Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

PubMed

Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2013-05-01

In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

Microhomology-mediated end joining induces hypermutagenesis at breakpoint junctions

PubMed Central

Li, Fuyang; Villarreal, Diana; Shim, Jae Hoon; Myung, Kyungjae; Shim, Eun Yong; Lee, Sang Eun

2017-01-01

Microhomology (MH) flanking a DNA double-strand break (DSB) drives chromosomal rearrangements but its role in mutagenesis has not yet been analyzed. Here we determined the mutation frequency of a URA3 reporter gene placed at multiple locations distal to a DSB, which is flanked by different sizes (15-, 18-, or 203-bp) of direct repeat sequences for efficient repair in budding yeast. Induction of a DSB accumulates mutations in the reporter gene situated up to 14-kb distal to the 15-bp MH, but more modestly to those carrying 18- and 203-bp or no homology. Increased mutagenesis in MH-mediated end joining (MMEJ) appears coupled to its slower repair kinetics and the extensive resection occurring at flanking DNA. Chromosomal translocations via MMEJ also elevate mutagenesis of the flanking DNA sequences 7.1 kb distal to the breakpoint junction as compared to those without MH. The results suggest that MMEJ could destabilize genomes by triggering structural alterations and increasing mutation burden. PMID:28419093

Targeted transgene insertion into the CHO cell genome using Cre recombinase-incorporating integrase-defective retroviral vectors.

PubMed

Kawabe, Yoshinori; Shimomura, Takuya; Huang, Shuohao; Imanishi, Suguru; Ito, Akira; Kamihira, Masamichi

2016-07-01

Retroviral vectors have served as efficient gene delivery tools in various biotechnology fields. However, viral DNA is randomly inserted into the genome, which can cause problems, such as insertional mutagenesis and gene silencing. Previously, we reported a site-specific gene integration system, in which a transgene is integrated into a predetermined chromosomal locus of Chinese hamster ovary (CHO) cells using integrase-defective retroviral vectors (IDRVs) and Cre recombinase. In this system, a Cre expression plasmid is transfected into founder cells before retroviral transduction. In practical applications of site-specific gene modification such as for hard-to-transfect cells or for in vivo gene delivery, both the transgene and the Cre protein into retroviral virions should be encapsulate. Here, we generated novel hybrid IDRVs in which viral genome and enzymatically active Cre can be delivered (Cre-IDRVs). Cre-IDRVs encoding marker genes, neomycin resistance and enhanced green fluorescent protein (EGFP), flanked by wild-type and mutated loxP sites were produced using an expression plasmid for a chimeric protein of Cre and retroviral gag-pol. After analyzing the incorporation of the Cre protein into retroviral virions by Western blotting, the Cre-IDRV was infected into founder CHO cells, in which marker genes (hygromycin resistance and red fluorescent protein) flanked with corresponding loxP sites are introduced into the genome. G418-resistant colonies expressing GFP appeared and the site-specific integration of the transgene into the expected chromosomal site was confirmed by PCR and sequencing of amplicons. Moreover, when Cre-IDRV carried a gene expression unit for a recombinant antibody, the recombinant cells in which the antibody expression cassette was integrated in a site-specific manner were generated and the cells produced the recombinant antibody. This method may provide a promising tool to perform site-specific gene modification according to Cre-based cell engineering. Biotechnol. Bioeng. 2016;113: 1600-1610. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

PubMed

Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

1989-11-25

Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids encoding PKI(1-31) inhibit the expression that is stimulated by the addition of cAMP analogs in both cell lines; basal expression, however, is inhibited by PKI(1-31) only in the JEG-3 cell line and not in the CV-1 cells. These observations indicate that, in JEG-3 cells, PKI(1-31) is a specific inhibitor of kinase A-mediated gene transcription, but it does not modify kinase C-directed transcription.(ABSTRACT TRUNCATED AT 400 WORDS)

Mosaic tetracycline resistance genes and their flanking regions in Bifidobacterium thermophilum and Lactobacillus johnsonii.

PubMed

van Hoek, Angela H A M; Mayrhofer, Sigrid; Domig, Konrad J; Flórez, Ana B; Ammor, Mohammed S; Mayo, Baltasar; Aarts, Henk J M

2008-01-01

For the first time, mosaic tetracycline resistance genes were identified in Lactobacillus johnsonii and in Bifidobacterium thermophilum strains. The L. johnsonii strain investigated contains a complex hybrid gene, tet(O/W/32/O/W/O), whereas the five bifidobacterial strains possess two different mosaic tet genes: i.e., tet(W/32/O) and tet(O/W). As reported by others, the crossover points of the mosaic tet gene segments were found at similar positions within the genes, suggesting a hot spot for recombination. Analysis of the sequences flanking these genes revealed that the upstream part corresponds to the 5' end of the mosaic open reading frame. In contrast, the downstream region was shown to be more variable. Surprisingly, in one of the B. thermophilum strains a third tet determinant was identified, coding for the efflux pump Tet(L).

Evaluation of ACE, SP17, and FSHB as candidates for stallion fertility in Hanoverian warmblood horses.

PubMed

Giesecke, K; Hamann, H; Stock, K F; Klewitz, J; Martinsson, G; Distl, O; Sieme, H

2011-07-01

The research of fertility in humans and other mammals has strongly advanced in the recent years. The examination of molecular mechanisms influencing horse fertility is relatively recent. We chose the angiotensin converting enzyme (ACE), the sperm autoantigenic protein 17 (SP17) and the follicle stimulating hormone (FSHB) as candidates for determining stallion fertility and to analyze associations of intragenic single nucleotide polymorphisms (SNPs), flanking microsatellites and candidate-gene linked haplotypes with the pregnancy rate per oestrus (PRO) in 179 Hanoverian stallions. Fertility traits analyzed were the least square means of PRO for stallions (LSMs) and the paternal and embryonic component of breeding values for PRO (BVs). We detected nine SNPs and two flanking microsatellites in ACE, eight SNPs and two flanking microsatellites in SP17 and four SNPs and one flanking microsatellite in FSHB. Three SP17-associated SNPs and the two flanking microsatellites showed significant association with the embryonic component of BVs and one SP17-associated microsatellite was also significantly associated with the paternal component of BVs. Two ACE-associated SNPs were significantly associated with the embryonic component of BVs. Significantly associated haplotypes were shown for all three candidate genes and the tested fertility parameters. The final regression analysis model indicated that haplotypes of all three candidate genes significantly contributed to the paternal and embryonic fertility components of PRO. This is the first report of associations of ACE, SP17 and FSHB with fertility traits of stallions. Copyright © 2011 Elsevier B.V. All rights reserved.

Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras.

PubMed

Abdallah, Joseph F; Okoth, Sheila Akinyi; Fontecha, Gustavo A; Torres, Rosa Elena Mejia; Banegas, Engels I; Matute, María Luisa; Bucheli, Sandra Tamara Mancero; Goldman, Ira F; de Oliveira, Alexandre Macedo; Barnwell, John W; Udhayakumar, Venkatachalam

2015-01-21

Recent studies have demonstrated the deletion of the histidine-rich protein 2 (PfHRP2) gene (pfhrp2) in field isolates of Plasmodium falciparum, which could result in false negative test results when PfHRP2-based rapid diagnostic tests (RDTs) are used for malaria diagnosis. Although primary diagnosis of malaria in Honduras is determined based on microscopy, RDTs may be useful in remote areas. In this study, it was investigated whether there are deletions of the pfhrp2, pfhrp3 and their respective flanking genes in 68 P. falciparum parasite isolates collected from the city of Puerto Lempira, Honduras. In addition, further investigation considered the possible correlation between parasite population structure and the distribution of these gene deletions by genotyping seven neutral microsatellites. Sixty-eight samples used in this study, which were obtained from a previous chloroquine efficacy study, were utilized in the analysis. All samples were genotyped for pfhrp2, pfhrp3 and flanking genes by PCR. The samples were then genotyped for seven neutral microsatellites in order to determine the parasite population structure in Puerto Lempira at the time of sample collection. It was found that all samples were positive for pfhrp2 and its flanking genes on chromosome 8. However, only 50% of the samples were positive for pfhrp3 and its neighboring genes while the rest were either pfhrp3-negative only or had deleted a combination of pfhrp3 and its neighbouring genes on chromosome 13. Population structure analysis predicted that there are at least two distinct parasite population clusters in this sample population. It was also determined that a greater proportion of parasites with pfhrp3-(and flanking gene) deletions belonged to one cluster compared to the other. The findings indicate that the P. falciparum parasite population in the municipality of Puerto Lempira maintains the pfhrp2 gene and that PfHRP2-based RDTs could be considered for use in this region; however continued monitoring of parasite population will be useful to detect any parasites with deletions of pfhrp2.

Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

PubMed

Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

2015-12-10

D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

Human renin 5'-flanking DNA to nucleotide-2750.

PubMed

Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J

1995-01-01

Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.

A physical map, including a BAC/PAC clone contig, of the Williams-Beuren syndrome--deletion region at 7q11.23.

PubMed

Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U

2000-01-01

Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.

Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

PubMed Central

Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

2002-01-01

κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

Identification of a precursor genomic segment that provided a sequence unique to glycophorin B and E genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Onda, M.; Kudo, S.; Fukuda, M.

Human glycophorin A, B, and E (GPA, GPB, and GPE) genes belong to a gene family located at the long arm of chromosome 4. These three genes are homologous from the 5'-flanking sequence to the Alu sequence, which is 1 kb downstream from the exon encoding the transmembrane domain. Analysis of the Alu sequence and flanking direct repeat sequences suggested that the GPA gene most closely resembles the ancestral gene, whereas the GPB and GPE gene arose by homologous recombination within the Alu sequence, acquiring 3' sequences from an unrelated precursor genomic segment. Here the authors describe the identification ofmore » this putative precursor genomic segment. A human genomic library was screened by using the sequence of the 3' region of the GPB gene as a probe. The genomic clones isolated were found to contain an Alu sequence that appeared to be involved in the recombination. Downstream from the Alu sequence, the nucleotide sequence of the precursor genomic segment is almost identical to that of the GPB or GPE gene. In contrast, the upstream sequence of the genomic segment differs entirely from that of the GPA, GPB, and GPE genes. Conservation of the direct repeats flanking the Alu sequence of the genomic segment strongly suggests that the sequence of this genomic segment has been maintained during evolution. This identified genomic segment was found to reside downstream from the GPA gene by both gene mapping and in situ chromosomal localization. The precursor genomic segment was also identified in the orangutan genome, which is known to lack GPB and GPE genes. These results indicate that one of the duplicated ancestral glycophorin genes acquired a unique 3' sequence by unequal crossing-over through its Alu sequence and the further downstream Alu sequence present in the duplicated gene. Further duplication and divergence of this gene yielded the GPB and GPE genes. 37 refs., 5 figs.« less

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Bypass of lethality with mosaic mice generated by Cre-loxP-mediated recombination.

PubMed

Betz, U A; Vosshenrich, C A; Rajewsky, K; Müller, W

1996-10-01

The analysis of gene function based on the generation of mutant mice by homologous recombination in embryonic stem cells is limited if gene disruption results in embryonic lethality. Mosaic mice, which contain a certain proportion of mutant cells in all organs, allow lethality to be circumvented and the potential of mutant cells to contribute to different cell lineages to be analyzed. To generate mosaic animals, we used the bacteriophage P1-derived Cre-loxP recombination system, which allows gene alteration by Cre-mediated deletion of loxP-flanked gene segments. We generated nestin-cre transgenic mouse lines, which expressed the Cre recombinase under the control of the rat nestin promoter and its second intron enhancer. In crosses to animals carrying a loxP-flanked target gene, partial deletion of the loxP-flanked allele occurred before day 10.5 post coitum and was detectable in all adult organs examined, including germ-line cells. Using this approach, we generated mosaic mice containing cells deficient in the gamma-chain of the interleukin-2 receptor (IL-2R gamma); in these animals, the IL-2R gamma-deficient cells were underrepresented in the thymus and spleen. Because mice deficient in DNA polymerase beta die perinatally, we studied the effects of DNA polymerase beta deficiency in mosaic animals. We found that some of the mosaic polymerase beta-deficient animals were viable, but were often reduced in size and weight. The fraction of DNA polymerase beta-deficient cells in mosaic embryos decreased during embryonic development, presumably because wild-type cells had a competitive advantage. The nestin-cre transgenic mice can be used to generate mosaic animals in which target genes are mutated by Cre-mediated recombination of loxP-flanked target genes. By using mosaic animals, embryonic lethality can be bypassed and cell lineages for whose development a given target gene is critical can be identified. In the case of DNA polymerase beta, deficient cells are already selected against during embryonic development, demonstrating the general importance of this protein in multiple cell types.

Gene Deletion in Barley Mediated by LTR-retrotransposon BARE

PubMed Central

Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao

2017-01-01

A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053

Positioning the actual interference fringe pattern on the tooth flank in measuring gear tooth flanks by laser interferometry

NASA Astrophysics Data System (ADS)

Fang, Suping; Wang, Leijie; Liu, Shiqiao; Komori, Masaharu; Kubo, Aizoh

2011-05-01

In measuring form deviation of gear tooth flanks by laser interferometry, the collected interference fringe pattern (IFP) is badly distorted, in the case of shape, relative to the actual tooth flank. Meanwhile, a clear and definite mapping relationship between the collected IFP and the actual tooth flank is indispensable for both transforming phase differences into deviation values and positioning the measurement result on the actual tooth flank. In order to solve these problems, this paper proposes a method using the simulation tooth image as a bridge connecting the actual tooth flank and the collected IFP. The mapping relationship between the simulation tooth image and the actual tooth flank has been obtained by ray tracing methods [Fang et al., Appl. Opt. 49(33), 6409-6415 (2010)]. This paper mainly discusses how to build the relationship between the simulation tooth image and the collected IFP by using a matching algorithm of two characteristic point sets. With the combination of the two above-mentioned assistant mapping relationships, the mapping relationship between the collected IFP and the actual tooth flank can be built; the collected IFP can be positioned on the actual tooth flank. Finally, the proposed method is employed in a measurement of the form deviation of a gear tooth flank and the result proves the feasibility of the proposed method.

Analysis of the xplAB-Containing Gene Cluster Involved in the Bacterial Degradation of the Explosive Hexahydro-1,3,5-Trinitro-1,3,5-Triazine

PubMed Central

Chong, Chun Shiong; Sabir, Dana Khdr; Lorenz, Astrid; Bontemps, Cyril; Andeer, Peter; Stahl, David A.; Strand, Stuart E.; Rylott, Elizabeth L.

2014-01-01

Repeated use of the explosive compound hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) on military land has resulted in significant soil and groundwater pollution. Rates of degradation of RDX in the environment are low, and accumulated RDX, which the U.S. Environmental Protection Agency has determined is a possible human carcinogen, is now threatening drinking water supplies. RDX-degrading microorganisms have been isolated from RDX-contaminated land; however, despite the presence of these species in contaminated soils, RDX pollution persists. To further understand this problem, we studied RDX-degrading species belonging to four different genera (Rhodococcus, Microbacterium, Gordonia, and Williamsia) isolated from geographically distinct locations and established that the xplA and xplB (xplAB) genes, which encode a cytochrome P450 and a flavodoxin redox partner, respectively, are nearly identical in all these species. Together, the xplAB system catalyzes the reductive denitration of RDX and subsequent ring cleavage under aerobic and anaerobic conditions. In addition to xplAB, the Rhodococcus species studied here share a 14-kb region flanking xplAB; thus, it appears likely that the RDX-metabolizing ability was transferred as a genomic island within a transposable element. The conservation and transfer of xplAB-flanking genes suggest a role in RDX metabolism. We therefore independently knocked out genes within this cluster in the RDX-degrading species Rhodococcus rhodochrous 11Y. Analysis of the resulting mutants revealed that XplA is essential for RDX degradation and that XplB is not the sole contributor of reducing equivalents to XplA. While XplA expression is induced under nitrogen-limiting conditions and further enhanced by the presence of RDX, MarR is not regulated by RDX. PMID:25128343

The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

PubMed

Holland, M J; Holland, J P; Thill, G P; Jackson, K A

1981-02-10

Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.

The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

PubMed

Fleckenstein, E C; Dirks, W G; Drexler, H G

2000-02-01

The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation

PubMed Central

Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.

2008-01-01

Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809

Seabream ghrelin: cDNA cloning, genomic organization and promoter studies.

PubMed

Yeung, Chung-Man; Chan, Chi-Bun; Woo, Norman Y S; Cheng, Christopher H K

2006-05-01

Recent studies have indicated that ghrelin stimulates growth hormone release from the pituitary via the growth hormone secretagogue receptor (GHSR). We have previously isolated two GHSR subtypes from the pituitary of the black seabream Acanthopagrus schlegeli. In the present study, we have cloned and characterized ghrelin from the same fish species at both the cDNA and gene levels. The full-length seabream ghrelin cDNA, isolated from sea-bream stomach using a novel approach by exploiting a single conserved region in the coding region, was found to encode a prepropeptide of 107 amino acids, with the predicted mature ghrelin peptide consisting of 20 amino acids (GSSFLSPSQKPQNRGKSSRV). Embedded in this full-length cDNA is a putative fish orthologue of the recently reported mammalian obestatin peptide. The ghrelin gene in black seabream, obtained by genomic PCR, was found to encompass four exons and three introns, possessing the same structural organization as in tilapia and goldfish, but different from that in rainbow trout. In addition, a 2230-bp 5'-flanking region of the seabream ghrelin gene was obtained by genome walking. Sequence analysis revealed that, as in the case of the human ghrelin gene, there is neither a GC box nor a CAAT box present in the isolated 5'-flanking region. However, a number of putative transcription factor-binding sites different from the human counterpart were found in the 5'-flanking region of the seabream ghrelin gene, suggesting that different cis- and trans-acting elements are involved in controlling their gene expression. Functional activity of this 5'-flanking region was examined by cloning it into the pGL3-Basic vector upstream of the luciferase reporter gene and transfected into various cell lines. Positive promoter activity could only be recorded in the colon-derived Caco-2 cells, suggesting that the cloned 5'-flanking region represents the functional promoter of the seabream ghrelin gene, which exhibits tissue-specific promoter activity. Using reverse transcriptase PCR analysis, expression of ghrelin was detected only in the seabream stomach, but not in the other tissues examined, including the brain, gill, intestine, kidney, liver and spleen. This stomach-specific expression of ghrelin in seabream is subject to regulation, as administration of growth hormone or ipamorelin to the fish in vivo was demonstrated to enhance its expression. Reminiscent of the homologous upregulation found in the transcriptional control of the seabream GHSR gene, a similar homologous regulatory mechanism might also exist in controlling the expression of seabream ghrelin. The identification of both GHSR and ghrelin from a single fish species would facilitate our subsequent studies on the elucidation of the physiological functions of the ghrelin/GHSR system in teleost. The possible existence of obestatin in teleost opens up new research avenues on the somatotropic axis in fish.

The virulence gene cluster of Listeria monocytogenes is also present in Listeria ivanovii, an animal pathogen, and Listeria seeligeri, a nonpathogenic species.

PubMed Central

Gouin, E; Mengaud, J; Cossart, P

1994-01-01

Most known Listeria monocytogenes virulence genes cluster within a 9.6-kb chromosomal region. This region is flanked on one end by two uncharacterized open reading frames (ORF A and ORF B) and ldh, an ORF presumably encoding the L. monocytogenes lactate dehydrogenase (J.-A. Vazquez-Boland, C. Kocks, S. Dramsi, H. Ohayon, C. Geoffroy, J. Mengaud, and P. Cossart, Infect. Immun. 60:219-230, 1992). We report here that the other end is flanked by prs, and ORF homologous to phosphoribosyl PPi synthetase genes. ORF B and prs were detected in all Listeria species and thus delimit the virulence region. This virulence gene cluster was detected exclusively in hemolytic Listeria species, Listeria ivanovii, an animal pathogen, and Listeria seeligeri, a nonpathogenic species. Images PMID:8039927

The presence of both negative and positive elements in the 5'-flanking sequence of the rat Na,K-ATPase alpha 3 subunit gene are required for brain expression in transgenic mice.

PubMed Central

Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B

1994-01-01

The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427

Diversity of plasmids and transmission of high-level mupirocin mupA resistance gene in Staphylococcus haemolyticus.

PubMed

do Carmo Ferreira, Natália; Schuenck, Ricardo P; dos Santos, Kátia Regina Netto; de Freire Bastos, Maria do Carmo; Giambiagi-deMarval, Marcia

2011-03-01

The coagulase-negative staphylococci are known for their ability to acquire resistance genes, which limits the choice of therapeutic options for the treatment of infections caused by these microorganisms. In this study, the diversity of high-level mupirocin resistance plasmids (Mup(R) ) was investigated in four strains of Staphylococcus haemolyticus belonging to different pulsed-field gel electrophoresis (PFGE) types or subtypes, isolated in a Brazilian hospital. These strains harbor the mupA gene in large plasmids. In addition, the presence of IS257 sequences flanking the mupA gene was also shown. Two isolates belonging to two different PFGE types exhibited a similar polymorphism for a fragment of the mupA gene and the closest proximal flanking copies of the IS257, suggesting horizontal transmission of S. haemolyticus mupirocin resistance plasmids in the environment and a role of this species as a reservoir of the mupA gene. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Chromosomal arrangement of leghemoglobin genes in soybean.

PubMed Central

Lee, J S; Brown, G G; Verma, D P

1983-01-01

A cluster of four different leghemoglobin (Lb) genes was isolated from AluI-HaeIII and EcoRI genomic libraries of soybean in a set of overlapping clones which together include 45 kilobases (kb) of contiguous DNA. These four genes, including a pseudogene, are present in the same orientation and are arranged in the order: 5'-Lba-Lbc1-Lb psi-Lbc3-3'. The intergenic regions average 2.5 kb. In addition to this main Lb locus, there are other Lb genes which do not appear to be contiguous to this locus. A sequence probably common to the 3' region of Lb loci was found flanking the Lbc3 gene. The 3' flanking region of the main Lb locus also contains a sequence that appears to be expressed more abundantly in root tissue. Another sequence which is primarily expressed in root and leaf is found 5' to two Lb loci. Overall, the main leghemoglobin locus is similar in structure to the mammalian globin gene loci. Images PMID:6310504

Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

PubMed Central

Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

2000-01-01

The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

Heat-shock-mediated elimination of the nptII marker gene in transgenic apple (Malus×domestica Borkh.).

PubMed

Herzog, Katja; Flachowsky, Henryk; Deising, Holger B; Hanke, Magda-Viola

2012-04-25

Production of marker-free genetically modified (GM) plants is one of the major challenges of molecular fruit breeding. Employing clean vector technologies, allowing the removal of undesired DNA sequences from GM plants, this goal can be achieved. The present study describes the establishment of a clean vector system in apple Malus×domestica Borkh., which is based on the use of the neomycin phosphotransferase II gene (nptII) as selectable marker gene and kanamycin/paramomycin as selective agent. The nptII gene can be removed after selection of GM shoots via site-specific excision mediated by heat-shock-inducible expression of the budding yeast FLP recombinase driven by the soybean Gmhsp17.5-E promoter. We created a monitoring vector containing the nptII and the flp gene as a box flanked by two direct repeats of the flp recognition target (FRT) sites. The FRT-flanked box separates the gusA reporter gene from the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter. Consequently, GUS expression does only occur after elimination of the FRT-flanked box. Transformation experiments using the monitoring vector resulted in a total of nine transgenic lines. These lines were investigated for transgenicity by PCR, RT-PCR and Southern hybridization. Among different temperature regimes tested, exposure to 42 °C for 3.5 to 4h led to efficient induction of FLP-mediated recombination and removal of the nptII marker gene. A second round of shoot regeneration from leaf explants led to GM apple plants completely free of the nptII gene. Copyright © 2012 Elsevier B.V. All rights reserved.

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals.

PubMed

Patel, Vidushi S; Cooper, Steven J B; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer A M

2008-07-25

Vertebrate alpha (alpha)- and beta (beta)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the alpha- and beta-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil beta-globin gene (omega) in the marsupial alpha-cluster, however, suggested that duplication of the alpha-beta cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous alpha- and beta-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. The platypus alpha-globin cluster (chromosome 21) contains embryonic and adult alpha- globin genes, a beta-like omega-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-zeta-zeta'-alphaD-alpha3-alpha2-alpha1-omega-GBY-3'. The platypus beta-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-epsilon-beta-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate alpha-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal beta-globin clusters are embedded in olfactory genes. Thus, the mammalian alpha- and beta-globin clusters are orthologous to the bird alpha- and beta-globin clusters respectively. We propose that alpha- and beta-globin clusters evolved from an ancient MPG-C16orf35-alpha-beta-GBY-LUC7L arrangement 410 million years ago. A copy of the original beta (represented by omega in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of beta-globin genes with different expression profiles in different lineages.

Microbial communities at the borehole observatory on the Costa Rica Rift flank (Ocean Drilling Program Hole 896A).

PubMed

Nigro, Lisa M; Harris, Kate; Orcutt, Beth N; Hyde, Andrew; Clayton-Luce, Samuel; Becker, Keir; Teske, Andreas

2012-01-01

The microbiology of subsurface, hydrothermally influenced basaltic crust flanking mid-ocean ridges has remained understudied, due to the difficulty in accessing the subsurface environment. The instrumented boreholes resulting from scientific ocean drilling offer access to samples of the formation fluids circulating through oceanic crust. We analyzed the phylogenetic diversity of bacterial communities of fluid and microbial mat samples collected in situ from the observatory at Ocean Drilling Program Hole 896A, drilled into ~6.5 million-year-old basaltic crust on the flank of the Costa Rica Rift in the equatorial Pacific Ocean. Bacterial 16S rRNA gene sequences recovered from borehole fluid and from a microbial mat coating the outer surface of the fluid port revealed both unique and shared phylotypes. The dominant bacterial clones from both samples were related to the autotrophic, sulfur-oxidizing genus Thiomicrospira. Both samples yielded diverse gamma- and alphaproteobacterial phylotypes, as well as members of the Bacteroidetes, Planctomycetes, and Verrucomicrobia. Analysis of ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO) genes (cbbL and cbbM) from the sampling port mat and from the borehole fluid demonstrated autotrophic carbon assimilation potential for in situ microbial communities; most cbbL genes were related to those of the sulfur-oxidizing genera Thioalkalivibrio and Thiomicrospira, and cbbM genes were affiliated with uncultured phylotypes from hydrothermal vent plumes and marine sediments. Several 16S rRNA gene phylotypes from the 896A observatory grouped with phylotypes recovered from seawater-exposed basalts and sulfide deposits at inactive hydrothermal vents, but there is little overlap with hydrothermally influenced basaltic boreholes 1026B and U1301A on the Juan de Fuca Ridge flank, suggesting that site-specific characteristics of Hole 896A (i.e., seawater mixing into borehole fluids) affect the microbial community composition.

A Physical Map, Including a BAC/PAC Clone Contig, of the Williams-Beuren Syndrome–Deletion Region at 7q11.23

PubMed Central

Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta

2000-01-01

Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136

PRIMARY STRUCTURE OF THE P450 LANOSTEROL DEMETHYLASE GENE FROM SACCHAROMYCES CEREVISIAE

EPA Science Inventory

We have sequenced the structural gene and flanking regions for lanosterol 14 alpha-demethylase (14DM) from Saccharomyces cerevisiae. An open reading frame of 530 codons encodes a 60.7-kDa protein. When this gene is disrupted by integrative transformation, the resulting strain req...

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

PubMed

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

Molecular Mapping of Stripe Rust Resistance Gene Yr76 in Winter Club Wheat Cultivar Tyee.

PubMed

Xiang, C; Feng, J Y; Wang, M N; Chen, X M; See, D R; Wan, A M; Wang, T

2016-10-01

Tyee, one of the wheat cultivars used to differentiate races of Puccinia striiformis f. sp. tritici in the United States, was identified to have a single gene for all-stage resistance, tentatively named YrTye. To map the gene, Tyee was crossed with 'Avocet Susceptible' (AvS). Genetic analysis of the F 1 , F 2 , F 2:3 , and BC 1 progenies confirmed a single dominant gene for resistance to race PSTv-37 that is avirulent to YrTye. A mapping population of 135 F 2 plants was phenotyped with PSTv-37 and the derived F 2:3 lines were tested with races PSTv-37, PSTv-40, and PSTv-79. The F 2 mapping population was genotyped with simple sequence repeat (SSR) markers. A genetic map comprising 13 SSR markers located YrTye in chromosome 3AS flanked distally by SSR marker wmc11 and proximally by wmc532 at 2.6 and 3.4 cM, respectively. Amplification of Chinese Spring 3A deletion lines placed the gene in the distal bin 3AS4-0.45 to 1.00. Because YrTye is different from all formally named Yr genes in chromosomal location, we permanently name the gene Yr76. A near-isogenic line of spring common wheat was developed and selected by testing F 3 lines derived from a AvS*4/Tyee cross with Tyee-avirulent and virulent races and the flanking markers. The specific SSR alleles flanking Yr76 were validated using cultivars and breeding lines with and without the gene, and showed high polymorphisms. The specificity of Yr76 is useful in differentiating P. striiformis f. sp. tritici races, and its tightly linked markers will be useful in developing resistant cultivars when combining the gene with other genes for resistance to stripe rust.

Homologous recombination within the capsid gene of porcine circovirus type 2 subgroup viruses via natural co-infection

USDA-ARS?s Scientific Manuscript database

Several studies had reported homologous recombination between porcine circovirus type 2 (PCV2)-group 1 (Gp1) and -group 2 (Gp2) viruses. Interestingly, the recombination events described thus far mapped either within the Rep gene sequences or the sequences flanking the Rep gene region. Previously, ...

Epigenetic modifications and chromatin loop organization explain the different expression profiles of the Tbrg4, WAP and Ramp3 genes

USDA-ARS?s Scientific Manuscript database

Whey Acidic Protein (WAP) gene expression is specific to the mammary gland and regulated by lactogenic hormones to peak during lactation. It differs markedly from the more constitutive expression of the two flanking genes, Ramp3 and Tbrg4. Our results show that the tight regulation of WAP gene expre...

Chromosomal Location and Comparative Genomics Analysis of Powdery Mildew Resistance Gene Pm51 in a Putative Wheat-Thinopyrum ponticum Introgression Line

PubMed Central

Zhang, Xiaojun; Li, Xin; Guo, Huijuan; Gong, Wenping; Jia, Juqing; Qiao, Linyi; Ren, Yongkang; Yang, Zujun; Chang, Zhijian

2014-01-01

Powdery mildew (PM) is a very destructive disease of wheat (Triticum aestivum L.). Wheat-Thinopyrum ponticum introgression line CH7086 was shown to possess powdery mildew resistance possibly originating from Th. ponticum. Genomic in situ hybridization and molecular characterization of the alien introgression failed to identify alien chromatin. To study the genetics of resistance, CH7086 was crossed with susceptible genotypes. Segregation in F2 populations and F2:3 lines tested with Chinese Bgt race E09 under controlled conditions indicated that CH7086 carries a single dominant gene for powdery mildew resistance. Fourteen SSR and EST-PCR markers linked with the locus were identified. The genetic distances between the locus and the two flanking markers were 1.5 and 3.2 cM, respectively. Based on the locations of the markers by nullisomic-tetrasomic and deletion lines of ‘Chinese Spring’, the resistance gene was located in deletion bin 2BL-0.89-1.00. Conserved orthologous marker analysis indicated that the genomic region flanking the resistance gene has a high level of collinearity to that of rice chromosome 4 and Brachypodium chromosome 5. Both resistance specificities and tests of allelism suggested the resistance gene in CH7086 was different from previously reported powdery mildew resistance genes on 2BL, and the gene was provisionally designated PmCH86. Molecular analysis of PmCH86 compared with other genes for resistance to Bgt in the 2BL-0.89-1.00 region suggested that PmCH86 may be a new PM resistance gene, and it was therefore designated as Pm51. The closely linked flanking markers could be useful in exploiting this putative wheat-Thinopyrum translocation line for rapid transfer of Pm51 to wheat breeding programs. PMID:25415194

DNA sequence responsible for the amplification of adjacent genes.

PubMed

Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

1987-10-01

A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

The association of SNPs in Hsp90β gene 5' flanking region with thermo tolerance traits and tissue mRNA expression in two chicken breeds.

PubMed

Chen, Zhuo-Yu; Gan, Jian-Kang; Xiao, Xiong; Jiang, Li-Yan; Zhang, Xi-Quan; Luo, Qing-Bin

2013-09-01

Thermo stress induces heat shock proteins (HSPs) expression and HSP90 family is one of them that has been reported to involve in cellular protection against heat stress. But whether there is any association of genetic variation in the Hsp90β gene in chicken with thermo tolerance is still unknown. Direct sequencing was used to detect possible SNPs in Hsp90β gene 5' flanking region in 3 chicken breeds (n = 663). Six mutations, among which 2 SNPs were chosen and genotypes were analyzed with PCR-RFLP method, were found in Hsp90β gene in these 3 chicken breeds. Association analysis indicated that SNP of C.-141G>A in the 5' flanking region of the Hsp90β gene in chicken had some effect on thermo tolerance traits, which may be a potential molecular marker of thermo tolerance, and the genotype GG was the thermo tolerance genotype. Hsp90β gene mRNA expression in different tissues detected by quantitative real-time PCR assay were demonstrated to be tissue dependent, implying that different tissues have distinct sensibilities to thermo stress. Besides, it was shown time specific and varieties differences. The expression of Hsp90β mRNA in Lingshan chickens in some tissues including heart, liver, brain and spleen were significantly higher or lower than that of White Recessive Rock (WRR). In this study, we presume that these mutations could be used in marker assisted selection for anti-heat stress chickens in our breeding program, and WRR were vulnerable to tropical thermo stress whereas Lingshan chickens were well adapted.

An internal regulatory element controls troponin I gene expression.

PubMed Central

Yutzey, K E; Kline, R L; Konieczny, S F

1989-01-01

During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, we have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene. Images PMID:2725509

Evolution of the Male-Determining Gene SRY Within the Cat Family Felidae

PubMed Central

King, V.; Goodfellow, P. N.; Wilkerson, A. J. Pearks; Johnson, W. E.; O'Brien, S. J.; Pecon-Slattery, J.

2007-01-01

In most placental mammals, SRY is a single-copy gene located on the Y chromosome and is the trigger for male sex determination during embryonic development. Here, we present comparative genomic analyses of SRY (705 bp) along with the adjacent noncoding 5′ flank (997 bp) and 3′ flank (948 bp) in 36 species of the cat family Felidae. Phylogenetic analyses indicate that the noncoding genomic flanks and SRY closely track species divergence. However, several inconsistencies are observed in SRY. Overall, the gene exhibits purifying selection to maintain function (ω = 0.815) yet SRY is under positive selection in two of the eight felid lineages. SRY has low numbers of nucleotide substitutions, yet most encode amino acid changes between species, and four different species have significantly altered SRY due to insertion/deletions. Moreover, fixation of nonsynonymous substitutions between sister taxa is not consistent and may occur rapidly, as in the case of domestic cat, or not at all over long periods of time, as observed within the Panthera lineage. The former resembles positive selection during speciation, and the latter purifying selection to maintain function. Thus, SRY evolution in cats likely reflects the different phylogeographic histories, selection pressures, and patterns of speciation in modern felids. PMID:17277366

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

PubMed Central

Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM

2008-01-01

Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

PubMed

Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

2013-05-29

Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in the most recent duplication are the main contributions of our study.

The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family

PubMed Central

2013-01-01

Background Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Results Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. Conclusions We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in the most recent duplication are the main contributions of our study. PMID:23718880

An internal regulatory element controls troponin I gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F.

1989-04-01

During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein genemore » has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.« less

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Single-molecule DNA unzipping reveals asymmetric modulation of a transcription factor by its binding site sequence and context

PubMed Central

Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa

2018-01-01

Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225

Genomic organization of the Neurospora crassa gsn gene: possible involvement of the STRE and HSE elements in the modulation of transcription during heat shock.

PubMed

Freitas, F Zanolli; Bertolini, M C

2004-12-01

Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Polycythemia in transgenic mice expressing the human erythropoietin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.

1989-04-01

Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5{prime} flanking sequence and 0.7 kilobase of 3{prime} flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver,more » adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels.« less

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.

PubMed

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-03-12

ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter

PubMed Central

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-01-01

ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529

Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

PubMed

Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

2006-12-01

An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

The pine Pschi4 promoter directs wound-induced transcription

Treesearch

Haiguo Wu; Charles H. Michler; Liborio LaRussa; John M. Davis

1999-01-01

Mechanical wounding stimulates the accumulation of Pschi4 transcripts (encoding a putative extracellular chitinase) in pine trees. To gain insight into the transcriptional regulatory region(s) in this gymnosperm defense gene, the 5'-flanking region of Pschi4 was fused to the uidA reporter gene encoding -...

Vector-mediated chromosomal integration of the glutamate decarboxylase gene in streptococcus thermophilus

USDA-ARS?s Scientific Manuscript database

The integrative vector pINTRS was used to transfer glutamate decarboxylase (GAD) activity to Streptococcus thermophilus ST128, thus allowing for the production of '-aminobutyric acid (GABA). In pINTRS, the gene encoding glutamate decarboxylase, gadB, was flanked by DNA fragments homologous to a S. ...

Members of the Genera Paenibacillus and Rhodococcus Harbor Genes Homologous to Enterococcal Glycopeptide Resistance Genes vanA and vanB

PubMed Central

Guardabassi, L.; Christensen, H.; Hasman, H.; Dalsgaard, A.

2004-01-01

Genes homologous to enterococcal glycopeptide resistance genes vanA and vanB were found in glycopeptide-resistant Paenibacillus and Rhodococcus strains from soil. The putative d-Ala:d-Lac ligase genes in Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B were closely related to vanA (92 and 87%) and flanked by genes homologous to vanH and vanX in vanA operons. PMID:15561881

Members of the genera Paenibacillus and Rhodococcus harbor genes homologous to enterococcal glycopeptide resistance genes vanA and vanB.

PubMed

Guardabassi, L; Christensen, H; Hasman, H; Dalsgaard, A

2004-12-01

Genes homologous to enterococcal glycopeptide resistance genes vanA and vanB were found in glycopeptide-resistant Paenibacillus and Rhodococcus strains from soil. The putative D-Ala:D-Lac ligase genes in Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B were closely related to vanA (92 and 87%) and flanked by genes homologous to vanH and vanX in vanA operons.

Innate Immune Complexity in the Purple Sea Urchin: Diversity of the Sp185/333 System

PubMed Central

Smith, L. Courtney

2012-01-01

The California purple sea urchin, Strongylocentrotus purpuratus, is a long-lived echinoderm with a complex and sophisticated innate immune system. There are several large gene families that function in immunity in this species including the Sp185/333 gene family that has ∼50 (±10) members. The family shows intriguing sequence diversity and encodes a broad array of diverse yet similar proteins. The genes have two exons of which the second encodes the mature protein and has repeats and blocks of sequence called elements. Mosaics of element patterns plus single nucleotide polymorphisms-based variants of the elements result in significant sequence diversity among the genes yet maintains similar structure among the members of the family. Sequence of a bacterial artificial chromosome insert shows a cluster of six, tightly linked Sp185/333 genes that are flanked by GA microsatellites. The sequences between the GA microsatellites in which the Sp185/333 genes and flanking regions are located, are much more similar to each other than are the sequences outside the microsatellites suggesting processes such as gene conversion, recombination, or duplication. However, close linkage does not correspond with greater sequence similarity compared to randomly cloned and sequenced genes that are unlikely to be linked. There are three segmental duplications that are bounded by GAT microsatellites and include three almost identical genes plus flanking regions. RNA editing is detectible throughout the mRNAs based on comparisons to the genes, which, in combination with putative post-translational modifications to the proteins, results in broad arrays of Sp185/333 proteins that differ among individuals. The mature proteins have an N-terminal glycine-rich region, a central RGD motif, and a C-terminal histidine-rich region. The Sp185/333 proteins are localized to the cell surface and are found within vesicles in subsets of polygonal and small phagocytes. The coelomocyte proteome shows full-length and truncated proteins, including some with missense sequence. Current results suggest that both native Sp185/333 proteins and a recombinant protein bind bacteria and are likely important in sea urchin innate immunity. PMID:22566951

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

Structural and functional differences in the dio1 gene in mice with inherited type 1 deiodinase deficiency.

PubMed

Maia, A L; Berry, M J; Sabbag, R; Harney, J W; Larsen, P R

1995-08-01

The type 1 deiodinase (D1) provides the major portion of the circulating T3 in vertebrates. In C3H and certain other inbred mice, liver and kidney D1 activity is 5- to 10-fold lower than in the common phenotype, C57. The lower D1 levels are paralleled by a decreased normal-sized dio1 mRNA and hyperthyroxinemia. Low activity cosegregates with a restriction fragment length variant (RFLV) in both inbred and recombinant strains, indicating it is due to differences in the dio1 gene. The exonic structure and the deduced amino acid sequences are identical for both strains and highly homologous to that of the rat. The RFLV is due to an approximately 150-base pair expansion of repetitive sequences in the second intron of the C3H gene, but this segment does not differentially affect the transient expression of a human GH gene. The promoter and 5'-flanking regions of the C3H and C57 dio1 genes are very similar and are GC rich without TATA or CCAAT boxes. However, functional assays of 1.5-kilobase 5'-flanking dio1-CAT constructs showed 2- to 3-fold higher activity of the C57-CAT constructs. Deletion mutants showed that sequences between -705 and -162 were the cause of this. In this region, the only major difference between the two genes is a 21-base pair insert containing five CTG repeats in the C3H promoter. This difference also cosegregates with low D1 activity and the intron RFLV in four other mouse strains. The correlation of the CTG repeat insert with both in vitro and in vivo expression and the absence of other significant sequence differences in the 5'-flanking region argue that this is the major explanation for the impaired expression of the dio1 gene and the resulting hyperthyroxinemia of the C3H mouse.

Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins

PubMed Central

Kramer, Marianne C.; Liang, Dongming; Tatomer, Deirdre C.; Gold, Beth; March, Zachary M.; Cherry, Sara; Wilusz, Jeremy E.

2015-01-01

Thousands of eukaryotic protein-coding genes are noncanonically spliced to produce circular RNAs. Bioinformatics has indicated that long introns generally flank exons that circularize in Drosophila, but the underlying mechanisms by which these circular RNAs are generated are largely unknown. Here, using extensive mutagenesis of expression plasmids and RNAi screening, we reveal that circularization of the Drosophila laccase2 gene is regulated by both intronic repeats and trans-acting splicing factors. Analogous to what has been observed in humans and mice, base-pairing between highly complementary transposable elements facilitates backsplicing. Long flanking repeats (∼400 nucleotides [nt]) promote circularization cotranscriptionally, whereas pre-mRNAs containing minimal repeats (<40 nt) generate circular RNAs predominately after 3′ end processing. Unlike the previously characterized Muscleblind (Mbl) circular RNA, which requires the Mbl protein for its biogenesis, we found that Laccase2 circular RNA levels are not controlled by Mbl or the Laccase2 gene product but rather by multiple hnRNP (heterogeneous nuclear ribonucleoprotein) and SR (serine–arginine) proteins acting in a combinatorial manner. hnRNP and SR proteins also regulate the expression of other Drosophila circular RNAs, including Plexin A (PlexA), suggesting a common strategy for regulating backsplicing. Furthermore, the laccase2 flanking introns support efficient circularization of diverse exons in Drosophila and human cells, providing a new tool for exploring the functional consequences of circular RNA expression across eukaryotes. PMID:26450910

Analysis of sequence variation among smeDEF multi drug efflux pump genes and flanking DNA from defined 16S rRNA subgroups of clinical Stenotrophomonas maltophilia isolates.

PubMed

Gould, Virginia C; Okazaki, Aki; Howe, Robin A; Avison, Matthew B

2004-08-01

To determine the level of variation in the smeDEF efflux pump and smeT transcriptional regulator genes among three defined 16S rRNA sequence subgroups of clinical Stenotrophomonas maltophilia isolates. smeDEF sequencing used a PCR genome walking approach. Determination of the sequence surrounding smeDEF used a flanking primer PCR method and specific primers anchored in smeD or smeF together with random primers. smeDEF is chromosomal and located in the same position in the chromosome in all three subgroups of isolates. Flanking smeD is a gene, smeT, encoding a putative transcriptional repressor for smeDEF. Variation at these loci among the isolates is considerably lower (up to 10%) than at intrinsic beta-lactamase loci (up to 30%) in the same isolates, implying greater functional constraint. The smeD-smeT intergenic region contains a highly conserved section, which maps with previously predicted promoter/operator regions, and a hypervariable untranslated region, which can be used to subgroup clinical isolates. These data provide further evidence that it is possible to group clinical isolates of the inherently variable species, S. maltophilia, based on genotypic properties. Isolate D457, in which most work concerning smeDEF expression has been performed, does not fall into S. maltophilia subgroup A, which is the most typical.

Genetic and biochemical characterization of an acquired subgroup B3 metallo-β-lactamase gene, blaAIM-1, and its unique genetic context in Pseudomonas aeruginosa from Australia.

PubMed

Yong, Dongeun; Toleman, Mark A; Bell, Jan; Ritchie, Brett; Pratt, Rachael; Ryley, Henry; Walsh, Timothy R

2012-12-01

Three clinical Pseudomonas aeruginosa isolates (WCH2677, WCH2813, and WCH2837) isolated from the Women's and Children's Hospital, Adelaide, Australia, produced a metallo-β-lactamase (MBL)-positive Etest result. All isolates were PCR negative for known MBL genes. A gene bank was created, and an MBL gene, designated bla(AIM-1), was cloned and fully characterized. The encoded enzyme, AIM-1, is a group B3 MBL that has the highest level of identity to THIN-B and L1. It is chromosomal and flanked by two copies (one intact and one truncated) of an ISCR element, ISCR15. Southern hybridization studies indicated the movement of both ISCR15 and bla(AIM-1) within the three different clinical isolates. AIM-1 hydrolyzes most β-lactams, with the exception of aztreonam and, to a lesser extent, ceftazidime; however, it possesses significantly higher k(cat) values for cefepime and carbapenems than most other MBLs. AIM-1 was the first mobile group B3 enzyme detected and signals further problems for already beleaguered antimicrobial regimes to treat serious P. aeruginosa and other Gram-negative infections.

Use of virion DNA as a cloning vector for the construction of mutant and recombinant herpesviruses.

PubMed

Duboise, S M; Guo, J; Desrosiers, R C; Jung, J U

1996-10-15

We have developed improved procedures for the isolation of deletion mutant, point mutant, and recombinant herpesvirus saimiri. These procedures take advantage of the absence of NotI and AscI restriction enzyme sites within the viral genome and use reporter genes for the identification of recombinant viruses. Genes for secreted engineered alkaline phosphatase and green fluorescent protein were placed under simian virus 40 early promoter control and flanked by NotI and AscI restriction sites. When permissive cells were cotransfected with herpesvirus saimiri virion DNA and one of the engineered reporter genes cloned within herpesvirus saimiri sequences, recombinant viruses were readily identified and purified on the basis of expression of the reporter gene. Digestion of recombinant virion DNA with NotI or AscI was used to delete the reporter gene from the recombinant herpesvirus saimiri. Replacement of the reporter gene can be achieved by NotI or AscI digestion of virion DNA and ligation with a terminally matched fragment or, alternatively, by homologous recombination in cotransfected cells. Any gene can, in theory, be cloned directly into the virion DNA when flanked by the appropriate NotI or AscI sites. These procedures should be widely applicable in their general form to most or all herpesviruses that replicate permissively in cultured cells.

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

PubMed

Meng, C X; Wei, W; Su, Z- L; Qin, S

2006-10-01

Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

Evidence for microbial carbon and sulfur cycling in deeply buried ridge flank basalt

USGS Publications Warehouse

Lever, Mark A.; Rouxel, Olivier; Alt, Jeffrey C.; Shimizu, Nobumichi; Ono, Shuhei; Coggon, Rosalind M.; Shanks, Wayne C.; Lapham, Laura; Elvert, Marcus; Prieto-Mollar, Xavier; Hinrichs, Kai-Uwe; Inagaki, Fumio; Teske, Andreas

2013-01-01

Sediment-covered basalt on the flanks of mid-ocean ridges constitutes most of Earth's oceanic crust, but the composition and metabolic function of its microbial ecosystem are largely unknown. By drilling into 3.5-million-year-old subseafloor basalt, we demonstrated the presence of methane- and sulfur-cycling microbes on the eastern flank of the Juan de Fuca Ridge. Depth horizons with functional genes indicative of methane-cycling and sulfate-reducing microorganisms are enriched in solid-phase sulfur and total organic carbon, host δ13C- and δ34S-isotopic values with a biological imprint, and show clear signs of microbial activity when incubated in the laboratory. Downcore changes in carbon and sulfur cycling show discrete geochemical intervals with chemoautotrophic δ13C signatures locally attenuated by heterotrophic metabolism.

WUS and STM-based reporter genes for studying meristem development in poplar

USDA-ARS?s Scientific Manuscript database

We describe the development of a reporter system for monitoring meristem initiation in poplar using promoters of poplar homologs to the meristem-active regulatory genes WUSCHEL (WUS) and SHOOTMERISTEMLESS (STM). When ~3 kb of the 5’ flanking regions of close homologs were used to drive expression o...

Intergenic Sequence Ribotyping using a region neighboring dkgB links genovar to Kauffman-White serotype of Salmonella enterica

USDA-ARS?s Scientific Manuscript database

Previous research identified that the 5S ribosomal (rrn) gene and associated flanking sequences that are closely linked to the dkgB gene of Salmonella enterica were highly variable between serotypes, but not between subpopulations within the same serotype (PMID: 17005008). The degree of variability ...

Rcount: simple and flexible RNA-Seq read counting.

PubMed

Schmid, Marc W; Grossniklaus, Ueli

2015-02-01

Analysis of differential gene expression by RNA sequencing (RNA-Seq) is frequently done using feature counts, i.e. the number of reads mapping to a gene. However, commonly used count algorithms (e.g. HTSeq) do not address the problem of reads aligning with multiple locations in the genome (multireads) or reads aligning with positions where two or more genes overlap (ambiguous reads). Rcount specifically addresses these issues. Furthermore, Rcount allows the user to assign priorities to certain feature types (e.g. higher priority for protein-coding genes compared to rRNA-coding genes) or to add flanking regions. Rcount provides a fast and easy-to-use graphical user interface requiring no command line or programming skills. It is implemented in C++ using the SeqAn (www.seqan.de) and the Qt libraries (qt-project.org). Source code and 64 bit binaries for (Ubuntu) Linux, Windows (7) and MacOSX are released under the GPLv3 license and are freely available on github.com/MWSchmid/Rcount. marcschmid@gmx.ch Test data, genome annotation files, useful Python and R scripts and a step-by-step user guide (including run-time and memory usage tests) are available on github.com/MWSchmid/Rcount. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

1987-11-01

To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

The importance of the specific Z-DNA structure and polyamines in carcinogenesis: fact or fiction.

PubMed

Juranic, Z; Kidric, M; Tomin, R; Juranić, I; Spuzić, I; Petrović, J

1991-08-01

In this work some aspects of carcinogenesis are given. The importance of the emergence of Z or H DNA structure in the gene, or in the flanking gene sequences for the gene deletion and unusual gene recombination, is discussed. Some considerations on the role of selective pressure (of polyamines, of Mg2+, of the various levels of topoisomerase II, and of ATP) in the process of oncogene amplification, are given too.

The 5S RNA gene minichromosome of Euplotes.

PubMed Central

Roberson, A E; Wolffe, A P; Hauser, L J; Olins, D E

1989-01-01

The macronucleus of the ciliated protozoan Euplotes eurystomus contains about 10(6) copies of a single type of 5S ribosomal RNA gene. This 5S gene DNA is only 930 bp long, is flanked by telomeres, and contains a single coding region of 120 bp which serves as a template for transcription in vivo and in vitro. The 5S gene minichromatin possesses four positioned nucleosomes and hypersensitive cleavage sites in the telomeric regions. Images PMID:2501759

Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.

PubMed

Wang, Limei; Beer, Steven V

2006-12-01

To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.

Cloning and Characterization of 5′ Flanking Regulatory Sequences of AhLEC1B Gene from Arachis Hypogaea L.

PubMed Central

Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei

2015-01-01

LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444

Varicella-zoster virus (VZV) origin of DNA replication oriS influences origin-dependent DNA replication and flanking gene transcription.

PubMed

Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M

2015-07-01

The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.

Genetic analysis and fine mapping of LH1 and LH2, a set of complementary genes controlling late heading in rice (Oryza sativa L.)

PubMed Central

Liu, Shuang; Wang, Feng; Gao, Li Jun; Li, Jin Hua; Li, Rong Bai; Gao, Han Liang; Deng, Guo Fu; Yang, Jin Shui; Luo, Xiao Jin

2012-01-01

Heading date in rice (Oryza sativa L.) is a critical agronomic trait with a complex inheritance. To investigate the genetic basis and mechanism of gene interaction in heading date, we conducted genetic analysis on segregation populations derived from crosses among the indica cultivars Bo B, Yuefeng B and Baoxuan 2. A set of dominant complementary genes controlling late heading, designated LH1 and LH2, were detected by molecular marker mapping. Genetic analysis revealed that Baoxuan 2 contains both dominant genes, while Bo B and Yuefeng B each possess either LH1 or LH2. Using larger populations with segregant ratios of 3 : 1, we fine-mapped LH1 to a 63-kb region near the centromere of chromosome 7 flanked by markers RM5436 and RM8034, and LH2 to a 177-kb region on the short arm of chromosome 8 between flanking markers Indel22468-3 and RM25. Some candidate genes were identified through sequencing of Bo B and Yuefeng B in these target regions. Our work provides a solid foundation for further study on gene interaction in heading date and has application in marker-assisted breeding of photosensitive hybrid rice in China. PMID:23341744

Genetic analysis and fine mapping of LH1 and LH2, a set of complementary genes controlling late heading in rice (Oryza sativa L.).

PubMed

Liu, Shuang; Wang, Feng; Gao, Li Jun; Li, Jin Hua; Li, Rong Bai; Gao, Han Liang; Deng, Guo Fu; Yang, Jin Shui; Luo, Xiao Jin

2012-12-01

Heading date in rice (Oryza sativa L.) is a critical agronomic trait with a complex inheritance. To investigate the genetic basis and mechanism of gene interaction in heading date, we conducted genetic analysis on segregation populations derived from crosses among the indica cultivars Bo B, Yuefeng B and Baoxuan 2. A set of dominant complementary genes controlling late heading, designated LH1 and LH2, were detected by molecular marker mapping. Genetic analysis revealed that Baoxuan 2 contains both dominant genes, while Bo B and Yuefeng B each possess either LH1 or LH2. Using larger populations with segregant ratios of 3 : 1, we fine-mapped LH1 to a 63-kb region near the centromere of chromosome 7 flanked by markers RM5436 and RM8034, and LH2 to a 177-kb region on the short arm of chromosome 8 between flanking markers Indel22468-3 and RM25. Some candidate genes were identified through sequencing of Bo B and Yuefeng B in these target regions. Our work provides a solid foundation for further study on gene interaction in heading date and has application in marker-assisted breeding of photosensitive hybrid rice in China.

Isolation, X location and activity of the marsupial homologue of SLC16A2, an XIST-flanking gene in eutherian mammals

PubMed Central

Wakefield, Matthew J.; Walcher, Cristina; Disteche, Christine M.; Whitehead, Siobhan; Ross, Mark; Marshall Graves, Jennifer A.

2010-01-01

X chromosome inactivation (XCI) achieves dosage compensation between males and females for most X-linked genes in eutherian mammals. It is a whole-chromosome effect under the control of the XIST locus, although some genes escape inactivation. Marsupial XCI differs from the eutherian process, implying fundamental changes in the XCI mechanism during the evolution of the two lineages. There is no direct evidence for the existence of a marsupial XIST homologue. XCI has been studied for only a handful of genes in any marsupial, and none in the model kangaroo Macropus eugenii (the tammar wallaby). We have therefore studied the sequence, location and activity of a gene SLC16A2 (solute carrier, family 16, class A, member 2) that flanks XIST on the human and mouse X chromosomes. A BAC clone containing the marsupial SLC16A2 was mapped to the end of the long arm of the tammar X chromosome and used in RNA FISH experiments to determine whether one or both loci are transcribed in female cells. In male and female cells, only a single signal was found, indicating that the marsupial SLC16A2 gene is silenced on the inactivated X. PMID:16235118

Glider and Vision: two new families of miniature inverted-repeat transposable elements in Xenopus laevis genome.

PubMed

Lepetit, D; Pasquet, S; Olive, M; Thézé, N; Thiébaud, P

2000-01-01

We have characterised from Xenopus laevis two new short interspersed repetitive elements, we have named Glider and Vision, that belong to the family of miniature inverted-repeat transposable elements (MITEs). Glider was first characterised in an intronic region of the alpha-tropomyosin (alpha-TM) gene and database search has revealed the presence of this element in 10 other Xenopus laevis genes. Glider elements are about 150 bp long and for some of them, their terminal inverted repeats are flanked by potential target-site duplications. Evidence for the mobility of Glider element has been provided by the presence/absence of one element at corresponding location in duplicated alpha-TM genes. Vision element has been identified in the promoter region of the cyclin dependant kinase 2 gene (cdk2) where it is boxed in a Glider element. Vision is 284bp long and is framed by 14-bp terminal inverted repeats that are flanked by 7-bp direct repeats. We have estimated that there are about 20,000 and 300 copies of Glider and Vision respectively scattered throughout the Xenopus laevis genome. Every MITEs elements but two described in our study are found either in 5' or in 3' regulatory regions of genes suggesting a potential role in gene regulation.

A candidate gene study in low HDL-cholesterol families provides evidence for the involvement of the APOA2 gene and the APOA1C3A4 gene cluster.

PubMed

Lilja, Heidi E; Soro, Aino; Ylitalo, Kati; Nuotio, Ilpo; Viikari, Jorma S A; Salomaa, Veikko; Vartiainen, Erkki; Taskinen, Marja-Riitta; Peltonen, Leena; Pajukanta, Päivi

2002-09-01

In patients with premature coronary heart disease, the most common lipoprotein abnormality is high-density lipoprotein (HDL) deficiency. To assess the genetic background of the low HDL-cholesterol trait, we performed a candidate gene study in 25 families with low HDL, collected from the genetically isolated population of Finland. We studied 21 genes encoding essential proteins involved in the HDL metabolism by genotyping intragenic and flanking markers for these genes. We found suggestive evidence for linkage in two candidate regions: Marker D1S2844, in the apolipoprotein A-II (APOA2) region, yielded a LOD score of 2.14 and marker D11S939 flanking the apolipoprotein A-I/C-III/A-IV gene cluster (APOA1C3A4) produced a LOD score of 1.69. Interestingly, we identified potential shared haplotypes in these two regions in a subset of low HDL families. These families also contributed to the obtained positive LOD scores, whereas the rest of the families produced negative LOD scores. None of the remaining candidate regions provided any evidence for linkage. Since only a limited number of loci were tested in this candidate gene study, these LOD scores suggest significant involvement of the APOA2 gene and the APOA1C3A4 gene cluster, or loci in their immediate vicinity, in the pathogenesis of low HDL.

Comprehensive search for accessory proteins encoded with archaeal and bacterial type III CRISPR-cas gene cassettes reveals 39 new cas gene families.

PubMed

Shah, Shiraz A; Alkhnbashi, Omer S; Behler, Juliane; Han, Wenyuan; She, Qunxin; Hess, Wolfgang R; Garrett, Roger A; Backofen, Rolf

2018-06-19

A study was undertaken to identify conserved proteins that are encoded adjacent to cas gene cassettes of Type III CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats - CRISPR associated) interference modules. Type III modules have been shown to target and degrade dsDNA, ssDNA and ssRNA and are frequently intertwined with cofunctional accessory genes, including genes encoding CRISPR-associated Rossman Fold (CARF) domains. Using a comparative genomics approach, and defining a Type III association score accounting for coevolution and specificity of flanking genes, we identified and classified 39 new Type III associated gene families. Most archaeal and bacterial Type III modules were seen to be flanked by several accessory genes, around half of which did not encode CARF domains and remain of unknown function. Northern blotting and interference assays in Synechocystis confirmed that one particular non-CARF accessory protein family was involved in crRNA maturation. Non-CARF accessory genes were generally diverse, encoding nuclease, helicase, protease, ATPase, transporter and transmembrane domains with some encoding no known domains. We infer that additional families of non-CARF accessory proteins remain to be found. The method employed is scalable for potential application to metagenomic data once automated pipelines for annotation of CRISPR-Cas systems have been developed. All accessory genes found in this study are presented online in a readily accessible and searchable format for researchers to audit their model organism of choice: http://accessory.crispr.dk .

