Successful Gene Tagging in Lettuce Using the Tnt1 Retrotransposon from Tobacco

PubMed Central

Mazier, Marianne; Botton, Emmanuel; Flamain, Fabrice; Bouchet, Jean-Paul; Courtial, Béatrice; Chupeau, Marie-Christine; Chupeau, Yves; Maisonneuve, Brigitte; Lucas, Hélène

2007-01-01

The tobacco (Nicotiana tabacum) element Tnt1 is one of the few identified active retrotransposons in plants. These elements possess unique properties that make them ideal genetic tools for gene tagging. Here, we demonstrate the feasibility of gene tagging using the retrotransposon Tnt1 in lettuce (Lactuca sativa), which is the largest genome tested for retrotransposon mutagenesis so far. Of 10 different transgenic bushes carrying a complete Tnt1 containing T-DNA, eight contained multiple transposed copies of Tnt1. The number of transposed copies of the element per plant was particularly high, the smallest number being 28. Tnt1 transposition in lettuce can be induced by a very simple in vitro culture protocol. Tnt1 insertions were stable in the progeny of the primary transformants and could be segregated genetically. Characterization of the sequences flanking some insertion sites revealed that Tnt1 often inserted into genes. The progeny of some primary transformants showed phenotypic alterations due to recessive mutations. One of these mutations was due to Tnt1 insertion in the gibberellin 3β-hydroxylase gene. Taken together, these results indicate that Tnt1 is a powerful tool for insertion mutagenesis especially in plants with a large genome. PMID:17351058

Analysis of JC virus DNA replication using a quantitative and high-throughput assay

PubMed Central

Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert; Gagnon, David; Gjoerup, Ole; Archambault, Jacques; Bullock, Peter A.

2015-01-01

Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. PMID:25155200

Activation tagging in indica rice identifies ribosomal proteins as potential targets for manipulation of water-use efficiency and abiotic stress tolerance in plants.

PubMed

Moin, Mazahar; Bakshi, Achala; Saha, Anusree; Udaya Kumar, M; Reddy, Attipalli R; Rao, K V; Siddiq, E A; Kirti, P B

2016-11-01

We have generated 3900 enhancer-based activation-tagged plants, in addition to 1030 stable Dissociator-enhancer plants in a widely cultivated indica rice variety, BPT-5204. Of them, 3000 were screened for water-use efficiency (WUE) by analysing photosynthetic quantum efficiency and yield-related attributes under water-limiting conditions that identified 200 activation-tagged mutants, which were analysed for flanking sequences at the site of enhancer integration in the genome. We have further selected five plants with low Δ 13 C, high quantum efficiency and increased plant yield compared with wild type for a detailed investigation. Expression studies of 18 genes in these mutants revealed that in four plants one of the three to four tagged genes became activated, while two genes were concurrently up-regulated in the fifth plant. Two genes coding for proteins involved in 60S ribosomal assembly, RPL6 and RPL23A, were among those that became activated by enhancers. Quantitative expression analysis of these two genes also corroborated the results on activating-tagging. The high up-regulation of RPL6 and RPL23A in various stress treatments and the presence of significant cis-regulatory elements in their promoter regions along with the high up-regulation of several of RPL genes in various stress treatments indicate that they are potential targets for manipulating WUE/abiotic stress tolerance. © 2016 John Wiley & Sons Ltd.

Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

PubMed

Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

2016-01-01

Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

Orthologs in Arabidopsis thaliana of the Hsp70 interacting protein Hip

PubMed Central

Webb, Mary Alice; Cavaletto, John M.; Klanrit, Preekamol; Thompson, Gary A.

2001-01-01

The Hsp70-interacting protein Hip binds to the adenosine triphosphatase domain of Hsp70, stabilizing it in the adenosine 5′-diphosphate–ligated conformation and promoting binding of target polypeptides. In mammalian cells, Hip is a component of the cytoplasmic chaperone heterocomplex that regulates signal transduction via interaction with hormone receptors and protein kinases. Analysis of the complete genome sequence of the model flowering plant Arabidopsis thaliana revealed 2 genes encoding Hip orthologs. The deduced sequence of AtHip-1 consists of 441 amino acid residues and is 42% identical to human Hip. AtHip-1 contains the same functional domains characterized in mammalian Hip, including an N-terminal dimerization domain, an acidic domain, 3 tetratricopeptide repeats flanked by a highly charged region, a series of degenerate GGMP repeats, and a C-terminal region similar to the Sti1/Hop/p60 protein. The deduced amino acid sequence of AtHip-2 consists of 380 amino acid residues. AtHip-2 consists of a truncated Hip-like domain that is 46% identical to human Hip, followed by a C-terminal domain related to thioredoxin. AtHip-2 is 63% identical to another Hip-thioredoxin protein recently identified in Vitis labrusca (grape). The truncated Hip domain in AtHip-2 includes the amino terminus, the acidic domain, and tetratricopeptide repeats with flanking charged region. Analyses of expressed sequence tag databases indicate that both AtHip-1 and AtHip-2 are expressed in A thaliana and that orthologs of Hip are also expressed widely in other plants. The similarity between AtHip-1 and its mammalian orthologs is consistent with a similar role in plant cells. The sequence of AtHip-2 suggests the possibility of additional unique chaperone functions. PMID:11599566

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress.

PubMed

Santos, Efrén; Remy, Serge; Thiry, Els; Windelinckx, Saskia; Swennen, Rony; Sági, László

2009-06-24

Next-generation transgenic plants will require a more precise regulation of transgene expression, preferably under the control of native promoters. A genome-wide T-DNA tagging strategy was therefore performed for the identification and characterization of novel banana promoters. Embryogenic cell suspensions of a plantain-type banana were transformed with a promoterless, codon-optimized luciferase (luc+) gene and low temperature-responsive luciferase activation was monitored in real time. Around 16,000 transgenic cell colonies were screened for baseline luciferase activity at room temperature 2 months after transformation. After discarding positive colonies, cultures were re-screened in real-time at 26 degrees C followed by a gradual decrease to 8 degrees C. The baseline activation frequency was 0.98%, while the frequency of low temperature-responsive luciferase activity was 0.61% in the same population of cell cultures. Transgenic colonies with luciferase activity responsive to low temperature were regenerated to plantlets and luciferase expression patterns monitored during different regeneration stages. Twenty four banana DNA sequences flanking the right T-DNA borders in seven independent lines were cloned via PCR walking. RT-PCR analysis in one line containing five inserts allowed the identification of the sequence that had activated luciferase expression under low temperature stress in a developmentally regulated manner. This activating sequence was fused to the uidA reporter gene and back-transformed into a commercial dessert banana cultivar, in which its original expression pattern was confirmed. This promoter tagging and real-time screening platform proved valuable for the identification of novel promoters and genes in banana and for monitoring expression patterns throughout in vitro development and low temperature treatment. Combination of PCR walking techniques was efficient for the isolation of candidate promoters even in a multicopy T-DNA line. Qualitative and quantitative GUS expression analyses of one tagged promoter in a commercial cultivar demonstrated a reproducible promoter activity pattern during in vitro culture. Thus, this promoter could be used during in vitro selection and generation of commercial transgenic plants.

Activity Enhancement of G-Quadruplex/Hemin DNAzyme by Flanking d(CCC).

PubMed

Chang, Tianjun; Gong, Hongmei; Ding, Pi; Liu, Xiangjun; Li, Weiguo; Bing, Tao; Cao, Zehui; Shangguan, Dihua

2016-03-14

G-quadruplex (G4)/hemin DNAzymes have been extensively applied in bioanalysis and molecular devices. However, their catalytic activity is still much lower than that of proteinous enzymes. The G4/hemin DNAzyme activity is correlated with the G4 conformations and the solution conditions. However, little is known about the effect of the flanking sequences on the activity, though they are important parts of G4s. Here, we report sequences containing d(CCC), flanked on both ends of the G4-core sequences remarkably enhance their DNAzyme activity. By using circular dichroism and UV-visible spectroscopy, the d(CCC) flanking sequences were demonstrated to improve the hemin binding affinity to G4s instead of increasing the parallel G4 formation, which might explain the enhanced DNAzyme activity. Meanwhile, the increased hemin binding ability promoted the degradation of hemin within the DNAzyme by H2O2. Furthermore, the DNAzyme with d(CCC) flanking sequences showed strong tolerance to pH value changes, which makes it more suitable for applications requiring wide pH conditions. The results highlight the influence of the flanking sequences on the DNAzyme activity and provide insightful information for the design of highly active DNAzymes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

MiMIC: a highly versatile transposon insertion resource for engineering Drosophila melanogaster genes

PubMed Central

Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.

2011-01-01

We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007

Analysis of JC virus DNA replication using a quantitative and high-throughput assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, Jong; Phelan, Paul J.; Chhum, Panharith

2014-11-15

Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCVmore » DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. - Highlights: • Development of a high-throughput screening assay for JCV DNA replication using C33A cells. • Evidence that T-ag fails to accumulate in the nuclei of established glioma cell lines. • Evidence that NF-1 directly promotes JCV DNA replication in C33A cells. • Proof-of-concept that the HTS assay can be used to identify pharmacological inhibitor of JCV DNA replication.« less

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

Influence of flanking sequences on presentation efficiency of a CD8+ cytotoxic T-cell epitope delivered by parvovirus-like particles.

PubMed

Rueda, P; Morón, G; Sarraseca, J; Leclerc, C; Casal, J I

2004-03-01

We have previously developed an antigen-delivery system based on hybrid recombinant porcine parvovirus-like particles (PPV-VLPs) formed by the self-assembly of the VP2 protein of PPV carrying a foreign epitope at its N terminus. In this study, different constructs were made containing a CD8(+) T-cell epitope of chicken ovalbumin (OVA) to analyse the influence of the sequence inserted into VP2 on the correct processing of VLPs by antigen-presenting cells. We analysed the presentation of the OVA epitope inserted without flanking sequences or with either different natural flanking sequences or with the natural flanking sequences of a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus nucleoprotein, and as a dimer with or without linker sequences. All constructs were studied in terms of level of expression, assembly of VLPs and ability to deliver the inserted epitope into the MHC I pathway. The presentation of the OVA epitope was considerably improved by insertion of short natural flanking sequences, which indicated the relevance of the flanking sequences on the processing of PPV-VLPs. Only PPV-VLPs carrying two copies of the OVA epitope linked by two glycines were able to be properly processed, suggesting that the introduction of flexible residues between the two consecutive OVA epitopes may be necessary for the correct presentation of these dimers by PPV-VLPs. These results provide information to improve the insertion of epitopes into PPV-VLPs to facilitate their processing and presentation by MHC class I molecules.

SH3-like motif-containing C-terminal domain of staphylococcal teichoic acid transporter suggests possible function.

PubMed

Ko, Tzu-Ping; Tseng, Shih-Ting; Lai, Shu-Jung; Chen, Sheng-Chia; Guan, Hong-Hsiang; Shin Yang, Chia; Jung Chen, Chun; Chen, Yeh

2016-09-01

The negatively charged bacterial polysaccharides-wall teichoic acids (WTAs) are synthesized intracellularly and exported by a two-component transporter, TagGH, comprising a transmembrane subunit TagG and an ATPase subunit TagH. We determined the crystal structure of the C-terminal domain of TagH (TagH-C) to investigate its function. The structure shows an N-terminal SH3-like subdomain wrapped by a C-terminal subdomain with an anti-parallel β-sheet and an outer shell of α-helices. A stretch of positively charged surface across the subdomain interface is flanked by two negatively charged regions, suggesting a potential binding site for negatively charged polymers, such as WTAs or acidic peptide chains. Proteins 2016; 84:1328-1332. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Length and sequence dependence in the association of Huntingtin protein with lipid membranes

NASA Astrophysics Data System (ADS)

Jawahery, Sudi; Nagarajan, Anu; Matysiak, Silvina

2013-03-01

There is a fundamental gap in our understanding of how aggregates of mutant Huntingtin protein (htt) with overextended polyglutamine (polyQ) sequences gain the toxic properties that cause Huntington's disease (HD). Experimental studies have shown that the most important step associated with toxicity is the binding of mutant htt aggregates to lipid membranes. Studies have also shown that flanking amino acid sequences around the polyQ sequence directly affect interactions with the lipid bilayer, and that polyQ sequences of greater than 35 glutamine repeats in htt are a characteristic of HD. The key steps that determine how flanking sequences and polyQ length affect the structure of lipid bilayers remain unknown. In this study, we use atomistic molecular dynamics simulations to study the interactions between lipid membranes of varying compositions and polyQ peptides of varying lengths and flanking sequences. We find that overextended polyQ interactions do cause deformation in model membranes, and that the flanking sequences do play a role in intensifying this deformation by altering the shape of the affected regions.

The membrane skeleton in Paramecium: Molecular characterization of a novel epiplasmin family and preliminary GFP expression results.

PubMed

Pomel, Sébastien; Diogon, Marie; Bouchard, Philippe; Pradel, Lydie; Ravet, Viviane; Coffe, Gérard; Viguès, Bernard

2006-02-01

Previous attempts to identify the membrane skeleton of Paramecium cells have revealed a protein pattern that is both complex and specific. The most prominent structural elements, epiplasmic scales, are centered around ciliary units and are closely apposed to the cytoplasmic side of the inner alveolar membrane. We sought to characterize epiplasmic scale proteins (epiplasmins) at the molecular level. PCR approaches enabled the cloning and sequencing of two closely related genes by amplifications of sequences from a macronuclear genomic library. Using these two genes (EPI-1 and EPI-2), we have contributed to the annotation of the Paramecium tetraurelia macronuclear genome and identified 39 additional (paralogous) sequences. Two orthologous sequences were found in the Tetrahymena thermophila genome. Structural analysis of the 43 sequences indicates that the hallmark of this new multigenic family is a 79 aa domain flanked by two Q-, P- and V-rich stretches of sequence that are much more variable in amino-acid composition. Such features clearly distinguish members of the multigenic family from epiplasmic proteins previously sequenced in other ciliates. The expression of Green Fluorescent Protein (GFP)-tagged epiplasmin showed significant labeling of epiplasmic scales as well as oral structures. We expect that the GFP construct described herein will prove to be a useful tool for comparative subcellular localization of different putative epiplasmins in Paramecium.

Multiplex analysis of DNA

DOEpatents

Church, George M.; Kieffer-Higgins, Stephen

1992-01-01

This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

Conformation of Tax-response elements in the human T-cell leukemia virus type I promoter.

PubMed

Cox, J M; Sloan, L S; Schepartz, A

1995-12-01

HTLV-I Tax is believed to activate viral gene expression by binding bZIP proteins (such as CREB) and increasing their affinities for proviral TRE target sites. Each 21 bp TRE target site contains an imperfect copy of the intrinsically bent CRE target site (the TRE core) surrounded by highly conserved flanking sequences. These flanking sequences are essential for maximal increases in DNA affinity and transactivation, but they are not, apparently, contacted by protein. Here we employ non-denaturing gel electrophoresis to evaluate TRE conformation in the presence and absence of bZIP proteins, and to explore the role of DNA conformation in viral transactivation. Our results show that the TRE-1 flanking sequences modulate the structure and modestly increase the affinity of a CREB bZIP peptide for the TRE-1 core recognition sequence. These flanking sequences are also essential for a maximal increase in stability of the CREB-DNA complex in the presence of Tax. The CRE-like TRE core and the TRE flanking sequences are both essential for formation of stable CREB-TRE-1 and Tax-CREB-TRE-1 complexes. These two DNA segments may have co-evolved into a unique structure capable of recognizing Tax and a bZIP protein.

Efficient Processing of the Immunodominant, HLA-A*0201-Restricted Human Immunodeficiency Virus Type 1 Cytotoxic T-Lymphocyte Epitope despite Multiple Variations in the Epitope Flanking Sequences

PubMed Central

Brander, Christian; Yang, Otto O.; Jones, Norman G.; Lee, Yun; Goulder, Philip; Johnson, R. Paul; Trocha, Alicja; Colbert, David; Hay, Christine; Buchbinder, Susan; Bergmann, Cornelia C.; Zweerink, Hans J.; Wolinsky, Steven; Blattner, William A.; Kalams, Spyros A.; Walker, Bruce D.

1999-01-01

Immune escape from cytotoxic T-lymphocyte (CTL) responses has been shown to occur not only by changes within the targeted epitope but also by changes in the flanking sequences which interfere with the processing of the immunogenic peptide. However, the frequency of such an escape mechanism has not been determined. To investigate whether naturally occurring variations in the flanking sequences of an immunodominant human immunodeficiency virus type 1 (HIV-1) Gag CTL epitope prevent antigen processing, cells infected with HIV-1 or vaccinia virus constructs encoding different patient-derived Gag sequences were tested for recognition by HLA-A*0201-restricted, p17-specific CTL. We found that the immunodominant p17 epitope (SL9) and its variants were efficiently processed from minigene expressing vectors and from six HIV-1 Gag variants expressed by recombinant vaccinia virus constructs. Furthermore, SL9-specific CTL clones derived from multiple donors efficiently inhibited virus replication when added to HLA-A*0201-bearing cells infected with primary or laboratory-adapted strains of virus, despite the variability in the SL9 flanking sequences. These data suggest that escape from this immunodominant CTL response is not frequently accomplished by changes in the epitope flanking sequences. PMID:10559335

Application safety evaluation of the radio frequency identification tag under magnetic resonance imaging.

