J.; Lipatov, Aleksandr S.; Monto, Arnold S.; Donis, Ruben O.; Stevens, James

    2010-01-01

    During the initial pandemic influenza H1N1 virus outbreak, assays such as hemagglutination inhibition and microneutralization provided important information on the relative protection afforded by the population's cross-reactivity from prior infections and immunizations with seasonal vaccines. However, these assays continue to be limited in that they are difficult to automate for high throughput, such as in pandemic situations, as well as to standardize between labs. Thus, new technologies are being sought to improve standardization, reliability, and throughput by using chemically defined reagents rather than whole cells and virions. We now report the use of a cell-free and label-free flu antibody biosensor assay (f-AbBA) for influenza research and diagnostics that utilizes recombinant hemagglutinin (HA) in conjunction with label-free biolayer interferometry technology to measure biomolecular interactions between the HA and specific anti-HA antibodies or sialylated ligands. We evaluated f-AbBA to determine anti-HA antibody binding activity in serum or plasma to assess vaccine-induced humoral responses. This assay can reveal the impact of antigenic difference on antibody binding to HA and also measure binding to different subtypes of HA. We also show that the biosensor assay can measure the ability of HA to bind a model sialylated receptor-like ligand. f-AbBA could be used in global surveillance laboratories since preliminary tests on desiccated HA probes showed no loss of activity after >2 months in storage at room temperature, indicating that the same reagent lots could be used in different laboratories to minimize interlaboratory assay fluctuation. Future development of such reagents and similar technologies may offer a robust platform for future influenza surveillance activities. PMID:20660137

  16. Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

    PubMed

    Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

    2012-12-04

    Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

  17. Transcriptional regulation of human MUC4 gene: identification of a novel inhibitory element and its nuclear binding protein.

    PubMed

    Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi

    2013-08-01

    The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.

  18. Coupling the Torpedo Microplate-Receptor Binding Assay with Mass Spectrometry to Detect Cyclic Imine Neurotoxins

    PubMed Central

    Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi

    2014-01-01

    Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021

  19. Domain-based assays of individual antibody concentrations in an oligoclonal combination targeting a single protein.

    PubMed

    Meng, Q; Li, M; Silberg, M A; Conrad, F; Bettencourt, J; To, R; Huang, C; Ma, J; Meyer, K; Shimizu, R; Cao, L; Tomic, M T; Marks, J D

    2012-02-15

    Quantitation of individual monoclonal antibodies (mAbs) within a combined antibody drug product is required for preclinical and clinical drug development, including pharmacokinetic (PK), toxicology, stability, and biochemical characterization studies of such drugs. We have developed an antitoxin, XOMA 3AB, consisting of three recombinant mAbs that potently neutralize the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind nonoverlapping BoNT/A epitopes with high affinity. XOMA 3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from Escherichia coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. mAb-specific domains were used to develop an enzyme-linked immunosorbent assay (ELISA) for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay that is robust to interference from components in serum was also developed, and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that binds the same protein and is superior to anti-idiotype approaches. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. The conserved potassium channel filter can have distinct ion binding profiles: Structural analysis of rubidium, cesium, and barium binding in NaK2K

    PubMed Central

    Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant

    2014-01-01

    Potassium channels are highly selective for K+ over the smaller Na+. Intriguingly, they are permeable to larger monovalent cations such as Rb+ and Cs+ but are specifically blocked by the similarly sized Ba2+. In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K+ channels KcsA and MthK. Rb+ bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs+, however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba2+ binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba2+ block. In the presence of K+, Ba2+ bound to the NaK2K channel at site 3 in conjunction with a K+ at site 1; this led to a prolonged block of the channel (the external K+-dependent Ba2+ lock-in state). In the absence of K+, however, Ba2+ acts as a permeating blocker. We found that, under these conditions, Ba2+ bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba2+ binding profile in the presence and absence of K+ thus provides a structural explanation for the short and prolonged Ba2+ block observed in NaK2K. PMID:25024267

  1. The conserved potassium channel filter can have distinct ion binding profiles: structural analysis of rubidium, cesium, and barium binding in NaK2K.

    PubMed

    Lam, Yee Ling; Zeng, Weizhong; Sauer, David Bryant; Jiang, Youxing

    2014-08-01

    Potassium channels are highly selective for K(+) over the smaller Na(+). Intriguingly, they are permeable to larger monovalent cations such as Rb(+) and Cs(+) but are specifically blocked by the similarly sized Ba(2+). In this study, we used structural analysis to determine the binding profiles for these permeant and blocking ions in the selectivity filter of the potassium-selective NaK channel mutant NaK2K and also performed permeation experiments using single-channel recordings. Our data revealed that some ion binding properties of NaK2K are distinct from those of the canonical K(+) channels KcsA and MthK. Rb(+) bound at sites 1, 3, and 4 in NaK2K, as it does in KcsA. Cs(+), however, bound predominantly at sites 1 and 3 in NaK2K, whereas it binds at sites 1, 3, and 4 in KcsA. Moreover, Ba(2+) binding in NaK2K was distinct from that which has been observed in KcsA and MthK, even though all of these channels show similar Ba(2+) block. In the presence of K(+), Ba(2+) bound to the NaK2K channel at site 3 in conjunction with a K(+) at site 1; this led to a prolonged block of the channel (the external K(+)-dependent Ba(2+) lock-in state). In the absence of K(+), however, Ba(2+) acts as a permeating blocker. We found that, under these conditions, Ba(2+) bound at sites 1 or 0 as well as site 3, allowing it to enter the filter from the intracellular side and exit from the extracellular side. The difference in the Ba(2+) binding profile in the presence and absence of K(+) thus provides a structural explanation for the short and prolonged Ba(2+) block observed in NaK2K. © 2014 Lam et al.

  2. Direct and sensitive detection of foodborne pathogens within fresh produce samples using a field-deployable handheld device.

    PubMed

    You, David J; Geshell, Kenneth J; Yoon, Jeong-Yeol

    2011-10-15

    Direct and sensitive detection of foodborne pathogens from fresh produce samples was accomplished using a handheld lab-on-a-chip device, requiring little to no sample processing and enrichment steps for a near-real-time detection and truly field-deployable device. The detection of Escherichia coli K12 and O157:H7 in iceberg lettuce was achieved utilizing optimized Mie light scatter parameters with a latex particle immunoagglutination assay. The system exhibited good sensitivity, with a limit of detection of 10 CFU mL(-1) and an assay time of <6 min. Minimal pretreatment with no detrimental effects on assay sensitivity and reproducibility was accomplished with a simple and cost-effective KimWipes filter and disposable syringe. Mie simulations were used to determine the optimal parameters (particle size d, wavelength λ, and scatter angle θ) for the assay that maximize light scatter intensity of agglutinated latex microparticles and minimize light scatter intensity of the tissue fragments of iceberg lettuce, which were experimentally validated. This introduces a powerful method for detecting foodborne pathogens in fresh produce and other potential sample matrices. The integration of a multi-channel microfluidic chip allowed for differential detection of the agglutinated particles in the presence of the antigen, revealing a true field-deployable detection system with decreased assay time and improved robustness over comparable benchtop systems. Additionally, two sample preparation methods were evaluated through simulated field studies based on overall sensitivity, protocol complexity, and assay time. Preparation of the plant tissue sample by grinding resulted in a two-fold improvement in scatter intensity over washing, accompanied with a significant increase in assay time: ∼5 min (grinding) versus ∼1 min (washing). Specificity studies demonstrated binding of E. coli O157:H7 EDL933 to only O157:H7 antibody conjugated particles, with no cross-reactivity to K12. This suggests the adaptability of the system for use with a wide variety of pathogens, and the potential to detect in a variety of biological matrices with little to no sample pretreatment. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. A MEMBRANE FILTER PROCEDURE FOR ASSAYING CYTOTOXIC ACTIVITY IN HETEROTROPHIC BACTERIA ISOLATED FROM DRINKING WATER

    EPA Science Inventory

    Cytotoxic activity assays of Gram-negative, heterotrophic bacteria are often laborious and time consuming. The objective of this study was to develop in situ procedures for testing potential cytotoxic activities of heterotrophic bacteria isolated from drinking water systems. Wate...

  4. Solid-phase receptor binding assay for /sup 125/I-hCG

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bortolussi, M.; Selmin, O.; Colombatti, A.

    1987-01-01

    A solid-phase radioligand-receptor assay (RRA) to measure the binding of /sup 125/I-labelled human chorionic gonadotropin (/sup 125/I-hCG) to target cell membranes has been developed. The binding of /sup 125/I-hCG to membranes immobilized on the wells of microtitration plates reached a maximum at about 3 hours at 37 degrees C, was saturable, displayed a high affinity (Ka = 2.4 X 10(9) M-1) and was specifically inhibited by unlabelled hCG. In comparison with RRAs carried out with membranes in suspension, the solid-phase RRA is significantly simpler and much faster to perform as it avoids centrifugation or filtration procedures. The solid-phase RRA wasmore » adapted profitably to process large numbers of samples at the same time. It proved particularly useful as a screening assay to detect anti-hCG monoclonal antibodies with high inhibitory activity for binding of /sup 125/I-hCG to its receptors.« less

  5. Antiviral and Anticancer Optimization Studies of the DNA-binding Marine Natural Product Aaptamine

    PubMed Central

    Bowling, John J.; Pennaka, Hari K.; Ivey, Kelly; Wahyuono, Subagus; Kelly, Michelle; Schinazi, Raymond F.; Valeriote, Frederick A.; Graves, David E.; Hamann, Mark T.

    2016-01-01

    Aaptamine has potent cytotoxicity that may be explained by its ability to intercalate DNA. Aaptamine was evaluated for its ability to bind to DNA to validate DNA binding as the primary mechanism of cytotoxicity. Based on UV–vis absorbance titration data, the Kobs for aaptamine was 4.0 (±0.2) × 103 which was essentially equivalent to the known DNA intercalator N-[2-(diethylamino)ethyl]-9-aminoacridine-4-carboxamide. Semi-synthetic core modifications were performed to improve the general structural diversity of known aaptamine analogs and vary its absorption characteristics. Overall, 26 aaptamine derivatives were synthesized which consisted of a simple homologous range of mono and di-N-alkylations as well as some 9-O-sulfonylation and bis-O-isoaaptamine dimer products. Each product was evaluated for activity in a variety of whole cell and viral assays including a unique solid tumor disk diffusion assay. Details of aaptamine's DNA-binding activity and its derivatives’ whole cell and viral assay results are discussed. PMID:18251774

  6. Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

    PubMed Central

    Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

    1998-01-01

    AIM: To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. METHODS: The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. RESULTS: In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. CONCLUSION: In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition. PMID:9893748

  7. Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

    PubMed

    Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

    1998-08-01

    To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition.

  8. Dye-binding protein assay using a long-wave-absorbing cyanine probe.

    PubMed

    Zheng, Hong; Mao, Yu Xia; Li, Dong Hui; Zhu, Chang Qing

    2003-07-01

    A simple and fast protein assay that involves the binding of water-soluble sulfonate heptamethylene cyanine to protein is described. The binding of the dye to protein causes a shift in the absorption maximum of the dye from 778 to 904 nm, and the increase in absorption at 904 nm is monitored. This assay is very reproducible, of good color stability for at least 80 min, and sensitive at the 100 ng/mL level of human serum albumin (HSA) when a spectrophotometer with near-infrared wavelength is used to measure absorbance. Few chemicals except ionic surfactants such as cetyltrimethylammonium bromide and sodium dodecyl sulfonate interfere with the assay. Purified proteins have different capacities to interact with the dye; under the experimental conditions, the linear ranges of bovine serum albumin (BSA), HSA and gamma-IgG were 200-2000, 100-2400, and 200-3000 ng/mL, respectively. The relative standard deviation for the five replicate determinations of 1200 ng/mL BSA is 2.1%.

  9. Lipid-binding analysis using a fat blot assay.

    PubMed

    Munnik, Teun; Wierzchowiecka, Magdalena

    2013-01-01

    Protein-lipid interactions play an important role in lipid metabolism, membrane trafficking and cell -signaling by regulating protein localization, activation, and function. The Fat Blot assay is a relatively simple and inexpensive method to examine these interactions using nitrocellulose membrane-immobilized lipids. The assay is adapted from the method by Dowler et al. (Sci STKE 129:pl6, 2002) and provides qualitative and quantitative information on the relative affinity with which a protein binds to a particular lipid. To perform a Fat Blot assay, serial dilutions of different phospholipids are spotted onto a nitrocellulose membrane. These membranes are then incubated with a lipid-binding protein possessing a GST (or other epitope) tag. The membranes are washed and the protein, which is bound to the membrane by virtue of its interaction with the lipid's head group, is detected by immunoblotting with an antibody against GST (or other epitope). The procedure only requires a few micrograms of protein and is quick, simple and cheap to perform.

  10. Beyond radio-displacement techniques for Identification of CB1 Ligands: The First Application of a Fluorescence-quenching Assay

    PubMed Central

    Bruno, Agostino; Lembo, Francesca; Novellino, Ettore; Stornaiuolo, Mariano; Marinelli, Luciana

    2014-01-01

    Cannabinoid type 1 Receptor (CB1) belongs to the GPCR family and it has been targeted, so far, for the discovery of drugs aimed at the treatment of neuropathic pain, nausea, vomit, and food intake disorders. Here, we present the development of the first fluorescent assay enabling the measurement of kinetic binding constants for CB1orthosteric ligands. The assay is based on the use of T1117, a fluorescent analogue of AM251. We prove that T1117 binds endogenous and recombinant CB1 receptors with nanomolar affinity. Moreover, T1117 binding to CB1 is sensitive to the allosteric ligand ORG27569 and thus it is applicable to the discovery of new allosteric drugs. The herein presented assay constitutes a sustainable valid alternative to the expensive and environmental impacting radiodisplacement techniques and paves the way for an easy, fast and cheap high-throughput drug screening toward CB1 for identification of new orthosteric and allosteric modulators. PMID:24441508

  11. Comparison of three different methods for the detection of circulating tumor cells in mice with lung metastasis.

    PubMed

    Xu, Weifeng; Wu, Bing; Fu, Lengxi; Chen, Junying; Wang, Zeng; Huang, Fei; Chen, Jinrong; Zhang, Mei; Zhang, Zhenhuan; Lin, Jingan; Lan, Ruilong; Chen, Ruiqing; Chen, Wei; Chen, Long; Hong, Jinsheng; Zhang, Weijian; Ding, Yuxiong; Okunieff, Paul; Lin, Jianhua; Zhang, Lurong

    2017-06-01

    Circulating tumor cells (CTCs) represent the key step of cancer cell dissemination. The alteration of CTCs correlates with the treatment outcome and prognosis. To enrich and identify CTCs from billions of blood cells renders a very challenging task, which triggers development of several methods, including lysis of RBC plus negative or positive enrichment using antibodies, and filter membrane or spiral microfluidics to capture CTCs. To compare the advantages of different enrichment methods for CTCs, we utilized the 4T1 breast cancer cells transfected with both green fluorescent protein (GFP) and luciferase to trace CTCs in the experimental lung metastasis model. Three methods were used to detect CTCs at the same time: bioluminescence assay, smearing method, and membrane filter method. The in vivo alive mouse imaging was used to dynamically monitor the growth of lung metastases. The sensitivity and accuracy of three detection methods were compared side-by-side. Our results showed that 1) the sensitivity of bioluminescence assay was the highest, but there was no information of CTC morphology; 2) the smearing method and membrane filter method could observe the detail of CTC morphology, such as in single or in cluster, while their sensitivity was lower than bioluminescence assay; 3) A dynamic observation at a 7-day intervals, the lung metastatic cancer grew at a log speed, while CTCs were increased at a low speed. This might be due to the activated immune cells eliminating the CTCs at a speed much faster than CTCs were generated. This comparison of three CTC detection methods in mouse model suggests that bioluminescence assay could be used in quantitative study of the effect of certain agent on the suppression of CTCs, while GFP-based morphological assays could be used to study the dissemination mechanism of CTCs. The combination of both bioluminescence assay and GFP-based assay would generate more information for quantity and quality of CTCs.

  12. Advantages and application of label-free detection assays in drug screening.

    PubMed

    Cunningham, Brian T; Laing, Lance G

    2008-08-01

    Adoption is accelerating for a new family of label-free optical biosensors incorporated into standard format microplates owing to their ability to enable highly sensitive detection of small molecules, proteins and cells for high-throughput drug discovery applications. Label-free approaches are displacing other detection technologies owing to their ability to provide simple assay procedures for hit finding/validation, accessing difficult target classes, screening the interaction of cells with drugs and analyzing the affinity of small molecule inhibitors to target proteins. This review describes several new drug discovery applications that are under development for microplate-based photonic crystal optical biosensors and the key issues that will drive adoption of the technology. Microplate-based optical biosensors are enabling a variety of cell-based assays, inhibition assays, protein-protein binding assays and protein-small molecule binding assays to be performed with high-throughput and high sensitivity.

  13. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    PubMed Central

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  14. Stimulation of iodine organification in porcine thyroid cells by thyroid stimulators.

    PubMed

    Ginsberg, J; Shewring, G; Howells, R; Smith, B R; Hall, R

    Several Graves' sera were simultaneously assessed in a bioassay based on the ability of porcine thyroid cells to organify 125I and in a radioreceptor assay for TSH receptor binding activity. Both assay systems were sensitive to 1 mcU/ml (final concentration) of unlabelled bovine TSH. Six Graves' sera were studied in detail over a wide (0-1.0 mcl sera) dose response range in repeat determinations. Two sera exhibited parallel binding and stimulating. However, two sera revealed significant inhibition of 125I-TSH binding prior to the demonstration of stimulation and the other two sera showed stimulatory capabilities before significant binding was evident. IgG was prepared from one serum by ammonium sulphate precipitation and chromatography on Sepharose 6B and then subjected to preparative isoelectric focusing. The isoelectric distribution of the two activities were found to be identical with major peaks of activity at pl=9.5 and pl=8.5. In summary: 1) each Graves' sera exhibits different dose-response curves with respect to binding and stimulation, 2) at certain concentrations of sera, only binding or stimulation were evident, 3) neither assay was consistently more sensitive for the presence of Graves' immunoglobulins, 4) for one Graves' sera, binding and stimulation could not be separated by isoelectric focusing. These studies would suggest each Graves' immunoglobulin has inherently different characteristics in its interaction with the TSH receptor.

  15. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  16. The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.

    PubMed

    Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E

    2017-12-05

    Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Alkylating derivative of oxotremorine interacts irreversibly with the muscarinic receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ehlert, F.J.; Jenden, D.J.; Ringdahl, B.

    A 2-chloroethylamine derivative of oxotremorine was studied in pharmacological experiments and muscarinic receptor binding assays. The compound, N-(4-(2-chloroethylmethylamino)-2-butynyl)-2-pyrrolidone (BM 123), forms an aziridinium ion in aqueous solution at neutral pH that stimulates contractions of guinea pig ileum with a potency similar to that of oxotremorine. Following the initial stimulation, there is a long lasting period of lack of sensitivity of the guinea pig ileum to muscarinic agonists. BM 123 also produces muscarinic effects in vivo. When homogenates of the rat cerebral cortex were incubated with BM 123 and assayed subsequently in muscarinic receptor binding assays, a loss of binding capacitymore » for the muscarinic antagonist, (/sup 3/H)N-methylscopolamine ((/sup 3/H)NMS), was noted without a change in affinity. Similar observations were made in (/sup 3/H)1-3-quinuclidinyl benzilate ((/sup 3/H)-QNB) binding assays on the forebrains of mice that had been injected with BM 123 24 hr earlier. The loss in receptor capacity for both (/sup 3/H)NMS and (/sup 3/H)-QNB was prevented by atropine treatment. Kinetic studies of the interaction of BM 123 with homogenates of the rat cerebral cortex in vitro showed that the half-time for the loss of (/sup 3/H)-QNB binding sites increased from 10 to 45 min as the concentration of BM 123 decreased from 10 to 1 ..mu..M. In contrast to the aziridinium ion, the parent 2-chloroethylamine compound and the alcoholic hydrolysis product were largely devoid of pharmacological and binding activity.« less

  18. A comparison of sperm agglutination and immobilization assays with a quantitative ELISA for anti-sperm antibody in serum.

    PubMed

    Lynch, D M; Leali, B A; Howe, S E

    1986-08-01

    An enzyme-linked immunosorbent assay (ELISA) that quantitates antisperm antibody in serum was compared with standard sperm agglutination and immobilization assays with the use of sera from 40 normal and 292 subfertile individuals. Quantitation of the assay was accomplished by standardizing assay parameters, including the incorporation of a standard reference curve, the number of whole target sperm, the optimal dilution of serum, the selection of microtiter plate, and the time and temperatures involved in the adsorption and incubation phases. With this method, the level of antisperm antibody binding to target sperm in 40 normal fertile individuals was found to be 2.3 (+/- 1.1 standard deviation [SD]) fg immunoglobulin (Ig)/sperm. An increased mean level of 7.4 +/- 3.7 fg Ig/sperm was determined in 84 infertile patients with positive agglutination and/or immobilization tests. In 208 individuals with negative agglutination and immobilization tests the mean concentration of antisperm antibody was 2.5 +/- 1.3 fg Ig/sperm. Postvasectomy patients assayed by this method had a mean Ig binding value of 7.1 +/- 2.4 fg Ig/sperm. The infertile group with positive agglutination and/or immobilization tests had a significantly higher mean antisperm antibody level than the normal fertile group, according to the Student's t-test for independent samples (P less than 0.001). This indirect serum-based assay reproducibly quantitates antisperm antibody binding to whole target sperm, suggests the normal and abnormal levels of antisperm antibody, and correlates with standard functional assays.

  19. A model of high-affinity antibody binding to type III group B Streptococcus capsular polysaccharide.

    PubMed

    Wessels, M R; Muñoz, A; Kasper, D L

    1987-12-01

    We recently reported that the single repeating-unit pentasaccharide of type III group B Streptococcus (GBS) capsular polysaccharide is only weakly reactive with type III GBS antiserum. To further elucidate the relationship between antigen-chain length and antigenicity, tritiated oligosaccharides derived from type III capsular polysaccharide were used to generate detailed saturation binding curves with a fixed concentration of rabbit antiserum in a radioactive antigen-binding assay. A graded increase in affinity of antigen-antibody binding was seen as oligosaccharide size increased from 2.6 repeating units to 92 repeating units. These differences in affinity of antibody binding to oligosaccharides of different molecular size were confirmed by immunoprecipitation and competitive ELISA, two independent assays of antigen-antibody binding. Analysis of the saturation binding experiment indicated a difference of 300-fold in antibody-binding affinity for the largest versus the smallest tested oligosaccharides. Unexpectedly, the saturation binding values approached by the individual curves were inversely related to oligosaccharide chain length on a molar basis but equivalent on a weight basis. This observation is compatible with a model in which binding of an immunoglobulin molecule to an antigenic site on the polysaccharide facilitates subsequent binding of antibody to that antigen.

  20. A new assay format for NF-kappaB based on a DNA triple helix and a fluorescence resonance energy transfer.

    PubMed

    Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard

    2009-10-07

    Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.

  1. Pectin-like carbohydrates in the green alga Micrasterias characterized by cytochemical analysis and energy filtering TEM.

    PubMed

    Eder, M; Lütz-Meindl, U

    2008-08-01

    Pectins are the major matrix polysaccharides of plant cell walls and are important for controlling growth, wall porosity and regulation of the ionic environment in plant cells. Pectic epitopes recognized by the monoclonal antibodies JIM5, JIM7 and 2F4 could be localized in the primary wall during development of the green alga Micrasterias. As the degree of pectin esterification determines the calcium-binding capacity and thus the physical properties of the cell wall, chemical and enzymatic in situ de-esterification was performed. This resulted in displacement of epitopes recognized by JIM5, JIM7 and 2F4, respectively, in changes in the intensity of the antibody labelling as visualized in CLSM. In addition, calcium-binding capacities of cell walls and components of the secretory apparatus were determined in transmission electron microscopy by electron energy loss spectroscopy and electron spectroscopic imaging. These analyses revealed that pectic polysaccharides are transported to the cell wall in a de-esterified form. At the primary wall, pectins get methyl-esterified at the inner side, thus allowing flexibility of the wall. At the outer side of the wall they become again de-esterified and bind high amounts of calcium which leads to cell wall stiffening. Mucilage vesicles possess the highest calcium-binding capacity of all structures observed in Micrasterias, indicating that the pectic polysaccharides of mucilage are secreted in a de-esterified, compact form. When mucilage is excreted through the cell wall, it loses its ability to bind calcium. The esterification of pectins involved is obviously required for swelling of mucilage by water uptake, which generates the motive force for orientation of this unicellular organism in respect to light. Incubation of Micrasterias in pectin methylesterase (PME), which de-esterifies pectic polymers in higher plants, resulted in growth inhibition, cell shape malformation and primary wall thickening. A PME-like enzyme could be found in Micrasterias by PME activity assays.

  2. Automated data processing and radioassays.

    PubMed

    Samols, E; Barrows, G H

    1978-04-01

    Radioassays include (1) radioimmunoassays, (2) competitive protein-binding assays based on competition for limited antibody or specific binding protein, (3) immunoradiometric assay, based on competition for excess labeled antibody, and (4) radioreceptor assays. Most mathematical models describing the relationship between labeled ligand binding and unlabeled ligand concentration have been based on the law of mass action or the isotope dilution principle. These models provide useful data reduction programs, but are theoretically unfactory because competitive radioassay usually is not based on classical dilution principles, labeled and unlabeled ligand do not have to be identical, antibodies (or receptors) are frequently heterogenous, equilibrium usually is not reached, and there is probably steric and cooperative influence on binding. An alternative, more flexible mathematical model based on the probability or binding collisions being restricted by the surface area of reactive divalent sites on antibody and on univalent antigen has been derived. Application of these models to automated data reduction allows standard curves to be fitted by a mathematical expression, and unknown values are calculated from binding data. The vitrues and pitfalls are presented of point-to-point data reduction, linear transformations, and curvilinear fitting approaches. A third-order polynomial using the square root of concentration closely approximates the mathematical model based on probability, and in our experience this method provides the most acceptable results with all varieties of radioassays. With this curvilinear system, linear point connection should be used between the zero standard and the beginning of significant dose response, and also towards saturation. The importance is stressed of limiting the range of reported automated assay results to that portion of the standard curve that delivers optimal sensitivity. Published methods for automated data reduction of Scatchard plots for radioreceptor assay are limited by calculation of a single mean K value. The quality of the input data is generally the limiting factor in achieving good precision with automated as it is with manual data reduction. The major advantages of computerized curve fitting include: (1) handling large amounts of data rapidly and without computational error; (2) providing useful quality-control data; (3) indicating within-batch variance of the test results; (4) providing ongoing quality-control charts and between assay variance.

  3. Dynamics of TBP binding to the TATA box

    NASA Astrophysics Data System (ADS)

    Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

    2008-02-01

    Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

  4. Engineering and exploitation of a fluorescent HIV-1 gp120 for live cell CD4 binding assays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Costantini, Lindsey M.; Irvin, Susan C.; Department of Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461

    The HIV-1 envelope glycoprotein, gp120, binds the host cell receptor, CD4, in the initial step of HIV viral entry and infection. This process is an appealing target for the development of inhibitory drugs and neutralizing antibodies. To study gp120 binding and intracellular trafficking, we engineered a fluorescent fusion of the humanized gp120 JRFL HIV-1 variant and GFP. Gp120-sfGFP is glycosylated with human sugars, robustly expressed, and secreted from cultured human cells. Protein dynamics, quality control, and trafficking can be visualized in live cells. The fusion protein can be readily modified with different gp120 variants or fluorescent proteins. Finally, secreted gp120-sfGFPmore » enables a sensitive and easy binding assay that can quantitatively screen potential inhibitors of gp120-CD4 binding on live cells via fluorescence imaging or laser scanning cytometry. This adaptable research tool should aid in studies of gp120 cell biology and the development of novel anti-HIV drugs. - Highlights: • Development of fluorescent protein labeled HIV-1 envelope gp120. • Imaging of gp120 dynamics and trafficking in live cells. • Quantitative visual assay of antibody-mediated inhibition of gp120 binding to CD4 on live cells.« less

  5. Data quality in drug discovery: the role of analytical performance in ligand binding assays

    NASA Astrophysics Data System (ADS)

    Wätzig, Hermann; Oltmann-Norden, Imke; Steinicke, Franziska; Alhazmi, Hassan A.; Nachbar, Markus; El-Hady, Deia Abd; Albishri, Hassan M.; Baumann, Knut; Exner, Thomas; Böckler, Frank M.; El Deeb, Sami

    2015-09-01

    Despite its importance and all the considerable efforts made, the progress in drug discovery is limited. One main reason for this is the partly questionable data quality. Models relating biological activity and structures and in silico predictions rely on precisely and accurately measured binding data. However, these data vary so strongly, such that only variations by orders of magnitude are considered as unreliable. This can certainly be improved considering the high analytical performance in pharmaceutical quality control. Thus the principles, properties and performances of biochemical and cell-based assays are revisited and evaluated. In the part of biochemical assays immunoassays, fluorescence assays, surface plasmon resonance, isothermal calorimetry, nuclear magnetic resonance and affinity capillary electrophoresis are discussed in details, in addition radiation-based ligand binding assays, mass spectrometry, atomic force microscopy and microscale thermophoresis are briefly evaluated. In addition, general sources of error, such as solvent, dilution, sample pretreatment and the quality of reagents and reference materials are discussed. Biochemical assays can be optimized to provide good accuracy and precision (e.g. percental relative standard deviation <10 %). Cell-based assays are often considered superior related to the biological significance, however, typically they cannot still be considered as really quantitative, in particular when results are compared over longer periods of time or between laboratories. A very careful choice of assays is therefore recommended. Strategies to further optimize assays are outlined, considering the evaluation and the decrease of the relevant error sources. Analytical performance and data quality are still advancing and will further advance the progress in drug development.

  6. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. A Spectrophotometric Assay Optimizing Conditions for Pepsin Activity.

    ERIC Educational Resources Information Center

    Harding, Ethelynda E.; Kimsey, R. Scott

    1998-01-01

    Describes a laboratory protocol optimizing the conditions for the assay of pepsin activity using the Coomasie Blue dye binding assay of protein concentration. The dye bonds through strong, noncovalent interactions to basic and aromatic amino acid residues. (DDR)

  8. Inactivation of human norovirus and Tulane virus in simple media and fresh whole strawberries by ionizing radiation.

    PubMed

    DiCaprio, Erin; Phantkankum, Nuttapong; Culbertson, Doug; Ma, Yuanmei; Hughes, John H; Kingsley, David; Uribe, Roberto M; Li, Jianrong

    2016-09-02

    Human norovirus (NoV) is a major cause of fresh produce-associated outbreaks and human NoV in irrigation water can potentially lead to viral internalization in fresh produce. Therefore, there is a need to develop novel intervention strategies to target internalized viral pathogens while maintaining fresh produce quality. In this study electron beam (E-beam) and gamma radiation were evaluated for efficacy against a human NoV GII.4 strain and Tulane virus (TV). Virus survival following ionizing radiation treatments was determined using direct quantitative reverse transcriptase PCR (RT-qPCR), the porcine gastric mucin magnetic bead (PGM-MB) binding assay followed by RT-qPCR, and plaque assay. In simple media, a high dose of E-beam treatment was required to completely abolish the receptor binding ability of human NoV (35.3kGy) and TV (19.5-24.1kGy), as assessed using the PGM-MB binding assay. Both human NoV and TV were more susceptible to gamma irradiation than E-beam, requiring 22.4kGy to achieve complete inactivation. In whole strawberries, no human NoV or TV RNA was detected following 28.7kGy of E-beam treatment using the PGM-MB binding assay. Overall, human NoV and TV are highly resistant to ionizing radiation and therefore the technology may not be suitable to eliminate viruses in fresh produce at the currently approved levels. In addition, the PGM-MB binding assay is an improved method to detect viral infectivity compared to direct RT-qPCR. Copyright © 2016. Published by Elsevier B.V.

  9. Label-free DNA quantification via a 'pipette, aggregate and blot' (PAB) approach with magnetic silica particles on filter paper.

    PubMed

    Li, Jingyi; Liu, Qian; Alsamarri, Hussein; Lounsbury, Jenny A; Haversitick, Doris M; Landers, James P

    2013-03-07

    Reliable measurement of DNA concentration is essential for a broad range of applications in biology and molecular biology, and for many of these, quantifying the nucleic acid content is inextricably linked to obtaining optimal results. In its most simplistic form, quantitative analysis of nucleic acids can be accomplished by UV-Vis absorbance and, in more sophisticated format, by fluorimetry. A recently reported new concept, the 'pinwheel assay', involves a label-free approach for quantifying DNA through aggregation of paramagnetic beads in a rotating magnetic field. Here, we describe a simplified version of that assay adapted for execution using only a pipet and filter paper. The 'pipette, aggregate, and blot' (PAB) approach allows DNA to induce bead aggregation in a pipette tip through exposure to a magnetic field, followed by dispensing (blotting) onto filter paper. The filter paper immortalises the extent of aggregation, and digital images of the immortalized bead conformation, acquired with either a document scanner or a cell phone camera, allows for DNA quantification using a noncomplex algorithm. Human genomic DNA samples extracted from blood are quantified with the PAB approach and the results utilized to define the volume of sample used in a PCR reaction that is sensitive to input mass of template DNA. Integrating the PAB assay with paper-based DNA extraction and detection modalities has the potential to yield 'DNA quant-on-paper' devices that may be useful for point-of-care testing.