Correcting Flank Skin Laxity and Dog Ear Plus Aggressive Liposuction: A Technique for Classic Abdominoplasty in Middle-Eastern Obese Women

PubMed Central

Hosseini, Seyed Nejat; Ammari, Ali; Mousavizadeh, Seyed Mehdi

2018-01-01

BACKGROUND Nowadays obesity is a common problem as it leads to abdominal deformation and people’s dissatisfaction of their own body. This study has explored using a new surgical technique based on a different incision to reform the flank skin laxity and dog ear plus aggressive liposuction on women with abdominal deformities. METHODS From May 2014 to February 2016, 25 women were chosen for this study. All women had a body mass index more than 28 kg/m2, flank folding, bulging and excess fat, abdominal and flank skin sagging and laxity. An important point of the new technique was that the paramedian perforator was preserved. RESULTS All women were between 33 and 62 years old (mean age of 47±7.2 years old). The average amount of liposuction aspirate was 2,350 mL (1700-3200 mL), and the size of average excised skin ellipse was 23.62×16.08 cm (from 19×15 to 27×18 cm). Dog ear, skin laxity, bulging and fat deposit correction were assessed and scored in two and four months after the surgery. CONCLUSION Aggressive abdominal and flank liposuction can be safely done when paramedian perforator is preserved. This has a good cosmetic result in the abdomen and flank and prevents bulging in the incision end and flank. Using this abdominoplasty technique is recommended on patients with high body mass indexes. PMID:29651396

Correcting Flank Skin Laxity and Dog Ear Plus Aggressive Liposuction: A Technique for Classic Abdominoplasty in Middle-Eastern Obese Women.

PubMed

Hosseini, Seyed Nejat; Ammari, Ali; Mousavizadeh, Seyed Mehdi

2018-01-01

Nowadays obesity is a common problem as it leads to abdominal deformation and people's dissatisfaction of their own body. This study has explored using a new surgical technique based on a different incision to reform the flank skin laxity and dog ear plus aggressive liposuction on women with abdominal deformities. From May 2014 to February 2016 , 25 women were chosen for this study. All women had a body mass index more than 28 kg/m 2 , flank folding, bulging and excess fat, abdominal and flank skin sagging and laxity. An important point of the new technique was that the paramedian perforator was preserved. All women were between 33 and 62 years old (mean age of 47±7.2 years old). The average amount of liposuction aspirate was 2,350 mL (1700-3200 mL), and the size of average excised skin ellipse was 23.62×16.08 cm (from 19×15 to 27×18 cm). Dog ear, skin laxity, bulging and fat deposit correction were assessed and scored in two and four months after the surgery. Aggressive abdominal and flank liposuction can be safely done when paramedian perforator is preserved. This has a good cosmetic result in the abdomen and flank and prevents bulging in the incision end and flank. Using this abdominoplasty technique is recommended on patients with high body mass indexes.

Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.

PubMed

Cox, J M; Sloan, L S; Schepartz, A

1995-12-01

HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.

PRIMARY STRUCTURE OF THE CYTOCHROME P450 LANOSTEROL 14A-DEMETHYLASE GENE FROM CANDIDA TROPICALIS

EPA Science Inventory

We report the nucleotide sequence of the gene and flanking DNA for the cytochrome P450 lanosterol 14 alpha-demethylase (14DM) from the yeast Candida tropicalis ATCC750. An open reading frame (ORF) of 528 codons encoding a 60.9-kD protein is identified. This ORF includes a charact...

Esrrb-Cre Excises loxP-Flanked Alleles in Early Four-Cell Embryos

PubMed Central

Kim, Suyeon; Shaffer, Benjamin; Simerly, Calvin R.; Richard Chaillet, J.; Barak, Yaacov

2015-01-01

Among transgenic mice with ubiquitous Cre recombinase activity, all strains to date excise loxP-flanked (floxed) alleles, either at or before the zygote stage or at nondescript stages of development. This manuscript describes a new mouse strain, in which Cre recombinase, integrated into the Esrrb locus, efficiently excises floxed alleles in pre-implantation embryos at the onset of the four-cell stage. By enabling inactivation of genes only after the embryo has undergone two cleavages, this strain should facilitate in vivo studies of genes with essential gametic or zygotic functions. In addition, this study describes a new, highly pluripotent hybrid C57BL/6J × 129S1/SvImJ mouse embryonic stem cell line, HYB12, in which this knock-in and additional targeted alleles have been generated. PMID:26663459

Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins.

PubMed

Kramer, Marianne C; Liang, Dongming; Tatomer, Deirdre C; Gold, Beth; March, Zachary M; Cherry, Sara; Wilusz, Jeremy E

2015-10-15

Thousands of eukaryotic protein-coding genes are noncanonically spliced to produce circular RNAs. Bioinformatics has indicated that long introns generally flank exons that circularize in Drosophila, but the underlying mechanisms by which these circular RNAs are generated are largely unknown. Here, using extensive mutagenesis of expression plasmids and RNAi screening, we reveal that circularization of the Drosophila laccase2 gene is regulated by both intronic repeats and trans-acting splicing factors. Analogous to what has been observed in humans and mice, base-pairing between highly complementary transposable elements facilitates backsplicing. Long flanking repeats (∼ 400 nucleotides [nt]) promote circularization cotranscriptionally, whereas pre-mRNAs containing minimal repeats (<40 nt) generate circular RNAs predominately after 3' end processing. Unlike the previously characterized Muscleblind (Mbl) circular RNA, which requires the Mbl protein for its biogenesis, we found that Laccase2 circular RNA levels are not controlled by Mbl or the Laccase2 gene product but rather by multiple hnRNP (heterogeneous nuclear ribonucleoprotein) and SR (serine-arginine) proteins acting in a combinatorial manner. hnRNP and SR proteins also regulate the expression of other Drosophila circular RNAs, including Plexin A (PlexA), suggesting a common strategy for regulating backsplicing. Furthermore, the laccase2 flanking introns support efficient circularization of diverse exons in Drosophila and human cells, providing a new tool for exploring the functional consequences of circular RNA expression across eukaryotes. © 2015 Kramer et al.; Published by Cold Spring Harbor Laboratory Press.

Refining the region of branchio-oto-renal syndrome and defining the flanking markers on chromosome 8q by genetic mapping.

PubMed Central

Kumar, S.; Kimberling, W. J.; Connolly, C. J.; Tinley, S.; Marres, H. A.; Cremers, C. W.

1994-01-01

Branchio-oto-renal syndrome (BOR) is an autosomal dominant disorder associated with external-, middle-, and inner-ear malformations, branchial cleft sinuses, cervical fistulas, mixed hearing loss, and renal anomalies. The gene for BOR was mapped to the long arm of chromosome 8q. Several polymorphic dinucleotide repeat markers were investigated for linkage in two large BOR families, and the region of localization was refined. Two-point linkage analysis yielded the maximum lod scores of 7.44 at theta = .03 and 6.71 at theta = .04, with markers D8S279 and D8S260, respectively. A multipoint analysis was carried out to position the BOR gene with a defined region using markers D8S165, D8S285, PENK, D8S166, D8S260, D8S279, D8S164, D8S286, D8S84, D8S275, D8S167, D8S273, and D8S271. Haplotype analysis of recombination events at these polymorphic loci was also performed in multigeneration BOR kindreds. The linkage analysis and analysis of recombination events identified markers that clearly flank the BOR locus. The order was determined to be D8S260-BOR-D8S279 at odds > 10(3):1 over the other possible orders. This flanking markers provide a resource for high-resolution mapping toward cloning and characterizing the BOR gene. PMID:7977379

Analysis, Characterization, and Loci of the tuf Genes in Lactobacillus and Bifidobacterium Species and Their Direct Application for Species Identification

PubMed Central

Ventura, Marco; Canchaya, Carlos; Meylan, Valèrie; Klaenhammer, Todd R.; Zink, Ralf

2003-01-01

We analyzed the tuf gene, encoding elongation factor Tu, from 33 strains representing 17 Lactobacillus species and 8 Bifidobacterium species. The tuf sequences were aligned and used to infer phylogenesis among species of lactobacilli and bifidobacteria. We demonstrated that the synonymous substitution affecting this gene renders elongation factor Tu a reliable molecular clock for investigating evolutionary distances of lactobacilli and bifidobacteria. In fact, the phylogeny generated by these tuf sequences is consistent with that derived from 16S rRNA analysis. The investigation of a multiple alignment of tuf sequences revealed regions conserved among strains belonging to the same species but distinct from those of other species. PCR primers complementary to these regions allowed species-specific identification of closely related species, such as Lactobacillus casei group members. These tuf gene-based assays developed in this study provide an alternative to present methods for the identification for lactic acid bacterial species. Since a variable number of tuf genes have been described for bacteria, the presence of multiple genes was examined. Southern analysis revealed one tuf gene in the genomes of lactobacilli and bifidobacteria, but the tuf gene was arranged differently in the genomes of these two taxa. Our results revealed that the tuf gene in bifidobacteria is flanked by the same gene constellation as the str operon, as originally reported for Escherichia coli. In contrast, bioinformatic and transcriptional analyses of the DNA region flanking the tuf gene in four Lactobacillus species indicated the same four-gene unit and suggested a novel tuf operon specific for the genus Lactobacillus. PMID:14602655

Genes with minimal phylogenetic information are problematic for coalescent analyses when gene tree estimation is biased.

PubMed

Xi, Zhenxiang; Liu, Liang; Davis, Charles C

2015-11-01

The development and application of coalescent methods are undergoing rapid changes. One little explored area that bears on the application of gene-tree-based coalescent methods to species tree estimation is gene informativeness. Here, we investigate the accuracy of these coalescent methods when genes have minimal phylogenetic information, including the implementation of the multilocus bootstrap approach. Using simulated DNA sequences, we demonstrate that genes with minimal phylogenetic information can produce unreliable gene trees (i.e., high error in gene tree estimation), which may in turn reduce the accuracy of species tree estimation using gene-tree-based coalescent methods. We demonstrate that this problem can be alleviated by sampling more genes, as is commonly done in large-scale phylogenomic analyses. This applies even when these genes are minimally informative. If gene tree estimation is biased, however, gene-tree-based coalescent analyses will produce inconsistent results, which cannot be remedied by increasing the number of genes. In this case, it is not the gene-tree-based coalescent methods that are flawed, but rather the input data (i.e., estimated gene trees). Along these lines, the commonly used program PhyML has a tendency to infer one particular bifurcating topology even though it is best represented as a polytomy. We additionally corroborate these findings by analyzing the 183-locus mammal data set assembled by McCormack et al. (2012) using ultra-conserved elements (UCEs) and flanking DNA. Lastly, we demonstrate that when employing the multilocus bootstrap approach on this 183-locus data set, there is no strong conflict between species trees estimated from concatenation and gene-tree-based coalescent analyses, as has been previously suggested by Gatesy and Springer (2014). Copyright © 2015 Elsevier Inc. All rights reserved.

A Tet-on and Cre-loxP Based Genetic Engineering System for Convenient Recycling of Selection Markers in Penicillium oxalicum

PubMed Central

Jiang, Baojie; Zhang, Ruiqin; Feng, Dan; Wang, Fangzhong; Liu, Kuimei; Jiang, Yi; Niu, Kangle; Yuan, Quanquan; Wang, Mingyu; Wang, Hailong; Zhang, Youming; Fang, Xu

2016-01-01

The lack of selective markers has been a key problem preventing multistep genetic engineering in filamentous fungi, particularly for industrial species such as the lignocellulose degrading Penicillium oxalicum JUA10-1(formerly named as Penicillium decumbens). To resolve this problem, we constructed a genetic manipulation system taking advantage of two established genetic systems: the Cre-loxP system and Tet-on system in P. oxalicum JUA10-1. This system is efficient and convenient. The expression of Cre recombinase was activated by doxycycline since it was controlled by Tet-on system. Using this system, two genes, ligD and bglI, were sequentially disrupted by loxP flanked ptrA. The successful application of this procedure will provide a useful tool for genetic engineering in filamentous fungi. This system will also play an important role in improving the productivity of interesting products and minimizing by-product when fermented by filamentous fungi. PMID:27148179

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

Targeted discovery of single-nucleotide polymorphisms in an unmarked wheat chromosomal region containing the Hessian fly resistance gene H33

USDA-ARS?s Scientific Manuscript database

The highly effective Hessian fly-resistance gene, H33, was introgressed from durum wheat into common wheat and genetically mapped to chromosome 3AS, in previous research. However, H33 located to a region that is well-known to be devoid of molecular markers, with the closest flanking simple sequence ...

Human Xq28 Inversion Polymorphism: From Sex Linkage to Genomics--A Genetic Mother Lode

ERIC Educational Resources Information Center

Kirby, Cait S.; Kolber, Natalie; Salih Almohaidi, Asmaa M.; Bierwert, Lou Ann; Saunders, Lori; Williams, Steven; Merritt, Robert

2016-01-01

An inversion polymorphism of the filamin and emerin genes at the tip of the long arm of the human X-chromosome serves as the basis of an investigative laboratory in which students learn something new about their own genomes. Long, nearly identical inverted repeats flanking the filamin and emerin genes illustrate how repetitive elements can lead to…

QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

PubMed

Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

2009-07-01

Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

A novel Xp22.13 microdeletion in Nance-Horan syndrome.

PubMed

Accogli, Andrea; Traverso, Monica; Madia, Francesca; Bellini, Tommaso; Vari, Maria Stella; Pinto, Francesca; Capra, Valeria

2017-07-03

Nance-Horan syndrome (NHS) is a rare X-linked developmental disorder characterized by congenital cataract, dental anomalies and facial dysmorphisms. Notably, up to 30% of NHS patients have intellectual disability and a few patients have been reported to have congenital cardiac defects. Nance-Horan syndrome is caused by mutations in the NHS gene that is highly expressed in the midbrain, retina, lens, tooth, and is conserved across vertebrate species. Although most pathogenic mutations are nonsense mutations, a few genomic rearrangements involving NHS locus have been reported, suggesting a possible pathogenic role of the flanking genes. Here, we report a microdeletion of 170,6 Kb at Xp22.13 (17.733.948-17.904.576) (GRCh37/hg19), detected by array-based comparative genomic hybridization in an Italian boy with NHS syndrome. The microdeletion harbors the NHS, SCLML1, and RAI2 genes and results in a phenotype consistent with NSH syndrome and developmental delay. We compare our case with the previous Xp22.13 microdeletions and discuss the possible pathogenetic role of the flanking genes. Birth Defects Research 109:866-868, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Virulence factor rtx in Legionella pneumophila, evidence suggesting it is a modular multifunctional protein.

PubMed

D'Auria, Giuseppe; Jiménez, Núria; Peris-Bondia, Francesc; Pelaz, Carmen; Latorre, Amparo; Moya, Andrés

2008-01-14

The repeats in toxin (Rtx) are an important pathogenicity factor involved in host cells invasion of Legionella pneumophila and other pathogenic bacteria. Its role in escaping the host immune system and cytotoxic activity is well known. Its repeated motives and modularity make Rtx a multifunctional factor in pathogenicity. The comparative analysis of rtx gene among 6 strains of L. pneumophila showed modularity in their structures. Among compared genomes, the N-terminal region of the protein presents highly dissimilar repeats with functionally similar domains. On the contrary, the C-terminal region is maintained with a fashionable modular configuration, which gives support to its proposed role in adhesion and pore formation. Despite the variability of rtx among the considered strains, the flanking genes are maintained in synteny and similarity. In contrast to the extracellular bacteria Vibrio cholerae, in which the rtx gene is highly conserved and flanking genes have lost synteny and similarity, the gene region coding for the Rtx toxin in the intracellular pathogen L. pneumophila shows a rapid evolution. Changes in the rtx could play a role in pathogenicity. The interplay of the Rtx toxin with host membranes might lead to the evolution of new variants that are able to escape host cell defences.

Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

PubMed

Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

2014-01-10

Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first experimental evidence of a pseudogene with stronger promoter activity than its parental gene. © 2013.

Application of the FLP/FRT system for conditional gene deletion in yeast Saccharomyces cerevisiae.

PubMed

Park, Yang-Nim; Masison, Daniel; Eisenberg, Evan; Greene, Lois E

2011-09-01

The yeast Saccharomyces cerevisiae has proved to be an excellent model organism to study the function of proteins. One of the many advantages of yeast is the many genetic tools available to manipulate gene expression, but there are still limitations. To complement the many methods used to control gene expression in yeast, we have established a conditional gene deletion system by using the FLP/FRT system on yeast vectors to conditionally delete specific yeast genes. Expression of Flp recombinase, which is under the control of the GAL1 promoter, was induced by galactose, which in turn excised FRT sites flanked genes. The efficacy of this system was examined using the FRT site-flanked genes HSP104, URA3 and GFP. The pre-excision frequency of this system, which might be caused by the basal activity of the GAL1 promoter or by spontaneous recombination between FRT sites, was detected ca. 2% under the non-selecting condition. After inducing expression of Flp recombinase, the deletion efficiency achieved ca. 96% of cells in a population within 9 h. After conditional deletion of the specific gene, protein degradation and cell division then diluted out protein that was expressed from this gene prior to its excision. Most importantly, the specific protein to be deleted could be expressed under its own promoter, so that endogenous levels of protein expression were maintained prior to excision by the Flp recombinase. Therefore, this system provides a useful tool for the conditional deletion of genes in yeast. Published in 2011 by John Wiley & Sons, Ltd.

The context of transcription start site regions is crucial for transcription of a plant tRNA(Lys)(UUU) gene group both in vitro and in vivo.

PubMed

Yukawa, Yasushi; Akama, Kazuhito; Noguchi, Kanta; Komiya, Masaaki; Sugiura, Masahiro

2013-01-10

Nuclear tRNA genes are transcribed by RNA polymerase III. The A- and B-boxes located within the transcribed regions are essential promoter elements for nuclear tRNA gene transcription. The Arabidopsis genome contains ten annotated genes encoding identical tRNA(Lys)(UUU) molecules, which are scattered on the five chromosomes. In this study, we prepared ten tDNA constructs including each of the tRNA(Lys)(UUU) coding sequences with their individual 5' and 3' flanking sequences, and assayed tRNA expression using an in vitro RNA polymerase III-dependent transcription system. Transcription levels differed significantly among the ten genes and two of the tRNA genes were transcribed at a very low level, despite possessing A- and B-boxes identical to those of the other tRNA genes. To examine whether the in vitro results were reproducible in vivo, the 5' flanking sequence of an amber suppressor tRNA gene was then replaced with those of the ten tRNA(Lys) genes. An in vivo experiment based on an amber suppressor tRNA that mediates suppression of a premature amber codon in a β-glucuronidase (GUS) reporter gene in plant tissues generated nearly identical results to those obtained in vitro. Analysis of mutated versions of the amber suppressor tRNA gene, which contained base substitutions around the transcription start site (TSS), showed that the context around the transcription start sites is a crucial determinant for transcription of plant tRNA(Lys)(UUU) both in vitro and in vivo. The above transcription regulation by context around TSS differed between tRNA genes and other Pol III-dependent genes. Copyright © 2012 Elsevier B.V. All rights reserved.

Circular RNA biogenesis can proceed through an exon-containing lariat precursor.

PubMed

Barrett, Steven P; Wang, Peter L; Salzman, Julia

2015-06-09

Pervasive expression of circular RNA is a recently discovered feature of eukaryotic gene expression programs, yet its function remains largely unknown. The presumed biogenesis of these RNAs involves a non-canonical 'backsplicing' event. Recent studies in mammalian cell culture posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s). Although such sequence elements are common in mammals, they are rare in lower eukaryotes, making current models insufficient to describe circularization. Through systematic splice site mutagenesis and the identification of splicing intermediates, we show that circular RNA in Schizosaccharomyces pombe is generated through an exon-containing lariat precursor. Furthermore, we have performed high-throughput and comprehensive mutagenesis of a circle-forming exon, which enabled us to discover a systematic effect of exon length on RNA circularization. Our results uncover a mechanism for circular RNA biogenesis that may account for circularization in genes that lack noticeable flanking intronic secondary structure.

Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast

PubMed Central

MacDonald, Chris; Piper, Robert C.

2015-01-01

Here we expand the set of tools for genetically manipulating Saccharomyces cerevisiae. We show that puromycin-resistance can be achieved in yeast through expression of a bacterial puromycin-resistance gene optimized to the yeast codon bias, which in turn serves as an easy to use dominant genetic marker suitable for gene disruption. We have constructed a similar DNA cassette expressing yeast codon-optimized mutant human dihydrofolate reductase (DHFR) that confers resistance to methotrexate and can also be used as a dominant selectable marker. Both of these drug-resistant marker cassettes are flanked by loxP sites allowing for their excision from the genome following expression of cre-recombinase. Finally, we have created a series of plasmids for low-level constitutive expression of cre-recombinase in yeast that allows for efficient excision of loxP-flanked markers. PMID:25688547

Thermal surveillance of active volcanoes

NASA Technical Reports Server (NTRS)

Friedman, J. D. (Principal Investigator)

1973-01-01

The author has identified the following significant results. There are three significant scientific results of the discovery of 48 pinpoint anomalies on the upper flanks of Mt. Rainier: (1) Many of these points may actually be the location of fumarolic vapor emission or warm ground considerably below the summit crater. (2) Discovery of these small anomalies required specific V/H scanner settings for precise elevation on Mt. Rainier's flank, to avoid smearing the anomalies to the point of nonrecognition. Several past missions flown to map the thermal anomalies of the summit area did not/detect the flank anomalies. (3) This illustrates the value of the aerial IR scanner as a geophysical tool suited to specific problem-oriented missions, in contrast to its more general value in a regional or reconnaissance anomaly-mapping role.

Identification of the maize gravitropism gene lazy plant1 by a transposon-tagging genome resequencing strategy.

PubMed

Howard, Thomas P; Hayward, Andrew P; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A; Tohme, Joe; Kausch, Albert P; Mottinger, John P; Dellaporta, Stephen L

2014-01-01

Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform.

Identification of the Maize Gravitropism Gene lazy plant1 by a Transposon-Tagging Genome Resequencing Strategy

PubMed Central

Howard, Thomas P.; Hayward, Andrew P.; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A.; Tohme, Joe; Kausch, Albert P.; Mottinger, John P.; Dellaporta, Stephen L.

2014-01-01

Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform. PMID:24498020

Molecular and Genetic Characterization of the Drosophila Melanogaster 87e Actin Gene Region

PubMed Central

Manseau, L. J.; Ganetzky, B.; Craig, E. A.

1988-01-01

A combined molecular and genetic analysis of the 87E actin gene (Act87E) in Drosophila melanogaster was undertaken. A clone of Act87E was isolated and characterized. The Act87E transcription unit is 1.57 kb and includes a 556-base intervening sequence in the 5' leader of the gene. The protein-coding region is contiguous and encodes a protein that is >93% identical to the other Drosophila actins. By in situ hybridization with a series of deficiencies that break in 87E, Act87E was localized to a region encompassing one to three faint, polytene chromosome bands. The region between the deficiency endpoints that flank the actin gene was isolated and measures approximately 24-30 kb. The closest proximal deficiency endpoint lies 8-10 kb 5' to the actin gene; the closest distal deficiency endpoint lies 16-20 kb 3' to the actin gene. A single, recessive lethal complementation group lies between the deficiency endpoints that flank the actin gene. An EMS mutagenesis screen produced four additional members of this recessive lethal complementation group. Molecular analysis of the members of this complementation group indicated that two of the newly induced mutations have deletions of approximately 1 kb in a transcribed region 4-5 kb 3' (distal) to the actin gene. This result suggests that the recessive lethal complementation group represents a gene separate from and distal to the actin gene. The mutagenesis screen failed to identify additional recessive lethal complementation groups in the actin gene-containing region. The implications of the failure to identify recessive lethal mutations in the actin gene are discussed in reference to studies of other conserved multigene families and other muscle protein mutations. PMID:2840338

Development of an efficient genetic manipulation strategy for sequential gene disruption and expression of different heterologous GFP genes in Candida tropicalis.

PubMed

Zhang, Lihua; Chen, Xianzhong; Chen, Zhen; Wang, Zezheng; Jiang, Shan; Li, Li; Pötter, Markus; Shen, Wei; Fan, You

2016-11-01

The diploid yeast Candida tropicalis, which can utilize n-alkane as a carbon and energy source, is an attractive strain for both physiological studies and practical applications. However, it presents some characteristics, such as rare codon usage, difficulty in sequential gene disruption, and inefficiency in foreign gene expression, that hamper strain improvement through genetic engineering. In this work, we present a simple and effective method for sequential gene disruption in C. tropicalis based on the use of an auxotrophic mutant host defective in orotidine monophosphate decarboxylase (URA3). The disruption cassette, which consists of a functional yeast URA3 gene flanked by a 0.3 kb gene disruption auxiliary sequence (gda) direct repeat derived from downstream or upstream of the URA3 gene and of homologous arms of the target gene, was constructed and introduced into the yeast genome by integrative transformation. Stable integrants were isolated by selection for Ura + and identified by PCR and sequencing. The important feature of this construct, which makes it very attractive, is that recombination between the flanking direct gda repeats occurs at a high frequency (10 -8 ) during mitosis. After excision of the URA3 marker, only one copy of the gda sequence remains at the recombinant locus. Thus, the resulting ura3 strain can be used again to disrupt a second allelic gene in a similar manner. In addition to this effective sequential gene disruption method, a codon-optimized green fluorescent protein-encoding gene (GFP) was functionally expressed in C. tropicalis. Thus, we propose a simple and reliable method to improve C. tropicalis by genetic manipulation.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

PubMed

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Xq28 duplication overlapping the int22h-1/int22h-2 region and including RAB39B and CLIC2 in a family with intellectual and developmental disability.

PubMed

Andersen, Erica F; Baldwin, Erin E; Ellingwood, Sara; Smith, Rosemarie; Lamb, Allen N

2014-07-01

Duplications involving terminal Xq28 are a known cause of intellectual disability (ID) in males and in females with unfavorable X-inactivation patterns. Within Xq28, functional disomy of MECP2 causes a severe ID syndrome, however the dosage sensitivity of other Xq28 duplicated genes is less certain. Duplications involving the int22h-1/int22h-2 LCR-flanked region in distal Xq28 have recently been linked to a novel ID-associated phenotype. While evidence for the dosage sensitivity of this region is emerging, the phenotypic contribution of individual genes within the int22h-1/int22h-2-flanked region has yet to be determined. We report a familial case of a novel 774 kb Xq28-qter duplication, detected by cytogenomic microarray analysis, that partially overlaps the int22h-1/int22h-2-flanked region. This duplication and a 570 kb Xpter-p22.33 loss within the pseudoautosomal region were identified in three siblings, one female and two males, who presented with developmental delays/intellectual disability, mild dysmorphic features and short stature. Although unconfirmed, these results are suggestive of maternal inheritance of a recombinant X. We compare our clinical findings to patients with int22h-1/int22h-2-mediated duplications and discuss the potential pathogenicity of genes within the duplicated region, including those within the shared region of overlap, RAB39B and CLIC2. © 2014 Wiley Periodicals, Inc.

A new sulfonamide resistance gene (sul3) in Escherichia coli is widespread in the pig population of Switzerland.

PubMed

Perreten, Vincent; Boerlin, Patrick

2003-03-01

A new gene, sul3, which specifies a 263-amino-acid protein similar to a dihydropteroate synthase encoded by the 54-kb conjugative plasmid pVP440 from Escherichia coli was characterized. Expression of the cloned sul3 gene conferred resistance to sulfamethoxazole on E. coli. Two copies of the insertion element IS15Delta/26 flanked the region containing sul3. The sul3 gene was detected in one-third of the sulfonamide-resistant pathogenic E. coli isolates from pigs in Switzerland.

A New Sulfonamide Resistance Gene (sul3) in Escherichia coli Is Widespread in the Pig Population of Switzerland

PubMed Central

Perreten, Vincent; Boerlin, Patrick

2003-01-01

A new gene, sul3, which specifies a 263-amino-acid protein similar to a dihydropteroate synthase encoded by the 54-kb conjugative plasmid pVP440 from Escherichia coli was characterized. Expression of the cloned sul3 gene conferred resistance to sulfamethoxazole on E. coli. Two copies of the insertion element IS15Δ/26 flanked the region containing sul3. The sul3 gene was detected in one-third of the sulfonamide-resistant pathogenic E. coli isolates from pigs in Switzerland. PMID:12604565

Modulation of hepatocyte growth factor gene expression by estrogen in mouse ovary.

PubMed

Liu, Y; Lin, L; Zarnegar, R

1994-09-01

Hepatocyte growth factor (HGF) is expressed in a variety of tissues and cell types under normal conditions and in response to various stimuli such as tissue injury. In the present study, we demonstrate that the transcription of the HGF gene is stimulated by estrogen in mouse ovary. A single injection of 17 beta-estradiol results in a dramatic and transient elevation of the levels of mouse HGF mRNA. Sequence analysis has found that two putative estrogen responsive elements (ERE) reside at -872 in the 5'-flanking region and at +511 in the first intron, respectively, of the mouse HGF gene. To test whether these ERE elements are responsible for estrogen induction of HGF gene expression, chimeric plasmids containing variable regions of the 5'-flanking sequence of HGF gene and the coding region for chloramphenicol acetyltransferase (CAT) gene were transiently transfected into both human endometrial carcinoma RL 95-2 cells and mouse fibroblast NIH 3T3 cells to assess hormone responsiveness. Transfection results indicate that the ERE elements of the mouse HGF gene can confer estrogen action to either homologous or heterologous promoters. Nuclear protein extracts either from RL95-2 cells transfected with the estrogen receptor expression vector or from mouse liver bound in vitro to ERE elements specifically, as shown by band shift assay. Therefore, our results demonstrate that the HGF gene is transcriptionally regulated by estrogen in mouse ovary; and such regulation is mediated via a direct interaction of the estrogen receptor complex with cis-acting ERE elements identified in the mouse HGF gene.

The Norrie disease gene maps to a 150 kb region on chromosome Xp11.3.

PubMed

Sims, K B; Lebo, R V; Benson, G; Shalish, C; Schuback, D; Chen, Z Y; Bruns, G; Craig, I W; Golbus, M S; Breakefield, X O

1992-05-01

Norrie disease is a human X-linked recessive disorder of unknown etiology characterized by congenital blindness, sensory neural deafness and mental retardation. This disease gene was previously linked to the DXS7 (L1.28) locus and the MAO genes in band Xp11.3. We report here fine physical mapping of the obligate region containing the Norrie disease gene (NDP) defined by a recombination and by the smallest submicroscopic chromosomal deletion associated with Norrie disease identified to date. Analysis, using in addition two overlapping YAC clones from this region, allowed orientation of the MAOA and MAOB genes in a 5'-3'-3'-5' configuration. A recombination event between a (GT)n polymorphism in intron 2 of the MAOB gene and the NDP locus, in a family previously reported to have a recombination between DXS7 and NDP, delineates a flanking marker telomeric to this disease gene. An anonymous DNA probe, dc12, present in one of the YACs and in a patient with a submicroscopic deletion which includes MAOA and MAOB but not L1.28, serves as a flanking marker centromeric to the disease gene. An Alu-PCR fragment from the right arm of the MAO YAC (YMAO.AluR) is not deleted in this patient and also delineates the centromeric extent of the obligate disease region. The apparent order of these loci is telomere ... DXS7-MAOA-MAOB-NDP-dc12-YMAO.AluR ... centromere. Together these data define the obligate region containing the NDP gene to a chromosomal segment less than 150 kb.

Multiple cis-acting elements involved in up-regulation of a cytochrome P450 gene conferring resistance to deltamethrin in smal brown planthopper, Laodelphax striatellus (Fallén).

PubMed

Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun

2016-11-01

As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.

Analysis of Morphogenic Effect of hDAB2IP on Prostate Cancer and its Disease Correlation

DTIC Science & Technology

2007-02-01

variety of or- gans and cell lines. By determining the promoter sequence from the 5’- flanking region of the mDab2ip gene in mouse prosta - tic epithelial...patient with de novo acute myeloid leukemia. Genes Chromo- somes Cancer 39, 324 –334. WANG, Z., TSENG, C.P., PONG, R.C., CHEN, H., MCCONNELL, J.D

The human serotonin 5-HT{sub 2C} receptor: Complete cDNA, genomic structure, and alternatively spliced variant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun

1996-08-01

The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less

Investigation of the 5' flanking region and exon 3 polymorphisms of IGF-1 gene showed moderate association with semen quality in Sanjabi breed rams.

PubMed

Bakhtiar, R; Abdolmohammadi, A; Hajarian, H; Nikousefat, Z; Kalantar-Neyestanaki, D

2017-12-01

In this study, semen samples were collected from 96 Sanjabi rams in order to investigate the IGF-1 gene polymorphisms and their relationship with the characteristics of semen quality and testicular size. The dimensions of scrotal length, width and circumference were measured during autumn and spring over two years. Blood samples were simultaneously collected from jugular vein to extract DNA. PCR was performed using specific primers to amplify 294 and 272bp fragments including 5' regulatory region and exon 3 of IGF-1 gene, respectively. PCR products were digested by BFOI and Eco88l restriction enzymes, respectively. Two genotypes including AA (194 and 100bp), AB (294, 194 and 100bp) and all possible genotypes including CC (182 and 90bp), CT (272, 182, and 90bp) and TT (272bp) were observed for 5' flanking region and exon 3 of IGF-1 gene, respectively. The significant differences among IGF-1 genotypes for testicular dimensions were not observed. However, the polymorphism of 5' flanking region in the studied population had significant effect on individual motility and percent morphology traits. Animals with AB genotype had significantly higher individual motility compared with AA genotype (P < 0.05). Also, animals with AA genotype had significantly the highest percent morphology compared with AB genotype (P < 0.1). The exon 3 of IGF-1 gene had significant effect on individual motility, concentration, morphology and water test traits. Animals with CT genotype had the highest sperm concentration (P < 0.1) and water test (P < 0.05) compared to CC and TT genotypes. Moreover, animals with TT genotype had significantly the highest percent morphology compared with other genotypes (P < 0.05). Briefly, the results indicated that individual motility, concentration, percent morphology and water test traits could be in association with IGF-1 genotypes. It might be concluded that polymorphisms in IGF-1gene can be considered to develop male fertility in future and for using in selection process of better animals under masker assisted selection programs. Copyright © 2017 Elsevier Inc. All rights reserved.

Reverse genetics: Its origins and prospects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berg, P.

1991-04-01

The nucleotide sequence of a gene and its flanking segments alone will not tell us how its expression is regulated during development and differentiation, or in response to environmental changes. To comprehend the physiological significance of the molecular details requires biological analysis. Recombinant DNA techniques provide a powerful experimental approach. A strategy termed reverse genetics' utilizes the analysis of the activities of mutant and normal genes and experimentally constructed mutants to explore the relationship between gene structure and function thereby helping elucidate the relationship between genotype and phenotype.

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herzog, R.; Lutz, S.; Blin, N.

1991-02-05

Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

Natural variation of H3K27me3 distribution between two Arabidopsis accessions and its association with flanking transposable elements

PubMed Central

2012-01-01

Background Histone H3 lysine 27 tri-methylation and lysine 9 di-methylation are independent repressive chromatin modifications in Arabidopsis thaliana. H3K27me3 is established and maintained by Polycomb repressive complexes whereas H3K9me2 is catalyzed by SUVH histone methyltransferases. Both modifications can spread to flanking regions after initialization and were shown to be mutually exclusive in Arabidopsis. Results We analyzed the extent of natural variation of H3K27me3 in the two accessions Landsberg erecta (Ler) and Columbia (Col) and their F1 hybrids. The majority of H3K27me3 target genes in Col were unchanged in Ler and F1 hybrids. A small number of Ler-specific targets were detected and confirmed. Consistent with a cis-regulatory mechanism for establishing H3K27me3, differential targets showed allele-specific H3K27me3 in hybrids. Five Ler-specific targets showed the active mark H3K4me3 in Col and for this group, differential H3K27me3 enrichment accorded to expression variation. On the other hand, the majority of Ler-specific targets were not expressed in Col, Ler or 17 other accessions. Instead of H3K27me3, the antagonistic mark H3K9me2 and other heterochromatic features were observed at these loci in Col. These loci were frequently flanked by transposable elements, which were often missing in the Ler genome assembly. Conclusion There is little variation in H3K27me3 occupancy within the species, although H3K27me3 targets were previously shown as overrepresented among differentially expressed genes. The existing variation in H3K27me3 seems mostly explained by flanking polymorphic transposable elements. These could nucleate heterochromatin, which then spreads into neighboring H3K27me3 genes, thus converting them to H3K9me2 targets. PMID:23253144

Chromatin looping defines expression of TAL1, its flanking genes, and regulation in T-ALL.

PubMed

Zhou, Yan; Kurukuti, Sreenivasulu; Saffrey, Peter; Vukovic, Milica; Michie, Alison M; Strogantsev, Ruslan; West, Adam G; Vetrie, David

2013-12-19

TAL1 is an important regulator of hematopoiesis and its expression is tightly controlled despite complexities in its genomic organization. It is frequently misregulated in T-cell acute lymphoblastic leukemia (T-ALL), often due to deletions between TAL1 and the neighboring STIL gene. To better understand the events that lead to TAL1 expression in hematopoiesis and in T-ALL, we studied looping interactions at the TAL1 locus. In TAL1-expressing erythroid cells, the locus adopts a looping "hub" which brings into close physical proximity all known TAL1 cis-regulatory elements including CTCF-bound insulators. Loss of GATA1 results in disassembly of the hub and loss of CTCF/RAD21 from one of its insulators. Genes flanking TAL1 are partly dependent on hub integrity for their transcriptional regulation. We identified looping patterns unique to TAL1-expressing T-ALL cells, and, intriguingly, loops occurring between the TAL1 and STIL genes at the common TAL1/STIL breakpoints found in T-ALL. These findings redefine how TAL1 and neighboring genes communicate within the nucleus, and indicate that looping facilitates both normal and aberrant TAL1 expression and may predispose to structural rearrangements in T-ALL. We also propose that GATA1-dependent looping mechanisms may facilitate the conservation of TAL1 regulation despite cis-regulatory remodeling during vertebrate evolution.

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

Molecular analysis of the inhibition of interleukin-8 production by dexamethasone in a human fibrosarcoma cell line.

PubMed Central

Mukaida, N; Gussella, G L; Kasahara, T; Ko, Y; Zachariae, C O; Kawai, T; Matsushima, K

1992-01-01

In order to analyse the effects of glucocorticoids on interleukin-8 (IL-8) production more precisely, we examined the effects of dexamethasone on IL-8 production at the molecular level in a human fibrosarcoma cell line, 8387, which IL-1 induces to express IL-8 messenger RNA (mRNA) and to secrete IL-8. Over a wide dose range, dexamethasone inhibited IL-8 production induced by IL-1 alpha stimulation. Northern blotting analysis showed that dexamethasone also inhibited the IL-8 mRNA accumulation in a similar dose-related manner. Nuclear run-off assay revealed that dexamethasone decreased the transcription of the IL-8 gene and the degree of inhibition of transcription correlated well with the inhibition of IL-8 production, suggesting that the action of glucocorticoids is mainly at the transcriptional level. Furthermore, transfection with chloramphenicol acetyl transferase (CAT) expression vectors inserted with the 5'-deleted IL-8 gene demonstrated that the 5'-flanking region which contains the glucocorticoid response element (GRE) was mainly involved in the dexamethasone-induced repression of the IL-8 gene. These data suggest that the inhibition of the IL-8 gene transcription by glucocorticoids occurs through the interaction of the glucocorticoid receptor complex with GRE in the 5'-flanking region of the IL-8 gene. Images Figure 1 Figure 2 Figure 3 PMID:1592440

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion.

PubMed

Abrão, M G; Leite, M V; Carvalho, L R; Billerbeck, A E C; Nishi, M Y; Barbosa, A S; Martin, R M; Arnhold, I J P; Mendonca, B B

2006-09-01

PROP1 mutations are the most common cause of genetic combined pituitary hormone deficiency (CPHD). The aim of this study was to investigate the PROP1 gene in two siblings with CPHD. Pituitary function and imaging assessment and molecular analysis of PROP1. Two siblings, born to consanguineous parents, presented with GH deficiency associated with other pituitary hormone deficiencies (TSH, PRL and gonadotrophins). The male sibling also had an evolving cortisol deficiency. Pituitary size was evaluated by magnetic resonance imaging (MRI). PROP1 gene analysis was performed by polymerase chain reaction (PCR), automatic sequencing and Southern blotting. Amplification of sequence tag sites (STS) and the Q8N6H0 gene flanking PROP1 were performed to define the extension of PROP1 deletion. MRI revealed a hypoplastic anterior pituitary in the girl at 14 years and pituitary enlargement in the boy at 18 years. The PROP1 gene failed to amplify in both siblings, whereas other genes were amplified. Southern blotting analysis revealed the PROP1 band in the controls and confirmed complete PROP1 deletion in both siblings. The extension of the deletion was 18.4 kb. The region flanking PROP1 contains several Alu core sequences that might have facilitated stem-loop-mediated excision of PROP1. We report here a complete deletion of PROP1 in two siblings with CPHD phenotype.

Processing of Archaebacterial Intron-Containing tRNA Gene Transcripts.

DTIC Science & Technology

1987-07-31

1{ 1. Project Goals: A. To determine the mechanism of tRNA intron processing in the halophilic archaebacteria. B. Characterize and compare the...enzyme(s) responsible for the removal of 5’-flanking sequences from halophilic and sulfur-dependent tRNA gene transcripts. C. Examine the structure and...distribution of tRNA introns in the halophilic archaebacteria. 2. Accomplishments: A. Intron processing mechanism We have succeeded in our primary

FARME DB: a functional antibiotic resistance element database

PubMed Central

Wallace, James C.; Port, Jesse A.; Smith, Marissa N.; Faustman, Elaine M.

2017-01-01

Antibiotic resistance (AR) is a major global public health threat but few resources exist that catalog AR genes outside of a clinical context. Current AR sequence databases are assembled almost exclusively from genomic sequences derived from clinical bacterial isolates and thus do not include many microbial sequences derived from environmental samples that confer resistance in functional metagenomic studies. These environmental metagenomic sequences often show little or no similarity to AR sequences from clinical isolates using standard classification criteria. In addition, existing AR databases provide no information about flanking sequences containing regulatory or mobile genetic elements. To help address this issue, we created an annotated database of DNA and protein sequences derived exclusively from environmental metagenomic sequences showing AR in laboratory experiments. Our Functional Antibiotic Resistant Metagenomic Element (FARME) database is a compilation of publically available DNA sequences and predicted protein sequences conferring AR as well as regulatory elements, mobile genetic elements and predicted proteins flanking antibiotic resistant genes. FARME is the first database to focus on functional metagenomic AR gene elements and provides a resource to better understand AR in the 99% of bacteria which cannot be cultured and the relationship between environmental AR sequences and antibiotic resistant genes derived from cultured isolates. Database URL: http://staff.washington.edu/jwallace/farme PMID:28077567

High-resolution meiotic and physical mapping of the Best vitelliform macular dystrophy (VMD2) locus to pericentromeric chromosome 11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weber, B.H.F.; Vogt, G.; Stoehr, H.

1994-12-01

Best vitelliform macular dystrophy (VMD2) has previously been linked to several microsatellite markers from chromosome 11. Subsequently, additional genetic studies have refined the Best disease region to a 3.7-cM interval flanked by markers at D11S903 and PYGM. To further narrow the interval containing the Best disease gene and to obtain an estimate of the physical size of the minimal candidate region, we used a combination of high-resolution PCR hybrid mapping and analysis of recombinant Best disease chromosomes. We identified six markers from within the D11S903-PYGM interval that show no recombination with the defective gene in three multigeneration Best disease pedigrees.more » Our hybrid panel localizes these markers on either side of the centromere on chromosome 11. The closest markers flanking the disease gene are at D11S986 in band p12-11.22 on the short arm and at D11S480 in band q13.2-13.3 on the proximal long arm. This study demonstrates that the physical size of the Best disease region is exceedingly larger than previously estimated from the genetic data, because of the proximity of the defective gene to the centromere of chromosome 11.« less

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

Development of a transgenic zebrafish model expressing GFP in the notochord, somite and liver directed by the hfe2 gene promoter.

PubMed

Bian, Yue-Hong; Xu, Cheng; Li, Junling; Xu, Jin; Zhang, Hongwei; Du, Shao Jun

2011-08-01

Hemojuvelin, also known as RGMc, is encoded by hfe2 gene that plays an important role in iron homeostasis. hfe2 is specifically expressed in the notochord, developing somite and skeletal muscles during development. The molecular regulation of hfe2 expression is, however, not clear. We reported here the characterization of hfe2 gene expression and the regulation of its tissue-specific expression in zebrafish embryos. We demonstrated that the 6 kb 5'-flanking sequence upstream of the ATG start codon in the zebrafish hfe2 gene could direct GFP specific expression in the notochord, somites, and skeletal muscle of zebrafish embryos, recapitulating the expression pattern of the endogenous gene. However, the Tg(hfe2:gfp) transgene is also expressed in the liver of fish embryos, which did not mimic the expression of the endogenous hfe2 at the early stage. Nevertheless, the Tg(hfe2:gfp) transgenic zebrafish provides a useful model to study liver development. Treating Tg(hfe2:gfp) transgenic zebrafish embryos with valproic acid, a liver development inhibitor, significantly inhibited GFP expression in zebrafish. Together, these data indicate that the tissue specific expression of hfe2 in the notochord, somites and muscles is regulated by regulatory elements within the 6 kb 5'-flanking sequence of the hfe2 gene. Moreover, the Tg(hfe2:gfp) transgenic zebrafish line provides a useful model system for analyzing liver development in zebrafish.

The uncharacterized gene 1700093K21Rik and flanking regions are correlated with reproductive isolation in the house mouse, Mus musculus.

PubMed

Kass, David H; Janoušek, Václav; Wang, Liuyang; Tucker, Priscilla K

2014-06-01

Reproductive barriers exist between the house mouse subspecies, Mus musculus musculus and M. m. domesticus, members of the Mus musculus species complex, primarily as a result of hybrid male infertility, and a hybrid zone exists where their ranges intersect in Europe. Using single nucleotide polymorphisms (SNPs) diagnostic for the two taxa, the extent of introgression across the genome was previously compared in these hybrid populations. Sixty-nine of 1316 autosomal SNPs exhibited reduced introgression in two hybrid zone transects suggesting maladaptive interactions among certain loci. One of these markers is within a region on chromosome 11 that, in other studies, has been associated with hybrid male sterility of these subspecies. We assessed sequence variation in a 20 Mb region on chromosome 11 flanking this marker, and observed its inclusion within a roughly 150 kb stretch of DNA showing elevated sequence differentiation between the two subspecies. Four genes are associated with this genomic subregion, with two entirely encompassed. One of the two genes, the uncharacterized 1700093K21Rik gene, displays distinguishing features consistent with a potential role in reproductive isolation between these subspecies. Along with its expression specifically within spermatogenic cells, we present various sequence analyses that demonstrate a high rate of molecular evolution of this gene, as well as identify a subspecies amino acid variant resulting in a structural difference. Taken together, the data suggest a role for this gene in reproductive isolation.

Structure and genomic organization of the human B1 receptor gene for kinins (BDKRB1).

PubMed

Bachvarov, D R; Hess, J F; Menke, J G; Larrivée, J F; Marceau, F

1996-05-01

Two subtypes of mammalian bradykinin receptors, B1 and B2 (BDKRB1 and BDKRB2), have been defined based on their pharmacological properties. The B1 type kinin receptors have weak affinity for intact BK or Lys-BK but strong affinity for kinin metabolites without the C-terminal arginine (e.g., des-Arg9-BK and Lys-des-Arg9-BK, also called des-Arg10-kallidin), which are generated by kininase I. The B1 receptor expression is up-regulated following tissue injury and inflammation (hyperemia, exudation, hyperalgesia, etc.). In the present study, we have cloned and sequenced the gene encoding human B1 receptor from a human genomic library. The human B1 receptor gene contains three exons separated by two introns. The first and the second exon are noncoding, while the coding region and the 3'-flanking region are located entirely on the third exon. The exon-intron arrangement of the human B1 receptor gene shows significant similarity with the genes encoding the B2 receptor subtype in human, mouse, and rat. Sequence analysis of the 5'-flanking region revealed the presence of a consensus TATA box and of numerous candidate transcription factor binding sequences. Primer extension experiments have shown the existence of multiple transcription initiation sites situated downstream and upstream from the consensus TATA box. Genomic Southern blot analysis indicated that the human B1 receptor is encoded by a single-copy gene.

Mitochondrial nad2 gene is co-transcripted with CMS-associated orfB gene in cytoplasmic male-sterile stem mustard (Brassica juncea).

PubMed

Yang, Jing-Hua; Zhang, Ming-Fang; Yu, Jing-Quan

2009-02-01

The transcriptional patterns of mitochondrial respiratory related genes were investigated in cytoplasmic male-sterile and fertile maintainer lines of stem mustard, Brassica juncea. There were numerous differences in nad2 (subunit 2 of NADH dehydrogenase) between stem mustard CMS and its maintainer line. One novel open reading frame, hereafter named orfB gene, was located at the downstream of mitochondrial nad2 gene in the CMS. The novel orfB gene had high similarity with YMF19 family protein, orfB in Raphanus sativus, Helianthus annuus, Nicotiana tabacum and Beta vulgaris, orfB-CMS in Daucus carota, atp8 gene in Arabidopsis thaliana, 5' flanking of orf224 in B. napus (nap CMS) and 5' flanking of orf220 gene in CMS Brassica juncea. Three copies probed by specific fragment (amplified by primers of nad2F and nad2R from CMS) were found in the CMS line following Southern blotting digested with HindIII, but only a single copy in its maintainer line. Meanwhile, two transcripts were shown in the CMS line following Northern blotting while only one transcript was detected in the maintainer line, which were probed by specific fragment (amplified by primers of nad2F and nad2R from CMS). Meanwhile, the expression of nad2 gene was reduced in CMS bud compared to that in its maintainer line. We thus suggested that nad2 gene may be co-transcripted with CMS-associated orfB gene in the CMS. In addition, the specific fragment that was amplified by primers of nad2F and nad2R just spanned partial sequences of nad2 gene and orfB gene. Such alterations in the nad2 gene would impact the activity of NADH dehydrogenase, and subsequently signaling, inducing the expression of nuclear genes involved in male sterility in this type of cytoplasmic male sterility.

Identification of genes from the Treacher Collins candidate region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, M.; Dixon, J.; Edwards, S.

Treacher Collins syndrome (TCOF1) is an autosomal dominant disorder of craniofacial development. The TCOF1 locus has previously been mapped to chromosome 5q32-33. The candidate gene region has been defined as being between two flanking markers, ribosomal protein S14 (RPS14) and Annexin 6 (ANX6), by analyzing recombination events in affected individuals. It is estimated that the distance between these flanking markers is 500 kb by three separate analysis methods: (1) radiation hybrid mapping; (2) genetic linkage; and (3) YAC contig analysis. A cosmid contig which spans the candidate gene region for TCOF1 has been constructed by screening the Los Alamos Nationalmore » Laboratory flow-sorted chromosome 5 cosmid library. Cosmids were obtained by using a combination of probes generated from YAC end clones, Alu-PCR fragments from YACs, and asymmetric PCR fragments from both T7 and T3 cosmid ends. Exon amplifications, the selection of genomic coding sequences based upon the presence of functional splice acceptor and donor sites, was used to identify potential exon sequences. Sequences found to be conserved between species were then used to screen cDNA libraries in order to identify candidate genes. To date, four different cDNAs have been isolated from this region and are being analyzed as potential candidate genes for TCOF1. These include the genes encoding plasma glutathione peroxidase (GPX3), heparin sulfate sulfotransferase (HSST), a gene with homology to the ETS family of proteins and one which shows no homology to any known genes. Work is also in progress to identify and characterize additional cDNAs from the candidate gene region.« less

Transformation of Neomycin Resistance Gene (neo(R)) into Silkworm (Bombyx mori.L.).

PubMed

Chen, Xiu; Zhao, Yun; Zhang, Feng; Peng, Wei-Ping; Feng, Xiao-Li; Huang, Jun-Ting; Lu, Chang-De

1999-01-01

Neomycin resistance gene (neo(R)) flanked by 5' and 3' regions of fibroin H-chain gene of silkworm (Bombyx mori.L.) was transferred into eggs of silkworm by gene gun in the early period of fertilization. The larvae were fed with an artificial diet containing neomycin in early 24 hours post transfettion, and some of them survived. The neo(R) encoding sequence in G(2) generation derived from the survivals was detected by Southern blotting. The results indicated that neo(R) could be used as a selective marker for studies on transgenic silkworm.

A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates.

PubMed

Al Abdallah, Qusai; Ge, Wenbo; Fortwendel, Jarrod R

2017-01-01

CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 is a novel genome-editing system that has been successfully established in Aspergillus fumigatus . However, the current state of the technology relies heavily on DNA-based expression cassettes for delivering Cas9 and the guide RNA (gRNA) to the cell. Therefore, the power of the technology is limited to strains that are engineered to express Cas9 and gRNA. To overcome such limitations, we developed a simple and universal CRISPR-Cas9 system for gene deletion that works across different genetic backgrounds of A. fumigatus . The system employs in vitro assembly of dual Cas9 ribonucleoproteins (RNPs) for targeted gene deletion. Additionally, our CRISPR-Cas9 system utilizes 35 to 50 bp of flanking regions for mediating homologous recombination at Cas9 double-strand breaks (DSBs). As a proof of concept, we first tested our system in the Δ akuB (Δ akuB ku80 ) laboratory strain and generated high rates (97%) of gene deletion using 2 µg of the repair template flanked by homology regions as short as 35 bp. Next, we inspected the portability of our system across other genetic backgrounds of A. fumigatus , namely, the wild-type strain Af293 and a clinical isolate, A. fumigatus DI15-102. In the Af293 strain, 2 µg of the repair template flanked by 35 and 50 bp of homology resulted in highly efficient gene deletion (46% and 74%, respectively) in comparison to classical gene replacement systems. Similar deletion efficiencies were also obtained in the clinical isolate DI15-102. Taken together, our data show that in vitro -assembled Cas9 RNPs coupled with microhomology repair templates are an efficient and universal system for gene manipulation in A. fumigatus . IMPORTANCE Tackling the multifactorial nature of virulence and antifungal drug resistance in A. fumigatus requires the mechanistic interrogation of a multitude of genes, sometimes across multiple genetic backgrounds. Classical fungal gene replacement systems can be laborious and time-consuming and, in wild-type isolates, are impeded by low rates of homologous recombination. Our simple and universal CRISPR-Cas9 system for gene manipulation generates efficient gene targeting across different genetic backgrounds of A. fumigatus . We anticipate that our system will simplify genome editing in A. fumigatus , allowing for the generation of single- and multigene knockout libraries. In addition, our system will facilitate the delineation of virulence factors and antifungal drug resistance genes in different genetic backgrounds of A. fumigatus .

Regulation of gene expression mediating indeterminate muscle growth in teleosts.

PubMed

Ahammad, A K Shakur; Asaduzzaman, Md; Asakawa, Shuichi; Watabe, Shugo; Kinoshita, Shigeharu

2015-08-01

Teleosts are unique among vertebrates due to their indeterminate muscle growth, i.e., continued production of neonatal muscle fibers until death. However, the molecular mechanism(s) underlying this property is unknown. Here, we focused on the torafugu (Takifugu rubripes) myosin heavy chain gene, MYHM2528-1, which is specifically expressed in neonatal muscle fibers produced by indeterminate muscle growth. We examined the flanking region of MYHM2528-1 through an in vivo reporter assay using zebrafish (Danio rerio) and identified a 2100 bp 5'-flanking sequence that contained sufficient promoter activity to allow specific gene expression. The effects of enhanced promoter activity were observed at the outer region of the fast muscle and the dorsal edge of slow muscle in zebrafish larvae. At the juvenile stage, the promoter was specifically activated in small diameter muscle fibers scattered throughout fast muscle and in slow muscle near the septum separating slow and fast muscles. This spatio-temporal promoter activity overlapped with known myogenic zones involved in teleost indeterminate muscle growth. A deletion mutant analysis revealed that the -2100 to -600 bp 5'flanking sequence of MYHM2528-1 is essential for promoter activity. This region contains putative binding sites for several representative myogenesis-related transcription factors and nuclear factor of activated T-cell (NFAT), a transcription activator involved in regeneration of mammalian adult skeletal muscle. A significant reduction in the promoter activity of the MYHM2528-1 deletion constructs was observed in accordance with a reduction in the number of these binding sites, suggesting the involvement of specific transcription factors in indeterminate muscle growth. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Molecular analysis of the human SLC13A4 sulfate transporter gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jefferis, J.; Rakoczy, J.; School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland

2013-03-29

Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the humanmore » SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.« less

Genetic Recombination at the Buff Spore Color Locus in SORDARIA BREVICOLLIS. II. Analysis of Flanking Marker Behavior in Crosses between Buff Mutants.

PubMed

Sang, H; Whitehouse, H L

1983-02-01

Aberrant asci containing one or more wild-type spores were selected from crosses between pairs of alleles of the buff locus in the presence of closely linked flanking markers. Data were obtained relating to the site of aberrant segregation and the position of any associated crossover giving recombination of flanking markers. Aberrant segregation at a proximal site within the buff gene may be associated with a crossover proximal to the site of aberrant segregation or, with equal frequency, with a crossover distal to the site of the second mutant present in the cross. Similarly, segregation at a distal site may be associated with a crossover distal to the site or, with lower frequency, with a crossover proximal to the site of the proximal mutant present in the cross. Crossovers between the alleles were rare. This evidence for the relationship between hybrid DNA and crossing over is discussed in terms of current models for the mechanism of recombination.

A function-based screen for seeking RubisCO active clones from metagenomes: novel enzymes influencing RubisCO activity.

PubMed

Böhnke, Stefanie; Perner, Mirjam

2015-03-01

Ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) is a key enzyme of the Calvin cycle, which is responsible for most of Earth's primary production. Although research on RubisCO genes and enzymes in plants, cyanobacteria and bacteria has been ongoing for years, still little is understood about its regulation and activation in bacteria. Even more so, hardly any information exists about the function of metagenomic RubisCOs and the role of the enzymes encoded on the flanking DNA owing to the lack of available function-based screens for seeking active RubisCOs from the environment. Here we present the first solely activity-based approach for identifying RubisCO active fosmid clones from a metagenomic library. We constructed a metagenomic library from hydrothermal vent fluids and screened 1056 fosmid clones. Twelve clones exhibited RubisCO activity and the metagenomic fragments resembled genes from Thiomicrospira crunogena. One of these clones was further analyzed. It contained a 35.2 kb metagenomic insert carrying the RubisCO gene cluster and flanking DNA regions. Knockouts of twelve genes and two intergenic regions on this metagenomic fragment demonstrated that the RubisCO activity was significantly impaired and was attributed to deletions in genes encoding putative transcriptional regulators and those believed to be vital for RubisCO activation. Our new technique revealed a novel link between a poorly characterized gene and RubisCO activity. This screen opens the door to directly investigating RubisCO genes and respective enzymes from environmental samples.

Genetic Variation among Major Human Geographic Groups Supports a Peculiar Evolutionary Trend in PAX9

PubMed Central

Paixão-Côrtes, Vanessa R.; Meyer, Diogo; Pereira, Tiago V.; Mazières, Stéphane; Elion, Jacques; Krishnamoorthy, Rajagopal; Zago, Marco A.; Silva, Wilson A.; Salzano, Francisco M.; Bortolini, Maria Cátira

2011-01-01

A total of 172 persons from nine South Amerindian, three African and one Eskimo populations were studied in relation to the Paired box gene 9 (PAX9) exon 3 (138 base pairs) as well as its 5′and 3′flanking intronic segments (232 bp and 220 bp, respectively) and integrated with the information available for the same genetic region from individuals of different geographical origins. Nine mutations were scored in exon 3 and six in its flanking regions; four of them are new South American tribe-specific singletons. Exon3 nucleotide diversity is several orders of magnitude higher than its intronic regions. Additionally, a set of variants in the PAX9 and 101 other genes related with dentition can define at least some dental morphological differences between Sub-Saharan Africans and non-Africans, probably associated with adaptations after the modern human exodus from Africa. Exon 3 of PAX9 could be a good molecular example of how evolvability works. PMID:21298044

Circular RNA biogenesis can proceed through an exon-containing lariat precursor

PubMed Central

Barrett, Steven P; Wang, Peter L; Salzman, Julia

2015-01-01

Pervasive expression of circular RNA is a recently discovered feature of eukaryotic gene expression programs, yet its function remains largely unknown. The presumed biogenesis of these RNAs involves a non-canonical ‘backsplicing’ event. Recent studies in mammalian cell culture posit that backsplicing is facilitated by inverted repeats flanking the circularized exon(s). Although such sequence elements are common in mammals, they are rare in lower eukaryotes, making current models insufficient to describe circularization. Through systematic splice site mutagenesis and the identification of splicing intermediates, we show that circular RNA in Schizosaccharomyces pombe is generated through an exon-containing lariat precursor. Furthermore, we have performed high-throughput and comprehensive mutagenesis of a circle-forming exon, which enabled us to discover a systematic effect of exon length on RNA circularization. Our results uncover a mechanism for circular RNA biogenesis that may account for circularization in genes that lack noticeable flanking intronic secondary structure. DOI: http://dx.doi.org/10.7554/eLife.07540.001 PMID:26057830

Silencing and transcriptional properties of the imprinted Airn ncRNA are independent of the endogenous promoter

PubMed Central

Stricker, Stefan H; Steenpass, Laura; Pauler, Florian M; Santoro, Federica; Latos, Paulina A; Huang, Ru; Koerner, Martha V; Sloane, Mathew A; Warczok, Katarzyna E; Barlow, Denise P

2008-01-01

The Airn macro ncRNA is the master regulator of imprinted expression in the Igf2r imprinted gene cluster where it silences three flanking genes in cis. Airn transcription shows unusual features normally viewed as promoter specific, such as impaired post-transcriptional processing and a macro size. The Airn transcript is 108 kb long, predominantly unspliced and nuclear localized, with only a minority being variably spliced and exported. Here, we show by deletion of the Airn ncRNA promoter and replacement with a constitutive strong or weak promoter that splicing suppression and termination, as well as silencing activity, are maintained by strong Airn expression from an exogenous promoter. This indicates that all functional regions are located within the Airn transcript. DNA methylation of the maternal imprint control element (ICE) restricts Airn expression to the paternal allele and we also show that a strong active promoter is required to maintain the unmethylated state of the paternal ICE. Thus, Airn expression not only induces silencing of flanking mRNA genes but also protects the paternal copy of the ICE from de novo methylation. PMID:19008856

Reversible Heat-Induced Inactivation of Chimeric β-Glucuronidase in Transgenic Plants1

PubMed Central

Almoguera, Concepción; Rojas, Anabel; Jordano, Juan

2002-01-01

We compared the expression patterns in transgenic tobacco (Nicotiana tabacum) of two chimeric genes: a translational fusion to β-glucuronidase (GUS) and a transcriptional fusion, both with the same promoter and 5′-flanking sequences of Ha hsp17.7 G4, a small heat shock protein (sHSP) gene from sunflower (Helianthus annuus). We found that immediately after heat shock, the induced expression from the two fusions in seedlings was similar, considering chimeric mRNA or GUS protein accumulation. Surprisingly, we discovered that the chimeric GUS protein encoded by the translational fusion was mostly inactive in such conditions. We also found that this inactivation was fully reversible. Thus, after returning to control temperature, the GUS activity was fully recovered without substantial changes in GUS protein accumulation. In contrast, we did not find differences in the in vitro heat inactivation of the respective GUS proteins. Insolubilization of the chimeric GUS protein correlated with its inactivation, as indicated by immunoprecipitation analyses. The inclusion in another chimeric gene of the 21 amino-terminal amino acids from a different sHSP lead to a comparable reversible inactivation. That effect not only illustrates unexpected post-translational problems, but may also point to sequences involved in interactions specific to sHSPs and in vivo heat stress conditions. PMID:12011363

A TALE of transposition: Tn3-like transposons play a major role in the spread of pathogenicity determinants of Xanthomonas citri and other xanthomonads.