PubMed

Fei, Xiaolu; Li, Shanshan; Gao, Shan; Wei, Lan; Wang, Lihong

2014-09-04

Radio Frequency Identification(RFID) has been widely used in healthcare facilities, but it has been paid little attention whether RFID applications are safe enough under healthcare environment. The purpose of this study is to assess the effects of RFID tags on Magnetic Resonance (MR) imaging in a typical electromagnetic environment in hospitals, and to evaluate the safety of their applications. A Magphan phantom was used to simulate the imaging objects, while active RFID tags were placed at different distances (0, 4, 8, 10 cm) from the phantom border. The phantom was scanned by using three typical sequences including spin-echo (SE) sequence, gradient-echo (GRE) sequence and inversion-recovery (IR) sequence. The quality of the image was quantitatively evaluated by using signal-to-noise ratio (SNR), uniformity, high-contrast resolution, and geometric distortion. RFID tags were read by an RFID reader to calculate their usable rate. RFID tags can be read properly after being placed in high magnetic field for up to 30 minutes. SNR: There were no differences between the group with RFID tags and the group without RFID tags using SE and IR sequence, but it was lower when using GRE sequence.Uniformity: There was a significant difference between the group with RFID tags and the group without RFID tags using SE and GRE sequence. Geometric distortion and high-contrast resolution: There were no obvious differences found. Active RFID tags can affect MR imaging quality, especially using the GRE sequence. Increasing the distance from the RFID tags to the imaging objects can reduce that influence. When the distance was longer than 8 cm, MR imaging quality were almost unaffected. However, the Gradient Echo related sequence is not recommended when patients wear a RFID wristband.

Elements in the transcriptional regulatory region flanking herpes simplex virus type 1 oriS stimulate origin function.

PubMed

Wong, S W; Schaffer, P A

1991-05-01

Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.

GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

2012-01-01

T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

Molecular analysis of the glucocerebrosidase gene locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winfield, S.L.; Martin, B.M.; Fandino, A.

1994-09-01

Gaucher disease is due to a deficiency in the activity of the lysosomal enzyme glucocerebrosidase. Both the functional gene for this enzyme and a pseudogene are located in close proximity on chromosome 1q21. Analysis of the mutations present in patient samples has suggested interaction between the functional gene and the pseudogene in the origin of mutant genotypes. To investigate the involvement of regions flanking the functional gene and pseudogene in the origin of mutations found in Gaucher disease, a YAC clone containing DNA from this locus has been subcloned and characterized. The original YAC containing {approximately}360 kb was truncated withmore » the use of fragmentation plasmids to about 85 kb. A lambda library derived from this YAC was screened to obtain clones containing glucocerebrosidase sequences. PCR amplification was used to identify subclones containing 5{prime}, central, or 3{prime} sequences of the functional gene or of the pseudogene. Clones spanning the entire distance from the last exon of the functional gene to intron 1 of the pseudogene, the 5{prime} end of the functional gene and 16 kb of 5{prime} flanking region and approximately 15 kb of 3{prime} flanking region of the pseudogene were sequenced. Sequence data from 48 kb of intergenic and flanking regions of the glucocerebrosidase gene and its pseudogene has been generated. A large number of Alu sequences and several simple repeats have been found. Two of these repeats exhibit fragment length polymorphism. There is almost 100% homology between the 3{prime} flanking regions of the functional gene and the pseudogene, extending to about 4 kb past the termination codons. A much lower degree of homology is observed in the 5{prime} flanking region. Patient samples are currently being screened for polymorphisms in these flanking regions.« less

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Generation of a Maize B Centromere Minimal Map Containing the Central Core Domain.

PubMed

Ellis, Nathanael A; Douglas, Ryan N; Jackson, Caroline E; Birchler, James A; Dawe, R Kelly

2015-10-28

The maize B centromere has been used as a model for centromere epigenetics and as the basis for building artificial chromosomes. However, there are no sequence resources for this important centromere. Here we used transposon display for the centromere-specific retroelement CRM2 to identify a collection of 40 sequence tags that flank CRM2 insertion points on the B chromosome. These were confirmed to lie within the centromere by assaying deletion breakpoints from centromere misdivision derivatives (intracentromere breakages caused by centromere fission). Markers were grouped together on the basis of their association with other markers in the misdivision series and assembled into a pseudocontig containing 10.1 kb of sequence. To identify sequences that interact directly with centromere proteins, we carried out chromatin immunoprecipitation using antibodies to centromeric histone H3 (CENH3), a defining feature of functional centromeric sequences. The CENH3 chromatin immunoprecipitation map was interpreted relative to the known transmission rates of centromere misdivision derivatives to identify a centromere core domain spanning 33 markers. A subset of seven markers was mapped in additional B centromere misdivision derivatives with the use of unique primer pairs. A derivative previously shown to have no canonical centromere sequences (Telo3-3) lacks these core markers. Our results provide a molecular map of the B chromosome centromere and identify key sequences within the map that interact directly with centromeric histone H3. Copyright © 2015 Ellis et al.

"De-novo" amino acid sequence elucidation of protein G'e by combined "top-down" and "bottom-up" mass spectrometry.

PubMed

Yefremova, Yelena; Al-Majdoub, Mahmoud; Opuni, Kwabena F M; Koy, Cornelia; Cui, Weidong; Yan, Yuetian; Gross, Michael L; Glocker, Michael O

2015-03-01

Mass spectrometric de-novo sequencing was applied to review the amino acid sequence of a commercially available recombinant protein G´ with great scientific and economic importance. Substantial deviations to the published amino acid sequence (Uniprot Q54181) were found by the presence of 46 additional amino acids at the N-terminus, including a so-called "His-tag" as well as an N-terminal partial α-N-gluconoylation and α-N-phosphogluconoylation, respectively. The unexpected amino acid sequence of the commercial protein G' comprised 241 amino acids and resulted in a molecular mass of 25,998.9 ± 0.2 Da for the unmodified protein. Due to the higher mass that is caused by its extended amino acid sequence compared with the original protein G' (185 amino acids), we named this protein "protein G'e." By means of mass spectrometric peptide mapping, the suggested amino acid sequence, as well as the N-terminal partial α-N-gluconoylations, was confirmed with 100% sequence coverage. After the protein G'e sequence was determined, we were able to determine the expression vector pET-28b from Novagen with the Xho I restriction enzyme cleavage site as the best option that was used for cloning and expressing the recombinant protein G'e in E. coli. A dissociation constant (K(d)) value of 9.4 nM for protein G'e was determined thermophoretically, showing that the N-terminal flanking sequence extension did not cause significant changes in the binding affinity to immunoglobulins.

Engineering Protein Hydrogels Using SpyCatcher-SpyTag Chemistry.

PubMed

Gao, Xiaoye; Fang, Jie; Xue, Bin; Fu, Linglan; Li, Hongbin

2016-09-12

Constructing hydrogels from engineered proteins has attracted significant attention within the material sciences, owing to their myriad potential applications in biomedical engineering. Developing efficient methods to cross-link tailored protein building blocks into hydrogels with desirable mechanical, physical, and functional properties is of paramount importance. By making use of the recently developed SpyCatcher-SpyTag chemistry, we successfully engineered protein hydrogels on the basis of engineered tandem modular elastomeric proteins. Our resultant protein hydrogels are soft but stable, and show excellent biocompatibility. As the first step, we tested the use of these hydrogels as a drug carrier, as well as in encapsulating human lung fibroblast cells. Our results demonstrate the robustness of the SpyCatcher-SpyTag chemistry, even when the SpyTag (or SpyCatcher) is flanked by folded globular domains. These results demonstrate that SpyCatcher-SpyTag chemistry can be used to engineer protein hydrogels from tandem modular elastomeric proteins that can find applications in tissue engineering, in fundamental mechano-biological studies, and as a controlled drug release vehicle.

Exploiting Multisite Gateway and pENFRUIT plasmid collection for fruit genetic engineering.

PubMed

Estornell, Leandro H; Granell, Antonio; Orzaez, Diego

2012-01-01

MultiSite Gateway cloning techniques based on homologous recombination facilitate the combinatorial assembly of basic genetic pieces (i.e., promoters, CDS, and terminators) into gene expression or gene silencing cassettes. pENFRUIT is a collection of MultiSite Triple Gateway Entry vectors dedicated to genetic engineering in fruits. It comprises a number of fruit-operating promoters as well as C-terminal tags adapted to the Gateway standard. In this way, flanking regulatory/labeling sequences can be easily Gateway-assembled with a given gene of interest for its ectopic expression or silencing in fruits. The resulting gene constructs can be analyzed in stable transgenic plants or in transient expression assays, the latter allowing fast testing of the increasing number of combinations arising from MultiSite methodology. A detailed description of the use of MultiSite cloning methodology for the assembly of pENFRUIT elements is presented.

Evolution of the dispersed SUC gene family of Saccharomyces by rearrangements of chromosome telomeres.

PubMed Central

Carlson, M; Celenza, J L; Eng, F J

1985-01-01

The SUC gene family of Saccharomyces contains six structural genes for invertase (SUC1 through SUC5 and SUC7) which are located on different chromosomes. Most yeast strains do not carry all six SUC genes and instead carry natural negative (suc0) alleles at some or all SUC loci. We determined the physical structures of SUC and suc0 loci. Except for SUC2, which is an unusual member of the family, all of the SUC genes are located very close to telomeres and are flanked by homologous sequences. On the centromere-proximal side of the gene, the conserved region contains X sequences, which are sequences found adjacent to telomeres (C. S. M. Chan and B.-K. Tye, Cell 33:563-573, 1983). On the other side of the gene, the homology includes about 4 kilobases of flanking sequence and then extends into a Y' element, which is an element often found distal to the X sequence at telomeres (Chan and Tye, Cell 33:563-573, 1983). Thus, these SUC genes and flanking sequences are embedded in telomere-adjacent sequences. Chromosomes carrying suc0 alleles (except suc20) lack SUC structural genes and portions of the conserved flanking sequences. The results indicate that the dispersal of SUC genes to different chromosomes occurred by rearrangements of chromosome telomeres. Images PMID:3018485

[Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

PubMed

Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

2015-04-01

This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Resolving Relationships among the Megadiverse Butterflies and Moths with a Novel Pipeline for Anchored Phylogenomics.

PubMed

Breinholt, Jesse W; Earl, Chandra; Lemmon, Alan R; Lemmon, Emily Moriarty; Xiao, Lei; Kawahara, Akito Y

2018-01-01

The advent of next-generation sequencing technology has allowed for thecollection of large portions of the genome for phylogenetic analysis. Hybrid enrichment and transcriptomics are two techniques that leverage next-generation sequencing and have shown much promise. However, methods for processing hybrid enrichment data are still limited. We developed a pipeline for anchored hybrid enrichment (AHE) read assembly, orthology determination, contamination screening, and data processing for sequences flanking the target "probe" region. We apply this approach to study the phylogeny of butterflies and moths (Lepidoptera), a megadiverse group of more than 157,000 described species with poorly understood deep-level phylogenetic relationships. We introduce a new, 855 locus AHE kit for Lepidoptera phylogenetics and compare resulting trees to those from transcriptomes. The enrichment kit was designed from existing genomes, transcriptomes, and expressed sequence tags and was used to capture sequence data from 54 species from 23 lepidopteran families. Phylogenies estimated from AHE data were largely congruent with trees generated from transcriptomes, with strong support for relationships at all but the deepest taxonomic levels. We combine AHE and transcriptomic data to generate a new Lepidoptera phylogeny, representing 76 exemplar species in 42 families. The tree provides robust support for many relationships, including those among the seven butterfly families. The addition of AHE data to an existing transcriptomic dataset lowers node support along the Lepidoptera backbone, but firmly places taxa with AHE data on the phylogeny. Combining taxa sequenced for AHE with existing transcriptomes and genomes resulted in a tree with strong support for (Calliduloidea $+$ Gelechioidea $+$ Thyridoidea) $+$ (Papilionoidea $+$ Pyraloidea $+$ Macroheterocera). To examine the efficacy of AHE at a shallow taxonomic level, phylogenetic analyses were also conducted on a sister group representing a more recent divergence, the Saturniidae and Sphingidae. These analyses utilized sequences from the probe region and data flanking it, nearly doubled the size of the dataset; resulting trees supported new phylogenetics relationships, especially within the Saturniidae and Sphingidae (e.g., Hemarina derived in the latter). We hope that our data processing pipeline, hybrid enrichment gene set, and approach of combining AHE data with transcriptomes will be useful for the broader systematics community. © The Author(s) 2017. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

DAMe: a toolkit for the initial processing of datasets with PCR replicates of double-tagged amplicons for DNA metabarcoding analyses.

PubMed

Zepeda-Mendoza, Marie Lisandra; Bohmann, Kristine; Carmona Baez, Aldo; Gilbert, M Thomas P

2016-05-03

DNA metabarcoding is an approach for identifying multiple taxa in an environmental sample using specific genetic loci and taxa-specific primers. When combined with high-throughput sequencing it enables the taxonomic characterization of large numbers of samples in a relatively time- and cost-efficient manner. One recent laboratory development is the addition of 5'-nucleotide tags to both primers producing double-tagged amplicons and the use of multiple PCR replicates to filter erroneous sequences. However, there is currently no available toolkit for the straightforward analysis of datasets produced in this way. We present DAMe, a toolkit for the processing of datasets generated by double-tagged amplicons from multiple PCR replicates derived from an unlimited number of samples. Specifically, DAMe can be used to (i) sort amplicons by tag combination, (ii) evaluate PCR replicates dissimilarity, and (iii) filter sequences derived from sequencing/PCR errors, chimeras, and contamination. This is attained by calculating the following parameters: (i) sequence content similarity between the PCR replicates from each sample, (ii) reproducibility of each unique sequence across the PCR replicates, and (iii) copy number of the unique sequences in each PCR replicate. We showcase the insights that can be obtained using DAMe prior to taxonomic assignment, by applying it to two real datasets that vary in their complexity regarding number of samples, sequencing libraries, PCR replicates, and used tag combinations. Finally, we use a third mock dataset to demonstrate the impact and importance of filtering the sequences with DAMe. DAMe allows the user-friendly manipulation of amplicons derived from multiple samples with PCR replicates built in a single or multiple sequencing libraries. It allows the user to: (i) collapse amplicons into unique sequences and sort them by tag combination while retaining the sample identifier and copy number information, (ii) identify sequences carrying unused tag combinations, (iii) evaluate the comparability of PCR replicates of the same sample, and (iv) filter tagged amplicons from a number of PCR replicates using parameters of minimum length, copy number, and reproducibility across the PCR replicates. This enables an efficient analysis of complex datasets, and ultimately increases the ease of handling datasets from large-scale studies.

Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

PubMed

Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2013-05-01

In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

PubMed Central

Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

1993-01-01

The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Photo-identification as a simple tool for studying invasive lionfish Pterois volitans populations.

PubMed

Chaves, L C T; Hall, J; Feitosa, J L L; Côté, I M

2016-02-01

Photo-tagging, i.e. using a specific software to match colour patterns on photographs, was tested as a means to identify individual Indo-Pacific Pterois volitans to assist with population and movement studies of this invasive species. The stripe pattern on the flank of adult P. volitans (n = 48) was the most individually distinctive of three body regions tested, leading to correct individual identification on 68 and 82% of tests with a single and two images of the reference individual, respectively. Photo-tagging is inexpensive, logistically simple and can involve citizen scientists, making it a viable alternative to traditional tagging to provide information on P. volitans distribution, movement patterns and recolonization rates after removals. © 2015 The Fisheries Society of the British Isles.

Site directed recombination

DOEpatents

Jurka, Jerzy W.

1997-01-01

Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.

Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication.

PubMed

Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

2016-06-04

Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.

Functional Analyses of a Novel Splice Variant in the CHD7 Gene, Found by Next Generation Sequencing, Confirm Its Pathogenicity in a Spanish Patient and Diagnose Him with CHARGE Syndrome.

PubMed

Villate, Olatz; Ibarluzea, Nekane; Fraile-Bethencourt, Eugenia; Valenzuela, Alberto; Velasco, Eladio A; Grozeva, Detelina; Raymond, F L; Botella, María P; Tejada, María-Isabel

2018-01-01

Mutations in CHD7 have been shown to be a major cause of CHARGE syndrome, which presents many symptoms and features common to other syndromes making its diagnosis difficult. Next generation sequencing (NGS) of a panel of intellectual disability related genes was performed in an adult patient without molecular diagnosis. A splice donor variant in CHD7 (c.5665 + 1G > T) was identified. To study its potential pathogenicity, exons and flanking intronic sequences were amplified from patient DNA and cloned into the pSAD ® splicing vector. HeLa cells were transfected with this construct and a wild-type minigene and functional analysis were performed. The construct with the c.5665 + 1G > T variant produced an aberrant transcript with an insert of 63 nucleotides of intron 28 creating a premature termination codon (TAG) 25 nucleotides downstream. This would lead to the insertion of 8 new amino acids and therefore a truncated 1896 amino acid protein. As a result of this, the patient was diagnosed with CHARGE syndrome. Functional analyses underline their usefulness for studying the pathogenicity of variants found by NGS and therefore its application to accurately diagnose patients.

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

Efficient gusA transient expression in Porphyra yezoensis protoplasts mediated by endogenous beta-tubulin flanking sequences

NASA Astrophysics Data System (ADS)

Gong, Qianhong; Yu, Wengong; Dai, Jixun; Liu, Hongquan; Xu, Rifu; Guan, Huashi; Pan, Kehou

2007-01-01

Endogenous tubulin promoter has been widely used for expressing foreign genes in green algae, but the efficiency and feasibility of endogenous tubulin promoter in the economically important Porphyra yezoensis (Rhodophyta) are unknown. In this study, the flanking sequences of beta-tubulin gene from P. yezoensis were amplified and two transient expression vectors were constructed to determine their transcription promoting feasibility for foreign gene gusA. The testing vector pATubGUS was constructed by inserting 5'-and 3'-flanking regions ( Tub5' and Tub3') up-and down-stream of β-glucuronidase (GUS) gene ( gusA), respectively, into pA, a derivative of pCAT®3-enhancer vector. The control construct, pAGUSTub3, contains only gusA and Tub3'. These constructs were electroporated into P. yezoensis protoplasts and the GUS activities were quantitatively analyzed by spectrometry. The results demonstrated that gusA gene was efficiently expressed in P. yezoensis protoplasts under the regulation of 5'-flanking sequence of the beta-tubulin gene. More interestingly, the pATubGUS produced stronger GUS activity in P. yezoensis protoplasts when compared to the result from pBI221, in which the gusA gene was directed by a constitutive CaMV 35S promoter. The data suggest that the integration of P. yezoensis protoplast and its endogenous beta-tubulin flanking sequences is a potential novel system for foreign gene expression.