  10. Combinatorial Libraries of Arrayable Single-Chain Antibodies

    NASA Astrophysics Data System (ADS)

    Benhar, Itai

    Antibodies that bind their respective targets with high affinity and specificity have proven to be essential reagents for biological research. Antibody phage display has become the leading tool for the rapid isolation of single-chain variable fragment (scFv) antibodies in vitro for research applications, but there is usually a gap between scFv isolation and its application in an array format suitable for high-throughput proteomics. In this chapter, we present our antibody phage display system where antibody isolation and scFv immobilization are facilitated by the design of the phagemid vector used as platform. In our system, the scFvs are fused at their C-termini to a cellulose-binding domain (CBD) and can be immobilized onto cellulose-based filters. This made it possible to develop a unique filter lift screen that allowed the efficient screen for multiple binding specificities, and to directly apply library-derived scFvs in an antibody spotted microarray.

  11. Insight into the novel inhibition mechanism of apigenin to Pneumolysin by molecular modeling

    NASA Astrophysics Data System (ADS)

    Niu, Xiaodi; Yang, Yanan; Song, Meng; Wang, Guizhen; Sun, Lin; Gao, Yawen; Wang, Hongsu

    2017-11-01

    In this study, the mechanism of apigenin inhibition was explored using molecular modelling, binding energy calculation, and mutagenesis assays. Energy decomposition analysis indicated that apigenin binds in the gap between domains 3 and 4 of PLY. Using principal component analysis, we found that binding of apigenin to PLY weakens the motion of domains 3 and 4. Consequently, these domains cannot complete the transition from monomer to oligomer, thereby blocking oligomerisation of PLY and counteracting its haemolytic activity. This inhibitory mechanism was confirmed by haemolysis assays, and these findings will promote the future development of an antimicrobial agent.

  12. A CE-FL based method for real-time detection of in-capillary self-assembly of the nanoconjugates of polycysteine ligand and quantum dots.

    PubMed

    Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian

    2018-07-06

    Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625 /S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.

  13. Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

    PubMed

    Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

    2014-07-01

    Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. A CE-FL based method for real-time detection of in-capillary self-assembly of the nanoconjugates of polycysteine ligand and quantum dots

    NASA Astrophysics Data System (ADS)

    Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian

    2018-07-01

    Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625/S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.

  15. An exonuclease I-based label-free fluorometric aptasensor for adenosine triphosphate (ATP) detection with a wide concentration range.

    PubMed

    Wei, Yanli; Chen, Yanxia; Li, Huanhuan; Shuang, Shaomin; Dong, Chuan; Wang, Gufeng

    2015-01-15

    A novel aptamer-based label-free assay for sensitive and selective detection of ATP was developed. This assay employs a new aptamer/fluorescent probe system that shows resistance to exonuclease I (Exo I) digestion upon binding to ATP molecules. In the absence of ATP, the complex between the ATP-binding aptamer (ATP-aptamer) and a DNA binding dye, berberine, is digested upon the addition of exonuclease I, leading to the release of berberine into solution and consequently, quenched berberine fluorescence. In the presence of ATP, the ATP-binding aptamer folds into a G-quadruplex structure that is resistant to Exo I digestion. Accordingly, berberine is protected in the G-quadruplex structure and high fluorescence intensity is observed. As such, based on the fluorescence signal change, a label-free fluorescence assay for ATP was developed. Factors affecting the analysis of ATP including the concentration of ATP-binding aptamer, reaction time, temperature and the concentration of Exo I were comprehensively investigated. Under optimal conditions, the fluorescence intensity of the sensing system displayed a response for ATP in a wide range up to 17.5 mM with a detection limit of 140 nM.

  16. Evaluation of an Immunochromatographic Assay for Rapid Detection of Penicillin-Binding Protein 2a in Human and Animal Staphylococcus intermedius Group, Staphylococcus lugdunensis, and Staphylococcus schleiferi Clinical Isolates.

    PubMed

    Arnold, A R; Burnham, C-A D; Ford, B A; Lawhon, S D; McAllister, S K; Lonsway, D; Albrecht, V; Jerris, R C; Rasheed, J K; Limbago, B; Burd, E M; Westblade, L F

    2016-03-01

    The performance of a rapid penicillin-binding protein 2a (PBP2a) detection assay, the Alere PBP2a culture colony test, was evaluated for identification of PBP2a-mediated beta-lactam resistance in human and animal clinical isolates of Staphylococcus intermedius group, Staphylococcus lugdunensis, and Staphylococcus schleiferi. The assay was sensitive and specific, with all PBP2a-negative and PBP2a-positive strains testing negative and positive, respectively. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  17. Synthesis and biological evaluation of guanylhydrazone coactivator binding inhibitors for the estrogen receptor.

    PubMed

    LaFrate, Andrew L; Gunther, Jillian R; Carlson, Kathryn E; Katzenellenbogen, John A

    2008-12-01

    Most patients with hormone-responsive breast cancer eventually develop resistance to traditional antiestrogens such as tamoxifen, and this has become a major obstacle in their treatment. We prepared and characterized the activity of a series of 16 guanylhydrazone small molecules that are designed to block estrogen receptor (ER) activity through a non-traditional mechanism, by directly interfering with coactivator binding to agonist-liganded ER. The inhibitory activity of these compounds was determined in cell-based transcription assays using ER-responsive reporter gene and mammalian two-hybrid assays. Several of the compounds gave IC(50) values in the low micromolar range. Two secondary assays were used to confirm that these compounds were acting through the proposed non-traditional mode of estrogen inhibitory action and not as conventional antagonists at the ligand binding site.

  18. Ribosomal targets for antibiotic drug discovery

    DOEpatents

    Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

    2016-09-13

    The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

  19. BiFC Assay to Detect Calmodulin Binding to Plant Receptor Kinases.

    PubMed

    Fischer, Cornelia; Sauter, Margret; Dietrich, Petra

    2017-01-01

    Plant receptor-like kinases (RLKs) are regulated at various levels including posttranscriptional modification and interaction with regulatory proteins. Calmodulin (CaM) is a calcium-sensing protein that was shown to bind to some RLKs such as the PHYTOSULFOKINE RECEPTOR1 (PSKR1). The CaM-binding site is embedded in subdomain VIa of the kinase domain. It is possible that many more of RLKs interact with CaM than previously described. To unequivocally confirm CaM binding, several methods exist. Bimolecular fluorescence complementation (BiFC) and pull-down assays have been successfully used to study CaM binding to PSKR1 and are described in this chapter (BiFC) and in Chapter 15 (pull down). The two methods are complementary. BiFC is useful to show localization and interaction of soluble as well as of membrane-bound proteins in planta.

  20. Influence of the Selectivity Filter Properties on Proton Selectivity in the Influenza A M2 Channel.

    PubMed

    Dudev, Todor; Grauffel, Cédric; Lim, Carmay

    2016-10-05

    The homotetrameric M2 proton channel of influenza A plays a crucial role in the viral life cycle and is thus an important therapeutic target. It selectively conducts protons against a background of other competing cations whose concentrations are up to a million times greater than the proton concentration. Its selectivity is largely determined by a constricted region of its open pore known as the selectivity filter, which is lined by four absolutely conserved histidines. While the mechanism of proton transport through the channel has been studied, the physical principles underlying the selectivity for protons over other cations in the channel's His 4 selectivity filter remain elusive. Furthermore, it is not known if proton selectivity absolutely requires all four histidines with two of the four histidines protonated and if other titratable amino acid residues in lieu of the histidines could bind protons and how they affect proton selectivity. Here, we elucidate how the competition between protons and rival cations such as Na + depends on the selectivity filter's (1) histidine protonation state, (2) solvent exposure, (3) oligomeric state (the number of protein chains and thus the number of His ligands), and (4) ligand composition by evaluating the free energies for replacing monovalent Na + with H 3 O + in various model selectivity filters. We show that tetrameric His 4 filters are more proton-selective than their trimeric His 3 counterparts, and a dicationic His 4 filter where two of the four histidines are protonated is more proton-selective than tetrameric filters with other charge states/composition (different combinations of His protonation states or different metal-ligating ligands). The [His 4 ] 2+ filter achieves proton selectivity by providing suboptimal binding conditions for rival cations such as Na + , which prefers a neutral or negatively charged filter instead of a dicationic one, and three rather than four ligands with oxygen-ligating atoms.

  1. Absorption into fluorescence. A method to sense biologically relevant gas molecules

    NASA Astrophysics Data System (ADS)

    Strianese, Maria; Varriale, Antonio; Staiano, Maria; Pellecchia, Claudio; D'Auria, Sabato

    2011-01-01

    In this work we present an innovative optical sensing methodology based on the use of biomolecules as molecular gating nano-systems. Here, as an example, we report on the detection ofanalytes related to climate change. In particular, we focused our attention on the detection ofnitric oxide (NO) and oxygen (O2). Our methodology builds on the possibility of modulating the excitation intensity of a fluorescent probe used as a transducer and a sensor molecule whose absorption is strongly affected by the binding of an analyte of interest used as a filter. The two simple conditions that have to be fulfilled for the method to work are: (a) the absorption spectrum of the sensor placed inside the cuvette, and acting as the recognition element for the analyte of interest, should strongly change upon the binding of the analyte and (b) the fluorescence dye transducer should exhibit an excitation band which overlaps with one or more absorption bands of the sensor. The absorption band of the sensor affected by the binding of the specific analyte should overlap with the excitation band of the transducer. The high sensitivity of fluorescence detection combined with the use of proteins as highly selective sensors makes this method a powerful basis for the development of a new generation of analytical assays. Proof-of-principle results showing that cytochrome c peroxidase (CcP) for NO detection and myoglobin (Mb) for O2 detection can be successfully used by exploiting our new methodology are reported. The proposed technology can be easily expanded to the determination of different target analytes.

  2. Lignans from the roots of Urtica dioica and their metabolites bind to human sex hormone binding globulin (SHBG).

    PubMed

    Schöttner, M; Gansser, D; Spiteller, G

    1997-12-01

    Polar extracts of the stinging nettle (Urtica dioica L.) roots contain the ligans (+)-neoolivil, (-)-secoisolariciresinol, dehydrodiconiferyl alcohol, isolariciresinol, pinoresinol, and 3,4-divanillyltetrahydrofuran. These compounds were either isolated from Urtica roots, or obtained semisynthetically. Their affinity to human sex hormone binding globulin (SHBG) was tested in an in vitro assay. In addition, the main intestinal transformation products of plant lignans in humans, enterodiol and enterolactone, together with enterofuran were checked for their activity. All lignans except (-)-pinoresinol developed a binding affinity to SHBG in the in vitro assay. The affinity of (-)-3,4-divanillyltetrahydrofuran was outstandingly high. These findings are discussed with respect to potential beneficial effects of plant lignans on benign prostatic hyperplasia (BPH).

  3. Tissue Specific and Hormonal Regulation of Gene Expression

    DTIC Science & Technology

    1997-08-01

    interference assays were performed. These assays identify DNA bases that, when modified, interfere with the binding of the nuclear factor to the hCRH promoter...thymidine residues. The DNA bases that when modified affected the binding of the protein are noted with arrows, and their location in the hCRH...indicated. B. Methylation interference. The fragments were partially methylated using dimethyl sulfate. The DNA bases that when modified affected the

  4. Binding of selected extracellular matrix proteins to enterococci and Streptococcus bovis of animal origin.

    PubMed

    Styriak, I; Lauková, A; Fallgren, C; Wadström, T

    1999-12-01

    Thirty-three enterococcal strains and 10 Streptococcus bovis strains were investigated for their protein-binding cell surface components. Seven extracellular matrix (ECM) proteins were immobilized on Difco latex beads to detect these components on the surface of all enterococcal strains and eight non-autoaggregating S. bovis strains by a particle agglutination assay (PAA). Twenty-three selected strains were also examined in microtiter plate assays. According to the absorbance readings (A(570nm)), 11 strains were classified as nonadherent (A(570nm) < 0.1), 10 strains as weakly adherent (0.1 < A(570nm) > 0.3), and 2 strains as strongly adherent (A(570nm) > 0.3) in these assays. A direct correlation was found between the values obtained in PAA and A(570nm) readings of microtiter plate assays. Binding of (125)I-labeled bovine lactoferrin to enterococci and streptococci was in the range of 6%-30% and of (125)I-labeled human vitronectin in the range of 9%-33% to streptococci. The binding of(125)I-labeled ECM proteins to selected strains was much more effectively inhibited by sulfated carbohydrates than by non-sulfated hyaluronic acid, indicating the importance of the sulfate groups of these inhibitors. An inhibition effect of heparin on bLf binding to four selected strains was higher in comparison with fucoidan in the microtiter plates. Thirty-five out of 44 strains had agglutinated rabbit erythrocytes. However, these strains showed no ability to agglutinate bovine or sheep erythrocytes.

  5. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

    1988-09-01

    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

  6. Evaluation of Impermeant, DNA-Binding Dye Fluorescence as a Real-Time Readout of Eukaryotic Cell Toxicity in a High Throughput Screening Format

    PubMed Central

    Chiaraviglio, Lucius

    2014-01-01

    Abstract Interpretation of high throughput screening (HTS) data in cell-based assays may be confounded by cytotoxic properties of screening compounds. Therefore, assessing cell toxicity in real time during the HTS process itself would be highly advantageous. Here, we investigate the potential of putatively impermeant, fluorescent, DNA-binding dyes to give cell toxicity readout during HTS. Amongst 19 DNA-binding dyes examined, three classes were identified that were (1) permeant, (2) cytotoxic, or (3) neither permeant nor cytotoxic during 3-day incubation with a macrophage cell line. In the last class, four dyes (SYTOX Green, CellTox Green, GelGreen, and EvaGreen) gave highly robust cytotoxicity data in 384-well screening plates. As proof of principle, successful combination with a luminescence-based assay in HTS format was demonstrated. Here, both intracellular growth of Legionella pneumophila (luminescence) and host cell viability (SYTOX Green exclusion) were assayed in the same screening well. Incorporation of membrane-impermeant, DNA-binding, fluorescent dyes in HTS assays should prove useful by allowing evaluation of cytotoxicity in real time, eliminating reagent addition steps and effort associated with endpoint cell viability analysis, and reducing the need for follow-up cytotoxicity screening. PMID:24831788

  7. Competitive Binding to Cuprous Ions of Protein and BCA in the Bicinchoninic Acid Protein Assay

    PubMed Central

    Huang, Tao; Long, Mian; Huo, Bo

    2010-01-01

    Although Bicinchoninic acid (BCA) has been widely used to determine protein concentration, the mechanism of interaction between protein, copper ion and BCA in this assay is still not well known. Using the Micro BCA protein assay kit (Pierce Company), we measured the absorbance at 562 nm of BSA solutions with different concentrations of protein, and also varied the BCA concentration. When the concentration of protein was increased, the absorbance exhibited the known linear and nonlinear increase, and then reached an unexpected plateau followed by a gradual decrease. We introduced a model in which peptide chains competed with BCA for binding to cuprous ions. Formation of the well-known chromogenic complex of BCA-Cu1+-BCA was competed with the binding of two peptide bonds (NTPB) to cuprous ion, and there is the possibility of the existence of two new complexes. A simple equilibrium equation was established to describe the correlations between the substances in solution at equilibrium, and an empirical exponential function was introduced to describe the reduction reaction. Theoretical predictions of absorbance from the model were in good agreement with the measurements, which not only validated the competitive binding model, but also predicted a new complex of BCA-Cu1+-NTPB that might exist in the final solution. This work provides a new insight into understanding the chemical bases of the BCA protein assay and might extend the assay to higher protein concentration. PMID:21625379

  8. CPTAC Assay Portal: a repository of targeted proteomic assays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Whiteaker, Jeffrey R.; Halusa, Goran; Hoofnagle, Andrew N.

    2014-06-27

    To address these issues, the Clinical Proteomic Tumor Analysis Consortium (CPTAC) of the National Cancer Institute (NCI) has launched an Assay Portal (http://assays.cancer.gov) to serve as a public repository of well-characterized quantitative, MS-based, targeted proteomic assays. The purpose of the CPTAC Assay Portal is to facilitate widespread adoption of targeted MS assays by disseminating SOPs, reagents, and assay characterization data for highly characterized assays. A primary aim of the NCI-supported portal is to bring together clinicians or biologists and analytical chemists to answer hypothesis-driven questions using targeted, MS-based assays. Assay content is easily accessed through queries and filters, enabling investigatorsmore » to find assays to proteins relevant to their areas of interest. Detailed characterization data are available for each assay, enabling researchers to evaluate assay performance prior to launching the assay in their own laboratory.« less

  9. Microbial biofilms for the removal of Cu²⁺ from CMP wastewater.

    PubMed

    Mosier, Aaron P; Behnke, Jason; Jin, Eileen T; Cady, Nathaniel C

    2015-09-01

    The modern semiconductor industry relies heavily on a process known as chemical mechanical planarization, which uses physical and chemical processes to remove excess material from the surface of silicon wafers during microchip fabrication. This process results in large volumes of wastewater containing dissolved metals including copper (Cu(2+)), which must then be filtered and treated before release into municipal waste systems. We have investigated the potential use of bacterial and fungal biomass as an alternative to the currently used ion-exchange resins for the adsorption of dissolved Cu(2+) from high-throughput industrial waste streams. A library of candidate microorganisms, including Lactobacillus casei and Pichia pastoris, was screened for ability to bind Cu(2+) from solution and to form static biofilm communities within packed-bed adsorption columns. The binding efficiency of these biomass-based adsorption columns was assessed under various flow conditions and compared to that of industrially used ion-exchange resins. We demonstrated the potential to regenerate the biomass within the adsorption columns through the use of a hydrochloric acid wash, and subsequently reuse the columns for additional copper binding. While the binding efficiency and capacity of the developed L. casei/P. pastoris biomass filters was inferior to ion-exchange resin, the potential for repeated reuse of these filters, coupled with the advantages of a more sustainable "green" adsorption process, make this technique an attractive candidate for use in industrial-scale CMP wastewater treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. N- vs. C-Domain Selectivity of Catalytic Inactivation of Human Angiotensin Converting Enzyme by Lisinopril-Coupled Transition Metal Chelates

    PubMed Central

    Hocharoen, Lalintip; Joyner, Jeff C.; Cowan, J. A.

    2014-01-01

    The N- and C-terminal domains of human somatic Angiotensin I Converting Enzyme (sACE-1) demonstrate distinct physiological functions, with resulting interest in the development of domain-selective inhibitors for specific therapeutic applications. Herein, the activity of lisinopril-coupled transition metal chelates were tested for both reversible binding and irreversible catalytic inactivation of sACE-1. C/N domain binding selectivity ratios ranged from 1 to 350, while rates of irreversible catalytic inactivation of the N- and C-domains were found to be significantly greater for the N-domain, suggesting a more optimal orientation of the M-chelate-lisinopril complexes within the active site of the N-domain of sACE-1. Finally, the combined effect of binding selectivity and inactivation selectivity was assessed for each catalyst (double-filter selectivity factors), and several catalysts were found to cause domain-selective catalytic inactivation. The results of this study demonstrate the ability to optimize the target selectivity of catalytic metallopeptides through both binding and orientation factors (double-filter effect). PMID:24228790

  11. N- versus C-domain selectivity of catalytic inactivation of human angiotensin converting enzyme by lisinopril-coupled transition metal chelates.

    PubMed

    Hocharoen, Lalintip; Joyner, Jeff C; Cowan, J A

    2013-12-27

    The N- and C-terminal domains of human somatic angiotensin I converting enzyme (sACE-1) demonstrate distinct physiological functions, with resulting interest in the development of domain-selective inhibitors for specific therapeutic applications. Herein, the activity of lisinopril-coupled transition metal chelates was tested for both reversible binding and irreversible catalytic inactivation of each domain of sACE-1. C/N domain binding selectivity ratios ranged from 1 to 350, while rates of irreversible catalytic inactivation of the N- and C-domains were found to be significantly greater for the N-domain, suggesting a more optimal orientation of M-chelate-lisinopril complexes within the active site of the N-domain of sACE-1. Finally, the combined effect of binding selectivity and inactivation selectivity was assessed for each catalyst (double-filter selectivity factors), and several catalysts were found to cause domain-selective catalytic inactivation. The results of this study demonstrate the ability to optimize the target selectivity of catalytic metallopeptides through both binding and catalytic factors (double-filter effect).

  12. Tuning the ion selectivity of tetrameric cation channels by changing the number of ion binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Derebe, Mehabaw G.; Sauer, David B.; Zeng, Weizhong

    2015-11-30

    Selective ion conduction across ion channel pores is central to cellular physiology. To understand the underlying principles of ion selectivity in tetrameric cation channels, we engineered a set of cation channel pores based on the nonselective NaK channel and determined their structures to high resolution. These structures showcase an ensemble of selectivity filters with a various number of contiguous ion binding sites ranging from 2 to 4, with each individual site maintaining a geometry and ligand environment virtually identical to that of equivalent sites in K{sup +} channel selectivity filters. Combined with single channel electrophysiology, we show that only themore » channel with four ion binding sites is K{sup +} selective, whereas those with two or three are nonselective and permeate Na{sup +} and K{sup +} equally well. These observations strongly suggest that the number of contiguous ion binding sites in a single file is the key determinant of the channel's selectivity properties and the presence of four sites in K{sup +} channels is essential for highly selective and efficient permeation of K{sup +} ions.« less

  13. High-Throughput Screens To Identify Autophagy Inducers That Function by Disrupting Beclin 1/Bcl-2 Binding.

    PubMed

    Chiang, Wei-Chung; Wei, Yongjie; Kuo, Yi-Chun; Wei, Shuguang; Zhou, Anwu; Zou, Zhongju; Yehl, Jenna; Ranaghan, Matthew J; Skepner, Adam; Bittker, Joshua A; Perez, Jose R; Posner, Bruce A; Levine, Beth

    2018-06-21

    Autophagy, a lysosomal degradation pathway, plays a crucial role in cellular homeostasis, development, immunity, tumor suppression, metabolism, prevention of neurodegeneration, and lifespan extension. Thus, pharmacological stimulation of autophagy may be an effective approach for preventing or treating certain human diseases and/or aging. We sought to establish a method for developing new chemical compounds that specifically induce autophagy. To do this, we developed two assays to identify compounds that target a key regulatory node of autophagy induction-specifically, the binding of Bcl-2 (a negative regulator of autophagy) to Beclin 1 (an allosteric modulator of the Beclin 1/VPS34 lipid kinase complex that functions in autophagy initiation). These assays use either a split-luciferase assay to measure Beclin 1/Bcl-2 binding in cells or an AlphaLISA assay to directly measure direct Beclin 1/Bcl-2 binding in vitro. We screened two different chemical compound libraries, comprising ∼300 K compounds, to identify small molecules that disrupt Beclin 1/Bcl-2 binding and induce autophagy. Three novel compounds were identified that directly inhibit Beclin 1/Bcl-2 interaction with an IC 50 in the micromolar range and increase autophagic flux. These compounds do not demonstrate significant cytotoxicity, and they exert selectivity for disruption of Bcl-2 binding to the BH3 domain of Beclin 1 compared with the BH3 domain of the pro-apoptotic Bcl-2 family members, Bax and Bim. Thus, we have identified candidate molecules that serve as lead templates for developing potent and selective Beclin 1/Bcl-2 inhibitors that may be clinically useful as autophagy-inducing agents.

  14. Involvement of sulfates from cruzipain, a major antigen of Trypanosoma cruzi, in the interaction with immunomodulatory molecule Siglec-E.

    PubMed

    Ferrero, Maximiliano R; Heins, Anja M; Soprano, Luciana L; Acosta, Diana M; Esteva, Mónica I; Jacobs, Thomas; Duschak, Vilma G

    2016-02-01

    In order to investigate the involvement of sulfated groups in the Trypanosoma cruzi host-parasite relationship, we studied the interaction between the major cysteine proteinase of T. cruzi, cruzipain (Cz), a sulfate-containing sialylated molecule and the sialic acid-binding immunoglobulin like lectin-E (Siglec-E). To this aim, ELISA, indirect immunofluorescence assays and flow cytometry, using mouse Siglec-E-Fc fusion molecules and glycoproteins of parasites, were performed. Competition assays verified that the lectins, Maackia amurensis II (Mal II) and Siglec-E-Fc, compete for the same binding sites. Taking into account that Mal II binding remains unaltered by sulfation, we established this lectin as sialylation degree control. Proteins of an enriched microsomal fraction showed the highest binding to Siglec-E as compared with those from the other parasite subcellular fractions. ELISA assays and the affinity purification of Cz by a Siglec-E column confirmed the interaction between both molecules. The significant decrease in binding of Siglec-E-Fc to Cz and to its C-terminal domain (C-T) after desulfation of these molecules suggests that sulfates contribute to the interaction between Siglec-E-Fc and these glycoproteins. Competitive ELISA assays confirmed the involvement of sulfated epitopes in the affinity between Siglec-E and Cz, probably modified by natural protein environment. Interestingly, data from flow cytometry of untreated and chlorate-treated parasites suggested that sulfates are not primary receptors, but enhance the binding of Siglec-E to trypomastigotic forms. Altogether, our findings support the notion that sulfate-containing sialylated glycoproteins interact with Siglec-E, an ortholog protein of human Siglec-9, and might modulate the immune response of the host, favoring parasitemia and persistence of the parasite.

  15. Quantitative pharmacological analysis of antagonist binding kinetics at CRF1 receptors in vitro and in vivo

    PubMed Central

    Ramsey, Simeon J; Attkins, Neil J; Fish, Rebecca; van der Graaf, Piet H

    2011-01-01

    BACKGROUND AND PURPOSE A series of novel non-peptide corticotropin releasing factor type-1 receptor (CRF1) antagonists were found to display varying degrees of insurmountable and non-competitive behaviour in functional in vitro assays. We describe how we attempted to relate this behaviour to ligand receptor-binding kinetics in a quantitative manner and how this resulted in the development and implementation of an efficient pharmacological screening method based on principles described by Motulsky and Mahan. EXPERIMENTAL APPROACH A non-equilibrium binding kinetic assay was developed to determine the receptor binding kinetics of non-peptide CRF1 antagonists. Nonlinear, mixed-effects modelling was used to obtain estimates of the compounds association and dissociation rates. We present an integrated pharmacokinetic–pharmacodynamic (PKPD) approach, whereby the time course of in vivo CRF1 receptor binding of novel compounds can be predicted on the basis of in vitro assays. KEY RESULTS The non-competitive antagonist behaviour appeared to be correlated to the CRF1 receptor off-rate kinetics. The integrated PKPD model suggested that, at least in a qualitative manner, the in vitro assay can be used to triage and select compounds for further in vivo investigations. CONCLUSIONS AND IMPLICATIONS This study provides evidence for a link between ligand offset kinetics and insurmountable/non-competitive antagonism at the CRF1 receptor. The exact molecular pharmacological nature of this association remains to be determined. In addition, we have developed a quantitative framework to study and integrate in vitro and in vivo receptor binding kinetic behaviour of CRF1 receptor antagonists in an efficient manner in a drug discovery setting. PMID:21449919

  16. A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry.

    PubMed

    Diago-Navarro, Elizabeth; Kamphuis, Monique B; Boelens, Rolf; Barendregt, Arjan; Heck, Albert J; van den Heuvel, Robert H; Díaz-Orejas, Ramón

    2009-09-01

    Kid, the toxin of the parD (kis, kid) maintenance system of plasmid R1, is an endoribonuclease that preferentially cleaves RNA at the 5' of A in the core sequence 5'-UA(A/C)-3'. A model of the Kid toxin interacting with the uncleavable mimetic 5'-AdUACA-3' is available. To evaluate this model, a significant collection of mutants in some of the key residues proposed to be involved in RNA binding (T46, A55, T69 and R85) or RNA cleavage (R73, D75 and H17) were analysed by mass spectrometry in RNA binding and cleavage assays. A pair of substrates, 5'-AUACA-3', and its uncleavable mimetic 5'-AdUACA-3', used to establish the model and structure of the Kid-RNA complex, were used in both the RNA cleavage and binding assays. A second RNA substrate, 5'-UUACU-3' efficiently cleaved by Kid both in vivo and in vitro, was also used in the cleavage assays. Compared with the wild-type protein, mutations in the residues of the catalytic site abolished RNA cleavage without substantially altering RNA binding. Mutations in residues proposed to be involved in RNA binding show reduced binding efficiency and a corresponding decrease in RNA cleavage efficiency. The cleavage profiles of the different mutants were similar with the two substrates used, but RNA cleavage required much lower protein concentrations when the 5'-UUACU-3' substrate was used. Protein synthesis and growth assays are consistent with there being a correlation between the RNase activity of Kid and its inhibitory potential. These results give important support to the available models of Kid RNase and the Kid-RNA complex.

  17. Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

    PubMed

    Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

    1997-03-14

    Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

  18. Replacing antibodies with modified DNA aptamers in vaccine potency assays.

    PubMed

    Trausch, Jeremiah J; Shank-Retzlaff, Mary; Verch, Thorsten

    2017-10-04

    Vaccine in vitro potency assays are vital regulatory tests that are used to confirm the presence and concentration of an antigen of interest in a form that directly or indirectly relates to protective activity in patients. Current assays come in many forms, but they almost exclusively use antibody reagents for selective detection of the target antigen. Antibodies provide specific recognition of vaccine antigens but also exhibit drawbacks such as stability limitations, cost, and lot-to-lot variation, which can make it challenging to maintain the reagent throughout the lifetime of the vaccine. We explored replacing antibodies with aptamers. Aptamers are macromolecules, such as nucleic acids, which can bind to their targets with high specificity and affinity, similar to that of antibodies. Some of the advantages of using aptamers over antibodies is that aptamers can be more stable, smaller, less expensive to produce, synthesized in vitro, and logistically easier to supply throughout the multi-decade lifespan of a commercial vaccine. We created modified DNA aptamers against the common vaccine carrier protein, CRM 197 . Several aptamers were discovered and one was chosen for further characterization. The binding kinetics of the aptamer revealed an off-rate 16-fold slower than anti-CRM 197 antibodies used for comparison. The aptamers were more sensitive than available antibodies in some assay formats and comparable in others. The aptamer epitope was mapped to the receptor-binding domain of CRM 197 , a site adjacent to a known antibody binding site. These data address some key aspects for a path forward in replacing antibodies with aptamers for use as critical reagents in vaccine assays. We further highlight the possibility of using nucleic acid reagents to develop next generation potency assays. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Image-based ELISA on an activated polypropylene microtest plate--a spectrophotometer-free low cost assay technique.

    PubMed

    Parween, Shahila; Nahar, Pradip

    2013-10-15

    In this communication, we report ELISA technique on an activated polypropylene microtest plate (APPµTP) as an illustrative example of a low cost diagnostic assay. Activated test zone in APPµTP binds a capture biomolecule through covalent linkage thereby, eliminating non-specific binding often prevalent in absorption based techniques. Efficacy of APPµTP is demonstrated by detecting human immunoglobulin G (IgG), human immunoglobulin E (IgE) and Aspergillus fumigatus antibody in patient's sera. Detection is done by taking the image of the assay solution by a desktop scanner and analyzing the color of the image. Human IgE quantification by color saturation in the image-based assay shows excellent correlation with absorbance-based assay (Pearson correlation coefficient, r=0.992). Significance of the relationship is seen from its p value which is 4.087e-11. Performance of APPµTP is also checked with respect to microtiter plate and paper-based ELISA. APPµTP can quantify an analyte as precisely as in microtiter plate with insignificant non-specific binding, a necessary prerequisite for ELISA assay. In contrast, paper-ELISA shows high non-specific binding in control sera (false positive). Finally, we have carried out ELISA steps on APPµTP by ultrasound waves on a sonicator bath and the results show that even in 8 min, it can convincingly differentiate a test sample from a control sample. In short, spectrophotometer-free image-based miniaturized ELISA on APPµTP is precise, reliable, rapid, and sensitive and could be a good substitute for conventional immunoassay procedures widely used in clinical and research laboratories. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

    PubMed

    Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

    2005-03-01

    We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

  1. Characterization of 12 GnRH peptide agonists - a kinetic perspective.

    PubMed

    Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak-Reppel, Katrin; Fernández-Montalván, Amaury E; IJzerman, Adriaan P; Heitman, Laura H

    2016-01-01

    Drug-target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin-releasing hormone (GnRH) receptor for the treatment of hormone-dependent diseases. Surprisingly, the kinetic receptor-binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor-binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. A novel radioligand-binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [(125) I]-triptorelin. In addition to radioligand-binding studies, a homogeneous time-resolved FRET Tag-lite™ method was developed as an alternative assay for the same purpose. Two novel competition association assays were successfully developed and applied to determine the kinetic receptor-binding characteristics of 12 high-affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. © 2015 The British Pharmacological Society.

  2. Characterization of 12 GnRH peptide agonists – a kinetic perspective

    PubMed Central

    Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak‐Reppel, Katrin; Fernández‐Montalván, Amaury E.; IJzerman, Adriaan P.

    2015-01-01

    Background and Purpose Drug‐target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin‐releasing hormone (GnRH) receptor for the treatment of hormone‐dependent diseases. Surprisingly, the kinetic receptor‐binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor‐binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. Experimental Approach A novel radioligand‐binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [125I]‐triptorelin. In addition to radioligand‐binding studies, a homogeneous time‐resolved FRET Tag‐lite™ method was developed as an alternative assay for the same purpose. Key Results Two novel competition association assays were successfully developed and applied to determine the kinetic receptor‐binding characteristics of 12 high‐affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Conclusions and Implications Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. PMID:26398856

  3. (+)-3-( sup 123 I)Iodo-MK-801: Synthesis and characterization of binding to the N-methyl-D-aspartate receptor complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ransom, R.W.; Wai-si Eng; Burns, H.D.