PubMed

Ferreira, Rafael Marini; de Oliveira, Amanda Carolina P; Moreira, Leandro M; Belasque, José; Gourbeyre, Edith; Siguier, Patricia; Ferro, Maria Inês T; Ferro, Jesus A; Chandler, Michael; Varani, Alessandro M

2015-02-17

Members of the genus Xanthomonas are among the most important phytopathogens. A key feature of Xanthomonas pathogenesis is the translocation of type III secretion system (T3SS) effector proteins (T3SEs) into the plant target cells via a T3SS. Several T3SEs and a murein lytic transglycosylase gene (mlt, required for citrus canker symptoms) are found associated with three transposition-related genes in Xanthomonas citri plasmid pXAC64. These are flanked by short inverted repeats (IRs). The region was identified as a transposon, TnXax1, with typical Tn3 family features, including a transposase and two recombination genes. Two 14-bp palindromic sequences within a 193-bp potential resolution site occur between the recombination genes. Additional derivatives carrying different T3SEs and other passenger genes occur in different Xanthomonas species. The T3SEs include transcription activator-like effectors (TALEs). Certain TALEs are flanked by the same IRs as found in TnXax1 to form mobile insertion cassettes (MICs), suggesting that they may be transmitted horizontally. A significant number of MICs carrying other passenger genes (including a number of TALE genes) were also identified, flanked by the same TnXax1 IRs and delimited by 5-bp target site duplications. We conclude that a large fraction of T3SEs, including individual TALEs and potential pathogenicity determinants, have spread by transposition and that TnXax1, which exhibits all of the essential characteristics of a functional transposon, may be involved in driving MIC transposition. We also propose that TALE genes may diversify by fork slippage during the replicative Tn3 family transposition. These mechanisms may play a crucial role in the emergence of Xanthomonas pathogenicity. Xanthomonas genomes carry many insertion sequences (IS) and transposons, which play an important role in their evolution and architecture. This study reveals a key relationship between transposons and pathogenicity determinants in Xanthomonas. We propose that several transposition events mediated by a Tn3-like element carrying different sets of passenger genes, such as different type III secretion system effectors (including transcription activation-like effectors [TALEs]), were determinant in the evolution and emergence of Xanthomonas pathogenicity. TALE genes are DNA-binding effectors that modulate plant transcription. We also present a model for generating TALE gene diversity based on fork slippage associated with the replicative transposition mechanism of Tn3-like transposons. This may provide a mechanism for niche adaptation, specialization, host-switching, and other lifestyle changes. These results will also certainly lead to novel insights into the evolution and emergence of the various diseases caused by different Xanthomonas species and pathovars. Copyright © 2015 Marini Ferreira et al.

An atypical case of fragile X syndrome caused by a deletion that includes the FMR1 gene.

PubMed Central

Quan, F; Zonana, J; Gunter, K; Peterson, K L; Magenis, R E; Popovich, B W

1995-01-01

Fragile X syndrome is the most common form of inherited mental retardation and results from the transcriptional inactivation of the FMR1 gene. In the vast majority of cases, this is caused by the expansion of an unstable CGG repeat in the first exon of the FMR1 gene. We describe here a phenotypically atypical case of fragile X syndrome, caused by a deletion that includes the entire FMR1 gene and > or = 9.0 Mb of flanking DNA. The proband, RK, was a 6-year-old mentally retarded male with obesity and anal atresia. A diagnosis of fragile X syndrome was established by the failure of RK's DNA to hybridize to a 558-bp PstI-XhoI fragment (pfxa3) specific for the 5'-end of the FMR1 gene. The analysis of flanking markers in the interval from Xq26.3-q28 indicated a deletion extending from between 160-500 kb distal and 9.0 Mb proximal to the FMR1 gene. High-resolution chromosome banding confirmed a deletion with breakpoints in Xq26.3 and Xq27.3. This deletion was maternally transmitted and arose as a new mutation on the grandpaternal X chromosome. The maternal transmission of the deletion was confirmed by FISH using a 34-kb cosmid (c31.4) containing most of the FMR1 gene. These results indicated that RK carried a deletion of the FMR1 region with the most proximal breakpoint described to date. This patient's unusual clinical presentation may indicate the presence of genes located in the deleted interval proximal to the FMR1 locus that are able to modify the fragile X syndrome phenotype. Images Figure 5 Figure 2 Figure 4 Figure 6 Figure 7 PMID:7726157

DDC and COBL, flanking the imprinted GRB10 gene on 7p12, are biallelically expressed.

PubMed

Hitchins, Megan P; Bentley, Louise; Monk, David; Beechey, Colin; Peters, Jo; Kelsey, Gavin; Ishino, Fumitoshi; Preece, Michael A; Stanier, Philip; Moore, Gudrun E

2002-12-01

Maternal duplication of human 7p11.2-p13 has been associated with Silver-Russell syndrome (SRS) in two familial cases. GRB10 is the only imprinted gene identified within this region to date. GRB10 demonstrates an intricate tissue- and isoform-specific imprinting profile in humans, with paternal expression in fetal brain and maternal expression of one isoform in skeletal muscle. The mouse homolog is maternally transcribed. The GRB10 protein is a potent growth inhibitor and represents a candidate for SRS, which is characterized by pre- and postnatal growth retardation and a spectrum of additional dysmorphic features. Since imprinted genes tend to be grouped in clusters, we investigated the imprinting status of the dopa-decarboxylase gene (DDC) and the Cordon-bleu gene (COBL) which flank GRB10 within the 7p11.2-p13 SRS duplicated region. Although both genes were found to replicate asynchronously, suggestive of imprinting, SNP expression analyses showed that neither gene was imprinted in multiple human fetal tissues. The mouse homologues, Ddc and Cobl, which map to the homologous imprinted region on proximal Chr 11, were also biallelically expressed in mice with uniparental maternal or paternal inheritance of this region. With the intent of using mouse Grb10 as an imprinted control, biallelic expression was consistently observed in fetal, postnatal, and adult brain of these mice, in contrast to the maternal-specific transcription previously demonstrated in brain in inter-specific F1 progeny. This may be a further example of over-expression of maternally derived transcripts in inter-specific mouse crosses. GRB10 remains the only imprinted gene identified within 7p11.2-p13.

Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

PubMed

Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

2016-06-01

As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

77 FR 22333 - Prospective Grant of Exclusive License: Development of Oncolytic Viral Cancer Therapies

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-13

..., ``Recombinant Vaccinia Virus Containing a Chimeric Gene Having Foreign DNA Flanked by Vaccinia Regulatory DNA..., ``Compositions Containing Recombinant Poxviruses Having Foreign DNA Expressed under the Control of Poxvirus... entitled, ``Methods of Immunization Using Recombinant Poxviruses Having Foreign DNA Expressed under the...

Molecular mapping and candidate gene analysis for resistance to powdery mildew in Cucumis sativus stem.

PubMed

Liu, P N; Miao, H; Lu, H W; Cui, J Y; Tian, G L; Wehner, T C; Gu, X F; Zhang, S P

2017-08-31

Powdery mildew (PM) of cucumber (Cucumis sativus), caused by Podosphaera xanthii, is a major foliar disease worldwide and resistance is one of the main objectives in cucumber breeding programs. The resistance to PM in cucumber stem is important to the resistance for the whole plant. In this study, genetic analysis and gene mapping were implemented with cucumber inbred lines NCG-122 (with resistance to PM in the stem) and NCG-121 (with susceptibility in the stem). Genetic analysis showed that resistance to PM in the stem of NCG-122 was qualitative and controlled by a single-recessive nuclear gene (pm-s). Susceptibility was dominant to resistance. In the initial genetic mapping of the pm-s gene, 10 SSR markers were discovered to be linked to pm-s, which was mapped to chromosome 5 (Chr.5) of cucumber. The pm-s gene's closest flanking markers were SSR20486 and SSR06184/SSR13237 with genetic distances of 0.9 and 1.8 cM, respectively. One hundred and fifty-seven pairs of new SSR primers were exploited by the sequence information in the initial mapping region of pm-s. The analysis on the F 2 mapping population using the new molecular markers showed that 17 SSR markers were confirmed to be linked to the pm-s gene. The two closest flanking markers, pmSSR27and pmSSR17, were 0.1 and 0.7 cM from pm-s, respectively, confirming the location of this gene on Chr.5. The physical length of the genomic region containing pm-s was 135.7 kb harboring 21 predicted genes. Among these genes, the gene Csa5G623470 annotated as encoding Mlo-related protein was defined as the most probable candidate gene for the pm-s. The results of this study will provide a basis for marker-assisted selection, and make the benefit for the cloning of the resistance gene.

Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

PubMed Central

Erickson, J. R.; Johnston, M.

1993-01-01

We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

Pineal-specific expression of green fluorescent protein under the control of the serotonin-N-acetyltransferase gene regulatory regions in transgenic zebrafish.

PubMed

Gothilf, Yoav; Toyama, Reiko; Coon, Steven L; Du, Shao-Jun; Dawid, Igor B; Klein, David C

2002-11-01

Zebrafish serotonin-N-acetyltransferase-2 (zfAANAT-2) mRNA is exclusively expressed in the pineal gland (epiphysis) at the embryonic stage. Here, we have initiated an effort to study the mechanisms underlying tissue-specific expression of this gene. DNA constructs were prepared in which green fluorescent protein (GFP) is driven by regulatory regions of the zfAANAT-2 gene. In vivo transient expression analysis in zebrafish embryos indicated that in addition to the 5'-flanking region, a regulatory sequence in the 3'-flanking region is required for pineal-specific expression. This finding led to an effort to produce transgenic lines expressing GFP under the control of the 5' and 3' regulatory regions of the zfAANAT-2 gene. Embryos transiently expressing GFP were raised to maturity and tested for germ cell transmission of the transgene. Three transgenic lines were produced in which GFP fluorescence in the pineal was detected starting 1 to 2 days after fertilization. One line was crossed with mindbomb and floating head mutants that cause abnormal development of the pineal and an elevation or reduction of zfAANAT-2 mRNA levels, respectively. Homozygous mutant transgenic embryos exhibited similar effects on GFP expression in the pineal gland. These observations indicate that the transgenic lines described here will be useful in studying the development of the pineal gland and the mechanisms that determine pineal-specific gene expression in the zebrafish. Published 2002 Wiley-Liss, Inc.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Tissue-specific expression of human CD4 in transgenic mice.

PubMed Central

Gillespie, F P; Doros, L; Vitale, J; Blackwell, C; Gosselin, J; Snyder, B W; Wadsworth, S C

1993-01-01

The gene for the human CD4 glycoprotein, which serves as the receptor for human immunodeficiency virus type 1, along with approximately 23 kb of sequence upstream of the translational start site, was cloned. The ability of 5' flanking sequences to direct tissue-specific expression was tested in cell culture and in transgenic mice. A 5' flanking region of 6 kb was able to direct transcription of the CD4 gene in NIH 3T3 cells but did not result in detectable expression in the murine T-cell line EL4 or in four lines of transgenic mice. A larger 5' flanking region of approximately 23 kb directed high-level CD4 transcription in the murine T-cell line EL4 and in three independent lines of transgenic mice. Human CD4 expression in all tissues analyzed was tightly correlated with murine CD4 expression; the highest levels of human CD4 RNA expression were found in the thymus and spleen, with relatively low levels detected in other tissues. Expression of human CD4 protein in peripheral blood mononuclear cells was examined by flow cytometry in these transgenic animals and found to be restricted to the murine CD4+ subset of lymphocytes. Human CD4 protein, detected with an anti-human CD4 monoclonal antibody, was present on the surface of 45 to 50% of the peripheral blood mononuclear cells from all transgenic lines. Images PMID:8474453

Efficient disruption of Zebrafish genes using a Gal4-containing gene trap

PubMed Central

2013-01-01

Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702

Evaluation of the arrestin gene in patients with retinitis pigmentosa or an allied disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

DeStefano, D.J.; Berson, E.L.; Dryja, T.P.

1994-09-01

Arrestin, also called 48K protein or S-antigen, plays a role in deactivating rhodopsin, the photosensitive, seven-helix, G-protein receptor found in rod photoreceptors. In Drosophila, null mutations in arrestin genes cause a light-dependent photoreceptor degeneration. It is possible that a comparable photoreceptor degeneration in humans is caused by defects in the rod arrestin gene. In order to evaluate this possibility, we are characterizing the human arrestin locus on chromosome 2q. We screened a genomic library (5 million plaques) using an arrestin cDNA clone. Sixty-eight hybridizing clones were identified; portions of 7 clones were sequenced to determine the intron sequence flanking themore » exons. We are using SSCP analysis and direct genomic sequencing to screen the entire coding region, splice donor and acceptor sites, and the promoter region of the arrestin gene in 188 patients with autosomal dominant and 104 patients with autosomal recessive retinitis pigmentosa. We have already obtained flanking intron sequences necessary for SSCP analysis for 13 of 16 exons. So far, we have identified 4 silent base changes at codons 67 (TGC-to-TGT), 107 (CTG-to-CTC), 163 (GCC-to-GCT), and 288 (CTG-to-TGT), all with allele frequencies at 1% or less. Several other variant bands detected by SSCP analysis are currently being sequenced.« less

Variability of lysozyme and lactoferrin bioactive protein concentrations in equine milk in relation to LYZ and LTF gene polymorphisms and expression.

PubMed

Cieslak, Jakub; Wodas, Lukasz; Borowska, Alicja; Sadoch, Jan; Pawlak, Piotr; Puppel, Kamila; Kuczynska, Beata; Mackowski, Mariusz

2017-05-01

Equine milk is considered to be an interesting product for human nutrition, mainly owing to its low allergenicity and significant amounts of bioactive proteins, including lysozyme (LYZ) and lactoferrin (LTF). The present study assessed the effect of genetic factors on LYZ and LTF concentration variability in mare's milk. Significant effects of horse breed and lactation stage on milk LYZ and LTF contents were observed. The highest level of LTF and the lowest concentration of LYZ were recorded for the Polish Warmblood Horse breed. The highest amounts of both proteins were found for the earliest investigated time point of lactation (5th week). Altogether 13 (nine novel) polymorphisms were found in the 5'-flanking regions of both genes, but they showed no significant relationship with milk LYZ and LTF contents. Several associations were found between selected SNPs and the LYZ gene relative transcript level. While the present study indicated the existence of intra- and interbreed variability of LYZ and LTF contents in mare's milk, this variation is rather unrelated to the 5'-flanking variants of genes encoding both proteins. This study is a good introduction for broader investigations focused on the genetic background for variability of bioactive protein contents in mare's milk. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Wide distribution of O157-antigen biosynthesis gene clusters in Escherichia coli.

PubMed

Iguchi, Atsushi; Shirai, Hiroki; Seto, Kazuko; Ooka, Tadasuke; Ogura, Yoshitoshi; Hayashi, Tetsuya; Osawa, Kayo; Osawa, Ro

2011-01-01

Most Escherichia coli O157-serogroup strains are classified as enterohemorrhagic E. coli (EHEC), which is known as an important food-borne pathogen for humans. They usually produce Shiga toxin (Stx) 1 and/or Stx2, and express H7-flagella antigen (or nonmotile). However, O157 strains that do not produce Stxs and express H antigens different from H7 are sometimes isolated from clinical and other sources. Multilocus sequence analysis revealed that these 21 O157:non-H7 strains tested in this study belong to multiple evolutionary lineages different from that of EHEC O157:H7 strains, suggesting a wide distribution of the gene set encoding the O157-antigen biosynthesis in multiple lineages. To gain insight into the gene organization and the sequence similarity of the O157-antigen biosynthesis gene clusters, we conducted genomic comparisons of the chromosomal regions (about 59 kb in each strain) covering the O-antigen gene cluster and its flanking regions between six O157:H7/non-H7 strains. Gene organization of the O157-antigen gene cluster was identical among O157:H7/non-H7 strains, but was divided into two distinct types at the nucleotide sequence level. Interestingly, distribution of the two types did not clearly follow the evolutionary lineages of the strains, suggesting that horizontal gene transfer of both types of O157-antigen gene clusters has occurred independently among E. coli strains. Additionally, detailed sequence comparison revealed that some positions of the repetitive extragenic palindromic (REP) sequences in the regions flanking the O-antigen gene clusters were coincident with possible recombination points. From these results, we conclude that the horizontal transfer of the O157-antigen gene clusters induced the emergence of multiple O157 lineages within E. coli and speculate that REP sequences may involve one of the driving forces for exchange and evolution of O-antigen loci.

Mapping and Genetic Structure Analysis of the Anthracnose Resistance Locus Co-1HY in the Common Bean (Phaseolus vulgaris L.).

PubMed

Chen, Mingli; Wu, Jing; Wang, Lanfen; Mantri, Nitin; Zhang, Xiaoyan; Zhu, Zhendong; Wang, Shumin

2017-01-01

Anthracnose is a destructive disease of the common bean (Phaseolus vulgaris L.). The Andean cultivar Hongyundou has been demonstrated to possess strong resistance to anthracnose race 81. To study the genetics of this resistance, the Hongyundou cultivar was crossed with a susceptible genotype Jingdou. Segregation of resistance for race 81 was assessed in the F2 population and F2:3 lines under controlled conditions. Results indicate that Hongyundou carries a single dominant gene for anthracnose resistance. An allele test by crossing Hongyundou with another resistant cultivar revealed that the resistance gene is in the Co-1 locus (therefore named Co-1HY). The physical distance between this locus and the two flanking markers was 46 kb, and this region included four candidate genes, namely, Phvul.001G243500, Phvul.001G243600, Phvul.001G243700 and Phvul.001G243800. These candidate genes encoded serine/threonine-protein kinases. Expression analysis of the four candidate genes in the resistant and susceptible cultivars under control condition and inoculated treatment revealed that all the four candidate genes are expressed at significantly higher levels in the resistant genotype than in susceptible genotype. Phvul.001G243600 and Phvul.001G243700 are expressed nearly 15-fold and 90-fold higher in the resistant genotype than in the susceptible parent before inoculation, respectively. Four candidate genes will provide useful information for further research into the resistance mechanism of anthracnose in common bean. The closely linked flanking markers identified here may be useful for transferring the resistance allele Co-1HY from Hongyundou to elite anthracnose susceptible common bean lines.

Mapping and Genetic Structure Analysis of the Anthracnose Resistance Locus Co-1HY in the Common Bean (Phaseolus vulgaris L.)

PubMed Central

Wang, Lanfen; Mantri, Nitin; Zhang, Xiaoyan; Zhu, Zhendong; Wang, Shumin

2017-01-01

Anthracnose is a destructive disease of the common bean (Phaseolus vulgaris L.). The Andean cultivar Hongyundou has been demonstrated to possess strong resistance to anthracnose race 81. To study the genetics of this resistance, the Hongyundou cultivar was crossed with a susceptible genotype Jingdou. Segregation of resistance for race 81 was assessed in the F2 population and F2:3 lines under controlled conditions. Results indicate that Hongyundou carries a single dominant gene for anthracnose resistance. An allele test by crossing Hongyundou with another resistant cultivar revealed that the resistance gene is in the Co-1 locus (therefore named Co-1HY). The physical distance between this locus and the two flanking markers was 46 kb, and this region included four candidate genes, namely, Phvul.001G243500, Phvul.001G243600, Phvul.001G243700 and Phvul.001G243800. These candidate genes encoded serine/threonine-protein kinases. Expression analysis of the four candidate genes in the resistant and susceptible cultivars under control condition and inoculated treatment revealed that all the four candidate genes are expressed at significantly higher levels in the resistant genotype than in susceptible genotype. Phvul.001G243600 and Phvul.001G243700 are expressed nearly 15-fold and 90-fold higher in the resistant genotype than in the susceptible parent before inoculation, respectively. Four candidate genes will provide useful information for further research into the resistance mechanism of anthracnose in common bean. The closely linked flanking markers identified here may be useful for transferring the resistance allele Co-1HY from Hongyundou to elite anthracnose susceptible common bean lines. PMID:28076395

DOE Office of Scientific and Technical Information (OSTI.GOV)

Quan, F.; Zonana, J.; Gunter, K.

Fragile X syndrome is the most common form of inherited mental retardation and results from the transcriptional inactivation of the FMR1 gene. In the vast majority of cases, this is caused by the expansion of an unstable CGG repeat in the first exon of the FMR1 gene. We describe here a phenotypically atypical case of fragile X syndrome, caused by a deletion that includes the entire FMR1 gene and {ge}9.0 Mb of flanking DNA. The proband, RK, was a 6-year-old mentally retarded male with obesity and anal atresia. A diagnosis of fragile X syndrome was established by the failure ofmore » RK`s DNA to hybridize to a 558-bp PstI-XhoI fragment (pfxa3) specific for the 5{prime}-end of the FMR1 gene. The analysis of flanking markers in the interval from Xq26.3-q28 indicated a deletion extending from between 160-500 kb distal and 9.0 Mb proximal to the FMR1 gene. High-resolution chromosome banding confirmed a deletion with breakpoints in Xq26.3 and Xq27.3. This deletion was maternally transmitted and arose as a new mutation on the grandpaternal X chromosome. The maternal transmission of the deletion was confirmed by FISH using a 34-kb cosmid (c31.4) containing most of the FMR1 gene. These results indicated that RK carried a deletion of the FMR1 region with the most proximal breakpoint described to date. This patient`s unusual clinical presentation may indicate the presence of genes located in the deleted interval proximal to the FMR1 locus that are able to modify the fragile X syndrome phenotype. 36 refs., 7 figs.« less

Genetic rescue of an endangered domestic animal through outcrossing with closely related breeds: A case study of the Norwegian Lundehund.

PubMed

Stronen, Astrid V; Salmela, Elina; Baldursdóttir, Birna K; Berg, Peer; Espelien, Ingvild S; Järvi, Kirsi; Jensen, Henrik; Kristensen, Torsten N; Melis, Claudia; Manenti, Tommaso; Lohi, Hannes; Pertoldi, Cino

2017-01-01

Genetic rescue, outcrossing with individuals from a related population, is used to augment genetic diversity in populations threatened by severe inbreeding and extinction. The endangered Norwegian Lundehund dog underwent at least two severe bottlenecks in the 1940s and 1960s that each left only five inbred dogs, and the approximately 1500 dogs remaining world-wide today appear to descend from only two individuals. The Lundehund has a high prevalence of a gastrointestinal disease, to which all remaining dogs may be predisposed. Outcrossing is currently performed with three Nordic Spitz breeds: Norwegian Buhund, Icelandic Sheepdog, and Norrbottenspets. Examination of single nucleotide polymorphism (SNP) genotypes based on 165K loci in 48 dogs from the four breeds revealed substantially lower genetic diversity for the Lundehund (HE 0.035) than for other breeds (HE 0.209-0.284). Analyses of genetic structure with > 15K linkage disequilibrium-pruned SNPs showed four distinct genetic clusters. Pairwise FST values between Lundehund and the candidate breeds were highest for Icelandic Sheepdog, followed by Buhund and Norrbottenspets. We assessed the presence of outlier loci among candidate breeds and examined flanking genome regions (1 megabase) for genes under possible selection to identify potential adaptive differences among breeds; outliers were observed in flanking regions of genes associated with key functions including the immune system, metabolism, cognition and physical development. We suggest crossbreeding with multiple breeds as the best strategy to increase genetic diversity for the Lundehund and to reduce the incidence of health problems. For this project, the three candidate breeds were first selected based on phenotypes and then subjected to genetic investigation. Because phenotypes are often paramount for domestic breed owners, such a strategy could provide a helpful approach for genetic rescue and restoration of other domestic populations at risk, by ensuring the involvement of owners, breeders and managers at the start of the project.

Organised Genome Dynamics in the Escherichia coli Species Results in Highly Diverse Adaptive Paths

PubMed Central

Barbe, Valérie; Baeriswyl, Simon; Bidet, Philippe; Bingen, Edouard; Bonacorsi, Stéphane; Bouchier, Christiane; Bouvet, Odile; Calteau, Alexandra; Chiapello, Hélène; Clermont, Olivier; Cruveiller, Stéphane; Danchin, Antoine; Diard, Médéric; Dossat, Carole; Karoui, Meriem El; Frapy, Eric; Garry, Louis; Ghigo, Jean Marc; Gilles, Anne Marie; Johnson, James; Le Bouguénec, Chantal; Lescat, Mathilde; Mangenot, Sophie; Martinez-Jéhanne, Vanessa; Matic, Ivan; Nassif, Xavier; Oztas, Sophie; Petit, Marie Agnès; Pichon, Christophe; Rouy, Zoé; Ruf, Claude Saint; Schneider, Dominique; Tourret, Jérôme; Vacherie, Benoit; Vallenet, David; Médigue, Claudine; Rocha, Eduardo P. C.; Denamur, Erick

2009-01-01

The Escherichia coli species represents one of the best-studied model organisms, but also encompasses a variety of commensal and pathogenic strains that diversify by high rates of genetic change. We uniformly (re-) annotated the genomes of 20 commensal and pathogenic E. coli strains and one strain of E. fergusonii (the closest E. coli related species), including seven that we sequenced to completion. Within the ∼18,000 families of orthologous genes, we found ∼2,000 common to all strains. Although recombination rates are much higher than mutation rates, we show, both theoretically and using phylogenetic inference, that this does not obscure the phylogenetic signal, which places the B2 phylogenetic group and one group D strain at the basal position. Based on this phylogeny, we inferred past evolutionary events of gain and loss of genes, identifying functional classes under opposite selection pressures. We found an important adaptive role for metabolism diversification within group B2 and Shigella strains, but identified few or no extraintestinal virulence-specific genes, which could render difficult the development of a vaccine against extraintestinal infections. Genome flux in E. coli is confined to a small number of conserved positions in the chromosome, which most often are not associated with integrases or tRNA genes. Core genes flanking some of these regions show higher rates of recombination, suggesting that a gene, once acquired by a strain, spreads within the species by homologous recombination at the flanking genes. Finally, the genome's long-scale structure of recombination indicates lower recombination rates, but not higher mutation rates, at the terminus of replication. The ensuing effect of background selection and biased gene conversion may thus explain why this region is A+T-rich and shows high sequence divergence but low sequence polymorphism. Overall, despite a very high gene flow, genes co-exist in an organised genome. PMID:19165319

First Staphylococcal Cassette Chromosome mec Containing a mecB-Carrying Gene Complex Independent of Transposon Tn6045 in a Macrococcus caseolyticus Isolate from a Canine Infection

PubMed Central

Gómez-Sanz, Elena; Schwendener, Sybille; Thomann, Andreas; Gobeli Brawand, Stefanie

2015-01-01

A methicillin-resistant mecB-positive Macrococcus caseolyticus (strain KM45013) was isolated from the nares of a dog with rhinitis. It contained a novel 39-kb transposon-defective complete mecB-carrying staphylococcal cassette chromosome mec element (SCCmecKM45013). SCCmecKM45013 contained 49 coding sequences (CDSs), was integrated at the 3′ end of the chromosomal orfX gene, and was delimited at both ends by imperfect direct repeats functioning as integration site sequences (ISSs). SCCmecKM45013 presented two discontinuous regions of homology (SCCmec coverage of 35%) to the chromosomal and transposon Tn6045-associated SCCmec-like element of M. caseolyticus JCSC7096: (i) the mec gene complex (98.8% identity) and (ii) the ccr-carrying segment (91.8% identity). The mec gene complex, located at the right junction of the cassette, also carried the β-lactamase gene blaZm (mecRm-mecIm-mecB-blaZm). SCCmecKM45013 contained two cassette chromosome recombinase genes, ccrAm2 and ccrBm2, which shared 94.3% and 96.6% DNA identity with those of the SCCmec-like element of JCSC7096 but shared less than 52% DNA identity with the staphylococcal ccrAB and ccrC genes. Three distinct extrachromosomal circularized elements (the entire SCCmecKM45013, ΨSCCmecKM45013 lacking the ccr genes, and SCCKM45013 lacking mecB) flanked by one ISS copy, as well as the chromosomal regions remaining after excision, were detected. An unconventional circularized structure carrying the mecB gene complex was associated with two extensive direct repeat regions, which enclosed two open reading frames (ORFs) (ORF46 and ORF51) flanking the chromosomal mecB-carrying gene complex. This study revealed M. caseolyticus as a potential disease-associated bacterium in dogs and also unveiled an SCCmec element carrying mecB not associated with Tn6045 in the genus Macrococcus. PMID:25987634

Linkage of the VNTR/insulin-gene and type I diabetes mellitus: Increased gene sharing in affected sibling pairs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Owerbach, D.; Gabbay, K.H.

1994-05-01

Ninety-six multiplex type I diabetic families were typed at the 5' flanking region of the insulin gene by using a PCR assay that better resolves the VNTR into multiple alleles. Affected sibling pairs shared 2, 1, and 0 VNTR alleles - identical by descent - at a frequency of .47, .45, and .08, respectively, a ratio that deviated from the expected 1:2:1 ratio (P<.001). These results confirm linkage of the chromosome 11p15.5 region with type I diabetes mellitus susceptibility. 20 refs., 2 tabs.

Regional centromeres in the yeast Candida lusitaniae lack pericentromeric heterochromatin

PubMed Central

Kapoor, Shivali; Zhu, Lisha; Froyd, Cara; Liu, Tao; Rusche, Laura N.

2015-01-01

Point centromeres are specified by a short consensus sequence that seeds kinetochore formation, whereas regional centromeres lack a conserved sequence and instead are epigenetically inherited. Regional centromeres are generally flanked by heterochromatin that ensures high levels of cohesin and promotes faithful chromosome segregation. However, it is not known whether regional centromeres require pericentromeric heterochromatin. In the yeast Candida lusitaniae, we identified a distinct type of regional centromere that lacks pericentromeric heterochromatin. Centromere locations were determined by ChIP-sequencing of two key centromere proteins, Cse4 and Mif2, and are consistent with bioinformatic predictions. The centromeric DNA sequence was unique for each chromosome and spanned 4–4.5 kbp, consistent with regional epigenetically inherited centromeres. However, unlike other regional centromeres, there was no evidence of pericentromeric heterochromatin in C. lusitaniae. In particular, flanking genes were expressed at a similar level to the rest of the genome, and a URA3 reporter inserted adjacent to a centromere was not repressed. In addition, regions flanking the centromeric core were not associated with hypoacetylated histones or a sirtuin deacetylase that generates heterochromatin in other yeast. Interestingly, the centromeric chromatin had a distinct pattern of histone modifications, being enriched for methylated H3K79 and H3R2 but lacking methylation of H3K4, which is found at other regional centromeres. Thus, not all regional centromeres require flanking heterochromatin. PMID:26371315

The localization of a gene causing X-linked cleft palate and ankyloglossia (CPX) in an Icelandic kindred is between DXS326 and DXYS1X

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stainer, P.; Forbes, S.A.; Moore, G.

1993-09-01

The locus responsible for X-linked, nonsyndromic cleft palate and/or ankyloglossia (CPX) has previously been mapped to the proximal long arm of the human X chromosome between Xq21.31 and q21.33 in an Icelandic kindred. The authors have extended these studies by analyzing an additional 14 informative markers in the family as well as including several newly investigated family members. Recombination analysis indicates that the CPX locus is more proximal than previously thought, within the interval Xq21.1-q21.31. Two recombinants place DXYS1X as the distal flanking marker, while one recombinant defines DXS326 as the proximal flanking marker, an interval of less than 5more » cM. Each of the flanking markers recombines with the CPX locus, giving 2-point lod scores of Z[sub max] = 4.16 at [theta] = 0.08 (DXS326) and Z[sub max] = 5.80 at [theta] = 0.06 (DXYS1X). 35 refs., 3 figs., 2 tabs.« less

Regional Spread of CTX-M-2-Producing Proteus mirabilis with the Identical Genetic Structure in Japan.

PubMed

Kato, Karin; Matsumura, Yasufumi; Yamamoto, Masaki; Nagao, Miki; Takakura, Shunji; Ichiyama, Satoshi

2017-07-01

In this study, we analyzed the molecular epidemiology of extended-spectrum β-lactamase (ESBL)-producing Proteus mirabilis isolates collected from the central region of Japan. Between 2005 and 2012, 820 clinical P. mirabilis isolates were obtained from ten acute care hospitals in Japan. We characterized ESBL confirmatory test-positive isolates by sequencing the ESBL genes and their flanking regions, detecting plasmid replicons, and performing pulsed-field gel electrophoresis (PFGE). Ninety-six isolates (12%) were positive according to the ESBL confirmatory test; all these isolates possessed bla CTX-M-2 with the same flanking structure of upstream ΔISEcp1 and a downstream region identical to downstream bla KLUA-1 . IncT was the prevalent, and only, replicon found in 63 isolates. PFGE analysis detected eight clusters with more than one isolate, among which three included 56 isolates and six included isolates from multiple hospitals. CTX-M-2-producing P. mirabilis with an identical genetic structure flanking bla CTX-M-2 is dominant in this Japanese region, and there is evidence for the clonal spread of isolates.

Construction of an infectious clone of canine herpesvirus genome as a bacterial artificial chromosome.

PubMed

Arii, Jun; Hushur, Orkash; Kato, Kentaro; Kawaguchi, Yasushi; Tohya, Yukinobu; Akashi, Hiroomi

2006-04-01

Canine herpesvirus (CHV) is an attractive candidate not only for use as a recombinant vaccine to protect dogs from a variety of canine pathogens but also as a viral vector for gene therapy in domestic animals. However, developments in this area have been impeded by the complicated techniques used for eukaryotic homologous recombination. To overcome these problems, we used bacterial artificial chromosomes (BACs) to generate infectious BACs. Our findings may be summarized as follows: (i) the CHV genome (pCHV/BAC), in which a BAC flanked by loxP sites was inserted into the thymidine kinase gene, was maintained in Escherichia coli; (ii) transfection of pCHV/BAC into A-72 cells resulted in the production of infectious virus; (iii) the BAC vector sequence was almost perfectly excisable from the genome of the reconstituted virus CHV/BAC by co-infection with CHV/BAC and a recombinant adenovirus that expressed the Cre recombinase; and (iv) a recombinant virus in which the glycoprotein C gene was deleted was generated by lambda recombination followed by Flp recombination, which resulted in a reduction in viral titer compared with that of the wild-type virus. The infectious clone pCHV/BAC is useful for the modification of the CHV genome using bacterial genetics, and CHV/BAC should have multiple applications in the rapid generation of genetically engineered CHV recombinants and the development of CHV vectors for vaccination and gene therapy in domestic animals.

Optimization of turning process through the analytic flank wear modelling

NASA Astrophysics Data System (ADS)

Del Prete, A.; Franchi, R.; De Lorenzis, D.

2018-05-01

In the present work, the approach used for the optimization of the process capabilities for Oil&Gas components machining will be described. These components are machined by turning of stainless steel castings workpieces. For this purpose, a proper Design Of Experiments (DOE) plan has been designed and executed: as output of the experimentation, data about tool wear have been collected. The DOE has been designed starting from the cutting speed and feed values recommended by the tools manufacturer; the depth of cut parameter has been maintained as a constant. Wear data has been obtained by means the observation of the tool flank wear under an optical microscope: the data acquisition has been carried out at regular intervals of working times. Through a statistical data and regression analysis, analytical models of the flank wear and the tool life have been obtained. The optimization approach used is a multi-objective optimization, which minimizes the production time and the number of cutting tools used, under the constraint on a defined flank wear level. The technique used to solve the optimization problem is a Multi Objective Particle Swarm Optimization (MOPS). The optimization results, validated by the execution of a further experimental campaign, highlighted the reliability of the work and confirmed the usability of the optimized process parameters and the potential benefit for the company.

Use of Intragenic Sequence Ribotyping (ISR) for serotyping Salmonella obtained from poultry and their environment

USDA-ARS?s Scientific Manuscript database

BACKGROUND: The dkgB-linked ribosomal region of Salmonella enterica flanking a 5S gene shows genetic heterogeneity that distinguishes closely related serovars such as Enteritidis, Dublin, Gallinarum and Pullorum (Morales et al, 2006). We wanted to know how sequence-based ISR compared to the traditio...

E74-like factor 2 regulates valosin-containing protein expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Binglin; Tomita, Yasuhiko; Qiu, Ying

2007-05-11

Enhanced expression of valosin-containing protein (VCP) correlates with invasion and metastasis of cancers. To clarify the transcription mechanism of VCP, human and mouse genomic sequence was compared, revealing a 260 bp DNA sequence in the 5'-flanking region of VCP gene to be highly conserved between the two, in which binding motif of E74-like factor 2/new Ets-related factor (ELF2/NERF) was identified. Chromatin immunoprecipitation assay showed binding of ELF2/NERF to the 5'-flanking region of VCP gene. Knock-down of ELF2/NERF by siRNA decreased expression level of VCP. Viability of cells under tumor necrosis factor-alpha treatment significantly reduced in ELF2/NERF-knock-down breast cancer cell line.more » Immunohistochemical analysis on clinical breast cancer specimens showed a correlation of nuclear ELF2/NERF expression with VCP expression and proliferative activity of cells shown by Ki-67 immunohistochemistry. These findings indicate that ELF2/NERF promotes VCP transcription and that ELF2/NERF-VCP pathway might be important for cell survival and proliferation under cytokine stress.« less

Functional characterization of the 5'-flanking and the promoter region of the human UCP3 (hUCP3) gene.

PubMed

Tu, N; Chen, H; Winnikes, U; Reinert, I; Pirke, K M; Lentes, K U

2000-09-22

Uncoupling protein-3 (UCP3) is considered as an important regulator of energy expenditure and thermogenesis in humans. To get insight into the mechanisms regulating its expression we have cloned and characterized about 5 kb of the 5'-flanking region of the human UCP3 (hUCP3) gene. 5'-RACE analysis suggested a single transcription initiation site 187 bp upstream from the translational start site. The promoter region contains both TATA and CAAT boxes as well as consensus motifs for PPRE, TRE, CRE and muscle-specific factors like MyoD and MEF2 sites. Functional characterization of a 3 kb hUCP3 promoter fragment in multiple cell lines using a CAT-ELISA identified a cis-acting negative regulatory element between -2983 and -982 while the region between -982 and -284 showed greatly increased basal promoter activity suggesting the presence of a strong enhancer element. Promoter activity was particularly enhanced in the murine skeletal muscle cell line C2C12 reflecting the tissue-selective expression pattern of UCP3.

Sequencing analysis of ghrelin gene 5' flanking region: relations between the sequence variants, fasting plasma total ghrelin concentrations, and body mass index.

PubMed

Vartiainen, Johanna; Kesäniemi, Y Antero; Ukkola, Olavi

2006-10-01

Ghrelin is a 28-amino-acid peptide with several functions linked to energy metabolism. Low ghrelin plasma concentrations are associated with obesity, hypertension, and type 2 diabetes mellitus, whereas high concentrations reflect states of negative energy balance. Several studies addressing the hormonal and neural regulation of ghrelin gene expression have been carried out, but the role of genetic factors in the regulation of ghrelin plasma levels remains unclear. To elucidate the role of genetic factors in the regulation of ghrelin expression, we screened 1657 nucleotides of the ghrelin gene 5' flanking region (promoter and possible regulatory sites) for new sequential variations from patient samples with low (n = 50) and high (n = 50) fasting plasma total ghrelin concentrations (low- and high-ghrelin groups). Eleven single nucleotide polymorphisms (SNPs), 3 of which were rare variants (allelic frequency less than 1%) were found in our population. The genotype distribution patterns of the SNPs did not differ between the study groups, except for SNP-501A>C (P = .039). In addition, the SNP-01A>C was associated with body mass index (BMI) (P = .018). This variant was studied further in our large and well-defined Oulu Project Elucidating Risk for Atherosclerosis (OPERA) cohort (n = 1045) by the restriction fragment length polymorphism (RFLP) technique. No significant association of SNP-501A>C genotypes with fasting ghrelin plasma concentrations was found in the whole OPERA population. However, the association of this SNP with BMI and with waist circumference reached statistical significance in OPERA (P = .047 and .049, respectively), remaining of borderline significance for BMI after adjustments (P = .055). The results indicate that factors other than the 11 SNPs found in this study in the 5' flanking region of ghrelin gene are the main determinants of ghrelin plasma levels. However, SNP-501 A>C genotype distribution seems to be different in subjects having the highest compared with those with the lowest ghrelin levels, and the SNP may be associated with BMI and waist circumference.

Exclusion of RAI2 as the causative gene for Nance-Horan syndrome.

PubMed

Walpole, S M; Ronce, N; Grayson, C; Dessay, B; Yates, J R; Trump, D; Toutain, A

1999-05-01

Nance-Horan syndrome (NHS) is an X-linked condition characterised by congenital cataracts, microphthalmia and/or microcornea, unusual dental morphology, dysmorphic facial features, and developmental delay in some cases. Recent linkage studies have mapped the NHS disease gene to a 3.5-cM interval on Xp22.2 between DXS1053 and DXS443. We previously identified a human homologue of a mouse retinoic-acid-induced gene (RAI2) within the NHS critical flanking interval and have tested the gene as a candidate for Nance-Horan syndrome in nine NHS-affected families. Direct sequencing of the RAI2 gene and predicted promoter region has revealed no mutations in the families screened; RAI2 is therefore unlikely to be associated with NHS.

A chromosome inversion near the KIT gene and the Tobiano spotting pattern in horses.

PubMed

Brooks, S A; Lear, T L; Adelson, D L; Bailey, E

2007-01-01

Tobiano is a white spotting pattern in horses caused by a dominant gene, Tobiano(TO). Here, we report TO associated with a large paracentric chromosome inversion on horse chromosome 3. DNA sequences flanking the inversion were identified and a PCR test was developed to detect the inversion. The inversion was only found in horses with the tobiano pattern, including horses with diverse genetic backgrounds, which indicated a common genetic origin thousands of years ago. The inversion does not interrupt any annotated genes, but begins approximately 100 kb downstream of the KIT gene. This inversion may disrupt regulatory sequences for the KIT gene and cause the white spotting pattern. Copyright (c) 2008 S. Karger AG, Basel.

[Detection of CRSPR-Cas system in Streptococcus thermophiles].

PubMed

Li, Wan; Liang, Hongzhang; Zhang, Danqing; Wang, Nana; Tang, Yaru; Li, Bailiang; Huo, Guicheng

2016-04-14

We aimed to detect the CRSPR-Cas system of six Streptococcus thermophilus. Bioinformatics method was used to predict CRSPR-Cas system of nine S. thermophilus that published in National Center for Biotechnology Information. Four primers were designed according to the flanking sequences of standard strains and the CRISPR-Cas system of six S. thermophilus have been detected by PCR method. S. thermophilus S4 had a Cas9 gene, others all had Cas9 gene, Cas10 gene and Cas9* gene. In addition, 79 and KLDS3.0207 still had Cas3 gene. Signature genes amplification of CRSPR-Cas system could predict the type of CRSPR-Cas system in unsequenced strains, these findings will help establish the foundation for the study of CRSPR-Cas system in lactic acid bacteria.

Structure and polymorphism of the mouse myelin/oligodendrocyte glycoprotein gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daubas, P.; Pham-Dinh, D.; Dautigny, A.

1994-09-01

The authors have isolated and characterized genomic clones containing the mouse myelin/oligodendrocyte glycoprotein (MOG) gene. It spans a region of 12.5 kb and consists of eight exons. Its exon-intron structure differs from that of classical MHC-class I genes, with which it is linked in the mouse genome. Nucleotide sequencing of the 5{prime} flanking region revelas that it contains several putative protein-binding sites, some of them in common with other myelin gene promoters. One intragenic polymorphism has been identified: it consists of a GA repeat, defining at least three alleles in mouse inbred strains, and is easily detectable using the polymerasemore » chain reaction method.« less

An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

PubMed

Itzhaki, H; Maxson, J M; Woodson, W R

1994-09-13

The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

Compelling Evidence for a Prostate Cancer Gene at 22q12.3 by the International Consortium for Prostate Cancer Genetics

PubMed Central

Camp, Nicola J.; Cannon-Albright, Lisa A.; Farnham, James M.; Baffoe-Bonnie, Agnes B.; George, Asha; Powell, Isaac; Bailey-Wilson, Joan E.; Carpten, John D.; Giles, Graham G.; Hopper, John L.; Severi, Gianluca; English, Dallas R.; Foulkes, William D.; Maehle, Lovise; Moller, Pal; Eeles, Ros; Easton, Douglas; Badzioch, Michael D.; Whittemore, Alice S.; Oakley-Girvan, Ingrid; Hsieh, Chih-Lin; Dimitrov, Latchezar; Xu, Jianfeng; Stanford, Janet L.; Johanneson, Bo; Deutsch, Kerry; McIntosh, Laura; Ostrander, Elaine A.; Wiley, Kathleen E.; Isaacs, Sarah D.; Walsh, Patrick C.; Thibodeau, Stephen N.; McDonnell, Shannon K.; Hebbring, Scott; Schaid, Daniel J.; Lange, Ethan M.; Cooney, Kathleen A.; Tammela, Teuvo L.J.; Schleutker, Johanna; Paiss, Thomas; Maier, Christiane; Grönberg, Henrik; Wiklund, Fredrik; Emanuelsson, Monica; Isaacs, William B.

2009-01-01

Previously, an analysis of 14 extended, high-risk Utah pedigrees localized the chromosome 22q linkage region to 3.2 Mb at 22q12.3-13.1 (flanked on each side by three recombinants), which contained 31 annotated genes. In this large, multi-centered, collaborative study, we performed statistical recombinant mapping in fifty-four pedigrees selected to be informative for recombinant mapping from nine member groups of the International Consortium for Prostate Cancer Genetics (ICPCG). These 54 pedigrees included the 14 extended pedigrees from Utah and 40 pedigrees from eight other ICPCG member groups. The additional 40 pedigrees were selected from a total pool of 1,213 such that each pedigree was required to both contain at least four prostate cancer (PRCA) cases and exhibit evidence for linkage to the chromosome 22q region. The recombinant events in these 40 independent pedigrees confirmed the previously proposed region. Further, when all 54 pedigrees were considered, the three-recombinant consensus region was narrowed by more than a megabase to 2.2 Mb at chromosome 22q12.3 flanked by D22S281 and D22S683. This narrower region eliminated 20 annotated genes from that previously proposed, leaving only eleven genes. This region at 22q12.3 is the most consistently identified and smallest linkage region for PRCA. This collaborative study by the ICPCG illustrates the value of consortium efforts and the continued utility of linkage analysis using informative pedigrees to localize genes for complex diseases. PMID:17478474

Multiple Genetic Backgrounds of the Amplified Plasmodium falciparum Multidrug Resistance (pfmdr1) Gene and Selective Sweep of 184F Mutation in Cambodia

PubMed Central

Vinayak, Sumiti; Alam, Md Tauqeer; Sem, Rithy; Shah, Naman K.; Susanti, Augustina I.; Lim, Pharath; Muth, Sinuon; Maguire, Jason D.; Rogers, William O.; Fandeur, Thierry; Barnwell, John W.; Escalante, Ananias A.; Wongsrichanalai, Chansuda; Ariey, Frederick; Meshnick, Steven R.; Udhayakumar, Venkatachalam

2011-01-01

Background The emergence of artesunate-mefloquine (AS+MQ)–resistant Plasmodium falciparum in the Thailand-Cambodia region is a major concern for malaria control. Studies indicate that copy number increase and key alleles in the pfmdr1 gene are associated with AS+MQ resistance. In the present study, we investigated evidence for a selective sweep around pfmdr1 because of the spread of adaptive mutation and/or multiple copies of this gene in the P. falciparum population in Cambodia. Methods We characterized 13 microsatellite loci flanking (± 99 kb) pfmdr1 in 93 single-clone P. falciparum infections, of which 31 had multiple copies and 62 had a single copy of the pfmdr1 gene. Results Genetic analysis revealed no difference in the mean (± standard deviation) expected heterozygosity (He) at loci around single (0.75 ± 0.03) and multiple (0.76 ± 0.04) copies of pfmdr1. Evidence of genetic hitchhiking with the selective sweep of certain haplotypes was seen around mutant (184F) pfmdr1 allele, irrespective of the copy number. There was an overall reduction of 28% in mean He (± SD) around mutant allele (0.56 ± 0.05), compared with wild-type allele (0.84 ± 0.02). Significant linkage disequilibrium was also observed between the loci flanking mutant pfmdr1 allele. Conclusion The 184F mutant allele is under selection, whereas amplification of pfmdr1 gene in this population occurs on multiple genetic backgrounds. PMID:20367478

CCAAT-enhancer-binding protein β (C/EBPβ) and downstream human placental growth hormone genes are targets for dysregulation in pregnancies complicated by maternal obesity.

PubMed

Vakili, Hana; Jin, Yan; Menticoglou, Savas; Cattini, Peter A

2013-08-02

Human chorionic somatomammotropin (CS) and placental growth hormone variant (GH-V) act as metabolic adaptors in response to maternal insulin resistance, which occurs in "normal" pregnancy. Maternal obesity can exacerbate this "resistance," suggesting that CS, GH-V, or transcription factors that regulate their production might be targets. The human CS genes, hCS-A and hCS-B, flank the GH-V gene. A significant decrease in pre-term placental CS/GH-V RNA levels was observed in transgenic mice containing the CS/GH-V genes in a model of high fat diet (HFD)-induced maternal obesity. Similarly, a decrease in CS/GH-V RNA levels was detected in term placentas from obese (body mass index (BMI) ≥ 35 kg/m(2)) versus lean (BMI 20-25 kg/m(2)) women. A specific decrease in transcription factor CCAAT-enhancer-binding protein β (C/EBPβ) RNA levels was also seen with obesity; C/EBPβ is required for mouse placenta development and is expressed, like CS and GH-V, in syncytiotrophoblasts. Binding of C/EBPβ to the CS gene downstream enhancer regions, which by virtue of their position distally flank the GH-V gene, was reduced in placenta chromatin from mice on a HFD and in obese women; a corresponding decrease in RNA polymerase II associated with CS/GH-V promoters was also observed. Detection of decreased endogenous CS/GH-V RNA levels in human placental tumor cells treated with C/EBPβ siRNA is consistent with a direct effect. These data provide evidence for CS/GH-V dysregulation in acute HFD-induced obesity in mouse pregnancy and chronic obesity in human pregnancy and implicate C/EBPβ, a factor associated with CS regulation and placental development.

Deletion of Plasmodium falciparum Histidine-Rich Protein 2 (pfhrp2) and Histidine-Rich Protein 3 (pfhrp3) Genes in Colombian Parasites.

PubMed

Murillo Solano, Claribel; Akinyi Okoth, Sheila; Abdallah, Joseph F; Pava, Zuleima; Dorado, Erika; Incardona, Sandra; Huber, Curtis S; Macedo de Oliveira, Alexandre; Bell, David; Udhayakumar, Venkatachalam; Barnwell, John W

2015-01-01

A number of studies have analyzed the performance of malaria rapid diagnostic tests (RDTs) in Colombia with discrepancies in performance being attributed to a combination of factors such as parasite levels, interpretation of RDT results and/or the handling and storage of RDT kits. However, some of the inconsistencies observed with results from Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-based RDTs could also be explained by the deletion of the gene that encodes the protein, pfhrp2, and its structural homolog, pfhrp3, in some parasite isolates. Given that pfhrp2- and pfhrp3-negative P. falciparum isolates have been detected in the neighboring Peruvian and Brazilian Amazon regions, we hypothesized that parasites with deletions of pfhrp2 and pfhrp3 may also be present in Colombia. In this study we tested 100 historical samples collected between 1999 and 2009 from six Departments in Colombia for the presence of pfhrp2, pfhrp3 and their flanking genes. Seven neutral microsatellites were also used to determine the genetic background of these parasites. In total 18 of 100 parasite isolates were found to have deleted pfhrp2, a majority of which (14 of 18) were collected from Amazonas Department, which borders Peru and Brazil. pfhrp3 deletions were found in 52 of the 100 samples collected from all regions of the country. pfhrp2 flanking genes PF3D7_0831900 and PF3D7_0831700 were deleted in 22 of 100 and in 1 of 100 samples, respectively. pfhrp3 flanking genes PF3D7_1372100 and PF3D7_1372400 were missing in 55 of 100 and in 57 of 100 samples. Structure analysis of microsatellite data indicated that Colombian samples tested in this study belonged to four clusters and they segregated mostly based on their geographic region. Most of the pfhrp2-deleted parasites were assigned to a single cluster and originated from Amazonas Department although a few pfhrp2-negative parasites originated from the other three clusters. The presence of a high proportion of pfhrp2-negative isolates in the Colombian Amazon may have implications for the use of PfHRP2-based RDTs in the region and may explain inconsistencies observed when PfHRP2-based tests and assays are performed.

Deletion of Plasmodium falciparum Histidine-Rich Protein 2 (pfhrp2) and Histidine-Rich Protein 3 (pfhrp3) Genes in Colombian Parasites

PubMed Central

Murillo Solano, Claribel; Akinyi Okoth, Sheila; Abdallah, Joseph F.; Pava, Zuleima; Dorado, Erika; Incardona, Sandra; Huber, Curtis S.; Macedo de Oliveira, Alexandre; Bell, David; Udhayakumar, Venkatachalam; Barnwell, John W.

2015-01-01

A number of studies have analyzed the performance of malaria rapid diagnostic tests (RDTs) in Colombia with discrepancies in performance being attributed to a combination of factors such as parasite levels, interpretation of RDT results and/or the handling and storage of RDT kits. However, some of the inconsistencies observed with results from Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-based RDTs could also be explained by the deletion of the gene that encodes the protein, pfhrp2, and its structural homolog, pfhrp3, in some parasite isolates. Given that pfhrp2- and pfhrp3-negative P. falciparum isolates have been detected in the neighboring Peruvian and Brazilian Amazon regions, we hypothesized that parasites with deletions of pfhrp2 and pfhrp3 may also be present in Colombia. In this study we tested 100 historical samples collected between 1999 and 2009 from six Departments in Colombia for the presence of pfhrp2, pfhrp3 and their flanking genes. Seven neutral microsatellites were also used to determine the genetic background of these parasites. In total 18 of 100 parasite isolates were found to have deleted pfhrp2, a majority of which (14 of 18) were collected from Amazonas Department, which borders Peru and Brazil. pfhrp3 deletions were found in 52 of the100 samples collected from all regions of the country. pfhrp2 flanking genes PF3D7_0831900 and PF3D7_0831700 were deleted in 22 of 100 and in 1 of 100 samples, respectively. pfhrp3 flanking genes PF3D7_1372100 and PF3D7_1372400 were missing in 55 of 100 and in 57 of 100 samples. Structure analysis of microsatellite data indicated that Colombian samples tested in this study belonged to four clusters and they segregated mostly based on their geographic region. Most of the pfhrp2-deleted parasites were assigned to a single cluster and originated from Amazonas Department although a few pfhrp2-negative parasites originated from the other three clusters. The presence of a high proportion of pfhrp2-negative isolates in the Colombian Amazon may have implications for the use of PfHRP2-based RDTs in the region and may explain inconsistencies observed when PfHRP2-based tests and assays are performed. PMID:26151448

Multiple Origins of Mutations in the mdr1 Gene—A Putative Marker of Chloroquine Resistance in P. vivax

PubMed Central

Schousboe, Mette L.; Ranjitkar, Samir; Rajakaruna, Rupika S.; Amerasinghe, Priyanie H.; Morales, Francisco; Pearce, Richard; Ord, Rosalyn; Leslie, Toby; Rowland, Mark; Gadalla, Nahla B.; Konradsen, Flemming; Bygbjerg, Ib C.; Roper, Cally; Alifrangis, Michael

2015-01-01

Background Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR). Single nucleotide polymorphisms (SNPs) in the multidrug resistance gene, Pvmdr1 are putative determinants of CQR but the extent of their emergence at population level remains to be explored. Objective In this study we describe the prevalence of SNPs in the Pvmdr1 among samples collected in seven P. vivax endemic countries and we looked for molecular evidence of drug selection by characterising polymorphism at microsatellite (MS) loci flanking the Pvmdr1 gene. Methods We examined the prevalence of SNPs in the Pvmdr1 gene among 267 samples collected from Pakistan, Afghanistan, Sri Lanka, Nepal, Sudan, São Tomé and Ecuador. We measured and diversity in four microsatellite (MS) markers flanking the Pvmdr1 gene to look evidence of selection on mutant alleles. Results SNP polymorphism in the Pvmdr1 gene was largely confined to codons T958M, Y976F and F1076L. Only 2.4% of samples were wildtype at all three codons (TYF, n = 5), 13.3% (n = 28) of the samples were single mutant MYF, 63.0% of samples (n = 133) were double mutant MYL, and 21.3% (n = 45) were triple mutant MFL. Clear geographic differences in the prevalence of these Pvmdr mutation combinations were observed. Significant linkage disequilibrium (LD) between Pvmdr1 and MS alleles was found in populations sampled in Ecuador, Nepal and Sri Lanka, while significant LD between Pvmdr1 and the combined 4 MS locus haplotype was only seen in Ecuador and Sri Lanka. When combining the 5 loci, high level diversity, measured as expected heterozygosity (He), was seen in the complete sample set (He = 0.99), while He estimates for individual loci ranged from 0.00–0.93. Although Pvmdr1 haplotypes were not consistently associated with specific flanking MS alleles, there was significant differentiation between geographic sites which could indicate directional selection through local drug pressure. Conclusions Our observations suggest that Pvmdr1 mutations emerged independently on multiple occasions even within the same population. In Sri Lanka population analysis at multiple sites showed evidence of local selection and geographical dispersal of Pvmdr1 mutations between sites. PMID:26539821

3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

PubMed

Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

2004-01-01

The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

A 3,387 bp 5'-flanking sequence of the goat alpha-S1-casein gene provides correct tissue-specific expression of human granulocyte colony-stimulating factor (hG-CSF) in the mammary gland of transgenic mice.

PubMed

Serova, Irina A; Dvoryanchikov, Gennady A; Andreeva, Ludmila E; Burkov, Ivan A; Dias, Luciene P B; Battulin, Nariman R; Smirnov, Alexander V; Serov, Oleg L

2012-06-01

A new expression vector containing the 1,944 bp 5'-flanking regulatory region together with exon 1 and intron 1 of the goat alpha-S1-casein gene (CSN1S1), the full-sized human granulocyte colony-stimulating factor gene (hGCSF) and the 3'-flanking sequence of the bovine CSN1S1, was created. The vector DNA was used for generation of four mouse transgenic lines. The transgene was integrated into chromosomes 8 and 12 of two founders as 2 and 5 copies, respectively. Tissue-specific secretion of hG-CSF into the milk of transgenic mice was in the range of 19-40 μg/ml. RT-PCR analysis of various tissues of the transgenic mice demonstrated that expression of hGCSF was detected in only the mammary gland in the progeny of all founders. Moreover, cells were shown to be positive for hG-CSF by immunofluorescent analysis in the mammary glands but not in any other tissues. There were no signs of mosaic expression in the mammary gland. Trace amounts of hG-CSF were detected in the serum of females of two transgenic lines during lactation only. However, no transgenic mice showed any changes in hematopoiesis based on the number of granulocytes in blood. Immunoblotting of hG-CSF in the milk of transgenic mice revealed two forms, presumably the glycosylated and non-glycosylated forms. The hematopoietic activity of hG-CSF in the milk of transgenic females is comparable to that of recombinant G-CSF. In general, the data obtained in this study show that the new expression vector is able to provide correct tissue-specific expression of hG-CSF with high biological activity in transgenic mice.

Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

PubMed

Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

2016-01-01

The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

Variation of genomic islands and flanking fragments in Vibrio parahaemolyticus isolates from environmental and clinical sources in Taiwan.

PubMed

Chi, Po-Shen; Wong, Hin-Chung

2017-10-16

Vibrio parahaemolyticus is a halophilic foodborne pathogenic bacterium that causes gastroenteritis; it has become an issue of global concern since the emergence and spread of pandemic O3:K6 strains. This study evaluated the role of Vibrio pathogenicity island (VPaI)-associated fragments in the genetic variation and grouping of this pathogen. Distribution of some VPaI fragments and flanking fragments (VPaI-1, VPaI-4, VPaI-5, VPaI-6 and VPaI-7) was determined in a total of 53 V. parahaemolyticus isolates from environmental and clinical sources in Taiwan, and supported by the sequences of seven fragments of VPaI-4 and its flanking fragment VP2145. As determined from the distribution of these VPaI-associated fragments, the clinical pandemic isolates were closely related in a single cluster; the clinical nonpandemic isolates were grouped into several clusters, while the environmental isolates were comparatively highly diversified. The profiles of virulence-associated genes of environmental pathogenic isolates varied, and were closer to those of clinical nonpandemic isolates than those of pandemic isolates. Isolates with atypical profiles of the VPaI-associated fragments and virulence-associated genes were identified. Sequences of VP2145 exhibited a close phylogenetic relationship among these local isolates, which were distinct from most V. parahaemolyticus strains from other geographic regions. This investigation demonstrated the application of VPaI-associated fragments in studying the genetic variation and clustering of V. parahaemolyticus isolates from different sources. Copyright © 2017. Published by Elsevier B.V.

The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs.

PubMed

Gálvez, José Héctor; Tai, Helen H; Lagüe, Martin; Zebarth, Bernie J; Strömvik, Martina V

2016-05-19

Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha(-1) was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency.

The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs

PubMed Central

Gálvez, José Héctor; Tai, Helen H.; Lagüe, Martin; Zebarth, Bernie J.; Strömvik, Martina V.

2016-01-01

Nitrogen (N) is the most important nutrient for the growth of potato (Solanum tuberosum L.). Foliar gene expression in potato plants with and without N supplementation at 180 kg N ha−1 was compared at mid-season. Genes with consistent differences in foliar expression due to N supplementation over three cultivars and two developmental time points were examined. In total, thirty genes were found to be over-expressed and nine genes were found to be under-expressed with supplemented N. Functional relationships between over-expressed genes were found. The main metabolic pathway represented among differentially expressed genes was amino acid metabolism. The 1000 bp upstream flanking regions of the differentially expressed genes were analysed and nine overrepresented motifs were found using three motif discovery algorithms (Seeder, Weeder and MEME). These results point to coordinated gene regulation at the transcriptional level controlling steady state potato responses to N sufficiency. PMID:27193058

Agrobacterium tumefaciens-mediated transformation for investigating pathogenicity genes of the phytopathogenic fungus Colletotrichum sansevieriae.

PubMed

Nakamura, Masayuki; Kuwahara, Hideto; Onoyama, Keisuke; Iwai, Hisashi

2012-08-01

Agrobacterium tumefaciens-mediated transformation (AtMT) has become a common technique for DNA transformation of yeast and filamentous fungi. In this study, we first established a protocol of AtMT for the phytopathogenic fungus Colletotrichum sansevieriae. Binary T-DNA vector containing the hygromycin B phosphotransferase gene controlled by the Aspergillus nidulans gpdA promoter and the trpC terminator was constructed with pCAMBIA0380 and used with three different strains LBA4404, GV3101, and GV2260 of A. tumefaciens. Transformants were most effectively obtained when GV2260 and C. sansevieriae Sa-1-2 were co-cultivated; there were about 320 transformants per 10(6) spores. When 1,048 transformants were inoculated on Sansevieria trifasciata, three transformants were found to have completely lost their pathogenicity and two transformants displayed reduced pathogenicity. All of the five transformants had a single copy of T-DNA in their genomes. The three pathogenicity-deficient transformants were subjected to thermal asymmetric interlaced polymerase chain reaction and the reaction allowed us to amplify the sequences flanking the left and/or right borders. The flanking sequences of the two transformants, M154 and M875, showed no homology to any sequences in databases, but the sequences of M678 contained motifs of alpha-1,3-glucan synthase, suggesting that the gene might contribute to the pathogenicity of C. sansevieriae. This study describes a useful method for investigating pathogenicity genes in C. sansevieriae.

Fungal origin by horizontal transfer of a plant mitochondrial group I intron in the chimeric CoxI gene of Peperomia.

PubMed

Vaughn, J C; Mason, M T; Sper-Whitis, G L; Kuhlman, P; Palmer, J D

1995-11-01

We present phylogenetic evidence that a group I intron in an angiosperm mitochondrial gene arose recently by horizontal transfer from a fungal donor species. A 1,716-bp fragment of the mitochondrial coxI gene from the angiosperm Peperomia polybotrya was amplified via the polymerase chain reaction and sequenced. Comparison to other coxI genes revealed a 966-bp group I intron, which, based on homology with the related yeast coxI intron aI4, potentially encodes a 279-amino-acid site-specific DNA endonuclease. This intron, which is believed to function as a ribozyme during its own splicing, is not present in any of 19 coxI genes examined from other diverse vascular plant species. Phylogenetic analysis of intron origin was carried out using three different tree-generating algorithms, and on a variety of nucleotide and amino acid data sets from the intron and its flanking exon sequences. These analyses show that the Peperomia coxI gene intron and exon sequences are of fundamentally different evolutionary origin. The Peperomia intron is more closely related to several fungal mitochondrial introns, two of which are located at identical positions in coxI, than to identically located coxI introns from the land plant Marchantia and the green alga Prototheca. Conversely, the exon sequence of this gene is, as expected, most closely related to other angiosperm coxI genes. These results, together with evidence suggestive of co-conversion of exonic markers immediately flanking the intron insertion site, lead us to conclude that the Peperomia coxI intron probably arose by horizontal transfer from a fungal donor, using the double-strand-break repair pathway. The donor species may have been one of the symbiotic mycorrhizal fungi that live in close obligate association with most plants.

Control of photosynthetic membrane assembly in Rhodobacter sphaeroides mediated by puhA and flanking sequences.

PubMed Central

Sockett, R E; Donohue, T J; Varga, A R; Kaplan, S

1989-01-01

A reaction center H- strain (RCH-) of Rhodobacter sphaeroides, PUHA1, was made by in vitro deletion of an XhoI restriction endonuclease fragment from the puhA gene coupled with insertion of a kanamycin resistance gene cartridge. The resulting construct was delivered to R. sphaeroides wild-type 2.4.1, with the defective puhA gene replacing the wild-type copy by recombination, followed by selection for kanamycin resistance. When grown under conditions known to induce intracytoplasmic membrane development, PUHA1 synthesized a pigmented intracytoplasmic membrane. Spectral analysis of this membrane showed that it was deficient in B875 spectral complexes as well as functional reaction centers and that the level of B800-850 spectral complexes was greater than in the wild type. The RCH- strain was photosythetically incompetent, but photosynthetic growth was restored by complementation with a 1.45-kilobase (kb) BamHI restriction endonuclease fragment containing the puhA gene carried in trans on plasmid pRK404. B875 spectral complexes were not restored by complementation with the 1.45-kb BamHI restriction endonuclease fragment containing the puhA gene but were restored along with photosynthetic competence by complementation with DNA from a cosmid carrying the puhA gene, as well as a flanking DNA sequence. Interestingly, B875 spectral complexes, but not photosynthetic competence, were restored to PUHA1 by introduction in trans of a 13-kb BamHI restriction endonuclease fragment carrying genes encoding the puf operon region of the DNA. The effect of the puhA deletion was further investigated by an examination of the levels of specific mRNA species derived from the puf and puc operons, as well as by determinations of the relative abundances of polypeptides associated with various spectral complexes by immunological methods. The roles of puhA and other genetic components in photosynthetic gene expression and membrane assembly are discussed. Images PMID:2644200

Absence of Interference in Association with Gene Conversion in SORDARIA FIMICOLA, and Presence of Interference in Association with Ordinary Recombination

PubMed Central

Kitani, Y.

1978-01-01

From the analysis of large samples of gene conversion asci in the g locus of Sordaria fimicola, it was found that neither the conversion event itself nor conversion-associated recombination of flanking markers cause either chiasma or chromatid interference with crossing over in a neighboring interval. The presence of more than one kind of crossover event, one causing interference the other not, is considered. The existence of two kinds of gene loci, one of single-cistron composition and the other of multiple-cistron composition, is discussed in relation to reciprocal recombination within a locus. PMID:17176535

Absence of interference in association with gene conversion in Sordaria fimicola, and presence of interference in association with ordinary recombination.

PubMed

Kitani, Y

1978-07-01

From the analysis of large samples of gene conversion asci in the g locus of Sordaria fimicola, it was found that neither the conversion event itself nor conversion-associated recombination of flanking markers cause either chiasma or chromatid interference with crossing over in a neighboring interval. The presence of more than one kind of crossover event, one causing interference the other not, is considered. The existence of two kinds of gene loci, one of single-cistron composition and the other of multiple-cistron composition, is discussed in relation to reciprocal recombination within a locus.

Hyperdiversity of ectomycorrhizal fungus assemblages on oak seedlings in mixed forests in the southern Appalachian Mountains

Treesearch

John F. Walker; Orson K. Miller; Jonathan L. Horton

2005-01-01

Diversity of ectotrophic mycobionts on outplanted seedlings of two oak species (Quercus rubra and Quercus prinus) was estimated at two sites in mature mixed forests in the southern Appalachian Mountains by sequencing nuclear 5.8S rRNA genes and the flanking internal transcribed spacer regions I and II (ITS). The...

A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xun; Guanga, Gerald P; Wan, Cheng

2012-11-13

MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

PubMed

Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

2018-02-10

OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

Glutathione and fungal elicitor regulation of a plant defense gene promoter in electroporated protoplasts

PubMed Central

Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A.; Lamb, Christopher J.

1988-01-01

To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells. Functional analysis of 5′ deletions suggests that promoter activity is determined by an elicitor-regulated activator located between the “TATA box” and nucleotide position -173 and an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response. Images PMID:16593981

The structure of the coding and 5'-flanking region of the type 1 iodothyronine deiodinase (dio1) gene is normal in a patient with suspected congenital dio1 deficiency.

PubMed

Toyoda, N; Kleinhaus, N; Larsen, P R

1996-06-01

We analyzed the exon-intron structure of the human type 1 deiodinase gene (dio1) and compared it with that of a patient with suspected congenital type 1 deiodinase (D1) deficiency. The hdio1 gene is identical in exon-intron arrangement to the mouse gene, with coding sequences and a selenocysteine insertion sequence (SECIS) element contained in four exons. There were no mutations in the sequences of exons 1-4 of the patient's genomic DNA. Functional studies by transient expression techniques showed no difference in basal promoter activity or T3 responsiveness between the patient's and the normal dio1 gene. A structural abnormality in the dio1 gene is not a likely explanation for this patient's D1-deficient phenotype.

Mutations of the Norrie gene in Korean ROP infants.

PubMed

Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup

2002-12-01

The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.

Identification and Characterization of a Novel Member of the Radical AdoMet Enzyme Superfamily and Implications for the Biosynthesis of the Hmd Hydrogenase Active Site Cofactor▿ †

PubMed Central

McGlynn, Shawn E.; Boyd, Eric S.; Shepard, Eric M.; Lange, Rachel K.; Gerlach, Robin; Broderick, Joan B.; Peters, John W.

2010-01-01

The genetic context, phylogeny, and biochemistry of a gene flanking the H2-forming methylene-H4-methanopterin dehydrogenase gene (hmdA), here designated hmdB, indicate that it is a new member of the radical S-adenosylmethionine enzyme superfamily. In contrast to the characteristic CX3CX2C or CX2CX4C motif defining this family, HmdB contains a unique CX5CX2C motif. PMID:19897660

Dissemination of CTX-M-15 β-Lactamase Genes Carried on Inc FI and FII Plasmids among Clinical Isolates of Escherichia coli in a University Hospital in Istanbul, Turkey▿

PubMed Central

Gonullu, Nevriye; Aktas, Zerrin; Kayacan, Cigdem Bal; Salcioglu, Melek; Carattoli, Alessandra; Yong, Dong Eun; Walsh, Timothy R.

2008-01-01

The CTX-M-1 group was found in 86.8% of the Escherichia coli isolates from Istanbul. A subset study revealed all isolates carrying blaCTX-M-15 genes flanked by the insertion element ISEcp1. Plasmid typing of transconjugates carrying blaCTX-M-15 showed that most isolates belonged to the Inc/rep FII group but that one isolate also belonged to the FI group. PMID:18184851

DOE Office of Scientific and Technical Information (OSTI.GOV)

Doug Blankenship

Archive of ArcGIS data from the West Flank FORGE site located in Coso, California. Archive contains the following eight shapefiles: Polygon of the 3D geologic model (WestFlank3DGeologicModelExtent) Polylines of the traces 3D modeled faults (WestFlank3DModeledFaultTraces) Polylines of the fault traces from Duffield and Bacon, 1980 (WestFlankFaultsfromDuffieldandBacon) Polygon of the West Flank FORGE site (WestFlankFORGEsite) Polylines of the traces of the geologic cross-sections (cross-sections in a separate archive in the GDR) (WestFlankGeologicCrossSections) Polylines of the traces of the seismic reflection profiles through and adjacent to the West Flank site (seismic reflection profiles in a separate archive in the GDR) (WestFlankSiesmicReflectionProfiles) Pointsmore » of the well collars in and around the West Flank site (WestFlankWellCollars) Polylines of the surface expression of the West Flank well paths (WestFlankWellPaths)« less

Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis.

PubMed

Lowe, A M; Deresiewicz, R L

1999-01-01

Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.

Targeted mapping and linkage analysis of morphological isozyme, and RAPD markers in peach.

PubMed

Chaparro, J X; Werner, D J; O'Malley, D; Sederoff, R R

1994-02-01

Nine different F2 families of peach [Prunus persica (L.) Batsch] were analyzed for linkage relationships between 14 morphological and two isozyme loci. Linkage was detected between weeping (We) and white flower (W), 33 cM; double flower (Dl) and pillar (Br), 10 cM; and flesh color (Y) and malate dehydrogenase (Mdh1), 26 cM. A leaf variant phenotypically distinct from the previously reported wavy-leaf (Wa) mutant in peach was found in progeny of 'Davie II'. The new willow-leaf character (designated Wa2) was closely linked (0.4 cM) to a new dwarf phenotype (designated Dw3). Two families derived from the pollen-fertile cultivar 'White Glory' segregated for pollen sterility, but segregation did not follow a 3∶1 ratio. Evidence is presented suggesting that 'White Glory' possesses a pollen-sterility gene (designated Ps2) that is non-allelic to the previously reported pollen-sterility gene (Ps) in peach. Ps2 was linked to both weeping (We-Ps2, 15.5 cM) and white flower (Ps2-W, 25.3 cM). A genomic map of peach containing 83 RAPD, one isozyme, and four morphological markers was generated using an F2 family obtained by selfing an NC174RL x 'Pillar' F1. A total of 83 RAPD markers were assigned to 15 linkage groups. Various RAPD markers were linked to morphological traits. Bulked segregant analysis was used to identify RAPD markers flanking the red-leaf (Gr) and Mdh1 loci in the NC174RL x 'Pillar' and 'Marsun' x 'White Glory' F2 families, respectively. Three markers flanking Mdh1 and ten markers flanking Gr were identified. The combination of RAPD markers and bulked segregant analysis provides an efficient method of identifying markers flanking traits of interest. Markers linked to traits that can only be scored late in development are potentially useful for marker-aided selection in trees. Alternatives for obtaining additional map order information for repulsion-phase markers in large F2 populations are proposed.

The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

PubMed

Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

2010-06-01

Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

PubMed Central

Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

2013-01-01

In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

PubMed

Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

2009-07-01

Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

Aphid Resistance in Medicago truncatula Involves Antixenosis and Phloem-Specific, Inducible Antibiosis, and Maps to a Single Locus Flanked by NBS-LRR Resistance Gene Analogs1

PubMed Central

Klingler, John; Creasy, Robert; Gao, Lingling; Nair, Ramakrishnan M.; Calix, Alonso Suazo; Jacob, Helen Spafford; Edwards, Owain R.; Singh, Karam B.

2005-01-01

Aphids and related insects feed from a single cell type in plants: the phloem sieve element. Genetic resistance to Acyrthosiphon kondoi Shinji (bluegreen aphid or blue alfalfa aphid) has been identified in Medicago truncatula Gaert. (barrel medic) and backcrossed into susceptible cultivars. The status of M. truncatula as a model legume allows an in-depth study of defense against this aphid at physiological, biochemical, and molecular levels. In this study, two closely related resistant and susceptible genotypes were used to characterize the aphid-resistance phenotype. Resistance conditions antixenosis since migratory aphids were deterred from settling on resistant plants within 6 h of release, preferring to settle on susceptible plants. Analysis of feeding behavior revealed the trait affects A. kondoi at the level of the phloem sieve element. Aphid reproduction on excised shoots demonstrated that resistance requires an intact plant. Antibiosis against A. kondoi is enhanced by prior infestation, indicating induction of this phloem-specific defense. Resistance segregates as a single dominant gene, AKR (Acyrthosiphon kondoi resistance), in two mapping populations, which have been used to map the locus to a region flanked by resistance gene analogs predicted to encode the CC-NBS-LRR subfamily of resistance proteins. This work provides the basis for future molecular analysis of defense against phloem parasitism in a plant model system. PMID:15778464

Fast and Efficient Drosophila melanogaster Gene Knock-Ins Using MiMIC Transposons

PubMed Central

Vilain, Sven; Vanhauwaert, Roeland; Maes, Ine; Schoovaerts, Nils; Zhou, Lujia; Soukup, Sandra; da Cunha, Raquel; Lauwers, Elsa; Fiers, Mark; Verstreken, Patrik

2014-01-01

Modern molecular genetics studies necessitate the manipulation of genes in their endogenous locus, but most of the current methodologies require an inefficient donor-dependent homologous recombination step to locally modify the genome. Here we describe a methodology to efficiently generate Drosophila knock-in alleles by capitalizing on the availability of numerous genomic MiMIC transposon insertions carrying recombinogenic attP sites. Our methodology entails the efficient PhiC31-mediated integration of a recombination cassette flanked by unique I-SceI and/or I-CreI restriction enzyme sites into an attP-site. These restriction enzyme sites allow for double-strand break−mediated removal of unwanted flanking transposon sequences, while leaving the desired genomic modifications or recombination cassettes. As a proof-of-principle, we mutated LRRK, tau, and sky by using different MiMIC elements. We replaced 6 kb of genomic DNA encompassing the tau locus and 35 kb encompassing the sky locus with a recombination cassette that permits easy integration of DNA at these loci and we also generated a functional LRRKHA knock in allele. Given that ~92% of the Drosophila genes are located within the vicinity (<35 kb) of a MiMIC element, our methodology enables the efficient manipulation of nearly every locus in the fruit fly genome without the need for inefficient donor-dependent homologous recombination events. PMID:25298537

Fast and efficient Drosophila melanogaster gene knock-ins using MiMIC transposons.

PubMed

Vilain, Sven; Vanhauwaert, Roeland; Maes, Ine; Schoovaerts, Nils; Zhou, Lujia; Soukup, Sandra; da Cunha, Raquel; Lauwers, Elsa; Fiers, Mark; Verstreken, Patrik

2014-10-08

Modern molecular genetics studies necessitate the manipulation of genes in their endogenous locus, but most of the current methodologies require an inefficient donor-dependent homologous recombination step to locally modify the genome. Here we describe a methodology to efficiently generate Drosophila knock-in alleles by capitalizing on the availability of numerous genomic MiMIC transposon insertions carrying recombinogenic attP sites. Our methodology entails the efficient PhiC31-mediated integration of a recombination cassette flanked by unique I-SceI and/or I-CreI restriction enzyme sites into an attP-site. These restriction enzyme sites allow for double-strand break-mediated removal of unwanted flanking transposon sequences, while leaving the desired genomic modifications or recombination cassettes. As a proof-of-principle, we mutated LRRK, tau, and sky by using different MiMIC elements. We replaced 6 kb of genomic DNA encompassing the tau locus and 35 kb encompassing the sky locus with a recombination cassette that permits easy integration of DNA at these loci and we also generated a functional LRRK(HA) knock in allele. Given that ~92% of the Drosophila genes are located within the vicinity (<35 kb) of a MiMIC element, our methodology enables the efficient manipulation of nearly every locus in the fruit fly genome without the need for inefficient donor-dependent homologous recombination events. Copyright © 2014 Vilain et al.

Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Hillman, D.; Herbert, E.

1986-05-01

Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

Increased expression of urokinase plasminogen activator in Quebec platelet disorder is linked to megakaryocyte differentiation

PubMed Central

Veljkovic, D. Kika; Rivard, Georges E.; Diamandis, Maria; Blavignac, Jessica; Cramer-Bordé, Elisabeth M.

2009-01-01

Quebec platelet disorder (QPD) is an inherited bleeding disorder associated with increased urokinase plasminogen activator (uPA) in platelets but not in plasma, intraplatelet plasmin generation, and α-granule protein degradation. These abnormalities led us to investigate uPA expression by QPD CD34+ progenitors, cultured megakaryocytes, and platelets, and whether uPA was stored in QPD α-granules. Although QPD CD34+ progenitors expressed normal amounts of uPA, their differentiation into megakaryocytes abnormally increased expression of the uPA gene but not the flanking genes for vinculin or calcium/calmodulin-dependent protein kinase IIγ on chromosome 10. The increased uPA production by cultured QPD megakaryocytes mirrored their production of α-granule proteins, which was normal. uPA was localized to QPD α-granules and it showed extensive colocalization with α-granule proteins in both cultured QPD megakaryocytes and platelets, and with plasminogen in QPD platelets. In QPD megakaryocytes, cultured without or with plasma as a source of plasminogen, α-granule proteins were stored undegraded and this was associated with much less uPA-plasminogen colocalization than in QPD platelets. Our studies indicate that the overexpression of uPA in QPD emerges with megakaryocyte differentiation, without altering the expression of flanking genes, and that uPA is costored with α-granule proteins prior to their proteolysis in QPD. PMID:19029443

Increased expression of urokinase plasminogen activator in Quebec platelet disorder is linked to megakaryocyte differentiation.

PubMed

Veljkovic, D Kika; Rivard, Georges E; Diamandis, Maria; Blavignac, Jessica; Cramer-Bordé, Elisabeth M; Hayward, Catherine P M

2009-02-12

Quebec platelet disorder (QPD) is an inherited bleeding disorder associated with increased urokinase plasminogen activator (uPA) in platelets but not in plasma, intraplatelet plasmin generation, and alpha-granule protein degradation. These abnormalities led us to investigate uPA expression by QPD CD34(+) progenitors, cultured megakaryocytes, and platelets, and whether uPA was stored in QPD alpha-granules. Although QPD CD34(+) progenitors expressed normal amounts of uPA, their differentiation into megakaryocytes abnormally increased expression of the uPA gene but not the flanking genes for vinculin or calcium/calmodulin-dependent protein kinase IIgamma on chromosome 10. The increased uPA production by cultured QPD megakaryocytes mirrored their production of alpha-granule proteins, which was normal. uPA was localized to QPD alpha-granules and it showed extensive colocalization with alpha-granule proteins in both cultured QPD megakaryocytes and platelets, and with plasminogen in QPD platelets. In QPD megakaryocytes, cultured without or with plasma as a source of plasminogen, alpha-granule proteins were stored undegraded and this was associated with much less uPA-plasminogen colocalization than in QPD platelets. Our studies indicate that the overexpression of uPA in QPD emerges with megakaryocyte differentiation, without altering the expression of flanking genes, and that uPA is costored with alpha-granule proteins prior to their proteolysis in QPD.

Identification, characterization and functional analysis of regulatory region of nanos gene from half-smooth tongue sole (Cynoglossus semilaevis).

PubMed

Huang, Jinqiang; Li, Yongjuan; Shao, Changwei; Wang, Na; Chen, Songlin

2017-06-20

The nanos gene encodes an RNA-binding zinc finger protein, which is required in the development and maintenance of germ cells. However, there is very limited information about nanos in flatfish, which impedes its application in fish breeding. In this study, we report the molecular cloning, characterization and functional analysis of the 3'-untranslated region of the nanos gene (Csnanos) from half-smooth tongue sole (Cynoglossus semilaevis), which is an economically important flatfish in China. The 1233-bp cDNA sequence, 1709-bp genomic sequence and flanking sequences (2.8-kb 5'- and 1.6-kb 3'-flanking regions) of Csnanos were cloned and characterized. Sequence analysis revealed that CsNanos shares low homology with Nanos in other species, but the zinc finger domain of CsNanos is highly similar. Phylogenetic analysis indicated that CsNanos belongs to the Nanos2 subfamily. Csnanos expression was widely detected in various tissues, but the expression level was higher in testis and ovary. During early development and sex differentiation, Csnanos expression exhibited a clear sexually dimorphic pattern, suggesting its different roles in the migration and differentiation of primordial germ cells (PGCs). Higher expression levels of Csnanos mRNA in normal females and males than in neomales indicated that the nanos gene may play key roles in maintaining the differentiation of gonad. Moreover, medaka PGCs were successfully labeled by the microinjection of synthesized mRNA consisting of green fluorescence protein and the 3'-untranslated region of Csnanos. These findings provide new insights into nanos gene expression and function, and lay the foundation for further study of PGC development and applications in tongue sole breeding. Copyright © 2017 Elsevier B.V. All rights reserved.

Deletion patterns of the STS gene and flanking sequences in Israeli X-linked ichthyosis patients and carriers: analysis by polymerase chain reaction and fluorescence in situ hybridization techniques.

PubMed

Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L

2000-03-01

Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

Detection of novel mutations that cause autosomal dominant retinitis pigmentosa in candidate genes by long-range PCR amplification and next-generation sequencing

PubMed Central

Dias, Miguel de Sousa; Hernan, Imma; Pascual, Beatriz; Borràs, Emma; Mañé, Begoña; Gamundi, Maria José

2013-01-01

Purpose To devise an effective method for detecting mutations in 12 genes (CA4, CRX, IMPDH1, NR2E3, RP9, PRPF3, PRPF8, PRPF31, PRPH2, RHO, RP1, and TOPORS) commonly associated with autosomal dominant retinitis pigmentosa (adRP) that account for more than 95% of known mutations. Methods We used long-range PCR (LR-PCR) amplification and next-generation sequencing (NGS) performed in a GS Junior 454 benchtop sequencing platform. Twenty LR-PCR fragments, between 3,000 and 10,000 bp, containing all coding exons and flanking regions of the 12 genes, were obtained from DNA samples of patients with adRP. Sequencing libraries were prepared with an enzymatic (Fragmentase technology) method. Results Complete coverage of the coding and flanking sequences of the 12 genes assayed was obtained with NGS, with an average sequence depth of 380× (ranging from 128× to 1,077×). Five previous known mutations in the adRP genes were detected with a sequence variation percentage between 35% and 65%. We also performed a parallel sequence analysis of four samples, three of them new patients with index adRP, in which two novel mutations were detected in RHO (p.Asn73del) and PRPF31 (p.Ile109del). Conclusions The results demonstrate that genomic LR-PCR amplification together with NGS is an effective method for analyzing individual patient samples for mutations in a monogenic heterogeneous disease such as adRP. This approach proved effective for the parallel analysis of adRP and has been introduced as routine. Additionally, this approach could be extended to other heterogeneous genetic diseases. PMID:23559859

Deep Sequencing of 71 Candidate Genes to Characterize Variation Associated with Alcohol Dependence.

PubMed

Clark, Shaunna L; McClay, Joseph L; Adkins, Daniel E; Kumar, Gaurav; Aberg, Karolina A; Nerella, Srilaxmi; Xie, Linying; Collins, Ann L; Crowley, James J; Quackenbush, Corey R; Hilliard, Christopher E; Shabalin, Andrey A; Vrieze, Scott I; Peterson, Roseann E; Copeland, William E; Silberg, Judy L; McGue, Matt; Maes, Hermine; Iacono, William G; Sullivan, Patrick F; Costello, Elizabeth J; van den Oord, Edwin J

2017-04-01

Previous genomewide association studies (GWASs) have identified a number of putative risk loci for alcohol dependence (AD). However, only a few loci have replicated and these replicated variants only explain a small proportion of AD risk. Using an innovative approach, the goal of this study was to generate hypotheses about potentially causal variants for AD that can be explored further through functional studies. We employed targeted capture of 71 candidate loci and flanking regions followed by next-generation deep sequencing (mean coverage 78X) in 806 European Americans. Regions included in our targeted capture library were genes identified through published GWAS of alcohol, all human alcohol and aldehyde dehydrogenases, reward system genes including dopaminergic and opioid receptors, prioritized candidate genes based on previous associations, and genes involved in the absorption, distribution, metabolism, and excretion of drugs. We performed single-locus tests to determine if any single variant was associated with AD symptom count. Sets of variants that overlapped with biologically meaningful annotations were tested for association in aggregate. No single, common variant was significantly associated with AD in our study. We did, however, find evidence for association with several variant sets. Two variant sets were significant at the q-value <0.10 level: a genic enhancer for ADHFE1 (p = 1.47 × 10 -5 ; q = 0.019), an alcohol dehydrogenase, and ADORA1 (p = 5.29 × 10 -5 ; q = 0.035), an adenosine receptor that belongs to a G-protein-coupled receptor gene family. To our knowledge, this is the first sequencing study of AD to examine variants in entire genes, including flanking and regulatory regions. We found that in addition to protein coding variant sets, regulatory variant sets may play a role in AD. From these findings, we have generated initial functional hypotheses about how these sets may influence AD. Copyright © 2017 by the Research Society on Alcoholism.

Multiple Translocation of the AVR-Pita Effector Gene among Chromosomes of the Rice Blast Fungus Magnaporthe oryzae and Related Species

PubMed Central

Chuma, Izumi; Isobe, Chihiro; Hotta, Yuma; Ibaragi, Kana; Futamata, Natsuru; Kusaba, Motoaki; Yoshida, Kentaro; Terauchi, Ryohei; Fujita, Yoshikatsu; Nakayashiki, Hitoshi; Valent, Barbara; Tosa, Yukio

2011-01-01

Magnaporthe oryzae is the causal agent of rice blast disease, a devastating problem worldwide. This fungus has caused breakdown of resistance conferred by newly developed commercial cultivars. To address how the rice blast fungus adapts itself to new resistance genes so quickly, we examined chromosomal locations of AVR-Pita, a subtelomeric gene family corresponding to the Pita resistance gene, in various isolates of M. oryzae (including wheat and millet pathogens) and its related species. We found that AVR-Pita (AVR-Pita1 and AVR-Pita2) is highly variable in its genome location, occurring in chromosomes 1, 3, 4, 5, 6, 7, and supernumerary chromosomes, particularly in rice-infecting isolates. When expressed in M. oryzae, most of the AVR-Pita homologs could elicit Pita-mediated resistance, even those from non-rice isolates. AVR-Pita was flanked by a retrotransposon, which presumably contributed to its multiple translocation across the genome. On the other hand, family member AVR-Pita3, which lacks avirulence activity, was stably located on chromosome 7 in a vast majority of isolates. These results suggest that the diversification in genome location of AVR-Pita in the rice isolates is a consequence of recognition by Pita in rice. We propose a model that the multiple translocation of AVR-Pita may be associated with its frequent loss and recovery mediated by its transfer among individuals in asexual populations. This model implies that the high mobility of AVR-Pita is a key mechanism accounting for the rapid adaptation toward Pita. Dynamic adaptation of some fungal plant pathogens may be achieved by deletion and recovery of avirulence genes using a population as a unit of adaptation. PMID:21829350

Endothelial Cell Implantation and Survival within Experimental Gliomas

NASA Astrophysics Data System (ADS)

Lal, Bachchu; Indurti, Ravi R.; Couraud, Pierre-Olivier; Goldstein, Gary W.; Laterra, John

1994-10-01

The delivery of therapeutic genes to primary brain neoplasms opens new opportunities for treating these frequently fatal tumors. Efficient gene delivery to tissues remains an important obstacle to therapy, and this problem has unique characteristics in brain tumors due to the blood-brain and blood-tumor barriers. The presence of endothelial mitogens and vessel proliferation within solid tumors suggests that genetically modified endothelial cells might efficiently transplant to brain tumors. Rat brain endothelial cells immortalized with the adenovirus E1A gene and further modified to express the β-galactosidase reporter were examined for their ability to survive implantation to experimental rat gliomas. Rats received 9L, F98, or C6 glioma cells in combination with endothelial cells intracranially to caudate/putamen or subcutaneously to flank. Implanted endothelial cells were identified by β-galactosidase histochemistry or by polymerase chain reaction in all tumors up to 35 days postimplantation, the latest time examined. Implanted endothelial cells appeared to cooperate in tumor vessel formation and expressed the brain-specific endothelial glucose transporter type 1 as identified by immunohistochemistry. The proliferation of implanted endothelial cells was supported by their increased number within tumors between postimplantation days 14 and 21 (P = 0.015) and by their expression of the proliferation antigen Ki67. These findings establish that genetically modified endothelial cells can be stably engrafted to growing gliomas and suggest that endothelial cell implantation may provide a means of delivering therapeutic genes to brain neoplasms and other solid tumors. In addition, endothelial implantation to brain may be useful for defining mechanisms of brain-specific endothelial differentiation.

Relevance of sodium/glucose cotransporter-1 (SGLT1) to diabetes mellitus and obesity in dogs.

PubMed

Batchelor, D J; German, A J; Shirazi-Beechey, S P

2013-04-01

Glucose transport across the enterocyte brush border membrane by sodium/glucose cotransporter-1 (SGLT1, coded by Slc5a1) is the rate-limiting step for intestinal glucose transport. The relevance of SGLT1 expression in predisposition to diabetes mellitus and to obesity was investigated in dogs. Cultured Caco-2/TC7 cells were shown to express SGLT1 in vitro. A 2-kbp fragment of the Slc5a1 5' flanking region was cloned from canine genomic DNA, ligated into reporter gene plasmids, and shown to drive reporter gene expression in these cells above control (P < 0.001). To determine the effect of the 3 known SNPs in this region on promoter function, new promoter/reporter constructs (all permutations of these 3 SNPs) were created by site-directed mutagenesis. No significant differences in promoter function were seen, suggesting that these SNPs do not have a significant effect on the constitutive transcription of SGLT1 mRNA in dogs. A search for novel SNPs in this region in dogs was made in 2 breeds predisposed to diabetes mellitus (Samoyed and cairn terrier), 2 breeds that rarely develop diabetes (boxer and German shepherd), and 2 breeds predisposed to obesity (Labrador retriever and cocker spaniel). The Slc5a1 5' flanking region was amplified from 10 healthy individuals of each of these breeds by high-fidelity PCR with the use of breed-labeled primers and sequenced by pyrosequencing. The sequence of the Slc5a1 5' flanking region in all individuals of all breeds tested was identical. On this evidence, variations in Slc5a1 promoter sequence between dogs do not influence the pathogenesis of diabetes mellitus or obesity in these breeds. Copyright © 2013 Elsevier Inc. All rights reserved.

Polymorphisms in the HSP90AA1 5' flanking region are associated with scrapie incubation period in sheep.

PubMed

Marcos-Carcavilla, Ane; Moreno, Carole; Serrano, Magdalena; Laurent, Pascal; Cribiu, Edmond P; Andréoletti, Olivier; Ruesche, Julien; Weisbecker, Jean-Louis; Calvo, Jorge H; Moazami-Goudarzi, Katayoun

2010-07-01

Susceptibility to scrapie is mainly controlled by point mutations at the PRNP locus. However, additional quantitative trait loci (QTL) have been identified across the genome including a region in OAR18. The gene which encodes the inducible form of the cytoplasmic Hsp90 chaperone (HSP90AA1) maps within this region and seems to be associated with the resistance/susceptibility to scrapie in sheep. Here, we have analyzed several polymorphisms which were previously described in the ovine HSP90AA1 5' flanking region and in intron 10 in two naturally scrapie infected Romanov sheep populations. First, we have studied 58 ARQ/VRQ animals pertaining to the sire family where the QTL influencing scrapie incubation period in OAR18 was detected. We have found a significant association between polymorphisms localized at -660 and -528 in the HSP90AA1 5' flanking region and the scrapie incubation period. These two polymorphisms have also been studied in a second sample constituted by 62 VRQ/VRQ sheep showing an extreme incubation period. Results are concordant with the first dataset. Finally, we have studied the HSP90AA1 expression in scrapie and control animals (N = 41) with different HSP90AA1 genotypes by real time PCR on blood samples. The HSP90AA1 expression rate was equivalent in CC(-600)AA(-528) and CG(-600)AG(-528) scrapie resistant animals (ARR/ARR) and was higher in their CC(-600)AA(-528) than in their CG(-600)AG(-528) scrapie susceptible counterparts (VRQ/VRQ). Our results support the hypothesis that the ovine HSP90AA1 gene acts as a modulator of scrapie susceptibility, contributing to the observed differences in the incubation period of scrapie infected animals with the same PRNP genotype.

Identification of a Recurrent Microdeletion at 17q23.1q23.2 Flanked by Segmental Duplications Associated with Heart Defects and Limb Abnormalities

PubMed Central

Ballif, Blake C.; Theisen, Aaron; Rosenfeld, Jill A.; Traylor, Ryan N.; Gastier-Foster, Julie; Thrush, Devon Lamb; Astbury, Caroline; Bartholomew, Dennis; McBride, Kim L.; Pyatt, Robert E.; Shane, Kate; Smith, Wendy E.; Banks, Valerie; Gallentine, William B.; Brock, Pamela; Rudd, M. Katharine; Adam, Margaret P.; Keene, Julia A.; Phillips, John A.; Pfotenhauer, Jean P.; Gowans, Gordon C.; Stankiewicz, Pawel; Bejjani, Bassem A.; Shaffer, Lisa G.

2010-01-01

Segmental duplications, which comprise ∼5%–10% of the human genome, are known to mediate medically relevant deletions, duplications, and inversions through nonallelic homologous recombination (NAHR) and have been suggested to be hot spots in chromosome evolution and human genomic instability. We report seven individuals with microdeletions at 17q23.1q23.2, identified by microarray-based comparative genomic hybridization (aCGH). Six of the seven deletions are ∼2.2 Mb in size and flanked by large segmental duplications of >98% sequence identity and in the same orientation. One of the deletions is ∼2.8 Mb in size and is flanked on the distal side by a segmental duplication, whereas the proximal breakpoint falls between segmental duplications. These characteristics suggest that NAHR mediated six out of seven of these rearrangements. These individuals have common features, including mild to moderate developmental delay (particularly speech delay), microcephaly, postnatal growth retardation, heart defects, and hand, foot, and limb abnormalities. Although all individuals had at least mild dysmorphic facial features, there was no characteristic constellation of features that would elicit clinical suspicion of a specific disorder. The identification of common clinical features suggests that microdeletions at 17q23.1q23.2 constitute a novel syndrome. Furthermore, the inclusion in the minimal deletion region of TBX2 and TBX4, transcription factors belonging to a family of genes implicated in a variety of developmental pathways including those of heart and limb, suggests that these genes may play an important role in the phenotype of this emerging syndrome. PMID:20206336

A Helitron-like Transposon Superfamily from Lepidoptera Disrupts (GAAA)n Microsatellites and is Responsible for Flanking Sequence Similarity within a Microsatellite Family

USDA-ARS?s Scientific Manuscript database

Transposable elements (TEs) are mobile DNA regions that alter host genome structure and gene expression. A novel 588 bp non-autonomous high copy number TE in the Ostrinia nubilalis genome has features in common with miniature inverted-repeat transposable elements (MITEs): high A+T content (62.3%),...

Ribosomal Biosynthesis of the Cyclic Peptide Toxins of Amanita Mushrooms

PubMed Central

Walton, Jonathan D.; Hallen-Adams, Heather E.; Luo, Hong

2014-01-01

Some species of mushrooms in the genus Amanita are extremely poisonous and frequently fatal to mammals including humans and dogs. Their extreme toxicity is due to amatoxins such as α- and β-amanitin. Amanita mushrooms also biosynthesize a chemically related group of toxins, the phallotoxins, such as phalloidin. The amatoxins and phallotoxins (collectively known as the Amanita toxins) are bicyclic octa- and heptapeptides, respectively. Both contain an unusual Trp-Cys cross-bridge known as tryptathionine. We have shown that, in Amanita bisporigera, the amatoxins and phallotoxins are synthesized as proproteins on ribosomes and not by nonribosomal peptide synthetases. The proproteins are 34–35 amino acids in length and have no predicted signal peptides. The genes for α-amanitin (AMA1) and phallacidin (PHA1) are members of a large family of related genes, characterized by highly conserved amino acid sequences flanking a hypervariable “toxin” region. The toxin regions are flanked by invariant proline (Pro) residues. An enzyme that could cleave the proprotein of phalloidin was purified from the phalloidin-producing lawn mushroom Conocybe apala. The enzyme is a serine protease in the prolyl oligopeptidase (POP) subfamily. The same enzyme cuts at both Pro residues to release the linear hepta- or octapeptide. PMID:20564017

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

PubMed

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification and fine-mapping of Xa33, a novel gene for resistance to Xanthomonas oryzae pv. oryzae.

PubMed

Kumar, P Natraj; Sujatha, K; Laha, G S; Rao, K Srinivasa; Mishra, B; Viraktamath, B C; Hari, Y; Reddy, C S; Balachandran, S M; Ram, T; Madhav, M Sheshu; Rani, N Shobha; Neeraja, C N; Reddy, G Ashok; Shaik, H; Sundaram, R M

2012-02-01

Broadening of the genetic base for identification and transfer of genes for resistance to insect pests and diseases from wild relatives of rice is an important strategy in resistance breeding programs across the world. An accession of Oryza nivara, International Rice Germplasm Collection (IRGC) accession number 105710, was identified to exhibit high level and broad-spectrum resistance to Xanthomonas oryzae pv. oryzae. In order to study the genetics of resistance and to tag and map the resistance gene or genes present in IRGC 105710, it was crossed with the bacterial blight (BB)-susceptible varieties 'TN1' and 'Samba Mahsuri' (SM) and then backcrossed to generate backcross mapping populations. Analysis of these populations and their progeny testing revealed that a single dominant gene controls resistance in IRGC 105710. The BC(1)F(2) population derived from the cross IRGC 105710/TN1//TN1 was screened with a set of 72 polymorphic simple-sequence repeat (SSR) markers distributed across the rice genome and the resistance gene was coarse mapped on chromosome 7 between the SSR markers RM5711 and RM6728 at a genetic distance of 17.0 and 19.3 centimorgans (cM), respectively. After analysis involving 49 SSR markers located between the genomic interval spanned by RM5711 and RM6728, and BC(2)F(2) population consisting of 2,011 individuals derived from the cross IRGC 105710/TN1//TN1, the gene was fine mapped between two SSR markers (RMWR7.1 and RMWR7.6) located at a genetic distance of 0.9 and 1.2 cM, respectively, from the gene and flanking it. The linkage distances were validated in a BC(1)F(2) mapping population derived from the cross IRGC 105710/SM//2 × SM. The BB resistance gene present in the O. nivara accession was identified to be novel based on its unique map location on chromosome 7 and wider spectrum of BB resistance; this gene has been named Xa33. The genomic region between the two closely flanking SSR markers was in silico analyzed for putatively expressed candidate genes. In total, eight genes were identified in the region and a putative gene encoding serinethreonine kinase appears to be a candidate for the Xa33 gene.

A novel nonsense mutation in CRYBB1 associated with autosomal dominant congenital cataract

PubMed Central

Yang, Juhua; Zhu, Yihua; Gu, Feng; He, Xiang; Cao, Zongfu; Li, Xuexi; Tong, Yi

2008-01-01

Purpose To identify the molecular defect underlying an autosomal dominant congenital nuclear cataract in a Chinese family. Methods Twenty-two members of a three-generation pedigree were recruited, clinical examinations were performed, and genomic DNA was extracted from peripheral blood leukocytes. All members were genotyped with polymorphic microsatellite markers adjacent to each of the known cataract-related genes. Linkage analysis was performed after genotyping. Candidate genes were screened for mutation using direct sequencing. Individuals were screened for presence of a mutation by restriction fragment length polymorphism (RFLP) analysis. Results Linkage analysis identified a maximum LOD score of 3.31 (recombination fraction [θ]=0.0) with marker D22S1167 on chromosome 22, which flanks the β-crystallin gene cluster (CRYBB3, CRYBB2, CRYBB1, and CRYBA4). Sequencing the coding regions and the flanking intronic sequences of these four candidate genes identified a novel, heterozygous C→T transition in exon 6 of CRYBB1 in the affected individuals of the family. This single nucleotide change introduced a novel BfaI site and was predicted to result in a nonsense mutation at codon 223 that changed a phylogenetically conserved amino acid to a stop codon (p.Q223X). RFLP analysis confirmed that this mutation co-segregated with the disease phenotype in all available family members and was not found in 100 normal unrelated individuals from the same ethnic background. Conclusions This study has identified a novel nonsense mutation in CRYBB1 (p.Q223X) associated with autosomal dominant congenital nuclear cataract. PMID:18432316

Knockdown of Zebrafish Lumican Gene (zlum) Causes Scleral Thinning and Increased Size of Scleral Coats*

PubMed Central

Yeh, Lung-Kun; Liu, Chia-Yang; Kao, Winston W.-Y.; Huang, Chang-Jen; Hu, Fung-Rong; Chien, Chung-Liang; Wang, I-Jong

2010-01-01

The lumican gene (lum), which encodes one of the major keratan sulfate proteoglycans (KSPGs) in the vertebrate cornea and sclera, has been linked to axial myopia in humans. In this study, we chose zebrafish (Danio rerio) as an animal model to elucidate the role of lumican in the development of axial myopia. The zebrafish lumican gene (zlum) spans ∼4.6 kb of the zebrafish genome. Like human (hLUM) and mouse (mlum), zlum consists of three exons, two introns, and a TATA box-less promoter at the 5′-flanking region of the transcription initiation site. Sequence analysis of the cDNA predicts that zLum encodes 344 amino acids. zLum shares 51% amino acid sequence identity with human lumican. Similar to hLUM and mlum, zlum mRNA is expressed in the eye and many other tissues, such as brain, muscle, and liver as well. Transgenic zebrafish harboring an enhanced GFP reporter gene construct downstream of a 1.7-kb zlum 5′-flanking region displayed enhanced GFP expression in the cornea and sclera, as well as throughout the body. Down-regulation of zlum expression by antisense zlum morpholinos manifested ocular enlargement resembling axial myopia due to disruption of the collagen fibril arrangement in the sclera and resulted in scleral thinning. Administration of muscarinic receptor antagonists, e.g. atropine and pirenzepine, effectively subdued the ocular enlargement caused by morpholinos in in vivo zebrafish larvae assays. The observation suggests that zebrafish can be used as an in vivo model for screening compounds in treating myopia. PMID:20551313

Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.

PubMed

Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E

2015-09-01

The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.

Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, L.A.

1994-05-06

We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

Integron-Associated DfrB4, a Previously Uncharacterized Member of the Trimethoprim-Resistant Dihydrofolate Reductase B Family, Is a Clinically Identified Emergent Source of Antibiotic Resistance.

PubMed

Toulouse, Jacynthe L; Edens, Thaddeus J; Alejaldre, Lorea; Manges, Amee R; Pelletier, Joelle N

2017-05-01

Whole-genome sequencing of trimethoprim-resistant Escherichia coli clinical isolates identified a member of the trimethoprim-resistant type II dihydrofolate reductase gene family ( dfrB ). The dfrB4 gene was located within a class I integron flanked by multiple resistance genes. This arrangement was previously reported in a 130.6-kb multiresistance plasmid. The DfrB4 protein conferred a >2,000-fold increased trimethoprim resistance on overexpression in E. coli Our results are consistent with the finding that dfrB4 contributes to clinical trimethoprim resistance. Copyright © 2017 American Society for Microbiology.

Somatic diversification of chicken immunoglobulin light chains by point mutations.

PubMed

Parvari, R; Ziv, E; Lantner, F; Heller, D; Schechter, I

1990-04-01

The light-chain locus of chicken has 1 functional V lambda 1 gene, 1 J gene, and 25 pseudo-V lambda-genes (where V = variable and J = joining). A major problem is which somatic mechanisms expand this extremely limited germ-line information to generate many different antibodies. Weill's group [Reynaud, C. A., Anquez, V., Grimal, H. & Weill, J. C. (1987) Cell 48, 379-388] has shown that the pseudo-V lambda-genes diversify the rearranged V lambda 1 by gene conversion. Here we demonstrate that chicken light chains are further diversified by somatic point mutations and by V lambda 1-J flexible joining. Somatic point mutations were identified in the J and 3' noncoding DNA of rearranged light-chain genes of chicken. These regions were analyzed because point mutations in V lambda 1 are obscured by gene conversion; the J and 3' noncoding DNA are presented in one copy per haploid genome and are not subject to gene conversion. In rodents point mutations occur as frequently in the V-J coding regions as in the adjacent flanking DNA. Therefore, we conclude that somatic point mutations diversify the V lambda 1 of chicken. The frequency (0-1%) and distribution of the mutations (decreasing in number with increased distance from the V lambda 1 segment) in chicken were as observed in rodents. Sequence variability at the V lambda 1-J junctions could be attributed to imprecise joining of the V lambda 1 and J genes. The modification by gene conversion of rearranged V lambda 1 genes in the bursa was similar in chicken aged 3 months (9.5%) or 3 weeks (9.1%)--i.e., gene conversion that generates the preimmune repertoire in the bursa seems to level off around 3 weeks of age. This preimmune repertoire can be further diversified by somatic point mutations that presumably lead to the formation of antibodies with increased affinity. A segment with structural features of a matrix association region [(A + T)-rich and four topoisomerase II binding sites] was identified in the middle of the J-C lambda intron (where C = constant).

Evolution of the chalcone synthase gene family in the genus Ipomoea.

PubMed Central

Durbin, M L; Learn, G H; Huttley, G A; Clegg, M T

1995-01-01

The evolution of the chalcone synthase [CHS; malonyl-CoA:4-coumaroyl-CoA malonyltransferase (cyclizing), EC 2.3.1.74] multigene family in the genus Ipomoea is explored. Thirteen CHS genes from seven Ipomoea species (family Convolvulaceae) were sequenced--three from genomic clones and the remainder from PCR amplification with primers designed from the 5' flanking region and the end of the 3' coding region of Ipomoea purpurea Roth. Analysis of the data indicates a duplication of CHS that predates the divergence of the Ipomoea species in this study. The Ipomoea CHS genes are among the most rapidly evolving of the CHS genes sequenced to date. The CHS genes in this study are most closely related to the Petunia CHS-B gene, which is also rapidly evolving and highly divergent from the rest of the Petunia CHS sequences. PMID:7724563

Genetics and fine mapping of a purple leaf gene, BoPr, in ornamental kale (Brassica oleracea L. var. acephala).

PubMed

Liu, Xiao-Ping; Gao, Bao-Zhen; Han, Feng-Qing; Fang, Zhi-Yuan; Yang, Li-Mei; Zhuang, Mu; Lv, Hong-Hao; Liu, Yu-Mei; Li, Zhan-Sheng; Cai, Cheng-Cheng; Yu, Hai-Long; Li, Zhi-Yuan; Zhang, Yang-Yong

2017-03-14

Due to its variegated and colorful leaves, ornamental kale (Brassica oleracea L. var. acephala) has become a popular ornamental plant. In this study, we report the fine mapping and analysis of a candidate purple leaf gene using a backcross population and an F 2 population derived from two parental lines: W1827 (with white leaves) and P1835 (with purple leaves). Genetic analysis indicated that the purple leaf trait is controlled by a single dominant gene, which we named BoPr. Using markers developed based on the reference genome '02-12', the BoPr gene was preliminarily mapped to a 280-kb interval of chromosome C09, with flanking markers M17 and BoID4714 at genetic distances of 4.3 cM and 1.5 cM, respectively. The recombination rate within this interval is almost 12 times higher than the usual level, which could be caused by assembly error for reference genome '02-12' at this interval. Primers were designed based on 'TO1000', another B. oleracea reference genome. Among the newly designed InDel markers, BRID485 and BRID490 were found to be the closest to BoPr, flanking the gene at genetic distances of 0.1 cM and 0.2 cM, respectively; the interval between the two markers is 44.8 kb (reference genome 'TO1000'). Seven annotated genes are located within the 44.8 kb genomic region, of which only Bo9g058630 shows high homology to AT5G42800 (dihydroflavonol reductase), which was identified as a candidate gene for BoPr. Blast analysis revealed that this 44.8 kb interval is located on an unanchored scaffold (Scaffold000035_P2) of '02-12', confirming the existence of assembly error at the interval between M17 and BoID4714 for reference genome '02-12'. This study identified a candidate gene for BoPr and lays a foundation for the cloning and functional analysis of this gene.

Construction of chromosomally located T7 expression system for production of heterologous secreted proteins in Bacillus subtilis.

PubMed

Chen, Po Ting; Shaw, Jei-Fu; Chao, Yun-Peng; David Ho, Tuan-Hua; Yu, Su-May

2010-05-12

Bacillus subtilis is most commonly employed for secretion of recombinant proteins. To circumvent the problems caused by using plasmids, the T7 expression system known for its high efficiency was rebuilt in B. subtilis. Accordingly, a markerless and replicon-free method was developed for genomic insertion of DNAs. By the act of homologous recombination via the guide DNA, a suicidal vector carrying the gene of interest was integrated into genomic loci of bacteria. Removal of the inserted selection marker and replicon flanked by FRT sites was mediated by the FLP recombinase. By using the mentioned system, B. subtilis strain PT5 was constructed to harbor a genomic copy of the spac promoter-regulated T7 gene 1 located at wprA (encoding the cell wall-associated protease). Similarly, the T7 promoter-driven nattokinase or endoglucanase E1 of Thermomonospora fusca genes were also integrated into mpr (encoding an extracellular protease) of strain PT5. Consequently, the integrant PT5/Mmp-T7N or PT5/MT1-E1 resulted in a "clean" producer strain deprived of six proteases. After 24 h, the strain receiving induction was able to secret nattokinase and endoglucanase E1 with the volumetric activity reaching 10860 CU/mL and 8.4 U/mL, respectively. This result clearly indicates the great promise of the proposed approach for high secretion of recombinant proteins in B. subtilis.

Fine mapping of the Darier's disease locus on chromosome 12q.

PubMed

Richard, G; Wright, A R; Harris, S; Doyle, S Z; Korge, B; Mazzanti, C; Tanaka, T; Harth, W; McBride, O W; Compton, J G; Bale, S J; DiGiovanna, J J

1994-11-01

Darier's disease (DD) is an autosomal dominant genodermatosis characterized by epidermal acantholysis and dyskeratosis. We have performed genetic linkage studies in 10 families with DD (34 affected) by analyzing 14 polymorphic microsatellite markers. Our results confirm recent reports mapping the DD gene to chromosome 12q23-q24.1. Haplotype analysis of recombinant chromosomes in our families, along with previously reported data, narrow the location of the DD gene to a 5 cM interval flanked by the loci D12S354 and D12S84/D12S105. This localization allowed exclusion of two known genes, PLA2A and PAH, as candidate loci for DD. Three other gene loci (PPP1C, PMCH, PMCA1), mapping in 12q21-q24, remain potential candidates.

The ergot alkaloid gene cluster in Claviceps purpurea: extension of the cluster sequence and intra species evolution.

PubMed

Haarmann, Thomas; Machado, Caroline; Lübbe, Yvonne; Correia, Telmo; Schardl, Christopher L; Panaccione, Daniel G; Tudzynski, Paul

2005-06-01

The genomic region of Claviceps purpurea strain P1 containing the ergot alkaloid gene cluster [Tudzynski, P., Hölter, K., Correia, T., Arntz, C., Grammel, N., Keller, U., 1999. Evidence for an ergot alkaloid gene cluster in Claviceps purpurea. Mol. Gen. Genet. 261, 133-141] was explored by chromosome walking, and additional genes probably involved in the ergot alkaloid biosynthesis have been identified. The putative cluster sequence (extending over 68.5kb) contains 4 different nonribosomal peptide synthetase (NRPS) genes and several putative oxidases. Northern analysis showed that most of the genes were co-regulated (repressed by high phosphate), and identified probable flanking genes by lack of co-regulation. Comparison of the cluster sequences of strain P1, an ergotamine producer, with that of strain ECC93, an ergocristine producer, showed high conservation of most of the cluster genes, but significant variation in the NRPS modules, strongly suggesting that evolution of these chemical races of C. purpurea is determined by evolution of NRPS module specificity.

Pl(17) is a novel gene independent of known downy mildew resistance genes in the cultivated sunflower (Helianthus annuus L.).

PubMed

Qi, L L; Long, Y M; Jan, C C; Ma, G J; Gulya, T J

2015-04-01

Pl 17, a novel downy mildew resistance gene independent of known downy mildew resistance genes in sunflowers, was genetically mapped to linkage group 4 of the sunflower genome. Downy mildew (DM), caused by Plasmopara halstedii (Farl.). Berl. et de Toni, is one of the serious sunflower diseases in the world due to its high virulence and the variability of the pathogen. DM resistance in the USDA inbred line, HA 458, has been shown to be effective against all virulent races of P. halstedii currently identified in the USA. To determine the chromosomal location of this resistance, 186 F 2:3 families derived from a cross of HA 458 with HA 234 were phenotyped for their resistance to race 734 of P. halstedii. The segregation ratio of the population supported that the resistance was controlled by a single dominant gene, Pl 17. Simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) primers were used to identify molecular markers linked to Pl 17. Bulked segregant analysis using 849 SSR markers located Pl 17 to linkage group (LG) 4, which is the first DM gene discovered in this linkage group. An F2 population of 186 individuals was screened with polymorphic SSR and SNP primers from LG4. Two flanking markers, SNP SFW04052 and SSR ORS963, delineated Pl 17 in an interval of 3.0 cM. The markers linked to Pl 17 were validated in a BC3 population. A search for the physical location of flanking markers in sunflower genome sequences revealed that the Pl 17 region had a recombination frequency of 0.59 Mb/cM, which was a fourfold higher recombination rate relative to the genomic average. This region can be considered amenable to molecular manipulation for further map-based cloning of Pl 17.

P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

PubMed Central

Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

1997-01-01

We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

Transposable elements are enriched within or in close proximity to xenobiotic-metabolizing cytochrome P450 genes

PubMed Central

Chen, Song; Li, Xianchun

2007-01-01

Background Transposons, i.e. transposable elements (TEs), are the major internal spontaneous mutation agents for the variability of eukaryotic genomes. To address the general issue of whether transposons mediate genomic changes in environment-adaptation genes, we scanned two alleles per each of the six xenobiotic-metabolizing Helicoverpa zea cytochrome P450 loci, including CYP6B8, CYP6B27, CYP321A1, CYP321A2, CYP9A12v3 and CYP9A14, for the presence of transposon insertions by genome walking and sequence analysis. We also scanned thirteen Drosophila melanogaster P450s genes for TE insertions by in silico mapping and literature search. Results Twelve novel transposons, including LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements), MITEs (miniature inverted-repeat transposable elements), one full-length transib-like transposon, and one full-length Tcl-like DNA transpson, are identified from the alleles of the six H. zea P450 genes. The twelve transposons are inserted into the 5'flanking region, 3'flanking region, exon, or intron of the six environment-adaptation P450 genes. In D. melanogaster, seven out of the eight Drosophila P450s (CYP4E2, CYP6A2, CYP6A8, CYP6A9, CYP6G1, CYP6W1, CYP12A4, CYP12D1) implicated in insecticide resistance are associated with a variety of transposons. By contrast, all the five Drosophila P450s (CYP302A1, CYP306A1, CYP307A1, CYP314A1 and CYP315A1) involved in ecdysone biosynthesis and developmental regulation are free of TE insertions. Conclusion These results indicate that TEs are selectively retained within or in close proximity to xenobiotic-metabolizing P450 genes. PMID:17381843

The chromosomal organization of horizontal gene transfer in bacteria.

PubMed

Oliveira, Pedro H; Touchon, Marie; Cury, Jean; Rocha, Eduardo P C

2017-10-10

Bacterial adaptation is accelerated by the acquisition of novel traits through horizontal gene transfer, but the integration of these genes affects genome organization. We found that transferred genes are concentrated in only ~1% of the chromosomal regions (hotspots) in 80 bacterial species. This concentration increases with genome size and with the rate of transfer. Hotspots diversify by rapid gene turnover; their chromosomal distribution depends on local contexts (neighboring core genes), and content in mobile genetic elements. Hotspots concentrate most changes in gene repertoires, reduce the trade-off between genome diversification and organization, and should be treasure troves of strain-specific adaptive genes. Most mobile genetic elements and antibiotic resistance genes are in hotspots, but many hotspots lack recognizable mobile genetic elements and exhibit frequent homologous recombination at flanking core genes. Overrepresentation of hotspots with fewer mobile genetic elements in naturally transformable bacteria suggests that homologous recombination and horizontal gene transfer are tightly linked in genome evolution.Horizontal gene transfer (HGT) is an important mechanism for genome evolution and adaptation in bacteria. Here, Oliveira and colleagues find HGT hotspots comprising  ~ 1% of the chromosomal regions in 80 bacterial species.