Isolation and molecular characterization of dTnp1, a mobile and defective transposable element of Nicotiana plumbaginifolia.

PubMed

Meyer, C; Pouteau, S; Rouzé, P; Caboche, M

1994-01-01

By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus).

PubMed

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from 'Arka Manik' × 'TS34' and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits.

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus)

PubMed Central

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from ‘Arka Manik’ × ‘TS34’ and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits. PMID:26700647

TagDust2: a generic method to extract reads from sequencing data.

PubMed

Lassmann, Timo

2015-01-28

Arguably the most basic step in the analysis of next generation sequencing data (NGS) involves the extraction of mappable reads from the raw reads produced by sequencing instruments. The presence of barcodes, adaptors and artifacts subject to sequencing errors makes this step non-trivial. Here I present TagDust2, a generic approach utilizing a library of hidden Markov models (HMM) to accurately extract reads from a wide array of possible read architectures. TagDust2 extracts more reads of higher quality compared to other approaches. Processing of multiplexed single, paired end and libraries containing unique molecular identifiers is fully supported. Two additional post processing steps are included to exclude known contaminants and filter out low complexity sequences. Finally, TagDust2 can automatically detect the library type of sequenced data from a predefined selection. Taken together TagDust2 is a feature rich, flexible and adaptive solution to go from raw to mappable NGS reads in a single step. The ability to recognize and record the contents of raw reads will help to automate and demystify the initial, and often poorly documented, steps in NGS data analysis pipelines. TagDust2 is freely available at: http://tagdust.sourceforge.net .

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

Single-molecule DNA unzipping reveals asymmetric modulation of a transcription factor by its binding site sequence and context

PubMed Central

Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa

2018-01-01

Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225

Novel green tissue-specific synthetic promoters and cis-regulatory elements in rice.

PubMed

Wang, Rui; Zhu, Menglin; Ye, Rongjian; Liu, Zuoxiong; Zhou, Fei; Chen, Hao; Lin, Yongjun

2015-12-11

As an important part of synthetic biology, synthetic promoter has gradually become a hotspot in current biology. The purposes of the present study were to synthesize green tissue-specific promoters and to discover green tissue-specific cis-elements. We first assembled several regulatory sequences related to tissue-specific expression in different combinations, aiming to obtain novel green tissue-specific synthetic promoters. GUS assays of the transgenic plants indicated 5 synthetic promoters showed green tissue-specific expression patterns and different expression efficiencies in various tissues. Subsequently, we scanned and counted the cis-elements in different tissue-specific promoters based on the plant cis-elements database PLACE and the rice cDNA microarray database CREP for green tissue-specific cis-element discovery, resulting in 10 potential cis-elements. The flanking sequence of one potential core element (GEAT) was predicted by bioinformatics. Then, the combination of GEAT and its flanking sequence was functionally identified with synthetic promoter. GUS assays of the transgenic plants proved its green tissue-specificity. Furthermore, the function of GEAT flanking sequence was analyzed in detail with site-directed mutagenesis. Our study provides an example for the synthesis of rice tissue-specific promoters and develops a feasible method for screening and functional identification of tissue-specific cis-elements with their flanking sequences at the genome-wide level in rice.

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

PubMed

Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

2007-02-14

The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

High-resolution phylogenetic microbial community profiling

DOE PAGES

Singer, Esther; Bushnell, Brian; Coleman-Derr, Devin; ...

2016-02-09

Over the past decade, high-throughput short-read 16S rRNA gene amplicon sequencing has eclipsed clone-dependent long-read Sanger sequencing for microbial community profiling. The transition to new technologies has provided more quantitative information at the expense of taxonomic resolution with implications for inferring metabolic traits in various ecosystems. We applied single-molecule real-time sequencing for microbial community profiling, generating full-length 16S rRNA gene sequences at high throughput, which we propose to name PhyloTags. We benchmarked and validated this approach using a defined microbial community. When further applied to samples from the water column of meromictic Sakinaw Lake, we show that while community structuresmore » at the phylum level are comparable between PhyloTags and Illumina V4 16S rRNA gene sequences (iTags), variance increases with community complexity at greater water depths. PhyloTags moreover allowed less ambiguous classification. Last, a platform-independent comparison of PhyloTags and in silico generated partial 16S rRNA gene sequences demonstrated significant differences in community structure and phylogenetic resolution across multiple taxonomic levels, including a severe underestimation in the abundance of specific microbial genera involved in nitrogen and methane cycling across the Lake's water column. Thus, PhyloTags provide a reliable adjunct or alternative to cost-effective iTags, enabling more accurate phylogenetic resolution of microbial communities and predictions on their metabolic potential.« less

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

PubMed

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

Genomic organization of human fetal specific P-450IIIA7 (cytochrome P-450HFLa)-related gene(s) and interaction of transcriptional regulatory factor with its DNA element in the 5' flanking region.

PubMed

Itoh, S; Yanagimoto, T; Tagawa, S; Hashimoto, H; Kitamura, R; Nakajima, Y; Okochi, T; Fujimoto, S; Uchino, J; Kamataki, T

1992-03-24

P-450IIIA7 is a form of cytochrome P-450 which was isolated from human fetal livers and termed P-450HFLa. This form has been clarified to be expressed during fetal life specifically (Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. and Kamataki, T. (1990) Biochemistry 29, 4430-4433). In the present study, we isolated five independent clones which probably corresponded to the human P-450IIIA7 gene. These clones were completely sequenced, all exons, exon-intron junctions and the 5' flanking region from the cap site to-869. Although the sequences in the coding region were completely identical to P-450IIIA7, it is possible that genomic fragments sequenced in this study encode portions of other P-450IIIA7-related genes since we could not obtain a complete overlapping set of genomic clones. Within its 5' flanking sequence, the putative binding sites of several transcriptional regulatory factors existed. Among them, it was shown that a basic transcription element binding factor (BTEB) actually interacted with the 5' flanking region of this gene.

Exploring the Presence of microDNAs in Prostate Cancer Cell Lines, Tissue, and Sera of Prostate Cancer Patients and its Possible Application as Biomarker

DTIC Science & Technology

2016-04-01

Sequence tags were mapped on the human reference genome using the Novoalign software. Only those...ends of the linear islands to create a novel junctional sequence that does not exist in the genome . Thus the PE- sequence of a fragment that breaks at... genome (Fig. 3b). Those PE-tags where one tag maps uniquely to an island and the other remains unmapped, but passes the sequence quality filter,

Isolation and characterization of a Ds-tagged rice (Oryza sativa L.) GA-responsive dwarf mutant defective in an early step of the gibberellin biosynthesis pathway.

PubMed

Margis-Pinheiro, Marcia; Zhou, Xue-Rong; Zhu, Qian-Hao; Dennis, Elizabeth S; Upadhyaya, Narayana M

2005-03-01

We have isolated a severe dwarf transposon (Ds) insertion mutant in rice (Oryza sativa L.), which could be differentiated early in the seedling stage by reduced shoot growth and dark green leaves, and later by severe dwarfism and failure to initiate flowering. These mutants, however, showed normal seed germination and root growth. One of the sequences flanking Ds, rescued from the mutant, was of a chromosome 4-located putative ent-kaurene synthase (KS) gene, encoding the enzyme catalyzing the second step of the gibberellin (GA) biosynthesis pathway. Dwarf mutants were always homozygous for this Ds insertion and no normal plants homozygous for this mutation were recovered in the segregating progeny, indicating that the Ds insertion mutation is recessive. As mutations in three recently reported rice GA-responsive dwarf mutant alleles and the dwarf mutation identified in this study mapped to the same locus, we designate the corresponding gene OsKS1. The osks1 mutant seedlings were responsive to exogenous gibberellin (GA3). OsKS1 transcripts of about 2.3 kb were detected in leaves and stem of wild-type plants, but not in germinating seeds or roots, suggesting that OsKS1 is not involved in germination or root growth. There are at least five OsKS1-like genes in the rice genome, four of which are also represented in rice expressed sequence tag (EST) databases. All OsKS1-like genes are transcribed with different expression patterns. ESTs corresponding to all six OsKS genes are represented in other cereal databases including barley, wheat and maize, suggesting that they are biologically active.

Evaluation of anonymous and expressed sequence tag derived polymorphic microsatellite markers in the tobacco budworm Heliothis virescens (Lepidoptera: noctuidae)

USDA-ARS?s Scientific Manuscript database

Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...

Differential gene expression in the siphonophore Nanomia bijuga (Cnidaria) assessed with multiple next-generation sequencing workflows.

PubMed

Siebert, Stefan; Robinson, Mark D; Tintori, Sophia C; Goetz, Freya; Helm, Rebecca R; Smith, Stephen A; Shaner, Nathan; Haddock, Steven H D; Dunn, Casey W

2011-01-01

We investigated differential gene expression between functionally specialized feeding polyps and swimming medusae in the siphonophore Nanomia bijuga (Cnidaria) with a hybrid long-read/short-read sequencing strategy. We assembled a set of partial gene reference sequences from long-read data (Roche 454), and generated short-read sequences from replicated tissue samples that were mapped to the references to quantify expression. We collected and compared expression data with three short-read expression workflows that differ in sample preparation, sequencing technology, and mapping tools. These workflows were Illumina mRNA-Seq, which generates sequence reads from random locations along each transcript, and two tag-based approaches, SOLiD SAGE and Helicos DGE, which generate reads from particular tag sites. Differences in expression results across workflows were mostly due to the differential impact of missing data in the partial reference sequences. When all 454-derived gene reference sequences were considered, Illumina mRNA-Seq detected more than twice as many differentially expressed (DE) reference sequences as the tag-based workflows. This discrepancy was largely due to missing tag sites in the partial reference that led to false negatives in the tag-based workflows. When only the subset of reference sequences that unambiguously have tag sites was considered, we found broad congruence across workflows, and they all identified a similar set of DE sequences. Our results are promising in several regards for gene expression studies in non-model organisms. First, we demonstrate that a hybrid long-read/short-read sequencing strategy is an effective way to collect gene expression data when an annotated genome sequence is not available. Second, our replicated sampling indicates that expression profiles are highly consistent across field-collected animals in this case. Third, the impacts of partial reference sequences on the ability to detect DE can be mitigated through workflow choice and deeper reference sequencing.

Differential Gene Expression in the Siphonophore Nanomia bijuga (Cnidaria) Assessed with Multiple Next-Generation Sequencing Workflows

PubMed Central

Siebert, Stefan; Robinson, Mark D.; Tintori, Sophia C.; Goetz, Freya; Helm, Rebecca R.; Smith, Stephen A.; Shaner, Nathan; Haddock, Steven H. D.; Dunn, Casey W.

2011-01-01

We investigated differential gene expression between functionally specialized feeding polyps and swimming medusae in the siphonophore Nanomia bijuga (Cnidaria) with a hybrid long-read/short-read sequencing strategy. We assembled a set of partial gene reference sequences from long-read data (Roche 454), and generated short-read sequences from replicated tissue samples that were mapped to the references to quantify expression. We collected and compared expression data with three short-read expression workflows that differ in sample preparation, sequencing technology, and mapping tools. These workflows were Illumina mRNA-Seq, which generates sequence reads from random locations along each transcript, and two tag-based approaches, SOLiD SAGE and Helicos DGE, which generate reads from particular tag sites. Differences in expression results across workflows were mostly due to the differential impact of missing data in the partial reference sequences. When all 454-derived gene reference sequences were considered, Illumina mRNA-Seq detected more than twice as many differentially expressed (DE) reference sequences as the tag-based workflows. This discrepancy was largely due to missing tag sites in the partial reference that led to false negatives in the tag-based workflows. When only the subset of reference sequences that unambiguously have tag sites was considered, we found broad congruence across workflows, and they all identified a similar set of DE sequences. Our results are promising in several regards for gene expression studies in non-model organisms. First, we demonstrate that a hybrid long-read/short-read sequencing strategy is an effective way to collect gene expression data when an annotated genome sequence is not available. Second, our replicated sampling indicates that expression profiles are highly consistent across field-collected animals in this case. Third, the impacts of partial reference sequences on the ability to detect DE can be mitigated through workflow choice and deeper reference sequencing. PMID:21829563

Functional classification of rice flanking sequence tagged genes using MapMan terms and global understanding on metabolic and regulatory pathways affected by dxr mutant having defects in light response.

PubMed

Chandran, Anil Kumar Nalini; Lee, Gang-Seob; Yoo, Yo-Han; Yoon, Ung-Han; Ahn, Byung-Ohg; Yun, Doh-Won; Kim, Jin-Hyun; Choi, Hong-Kyu; An, GynHeung; Kim, Tae-Ho; Jung, Ki-Hong

2016-12-01

Rice is one of the most important food crops for humans. To improve the agronomical traits of rice, the functions of more than 1,000 rice genes have been recently characterized and summarized. The completed, map-based sequence of the rice genome has significantly accelerated the functional characterization of rice genes, but progress remains limited in assigning functions to all predicted non-transposable element (non-TE) genes, estimated to number 37,000-41,000. The International Rice Functional Genomics Consortium (IRFGC) has generated a huge number of gene-indexed mutants by using mutagens such as T-DNA, Tos17 and Ds/dSpm. These mutants have been identified by 246,566 flanking sequence tags (FSTs) and cover 65 % (25,275 of 38,869) of the non-TE genes in rice, while the mutation ratio of TE genes is 25.7 %. In addition, almost 80 % of highly expressed non-TE genes have insertion mutations, indicating that highly expressed genes in rice chromosomes are more likely to have mutations by mutagens such as T-DNA, Ds, dSpm and Tos17. The functions of around 2.5 % of rice genes have been characterized, and studies have mainly focused on transcriptional and post-transcriptional regulation. Slow progress in characterizing the function of rice genes is mainly due to a lack of clues to guide functional studies or functional redundancy. These limitations can be partially solved by a well-categorized functional classification of FST genes. To create this classification, we used the diverse overviews installed in the MapMan toolkit. Gene Ontology (GO) assignment to FST genes supplemented the limitation of MapMan overviews. The functions of 863 of 1,022 known genes can be evaluated by current FST lines, indicating that FST genes are useful resources for functional genomic studies. We assigned 16,169 out of 29,624 FST genes to 34 MapMan classes, including major three categories such as DNA, RNA and protein. To demonstrate the MapMan application on FST genes, transcriptome analysis was done from a rice mutant of 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) gene with FST. Mapping of 756 down-regulated genes in dxr mutants and their annotation in terms of various MapMan overviews revealed candidate genes downstream of DXR-mediating light signaling pathway in diverse functional classes such as the methyl-D-erythritol 4-phosphatepathway (MEP) pathway overview, photosynthesis, secondary metabolism and regulatory overview. This report provides a useful guide for systematic phenomics and further applications to enhance the key agronomic traits of rice.

A Versatile Transposon-Based Activation Tag Vector System for Functional Genomics in Cereals and Other Monocot Plants1[OA

PubMed Central

Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan

2008-01-01

Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.

PubMed

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-03-12

ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter

PubMed Central

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-01-01

ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529

Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

PubMed

Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

2009-11-25

Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

Amplification and chromosomal dispersion of human endogenous retroviral sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steele, P.E.; Martin, M.A.; Rabson, A.B.

1986-09-01

Endogenous retroviral sequences have undergone amplification events involving both viral and flanking cellular sequences. The authors cloned members of an amplified family of full-length endogenous retroviral sequences. Genomic blotting, employing a flanking cellular DNA probe derived from a member of this family, revealed a similar array of reactive bands in both humans and chimpanzees, indicating that an amplification event involving retroviral and associated cellular DNA sequences occurred before the evolutionary separation of these two primates. Southern analyses of restricted somatic cell hybrid DNA preparations suggested that endogenous retroviral segments are widely dispersed in the human genome and that amplification andmore » dispersion events may be linked.« less

Mapping of herpes simplex virus-1 neurovirulence to. gamma. sub 1 34. 5, a gene nonessential for growth in culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chou, J.; Roizman, B.; Kern, E.R.

1990-11-30

The gene designated {gamma}{sub 1}34.5 maps in the inverted repeats flanking the long unique sequence of herpes simplex virus-1 (HSV-1) DNA, and therefore it is present in two copies per genome. This gene is not essential for viral growth in cell culture. Four recombinant viruses were genetically engineered to test the function of this gene. These were (i) a virus from which both copies of the gene were deleted, (ii) a virus containing a stop codon in both copies of the gene, (iii) a virus containing after the first codon an insert encoding a 16-amino acid epitope known to reactmore » with a specific monoclonal antibody, and (iv) a virus in which the deleted sequences were restored. The viruses from which the gene was deleted or which carried stop codons were avirulent on intracerebral inoculation of mice. The virus with the gene tagged by the sequence encoding the epitope was moderately virulent, whereas the restored virus reacquired the phenotype of the parent virus. Significant amounts of virus were recovered only from brains of animals inoculated with virulent viruses. Inasmuch as the product of the {gamma}{sub 1}34.5 gene extended the host range of the virus by enabling it to replicate and destroy brain cells, it is a viral neurovirulence factor.« less

Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication

PubMed Central

Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

2016-01-01

Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to “Gopoong” and “K-1” were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information. PMID:27271615

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

PubMed

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

Serial analysis of gene expression (SAGE) in normal human trabecular meshwork.