    1990-01-01

    Synthetic methods have been established for preparing high specific activity (+)-3-({sup 123}I)Iodo-MK-801 in high radiochemical yield. The binding of the radiotracer to rat cortical membranes has been examine to assess its potential use as an in vivo imaging agent for the N-methyl-D-aspartate (NMDA) receptor-ion channel complex. Under the conditions of the assay, specific (+)-3-({sup 123}I)Iodo-MK-801 binding to membrane homogenates represented greater than 95% of the total binding. Several structurally distinct, noncompetitive NMDA receptor antagonists inhibited binding with potencies in accordance with their reported inhibitory activity at the receptor complex. The concentration of ({plus minus})-3-Iodo-MK-801 required to inhibit 50% of (+)-3-({supmore » 123}I)Iodo-MK-801 binding (IC{sub 50}) was 3.4 nM when using a low ionic strength assay buffer and 5.5 nM in a physiological buffer. In a thoroughly washed membrane preparation, (+)-3-({sup 123}I)Iodo-MK-801 binding was enhanced by L-glutamate and glycine at concentrations known to activate the NMDA receptor. The results indicate that (+)-3-({sup 123}I)Iodo-MK-801 specifically labels the NMDA receptor complex in rat brain membranes and the retention of high affinity under near physiological assay conditions suggests that it may be useful as a SPECT imaging agent for the receptor in vivo.« less

  4. Zinc finger transcription factor CASZ1 interacts with histones, DNA repair proteins and recruits NuRD complex to regulate gene transcription.

    PubMed

    Liu, Zhihui; Lam, Norris; Thiele, Carol J

    2015-09-29

    The zinc finger transcription factor CASZ1 has been found to control neural fate-determination in flies, regulate murine and frog cardiac development, control murine retinal cell progenitor expansion and function as a tumor suppressor gene in humans. However, the molecular mechanism by which CASZ1 regulates gene transcription to exert these diverse biological functions has not been described. Here we identify co-factors that are recruited by CASZ1b to regulate gene transcription using co-immunoprecipitation (co-IP) and mass spectrometry assays. We find that CASZ1b binds to the nucleosome remodeling and histone deacetylase (NuRD) complex, histones and DNA repair proteins. Mutagenesis of the CASZ1b protein assay demonstrates that the N-terminus of CASZ1b is required for NuRD binding, and a poly(ADP-ribose) binding motif in the CASZ1b protein is required for histone H3 and DNA repair proteins binding. The N-terminus of CASZ1b fused to an artificial DNA-binding domain (GAL4DBD) causes a significant repression of transcription (5xUAS-luciferase assay), which could be blocked by treatment with an HDAC inhibitor. Realtime PCR results show that the transcriptional activity of CASZ1b mutants that abrogate NuRD or histone H3/DNA binding is significantly decreased. This indicates a model in which CASZ1b binds to chromatin and recruits NuRD complexes to orchestrate epigenetic-mediated transcriptional programs.

  5. Transfer in SDS of biotinylated proteins from acrylamide gels to an avidin-coated membrane filter.

    PubMed

    Karlin, Arthur; Wang, Chaojian; Li, Jing; Xu, Qiang

    2004-06-01

    Avidin was covalently linked to aldehyde-derivatized polyethersulfone membrane filters. These filters were used in Western blot analysis of proteins reacted with biotinylation reagents and electrophoresed in sodium dodecyl sulfate (SDS) on polyacrylamide gels. Electrophoretic transfer from the gels to these filters was in 0.1% SDS, in which the covalently bound avidin retained its biotin-binding capacity. We compared Western blots on avidin-coated membrane filters of biotinylated and nonbiotinylated forms of mouse immunoglobulin G (IgG), mouse IgG heavy chain, muscle-type acetylcholine receptor alpha subunit, and fused alpha and beta subunits of receptor. Biotinylated proteins were captured with high specificity compared to their nonbiotinylated counterparts and sensitively detected on the avidin-coated membranes.

  6. Binary Classification of a Large Collection of Environmental Chemicals from Estrogen Receptor Assays by Quantitative Structure-Activity Relationship and Machine Learning Methods

    EPA Science Inventory

    ABSTRACT: There are thousands of environmental chemicals subject to regulatory decisions for endocrine disrupting potential. A promising approach to manage this large universe of untested chemicals is to use a prioritization filter that combines in vitro assays with in silico QSA...

  7. A filter paper dry blood spot procedure for acute intermittent porphyria population screening by use of whole blood uroporphyrinogen-I-synthase assay.

    PubMed

    Johansson, L; Thunell, S; Wetterberg, L

    1984-03-13

    A filter paper dry blood spot procedure for the determination of whole blood uroporphyrinogen-I-synthase (UIS) activity is presented. The method is based on the concept of enzyme specific activity, the enzyme activity being related to the haemoglobin concentration of the assay sample. The diagnostic capacity with regard to the acute intermittent porphyria (AIP) gene carrier state is shown to be equivalent to that of a washed red cell reference method. On grounds of easy capillary blood sampling, uncomplicated and safe mail specimen transport and simple laboratory reception routines, the method is stated to be well adapted for use in AIP preadolescent population screening.

  8. Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination.

    PubMed

    Ren, Xiao-Min; Guo, Liang-Hong; Gao, Yu; Zhang, Bin-Tian; Wan, Bin

    2013-05-01

    Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effect on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2'-OH-BDE-28, 3'-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3'-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. A High Content Drug Screen Identifies Ursolic Acid as an Inhibitor of Amyloid β Protein Interactions with Its Receptor CD36*

    PubMed Central

    Wilkinson, Kim; Boyd, Justin D.; Glicksman, Marcie; Moore, Kathryn J.; El Khoury, Joseph

    2011-01-01

    A pathological hallmark of Alzheimer disease (AD) is deposition of amyloid β (Aβ) in the brain. Aβ binds to microglia via a receptor complex that includes CD36 leading to production of proinflammatory cytokines and neurotoxic reactive oxygen species and subsequent neurodegeneration. Interruption of Aβ binding to CD36 is a potential therapeutic strategy for AD. To identify pharmacologic inhibitors of Aβ binding to CD36, we developed a 384-well plate assay for binding of fluorescently labeled Aβ to Chinese hamster ovary cells stably expressing human CD36 (CHO-CD36) and screened an Food and Drug Administration-approved compound library. The assay was optimized based on the cells' tolerance to dimethyl sulfoxide, Aβ concentration, time required for Aβ binding, reproducibility, and signal-to-background ratio. Using this assay, we identified four compounds as potential inhibitors of Aβ binding to CD36. These compounds were ursolic acid, ellipticine, zoxazolamine, and homomoschatoline. Of these compounds, only ursolic acid, a naturally occurring pentacyclic triterpenoid, successfully inhibited binding of Aβ to CHO-CD36 cells in a dose-dependent manner. The ursolic acid effect reached a plateau at ∼20 μm, with a maximal inhibition of 64%. Ursolic acid also blocked binding of Aβ to microglial cells and subsequent ROS production. Our data indicate that cell-based high-content screening of small molecule libraries for their ability to block binding of Aβ to its receptors is a useful tool to identify novel inhibitors of receptors involved in AD pathogenesis. Our data also suggest that ursolic acid is a potential therapeutic agent for AD via its ability to block Aβ-CD36 interactions. PMID:21835916

  10. A receptor binding assay for paralytic shellfish poisoning toxins: recent advances and applications.

    PubMed

    Powell, C L; Doucette, G J

    1999-01-01

    We recently described a high throughput receptor binding assay for paralytic shellfish poisoning (PSP) toxins, the use of the assay for detecting toxic activity in shellfish and algal extracts, and the validation of 11-[3H]-tetrodotoxin as an alternative radioligand to the [3H]-saxitoxin conventionally employed in the assay. Here, we report a dramatic increase in assay efficiency through application of microplate scintillation technology, resulting in an assay turn around time of 4 h. Efforts are now focused on demonstrating the range of applications for which this receptor assay can provide data comparable to the more time consuming, technically demanding HPLC analysis of PSP toxins, currently the method of choice for researchers. To date, we have compared the results of both methods for a variety of sample types, including different genera of PSP toxin producing dinoflagellates (e.g. Alexandrium lusitanicum, r2 = 0.9834, n = 12), size-fractioned field samples of Alexandrium spp. (20-64 microm; r2 = 0.9997, n = 10) as well as its associated zooplankton grazer community (200-500 microm: r2 = 0.6169, n = 10; >500 microm: r2 = 0.5063, n = 10), and contaminated human fluids (r2 = 0.9661, n = 7) from a PSP outbreak. Receptor-based STX equivalent values for all but the zooplankton samples were highly correlated and exhibited close quantitative agreement with those produced by HPLC. While the PSP receptor binding assay does not provide information on toxin composition obtainable by HPLC, it does represent a robust and reliable means of rapidly assessing PSP-like toxicity in laboratory and field samples. Moreover, this assay should be effective as a screening tool for use by public health officials in responding to suspected cases of PSP intoxication.

  11. Cytometer on a chip

    NASA Technical Reports Server (NTRS)

    Lynes, Michael A. (Inventor); Fernandez, Salvador M. (Inventor)

    2010-01-01

    An assay technique for label-free, highly parallel, qualitative and quantitative detection of specific cell populations in a sample and for assessing cell functional status, cell-cell interactions and cellular responses to drugs, environmental toxins, bacteria, viruses and other factors that may affect cell function. The technique includes a) creating a first array of binding regions in a predetermined spatial pattern on a sensor surface capable of specifically binding the cells to be assayed; b) creating a second set of binding regions in specific spatial patterns relative to the first set designed to efficiently capture potential secreted or released products from cells captured on the first set of binding regions; c) contacting the sensor surface with the sample, and d) simultaneously monitoring the optical properties of all the binding regions of the sensor surface to determine the presence and concentration of specific cell populations in the sample and their functional status by detecting released or secreted bioproducts.

  12. DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuzuhara, T.; Suganuma, M.; Oka, K.

    2007-11-03

    Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

  13. Radioligand Recognition of Insecticide Targets.

    PubMed

    Casida, John E

    2018-04-04

    Insecticide radioligands allow the direct recognition and analysis of the targets and mechanisms of toxic action critical to effective and safe pest control. These radioligands are either the insecticides themselves or analogs that bind at the same or coupled sites. Preferred radioligands and their targets, often in both insects and mammals, are trioxabicyclooctanes for the γ-aminobutyric acid (GABA) receptor, avermectin for the glutamate receptor, imidacloprid for the nicotinic receptor, ryanodine and chlorantraniliprole for the ryanodine receptor, and rotenone or pyridaben for NADH + ubiquinone oxidoreductase. Pyrethroids and other Na + channel modulator insecticides are generally poor radioligands due to lipophilicity and high nonspecific binding. For target site validation, the structure-activity relationships competing with the radioligand in the binding assays should be the same as that for insecticidal activity or toxicity except for rapidly detoxified or proinsecticide analogs. Once the radioligand assay is validated for relevance, it will often help define target site modifications on selection of resistant pest strains, selectivity between insects and mammals, and interaction with antidotes and other chemicals at modulator sites. Binding assays also serve for receptor isolation and photoaffinity labeling to characterize the interactions involved.

  14. Streptomyces coelicolor SCO4226 Is a Nickel Binding Protein

    PubMed Central

    Jin, Hua; Zhang, Rong-Guang; Virolle, Marie-Joelle; Chen, Yuxing; Zhou, Cong-Zhao

    2014-01-01

    The open reading frame SCO4226 of Streptomyces coelicolor A3(2) encodes an 82-residue hypothetical protein. Biochemical assays revealed that each SCO4226 dimer binds four nickel ions. To decipher the molecular function, we solved the crystal structures of SCO4226 in both apo- and nickel-bound (Ni-SCO4226) forms at 1.30 and 2.04 Å resolution, respectively. Each subunit of SCO4226 dimer adopts a canonical ferredoxin-like fold with five β-strands flanked by two α-helices. In the structure of Ni-SCO4226, four nickel ions are coordinated at the surface of the dimer. Further biochemical assays suggested that the binding of Ni2+ triggers the self-aggregation of SCO4226 in vitro. In addition, RT-qPCR assays demonstrated that the expression of SCO4226 gene in S. coelicolor is specifically up-regulated by the addition of Ni2+, but not other divalent ions such as Cu2+, Mn2+ or Co2+. All these results suggested that SCO4226 acts as a nickel binding protein, probably required for nickel sequestration and/or detoxification. PMID:25285530

  15. A PROP1-binding factor, AES cloned by yeast two-hybrid assay represses PROP1-induced Pit-1 gene expression.

    PubMed

    Sugiyama, Yuka; Ikeshita, Nobuko; Shibahara, Hiromi; Yamamoto, Daisuke; Kawagishi, Mayuko; Iguchi, Genzo; Iida, Keiji; Takahashi, Yutaka; Kaji, Hidesuke; Chihara, Kazuo; Okimura, Yasuhiko

    2013-08-25

    PROP1 mutation causes combined pituitary hormone deficiency (CPHD). Several mutations are located in a transactivation domain (TAD) of Prop1, and the loss of TAD binding to cofactors is likely the cause of CPHD. PROP1 cofactors have not yet been identified. In the present study, we aimed to identify the PROP1-interacting proteins from the human brain cDNA library. Using a yeast two-hybrid assay, we cloned nine candidate proteins that may bind to PROP1. Of those nine candidates, amino-terminal enhancer of split (AES) was the most abundant, and we analyzed the AES function. AES dose-dependently decreased the PROP1-induced Pit-1 reporter gene expression. An immunoprecipitation assay revealed the relationship between AES and PROP1. In a mammalian two-hybrid assay, a leucine zipper-like motif of the AES Q domain was identified as a region that interacted with TAD. These results indicated that AES was a corepressor of PROP1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  16. Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

    PubMed Central

    Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

    2017-01-01

    Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

  17. Structural Requirements For Bone Sialoprotein Binding And Modulation Of Matrix Metalloproteinase-2

    PubMed Central

    Jain, Alka; Karadag, Abdullah; Fisher, Larry W.; Fedarko, Neal S.

    2008-01-01

    Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2′s propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation. PMID:18729384

  18. Structural requirements for bone sialoprotein binding and modulation of matrix metalloproteinase-2.

    PubMed

    Jain, Alka; Karadag, Abdullah; Fisher, Larry W; Fedarko, Neal S

    2008-09-23

    Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2's propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation.

  19. Addressing matrix effects in ligand-binding assays through the use of new reagents and technology.

    PubMed

    Chilewski, Shannon D; Mora, Johanna R; Gleason, Carol; DeSilva, Binodh

    2014-04-01

    Ligand-binding assays (LBAs) used in the quantification of biotherapeutics for pharmacokinetic determinations rely on interactions between reagents (antibodies or target molecule) and the biotherapeutic. Most LBAs do not employ an analyte extraction procedure and are susceptible to matrix interference. Here, we present a case study on the development of a LBA for the quantification of a PEGylated domain antibody where matrix interference was observed. The assay used to support the single ascending dose study was a plate-based electrochemiluminescent assay with a lower limit of quantification of 80 ng/mL. To meet sensitivity requirements of future studies, new reagents and the Gyrolab™ Workstation were evaluated. Assay sensitivity improved nearly threefold in the final method utilizing new antibody reagents, a buffer containing blockers to human anti-animal antibodies, and the Gyrolab Workstation. Experimental data indicate that all factors changed played a role in overcoming matrix effects.

  20. Paraffin section immunocytochemistry and cytosol-based ligand-binding assays for ER and PR detection in breast cancer: the time has come for more objectivity.

    PubMed

    Goussard, J

    1998-10-23

    The importance of the receptor level in breast cancer as an indicator of hormone response has been extensively studied for more than 20 years. Besides cytosol-based ligand-binding assays (dextran-coated charcoal assay, DCC), new methods using monoclonal antibodies raised against estrogen and progesterone receptors allow for the detection of receptors both in cytosol extracts (enzyme immunoassay, EIA) and in tissue sections (immunocytochemical assay, ICA). The biochemical assays (DCC and EIA) as well as the immunochemical detection (ICA) have specific qualities and produce original information which is useful for the therapeutic decision. While DCC gives a measure of the receptor level, whatever the real source of synthesis (normal and/or neoplastic tissue), ICA locates the positive cells and their relative proportion in the tumor. Both methods present their own advantages and disadvantages which are summarized in this study.

  1. Multiplexed analysis of protein-ligand interactions by fluorescence anisotropy in a microfluidic platform.

    PubMed

    Cheow, Lih Feng; Viswanathan, Ramya; Chin, Chee-Sing; Jennifer, Nancy; Jones, Robert C; Guccione, Ernesto; Quake, Stephen R; Burkholder, William F

    2014-10-07

    Homogeneous assay platforms for measuring protein-ligand interactions are highly valued due to their potential for high-throughput screening. However, the implementation of these multiplexed assays in conventional microplate formats is considerably expensive due to the large amounts of reagents required and the need for automation. We implemented a homogeneous fluorescence anisotropy-based binding assay in an automated microfluidic chip to simultaneously interrogate >2300 pairwise interactions. We demonstrated the utility of this platform in determining the binding affinities between chromatin-regulatory proteins and different post-translationally modified histone peptides. The microfluidic chip assay produces comparable results to conventional microtiter plate assays, yet requires 2 orders of magnitude less sample and an order of magnitude fewer pipetting steps. This approach enables one to use small samples for medium-scale screening and could ease the bottleneck of large-scale protein purification.

  2. Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform

    PubMed Central

    Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

    2015-01-01

    A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329

  3. Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform.

    PubMed

    Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

    2015-07-16

    A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.

  4. Quantitation of proteins using a dye-metal-based colorimetric protein assay.

    PubMed

    Antharavally, Babu S; Mallia, Krishna A; Rangaraj, Priya; Haney, Paul; Bell, Peter A

    2009-02-15

    We describe a dye-metal (polyhydroxybenzenesulfonephthalein-type dye and a transition metal) complex-based total protein determination method. The binding of the complex to protein causes a shift in the absorption maximum of the dye-metal complex from 450 to 660 nm. The dye-metal complex has a reddish brown color that changes to green on binding to protein. The color produced from this reaction is stable and increases in a proportional manner over a broad range of protein concentrations. The new Pierce 660 nm Protein Assay is very reproducible, rapid, and more linear compared with the Coomassie dye-based Bradford assay. The assay reagent is room temperature stable, and the assay is a simple and convenient mix-and-read format. The assay has a moderate protein-to-protein variation and is compatible with most detergents, reducing agents, and other commonly used reagents. This is an added advantage for researchers needing to determine protein concentrations in samples containing both detergents and reducing agents.

  5. Beta-endorphin. Biological activity of synthetic analogs with analgesia inhibiting property in rat vas deferens and guinea pig ileum assays.

    PubMed

    Ho, C L; Li, C H

    1985-03-01

    Three synthetic analogs of human beta-endorphin (beta h-EP) (I, [Gln8, Gly31]-beta h-EP-Gly-Gly-NH2; II, [Arg9,12,24,28,29]-beta h-EP and III, [Cys11,26, Phe27, Gly31]-beta h-EP), which have been shown to possess potent inhibiting activity to beta h-EP-induced analgesia, were assayed in rat vas deferens and guinea pig ileum bioassay systems. In the rat vas deferens assay, relative potencies of these analogs were beta h-EP, 100; I, 30; II, 40; III, 1, whereas in the guinea pig ileum assay: beta h-EP, 100; I, 184; II, 81; III, 163. From previous studies on their analgesia potency in mice and opiate receptor-binding activity in rat brain membranes, their activity in rat vas deferens correlates well with the analgesic potency and the activity from guinea pig ileum assay shows good correlations with that from the opiate receptor-binding assay.

  6. Comparison of reverse transcriptase PCR, reverse transcriptase loop-mediated isothermal amplification, and culture-based assays for Salmonella detection from pork processing environments.

    PubMed

    Techathuvanan, Chayapa; Draughon, Frances Ann; D'Souza, Doris Helen

    2011-02-01

    Novel rapid Salmonella detection assays without the need for sophisticated equipment or labor remain in high demand. Real-time reverse transcriptase PCR (RT-PCR) assays, though rapid and sensitive, require expensive thermocyclers, while a novel RT loop-mediated isothermal amplification (RT-LAMP) method requires only a simple water bath. Our objective was to compare the detection sensitivity of Salmonella Typhimurium from the pork processing environment by RT-LAMP, RT-PCR, and culture-based assays. Carcass and surface swabs and carcass rinses were obtained from a local processing plant. Autoclaved carcass rinses (500 ml) were spiked with Salmonella Typhimurium and filtered. Filters were placed in stomacher bags containing tetrathionate broth (TTB) and analyzed with or without 10-h enrichment at 37 °C. Natural swabs were stomached with buffered peptone water, and natural carcass rinses were filtered, preenriched, and further enriched in TTB. Serially-diluted enriched samples were enumerated by spread plating on xylose lysine Tergitol 4 agar. RNA was extracted from 5 ml of enriched TTB with TRIzol. RT-LAMP assay using previously described invA primers was conducted at 62 °C for 90 min in a water bath with visual detection and by gel electrophoresis. SYBR Green I-based-real-time RT-PCR was carried out with invA primers followed by melt temperature analysis. The results of RT-LAMP detection for spiked carcass rinses were comparable to those of RT-PCR and cultural plating, with detection limits of 1 log CFU/ml, although they were obtained significantly faster, within 24 h including preenrichment and enrichment. RT-LAMP showed 4 of 12 rinse samples positive, while RT-PCR showed 1 of 12 rinse samples positive. For swabs, 6 of 27 samples positive by RT-LAMP and 5 of 27 by RT-PCR were obtained. This 1-day RT-LAMP assay shows promise for routine Salmonella screening by the pork industry. Copyright ©, International Association for Food Protection

  7. Probing structurally altered and aggregated states of therapeutically relevant proteins using GroEL coupled to bio-layer interferometry.

    PubMed

    Naik, Subhashchandra; Kumru, Ozan S; Cullom, Melissa; Telikepalli, Srivalli N; Lindboe, Elizabeth; Roop, Taylor L; Joshi, Sangeeta B; Amin, Divya; Gao, Phillip; Middaugh, C Russell; Volkin, David B; Fisher, Mark T

    2014-10-01

    The ability of a GroEL-based bio-layer interferometry (BLI) assay to detect structurally altered and/or aggregated species of pharmaceutically relevant proteins is demonstrated. Assay development included optimizing biotinylated-GroEL immobilization to streptavidin biosensors, combined with biophysical and activity measurements showing native and biotinylated GroEL are both stable and active. First, acidic fibroblast growth factor (FGF-1) was incubated under conditions known to promote (40°C) and inhibit (heparin addition) molten globule formation. Heat exposed (40°C) FGF-1 exhibited binding to GroEL-biosensors, which was significantly diminished in the presence of heparin. Second, a polyclonal human IgG solution containing 6-8% non-native dimer showed an increase in higher molecular weight aggregates upon heating by size exclusion chromatography (SEC). The poly IgG solution displayed binding to GroEL-biosensors initially with progressively increased binding upon heating. Enriched preparations of the IgG dimers or monomers showed significant binding to GroEL-biosensors. Finally, a thermally treated IgG1 monoclonal antibody (mAb) solution also demonstrated increased GroEL-biosensor binding, but with different kinetics. The bound complexes could be partially to fully dissociated after ATP addition (i.e., specific GroEL binding) depending on the protein, environmental stress, and the assay's experimental conditions. Transmission electron microscopy (TEM) images of GroEL-mAb complexes, released from the biosensor, also confirmed interaction of bound complexes at the GroEL binding site with heat-stressed mAb. Results indicate that the GroEL-biosensor-BLI method can detect conformationally altered and/or early aggregation states of proteins, and may potentially be useful as a rapid, stability-indicating biosensor assay for monitoring the structural integrity and physical stability of therapeutic protein candidates. © 2014 The Protein Society.

  8. Small molecule antagonists of the urokinase (uPA): urokinase receptor (uPAR) interaction with high reported potencies show only weak effects in cell-based competition assays employing the native uPAR ligand.

    PubMed

    De Souza, Melissa; Matthews, Hayden; Lee, Jodi A; Ranson, Marie; Kelso, Michael J

    2011-04-15

    Binding of the urokinase-type plasminogen activator (uPA) to its cell-surface-bound receptor uPAR and upregulation of the plasminogen activation system (PAS) correlates with increased metastasis and poor prognosis in several tumour types. Disruptors of the uPA:uPAR interaction represent promising anti-tumour/metastasis agents and several approaches have been explored for this purpose, including the use of small molecule antagonists. Two highly potent non-peptidic antagonists 1 and 2 (IC(50)1=0.8 nM, IC(50)2=33 nM) from the patent literature were reportedly identified using competition assays employing radiolabelled uPAR-binding uPA fragments and appeared as useful pharmacological tools for studying the PAS. Before proceeding to such studies, confirmation was sought that 1 and 2 retained their potencies in physiologically relevant cell-based competition assays employing uPAR's native binding partner high molecular weight uPA (HMW-uPA). This study describes a new solution phase synthesis of 1, a mixed solid/solution phase synthesis of 2 and reports the activities of 1 and 2 in semi-quantitative competition flow cytometry assays and quantitative cell-based uPA activity assays that employed HMW-uPA as the competing ligand. The flow cytometry experiments revealed that high concentrations of 2 (10-100 μM) are required to compete with HMW-uPA for uPAR binding and that 1 shows no antagonist effects at 100 μM. The cell-based enzyme activity assays similarly revealed that 1 and 2 are poor inhibitors of cell surface-bound HMW-uPA activity (IC(50) >100 μM for 1 and 2). The report highlights the dangers of identifying false-positive lead uPAR antagonists from competition assays employing labelled competing ligands other than the native HMW-uPA. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Sub-micron filter

    DOEpatents

    Tepper, Frederick [Sanford, FL; Kaledin, Leonid [Port Orange, FL

    2009-10-13

    Aluminum hydroxide fibers approximately 2 nanometers in diameter and with surface areas ranging from 200 to 650 m.sup.2/g have been found to be highly electropositive. When dispersed in water they are able to attach to and retain electronegative particles. When combined into a composite filter with other fibers or particles they can filter bacteria and nano size particulates such as viruses and colloidal particles at high flux through the filter. Such filters can be used for purification and sterilization of water, biological, medical and pharmaceutical fluids, and as a collector/concentrator for detection and assay of microbes and viruses. The alumina fibers are also capable of filtering sub-micron inorganic and metallic particles to produce ultra pure water. The fibers are suitable as a substrate for growth of cells. Macromolecules such as proteins may be separated from each other based on their electronegative charges.

  10. [Radiolabelling and assay of Chinese agkistrodon acutus venom with carrier-free Na 125I].

    PubMed

    Gong, Y; Deng, C; Li, S; Li, L; Guan, J

    1995-03-01

    Chinese agkistroden acutus venom (CAAV) was radiolabelled with carrier-free Na 125I by the method of Iodogen. The specific activity and radiochemical purity for radiolabelled products were 4236.5 x 10(10) Bq/mmol and 98%, respectively. Each CAAV molecule carried 0.52 125I atom. Physical and chemical characterization of radiolabelled CAAV was similar to unradiolabelled CAAV. Binding analysis showed that 125I-CAAV was bound to platelet in a saturable manner. Binding sites per platelet were 13,255 +/- 6292/platelet. The dissociation constant (Kd) was 3.2 +/- 0.69 x 10(-10) mol/L. These results are similar to binding sites of other snake venom on platelet. The investigation showed that radiolabelled CAAV made by our laboratory was useful for radioligand binding assay.

  11. Sponsor relationships, analyte stability in ligand-binding assays and critical reagent management: a bioanalytical CRO perspective.

    PubMed

    Lefor Bradford, Julia

    2015-01-01

    This perspective article discusses key points to address in the establishment of sound partnerships between sponsors and bioanalytical CROs to assure the timeliness, quality and consistency of bioanalysis throughout biological therapeutic development. The performance of ligand-binding assays can be greatly impacted by low-grade reagents, lot-to-lot variability and lack of stability of the analyte in matrix, impacting both timelines and cost. Thorough characterization of the biologic of interest and its assay-enabling critical reagents will lend itself well to conservation of materials and continuity of assay performance. When unplanned events occur, such as performance declines or premature depletion of material, structured procedures are paramount to supplement the current loosely defined regulatory guidance on critical reagent characterization and method bridging.

  12. Shikonin, a natural product from the root of Lithospermum erythrorhizon, is a cytotoxic DNA-binding agent.

    PubMed

    Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L

    2013-04-11

    To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Interpretation of the Raji cell assay in sera containing anti-nuclear antibodies and immune complexes.

    PubMed Central

    Horsfall, A C; Venables, P J; Mumford, P A; Maini, R N

    1981-01-01

    The Raji cell assay is regarded as a test for the detection and quantitation of immune complexes. It is frequently positive in sera from patients with SLE. We have demonstrated a relationship between Raji cell binding and antibodies to DNA and soluble cellular antigens. In five sera containing high titres of antibodies of known single specificity, most of the Raji cell binding occurred in the 7S IgG fraction where the majority of anti-nuclear antibody was also found. When each of these sera was incubated with its specific antigen, Raji cell binding increased. Subsequent fractionation showed that this binding was in the high molecular weight fraction (greater than 200,000 daltons) and that Raji cell binding and antibody activity were abolished in the 7S fraction. These data confirm that Raji cell bind immune complexes but also indicate that 7S anti-nuclear antibodies may interact directly with Raji cells by an unknown mechanism. Therefore, in sera of patients with anti-nuclear antibodies, binding to Raji cells does not necessarily imply the presence of immune complexes alone. PMID:6975676

  14. An assay that may predict the development of IgG enhancing allergen-specific IgE binding during birch immunotherapy

    PubMed Central

    Selb, R.; Eckl-Dorna, J.; Vrtala, S.; Valenta, R.; Niederberger, V.

    2017-01-01

    Background It has been shown that birch pollen immunotherapy can induce IgG antibodies which enhance IgE binding to Bet v 1. We aimed to develop a serological assay to predict the development of antibodies which enhance IgE binding to Bet v 1 during immunotherapy. Methods In 18 patients treated by Bet v 1-fragment-specific immunotherapy, the effects of IgG antibodies specific for the fragments on the binding of IgE antibodies to Bet v 1 were measured by ELISA. Blocking and possible enhancing effects on IgE binding were compared with skin sensitivity to Bet v 1 after treatment. Results We found that fragment-specific IgG enhanced IgE binding to Bet v 1 in two patients who also showed an increase of skin sensitivity to Bet v 1. Conclusion Our results indicate that it may be possible to develop serological tests which predict the induction of unfavourable IgG antibodies enhancing the binding of IgE to Bet v 1 during immunotherapy. PMID:23998344

  15. Ligand- and structure-based in silico studies to identify kinesin spindle protein (KSP) inhibitors as potential anticancer agents.

    PubMed

    Balakumar, Chandrasekaran; Ramesh, Muthusamy; Tham, Chuin Lean; Khathi, Samukelisiwe Pretty; Kozielski, Frank; Srinivasulu, Cherukupalli; Hampannavar, Girish A; Sayyad, Nisar; Soliman, Mahmoud E; Karpoormath, Rajshekhar

    2017-11-29

    Kinesin spindle protein (KSP) belongs to the kinesin superfamily of microtubule-based motor proteins. KSP is responsible for the establishment of the bipolar mitotic spindle which mediates cell division. Inhibition of KSP expedites the blockade of the normal cell cycle during mitosis through the generation of monoastral MT arrays that finally cause apoptotic cell death. As KSP is highly expressed in proliferating/cancer cells, it has gained considerable attention as a potential drug target for cancer chemotherapy. Therefore, this study envisaged to design novel KSP inhibitors by employing computational techniques/tools such as pharmacophore modelling, virtual database screening, molecular docking and molecular dynamics. Initially, the pharmacophore models were generated from the data-set of highly potent KSP inhibitors and the pharmacophore models were validated against in house test set ligands. The validated pharmacophore model was then taken for database screening (Maybridge and ChemBridge) to yield hits, which were further filtered for their drug-likeliness. The potential hits retrieved from virtual database screening were docked using CDOCKER to identify the ligand binding landscape. The top-ranked hits obtained from molecular docking were progressed to molecular dynamics (AMBER) simulations to deduce the ligand binding affinity. This study identified MB-41570 and CB-10358 as potential hits and evaluated these experimentally using in vitro KSP ATPase inhibition assays.

  16. Diagnosis of amphimeriasis by LAMPhimerus assay in human stool samples long-term storage onto filter paper

    PubMed Central

    Calvopiña, Manuel; Buendía-Sánchez, María; López-Abán, Julio; Vicente, Belén; Muro, Antonio

    2018-01-01

    Amphimeriasis, a fish-borne zoonotic disease caused by the liver fluke Amphimerus spp., has recently been reported as an emerging disease affecting an indigenous Ameridian group, the Chachi, living in Ecuador. The only method for diagnosing amphimeriasis was the microscopic detection of eggs from the parasite in patients' stool samples with very low sensitivity. Our group developed an ELISA technique for detection of anti-Amphimerus IgG in human sera and a molecular method based on LAMP technology (named LAMPhimerus) for specific and sensitive parasite DNA detection. The LAMPhimerus method showed to be much more sensitive than classical parasitological methods for amphimeriasis diagnosis using human stool samples for analysis. The objective of this work is to demonstrate the feasibility of using dried stool samples on filter paper as source of DNA in combination with the effectiveness of our previously designed LAMPhimerus assay for successfully Amphimerus sp. detection in clinical stool samples. A total of 102 untreated and undiluted stool samples collected from Chachi population were spread as thin layer onto common filter paper for easily transportation to our laboratory and stored at room temperature for one year until DNA extraction. When LAMPhimerus method was applied for Amphimerus sp. DNA detection, a higher number of positive results was detected (61/102; 59.80%) in comparison to parasitological methods (38/102; 37.25%), including 28/61 (45.90%) microscopy-confirmed Amphimerus sp. infections. The diagnostic parameters for the sensitivity and specificity werecalculated for our LAMPhimerus assay, which were 79.17% and 65.98%, respectively. We demonstrate, for the first time, that common filter paper is useful for easy collection and long-term storage of human stool samples for later DNA extraction and molecular analysis of human-parasitic trematode eggs. This simple, economic and easily handling method combined with the specific and sensible LAMPhimerus assay has the potential to beused as an effective molecular large-scale screening test for amphimeriasis-endemic areas. PMID:29444135

  17. Marine Bivalve Cellular Responses to Beta Blocker Exposures ...

    EPA Pesticide Factsheets

    β blockers are prescription drugs used for medical treatment of hypertension and arrhythmias. They prevent binding of agonists such as catecholamines to β adrenoceptors. In the absence of agonist induced activation of the receptor, adenylate cyclase is not activated which in turn limits cAMP production and protein kinase A activation, preventing increases in blood pressure and arrhythmias. After being taken therapeutically, commonly prescribed β blockers may make their way to coastal habitats via discharge from waste water treatment plants (WWTP) posing a potential risk to aquatic organisms. The aim of our research is to evaluate cellular responses of three commercially important marine bivalves - Eastern oysters, blue mussels and hard clams - upon exposure to two β blocker drugs, propranolol and metoprolol, and to find molecular initiating events (MIEs) indicative of the exposure. Bivalves were obtained from Narragansett Bay (Rhode Island, USA) and acclimated in the laboratory. Following acclimation, gills and hepatopancreas (HP) tissues were harvested and separately exposed to 0, 1, 10, 100 and 1000 ng/l of each drug. Tissues were bathed in 30 parts per thousand (ppt) filtered seawater, antibiotic mix, Leibovitz nutrient media, and the test drug. Exposures were conducted for 24 hours and samples were saved for cellular biomarker assays. A lysosomal destabilization assay, which is a marker of membrane damage, was also performed at the end of each exposure.