Altering the spectrum of immunoglobulin V gene somatic hypermutation by modifying the active site of AID.

PubMed

Wang, Meng; Rada, Cristina; Neuberger, Michael S

2010-01-18

High-affinity antibodies are generated by somatic hypermutation with nucleotide substitutions introduced into the IgV in a semirandom fashion, but with intrinsic mutational hotspots strategically located to optimize antibody affinity maturation. The process is dependent on activation-induced deaminase (AID), an enzyme that can deaminate deoxycytidine in DNA in vitro, where its activity is sensitive to the identity of the 5'-flanking nucleotide. As a critical test of whether such DNA deamination activity underpins antibody diversification and to gain insight into the extent to which the antibody mutation spectrum is dependent on the intrinsic substrate specificity of AID, we investigated whether it is possible to change the IgV mutation spectrum by altering AID's active site such that it prefers a pyrimidine (rather than a purine) flanking the targeted deoxycytidine. Consistent with the DNA deamination mechanism, B cells expressing the modified AID proteins yield altered IgV mutation spectra (exhibiting a purine-->pyrimidine shift in flanking nucleotide preference) and altered hotspots. However, AID-catalyzed deamination of IgV targets in vitro does not yield the same degree of hotspot dominance to that observed in vivo, indicating the importance of features beyond AID's active site and DNA local sequence environment in determining in vivo hotspot dominance.

Isolation and Identification of Pathogenicity Mutant of Curvularia lunata via Restriction Enzyme-Mediated Integration.

PubMed

Wang, Y J; Liu, T; Hou, J M; Zuo, Y H

2013-09-01

In this report, 156 hygromycin-resistant mutants were generated via restriction enzyme-mediated insertional (REMI) mutagenesis. All mutants were subjected to a bioassay on detached leaves. Five mutants (T4, T39, T71, T91, and T135) showed reduced symptom development, whereas one mutant (T120) did not exhibit any symptoms on the leaves compared with the wild type. The pathogenicity of these mutants was further assayed through the spray inoculation of whole seedlings. The results demonstrated that the pathogenicity of the T4, T39, T71, T91, and T135 mutants was reduced, whereas the T120 mutant lost its pathogenicity. Southern blot analysis revealed that the plasmids were inserted at different sites in the genome with different copy numbers. Flanking sequences approximately 550, 860, and 150 bp were obtained from T7, T91, and T120, respectively through plasmids rescue. Sequence analysis of the flanking sequences from T7 and T91 showed no homology to any known sequences in GenBank. The flanking sequence from the T120 mutant was highly homologous to MAPKK kinases, which regulates sexual/asexual development, melanization, pathogenicity from Cochliobolus heterostrophus. These results indicate that REMI and plasmids rescue have great potential for finding pathogenicity genes.

Transmission disequilibrium testing of arginine vasopressin receptor 1A (AVPR1A) polymorphisms in autism.

PubMed

Kim, S-J; Young, L J; Gonen, D; Veenstra-VanderWeele, J; Courchesne, R; Courchesne, E; Lord, C; Leventhal, B L; Cook, E H; Insel, T R

2002-01-01

Impairment in social reciprocity is a central component of autism. In preclinical studies, arginine vasopressin (AVP) has been shown to increase a range of social behaviors, including affiliation and attachment, via the V(1a) receptor (AVPR1A) in the brain. Both the behavioral effects of AVP and the neural distribution of the V1a receptor vary greatly across mammalian species. This difference in regional receptor expression as well as differences in social behavior may result from a highly variable repetitive sequence in the 5' flanking region of the V1a gene (AVPR1A). Given this comparative evidence for a role in inter-species variation in social behavior, we explored whether within our own species, variation in the human AVPR1A may contribute to individual variations in social behavior, with autism representing an extreme form of social impairment. We genotyped two microsatellite polymorphisms from the 5' flanking region of AVPR1A for 115 autism trios and found nominally significant transmission disequilibrium between autism and one of the microsatellite markers by Multiallelic Transmission/Disequilibrium test (MTDT) that was not significant after Bonferroni correction. We also screened approximately 2 kb of the 5' flanking region and the coding region and identified 10 single nucleotide polymorphisms.

A Boy with an LCR3/4-Flanked 10q22.3q23.2 Microdeletion and Uncommon Phenotypic Features

PubMed Central

Petrova, E.; Neuner, C.; Haaf, T.; Schmid, M.; Wirbelauer, J.; Jurkutat, A.; Wermke, K.; Nanda, I.; Kunstmann, E.

2014-01-01

The recurrent 10q22.3q23.2 deletion with breakpoints within low copy repeats 3 and 4 is a rare genomic disorder, reported in only 13 patients to date. The phenotype is rather uncharacteristic, which makes a clinical diagnosis difficult. A phenotypic feature described in almost all patients is a delay in speech development, albeit systematic studies are still pending. In this study, we report on a boy with an LCR3/4-flanked 10q22.3q23.2 deletion exhibiting an age-appropriate language development evaluated by a standardized test at an age of 2 years and 3 months. The boy was born with a cleft palate – a feature not present in any of the patients described before. Previously reported cases are reviewed, and the role of the BMPR1A gene is discussed. The phenotype of patients with an LCR3/4-flanked 10q22.3q23.2 deletion can be rather variable, so counseling the families regarding the prognosis of an affected child should be done with caution. Long-term studies of affected children are needed to delineate the natural history of this rare disorder. PMID:24550761

Aphanius arakensis, a new species of tooth-carp (Actinopterygii, Cyprinodontidae) from the endorheic Namak Lake basin in Iran.

PubMed

Teimori, Azad; Esmaeili, Hamid Reza; Gholami, Zeinab; Zarei, Neda; Reichenbacher, Bettina

2012-01-01

A new species of tooth-carp, Aphanius arakensissp. n., is described from the Namak Lake basin in Iran. The new species is distinguished by the congeners distributed in Iran by the following combination of characters: 10-12 anal fin rays, 28-32 lateral line scales, 10-13 caudal peduncle scales, 8-10 gill rakers, 12-19, commonly 15-16, clearly defined flank bars in males, a more prominent pigmentation along the flank added by relatively big blotches in the middle and posterior flank segments in females, a short but high antirostrum of the otolith that has a wide excisura, and a ventral rim with some small, drop-like processes, and 19 molecular apomorphies (17 transitions, two transversions) in the cytochrome b gene. It was suggested based on the phylogenetic analysis that the new species is sister to Aphanius sophiae from the Kor River and that Aphanius farsicus from the Maharlu Lake basin is sister to Aphanius arakensis plus Aphanius sophiae. A noticeable feature of the Aphanius diversity in Iran is the conservatism of the external morphology as well as morphometric and meristic characters, while distinctive differences are present in genetic characters, otolith morphology, and male color pattern. Transformation of the latter was probably driven by sexual selection.

Structure of the beta-galactosidase gene from Thermus sp. strain T2: expression in Escherichia coli and purification in a single step of an active fusion protein.

PubMed

Vian, A; Carrascosa, A V; García, J L; Cortés, E

1998-06-01

The nucleotide sequence of both the bgaA gene, coding for a thermostable beta-galactosidase of Thermus sp. strain T2, and its flanking regions was determined. The deduced amino acid sequence of the enzyme predicts a polypeptide of 645 amino acids (Mr, 73,595). Comparative analysis of the open reading frames located in the flanking regions of the bgaA gene revealed that they might encode proteins involved in the transport and hydrolysis of sugars. The observed homology between the deduced amino acid sequences of BgaA and the beta-galactosidase of Bacillus stearothermophilus allows us to classify the new enzyme within family 42 of glycosyl hydrolases. BgaA was overexpressed in its active form in Escherichia coli, but more interestingly, an active chimeric beta-galactosidase was constructed by fusing the BgaA protein to the choline-binding domain of the major pneumococcal autolysin. This chimera illustrates a novel approach for producing an active and thermostable hybrid enzyme that can be purified in a single step by affinity chromatography on DEAE-cellulose, retaining the catalytic properties of the native enzyme. The chimeric enzyme showed a specific activity of 191,000 U/mg at 70 degrees C and a Km value of 1.6 mM with o-nitrophenyl-beta-D-galactopyranoside as a substrate, and it retained 50% of its initial activity after 1 h of incubation at 70 degrees C.

A novel nonsteroidal antifibrotic oligo decoy containing the TGF-beta element found in the COL1A1 gene which regulates murine schistosomiasis liver fibrosis.

PubMed

Boros, D L; Singh, K P; Gerard, H C; Hudson, A P; White, S L; Cutroneo, K R

2005-08-01

Schistosomiasis mansoni disseminated worm eggs in mice and humans induce granulomatous inflammations and cumulative fibrosis causing morbidity and possibly mortality. In this study, intrahepatic and I.V. injections of a double-stranded oligodeoxynucleotide decoy containing the TGF-beta regulatory element found in the distal promoter of the COL1A1 gene into worm-infected mice suppressed TGF-beta1, COL1A1, tissue inhibitor of metalloproteinase-1, and decreased COL3A1 mRNAs to a lesser extent. Sequence comparisons within the mouse genome found homologous sequences within the COL3A1, TGF-beta1, and TIMP-1 5' flanking regions. Cold competition gel mobility shift assays using these homologous sequences with 5' and 3' flanking regions found in the natural COL1A1 gene showed competition. Competitive gel mobility assays in a separate experiment showed no competition using a 5-base mutated or scrambled sequence. Explanted liver granulomas from saline-injected mice incorporated 10.45 +/- 1.7% (3)H-proline into newly synthesized collagen, whereas decoy-treated mice showed no collagen synthesis. Compared with the saline control schistosomiasis mice phosphorothioate double-stranded oligodeoxynucleotide treatment decreased total liver collagen content (i.e. hydroxy-4-proline) by 34%. This novel molecular approach has the potential to be employed as a novel antifibrotic treatment modality. (c) 2005 Wiley-Liss, Inc.

CRISPR-based screening of genomic island excision events in bacteria.

PubMed

Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

2015-06-30

Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

PubMed Central

Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

2010-01-01

The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

Evaluation of the mechanisms of intron loss and gain in the social amoebae Dictyostelium.

PubMed

Ma, Ming-Yue; Che, Xun-Ru; Porceddu, Andrea; Niu, Deng-Ke

2015-12-18

Spliceosomal introns are a common feature of eukaryotic genomes. To approach a comprehensive understanding of intron evolution on Earth, studies should look beyond repeatedly studied groups such as animals, plants, and fungi. The slime mold Dictyostelium belongs to a supergroup of eukaryotes not covered in previous studies. We found 441 precise intron losses in Dictyostelium discoideum and 202 precise intron losses in Dictyostelium purpureum. Consistent with these observations, Dictyostelium discoideum was found to have significantly more copies of reverse transcriptase genes than Dictyostelium purpureum. We also found that the lost introns are significantly further from the 5' end of genes than the conserved introns. Adjacent introns were prone to be lost simultaneously in Dictyostelium discoideum. In both Dictyostelium species, the exonic sequences flanking lost introns were found to have a significantly higher GC content than those flanking conserved introns. Together, these observations support a reverse-transcription model of intron loss in which intron losses were caused by gene conversion between genomic DNA and cDNA reverse transcribed from mature mRNA. We also identified two imprecise intron losses in Dictyostelium discoideum that may have resulted from genomic deletions. Ninety-eight putative intron gains were also observed. Consistent with previous studies of other lineages, the source sequences were found in only a small number of cases, with only two instances of intron gain identified in Dictyostelium discoideum. Although they diverged very early from animals and fungi, Dictyostelium species have similar mechanisms of intron loss.

Genetic and Functional Evidence Supports LPAR1 as a Susceptibility Gene for Hypertension.

PubMed

Xu, Ke; Ma, Lu; Li, Yang; Wang, Fang; Zheng, Gu-Yan; Sun, Zhijun; Jiang, Feng; Chen, Yundai; Liu, Huirong; Dang, Aimin; Chen, Xi; Chun, Jerold; Tian, Xiao-Li

2015-09-01

Essential hypertension is a complex disease affected by genetic and environmental factors and serves as a major risk factor for cardiovascular diseases. Serum lysophosphatidic acid correlates with an elevated blood pressure in rats, and lysophosphatidic acid interacts with 6 subtypes of receptors. In this study, we assessed the genetic association of lysophosphatidic acid receptors with essential hypertension by genotyping 28 single-nucleotide polymorphisms from genes encoding for lysophosphatidic acid receptors, LPAR1, LPAR2, LPAR3, LPAR4, LPAR5, and LPAR6 and their flanking sequences, in 3 Han Chinese cohorts consisting of 2630 patients and 3171 controls in total. We identified a single-nucleotide polymorphism, rs531003 in the 3'-flanking genomic region of LPAR1, associated with hypertension (the Bonferroni corrected P=1.09×10(-5), odds ratio [95% confidence interval]=1.23 [1.13-1.33]). The risk allele C of rs531003 is associated with the increased expression of LPAR1 and the susceptibility of hypertension, particularly in those with a shortage of sleep (P=4.73×10(-5), odds ratio [95% confidence interval]=1.75 [1.34-2.28]). We further demonstrated that blood pressure elevation caused by sleep deprivation and phenylephrine-induced vasoconstriction was both diminished in LPAR1-deficient mice. Together, we show that LPAR1 is a novel susceptibility gene for human essential hypertension and that stress, such as shortage of sleep, increases the susceptibility of patients with risk allele to essential hypertension. © 2015 American Heart Association, Inc.

Functional Metagenomics Reveals Previously Unrecognized Diversity of Antibiotic Resistance Genes in Gulls

PubMed Central

Martiny, Adam C.; Martiny, Jennifer B. H.; Weihe, Claudia; Field, Andrew; Ellis, Julie C.

2011-01-01

Wildlife may facilitate the spread of antibiotic resistance (AR) between human-dominated habitats and the surrounding environment. Here, we use functional metagenomics to survey the diversity and genomic context of AR genes in gulls. Using this approach, we found a variety of AR genes not previously detected in gulls and wildlife, including class A and C β-lactamases as well as six tetracycline resistance gene types. An analysis of the flanking sequences indicates that most of these genes are present in Enterobacteriaceae and various Gram-positive bacteria. In addition to finding known gene types, we detected 31 previously undescribed AR genes. These undescribed genes include one most similar to an uncharacterized gene in Verrucomicrobium and another to a putative DNA repair protein in Lactobacillus. Overall, the study more than doubled the number of clinically relevant AR gene types known to be carried by gulls or by wildlife in general. Together with the propensity of gulls to visit human-dominated habitats, this high diversity of AR gene types suggests that gulls could facilitate the spread of AR. PMID:22347872

Genomic structure of rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD, AKR1C9).

PubMed

Lin, H K; Hung, C F; Moore, M; Penning, T M

1999-11-01

Rat liver 3alpha-hydroxysteroid/dihydrodiol dehydrogenase (3alpha-HSD/DD) is a member of the aldo-keto reductase (AKR) superfamily. It is involved in the inactivation of steroid hormones and the metabolic activation of polycyclic aromatic hydrocarbons (PAH) by converting trans-dihydrodiols into reactive and redox-active o-quinones. The structure of the 5'-flanking region of the gene and factors involved in the constitutive and regulated expression of this gene have been reported [H.-K. Lin, T.M. Penning, Cloning, sequencing, and functional analysis of the 5'-flanking region of the rat 3alpha-hydroxysteroid/dihydrodiol dehydrogenase gene, Cancer Res. 55 (1995) 4105-4113]. We now describe the complete genomic structure of the rat type 1 3alpha-HSD/DD gene. Charon 4A and P1 genomic clones contained at least three rat genes (type 1, type 2 and type 3 3alpha-HSD/DD) each of which encoded for the same open reading frame (ORF) but differed in their exon-intron organization. 5'-RACE confirmed that the type 1 3alpha-HSD/DD gene encodes for the dominant transcript in rat liver and it was the regulation of this gene that was previously studied. The rat type 1 3alpha-HSD/DD gene is 30 kb in length and consists of nine exons and eight introns. Exon 9 encodes +931 to 966 bp of the ORF and the 1292 bp 3'-UTR implicated in mRNA stability. This genomic structure is nearly identical to the homologous human genes, type 1 3alpha-HSD (chlordecone reductase/DD4, AKR1C4), type 2 3alpha-HSD (AKR1C3) and type 3 3alpha-HSD (bile-acid binding protein, AKR1C2) genes. Three different cDNA's containing identical ORFs for 3alpha-HSD have been reported suggesting that all three genes may be expressed in rat liver. Using 5' primers corresponding to the 5'-UTR's of the three different cDNA's only one PCR fragment was obtained and corresponded to the type 1 3alpha-HSD/DD gene. These data suggested that the type 2 and type 3 3alpha-HSD/DD genes are not abundantly expressed in rat liver. It is unknown whether the type 2 and type 3 3alpha-HSD/DD genes represent pseudo-genes or whether they represent genes that are differentially expressed in other rat tissues.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Gene disruption in Trichoderma atroviride via Agrobacterium-mediated transformation.

PubMed

Zeilinger, Susanne

2004-02-01

A modified Agrobacterium-mediated transformation method for the efficient disruption of two genes encoding signaling compounds of the mycoparasite Trichoderma atroviride is described, using the hph gene of Escherichia coli as selection marker. The transformation vectors contained about 1 kb of 5' and 3' non-coding regions from the tmk1 (encoding a MAP kinase) or tga3 (encoding an alpha-subunit of a heterotrimeric G protein) target loci flanking a selection marker. Transformation of fungal conidia and selection on hygromycin-containing media applying an overlay-based procedure, which overcomes the lack of formation of distinct single colonies by the fungus, led to stable clones for both disruption constructs. Southern and PCR analyses proved gene disruption by single-copy homologous integration with a frequency of approximately 60% for both genes; and the loss of tmk1 and tga3 transcript formation in the disruptants was demonstrated by RT-PCR.

Plasmid-Encoded Transferable mecB-Mediated Methicillin Resistance in Staphylococcus aureus

PubMed Central

van Alen, Sarah; Idelevich, Evgeny A.; Schleimer, Nina; Seggewiß, Jochen; Mellmann, Alexander; Kaspar, Ursula; Peters, Georg

2018-01-01

During cefoxitin-based nasal screening, phenotypically categorized methicillin-resistant Staphylococcus aureus (MRSA) was isolated and tested negative for the presence of the mecA and mecC genes as well as for the SCCmec-orfX junction region. The isolate was found to carry a mecB gene previously described for Macrococcus caseolyticus but not for staphylococcal species. The gene is flanked by β-lactam regulatory genes similar to mecR, mecI, and blaZ and is part of an 84.6-kb multidrug-resistance plasmid that harbors genes encoding additional resistances to aminoglycosides (aacA-aphD, aphA, and aadK) as well as macrolides (ermB) and tetracyclines (tetS). This further plasmidborne β-lactam resistance mechanism harbors the putative risk of acceleration or reacceleration of MRSA spread, resulting in broad ineffectiveness of β-lactams as a main therapeutic application against staphylococcal infections. PMID:29350135

Candidate chromosome 1 disease susceptibility genes for Sjogren’s syndrome xerostomia are narrowed by novel NOD.B10 congenic mice

PubMed Central

Mongini, Patricia K. A.; Kramer, Jill M.; Ishikawa, Tomo-o; Herschman, Harvey; Esposito, Donna

2014-01-01

Sjogren’s syndrome (SS) is characterized by salivary gland leukocytic infiltrates and impaired salivation (xerostomia). Cox-2 (Ptgs2) is located on chromosome 1 within the span of the Aec2 region. In an attempt to demonstrate that COX-2 drives antibody-dependent hyposalivation, NOD.B10 congenic mice bearing a Cox-2flox gene were generated. A congenic line with non-NOD alleles in Cox-2-flanking genes failed manifest xerostomia. Further backcrossing yielded disease-susceptible NOD.B10 Cox-2flox lines; fine genetic mapping determined that critical Aec2 genes lie within a 1.56 to 2.17 Mb span of DNA downstream of Cox-2. Bioinformatics analysis revealed that susceptible and non-susceptible lines exhibit non-synonymous coding SNPs in 8 protein-encoding genes of this region, thereby better delineating candidate Aec2 alleles needed for SS xerostomia. PMID:24685748

A murC gene from coryneform bacteria.

PubMed

Wachi, M; Wijayarathna, C D; Teraoka, H; Nagai, K

1999-02-01

The upstream flanking region of the ftsQ and ftsZ genes of Brevibacterium flavum MJ233, which belongs to the coryneform bacteria, was amplified by the inverse polymerase chain reaction method and cloned in Escherichia coli. Complementation analysis of E. coli mutant with a defective cell-wall synthesis mechanism with the cloned fragment and its DNA sequencing indicated the presence of the murC gene, encoding UDP-N-acetylmuramate:L-alanine ligase involved in peptidoglycan synthesis, just upstream from the ftsQ gene. The B. flavum murC gene could encode a protein of 486 amino acid residues with a calculated molecular mass of 51 198 Da. A 50-kDa protein was synthesized by the B. flavum murC gene in an in vitro transcription/translation system using E. coli S30 lysate. These results indicate that the genes responsible for cell-wall synthesis and cell division are located as a cluster in B. flavum similar to the E. coli mra region.

The thiostrepton-resistance-encoding gene in Streptomyces laurentii is located within a cluster of ribosomal protein operons.

PubMed

Smith, T M; Jiang, Y F; Shipley, P; Floss, H G

1995-10-16

A common approach to identify and clone biosynthetic gene from an antibiotic-producing streptomycete is to clone the resistance gene for the antibiotic of interest and then use that gene to clone DNA that is linked to it. As a first step toward cloning the genes responsible for the biosynthesis of thiostrepton (Th) in Streptomyces laurentii (Sl), the Th resistance-encoding gene (tsnR) was cloned as a 1.5-kb BamHI-PvuII fragment in Escherichia coli (Ec), and shown to confer Th resistance when introduced into S. lividans TK24. The tsnR-containing DNA fragment was used as a probe to isolate clones from cosmid libraries of DNA in the Ec cosmid vector SuperCos, and pOJ446 (an Ec/streptomycete) cosmid vector. Sequence and genetic analysis of the DNA flanking the tsnR indicates that the Sl tsnR is not closely linked to biosynthetic genes. Instead it is located within a cluster of ribosomal protein operons.

Comparison of dkgB-linked intergenic sequence ribotyping to DNA microarray hybridization for assigning serotype to Salmonella enterica

PubMed Central

Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur

2012-01-01

Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607

Targeting of >1.5 Mb of Human DNA into the Mouse X Chromosome Reveals Presence of cis-Acting Regulators of Epigenetic Silencing

PubMed Central

Yang, Christine; McLeod, Andrea J.; Cotton, Allison M.; de Leeuw, Charles N.; Laprise, Stéphanie; Banks, Kathleen G.; Simpson, Elizabeth M.; Brown, Carolyn J.

2012-01-01

Regulatory sequences can influence the expression of flanking genes over long distances, and X chromosome inactivation is a classic example of cis-acting epigenetic gene regulation. Knock-ins directed to the Mus musculus Hprt locus offer a unique opportunity to analyze the spread of silencing into different human DNA sequences in the identical genomic environment. X chromosome inactivation of four knock-in constructs, including bacterial artificial chromosome (BAC) integrations of over 195 kb, was demonstrated by both the lack of expression from the inactive X chromosome in females with nonrandom X chromosome inactivation and promoter DNA methylation of the human transgene in females. We further utilized promoter DNA methylation to assess the inactivation status of 74 human reporter constructs comprising >1.5 Mb of DNA. Of the 47 genes examined, only the PHB gene showed female DNA hypomethylation approaching the level seen in males, and escape from X chromosome inactivation was verified by demonstration of expression from the inactive X chromosome. Integration of PHB resulted in lower DNA methylation of the flanking HPRT promoter in females, suggesting the action of a dominant cis-acting escape element. Female-specific DNA hypermethylation of CpG islands not associated with promoters implies a widespread imposition of DNA methylation during X chromosome inactivation; yet transgenes demonstrated differential capacities to accumulate DNA methylation when integrated into the identical location on the inactive X chromosome, suggesting additional cis-acting sequence effects. As only one of the human transgenes analyzed escaped X chromosome inactivation, we conclude that elements permitting ongoing expression from the inactive X are rare in the human genome. PMID:23023002

Analysis of chromosome 22 deletions in neurofibromatosis type 2-related tumors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolff, R.K.; Frazer, K.A.; Jackler, R.K.

The neurofibromatosis type 2 (NF2) gene has been hypothesized to be a recessive tumor suppressor, with mutations at the same locus on chromosome 22 that lead to NF2 also leading to sporadic tumors of the types seen in NF2. Flanking markers for this gene have previously been defined as D22S1 centromeric and D22S28 telomeric. Identification of subregions of this interval that are consistently rearranged in the NF2-related tumors would aid in better defining the disease locus. To this end, the authors have compared tumor and constitutional DNAs, isolated from 39 unrelated patients with sporadic and NF2-associated acoustic neuromas, meningiomas, schwannomas,more » and ependymomas, at eight polymorphic loci on chromosome 22. Two of the tumors studied revealed loss-of-heterozygosity patterns, which is consistent with the presence of chromosome 22 terminal deletions. By using additional polymorphic markers, the terminal deletion breakpoint found in one of the tumors, an acoustic neuroma from an NF2 patient, was mapped within the previously defined NF2 region. The breakpoint occurred between the haplotyped markers D22S41/D22S46 and D22S56. This finding redefines the proximal flanking marker and localizes the NF2 gene between markers D22S41/D22S46 and D22S28. In addition, the authors identified a sporadic acoustic neuroma that reveals a loss-of-heterozygosity pattern consistent with mitotic recombination or deletion and reduplication, which are mechanisms not previously seen in studies of these tumors. This finding, while inconsistent with models of tumorigenesis that invoke single deletions and their gene-dosage effects, lends further support to the recessive tumor-suppressor model. 33 refs., 2 figs., 1 tab.« less

Pax8 modulates the expression of Wnt4 that is necessary for the maintenance of the epithelial phenotype of thyroid cells

PubMed Central

2014-01-01

Background The transcription factor Pax8 is expressed during thyroid development and is involved in the morphogenesis of the thyroid gland and maintenance of the differentiated phenotype. In particular, Pax8 has been shown to regulate genes that are considered markers of thyroid differentiation. Recently, the analysis of the gene expression profile of FRTL-5 differentiated thyroid cells after the silencing of Pax8 identified Wnt4 as a novel target. Like the other members of the Wnt family, Wnt4 has been implicated in several developmental processes including regulation of cell fate and patterning during embryogenesis. To date, the only evidence on Wnt4 in thyroid concerns its down-regulation necessary for the progression of thyroid epithelial tumors. Results Here we demonstrate that Pax8 is involved in the transcriptional modulation of Wnt4 gene expression directly binding to its 5’-flanking region, and that Wnt4 expression in FRTL-5 cells is TSH-dependent. Interestingly, we also show that in thyroid cells a reduced expression of Wnt4 correlates with the alteration of the epithelial phenotype and that the overexpression of Wnt4 in thyroid cancer cells is able to inhibit cellular migration. Conclusions We have identified and characterized a functional Pax8 binding site in the 5’-flanking region of the Wnt4 gene and we show that Pax8 modulates the expression of Wnt4 in thyroid cells. Taken together, our results suggest that in thyroid cells Wnt4 expression correlates with the integrity of the epithelial phenotype and is reduced when this integrity is perturbed. In the end, we would like to suggest that the overexpression of Wnt4 in thyroid cancer cells is able to revert the mesenchymal phenotype. PMID:25270402

Analysis of chromosome 22 deletions in neurofibromatosis type 2-related tumors.

PubMed

Wolff, R K; Frazer, K A; Jackler, R K; Lanser, M J; Pitts, L H; Cox, D R

1992-09-01

The neurofibromatosis type 2 (NF2) gene has been hypothesized to be a recessive tumor suppressor, with mutations at the same locus on chromosome 22 that lead to NF2 also leading to sporadic tumors of the types seen in NF2. Flanking markers for this gene have previously been defined as D22S1 centromeric and D22S28 telomeric. Identification of subregions of this interval that are consistently rearranged in the NF2-related tumors would aid in better defining the disease locus. To this end, we have compared tumor and constitutional DNAs, isolated from 39 unrelated patients with sporadic and NF2-associated acoustic neuromas, meningiomas, schwannomas, and ependymomas, at eight polymorphic loci on chromosome 22. Two of the tumors studied revealed loss-of-heterozygosity patterns, which is consistent with the presence of chromosome 22 terminal deletions. By using additional polymorphic markers, the terminal deletion breakpoint found in one of the tumors, an acoustic neuroma from an NF2 patient, was mapped within the previously defined NF2 region. The breakpoint occurred between the haplotyped markers D22S41/D22S46 and D22S56. This finding redefines the proximal flanking marker and localizes the NF2 gene between markers D22S41/D22S46 and D22S28. In addition, we identified a sporadic acoustic neuroma that reveals a loss-of-heterozygosity pattern consistent with mitotic recombination or deletion and reduplication, which are mechanisms not previously seen in studies of these tumors. This finding, while inconsistent with models of tumorigenesis that invoke single deletions and their gene-dosage effects, lends further support to the recessive tumor-suppressor model.

Analysis of chromosome 22 deletions in neurofibromatosis type 2-related tumors.

PubMed Central

Wolff, R K; Frazer, K A; Jackler, R K; Lanser, M J; Pitts, L H; Cox, D R

1992-01-01

The neurofibromatosis type 2 (NF2) gene has been hypothesized to be a recessive tumor suppressor, with mutations at the same locus on chromosome 22 that lead to NF2 also leading to sporadic tumors of the types seen in NF2. Flanking markers for this gene have previously been defined as D22S1 centromeric and D22S28 telomeric. Identification of subregions of this interval that are consistently rearranged in the NF2-related tumors would aid in better defining the disease locus. To this end, we have compared tumor and constitutional DNAs, isolated from 39 unrelated patients with sporadic and NF2-associated acoustic neuromas, meningiomas, schwannomas, and ependymomas, at eight polymorphic loci on chromosome 22. Two of the tumors studied revealed loss-of-heterozygosity patterns, which is consistent with the presence of chromosome 22 terminal deletions. By using additional polymorphic markers, the terminal deletion breakpoint found in one of the tumors, an acoustic neuroma from an NF2 patient, was mapped within the previously defined NF2 region. The breakpoint occurred between the haplotyped markers D22S41/D22S46 and D22S56. This finding redefines the proximal flanking marker and localizes the NF2 gene between markers D22S41/D22S46 and D22S28. In addition, we identified a sporadic acoustic neuroma that reveals a loss-of-heterozygosity pattern consistent with mitotic recombination or deletion and reduplication, which are mechanisms not previously seen in studies of these tumors. This finding, while inconsistent with models of tumorigenesis that invoke single deletions and their gene-dosage effects, lends further support to the recessive tumor-suppressor model. Images Figure 1 Figure 2 PMID:1496981

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

A Versatile Transposon-Based Activation Tag Vector System for Functional Genomics in Cereals and Other Monocot Plants1[OA

PubMed Central

Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan

2008-01-01

Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541

Fine mapping of the pond snail left-right asymmetry (chirality) locus using RAD-Seq and fibre-FISH.

PubMed

Liu, Mengning Maureen; Davey, John W; Banerjee, Ruby; Han, Jie; Yang, Fengtang; Aboobaker, Aziz; Blaxter, Mark L; Davison, Angus

2013-01-01

The left-right asymmetry of snails, including the direction of shell coiling, is determined by the delayed effect of a maternal gene on the chiral twist that takes place during early embryonic cell divisions. Yet, despite being a well-established classical problem, the identity of the gene and the means by which left-right asymmetry is established in snails remain unknown. We here demonstrate the power of new genomic approaches for identification of the chirality gene, "D". First, heterozygous (Dd) pond snails Lymnaea stagnalis were self-fertilised or backcrossed, and the genotype of more than six thousand offspring inferred, either dextral (DD/Dd) or sinistral (dd). Then, twenty of the offspring were used for Restriction-site-Associated DNA Sequencing (RAD-Seq) to identify anonymous molecular markers that are linked to the chirality locus. A local genetic map was constructed by genotyping three flanking markers in over three thousand snails. The three markers lie either side of the chirality locus, with one very tightly linked (<0.1 cM). Finally, bacterial artificial chromosomes (BACs) were isolated that contained the three loci. Fluorescent in situ hybridization (FISH) of pachytene cells showed that the three BACs tightly cluster on the same bivalent chromosome. Fibre-FISH identified a region of greater that ∼0.4 Mb between two BAC clone markers that must contain D. This work therefore establishes the resources for molecular identification of the chirality gene and the variation that underpins sinistral and dextral coiling. More generally, the results also show that combining genomic technologies, such as RAD-Seq and high resolution FISH, is a robust approach for mapping key loci in non-model systems.

Fine Mapping of the Pond Snail Left-Right Asymmetry (Chirality) Locus Using RAD-Seq and Fibre-FISH

PubMed Central

Han, Jie; Yang, Fengtang; Aboobaker, Aziz; Blaxter, Mark L.; Davison, Angus

2013-01-01

The left-right asymmetry of snails, including the direction of shell coiling, is determined by the delayed effect of a maternal gene on the chiral twist that takes place during early embryonic cell divisions. Yet, despite being a well-established classical problem, the identity of the gene and the means by which left-right asymmetry is established in snails remain unknown. We here demonstrate the power of new genomic approaches for identification of the chirality gene, “D”. First, heterozygous (Dd) pond snails Lymnaea stagnalis were self-fertilised or backcrossed, and the genotype of more than six thousand offspring inferred, either dextral (DD/Dd) or sinistral (dd). Then, twenty of the offspring were used for Restriction-site-Associated DNA Sequencing (RAD-Seq) to identify anonymous molecular markers that are linked to the chirality locus. A local genetic map was constructed by genotyping three flanking markers in over three thousand snails. The three markers lie either side of the chirality locus, with one very tightly linked (<0.1 cM). Finally, bacterial artificial chromosomes (BACs) were isolated that contained the three loci. Fluorescent in situ hybridization (FISH) of pachytene cells showed that the three BACs tightly cluster on the same bivalent chromosome. Fibre-FISH identified a region of greater that ∼0.4 Mb between two BAC clone markers that must contain D. This work therefore establishes the resources for molecular identification of the chirality gene and the variation that underpins sinistral and dextral coiling. More generally, the results also show that combining genomic technologies, such as RAD-Seq and high resolution FISH, is a robust approach for mapping key loci in non-model systems. PMID:23951082

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

A case report and literature review of Fanconi Anemia (FA) diagnosed by genetic testing.

PubMed

Solomon, Ponnumony John; Margaret, Priya; Rajendran, Ramya; Ramalingam, Revathy; Menezes, Godfred A; Shirley, Alph S; Lee, Seung Jun; Seong, Moon-Woo; Park, Sung Sup; Seol, Dodam; Seo, Soo Hyun

2015-05-08

Fanconi anemia (FA) is a genetically heterogeneous rare autosomal recessive disorder characterized by congenital malformations, hematological problems and predisposition to malignancies. The genes that have been found to be mutated in FA patients are called FANC. To date 16 distinct FANC genes have been reported. Among these, mutations in FANCA are the most frequent among FA patients worldwide which account for 60- 65%. In this study, a nine years old male child was brought to our hospital one year ago for opinion and advice. He was the third child born to consanguineous parents. The mutation analyses were performed for proband, parents, elder sibling and the relatives [maternal aunt and maternal aunt's son (cousin)]. Molecular genetic testing [targeted next-generation sequencing (MiSeq, Illumina method)] was performed by mutation analysis in 15 genes involved. Entire coding exons and their flanking regions of the genes were analysed. Sanger sequencing [(ABI 3730 analyzer by Applied Biosystems)] was performed using primers specific for 43 coding exons of the FANCA gene. A novel splice site mutation, c.3066 + 1G > T, (IVS31 + 1G > T), homozygote was detected by sequencing in the patient. The above sequence variant was identified in heterozygous state in his parents. Further, the above sequence variant was not identified in other family members (elder sibling, maternal aunt and cousin). It is concluded that genetic study should be done if possible in all the cases of suspected FA, including siblings, parents and close blood relatives. It will help us to plan appropriate treatment and also to select suitable donor for hematopoietic stem cell transplantation and to plan for genetic counseling. In addition to the case report, the main focus of this manuscript was to review literature on role of FANCA gene in FA since large number of FANCA mutations and polymorphisms have been identified.

Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

PubMed

Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

2003-09-01

Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

Cytoplasmic male sterility in Mimulus hybrids has pleiotropic effects on corolla and pistil traits.

PubMed

Barr, C M; Fishman, L

2011-05-01

The mechanisms underlying genetic associations have important consequences for evolutionary outcomes, but distinguishing linkage from pleiotropy is often difficult. Here, we use a fine mapping approach to determine the genetic basis of association between cytonuclear male sterility and other floral traits in Mimulus hybrids. Previous work has shown that male sterility in hybrids between Mimulus guttatus and Mimulus nasutus is due to interactions between a mitochondrial gene from M. guttatus and two tightly linked nuclear restorer alleles on Linkage Group 7, and that male sterility is associated with reduced corolla size. In the present study, we generated a set of nearly isogenic lines segregating for the restorer region and male sterility, but with unique flanking introgressions. Male-sterile flowers had significantly smaller corollas, longer styles and greater stigmatic exsertion than fertile flowers. Because these effects were significant regardless of the genotypic composition of introgressions flanking the restorer region, they suggest that these floral differences are a direct byproduct of the genetic incompatibility causing anther abortion. In addition, we found a non-significant but intriguing trend for male-sterile plants to produce more seeds per flower than fertile siblings after supplemental pollination. Such pleiotropic effects may underlie the corolla dimorphism frequently observed in gynodioecious taxa and may affect selection on cytoplasmic male sterility genes when they initially arise.

Linkage disequilibrium interval mapping of quantitative trait loci.

PubMed

Boitard, Simon; Abdallah, Jihad; de Rochambeau, Hubert; Cierco-Ayrolles, Christine; Mangin, Brigitte

2006-03-16

For many years gene mapping studies have been performed through linkage analyses based on pedigree data. Recently, linkage disequilibrium methods based on unrelated individuals have been advocated as powerful tools to refine estimates of gene location. Many strategies have been proposed to deal with simply inherited disease traits. However, locating quantitative trait loci is statistically more challenging and considerable research is needed to provide robust and computationally efficient methods. Under a three-locus Wright-Fisher model, we derived approximate expressions for the expected haplotype frequencies in a population. We considered haplotypes comprising one trait locus and two flanking markers. Using these theoretical expressions, we built a likelihood-maximization method, called HAPim, for estimating the location of a quantitative trait locus. For each postulated position, the method only requires information from the two flanking markers. Over a wide range of simulation scenarios it was found to be more accurate than a two-marker composite likelihood method. It also performed as well as identity by descent methods, whilst being valuable in a wider range of populations. Our method makes efficient use of marker information, and can be valuable for fine mapping purposes. Its performance is increased if multiallelic markers are available. Several improvements can be developed to account for more complex evolution scenarios or provide robust confidence intervals for the location estimates.

Functional classification of rice flanking sequence tagged genes using MapMan terms and global understanding on metabolic and regulatory pathways affected by dxr mutant having defects in light response.

PubMed

Chandran, Anil Kumar Nalini; Lee, Gang-Seob; Yoo, Yo-Han; Yoon, Ung-Han; Ahn, Byung-Ohg; Yun, Doh-Won; Kim, Jin-Hyun; Choi, Hong-Kyu; An, GynHeung; Kim, Tae-Ho; Jung, Ki-Hong

2016-12-01

Rice is one of the most important food crops for humans. To improve the agronomical traits of rice, the functions of more than 1,000 rice genes have been recently characterized and summarized. The completed, map-based sequence of the rice genome has significantly accelerated the functional characterization of rice genes, but progress remains limited in assigning functions to all predicted non-transposable element (non-TE) genes, estimated to number 37,000-41,000. The International Rice Functional Genomics Consortium (IRFGC) has generated a huge number of gene-indexed mutants by using mutagens such as T-DNA, Tos17 and Ds/dSpm. These mutants have been identified by 246,566 flanking sequence tags (FSTs) and cover 65 % (25,275 of 38,869) of the non-TE genes in rice, while the mutation ratio of TE genes is 25.7 %. In addition, almost 80 % of highly expressed non-TE genes have insertion mutations, indicating that highly expressed genes in rice chromosomes are more likely to have mutations by mutagens such as T-DNA, Ds, dSpm and Tos17. The functions of around 2.5 % of rice genes have been characterized, and studies have mainly focused on transcriptional and post-transcriptional regulation. Slow progress in characterizing the function of rice genes is mainly due to a lack of clues to guide functional studies or functional redundancy. These limitations can be partially solved by a well-categorized functional classification of FST genes. To create this classification, we used the diverse overviews installed in the MapMan toolkit. Gene Ontology (GO) assignment to FST genes supplemented the limitation of MapMan overviews. The functions of 863 of 1,022 known genes can be evaluated by current FST lines, indicating that FST genes are useful resources for functional genomic studies. We assigned 16,169 out of 29,624 FST genes to 34 MapMan classes, including major three categories such as DNA, RNA and protein. To demonstrate the MapMan application on FST genes, transcriptome analysis was done from a rice mutant of 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) gene with FST. Mapping of 756 down-regulated genes in dxr mutants and their annotation in terms of various MapMan overviews revealed candidate genes downstream of DXR-mediating light signaling pathway in diverse functional classes such as the methyl-D-erythritol 4-phosphatepathway (MEP) pathway overview, photosynthesis, secondary metabolism and regulatory overview. This report provides a useful guide for systematic phenomics and further applications to enhance the key agronomic traits of rice.

Rapid Hypothesis Testing with Candida albicans through Gene Disruption with Short Homology Regions

PubMed Central

Wilson, R. Bryce; Davis, Dana; Mitchell, Aaron P.

1999-01-01

Disruption of newly identified genes in the pathogen Candida albicans is a vital step in determination of gene function. Several gene disruption methods described previously employ long regions of homology flanking a selectable marker. Here, we describe disruption of C. albicans genes with PCR products that have 50 to 60 bp of homology to a genomic sequence on each end of a selectable marker. We used the method to disrupt two known genes, ARG5 and ADE2, and two sequences newly identified through the Candida genome project, HRM101 and ENX3. HRM101 and ENX3 are homologous to genes in the conserved RIM101 (previously called RIM1) and PacC pathways of Saccharomyces cerevisiae and Aspergillus nidulans. We show that three independent hrm101/hrm101 mutants and two independent enx3/enx3 mutants are defective in filamentation on Spider medium. These observations argue that HRM101 and ENX3 sequences are indeed portions of genes and that the respective gene products have related functions. PMID:10074081

Conditional genomic rearrangement by designed meiotic recombination using VDE (PI-SceI) in yeast.

PubMed

Fukuda, Tomoyuki; Ohya, Yoshikazu; Ohta, Kunihiro

2007-10-01

Meiotic recombination plays critical roles in the acquisition of genetic diversity and has been utilized for conventional breeding of livestock and crops. The frequency of meiotic recombination is normally low, and is extremely low in regions called "recombination cold domains". Here, we describe a new and highly efficient method to modulate yeast meiotic gene rearrangements using VDE (PI-SceI), an intein-encoded endonuclease that causes an efficient unidirectional meiotic gene conversion at its recognition sequence (VRS). We designed universal targeting vectors, by use of which the strain that inserts the VRS at a desired site is acquired. Meiotic induction of the strains provided unidirectional gene conversions and frequent genetic rearrangements of flanking genes with little impact on cell viability. This system thus opens the way for the designed modulation of meiotic gene rearrangements, regardless of recombinational activity of chromosomal domains. Finally, the VDE-VRS system enabled us to conduct meiosis-specific conditional knockout of genes where VDE-initiated gene conversion disrupts the target gene during meiosis, serving as a novel approach to examine the functions of genes during germination of resultant spores.

Coexistence of Two blaNDM-5 Genes on an IncF Plasmid as Revealed by Nanopore Sequencing.

PubMed

Feng, Yu; Liu, Lu; McNally, Alan; Zong, Zhiyong

2018-05-01

In a carbapenem-resistant Escherichia coli clinical isolate of sequence type 167, two copies of bla NDM-5 were found on a 144,225-bp IncF self-transmissible plasmid of the F36:A4:B - type. Both bla NDM-5 genes were located in 11,065-bp regions flanked by two copies of IS 26 The two regions were identical in sequence but were present at different locations on the plasmid, suggesting a duplication of the same region. This study highlights the complex genetic contexts of bla NDM-5 . Copyright © 2018 American Society for Microbiology.

High level of microsynteny and purifying selection affect the evolution of WRKY family in Gramineae.

PubMed

Jin, Jing; Kong, Jingjing; Qiu, Jianle; Zhu, Huasheng; Peng, Yuancheng; Jiang, Haiyang

2016-01-01

The WRKY gene family, which encodes proteins in the regulation processes of diverse developmental stages, is one of the largest families of transcription factors in higher plants. In this study, by searching for interspecies gene colinearity (microsynteny) and dating the age distributions of duplicated genes, we found 35 chromosomal segments of subgroup I genes of WRKY family (WRKY I) in four Gramineae species (Brachypodium, rice, sorghum, and maize) formed eight orthologous groups. After a stepwise gene-by-gene reciprocal comparison of all the protein sequences in the WRKY I gene flanking areas, highly conserved regions of microsynteny were found in the four Gramineae species. Most gene pairs showed conserved orientation within syntenic genome regions. Furthermore, tandem duplication events played the leading role in gene expansion. Eventually, environmental selection pressure analysis indicated strong purifying selection for the WRKY I genes in Gramineae, which may have been followed by gene loss and rearrangement. The results presented in this study provide basic information of Gramineae WRKY I genes and form the foundation for future functional studies of these genes. High level of microsynteny in the four grass species provides further evidence that a large-scale genome duplication event predated speciation.

Construction of Poxviruses as Cloning Vectors: Insertion of the Thymidine Kinase Gene from Herpes Simplex Virus into the DNA of Infectious Vaccinia Virus

NASA Astrophysics Data System (ADS)

Panicali, Dennis; Paoletti, Enzo

1982-08-01

We have constructed recombinant vaccinia viruses containing the thymidine kinase gene from herpes simplex virus. The gene was inserted into the genome of a variant of vaccinia virus that had undergone spontaneous deletion as well as into the 120-megadalton genome of the large prototypic vaccinia variant. This was accomplished via in vivo recombination by contransfection of eukaryotic tissue culture cells with cloned BamHI-digested thymidine kinase gene from herpes simplex virus containing flanking vaccinia virus DNA sequences and infectious rescuing vaccinia virus. Pure populations of the recombinant viruses were obtained by replica filter techniques or by growth of the recombinant virus in biochemically selective medium. The herpes simplex virus thymidine kinase gene, as an insert in vaccinia virus, is transcribed in vivo and in vitro, and the fidelity of in vivo transcription into a functional gene product was detected by the phosphorylation of 5-[125I]iodo-2'-deoxycytidine.

Strain variation, based on the hemagglutinin gene, in Norwegian ISA virus isolates collected from 1987 to 2001: indications of recombination.

PubMed

Devold, M; Falk, K; Dale, B; Krossøy, B; Biering, E; Aspehaug, V; Nilsen, F; Nylund, A

2001-11-08

Infectious salmon anemia (ISA) is caused by a virus that probably belongs to the Orthomyxoviridae and was first recorded in Norway in 1984. The disease has since spread along the Norwegian coast and has later been found in Canada, Scotland, the Faroe Islands, Chile, and the USA. This study presents sequence variation of the hemagglutinin gene from 37 ISA virus isolates, viz. one isolate from Scotland, one from Canada and 35 from Norway. The hemagglutinin gene contains a highly polymorphic region (HPR), which together with the rest of the gene sequence provides a good tool for studies of epizootics. The gene shows temporal and geographical sequence variation, where certain areas are dominated by distinct groups of isolates. Evidence of transmission of ISA virus isolates within and between regions is given. It is suggested that the hemagglutinin gene from different isolates may recombine. Possible recombination sites are found within the HPR and in the 5'-end flanking region close to the HPR.

Paired termini stabilize antisense RNAs and enhance conditional gene silencing in Escherichia coli

PubMed Central

Nakashima, Nobutaka; Tamura, Tomohiro; Good, Liam

2006-01-01

Reliable methods for conditional gene silencing in bacteria have been elusive. To improve silencing by expressed antisense RNAs (asRNAs), we systematically altered several design parameters and targeted multiple reporter and essential genes in Escherichia coli. A paired termini (PT) design, where flanking inverted repeats create paired dsRNA termini, proved effective. PTasRNAs targeted against the ackA gene within the acetate kinase-phosphotransacetylase operon (ackA-pta) triggered target mRNA decay and a 78% reduction in AckA activity with high genetic penetrance. PTasRNAs are abundant and stable and function through an RNase III independent mechanism that requires a large stoichiometric excess of asRNA. Conditional ackA silencing reduced carbon flux to acetate and increased heterologous gene expression. The PT design also improved silencing of the essential fabI gene. Full anti-fabI PTasRNA induction prevented growth and partial induction sensitized cells to a FabI inhibitor. PTasRNAs have potential for functional genomics, antimicrobial discovery and metabolic flux control. PMID:17062631

Paired termini stabilize antisense RNAs and enhance conditional gene silencing in Escherichia coli.

PubMed

Nakashima, Nobutaka; Tamura, Tomohiro; Good, Liam

2006-01-01

Reliable methods for conditional gene silencing in bacteria have been elusive. To improve silencing by expressed antisense RNAs (asRNAs), we systematically altered several design parameters and targeted multiple reporter and essential genes in Escherichia coli. A paired termini (PT) design, where flanking inverted repeats create paired dsRNA termini, proved effective. PTasRNAs targeted against the ackA gene within the acetate kinase-phosphotransacetylase operon (ackA-pta) triggered target mRNA decay and a 78% reduction in AckA activity with high genetic penetrance. PTasRNAs are abundant and stable and function through an RNase III independent mechanism that requires a large stoichiometric excess of asRNA. Conditional ackA silencing reduced carbon flux to acetate and increased heterologous gene expression. The PT design also improved silencing of the essential fabI gene. Full anti-fabI PTasRNA induction prevented growth and partial induction sensitized cells to a FabI inhibitor. PTasRNAs have potential for functional genomics, antimicrobial discovery and metabolic flux control.

Computationally expanding infinium HumanMethylation450 BeadChip array data to reveal distinct DNA methylation patterns of rheumatoid arthritis

PubMed Central

Li, Chengzhe; Ai, Rizi; Wang, Mengchi; Firestein, Gary S.; Wang, Wei

2016-01-01

Motivation: DNA methylation signatures in rheumatoid arthritis (RA) have been identified in fibroblast-like synoviocytes (FLS) with Illumina HumanMethylation450 array. Since <2% of CpG sites are covered by the Illumina 450K array and whole genome bisulfite sequencing is still too expensive for many samples, computationally predicting DNA methylation levels based on 450K data would be valuable to discover more RA-related genes. Results: We developed a computational model that is trained on 14 tissues with both whole genome bisulfite sequencing and 450K array data. This model integrates information derived from the similarity of local methylation pattern between tissues, the methylation information of flanking CpG sites and the methylation tendency of flanking DNA sequences. The predicted and measured methylation values were highly correlated with a Pearson correlation coefficient of 0.9 in leave-one-tissue-out cross-validations. Importantly, the majority (76%) of the top 10% differentially methylated loci among the 14 tissues was correctly detected using the predicted methylation values. Applying this model to 450K data of RA, osteoarthritis and normal FLS, we successfully expanded the coverage of CpG sites 18.5-fold and accounts for about 30% of all the CpGs in the human genome. By integrative omics study, we identified genes and pathways tightly related to RA pathogenesis, among which 12 genes were supported by triple evidences, including 6 genes already known to perform specific roles in RA and 6 genes as new potential therapeutic targets. Availability and implementation: The source code, required data for prediction, and demo data for test are freely available at: http://wanglab.ucsd.edu/star/LR450K/. Contact: wei-wang@ucsd.edu or gfirestein@ucsd.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26883487

Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kimura, Yasutoshi; Furuhata, Tomohisa; Nakamura, Yusuke

1997-05-01

Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons, and the p53-binding sequence is present in the 5{prime}-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of themore » Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region. 20 refs., 2 figs., 1 tab.« less

Novel insertion sequence- and transposon-mediated genetic rearrangements in genomic island SGI1 of Salmonella enterica serovar Kentucky.

PubMed

Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel

2008-10-01

Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.

[Polymorphism of POU1F1 gene and PRL gene and their combined effects on milk performance traits in Chinese Holstein cattle].

PubMed

Jia, Xiang-Jie; Wang, Chang-Fa; Yang, Gui-Wen; Huang, Jin-Ming; Li, Qiu-Ling; Zhong, Ji-Feng

2011-12-01

Three novel SNPs were found by DNA sequencing, PCR-RFLP and CRS-PCR methods were used for genotyping in 979 Chinese Holstein cattle. One SNP, G1178C, was identified in exon 2 of POU1F1 gene. Two novel SNPs, A906G and A1134G, were identified in 5'-flanking regulatory region (5'-UTR) of PRL gene. The association between polymorphisms of the two genes and milk performance traits were analyzed with PROC GLM of SAS. The results showed that GC genotype at 1178 locus of POU1F1 gene was advantageous for milk yield, milk protein yield, and milk fat yield. AG genotype at 906 locus was advantageous for milk yield. There was no significant difference between 1134 locus and milk performance traits of 5'-UTR of PRL gene. Analysis of genotype combination effect on milk production traits showed that the effect of combined genotype was not simple sum of single genotypes and the effects of gene pyramiding seemed to be more important in molecular breeding.

Two candidate genes (FTO and INSIG2) for fat accumulation in four canids: chromosome mapping, gene polymorphisms and association studies of body and skin weight of red foxes.

PubMed

Grzes, M; Szczerbal, I; Fijak-Nowak, H; Szydlowski, M; Switonski, M

2011-01-01

Fat accumulation is a polygenic trait which has a significant impact on human health and animal production. Obesity is also an increasingly serious problem in dog breeding. The FTO and INSIG2 are considered as candidate genes associated with predisposition for human obesity. In this report we present a comparative genomic analysis of these 2 genes in 4 species belonging to the family Canidae - the dog and 3 species which are kept in captivity for fur production, i.e. red fox, arctic fox and Chinese raccoon dog. We cytogenetically mapped these 2 loci by FISH and compared the entire coding sequence of INSIG2 and a fragment of the coding sequence of FTO. The FTO gene was assigned to the following chromosomes: CFA2q25 (dog), VVU2q21 (red fox), ALA8q25 (arctic fox) and NPP10q24-25 (Chinese raccoon dog), while the INSIG2 was mapped to CFA19q17, VVU5p14, ALA24q15 and NPP9q22, respectively. Altogether, 29 SNPs were identified (16 in INSIG2 and 13 in FTO) and among them 2 were missense substitutions in the dog (23C/T, Thr>Met in the FTO gene and 40C/A, Arg>Ser in INSIG2). The distribution of these 2 SNPs was studied in 14 dog breeds. Two synonymous SNPs, one in the FTO gene (-28T>C in the 5'-flanking region) and one in the INSIG2 (10175C>T in intron 2), were used for the association studies in red foxes (n = 390) and suggestive evidence was observed for their association with body weight (FTO, p < 0.08) and weight of raw skin (INSIG2, p < 0.05). These associations indicate that both genes are potential candidates for growth or adipose tissue accumulation in canids. We also suggest that the 2 missense substitutions found in dogs should be studied in terms of genetic predisposition to obesity. Copyright © 2011 S. Karger AG, Basel.

Reproductive organ and vascular specific promoter of the rice plasma membrane Ca2+ATPase mediates environmental stress responses in plants.

PubMed

Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra

2013-01-01

Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this promoter could grant wide applicability in plant biotechnology.

A Preliminary Study on a Specifically Expressed Arabidopsis Promotor in Vascular Bundle

NASA Astrophysics Data System (ADS)

Yun-hong, Gu; Chuan-xiao, Xie; Li-fang, Wu; Zeng-liang, Yu; Guang-yong, Qin; Yu-ping, Huo

2003-04-01

From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonatrated through transformation.

Prenatal exclusion of Norrie disease with flanking DNA markers.

PubMed

Gal, A; Uhlhaas, S; Glaser, D; Grimm, T

1988-10-01

Three polymorphic DNA markers linked to the locus of Norrie disease were used for indirect genotype analysis in a ten-wk-old fetus at risk for the disease. When haplotypes of the family members and the estimated recombination frequency between Norrie gene and each of the DNA marker loci DXS7, DXS84, and DXS146 were taken into account, the risk that the fetus had inherited the mutation was about 1%.

Identification of Loci Associated with Drought Resistance Traits in Heterozygous Autotetraploid Alfalfa (Medicago sativa L.) Using Genome-Wide Association Studies with Genotyping by Sequencing.

PubMed

Zhang, Tiejun; Yu, Long-Xi; Zheng, Ping; Li, Yajun; Rivera, Martha; Main, Dorrie; Greene, Stephanie L

2015-01-01

Drought resistance is an important breeding target for enhancing alfalfa productivity in arid and semi-arid regions. Identification of genes involved in drought tolerance will facilitate breeding for improving drought resistance and water use efficiency in alfalfa. Our objective was to use a diversity panel of alfalfa accessions comprised of 198 cultivars and landraces to identify genes involved in drought tolerance. The panel was selected from the USDA-ARS National Plant Germplasm System alfalfa collection and genotyped using genotyping by sequencing. A greenhouse procedure was used for phenotyping two important traits associated with drought tolerance: drought resistance index (DRI) and relative leaf water content (RWC). Marker-trait association identified nineteen and fifteen loci associated with DRI and RWC, respectively. Alignments of target sequences flanking to the resistance loci against the reference genome of M. truncatula revealed multiple chromosomal locations. Markers associated with DRI are located on all chromosomes while markers associated with RWC are located on chromosomes 1, 2, 3, 4, 5, 6 and 7. Co-localizations of significant markers between DRI and RWC were found on chromosomes 3, 5 and 7. Most loci associated with DRI in this work overlap with the reported QTLs associated with biomass under drought in alfalfa. Additional significant markers were targeted to several contigs with unknown chromosomal locations. BLAST search using their flanking sequences revealed homology to several annotated genes with functions in stress tolerance. With further validation, these markers may be used for marker-assisted breeding new alfalfa varieties with drought resistance and enhanced water use efficiency.

Functionality of promoter microsatellites of arginine vasopressin receptor 1A (AVPR1A): implications for autism.

PubMed

Tansey, Katherine E; Hill, Matthew J; Cochrane, Lynne E; Gill, Michael; Anney, Richard Jl; Gallagher, Louise

2011-03-31

Arginine vasopressin (AVP) has been hypothesized to play a role in aetiology of autism based on a demonstrated involvement in the regulation of social behaviours. The arginine vasopressin receptor 1A gene (AVPR1A) is widely expressed in the brain and is considered to be a key receptor for regulation of social behaviour. Moreover, genetic variation at AVPR1A has been reported to be associated with autism. Evidence from non-human mammals implicates variation in the 5'-flanking region of AVPR1A in variable gene expression and social behaviour. We examined four tagging single nucleotide polymorphisms (SNPs) (rs3803107, rs1042615, rs3741865, rs11174815) and three microsatellites (RS3, RS1 and AVR) at the AVPR1A gene for association in an autism cohort from Ireland. Two 5'-flanking region polymorphisms in the human AVPR1A, RS3 and RS1, were also tested for their effect on relative promoter activity. The short alleles of RS1 and the SNP rs11174815 show weak association with autism in the Irish population (P = 0.036 and P = 0.008, respectively). Both RS1 and RS3 showed differences in relative promoter activity by length. Shorter repeat alleles of RS1 and RS3 decreased relative promoter activity in the human neuroblastoma cell line SH-SY5Y. These aligning results can be interpreted as a functional route for this association, namely that shorter alleles of RS1 lead to decreased AVPR1A transcription, which may proffer increased susceptibility to the autism phenotype.

Exploring synonymous codon usage preferences of disulfide-bonded and non-disulfide bonded cysteines in the E. coli genome.

PubMed

Song, Jiangning; Wang, Minglei; Burrage, Kevin

2006-07-21

High-quality data about protein structures and their gene sequences are essential to the understanding of the relationship between protein folding and protein coding sequences. Firstly we constructed the EcoPDB database, which is a high-quality database of Escherichia coli genes and their corresponding PDB structures. Based on EcoPDB, we presented a novel approach based on information theory to investigate the correlation between cysteine synonymous codon usages and local amino acids flanking cysteines, the correlation between cysteine synonymous codon usages and synonymous codon usages of local amino acids flanking cysteines, as well as the correlation between cysteine synonymous codon usages and the disulfide bonding states of cysteines in the E. coli genome. The results indicate that the nearest neighboring residues and their synonymous codons of the C-terminus have the greatest influence on the usages of the synonymous codons of cysteines and the usage of the synonymous codons has a specific correlation with the disulfide bond formation of cysteines in proteins. The correlations may result from the regulation mechanism of protein structures at gene sequence level and reflect the biological function restriction that cysteines pair to form disulfide bonds. The results may also be helpful in identifying residues that are important for synonymous codon selection of cysteines to introduce disulfide bridges in protein engineering and molecular biology. The approach presented in this paper can also be utilized as a complementary computational method and be applicable to analyse the synonymous codon usages in other model organisms.