PubMed

Liu, Yutao; Munro, Drew; Layfield, David; Dellinger, Andrew; Walter, Jeffrey; Peterson, Katherine; Rickman, Catherine Bowes; Allingham, R Rand; Hauser, Michael A

2011-04-08

To identify the genes expressed in normal human trabecular meshwork tissue, a tissue critical to the pathogenesis of glaucoma. Total RNA was extracted from human trabecular meshwork (HTM) harvested from 3 different donors. Extracted RNA was used to synthesize individual SAGE (serial analysis of gene expression) libraries using the I-SAGE Long kit from Invitrogen. Libraries were analyzed using SAGE 2000 software to extract the 17 base pair sequence tags. The extracted sequence tags were mapped to the genome using SAGE Genie map. A total of 298,834 SAGE tags were identified from all HTM libraries (96,842, 88,126, and 113,866 tags, respectively). Collectively, there were 107,325 unique tags. There were 10,329 unique tags with a minimum of 2 counts from a single library. These tags were mapped to known unique Unigene clusters. Approximately 29% of the tags (orphan tags) did not map to a known Unigene cluster. Thirteen percent of the tags mapped to at least 2 Unigene clusters. Sequence tags from many glaucoma-related genes, including myocilin, optineurin, and WD repeat domain 36, were identified. This is the first time SAGE analysis has been used to characterize the gene expression profile in normal HTM. SAGE analysis provides an unbiased sampling of gene expression of the target tissue. These data will provide new and valuable information to improve understanding of the biology of human aqueous outflow.

Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

PubMed

Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

2003-09-01

Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

Influence of flanking sequences on variability in expression levels of an introduced gene in transgenic tobacco plants.

PubMed Central

Dean, C; Jones, J; Favreau, M; Dunsmuir, P; Bedbrook, J

1988-01-01

The petunia rbcS gene SSU301 was introduced into tobacco using Agrobacterium tumefaciens-mediated transformation. The time at which rbcS expression was maximal after transfer of the tobacco plants to the greenhouse was determined. The expression level of the SSU301 gene varied up to 9 fold between individual tobacco plants which had been standardized physiologically as much as possible. The presence of adjacent pUC plasmid sequences did not affect the expression of the SSU301 gene. In an attempt to reduce the between-transformant variability in expression, the SSU301 gene was introduced into tobacco surrounded by 10kb of 5' and 13 kb of 3' DNA sequences which normally flank SSU301 in petunia. The longer flanking regions did not reduce the between-transformant variability of SSU301 gene expression. Images PMID:3174450

Identification of differentially expressed genes in cucumber (Cucumis sativus L.) root under waterlogging stress by digital gene expression profile.

PubMed

Qi, Xiao-Hua; Xu, Xue-Wen; Lin, Xiao-Jian; Zhang, Wen-Jie; Chen, Xue-Hao

2012-03-01

High-throughput tag-sequencing (Tag-seq) analysis based on the Solexa Genome Analyzer platform was applied to analyze the gene expression profiling of cucumber plant at 5 time points over a 24h period of waterlogging treatment. Approximately 5.8 million total clean sequence tags per library were obtained with 143013 distinct clean tag sequences. Approximately 23.69%-29.61% of the distinct clean tags were mapped unambiguously to the unigene database, and 53.78%-60.66% of the distinct clean tags were mapped to the cucumber genome database. Analysis of the differentially expressed genes revealed that most of the genes were down-regulated in the waterlogging stages, and the differentially expressed genes mainly linked to carbon metabolism, photosynthesis, reactive oxygen species generation/scavenging, and hormone synthesis/signaling. Finally, quantitative real-time polymerase chain reaction using nine genes independently verified the tag-mapped results. This present study reveals the comprehensive mechanisms of waterlogging-responsive transcription in cucumber. Copyright © 2011 Elsevier Inc. All rights reserved.

Method to amplify variable sequences without imposing primer sequences

DOEpatents

Bradbury, Andrew M.; Zeytun, Ahmet

2006-11-14

The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

OSIRIS-REx Touch-And-Go (TAG) Navigation Performance

NASA Technical Reports Server (NTRS)

Berry, Kevin; Antreasian, Peter; Moreau, Michael C.; May, Alex; Sutter, Brian

2015-01-01

The Origins Spectral Interpretation Resource identification Security Regolith Explorer (OSIRIS-REx) mission is a NASA New Frontiers mission launching in 2016 to rendezvous with the near-Earth asteroid (101955) Bennu in late 2018. Following an extensive campaign of proximity operations activities to characterize the properties of Bennu and select a suitable sample site, OSIRIES-REx will fly a Touch-And-Go (TAG) trajectory to the asteroid's surface to obtain a regolith sample. The paper summarizes the mission design of the TAG sequence, the propulsive required to achieve the trajectory, and the sequence of events leading up to the TAG event. The paper will summarize the Monte-Carlo simulation of the TAG sequence and present analysis results that demonstrate the ability to conduct the TAG within 25 meters of the selected sample site and +-2 cms of the targeted contact velocity. The paper will describe some of the challenges associated with conducting precision navigation operations and ultimately contacting a very small asteroid.

OSIRI-REx Touch and Go (TAG) Navigation Performance

NASA Technical Reports Server (NTRS)

Berry, Kevin; Antreasian, Peter; Moreau, Michael C.; May, Alex; Sutter, Brian

2015-01-01

The Origins Spectral Interpretation Resource Identification Security Regolith Explorer (OSIRIS-REx) mission is a NASA New Frontiers mission launching in 2016 to rendezvous with the near-Earth asteroid (101955) Bennu in late 2018. Following an extensive campaign of proximity operations activities to characterize the properties of Bennu and select a suitable sample site, OSIRIS-REx will fly a Touch-And-Go (TAG) trajectory to the asteroid's surface to obtain a regolith sample. The paper summarizes the mission design of the TAG sequence, the propulsive maneuvers required to achieve the trajectory, and the sequence of events leading up to the TAG event. The paper also summarizes the Monte-Carlo simulation of the TAG sequence and presents analysis results that demonstrate the ability to conduct the TAG within 25 meters of the selected sample site and 2 cm/s of the targeted contact velocity. The paper describes some of the challenges associated with conducting precision navigation operations and ultimately contacting a very small asteroid.

Regional centromeres in the yeast Candida lusitaniae lack pericentromeric heterochromatin

PubMed Central

Kapoor, Shivali; Zhu, Lisha; Froyd, Cara; Liu, Tao; Rusche, Laura N.

2015-01-01

Point centromeres are specified by a short consensus sequence that seeds kinetochore formation, whereas regional centromeres lack a conserved sequence and instead are epigenetically inherited. Regional centromeres are generally flanked by heterochromatin that ensures high levels of cohesin and promotes faithful chromosome segregation. However, it is not known whether regional centromeres require pericentromeric heterochromatin. In the yeast Candida lusitaniae, we identified a distinct type of regional centromere that lacks pericentromeric heterochromatin. Centromere locations were determined by ChIP-sequencing of two key centromere proteins, Cse4 and Mif2, and are consistent with bioinformatic predictions. The centromeric DNA sequence was unique for each chromosome and spanned 4–4.5 kbp, consistent with regional epigenetically inherited centromeres. However, unlike other regional centromeres, there was no evidence of pericentromeric heterochromatin in C. lusitaniae. In particular, flanking genes were expressed at a similar level to the rest of the genome, and a URA3 reporter inserted adjacent to a centromere was not repressed. In addition, regions flanking the centromeric core were not associated with hypoacetylated histones or a sirtuin deacetylase that generates heterochromatin in other yeast. Interestingly, the centromeric chromatin had a distinct pattern of histone modifications, being enriched for methylated H3K79 and H3R2 but lacking methylation of H3K4, which is found at other regional centromeres. Thus, not all regional centromeres require flanking heterochromatin. PMID:26371315

Complete mitochondrial genome of Bactrocera arecae (Insecta: Tephritidae) by next-generation sequencing and molecular phylogeny of Dacini tribe

PubMed Central

Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Chan, Kok-Gan; Chow, Wan-Loo; Eamsobhana, Praphathip

2015-01-01

The whole mitochondrial genome of the pest fruit fly Bactrocera arecae was obtained from next-generation sequencing of genomic DNA. It had a total length of 15,900 bp, consisting of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a non-coding region (A + T-rich control region). The control region (952 bp) was flanked by rrnS and trnI genes. The start codons included 6 ATG, 3 ATT and 1 each of ATA, ATC, GTG and TCG. Eight TAA, two TAG, one incomplete TA and two incomplete T stop codons were represented in the protein-coding genes. The cloverleaf structure for trnS1 lacked the D-loop, and that of trnN and trnF lacked the TΨC-loop. Molecular phylogeny based on 13 protein-coding genes was concordant with 37 mitochondrial genes, with B. arecae having closest genetic affinity to B. tryoni. The subgenus Bactrocera of Dacini tribe and the Dacinae subfamily (Dacini and Ceratitidini tribes) were monophyletic. The whole mitogenome of B. arecae will serve as a useful dataset for studying the genetics, systematics and phylogenetic relationships of the many species of Bactrocera genus in particular, and tephritid fruit flies in general. PMID:26472633

BASIC: A Simple and Accurate Modular DNA Assembly Method.

PubMed

Storch, Marko; Casini, Arturo; Mackrow, Ben; Ellis, Tom; Baldwin, Geoff S

2017-01-01

Biopart Assembly Standard for Idempotent Cloning (BASIC) is a simple, accurate, and robust DNA assembly method. The method is based on linker-mediated DNA assembly and provides highly accurate DNA assembly with 99 % correct assemblies for four parts and 90 % correct assemblies for seven parts [1]. The BASIC standard defines a single entry vector for all parts flanked by the same prefix and suffix sequences and its idempotent nature means that the assembled construct is returned in the same format. Once a part has been adapted into the BASIC format it can be placed at any position within a BASIC assembly without the need for reformatting. This allows laboratories to grow comprehensive and universal part libraries and to share them efficiently. The modularity within the BASIC framework is further extended by the possibility of encoding ribosomal binding sites (RBS) and peptide linker sequences directly on the linkers used for assembly. This makes BASIC a highly versatile library construction method for combinatorial part assembly including the construction of promoter, RBS, gene variant, and protein-tag libraries. In comparison with other DNA assembly standards and methods, BASIC offers a simple robust protocol; it relies on a single entry vector, provides for easy hierarchical assembly, and is highly accurate for up to seven parts per assembly round [2].

Biothems: Sequence stratigraphic units and their implications for regional tectono-stratigraphic interpretations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lane, H.R.; Frye, M.W.; Couples, G.D.

1992-01-01

Biothems are regional wedge- or lens-shaped bodies of strata that are bounded shelfward or cratonward by paleontologically recognizable unconformities; generally thicken on marine shelves, where they are typically conformable with underlying and overlying biothems; are commonly thinner or represent starved sequences further basinward; and in their most basinward extent, are either bounded by biostratigraphically recognizable unconformities or are conformable with underlying and overlying biothems. As recognized to date, biothems have a logical distribution of faunal and floral components, as well as facies groupings that represent internally consistent and logical sequences of depositional environments. A west-to-east transect within the North Americanmore » Mississippian System which extends from the Basin and Range Province, across the Transcontinental Arch (TA), into the Anadarko Basin, was constructed to demonstrate the regional distribution and tectono-stratigraphic significance of biothems relative to the axis of the TA. The relationships portrayed on the transect, tied to an understanding of North American Mississippian paleogeography, imply that biothems deposited during relative highstand events on one flank of the TA are time-equivalent to biothems deposited during relative lowstand events on the opposite flank of the TA. This distribution is interpreted to have been controlled by intraplate tectonic events that formed piano key basins along the flanks of the TA. The spatial patterns of these basins are not consistent with published models of basin evolution. A further conclusion is that the lack of coincident, transgressive or regressive Mississippian biothems on either flank of the TA suggests that it is inadvisable to impose the Mississippi Valley-derived eustasy curve on western flank depositional sequences.« less

Methyl-CpG island-associated genome signature tags

DOEpatents

Dunn, John J

2014-05-20

Disclosed is a method for analyzing the organismic complexity of a sample through analysis of the nucleic acid in the sample. In the disclosed method, through a series of steps, including digestion with a type II restriction enzyme, ligation of capture adapters and linkers and digestion with a type IIS restriction enzyme, genome signature tags are produced. The sequences of a statistically significant number of the signature tags are determined and the sequences are used to identify and quantify the organisms in the sample. Various embodiments of the invention described herein include methods for using single point genome signature tags to analyze the related families present in a sample, methods for analyzing sequences associated with hyper- and hypo-methylated CpG islands, methods for visualizing organismic complexity change in a sampling location over time and methods for generating the genome signature tag profile of a sample of fragmented DNA.

Gene structure of CYP3A4, an adult-specific form of cytochrome P450 in human livers, and its transcriptional control.

PubMed

Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T

1993-12-01

CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.

An efficient annotation and gene-expression derivation tool for Illumina Solexa datasets.

PubMed

Hosseini, Parsa; Tremblay, Arianne; Matthews, Benjamin F; Alkharouf, Nadim W

2010-07-02

The data produced by an Illumina flow cell with all eight lanes occupied, produces well over a terabyte worth of images with gigabytes of reads following sequence alignment. The ability to translate such reads into meaningful annotation is therefore of great concern and importance. Very easily, one can get flooded with such a great volume of textual, unannotated data irrespective of read quality or size. CASAVA, a optional analysis tool for Illumina sequencing experiments, enables the ability to understand INDEL detection, SNP information, and allele calling. To not only extract from such analysis, a measure of gene expression in the form of tag-counts, but furthermore to annotate such reads is therefore of significant value. We developed TASE (Tag counting and Analysis of Solexa Experiments), a rapid tag-counting and annotation software tool specifically designed for Illumina CASAVA sequencing datasets. Developed in Java and deployed using jTDS JDBC driver and a SQL Server backend, TASE provides an extremely fast means of calculating gene expression through tag-counts while annotating sequenced reads with the gene's presumed function, from any given CASAVA-build. Such a build is generated for both DNA and RNA sequencing. Analysis is broken into two distinct components: DNA sequence or read concatenation, followed by tag-counting and annotation. The end result produces output containing the homology-based functional annotation and respective gene expression measure signifying how many times sequenced reads were found within the genomic ranges of functional annotations. TASE is a powerful tool to facilitate the process of annotating a given Illumina Solexa sequencing dataset. Our results indicate that both homology-based annotation and tag-count analysis are achieved in very efficient times, providing researchers to delve deep in a given CASAVA-build and maximize information extraction from a sequencing dataset. TASE is specially designed to translate sequence data in a CASAVA-build into functional annotations while producing corresponding gene expression measurements. Achieving such analysis is executed in an ultrafast and highly efficient manner, whether the analysis be a single-read or paired-end sequencing experiment. TASE is a user-friendly and freely available application, allowing rapid analysis and annotation of any given Illumina Solexa sequencing dataset with ease.

Evaluation of four surgical implantation techniques for age-0 white sturgeon ( Acipenser transmontanus Richardson, 1836) with a new acoustic transmitter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liss, S. A.; Ashton, N. K.; Brown, R. S.

A new acoustic transmitter (AT; cylindrical, 0.7 g in air, 24.2×5.0 mm, up to 365 d battery life) was developed to monitor age-0 sturgeon; however, an implantation technique is critical to provide guidance for its use in field research. The goal of this study was to evaluate four implantation techniques by assessing transmitter retention, survival, growth, and wound healing variables. White sturgeon (Acipenser transmontanus; n = 150, 35–116 g, 182–289 mm fork length) were separated into five treatments: 1) unmarked, 2) flank incision with one suture, 3) flank incision without a suture, 4) offline incision with one suture, and 5)more » offline incision without a suture. Tagged fish were implanted with a non-functioning AT and all fish were held for 28 days. There was 100% transmitter retention and no difference in survival or growth (by 14 d post-implantation) among treatments. Sutured treatments had greater inflammation and presence of ulceration and water mold than non-sutured. Offline incision fish were more susceptible to red vein aggregation than flank incision fish. Non-sutured treatments had greater openness than sutured, but only during the first 14 d post-implantation. The flank incision without a suture technique is recommended.« less

Microhomology-mediated end joining induces hypermutagenesis at breakpoint junctions

PubMed Central

Li, Fuyang; Villarreal, Diana; Shim, Jae Hoon; Myung, Kyungjae; Shim, Eun Yong; Lee, Sang Eun

2017-01-01

Microhomology (MH) flanking a DNA double-strand break (DSB) drives chromosomal rearrangements but its role in mutagenesis has not yet been analyzed. Here we determined the mutation frequency of a URA3 reporter gene placed at multiple locations distal to a DSB, which is flanked by different sizes (15-, 18-, or 203-bp) of direct repeat sequences for efficient repair in budding yeast. Induction of a DSB accumulates mutations in the reporter gene situated up to 14-kb distal to the 15-bp MH, but more modestly to those carrying 18- and 203-bp or no homology. Increased mutagenesis in MH-mediated end joining (MMEJ) appears coupled to its slower repair kinetics and the extensive resection occurring at flanking DNA. Chromosomal translocations via MMEJ also elevate mutagenesis of the flanking DNA sequences 7.1 kb distal to the breakpoint junction as compared to those without MH. The results suggest that MMEJ could destabilize genomes by triggering structural alterations and increasing mutation burden. PMID:28419093

Structure-Related Roles for the Conservation of the HIV-1 Fusion Peptide Sequence Revealed by Nuclear Magnetic Resonance.

PubMed

Serrano, Soraya; Huarte, Nerea; Rujas, Edurne; Andreu, David; Nieva, José L; Jiménez, María Angeles

2017-10-17

Despite extensive characterization of the human immunodeficiency virus type 1 (HIV-1) hydrophobic fusion peptide (FP), the structure-function relationships underlying its extraordinary degree of conservation remain poorly understood. Specifically, the fact that the tandem repeat of the FLGFLG tripeptide is absolutely conserved suggests that high hydrophobicity may not suffice to unleash FP function. Here, we have compared the nuclear magnetic resonance (NMR) structures adopted in nonpolar media by two FP surrogates, wtFP-tag and scrFP-tag, which had equal hydrophobicity but contained wild-type and scrambled core sequences LFLGFLG and FGLLGFL, respectively. In addition, these peptides were tagged at their C-termini with an epitope sequence that folded independently, thereby allowing Western blot detection without interfering with FP structure. We observed similar α-helical FP conformations for both specimens dissolved in the low-polarity medium 25% (v/v) 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), but important differences in contact with micelles of the membrane mimetic dodecylphosphocholine (DPC). Thus, whereas wtFP-tag preserved a helix displaying a Gly-rich ridge, the scrambled sequence lost in great part the helical structure upon being solubilized in DPC. Western blot analyses further revealed the capacity of wtFP-tag to assemble trimers in membranes, whereas membrane oligomers were not observed in the case of the scrFP-tag sequence. We conclude that, beyond hydrophobicity, preserving sequence order is an important feature for defining the secondary structures and oligomeric states adopted by the HIV FP in membranes.