  18. 31P and 1H NMR Studies of the Molecular Organization of Lipids in the Parallel Artificial Membrane Permeability Assay.

    PubMed

    Assmus, Frauke; Ross, Alfred; Fischer, Holger; Seelig, Joachim; Seelig, Anna

    2017-01-03

    The parallel artificial membrane permeability assay (PAMPA) has emerged as a widely used primary in vitro screen for passive permeability of potential drug candidates. However, the molecular structure of the permeation barrier (consisting of a filter-supported dodecane-egg lecithin mixture) has never been characterized. Here, we investigated the long-range order of phospholipids in the PAMPA barrier by means of 31 P static solid-state NMR. Diffusion constants of PAMPA membrane components were derived from liquid state NMR and, in addition, drug distribution between the PAMPA lipid phase and buffer (log D PAMPA at pH 7.4) was systematically investigated. Increasing concentration of n-dodecane to the system egg lecithin-water (lamellar phase, L α ) induces formation of inverted hexagonal (H ii ) and isotropic phases. At n-dodecane concentrations matching those used in PAMPA (9%, w/v) a purely "isotropic" phase was observed corresponding to lipid aggregates with a diameter in the range 4-7 nm. Drug distribution studies indicate that these reverse micelles facilitate the binding to, and in turn the permeation across, the PAMPA dodecane barrier, in particular for amphiphilic solutes. The proposed model for the molecular architecture and function of the PAMPA barrier provides a fundamental, hitherto missing framework to evaluate the scope but also limitations of PAMPA for the prediction of in vivo membrane permeability.

  19. Hormone Binding to Recombinant Estrogen Receptors from Human, Alligator, Quail, Salamander, and Fathead Minnow

    EPA Science Inventory

    In this work, a 96-well plate estrogen receptor binding assay was developed to facilitate the direct comparison of chemical binding to full-length recombinant estrogen receptors across vertebrate classes. Receptors were generated in a baculovirus expression system. This approach ...

  20. Ultramicro-fluorometric assay for the diagnosis of Gaucher disease in dried blood spots on filter paper.

    PubMed

    Herrera, D; Monaga, M; Campos, D; Pampín, Y; González, E C; Lavaut, K

    2013-01-01

    Gaucher disease (GD) is a lysosomal storage disorder characterized by a deficiency of the lysosomal acid β-D-glucosidase (GBA). The aim of this study was to develop an ultramicro-fluorometric assay based on the method of Chamoles et al. for determining GBA activity in dried blood spots on filter paper (DBS). The assay used 3-mm diameter blood spot and 8 mmol/l of 4-methylumbelliferyl-β-D-glucoside as enzymatic substrate. The reaction occurred in plates incubated at 37°C for 20 hours and the enzyme activity was expressed in μmol hydrolysed substrate/l blood/h. The fluorescence of the enzyme product was automatically measured in a fluorometer-photometer reader (SUMA Technology). The intra and inter-assay coefficients of variation were lower than 9 and 12%, respectively, and the recovery range was 97-109%.Three patients with GD were correctly diagnosed using the ultramicroassay. Healthy newborn DBS samples (n = 3003) from the National Neonatal Screening Program were analyzed, and the mean GBA activity was 5.7 μmol/l blood/h. Our assay showed high Pearson (n = 26; r = 0.99) and concordance correlations (ρc = 0.99) with the traditional method described by Chamoles et al. The analytical performance characteristics of our ultramicro-fluorometric assay suggest that it can be used in the diagnosis of GD in newborns and adults.

  1. Anti-DNA antibodies--quintessential biomarkers of SLE.

    PubMed

    Pisetsky, David S

    2016-02-01

    Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.

  2. POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

    PubMed

    Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

    2002-07-26

    The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

  3. Nanoprobe-Enhanced, Split Aptamer-Based Electrochemical Sandwich Assay for Ultrasensitive Detection of Small Molecules.

    PubMed

    Zhao, Tao; Liu, Ran; Ding, Xiaofan; Zhao, Juncai; Yu, Haixiang; Wang, Lei; Xu, Qing; Wang, Xuan; Lou, Xinhui; He, Miao; Xiao, Yi

    2015-08-04

    It is quite challenging to improve the binding affinity of antismall molecule aptamers. We report that the binding affinity of anticocaine split aptamer pairs improved by up to 66-fold by gold nanoparticles (AuNP)-attached aptamers due to the substantially increased local concentration of aptamers and multiple and simultaneous ligand interactions. The significantly improved binding affinity enables the detection of small molecule targets with unprecedented sensitivity, as demonstrated in nanoprobe-enhanced split aptamer-based electrochemical sandwich assays (NE-SAESA). NE-SAESA replaces the traditional molecular reporter probe with AuNPs conjugated to multiple reporter probes. The increased binding affinity allowed us to use 1,000-fold lower reporter probe concentrations relative to those employed in SAESA. We show that the near-elimination of background in NE-SAESA effectively improves assay sensitivity by ∼1,000-100,000-fold for ATP and cocaine detection, relative to equivalent SAESA. With the ongoing development of new strategies for the selection of aptamers, we anticipate that our sensor platform should offer a generalizable approach for the high-sensitivity detection of diverse targets. More importantly, we believe that NE-SAESA represents a novel strategy to improve the binding affinity between a small molecule and its aptamer and potentially can be extended to other detection platforms.

  4. Inhibition of HMGA2 binding to DNA by netropsin

    PubMed Central

    Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

    2008-01-01

    The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

  5. Phosphatidylserine recognition and induction of apoptotic cell clearance by Drosophila engulfment receptor Draper.

    PubMed

    Tung, Tran Thanh; Nagaosa, Kaz; Fujita, Yu; Kita, Asana; Mori, Hiroki; Okada, Ryo; Nonaka, Saori; Nakanishi, Yoshinobu

    2013-05-01

    The membrane phospholipid phosphatidylserine is exposed on the cell surface during apoptosis and acts as an eat-me signal in the phagocytosis of apoptotic cells in mammals and nematodes. However, whether this is also true in insects was unclear. When milk fat globule-epidermal growth factor 8, a phosphatidylserine-binding protein of mammals, was ectopically expressed in Drosophila, the level of phagocytosis was reduced, whereas this was not the case for the same protein lacking a domain responsible for the binding to phosphatidylserine. We found that the extracellular region of Draper, an engulfment receptor of Drosophila, binds to phosphatidylserine in an enzyme-linked immunosorbent assay-like solid-phase assay and in an assay for surface plasmon resonance. A portion of Draper containing domains EMI and NIM located close to the N-terminus was required for binding to phosphatidylserine, and a Draper protein lacking this region was not active in Drosophila. Finally, the level of tyrosine-phosphorylated Draper, indicative of the activation of Draper, in a hemocyte-derived cell line was increased after treatment with phosphatidylserine-containing liposome. These results indicated that phosphatidylserine serves as an eat-me signal in the phagocytic removal of apoptotic cells in Drosophila and that Draper is a phosphatidylserine-binding receptor for phagocytosis.

  6. Identification of berberine as a direct thrombin inhibitor from traditional Chinese medicine through structural, functional and binding studies

    NASA Astrophysics Data System (ADS)

    Wang, Xing; Zhang, Yuxin; Yang, Ying; Wu, Xia; Fan, Hantian; Qiao, Yanjiang

    2017-03-01

    Thrombin acts as a key enzyme in the blood coagulation cascade and represents a potential drug target for the treatment of several cardiovascular diseases. The aim of this study was to identify small-molecule direct thrombin inhibitors from herbs used in traditional Chinese medicine (TCM). A pharmacophore model and molecular docking were utilized to virtually screen a library of chemicals contained in compositions of traditional Chinese herbs, and these analyses were followed by in vitro bioassay validation and binding studies. Berberine (BBR) was first confirmed as a thrombin inhibitor using an enzymatic assay. The BBR IC50 value for thrombin inhibition was 2.92 μM. Direct binding studies using surface plasmon resonance demonstrated that BBR directly interacted with thrombin with a KD value of 16.39 μM. Competitive binding assay indicated that BBR could bind to the same argartroban/thrombin interaction site. A platelet aggregation assay demonstrated that BBR had the ability to inhibit thrombin-induced platelet aggregation in washed platelets samples. This study proved that BBR is a direct thrombin inhibitor that has activity in inhibiting thrombin-induced platelet aggregation. BBR may be a potential candidate for the development of safe and effective thrombin-inhibiting drugs.

  7. High-throughput screening and mechanism-based evaluation of estrogenic botanical extracts

    PubMed Central

    Overk, Cassia R.; Yao, Ping; Chen, Shaonong; Deng, Shixing; Imai, Ayano; Main, Matthew; Schinkovitz, Andreas; Farnsworth, Norman R.; Pauli, Guido F.; Bolton, Judy L.

    2009-01-01

    Symptoms associated with menopause can greatly affect the quality of life for women. Botanical dietary supplements have been viewed by the public as safe and effective despite a lack of evidence indicating a urgent necessity to standardize these supplements chemically and biologically. Seventeen plants were evaluated for estrogenic biological activity using standard assays: competitive estrogen receptor (ER) binding assay for both alpha and beta subtypes, transient transfection of the estrogen response element luciferase plasmid into MCF-7 cells expressing either ER alpha or ER beta, and the Ishikawa alkaline phosphatase induction assay for both estrogenic and antiestrogenic activities. Based on the combination of data pooled from these assays, the following was determined: a) a high rate of false positive activity for the competitive binding assays, b) some extracts had estrogenic activity despite a lack of ability to bind the ER, c) one extract exhibited selective estrogen receptor modulator (SERM) activity, and d) several extracts show additive/synergistic activity. Taken together, these data indicate a need to reprioritize the order in which the bioassays are performed for maximal efficiency of programs involving bioassay-guided fractionation. In addition, possible explanations for the conflicts in the literature over the estrogenicity of Cimicifuga racemosa (black cohosh) are suggested. PMID:18473738

  8. Establishment and characterization of a new and stable collagen-binding assay for the assessment of von Willebrand factor activity

    PubMed Central

    Ni, Y; Nesrallah, J; Agnew, M; Geske, F J; Favaloro, E J

    2013-01-01

    Introduction Laboratory diagnosis of von Willebrand disease (VWD) requires determination of both von Willebrand factor (VWF) protein levels and activity. Current VWF activity tests include the ristocetin cofactor assay and the collagen-binding assay (VWF:CB). The goal of this investigation is to characterize a new collagen-binding assay and to determine its effectiveness in identifying VWD. Methods Analytical studies were carried out to characterize the performance of a new VWF:CB ELISA. Additionally, samples from a normal population were tested as were well-characterized type 1 and type 2 VWD samples. Results Repeatability and within-laboratory precision studies resulted in coefficients of variation (CVs) of ≤11%. A linear range of 1–354% (0.01–3.54 IU/mL) was determined, along with a limit of detection and a lower limit of quantitation of 1.6% and 4.0% (0.016 and 0.04 IU/mL), respectively. Samples tested from apparently healthy individuals resulted in a normal range of 54–217% (0.54–2.17 IU/mL). Known VWD type 1 and type 2 samples were also analyzed by the ELISA, with 99% of samples having VWF:CB below the normal reference range and an estimated 96% sensitivity and 87% specificity using a VWF collagen-binding/antigen cutoff ratio of 0.50. Conclusion This new VWF:CB ELISA provides an accurate measure of collagen-binding activity that aids in the diagnosis and differentiation of type 1 from type 2 VWD. PMID:23107512

  9. The Activation of the Rat Insulin Gene II by BETA2 and PDX-1 in Rat Insulinoma Cells Is Repressed by Pax6

    PubMed Central

    Wolf, Gabriele; Hessabi, Behnam; Karkour, Anke; Henrion, Ulrike; Dahlhaus, Meike; Ostmann, Annett; Giese, Bernd; Fraunholz, Martin; Grabarczyk, Piotr; Jack, Robert; Walther, Reinhard

    2010-01-01

    The transcriptional transactivator Pax6 binds the pancreatic islet cell-specific enhancer sequence (PISCES) of the rat insulin I gene. However the human, mouse, and rat insulin gene II promoters do not contain a PISCES element. To analyze the role of Pax6 in those PISCES-less promoters, we investigated its influence on rat insulin gene II expression and included in our studies the main activators: pancreatic and duodenal homeobox protein-1 (PDX-1) and BETA2/E47. Luciferase assays, Northern blots, and RIA were used to study effects of Pax6 overexpression, gel shift and chromatin precipitation assays to study its binding to the DNA, and yeast two-hybrid assays and glutathione S transferase capture assays to investigate its interactions with PDX-1 and BETA2. Finally, glucose-dependent intracellular transport of Pax6 was demonstrated by fluorescence microscopy. Overexpression of Pax6 prevents activation of the rat insulin II gene by BETA2 and PDX-1 and hence suppresses insulin synthesis and secretion. In vitro, Pax6 binds to the A-boxes, thereby blocking binding of PDX-1, and at the same time, its paired domain interacts with BETA2. Fluorescence microscopy demonstrated that the nuclear-cytoplasmic localization of Pax6 and PDX-1 are oppositely regulated by glucose. From the results, it is suggested that at low concentrations of glucose, Pax6 is localized in the nucleus and prevents the activation of the insulin gene by occupying the PDX-1 binding site and by interacting with BETA2. PMID:20943817

  10. Air filters from HVAC systems as possible source of volatile organic compounds (VOC) - laboratory and field assays

    NASA Astrophysics Data System (ADS)

    Schleibinger, Hans; Rüden, Henning

    The emission of volatile organic compounds (VOC) from air filters of HVAC systems was to be evaluated. In a first study carbonyl compounds (14 aldehydes and two ketones) were measured by reacting them with 2,4-dinitrophenylhydrazine (DNPH). Analysis was done by HPLC and UV detection. In laboratory experiments pieces of used and unused HVAC filters were incubated in test chambers. Filters to be investigated were taken from a filter bank of a large HVAC system in the centre of Berlin. First results show that - among those compounds - formaldehyde and acetone were found in higher concentrations in the test chambers filled with used filters in comparison to those with unused filters. Parallel field measurements were carried out at the prefilter and main filter banks of the two HVAC systems. Here measurements were carried out simultaneously before and after the filters to investigate whether those aldehydes or ketones arise from the filter material on site. Formaldehyde and acetone significantly increased in concentration after the filters of one HVAC system. In parallel experiments microorganisms were proved to be able to survive on air filters. Therefore, a possible source of formaldehyde and acetone might be microbes.

  11. Agglutination Assays of the Plasmodium falciparum-Infected Erythrocyte.

    PubMed

    Tan, Joshua; Bull, Peter C

    2015-01-01

    The agglutination assay is used to determine the ability of antibodies to recognize parasite variant antigens on the surface of Plasmodium falciparum-infected erythrocytes. In this technique, infected erythrocytes are selectively labelled with a DNA-binding fluorescent dye and mixed with antibodies of interest to allow antibody-surface antigen binding. Recognition of surface antigens by the antibodies can result in the formation of agglutinates containing multiple parasite-infected erythrocytes. These can be viewed and quantified using a fluorescence microscope.

  12. Domain based assays of individual antibody concentrations in an oligoclonal combination targeting a single protein

    PubMed Central

    Meng, Q.; Li, M.; Silberg, M.A.; Conrad, F.; Bettencourt, J.; To, R.; Huang, C.; Ma, J.; Meyer, K.; Shimizu, R.; Cao, L.; Tomic, M.T.; Marks, J.D.

    2014-01-01

    Quantitation of individual mAbs within a combined antibody drug product is required for preclinical and clinical drug development including pharmacokinetics (PK), toxicology, stability and biochemical characterization studies of such drugs. We have developed an antitoxin (XOMA 3AB) consisting of three recombinant monoclonal antibodies (mAbs) that potently neutralizes the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind non-overlapping BoNT/A epitopes with high affinity. XOMA3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from E. coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. MAb specific domains were used to develop an ELISA for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay was also developed that is robust to interference from components in serum and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that bind the same protein and is superior to anti-idiotype approaches. PMID:22037290

  13. Optimization of Time-Resolved Fluorescence Assay for Detection of Eu-DOTA-labeled Ligand-Receptor Interactions

    PubMed Central

    De Silva, Channa R.; Vagner, Josef; Lynch, Ronald; Gillies, Robert J.; Hruby, Victor J.

    2010-01-01

    Lanthanide-based luminescent ligand binding assays are superior to traditional radiolabel assays due to improved sensitivity and affordability in high throughput screening while eliminating the use of radioactivity. Despite significant progress using lanthanide(III)-coordinated chelators such as DTPA derivatives, dissociation-enhanced lanthanide fluoroimmunoassays (DELFIA) have not yet been successfully used with more stable chelators, e.g. DOTA derivatives, due to the incomplete release of lanthanide(III) ions from the complex. Here, a modified and an optimized DELFIA procedure incorporating an acid treatment protocol is introduced for use with Eu(III)-DOTA labeled peptides. Complete release of Eu(III) ions from DOTA labeled ligands was observed using hydrochloric acid (2.0 M) prior to the luminescent enhancement step. NDP-α-MSH labeled with Eu(III)-DOTA was synthesized and the binding affinity to cells overexpressing the human melanocortin-4 receptors (hMC4R) was evaluated using the modified protocol. Binding data indicate that the Eu(III)-DOTA linked peptide bound to these cells with an affinity similar to its DTPA analogue. The modified DELFIA procedure was further used to monitor the binding of an Eu(III)-DOTA labeled heterobivalent peptide to the cells expressing both hMC4R and CCK-2 (Cholecystokinin) receptors. The modified assay provides superior results and is appropriate for high-throughput screening of ligand libraries. PMID:19852924

  14. miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.

    PubMed

    Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie

    2015-05-01

    Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Measuring Positive Cooperativity Using the Direct ESI-MS Assay. Cholera Toxin B Subunit Homopentamer Binding to GM1 Pentasaccharide

    NASA Astrophysics Data System (ADS)

    Lin, Hong; Kitova, Elena N.; Klassen, John S.

    2014-01-01

    Direct electrospray ionization mass spectrometry (ESI-MS) assay was used to investigate the stepwise binding of the GM1 pentasaccharide β- D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β- D-Gal p-(1→4)-β-D-Glc p (GM1os) to the cholera toxin B subunit homopentamer (CTB5) and to establish conclusively whether GM1os binding is cooperative. Apparent association constants were measured for the stepwise addition of one to five GM1os to CTB5 at pH 6.9 and 22 °C. The intrinsic association constant, which was established from the apparent association constant for the addition of a single GM1os to CTB5, was found to be (3.2 ± 0.2) × 106 M-1. This is in reasonable agreement with the reported value of (6.4 ± 0.3) × 106 M-1, which was measured at pH 7.4 and 25 °C using isothermal titration calorimetry (ITC). Analysis of the apparent association constants provides direct and unambiguous evidence that GM1os binding exhibits small positive cooperativity. Binding was found to be sensitive to the number of ligand-bound nearest neighbor subunits, with the affinities enhanced by a factor of 1.7 and 2.9 when binding occurs next to one or two ligand-bound subunits, respectively. These findings, which provide quantitative support for the binding model proposed by Homans and coworkers [14], highlight the unique strengths of the direct ESI-MS assay for measuring cooperative ligand binding.

  16. Estrogenicity of halogenated bisphenol A: in vitro and in silico investigations.

    PubMed

    Zhang, Jie; Li, Tiezhu; Wang, Tuoyi; Yuan, Cuiping; Zhong, Shuning; Guan, Tianzhu; Li, Zhuolin; Wang, Yongzhi; Yu, Hansong; Luo, Quan; Wang, Yongjun; Zhang, Tiehua

    2018-03-01

    The binding interactions of bisphenol A (BPA) and its halogenated derivatives (halogenated BPAs) to human estrogen receptor α ligand binding domain (hERα-LBD) was investigated using a combined in vitro and in silico approach. First, the recombinant hERα-LBD was prepared as a soluble protein in Escherichia coli BL21(DE3)pLysS. A native fluorescent phytoestrogen, coumestrol, was employed as tracer for the fluorescence polarization assay. The results of the in vitro binding assay showed that bisphenol compounds could bind to hERα-LBD as the affinity ligands. All the tested halogenated BPAs exhibited weaker receptor binding than BPA, which might be explained by the steric effect of substituents. Molecular docking studies elucidated that the halogenated BPAs adopted different conformations in the flexible hydrophobic ligand binding pocket (LBP), which is mainly dependent on their distinct halogenation patterns. The compounds with halogen substituents on the phenolic rings and on the bridging alkyl moiety acted as agonists and antagonists for hERα, respectively. Interestingly, all the compounds in the agonist conformation of hERα formed a hydrogen bond with His524, while the compounds in the antagonist conformation formed a hydrogen bond with Thr347. These docking results suggested a pivotal role of His524/Thr347 in maintaining the hERα structure in the biologically active agonist/antagonist conformation. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation, which might be applicable for the structure-based design of novel bisphenol compounds with reduced toxicities and for environmental risk assessment. In addition, based on hERα-LBD as a recognition element, the proposed fluorescence polarization assay may offer an alternative to chromatographic techniques for the multi-residue determination of bisphenol compounds.

  17. Comparison of Relative Binding Affinities for Trout and Human Estrogen Receptor Based upon Different Competitive Binding Assays

    EPA Science Inventory

    The development of a predictive model based upon a single aquatic species inevitably raises the question of whether this information is valid for other species. To partially address this question, relative binding affinities (RBA) for six alkylphenols (para-substituted, n- and b...

  18. A Novel Assay for Antibody-Dependent Cell-Mediated Cytotoxicity against HIV-1- or SIV-Infected Cells Reveals Incomplete Overlap with Antibodies Measured by Neutralization and Binding Assays

    PubMed Central

    Alpert, Michael D.; Heyer, Lisa N.; Williams, David E. J.; Harvey, Jackson D.; Greenough, Thomas; Allhorn, Maria

    2012-01-01

    The resistance of human immunodeficiency virus type 1 (HIV-1) to antibody-mediated immunity often prevents the detection of antibodies that neutralize primary isolates of HIV-1. However, conventional assays for antibody functions other than neutralization are suboptimal. Current methods for measuring the killing of virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC) are limited by the number of natural killer (NK) cells obtainable from individual donors, donor-to-donor variation, and the use of nonphysiological targets. We therefore developed an ADCC assay based on NK cell lines that express human or macaque CD16 and a CD4+ T-cell line that expresses luciferase from a Tat-inducible promoter upon HIV-1 or simian immunodeficiency virus (SIV) infection. NK cells and virus-infected targets are mixed in the presence of serial plasma dilutions, and ADCC is measured as the dose-dependent loss of luciferase activity. Using this approach, ADCC titers were measured in plasma samples from HIV-infected human donors and SIV-infected macaques. For the same plasma samples paired with the same test viruses, this assay was approximately 2 orders of magnitude more sensitive than optimized assays for neutralizing antibodies—frequently allowing the measurement of ADCC in the absence of detectable neutralization. Although ADCC correlated with other measures of Env-specific antibodies, neutralizing and gp120 binding titers did not consistently predict ADCC activity. Hence, this assay affords a sensitive method for measuring antibodies capable of directing ADCC against HIV- or SIV-infected cells expressing native conformations of the viral envelope glycoprotein and reveals incomplete overlap of the antibodies that direct ADCC and those measured in neutralization and binding assays. PMID:22933282

  19. Novel enzyme-linked immunosorbent assay for determination of fluvastatin in plasma at picogram level.

    PubMed

    Darwish, Ibrahim A; Al-Obaid, Abdul-Rahman M; Al-Malaq, Hamoud A

    2009-11-15

    For the first time, an enzyme-linked immunosorbent assay (ELISA) has been developed and validated for the determination of fluvastatin (FLV) in plasma samples at picogram level. The assay employed a polyclonal antibody that specifically recognizes FLV with high affinity, and FLV conjugate of bovine serum albumin (FLV-BSA) immobilized onto microplate wells as a solid-phase. The assay involved a competitive binding reaction between FLV, in plasma sample, and the immobilized FLV-BSA for the binding sites on a limited amount of the anti-FLV antibody. The bound anti-FLV antibody was quantified with horseradish peroxidase-labeled second anti-rabbit IgG antibody (HRP-IgG) and 3,3',5,5'-tetramethylbenzidine (TMB) as a substrate for the peroxidase enzyme. The concentration of FLV in the sample was quantified by its ability to inhibit the binding of the anti-FLV antibody to the immobilized FLV-BSA and subsequently the color intensity in the assay wells. The conditions for the proposed ELISA were investigated and the optimum conditions were employed in the determination of FLV in plasma samples. The assay limit of detection was 10 pg mL(-1) and the effective working range at relative standard deviations (RSD) of

  20. 76 FR 4920 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-27

    ... appear to be distinct from each other. Available for licensing is a Plk1 ELISA assay using peptide... binding property, an easy and reliable ELISA assay has been developed to quantify Plk1 expression levels... sequence. ELISA assay to quantify Plk1 expression and kinase activity. Advantages: Rapid, highly sensitive...

  1. Periplasmic binding protein-based detection of maltose using liposomes: a new class of biorecognition elements in competitive assays.

    PubMed

    Edwards, Katie A; Baeumner, Antje J

    2013-03-05

    A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.

  2. Production of Antiserum to LH-Releasing Hormone (LH-RH) Associated with Gonadal Atrophy in Rabbits: Development of Radioimmunoassays for LH-RH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    ARIMURA, A.; SATO, H.; KUMASAKA, T.

    1973-11-01

    Repeated injections of synthetic LH -- RH decapeptide, adsorbed on polyvinylpyrrolidone and emulsified with complete Freund's adjuvant, resulted in the production of a specific antiserum to LH-- RH in two of three rabbits. The animals that produced this antiserum showed a reduction of pituitary LH content and marked atrophy of the testes. The antiserum-antibody complex was detected by the complement flxation test. The antiserum was capable of binding /sup 125/I- labeled LH--RH. After iodination of LHRH (using /sup 125/I and either the chloramine T or lactoperoxidase method) separation of the iodination products on CMC yielded three main peaks of radioactivity:more » The first was free iodide, the second was labeled peptide with low immunoreactivity, and the third was immunoreactive peptide. This 3rd peak consisted of two or three subpeaks; the leading subpeak(s) were more readily bound by antiserum than the trailing one(s). Binding of these fractions to antiserum was increased in the presence of small amounts of unlabeled LH--RH (a phenomenon called paradoxical binding or hock effect) but inhibited by larger amounts. Both the augmentation and the inhibition effects were dose-related, allowing the development of two different radioimmunoassay (RIA) systems for LH--RH. An ordinary (coinpetitive) type of RIA was developed in which a small amount (0.31 ng/assay tube) of unlabeled LH-- RH was added to the labeled peptide. This saturated the antiserum's capacity for paradoxical binding, so that further addition of LH-- RH (from 0.04 to 2.5 ng/ tube) inhibited binding of labeled LH--RH. The assay developed using paradoxical binding omitted the premixing of labeled and unlabeled LH--RH; in this assay addition of very small amounts (0.5 to 310 pg) of unlabeled LH--RH to the assay tubes increased the amount of label bound to antiserum and allowed construction of a parabolic curve of positive slope when B/T was plotted against arithmetic dose. The assays seem to be highly specific for LH--RH although both polymers and degradation products of LH--RH appeared to have some immunoreactivity.« less

  3. Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

    PubMed

    Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

    2009-08-13

    Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

  4. Effects of egg-adaptation on receptor-binding and antigenic properties of recent influenza A (H3N2) vaccine viruses.

    PubMed

    Parker, Lauren; Wharton, Stephen A; Martin, Stephen R; Cross, Karen; Lin, Yipu; Liu, Yan; Feizi, Ten; Daniels, Rodney S; McCauley, John W

    2016-06-01

    Influenza A virus (subtype H3N2) causes seasonal human influenza and is included as a component of influenza vaccines. The majority of vaccine viruses are isolated and propagated in eggs, which commonly results in amino acid substitutions in the haemagglutinin (HA) glycoprotein. These substitutions can affect virus receptor-binding and alter virus antigenicity, thereby, obfuscating the choice of egg-propagated viruses for development into candidate vaccine viruses. To evaluate the effects of egg-adaptive substitutions seen in H3N2 vaccine viruses on sialic acid receptor-binding, we carried out quantitative measurement of virus receptor-binding using surface biolayer interferometry with haemagglutination inhibition (HI) assays to correlate changes in receptor avidity with antigenic properties. Included in these studies was a panel of H3N2 viruses generated by reverse genetics containing substitutions seen in recent egg-propagated vaccine viruses and corresponding cell culture-propagated wild-type viruses. These assays provide a quantitative approach to investigating the importance of individual amino acid substitutions in influenza receptor-binding. Results show that viruses with egg-adaptive HA substitutions R156Q, S219Y, and I226N, have increased binding avidity to α2,3-linked receptor-analogues and decreased binding avidity to α2,6-linked receptor-analogues. No measurable binding was detected for the viruses with amino acid substitution combination 156Q+219Y and receptor-binding increased in viruses where egg-adaptation mutations were introduced into cell culture-propagated virus. Substitutions at positions 156 and 190 appeared to be primarily responsible for low reactivity in HI assays with post-infection ferret antisera raised against 2012-2013 season H3N2 viruses. Egg-adaptive substitutions at position 186 caused substantial differences in binding avidity with an insignificant effect on antigenicity.

  5. Image Restoration and Analysis of Influenza Virions Binding to Membrane Receptors Reveal Adhesion-Strengthening Kinetics

    PubMed Central

    Lee, Donald W.; Hsu, Hung-Lun; Bacon, Kaitlyn B.; Daniel, Susan

    2016-01-01

    With the development of single-particle tracking (SPT) microscopy and host membrane mimics called supported lipid bilayers (SLBs), stochastic virus-membrane binding interactions can be studied in depth while maintaining control over host receptor type and concentration. However, several experimental design challenges and quantitative image analysis limitations prevent the widespread use of this approach. One main challenge of SPT studies is the low signal-to-noise ratio of SPT videos, which is sometimes inevitable due to small particle sizes, low quantum yield of fluorescent dyes, and photobleaching. These situations could render current particle tracking software to yield biased binding kinetic data caused by intermittent tracking error. Hence, we developed an effective image restoration algorithm for SPT applications called STAWASP that reveals particles with a signal-to-noise ratio of 2.2 while preserving particle features. We tested our improvements to the SPT binding assay experiment and imaging procedures by monitoring X31 influenza virus binding to α2,3 sialic acid glycolipids. Our interests lie in how slight changes to the peripheral oligosaccharide structures can affect the binding rate and residence times of viruses. We were able to detect viruses binding weakly to a glycolipid called GM3, which was undetected via assays such as surface plasmon resonance. The binding rate was around 28 folds higher when the virus bound to a different glycolipid called GD1a, which has a sialic acid group extending further away from the bilayer surface than GM3. The improved imaging allowed us to obtain binding residence time distributions that reflect an adhesion-strengthening mechanism via multivalent bonds. We empirically fitted these distributions using a time-dependent unbinding rate parameter, koff, which diverges from standard treatment of koff as a constant. We further explain how to convert these models to fit ensemble-averaged binding data obtained by assays such as surface plasmon resonance. PMID:27695072

  6. Evaluation of the surface properties of PTFE foam coating filter media using XPS and contact angle measurements

    NASA Astrophysics Data System (ADS)

    Park, Byung Hyun; Lee, Myong-Hwa; Kim, Sang Bum; Jo, Young Min

    2011-02-01

    A newly developed PTFE foam coating filter was developed which can be used for hot gas cleaning at temperatures up to 250 °C. The emulsion-type PTFE was coated onto a woven glass fiber using a foam coating method. The filter surface was closely examined using X-ray photoelectron spectroscopy (XPS) and contact angle measurements. The XPS results were used to determine the binding force between the carbon and fluorine of PTFE, which imparts coating stability to the filter medium. More than 95% of the bonds of the PTFE foam coating filter were between carbon and fluorine, and this filter demonstrated excellent hydrophobic and good oleophobic properties at the same time. The contact angles of liquid droplets on the filter surface were used to predict the potential wetability of the filter against water or oil. In addition, the very low surface free energy of the filter medium, which was evaluated using the Owens-Wendt method, demonstrates a very stable surface and a high de-dusting quality.