Aphanius arakensis, a new species of tooth-carp (Actinopterygii, Cyprinodontidae) from the endorheic Namak Lake basin in Iran

PubMed Central

Teimori, Azad; Esmaeili, Hamid Reza; Gholami, Zeinab; Zarei, Neda; Reichenbacher, Bettina

2012-01-01

Abstract A new species of tooth-carp, Aphanius arakensis sp. n., is described from the Namak Lake basin in Iran. The new species is distinguished by the congeners distributed in Iran by the following combination of characters: 10–12 anal fin rays, 28–32 lateral line scales, 10–13 caudal peduncle scales, 8–10 gill rakers, 12–19, commonly 15–16, clearly defined flank bars in males, a more prominent pigmentation along the flank added by relatively big blotches in the middle and posterior flank segments in females, a short but high antirostrum of the otolith that has a wide excisura, and a ventral rim with some small, drop-like processes, and 19 molecular apomorphies (17 transitions, two transversions) in the cytochrome b gene. It was suggested based on the phylogenetic analysis that the new species is sister to Aphanius sophiae from the Kor River and that Aphanius farsicus from the Maharlu Lake basin is sister to Aphanius arakensis plus Aphanius sophiae. A noticeable feature of the Aphanius diversity in Iran is the conservatism of the external morphology as well as morphometric and meristic characters, while distinctive differences are present in genetic characters, otolith morphology, and male color pattern. Transformation of the latter was probably driven by sexual selection. PMID:22936871

Exploiting Multisite Gateway and pENFRUIT plasmid collection for fruit genetic engineering.

PubMed

Estornell, Leandro H; Granell, Antonio; Orzaez, Diego

2012-01-01

MultiSite Gateway cloning techniques based on homologous recombination facilitate the combinatorial assembly of basic genetic pieces (i.e., promoters, CDS, and terminators) into gene expression or gene silencing cassettes. pENFRUIT is a collection of MultiSite Triple Gateway Entry vectors dedicated to genetic engineering in fruits. It comprises a number of fruit-operating promoters as well as C-terminal tags adapted to the Gateway standard. In this way, flanking regulatory/labeling sequences can be easily Gateway-assembled with a given gene of interest for its ectopic expression or silencing in fruits. The resulting gene constructs can be analyzed in stable transgenic plants or in transient expression assays, the latter allowing fast testing of the increasing number of combinations arising from MultiSite methodology. A detailed description of the use of MultiSite cloning methodology for the assembly of pENFRUIT elements is presented.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Mitochondrial functions mediate cellulase gene expression in Trichoderma reesei.

PubMed

Abrahão-Neto, J; Rossini, C H; el-Gogary, S; Henrique-Silva, F; Crivellaro, O; el-Dorry, H

1995-08-22

We examined the effects of inhibition of mitochondrial functions on the expression of two nuclear genes encoding the extracellular cellobiohydrolase I (cbh1) and endoglucanase I (egl1) of the cellulase system of the filamentous fungus Trichoderma reesei. The cbh1 and egl1 transcripts are repressed at a low oxygen tension, and by glucose at a concentration known to repress mitochondrial respiration. The transcripts are also down-regulated by chemical agents known to dissipate the proton electrochemical gradient of the inner mitochondrial membrane and blocking of the electron-transport chain, such as DNP and KCN, respectively. These results suggest that expression of those transcripts is influenced by the physiological state of the mitochondria. In addition, heterologous gene fusion shows that the sensitivity of the expression of those transcripts to the functional state of the mitochondria is transcriptionally controlled through the 5'-flanking DNA sequence of those genes.

Epigenetics of the myotonic dystrophy-associated DMPK gene neighborhood

PubMed Central

Buckley, Lauren; Lacey, Michelle; Ehrlich, Melanie

2016-01-01

Aim: Identify epigenetic marks in the vicinity of DMPK (linked to myotonic dystrophy, DM1) that help explain tissue-specific differences in its expression. Materials & methods: At DMPK and its flanking genes (DMWD, SIX5, BHMG1 and RSPH6A), we analyzed many epigenetic and transcription profiles from myoblasts, myotubes, skeletal muscle, heart and 30 nonmuscle samples. Results: In the DMPK gene neighborhood, muscle-associated DNA hypermethylation and hypomethylation, enhancer chromatin, and CTCF binding were seen. Myogenic DMPK hypermethylation correlated with high expression and decreased alternative promoter usage. Testis/sperm hypomethylation of BHMG1 and RSPH6A was associated with testis-specific expression. G-quadruplex (G4) motifs and sperm-specific hypomethylation were found near the DM1-linked CTG repeats within DMPK. Conclusion: Tissue-specific epigenetic features in DMPK and neighboring genes help regulate its expression. G4 motifs in DMPK DNA and RNA might contribute to DM1 pathology. PMID:26756355

Molecular analysis of the ependymin gene and functional test of its promoter region by transient expression in Brachydanio rerio.

PubMed

Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W

1992-01-01

Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

Complete loss of Fas ligand gene causes massive lymphoproliferation and early death, indicating a residual activity of gld allele.

PubMed

Karray, Saoussen; Kress, Chantal; Cuvellier, Sylvain; Hue-Beauvais, Catherine; Damotte, Diane; Babinet, Charles; Lévi-Strauss, Matthieu

2004-02-15

To investigate the in vivo function of Fas ligand (FasL), we produced a mouse strain with a FasL gene flanked by loxP sequences. Mice with homozygous floxed FasL gene showed no obvious abnormalities. However, germline deletion of the FasL gene, obtained after mating with mice expressing ubiquitous Cre recombinase, resulted in an unexpectedly severe phenotype. FasL(-/-) mice exhibited an extreme splenomegaly and lymphadenopathy associated with lymphocytic infiltration into multiple organs and autoimmune disease. This severe phenotype led to the premature death at 4 mo of age of >50% of the homozygous mice. It stands in sharp contrast with the milder disease observed in gld (generalized lymphoproliferative disease) mice, indicating that the FasL allele of these mice encodes a protein still able to bind, albeit at a very low level, the Fas receptor.

Abundance of litter on Condor seamount (Azores, Portugal, Northeast Atlantic)

NASA Astrophysics Data System (ADS)

Pham, C. K.; Gomes-Pereira, J. N.; Isidro, E. J.; Santos, R. S.; Morato, T.

2013-12-01

Marine litter is an emerging problem for the world's ocean health but little is known on its distribution and abundance on seamounts and how it affects deep-sea ecosystems. The scientific underwater laboratory set up on Condor seamount offered an ideal case study for the first documentation of litter distribution on a shallow seamount with historical fishing. A total of 48 video transects deployed on the summit (n=45) and the northern flank (n=3) covered an area of 0.031 and 0.025km2, respectively, revealing 55 litter items. Litter density on the summit was 1439 litter items km-2, whilst on the deeper northern flank, estimates indicate densities of 397 litter items km-2. Lost fishing line was the dominant litter item encountered on both areas (73% of total litter on the summit and 50% on northern flank), all being entirely or partly entangled in the locally abundant gorgonians Dentomuricea cf. meteor and Viminella flagellum. Other items included lost weights, anchors and glass bottles. The predominance of lost fishing gear identifies the source of litter on Condor seamount as exclusively ocean-based and related to fishing activities. Abundance of litter on the Condor seamount was much lower than that reported from other locations closer to populated areas.

K-sam, an amplified gene in stomach cancer, is a member of the heparin-binding growth factor receptor genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hattori, Yutaka; Odagiri, Hiroki; Nakatani, Hiroshi

1990-08-01

DNA fragments amplified in a stomach cancer-derived cell line, KATO-III, were previously identified by the in-gel DNA renaturation method, and a 0.2-kilobase-pair fragment of the amplified sequence was subsequently cloned. By genomic walking, a portion of the exon of the gene flanking this 0.2-kilobase-pair fragment was cloned, and the gene was designated as K-sam ({und K}ATO-III cell-derived {und s}tomach cancer {und am}plified gene). The K-sam cDNAs, corresponding to the 3.5-kilobase K-sam mRNA, were cloned from the KATO-III cells. Sequence analysis revealed that this gene coded for 682 amino acid residues that satisfied the characteristics of the receptor tyrosine kinase. Themore » K-sam gene had significant homologies with bek, FLG, and chicken basic fibroblast growth factor receptor gene. The K-sam gene was amplified in KATO-III cells with the major transcript of 3.5-kilobases in size. This gene was also expressed in some other stomach cancer cells, a small cell lung cancer, and germ cell tumors.« less

Genome structure drives patterns of gene family evolution in ciliates, a case study using Chilodonella uncinata (Protista, Ciliophora, Phyllopharyngea)

PubMed Central

Gao, Feng; Song, Weibo; Katz, Laura A.

2014-01-01

In most lineages, diversity among gene family members results from gene duplication followed by sequence divergence. Because of the genome rearrangements during the development of somatic nuclei, gene family evolution in ciliates involves more complex processes. Previous work on the ciliate Chilodonella uncinata revealed that macronuclear β-tubulin gene family members are generated by alternative processing, in which germline regions are alternatively used in multiple macronuclear chromosomes. To further study genome evolution in this ciliate, we analyzed its transcriptome and found that: 1) alternative processing is extensive among gene families; and 2) such gene families are likely to be C. uncinata-specific. We characterized additional macronuclear and micronuclear copies of one candidate alternatively processed gene family -- a protein kinase domain containing protein (PKc) -- from two C. uncinata strains. Analysis of the PKc sequences reveals: 1) multiple PKc gene family members in the macronucleus share some identical regions flanked by divergent regions; and 2) the shared identical regions are processed from a single micronuclear chromosome. We discuss analogous processes in lineages across the eukaryotic tree of life to provide further insights on the impact of genome structure on gene family evolution in eukaryotes. PMID:24749903

Genetic characterization of the Bifidobacterium breve UCC 2003 hrcA locus.

PubMed

Ventura, Marco; Canchaya, Carlos; Bernini, Valentina; Del Casale, Antonio; Dellaglio, Franco; Neviani, Erasmo; Fitzgerald, Gerald F; van Sinderen, Douwe

2005-12-01

The bacterial heat shock response is characterized by the elevated expression of a number of chaperone complexes and transcriptional regulators, including the DnaJ and the HrcA proteins. Genome analysis of Bifidobacterium breve UCC 2003 revealed a second copy of a dnaJ gene, named dnaJ2, which is flanked by the hrcA gene in a genetic constellation that appears to be unique to the actinobacteria. Phylogenetic analysis using 53 bacterial dnaJ sequences, including both dnaJ1 and dnaJ2 sequences, suggests that these genes have followed a different evolutionary development. Furthermore, the B. breve UCC 2003 dnaJ2 gene seems to be regulated in a manner that is different from that of the previously characterized dnaJ1 gene. The dnaJ2 gene, which was shown to be part of a 2.3-kb bicistronic operon with hrcA, was induced by osmotic shock but not significantly by heat stress. This induction pattern is unlike those of other characterized dnaJ genes and may be indicative of a unique stress adaptation strategy by this commensal microorganism.

Organization of the human [zeta]-crystallin/quinone reductase gene (CRYZ)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonzalez, P.; Rao, P.V.; Zigler, J.S. Jr.

1994-05-15

[zeta]-Crystallin is a protein highly expressed in the lens of guinea pigs and camels, where it comprises about 10% of the total soluble protein. It has recently been characterized as a novel quinone oxidoreductase present in a variety of mammalian tissues. The authors report here the isolation and characterization of the human [zeta]-crystallin gene (CRYZ) and its processed pseudogene. The functional gene is composed of nine exons and spans about 20 kb. The 5[prime]-flanking region of the gene is rich in G and C (58%) and lacks TATA and CAAT boxes. Previous analysis of the guinea pig gene revealed themore » presence of two different promoters, one responsible for the high lens-specific expression and the other for expression at the enzymatic level in numerous tissues. Comparative analysis with the guinea pig gene shows that a region of [approximately]2.5 kb that includes the promoter responsible for the high expression in the lens in guinea pig is not present in the human gene. 34 refs., 6 figs., 1 tab.« less

Genetic Characterization of the Bifidobacterium breve UCC 2003 hrcA Locus

PubMed Central

Ventura, Marco; Canchaya, Carlos; Bernini, Valentina; Del Casale, Antonio; Dellaglio, Franco; Neviani, Erasmo; Fitzgerald, Gerald F.; van Sinderen, Douwe

2005-01-01

The bacterial heat shock response is characterized by the elevated expression of a number of chaperone complexes and transcriptional regulators, including the DnaJ and the HrcA proteins. Genome analysis of Bifidobacterium breve UCC 2003 revealed a second copy of a dnaJ gene, named dnaJ2, which is flanked by the hrcA gene in a genetic constellation that appears to be unique to the actinobacteria. Phylogenetic analysis using 53 bacterial dnaJ sequences, including both dnaJ1 and dnaJ2 sequences, suggests that these genes have followed a different evolutionary development. Furthermore, the B. breve UCC 2003 dnaJ2 gene seems to be regulated in a manner that is different from that of the previously characterized dnaJ1 gene. The dnaJ2 gene, which was shown to be part of a 2.3-kb bicistronic operon with hrcA, was induced by osmotic shock but not significantly by heat stress. This induction pattern is unlike those of other characterized dnaJ genes and may be indicative of a unique stress adaptation strategy by this commensal microorganism. PMID:16332909

Marker-assisted pyramiding of brown planthopper (Nilaparvata lugens Stål) resistance genes Bph1 and Bph2 on rice chromosome 12.

PubMed

Sharma, Prem N; Torii, Akihide; Takumi, Shigeo; Mori, Naoki; Nakamura, Chiharu

2004-01-01

Brown planthopper (BPH) (Nilaparvata lugens Stål) is a significant insect pest of rice (Oryza sativa L.). We constructed a gene-pyramided japonica line, in which two BPH resistance genes Bph1 and Bph2 on the long arm of chromosome 12 independently derived from two indica resistance lines were combined through the recombinant selection. The gene-pyramiding was achieved based on the previously constructed high-resolution linkage maps of the two genes. Two co-dominant and four dominant PCR-based markers flanking the loci were used to select for a homozygous recombinant line in a segregating population that was derived from a cross between the parental homozygous single-gene introgression lines. BPH bioassay showed that the resistance level of the pyramided line was equivalent to that of the Bph1-single introgression line, which showed a higher level of resistance than the Bph2-single introgression line. The pyramid line should provide a useful experimental means for studying the fine structure of the chromosomal region covering these two major BPH resistance genes.

High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

PubMed

Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

2017-08-01

Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

A novel lens epithelium gene, LEP503, is highly conserved in different vertebrate species and is developmentally regulated in postnatal rat lens.

PubMed

Wen, Y; Sachs, G; Athmann, C

2000-02-01

The development of the lens is dependent on the proliferation of lens epithelial cells and their differentiation into fiber cells near the lens bow/equator. Identification of genes specifically expressed in the lens epithelial cells and their functions may provide insight into molecular events that regulate the processes of lens epithelial cell differentiation. In this study, a novel lens epithelium gene product, LEP503, identified from rat by a subtractive cDNA cloning strategy was investigated in the genome organization, mRNA expression and protein localization. The genomic sequences for LEP503 isolated from rat, mouse and human span 1754 bp, 1694 bp and 1895 bp regions encompassing the 5'-flanking region, two exons, one intron and 3'-flanking region. All exon-intron junction sequences conform to the GT/AG rule. Both mouse and human LEP503 genes show very high identity (93% for mouse and 79% for human) to rat LEP503 gene in the exon 1 that contains an open reading frame coding for a protein of 61 amino acid residues with a leucine-rich domain. The deduced protein sequences also show high identity (91% between mouse and rat and 77% between human and rat). Western blot shows that LEP503 is present as a specific approximately 6.9 kDa band in the water-insoluble-urea-soluble fraction of lens cortex where lens epithelium is included. Immuno-staining shows that LEP503 is localized in the epithelial cells along the entire anterior surface of rat lens. Developmentally, LEP503 is expressed at a low level at newborn, and then the expression level increases by about ten-fold around postnatal day 14 and remains at this high level for about 25 days before it drops back to the low level by postnatal day 84. These data suggest that the LEP503 may be an important lens epithelial cell gene involving the processes of epithelial cell differentiation. Copyright 2000 Academic Press.

Transfection and heat-inducible expression of molluscan promoter-luciferase reporter gene constructs in the Biomphalaria glabrata embryonic snail cell line.

PubMed

Yoshino, T P; Wu, X J; Liu, H D

1998-09-01

Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable integration and expression of snail genes of interest into the Bge cell line.

Microbial diversity within Juan de Fuca ridge basement fluids sampled from oceanic borehole observatories

NASA Astrophysics Data System (ADS)

Jungbluth, S.; Bowers, R.; Lin, H.; Hsieh, C.; Cowen, J. P.; Rappé, M.

2012-12-01

Three generations of sampling and instrumentation platforms known as Circulation Obviation Retrofit Kit (CORK) observatories affixed to Ocean Drilling Program (ODP) and Integrated Ocean Drilling Program (IODP) boreholes are providing unrivaled access to fluids originating from 1.2-3.5 million-years (Myr) old basaltic crust of the eastern flank of the Juan de Fuca ridge. Borehole fluid samples obtained via a custom seafloor fluid pumping and sampling system coupled to CORK continuous fluid delivery lines are yielding critical insights into the biogeochemistry and nature of microbial life inhabiting the sediment-covered basement environment. Direct microscopic enumeration revealed microbial cell abundances that are 2-41% of overlying bottom seawater. Snapshots of basement fluid microbial diversity and community structure have been obtained through small subunit ribosomal RNA (SSU rRNA) gene cloning and sequencing from five boreholes that access a range of basement ages and temperatures at the sediment-basement interface. SSU rRNA gene clones were derived from four different CORK installations (1026B, 1301A, 1362A, and 1362B) accessing relatively warmer (65°C) and older (3.5 Myr) ridge flank, and one location (1025C) accessing relatively cooler (39°C) and younger (1.2 Myr) ridge flank, revealing that warmer basement fluids had higher microbial diversity. A sampling time-series collected from borehole 1301A has revealed a microbial community that is temporally variable, with the dominant lineages changing between years. Each of the five boreholes sampled contained a unique microbial assemblage, however, common members are found from both cultivated and uncultivated lineages within the archaeal and bacterial domains, including meso- and thermophilic microbial lineages involved with sulfur cycling (e.g Thiomicrospira, Sulfurimonas, Desulfocapsa, Desulfobulbus). In addition, borehole fluid environmental gene clones were also closely related to uncultivated lineages recovered from both terrestrial and marine hydrothermal systems (e.g. Candidatus Desulforudis, Candidate Phylum OP8) as well as globally distributed marine sediments (e.g. Miscellaneous Crenarchaeotic Group, JTB35). This analysis provides a framework for future research investigating the evolutionary and functional diversity, population genetics, and activity of the poorly understood habitat. These ongoing sampling expeditions greatly benefit from improvements to both CORK observatories and evolving sampling equipment including microbiologically-friendly materials and dependable access to pristine fluids from the ocean crust.

Identification of QTL regions and SSR markers associated with resistance to reniform nematode in Gossypium barbadense L. accession GB713.

PubMed

Gutiérrez, Osman A; Robinson, Arin F; Jenkins, Johnie N; McCarty, Jack C; Wubben, Martin J; Callahan, Franklin E; Nichols, Robert L

2011-02-01

The identification of molecular markers that are closely linked to gene(s) in Gossypium barbadense L. accession GB713 that confer a high level of resistance to reniform nematode (RN), Rotylenchulus reniformis Linford & Oliveira, would be very useful in cotton breeding programs. Our objectives were to determine the inheritance of RN resistance in the accession GB713, to identify SSR markers linked with RN resistance QTLs, and to map these linked markers to specific chromosomes. We grew and scored plants for RN reproduction in the P(1), P(2), F(1), F(2), BC(1)P(1), and BC(1)P(2) generations from the cross of GB713 × Acala Nem-X. The generation means analysis using the six generations indicated that one or more genes were involved in the RN resistance of GB713. The interspecific F(2) population of 300 plants was genotyped with SSR molecular markers that covered most of the chromosomes of Upland cotton (G. hirsutum L.). Results showed two QTLs on chromosome 21 and one QTL on chromosome 18. One QTL on chromosome 21 was at map position 168.6 (LOD 28.0) flanked by SSR markers, BNL 1551_162 and GH 132_199 at positions 154.2 and 177.3, respectively. A second QTL on chromosome 21 was at map position 182.7 (LOD 24.6) flanked by SSR markers BNL 4011_155 and BNL 3279_106 at positions 180.6 and 184.5, respectively. Our chromosome 21 map had 61 SSR markers covering 219 cM. One QTL with smaller genetic effects was localized to chromosome 18 at map position 39.6 (LOD 4.0) and flanked by SSR markers BNL 1721_178 and BNL 569_131 at positions 27.6 and 42.9, respectively. The two QTLs on chromosome 21 had significant additive and dominance effects, which were about equal for each QTL. The QTL on chromosome 18 showed larger additive than dominance effects. Following the precedent set by the naming of the G. longicalyx Hutchinson & Lee and G. aridum [(Rose & Standley) Skovsted] sources of resistance, we suggest the usage of Ren (barb1) and Ren (barb2) to designate these QTLs on chromosome 21 and Ren (barb3) on chromosome 18.

Further evidence that aberrant segregation and crossing over in Sordaria brevicollis may be discrete, though associated, events.

PubMed

Theivendirarajah, K; Whitehouse, H L

1983-01-01

Crosses were made between buff spore colour mutants in Sordaria brevicollis in the presence of flanking markers. Recombinant asci with one or more wild-type spores were isolated and the spores germinated and scored for buff and flanking marker genotype. The buff genotype was determined by back-crossing to each parent and looking for recombinants. It was found that the majority of the recombinant asci had aberrant segregation at one or other mutant site but not both. It was inferred that in the recombinants hybrid DNA rarely extended to both sites. When the aberrant segregation was associated with crossing-over, the crossovers were situated at either end of the gene rather than between the allelic sites where the hybrid DNA was believed to terminate. Thus, some of the crossovers were separated from the site of the aberrant segregation by a site apparently not involved in hybrid DNA and none was in the position predicted by the Meselson-Radding model, that is, where the hybrid DNA terminates.

Plasmodium falciparum sulfadoxine resistance is geographically and genetically clustered within the DR Congo

PubMed Central

Taylor, Steve M.; Antonia, Alejandro L.; Parobek, Christian M.; Juliano, Jonathan J.; Janko, Mark; Emch, Michael; Alam, Md Tauqeer; Udhayakumar, Venkatachalam; Tshefu, Antoinette K.; Meshnick, Steven R.

2013-01-01

Understanding the spatial clustering of Plasmodium falciparum populations can assist efforts to contain drug-resistant parasites and maintain the efficacy of future drugs. We sequenced single nucleotide polymorphisms (SNPs) in the dihydropteroate synthase gene (dhps) associated with sulfadoxine resistance and 5 microsatellite loci flanking dhps in order to investigate the genetic backgrounds, genetic relatedness, and geographic clustering of falciparum parasites in the Democratic Republic of the Congo (DRC). Resistant haplotypes were clustered into subpopulations: one in the northeast DRC, and the other in the balance of the DRC. Network and clonal lineage analyses of the flanking microsatellites indicate that geographically-distinct mutant dhps haplotypes derive from separate lineages. The DRC is therefore a watershed for haplotypes associated with sulfadoxine resistance. Given the importance of central Africa as a corridor for the spread of antimalarial resistance, the identification of the mechanisms of this transit can inform future policies to contain drug-resistant parasite strains. PMID:23372922

Hemizygosity at the elastin locus and clinical features of Williams syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morimoto, Y; Kuwano, A.; Kuwajima, K.

1994-09-01

Williams syndrome is a recognizable syndrome characterized by distinctive facial appearance, gregarious personality, mental retardation, congenital heart defect, particularly supravalvular aortic stenosis (SVAS), and joint limitation. SVAS is an autosomal vascular disorder and the elastin gene was disrupted in patients with SVAS. Ewat et al. reported that hemizygosity at the elastin locus was detected in four familial and five sporadic cases of Williams syndrome. However, three patients did not have SVAS. We reconfirmed hemizygosity at the elastin locus in five patients with typical clinical features of Williams syndrome. Hemizygosity was detected in four cases with SVAS. However, one patient withmore » distinctive facial appearance and typical Williams syndrome personality had two alleles of the elastin gene, but he did not have the congenital heart anomaly. Williams syndrome is thought to be a contiguous gene disorder. Thus, our data suggest that the elastin gene is responsible for the vascular defect in patients with Williams syndrome, and flanking genes are responsible for characteristic facial appearance and personality.« less

The G-Box Transcriptional Regulatory Code in Arabidopsis1[OPEN

PubMed Central

Shepherd, Samuel J.K.; Brestovitsky, Anna; Dickinson, Patrick; Biswas, Surojit

2017-01-01

Plants have significantly more transcription factor (TF) families than animals and fungi, and plant TF families tend to contain more genes; these expansions are linked to adaptation to environmental stressors. Many TF family members bind to similar or identical sequence motifs, such as G-boxes (CACGTG), so it is difficult to predict regulatory relationships. We determined that the flanking sequences near G-boxes help determine in vitro specificity but that this is insufficient to predict the transcription pattern of genes near G-boxes. Therefore, we constructed a gene regulatory network that identifies the set of bZIPs and bHLHs that are most predictive of the expression of genes downstream of perfect G-boxes. This network accurately predicts transcriptional patterns and reconstructs known regulatory subnetworks. Finally, we present Ara-BOX-cis (araboxcis.org), a Web site that provides interactive visualizations of the G-box regulatory network, a useful resource for generating predictions for gene regulatory relations. PMID:28864470

Removal of Heterologous Sequences from Plasmodium falciparum Mutants Using FLPe-Recombinase

PubMed Central

van Schaijk, Ben C. L.; Vos, Martijn W.; Janse, Chris J.; Sauerwein, Robert W.; Khan, Shahid M.

2010-01-01

Genetically-modified mutants are now indispensable Plasmodium gene-function reagents, which are also being pursued as genetically attenuated parasite vaccines. Currently, the generation of transgenic malaria-parasites requires the use of drug-resistance markers. Here we present the development of an FRT/FLP-recombinase system that enables the generation of transgenic parasites free of resistance genes. We demonstrate in the human malaria parasite, P. falciparum, the complete and efficient removal of the introduced resistance gene. We targeted two neighbouring genes, p52 and p36, using a construct that has a selectable marker cassette flanked by FRT-sequences. This permitted the subsequent removal of the selectable marker cassette by transient transfection of a plasmid that expressed a 37°C thermostable and enhanced FLP-recombinase. This method of removing heterologous DNA sequences from the genome opens up new possibilities in Plasmodium research to sequentially target multiple genes and for using genetically-modified parasites as live, attenuated malaria vaccines. PMID:21152048

Disruption of Hox9,10,11 function results in cellular level lineage infidelity in the kidney.

PubMed

Drake, Keri A; Adam, Mike; Mahoney, Robert; Potter, S Steven

2018-04-20

Hox genes are important regulators of development. The 39 mammalian Hox genes have considerable functional overlap, greatly confounding their study. In this report, we generated mice with multiple combinations of paralogous and flanking Abd-B Hox gene mutations to investigate functional redundancies in kidney development. The resulting mice developed a number of kidney abnormalities, including hypoplasia, agenesis, and severe cysts, with distinct Hox functions observed in early metanephric kidney formation and nephron progenitor maintenance. Most surprising, however, was that extensive removal of Hox shared function in these kidneys resulted in cellular level lineage infidelity. Strikingly, mutant nephron tubules consisted of intermixed cells with proximal tubule, loop of Henle, and collecting duct identities, with some single cells expressing markers associated with more than one nephron segment. These results indicate that Hox genes are required for proper lineage selection/maintenance and full repression of genes involved in cell fate restriction in the developing kidney.

Tissue-specifically regulated site-specific excision of selectable marker genes in bivalent insecticidal, genetically-modified rice.

PubMed

Hu, Zhan; Ding, Xuezhi; Hu, Shengbiao; Sun, Yunjun; Xia, Liqiu

2013-12-01

Marker-free, genetically-modified rice was created by the tissue-specifically regulated Cre/loxP system, in which the Cre recombinase gene and hygromycin phosphotransferase gene (hpt) were flanked by two directly oriented loxP sites. Cre expression was activated by the tissue-specific promoter OsMADS45 in flower or napin in seed, resulting in simultaneous excision of the recombinase and marker genes. Segregation of T1 progeny was performed to select recombined plants. The excision was confirmed by PCR, Southern blot and sequence analyses indicating that efficiency varied from 10 to 53 % for OsMADS45 and from 12 to 36 % for napin. The expression of cry1Ac and vip3A was detected by RT-PCR analysis in marker-free transgenic rice. These results suggested that our tissue-specifically regulated Cre/loxP system could auto-excise marker genes from transgenic rice and alleviate public concerns about the security of GM crops.

Genomic organization, complete sequence, and chromosomal location of the gene for human eotaxin (SCYA11), an eosinophil-specific CC chemokine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia-Zepeda, E.A.; Sarafi, M.N.; Luster, A.D.

1997-05-01

Eotaxin is a CC chemokine that is a specific chemoattractant for eosinophils and is implicated in the pathogenesis of eosinophilic inflammatory diseases, such as asthma. We describe the genomic organization, complete sequence, including 1354 bp 5{prime} of the RNA initiation site, and chromosomal localization of the human eotaxin gene. Fluorescence in situ hybridization analysis localized eotaxin to human chromosome 17, in the region q21.1-q21.2, and the human gene name SCYA11 was assigned. We also present the 5{prime} flanking sequence of the mouse eotaxin gene and have identified several regulatory elements that are conserved between the murine and the human promoters.more » In particular, the presence of elements such as NF-{Kappa}B, interferon-{gamma} response element, and glucocorticoid response element may explain the observed regulation of the eotaxin gene by cytokines and glucocorticoids. 17 refs., 4 figs., 1 tab.« less

Recurrence of 49-base decamers, nonomers, and octamers within mouse C mu gene of Ig heavy chain and its primordial building block.

PubMed Central

Yazaki, A; Ohno, S

1983-01-01

Within the published 2,168-base-long mouse C mu gene of Ig heavy chain consisting of four coding and four noncoding segments, 2 base decamers, 8 nonomers, and 39 octamers recurred. Recurring base heptamers (about 100) and hexamers (about 350) were simply too numerous to merit individual identification. In spite of extensive overlaps between these recurring base decamers to hexamers, they occupied nearly the entire length of mouse Ig C mu gene. As with other genes of the beta-sheet-forming beta 2-microglobulin family, the Ig C mu gene (flanking and intervening noncoding sequences included) is not a unique sequence but rather it is degenerate repeats of the 45-base-long primordial building-block sequence uniquely its own. This primordial building block must originally have specified the 15-amino-acid-residue-long primordial arm of beta-sheet-forming loops, the characteristics of the beta 2-microglobulin family of polypeptides. PMID:6403948

Design of a muscle cell-specific expression vector utilising human vascular smooth muscle alpha-actin regulatory elements.

PubMed

Keogh, M C; Chen, D; Schmitt, J F; Dennehy, U; Kakkar, V V; Lemoine, N R

1999-04-01

The facility to direct tissue-specific expression of therapeutic gene constructs is desirable for many gene therapy applications. We describe the creation of a muscle-selective expression vector which supports transcription in vascular smooth muscle, cardiac muscle and skeletal muscle, while it is essentially silent in other cell types such as endothelial cells, hepatocytes and fibroblasts. Specific transcriptional regulatory elements have been identified in the human vascular smooth muscle cell (VSMC) alpha-actin gene, and used to create an expression vector which directs the expression of genes in cis to muscle cells. The vector contains an enhancer element we have identified in the 5' flanking region of the human VSMC alpha-actin gene involved in mediating VSMC expression. Heterologous pairing experiments have shown that the enhancer does not interact with the basal transcription complex recruited at the minimal SV40 early promoter. Such a vector has direct application in the modulation of VSMC proliferation associated with intimal hyperplasia/restenosis.

Profiling the genome-wide DNA methylation pattern of porcine ovaries using reduced representation bisulfite sequencing.

PubMed

Yuan, Xiao-Long; Gao, Ning; Xing, Yan; Zhang, Hai-Bin; Zhang, Ai-Ling; Liu, Jing; He, Jin-Long; Xu, Yuan; Lin, Wen-Mian; Chen, Zan-Mou; Zhang, Hao; Zhang, Zhe; Li, Jia-Qi

2016-02-25

Substantial evidence has shown that DNA methylation regulates the initiation of ovarian and sexual maturation. Here, we investigated the genome-wide profile of DNA methylation in porcine ovaries at single-base resolution using reduced representation bisulfite sequencing. The biological variation was minimal among the three ovarian replicates. We found hypermethylation frequently occurred in regions with low gene abundance, while hypomethylation in regions with high gene abundance. The DNA methylation around transcriptional start sites was negatively correlated with their own CpG content. Additionally, the methylation level in the bodies of genes was higher than that in their 5' and 3' flanking regions. The DNA methylation pattern of the low CpG content promoter genes differed obviously from that of the high CpG content promoter genes. The DNA methylation level of the porcine ovary was higher than that of the porcine intestine. Analyses of the genome-wide DNA methylation in porcine ovaries would advance the knowledge and understanding of the porcine ovarian methylome.

Mutations in the RS1 gene in a Chinese family with X-linked juvenile retinoschisis.

PubMed

Hou, Qiaofang; Chu, Yan; Guo, Qiannan; Wu, Dong; Liao, Shixiu

2012-02-01

The purpose of our study was to identify the mutations in the retinoschisis 1 (RS1) gene, which was associated with X-linked retinoschisis (XLRS) in a four-generation Chinese family, and to provide the theoretical basis for gene diagnosis and gene therapy. Genomic DNA was extracted from peripheral leukocytes. All six exons and flanking intronic regions were amplified by polymerase chain reaction (PCR), followed by direct sequencing. Through our genetic analysis, one frameshift 573delG mutation was identified in the patients of this four-generation pedigree; however, this mutation was absent in normal or non-carrier subjects. In conclusion, this 573delG mutation is reported in the Chinese population for the first time. This mutation widens the mutational spectrum of RS1 in Asians. Identification of mutations in the RS1 gene and expanded information on clinical manifestations will facilitate early diagnosis, appropriate early therapy, and genetic counseling regarding the prognosis of XLRS.

Concurrent Preoperative Presence of Hydronephrosis and Flank Pain Independently Predicts Worse Outcome of Upper Tract Urothelial Carcinoma.

PubMed

Yeh, Hsin-Chih; Jan, Hau-Chern; Wu, Wen-Jeng; Li, Ching-Chia; Li, Wei-Ming; Ke, Hung-Lung; Huang, Shu-Pin; Liu, Chia-Chu; Lee, Yung-Chin; Yang, Sheau-Fang; Liang, Peir-In; Huang, Chun-Nung

2015-01-01

To investigate the impact of preoperative hydronephrosis and flank pain on prognosis of patients with upper tract urothelial carcinoma. In total, 472 patients with upper tract urothelial carcinoma managed by radical nephroureterectomy were included from Kaohsiung Medical University Hospital Healthcare System. Clinicopathological data were collected retrospectively for analysis. The significance of hydronephrosis, especially when combined with flank pain, and other relevant factors on overall and cancer-specific survival were evaluated. Of the 472 patients, 292 (62%) had preoperative hydronephrosis and 121 (26%) presented with flank pain. Preoperative hydronephrosis was significantly associated with age, hematuria, flank pain, tumor location, and pathological tumor stage. Concurrent presence of hydronephrosis and flank pain was a significant predictor of non-organ-confined disease (multivariate-adjusted hazard ratio = 2.10, P = 0.025). Kaplan-Meier analysis showed significantly poorer overall and cancer-specific survival in patients with preoperative hydronephrosis (P = 0.005 and P = 0.026, respectively) and in patients with flank pain (P < 0.001 and P = 0.001, respectively) than those without. However, only simultaneous hydronephrosis and flank pain independently predicted adverse outcome (hazard ratio = 1.98, P = 0.016 for overall survival and hazard ratio = 1.87, P = 0.036 for and cancer-specific survival, respectively) in multivariate Cox proportional hazards models. In addition, concurrent presence of hydronephrosis and flank pain was also significantly predictive of worse survival in patient with high grade or muscle-invasive disease. Notably, there was no difference in survival between patients with hydronephrosis but devoid of flank pain and those without hydronephrosis. Concurrent preoperative presence of hydronephrosis and flank pain predicted non-organ-confined status of upper tract urothelial carcinoma. When accompanied with flank pain, hydronephrosis represented an independent predictor for worse outcome in patients with upper tract urothelial carcinoma.

Relative stability of DNA as a generic criterion for promoter prediction: whole genome annotation of microbial genomes with varying nucleotide base composition.

PubMed

Rangannan, Vetriselvi; Bansal, Manju

2009-12-01

The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool PromPredict. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.

Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays

PubMed Central

Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel

2006-01-01

Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921

PhiC31 recombination system demonstrates heritable germinal transmission of site-specific excision from the Arabidopsis genome

PubMed Central

2010-01-01

Background The large serine recombinase phiC31 from broad host range Streptomyces temperate phage, catalyzes the site-specific recombination of two recognition sites that differ in sequence, typically known as attachment sites attB and attP. Previously, we characterized the phiC31 catalytic activity and modes of action in the fission yeast Schizosaccharomyces pombe. Results In this work, the phiC31 recombinase gene was placed under the control of the Arabidopsis OXS3 promoter and introduced into Arabidopsis harboring a chromosomally integrated attB and attP-flanked target sequence. The phiC31 recombinase excised the attB and attP-flanked DNA, and the excision event was detected in subsequent generations in the absence of the phiC31 gene, indicating germinal transmission was possible. We further verified that the genomic excision was conservative and that introduction of a functional recombinase can be achieved through secondary transformation as well as manual crossing. Conclusion The phiC31 system performs site-specific recombination in germinal tissue, a prerequisite for generating stable lines with unwanted DNA removed. The precise site-specific deletion by phiC31 in planta demonstrates that the recombinase can be used to remove selectable markers or other introduced transgenes that are no longer desired and therefore can be a useful tool for genome engineering in plants. PMID:20178628

Watershed management problems and opportunities for the Colorado Front Range ponderosa pine zone: The status of our knowledge

Treesearch

Howard L. Gary

1975-01-01

The east flank of the Continental Divide consists largely of open timber stands and grasslands. Soils erode easily after abuse. Precipitation ranges from 15 to 20 inches, about two-thirds from high-intensity storms from April to September. Guidelines are provided for maintaining satisfactorv watershed conditions. The 3- to 5-inch water yields are comparatively small in...

Activation-dependent intrachromosomal interactions formed by the TNF gene promoter and two distal enhancers

PubMed Central

Tsytsykova, Alla V.; Rajsbaum, Ricardo; Falvo, James V.; Ligeiro, Filipa; Neely, Simon R.; Goldfeld, Anne E.

2007-01-01

Here we provide a mechanism for specific, efficient transcription of the TNF gene and, potentially, other genes residing within multigene loci. We identify and characterize highly conserved noncoding elements flanking the TNF gene, which undergo activation-dependent intrachromosomal interactions. These elements, hypersensitive site (HSS)−9 and HSS+3 (9 kb upstream and 3 kb downstream of the TNF gene, respectively), contain DNase I hypersensitive sites in naive, T helper 1, and T helper 2 primary T cells. Both HSS-9 and HSS+3 inducibly associate with acetylated histones, indicative of chromatin remodeling, bind the transcription factor nuclear factor of activated T cells (NFAT)p in vitro and in vivo, and function as enhancers of NFAT-dependent transactivation mediated by the TNF promoter. Using the chromosome conformation capture assay, we demonstrate that upon T cell activation intrachromosomal looping occurs in the TNF locus. HSS-9 and HSS+3 each associate with the TNF promoter and with each other, circularizing the TNF gene and bringing NFAT-containing nucleoprotein complexes into close proximity. TNF gene regulation thus reveals a mode of intrachromosomal interaction that combines a looped gene topology with interactions between enhancers and a gene promoter. PMID:17940009

Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

PubMed

Tornow, J; Santangelo, G M

1994-06-01

A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

Cis-acting elements in the promoter region of the human aldolase C gene.

PubMed

Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F

1993-08-16

We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.

Determination of genetic effects of ATF3 and CDKN1A genes on milk yield and compositions in Chinese Holstein population.

PubMed

Han, Bo; Liang, Weijun; Liu, Lin; Li, Yanhua; Sun, Dongxiao

2017-05-19

Our previous RNA-sequencing study revealed that the ATF3 and CDKN1A genes were remarkably differentially expressed between the mammary glands of lactating Holstein cows with extremely high and low milk protein and fat percentage so that both of them were considered as candidates for milk composition. Herein, we further verified whether these genes have genetic effects on milk production traits in a Chinese Holstein cow population. By re-sequencing the entire coding and regulatory regions, we identified four SNPs in 5'promoter region, two in exons, seven in 3' un-translated region (UTR), and six in 3'flanking region of ATF3 gene, and one SNP in exon 5, two in 3'UTR, and two in 3'flanking region of CDKN1A gene. Of these, only the SNP, c.271C > T (rs442346530), in exon 5 of CDKN1A gene was predicted to result in an amino acid replacement from arginine to tryptophan. Subsequent genotype-phenotype association analysis revealed that 19 SNPs in ATF3 and 5 SNPs in CDKN1A were evidently associated with 305-days milk yield, fat yield, protein yield, or protein percentage (P = < 0.0001 ~ 0.0494). Whilst, no significant SNPs in ATF3 gene were associated with fat percentage in both first and second lactations (P > 0.05), and only two SNPs of CDKN1A gene, c.271C > T (P = 0.0377) and c.*654C > T (P = 0.0144), were markedly associated with fat percentage in the first lactation. Further, linkage disequilibrium (LD) analyses were conducted among the identified SNPs in ATF3 and/or CDKN1A genes to further confirm the association results. We also observed that the four SNPs, g.72834301C > A, g.72834229C > A, g.72833969A > G, and g.72833562G > T altered the specific transcription factor (TF) binding sites in ATF3 promoter, and one SNP, c.271C > T, changed the CDKN1A protein secondary structure, suggesting they might be the promising potential functional mutations. Our findings first profiled the genetic effects of ATF3 and CDKN1A genes for milk production traits in dairy cattle and will be available for marker-assisted breeding in dairy cattle.

Flight investigation of cabin noise control treatments for a light turboprop aircraft

NASA Technical Reports Server (NTRS)

Wilby, J. F.; Oneal, R. L.; Mixson, J. S.

1985-01-01

The in-flight evaluation of noise control treatments for a light, twin-engined turboprop aircraft presents several problems associated with data analysis and interpretation. These problems include data repeatability, propeller synchronization, spatial distributions of the exterior pressure field and acoustic treatment, and the presence of flanking paths. They are discussed here with regard to a specific aeroplane configuration. Measurements were made in an untreated cabin and in a cabin fitted with an experimental sidewall treatment. Results are presented in terms of the insertion loss provided by the treatment and comparison made with predictions based on laboratory measurements.

Design of retrovirus vectors for transfer and expression of the human. beta. -globin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, A.D.; Bender, M.A.; Harris, E.A.S.

1988-11-01

Regulated expression of the human ..beta..-globin gene has been demonstrated in cultured murine erythroleukemia cells and in mice after retrovirus-mediated gene transfer. However, the low titer of recombinant viruses described to date results in relatively inefficient gene transfer, which limits their usefulness for animal studies and for potential gene therapy in humans for diseases involving defective ..beta..-globin genes. The authors found regions that interfered with virus production within intron 2 of the ..beta..-globin gene and on both sides of the gene. The flanking regions could be removed, but intron 2 was required for ..beta..-globin expression. Inclusion of ..beta..-globin introns necessitatesmore » an antisense orientation of the gene within the retrovirus vector. However, they found no effect of the antisense ..beta..-globin transcription on virus production. A region downstream of the ..beta..-globin gene that stimulates expression of the gene in transgenic mice was included in the viruses without detrimental effects on virus titer. Virus titers of over 10/sup 6/ CFU/ml were obtained with the final vector design, which retained the ability to direct regulated expression of human ..beta..-globin in murine erythroleukemia cells. The vector also allowed transfer and expression of the human ..beta..-globin gene in hematopoietic cells (CFU-S cells) in mice.« less

The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

PubMed

Gaji, Rajshekhar Y; Howe, Daniel K

2009-07-01

The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

Archaebacterial rhodopsin sequences: Implications for evolution

NASA Technical Reports Server (NTRS)

Lanyi, J. K.

1991-01-01

It was proposed over 10 years ago that the archaebacteria represent a separate kingdom which diverged very early from the eubacteria and eukaryotes. It follows that investigations of archaebacterial characteristics might reveal features of early evolution. So far, two genes, one for bacteriorhodopsin and another for halorhodopsin, both from Halobacterium halobium, have been sequenced. We cloned and sequenced the gene coding for the polypeptide of another one of these rhodopsins, a halorhodopsin in Natronobacterium pharaonis. Peptide sequencing of cyanogen bromide fragments, and immuno-reactions of the protein and synthetic peptides derived from the C-terminal gene sequence, confirmed that the open reading frame was the structural gene for the pharaonis halorhodopsin polypeptide. The flanking DNA sequences of this gene, as well as those of other bacterial rhodopsins, were compared to previously proposed archaebacterial consensus sequences. In pairwise comparisons of the open reading frame with DNA sequences for bacterio-opsin and halo-opsin from Halobacterium halobium, silent divergences were calculated. These indicate very considerable evolutionary distance between each pair of genes, even in the dame organism. In spite of this, three protein sequences show extensive similarities, indicating strong selective pressures.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

PubMed

Beauparlant, Marc A; Drouin, Guy

2014-02-01

Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

Ras-dva Is a Novel Pit-1- and Glucocorticoid-Regulated Gene in the Embryonic Anterior Pituitary Gland

PubMed Central

Ellestad, Laura E.

2013-01-01

Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5′-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5′-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland. PMID:23161868

Ras-dva is a novel Pit-1- and glucocorticoid-regulated gene in the embryonic anterior pituitary gland.

PubMed

Ellestad, Laura E; Porter, Tom E

2013-01-01

Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5'-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5'-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland.

TALEN-mediated generation and genetic correction of disease-specific human induced pluripotent stem cells.

PubMed

Ramalingam, Sivaprakash; Annaluru, Narayana; Kandavelou, Karthikeyan; Chandrasegaran, Srinivasan

2014-01-01

Generation and precise genetic correction of patient-derived hiPSCs have great potential in regenerative medicine. Such targeted genetic manipulations can now be achieved using gene-editing nucleases. Here, we report generation of cystic fibrosis (CF) and Gaucher's disease (GD) hiPSCs respectively from CF (homozygous for CFTRΔF508 mutation) and Type II GD [homozygous for β-glucocerebrosidase (GBA) 1448T>C mutation] patient fibroblasts, using CCR5- specific TALENs. Site-specific addition of loxP-flanked Oct4/Sox2/Klf4/Lin28/Nanog/eGFP gene cassette at the endogenous CCR5 site of patient-derived disease-specific primary fibroblasts induced reprogramming, giving rise to both monoallele (heterozygous) and biallele CCR5-modified hiPSCs. Subsequent excision of the donor cassette was done by treating CCR5-modified CF and GD hiPSCs with Cre. We also demonstrate site-specific correction of sickle cell disease (SCD) mutations at the endogenous HBB locus of patient-specific hiPSCs [TNC1 line that is homozygous for mutated β- globin alleles (βS/βS)], using HBB-specific TALENs. SCD-corrected hiPSC lines showed gene conversion of the mutated βS to the wild-type βA in one of the HBB alleles, while the other allele remained a mutant phenotype. After excision of the loxP-flanked DNA cassette from the SCD-corrected hiPSC lines using Cre, we obtained secondary heterozygous βS/βA hiPSCs, which express the wild-type (βA) transcript to 30-40% level as compared to uncorrected (βS/βS) SCD hiPSCs when differentiated into erythroid cells. Furthermore, we also show that TALEN-mediated generation and genetic correction of disease-specific hiPSCs did not induce any off-target mutations at closely related sites.

Unique CD44 intronic SNP is associated with tumor grade in breast cancer: a case control study and in silico analysis.

PubMed

Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan

2018-01-01

CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.

A genome-wide association study of asthma symptoms in Latin American children.

PubMed

Costa, Gustavo N O; Dudbridge, Frank; Fiaccone, Rosemeire L; da Silva, Thiago M; Conceição, Jackson S; Strina, Agostino; Figueiredo, Camila A; Magalhães, Wagner C S; Rodrigues, Maira R; Gouveia, Mateus H; Kehdy, Fernanda S G; Horimoto, Andrea R V R; Horta, Bernardo; Burchard, Esteban G; Pino-Yanes, Maria; Del Rio Navarro, Blanca; Romieu, Isabelle; Hancock, Dana B; London, Stephanie; Lima-Costa, Maria Fernanda; Pereira, Alexandre C; Tarazona, Eduardo; Rodrigues, Laura C; Barreto, Mauricio L

2015-12-03

Asthma is a chronic disease of the airways and, despite the advances in the knowledge of associated genetic regions in recent years, their mechanisms have yet to be explored. Several genome-wide association studies have been carried out in recent years, but none of these have involved Latin American populations with a high level of miscegenation, as is seen in the Brazilian population. 1246 children were recruited from a longitudinal cohort study in Salvador, Brazil. Asthma symptoms were identified in accordance with an International Study of Asthma and Allergies in Childhood (ISAAC) questionnaire. Following quality control, 1,877,526 autosomal SNPs were tested for association with childhood asthma symptoms by logistic regression using an additive genetic model. We complemented the analysis with an estimate of the phenotypic variance explained by common genetic variants. Replications were investigated in independent Mexican and US Latino samples. Two chromosomal regions reached genome-wide significance level for childhood asthma symptoms: the 14q11 region flanking the DAD1 and OXA1L genes (rs1999071, MAF 0.32, OR 1.78, 95% CI 1.45-2.18, p-value 2.83 × 10(-8)) and 15q22 region flanking the FOXB1 gene (rs10519031, MAF 0.04, OR 3.0, 95% CI 2.02-4.49, p-value 6.68 × 10(-8) and rs8029377, MAF 0.03, OR 2.49, 95% CI 1.76-3.53, p-value 2.45 × 10(-7)). eQTL analysis suggests that rs1999071 regulates the expression of OXA1L gene. However, the original findings were not replicated in the Mexican or US Latino samples. We conclude that the 14q11 and 15q22 regions may be associated with asthma symptoms in childhood.

The beetle Tribolium castaneum has a fushi tarazu homolog expressed in stripes during segmentation

NASA Technical Reports Server (NTRS)

Brown, S. J.; Hilgenfeld, R. B.; Denell, R. E.; Spooner, B. S. (Principal Investigator)

1994-01-01

The genetic control of embryonic organization is far better understood for the fruit fly Drosophila melanogaster than for any other metazoan. A gene hierarchy acts during oogenesis and embryogenesis to regulate the establishment of segmentation along the anterior-posterior axis, and homeotic selector genes define developmental commitments within each parasegmental unit delineated. One of the most intensively studied Drosophila segmentation genes is fushi tarazu (ftz), a pair-rule gene expressed in stripes that is important for the establishment of the parasegmental boundaries. Although ftz is flanked by homeotic selector genes conserved throughout the metazoa, there is no evidence that it was part of the ancestral homeotic complex, and it has been unclear when the gene arose and acquired a role in segmentation. We show here that the beetle Tribolium castaneum has a ftz homolog located in its Homeotic complex and expressed in a pair-rule fashion, albeit in a register differing from that of the fly gene. These and other observations demonstrate that a ftz gene preexisted the radiation of holometabolous insects and suggest that it has a role in beetle embryogenesis which differs somewhat from that described in flies.

A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.

PubMed

Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris

2008-04-01

Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.

Polymorphisms in the phosducin (PDC) gene on chromosome 1q25-32

DOE Office of Scientific and Technical Information (OSTI.GOV)

Humphries, P.; Mansergh, F.C.; Farrar, G.J.

1994-09-01

Phosducin (33 kDa protein or MEKA) is a principal water-soluble phosphoprotein in the rod and cone photoreceptor cells and pinealocytes. This protein modulates the phototransduction cascade by binding to the beta and gamma subunit complexes of transducin. The PDC gene has been mapped to 1q25-32, the region of linkage of two hereditary retinal degenerative disorders; autosomal dominant juvenile-onset open-angle glaucoma and one form of autosomal recessive RP. Using previously published sequence data, PCR primers were designed to amplify the coding and 5{prime} flanking regions of the PDC gene. Direct sequencing revealed three polymorphisms in the 5{prime} flanking region, two ofmore » which were in regions highly homologous between humans and mice. Analysis of the polymorphisms was then extended to larger population samples using SSCPE and denaturing gel analysis. The first polymorphism PDC1 resulted from an insertion of a G residue at position -653/4. Allele frequencies were determined to be 0.51 (insG) and 0.49 (normal) giving a PIC value of 0.50. A deletion of a T residue at position -488 was the basis of the PDC2 polymorphism with allele frequencies of 0.88 (normal) and 0.12 (delT) and a PIC value of 0.21. Interestingly, the allele with an inserted G residue in PDC1 always segregrated with the deleted T allele in PDC2. The third polymorphism PDC3 was caused by a T or G residue at position -1083. Allele frequencies of 0.26 (G residue) and 0.74 (T residue) were determined from an analysis of 80 individuals with an overall PIC value of 0.39. The identification of these three polymorphisms in the PDC gene will be useful for future genetic linkage studies of chromosome 1q in inherited retinopathies.« less

[Construction of a recombinant HVT virus expressing the HA gene of avian influenza virus H5N1 via Rde/ET recombination system].

PubMed

Lan, Desong; Shi, Xingming; Wang, Yunfeng; Liu, Changjun; Wang, Mei; Cui, Hongyu; Tian, Guobin; Li, Jisong; Tong, Guangzhi

2009-01-01

In recent years,manipulation of large herpesvirus genomes has been facilitated by using bacterial artificial chromosome (BAC) vectors. We have previously reported the construction of the BAC clones (HVT BACs) of herpesvirus of turkey (HVT). With these BAC clones in hand,we manipulated the genome of HVT by utilizing Red/ET recombination system, and developed a biologically safe live vaccine based on the HVT BACs. In this two-step approach, we first transformed the plasmid pRedET into the DH10B competent cells that carried the HVT BACs,and added inducer L-arabinose into the cells. We prepared the cells into competent cells and electroporated the linear rpsL-neo counter-selection/selection cassette flanked by the 50 bp long homology arms into the cells. So the functional cassette was inserted into the U(S)2 locus. Only colonies carrying the modified BAC would survive Kanamycin selection on the agar plates. The successful integration of the rpsL-neo cassette was monitored by PCR and Streptomycin selection, for the insertion of rpsL-neo cassette cells will become Streptomycin sensitive. Secondly, in the same way, we replaced the rpsL-neo cassette with the hemagglutinin (HA) gene of (HPAIV) A/Goose/ Guangdong/1/96(H5N1) flanked by the same homology arms. Only colonies which lost the rpsL-neo cassette will grow on Streptomycin containing plates. Finally, we obtained many colonies of which the HA gene of the AIV was inserted into the U(S)2 locus to be modified of HVT. And we reconstituted one recombinant virus from transfecting one of these BAC clones DNA into chick embryo fibroblasts (CEFs). We achieved one rescued recombinant virus which designated as rHVT-HA3. The H5 subtype HA gene expression in this recombinant virus rHVT-HA3 was confirmed by immunofluorescence assay.

Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

PubMed

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

Evidence for Sexual Reproduction: Identification, Frequency, and Spatial Distribution of Venturia effusa (Pecan Scab) Mating Type Idiomorphs.

PubMed

Young, Carolyn A; Bock, Clive H; Charlton, Nikki D; Mattupalli, Chakradhar; Krom, Nick; Bowen, Joanna K; Templeton, Matthew; Plummer, Kim M; Wood, Bruce W

2018-05-10

Venturia effusa (syn. Fusicladium effusum), causal agent of pecan scab, is the most prevalent pathogen of pecan (Carya illinoinensis), causing severe yield losses in the southeastern United States. V. effusa is currently known only by its asexual (conidial) stage. However, the degree and distribution of genetic diversity observed within and among populations of V. effusa are typical of a sexually reproducing fungal pathogen, and comparable with other dothideomycetes with a known sexual stage, including the closely related apple scab pathogen, V. inaequalis. Using the mating type (MAT) idiomorphs from V. inaequalis, we identified a single MAT gene, MAT1-1-1, in a draft genome of V. effusa. The MAT1-1-1 locus is flanked by two conserved genes encoding a DNA lyase (APN2) and a hypothetical protein. The MAT locus spanning the flanking genes was amplified and sequenced from a subset of 14 isolates, of which 7 contained MAT1-1-1 and the remaining samples contained MAT1-2-1. A multiplex polymerase chain reaction screen was developed to amplify MAT1-1-1, MAT1-2-1, and a conserved reference gene encoding β-tubulin, and used to screen 784 monoconidial isolates of V. effusa collected from 11 populations of pecan across the southeastern United States. A hierarchical sampling protocol representing region, orchard, and tree allowed for analysis of MAT structure at different spatial scales. Analysis of this collection revealed the frequency of the MAT idiomorphs is in a 1:1 equilibrium of MAT1-1:MAT1-2. The apparent equilibrium of the MAT idiomorphs provides impetus for a renewed effort to search for the sexual stage of V. effusa. [Formula: see text] Copyright © 2018 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

mCAL: A New Approach for Versatile Multiplex Action of Cas9 Using One sgRNA and Loci Flanked by a Programmed Target Sequence.

PubMed

Finnigan, Gregory C; Thorner, Jeremy

2016-07-07

Genome editing exploiting CRISPR/Cas9 has been adopted widely in academia and in the biotechnology industry to manipulate DNA sequences in diverse organisms. Molecular engineering of Cas9 itself and its guide RNA, and the strategies for using them, have increased efficiency, optimized specificity, reduced inappropriate off-target effects, and introduced modifications for performing other functions (transcriptional regulation, high-resolution imaging, protein recruitment, and high-throughput screening). Moreover, Cas9 has the ability to multiplex, i.e., to act at different genomic targets within the same nucleus. Currently, however, introducing concurrent changes at multiple loci involves: (i) identification of appropriate genomic sites, especially the availability of suitable PAM sequences; (ii) the design, construction, and expression of multiple sgRNA directed against those sites; (iii) potential difficulties in altering essential genes; and (iv) lingering concerns about "off-target" effects. We have devised a new approach that circumvents these drawbacks, as we demonstrate here using the yeast Saccharomyces cerevisiae First, any gene(s) of interest are flanked upstream and downstream with a single unique target sequence that does not normally exist in the genome. Thereafter, expression of one sgRNA and cotransformation with appropriate PCR fragments permits concomitant Cas9-mediated alteration of multiple genes (both essential and nonessential). The system we developed also allows for maintenance of the integrated, inducible Cas9-expression cassette or its simultaneous scarless excision. Our scheme-dubbed mCAL for " M: ultiplexing of C: as9 at A: rtificial L: oci"-can be applied to any organism in which the CRISPR/Cas9 methodology is currently being utilized. In principle, it can be applied to install synthetic sequences into the genome, to generate genomic libraries, and to program strains or cell lines so that they can be conveniently (and repeatedly) manipulated at multiple loci with extremely high efficiency. Copyright © 2016 Finnigan and Thorner.

Concurrent Preoperative Presence of Hydronephrosis and Flank Pain Independently Predicts Worse Outcome of Upper Tract Urothelial Carcinoma

PubMed Central

Yeh, Hsin-Chih; Jan, Hau-Chern; Wu, Wen-Jeng; Li, Ching-Chia; Li, Wei-Ming; Ke, Hung-Lung; Huang, Shu-Pin; Liu, Chia-Chu; Lee, Yung-Chin; Yang, Sheau-Fang; Liang, Peir-In; Huang, Chun-Nung

2015-01-01

Objectives To investigate the impact of preoperative hydronephrosis and flank pain on prognosis of patients with upper tract urothelial carcinoma. Methods In total, 472 patients with upper tract urothelial carcinoma managed by radical nephroureterectomy were included from Kaohsiung Medical University Hospital Healthcare System. Clinicopathological data were collected retrospectively for analysis. The significance of hydronephrosis, especially when combined with flank pain, and other relevant factors on overall and cancer-specific survival were evaluated. Results Of the 472 patients, 292 (62%) had preoperative hydronephrosis and 121 (26%) presented with flank pain. Preoperative hydronephrosis was significantly associated with age, hematuria, flank pain, tumor location, and pathological tumor stage. Concurrent presence of hydronephrosis and flank pain was a significant predictor of non-organ-confined disease (multivariate-adjusted hazard ratio = 2.10, P = 0.025). Kaplan-Meier analysis showed significantly poorer overall and cancer-specific survival in patients with preoperative hydronephrosis (P = 0.005 and P = 0.026, respectively) and in patients with flank pain (P < 0.001 and P = 0.001, respectively) than those without. However, only simultaneous hydronephrosis and flank pain independently predicted adverse outcome (hazard ratio = 1.98, P = 0.016 for overall survival and hazard ratio = 1.87, P = 0.036 for and cancer-specific survival, respectively) in multivariate Cox proportional hazards models. In addition, concurrent presence of hydronephrosis and flank pain was also significantly predictive of worse survival in patient with high grade or muscle-invasive disease. Notably, there was no difference in survival between patients with hydronephrosis but devoid of flank pain and those without hydronephrosis. Conclusion Concurrent preoperative presence of hydronephrosis and flank pain predicted non-organ-confined status of upper tract urothelial carcinoma. When accompanied with flank pain, hydronephrosis represented an independent predictor for worse outcome in patients with upper tract urothelial carcinoma. PMID:26469704

The spectrum of persistent volcanic flank instability: A review and proposed framework based on Kīlauea, Piton de la Fournaise, and Etna

USGS Publications Warehouse

Poland, Michael; Peltier, Aline; Bonaforte, Alessandro; Puglisi, Giuseppe

2017-01-01

Persistent motion of the south flank of Kīlauea Volcano, Hawai'i, has been known for several decades, but has only recently been identified at other large basaltic volcanoes—namely Piton de la Fournaise (La Réunion) and Etna (Sicily)—thanks to the advent of space geodetic techniques. Nevertheless, understanding of long-term flank instability is based largely on the example of Kīlauea, despite the large differences in the manifestations and mechanisms of the process when viewed through a comparative lens. For example, the rate of flank motion at Kīlauea is several times that of Etna and Piton de la Fournaise and is accommodated on a slip plane several km deeper than is probably present at the other two volcanoes. Gravitational spreading also appears to be the dominant driving force at Kīlauea, given the long-term steady motion of the volcano's south flank regardless of eruptive/intrusive activity, whereas magmatic activity plays a larger role in flank deformation at Etna and Piton de la Fournaise. Kīlauea and Etna, however, are both characterized by heavily faulted flanks, while Piton de la Fournaise shows little evidence for flank faulting. A helpful means of understanding the spectrum of persistent flank motion at large basaltic edifices may be through a framework defined on one hand by magmatic activity (which encompasses both magma supply and edifice size), and on the other hand by the structural setting of the volcano (especially the characteristics of the subvolcanic basement or subhorizontal intravolcanic weak zones). A volcano's size and magmatic activity will dictate the extent to which gravitational and magmatic forces can drive motion of an unstable flank (and possibly the level of faulting of that flank), while the volcano's structural setting governs whether or not a plane of weakness exists beneath or within the edifice and can facilitate flank slip. Considering persistent flank instability using this conceptual model is an alternative to using a single volcano as a “type example”—especially given that the example is usually Kīlauea, which defines an extreme end of the spectrum—and can provide a basis for understanding why flank motion may or may not exist on other large basaltic volcanoes worldwide.