Genetically encoded fluorescent tags

PubMed Central

Thorn, Kurt

2017-01-01

Genetically encoded fluorescent tags are protein sequences that can be fused to a protein of interest to render it fluorescent. These tags have revolutionized cell biology by allowing nearly any protein to be imaged by light microscopy at submicrometer spatial resolution and subsecond time resolution in a live cell or organism. They can also be used to measure protein abundance in thousands to millions of cells using flow cytometry. Here I provide an introduction to the different genetic tags available, including both intrinsically fluorescent proteins and proteins that derive their fluorescence from binding of either endogenous or exogenous fluorophores. I discuss their optical and biological properties and guidelines for choosing appropriate tags for an experiment. Tools for tagging nucleic acid sequences and reporter molecules that detect the presence of different biomolecules are also briefly discussed. PMID:28360214

Enhancing the GABI-Kat Arabidopsis thaliana T-DNA Insertion Mutant Database by Incorporating Araport11 Annotation.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd

2017-01-01

SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Regionally clustered ABCC8 polymorphisms in a prospective cohort predict cerebral oedema and outcome in severe traumatic brain injury.

PubMed

Jha, Ruchira Menka; Koleck, Theresa A; Puccio, Ava M; Okonkwo, David O; Park, Seo-Young; Zusman, Benjamin E; Clark, Robert S B; Shutter, Lori A; Wallisch, Jessica S; Empey, Philip E; Kochanek, Patrick M; Conley, Yvette P

2018-04-19

ABCC8 encodes sulfonylurea receptor 1, a key regulatory protein of cerebral oedema in many neurological disorders including traumatic brain injury (TBI). Sulfonylurea-receptor-1 inhibition has been promising in ameliorating cerebral oedema in clinical trials. We evaluated whether ABCC8 tag single-nucleotide polymorphisms predicted oedema and outcome in TBI. DNA was extracted from 485 prospectively enrolled patients with severe TBI. 410 were analysed after quality control. ABCC8 tag single-nucleotide polymorphisms (SNPs) were identified (Hapmap, r 2 >0.8, minor-allele frequency >0.20) and sequenced (iPlex-Gold, MassArray). Outcomes included radiographic oedema, intracranial pressure (ICP) and 3-month Glasgow Outcome Scale (GOS) score. Proxy SNPs, spatial modelling, amino acid topology and functional predictions were determined using established software programs. Wild-type rs7105832 and rs2237982 alleles and genotypes were associated with lower average ICP (β=-2.91, p=0.001; β=-2.28, p=0.003) and decreased radiographic oedema (OR 0.42, p=0.012; OR 0.52, p=0.017). Wild-type rs2237982 also increased favourable 3-month GOS (OR 2.45, p=0.006); this was partially mediated by oedema (p=0.03). Different polymorphisms predicted 3-month outcome: variant rs11024286 increased (OR 1.84, p=0.006) and wild-type rs4148622 decreased (OR 0.40, p=0.01) the odds of favourable outcome. Significant tag and concordant proxy SNPs regionally span introns/exons 2-15 of the 39-exon gene. This study identifies four ABCC8 tag SNPs associated with cerebral oedema and/or outcome in TBI, tagging a region including 33 polymorphisms. In polymorphisms predictive of oedema, variant alleles/genotypes confer increased risk. Different variant polymorphisms were associated with favourable outcome, potentially suggesting distinct mechanisms. Significant polymorphisms spatially clustered flanking exons encoding the sulfonylurea receptor site and transmembrane domain 0/loop 0 (juxtaposing the channel pore/binding site). This, if validated, may help build a foundation for developing future strategies that may guide individualised care, treatment response, prognosis and patient selection for clinical trials. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Digital transcriptome analysis of putative sex-determination genes in papaya (Carica papaya).

PubMed

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Y(h)) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Y(h) chromosome, implying a loss of many genes on the Y(h) chromosome. Nevertheless, candidate Y(h) chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya.

Digital Transcriptome Analysis of Putative Sex-Determination Genes in Papaya (Carica papaya)

PubMed Central

Urasaki, Naoya; Tarora, Kazuhiko; Shudo, Ayano; Ueno, Hiroki; Tamaki, Moritoshi; Miyagi, Norimichi; Adaniya, Shinichi; Matsumura, Hideo

2012-01-01

Papaya (Carica papaya) is a trioecious plant species that has male, female and hermaphrodite flowers on different plants. The primitive sex chromosomes genetically determine the sex of the papaya. Although draft sequences of the papaya genome are already available, the genes for sex determination have not been identified, likely due to the complicated structure of its sex-chromosome sequences. To identify the candidate genes for sex determination, we conducted a transcriptome analysis of flower samples from male, female and hermaphrodite plants using high-throughput SuperSAGE for digital gene expression analysis. Among the short sequence tags obtained from the transcripts, 312 unique tags were specifically mapped to the primitive sex chromosome (X or Yh) sequences. An annotation analysis revealed that retroelements are the most abundant sequences observed in the genes corresponding to these tags. The majority of tags on the sex chromosomes were located on the X chromosome, and only 30 tags were commonly mapped to both the X and Yh chromosome, implying a loss of many genes on the Yh chromosome. Nevertheless, candidate Yh chromosome-specific female determination genes, including a MADS-box gene, were identified. Information on these sex chromosome-specific expressed genes will help elucidating sex determination in the papaya. PMID:22815863

Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods

DOEpatents

Mayer-Cumblidge, M. Uljana; Cao, Haishi

2013-01-15

A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

Cyanine-based probe\\tag-peptide pair for fluorescence protein imaging and fluorescence protein imaging methods

DOEpatents

Mayer-Cumblidge, M Uljana [Richland, WA; Cao, Haishi [Richland, WA

2010-08-17

A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

Isolation of a promoter region in mouse cytochrome P450 3A (Cyp3A16) gene and its transcriptional control.

PubMed

Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T

1997-02-07

An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.

Towards Determination of Visual Requirements for Augmented Reality Displays and Virtual Environments for the Airport Tower

DTIC Science & Technology

2006-06-01

allowing substantial see-around capability. Regions of visual suppression due to binocular rivalry ( luning ) are shown along the shaded flanks of...that the visual suppression of binocular rivalry, luning , (Velger, 1998, p.56-58) associated with the partial overlap conditions did not materially...tags were displayed. Thus, the frequency of conflicting binocular contours was reduced. In any case, luning does not seem to introduce major

Gene Deletion in Barley Mediated by LTR-retrotransposon BARE

PubMed Central

Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao

2017-01-01

A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053

Peptides derivatized with bicyclic quaternary ammonium ionization tags. Sequencing via tandem mass spectrometry.

PubMed

Setner, Bartosz; Rudowska, Magdalena; Klem, Ewelina; Cebrat, Marek; Szewczuk, Zbigniew

2014-10-01

Improving the sensitivity of detection and fragmentation of peptides to provide reliable sequencing of peptides is an important goal of mass spectrometric analysis. Peptides derivatized by bicyclic quaternary ammonium ionization tags: 1-azabicyclo[2.2.2]octane (ABCO) or 1,4-diazabicyclo[2.2.2]octane (DABCO), are characterized by an increased detection sensitivity in electrospray ionization mass spectrometry (ESI-MS) and longer retention times on the reverse-phase (RP) chromatography columns. The improvement of the detection limit was observed even for peptides dissolved in 10 mM NaCl. Collision-induced dissociation tandem mass spectrometry of quaternary ammonium salts derivatives of peptides showed dominant a- and b-type ions, allowing facile sequencing of peptides. The bicyclic ionization tags are stable in collision-induced dissociation experiments, and the resulted fragmentation pattern is not significantly influenced by either acidic or basic amino acid residues in the peptide sequence. Obtained results indicate the general usefulness of the bicyclic quaternary ammonium ionization tags for ESI-MS/MS sequencing of peptides. Copyright © 2014 John Wiley & Sons, Ltd.

Application of Cydia pomonella expressed sequence tags: identification and expression of three general odorant binding proteins in codling moth

USDA-ARS?s Scientific Manuscript database

The codling moth, Cydia pomonella, is one of the most important pests of pome fruits in the world, yet the molecular genetics and physiology of this insect remains poorly understood. A combined assembly of 8340 expressed sequence tags (ESTs) was generated from Roche 454 GS-FLX sequencing of 8 tissu...

Isolation and Identification of Pathogenicity Mutant of Curvularia lunata via Restriction Enzyme-Mediated Integration.

PubMed

Wang, Y J; Liu, T; Hou, J M; Zuo, Y H

2013-09-01

In this report, 156 hygromycin-resistant mutants were generated via restriction enzyme-mediated insertional (REMI) mutagenesis. All mutants were subjected to a bioassay on detached leaves. Five mutants (T4, T39, T71, T91, and T135) showed reduced symptom development, whereas one mutant (T120) did not exhibit any symptoms on the leaves compared with the wild type. The pathogenicity of these mutants was further assayed through the spray inoculation of whole seedlings. The results demonstrated that the pathogenicity of the T4, T39, T71, T91, and T135 mutants was reduced, whereas the T120 mutant lost its pathogenicity. Southern blot analysis revealed that the plasmids were inserted at different sites in the genome with different copy numbers. Flanking sequences approximately 550, 860, and 150 bp were obtained from T7, T91, and T120, respectively through plasmids rescue. Sequence analysis of the flanking sequences from T7 and T91 showed no homology to any known sequences in GenBank. The flanking sequence from the T120 mutant was highly homologous to MAPKK kinases, which regulates sexual/asexual development, melanization, pathogenicity from Cochliobolus heterostrophus. These results indicate that REMI and plasmids rescue have great potential for finding pathogenicity genes.

Preparation of next-generation sequencing libraries using Nextera™ technology: simultaneous DNA fragmentation and adaptor tagging by in vitro transposition.

PubMed

Caruccio, Nicholas

2011-01-01

DNA library preparation is a common entry point and bottleneck for next-generation sequencing. Current methods generally consist of distinct steps that often involve significant sample loss and hands-on time: DNA fragmentation, end-polishing, and adaptor-ligation. In vitro transposition with Nextera™ Transposomes simultaneously fragments and covalently tags the target DNA, thereby combining these three distinct steps into a single reaction. Platform-specific sequencing adaptors can be added, and the sample can be enriched and bar-coded using limited-cycle PCR to prepare di-tagged DNA fragment libraries. Nextera technology offers a streamlined, efficient, and high-throughput method for generating bar-coded libraries compatible with multiple next-generation sequencing platforms.

Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

PubMed

Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

2009-07-14

In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

Two translocating hydrophilic segments of a nascent chain span the ER membrane during multispanning protein topogenesis

PubMed Central

Kida, Yuichiro; Morimoto, Fumiko; Sakaguchi, Masao

2007-01-01

During protein integration into the endoplasmic reticulum, the N-terminal domain preceding the type I signal-anchor sequence is translocated through a translocon. By fusing a streptavidin-binding peptide tag to the N terminus, we created integration intermediates of multispanning membrane proteins. In a cell-free system, N-terminal domain (N-domain) translocation was arrested by streptavidin and resumed by biotin. Even when N-domain translocation was arrested, the second hydrophobic segment mediated translocation of the downstream hydrophilic segment. In one of the defined intermediates, two hydrophilic segments and two hydrophobic segments formed a transmembrane disposition in a productive state. Both of the translocating hydrophilic segments were crosslinked with a translocon subunit, Sec61α. We conclude that two translocating hydrophilic segment in a single membrane protein can span the membrane during multispanning topogenesis flanking the translocon. Furthermore, even after six successive hydrophobic segments entered the translocon, N-domain translocation could be induced to restart from an arrested state. These observations indicate the remarkably flexible nature of the translocon. PMID:18166653

SPlinted Ligation Adapter Tagging (SPLAT), a novel library preparation method for whole genome bisulphite sequencing

PubMed Central

Manlig, Erika; Wahlberg, Per

2017-01-01

Abstract Sodium bisulphite treatment of DNA combined with next generation sequencing (NGS) is a powerful combination for the interrogation of genome-wide DNA methylation profiles. Library preparation for whole genome bisulphite sequencing (WGBS) is challenging due to side effects of the bisulphite treatment, which leads to extensive DNA damage. Recently, a new generation of methods for bisulphite sequencing library preparation have been devised. They are based on initial bisulphite treatment of the DNA, followed by adaptor tagging of single stranded DNA fragments, and enable WGBS using low quantities of input DNA. In this study, we present a novel approach for quick and cost effective WGBS library preparation that is based on splinted adaptor tagging (SPLAT) of bisulphite-converted single-stranded DNA. Moreover, we validate SPLAT against three commercially available WGBS library preparation techniques, two of which are based on bisulphite treatment prior to adaptor tagging and one is a conventional WGBS method. PMID:27899585

A physical map, including a BAC/PAC clone contig, of the Williams-Beuren syndrome--deletion region at 7q11.23.

PubMed

Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U

2000-01-01

Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.

An expressed sequence tag (EST) data mining strategy succeeding in the discovery of new G-protein coupled receptors.

PubMed

Wittenberger, T; Schaller, H C; Hellebrand, S

2001-03-30

We have developed a comprehensive expressed sequence tag database search method and used it for the identification of new members of the G-protein coupled receptor superfamily. Our approach proved to be especially useful for the detection of expressed sequence tag sequences that do not encode conserved parts of a protein, making it an ideal tool for the identification of members of divergent protein families or of protein parts without conserved domain structures in the expressed sequence tag database. At least 14 of the expressed sequence tags found with this strategy are promising candidates for new putative G-protein coupled receptors. Here, we describe the sequence and expression analysis of five new members of this receptor superfamily, namely GPR84, GPR86, GPR87, GPR90 and GPR91. We also studied the genomic structure and chromosomal localization of the respective genes applying in silico methods. A cluster of six closely related G-protein coupled receptors was found on the human chromosome 3q24-3q25. It consists of four orphan receptors (GPR86, GPR87, GPR91, and H963), the purinergic receptor P2Y1, and the uridine 5'-diphosphoglucose receptor KIAA0001. It seems likely that these receptors evolved from a common ancestor and therefore might have related ligands. In conclusion, we describe a data mining procedure that proved to be useful for the identification and first characterization of new genes and is well applicable for other gene families. Copyright 2001 Academic Press.

Differentiated evolutionary conservatism and lack of polymorphism of crucial sex determination genes (SRY and SOX9) in four species of the family Canidae.

PubMed

Nowacka-Woszuk, Joanna; Switonski, Marek

2009-01-01

The sex determination process is under the control of several genes of which two (SRY and SOX9), encoding transcription factors, play a crucial role. It is well-known that mutations at these genes may cause the development of an intersexual phenotype. The aim of this study was to conduct a comparative analysis of the coding sequence and 5'-flanking regions of both genes in four species of the family Canidae (the dog, red fox, arctic fox and Chinese raccoon dog). Similarity of the coding sequence of the SOX9 gene among the studied species was higher (99.7-99.9%) than in the case of the SRY gene (96.7-97.3%). Only single nucleotide changes were found in the compared coding sequences, whereas in the 5'-flanking region of both genes nucleotide substitutions, as well as insertions and deletions were observed. None of the changes detected in the 5'-flanking region occurred within the potential consensus sequences for transcription factors. No polymorphism was found for either of these genes in any of the analyzed species.

Comparative analysis on the structural features of the 5' flanking region of κ-casein genes from six different species

PubMed Central

Gerencsér, Ákos; Barta, Endre; Boa, Simon; Kastanis, Petros; Bösze, Zsuzsanna; Whitelaw, C Bruce A

2002-01-01

κ-casein plays an essential role in the formation, stabilisation and aggregation of milk micelles. Control of κ-casein expression reflects this essential role, although an understanding of the mechanisms involved lags behind that of the other milk protein genes. We determined the 5'-flanking sequences for the murine, rabbit and human κ-casein genes and compared them to the published ruminant sequences. The most conserved region was not the proximal promoter region but an approximately 400 bp long region centred 800 bp upstream of the TATA box. This region contained two highly conserved MGF/STAT5 sites with common spacing relative to each other. In this region, six conserved short stretches of similarity were also found which did not correspond to known transcription factor consensus sites. On the contrary to ruminant and human 5' regulatory sequences, the rabbit and murine 5'-flanking regions did not harbour any kind of repetitive elements. We generated a phylogenetic tree of the six species based on multiple alignment of the κ-casein sequences. This study identified conserved candidate transcriptional regulatory elements within the κ-casein gene promoter. PMID:11929628

An efficient annotation and gene-expression derivation tool for Illumina Solexa datasets

PubMed Central

2010-01-01

Background The data produced by an Illumina flow cell with all eight lanes occupied, produces well over a terabyte worth of images with gigabytes of reads following sequence alignment. The ability to translate such reads into meaningful annotation is therefore of great concern and importance. Very easily, one can get flooded with such a great volume of textual, unannotated data irrespective of read quality or size. CASAVA, a optional analysis tool for Illumina sequencing experiments, enables the ability to understand INDEL detection, SNP information, and allele calling. To not only extract from such analysis, a measure of gene expression in the form of tag-counts, but furthermore to annotate such reads is therefore of significant value. Findings We developed TASE (Tag counting and Analysis of Solexa Experiments), a rapid tag-counting and annotation software tool specifically designed for Illumina CASAVA sequencing datasets. Developed in Java and deployed using jTDS JDBC driver and a SQL Server backend, TASE provides an extremely fast means of calculating gene expression through tag-counts while annotating sequenced reads with the gene's presumed function, from any given CASAVA-build. Such a build is generated for both DNA and RNA sequencing. Analysis is broken into two distinct components: DNA sequence or read concatenation, followed by tag-counting and annotation. The end result produces output containing the homology-based functional annotation and respective gene expression measure signifying how many times sequenced reads were found within the genomic ranges of functional annotations. Conclusions TASE is a powerful tool to facilitate the process of annotating a given Illumina Solexa sequencing dataset. Our results indicate that both homology-based annotation and tag-count analysis are achieved in very efficient times, providing researchers to delve deep in a given CASAVA-build and maximize information extraction from a sequencing dataset. TASE is specially designed to translate sequence data in a CASAVA-build into functional annotations while producing corresponding gene expression measurements. Achieving such analysis is executed in an ultrafast and highly efficient manner, whether the analysis be a single-read or paired-end sequencing experiment. TASE is a user-friendly and freely available application, allowing rapid analysis and annotation of any given Illumina Solexa sequencing dataset with ease. PMID:20598141

Human renin 5'-flanking DNA to nucleotide-2750.