  7. Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System.

    PubMed

    Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke

    2015-01-19

    We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step.

  8. Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System

    PubMed Central

    Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke

    2015-01-01

    We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step. PMID:25607476

  9. A force-based protein biochip

    NASA Astrophysics Data System (ADS)

    Blank, K.; Mai, T.; Gilbert, I.; Schiffmann, S.; Rankl, J.; Zivin, R.; Tackney, C.; Nicolaus, T.; Spinnler, K.; Oesterhelt, F.; Benoit, M.; Clausen-Schaumann, H.; Gaub, H. E.

    2003-09-01

    A parallel assay for the quantification of single-molecule binding forces was developed based on differential unbinding force measurements where ligand-receptor interactions are compared with the unzipping forces of DNA hybrids. Using the DNA zippers as molecular force sensors, the efficient discrimination between specific and nonspecific interactions was demonstrated for small molecules binding to specific receptors, as well as for protein-protein interactions on protein arrays. Finally, an antibody sandwich assay with different capture antibodies on one chip surface and with the detection antibodies linked to a congruent surface via the DNA zippers was used to capture and quantify a recombinant hepatitis C antigen from solution. In this case, the DNA zippers enable not only discrimination between specific and nonspecific binding, but also allow for the local application of detection antibodies, thereby eliminating false-positive results caused by cross-reactive antibodies and nonspecific binding.

  10. What Do Chaotrope-Based Avidity Assays for Antibodies to HIV-1 Envelope Glycoproteins Measure?

    PubMed Central

    Alexander, Marina R.; Ringe, Rajesh; Sanders, Rogier W.; Voss, James E.; Moore, John P.

    2015-01-01

    ABSTRACT When HIV-1 vaccine candidates that include soluble envelope glycoproteins (Env) are tested in humans and other species, the resulting antibody responses to Env are sifted for correlates of protection or risk. One frequently used assay measures the reduction in antibody binding to Env antigens by an added chaotrope (such as thiocyanate). Based on that assay, an avidity index was devised for assessing the affinity maturation of antibodies of unknown concentration in polyclonal sera. Since a high avidity index was linked to protection in animal models of HIV-1 infection, it has become a criterion for evaluating antibody responses to vaccine candidates. But what does the assay measure and what does an avidity index mean? Here, we have used a panel of monoclonal antibodies to well-defined epitopes on Env (gp120, gp41, and SOSIP.664 trimers) to explore how the chaotrope acts. We conclude that the chaotrope sensitivity of antibody binding to Env depends on several properties of the epitopes (continuity versus tertiary- and quaternary-structural dependence) and that the avidity index has no simple relationship to antibody affinity for functional Env spikes on virions. We show that the binding of broadly neutralizing antibodies against quaternary-structural epitopes is particularly sensitive to chaotrope treatment, whereas antibody binding to epitopes in variable loops and to nonneutralization epitopes in gp41 is generally resistant. As a result of such biases, the avidity index may at best be a mere surrogate for undefined antibody or other immune responses that correlate weakly with protection. IMPORTANCE An effective HIV-1 vaccine is an important goal. Such a vaccine will probably need to induce antibodies that neutralize typically transmitted variants of HIV-1, preventing them from infecting target cells. Vaccine candidates have so far failed to induce such antibody responses, although some do protect weakly against infection in animals and, possibly, humans. In the search for responses associated with protection, an avidity assay based on chemical disruption is often used to measure the strength of antibody binding. We have analyzed this assay mechanistically and found that the epitope specificity of an antibody has a greater influence on the outcome than does its affinity. As a result, the avidity assay is biased toward the detection of some antibody specificities while disfavoring others. We conclude that the assay may yield merely indirect correlations with weak protection, specifically when Env vaccination has failed to induce broad neutralizing responses. PMID:25810537

  11. Assays for the determination of the activity of DNA nucleases based on the fluorometric properties of the YOYO dye.

    PubMed

    Fernández-Sierra, Mónica; Quiñones, Edwin

    2015-03-15

    Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Enzyme-linked immunosorbent assays for determination of plasma aldosterone using highly specific polyclonal antibodies.

    PubMed

    Schwartz, F; Hadas, E; Harnik, M; Solomon, B

    1990-01-01

    Two enzyme-linked immunosorbent assays were established and compared for the estimation of plasma aldosterone. In the first method immobilized aldosterone-protein complexes on the ELISA plates compete with aldosterone to be determined for the binding of certain amount of anti-aldosterone antibodies. The sensitivity of this method depends on the protein carrier used to conjugate with aldosterone. In the second method, anti-aldosterone antibodies adsorbed on ELISA plates compete for binding of known amount of the enzyme-labeled aldosterone and aldosterone to be determined. The highly specific rabbit anti-aldosterone antibodies were obtained by injection of aldosterone-oxime thyroglobulin. The detection limit of aldosterone in both methods ranged between 2-20 pg. The proposed assays are suitable for the determination of aldosterone in biological fluids compared with other reported ELISA assays, as well as with RIA.

  13. Production and assay of forskolin antibodies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, L.T.; Ho, R.J.

    1986-05-01

    Forskolin (Fo), a cardiovascular active diterpene of plant origin, has been widely used as a research tool in regulation of the catalytic activity of adenylate cyclase (AC). A linear relationship of Fo binding to plasma membrane with activation of AC has been reported. The present abstract describes the production and assay of Fo antibodies (AB). 7-0-Hemisuccinyl-7-deacetyl Fo, coupled to either human serum albumin or goat IgG, was injected into goats to elicit AB to Fo haptan. AB to Fo in antiserum or an isolated IgG fraction was tested by two assay methods, a radioimmunoassay using /sup 3/H-Fo as a tracermore » and a colorimetric enzyme-linked immunosorbent assay (ELISA) using horse radish peroxidase-rabbit anti goat IgG as indicator. The titers for Fo antiserum were 4000-10,000. In the defined assay condition, approximately 20-25% of the added /sup 3/H-Fo was found to bind to AB. The bound radioactivity was displaced by Fo-HSA or Fo-goat IgG or free unlabelled Fo ranging from 0.5-50 pmol/tube, or 5-500 nM. The IC/sub 50/ was approximately 8-10 pmol/tube or 80-100 nM. The binding of HRP-rabbit anti goat IgG in the ELISA was inhibited by proper Fo conjugate. The development of methods for production and assay for Fo AB may be useful in the study of mechanism of activation of AC by Fo and Fo-like compound.« less

  14. Functional efficacy of adenosine A2A receptor agonists is positively correlated to their receptor residence time

    PubMed Central

    Guo, Dong; Mulder-Krieger, Thea; IJzerman, Adriaan P; Heitman, Laura H

    2012-01-01

    BACKGROUND AND PURPOSE The adenosine A2A receptor belongs to the superfamily of GPCRs and is a promising therapeutic target. Traditionally, the discovery of novel agents for the A2A receptor has been guided by their affinity for the receptor. This parameter is determined under equilibrium conditions, largely ignoring the kinetic aspects of the ligand-receptor interaction. The aim of this study was to assess the binding kinetics of A2A receptor agonists and explore a possible relationship with their functional efficacy. EXPERIMENTAL APPROACH We set up, validated and optimized a kinetic radioligand binding assay (a so-called competition association assay) at the A2A receptor from which the binding kinetics of unlabelled ligands were determined. Subsequently, functional efficacies of A2A receptor agonists were determined in two different assays: a novel label-free impedance-based assay and a more traditional cAMP determination. KEY RESULTS A simplified competition association assay yielded an accurate determination of the association and dissociation rates of unlabelled A2A receptor ligands at their receptor. A correlation was observed between the receptor residence time of A2A receptor agonists and their intrinsic efficacies in both functional assays. The affinity of A2A receptor agonists was not correlated to their functional efficacy. CONCLUSIONS AND IMPLICATIONS This study indicates that the molecular basis of different agonist efficacies at the A2A receptor lies within their different residence times at this receptor. PMID:22324512

  15. Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).

    PubMed

    Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M

    2015-02-21

    This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.

  16. Development and validation of receptor occupancy pharmacodynamic assays used in the clinical development of the monoclonal antibody vedolizumab.

    PubMed

    Wyant, Tim; Estevam, Jose; Yang, Lili; Rosario, Maria

    2016-03-01

    Vedolizumab is a monoclonal antibody approved for use in ulcerative colitis and Crohn's disease. By specifically binding to α4 β7 integrin, vedolizumab prevents trafficking of lymphocytes to the gut, thereby interfering with disease pathology. During the clinical development program, the pharmacodynamic effect of vedolizumab was evaluated by 2 flow cytometry receptor occupancy assays: act-1 (ACT-1) and mucosal addressin cell adhesion molecule-1 (MAdCAM-1). Here we describe the development and validation of these assays. The ACT-1 assay is a receptor occupancy free-site assay that uses a monoclonal antibody with the same binding epitope as vedolizumab to detect free (unbound) sites on α4 β7 integrin. The MAdCAM-1 assay used a soluble version of the natural ligand for α4 β7 integrin to detect free sites. The assays were validated using a fit-for-purpose approach throughout the clinical development of vedolizumab. Both the ACT-1 assay and the MAdCAM-1 assay demonstrated acceptable reproducibility and repeatability. The assays were sufficiently stable to allow for clinical use. During clinical testing the assays demonstrated that vedolizumab was able to saturate peripheral cells at all doses tested. Two pharmacodynamic receptor occupancy assays were developed and validated to assess the effect of vedolizumab on peripheral blood cells. The results of these assays demonstrated the practical use of flow cytometry to examine pharmacodynamic response in clinical trials. © 2015 International Clinical Cytometry Society.

  17. Ca(2+)-triggered coelenterazine-binding protein from Renilla as an enzyme-dependent label for binding assay.

    PubMed

    Krasitskaya, V V; Korneeva, S I; Kudryavtsev, A N; Markova, S V; Stepanyuk, G A; Frank, L A

    2011-11-01

    The recombinant Ca(2+)-triggered coelenterazine-binding protein (CBP) from Renilla muelleri was investigated as a biospecifically labeled molecule for in vitro assay applications. The protein was shown to be stable in solutions in the frozen state, as well as stable under heating and to chemical modifications. Conjugates with biotin, oligonucleotide, and proteins were obtained and applied as biospecific molecules in a solid-phase microassay. CBP detection was performed with intact (no modifications were made) Renilla luciferase in the presence of calcium, and the detection limit was found to be 75 amol. Model experiments indicate that this approach shows much promise, especially with regard to the development of multianalytical systems.

  18. Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.

    PubMed

    Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D

    1980-04-01

    Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency.

  19. Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.

    PubMed Central

    Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D

    1980-01-01

    Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency. PMID:6246537

  20. Measurement of monomolecular binding constants of neutral phenols into the beta-cyclodextrin by continuous frontal analysis in capillary and microchip electrophoresis via a competitive assay.

    PubMed

    Le Saux, Thomas; Hisamoto, Hideaki; Terabe, Shigeru

    2006-02-03

    Measurement of binding constant by chip electrophoresis is a very promising technique for the high throughput screening of non-covalent interactions. Among the different electrophoretic methods available that yield the binding parameters, continuous frontal analysis is the most appropriate for a transposition from capillary electrophoresis (CE) to microchip electrophoresis. Implementation of this methodology in microchip was exemplified by the measurement of inclusion constants of 2-naphtalenesulfonate and neutral phenols (phenol, 4-chlorophenol and 4-nitrophenol) into beta-cyclodextrin by competitive assays. The issue of competitor choice is discussed in relation to its appropriateness for proper monitoring of the interaction.

  1. System and method for detecting components of a mixture including a valving scheme for competition assays

    DOEpatents

    Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

    2017-09-19

    Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

  2. System and method for detecting components of a mixture including a valving scheme for competition assays

    DOEpatents

    Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

    2017-07-11

    Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

  3. Detection of molecular interactions

    DOEpatents

    Groves, John T [Berkeley, CA; Baksh, Michael M [Fremont, CA; Jaros, Michal [Brno, CH

    2012-02-14

    A method and assay are described for measuring the interaction between a ligand and an analyte. The assay can include a suspension of colloidal particles that are associated with a ligand of interest. The colloidal particles are maintained in the suspension at or near a phase transition state from a condensed phase to a dispersed phase. An analyte to be tested is then added to the suspension. If the analyte binds to the ligand, a phase change occurs to indicate that the binding was successful.

  4. Targeting the UPR to Circumvent Endocrine Resistance in Breast Cancer

    DTIC Science & Technology

    2015-10-01

    were submitted for the screen. Kinase assay protocol (DiscoverX): For most assays, kinase-tagged T7 phage strains were grown in parallel in 24-well...blocks in an E. coli host derived from the BL21 strain. E. coli were grown to log-phase and infected with T7 phage from a frozen stock (multiplicity of...unbound ligand and to reduce non-specific phage binding. Binding reactions were assembled by combining kinases, liganded affinity beads, and test

  5. Phosphatidic acid binding proteins display differential binding as a function of membrane curvature stress and chemical properties.

    PubMed

    Putta, Priya; Rankenberg, Johanna; Korver, Ruud A; van Wijk, Ringo; Munnik, Teun; Testerink, Christa; Kooijman, Edgar E

    2016-11-01

    Phosphatidic acid (PA) is a crucial membrane phospholipid involved in de novo lipid synthesis and numerous intracellular signaling cascades. The signaling function of PA is mediated by peripheral membrane proteins that specifically recognize PA. While numerous PA-binding proteins are known, much less is known about what drives specificity of PA-protein binding. Previously, we have described the ionization properties of PA, summarized in the electrostatic-hydrogen bond switch, as one aspect that drives the specific binding of PA by PA-binding proteins. Here we focus on membrane curvature stress induced by phosphatidylethanolamine and show that many PA-binding proteins display enhanced binding as a function of negative curvature stress. This result is corroborated by the observation that positive curvature stress, induced by lyso phosphatidylcholine, abolishes PA binding of target proteins. We show, for the first time, that a novel plant PA-binding protein, Arabidopsis Epsin-like Clathrin Adaptor 1 (ECA1) displays curvature-dependence in its binding to PA. Other established PA targets examined in this study include, the plant proteins TGD2, and PDK1, the yeast proteins Opi1 and Spo20, and, the mammalian protein Raf-1 kinase and the C2 domain of the mammalian phosphatidylserine binding protein Lact as control. Based on our observations, we propose that liposome binding assays are the preferred method to investigate lipid binding compared to the popular lipid overlay assays where membrane environment is lost. The use of complex lipid mixtures is important to elucidate further aspects of PA binding proteins. Copyright © 2016. Published by Elsevier B.V.

  6. Use of poisons in determination of microbial manganese binding rates in seawater

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosson, R.A.; Tebo, B.M.; Nealson, K.H.

    1984-04-01

    A method was developed to determine whether microorganisms mediate the precipitation of manganese(II) in the marine environment. Radioactive /sup 54/Mn(II) was used as a tracer to measure the precipitation (binding and oxidation) of Mn(II) (i.e., the /sup 54/Mn(II) trapped on 0.2-..mu..m membrane filters) in the presence and absence of biological poisons. A variety of antibiotics, fixatives, and metabolic inhibitors were tested in laboratory control experiments to select poisons that did not interfere in the chemistry of manganese. The poisons were deemed suitable if (i) they did not complex Mn(II) more strongly than the ion-exchange resin Chelex 100, (ii) they didmore » not interfere in the adsorption of /sup 54/Mn(II) onto synthetic deltaMnO/sub 2/ (manganate), (iii) they did not cause desorption of /sup 54/Mn(II) which had been preadsorbed onto synthetic manganate, and (iv) they did not solubilize synthetic /sup 54/manganate. In addition, several known chelators, reducing agents, and buffers normally added to microbiological growth media or used in biochemical assays were tested. Most additions interfered to some extent with manganese chemistry. However, at least one inhibitor, sodium azide, or a mixture of sodium azide, penicillin, and tetracycline was shown to be appropriate for use in field studies of /sup 54/Mn(II) binding. Formaldehyde could also be used in short incubations (1 to 3 h) but was not suitable for longer time course studies. The method was applied to studies of Mn(II) precipitation in Saanich Inlet, British Columbia, Canada. Bacteria were shown to significantly enhance the rate of Mn(II) removal from solution in the manganese-rich particulate layer which occurs just above the oxygen-hydrogen sulfide interface in the water column. 23 references.« less

  7. Is GABA neurotransmission enhanced in auditory thalamus relative to inferior colliculus?

    PubMed Central

    Cai, Rui; Kalappa, Bopanna I.; Brozoski, Thomas J.; Ling, Lynne L.

    2013-01-01

    Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the central auditory system. Sensory thalamic structures show high levels of non-desensitizing extrasynaptic GABAA receptors (GABAARs) and a reduction in the redundancy of coded information. The present study compared the inhibitory potency of GABA acting at GABAARs between the inferior colliculus (IC) and the medial geniculate body (MGB) using quantitative in vivo, in vitro, and ex vivo experimental approaches. In vivo single unit studies compared the ability of half maximal inhibitory concentrations of GABA to inhibit sound-evoked temporal responses, and found that GABA was two to three times (P < 0.01) more potent at suppressing MGB single unit responses than IC unit responses. In vitro whole cell patch-clamp slice recordings were used to demonstrate that gaboxadol, a δ-subunit selective GABAAR agonist, was significantly more potent at evoking tonic inhibitory currents from MGB neurons than IC neurons (P < 0.01). These electrophysiological findings were supported by an in vitro receptor binding assay which used the picrotoxin analog [3H]TBOB to assess binding in the GABAAR chloride channel. MGB GABAARs had significantly greater total open chloride channel capacity relative to GABAARs in IC (P < 0.05) as shown by increased total [3H]TBOB binding. Finally, a comparative ex vivo measurement compared endogenous GABA levels and suggested a trend towards higher GABA concentrations in MGB than in IC. Collectively, these studies suggest that, per unit GABA, high affinity extrasynaptic and synaptic GABAARs confer a significant inhibitory GABAAR advantage to MGB neurons relative to IC neurons. This increased GABA sensitivity likely underpins the vital filtering role of auditory thalamus. PMID:24155003

  8. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  9. Expression and purification of RHC-EGFP fusion protein and its application in hyaluronic acid assay.

    PubMed

    Duan, Ningjun; Lv, Wansheng; Zhu, Lingli; Zheng, Weijuan; Hua, Zichun

    2017-03-16

    Hyaluronan is a widely distributed glycosaminoglycan which has multiple functions. Hyaluronic acid (HA) accumulation has been reported in many human diseases. Understanding the role of hyaluronan and its binding proteins in the pathobiology of disease will facilitate the development of novel therapeutics for many critical diseases. Current techniques described for the analysis of HA are mainly for HA quantification in solutions, not for the direct detection of HA in tissues or on cell surfaces. In our study, a fusion protein, named C-terminal domain of RHAMM-enhanced green fluorescence protein (RHC-EGFP), combined the HA-binding domain, C-terminal of receptor for hyaluronan-mediated motility, with EGFP, a widely used enhanced green fluorescence protein, was expressed and purified from Escherichia coli with high purity. Based on the sensitivity and convenience of fluorescence detection, methods for direct assay of HA in solutions, on cell surface or in tissues were established using RHC-EGFP. The binding specificity was also confirmed by competitive binding experiment and hyaluronidase degradation experiment. Our results provide an alternative choice for the specific and convenient assay of HA in various samples, and maybe helpful for further understanding of the fundamental and comprehensive functions of HA.

  10. A novel multiplex poliovirus binding inhibition assay applicable for large serosurveillance and vaccine studies, without the use of live poliovirus.

    PubMed

    Schepp, Rutger M; Berbers, Guy A M; Ferreira, José A; Reimerink, Johan H; van der Klis, Fiona R

    2017-03-01

    Large-scale serosurveillance or vaccine studies for poliovirus using the "gold standard" WHO neutralisation test (NT) are very laborious and time consuming. With the polio eradication at hand and with the removal of live attenuated Sabin strains from the oral poliovirus vaccine (OPV), starting with type 2 (as of April 2016), laboratories will need to conform to much more stringent laboratory biosafety regulations when handling live poliovirus strains. In this study, a poliovirus binding inhibition multiplex immunoassay (polio MIA) using inactivated poliovirus vaccine (IPV-Salk) was developed for simultaneous quantification of serum antibodies directed to all three poliovirus types. Our assay shows a good correlation with the NT and an excellent correlation with the ELISA-based binding inhibition assay (POBI). The assay is highly type-specific and reproducible. Additionally, serum sample throughput increases about fivefold relative to NT and POBI and the amount of serum needed is reduced by more than 90%. In conclusion, the polio MIA can be used as a safe and high throughput application, especially for large-scale surveillance and vaccine studies, reducing laboratory time and serum amounts needed. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Determination of nuvenzepine in human plasma by a sensitive sup 3 Hpirenzepine radioreceptor binding assay

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caselli, G.; Ferrari, M.P.; Tonon, G.

    1991-02-01

    A sensitive method for the quantitation of small amounts of nuvenzepine, a new M1-selective antimuscarinic drug, in plasma is described. The analytical method involves the use of a radioreceptor binding assay based on {sup 3}Hpirenzepine displacement in rat cerebral cortex homogenates; no previous extraction is required. The method is reliable, with an interassay CV ranging from 5 to 10%, and allows the analysis of greater than 100 samples/experiment. The limit of detection is {approximately} 0.1 ng/assay. Using this method we have determined the plasma levels of nuvenzepine in eight healthy volunteers treated PO with 15 or 25 mg of nuvenzepine.HCl.more » The pharmacokinetic parameters obtained were (for 15 and 25 mg): Cmax, 64 and 131 ng/mL; AUC0-infinity, 851 and 1379 ng.h/mL; t1/2, 8.6 and 7.2 h. These values are in good agreement with those obtained using an HPLC method. Therefore, this radioreceptor binding assay proved to be simple, rapid, and specific for the determination of low levels of nuvenzepine in human plasma.« less

  12. Herpes Simplex Virus Processivity Factor UL42 Imparts Increased DNA-Binding Specificity to the Viral DNA Polymerase and Decreased Dissociation from Primer-Template without Reducing the Elongation Rate

    PubMed Central

    Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.

    1999-01-01

    Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307

  13. Overexpression of the Arabidopsis 10-kilodalton acyl-coenzyme A-binding protein ACBP6 enhances freezing tolerance.

    PubMed

    Chen, Qin-Fang; Xiao, Shi; Chye, Mee-Len

    2008-09-01

    Small 10-kD acyl-coenzyme A-binding proteins (ACBPs) are highly conserved proteins that are prevalent in eukaryotes. In Arabidopsis (Arabidopsis thaliana), other than the 10-kD ACBP homolog (designated Arabidopsis ACBP6), there are five larger forms of ACBPs ranging from 37.5 to 73.1 kD. In this study, the cytosolic subcellular localization of Arabidopsis ACBP6 was confirmed by analyses of transgenic Arabidopsis expressing autofluorescence-tagged ACBP6 and western-blot analysis of subcellular fractions using ACBP6-specific antibodies. The expression of Arabidopsis ACBP6 was noticeably induced at 48 h after 4 degrees C treatment by northern-blot analysis and western-blot analysis. Furthermore, an acbp6 T-DNA insertional mutant that lacked ACBP6 mRNA and protein displayed increased sensitivity to freezing temperature (-8 degrees C), while ACBP6-overexpressing transgenic Arabidopsis plants were conferred enhanced freezing tolerance. Northern-blot analysis indicated that ACBP6-associated freezing tolerance was not dependent on the induction of cold-regulated COLD-RESPONSIVE gene expression. Instead, ACBP6 overexpressors showed increased expression of mRNA encoding phospholipase Ddelta. Lipid profiling analyses of rosettes from cold-acclimated, freezing-treated (-8 degrees C) transgenic Arabidopsis plants overexpressing ACBP6 showed a decline in phosphatidylcholine (-36% and -46%) and an elevation of phosphatidic acid (73% and 67%) in comparison with wild-type plants. From our comparison, the gain in freezing tolerance in ACBP6 overexpressors that was accompanied by decreases in phosphatidylcholine and an accumulation of phosphatidic acid is consistent with previous findings on phospholipase Ddelta-overexpressing transgenic Arabidopsis. In vitro filter-binding assays indicating that histidine-tagged ACBP6 binds phosphatidylcholine, but not phosphatidic acid or lysophosphatidylcholine, further imply a role for ACBP6 in phospholipid metabolism in Arabidopsis, including the possibility of ACBP6 in the cytosolic trafficking of phosphatidylcholine.

  14. Evaluation of maternal serum alpha-foetoprotein assay using dry blood spot samples.

    PubMed

    González, C; Guerrero, J M; Elorza, F L; Molinero, P; Goberna, R

    1988-02-01

    The quantification of alpha-foetoprotein in dry blood spots from pregnant women was evaluated, using a conventional radioimmunoassay (RIA) with a monospecific antibody. The stability of alpha-foetoprotein in dry blood spots on filter paper was evaluated with respect to mailing, distances travelled, and the existence of high summer temperatures in our region. The results obtained show that the blood alpha-foetoprotein is stable on dry filter spots sent by mail and is stable for up to four weeks at 4, 25 and 37 degrees C. The analytical method used has a minimal detectable concentration of 10 +/- 1.9 international kilo-units/l. Both inter- and intra-assay variabilities are smaller than 10% and this method can provide results comparable with those of conventional serum assays. Results from dry blood spots and serum samples (the latter analysed by both RIA and two-site enzyme immunoassay) exhibited a good correlation (r = 0.98 and r = 0.97, p less than 0.001). The design of the assay and the nature of the samples make this method suitable for a screening programmes for the antenatal detection of open neural tube defects.

  15. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  16. Acetylcholinesterase affinity-based screening assay on Lippia gracilis Schauer extracts.

    PubMed

    Vanzolini, K L; da F Sprenger, R; Leme, G M; de S Moraes, V R; Vilela, A F L; Cardoso, C L; Cass, Q B

    2018-05-10

    The use of affinity-based protein assay produced by covalently linking acetylcholinesterase to magnetic beads, followed by chemical characterization of the selective binders using Liquid Chromatography with tandem High-Resolution Mass Spectrometry (LC-HRMS) is herein described for profiling crude aqueous natural product extracts. The fishing assay was first modulated using galanthamine as a reference ligand and then, the assay condition was adjusted for the aqueous leaves extracts obtained from Lippia gracilis Schauer (genotype 201) that was used as the natural combinatory library. From the experiments, a selective binder has been undisclosed with an accurate mass of 449.1131 m/z and identified as eriodictyol 2'-O-glucoside or eriodictyol 3'-O-glucoside. The selectivity of the binding assay was demonstrated, as much as, that erydictiol 7-O-glucoside was not fished, although it was present in the crude aqueous extract. The binding assay platform exhibited high specificity and did not require any sample pretreatment, making it appropriate for profiling binders at natural libraries. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Quantifying domain-ligand affinities and specificities by high-throughput holdup assay

    PubMed Central

    Vincentelli, Renaud; Luck, Katja; Poirson, Juline; Polanowska, Jolanta; Abdat, Julie; Blémont, Marilyne; Turchetto, Jeremy; Iv, François; Ricquier, Kevin; Straub, Marie-Laure; Forster, Anne; Cassonnet, Patricia; Borg, Jean-Paul; Jacob, Yves; Masson, Murielle; Nominé, Yves; Reboul, Jérôme; Wolff, Nicolas; Charbonnier, Sebastian; Travé, Gilles

    2015-01-01

    Many protein interactions are mediated by small linear motifs interacting specifically with defined families of globular domains. Quantifying the specificity of a motif requires measuring and comparing its binding affinities to all its putative target domains. To this aim, we developed the high-throughput holdup assay, a chromatographic approach that can measure up to a thousand domain-motif equilibrium binding affinities per day. Extracts of overexpressed domains are incubated with peptide-coated resins and subjected to filtration. Binding affinities are deduced from microfluidic capillary electrophoresis of flow-throughs. After benchmarking the approach on 210 PDZ-peptide pairs with known affinities, we determined the affinities of two viral PDZ-binding motifs derived from Human Papillomavirus E6 oncoproteins for 209 PDZ domains covering 79% of the human PDZome. We obtained exquisite sequence-dependent binding profiles, describing quantitatively the PDZome recognition specificity of each motif. This approach, applicable to many categories of domain-ligand interactions, has a wide potential for quantifying the specificities of interactomes. PMID:26053890

  18. Galline Ex-FABP is an Antibacterial Siderocalin and a Lysophosphatidic Acid Sensor Functioning through Dual Ligand Specificities

    PubMed Central

    Correnti, Colin; Clifton, Matthew C.; Abergel, Rebecca J.; Allred, Ben; Hoette, Trisha M.; Ruiz, Mario; Cancedda, Ranieri; Raymond, Kenneth N.; Descalzi, Fiorella; Strong, Roland K.

    2011-01-01

    SUMMARY Galline Ex-FABP was identified as another candidate antibacterial, catecholate siderophore binding lipocalin (siderocalin) based on structural parallels with the family archetype, mammalian Siderocalin. Binding assays show that Ex-FABP retains iron in a siderophore-dependent manner in both hypertrophic and dedifferentiated chondrocytes, where Ex-FABP expression is induced after treatment with proinflammatory agents, and specifically binds ferric complexes of enterobactin, parabactin, bacillibactin and, unexpectedly, monoglucosylated enterobactin, which does not bind to Siderocalin. Growth arrest assays functionally confirm the bacteriostatic effect of Ex-FABP in vitro under iron-limiting conditions. The 1.8Å crystal structure of Ex-FABP explains the expanded specificity, but also surprisingly reveals an extended, multi-chambered cavity extending through the protein and encompassing two separate ligand specificities, one for bacterial siderophores (as in Siderocalin) at one end and one specifically binding co-purified lysophosphatidic acid, a potent cell signaling molecule, at the other end, suggesting Ex-FABP employs dual functionalities to explain its diverse endogenous activities. PMID:22153502

  19. Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

    NASA Astrophysics Data System (ADS)

    Song, Hong Yan; Su, Xiaodi

    In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

  20. Exploring blocking assays using Octet, ProteOn, and Biacore biosensors.

    PubMed

    Abdiche, Yasmina N; Malashock, Dan S; Pinkerton, Alanna; Pons, Jaume

    2009-03-15

    We demonstrate the use of label-free real-time optical biosensors in competitive binding assays by epitope binning a panel of antibodies. We describe three assay orientations that we term in tandem, premix, and classical sandwich blocking, and we perform each of them on three platforms: ForteBio's Octet QK, Bio-Rad's ProteOn XPR36, and GE Healthcare's Biacore 3000. By testing whether antibodies block one another's binding to their antigen in a pairwise fashion, we establish a blocking profile for each antibody relative to the others in the panel. The blocking information is then used to create "bins" of antibodies with similar epitopes. The advantages and disadvantages of each biosensor, factors to consider when deciding on the most appropriate blocking assay orientation for a particular interaction system, and tips for dealing with ambiguous data are discussed. The data from our different assay orientations and biosensors agree very well, establishing these machines as valuable tools for characterizing antibody epitopes and multiprotein complexes of biological significance.

  1. PSNCBAM-1, a novel allosteric antagonist at cannabinoid CB1 receptors with hypophagic effects in rats.

    PubMed

    Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P

    2007-11-01

    Rimonabant (Acomplia, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPgammaS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPgammaS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist.

  2. PSNCBAM-1, a novel allosteric antagonist at cannabinoid CB1 receptors with hypophagic effects in rats

    PubMed Central

    Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P

    2007-01-01

    Background and purpose: Rimonabant (AcompliaTM, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. Experimental approach: A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPγS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. Key results: In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPγS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. Conclusions and implications: PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist. PMID:17592509

  3. Functional diagnostics for thyrotropin hormone receptor autoantibodies: bioassays prevail over binding assays.

    PubMed

    Lytton, Simon David; Schluter, Anke; Banga, Paul J

    2018-06-01

    Autoantibodies to the thyrotropin hormone receptor (TSH-R) are directly responsible for the hyperthyroidism in Graves' disease and mediate orbital manifestations in Graves' orbitopathy (otherwise known as thyroid eye disease). These autoantibodies are heterogeneous in their function and collectively referred to as TRAbs. Measurement of TRAbs is clinically important for diagnosis of a variety of conditions and different commercial assays with high sensitivity and specificity are available for diagnostic purposes. This review provides overwhelming evidence that the TRAbs detected in binding assays by mainly the automated electrochemical luminescence immunoassays (ECLIA) do not distinguish TRAbs that stimulate the TSH-R (called TSIs or TSAbs) and TRAbs that just inhibit the binding of TSH without stimulating the TSH-R (called TBAbs). However, TSAbs and TBAbs have divergent pathogenic roles, and depending which fraction predominates cause different clinical symptoms and engender different therapeutic regimen. Therefore, diagnostic distinction of TSAbs and TBAbs is of paramount clinical importance. To date, only bioassays such as the Mc4 TSH-R bioassay (Thyretain TM , Quidel) and the Bridge assay (Immulite 2000, Siemens) can measure TSAbs, with only the former being able to distinguish between TSAbs and TBAbs. On this note, it is strongly recommended to only use the term TSI or TSAb when reporting the results of bioassays, whereas the results of automated TRAb binding assays should be reported as TRAbs (of undetermined functional significance). This review aims to present a technical and analytical account of leading commercial diagnostic methods of anti-TSH-R antibodies, a metaanalysis of their clinical performance and a perspective for the use of cell based TSH-R bioassays in the clinical diagnostics of Graves' disease.

  4. Generation of cell lines for drug discovery through random activation of gene expression: application to the human histamine H3 receptor.