The spectrum of persistent volcanic flank instability: A review and proposed framework based on Kīlauea, Piton de la Fournaise, and Etna

NASA Astrophysics Data System (ADS)

Poland, Michael P.; Peltier, Aline; Bonforte, Alessandro; Puglisi, Giuseppe

2017-06-01

Persistent motion of the south flank of Kīlauea Volcano, Hawai'i, has been known for several decades, but has only recently been identified at other large basaltic volcanoes-namely Piton de la Fournaise (La Réunion) and Etna (Sicily)-thanks to the advent of space geodetic techniques. Nevertheless, understanding of long-term flank instability is based largely on the example of Kīlauea, despite the large differences in the manifestations and mechanisms of the process when viewed through a comparative lens. For example, the rate of flank motion at Kīlauea is several times that of Etna and Piton de la Fournaise and is accommodated on a slip plane several km deeper than is probably present at the other two volcanoes. Gravitational spreading also appears to be the dominant driving force at Kīlauea, given the long-term steady motion of the volcano's south flank regardless of eruptive/intrusive activity, whereas magmatic activity plays a larger role in flank deformation at Etna and Piton de la Fournaise. Kīlauea and Etna, however, are both characterized by heavily faulted flanks, while Piton de la Fournaise shows little evidence for flank faulting. A helpful means of understanding the spectrum of persistent flank motion at large basaltic edifices may be through a framework defined on one hand by magmatic activity (which encompasses both magma supply and edifice size), and on the other hand by the structural setting of the volcano (especially the characteristics of the subvolcanic basement or subhorizontal intravolcanic weak zones). A volcano's size and magmatic activity will dictate the extent to which gravitational and magmatic forces can drive motion of an unstable flank (and possibly the level of faulting of that flank), while the volcano's structural setting governs whether or not a plane of weakness exists beneath or within the edifice and can facilitate flank slip. Considering persistent flank instability using this conceptual model is an alternative to using a single volcano as a "type example"-especially given that the example is usually Kīlauea, which defines an extreme end of the spectrum-and can provide a basis for understanding why flank motion may or may not exist on other large basaltic volcanoes worldwide.

Using case-control designs for genome-wide screening for associations between genetic markers and disease susceptibility loci.

PubMed

Yang, Q; Khoury, M J; Atkinson, M; Sun, F; Cheng, R; Flanders, W D

1999-01-01

We used a case-control design to scan the genome for any associations between genetic markers and disease susceptibility loci using the first two replicates of the Mycenaean population from the GAW11 (Problem 2) data. Using a case-control approach, we constructed a series of 2-by-3 tables for each allele of every marker on all six chromosomes. Odds ratios (ORs) and 95% confidence intervals (95% CI) were estimated for all alleles of every marker. We selected the one allele for which the estimated OR had the minimum p-value to plot in the graph. Among these selected ORs, we calculated 95% CI for those that had a p-value < or = adjusted alpha level. Significantly high ORs were taken to indicate an association between a marker locus and a suspected disease-susceptibility gene. For the Mycenaean population, the case-control design identified allele number 1 of marker 24 on chromosome 1 to be associated with a disease susceptibility gene, OR = 2.10 (95% CI 1.66-2.62). Our approach failed to show any other significant association between case-control status and genetic markers. Stratified analysis on the environmental risk factor (E1) provided no further evidence of significant association other than allele 1 of marker 24 on chromosome 1. These data indicate the absence of linkage disequilibrium for markers flanking loci A, B, and C. Finally, we examined the effect of gene x environment (G x E) interaction for the identified allele. Our results provided no evidence of G x E interaction, but suggested that the environmental exposure alone was a risk factor for the disease.

Solidago Vigaurea for Prostate Cancer Therapy

DTIC Science & Technology

2011-04-01

Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 ...tumorigenesis using a xenograft model. Human prostate cancer cell line PC3mm which was “labeled” with the luciferase gene was injected into the dorsal flank...with treatment (A) (B) 0 5 10 15 20 25 16 17 18 19 20 21 22 23 24 Control Cacalol Days B od y w ei gh t ( g) Hepatic injury maker  Control

An HLLC Riemann solver for resistive relativistic magnetohydrodynamics

NASA Astrophysics Data System (ADS)

Miranda-Aranguren, S.; Aloy, M. A.; Rembiasz, T.

2018-05-01

We present a new approximate Riemann solver for the augmented system of equations of resistive relativistic magnetohydrodynamics that belongs to the family of Harten-Lax-van Leer contact wave (HLLC) solvers. In HLLC solvers, the solution is approximated by two constant states flanked by two shocks separated by a contact wave. The accuracy of the new approximate solver is calibrated through 1D and 2D test problems.

Promoter characteristics of two cyp19 genes differentially expressed in the brain and ovary of teleost fish.

PubMed

Tchoudakova, A; Kishida, M; Wood, E; Callard, G V

2001-11-01

Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most prominently in retinal ganglion cells (RGC) and axon-like projections to the optic tectum. Expression of a cyp19a/GFP reporter was not detectable up to 72 hpf. Tandem analysis of cyp19a and cyp19b promoters in living zebrafish embryos can be a useful approach for identifying cis-elements and cellular factors involved in the correct tissue-specific, spatial, temporal and estrogen regulated expression of aromatase genes during CNS and gonadal development.

Genome structure drives patterns of gene family evolution in ciliates, a case study using Chilodonella uncinata (Protista, Ciliophora, Phyllopharyngea).

PubMed

Gao, Feng; Song, Weibo; Katz, Laura A

2014-08-01

In most lineages, diversity among gene family members results from gene duplication followed by sequence divergence. Because of the genome rearrangements during the development of somatic nuclei, gene family evolution in ciliates involves more complex processes. Previous work on the ciliate Chilodonella uncinata revealed that macronuclear β-tubulin gene family members are generated by alternative processing, in which germline regions are alternatively used in multiple macronuclear chromosomes. To further study genome evolution in this ciliate, we analyzed its transcriptome and found that (1) alternative processing is extensive among gene families; and (2) such gene families are likely to be C. uncinata specific. We characterized additional macronuclear and micronuclear copies of one candidate alternatively processed gene family-a protein kinase domain containing protein (PKc)-from two C. uncinata strains. Analysis of the PKc sequences reveals that (1) multiple PKc gene family members in the macronucleus share some identical regions flanked by divergent regions; and (2) the shared identical regions are processed from a single micronuclear chromosome. We discuss analogous processes in lineages across the eukaryotic tree of life to provide further insights on the impact of genome structure on gene family evolution in eukaryotes. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

An EAV-HP Insertion in 5′ Flanking Region of SLCO1B3 Causes Blue Eggshell in the Chicken

PubMed Central

Yang, Xiaolin; Li, Guangqi; Zhang, Yuanyuan; Li, Junying; Wang, Xiaotong; Bai, Jirong; Xu, Guiyun; Deng, Xuemei; Yang, Ning; Wu, Changxin

2013-01-01

The genetic determination of eggshell coloration has not been determined in birds. Here we report that the blue eggshell is caused by an EAV-HP insertion that promotes the expression of SLCO1B3 gene in the uterus (shell gland) of the oviduct in chicken. In this study, the genetic map location of the blue eggshell gene was refined by linkage analysis in an F2 chicken population, and four candidate genes within the refined interval were subsequently tested for their expression levels in the shell gland of the uterus from blue-shelled and non-blue-shelled hens. SLCO1B3 gene was found to be the only one expressed in the uterus of blue-shelled hens but not in that of non-blue-shelled hens. Results from a pyrosequencing analysis showed that only the allele of SLCO1B3 from blue-shelled chickens was expressed in the uterus of heterozygous hens (O*LC/O*N). SLCO1B3 gene belongs to the organic anion transporting polypeptide (OATP) family; and the OATPs, functioning as membrane transporters, have been reported for the transportation of amphipathic organic compounds, including bile salt in mammals. We subsequently resequenced the whole genomic region of SLCO1B3 and discovered an EAV-HP insertion in the 5′ flanking region of SLCO1B3. The EAV-HP insertion was found closely associated with blue eggshell phenotype following complete Mendelian segregation. In situ hybridization also demonstrated that the blue eggshell is associated with ectopic expression of SLCO1B3 in shell glands of uterus. Our finding strongly suggests that the EAV-HP insertion is the causative mutation for the blue eggshell phenotype. The insertion was also found in another Chinese blue-shelled breed and an American blue-shelled breed. In addition, we found that the insertion site in the blue-shelled chickens from Araucana is different from that in Chinese breeds, which implied independent integration events in the blue-shelled chickens from the two continents, providing a parallel evolutionary example at the molecular level. PMID:23359636

High-resolution meiotic and physical mapping of the Best`s vitelliform macular dystrophy (VMD2) locus to pericentromeric chromosome 11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weber, B.H.F.; Vogt, G.; Walker, D.

1994-09-01

Vitelliform macular dystrophy, also known as Best`s disease, is a juvenile-onset macular degeneration with autosomal dominant inheritance. It is characterized by well-demarcated accumulation of lipofuscin-like material within and beneath the retinal pigment epithelium (RPE) and classically results in an egg yolk-like appearance of the macula. Typically, carriers of the disease gene show a specific electrophysiological sign which can be detected by electrooculography (EOG). The EOG measures a standing potential between the cornea and the retina which is primarily generated by the RPE. The histopathological findings as well as the EOG abnormalities suggest that Best`s disease is a generalized disorder ofmore » the RPE. The basic biochemical defect is still unknown. As a first step in the positional cloning of the defective gene, the Best`s disease locus was mapped to chromosome 11 between markers at D11S871 and INT2. Subsequently, his region was refined to a 3.7 cM interval flanked by loci D11S903 and PYGM. To further narrow the D11S903-PYGM interval and to obtain an estimate of the physical size of the minimal candidate region, we used a combination of high-resolution PCR hybrid mapping and analysis of recombinant Best`s disease chromosomes. We identified six markers from within the D11S903-PYGM interval that show no recombination with the defective gene in three multigeneration Best`s disease pedigrees. Our hybrid panel localizes these markers on either side of the centromere on chromosome 11. The closest markers flanking the disease gene are at D11S986 in band p12-11.22 and at D11S480 in band q13.2-13.3. Our study demonstrates that the physical size of the Best`s disease region is exceedingly larger than was previously estimated from the genetic data due to the proximity of the defective gene to the centromere of chromosome 11.« less

Gene-centric Association Signals for Lipids and Apolipoproteins Identified via the HumanCVD BeadChip

PubMed Central

Talmud, Philippa J.; Drenos, Fotios; Shah, Sonia; Shah, Tina; Palmen, Jutta; Verzilli, Claudio; Gaunt, Tom R.; Pallas, Jacky; Lovering, Ruth; Li, Kawah; Casas, Juan Pablo; Sofat, Reecha; Kumari, Meena; Rodriguez, Santiago; Johnson, Toby; Newhouse, Stephen J.; Dominiczak, Anna; Samani, Nilesh J.; Caulfield, Mark; Sever, Peter; Stanton, Alice; Shields, Denis C.; Padmanabhan, Sandosh; Melander, Olle; Hastie, Claire; Delles, Christian; Ebrahim, Shah; Marmot, Michael G.; Smith, George Davey; Lawlor, Debbie A.; Munroe, Patricia B.; Day, Ian N.; Kivimaki, Mika; Whittaker, John; Humphries, Steve E.; Hingorani, Aroon D.

2009-01-01

Blood lipids are important cardiovascular disease (CVD) risk factors with both genetic and environmental determinants. The Whitehall II study (n = 5592) was genotyped with the gene-centric HumanCVD BeadChip (Illumina). We identified 195 SNPs in 16 genes/regions associated with 3 major lipid fractions and 2 apolipoprotein components at p < 10−5, with the associations being broadly concordant with prior genome-wide analysis. SNPs associated with LDL cholesterol and apolipoprotein B were located in LDLR, PCSK9, APOB, CELSR2, HMGCR, CETP, the TOMM40-APOE-C1-C2-C4 cluster, and the APOA5-A4-C3-A1 cluster; SNPs associated with HDL cholesterol and apolipoprotein AI were in CETP, LPL, LIPC, APOA5-A4-C3-A1, and ABCA1; and SNPs associated with triglycerides in GCKR, BAZ1B, MLXIPL, LPL, and APOA5-A4-C3-A1. For 48 SNPs in previously unreported loci that were significant at p < 10−4 in Whitehall II, in silico analysis including the British Women's Heart and Health Study, BRIGHT, ASCOT, and NORDIL studies (total n > 12,500) revealed previously unreported associations of SH2B3 (p < 2.2 × 10−6), BMPR2 (p < 2.3 × 10−7), BCL3/PVRL2 (flanking APOE; p < 4.4 × 10−8), and SMARCA4 (flanking LDLR; p < 2.5 × 10−7) with LDL cholesterol. Common alleles in these genes explained 6.1%–14.7% of the variance in the five lipid-related traits, and individuals at opposite tails of the additive allele score exhibited substantial differences in trait levels (e.g., >1 mmol/L in LDL cholesterol [∼1 SD of the trait distribution]). These data suggest that multiple common alleles of small effect can make important contributions to individual differences in blood lipids potentially relevant to the assessment of CVD risk. These genes provide further insights into lipid metabolism and the likely effects of modifying the encoded targets therapeutically. PMID:19913121

A Large Proportion of P. falciparum Isolates in the Amazon Region of Peru Lack pfhrp2 and pfhrp3: Implications for Malaria Rapid Diagnostic Tests

PubMed Central

Gamboa, Dionicia; Ho, Mei-Fong; Bendezu, Jorge; Torres, Katherine; Chiodini, Peter L.; Barnwell, John W.; Incardona, Sandra; Perkins, Mark; Bell, David; McCarthy, James; Cheng, Qin

2010-01-01

Background Malaria rapid diagnostic tests (RDTs) offer significant potential to improve the diagnosis of malaria, and are playing an increasing role in malaria case management, control and elimination. Peru, along with other South American countries, is moving to introduce malaria RDTs as components of malaria control programmes supported by the Global Fund for AIDS, TB and malaria. The selection of the most suitable malaria RDTs is critical to the success of the programmes. Methods Eight of nine microscopy positive P. falciparum samples collected in Iquitos, Peru tested negative or weak positive using HRP2-detecting RDTs. These samples were tested for the presence of pfhrp2 and pfhrp3 and their flanking genes by PCR, as well as the presence of HRP proteins by ELISA. To investigate for geographic extent of HRP-deleted parasites and their temporal occurrence a retrospective study was undertaken on 148 microscopy positive P. falciparum samples collected in different areas of the Amazon region of Peru. Findings Eight of the nine isolates lacked the pfhrp2 and/or pfhrp3 genes and one or both flanking genes, and the absence of HRP was confirmed by ELISA. The retrospective study showed that 61 (41%) and 103 (70%) of the 148 samples lacked the pfhrp2 or pfhrp3 genes respectively, with 32 (21.6%) samples lacking both hrp genes. Conclusions This is the first documentation of P. falciparum field isolates lacking pfhrp2 and/or pfhrp3. The high frequency and wide distribution of different parasites lacking pfhrp2 and/or pfhrp3 in widely dispersed areas in the Peruvian Amazon implies that malaria RDTs targeting HRP2 will fail to detect a high proportion of P. falciparum in malaria-endemic areas of Peru and should not be used. RDTs detecting parasite LDH or aldolase and quality microscopy should be use for malaria diagnosis in this region. There is an urgent need for investigation of the abundance and geographic distribution of these parasites in Peru and neighbouring countries. PMID:20111602

Structure and regulation of KGD1, the structural gene for yeast alpha-ketoglutarate dehydrogenase.

PubMed

Repetto, B; Tzagoloff, A

1989-06-01

Nuclear respiratory-defective mutants of Saccharomyces cerevisiae have been screened for lesions in the mitochondrial alpha-ketoglutarate dehydrogenase complex. Strains assigned to complementation group G70 were ascertained to be deficient in enzyme activity due to mutations in the KGD1 gene coding for the alpha-ketoglutarate dehydrogenase component of the complex. The KGD1 gene has been cloned by transformation of a representative kgd1 mutant, C225/U1, with a recombinant plasmid library of wild-type yeast nuclear DNA. Transformants containing the gene on a multicopy plasmid had three- to four-times-higher alpha-ketoglutarate dehydrogenase activity than did wild-type S. cerevisiae. Substitution of the chromosomal copy of KGD1 with a disrupted allele (kgd1::URA3) induced a deficiency in alpha-ketoglutarate dehydrogenase. The sequence of the cloned region of DNA which complements kgd1 mutants was found to have an open reading frame of 3,042 nucleotides capable of coding for a protein of Mw 114,470. The encoded protein had 38% identical residues with the reported sequence of alpha-ketoglutarate dehydrogenase from Escherichia coli. Two lines of evidence indicated that transcription of KGD1 is catabolite repressed. Higher steady-state levels of KGD1 mRNA were detected in wild-type yeast grown on the nonrepressible sugar galactose than in yeast grown on high glucose. Regulation of KGD1 was also studied by fusing different 5'-flanking regions of KGD1 to the lacZ gene of E. coli and measuring the expression of beta-galactosidase in yeast. Transformants harboring a fusion of 693 nucleotides of the 5'-flanking sequence expressed 10 times more beta-galactosidase activity when grown under derepressed conditions. The response to the carbon source was reduced dramatically when the same lacZ fusion was present in a hap2 or hap3 mutant. The promoter element(s) responsible for the regulated expression of KGD1 has been mapped to the -354 to -143 region. This region contained several putative activation sites with sequences matching the core element proposed to be essential for binding of the HAP2 and HAP3 regulatory proteins.

Tandem duplication within a Neurofibromatosis type I (NFI) gene exon in a family with features of Watson syndrome and Noonan syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tassabehji, M.; Strachan, T.; Colley, A.

Type 1 neurofibromatosis (NF1), Watson syndrome (WS), and Noonan syndrome (NS) show some overlap in clinical manifestations. In addition, WS has been shown to be linked to markers flanking the NF1 locus and a deletion at the NF1 locus demonstrated in a WS patient. This suggests either that WS and NF1 are allelic or the phenotypes arise from mutations in very closely linked genes. Here the authors provide evidence for the former by demonstrating a mutation in the NF1 gene in a family with features of both WS and NS. The mutation is an almost perfect in-frame tandem duplication ofmore » 42 bases in exon 28 of the NF1 gene. Unlike the mutations previously described in classical NF1, which show a preponderance of null alleles, the mutation in this family would be expected to result in a mutant neurofibromin product. 31 refs., 2 figs.« less

Marker-Assisted Introgression in Backcross Breeding Programs

PubMed Central

Visscher, P. M.; Haley, C. S.; Thompson, R.

1996-01-01

The efficiency of marker-assisted introgression in backcross populations derived from inbred lines was investigated by simulation. Background genotypes were simulated assuming that a genetic model of many genes of small effects in coupling phase explains the observed breed difference and variance in backcross populations. Markers were efficient in introgression backcross programs for simultaneously introgressing an allele and selecting for the desired genomic background. Using a marker spacing of 10-20 cM gave an advantage of one to two backcross generations selection relative to random or phenotypic selection. When the position of the gene to be introgressed is uncertain, for example because its position was estimated from a trait gene mapping experiment, a chromosome segment should be introgressed that is likely to include the allele of interest. Even for relatively precisely mapped quantitative trait loci, flanking markers or marker haplotypes should cover ~10-20 cM around the estimated position of the gene, to ensure that the allele frequency does not decline in later backcross generations. PMID:8978075

The chloroplast tRNALys(UUU) gene from mustard (Sinapis alba) contains a class II intron potentially coding for a maturase-related polypeptide.

PubMed

Neuhaus, H; Link, G

1987-01-01

The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.

Persons with Quebec platelet disorder have a tandem duplication of PLAU, the urokinase plasminogen activator gene.

PubMed

Paterson, Andrew D; Rommens, Johanna M; Bharaj, Bhupinder; Blavignac, Jessica; Wong, Isidro; Diamandis, Maria; Waye, John S; Rivard, Georges E; Hayward, Catherine P M

2010-02-11

Quebec platelet disorder (QPD) is an autosomal dominant bleeding disorder linked to a region on chromosome 10 that includes PLAU, the urokinase plasminogen activator gene. QPD increases urokinase plasminogen activator mRNA levels, particularly during megakaryocyte differentiation, without altering expression of flanking genes. Because PLAU sequence changes were excluded as the cause of this bleeding disorder, we investigated whether the QPD mutation involved PLAU copy number variation. All 38 subjects with QPD had a direct tandem duplication of a 78-kb genomic segment that includes PLAU. This mutation was specific to QPD as it was not present in any unaffected family members (n = 114), unrelated French Canadians (n = 221), or other persons tested (n = 90). This new information on the genetic mutation will facilitate diagnostic testing for QPD and studies of its pathogenesis and prevalence. QPD is the first bleeding disorder to be associated with a gene duplication event and a PLAU mutation.

Molecular mapping of 21 features associated with partial monosomy 21: Involvement of the APP-SODI region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chettouh, Z.; Maunoury, C.; Sinet, P.M.

1995-07-01

We compared the phenotypes, karyotypes, and molecular data for six cases of partial monosomy 21. Regions of chromosome 21, the deletion of which corresponds to particular features of monosomy 21, were thereby defined. Five such regions were identified for 21 features. Ten of the features could be assigned to the region flanked by genes APP and SOD1: six facial features, transverse palmar crease, arthrogryposis-like symptoms, hypertonia, and contribution to mental retardation. This region, covering the interface of bands 21q21-21q22.1, is 4.7-6.4 Mb long and contains the gene encoding the glutamate receptor subunit GluR5 (GRIK1). 82 refs., 5 figs., 1 tab.

[Detection and prenatal diagnosis for RS1 gene mutations in two Chinese families with X-linked juvenile retinoschisis].

PubMed

Chu, Yan; Fang, Dong; Hou, Qiao-fang; Wang, Li-ya; Guo, Xi-rang; Wang, Ying-tai; Liao, Shi-xiu

2013-04-01

To identify potential mutations of retinoschisis 1 (RS1) gene responsible for X-linked retinoschisis (XLRS) in two Chinese families. The 6 exons and flanking intronic regions were analyzed with PCR and direct sequencing. Two RS1 mutations were identified in the two families, which included 1 frameshift mutation (c.573delG, p.Pro192fs) and 1 missense mutation (c.626G>A, p.Arg209His). Two RS1 mutations have been identified, among which Pro192fs mutation is discovered for the first time in Chinese population. Above results may enrich our understanding of the clinical manifestations of XLRS and facilitated early diagnosis and genetic counseling for the disease.

The insulin and islet amyloid polypeptide genes contain similar cell-specific promoter elements that bind identical beta-cell nuclear complexes.

PubMed Central

German, M S; Moss, L G; Wang, J; Rutter, W J

1992-01-01

The pancreatic beta cell makes several unique gene products, including insulin, islet amyloid polypeptide (IAPP), and beta-cell-specific glucokinase (beta GK). The functions of isolated portions of the insulin, IAPP, and beta GK promoters were studied by using transient expression and DNA binding assays. A short portion (-247 to -197 bp) of the rat insulin I gene, the FF minienhancer, contains three interacting transcriptional regulatory elements. The FF minienhancer binds at least two nuclear complexes with limited tissue distribution. Sequences similar to that of the FF minienhancer are present in the 5' flanking DNA of the human IAPP and rat beta GK genes and also the rat insulin II and mouse insulin I and II genes. Similar minienhancer constructs from the insulin and IAPP genes function as cell-specific transcriptional regulatory elements and compete for binding of the same nuclear factors, while the beta GK construct competes for protein binding but functions poorly as a minienhancer. These observations suggest that the patterns of expression of the beta-cell-specific genes result in part from sharing the same transcriptional regulators. Images PMID:1549125

Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

PubMed

Spielmann, A; Stutz, E

1983-10-25

The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.

Molecular cloning and characterization of a gene encoding glutaminase from Aspergillus oryzae.

PubMed

Koibuchi, K; Nagasaki, H; Yuasa, A; Kataoka, J; Kitamoto, K

2000-07-01

A glutaminase from Aspergillus oryzae was purified and its molecular weight was determined to be 82,091 by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Purified glutaminase catalysed the hydrolysis not only of L-glutamine but also of D-glutamine. Both the molecular weight and the substrate specificity of this glutaminase were different from those reported previously [Yano et al. (1998) J Ferment Technol 66: 137-143]. On the basis of its internal amino acid sequences, we have isolated and characterized the glutaminase gene (gtaA) from A. oryzae. The gtaA gene had an open reading frame coding for 690 amino acid residues, including a signal peptide of 20 amino acid residues and a mature protein of 670 amino acid residues. In the 5'-flanking region of the gene, there were three putative CreAp binding sequences and one putative AreAp binding sequence. The gtaA structural gene was introduced into A. oryzae NS4 and a marked increase in activity was detected in comparison with the control strain. The gtaA gene was also isolated from Aspergillus nidulans on the basis of the determined nucleotide sequence of the gtaA gene from A. oryzae.

Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07.

PubMed

Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting

2016-02-25

Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis.

Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07

PubMed Central

Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting

2016-01-01

Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis. PMID:26911736

Gene organization and alternative splicing of human prohormone convertase PC8.

PubMed Central

Goodge, K A; Thomas, R J; Martin, T J; Gillespie, M T

1998-01-01

The mammalian Ca2+-dependent serine protease prohormone convertase PC8 is expressed ubiquitously, being transcribed as 3.5, 4.3 and 6.0 kb mRNA isoforms in various tissues. To determine the origin of these various mRNA isoforms we report the characterization of the human PC8 gene, which has been previously localized to chromosome 11q23-24. Consisting of 16 exons, the human PC8 gene spans approx. 27 kb. A comparison of the position of intron-exon junctions of the human PC8 gene with the gene structures of previously reported prohormone convertase genes demonstrated a divergence of the human PC8 from the highly conserved nature of the gene organization of this enzyme family. The nucleotide sequence of the 5'-flanking region of the human PC8 is reported and possesses putative promoter elements characteristic of a GC-rich promoter. Further supporting the potential role of a GC-rich promoter element, multiple transcriptional initiation sites within a 200 bp region were demonstrated. We propose that the various mRNA isoforms of PC8 result from the inclusion of intronic sequences within transcripts. PMID:9820811

Identification and Analysis of the Biosynthetic Gene Cluster Encoding the Thiopeptide Antibiotic Cyclothiazomycin in Streptomyces hygroscopicus 10-22▿ †

PubMed Central

Wang, Jiang; Yu, Yi; Tang, Kexuan; Liu, Wen; He, Xinyi; Huang, Xi; Deng, Zixin

2010-01-01

Thiopeptide antibiotics are an important class of natural products resulting from posttranslational modifications of ribosomally synthesized peptides. Cyclothiazomycin is a typical thiopeptide antibiotic that has a unique bridged macrocyclic structure derived from an 18-amino-acid structural peptide. Here we reported cloning, sequencing, and heterologous expression of the cyclothiazomycin biosynthetic gene cluster from Streptomyces hygroscopicus 10-22. Remarkably, successful heterologous expression of a 22.7-kb gene cluster in Streptomyces lividans 1326 suggested that there is a minimum set of 15 open reading frames that includes all of the functional genes required for cyclothiazomycin production. Six genes of these genes, cltBCDEFG flanking the structural gene cltA, were predicted to encode the enzymes required for the main framework of cyclothiazomycin, and two enzymes encoded by a putative operon, cltMN, were hypothesized to participate in the tailoring step to generate the tertiary thioether, leading to the final cyclization of the bridged macrocyclic structure. This rigorous bioinformatics analysis based on heterologous expression of cyclothiazomycin resulted in an ideal biosynthetic model for us to understand the biosynthesis of thiopeptides. PMID:20154110

Active and Repressive Chromatin Are Interspersed without Spreading in an Imprinted Gene Cluster in the Mammalian Genome

PubMed Central

Regha, Kakkad; Sloane, Mathew A.; Huang, Ru; Pauler, Florian M.; Warczok, Katarzyna E.; Melikant, Balázs; Radolf, Martin; Martens, Joost H.A.; Schotta, Gunnar; Jenuwein, Thomas; Barlow, Denise P.

2010-01-01

SUMMARY The Igf2r imprinted cluster is an epigenetic silencing model in which expression of a ncRNA silences multiple genes in cis. Here, we map a 250 kb region in mouse embryonic fibroblast cells to show that histone modifications associated with expressed and silent genes are mutually exclusive and localized to discrete regions. Expressed genes were modified at promoter regions by H3K4me3 + H3K4me2 + H3K9Ac and on putative regulatory elements flanking active promoters by H3K4me2 + H3K9Ac. Silent genes showed two types of nonoverlapping profile. One type spread over large domains of tissue-specific silent genes and contained H3K27me3 alone. A second type formed localized foci on silent imprinted gene promoters and a nonexpressed pseudogene and contained H3K9me3 + H4K20me3 ± HP1. Thus, mammalian chromosome arms contain active chromatin interspersed with repressive chromatin resembling the type of heterochromatin previously considered a feature of centromeres, telomeres, and the inactive X chromosome. PMID:17679087

Identification and characterization of the gltK gene encoding a membrane-associated glucose transport protein of pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

2000-08-08

The Pseudomonas aeruginosa oprB gene encodes the carbohydrate-selective OprB porin, which translocates substrate molecules across the outer membrane to the periplasmic glucose-binding protein. We identified and cloned two open reading frames (ORFs) flanking the oprB gene but are not in operonic arrangement with the oprB gene. The downstream ORF encodes a putative polypeptide homologous to members of a family of transcriptional repressors, whereas the oprB gene is preceded by an ORF encoding a putative product, which exhibits strong homology to several carbohydrate transport ATP-binding cassette (ABC) proteins. The genomic copy of the upstream ORF was mutagenized by homologous recombination. Analysis of the deletion mutant in comparison with the wild type revealed a significant reduction in [14C] glucose transport activity in the mutant strain, suggesting that this ORF likely encodes the inner membrane component of the glucose ABC transporter. It is thus designated gltK gene to reflect its homology to the Pseudomona fluorescens mtlK and its involvement in the high-affinity glucose transport system. Multiple alignment analysis revealed that the P. aeruginosa gltK gene product is a member of the MalK subfamily of ABC proteins.

Organization, chromosomal localization and promoter analysis of the gene encoding human acidic fibroblast growth factor intracellular binding protein.

PubMed Central

Kolpakova, E; Frengen, E; Stokke, T; Olsnes, S

2000-01-01

Acidic fibroblast growth factor (aFGF) intracellular binding protein (FIBP) is a protein found mainly in the nucleus that might be involved in the intracellular function of aFGF. Here we present a comparative analysis of the deduced amino acid sequences of human, murine and Drosophila FIBP analogues and demonstrate that FIBP is an evolutionarily conserved protein. The human gene spans more than 5 kb, comprising ten exons and nine introns, and maps to chromosome 11q13.1. Two slightly different splice variants found in different tissues were isolated and characterized. Sequence analysis of the region surrounding the translation start revealed a CpG island, a classical feature of widely expressed genes. Functional studies of the promoter region with a luciferase reporter system suggested a strong transcriptional activity residing within 600 bp of the 5' flanking region. PMID:11104667

[Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

PubMed

Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

2015-05-01

The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

Biparental inheritance of organelles in Pelargonium: evidence for intergenomic recombination of mitochondrial DNA.

PubMed

Apitz, Janina; Weihe, Andreas; Pohlheim, Frank; Börner, Thomas

2013-02-01

While uniparental transmission of mtDNA is widespread and dominating in eukaryotes leaving mutation as the major source of genotypic diversity, recently, biparental inheritance of mitochondrial genes has been demonstrated in reciprocal crosses of Pelargonium zonale and P. inquinans. The thereby arising heteroplasmy carries the potential for recombination between mtDNAs of different descent, i.e. between the parental mitochondrial genomes. We have analyzed these Pelargonium hybrids for mitochondrial intergenomic recombination events by examining differences in DNA blot hybridization patterns of the mitochondrial genes atp1 and cob. Further investigation of these genes and their flanking regions using nucleotide sequence polymorphisms and PCR revealed DNA segments in the progeny, which contained both P. zonale and P. inquinans sequences suggesting an intergenomic recombination in hybrids of Pelargonium. This turns Pelargonium into an interesting subject for studies of recombination and evolutionary dynamics of mitochondrial genomes.

Transcription forms and remodels supercoiling domains unfolding large-scale chromatin structures

PubMed Central

Naughton, Catherine; Avlonitis, Nicolaos; Corless, Samuel; Prendergast, James G.; Mati, Ioulia K.; Eijk, Paul P.; Cockroft, Scott L.; Bradley, Mark; Ylstra, Bauke; Gilbert, Nick

2013-01-01

DNA supercoiling is an inherent consequence of twisting DNA and is critical for regulating gene expression and DNA replication. However, DNA supercoiling at a genomic scale in human cells is uncharacterized. To map supercoiling we used biotinylated-trimethylpsoralen as a DNA structure probe to show the genome is organized into supercoiling domains. Domains are formed and remodeled by RNA polymerase and topoisomerase activities and are flanked by GC-AT boundaries and CTCF binding sites. Under-wound domains are transcriptionally active, enriched in topoisomerase I, “open” chromatin fibers and DNaseI sites, but are depleted of topoisomerase II. Furthermore DNA supercoiling impacts on additional levels of chromatin compaction as under-wound domains are cytologically decondensed, topologically constrained, and decompacted by transcription of short RNAs. We suggest that supercoiling domains create a topological environment that facilitates gene activation providing an evolutionary purpose for clustering genes along chromosomes. PMID:23416946

Genetic variation of the Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion.

PubMed

Zhang, J R; Norris, S J

1998-08-01

The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5' and 3' coding sequences of vlsE that flank the cassette region are not subject to sequence variation during these recombination events. The segments of the silent vls cassettes recombine in the vlsE cassette region through a unidirectional process such that the sequence and organization of the silent vls loci are not affected. As a result of recombination, the previously expressed segments are replaced by incoming segments and apparently degraded. These results provide evidence for a gene conversion mechanism in VlsE antigenic variation.

Reproductive Organ and Vascular Specific Promoter of the Rice Plasma Membrane Ca2+ATPase Mediates Environmental Stress Responses in Plants

PubMed Central

Huda, Kazi Md. Kamrul; Banu, Mst. Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra

2013-01-01

Background Plasma membrane Ca2+ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca2+) from the cell, hence regulating Ca2+ level within cells. Though plant Ca2+ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. Results The 1478 bp promoter sequence of rice plasma membrane Ca2+ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca2+ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The −1478 to −886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for −1210 and −886 bp flanking region. The −1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The −1210 and −886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the −886 bp and −519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. Conclusions The rice plasma membrane Ca2+ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this promoter could grant wide applicability in plant biotechnology. PMID:23469243

The DNA methylation status alteration of two steroidogenic genes in gonads of rare minnow after bisphenol A exposure.

PubMed

Zhang, Ting; Liu, Yan; Chen, Hong; Gao, Jiancao; Zhang, Yingying; Yuan, Cong; Wang, Zaizhao

2017-08-01

Both cytochrome P450c17 (CYP17A1) and P-450 side chain cleavage (CYP11A1) play important roles in steroid biosynthesis. According to our previous studies, bisphenol A (BPA) could regulate the mRNA expression of cyp17a1 and cyp11a1 in rare minnow Gobiocypris rarus. However, the potential mechanism of the regulation is barely understood. In the present study, aiming to explore how BPA affects the mRNA expression of cyp17a1 and cyp11a1 in testes and ovaries of G. rarus, we firstly cloned 340-bp fragment of 5' flanking region of cyp11a1 and then detected the methylation level of CpG loci involved in 5' flanking of cyp11a1 and cyp17a1 and their mRNA expression levels. Results showed that exposure to BPA significantly increased serum estradiol (E2) and 11-ketotesterone (11-KT) concentrations. Ovarian mRNA expression of cyp17a1 and cyp11a1 were significantly decreased after BPA exposure 7- for and 14-days. However, transcriptions of testicular cyp17a1 and cyp11a1 were significantly increased and decreased respectively after BPA treatment for 14days. The DNA methylation levels of cyp17a1 were decreased in ovaries on day 7 and increased in ovaries and decreased in testes respectively on day 14. The methylation levels of cyp11a1 were increased in ovaries on day 7 and both ovaries and testes on day 14. There were a significant correlation between DNA methylation at specific CpG loci and cyp17a1 and cyp11a1 genes transcription levels. In conclusion, the CpG loci methylation in 5' flanking region appears to involve in the regulation of mRNA expression of cyp17a1 and cyp11a1 mediated by BPA. Copyright © 2017 Elsevier Inc. All rights reserved.

A novel non prophage(-like) gene-intervening element within gerE that is reconstituted during sporulation in Bacillus cereus ATCC10987.

PubMed

Abe, Kimihiro; Shimizu, Shin-Ya; Tsuda, Shuhei; Sato, Tsutomu

2017-09-12

Gene rearrangement is a widely-shared phenomenon in spore forming bacteria, in which prophage(-like) elements interrupting sporulation-specific genes are excised from the host genome to reconstitute the intact gene. Here, we report a novel class of gene-intervening elements, named gin, inserted in the 225 bp gerE-coding region of the B. cereus ATCC10987 genome, which generates a sporulation-specific rearrangement. gin has no phage-related genes and possesses three site-specific recombinase genes; girA, girB, and girC. We demonstrated that the gerE rearrangement occurs at the middle stage of sporulation, in which site-specific DNA recombination took place within the 9 bp consensus sequence flanking the disrupted gerE segments. Deletion analysis of gin uncovered that GirC and an additional factor, GirX, are responsible for gerE reconstitution. Involvement of GirC and GirX in DNA recombination was confirmed by an in vitro recombination assay. These results broaden the definition of the sporulation-specific gene rearrangement phenomenon: gene-intervening elements are not limited to phage DNA but may include non-viral genetic elements that carry a developmentally-regulated site-specific recombination system.

QTL mapping of fruit mineral contents provides new chances for molecular breeding of tomato nutritional traits.

PubMed

Capel, Carmen; Yuste-Lisbona, Fernando J; López-Casado, Gloria; Angosto, Trinidad; Heredia, Antonio; Cuartero, Jesús; Fernández-Muñoz, Rafael; Lozano, Rafael; Capel, Juan

2017-05-01

Agronomical characterization of a RIL population for fruit mineral contents allowed for the identification of QTL controlling these fruit quality traits, flanked by co-dominant markers useful for marker-assisted breeding. Tomato quality is a multi-variant attribute directly depending on fruit chemical composition, which in turn determines the benefits of tomato consumption for human health. Commercially available tomato varieties possess limited variability in fruit quality traits. Wild species, such as Solanum pimpinellifolium, could provide different nutritional advantages and can be used for tomato breeding to improve overall fruit quality. Determining the genetic basis of the inheritance of all the traits that contribute to tomato fruit quality will increase the efficiency of the breeding program necessary to take advantage of the wild species variability. A high-density linkage map has been constructed from a recombinant inbred line (RIL) population derived from a cross between tomato Solanum lycopersicum and the wild-relative species S. pimpinellifolium. The RIL population was evaluated for fruit mineral contents during three consecutive growing seasons. The data obtained allowed for the identification of main QTL and novel epistatic interaction among QTL controlling fruit mineral contents on the basis of a multiple-environment analysis. Most of the QTL were flanked by candidate genes providing valuable information for both tomato breeding for new varieties with novel nutritional properties and the starting point to identify the genes underlying these QTL, which will help to reveal the genetic basis of tomato fruit nutritional properties.

Internal control regions for transcription of eukaryotic tRNA genes.

PubMed Central

Sharp, S; DeFranco, D; Dingermann, T; Farrell, P; Söll, D

1981-01-01

We have identified the region within a eukaryotic tRNA gene required for initiation of transcription. These results were obtained by systematically constructing deletions extending from the 5' or the 3' flanking regions into a cloned Drosophila tRNAArg gene by using nuclease BAL 31. The ability of the newly generated deletion clones to direct the in vitro synthesis of tRNA precursors was measured in transcription systems from Xenopus laevis oocytes, Drosophila Kc cells, and HeLa cells. Two control regions within the coding sequence were identified. The first was essential for transcription and was contained between nucleotides 8 and 25 of the mature tRNA sequence. Genes devoid of the second control region, which was contained between nucleotides 50 and 58 of the mature tRNA sequence, could be transcribed but with reduced efficiency. Thus, the promoter regions within a tRNA gene encode the tRNA sequences of the D stem and D loop, the invariant uridine at position 8, and the semi-invariant G-T-psi-C sequence. Images PMID:6947245

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

Functional Analysis of the Gene Cluster Involved in Production of the Bacteriocin Circularin A by Clostridium beijerinckii ATCC 25752

PubMed Central

Kemperman, Robèr; Jonker, Marnix; Nauta, Arjen; Kuipers, Oscar P.; Kok, Jan

2003-01-01

A region of 12 kb flanking the structural gene of the cyclic antibacterial peptide circularin A of Clostridium beijerinckii ATCC 25752 was sequenced, and the putative proteins involved in the production and secretion of circularin A were identified. The genes are tightly organized in overlapping open reading frames. Heterologous expression of circularin A in Enterococcus faecalis was achieved, and five genes were identified as minimally required for bacteriocin production and secretion. Two of the putative proteins, CirB and CirC, are predicted to contain membrane-spanning domains, while CirD contains a highly conserved ATP-binding domain. Together with CirB and CirC, this ATP-binding protein is involved in the production of circularin A. The fifth gene, cirE, confers immunity towards circularin A when expressed in either Lactococcus lactis or E. faecalis and is needed in order to allow the bacteria to produce bacteriocin. Additional resistance against circularin A is conferred by the activity of the putative transporter consisting of CirB and CirD. PMID:14532033

A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

PubMed

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

PubMed Central

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

Scintigraphic detection of occult hemorrhage using RBCs labeled in vitro with technetium Tc 99m sodium pertechnetate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bunker, S.R.; Kolina, J.S.; Kaplan, K.A.

1983-05-01

Scintigraphy with RBCs labeled with technetium Tc 99m sodium pertechnetate effectively located the source of hemorrhage in a patient receiving long-term anticoagulant therapy. (The patient was initially seen with a large hematoma on the flank.) More important, the procedure was used to monitor activity in this otherwise-occult bleeding site. Scintigraphic studies may be useful in the management of these difficult clinical problems.

Structural and transcription analysis of two homologous genes for the P700 chlorophyll a-apoproteins in Chlamydomonas reinhardii: evidence for in vivo trans-splicing

PubMed Central

Kück, Ulrich; Choquet, Yves; Schneider, Michel; Dron, Michel; Bennoun, Pierre

1987-01-01

The two homologous genes for the P700 chlorophyll a-apoproteins (ps1A1 and ps1A2) are encoded by the plastom in the green alga Chlamydomonas reinhardii. The structure and organization of the two genes were determined by comparison with the homologous genes from maize using data from heterologous hybridizations as well as from DNA and RNA sequencing. While the ps1A2 (736 codons) gene shows a continuous gene organization, the ps1A1 (754 codons) gene possesses some unusual features. The discontinuous gene is split into three separate exons which are scattered around the circular chloroplast genome. Exon 1 (86 bp) is separated by ∼50 kb from exon 2 (198 bp), which is located ∼ 90 kb apart from exon 3 (1984 bp). All exons are flanked by intronic sequences of group II. Transcription analysis reveals that the ps1A2 gene hybridizes with a 2.8-kb transcript, while all exon regions of the ps1A1 gene are homologous to a mature mRNA of 2.7 kb. From our data we conclude that the three distantly separated exonic sequences of the ps1A1 gene constitute a functional gene which probably operates by a trans-splicing mechanism. ImagesFig. 3.Fig. 5.Fig. 6. PMID:16453785

Assessment of Postoperative Pain in Cats After Ovariectomy by Laparoscopy, Median Celiotomy, or Flank Laparotomy.

PubMed

Gauthier, Olivier; Holopherne-Doran, Delphine; Gendarme, Thalia; Chebroux, Alexandre; Thorin, Chantal; Tainturier, Daniel; Bencharif, Djemil

2015-07-01

To compare postoperative pain, duration of surgery, and duration of anesthesia for 3 methods of ovariectomy in cats: (1) conventional ventral median open approach (Midline), (2) right flank approach (Flank), and (3) median 2-portal laparoscopic procedure (Lap). Randomized, prospective clinical trial. Healthy, sexually intact female cats (n = 60). Cats were randomly assigned to 1 of 3 groups: Midline (n = 20), Flank (20), and Lap (20) were evaluated 1, 2, 4, 6, and 12 hours after endotracheal extubation. Postoperative pain was scored using the 4A-vet pain scale that combines a subjective numerical pain rating and objective scoring of physiologic and behavioral variables including the response to stimulation of the surgical site. Pain scores (PS) were compared between groups. There was a significant difference in the PS between groups. PS for Midline and Flank were not significantly different but were both significantly higher compared with Lap. Depending on time, 5-20% of the cats had intense postoperative pain in both Midline and Flank groups. None of the Lap cats had intense postoperative pain. Laparoscopic ovariectomy, although slower, appeared less painful compared with conventional ventral midline and flank ovariectomy. Postoperative pain did not differ significantly between midline and flank groups. © Copyright 2014 by The American College of Veterinary Surgeons.

The effect of giant flank collapses on magma pathways and location of volcanic vents

NASA Astrophysics Data System (ADS)

Maccaferri, Francesco; Richter, Nicole; Walter, Thomas

2017-04-01

Flank collapses have been identified at tall volcanoes and ocean islands worldwide. They are recurrent processes, significantly contributing to the morphological and structural evolution of volcanic edifices, and they often occur in interaction with magmatic activity. Moreover, it has been observed that the intrusion pathways and eruption's sites often differ before and after flank collapses. While it is understood that dyke intrusions might destabilise a volcano flank, and a moving flank might create the space needed for further intrusions, the effect of collapses on the magma pathways has been rarely addressed. Here we use a boundary element model for dyke propagation to study the effect of the stress redistribution due to a flank collapse on the location of eruptive vents. We use our model to simulate the path of magmatic intrusion after the collapse of the eastern flank of Fogo Volcano, Cabe Verde. We find that the competition between loading stress due to the volcanic edifice and unloading due to the collapse of a flank favours magmatic activity to cluster within the collapse scar, displaced with respect to the pre-collapse volcanic centre. Our results are compared with geomorphological observations at Fogo Island and are discussed in the general context of the long-term evolution intraplate volcanic ocean islands worldwide.

Rapid deformation of the South flank of kilauea volcano, hawaii.

PubMed

Owen, S; Segall, P; Freymueller, J; Mikijus, A; Denlinger, R; Arnadóttir, T; Sako, M; Bürgmann, R

1995-03-03

The south flank of Kilauea volcano has experienced two large [magnitude (M) 7.2 and M 6.1] earthquakes in the past two decades. Global Positioning System measurements conducted between 1990 and 1993 reveal seaward displacements of Kilauea's central south flank at rates of up to about 10 centimeters per year. In contrast, the northern side of the volcano and the distal ends of the south flank did not displace significantly. The observations can be explained by slip on a low-angle fault beneath the south flank combined with dilation deep within Kilauea's rift system, both at rates of at least 15 centimeters per year.

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus).

PubMed

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from 'Arka Manik' × 'TS34' and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits.

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus)

PubMed Central

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from ‘Arka Manik’ × ‘TS34’ and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits. PMID:26700647

Linkage analysis and physical mapping near the gene for x-linked agammaglobulinemia at Xq22

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parolini, O.; Lassiter, G.L.; Henry, M.J.

The gene for x-linked agammaglobulinemia (XLA) has been mapped to Xq22. No recombinations have been reported between the gene and the prob p212 at DXS178; however, this probe is informative in only 30-40% of women and the reported flanking markers, DXS3 and DXS94, and 10-15 cM apart. To identify additional probes that might be useful in genetic counseling, we examined 11 polymorphisms that have been mapped to the Xq21.3-q22 region in 13 families with XLA. In addition, pulsed-field gel electrophoresis and yeast artificial chromosomes (YACs) were used to further characterize the segman of DNA within which the gene for SLAmore » must lie. The results demonstrated that DXS366 and DXS442, which share a 430-kb pulsed-field fragment, could replace DXS3 as proximal flanking markers. Probes at DXS178 and DXS265 identified the same 145-kb pulsed-field fragment, and both loci were contained within a 200-kb YAC identified with the probe p212. A highly polymorphic CA repeat (DCS178CA) was isolated from one end of this YAC and used in linkage analysis. Probes at DXS101 and DXS328 shared several pulsed-field fragments, the smallest of which was 250 kb. No recombinations were seen between XLA and the DXS178-DXS265-DXS178CA complex, DXS101, DXS328, DXS87, or the gene for proteolipid protein (PLP). Key crossovers, when combined with the linkage data from families with Alport syndrome, suggested the following order of loci: cen-DXS3-DXS366-DXS442-(PLP, DXS101, DXS328, DXS178-DXS265-DXS178CA complex, XL)-(DXS87, DXS94)-DXS327-(DXS350, DXS362)-tel. Our studies also limit the segment of DNA within which the XLA gene must lie to the 3- to 4-cM distance between DCS442 and DXS94 and they identify and orient polymorphisms that can be used in genetic counseling not only for XLA but also for Pelizaeus-Merzbacher disease (PLP deficiency), Alport syndrome (COL4A5 deficiency), and Fabry disease ([alpha]-galactosidase A difficiency). 31 refs., 5 figs., 2 tabs.« less

Polymorphism of BMP4 gene in Indian goat breeds differing in prolificacy.

PubMed

Sharma, Rekha; Ahlawat, Sonika; Maitra, A; Roy, Manoranjan; Mandakmale, S; Tantia, M S

2013-12-10

Bone morphogenetic proteins (BMPs) are members of the TGF-β (transforming growth factor-beta) superfamily, of which BMP4 is the most important due to its crucial role in follicular growth and differentiation, cumulus expansion and ovulation. Reproduction is a crucial trait in goat breeding and based on the important role of BMP4 gene in reproduction it was considered as a possible candidate gene for the prolificacy of goats. The objective of the present study was to detect polymorphism in intronic, exonic and 3' un-translated regions of BMP4 gene in Indian goats. Nine different goat breeds (Barbari, Beetal, Black Bengal, Malabari, Jakhrana (Twinning>40%), Osmanabadi, Sangamneri (Twinning 20-30%), Sirohi and Ganjam (Twinning<10%)) differing in prolificacy and geographic distribution were employed for polymorphism scanning. Cattle sequence (AC_000167.1) was used to design primers for the amplification of a targeted region followed by direct DNA sequencing to identify the genetic variations. Single nucleotide polymorphisms (SNPs) were not detected in exon 3, the intronic region and the 3' flanking region. A SNP (G1534A) was identified in exon 2. It was a non-synonymous mutation resulting in an arginine to lysine change in a corresponding protein sequence. G to A transition at the 1534 locus revealed two genotypes GG and GA in the nine investigated goat breeds. The GG genotype was predominant with a genotype frequency of 0.98. The GA genotype was present in the Black Bengal as well as Jakhrana breed with a genotype frequency of 0.02. A microsatellite was identified in the 3' flanking region, only 20 nucleotides downstream from the termination site of the coding region, as a short sequence with more than nineteen continuous and repeated CA dinucleotides. Since the gene is highly evolutionarily conserved, identification of a non-synonymous SNP (G1534A) in the coding region gains further importance. To our knowledge, this is the first report of a mutation in the coding region of the caprine BMP4 gene. But whether the reproduction trait of goat is associated with the BMP4 polymorphism, needs to be further defined by association studies in more populations so as to delineate an effect on it. © 2013 Elsevier B.V. All rights reserved.

Flank wears Simulation by using back propagation neural network when cutting hardened H-13 steel in CNC End Milling

NASA Astrophysics Data System (ADS)

Hazza, Muataz Hazza F. Al; Adesta, Erry Y. T.; Riza, Muhammad

2013-12-01

High speed milling has many advantages such as higher removal rate and high productivity. However, higher cutting speed increase the flank wear rate and thus reducing the cutting tool life. Therefore estimating and predicting the flank wear length in early stages reduces the risk of unaccepted tooling cost. This research presents a neural network model for predicting and simulating the flank wear in the CNC end milling process. A set of sparse experimental data for finish end milling on AISI H13 at hardness of 48 HRC have been conducted to measure the flank wear length. Then the measured data have been used to train the developed neural network model. Artificial neural network (ANN) was applied to predict the flank wear length. The neural network contains twenty hidden layer with feed forward back propagation hierarchical. The neural network has been designed with MATLAB Neural Network Toolbox. The results show a high correlation between the predicted and the observed flank wear which indicates the validity of the models.

Suppression subtractive hybridization identifies an autotransporter adhesin gene of E. coli IMT5155 specifically associated with avian pathogenic Escherichia coli (APEC).

PubMed

Dai, Jianjun; Wang, Shaohui; Guerlebeck, Doreen; Laturnus, Claudia; Guenther, Sebastian; Shi, Zhenyu; Lu, Chengping; Ewers, Christa

2010-09-09

Extraintestinal pathogenic E. coli (ExPEC) represent a phylogenetically diverse group of bacteria which are implicated in a large range of infections in humans and animals. Although subgroups of different ExPEC pathotypes, including uropathogenic, newborn meningitis causing, and avian pathogenic E. coli (APEC) share a number of virulence features, there still might be factors specifically contributing to the pathogenesis of a certain subset of strains or a distinct pathotype. Thus, we made use of suppression subtractive hybridization and compared APEC strain IMT5155 (O2:K1:H5; sequence type complex 95) with human uropathogenic E. coli strain CFT073 (O6:K2:H5; sequence type complex 73) to identify factors which may complete the currently existing model of APEC pathogenicity and further elucidate the position of this avian pathotype within the whole ExPEC group. Twenty-eight different genomic loci were identified, which are present in IMT5155 but not in CFT073. One of these loci contained a gene encoding a putative autotransporter adhesin. The open reading frame of the gene spans a 3,498 bp region leading to a putative 124-kDa adhesive protein. A specific antibody was raised against this protein and expression of the adhesin was shown under laboratory conditions. Adherence and adherence inhibition assays demonstrated a role for the corresponding protein in adhesion to DF-1 chicken fibroblasts. Sequence analyses revealed that the flanking regions of the chromosomally located gene contained sequences of mobile genetic elements, indicating a probable spread among different strains by horizontal gene transfer. In accordance with this hypothesis, the adhesin was found to be present not only in different phylogenetic groups of extraintestinal pathogenic but also of commensal E. coli strains, yielding a significant association with strains of avian origin. We identified a chromosomally located autotransporter gene in a highly virulent APEC strain which confers increased adherence of a non-fimbriated E. coli K-12 strain to a chicken fibroblast cell line. Even though flanked by mobile genetic elements and three different genetic regions upstream of the gene, most probably indicating horizontal gene transfer events, the adhesin gene was significantly linked with strains of avian origin. Due to the nucleotide sequence similarity of 98% to a recently published adhesin-related gene, located on plasmid pAPEC-O1-ColBM, the name aatA (APEC autotransporter adhesin A) was adopted from that study.Our data substantiate that AatA might not only be of relevance in APEC pathogenicity but also in facilitating their reservoir life style in the chicken intestine, which might pave the way for future intestinal preventive strategies.

[Exon-intron structure of the fet5+ gene of Schizosaccharomyces pombe and physical mapping of genome encompassing regions].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N

1998-01-01

Plasmid pYUK3 bearing the fet5+ gene of Schizosaccharomyces pombe was isolated from a genomic library of the fission yeast, and a detailed physical map of the whole genomic insert (ca. 9.6 Kbp) was constructed. The primary structure of the fet5+ gene and its flanking regions is established. The gene contains a single 45-bp intron in its distal part. A typical TATA-box (TATAAG) was found in the 5'-noncoding region ca. 50 bp upstream of the putative start of transcription, and the 3'-noncoding region contains AT-rich palindromes, which are probably involved in termination of the fet5+ transcription. A previously unidentified gene of Sz. pombe encoding a protein with some similarity to one of the transcriptional activators from the TBP (TATA-binding protein) group of SPT factors of transcription was found in the vicinity of the fet5+ gene. Taking into account that cDNA of the fet5(+)-gene was isolated as a suppressor of the genetic-defect of nuclear RNA polymerases I-III (Bioorg. Khim., 1997, vol. 23, No 3, pp. 234-237), this vicinity may be the first evidence of possible clustering, in the genome of the fission yeast, of genes participating in transcription regulation.

Heterochromatin influences the secondary metabolite profile in the plant pathogen Fusarium graminearum

PubMed Central

Reyes-Dominguez, Yazmid; Boedi, Stefan; Sulyok, Michael; Wiesenberger, Gerlinde; Stoppacher, Norbert; Krska, Rudolf; Strauss, Joseph

2012-01-01

Chromatin modifications and heterochromatic marks have been shown to be involved in the regulation of secondary metabolism gene clusters in the fungal model system Aspergillus nidulans. We examine here the role of HEP1, the heterochromatin protein homolog of Fusarium graminearum, for the production of secondary metabolites. Deletion of Hep1 in a PH-1 background strongly influences expression of genes required for the production of aurofusarin and the main tricothecene metabolite DON. In the Hep1 deletion strains AUR genes are highly up-regulated and aurofusarin production is greatly enhanced suggesting a repressive role for heterochromatin on gene expression of this cluster. Unexpectedly, gene expression and metabolites are lower for the trichothecene cluster suggesting a positive function of Hep1 for DON biosynthesis. However, analysis of histone modifications in chromatin of AUR and DON gene promoters reveals that in both gene clusters the H3K9me3 heterochromatic mark is strongly reduced in the Hep1 deletion strain. This, and the finding that a DON-cluster flanking gene is up-regulated, suggests that the DON biosynthetic cluster is repressed by HEP1 directly and indirectly. Results from this study point to a conserved mode of secondary metabolite (SM) biosynthesis regulation in fungi by chromatin modifications and the formation of facultative heterochromatin. PMID:22100541

Complete Genome Sequence and Comparative Analysis of the Fish Pathogen Lactococcus garvieae

PubMed Central

Oshima, Kenshiro; Yoshizaki, Mariko; Kawanishi, Michiko; Nakaya, Kohei; Suzuki, Takehito; Miyauchi, Eiji; Ishii, Yasuo; Tanabe, Soichi; Murakami, Masaru; Hattori, Masahira

2011-01-01

Lactococcus garvieae causes fatal haemorrhagic septicaemia in fish such as yellowtail. The comparative analysis of genomes of a virulent strain Lg2 and a non-virulent strain ATCC 49156 of L. garvieae revealed that the two strains shared a high degree of sequence identity, but Lg2 had a 16.5-kb capsule gene cluster that is absent in ATCC 49156. The capsule gene cluster was composed of 15 genes, of which eight genes are highly conserved with those in exopolysaccharide biosynthesis gene cluster often found in Lactococcus lactis strains. Sequence analysis of the capsule gene cluster in the less virulent strain L. garvieae Lg2-S, Lg2-derived strain, showed that two conserved genes were disrupted by a single base pair deletion, respectively. These results strongly suggest that the capsule is crucial for virulence of Lg2. The capsule gene cluster of Lg2 may be a genomic island from several features such as the presence of insertion sequences flanked on both ends, different GC content from the chromosomal average, integration into the locus syntenic to other lactococcal genome sequences, and distribution in human gut microbiomes. The analysis also predicted other potential virulence factors such as haemolysin. The present study provides new insights into understanding of the virulence mechanisms of L. garvieae in fish. PMID:21829716

Effects of a petunia scaffold/matrix attachment region on copy number dependency and stability of transgene expression in Nicotiana tabacum.