PubMed

Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J

1995-01-01

Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.

Identification of a precursor genomic segment that provided a sequence unique to glycophorin B and E genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Onda, M.; Kudo, S.; Fukuda, M.

Human glycophorin A, B, and E (GPA, GPB, and GPE) genes belong to a gene family located at the long arm of chromosome 4. These three genes are homologous from the 5'-flanking sequence to the Alu sequence, which is 1 kb downstream from the exon encoding the transmembrane domain. Analysis of the Alu sequence and flanking direct repeat sequences suggested that the GPA gene most closely resembles the ancestral gene, whereas the GPB and GPE gene arose by homologous recombination within the Alu sequence, acquiring 3' sequences from an unrelated precursor genomic segment. Here the authors describe the identification ofmore » this putative precursor genomic segment. A human genomic library was screened by using the sequence of the 3' region of the GPB gene as a probe. The genomic clones isolated were found to contain an Alu sequence that appeared to be involved in the recombination. Downstream from the Alu sequence, the nucleotide sequence of the precursor genomic segment is almost identical to that of the GPB or GPE gene. In contrast, the upstream sequence of the genomic segment differs entirely from that of the GPA, GPB, and GPE genes. Conservation of the direct repeats flanking the Alu sequence of the genomic segment strongly suggests that the sequence of this genomic segment has been maintained during evolution. This identified genomic segment was found to reside downstream from the GPA gene by both gene mapping and in situ chromosomal localization. The precursor genomic segment was also identified in the orangutan genome, which is known to lack GPB and GPE genes. These results indicate that one of the duplicated ancestral glycophorin genes acquired a unique 3' sequence by unequal crossing-over through its Alu sequence and the further downstream Alu sequence present in the duplicated gene. Further duplication and divergence of this gene yielded the GPB and GPE genes. 37 refs., 5 figs.« less

Sequence tagging reveals unexpected modifications in toxicoproteomics

PubMed Central

Dasari, Surendra; Chambers, Matthew C.; Codreanu, Simona G.; Liebler, Daniel C.; Collins, Ben C.; Pennington, Stephen R.; Gallagher, William M.; Tabb, David L.

2010-01-01

Toxicoproteomic samples are rich in posttranslational modifications (PTMs) of proteins. Identifying these modifications via standard database searching can incur significant performance penalties. Here we describe the latest developments in TagRecon, an algorithm that leverages inferred sequence tags to identify modified peptides in toxicoproteomic data sets. TagRecon identifies known modifications more effectively than the MyriMatch database search engine. TagRecon outperformed state of the art software in recognizing unanticipated modifications from LTQ, Orbitrap, and QTOF data sets. We developed user-friendly software for detecting persistent mass shifts from samples. We follow a three-step strategy for detecting unanticipated PTMs in samples. First, we identify the proteins present in the sample with a standard database search. Next, identified proteins are interrogated for unexpected PTMs with a sequence tag-based search. Finally, additional evidence is gathered for the detected mass shifts with a refinement search. Application of this technology on toxicoproteomic data sets revealed unintended cross-reactions between proteins and sample processing reagents. Twenty five proteins in rat liver showed signs of oxidative stress when exposed to potentially toxic drugs. These results demonstrate the value of mining toxicoproteomic data sets for modifications. PMID:21214251

Linear reduction method for predictive and informative tag SNP selection.

PubMed

He, Jingwu; Westbrooks, Kelly; Zelikovsky, Alexander

2005-01-01

Constructing a complete human haplotype map is helpful when associating complex diseases with their related SNPs. Unfortunately, the number of SNPs is very large and it is costly to sequence many individuals. Therefore, it is desirable to reduce the number of SNPs that should be sequenced to a small number of informative representatives called tag SNPs. In this paper, we propose a new linear algebra-based method for selecting and using tag SNPs. We measure the quality of our tag SNP selection algorithm by comparing actual SNPs with SNPs predicted from selected linearly independent tag SNPs. Our experiments show that for sufficiently long haplotypes, knowing only 0.4% of all SNPs the proposed linear reduction method predicts an unknown haplotype with the error rate below 2% based on 10% of the population.

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Analysis and Functional Annotation of an Expressed Sequence Tag Collection for Tropical Crop Sugarcane

PubMed Central

Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo

2003-01-01

To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979

Exploring the Presence of microDNAs in Prostate Cancer Cell Lines, Tissue, and Sera of Prostate Cancer Patients and its Possible Application as Biomarker

DTIC Science & Technology

2015-08-01

Sequence tags were mapped on the human reference genome using the Novoalign software. Only those tags... the linear islands to create a novel junctional sequence that does not exist in the genome . Thus the PE- sequence of a fragment that breaks at or...identified in cancer cell lines. (b) Median percent GC content of microDNAs and the genomic sequences up- or downstream of the source loci are

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

PubMed Central

Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

2014-01-01

The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

Characterization of genetic sequence variation of 58 STR loci in four major population groups.

PubMed

Novroski, Nicole M M; King, Jonathan L; Churchill, Jennifer D; Seah, Lay Hong; Budowle, Bruce

2016-11-01

Massively parallel sequencing (MPS) can identify sequence variation within short tandem repeat (STR) alleles as well as their nominal allele lengths that traditionally have been obtained by capillary electrophoresis. Using the MiSeq FGx Forensic Genomics System (Illumina), STRait Razor, and in-house excel workbooks, genetic variation was characterized within STR repeat and flanking regions of 27 autosomal, 7 X-chromosome and 24 Y-chromosome STR markers in 777 unrelated individuals from four population groups. Seven hundred and forty six autosomal, 227 X-chromosome, and 324 Y-chromosome STR alleles were identified by sequence compared with 357 autosomal, 107 X-chromosome, and 189 Y-chromosome STR alleles that were identified by length. Within the observed sequence variation, 227 autosomal, 156 X-chromosome, and 112 Y-chromosome novel alleles were identified and described. One hundred and seventy six autosomal, 123 X-chromosome, and 93 Y-chromosome sequence variants resided within STR repeat regions, and 86 autosomal, 39 X-chromosome, and 20 Y-chromosome variants were located in STR flanking regions. Three markers, D18S51, DXS10135, and DYS385a-b had 1, 4, and 1 alleles, respectively, which contained both a novel repeat region variant and a flanking sequence variant in the same nucleotide sequence. There were 50 markers that demonstrated a relative increase in diversity with the variant sequence alleles compared with those of traditional nominal length alleles. These population data illustrate the genetic variation that exists in the commonly used STR markers in the selected population samples and provide allele frequencies for statistical calculations related to STR profiling with MPS data. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

PubMed Central

Kardinal, C; Selmayr, M; Mocikat, R

1996-01-01

Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation. Images Figure 2 PMID:8958041

Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

PubMed

Kardinal, C; Selmayr, M; Mocikat, R

1996-11-01

Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.

Genome-Wide Association Study Identifies Loci for Salt Tolerance during Germination in Autotetraploid Alfalfa (Medicago sativa L.) Using Genotyping-by-Sequencing

PubMed Central

Yu, Long-Xi; Liu, Xinchun; Boge, William; Liu, Xiang-Ping

2016-01-01

Salinity is one of major abiotic stresses limiting alfalfa (Medicago sativa L.) production in the arid and semi-arid regions in US and other counties. In this study, we used a diverse panel of alfalfa accessions previously described by Zhang et al. (2015) to identify molecular markers associated with salt tolerance during germination using genome-wide association study (GWAS) and genotyping-by-sequencing (GBS). Phenotyping was done by germinating alfalfa seeds under different levels of salt stress. Phenotypic data of adjusted germination rates and SNP markers generated by GBS were used for marker-trait association. Thirty six markers were significantly associated with salt tolerance in at least one level of salt treatments. Alignment of sequence tags to the Medicago truncatula genome revealed genetic locations of the markers on all chromosomes except chromosome 3. Most significant markers were found on chromosomes 1, 2, and 4. BLAST search using the flanking sequences of significant markers identified 14 putative candidate genes linked to 23 significant markers. Most of them were repeatedly identified in two or three salt treatments. Several loci identified in the present study had similar genetic locations to the reported QTL associated with salt tolerance in M. truncatula. A locus identified on chromosome 6 by this study overlapped with that by drought in our previous study. To our knowledge, this is the first report on mapping loci associated with salt tolerance during germination in autotetraploid alfalfa. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms by which salt and drought stresses affect alfalfa growth. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to drought and salt stresses. PMID:27446182

Ontology and diversity of transcript-associated microsatellites mined from a globe artichoke EST database

PubMed Central

Scaglione, Davide; Acquadro, Alberto; Portis, Ezio; Taylor, Christopher A; Lanteri, Sergio; Knapp, Steven J

2009-01-01

Background The globe artichoke (Cynara cardunculus var. scolymus L.) is a significant crop in the Mediterranean basin. Despite its commercial importance and its both dietary and pharmaceutical value, knowledge of its genetics and genomics remains scant. Microsatellite markers have become a key tool in genetic and genomic analysis, and we have exploited recently acquired EST (expressed sequence tag) sequence data (Composite Genome Project - CGP) to develop an extensive set of microsatellite markers. Results A unigene assembly was created from over 36,000 globe artichoke EST sequences, containing 6,621 contigs and 12,434 singletons. Over 12,000 of these unigenes were functionally assigned on the basis of homology with Arabidopsis thaliana reference proteins. A total of 4,219 perfect repeats, located within 3,308 unigenes was identified and the gene ontology (GO) analysis highlighted some GO term's enrichments among different classes of microsatellites with respect to their position. Sufficient flanking sequence was available to enable the design of primers to amplify 2,311 of these microsatellites, and a set of 300 was tested against a DNA panel derived from 28 C. cardunculus genotypes. Consistent amplification and polymorphism was obtained from 236 of these assays. Their polymorphic information content (PIC) ranged from 0.04 to 0.90 (mean 0.66). Between 176 and 198 of the assays were informative in at least one of the three available mapping populations. Conclusion EST-based microsatellites have provided a large set of de novo genetic markers, which show significant amounts of polymorphism both between and within the three taxa of C. cardunculus. They are thus well suited as assays for phylogenetic analysis, the construction of genetic maps, marker-assisted breeding, transcript mapping and other genomic applications in the species. PMID:19785740

Incidence of genome structure, DNA asymmetry, and cell physiology on T-DNA integration in chromosomes of the phytopathogenic fungus Leptosphaeria maculans.

PubMed

Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry

2012-08-01

The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.

Genome-Wide Association Study Identifies Loci for Salt Tolerance during Germination in Autotetraploid Alfalfa (Medicago sativa L.) Using Genotyping-by-Sequencing.

PubMed

Yu, Long-Xi; Liu, Xinchun; Boge, William; Liu, Xiang-Ping

2016-01-01

Salinity is one of major abiotic stresses limiting alfalfa (Medicago sativa L.) production in the arid and semi-arid regions in US and other counties. In this study, we used a diverse panel of alfalfa accessions previously described by Zhang et al. (2015) to identify molecular markers associated with salt tolerance during germination using genome-wide association study (GWAS) and genotyping-by-sequencing (GBS). Phenotyping was done by germinating alfalfa seeds under different levels of salt stress. Phenotypic data of adjusted germination rates and SNP markers generated by GBS were used for marker-trait association. Thirty six markers were significantly associated with salt tolerance in at least one level of salt treatments. Alignment of sequence tags to the Medicago truncatula genome revealed genetic locations of the markers on all chromosomes except chromosome 3. Most significant markers were found on chromosomes 1, 2, and 4. BLAST search using the flanking sequences of significant markers identified 14 putative candidate genes linked to 23 significant markers. Most of them were repeatedly identified in two or three salt treatments. Several loci identified in the present study had similar genetic locations to the reported QTL associated with salt tolerance in M. truncatula. A locus identified on chromosome 6 by this study overlapped with that by drought in our previous study. To our knowledge, this is the first report on mapping loci associated with salt tolerance during germination in autotetraploid alfalfa. Further investigation on these loci and their linked genes would provide insight into understanding molecular mechanisms by which salt and drought stresses affect alfalfa growth. Functional markers closely linked to the resistance loci would be useful for MAS to improve alfalfa cultivars with enhanced resistance to drought and salt stresses.

Positional cloning of the chromosome 14 Alzheimer`s disease locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clark, R.F.; Korenblat, K.M.; Goate, A.M.

1994-09-01

Genetic linkage analysis had indicated a locus for familial early-onset Alzheimer`s disease (FAD) on chromosome 14 at q24.3. The FAD locus has been shown previously to lie between the dinucleotide markers D14S61 and D14S63, a genetic distance of approximately 13 cM. We are currently attempting to identify the gene using a positional cloning strategy. The first step towards the isolation and characterization of this locus was the construction of an overlapping YAC contig covering the entire region. Over forty YACs which map to this region have been isolated from the St. Louis and CEPH libraries by a combination of YACmore » end sequence walking and sequence tagged site mapping. Our contig fully spans the complete domain, encompassing all genetic markers non-recombinant with FAD (i.e. D14S76, D14S43, D14S71, D14S77) and the two nearest flanking FAD-recombinant markers. With restriction mapping of the domain, we can determine the exact size of the region. As a second step, the YACs in this contig are currently being inspected for expressed sequences by exon trapping, initially on those YACs known to be nonchimeric. We have currently made exon-trapped libraries from YACs that have the markers D14S76 and D14S43. Sequence analysis of these libraries indicates that a trapped exon is identified on average for each 30 kb of YAC DNA. The trapped exons are being screened to identify likely candidate genes, which will be examined for mutations in FAD families.« less

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging.

PubMed

Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei

2018-01-01

DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

TagDigger: user-friendly extraction of read counts from GBS and RAD-seq data.

PubMed

Clark, Lindsay V; Sacks, Erik J

2016-01-01

In genotyping-by-sequencing (GBS) and restriction site-associated DNA sequencing (RAD-seq), read depth is important for assessing the quality of genotype calls and estimating allele dosage in polyploids. However, existing pipelines for GBS and RAD-seq do not provide read counts in formats that are both accurate and easy to access. Additionally, although existing pipelines allow previously-mined SNPs to be genotyped on new samples, they do not allow the user to manually specify a subset of loci to examine. Pipelines that do not use a reference genome assign arbitrary names to SNPs, making meta-analysis across projects difficult. We created the software TagDigger, which includes three programs for analyzing GBS and RAD-seq data. The first script, tagdigger_interactive.py, rapidly extracts read counts and genotypes from FASTQ files using user-supplied sets of barcodes and tags. Input and output is in CSV format so that it can be opened by spreadsheet software. Tag sequences can also be imported from the Stacks, TASSEL-GBSv2, TASSEL-UNEAK, or pyRAD pipelines, and a separate file can be imported listing the names of markers to retain. A second script, tag_manager.py, consolidates marker names and sequences across multiple projects. A third script, barcode_splitter.py, assists with preparing FASTQ data for deposit in a public archive by splitting FASTQ files by barcode and generating MD5 checksums for the resulting files. TagDigger is open-source and freely available software written in Python 3. It uses a scalable, rapid search algorithm that can process over 100 million FASTQ reads per hour. TagDigger will run on a laptop with any operating system, does not consume hard drive space with intermediate files, and does not require programming skill to use.

Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing

PubMed Central

Nunoura, Takuro; Takaki, Yoshihiro; Kazama, Hiromi; Hirai, Miho; Ashi, Juichiro; Imachi, Hiroyuki; Takai, Ken

2012-01-01

Microbial community structures in methane seep sediments in the Nankai Trough were analyzed by tag-sequencing analysis for the small subunit (SSU) rRNA gene using a newly developed primer set. The dominant members of Archaea were Deep-sea Hydrothermal Vent Euryarchaeotic Group 6 (DHVEG 6), Marine Group I (MGI) and Deep Sea Archaeal Group (DSAG), and those in Bacteria were Alpha-, Gamma-, Delta- and Epsilonproteobacteria, Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. Diversity and richness were examined by 8,709 and 7,690 tag-sequences from sediments at 5 and 25 cm below the seafloor (cmbsf), respectively. The estimated diversity and richness in the methane seep sediment are as high as those in soil and deep-sea hydrothermal environments, although the tag-sequences obtained in this study were not sufficient to show whole microbial diversity in this analysis. We also compared the diversity and richness of each taxon/division between the sediments from the two depths, and found that the diversity and richness of some taxa/divisions varied significantly along with the depth. PMID:22510646

Sequence analysis of diacylglycerol acyltransferases

USDA-ARS?s Scientific Manuscript database

Diacylglycerol acyltransferases (DGATs) catalyze the final step of triacylglycerol (TAG) biosynthesis in eukaryotes. DGATs esterify sn-1,2-diacylglycerol with a long-chain fatty acyl-CoA. Plants and animals deficient in DGATs accumulate less TAG and over-expression of DGATs increases TAG. DGAT knock...

Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

PubMed

Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

1989-11-25

Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids encoding PKI(1-31) inhibit the expression that is stimulated by the addition of cAMP analogs in both cell lines; basal expression, however, is inhibited by PKI(1-31) only in the JEG-3 cell line and not in the CV-1 cells. These observations indicate that, in JEG-3 cells, PKI(1-31) is a specific inhibitor of kinase A-mediated gene transcription, but it does not modify kinase C-directed transcription.(ABSTRACT TRUNCATED AT 400 WORDS)

Improved microarray methods for profiling the yeast knockout strain collection

PubMed Central

Yuan, Daniel S.; Pan, Xuewen; Ooi, Siew Loon; Peyser, Brian D.; Spencer, Forrest A.; Irizarry, Rafael A.; Boeke, Jef D.

2005-01-01

A remarkable feature of the Yeast Knockout strain collection is the presence of two unique 20mer TAG sequences in almost every strain. In principle, the relative abundances of strains in a complex mixture can be profiled swiftly and quantitatively by amplifying these sequences and hybridizing them to microarrays, but TAG microarrays have not been widely used. Here, we introduce a TAG microarray design with sophisticated controls and describe a robust method for hybridizing high concentrations of dye-labeled TAGs in single-stranded form. We also highlight the importance of avoiding PCR contamination and provide procedures for detection and eradication. Validation experiments using these methods yielded false positive (FP) and false negative (FN) rates for individual TAG detection of 3–6% and 15–18%, respectively. Analysis demonstrated that cross-hybridization was the chief source of FPs, while TAG amplification defects were the main cause of FNs. The materials, protocols, data and associated software described here comprise a suite of experimental resources that should facilitate the use of TAG microarrays for a wide variety of genetic screens. PMID:15994458

Assignment of the dystonia-parkinsonism syndrome locus, DYT3, to a small region within a 1.8-Mb YAC contig of Xq13.1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haberhausen, G.; Schmitt, I.; Koehler, A.

1995-09-01

A YAC contig was constructed of Xq13.1 in order to sublocalize the X-linked dystonia-parkinsonism (XDP) syndrome locus, DYT3. The contig spans a region of {approximately}1.8 Mb and includes loci DXS453/DXS348/IL2R{gamma}/GJB1/CCG1/DXS559. For the construction of the contig, nine sequence-tagged sites and four short tandem repeat polymorphisms (STRPs) were isolated. The STRPs, designated as 4704 No. 6 (DXS7113), 4704 No. 7 (DXS7114), 67601 (DXS7117), and B4Pst (DXS7119) were assigned to a region flanked by DXS348 proximally and by DXS559 distally. Their order was DXS348/4704 No. 6/4704 No. 7/67601/B4Pst/DXS559. They were applied to the analysis of allelic association and of haplotypes in 47more » not-obviously-related XDP patients and in 105 Filipino male controls. The same haplotype was found at loci 67601 (DXS7117) and B4Pst (DXS7119) in 42 of 47 patients. This percentage of common haplotypes decreased at the adjacent loci. The findings, together with the previous demonstration of DXS559 being the distal flanking marker of DYT3, assign the disease locus to a small region in Xq13.1 defined by loci 67601 (DXS7117) and B4Pst (DXS7119). The location of DYT3 was born out by the application of a newly developed likelihood method for the analysis of linkage disequilibrium. 28 refs., 1 fig., 6 tabs.« less

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing Analysis

PubMed Central

Tinker, Nicholas A.; Bekele, Wubishet A.; Hattori, Jiro

2016-01-01

Genotyping-by-sequencing (GBS), and related methods, are based on high-throughput short-read sequencing of genomic complexity reductions followed by discovery of single nucleotide polymorphisms (SNPs) within sequence tags. This provides a powerful and economical approach to whole-genome genotyping, facilitating applications in genomics, diversity analysis, and molecular breeding. However, due to the complexity of analyzing large data sets, applications of GBS may require substantial time, expertise, and computational resources. Haplotag, the novel GBS software described here, is freely available, and operates with minimal user-investment on widely available computer platforms. Haplotag is unique in fulfilling the following set of criteria: (1) operates without a reference genome; (2) can be used in a polyploid species; (3) provides a discovery mode, and a production mode; (4) discovers polymorphisms based on a model of tag-level haplotypes within sequenced tags; (5) reports SNPs as well as haplotype-based genotypes; and (6) provides an intuitive visual “passport” for each inferred locus. Haplotag is optimized for use in a self-pollinating plant species. PMID:26818073

A combination of LongSAGE with Solexa sequencing is well suited to explore the depth and the complexity of transcriptome

PubMed Central

Hanriot, Lucie; Keime, Céline; Gay, Nadine; Faure, Claudine; Dossat, Carole; Wincker, Patrick; Scoté-Blachon, Céline; Peyron, Christelle; Gandrillon, Olivier

2008-01-01

Background "Open" transcriptome analysis methods allow to study gene expression without a priori knowledge of the transcript sequences. As of now, SAGE (Serial Analysis of Gene Expression), LongSAGE and MPSS (Massively Parallel Signature Sequencing) are the mostly used methods for "open" transcriptome analysis. Both LongSAGE and MPSS rely on the isolation of 21 pb tag sequences from each transcript. In contrast to LongSAGE, the high throughput sequencing method used in MPSS enables the rapid sequencing of very large libraries containing several millions of tags, allowing deep transcriptome analysis. However, a bias in the complexity of the transcriptome representation obtained by MPSS was recently uncovered. Results In order to make a deep analysis of mouse hypothalamus transcriptome avoiding the limitation introduced by MPSS, we combined LongSAGE with the Solexa sequencing technology and obtained a library of more than 11 millions of tags. We then compared it to a LongSAGE library of mouse hypothalamus sequenced with the Sanger method. Conclusion We found that Solexa sequencing technology combined with LongSAGE is perfectly suited for deep transcriptome analysis. In contrast to MPSS, it gives a complex representation of transcriptome as reliable as a LongSAGE library sequenced by the Sanger method. PMID:18796152

A Physical Map, Including a BAC/PAC Clone Contig, of the Williams-Beuren Syndrome–Deletion Region at 7q11.23

PubMed Central

Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta

2000-01-01

Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136

Comparative genomics of grass EST libraries reveals previously uncharacterized splicing events in crop plants.

PubMed

Chuang, Trees-Juen; Yang, Min-Yu; Lin, Chuang-Chieh; Hsieh, Ping-Hung; Hung, Li-Yuan

2015-02-05

Crop plants such as rice, maize and sorghum play economically-important roles as main sources of food, fuel, and animal feed. However, current genome annotations of crop plants still suffer false-positive predictions; a more comprehensive registry of alternative splicing (AS) events is also in demand. Comparative genomics of crop plants is largely unexplored. We performed a large-scale comparative analysis (ExonFinder) of the expressed sequence tag (EST) library from nine grass plants against three crop genomes (rice, maize, and sorghum) and identified 2,879 previously-unannotated exons (i.e., novel exons) in the three crops. We validated 81% of the tested exons by RT-PCR-sequencing, supporting the effectiveness of our in silico strategy. Evolutionary analysis reveals that the novel exons, comparing with their flanking annotated ones, are generally under weaker selection pressure at the protein level, but under stronger pressure at the RNA level, suggesting that most of the novel exons also represent novel alternatively spliced variants (ASVs). However, we also observed the consistency of evolutionary rates between certain novel exons and their flanking exons, which provided further evidence of their co-occurrence in the transcripts, suggesting that previously-annotated isoforms might be subject to erroneous predictions. Our validation showed that 54% of the tested genes expressed the newly-identified isoforms that contained the novel exons, rather than the previously-annotated isoforms that excluded them. The consistent results were steadily observed across cultivated (Oryza sativa and O. glaberrima) and wild (O. rufipogon and O. nivara) rice species, asserting the necessity of our curation of the crop genome annotations. Our comparative analyses also inferred the common ancestral transcriptome of grass plants and gain- and loss-of-ASV events. We have reannotated the rice, maize, and sorghum genomes, and showed that evolutionary rates might serve as an indicator for determining whether the identified exons were alternatively spliced. This study not only presents an effective in silico strategy for the improvement of plant annotations, but also provides further insights into the role of AS events in the evolution and domestication of crop plants. ExonFinder and the novel exons/ASVs identified are publicly accessible at http://exonfinder.sourceforge.net/ .

The role of polyglutamine expansion and protein context in disease-related huntingtin/lipid interactions

NASA Astrophysics Data System (ADS)

Burke, Kathleen Anne

Huntington's Disease (HD) is a neurodegenerative disorder that is defined by the accumulation of nanoscale aggregates comprised of the huntingtin (htt) protein. Aggregation is directly caused by an expanded polyglutamine (polyQ) domain in htt, leading to a diverse population of aggregate species, such as oligomers, fibrils, and annular aggregates. Furthermore, the length of this polyQ domain is directly related to onset and severity of disease. The first 17 amino acids on the N-terminus (N17) and the polyproline domain on the C-terminal side of the polyQ domain have been shown to further modulate the aggregation process. Additionally, N17 appears to have lipid binding properties as htt interacts with a variety of membrane-containing structures present in cells, such as organelles, and interactions with these membrane surfaces may further modulate htt aggregation. To investigate the interaction between htt exon1 and lipid bilayers, in situ atomic force microscopy (AFM) was used to directly monitor the aggregation of htt exon1 constructs with varying Q-length (35Q, 46Q, 51Q, and myc- 53Q) or synthetic peptides with different polyQ domain flanking sequences (KK-Q35-KK, KK-Q 35-P10-KK, N17-Q35-KK, and N 17-Q35-P10-KK) on supported lipid membranes comprised of total brain lipid extract. The exon1 fragments accumulated on the lipid membranes, causing disruption of the membrane, in a polyQ dependent manner. By adding N-terminal tags to the htt exon1 fragments, the interaction with the lipid bilayer was impeded. The KK-Q35-KK and KK-Q 35-P10-KK peptides had no appreciable interaction with lipid bilayers. Interestingly, polyQ peptides with the N17 flanking sequence interacted with the bilayer. N17-Q35-KK formed discrete aggregates on the bilayer, but there was minimal membrane disruption. The N17-Q35-P10-KK peptide interacted more aggressively with the lipid bilayer in a manner reminiscent of the htt exon1 proteins.

Next-generation sequencing is a robust strategy for the high-throughput detection of zygosity in transgenic maize.

PubMed

Fritsch, Leonie; Fischer, Rainer; Wambach, Christoph; Dudek, Max; Schillberg, Stefan; Schröper, Florian

2015-08-01

Simple and reliable, high-throughput techniques to detect the zygosity of transgenic events in plants are valuable for biotechnology and plant breeding companies seeking robust genotyping data for the assessment of new lines and the monitoring of breeding programs. We show that next-generation sequencing (NGS) applied to short PCR products spanning the transgene integration site provides accurate zygosity data that are more robust and reliable than those generated by PCR-based methods. The NGS reads covered the 5' border of the transgenic events (incorporating part of the transgene and the flanking genomic DNA), or the genomic sequences flanking the unfilled transgene integration site at the wild-type locus. We compared the NGS method to competitive real-time PCR with transgene-specific and wild-type-specific primer/probe pairs, one pair matching the 5' genomic flanking sequence and 5' part of the transgene and the other matching the unfilled transgene integration site. Although both NGS and real-time PCR provided useful zygosity data, the NGS technique was favorable because it needed fewer optimization steps. It also provided statistically more-reliable evidence for the presence of each allele because each product was often covered by more than 100 reads. The NGS method is also more suitable for the genotyping of large panels of plants because up to 80 million reads can be produced in one sequencing run. Our novel method is therefore ideal for the rapid and accurate genotyping of large numbers of samples.

Genome-Wide Mutagenesis in Borrelia burgdorferi.

PubMed

Lin, Tao; Gao, Lihui

2018-01-01

Signature-tagged mutagenesis (STM) is a functional genomics approach to identify bacterial virulence determinants and virulence factors by simultaneously screening multiple mutants in a single host animal, and has been utilized extensively for the study of bacterial pathogenesis, host-pathogen interactions, and spirochete and tick biology. The signature-tagged transposon mutagenesis has been developed to investigate virulence determinants and pathogenesis of Borrelia burgdorferi. Mutants in genes important in virulence are identified by negative selection in which the mutants fail to colonize or disseminate in the animal host and tick vector. STM procedure combined with Luminex Flex ® Map™ technology and next-generation sequencing (e.g., Tn-seq) are the powerful high-throughput tools for the determination of Borrelia burgdorferi virulence determinants. The assessment of multiple tissue sites and two DNA resources at two different time points using Luminex Flex ® Map™ technology provides a robust data set. B. burgdorferi transposon mutant screening indicates that a high proportion of genes are the novel virulence determinants that are required for mouse and tick infection. In this protocol, an effective signature-tagged Himar1-based transposon suicide vector was developed and used to generate a sequence-defined library of nearly 4800 mutants in the infectious B. burgdorferi B31 clone. In STM, signature-tagged suicide vectors are constructed by inserting unique DNA sequences (tags) into the transposable elements. The signature-tagged transposon mutants are generated when transposon suicide vectors are transformed into an infectious B. burgdorferi clone, and the transposable element is transposed into the 5'-TA-3' sequence in the B. burgdorferi genome with the signature tag. The transposon library is created and consists of many sub-libraries, each sub-library has several hundreds of mutants with same tags. A group of mice or ticks are infected with a mixed population of mutants with different tags, after recovered from different tissues of infected mice and ticks, mutants from output pool and input pool are detected using high-throughput, semi-quantitative Luminex ® FLEXMAP™ or next-generation sequencing (Tn-seq) technologies. Thus far, we have created a high-density, sequence-defined transposon library of over 6600 STM mutants for the efficient genome-wide investigation of genes and gene products required for wild-type pathogenesis, host-pathogen interactions, in vitro growth, in vivo survival, physiology, morphology, chemotaxis, motility, structure, metabolism, gene regulation, plasmid maintenance and replication, etc. The insertion sites of 4480 transposon mutants have been determined. About 800 predicted protein-encoding genes in the genome were disrupted in the STM transposon library. The infectivity and some functions of 800 mutants in 500 genes have been determined. Analysis of these transposon mutants has yielded valuable information regarding the genes and gene products important in the pathogenesis and biology of B. burgdorferi and its tick vectors.

Increasing ecological inference from high throughput sequencing of fungi in the environment through a tagging approach

Treesearch

D. Lee Taylor; Michael G. Booth; Jack W. McFarland; Ian C. Herriott; Niall J. Lennon; Chad Nusbaum; Thomas G. Marr

2008-01-01

High throughput sequencing methods are widely used in analyses of microbial diversity but are generally applied to small numbers of samples, which precludes charaterization of patterns of microbial diversity across space and time. We have designed a primer-tagging approach that allows pooling and subsequent sorting of numerous samples, which is directed to...

The role of heterologous chloroplast sequence elements in transgene integration and expression.

PubMed

Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

2010-04-01

Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5' untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5' UTR and 3' UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5' UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5' UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation.

The Role of Heterologous Chloroplast Sequence Elements in Transgene Integration and Expression1[W][OA

PubMed Central

Ruhlman, Tracey; Verma, Dheeraj; Samson, Nalapalli; Daniell, Henry

2010-01-01

Heterologous regulatory elements and flanking sequences have been used in chloroplast transformation of several crop species, but their roles and mechanisms have not yet been investigated. Nucleotide sequence identity in the photosystem II protein D1 (psbA) upstream region is 59% across all taxa; similar variation was consistent across all genes and taxa examined. Secondary structure and predicted Gibbs free energy values of the psbA 5′ untranslated region (UTR) among different families reflected this variation. Therefore, chloroplast transformation vectors were made for tobacco (Nicotiana tabacum) and lettuce (Lactuca sativa), with endogenous (Nt-Nt, Ls-Ls) or heterologous (Nt-Ls, Ls-Nt) psbA promoter, 5′ UTR and 3′ UTR, regulating expression of the anthrax protective antigen (PA) or human proinsulin (Pins) fused with the cholera toxin B-subunit (CTB). Unique lettuce flanking sequences were completely eliminated during homologous recombination in the transplastomic tobacco genomes but not unique tobacco sequences. Nt-Ls or Ls-Nt transplastomic lines showed reduction of 80% PA and 97% CTB-Pins expression when compared with endogenous psbA regulatory elements, which accumulated up to 29.6% total soluble protein PA and 72.0% total leaf protein CTB-Pins, 2-fold higher than Rubisco. Transgene transcripts were reduced by 84% in Ls-Nt-CTB-Pins and by 72% in Nt-Ls-PA lines. Transcripts containing endogenous 5′ UTR were stabilized in nonpolysomal fractions. Stromal RNA-binding proteins were preferentially associated with endogenous psbA 5′ UTR. A rapid and reproducible regeneration system was developed for lettuce commercial cultivars by optimizing plant growth regulators. These findings underscore the need for sequencing complete crop chloroplast genomes, utilization of endogenous regulatory elements and flanking sequences, as well as optimization of plant growth regulators for efficient chloroplast transformation. PMID:20130101

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE PAGES

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

2016-03-09

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.

PubMed

Schwartz, Matthew L; Jorgensen, Erik M

2016-04-01

In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.

FARME DB: a functional antibiotic resistance element database

PubMed Central

Wallace, James C.; Port, Jesse A.; Smith, Marissa N.; Faustman, Elaine M.