    PubMed

    Song, J; Doucette, C; Hanniford, D; Hunady, K; Wang, N; Sherf, B; Harrington, J J; Brunden, K R; Stricker-Krongrad, A

    2005-06-01

    Target-based high-throughput screening (HTS) plays an integral role in drug discovery. The implementation of HTS assays generally requires high expression levels of the target protein, and this is typically accomplished using recombinant cDNA methodologies. However, the isolated gene sequences to many drug targets have intellectual property claims that restrict the ability to implement drug discovery programs. The present study describes the pharmacological characterization of the human histamine H3 receptor that was expressed using random activation of gene expression (RAGE), a technology that over-expresses proteins by up-regulating endogenous genes rather than introducing cDNA expression vectors into the cell. Saturation binding analysis using [125I]iodoproxyfan and RAGE-H3 membranes revealed a single class of binding sites with a K(D) value of 0.77 nM and a B(max) equal to 756 fmol/mg of protein. Competition binding studies showed that the rank order of potency for H3 agonists was N(alpha)-methylhistamine approximately (R)-alpha- methylhistamine > histamine and that the rank order of potency for H3 antagonists was clobenpropit > iodophenpropit > thioperamide. The same rank order of potency for H3 agonists and antagonists was observed in the functional assays as in the binding assays. The Fluorometic Imaging Plate Reader assays in RAGE-H3 cells gave high Z' values for agonist and antagonist screening, respectively. These results reveal that the human H3 receptor expressed with the RAGE technology is pharmacologically comparable to that expressed through recombinant methods. Moreover, the level of expression of the H3 receptor in the RAGE-H3 cells is suitable for HTS and secondary assays.

  5. Flavonoid Regulation of HCN2 Channels*

    PubMed Central

    Carlson, Anne E.; Rosenbaum, Joel C.; Brelidze, Tinatin I.; Klevit, Rachel E.; Zagotta, William N.

    2013-01-01

    The hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels are pacemaker channels whose currents contribute to rhythmic activity in the heart and brain. HCN channels open in response to hyperpolarizing voltages, and the binding of cAMP to their cyclic nucleotide-binding domain (CNBD) facilitates channel opening. Here, we report that, like cAMP, the flavonoid fisetin potentiates HCN2 channel gating. Fisetin sped HCN2 activation and shifted the conductance-voltage relationship to more depolarizing potentials with a half-maximal effective concentration (EC50) of 1.8 μm. When applied together, fisetin and cAMP regulated HCN2 gating in a nonadditive fashion. Fisetin did not potentiate HCN2 channels lacking their CNBD, and two independent fluorescence-based binding assays reported that fisetin bound to the purified CNBD. These data suggest that the CNBD mediates the fisetin potentiation of HCN2 channels. Moreover, binding assays suggest that fisetin and cAMP partially compete for binding to the CNBD. NMR experiments demonstrated that fisetin binds within the cAMP-binding pocket, interacting with some of the same residues as cAMP. Together, these data indicate that fisetin is a partial agonist for HCN2 channels. PMID:24085296

  6. The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

    PubMed

    Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

    2004-11-15

    Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

  7. Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity

    NASA Astrophysics Data System (ADS)

    Woods, Christopher J.; Malaisree, Maturos; Long, Ben; McIntosh-Smith, Simon; Mulholland, Adrian J.

    2013-12-01

    The emergence of a novel H7N9 avian influenza that infects humans is a serious cause for concern. Of the genome sequences of H7N9 neuraminidase available, one contains a substitution of arginine to lysine at position 292, suggesting a potential for reduced drug binding efficacy. We have performed molecular dynamics simulations of oseltamivir, zanamivir and peramivir bound to H7N9, H7N9-R292K, and a structurally related H11N9 neuraminidase. They show that H7N9 neuraminidase is structurally homologous to H11N9, binding the drugs in identical modes. The simulations reveal that the R292K mutation disrupts drug binding in H7N9 in a comparable manner to that observed experimentally for H11N9-R292K. Absolute binding free energy calculations with the WaterSwap method confirm a reduction in binding affinity. This indicates that the efficacy of antiviral drugs against H7N9-R292K will be reduced. Simulations can assist in predicting disruption of binding caused by mutations in neuraminidase, thereby providing a computational `assay.'

  8. Spectroscopic and molecular modeling approaches to investigate the interaction of bisphenol A, bisphenol F and their diglycidyl ethers with PPARα.

    PubMed

    Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Ruan, Ping; Ren, Dayong; Dai, Weichang; Yu, Hansong; Li, Tiezhu

    2017-08-01

    A fluorescence polarization (FP) assay for the simultaneous determination of bisphenol A (BPA), bisphenol F (BPF), bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) was developed. The method was based on the competition between bisphenols (BPs) and fluorescein-labeled dexamethasone derivative (Dex-fl) for mouse peroxisome proliferator-activated receptor α ligand binding domain (mPPARα-LBD). A recombinant soluble protein derivative mPPARα-LBD* was prepared, then in vitro binding of 4 BPs to mPPARα-LBD* was investigated. Fluorescence polarization assay showed that these compounds exhibited different binding potencies with mPPARα-LBD*. Additionally, molecular dynamics simulations were performed to further understand the mechanism of BPs binding affinity for mPPARα-LBD*. Docking results elucidated that the driving forces for the binding of BPs to mPPARα-LBD* were predominantly dependent on hydrophobic and hydrogen-bonding interactions. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2  = 0.7258). The proposed method has potential for multi-residue detection of BPA, BPF, BADGE, and BFDGE. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Characterization of the receptor-binding domain of Ebola glycoprotein in viral entry.

    PubMed

    Wang, Jizhen; Manicassamy, Balaji; Caffrey, Michael; Rong, Lijun

    2011-06-01

    Ebola virus infection causes severe hemorrhagic fever in human and non-human primates with high mortality. Viral entry/infection is initiated by binding of glycoprotein GP protein on Ebola virion to host cells, followed by fusion of virus-cell membrane also mediated by GP. Using an human immunodeficiency virus (HIV)-based pseudotyping system, the roles of 41 Ebola GP1 residues in the receptor-binding domain in viral entry were studied by alanine scanning substitutions. We identified that four residues appear to be involved in protein folding/structure and four residues are important for viral entry. An improved entry interference assay was developed and used to study the role of these residues that are important for viral entry. It was found that R64 and K95 are involved in receptor binding. In contrast, some residues such as I170 are important for viral entry, but do not play a major role in receptor binding as indicated by entry interference assay and/or protein binding data, suggesting that these residues are involved in post-binding steps of viral entry. Furthermore, our results also suggested that Ebola and Marburg viruses share a common cellular molecule for entry.

  10. Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grøftehauge, Morten K., E-mail: m.k.groftehauge@durham.ac.uk; Hajizadeh, Nelly R.; Swann, Marcus J.

    2015-01-01

    The biophysical characterization of protein–ligand interactions in solution using techniques such as thermal shift assay, or on surfaces using, for example, dual polarization interferometry, plays an increasingly important role in complementing crystal structure determinations. Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmonmore » resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.« less

  11. Functional assay for T4 lysozyme-engineered G protein-coupled receptors with an ion channel reporter.

    PubMed

    Niescierowicz, Katarzyna; Caro, Lydia; Cherezov, Vadim; Vivaudou, Michel; Moreau, Christophe J

    2014-01-07

    Structural studies of G protein-coupled receptors (GPCRs) extensively use the insertion of globular soluble protein domains to facilitate their crystallization. However, when inserted in the third intracellular loop (i3 loop), the soluble protein domain disrupts their coupling to G proteins and impedes the GPCRs functional characterization by standard G protein-based assays. Therefore, activity tests of crystallization-optimized GPCRs are essentially limited to their ligand binding properties using radioligand binding assays. Functional characterization of additional thermostabilizing mutations requires the insertion of similar mutations in the wild-type receptor to allow G protein-activation tests. We demonstrate that ion channel-coupled receptor technology is a complementary approach for a comprehensive functional characterization of crystallization-optimized GPCRs and potentially of any engineered GPCR. Ligand-induced conformational changes of the GPCRs are translated into electrical signal and detected by simple current recordings, even though binding of G proteins is sterically blocked by the added soluble protein domain. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Human sex hormone-binding globulin binding affinities of 125 structurally diverse chemicals and comparison with their binding to androgen receptor, estrogen receptor, and α-fetoprotein.

    PubMed

    Hong, Huixiao; Branham, William S; Ng, Hui Wen; Moland, Carrie L; Dial, Stacey L; Fang, Hong; Perkins, Roger; Sheehan, Daniel; Tong, Weida

    2015-02-01

    One endocrine disruption mechanism is through binding to nuclear receptors such as the androgen receptor (AR) and estrogen receptor (ER) in target cells. The concentration of a chemical in serum is important for its entry into the target cells to bind the receptors, which is regulated by the serum proteins. Human sex hormone-binding globulin (SHBG) is the major transport protein in serum that can bind androgens and estrogens and thus change a chemical's availability to enter the target cells. Sequestration of an androgen or estrogen in the serum can alter the chemical elicited AR- and ER-mediated responses. To better understand the chemical-induced endocrine activity, we developed a competitive binding assay using human pregnancy plasma and measured the binding to the human SHBG for 125 structurally diverse chemicals, most of which were known to bind AR and ER. Eighty seven chemicals were able to bind the human SHBG in the assay, whereas 38 chemicals were nonbinders. Binding data for human SHBG are compared with that for rat α-fetoprotein, ER and AR. Knowing the binding profiles between serum and nuclear receptors will improve assessment of a chemical's potential for endocrine disruption. The SHBG binding data reported here represent the largest data set of structurally diverse chemicals tested for human SHBG binding. Utilization of the SHBG binding data with AR and ER binding data could enable better evaluation of endocrine disrupting potential of chemicals through AR- and ER-mediated responses since sequestration in serum could be considered. Published by Oxford University Press on behalf of the Society of Toxicology 2014. This work is written by US Government employees and is in the public domain in the US.

  13. Isolation of serotype-specific antibodies against dengue virus non-structural protein 1 using phage display and application in a multiplexed serotyping assay.

    PubMed

    Lebani, Kebaneilwe; Jones, Martina L; Watterson, Daniel; Ranzoni, Andrea; Traves, Renee J; Young, Paul R; Mahler, Stephen M

    2017-01-01

    The multidimensional nature of dengue virus (DENV) infections, which can be caused by four distinct serotypes of the virus, complicates the sensitivity of assays designed for the diagnosis of infection. Different viral markers can be optimally detected at different stages of infection. Of particular clinical importance is the early identification of infection, which is pivotal for disease management and the development of blood screening assays. Non-structural protein 1 (NS1) is an early surrogate marker of infection and its detection in serum coincides with detectable viraemia. The aim of this work was to isolate and characterise serotype-specific monoclonal antibodies that bind to NS1 for each of the four DENV serotypes. This was achieved using phage display and a subtractive biopanning strategy to direct the antibody selection towards serotype-specific epitopes. This antibody isolation strategy has advantages over immunisation techniques where it is difficult to avoid antibody responses to cross-reactive, immunodominant epitopes. Serotype specificity to recombinant antigen for each of the antibodies was confirmed by Enzyme Linked Immunosorbent Assay (ELISA) and Surface Plasmon Resonance. Confirmation of binding to native DENV NS1 was achieved using ELISA and immunofluorescence assay on DENV infected Vero cells. No cross-reactivity with Zika or Kunjin viruses was observed. A previously isolated pan-reactive antibody that binds to an immunodominant epitope was able to pair with each of the serotype-specific antibodies in a sandwich ELISA, indicating that the serotype specific antibodies bind to epitopes which are all spatially distinct from the immunodominant epitope. These antibodies were suitable for use in a multiplexed assay for simultaneous detection and serotyping of DENV NS1 in human serum. This work demonstrates that phage display coupled with novel biopanning strategies is a valuable in vitro methodology for isolation of binders that can discern amongst antigens with high homology for diagnostic applicability.

  14. Molecular interactions between general anesthetics and the 5HT2B receptor.

    PubMed

    Matsunaga, Felipe; Gao, Lu; Huang, Xi-Ping; Saven, Jeffery G; Roth, Bryan L; Liu, Renyu

    2015-01-01

    Serotonin modulates many processes through a family of seven serotonin receptors. However, no studies have screened for interactions between general anesthetics currently in clinical use and serotonergic G-protein-coupled receptors (GPCRs). Given that both intravenous and inhalational anesthetics have been shown to target other classes of GPCRs, we hypothesized that general anesthetics might interact directly with some serotonin receptors and thus modify their function. Radioligand binding assays were performed to screen serotonin receptors for interactions with propofol and isoflurane as well as for affinity determinations. Docking calculations using the crystal structure of 5-HT2B were performed to computationally confirm the binding assay results and locate anesthetic binding sites. The 5-HT2B class of receptors interacted significantly with both propofol and isoflurane in the primary screen. The affinities for isoflurane and propofol were determined to be 7.78 and .95 μM, respectively, which were at or below the clinical concentrations for both anesthetics. The estimated free energy derived from docking calculations for propofol (-6.70 kcal/mol) and isoflurane (-5.10 kcal/mol) correlated with affinities from the binding assay. The anesthetics were predicted to dock at a pharmacologically relevant binding site of 5HT2B. The molecular interactions between propofol and isoflurane with the 5-HT2B class of receptors were discovered and characterized. This finding implicates the serotonergic GPCRs as potential anesthetic targets.

  15. A rapid method for selecting suitable animal species for studying pathogen interactions with plasma protein ligands in vivo.

    PubMed

    Naudin, Clément; Schumski, Ariane; Salo-Ahen, Outi M H; Herwald, Heiko; Smeds, Emanuel

    2017-05-01

    Species tropism constitutes a serious problem for developing relevant animal models of infection. Human pathogens can express virulence factors that show specific selectivity to human proteins, while their affinity for orthologs from other species can vary significantly. Suitable animal species must be used to analyse whether virulence factors are potential targets for drug development. We developed an assay that rapidly predicts applicable animal species for studying virulence factors binding plasma proteins. We used two well-characterized Staphylococcus aureus proteins, SSL7 and Efb, to develop an ELISA-based inhibition assay using plasma from different animal species. The interaction between SSL7 and human C5 and the binding of Efb to human fibrinogen and human C3 was studied. Affinity experiments and Western blot analyses were used to validate the assay. Human, monkey and cat plasma interfered with binding of SSL7 to human C5. Binding of Efb to human fibrinogen was blocked in human, monkey, gerbil and pig plasma, while human, monkey, gerbil, rabbit, cat and guinea pig plasma inhibited the binding of Efb to human C3. These results emphasize the importance of choosing correct animal models, and thus, our approach is a rapid and cost-effective method that can be used to prevent unnecessary animal experiments. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  16. Mobile Phone Ratiometric Imaging Enables Highly Sensitive Fluorescence Lateral Flow Immunoassays without External Optical Filters.

    PubMed

    Shah, Kamal G; Singh, Vidhi; Kauffman, Peter C; Abe, Koji; Yager, Paul

    2018-05-14

    Paper-based diagnostic tests based on the lateral flow immunoassay concept promise low-cost, point-of-care detection of infectious diseases, but such assays suffer from poor limits of detection. One factor that contributes to poor analytical performance is a reliance on low-contrast chromophoric optical labels such as gold nanoparticles. Previous attempts to improve the sensitivity of paper-based diagnostics include replacing chromophoric labels with enzymes, fluorophores, or phosphors at the expense of increased fluidic complexity or the need for device readers with costly optoelectronics. Several groups, including our own, have proposed mobile phones as suitable point-of-care readers due to their low cost, ease of use, and ubiquity. However, extant mobile phone fluorescence readers require costly optical filters and were typically validated with only one camera sensor module, which is inappropriate for potential point-of-care use. In response, we propose to couple low-cost ultraviolet light-emitting diodes with long Stokes-shift quantum dots to enable ratiometric mobile phone fluorescence measurements without optical filters. Ratiometric imaging with unmodified smartphone cameras improves the contrast and attenuates the impact of excitation intensity variability by 15×. Practical application was shown with a lateral flow immunoassay for influenza A with nucleoproteins spiked into simulated nasal matrix. Limits of detection of 1.5 and 2.6 fmol were attained on two mobile phones, which are comparable to a gel imager (1.9 fmol), 10× better than imaging gold nanoparticles on a scanner (18 fmol), and >2 orders of magnitude better than gold nanoparticle-labeled assays imaged with mobile phones. Use of the proposed filter-free mobile phone imaging scheme is a first step toward enabling a new generation of highly sensitive, point-of-care fluorescence assays.

  17. dsRNA binding characterization of full length recombinant wild type and mutants Zaire ebolavirus VP35.

    PubMed

    Zinzula, Luca; Esposito, Francesca; Pala, Daniela; Tramontano, Enzo

    2012-03-01

    The Ebola viruses (EBOVs) VP35 protein is a multifunctional major virulence factor involved in EBOVs replication and evasion of the host immune system. EBOV VP35 is an essential component of the viral RNA polymerase, it is a key participant of the nucleocapsid assembly and it inhibits the innate immune response by antagonizing RIG-I like receptors through its dsRNA binding function and, hence, by suppressing the host type I interferon (IFN) production. Insights into the VP35 dsRNA recognition have been recently revealed by structural and functional analysis performed on its C-terminus protein. We report the biochemical characterization of the Zaire ebolavirus (ZEBOV) full-length recombinant VP35 (rVP35)-dsRNA binding function. We established a novel in vitro magnetic dsRNA binding pull down assay, determined the rVP35 optimal dsRNA binding parameters, measured the rVP35 equilibrium dissociation constant for heterologous in vitro transcribed dsRNA of different length and short synthetic dsRNA of 8bp, and validated the assay for compound screening by assessing the inhibitory ability of auryntricarboxylic acid (IC(50) value of 50μg/mL). Furthermore, we compared the dsRNA binding properties of full length wt rVP35 with those of R305A, K309A and R312A rVP35 mutants, which were previously reported to be defective in dsRNA binding-mediated IFN inhibition, showing that the latter have measurably increased K(d) values for dsRNA binding and modified migration patterns in mobility shift assays with respect to wt rVP35. Overall, these results provide the first characterization of the full-length wt and mutants VP35-dsRNA binding functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. A simple method for determining polymeric IgA-containing immune complexes.

    PubMed

    Sancho, J; Egido, J; González, E

    1983-06-10

    A simplified assay to measure polymeric IgA-immune complexes in biological fluids is described. The assay is based upon the specific binding of a secretory component for polymeric IgA. In the first step, multimeric IgA (monomeric and polymeric) immune complexes are determined by the standard Raji cell assay. Secondly, labeled secretory component added to the assay is bound to polymeric IgA-immune complexes previously fixed to Raji cells, but not to monomeric IgA immune complexes. To avoid false positives due to possible complement-fixing IgM immune complexes, prior IgM immunoadsorption is performed. Using anti-IgM antiserum coupled to CNBr-activated Sepharose 4B this step is not time-consuming. Polymeric IgA has a low affinity constant and binds weakly to Raji cells, as Scatchard analysis of the data shows. Thus, polymeric IgA immune complexes do not bind to Raji cells directly through Fc receptors, but through complement breakdown products, as with IgG-immune complexes. Using this method, we have been successful in detecting specific polymeric-IgA immune complexes in patients with IgA nephropathy (Berger's disease) and alcoholic liver disease, as well as in normal subjects after meals of high protein content. This new, simple, rapid and reproducible assay might help to study the physiopathological role of polymeric IgA immune complexes in humans and animals.

  19. Identifying Metabolically Active Chemicals Using a Consensus ...

    EPA Pesticide Factsheets

    Endocrine disrupting chemicals (EDCs) are abundant throughout the environment and can alter neurodevelopment, behavior, and reproductive success of humans and other species by perturbing signaling pathways related to the estrogen receptor (ER). A recent study compared results across 18 ER-related assays in the ToxCast™ in vitro screening program to predict the likelihood of a chemical exhibiting in vivo estrogenic activity, with the purpose of eliminating chemicals that may produce a false signal by interfering with the technological attributes of an individual assay. However, flaws in in vitro assay design can also prevent induction of signal activity by EDCs. Another reason for not observing activity for some EDCs in in vitro assays is that metabolic activation is required to perturb ER-related pathways. In the current study, 1,024 chemicals were identified as lacking ER activity after establishing a consensus across each of the 18 ER-related in vitro assays, and nearly 2,000 primary and 3,700 secondary unique metabolites were predicted for these chemicals. The ER binding activity for each metabolite was then predicted using an existing ER activity quantitative structure activity relationship (QSAR) consensus model. Binding activity was predicted for 2-3% of the metabolites within each generation. Of the inactive parent compounds generating at least one metabolite predicted to have ER-binding activity, nearly 30% were found to have metabolites from both gene

  20. Nanosize electropositive fibrous adsorbent

    DOEpatents

    Tepper, Frederick; Kaledin, Leonid

    2005-01-04

    Aluminum hydroxide fibers approximately 2 nanometers in diameter and with surface areas ranging from 200 to 650 m.sup.2 /g have been fount to be highly electropositive. When dispersed in water they are able to attach to and retain electronegative particles. When combined into a composite filter with other fibers or particles they can filter bacteria and nano size particulates such as viruses and colloidal particles at high flux through the filter. Such filters can be used for purification and sterilization of water, biological, medical and pharmaceutical fluids, and as a collector/concentrator for detection and assay of mirobes and viruses. The alumina fibers are also capable of filtering sub-micron inorganic and metallic particles to produce ultra pure water. The fibers are suitable as a substrate for growth of cells. Macromolicules such as proteins may be separated from each other based on their electronegative charges.

  1. Role of the Filters in the Formation and Stabilization of Semiquinone Radicals Collected from Cigarette Smoke

    PubMed Central

    Maskos, Zofia; Dellinger, Barry

    2013-01-01

    The fractional pyrolysis of Bright tobacco was performed in nitrogen atmosphere over the temperature range of 240 – 510 °C in a specially constructed, high temperature flow reactor system. Electron paramagnetic resonance (EPR) spectroscopy was used to analyze the free radicals in the initially produced total particular matter (TPM) and in TPM after exposure to ambient air (aging). Different filters have been used to collect TPM from tobacco smoke: cellulosic, cellulose nitrate, cellulose acetate, nylon, Teflon and Cambridge. The collection of the primary radicals (measured immediately after collection of TPM on filters), the formation and stabilization of the secondary radicals (defined as radicals formed during aging of TPM samples on the filters) depend significantly on the material of the filter. A mechanistic explanation about different binding capability of the filters decreasing in the order: cellulosic < cellulose nitrate < cellulose acetate < nylon ~ teflon is presented. Different properties were observed for the Cambridge filter. Specific care must be taken using the filters for identification of radicals from tobacco smoke to avoid artifacts in each case. PMID:24265513

  2. The hURAT1 rs559946 polymorphism and the incidence of gout in Han Chinese men.

    PubMed

    Li, C; Yu, Q; Han, L; Wang, C; Chu, N; Liu, S

    2014-01-01

    Our previous study identified rs559946, a human urate transporter 1 (hURAT1) single nucleotide polymorphism (SNP), as being significantly associated with risk of primary hyperuricaemia (HUA) in a Han Chinese population. In the current study we aimed to identify the genetic effects of rs559946 on gout susceptibility in Han Chinese men. A total of 335 patients with gout and 376 healthy controls were recruited for a case-control association study. To examine the functional effect of rs559946, we performed luciferase reporter assays and an electrophoretic mobility shift assay (EMSA). rs559946 was found to be significantly associated with gout susceptibility (p = 0.004), with T-allele carriers showing a decreased risk of gout [odds ratio (OR) 0.70, 95% confidence interval (CI) 0.55-0.89]. Multiple linear regression analysis identified a significant association between rs559946 genotypes and tophi. Luciferase reporter assays show increased transcriptional activity of the hURAT1 promoter with the C allele of rs559946. EMSA detected binding of nuclear proteins to both the T and C alleles, although increased binding was observed with the T allele. Cold competition assays suggest that rs559946 may bind within a glucocorticoid receptor (GR) binding motif. Our study suggests that the rs559946 polymorphism is associated with increased HUA risk and may also contribute to gout development in Han Chinese men. The T to C substitution within rs559946 increased the transcriptional activity, and potentially increases gout susceptibility.

  3. Analysis of the stability of urea in dried blood spots collected and stored on filter paper.

    PubMed

    Quraishi, Rizwana; Lakshmy, Ramakrishnan; Mukhopadhyay, Ashok Kumar; Jailkhani, Bansi Lal

    2013-05-01

    The ability to use dry blood spots (DBSs) on filter paper for the analysis of urea levels could be an important diagnostic tool for areas that have limited access to laboratory facilities. We developed a method for the extraction and quantification of urea from DBSs that were stored on 3M Whatman filter paper and investigated the effect of long-term storage on the level of urea in DBSs. DBSs of 4.5 mm in diameter were used for our assay, and we determined the urea levels in blood using a commercially available enzymatic kit (UV GLDH-method; Randox laboratories Ltd., UK). The DBSs on filter discs were stored at 4℃ or at 37℃ for 120 days. The mean intra- and inter-assay coefficient of variance for our method of urea extraction from dried blood was 4.2% and 6.3%, respectively. We collected 75 fresh blood samples and compared the urea content of each fresh sample with the urea content of DBSs taken from corresponding fresh blood samples. Regression analysis reported a regression coefficient (r) value of 0.97 and a recovery of urea from dried spots was 102.2%. Urea concentrations in DBSs were stable for up to 120 and 90 days when stored at 4℃ and 37℃, respectively. Our results show that urea can be stored and quantitatively recovered from small volumes of blood that was collected on filter paper.

  4. Dopaminergic receptor-ligand binding assays based on molecularly imprinted polymers on quartz crystal microbalance sensors.

    PubMed

    Naklua, Wanpen; Suedee, Roongnapa; Lieberzeit, Peter A

    2016-07-15

    Molecularly imprinted polymers (MIPs) have been successfully applied as selective materials for assessing the binding activity of agonist and antagonist of dopamine D1 receptor (D1R) by using quartz crystal microbalance (QCM). In this study, D1R derived from rat hypothalamus was used as a template and thus self-organized on stamps. Those were pressed into an oligomer film consisting of acrylic acid: N-vinylpyrrolidone: N,N'-(1,2-dihydroxyethylene) bis-acrylamide in a ratio of 2:3:12 spin coated onto a dual electrode QCM. Such we obtained one D1R-MIP-QCM electrode, whereas the other electrode carried the non-imprinted control polymer (NIP) that had remained untreated. Successful imprinting of D1R was confirmed by AFM. The polymer can re-incorporate D1R leading to frequency responses of 100-1200Hz in a concentration range of 5.9-47.2µM. In a further step such frequency changes proved inherently useful for examining the binding properties of test ligands to D1R. The resulting mass-sensitive measurements revealed Kd of dopamine∙HCl, haloperidol, and (+)-SCH23390 at 0.874, 25.6, and 0.004nM, respectively. These results correlate well with the values determined in radio ligand binding assays. Our experiments revealed that D1R-MIP sensors are useful for estimating the strength of ligand binding to the active single site. Therefore, we have developed a biomimetic surface imprinting strategy for QCM studies of D1R-ligand binding and presented a new method to ligand binding assay for D1R. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Prevalence of congenital Toxoplasma gondii infection among newborns from the Poznań region of Poland: validation of a new combined enzyme immunoassay for Toxoplasma gondii-specific immunoglobulin A and immunoglobulin M antibodies.

    PubMed

    Paul, M; Petersen, E; Szczapa, J

    2001-05-01

    We determined the value of a new serological assay detecting Toxoplasma-specific immunoglobulin M (IgM) and IgA antibodies at birth for use in mass neonatal screening. The incidence of congenital infection in newborns was compared with data from an epidemiological investigation on the seroprevalence of Toxoplasma in the studied population. Peripheral blood was collected on Guthrie cards during the first 3 days of life and tested for anti-Toxoplasma IgA and IgM using a noncommercial immunocapture enzyme-linked immunosorbent assay (ELISA). When the screening assay was positive, serum samples from the child and the mother were collected for use in Western blotting comparative immunological profile analysis and traditional serological tests for determination of specific IgG, IgM, and IgA antibodies. From December 1998 to April 2000, 17,653 filter paper samples from live-born neonates were successively screened. Congenital T. gondii infection was finally confirmed in 19 newborns. In traditional assays, 13 of 19 infants were IgM and IgA positive using filter paper eluates at birth, 1 child was positive only for IgM, 1 patient was positive for IgM and borderline for IgA, 1 had an equivocal level of IgA, and 3 cases were confirmed only by the Western blot assay. The prevalence of Toxoplasma-specific IgA and/or IgM in filter paper samples at birth was 1 per 929 live-born neonates (1.08/1,000) or about 1 per 523 children (1.9/1,000) born to nonimmune women with a potential risk of primary T. gondii infection during pregnancy, compared to the actual seropositivity rate of 43.7%. The diagnostic sensitivity of the combined IgA-IgM ELISA using neonatal filter paper specimens was not more than 95%, the positive predictive value of the test was 82.6%, and the diagnostic specificity was calculated to be 99.9%. The combined IgA-IgM ELISA is a valuable method for the diagnosis of congenital toxoplasmosis at birth and fulfills criteria for neonatal screening programs. The method showed a good diagnostic sensitivity in neonates untreated prenatally who were born in an area of high seroprevalence of T. gondii infection.

  6. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  7. Evaluation of the In Vivo and Ex Vivo Binding of Novel BC1 Cannabinoid Receptor Radiotracers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, A.; Gatley, J.; Gifford, A.

    The primary active ingredient of marijuana, 9-tetrahydrocannabinol, exerts its psychoactive effects by binding to cannabinoid CB1 receptors. These receptors are found throughout the brain with high concentrations in the hippocampus and cerebellum. The current study was conducted to evaluate the binding of a newly developed putative cannabinoid antagonist, AM630, and a classical cannabinoid 8-tetrahydrocannabinol as potential PET and/or SPECT imaging agents for brain CB1 receptors. For both of these ligands in vivo and ex vivo studies in mice were conducted. AM630 showed good overall brain uptake (as measure by %IA/g) and a moderately rapid clearance from the brain with amore » half-clearance time of approximately 30 minutes. However, AM630 did not show selective binding to CB1 cannabinoid receptors. Ex vivo autoradiography supported the lack of selective binding seen in the in vivo study. Similar to AM630, 8-tetrahydrocanibol also failed to show selective binding to CB1 receptor rich brain areas. The 8-tetrahydrocanibol showed moderate overall brain uptake and relatively slow brain clearance as compared to AM630. Further studies were done with AM2233, a cannabinoid ligand with a similar structure as AM630. These studies were done to develop an ex vivo binding assay to quantify the displacement of [131I]AM2233 binding by other ligands in Swiss-Webster and CB1 receptor knockout mice. By developing this assay we hoped to determine the identity of an unknown binding site for AM2233 present in the hippocampus of CB1 knockout mice. Using an approach based on incubation of brain slices prepared from mice given intravenous [131I]AM2233 in either the presence or absence of AM2233 (unlabelled) it was possible to demonstrate a significant AM2233-displacable binding in the Swiss-Webster mice. Future studies will determine if this assay is appropriate for identifying the unknown binding site for AM2233 in the CB1 knockout mice.« less

  8. Development of an assay for a biomarker of pregnancy and early fetal loss

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canfield, R.E.; O'Connor, J.F.; Birken, S.

    1987-10-01

    Human chorionic gonadotropin (hCG) is a glycoprotein hormone, secreted by the syncytiotrophoblast cells of the fertilized ovum, that enters the maternal circulation at the time of endometrial implantation. It is composed of two nonidentical subunits; ..cap alpha.. and ..beta.., with molecular weights of 14 kD and 23 kD, respectively. Human chorionic gonadotropin binds to the same receptor as hLH and displays the same biological response, namely, to stimulate the declining function of the corpus luteum to produce progestins and estrogen late in the menstrual cycle. The differences in the structures of hCG and hLH have been exploited to develop antibodiesmore » that can measure hCG specifically in the presence of hLH. Two-site antibody binding assays have been developed, based on a surface immunological concept of hCG epitopes, that involve four distinct regions to which antibodies against hCG can bind simultaneously. Antibody cooperative effects, in conjunction with kinetic advantages derived from the concentration factors by use of the sandwich assay technique (immunoradiometric assay, IRMA), have enabled development of extremely sensitive and specific measurement protocols for urinary hCG. The assay described herein permits the detection of pregnancy on an average 25.4 days after the first day of the preceding menses, as opposed to 29.5 days for conventional radioimmunoassay techniques. In addition, the greater sensitivity and specificity of this assay method has permitted the detection of episodes of fetal loss not detected by radioimmunoassay of urine specimens. A large scale epidemiological study is in progress using this assay technique as a way to identify pregnancies that are lost before becoming clinically apparent.« less

  9. Fate of wastewater effluent hER-agonists and hER-antagonists during soil aquifer treatment.

    PubMed

    Otakuye, Conroy; Quanrud, David M; Ela, Wendell P; Wicke, Daniel; Lansey, Kevin E; Arnold, Robert G

    2005-04-01

    Estrogen activity was measured in wastewater effluent before and after polishing via soil-aquifer treatment (SAT) using both a (hER-beta) competitive binding assay and a transcriptional activation (yeast estrogen screen, YES) assay. From the competitive binding assay, the equivalent 17alpha-ethinylestradiol (EE2) concentration in secondary effluent was 4.7 nM but decreased to 0.22 nM following SAT. The YES assay indicated that the equivalent EE2 concentration in the same effluent sample was below the method-detection limit (<2.5 x 10(-3) nM) but increased to 0.68 nM in effluent polished via SAT processes. It was hypothesized thattest-dependent differences arose because the competitive binding assay responds positively to both estrogen mimics and anti-estrogens; the YES assay responds to estrogen mimics, but test response is inhibited by anti-estrogens. The hypothesis was supported when organics extracted from wastewater effluent inhibited the YES test response to EE2 (anti-estrogenic effect). A similar extract prepared from SAT-polished effluent augmented the EE2 curve (agonist response). When hydrophobic organics in secondary effluent were fractionated, assay results indicated that several physically distinct anti-estrogens were present in the sample. From this work, it is evident that transcription-activation bioassays alone should not be relied upon to measure estrogenic activity in complex environmental samples because the simultaneous presence of both agonists and antagonist compounds can yield false negatives. Multiple in vitro bioassays, sample fractionation or tests designed to measure anti-estrogenic activity can be used to overcome this problem. It is also clear that there are circumstances under which SAT does not completely remove estrogenic activity during municipal wastewater effluent polishing.