PubMed

Dietz-Pfeilstetter, Antje; Arndt, Nicola; Manske, Ulrike

2016-04-01

Transgenes in genetically modified plants are often not reliably expressed during development or in subsequent generations. Transcriptional gene silencing (TGS) as well as post-transcriptional gene silencing (PTGS) have been shown to occur in transgenic plants depending on integration pattern, copy number and integration site. In an effort to reduce position effects, to prevent read-through transcription and to provide a more accessible chromatin structure, a P35S-ß-glucuronidase (P35S-gus) transgene flanked by a scaffold/matrix attachment region from petunia (Petun-SAR), was introduced in Nicotiana tabacum plants by Agrobacterium tumefaciens mediated transformation. It was found that Petun-SAR mediates enhanced expression and copy number dependency up to 2 gene copies, but did not prevent gene silencing in transformants with multiple and rearranged gene copies. However, in contrast to the non-SAR transformants where silencing was irreversible and proceeded during long-term vegetative propagation and in progeny plants, gus expression in Petun-SAR plants was re-established in the course of development. Gene silencing was not necessarily accompanied by DNA methylation, while the gus transgene could still be expressed despite considerable CG methylation within the coding region.

Ancient Origin of the U2 Small Nuclear RNA Gene-Targeting Non-LTR Retrotransposons Utopia

PubMed Central

Kojima, Kenji K.

2015-01-01

Most non-long terminal repeat (non-LTR) retrotransposons encoding a restriction-like endonuclease show target-specific integration into repetitive sequences such as ribosomal RNA genes and microsatellites. However, only a few target-specific lineages of non-LTR retrotransposons are distributed widely and no lineage is found across the eukaryotic kingdoms. Here we report the most widely distributed lineage of target sequence-specific non-LTR retrotransposons, designated Utopia. Utopia is found in three supergroups of eukaryotes: Amoebozoa, SAR, and Opisthokonta. Utopia is inserted into a specific site of U2 small nuclear RNA genes with different strength of specificity for each family. Utopia families from oomycetes and wasps show strong target specificity while only a small number of Utopia copies from reptiles are flanked with U2 snRNA genes. Oomycete Utopia families contain an “archaeal” RNase H domain upstream of reverse transcriptase (RT), which likely originated from a plant RNase H gene. Analysis of Utopia from oomycetes indicates that multiple lineages of Utopia have been maintained inside of U2 genes with few copy numbers. Phylogenetic analysis of RT suggests the monophyly of Utopia, and it likely dates back to the early evolution of eukaryotes. PMID:26556480

The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

PubMed Central

Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

1997-01-01

A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

Gene disruption in Salmonella typhimurim by modified λ Red disruption system.

PubMed

Ahani Azari, A; Zahraei Salehi, T; Nayeri Fasaei, B; Alebouyeh, M

2015-01-01

There are many techniques to knock out directed genes in bacteria, some of which have been described in Salmonella species. In this study, a combination of SOEing PCR method and the λ Red disruption system were used to disrupt phoP gene in wild type and standard strains of Salmonella typhimurium. Three standards PCR and one fusion PCR reactions were performed to construct a linear DNA including upstream and downstream of phoP gene and Kanamycin cassette. As a template plasmid, we used pKD4 which carries kanamycin gene flanked by FRT (FLP recognition target) sites. The resulting construct was electroporated into prepared competent cells of S. typhimurium. The transformants colonies related to the standard strain appeared on the LB-Km-agar plates after incubation, but there was no colony on LB-Km-agar plates corresponding to the wild type strain. The failure in transformation of the wild type strain may be because of inflexibility of the λ Red disruption system in this strain or its unique restriction-modification system. However, by this construct we are able to generate phoP mutant in many of the Salmonella species due to high homology of the phoP gene which exists in different species.

The Mechanism of Word Crowding

PubMed Central

Yu, Deyue; Akau, Melanie M. U.; Chung, Susana T. L.

2011-01-01

Word reading speed in peripheral vision is slower when words are in close proximity of other words (Chung, 2004). This word crowding effect could arise as a consequence of interaction of low-level letter features between words, or the interaction between high-level holistic representations of words. We evaluated these two hypotheses by examining how word crowding changes for five configurations of flanking words: the control condition — flanking words were oriented upright; scrambled — letters in each flanking word were scrambled in order; horizontal-flip — each flanking word was the left-right mirror-image of the original; letter-flip — each letter of the flanking word was the left-right mirror-image of the original; and vertical-flip — each flanking word was the up-down mirror-image of the original. The low-level letter feature interaction hypothesis predicts similar word crowding effect for all the different flanker configurations, while the high-level holistic representation hypothesis predicts less word crowding effect for all the alternative flanker conditions, compared with the control condition. We found that oral reading speed for words flanked above and below by other words, measured at 10° eccentricity in the nasal field, showed the same dependence on the vertical separation between the target and its flanking words, for the various flanker configurations. The result was also similar when we rotated the flanking words by 90° to disrupt the periodic vertical pattern, which presumably is the main structure in words. The remarkably similar word crowding effect irrespective of the flanker configurations suggests that word crowding arises as a consequence of interactions of low-level letter features. PMID:22079315

Occurrence and properties of composite transposon Tn2672: evolution of multiple drug resistance transposons.

PubMed Central

Hänni, C; Meyer, J; Iida, S; Arber, W

1982-01-01

We found Tn2671 (the 23-kb long IS1-flanked r-determinant of NR1-Basel) inserted into the ampicillin resistance gene bla of the Tn3-related transposon Tn902. The resulting 28-kilobase-long composite transposon Tn2672 (= Tn902 bla::Tn2671) is stable, and it translocates as a unit into various loci including IS1 of the resistance transfer factor of R100-1. These results are discussed with respect to the evolution of R plasmids providing multiple drug resistance. Images PMID:6281241

Avian sarcoma virus 17 carries the jun oncogene.

PubMed Central

Maki, Y; Bos, T J; Davis, C; Starbuck, M; Vogt, P K

1987-01-01

Biologically active molecular clones of avian sarcoma virus 17 (ASV 17) contain a replication-defective proviral genome of 3.5 kilobases (kb). The genome retains partial gag and env sequences, which flank a cell-derived putative oncogene of 0.93 kb, termed jun. The jun gene lacks preserved coding domains of tyrosine-specific protein kinases. It also shows no significant nucleic acid homology with other known oncogenes. The probable transformation-specific protein in ASV 17-transformed cells is a 55-kDa gag-jun fusion product. Images PMID:3033666

Research Training Program in Breast Cancer

DTIC Science & Technology

2002-07-01

kb of incubated for 10 min at room temperature with 1 pL of 5’ flanking sequences of the COUP- TF1 gene (Fig. IA). labeled probe (2-3 x 104 c.p.m.) and...shown -387 underlined. The transcription initiation site is -387 marked by an arrow. (B) Luciferase activity of -197 5’ deletions of the niCOUP- TF1 ...binding site is not the same for all these proteins. 4- Therefore, it is likely that the COUP- TF1 promoter might have evolved to be more highly

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

Enhancing maximum measurable sound reduction index using sound intensity method and strong receiving room absorption.

PubMed

Hongisto, V; Lindgren, M; Keränen, J

2001-01-01

The sound intensity method is usually recommended instead of the pressure method in the presence of strong flanking transmission. Especially when small and/or heavy specimens are tested, the flanking often causes problems in laboratories practicing only the pressure method. The purpose of this study was to determine experimentally the difference between the maximum sound reduction indices obtained by the intensity method, RI,max, and by the pressure method, Rmax. In addition, the influence of adding room absorption to the receiving room was studied. The experiments were carried out in an ordinary two-room test laboratory. The exact value of RI,max was estimated by applying a fitting equation to the measured data points. The fitting equation involved the dependence of the pressure-intensity indicator on measured acoustical parameters. In an empty receiving room, the difference between RI,max and Rmax was 4-15 dB, depending on frequency. When the average reverberation time was reduced from 3.5 to 0.6 s, the values of RI,max increased by 2-10 dB compared to the results in the empty room. Thus, it is possible to measure wall structures having 9-22 dB better sound reduction index using the intensity method than with the pressure method. This facilitates the measurements of small and/or heavy specimens in the presence of flanking. Moreover, when new laboratories are designed, the intensity method is an alternative to the pressure method which presupposes expensive isolation structures between the rooms.

On the Magnetospheric Heating Problem

NASA Astrophysics Data System (ADS)

Nykyri, K.; Moore, T.; Dimmock, A. P.; Ma, X.; Johnson, J.; Delamere, P. A.

2016-12-01

In the Earth's magnetosphere the specific entropy, increases by approximately two orders of magnitude when transitioning from the magnetosheath into the magnetosphere. However, the origin of this non-adiabatic heating is not well understood. In addition, there exists a dawn-dusk temperature asymmetry in the flanks of the plasma sheet - the cold component ions are hotter by 30-40% at the dawnside plasma sheet compared to the duskside plasma sheet. Our recent statistical study of magnetosheath temperatures using 7 years of THEMIS data indicates that ion magnetosheath temperatures downstream of quasi-parallel (dawn-flank for the Parker-Spiral IMF) bow shock are only 15 percent higher than downstream of the quasi-perpendicular shock. This magnetosheath temperature asymmetry is therefore inadequate to cause the observed level of the plasma sheet temperature asymmetry. In this presentation we address the origin of non-adiabatic heating from the magnetosheath into the plasma sheet by utilizing small Cluster spacecraft separations, 9 years of statistical THEMIS data as well as Hall-MHD and hybrid simulations. We present evidence of a new physical mechanism capable of cross-scale energy transport at the flank magnetopause with strong contributions to the non-adiabatic heating observed between the magnetosheath and plasma sheet. This same heating mechanism may occur and drive asymmetries also in the magnetospheres of gas giants: Jupiter and Saturn, as well as play role elsewhere in the universe where significant flow shears are present such as in the solar corona, and other astrophysical and laboratory plasmas.

Germ-Line Recombination Activity of the Widely Used hGFAP-Cre and Nestin-Cre Transgenes

PubMed Central

Zhang, Jiong; Dublin, Pavel; Griemsmann, Stephanie; Klein, Alexandra; Brehm, Ralph; Bedner, Peter; Fleischmann, Bernd K.; Steinhäuser, Christian; Theis, Martin

2013-01-01

Herein we demonstrate with PCR, immunodetection and reporter gene approaches that the widely used human Glial Fibrillary Acidic Protein (hGFAP)-Cre transgene exhibits spontaneous germ-line recombination activity in leading to deletion in brain, heart and tail tissue with high frequency. The ectopic activity of hGFAP-Cre requires a rigorous control. We likewise observed that a second widely used nestin-Cre transgene shows germ-line deletion. Here we describe procedures to identify mice with germ-line recombination mediated by the hGFAP-Cre and nestin-Cre transgenes. Such control is essential to avoid pleiotropic effects due to germ-line deletion of loxP-flanked target genes and to maintain the CNS-restricted deletion status in transgenic mouse colonies. PMID:24349371

Dehalogenation Activities and Distribution of Reductive Dehalogenase Homologous Genes in Marine Subsurface Sediments▿ †

PubMed Central

Futagami, Taiki; Morono, Yuki; Terada, Takeshi; Kaksonen, Anna H.; Inagaki, Fumio

2009-01-01

Halogenated organic compounds serve as terminal electron acceptors for anaerobic respiration in a diverse range of microorganisms. Here, we report on the widespread distribution and diversity of reductive dehalogenase homologous (rdhA) genes in marine subsurface sediments. A total of 32 putative rdhA phylotypes were detected in sediments from the southeast Pacific off Peru, the eastern equatorial Pacific, the Juan de Fuca Ridge flank off Oregon, and the northwest Pacific off Japan, collected at a maximum depth of 358 m below the seafloor. In addition, significant dehalogenation activity involving 2,4,6-tribromophenol and trichloroethene was observed in sediment slurry from the Nankai Trough Forearc Basin. These results suggest that dehalorespiration is an important energy-yielding pathway in the subseafloor microbial ecosystem. PMID:19749069

Isolation and characterization of major histocompatibility complex class II B genes in cranes.

PubMed

Kohyama, Tetsuo I; Akiyama, Takuya; Nishida, Chizuko; Takami, Kazutoshi; Onuma, Manabu; Momose, Kunikazu; Masuda, Ryuichi

2015-11-01

In this study, we isolated and characterized the major histocompatibility complex (MHC) class II B genes in cranes. Genomic sequences spanning exons 1 to 4 were amplified and determined in 13 crane species and three other species closely related to cranes. In all, 55 unique sequences were identified, and at least two polymorphic MHC class II B loci were found in most species. An analysis of sequence polymorphisms showed the signature of positive selection and recombination. A phylogenetic reconstruction based on exon 2 sequences indicated that trans-species polymorphism has persisted for at least 10 million years, whereas phylogenetic analyses of the sequences flanking exon 2 revealed a pattern of concerted evolution. These results suggest that both balancing selection and recombination play important roles in the crane MHC evolution.

Dehalogenation activities and distribution of reductive dehalogenase homologous genes in marine subsurface sediments.

PubMed

Futagami, Taiki; Morono, Yuki; Terada, Takeshi; Kaksonen, Anna H; Inagaki, Fumio

2009-11-01

Halogenated organic compounds serve as terminal electron acceptors for anaerobic respiration in a diverse range of microorganisms. Here, we report on the widespread distribution and diversity of reductive dehalogenase homologous (rdhA) genes in marine subsurface sediments. A total of 32 putative rdhA phylotypes were detected in sediments from the southeast Pacific off Peru, the eastern equatorial Pacific, the Juan de Fuca Ridge flank off Oregon, and the northwest Pacific off Japan, collected at a maximum depth of 358 m below the seafloor. In addition, significant dehalogenation activity involving 2,4,6-tribromophenol and trichloroethene was observed in sediment slurry from the Nankai Trough Forearc Basin. These results suggest that dehalorespiration is an important energy-yielding pathway in the subseafloor microbial ecosystem.

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

PubMed

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

PubMed

Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

2006-01-24

Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The way it provides for the retrieval and extraction of sequences allows the user to overcome the obstacles encountered in the integrative use of different bioinformatic resources and the completeness of the sequence collection allows intra- and interspecies comparison at different biological levels (gene, transcript and protein).

Evolution of an Expanded Mannose Receptor Gene Family

PubMed Central

Staines, Karen; Hunt, Lawrence G.; Young, John R.; Butter, Colin

2014-01-01

Sequences of peptides from a protein specifically immunoprecipitated by an antibody, KUL01, that recognises chicken macrophages, identified a homologue of the mammalian mannose receptor, MRC1, which we called MRC1L-B. Inspection of the genomic environment of the chicken gene revealed an array of five paralogous genes, MRC1L-A to MRC1L-E, located between conserved flanking genes found either side of the single MRC1 gene in mammals. Transcripts of all five genes were detected in RNA from a macrophage cell line and other RNAs, whose sequences allowed the precise definition of spliced exons, confirming or correcting existing bioinformatic annotation. The confirmed gene structures were used to locate orthologues of all five genes in the genomes of two other avian species and of the painted turtle, all with intact coding sequences. The lizard genome had only three genes, one orthologue of MRC1L-A and two orthologues of the MRC1L-B antigen gene resulting from a recent duplication. The Xenopus genome, like that of most mammals, had only a single MRC1-like gene at the corresponding locus. MRC1L-A and MRC1L-B genes had similar cytoplasmic regions that may be indicative of similar subcellular migration and functions. Cytoplasmic regions of the other three genes were very divergent, possibly indicating the evolution of a new functional repertoire for this family of molecules, which might include novel interactions with pathogens. PMID:25390371

Role of large flank-collapse events on magma evolution of volcanoes. Insights from the Lesser Antilles Arc

NASA Astrophysics Data System (ADS)

Boudon, Georges; Villemant, Benoît; Friant, Anne Le; Paterne, Martine; Cortijo, Elsa

2013-08-01

Flank-collapse events are now recognized as common processes of destruction of volcanoes. They may occur several times on a volcanic edifice pulling out varying volumes of material from km3 to thousands of km3. In the Lesser Antilles Arc, a large number of flank-collapse events were identified. Here, we show that some of the largest events are correlated to significant variations in erupted magma compositions and eruptive styles. On Montagne Pelée (Martinique), magma production rate has been sustained during several thousand years following a 32 ka old flank-collapse event. Basic and dense magmas were emitted through open-vent eruptions that generated abundant scoria flows while significantly more acidic magmas were produced before the flank collapse. The rapid building of a new cone increased the load on magma bodies at depth and the density threshold. Magma production rate decreased and composition of the erupted products changed to more acidic compared to the preceding period of activity. These low density magma generated plinian and dome-forming eruptions up to the Present. In contrast at Soufrière Volcanic Centre of St. Lucia and at Pitons du Carbet in Martinique, the flank-collapses have an opposite effect: in both cases, the acidic magmas erupted immediately after the flank-collapses. These magmas are highly porphyritic (up to 60% phenocrysts) and much more viscous than the magmas erupted before the flank-collapses. They have been generally emplaced as voluminous and uptight lava domes (called “the Pitons”). Such magmas could not ascent without a significant decrease of the threshold effect produced by the volcanic edifice loading before the flank-collapse.

The mechanism of word crowding.

PubMed

Yu, Deyue; Akau, Melanie M U; Chung, Susana T L

2012-01-01

Word reading speed in peripheral vision is slower when words are in close proximity of other words (Chung, 2004). This word crowding effect could arise as a consequence of interaction of low-level letter features between words, or the interaction between high-level holistic representations of words. We evaluated these two hypotheses by examining how word crowding changes for five configurations of flanking words: the control condition - flanking words were oriented upright; scrambled - letters in each flanking word were scrambled in order; horizontal-flip - each flanking word was the left-right mirror-image of the original; letter-flip - each letter of the flanking word was the left-right mirror-image of the original; and vertical-flip - each flanking word was the up-down mirror-image of the original. The low-level letter feature interaction hypothesis predicts similar word crowding effect for all the different flanker configurations, while the high-level holistic representation hypothesis predicts less word crowding effect for all the alternative flanker conditions, compared with the control condition. We found that oral reading speed for words flanked above and below by other words, measured at 10° eccentricity in the nasal field, showed the same dependence on the vertical separation between the target and its flanking words, for the various flanker configurations. The result was also similar when we rotated the flanking words by 90° to disrupt the periodic vertical pattern, which presumably is the main structure in words. The remarkably similar word crowding effect irrespective of the flanker configurations suggests that word crowding arises as a consequence of interactions of low-level letter features. Copyright © 2011 Elsevier Ltd. All rights reserved.

Relaxation of the south flank after the 7.2-magnitude Kalapana earthquake, Kilauea Volcano, Hawaii

USGS Publications Warehouse

Dvorak, John J.; Klein, Fred W.; Swanson, Donald A.

1994-01-01

An M = 7.2 earthquake on 29 November 1975 caused the south flank of Kilauea Volcano, Hawaii, to move seaward several meters: a catastrophic release of compression of the south flank caused by earlier injections of magma into the adjacent segment of a rift zone. The focal mechanisms of the mainshock, the largest foreshock, and the largest aftershock suggest seaward movement of the upper block. The rate of aftershocks decreased in a familiar hyperbolic decay, reaching the pre-1975 rate of seismicity by the mid-1980s. Repeated rift-zone intrusions and eruptions after 1975, which occurred within 25 km of the summit area, compressed the adjacent portion of the south flank, apparently masking continued seaward displacement of the south flank. This is evident along a trilateration line that continued to extend, suggesting seaward displacement, immediately after the M = 7.2 earthquake, but then was compressed during a series of intrusions and eruptions that began in September 1977. Farther to the east, trilateration measurements show that the portion of the south flank above the aftershock zone, but beyond the area of compression caused by the rift-zone intrusions and eruptions, continued to move seaward at a decreasing rate until the mid-1980s, mimicking the decay in aftershock rate. Along the same portion of the south flank, the pattern of vertical surface displacements can be explained by continued seaward movement of the south flank and development of two eruptive fissures along the east rift zone, each of which extended from a depth of ∼3 km to the surface. The aftershock rate and continued seaward movement of the south flank are reminiscent of crustal response to other large earthquakes, such as the 1966 M = 6 Parkfield earthquake and the 1983 M = 6.5 Coalinga earthquake.

Three-dimensional displacements of a large volcano flank movement during the May 2010 eruptions at Pacaya Volcano, Guatemala

NASA Astrophysics Data System (ADS)

Schaefer, L. N.; Wang, T.; Escobar-Wolf, R.; Oommen, T.; Lu, Z.; Kim, J.; Lundgren, P. R.; Waite, G. P.

2017-01-01

Although massive flank failure is fairly common in the evolution of volcanoes, measurements of flank movement indicative of instability are rare. Here 3-D displacements from airborne radar amplitude images derived using an amplitude image pixel offset tracking technique show that the west and southwest flanks of Pacaya Volcano in Guatemala experienced large ( 4 m), discrete landsliding that was ultimately aborted. Pixel offset tracking improved measurement recovery by nearly 50% over classic interferometric synthetic aperture radar techniques, providing unique measurements at the event. The 3-D displacement field shows that the flank moved coherently downslope along a complex failure surface involving both rotational and along-slope movement. Notably, the lack of continuous movement of the slide in the years leading up to the event emphasizes that active movement should not always be expected at volcanoes for which triggering factors (e.g., magmatic intrusions and eruptions) could precipitate sudden major flank instability.

Complete mitochondrial genome of Bactrocera arecae (Insecta: Tephritidae) by next-generation sequencing and molecular phylogeny of Dacini tribe

PubMed Central

Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Chan, Kok-Gan; Chow, Wan-Loo; Eamsobhana, Praphathip

2015-01-01

The whole mitochondrial genome of the pest fruit fly Bactrocera arecae was obtained from next-generation sequencing of genomic DNA. It had a total length of 15,900 bp, consisting of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a non-coding region (A + T-rich control region). The control region (952 bp) was flanked by rrnS and trnI genes. The start codons included 6 ATG, 3 ATT and 1 each of ATA, ATC, GTG and TCG. Eight TAA, two TAG, one incomplete TA and two incomplete T stop codons were represented in the protein-coding genes. The cloverleaf structure for trnS1 lacked the D-loop, and that of trnN and trnF lacked the TΨC-loop. Molecular phylogeny based on 13 protein-coding genes was concordant with 37 mitochondrial genes, with B. arecae having closest genetic affinity to B. tryoni. The subgenus Bactrocera of Dacini tribe and the Dacinae subfamily (Dacini and Ceratitidini tribes) were monophyletic. The whole mitogenome of B. arecae will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general. PMID:26472633

Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

PubMed Central

Spielmann, A; Stutz, E

1983-01-01

The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2. PMID:6314279

Genome-Wide Methylome Analyses Reveal Novel Epigenetic Regulation Patterns in Schizophrenia and Bipolar Disorder

PubMed Central

Li, Yongsheng; Camarillo, Cynthia; Xu, Juan; Arana, Tania Bedard; Xiao, Yun; Zhao, Zheng; Chen, Hong; Ramirez, Mercedes; Zavala, Juan; Escamilla, Michael A.; Armas, Regina; Mendoza, Ricardo; Ontiveros, Alfonso; Nicolini, Humberto; Jerez Magaña, Alvaro Antonio; Rubin, Lewis P.; Li, Xia; Xu, Chun

2015-01-01

Schizophrenia (SZ) and bipolar disorder (BP) are complex genetic disorders. Their appearance is also likely informed by as yet only partially described epigenetic contributions. Using a sequencing-based method for genome-wide analysis, we quantitatively compared the blood DNA methylation landscapes in SZ and BP subjects to control, both in an understudied population, Hispanics along the US-Mexico border. Remarkably, we identified thousands of differentially methylated regions for SZ and BP preferentially located in promoters 3′-UTRs and 5′-UTRs of genes. Distinct patterns of aberrant methylation of promoter sequences were located surrounding transcription start sites. In these instances, aberrant methylation occurred in CpG islands (CGIs) as well as in flanking regions as well as in CGI sparse promoters. Pathway analysis of genes displaying these distinct aberrant promoter methylation patterns showed enhancement of epigenetic changes in numerous genes previously related to psychiatric disorders and neurodevelopment. Integration of gene expression data further suggests that in SZ aberrant promoter methylation is significantly associated with altered gene transcription. In particular, we found significant associations between (1) promoter CGIs hypermethylation with gene repression and (2) CGI 3′-shore hypomethylation with increased gene expression. Finally, we constructed a specific methylation analysis platform that facilitates viewing and comparing aberrant genome methylation in human neuropsychiatric disorders. PMID:25734057

Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Altabella, T.; Chrispeels, M.J.

Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{submore » r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.« less

Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

PubMed

Vieille-Grosjean, I; Huber, P

1995-03-03

The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

Structure of CARB-4 and AER-1 CarbenicillinHydrolyzing β-Lactamases

PubMed Central

Sanschagrin, François; Bejaoui, Noureddine; Levesque, Roger C.

1998-01-01

We determined the nucleotide sequences of blaCARB-4 encoding CARB-4 and deduced a polypeptide of 288 amino acids. The gene was characterized as a variant of group 2c carbenicillin-hydrolyzing β-lactamases such as PSE-4, PSE-1, and CARB-3. The level of DNA homology between the bla genes for these β-lactamases varied from 98.7 to 99.9%, while that between these genes and blaCARB-4 encoding CARB-4 was 86.3%. The blaCARB-4 gene was acquired from some other source because it has a G+C content of 39.1%, compared to a G+C content of 67% for typical Pseudomonas aeruginosa genes. DNA sequencing revealed that blaAER-1 shared 60.8% DNA identity with blaPSE-3 encoding PSE-3. The deduced AER-1 β-lactamase peptide was compared to class A, B, C, and D enzymes and had 57.6% identity with PSE-3, including an STHK tetrad at the active site. For CARB-4 and AER-1, conserved canonical amino acid boxes typical of class A β-lactamases were identified in a multiple alignment. Analysis of the DNA sequences flanking blaCARB-4 and blaAER-1 confirmed the importance of gene cassettes acquired via integrons in bla gene distribution. PMID:9687391

Axial patterning and diversification in the cnidaria predate the Hox system.

PubMed

Kamm, Kai; Schierwater, Bernd; Jakob, Wolfgang; Dellaporta, Stephen L; Miller, David J

2006-05-09

Across the animal kingdom, Hox genes are organized in clusters whose genomic organization reflects their central roles in patterning along the anterior/posterior (A/P) axis . While a cluster of Hox genes was present in the bilaterian common ancestor, the origins of this system remain unclear (cf. ). With new data for two representatives of the closest extant phylum to the Bilateria, the sea anemone Nematostella and the hydromedusa Eleutheria, we argue here that the Cnidaria predate the evolution of the Hox system. Although Hox-like genes are present in a range of cnidarians, many of these are paralogs and in neither Nematostella nor Eleutheria is an equivalent of the Hox cluster present. With the exception of independently duplicated genes, the cnidarian genes are unlinked and in several cases are flanked by non-Hox genes. Furthermore, the cnidarian genes are expressed in patterns that are inconsistent with the Hox paradigm. We conclude that the Cnidaria/Bilateria split occurred before a definitive Hox system developed. The spectacular variety in morphological and developmental characteristics shown by extant cnidarians demonstrates that there is no obligate link between the Hox system and morphological diversity in the animal kingdom and that a canonical Hox system is not mandatory for axial patterning.

Studies on the expression of an H-2K/human growth hormone fusion gene in giant transgenic mice.

PubMed Central

Morello, D; Moore, G; Salmon, A M; Yaniv, M; Babinet, C

1986-01-01

Transgenic mice carrying the H-2K/human growth hormone (hGH) fusion gene were produced by microinjecting into the pronucleus of fertilized eggs DNA molecules containing 2 kb of the 5' flanking sequences (including promoter) of the class I H-2Kb gene joined to the coding sequences of the hGH gene. Thirteen transgenic mice were obtained which all contained detectable levels of hGH hormone in their blood. Nine grew larger than their control litter-mates. Endogenous H-2Kb and exogenous hGH mRNA levels were analysed by S1 nuclease digestion experiments. hGH transcripts were found in all the tissues examined and the pattern of expression paralleled that of endogenous H-2K gene expression, being high in liver and lymphoid organs and low in muscle and brain. Thus 2 kb of the 5' promoter/regulatory region of the H-2K gene are sufficient to ensure regulated expression of hGH in transgenic mice. This promoter may therefore be of use to target the expression of different exogenous genes in most tissues of transgenic mice and to study the biological role of the corresponding proteins in different cellular environments. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:3019667

Sequences 5' to translation start regulate expression of petunia rbcS genes.

PubMed Central

Dean, C; Favreau, M; Bedbrook, J; Dunsmuir, P

1989-01-01

The promoter sequences that contribute to quantitative differences in expression of the petunia genes (rbcS) encoding the small subunit of ribulose bisphosphate carboxylase have been characterized. The promoter regions of the two most abundantly expressed petunia rbcS genes, SSU301 and SSU611, show sequence similarity not present in other rbcS genes. We investigated the significance of these and other sequences by adding specific regions from the SSU301 promoter (the most strongly expressed gene) to equivalent regions in the SSU911 promoter (the least strongly expressed gene) and assaying the expression of the fusions in transgenic tobacco plants. In this way, we characterized an SSU301 promoter region (either from -285 to -178 or -291 to -204) which, when added to SSU911, in either orientation, increased SSU911 expression 25-fold. This increase was equivalent to that caused by addition of the entire SSU301 5'-flanking region. Replacement of SSU911 promoter sequences between -198 and the start codon with sequences from the equivalent region of SSU301 did not increase SSU911 expression significantly. The -291 to -204 SSU301 promoter fragment contributes significantly to quantitative differences in expression between the petunia rbcS genes. PMID:2535543

Mechanical response of the south flank of kilauea volcano, hawaii, to intrusive events along the rift systems

USGS Publications Warehouse

Dvorak, J.J.; Okamura, A.T.; English, T.T.; Koyanagi, R.Y.; Nakata, J.S.; Sako, M.K.; Tanigawa, W.T.; Yamashita, K.M.

1986-01-01

Increased earthquake activity and compression of the south flank of Kilauea volcano, Hawaii, have been recognized by previous investigators to accompany rift intrusions. We further detail the temporal and spatial changes in earthquake rates and ground strain along the south flank induced by six major rift intrusions which occurred between December 1971 and January 1981. The seismic response of the south flank to individual rift intrusions is immediate; the increased rate of earthquake activity lasts from 1 to 4 weeks. Horizontal strain measurements indicate that compression of the south flank usually accompanies rift intrusions and eruptions. Emplacement of an intrusion at a depth greater than about 4 km, such as the June 1982 southwest rift intrusion, however, results in a slight extension of the subaerial portion of the south flank. Horizontal strain measurements along the south flank are used to locate the January 1983 east-rift intrusion, which resulted in eruptive activity. The intrusion is modeled as a vertical rectangular sheet with constant displacement perpendicular to the plane of the sheet. This model suggests that the intrusive body that compressed the south flank in January 1983 extended from the surface to about 2.4 km depth, and was aligned along a strike of N66??E. The intrusion is approximately 11 km in length, extended beyond the January 1983 eruptive fissures, which are 8 km in length and is contained within the 14-km-long region of shallow rift earthquakes. ?? 1986.

Morphotectonic evolution of the central Kenya rift flanks: Implications for late Cenozoic environmental change in East Africa

NASA Astrophysics Data System (ADS)

Spiegel, Cornelia; Kohn, Barry P.; Belton, David X.; Gleadow, Andrew J. W.

2007-05-01

The Kenya rift valley is the classic example of an active continental rift zone. We report the rift flank cooling history based on a combination of previous apatite fission track (AFT) and new (U-Th)/He (AHe) data. Our results corroborate the Late Cretaceous rapid cooling episode of continent-wide significance revealed previously by AFT dating. Post-Cretaceous cooling of the eastern rift flank was slow with net cooling of <20 °C through much of the Cenozoic. We interpret this cooling style in terms of the absence of significant relief. Samples from the western rift flank and from low elevations of the eastern rift flank reveal a late Neogene cooling episode associated with net cooling of ˜38 °C, indicating that this flank was eroded to a deeper level than that to the east. The late Neogene cooling episode is interpreted as the time of uplift and shaping of the present-day relief of the graben shoulders, which attain elevations of >3400 m in central Kenya. This timing also largely coincides with the uplift of the Western Rift flanks in Uganda and Congo and with the change toward drier conditions and grassland-dominated vegetation in East Africa. We propose that the regional morphotectonic evolution of the Kenyan rift flanks contributed to late Cenozoic environmental change in East Africa, thus superimposing a pronounced local effect on global climate change at that time.

Biogeochemical and Microbial Survey of Gravity Cores from the Guaymas Basin and Sonora Margin

NASA Astrophysics Data System (ADS)

Buckley, A.; Mckay, L. J.; Chanton, J.; Hensen, C.; Turner, T.; Aiello, I. W.; Ravelo, A. C.; Mortera, C.; Teske, A.

2015-12-01

During the cruise "Guaymas14" with RV El Puma (Oct. 14-25, 2014), 15 sediment cores were obtained from the Guaymas Basin Ridge flanks and the Sonora Margin, to contrast the shallow subsurface sediments of the seafloor set at this spreading center and its adjacent continental margin. Here we present biogeochemical profiles of porewater dissolved gases and stable ions, along with high-throughout 16S rRNA gene sequencing of selected samples. Cores from the NW and SE ends of the Guaymas Basin ridge flanks were not sulfidic, and showed neither sulfate depletion nor methane accumulation. In contrast, samples of compression-impacted Sonora Margin on the NE edge of Guaymas Basin and from the upper Sonora Margin beneath the oxygen minimum zone showed an abundance of sulfide, DIC with sulfate depletion, and accumulation of biogenic methane (δ13C-CH4 ca. -85 to -88 ‰) at supersaturated concentrations below sulfate-replete sediment. Samples from an attenuated off-axis seep site on the NW flank of Guaymas Basin differed from both Sonora Margin and Guaymas Basin. The off-axis seep sediments contained 1 to 1.5 mM methane, with distinct δ13C -isotopic content (δ13C-CH4 near -60 ‰); intermediate to the biogenic methane of the Sonora Margin and the hydrothermally produced methane at Guaymas Basin. Unaltered sulfate and low sulfide concentrations indicate insufficiently reduced conditions, suggesting the methane was not produced in situ. Porewater DIC concentrations in the old seep site and the control site were similar to each other (3-5 mM), and lower than in the Sonora Margin sites (ca. 20-40 mM), indicating low bioremineralization in the old seep site and control sediments. Diverse seafloor habitats are expected to result in distinct microbiota that range from strictly anaerobic seep specialists and methane-cycling archaea in the Sonora Margin to diversified heterotrophic communities in the off-axis ridge flank sediments of Guaymas Basin; high-throughput sequencing should also address potential hydrothermal microbial signature in the attenuated off-axis seep site.

A dual selection based, targeted gene replacement tool for Magnaporthe grisea and Fusarium oxysporum.

PubMed

Khang, Chang Hyun; Park, Sook-Young; Lee, Yong-Hwan; Kang, Seogchan

2005-06-01

Rapid progress in fungal genome sequencing presents many new opportunities for functional genomic analysis of fungal biology through the systematic mutagenesis of the genes identified through sequencing. However, the lack of efficient tools for targeted gene replacement is a limiting factor for fungal functional genomics, as it often necessitates the screening of a large number of transformants to identify the desired mutant. We developed an efficient method of gene replacement and evaluated factors affecting the efficiency of this method using two plant pathogenic fungi, Magnaporthe grisea and Fusarium oxysporum. This method is based on Agrobacterium tumefaciens-mediated transformation with a mutant allele of the target gene flanked by the herpes simplex virus thymidine kinase (HSVtk) gene as a conditional negative selection marker against ectopic transformants. The HSVtk gene product converts 5-fluoro-2'-deoxyuridine to a compound toxic to diverse fungi. Because ectopic transformants express HSVtk, while gene replacement mutants lack HSVtk, growing transformants on a medium amended with 5-fluoro-2'-deoxyuridine facilitates the identification of targeted mutants by counter-selecting against ectopic transformants. In addition to M. grisea and F. oxysporum, the method and associated vectors are likely to be applicable to manipulating genes in a broad spectrum of fungi, thus potentially serving as an efficient, universal functional genomic tool for harnessing the growing body of fungal genome sequence data to study fungal biology.

Mapping of herpes simplex virus-1 neurovirulence to. gamma. sub 1 34. 5, a gene nonessential for growth in culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chou, J.; Roizman, B.; Kern, E.R.

1990-11-30

The gene designated {gamma}{sub 1}34.5 maps in the inverted repeats flanking the long unique sequence of herpes simplex virus-1 (HSV-1) DNA, and therefore it is present in two copies per genome. This gene is not essential for viral growth in cell culture. Four recombinant viruses were genetically engineered to test the function of this gene. These were (i) a virus from which both copies of the gene were deleted, (ii) a virus containing a stop codon in both copies of the gene, (iii) a virus containing after the first codon an insert encoding a 16-amino acid epitope known to reactmore » with a specific monoclonal antibody, and (iv) a virus in which the deleted sequences were restored. The viruses from which the gene was deleted or which carried stop codons were avirulent on intracerebral inoculation of mice. The virus with the gene tagged by the sequence encoding the epitope was moderately virulent, whereas the restored virus reacquired the phenotype of the parent virus. Significant amounts of virus were recovered only from brains of animals inoculated with virulent viruses. Inasmuch as the product of the {gamma}{sub 1}34.5 gene extended the host range of the virus by enabling it to replicate and destroy brain cells, it is a viral neurovirulence factor.« less

Identification and Characterization of Multiple Spidroin 1 Genes Encoding Major Ampullate Silk Proteins in Nephila clavipes

PubMed Central

Gaines, William A.; Marcotte, William R.

2010-01-01

Spider dragline silk is primarily composed of proteins called major ampullate spidroins (MaSp) that consist of a large repeat array flanked by non-repetitive N- and C-terminal domains. Until recently, there has been little evidence for more than one gene encoding each of the two major spidroin silk proteins, MaSp1 and MaSp2. Here, we report the deduced N-terminal domain sequences for two distinct MaSp1 genes from Nephila clavipes (MaSp1A and MaSp1B) and for MaSp2. All three MaSp genes are co-expressed in the major ampullate gland. A search of the GenBank database also revealed two distinct MaSp1 C-terminal domain sequences. Sequencing confirmed that both MaSp1 genes are present in all seven Nephila clavipes spiders examined. The presence of nucleotide polymorphisms in these genes confirmed that MaSp1A and MaSp1B are distinct genetic loci and not merely alleles of the same gene. We have experimentally determined the transcription start sites for all three MaSp genes and established preliminary pairing between the two MaSp1 N- and C-terminal domains. Phylogenetic analysis of these new sequences and other published MaSp N- and C-terminal domain sequences illustrated that duplications of MaSp genes may be widespread among spider species. PMID:18828837

Identification of Genetic Elements Associated with EPSPS Gene Amplification

PubMed Central

Gaines, Todd A.; Wright, Alice A.; Molin, William T.; Lorentz, Lothar; Riggins, Chance W.; Tranel, Patrick J.; Beffa, Roland; Westra, Philip; Powles, Stephen B.

2013-01-01

Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world’s most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S) A. palmeri, and that only one of these was amplified in glyphosate-resistant (R) A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs) were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac) transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene. PMID:23762434

Structural organization of the porcine and human genes coding for a leydig cell-specific insulin-like peptide (LEY I-L) and chromosomal localization of the human gene (INSL3)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkhardt E.; Adham, I.M.; Brosig, B.

1994-03-01

Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less

Characterization of the groEL and groES loci in Bifidobacterium breve UCC 2003: genetic, transcriptional, and phylogenetic analyses.

PubMed

Ventura, Marco; Canchaya, Carlos; Zink, Ralf; Fitzgerald, Gerald F; van Sinderen, Douwe

2004-10-01

The bacterial heat shock response is characterized by the elevated expression of a number of chaperone complexes, including the GroEL and GroES proteins. The groES and groEL genes are highly conserved among eubacteria and are typically arranged as an operon. Genome analysis of Bifidobacterium breve UCC 2003 revealed that the groES and groEL genes are located in different chromosomal regions. The heat inducibility of the groEL and groES genes of B. breve UCC 2003 was verified by slot blot analysis. Northern blot analyses showed that the cspA gene is cotranscribed with the groEL gene, while the groES gene is transcribed as a monocistronic unit. The transcription initiation sites of these two mRNAs were determined by primer extension. Sequence and transcriptional analyses of the region flanking the groEL and groES genes of various bifidobacteria revealed similar groEL-cspA and groES gene units, suggesting a novel genetic organization of these chaperones. Phylogenetic analysis of the available bifidobacterial groES and groEL genes suggested that these genes evolved differently. Discrepancies in the phylogenetic positioning of groES-based trees make this gene an unreliable molecular marker. On the other hand, the bifidobacterial groEL gene sequences can be used as an alternative to current methods for tracing Bifidobacterium species, particularly because they allow a high level of discrimination between closely related species of this genus.

Phage T4 SegB protein is a homing endonuclease required for the preferred inheritance of T4 tRNA gene region occurring in co-infection with a related phage.

PubMed

Brok-Volchanskaya, Vera S; Kadyrov, Farid A; Sivogrivov, Dmitry E; Kolosov, Peter M; Sokolov, Andrey S; Shlyapnikov, Michael G; Kryukov, Valentine M; Granovsky, Igor E

2008-04-01

Homing endonucleases initiate nonreciprocal transfer of DNA segments containing their own genes and the flanking sequences by cleaving the recipient DNA. Bacteriophage T4 segB gene, which is located in a cluster of tRNA genes, encodes a protein of unknown function, homologous to homing endonucleases of the GIY-YIG family. We demonstrate that SegB protein is a site-specific endonuclease, which produces mostly 3' 2-nt protruding ends at its DNA cleavage site. Analysis of SegB cleavage sites suggests that SegB recognizes a 27-bp sequence. It contains 11-bp conserved sequence, which corresponds to a conserved motif of tRNA TpsiC stem-loop, whereas the remainder of the recognition site is rather degenerate. T4-related phages T2L, RB1 and RB3 contain tRNA gene regions that are homologous to that of phage T4 but lack segB gene and several tRNA genes. In co-infections of phages T4 and T2L, segB gene is inherited with nearly 100% of efficiency. The preferred inheritance depends absolutely on the segB gene integrity and is accompanied by the loss of the T2L tRNA gene region markers. We suggest that SegB is a homing endonuclease that functions to ensure spreading of its own gene and the surrounding tRNA genes among T4-related phages.

An A−71C substitution in a green gene at the second position in the red/green visual-pigment gene array is associated with deutan color-vision deficiency

PubMed Central

Ueyama, Hisao; Li, Yao-Hua; Fu, Gui-Lian; Lertrit, Patcharee; Atchaneeyasakul, La-ongsri; Oda, Sanae; Tanabe, Shoko; Nishida, Yasuhiro; Yamade, Shinichi; Ohkubo, Iwao

2003-01-01

We studied 247 Japanese males with congenital deutan color-vision deficiency and found that 37 subjects (15.0%) had a normal genotype of a single red gene followed by a green gene(s). Two of them had missense mutations in the green gene(s), but the other 35 subjects had no mutations in either the exons or their flanking introns. However, 32 of the 35 subjects, including all 8 subjects with pigment-color defect, a special category of deuteranomaly, had a nucleotide substitution, A−71C, in the promoter of a green gene at the second position in the red/green visual-pigment gene array. Although the −71C substitution was also present in color-normal Japanese males at a frequency of 24.3%, it was never at the second position but always found further downstream. The substitution was found in 19.4% of Chinese males and 7.7% of Thai males but rarely in Caucasians or African Americans. These results suggest that the A−71C substitution in the green gene at the second position is closely associated with deutan color-vision deficiency. In Japanese and presumably other Asian populations further downstream genes with −71C comprise a reservoir of the visual-pigment genes that cause deutan color-vision deficiency by unequal crossing over between the intergenic regions. PMID:12626747

Identification of an estrogen response element in the 3'-flanking region of the murine c-fos protooncogene.

PubMed

Hyder, S M; Stancel, G M; Nawaz, Z; McDonnell, D P; Loose-Mitchell, D S

1992-09-05

We have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyltransferase, linked to regions of mouse c-fos, to identify a specific estrogen response element (ERE) in this protooncogene. This element is located in the untranslated 3'-flanking region of the c-fos gene, 5 kilobases (kb) downstream from the c-fos promoter and 1.5 kb downstream of the poly(A) signal. This element confers estrogen responsiveness to chloramphenicol acetyltransferase reporters linked to both the herpes simplex virus thymidine kinase promoter and the homologous c-fos promoter. Deletion analysis localized the response element to a 200-base pair fragment which contains the element GGTCACCACAGCC that resembles the consensus ERE sequence GGTCACAGTGACC originally identified in Xenopus vitellogenin A2 gene. A synthetic 36-base pair oligodeoxynucleotide containing this c-fos sequence conferred estrogen inducibility to the thymidine kinase promoter. The corresponding sequence also induced reporter activity when present in the c-fos gene fragment 3 kb from the thymidine kinase promoter. Gel-shift experiments demonstrated that synthetic oligonucleotides containing either the consensus ERE or the c-fos element bind human estrogen receptor obtained from a yeast expression system. However, the mobility of the shifted band is faster for the fos-ERE-complex than the consensus ERE complex suggesting that the three-dimensional structure of the protein-DNA complexes is different or that other factors are differentially involved in the two reactions. When the 5'-GGTCA sequence present in the c-fos ERE is mutated to 5'-TTTCA, transcriptional activation and receptor binding activities are both lost. Mutation of the CAGCC-3' element corresponding to the second half-site of the c-fos sequence also led to the loss of receptor binding activity, suggesting that both half-sites of this element are involved in this function. The estrogen induction mediated by either the c-fos or the consensus ERE was blunted by the antiestrogen tamoxifen. Based on these studies, we believe the 3'-fos ERE sequence we have identified may be a major cis-acting element involved in the physiological regulation of the gene by estrogens in vivo.

A conditional allele of Rspo3 reveals redundant function of R-spondins during mouse limb development.

PubMed

Neufeld, Stanley; Rosin, Jessica M; Ambasta, Anshula; Hui, Kristen; Shaneman, Venessa; Crowder, Ray; Vickerman, Lori; Cobb, John

2012-10-01

R-spondins are secreted ligands that bind cell surface receptors and activate Wnt/β-catenin signaling. Human mutations and gene inactivation studies in mice have revealed a role for these four proteins (RSPO1-4) in diverse developmental processes ranging from sex determination to limb development. Among the genes coding for R-spondins, only inactivation of Rspo3 shows early embryonic lethality (E10.5 in mice). Therefore, a conditional allele of this gene is necessary to understand the function of R-spondins throughout murine development. To address this need, we have produced an allele in which loxP sites flank exons 2-4 of Rspo3, allowing tissue-specific deletion of these exons in the presence of Cre recombinase. We used these mice to investigate the role of Rspo3 during limb development and found that limbs ultimately developed normally in the absence of Rspo3 function. However, severe hindlimb truncations resulted when Rspo3 and Rspo2 mutations were combined, demonstrating redundant function of these genes. Copyright © 2012 Wiley Periodicals, Inc.

Analysis of alterative cleavage and polyadenylation by 3′ region extraction and deep sequencing

PubMed Central

Hoque, Mainul; Ji, Zhe; Zheng, Dinghai; Luo, Wenting; Li, Wencheng; You, Bei; Park, Ji Yeon; Yehia, Ghassan; Tian, Bin

2012-01-01

Alternative cleavage and polyadenylation (APA) leads to mRNA isoforms with different coding sequences (CDS) and/or 3′ untranslated regions (3′UTRs). Using 3′ Region Extraction And Deep Sequencing (3′READS), a method which addresses the internal priming and oligo(A) tail issues that commonly plague polyA site (pA) identification, we comprehensively mapped pAs in the mouse genome, thoroughly annotating 3′ ends of genes and revealing over five thousand pAs (~8% of total) flanked by A-rich sequences, which have hitherto been overlooked. About 79% of mRNA genes and 66% of long non-coding RNA (lncRNA) genes have APA; but these two gene types have distinct usage patterns for pAs in introns and upstream exons. Promoter-distal pAs become relatively more abundant during embryonic development and cell differentiation, a trend affecting pAs in both 3′-most exons and upstream regions. Upregulated isoforms generally have stronger pAs, suggesting global modulation of the 3′ end processing activity in development and differentiation. PMID:23241633

Chromosome-based survey sequencing reveals the genome organization of wild wheat progenitor Triticum dicoccoides.

PubMed

Akpinar, Bala Ani; Biyiklioglu, Sezgi; Alptekin, Burcu; Havránková, Miroslava; Vrána, Jan; Doležel, Jaroslav; Distelfeld, Assaf; Hernandez, Pilar; Budak, Hikmet

2018-05-04

Wild emmer wheat (Triticum turgidum ssp. dicoccoides) is the progenitor of wheat. We performed chromosome-based survey sequencing of the 14 chromosomes, examining repetitive sequences, protein-coding genes, miRNA/target pairs and tRNA genes, as well as syntenic relationships with related grasses. We found considerable differences in the content and distribution of repetitive sequences between the A and B subgenomes. The gene contents of individual chromosomes varied widely, not necessarily correlating with chromosome size. We catalogued candidate agronomically important loci, along with new alleles and flanking sequences that can be used to design exome sequencing. Syntenic relationships and virtual gene orders revealed several small-scale evolutionary rearrangements, in addition to providing evidence for the 4AL-5AL-7BS translocation in wild emmer wheat. Chromosome-based sequence assemblies contained five novel miRNA families, among 59 families putatively encoded in the entire genome which provide insight into the domestication of wheat and an overview of the genome content and organization. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Psi- vectors: murine leukemia virus-based self-inactivating and self-activating retroviral vectors.

PubMed Central

Delviks, K A; Hu, W S; Pathak, V K

1997-01-01

We have developed murine leukemia virus (MLV)-based self-inactivating and self-activating vectors to show that the previously demonstrated high-frequency direct repeat deletions are not unique to spleen necrosis virus (SNV) or the neomycin drug resistance gene. Retroviral vectors pKD-HTTK and pKD-HTpTK containing direct repeats composed of segments of the herpes simplex virus type 1 thymidine kinase (HTK) gene were constructed; in pKD-HTpTK, the direct repeat flanked the MLV packaging signal. The generation of hypoxanthine-aminopterin-thymidine-resistant colonies after one cycle of retroviral replication demonstrated functional reconstitution of the HTK gene. Quantitative Southern analysis indicated that direct repeat deletions occurred in 57 and 91% of the KD-HTTK and KD-HTpTK proviruses, respectively. These results demonstrate that (i) deletion of direct repeats occurs at similar high frequencies in SNV and MLV vectors, (ii) MLV psi can be efficiently deleted by using direct repeats, (iii) suicide genes can be functionally reconstituted during reverse transcription, and (iv) the psi region may be a hot spot for reverse transcriptase template switching events. PMID:9223521

The -913 G/A glutamine:fructose-6-phosphate aminotransferase gene polymorphism is associated with measures of obesity and intramyocellular lipid content in nondiabetic subjects.

PubMed

Weigert, Cora; Thamer, Claus; Brodbeck, Katrin; Guirguis, Alke; Machicao, Fausto; Machann, Jürgen; Schick, Fritz; Stumvoll, Michael; Fritsche, Andreas; Häring, Hans U; Schleicher, Erwin D

2005-03-01

Increases in glutamine:fructose-6-phosphate aminotransferase (GFAT) protein levels directly activate flux through the hexosamine biosynthetic pathway. This pathway has been involved as a fuel sensor in energy metabolism and development of insulin resistance. We screened the 5'-flanking region of the human GFAT gene for polymorphisms and subsequently genotyped 412 nondiabetic, metabolically characterized Caucasians for the two single-nucleotide polymorphisms (SNP) at positions -913 (G/A) and -1412 (C/G) with rare allele frequencies of 42% and 16%, respectively. The -913 G SNP was associated with significantly higher body mass index and percent body fat in men (P = 0.02 and 0.004, respectively), but not in women (P = 0.47 and 0.26, respectively). In the subgroup of individuals (n = 193) who underwent hyperinsulinemic-euglycemic clamp, an association of the -913 G SNP with insulin sensitivity independent of body mass index was not detected. Moreover, the -913 G allele in a group of 71 individuals who had undergone magnetic resonance spectroscopy was associated with higher intramyocellular lipid content (IMCL) in tibialis anterior muscle (4.21 +/- 0.31 vs. 3.36 +/- 0.35; P = 0.04) independent of percent body fat and maximal aerobic power. The -1412 SNP had no effect on percent body fat, insulin sensitivity, or IMCL. In conclusion, we identified two polymorphisms in the 5'-flanking region of GFAT, of which the -913 SNP seems to alter the risk for obesity and IMCL accumulation in male subjects.

Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

PubMed

Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

2005-03-01

We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

Phylogeny and strain typing of Escherichia coli, inferred from variation at mononucleotide repeat loci.

PubMed

Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M; Kashi, Yechezkel

2004-04-01

Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria.

Phylogeny and Strain Typing of Escherichia coli, Inferred from Variation at Mononucleotide Repeat Loci

PubMed Central

Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M.; Kashi, Yechezkel

2004-01-01

Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria. PMID:15066845

Rubisco activase is required for optimal photosynthesis in the green alga Chlamydomonas reinhardtii in a low-CO(2) atmosphere.

PubMed

Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V

2003-12-01

This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.

Microbial diversity within basement fluids of the sediment-buried Juan de Fuca Ridge flank

PubMed Central

Jungbluth, Sean P; Grote, Jana; Lin, Huei-Ting; Cowen, James P; Rappé, Michael S

2013-01-01

Despite its immense size, logistical and methodological constraints have largely limited microbiological investigations of the subseafloor basement biosphere. In this study, a unique sampling system was used to collect fluids from the subseafloor basaltic crust via a Circulation Obviation Retrofit Kit (CORK) observatory at Integrated Ocean Drilling Program borehole 1301A, located at a depth of 2667 m in the Pacific Ocean on the eastern flank of the Juan de Fuca Ridge. Here, a fluid delivery line directly accesses a 3.5 million years old basalt-hosted basement aquifer, overlaid by 262 m of sediment, which serves as a barrier to direct exchange with bottom seawater. At an average of 1.2 × 104 cells ml−1, microorganisms in borehole fluids were nearly an order of magnitude less abundant than in surrounding bottom seawater. Ribosomal RNA genes were characterized from basement fluids, providing the first snapshots of microbial community structure using a high-integrity fluid delivery line. Interestingly, microbial communities retrieved from different CORKs (1026B and 1301A) nearly a decade apart shared major community members, consistent with hydrogeological connectivity. However, over three sampling years, the dominant gene clone lineage changed from relatives of Candidatus Desulforudis audaxviator within the bacterial phylum Firmicutes in 2008 to the Miscellaneous Crenarchaeotic Group in 2009 and a lineage within the JTB35 group of Gammaproteobacteria in 2010, and statistically significant variation in microbial community structure was observed. The enumeration of different phylogenetic groups of cells within borehole 1301A fluids supported our observation that the deep subsurface microbial community was temporally dynamic. PMID:22791235

Ridge-flank crustal microbiology investigated with long-term borehole observatories

NASA Astrophysics Data System (ADS)

Orcutt, B. N.; Bach, W.; Becker, K.; Edwards, K. J.; Fisher, A. T.; Haddad, A.; Hulme, S.; Teske, A.; Toner, B.; Wheat, C. G.

2011-12-01

The ridge flank environment represents an important habitat for microbial life on Earth, considering its size and chemical disequilibria between circulating fluids and rocks. However, the potential for this habitat to harbor life, and the characteristics that such life might have, are poorly known at present. Furthermore, the interactions of microbial communities across deep sediment-basement interfaces are not well-characterized. Subseafloor borehole observatories provide a novel platform for sampling and monitoring the microbiology of the crustal ridge flank environment. We present current results from a series of subsurface microbial colonization experiments using borehole observatories on the eastern flank of the Juan de Fuca Ridge, as well as analysis of samples collected on a transect away from a seawater-recharging seamount on this ridge flank. These results are compared to the microbiology of observatories installed in the Costa Rica Rift flank with similar fluid composition and temperatures (i.e. anoxic and warm). We will also discuss on-going experiments on the western-flank of the Mid-Atlantic Ridge, where formation fluids in basement are oxic and cool. Results from these experiments represent some of the extremes in crustal fluid conditions, paving the way for additional studies that are needed to address the importance of this biome as a carbon reservoir and a mechanism for crustal alteration.

Flank eruptions of Mt Etna during the Greek-Roman and Early Medieval periods: New data from 226Ra-230Th dating and archaeomagnetism

NASA Astrophysics Data System (ADS)

Branca, Stefano; Condomines, Michel; Tanguy, Jean-Claude

2015-10-01

In this paper, we present new data from 226Ra-230Th dating and archaeomagnetism with the aim of improving the knowledge of the flank eruptions that occurred at Mt Etna during the Greek-Roman and Early Medieval periods, as defined in the new geological map of the volcano. The combination of the two dating techniques demonstrates that three major flank eruptions occurred on the lower north and west flanks during Greek-Roman epochs, producing large scoria cones and extensive lava flows. In particular, the Mt Ruvolo and Mt Minardo events highly impacted the territory of the west flank, notably by damming the Simeto River. The new data of the Millicucco and Due Monti lava flows, on the lower north-east flank, indicate a younger age than their stratigraphic ages quoted in the 2011 geological map, since they occurred around 700 and 500 AD, respectively. None of the large flank eruptions occurring on the lower slopes of Etna during the Early Medieval age are reported in the historical sources. Overall, our paper shows that a comprehensive assessment of eruptions at Mount Etna in the last three millennia can only be achieved through a multidisciplinary approach.

Stereochemical analysis of the functional significance of the conserved inverted CCAAT and TATA elements in the rat bone sialoprotein gene promoter.

PubMed

Su, Ming; Lee, Daniel; Ganss, Bernhard; Sodek, Jaro

2006-04-14

Basal transcription of the bone sialoprotein gene is mediated by highly conserved inverted CCAAT (ICE; ATTGG) and TATA elements (TTTATA) separated by precisely 21 nucleotides. Here we studied the importance of the relative position and orientation of the CCAAT and TATA elements in the proximal promoter by measuring the transcriptional activity of a series of mutated reporter constructs in transient transfection assays. Whereas inverting the TTTATA (wild type) to a TATAAA (consensus TATA) sequence increased transcription slightly, transcription was reduced when the flanking dinucleotides were also inverted. In contrast, reversing the ATTGG (wild type; ICE) to a CCAAT (RICE) sequence caused a marked reduction in transcription, whereas both transcription and NF-Y binding were progressively increased with the simultaneous inversion of flanking nucleotides (f-RICE-f). Reducing the distance between the ICE and TATA elements produced cyclical changes in transcriptional activity that correlated with progressive alterations in the relative positions of the CCAAT and TATA elements on the face of the DNA helix. Minimal transcription was observed after 5 nucleotides were deleted (equivalent to approximately one half turn of the helix), whereas transcription was fully restored after deleting 10 nucleotides (approximately one full turn of the DNA helix), transcriptional activity being progressively lost with deletions beyond 10 nucleotides. In comparison, when deletions were made with the ICE in the reversed (f-RICE-f) orientation transcriptional activity was progressively lost with no recovery. These results show that, although transcription can still occur when the CCAAT box is reversed and/or displaced relative to the TATA box, the activity is dependent upon the flexibility of the intervening DNA helix needed to align the NF-Y complex on the CCAAT box with preinitiation complex proteins that bind to the TATA box. Thus, the precise location and orientation of the CCAAT element is necessary for optimizing basal transcription of the bone sialoprotein gene.

Cloning a balanced t(9;11)(p24;q23.1) chromosomal translocation breakpoint segregating with bipolar affective disorder in a small pedigree

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duggan, D.J.; Baysal, B.E.; Gollin, S.M.

A small multigenerational pedigree was previously identified in which a balanced 9;11 chromosomal translocation was cosegregating with bipolar affective disorder. We hypothesize that genes or gene regulatory sequences disrupted by the translocation are contributing to bipolar affective disorder in a dominant fashion. The general strategy involves (1) using somatic cell hybrids containing the derivative 9 or 11 chromosomes to identify the closest chromosome 9 and 11 flanking markers, (2) using the nearest markers as PCR and hybridization probes to isolate both normal DNA (YAC) and patient DNA (cosmid) adjacent to and incorporating the translocation breakpoint, and (3) identifying expressed sequencesmore » in the genomic DNA that may be disrupted by the translocation. From a fusion of the translocation patient cell line and a recipient hamster cell line, somatic cell hybrids were isolated which contain either the human derivative 9 or derivative 11 chromosome. Using PCR-based STS assays with these hybrids, the location of the translocation breakpoint was localized to an estimated 500 kb region at chromosome 11 band q23.1 and a 1 cM region in 9 band p24 (more telomeric than originally reported). From a large set of CEPH and Roswell Park yeast artificial chromosomes (YACs), six chromosome 11 YACs spanning the 11q23.1 breakpoint have now been identified. A combination of pulsed field gel eletrophoresis and YAC mapping has narrowed the chromosome 11 region to less than 430 kb. Current efforts are focused on generating new chromosome 11 probes within the flanking markers, mapping these probes back to the der(9) and der(11) containing hybrids and the chromosome 11 YAC mapping panel. As the region is physically narrowed, we will identify candidate genes whose expression may be altered by this t(9:11) translocation.« less