  10. Generation and characterization of a unique reagent that recognizes a panel of recombinant human monoclonal antibody therapeutics in the presence of endogenous human IgG.

    PubMed

    Wang, Xiangdan; Quarmby, Valerie; Ng, Carl; Chuntharapai, Anan; Shek, Theresa; Eigenbrot, Charles; Kelley, Robert F; Shia, Steven; McCutcheon, Krista; Lowe, John; Leddy, Cecilia; Coachman, Kyle; Cain, Gary; Chu, Felix; Hotzel, Isidro; Maia, Mauricio; Wakshull, Eric; Yang, Jihong

    2013-01-01

    Pharmacokinetic (PK) and immunohistochemistry (IHC) assays are essential to the evaluation of the safety and efficacy of therapeutic monoclonal antibodies (mAb) during drug development. These methods require reagents with a high degree of specificity because low concentrations of therapeutic antibody need to be detected in samples containing high concentrations of endogenous human immunoglobulins. Current assay reagent generation practices are labor-intensive and time-consuming. Moreover, these practices are molecule-specific and so only support one assay for one program at a time. Here, we describe a strategy to generate a unique assay reagent, 10C4, that preferentially recognizes a panel of recombinant human mAbs over endogenous human immunoglobulins. This "panel-specific" feature enables the reagent to be used in PK and IHC assays for multiple structurally-related therapeutic mAbs. Characterization revealed that the 10C4 epitope is conformational, extensive and mainly composed of non-CDR residues. Most key contact residues were conserved among structurally-related therapeutic mAbs, but the combination of these residues exists at low prevalence in endogenous human immunoglobulins. Interestingly, an indirect contact residue on the heavy chain of the therapeutic appears to play a critical role in determining whether or not it can bind to 10C4, but has no affect on target binding. This may allow us to improve the binding of therapeutic mAbs to 10C4 for assay development in the future. Here, for the first time, we present a strategy to develop a panel-specific reagent that can expedite the development of multiple clinical assays for structurally-related therapeutic mAbs.

  11. A 23Na Multiple-Quantum-Filtered NMR Study of the Effect of the Cytoskeleton Conformation on the Anisotropic Motion of Sodium Ions in Red Blood Cells

    NASA Astrophysics Data System (ADS)

    Knubovets, Tatyana; Shinar, Hadassah; Eliav, Uzi; Navon, Gil

    1996-01-01

    Recently, it has been shown that23Na double-quantum-filtered NMR spectroscopy can be used to detect anisotropic motion of bound sodium ions in biological systems. The technique is based on the formation of the second-rank tensor when the quadrupolar interaction is not averaged to zero. Using this method, anisotropic motion of bound sodium in human and dog red blood cells was detected, and the effect was shown to depend on the integrity of the membrane cytoskeleton. In the present study, multiple-quantum-filtered techniques were applied in combination with a quadrupolar echo to measure the transverse-relaxation times,T2fandT2s. Line fitting was performed to obtain the values of the residual quadrupolar interaction, which was measured for sodium in a variety of mammalian erythrocytes of different size, shape, rheological properties, and sodium concentrations. Human unsealed white ghosts were used to study sodium bound at the anisotropic sites on the inner side of the RBC membrane. Modulations of the conformation of the cytoskeleton by the variation of either the ionic strength or pH of the suspending medium caused drastic changes in both the residual quadrupolar interaction andT2fdue to changes in the fraction of bound sodium ions as well as changes in the structure of the binding sites. By combining the two spectroscopic parameters, structural change can be followed. The changes in the structure of the sodium anisotropic binding sites deduced by this method were found to correlate with known conformational changes of the membrane cytoskeleton. Variations of the medium pH affected both the fraction of bound sodium ions and the structure of the anisotropic binding sites. Sodium and potassium were shown to bind to the anisotropic binding sites with the same affinity.

  12. Evaluation of colorimetric assays for analyzing reductively methylated proteins: Biases and mechanistic insights.

    PubMed

    Brady, Pamlea N; Macnaughtan, Megan A

    2015-12-15

    Colorimetric protein assays, such as the Coomassie blue G-250 dye-binding (Bradford) and bicinchoninic acid (BCA) assays, are commonly used to quantify protein concentration. The accuracy of these assays depends on the amino acid composition. Because of the extensive use of reductive methylation in the study of proteins and the importance of biological methylation, it is necessary to evaluate the impact of lysyl methylation on the Bradford and BCA assays. Unmodified and reductively methylated proteins were analyzed using the absorbance at 280 nm to standardize the concentrations. Using model compounds, we demonstrate that the dimethylation of lysyl ε-amines does not affect the proteins' molar extinction coefficients at 280 nm. For the Bradford assay, the responses (absorbance per unit concentration) of the unmodified and reductively methylated proteins were similar, with a slight decrease in the response upon methylation. For the BCA assay, the responses of the reductively methylated proteins were consistently higher, overestimating the concentrations of the methylated proteins. The enhanced color formation in the BCA assay may be due to the lower acid dissociation constants of the lysyl ε-dimethylamines compared with the unmodified ε-amine, favoring Cu(II) binding in biuret-like complexes. The implications for the analysis of biologically methylated samples are discussed. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Evaluation of Colorimetric Assays for Analyzing Reductively Methylated Proteins: Biases and Mechanistic Insights

    PubMed Central

    Brady, Pamlea N.; Macnaughtan, Megan A.

    2015-01-01

    Colorimetric protein assays, such as the Coomassie blue G-250 dye-binding (Bradford) and bicinchoninic acid (BCA) assays, are commonly used to quantify protein concentration. The accuracy of these assays depends on the amino acid composition. Because of the extensive use of reductive methylation in the study of proteins and the importance of biological methylation, it is necessary to evaluate the impact of lysyl methylation on the Bradford and BCA assays. Unmodified and reductively methylated proteins were analyzed using the absorbance at 280 nm to standardize the concentrations. Using model compounds, we demonstrate that the dimethylation of lysyl ε-amines does not affect the proteins’ molar extinction coefficients at 280 nm. For the Bradford assay, the response (absorbance per unit concentration) of the unmodified and reductively methylated proteins were similar with a slight decrease in the response upon methylation. For the BCA assay, the responses of the reductively methylated proteins were consistently higher, overestimating the concentrations of the methylated proteins. The enhanced color-formation in the BCA assay may be due to the lower acid dissociation constants of the lysyl ε-dimethylamines, compared to the unmodified ε-amine, favoring Cu(II) binding in biuret-like complexes. The implications for the analysis of biologically methylated samples are discussed. PMID:26342307

  14. An assay to image neuronal microtubule dynamics in mice.

    PubMed

    Kleele, Tatjana; Marinković, Petar; Williams, Philip R; Stern, Sina; Weigand, Emily E; Engerer, Peter; Naumann, Ronald; Hartmann, Jana; Karl, Rosa M; Bradke, Frank; Bishop, Derron; Herms, Jochen; Konnerth, Arthur; Kerschensteiner, Martin; Godinho, Leanne; Misgeld, Thomas

    2014-09-12

    Microtubule dynamics in neurons play critical roles in physiology, injury and disease and determine microtubule orientation, the cell biological correlate of neurite polarization. Several microtubule binding proteins, including end-binding protein 3 (EB3), specifically bind to the growing plus tip of microtubules. In the past, fluorescently tagged end-binding proteins have revealed microtubule dynamics in vitro and in non-mammalian model organisms. Here, we devise an imaging assay based on transgenic mice expressing yellow fluorescent protein-tagged EB3 to study microtubules in intact mammalian neurites. Our approach allows measurement of microtubule dynamics in vivo and ex vivo in peripheral nervous system and central nervous system neurites under physiological conditions and after exposure to microtubule-modifying drugs. We find an increase in dynamic microtubules after injury and in neurodegenerative disease states, before axons show morphological indications of degeneration or regrowth. Thus increased microtubule dynamics might serve as a general indicator of neurite remodelling in health and disease.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kovtun, Oleg; Ross, Emily J.; Tomlinson, Ian D.

    Here we present the development and validation of a flow cytometry-based dopamine transporter (DAT) binding assay that uses antagonist-conjugated quantum dots (QDs). Our anticipation is that our QD-based assay is of immediate value to the high throughput screening of novel DAT modulators.

  16. Assay for Arf GTP-binding Proteins | NCI Technology Transfer Center | TTC

    Cancer.gov

    The National Cancer Institute's Laboratory of Cellular and Molecular Biology is seeking statements of capability or interest from parties interested in collaborative research to further develop, evaluate, or commercialize an antibody-based proteomics assay.

  17. Spectroscopy on the wing: naturally inspired SERS substrates for biochemical analysis.

    PubMed

    Garrett, Natalie L; Vukusic, Peter; Ogrin, Feodor; Sirotkin, Evgeny; Winlove, C Peter; Moger, Julian

    2009-03-01

    We show that naturally occurring chitinous nanostructures found on the wings of the Graphium butterfly can be used as substrates for surface-enhanced Raman scattering when coated with a thin film of gold or silver. The substrates were found to exhibit excellent biocompatibility and sensitivity, making them ideal for protein assaying. An assay using avidin/biotin binding showed that the substrates could be used to quantify protein binding directly from changes in the surface-enhanced Raman scattering (SERS) spectra and were sensitive over a concentration range comparable with a typical enzyme-linked immunosorbent assays (ELISA) assay. A biomimetic version of the wing nanostructures produced using a highly reproducible, large-scale fabrication process, yielded comparable enhancement factors and biocompatibility. The excellent biocompatibility of the wings and biomimetic substrates is unparalleled by other lithographically produced substrates, and this could pave the way for widespread application of ultrasensitive SERS-based bioassays.

  18. High-throughput process development: determination of dynamic binding capacity using microtiter filter plates filled with chromatography resin.

    PubMed

    Bergander, Tryggve; Nilsson-Välimaa, Kristina; Oberg, Katarina; Lacki, Karol M

    2008-01-01

    Steadily increasing demand for more efficient and more affordable biomolecule-based therapies put a significant burden on biopharma companies to reduce the cost of R&D activities associated with introduction of a new drug to the market. Reducing the time required to develop a purification process would be one option to address the high cost issue. The reduction in time can be accomplished if more efficient methods/tools are available for process development work, including high-throughput techniques. This paper addresses the transitions from traditional column-based process development to a modern high-throughput approach utilizing microtiter filter plates filled with a well-defined volume of chromatography resin. The approach is based on implementing the well-known batch uptake principle into microtiter plate geometry. Two variants of the proposed approach, allowing for either qualitative or quantitative estimation of dynamic binding capacity as a function of residence time, are described. Examples of quantitative estimation of dynamic binding capacities of human polyclonal IgG on MabSelect SuRe and of qualitative estimation of dynamic binding capacity of amyloglucosidase on a prototype of Capto DEAE weak ion exchanger are given. The proposed high-throughput method for determination of dynamic binding capacity significantly reduces time and sample consumption as compared to a traditional method utilizing packed chromatography columns without sacrificing the accuracy of data obtained.

  19. Blood collected on filter paper for wildlife serology: detecting antibodies to Neospora caninum, West Nile virus, and five bovine viruses in reindeer.

    PubMed

    Curry, Patricia S; Ribble, Carl; Sears, William C; Hutchins, Wendy; Orsel, Karin; Godson, Dale; Lindsay, Robbin; Dibernardo, Antonia; Kutz, Susan J

    2014-04-01

    We compared Nobuto filter paper (FP) whole-blood samples to serum for detecting antibodies to seven pathogens in reindeer (Rangifer tarandus tarandus). Serum and FP samples were collected from captive reindeer in 2008-2009. Sample pairs (serum and FP eluates) were assayed in duplicate at diagnostic laboratories with the use of competitive enzyme-linked immunosorbent assays (cELISAs) for Neospora caninum and West Nile virus (WNV); indirect ELISA (iELISAs) for bovine herpesvirus type 1 (BHV-1), parainfluenza virus type 3 (PI-3), and bovine respiratory syncytial virus (BRSV); and virus neutralization (VN) for bovine viral diarrhea virus (BVDV) types I and II. Assay thresholds were evidence-based values employed by each laboratory. Comparable performance to serum was defined as FP sensitivity and specificity ≥ 80%. Filter-paper specificity estimates ranged from 92% in the cELISAs for N. caninum and WNV to 98% in the iELISAs for PI-3 and BRSV. Sensitivity was >85% for five tests (most ≥ 95%) but was insufficient (71-82%) for the PI-3 and BRSV iELISAs. Lowering the threshold for FP samples in these two ELISAs raised sensitivity to ≥ 87% and reduced specificity slightly (≥ 90% in three of the four test runs). Sample size limited the precision of some performance estimates. Based on the criteria of sensitivity and specificity ≥ 80%, and using adjusted FP thresholds for PI-3 and BRSV, FP sensitivity and specificity were comparable to serum in all seven assays. A potential limitation of FP is reduced sensitivity in tests that require undiluted serum (i.e., N. caninum cELISA and BVDV VNs). Possible toxicity to the assay cell layer in VN requires investigation. Results suggested that cELISA is superior to iELISA for detecting antibodies in FP samples from reindeer and other Rangifer tarandus subspecies. Our findings expand the potential utility of FP sampling from wildlife.

  20. Respiratory Syncytial Virus (RSV): Neutralizing Antibody, a Correlate of Immune Protection.

    PubMed

    Piedra, Pedro A; Hause, Anne M; Aideyan, Letisha

    2016-01-01

    Assays that measure RSV-specific neutralizing antibody activity are very useful for evaluating vaccine candidates, performing seroprevalence studies, and detecting infection. Neutralizing antibody activity is normally measured by a plaque reduction neutralization assay or by a microneutralization assay with or without complement. These assays measure the functional capacity of serum (or other fluids) to neutralize virus infectivity in cells as compared to ELISA assays that only measure the binding capacity against an antigen. This chapter discusses important elements in standardization of the RSV-specific microneutralization assay for use in the laboratory.

  1. Quantitative and discriminative analysis of nucleic acid samples using luminometric nonspecific nanoparticle methods

    NASA Astrophysics Data System (ADS)

    Pihlasalo, S.; Mariani, L.; Härmä, H.

    2016-03-01

    Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays.Homogeneous simple assays utilizing luminescence quenching and time-resolved luminescence resonance energy transfer (TR-LRET) were developed for the quantification of nucleic acids without sequence information. Nucleic acids prevent the adsorption of a protein to europium nanoparticles which is detected as a luminescence quenching of europium nanoparticles with a soluble quencher or as a decrease of TR-LRET from europium nanoparticles to the acceptor dye. Contrary to the existing methods based on fluorescent dye binding to nucleic acids, equal sensitivities for both single- (ssDNA) and double-stranded DNA (dsDNA) were measured and a detection limit of 60 pg was calculated for the quenching assay. The average coefficient of variation was 5% for the quenching assay and 8% for the TR-LRET assay. The TR-LRET assay was also combined with a nucleic acid dye selective to dsDNA in a single tube assay to measure the total concentration of DNA and the ratio of ssDNA and dsDNA in the mixture. To our knowledge, such a multiplexed assay is not accomplished with commercially available assays. Electronic supplementary information (ESI) available: The labeling of amino modified polystyrene nanoparticles with Eu3+ chelate and the experimental details and results for the optimization of nucleic acid binding protein and for the ratiometric measurement of DNA and RNA with quenching assay. See DOI: 10.1039/c5nr09252c

  2. Soy lecithin replaces egg yolk for cryopreservation of human sperm without adversely affecting postthaw motility, morphology, sperm DNA integrity, or sperm binding to hyaluronate.

    PubMed

    Reed, Michael L; Ezeh, Peace C; Hamic, Amanda; Thompson, Douglas J; Caperton, Charles L

    2009-11-01

    Semen specimens (one ejaculate from each of 20 consenting study participants) were subjected to routine semen analysis, an in vitro sperm binding assay (HBA), and a sperm chromatin dispersion assay (HaloSperm), both before and after cryopreservation using cryoprotectant media supplemented with either egg yolk or soy lecithin. Comparing the equivalency of the two phospholipid cryopreservation supplements with regard to postthaw functional parameters demonstrated that there were no statistically significant differences between the two supplements for [1] recovery of motile sperm, [2] maintenance of sperm cell morphology, [3] maintenance of the ability of sperm to bind to hyaluronate in vitro, or [4] maintenance of sperm DNA integrity.

  3. Protein-ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI).

    PubMed

    Grøftehauge, Morten K; Hajizadeh, Nelly R; Swann, Marcus J; Pohl, Ehmke

    2015-01-01

    Over the last decades, a wide range of biophysical techniques investigating protein-ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.

  4. Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

    PubMed Central

    Grøftehauge, Morten K.; Hajizadeh, Nelly R.; Swann, Marcus J.; Pohl, Ehmke

    2015-01-01

    Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography. PMID:25615858

  5. Is there a link between selectivity and binding thermodynamics profiles?

    PubMed

    Tarcsay, Ákos; Keserű, György M

    2015-01-01

    Thermodynamics of ligand binding is influenced by the interplay between enthalpy and entropy contributions of the binding event. The impact of these binding free energy components, however, is not limited to the primary target only. Here, we investigate the relationship between binding thermodynamics and selectivity profiles by combining publicly available data from broad off-target assay profiling and the corresponding thermodynamics measurements. Our analysis indicates that compounds binding their primary targets with higher entropy contributions tend to hit more off-targets compared with those ligands that demonstrated enthalpy-driven binding. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Evaluation of Chlorine Treatment Levels for Inactivation of Human Norovirus and MS2 Bacteriophage during Sewage Treatment.

    PubMed

    Kingsley, David H; Fay, Johnna P; Calci, Kevin; Pouillot, Régis; Woods, Jacquelina; Chen, Haiqiang; Niemira, Brendan A; Van Doren, Jane M

    2017-12-01

    This study examined the inactivation of human norovirus (HuNoV) GI.1 and GII.4 by chlorine under conditions mimicking sewage treatment. Using a porcine gastric mucin-magnetic bead (PGM-MB) assay, no statistically significant loss in HuNoV binding (inactivation) was observed for secondary effluent treatments of ≤25 ppm total chlorine; for both strains, 50 and 100 ppm treatments resulted in ≤0.8-log 10 unit and ≥3.9-log 10 unit reductions, respectively. Treatments of 10, 25, 50, and 100 ppm chlorine inactivated 0.31, 1.35, >5, and >5 log 10 units, respectively, of the norovirus indicator MS2 bacteriophage. Evaluation of treatment time indicated that the vast majority of MS2 and HuNoV inactivation occurred in the first 5 min for 0.2-μm-filtered, prechlorinated secondary effluent. Free chlorine measurements of secondary effluent seeded with MS2 and HuNoV demonstrated substantial oxidative burdens. With 25, 50, and 100 ppm treatments, free chlorine levels after 5 min of exposure ranged from 0.21 to 0.58 ppm, from 0.28 to 16.7 ppm, and from 11.6 to 53 ppm, respectively. At chlorine treatment levels of >50 ppm, statistically significant differences were observed between reductions for PGM-MB-bound HuNoV (potentially infectious) particles and those for unbound (noninfectious) HuNoV particles or total norovirus particles. While results suggested that MS2 and HuNoV (measured as PGM-MB binding) behave similarly, although not identically, both have limited susceptibility to chlorine treatments of ≤25 ppm total chlorine. Since sewage treatment is performed at ≤25 ppm total chlorine, targeting free chlorine levels of 0.5 to 1.0 ppm, these results suggest that traditional chlorine-based sewage treatment does not inactivate HuNoV efficiently. IMPORTANCE HuNoV is ubiquitous in sewage. A receptor binding assay was used to assess inactivation of HuNoV by chlorine-based sewage treatment, given that the virus cannot be routinely propagated in vitro Results reported here indicate that chlorine treatment of sewage is not effective for inactivating HuNoV unless chlorine levels are above those routinely used for sewage treatment. Copyright © 2017 American Society for Microbiology.

  7. Evaluation of Chlorine Treatment Levels for Inactivation of Human Norovirus and MS2 Bacteriophage during Sewage Treatment

    PubMed Central

    Fay, Johnna P.; Calci, Kevin; Pouillot, Régis; Woods, Jacquelina; Chen, Haiqiang; Niemira, Brendan A.; Van Doren, Jane M.

    2017-01-01

    ABSTRACT This study examined the inactivation of human norovirus (HuNoV) GI.1 and GII.4 by chlorine under conditions mimicking sewage treatment. Using a porcine gastric mucin-magnetic bead (PGM-MB) assay, no statistically significant loss in HuNoV binding (inactivation) was observed for secondary effluent treatments of ≤25 ppm total chlorine; for both strains, 50 and 100 ppm treatments resulted in ≤0.8-log10 unit and ≥3.9-log10 unit reductions, respectively. Treatments of 10, 25, 50, and 100 ppm chlorine inactivated 0.31, 1.35, >5, and >5 log10 units, respectively, of the norovirus indicator MS2 bacteriophage. Evaluation of treatment time indicated that the vast majority of MS2 and HuNoV inactivation occurred in the first 5 min for 0.2-μm-filtered, prechlorinated secondary effluent. Free chlorine measurements of secondary effluent seeded with MS2 and HuNoV demonstrated substantial oxidative burdens. With 25, 50, and 100 ppm treatments, free chlorine levels after 5 min of exposure ranged from 0.21 to 0.58 ppm, from 0.28 to 16.7 ppm, and from 11.6 to 53 ppm, respectively. At chlorine treatment levels of >50 ppm, statistically significant differences were observed between reductions for PGM-MB-bound HuNoV (potentially infectious) particles and those for unbound (noninfectious) HuNoV particles or total norovirus particles. While results suggested that MS2 and HuNoV (measured as PGM-MB binding) behave similarly, although not identically, both have limited susceptibility to chlorine treatments of ≤25 ppm total chlorine. Since sewage treatment is performed at ≤25 ppm total chlorine, targeting free chlorine levels of 0.5 to 1.0 ppm, these results suggest that traditional chlorine-based sewage treatment does not inactivate HuNoV efficiently. IMPORTANCE HuNoV is ubiquitous in sewage. A receptor binding assay was used to assess inactivation of HuNoV by chlorine-based sewage treatment, given that the virus cannot be routinely propagated in vitro. Results reported here indicate that chlorine treatment of sewage is not effective for inactivating HuNoV unless chlorine levels are above those routinely used for sewage treatment. PMID:28939600

  8. Thermodynamic Exploration of Eosin-Lysozyme Binding: A Physical Chemistry and Biochemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Huisman, Andrew J.; Hartsell, Lydia R.; Krueger, Brent P.; Pikaart, Michael J.

    2010-01-01

    We developed a modular pair of experiments for use in the undergraduate physical chemistry and biochemistry laboratories. Both experiments examine the thermodynamics of the binding of a small molecule, eosin Y, to the protein lysozyme. The assay for binding is the quenching of lysozyme fluorescence by eosin through resonant energy transfer. In…

  9. Tumor necrosis factor interaction with gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Tsai, De-Hao; Elzey, Sherrie; Delrio, Frank W.; Keene, Athena M.; Tyner, Katherine M.; Clogston, Jeffrey D.; Maccuspie, Robert I.; Guha, Suvajyoti; Zachariah, Michael R.; Hackley, Vincent A.

    2012-05-01

    We report on a systematic investigation of molecular conjugation of tumor necrosis factor-α (TNF) protein onto gold nanoparticles (AuNPs) and the subsequent binding behavior to its antibody (anti-TNF). We employ a combination of physical and spectroscopic characterization methods, including electrospray-differential mobility analysis, dynamic light scattering, polyacrylamide gel electrophoresis, attenuated total reflectance-Fourier transform infrared spectroscopy, fluorescence assay, and enzyme-linked immunosorbent assay. The native TNF used in this study exists in the active homotrimer configuration prior to conjugation. After binding to AuNPs, the maximum surface density of TNF is (0.09 +/- 0.02) nm-2 with a binding constant of 3 × 106 (mol L-1)-1. Dodecyl sulfate ions induce desorption of monomeric TNF from the AuNP surface, indicating a relatively weak intermolecular binding within the AuNP-bound TNF trimers. Anti-TNF binds to both TNF-conjugated and citrate-stabilized AuNPs, showing that non-specific binding is significant. Based on the number of anti-TNF molecules adsorbed, a substantially higher binding affinity was observed for the TNF-conjugated surface. The inclusion of thiolated polyethylene glycol (SH-PEG) on the AuNPs inhibits the binding of anti-TNF, and the amount of inhibition is related to the number ratio of surface bound SH-PEG to TNF and the way in which the ligands are introduced. This study highlights the challenges in quantitatively characterizing complex hybrid nanoscale conjugates, and provides insight on TNF-AuNP formation and activity.We report on a systematic investigation of molecular conjugation of tumor necrosis factor-α (TNF) protein onto gold nanoparticles (AuNPs) and the subsequent binding behavior to its antibody (anti-TNF). We employ a combination of physical and spectroscopic characterization methods, including electrospray-differential mobility analysis, dynamic light scattering, polyacrylamide gel electrophoresis, attenuated total reflectance-Fourier transform infrared spectroscopy, fluorescence assay, and enzyme-linked immunosorbent assay. The native TNF used in this study exists in the active homotrimer configuration prior to conjugation. After binding to AuNPs, the maximum surface density of TNF is (0.09 +/- 0.02) nm-2 with a binding constant of 3 × 106 (mol L-1)-1. Dodecyl sulfate ions induce desorption of monomeric TNF from the AuNP surface, indicating a relatively weak intermolecular binding within the AuNP-bound TNF trimers. Anti-TNF binds to both TNF-conjugated and citrate-stabilized AuNPs, showing that non-specific binding is significant. Based on the number of anti-TNF molecules adsorbed, a substantially higher binding affinity was observed for the TNF-conjugated surface. The inclusion of thiolated polyethylene glycol (SH-PEG) on the AuNPs inhibits the binding of anti-TNF, and the amount of inhibition is related to the number ratio of surface bound SH-PEG to TNF and the way in which the ligands are introduced. This study highlights the challenges in quantitatively characterizing complex hybrid nanoscale conjugates, and provides insight on TNF-AuNP formation and activity. Electronic supplementary information (ESI) available: Experimental procedures, instrumentation, materials and calculations. See DOI: 10.1039/c2nr30415e

  10. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  11. Combining transcription factor binding affinities with open-chromatin data for accurate gene expression prediction

    PubMed Central

    Schmidt, Florian; Gasparoni, Nina; Gasparoni, Gilles; Gianmoena, Kathrin; Cadenas, Cristina; Polansky, Julia K.; Ebert, Peter; Nordström, Karl; Barann, Matthias; Sinha, Anupam; Fröhler, Sebastian; Xiong, Jieyi; Dehghani Amirabad, Azim; Behjati Ardakani, Fatemeh; Hutter, Barbara; Zipprich, Gideon; Felder, Bärbel; Eils, Jürgen; Brors, Benedikt; Chen, Wei; Hengstler, Jan G.; Hamann, Alf; Lengauer, Thomas; Rosenstiel, Philip; Walter, Jörn; Schulz, Marcel H.

    2017-01-01

    The binding and contribution of transcription factors (TF) to cell specific gene expression is often deduced from open-chromatin measurements to avoid costly TF ChIP-seq assays. Thus, it is important to develop computational methods for accurate TF binding prediction in open-chromatin regions (OCRs). Here, we report a novel segmentation-based method, TEPIC, to predict TF binding by combining sets of OCRs with position weight matrices. TEPIC can be applied to various open-chromatin data, e.g. DNaseI-seq and NOMe-seq. Additionally, Histone-Marks (HMs) can be used to identify candidate TF binding sites. TEPIC computes TF affinities and uses open-chromatin/HM signal intensity as quantitative measures of TF binding strength. Using machine learning, we find low affinity binding sites to improve our ability to explain gene expression variability compared to the standard presence/absence classification of binding sites. Further, we show that both footprints and peaks capture essential TF binding events and lead to a good prediction performance. In our application, gene-based scores computed by TEPIC with one open-chromatin assay nearly reach the quality of several TF ChIP-seq data sets. Finally, these scores correctly predict known transcriptional regulators as illustrated by the application to novel DNaseI-seq and NOMe-seq data for primary human hepatocytes and CD4+ T-cells, respectively. PMID:27899623

  12. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  13. Evaluation of flow cytometric HIT assays in relation to an IgG-Specific immunoassay and clinical outcome.

    PubMed

    Kerényi, Adrienne; Beke Debreceni, Ildikó; Oláh, Zsolt; Ilonczai, Péter; Bereczky, Zsuzsanna; Nagy, Béla; Muszbek, László; Kappelmayer, János

    2017-09-01

    Heparin-induced thrombocytopenia (HIT) is a severe side effect of heparin treatment caused by platelet activating IgG antibodies generated against the platelet factor 4 (PF4)-heparin complex. Thrombocytopenia and thrombosis are the leading clinical symptoms of HIT. The clinical pretest probability of HIT was evaluated by the 4T score system. Laboratory testing of HIT was performed by immunological detection of antibodies against PF4-heparin complex (EIA) and two functional assays. Heparin-dependent activation of donor platelets by patient plasma was detected by flow cytometry. Increased binding of Annexin-V to platelets and elevated number of platelet-derived microparticles (PMP) were the indicators of platelet activation. EIA for IgG isotype HIT antibodies was performed in 405 suspected HIT patients. Based on negative EIA results, HIT was excluded in 365 (90%) of cases. In 40 patients with positive EIA test result functional tests were performed. Platelet activating antibodies were detected in 17 cases by Annexin V binding. PMP count analysis provided nearly identical results. The probability of a positive flow cytometric assay result was higher in patients with elevated antibody titer. 71% of patients with positive EIA and functional assay had thrombosis. EIA is an important first line laboratory test in the diagnosis of HIT; however, HIT must be confirmed by a functional test. Annexin V binding and PMP assays using flow cytometry are functional HIT tests convenient in a clinical diagnostic laboratory. The positive results of functional assays may predict the onset of thrombosis. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

  14. Key learnings from performance of the U.S. EPA Endocrine Disruptor Screening Program (EDSP) Tier 1 in vitro assays.

    PubMed

    LeBaron, Matthew J; Coady, Katie K; O'Connor, John C; Nabb, Diane L; Markell, Lauren K; Snajdr, Suzanne; Sue Marty, M

    2014-02-01

    Tier 1 of the U.S. EPA Endocrine Disruptor Screening Program comprises 11 studies: five in vitro assays, four in vivo mammalian assays, and two in vivo nonmammalian assays. The battery is designed to detect compounds with the potential to interact with the estrogen, androgen, or thyroid signaling pathways. This article examines the procedures, results, and data interpretation for the five Tier 1 in vitro assays: estrogen receptor (ER) and androgen receptor binding assays, an ER transactivation assay, an aromatase assay, and a steroidogenesis assay. Data are presented from two laboratories that have evaluated approximately 11 compounds in the Tier 1 in vitro assays. Generally, the ER and androgen receptor binding assays and the aromatase assay showed good specificity and reproducibility. As described in the guideline for the ER transactivation assay, a result is considered positive when the test compound induces a reporter gene signal that reaches 10% of the response seen with 1 nM 17β-estradiol (positive control). In the experience of these laboratories, this cutoff criterion may result in false-positive responses. For the steroidogenesis assay, there is variability in the basal and stimulated production of testosterone and estradiol by the H295R cells. This variability in responsiveness, coupled with potential cell stress at high concentrations of test compound, may make it difficult to discern whether hormone alterations are specific steroidogenesis alterations (i.e., endocrine active). Lastly, both laboratories had difficulty meeting some recommended performance criteria for each Tier 1 in vitro assay. Data with only minor deviations were deemed valid. © 2014 Wiley Periodicals, Inc.

  15. Selective labelling of diazepam-insensitive GABAA receptors in vivo using [3H]Ro 15-4513.

    PubMed

    Pym, Luanda J; Cook, Susan M; Rosahl, Thomas; McKernan, Ruth M; Atack, John R

    2005-11-01

    Classical benzodiazepines (BZs), such as diazepam, bind to GABAA receptors containing alpha1, alpha2, alpha3 or alpha5 subunits that are therefore described as diazepam-sensitive (DS) receptors. However, the corresponding binding site of GABAA receptors containing either an alpha4 or alpha6 subunit do not bind the classical BZs and are therefore diazepam-insensitive (DIS) receptors; a difference attributable to a single amino acid (histidine in alpha1, alpha2, alpha3 and alpha5 subunits and arginine in alpha4 and alpha6). Unlike classical BZs, the imidazobenzodiazepines Ro 15-4513 and bretazenil bind to both DS and DIS populations of GABAA receptors. In the present study, an in vivo assay was developed using lorazepam to fully occupy DS receptors such that [3H]Ro 15-4513 was then only able to bind to DIS receptors. When dosed i.v., [3H]Ro 15-4513 rapidly entered and was cleared from the brain, with approximately 70% of brain radioactivity being membrane-bound. Essentially all membrane binding to DS+DIS receptors could be displaced by unlabelled Ro 15-4513 or bretazenil, with respective ID50 values of 0.35 and 1.2 mg kg(-1). A dose of 30 mg kg(-1) lorazepam was used to block all DS receptors in a [3H]Ro 15-1788 in vivo binding assay. When predosed in a [3H]Ro 15-4513 binding assay, lorazepam blocked [3H]Ro 15-4513 binding to DS receptors, with the remaining binding to DIS receptors accounting for 5 and 23% of the total (DS plus DIS) receptors in the forebrain and cerebellum, respectively. The in vivo binding of [3H]Ro 15-4513 to DIS receptors in the presence of lorazepam was confirmed using alpha1H101R knock-in mice, in which alpha1-containing GABAA receptors are rendered diazepam insensitive by mutation of the histidine that confers diazepam sensitivity to arginine. In these mice, and in the presence of lorazepam, there was an increase of in vivo [3H]Ro 15-4513 binding in the forebrain and cerebellum from 4 and 15% to 36 and 59% of the total (i.e. DS plus DIS) [3H]Ro 15-4513 binding observed in the absence of lorazepam.

  16. Chemically grafted polymeric filters for chemical sensors: Hyperbranched poly(acrylic acid) films incorporating {Beta}-cyclodextrin receptors and amine-functionalized filter layers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dermody, D.L.; Peez, R.F.; Bergbreiter, D.E.

    1999-02-02

    The authors report a new molecular-filter approach for enhancing the selectivity of chemical sensors. Specifically, they describe electrochemical sensors prepared from Au electrodes coated with {beta}-cyclodextrin-functionalized, hyperbranched poly(acrylic acid)(PAA) films capped with a chemically grafted, ultrathin polyamine layer. The hyperbranched PAA film is a highly functionalized framework for covalently binding the {beta}-cyclodextrin molecular receptors. The thin, grafted polyamine overlayer acts as a pH-sensitive molecular filter that selectively passes suitably charged analytes. Poly(amidoamine) dendrimers or poly-D-lysine is used as 10--15-nm-thick filter layers. The results show that at low pH, when the polyamines are fully protonated, positively charged redox probe molecules, suchmore » as benzyl viologen (BV), do not permeate the filter layer. However, at high pH, when the filter layer is uncharged, BV penetrates the filter layer and is reduced at the electrode. The opposite pH dependence is observed for negatively charged redox molecules such as anthraquinone-2-sulfonate (AQS). Both BV and AQS specifically interact with the {beta}-cyclodextrin receptors underlying the polyamine filter layers.« less

  17. Effect of Environmental Parameters on the Biocidal Performance of Iodine-Treated Filters

    DTIC Science & Technology

    2008-01-01

    the new device. D. METHODOLOGY: The iodine-treated filter media were challenged at a face velocity of 14.2 cm/s with Bacillus subtilis spores or...Microorganisms Bacillus subtilis spores supplied by the Department of Microbiology and Cell Sciences at the University of Florida and MS2 bacteriophage...resistance of Bacillus subtilis spores with increased core water content and with or without major DNA-Binding proteins. Appl. Environ. Microbiol

  18. Proteoform-specific protein binding of small molecules in complex matrices

    USDA-ARS?s Scientific Manuscript database

    Characterizing the specific binding between protein targets and small molecules is critically important for drug discovery. Conventional assays require isolation and purification of small molecules from complex matrices through multistep chromatographic fractionation, which may alter their original ...

  19. A Two-Component Assay for Hypoxia Incorporating Long-Term Nitroreduction and Short-Term DNA-Damage Allows Differentiation of the Three Hypoxia Sub-types.

    PubMed

    Koch, Cameron J

    2018-05-10

    Hypoxia in tumors has many well-characterized effects that are known to prevent optimal cancer treatment. Despite the existence of a large number of assays that have supported hypoxia as an important diagnostic, there is no routine clinical assay in use, and anti-hypoxia therapies have often not included parallel hypoxia measurements. Even with a functioning hypoxia assay, it is difficult to match the oxygen dependence of treatment resistance to that of the assay, and this mismatch can vary substantially from assay to assay and even from tumor to tumor [e.g., caused by endogenous variations in non-protein sulfhydryls (NPSH)]. An underlying concern is the current inability to measure the three types of hypoxia; in particular, cycling hypoxia can affect all aspects of detection and treatment strategy. Here we present data that help validate a new two-component hypoxia assay recently suggested by our laboratory. This assay incorporates the long-term bioreduction of the 2-nitroimidazole, EF5, and the short-term production of γ-H2AX (e.g., time of ionizing radiation exposure). The former can be calibrated to provide the average tissue pO 2 over the EF5 exposure time while the latter provides the combined sum of microenvironmental radiation response modifiers (e.g., oxygen and NPSH) at the time of irradiation. Importantly, formation of γ-H2AX is not dependent on blood flow, while EF5 binding is only minimally so, due to the rapid and extensive diffusion characteristics of lipophilic compounds. While both individual assays have their limitations, which are addressed in this article, their combination can dissect the type of hypoxia present. In particular, a mismatch between the two assays can directly detect cycling hypoxia in a therapeutically relevant manner. Preliminary use of this two-component assay in small PC3 tumors showed essentially no binding of EF5. Similarly, there were no tumor regions (for uniform irradiation with 12 Gy) with the low levels of γ-H2AX expected for a condition of cycling hypoxia. Thus, both assays were consistent with an essentially aerobic, radiation-responsive tumor. In a larger PC3 tumor, all regions of high EF5 binding had low levels of γ-H2AX.

  20. Small molecule and peptide-mediated inhibition of Epstein-Barr virus nuclear antigen 1 dimerization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Sun Young; Song, Kyung-A; Samsung Biomedical Research Institute

    Highlights: Black-Right-Pointing-Pointer Evidence that targeting EBNA1 dimer, an EBV onco-antigen, can be achievable. Black-Right-Pointing-Pointer A small molecule and a peptide as EBNA1 dimerization inhibitors identified. Black-Right-Pointing-Pointer Both inhibitors associated with EBNA1 and blocked EBNA1 DNA binding activity. Black-Right-Pointing-Pointer Also, prevented its dimerization, and repressed viral gene transcription. -- Abstract: Latent Epstein-Barr virus (EBV) infection is associated with human B cell lymphomas and certain carcinomas. EBV episome persistence, replication, and gene expression are dependent on EBV-encoded nuclear antigen 1 (EBNA1)'s DNA binding domain (DBD)/dimerization domain (DD)-mediated sequence-specific DNA binding activity. Homodimerization of EBNA1 is essential for EBNA1 DNA binding and transactivation.more » In this study, we characterized a novel small molecule EBNA1 inhibitor EiK1, screened from the previous high throughput screening (HTS). The EiK1 compound specifically inhibited the EBNA1-dependent, OriP-enhanced transcription, but not EBNA1-independent transcription. A Surface Plasmon Resonance Biacore assay revealed that EiK1 associates with EBNA1 amino acid 459-607 DBD/DD. Consistent with the SPR data, in vitro gel shift assays showed that EiK1 suppressed the activity of EBNA1 binding to the cognate familial repeats (FR) sequence, but not control RBP-J{kappa} binding to the J{kappa} site. Subsequently, a cross-linker-mediated in vitro multimerization assay and EBNA1 homodimerization-dependent yeast two-hybrid assay showed that EiK1 significantly inhibited EBNA1 dimerization. In an attempt to identify more highly specific peptide inhibitors, small peptides encompassing the EBNA1 DBD/DD were screened for inhibition of EBNA1 DBD-mediated DNA binding function. The small peptide P85, covering EBNA1 a.a. 560-574, significantly blocked EBNA1 DNA binding activity in vitro, prevented dimerization in vitro and in vivo, associated with EBNA1 in vitro, and repressed EBNA1-dependent transcription in vivo. Collectively, this study describes two novel inhibitors of EBNA1 dimerization. This study demonstrates that EBNA1 homodimerization can be effectively targeted by a small molecule or peptide.« less

  1. Further evaluation of the NWF filter for the purification of Plasmodium vivax-infected erythrocytes.

    PubMed

    Li, Jiangyan; Tao, Zhiyong; Li, Qian; Brashear, Awtum; Wang, Ying; Xia, Hui; Fang, Qiang; Cui, Liwang

    2017-05-17

    Isolation of Plasmodium-infected red blood cells (iRBCs) from clinical blood samples is often required for experiments, such as ex vivo drug assays, in vitro invasion assays and genome sequencing. Current methods for removing white blood cells (WBCs) from malaria-infected blood are time-consuming or costly. A prototype non-woven fabric (NWF) filter was developed for the purification of iRBCs, which showed great efficiency for removing WBCs in a pilot study. Previous work was performed with prototype filters optimized for processing 5-10 mL of blood. With the commercialization of the filters, this study aims to evaluate the efficiency and suitability of the commercial NWF filter for the purification of Plasmodium vivax-infected RBCs in smaller volumes of blood and to compare its performance with that of Plasmodipur ® filters. Forty-three clinical P. vivax blood samples taken from symptomatic patients attending malaria clinics at the China-Myanmar border were processed using the NWF filters in a nearby field laboratory. The numbers of WBCs and iRBCs and morphology of P. vivax parasites in the blood samples before and after NWF filtration were compared. The viability of P. vivax parasites after filtration from 27 blood samples was examined by in vitro short-term culture. In addition, the effectiveness of the NWF filter for removing WBCs was compared with that of the Plasmodipur ® filter in six P. vivax blood samples. Filtration of 1-2 mL of P. vivax-infected blood with the NWF filter removed 99.68% WBCs. The densities of total iRBCs, ring and trophozoite stages before and after filtration were not significantly different (P > 0.05). However, the recovery rates of schizont- and gametocyte-infected RBCs, which were minor parasite stages in the clinical samples, were relatively low. After filtration, the P. vivax parasites did not show apparent morphological changes. Culture of 27 P. vivax-infected blood samples after filtration showed that parasites successfully matured into the schizont stage. The WBC removal rates and iRBC recovery rates were not significantly different between the NWF and Plasmodipur ® filters (P > 0.05). When tested with 1-2 mL of P. vivax-infected blood, the NWF filter could effectively remove WBCs and the recovery rates for ring- and trophozoite-iRBCs were high. P. vivax parasites after filtration could be successfully cultured in vitro to reach maturity. The performance of the NWF and Plasmodipur ® filters for removing WBCs and recovering iRBCs was comparable.

  2. Diagnosis of Enterocytozoon bieneusi by PCR in Stool Samples Eluted from Filter Paper Disks

    PubMed Central

    Carnevale, Silvana; Velásquez, Jorge N.; Labbé, Jorge H.; Chertcoff, Agustín; Cabrera, Marta G.; Rodríguez, Mónica I.

    2000-01-01

    We report a PCR-based assay for the detection of Enterocytozoon bieneusi. We extracted DNA from feces which had been applied to filter paper disks and evaluated four preserving solutions. Infected specimens were identified by electrophoresis of amplicons from concentrated formalin-fixed samples and unconcentrated fresh feces. Our findings demonstrate that this methodology is effective for sample collection, mailing, and diagnosis of this pathogen. PMID:10799469

  3. Persistence of human immunodeficiency virus type 1 subtype B DNA in dried-blood samples on FTA filter paper.

    PubMed

    Li, Chung-Chen; Beck, Ingrid A; Seidel, Kristy D; Frenkel, Lisa M

    2004-08-01

    The stability of human immunodeficiency virus type 1 (HIV-1) DNA in whole blood collected on filter paper (FTA Card) was evaluated. After >4 years of storage at room temperature in the dark our qualitative assay detected virus at a rate similar to that of our initial test (58 of 60, 97%; P = 0.16), suggesting long-term HIV-1 DNA stability.

  4. Persistence of Human Immunodeficiency Virus Type 1 Subtype B DNA in Dried-Blood Samples on FTA Filter Paper

    PubMed Central

    Li, Chung-Chen; Beck, Ingrid A.; Seidel, Kristy D.; Frenkel, Lisa M.

    2004-01-01

    The stability of human immunodeficiency virus type 1 (HIV-1) DNA in whole blood collected on filter paper (FTA Card) was evaluated. After >4 years of storage at room temperature in the dark our qualitative assay detected virus at a rate similar to that of our initial test (58 of 60, 97%; P = 0.16), suggesting long-term HIV-1 DNA stability. PMID:15297546

  5. Expression of human FcgammaRIIIa as a GPI-linked molecule on CHO cells to enable measurement of human IgG binding.

    PubMed

    Armour, Kathryn L; Smith, Cheryl S; Clark, Michael R

    2010-03-31

    The efficacy of a therapeutic IgG molecule may be as dependent on the optimisation of the constant region to suit its intended indication as on the selection of its variable regions. A crucial effector function to be maximised or minimised is antibody-dependent cell-mediated cytotoxicity by natural killer cells. Traditional assays of ADCC activity suffer from considerable inter-donor and intra-donor variability, which makes the measurement of antibody binding to human FcgammaRIIIa, the key receptor for ADCC, an attractive alternative method of assessment. Here, we describe the development of cell lines and assays for this purpose. The transmembrane receptor, FcgammaRIIIa, requires co-expression with signal transducing subunits to prevent its degradation, unlike the homologous receptor FcgammaRIIIb that is expressed as a GPI-anchored molecule. Therefore, to simplify the production of cell lines as reliable assay components, we expressed FcgammaRIIIa as a GPI-anchored molecule. Separate, stable CHO cell lines that express either the 158F or the higher-affinity 158V allotype of FcgammaRIIIa were isolated using fluorescence-activated cell sorting. The identities of the expressed receptors were confirmed using a panel of monoclonal antibodies that distinguish between subclasses and allotypes of FcgammaRIII and the cell lines were shown to have slightly higher levels of receptor than FcgammaRIII-positive peripheral blood mononuclear cells. Because the affinity of FcgammaRIIIa for IgG is intermediate amongst the receptors that bind IgG, we were able to use these cell lines to develop flow cytometric assays to measure the binding of both complexed and monomeric immunoglobulin. Thus, by choosing the appropriate method, weakly- or strongly-binding IgG can be efficiently compared. We have quantified the difference in the binding of wildtype IgG1 and IgG3 molecules to the two functional allotypes of the receptor and report that the FcgammaRIIIa-158V-antibody interaction is 3- to 4-fold stronger that the interaction with FcgammaRIIIa-158F. Overall, these robust assays should be valuable for batch-testing clinical material as well as providing tools for improving the design of therapeutic IgG. 2010 Elsevier B.V. All rights reserved.

  6. Assessing cellular efficacy of bromodomain inhibitors using fluorescence recovery after photobleaching

    PubMed Central

    2014-01-01

    Background Acetylation of lysine residues in histone tails plays an important role in the regulation of gene transcription. Bromdomains are the readers of acetylated histone marks, and, consequently, bromodomain-containing proteins have a variety of chromatin-related functions. Moreover, they are increasingly being recognised as important mediators of a wide range of diseases. The first potent and selective bromodomain inhibitors are beginning to be described, but the diverse or unknown functions of bromodomain-containing proteins present challenges to systematically demonstrating cellular efficacy and selectivity for these inhibitors. Here we assess the viability of fluorescence recovery after photobleaching (FRAP) assays as a target agnostic method for the direct visualisation of an on-target effect of bromodomain inhibitors in living cells. Results Mutation of a conserved asparagine crucial for binding to acetylated lysines in the bromodomains of BRD3, BRD4 and TRIM24 all resulted in reduction of FRAP recovery times, indicating loss of or significantly reduced binding to acetylated chromatin, as did the addition of known inhibitors. Significant differences between wild type and bromodomain mutants for ATAD2, BAZ2A, BRD1, BRD7, GCN5L2, SMARCA2 and ZMYND11 required the addition of the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) to amplify the binding contribution of the bromodomain. Under these conditions, known inhibitors decreased FRAP recovery times back to mutant control levels. Mutation of the bromodomain did not alter FRAP recovery times for full-length CREBBP, even in the presence of SAHA, indicating that other domains are primarily responsible for anchoring CREBBP to chromatin. However, FRAP assays with multimerised CREBBP bromodomains resulted in a good assay to assess the efficacy of bromodomain inhibitors to this target. The bromodomain and extraterminal protein inhibitor PFI-1 was inactive against other bromodomain targets, demonstrating the specificity of the method. Conclusions Viable FRAP assays were established for 11 representative bromodomain-containing proteins that broadly cover the bromodomain phylogenetic tree. Addition of SAHA can overcome weak binding to chromatin, and the use of tandem bromodomain constructs can eliminate masking effects of other chromatin binding domains. Together, these results demonstrate that FRAP assays offer a potentially pan-bromodomain method for generating cell-based assays, allowing the testing of compounds with respect to cell permeability, on-target efficacy and selectivity. PMID:25097667

  7. Structural and functional characterization of a calcium-activated cation channel from Tsukamurella paurometabola

    NASA Astrophysics Data System (ADS)

    Dhakshnamoorthy, Balasundaresan; Rohaim, Ahmed; Rui, Huan; Blachowicz, Lydia; Roux, Benoît

    2016-09-01

    The selectivity filter is an essential functional element of K+ channels that is highly conserved both in terms of its primary sequence and its three-dimensional structure. Here, we investigate the properties of an ion channel from the Gram-positive bacterium Tsukamurella paurometabola with a selectivity filter formed by an uncommon proline-rich sequence. Electrophysiological recordings show that it is a non-selective cation channel and that its activity depends on Ca2+ concentration. In the crystal structure, the selectivity filter adopts a novel conformation with Ca2+ ions bound within the filter near the pore helix where they are coordinated by backbone oxygen atoms, a recurrent motif found in multiple proteins. The binding of Ca2+ ion in the selectivity filter controls the widening of the pore as shown in crystal structures and in molecular dynamics simulations. The structural, functional and computational data provide a characterization of this calcium-gated cationic channel.

  8. Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Xiao-Min, E-mail: rxm200318@gmail.com; Guo, Liang-Hong, E-mail: LHGuo@rcees.ac.cn; Gao, Yu, E-mail: francesscototti@gmail.com

    2013-05-01

    Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effectmore » on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2′-OH-BDE-28, 3′-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3′-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. - Highlights: ► Thyroid hormone (TH) activity of OH-PBDEs with different Br number was evaluated. ► Four different experimental approaches were employed to investigate the mechanism. ► Low-brominated OH-PBDEs were agonists, but high-brominated ones were antagonists. ► Low-brominated OH-PBDEs bind to TH receptor differently than high-brominated ones.« less

  9. Analysis of Video-Based Microscopic Particle Trajectories Using Kalman Filtering

    PubMed Central

    Wu, Pei-Hsun; Agarwal, Ashutosh; Hess, Henry; Khargonekar, Pramod P.; Tseng, Yiider

    2010-01-01

    Abstract The fidelity of the trajectories obtained from video-based particle tracking determines the success of a variety of biophysical techniques, including in situ single cell particle tracking and in vitro motility assays. However, the image acquisition process is complicated by system noise, which causes positioning error in the trajectories derived from image analysis. Here, we explore the possibility of reducing the positioning error by the application of a Kalman filter, a powerful algorithm to estimate the state of a linear dynamic system from noisy measurements. We show that the optimal Kalman filter parameters can be determined in an appropriate experimental setting, and that the Kalman filter can markedly reduce the positioning error while retaining the intrinsic fluctuations of the dynamic process. We believe the Kalman filter can potentially serve as a powerful tool to infer a trajectory of ultra-high fidelity from noisy images, revealing the details of dynamic cellular processes. PMID:20550894

  10. Monitoring of cyclosporine concentrations by using dry blood-spot samples.

    PubMed

    Mee, A V; Wong, P Y; Sun, C; Oei, L; Elliott, S; Naik, N; Joaquin, B; Uchimaru, D

    1991-01-01

    We modified the Incstar Cyclo Trac SP kit to enable its use with dry blood-spots on filter paper. The recovery ranged from 92 to 106%. Dilution studies have shown excellent linearity and parallelism throughout the range of the assay. Precision is demonstrated by within-assay CV's of 6.6 and 4.3% at 96 and 342 micrograms/L respectively and between-assay CV's of 9.1 and 7.0% at 138 and 506 micrograms/L respectively. A comparison study (n = 209) with whole blood assay gave a correlation coefficient of 0.97, a slope of 1.04, and an intercept of 13.2. Whole blood and dry blood-spot cyclosporine assays on heart, kidney, liver, and lung transplants were also compared.

  11. Total protein measurement in canine cerebrospinal fluid: agreement between a turbidimetric assay and 2 dye-binding methods and determination of reference intervals using an indirect a posteriori method.

    PubMed

    Riond, B; Steffen, F; Schmied, O; Hofmann-Lehmann, R; Lutz, H

    2014-03-01

    In veterinary clinical laboratories, qualitative tests for total protein measurement in canine cerebrospinal fluid (CSF) have been replaced by quantitative methods, which can be divided into dye-binding assays and turbidimetric methods. There is a lack of validation data and reference intervals (RIs) for these assays. The aim of the present study was to assess agreement between the turbidimetric benzethonium chloride method and 2 dye-binding methods (Pyrogallol Red-Molybdate method [PRM], Coomassie Brilliant Blue [CBB] technique) for measurement of total protein concentration in canine CSF. Furthermore, RIs were determined for all 3 methods using an indirect a posteriori method. For assay comparison, a total of 118 canine CSF specimens were analyzed. For RIs calculation, clinical records of 401 canine patients with normal CSF analysis were studied and classified according to their final diagnosis in pathologic and nonpathologic values. The turbidimetric assay showed excellent agreement with the PRM assay (mean bias 0.003 g/L [-0.26-0.27]). The CBB method generally showed higher total protein values than the turbidimetric assay and the PRM assay (mean bias -0.14 g/L for turbidimetric and PRM assay). From 90 of 401 canine patients, nonparametric reference intervals (2.5%, 97.5% quantile) were calculated (turbidimetric assay and PRM method: 0.08-0.35 g/L (90% CI: 0.07-0.08/0.33-0.39); CBB method: 0.17-0.55 g/L (90% CI: 0.16-0.18/0.52-0.61). Total protein concentration in canine CSF specimens remained stable for up to 6 months of storage at -80°C. Due to variations among methods, RIs for total protein concentration in canine CSF have to be calculated for each method. The a posteriori method of RIs calculation described here should encourage other veterinary laboratories to establish RIs that are laboratory-specific. ©2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

  12. Domain-specific phosphomimetic mutation allows dissection of different protein kinase C (PKC) isotype-triggered activities of the RNA binding protein HuR.

    PubMed

    Schulz, Sebastian; Doller, Anke; Pendini, Nicole R; Wilce, Jacqueline A; Pfeilschifter, Josef; Eberhardt, Wolfgang

    2013-12-01

    The ubiquitous mRNA binding protein human antigen R (HuR) participates in the post-transcriptional regulation of many AU-rich element (ARE)-bearing mRNAs. Previously, by using in vitro kinase assay, we have identified serines (Ser) 158, 221 and 318 as targets of protein kinase C (PKC)-triggered phosphorylation. In this study, we tested whether GFP- or GST-tagged HuR constructs bearing a phosphomimetic Ser (S)-to-Asp (D) substitution at the different PKC target sites, would affect different HuR functions including HuR nucleo-cytoplasmic redistribution and binding to different types of ARE-containing mRNAs. The phosphomimetic GFP-tagged HuR protein bearing a phosphomimetic substitution in the hinge region of HuR (HuR-S221D) showed an increased cytoplasmic abundance when compared to wild-type HuR. Conversely, data from in vitro kinase assay and electrophoretic mobility shift assay (EMSA), implicates that phosphorylation at Ser 221 is not relevant for mRNA binding of HuR. Quantification of in vitro binding affinities of GST-tagged wild-type HuR and corresponding HuR proteins bearing a phosphomimetic substitution in either RRM2 (HuR-S158D) or in RRM3 (HuR-S318D) by microscale thermophoresis (MST) indicates a specific binding of wild-type HuR to type I, II or type III-ARE-oligonucleotides in the high nanomolar range. Interestingly, phosphomimetic mutation at position 158 or 318 had a negative influence on HuR binding to type I- and type II-ARE-mRNAs whereas it significantly enhanced HuR affinity to a type III-ARE substrate. Our data suggest that differential phosphorylation of HuR by PKCs at different HuR domains coordinates subcellular HuR distribution and leads to a preferential binding to U-rich bearing target mRNA. © 2013.

  13. NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR

    PubMed Central

    Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

    2012-01-01

    The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the 2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury, et. al. 2011). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. PMID:23000369

  14. NMR resolved multiple anesthetic binding sites in the TM domains of the α4β2 nAChR.

    PubMed

    Bondarenko, Vasyl; Mowrey, David; Liu, Lu Tian; Xu, Yan; Tang, Pei

    2013-02-01

    The α4β2 nicotinic acetylcholine receptor (nAChR) has significant roles in nervous system function and disease. It is also a molecular target of general anesthetics. Anesthetics inhibit the α4β2 nAChR at clinically relevant concentrations, but their binding sites in α4β2 remain unclear. The recently determined NMR structures of the α4β2 nAChR transmembrane (TM) domains provide valuable frameworks for identifying the binding sites. In this study, we performed solution NMR experiments on the α4β2 TM domains in the absence and presence of halothane and ketamine. Both anesthetics were found in an intra-subunit cavity near the extracellular end of the β2 transmembrane helices, homologous to a common anesthetic binding site observed in X-ray structures of anesthetic-bound GLIC (Nury et al., [32]). Halothane, but not ketamine, was also found in cavities adjacent to the common anesthetic site at the interface of α4 and β2. In addition, both anesthetics bound to cavities near the ion selectivity filter at the intracellular end of the TM domains. Anesthetic binding induced profound changes in protein conformational exchanges. A number of residues, close to or remote from the binding sites, showed resonance signal splitting from single to double peaks, signifying that anesthetics decreased conformation exchange rates. It was also evident that anesthetics shifted population of two conformations. Altogether, the study comprehensively resolved anesthetic binding sites in the α4β2 nAChR. Furthermore, the study provided compelling experimental evidence of anesthetic-induced changes in protein dynamics, especially near regions of the hydrophobic gate and ion selectivity filter that directly regulate channel functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Phytoestrogens and Mycoestrogens Induce Signature Structure Dynamics Changes on Estrogen Receptor α

    PubMed Central

    Chen, Xueyan; Uzuner, Ugur; Li, Man; Shi, Weibing; Yuan, Joshua S.; Dai, Susie Y.

    2016-01-01

    Endocrine disrupters include a broad spectrum of chemicals such as industrial chemicals, natural estrogens and androgens, synthetic estrogens and androgens. Phytoestrogens are widely present in diet and food supplements; mycoestrogens are frequently found in grains. As human beings and animals are commonly exposed to phytoestrogens and mycoestrogens in diet and environment, it is important to understand the potential beneficial or hazardous effects of estrogenic compounds. Many bioassays have been established to study the binding of estrogenic compounds with estrogen receptor (ER) and provided rich data in the literature. However, limited assays can offer structure information with regard to the ligand/ER complex. Our current study surveys the global structure dynamics changes for ERα ligand binding domain (LBD) when phytoestrogens and mycoestrogens bind. The assay is based on the structure dynamics information probed by hydrogen deuterium exchange mass spectrometry and offers a unique viewpoint to elucidate the mechanism how phytoestrogens and mycoestrogens interact with estrogen receptor. The cluster analysis based on the hydrogen deuterium exchange (HDX) assay data reveals a unique pattern when phytoestrogens and mycoestrogens bind with ERα LBD compared to that of estradiol and synthetic estrogen modulators. Our study highlights that structure dynamics could play an important role in the structure function relationship when endocrine disrupters interact with estrogen receptors. PMID:27589781

  16. Autoregulation and Virulence Control by the Toxin-Antitoxin System SavRS in Staphylococcus aureus

    PubMed Central

    Wen, Wen; Liu, Banghui; Xue, Lu; Zhu, Zhongliang; Niu, Liwen

    2018-01-01

    ABSTRACT Toxin-antitoxin (TA) systems play diverse physiological roles, such as plasmid maintenance, growth control, and persister cell formation, but their involvement in bacterial pathogenicity remains largely unknown. Here, we have identified a novel type II toxin-antitoxin system, SavRS, and revealed the molecular mechanisms of its autoregulation and virulence control in Staphylococcus aureus. Electrophoretic mobility shift assay and isothermal titration calorimetry data indicated that the antitoxin SavR acted as the primary repressor bound to its own promoter, while the toxin SavS formed a complex with SavR to enhance the ability to bind to the operator site. DNase I footprinting assay identified the SavRS-binding site containing a short and long palindrome in the promoter region. Further, mutation and DNase I footprinting assay demonstrated that the two palindromes were crucial for DNA binding and transcriptional repression. More interestingly, genetic deletion of the savRS system led to the increased hemolytic activity and pathogenicity in a mouse subcutaneous abscess model. We further identified two virulence genes, hla and efb, by real-time quantitative reverse transcription-PCR and demonstrated that SavR and SavRS could directly bind to their promoter regions to repress virulence gene expression. PMID:29440365

  17. Bioengineering bacteriophages to enhance the sensitivity of phage amplification-based paper fluidic detection of bacteria.

    PubMed

    Alcaine, S D; Law, K; Ho, S; Kinchla, A J; Sela, D A; Nugen, S R

    2016-08-15

    Bacteriophage (phage) amplification is an attractive method for the detection of bacteria due to a narrow phage-host specificity, short amplification times, and the phages' ability to differentiate between viable and non-viable bacterial cells. The next step in phage-based bacteria detection is leveraging bioengineered phages to create low-cost, rapid, and easy-to-use detection platforms such as lateral flow assays. Our work establishes the proof-of-concept for the use of bioengineered T7 phage strains to increase the sensitivity of phage amplification-based lateral flow assays. We have demonstrated a greater than 10-fold increase in sensitivity using a phage-based protein reporter, maltose-binding protein, over the detection of replicated T7 phage viron itself, and a greater then 100-fold increase in sensitivity using a phage-based enzymatic reporter, alkaline phosphatase. This increase in sensitivity enabled us to detect 10(3)CFU/mL of Escherichia coli in broth after 7h, and by adding a filter concentration step, the ability to detect a regulatory relevant E. coli concentration of 100CFU/100mL in inoculated river water after 9h, where the current standard requires days for results. The combination of the paper fluidic format with phage-based detection provides a platform for the development of novel diagnostics that are sensitive, rapid, and easy to use. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Empirically Optimized Flow Cytometric Immunoassay Validates Ambient Analyte Theory

    PubMed Central

    Parpia, Zaheer A.; Kelso, David M.

    2010-01-01

    Ekins’ ambient analyte theory predicts, counter intuitively, that an immunoassay’s limit of detection can be improved by reducing the amount of capture antibody. In addition, it also anticipates that results should be insensitive to the volume of sample as well as the amount of capture antibody added. The objective of this study is to empirically validate all of the performance characteristics predicted by Ekins’ theory. Flow cytometric analysis was used to detect binding between a fluorescent ligand and capture microparticles since it can directly measure fractional occupancy, the primary response variable in ambient analyte theory. After experimentally determining ambient analyte conditions, comparisons were carried out between ambient and non-ambient assays in terms of their signal strengths, limits of detection, and their sensitivity to variations in reaction volume and number of particles. The critical number of binding sites required for an assay to be in the ambient analyte region was estimated to be 0.1VKd. As predicted, such assays exhibited superior signal/noise levels and limits of detection; and were not affected by variations in sample volume and number of binding sites. When the signal detected measures fractional occupancy, ambient analyte theory is an excellent guide to developing assays with superior performance characteristics. PMID:20152793

  19. Functional Stability of the Human Kappa Opioid Receptor Reconstituted in Nanodiscs Revealed by a Time-Resolved Scintillation Proximity Assay

    PubMed Central

    Hansen, Randi Westh; Wang, Xiaole; Golab, Agnieszka; Bornert, Olivier; Oswald, Christine; Wagner, Renaud; Martinez, Karen Laurence

    2016-01-01

    Long-term functional stability of isolated membrane proteins is crucial for many in vitro applications used to elucidate molecular mechanisms, and used for drug screening platforms in modern pharmaceutical industry. Compared to soluble proteins, the understanding at the molecular level of membrane proteins remains a challenge. This is partly due to the difficulty to isolate and simultaneously maintain their structural and functional stability, because of their hydrophobic nature. Here we show, how scintillation proximity assay can be used to analyze time-resolved high-affinity ligand binding to membrane proteins solubilized in various environments. The assay was used to establish conditions that preserved the biological function of isolated human kappa opioid receptor. In detergent solution the receptor lost high-affinity ligand binding to a radiolabelled ligand within minutes at room temperature. After reconstitution in Nanodiscs made of phospholipid bilayer the half-life of high-affinity ligand binding to the majority of receptors increased 70-fold compared to detergent solubilized receptors—a level of stability that is appropriate for further downstream applications. Time-resolved scintillation proximity assay has the potential to screen numerous conditions in parallel to obtain high levels of stable and active membrane proteins, which are intrinsically unstable in detergent solution, and with minimum material consumption. PMID:27035823

  20. Visualizing repetitive diffusion activity of double-strand RNA binding proteins by single molecule fluorescence assays.

    PubMed

    Koh, Hye Ran; Wang, Xinlei; Myong, Sua

    2016-08-01

    TRBP, one of double strand RNA binding proteins (dsRBPs), is an essential cofactor of Dicer in the RNA interference pathway. Previously we reported that TRBP exhibits repetitive diffusion activity on double strand (ds)RNA in an ATP independent manner. In the TRBP-Dicer complex, the diffusion mobility of TRBP facilitates Dicer-mediated RNA cleavage. Such repetitive diffusion of dsRBPs on a nucleic acid at the nanometer scale can be appropriately captured by several single molecule detection techniques. Here, we provide a step-by-step guide to four different single molecule fluorescence assays by which the diffusion activity of dsRBPs on dsRNA can be detected. One color assay, termed protein induced fluorescence enhancement enables detection of unlabeled protein binding and diffusion on a singly labeled RNA. Two-color Fluorescence Resonance Energy Transfer (FRET) in which labeled dsRBPs is applied to labeled RNA, allows for probing the motion of protein along the RNA axis. Three color FRET reports on the diffusion movement of dsRBPs from one to the other end of RNA. The single molecule pull down assay provides an opportunity to collect dsRBPs from mammalian cells and examine the protein-RNA interaction at single molecule platform. Copyright © 2016 Elsevier Inc. All rights reserved.

Top