2017-01-01

Antibiotic resistance (AR) is a major global public health threat but few resources exist that catalog AR genes outside of a clinical context. Current AR sequence databases are assembled almost exclusively from genomic sequences derived from clinical bacterial isolates and thus do not include many microbial sequences derived from environmental samples that confer resistance in functional metagenomic studies. These environmental metagenomic sequences often show little or no similarity to AR sequences from clinical isolates using standard classification criteria. In addition, existing AR databases provide no information about flanking sequences containing regulatory or mobile genetic elements. To help address this issue, we created an annotated database of DNA and protein sequences derived exclusively from environmental metagenomic sequences showing AR in laboratory experiments. Our Functional Antibiotic Resistant Metagenomic Element (FARME) database is a compilation of publically available DNA sequences and predicted protein sequences conferring AR as well as regulatory elements, mobile genetic elements and predicted proteins flanking antibiotic resistant genes. FARME is the first database to focus on functional metagenomic AR gene elements and provides a resource to better understand AR in the 99% of bacteria which cannot be cultured and the relationship between environmental AR sequences and antibiotic resistant genes derived from cultured isolates. Database URL: http://staff.washington.edu/jwallace/farme PMID:28077567

Transcriptional insulation of the human keratin 18 gene in transgenic mice.

PubMed Central

Neznanov, N; Thorey, I S; Ceceña, G; Oshima, R G

1993-01-01

Expression of the 10-kb human keratin 18 (K18) gene in transgenic mice results in efficient and appropriate tissue-specific expression in a variety of internal epithelial organs, including liver, lung, intestine, kidney, and the ependymal epithelium of brain, but not in spleen, heart, or skeletal muscle. Expression at the RNA level is directly proportional to the number of integrated K18 transgenes. These results indicate that the K18 gene is able to insulate itself both from the commonly observed cis-acting effects of the sites of integration and from the potential complications of duplicated copies of the gene arranged in head-to-tail fashion. To begin to identify the K18 gene sequences responsible for this property of transcriptional insulation, additional transgenic mouse lines containing deletions of either the 5' or 3' distal end of the K18 gene have been characterized. Deletion of 1.5 kb of the distal 5' flanking sequence has no effect upon either the tissue specificity or the copy number-dependent behavior of the transgene. In contrast, deletion of the 3.5-kb 3' flanking sequence of the gene results in the loss of the copy number-dependent behavior of the gene in liver and intestine. However, expression in kidney, lung, and brain remains efficient and copy number dependent in these transgenic mice. Furthermore, herpes simplex virus thymidine kinase gene expression is copy number dependent in transgenic mice when the gene is located between the distal 5'- and 3'-flanking sequences of the K18 gene. Each adult transgenic male expressed the thymidine kinase gene in testes and brain and proportionally to the number of integrated transgenes. We conclude that the characteristic of copy number-dependent expression of the K18 gene is tissue specific because the sequence requirements for transcriptional insulation in adult liver and intestine are different from those for lung and kidney. In addition, the behavior of the transgenic thymidine kinase gene in testes and brain suggests that the property of transcriptional insulation of the K18 gene may be conferred by the distal flanking sequences of the K18 gene and, additionally, may function for other genes. Images PMID:7681143

The structure of the SBP-Tag–streptavidin complex reveals a novel helical scaffold bridging binding pockets on separate subunits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barrette-Ng, Isabelle H.; Wu, Sau-Ching; Tjia, Wai-Mui

2013-05-01

The structure of the SBP-Tag–streptavidin complex reveals a novel mode of peptide recognition in which a single peptide binds simultaneously to biotin-binding pockets from adjacent subunits of streptavidin. The molecular details of peptide recognition suggest how the SBP-Tag can be further modified to become an even more useful tag for a wider range of biotechnological applications. The 38-residue SBP-Tag binds to streptavidin more tightly (K{sub d} ≃ 2.5–4.9 nM) than most if not all other known peptide sequences. Crystallographic analysis at 1.75 Å resolution shows that the SBP-Tag binds to streptavidin in an unprecedented manner by simultaneously interacting with biotin-bindingmore » pockets from two separate subunits. An N-terminal HVV peptide sequence (residues 12–14) and a C-terminal HPQ sequence (residues 31–33) form the bulk of the direct interactions between the SBP-Tag and the two biotin-binding pockets. Surprisingly, most of the peptide spanning these two sites (residues 17–28) adopts a regular α-helical structure that projects three leucine side chains into a groove formed at the interface between two streptavidin protomers. The crystal structure shows that residues 1–10 and 35–38 of the original SBP-Tag identified through in vitro selection and deletion analysis do not appear to contact streptavidin and thus may not be important for binding. A 25-residue peptide comprising residues 11–34 (SBP-Tag2) was synthesized and shown using surface plasmon resonance to bind streptavidin with very similar affinity and kinetics when compared with the SBP-Tag. The SBP-Tag2 was also added to the C-terminus of β-lactamase and was shown to be just as effective as the full-length SBP-Tag in affinity purification. These results validate the molecular structure of the SBP-Tag–streptavidin complex and establish a minimal bivalent streptavidin-binding tag from which further rational design and optimization can proceed.« less

Application of Stochastic Labeling with Random-Sequence Barcodes for Simultaneous Quantification and Sequencing of Environmental 16S rRNA Genes.

PubMed

Hoshino, Tatsuhiko; Inagaki, Fumio

2017-01-01

Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.

Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

PubMed

Jia, Xianbo; Lin, Xinjian; Chen, Jichen

2017-11-02

Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

[Comparative analysis of clustered regularly interspaced short palindromic repeats (CRISPRs) loci in the genomes of halophilic archaea].

PubMed

Zhang, Fan; Zhang, Bing; Xiang, Hua; Hu, Songnian

2009-11-01

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a widespread system that provides acquired resistance against phages in bacteria and archaea. Here we aim to genome-widely analyze the CRISPR in extreme halophilic archaea, of which the whole genome sequences are available at present time. We used bioinformatics methods including alignment, conservation analysis, GC content and RNA structure prediction to analyze the CRISPR structures of 7 haloarchaeal genomes. We identified the CRISPR structures in 5 halophilic archaea and revealed a conserved palindromic motif in the flanking regions of these CRISPR structures. In addition, we found that the repeat sequences of large CRISPR structures in halophilic archaea were greatly conserved, and two types of predicted RNA secondary structures derived from the repeat sequences were likely determined by the fourth base of the repeat sequence. Our results support the proposal that the leader sequence may function as recognition site by having palindromic structures in flanking regions, and the stem-loop secondary structure formed by repeat sequences may function in mediating the interaction between foreign genetic elements and CAS-encoded proteins.

Analysis of sequence variation among smeDEF multi drug efflux pump genes and flanking DNA from defined 16S rRNA subgroups of clinical Stenotrophomonas maltophilia isolates.

PubMed

Gould, Virginia C; Okazaki, Aki; Howe, Robin A; Avison, Matthew B

2004-08-01

To determine the level of variation in the smeDEF efflux pump and smeT transcriptional regulator genes among three defined 16S rRNA sequence subgroups of clinical Stenotrophomonas maltophilia isolates. smeDEF sequencing used a PCR genome walking approach. Determination of the sequence surrounding smeDEF used a flanking primer PCR method and specific primers anchored in smeD or smeF together with random primers. smeDEF is chromosomal and located in the same position in the chromosome in all three subgroups of isolates. Flanking smeD is a gene, smeT, encoding a putative transcriptional repressor for smeDEF. Variation at these loci among the isolates is considerably lower (up to 10%) than at intrinsic beta-lactamase loci (up to 30%) in the same isolates, implying greater functional constraint. The smeD-smeT intergenic region contains a highly conserved section, which maps with previously predicted promoter/operator regions, and a hypervariable untranslated region, which can be used to subgroup clinical isolates. These data provide further evidence that it is possible to group clinical isolates of the inherently variable species, S. maltophilia, based on genotypic properties. Isolate D457, in which most work concerning smeDEF expression has been performed, does not fall into S. maltophilia subgroup A, which is the most typical.

Radioresistance of GGG Sequences to Prompt Strand Break Formation from Direct-Type Radiation Damage

PubMed Central

Black, Paul J.; Miller, Adam S.; Hayes, Jeffrey J.

2016-01-01

Purpose As humans, we are constantly exposed to ionizing radiation from natural, man-made and cosmic sources which can damage DNA, leading to deleterious effects including cancer incidence. In this work we introduce a method to monitor strand breaks resulting from damage due to the direct effect of ionizing radiation and provide evidence for sequence-dependent effects leading to strand breaks. Materials and methods To analyze only DNA strand breaks caused by radiation damage due to the direct effect of ionizing radiation, we combined an established technique to generate dehydrated DNA samples with a technique to analyze single strand breaks on short oligonucleotide sequences via denaturing gel electrophoresis. Results We find that direct damage primarily results in a reduced number of strand breaks in guanine triplet regions (GGG) when compared to isolated guanine (G) bases with identical flanking base context. In addition, we observe strand break behavior possibly indicative of protection of guanine bases when flanked by pyrimidines, and sensitization of guanine to strand break when flanked by adenine (A) bases in both isolated G and GGG cases. Conclusions These observations provide insight into the strand break behavior in GGG regions damaged via the direct effect of ionizing radiation. In addition, this could be indicative of DNA sequences that are naturally more susceptible to strand break due to the direct effect of ionizing radiation. PMID:27349757

Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

PubMed

Feng, X; Happ, G M

1996-11-14

The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

RFID tags as a direct tracer for water and sediment dynamics

NASA Astrophysics Data System (ADS)

Sommerer, Erik; Plate, Simon; Güntner, Andreas

2014-05-01

RFID (Radio Frequency IDentification) is a wireless automatic identification system to track objects with widespread application in industrial operations, but also selected applications in ecological research (animal tracking) and for hydro-sedimentological studies (sediment transport with RFID tags embedded in bedload material). In this study, for the first time, we test and apply RFID tags as a direct tracer to track water pathways, erosion patterns and sediment transport on the surface at the hillslope and headwater scale. The RFID system used here consists of tags with a size of 12 x 2 mm and a combination of mobile and stationary antennas. The transport pathways and velocities of the RFID tags can be individually assessed due to their unique identification numbers. The study area is a badland of easily erodible marls and carbonates located in the Villacarli catchment (42 km²) in the Central Spanish Pyrenees. The badlands have been identified as one of the main sediment sources for siltation of the downstream Barasona Reservoir. More than 700 tags were placed in different terrain units using three experimental setups, including lab experiments: (i) intensive feasibility tests ranging from laboratory flume experiments to tracer studies under natural channel and slope conditions to compare the transport of RFID tags relative to colored particles of the natural sediment; (ii) several transects across the badland to investigate sediment transfer characteristics on different morphological units (i.e. channel, rills, slopes); (iii) a raster of 99 RFID tags covering a slope flank with vegetated and unvegetated parts to reveal the influence of vegetation to erosion and transport processes. The detection of transported tags was carried out with a mobile antenna system to map the spatial distribution of tags after selected rainfall events and with two stationary antennas in channel cross-sections for time-continuous observation of tag passage. From the observations, we derived transport distances and velocities for a one year period. The transport behavior of the RFID tags was similar to the micrite limestone material of the badland. These results indicate the important role of terrain position and vegetation patches for erosion patterns, sediment transfer and the associated time scales along the catchment. We assess the potentials and limitations of the RFID technique as a direct tracer for assessing water and sediment connectivity along hillslopes to first order channels.

Evidence for the Concerted Evolution between Short Linear Protein Motifs and Their Flanking Regions

PubMed Central

Chica, Claudia; Diella, Francesca; Gibson, Toby J.

2009-01-01

Background Linear motifs are short modules of protein sequences that play a crucial role in mediating and regulating many protein–protein interactions. The function of linear motifs strongly depends on the context, e.g. functional instances mainly occur inside flexible regions that are accessible for interaction. Sometimes linear motifs appear as isolated islands of conservation in multiple sequence alignments. However, they also occur in larger blocks of sequence conservation, suggesting an active role for the neighbouring amino acids. Results The evolution of regions flanking 116 functional linear motif instances was studied. The conservation of the amino acid sequence and order/disorder tendency of those regions was related to presence/absence of the instance. For the majority of the analysed instances, the pairs of sequences conserving the linear motif were also observed to maintain a similar local structural tendency and/or to have higher local sequence conservation when compared to pairs of sequences where one is missing the linear motif. Furthermore, those instances have a higher chance to co–evolve with the neighbouring residues in comparison to the distant ones. Those findings are supported by examples where the regulation of the linear motif–mediated interaction has been shown to depend on the modifications (e.g. phosphorylation) at neighbouring positions or is thought to benefit from the binding versatility of disordered regions. Conclusion The results suggest that flanking regions are relevant for linear motif–mediated interactions, both at the structural and sequence level. More interestingly, they indicate that the prediction of linear motif instances can be enriched with contextual information by performing a sequence analysis similar to the one presented here. This can facilitate the understanding of the role of these predicted instances in determining the protein function inside the broader context of the cellular network where they arise. PMID:19584925

FRET Imaging of Diatoms Expressing a Biosilica-Localized Ribose Sensor

PubMed Central

Marshall, Kathryn E.; Robinson, Errol W.; Hengel, Shawna M.; Paša-Tolić, Ljiljana; Roesijadi, Guritno

2012-01-01

Future materials are envisioned to include bio-assembled, hybrid, three-dimensional nanosystems that incorporate functional proteins. Diatoms are amenable to genetic modification for localization of recombinant proteins in the biosilica cell wall. However, the full range of protein functionalities that can be accommodated by the modified porous biosilica has yet to be described. Our objective was to functionalize diatom biosilica with a reagent-less sensor dependent on ligand-binding and conformational change to drive FRET-based signaling capabilities. A fusion protein designed to confer such properties included a bacterial periplasmic ribose binding protein (R) flanked by CyPet (C) and YPet (Y), cyan and yellow fluorescent proteins that act as a FRET pair. The structure and function of the CRY recombinant chimeric protein was confirmed by expression in E. coli prior to transformation of the diatom Thalassiosira pseudonana. Mass spectrometry of the recombinant CRY showed 97% identity with the deduced amino acid sequence. CRY with and without an N-terminal Sil3 tag for biosilica localization exhibited characteristic ribose-dependent changes in FRET, with similar dissociation constants of 123.3 µM and 142.8 µM, respectively. The addition of the Sil3 tag did not alter the affinity of CRY for the ribose substrate. Subsequent transformation of T. pseudonana with a vector encoding Sil3-CRY resulted in fluorescence localization in the biosilica and changes in FRET in both living cells and isolated frustules in response to ribose. This work demonstrated that the nano-architecture of the genetically modified biosilica cell wall was able to support the functionality of the relatively complex Sil3-CyPet-RBP-YPet fusion protein with its requirement for ligand-binding and conformational change for FRET-signal generation. PMID:22470473

FRET imaging of diatoms expressing a biosilica-localized ribose sensor.

PubMed

Marshall, Kathryn E; Robinson, Errol W; Hengel, Shawna M; Paša-Tolić, Ljiljana; Roesijadi, Guritno

2012-01-01

Future materials are envisioned to include bio-assembled, hybrid, three-dimensional nanosystems that incorporate functional proteins. Diatoms are amenable to genetic modification for localization of recombinant proteins in the biosilica cell wall. However, the full range of protein functionalities that can be accommodated by the modified porous biosilica has yet to be described. Our objective was to functionalize diatom biosilica with a reagent-less sensor dependent on ligand-binding and conformational change to drive FRET-based signaling capabilities. A fusion protein designed to confer such properties included a bacterial periplasmic ribose binding protein (R) flanked by CyPet (C) and YPet (Y), cyan and yellow fluorescent proteins that act as a FRET pair. The structure and function of the CRY recombinant chimeric protein was confirmed by expression in E. coli prior to transformation of the diatom Thalassiosira pseudonana. Mass spectrometry of the recombinant CRY showed 97% identity with the deduced amino acid sequence. CRY with and without an N-terminal Sil3 tag for biosilica localization exhibited characteristic ribose-dependent changes in FRET, with similar dissociation constants of 123.3 µM and 142.8 µM, respectively. The addition of the Sil3 tag did not alter the affinity of CRY for the ribose substrate. Subsequent transformation of T. pseudonana with a vector encoding Sil3-CRY resulted in fluorescence localization in the biosilica and changes in FRET in both living cells and isolated frustules in response to ribose. This work demonstrated that the nano-architecture of the genetically modified biosilica cell wall was able to support the functionality of the relatively complex Sil3-CyPet-RBP-YPet fusion protein with its requirement for ligand-binding and conformational change for FRET-signal generation.

Linear reduction methods for tag SNP selection.

PubMed

He, Jingwu; Zelikovsky, Alex

2004-01-01

It is widely hoped that constructing a complete human haplotype map will help to associate complex diseases with certain SNP's. Unfortunately, the number of SNP's is huge and it is very costly to sequence many individuals. Therefore, it is desirable to reduce the number of SNP's that should be sequenced to considerably small number of informative representatives, so called tag SNP's. In this paper, we propose a new linear algebra based method for selecting and using tag SNP's. Our method is purely combinatorial and can be combined with linkage disequilibrium (LD) and block based methods. We measure the quality of our tag SNP selection algorithm by comparing actual SNP's with SNP's linearly predicted from linearly chosen tag SNP's. We obtain an extremely good compression and prediction rates. For example, for long haplotypes (>25000 SNP's), knowing only 0.4% of all SNP's we predict the entire unknown haplotype with 2% accuracy while the prediction method is based on a 10% sample of the population.

Detecting authorized and unauthorized genetically modified organisms containing vip3A by real-time PCR and next-generation sequencing.

PubMed

Liang, Chanjuan; van Dijk, Jeroen P; Scholtens, Ingrid M J; Staats, Martijn; Prins, Theo W; Voorhuijzen, Marleen M; da Silva, Andrea M; Arisi, Ana Carolina Maisonnave; den Dunnen, Johan T; Kok, Esther J

2014-04-01

The growing number of biotech crops with novel genetic elements increasingly complicates the detection of genetically modified organisms (GMOs) in food and feed samples using conventional screening methods. Unauthorized GMOs (UGMOs) in food and feed are currently identified through combining GMO element screening with sequencing the DNA flanking these elements. In this study, a specific and sensitive qPCR assay was developed for vip3A element detection based on the vip3Aa20 coding sequences of the recently marketed MIR162 maize and COT102 cotton. Furthermore, SiteFinding-PCR in combination with Sanger, Illumina or Pacific BioSciences (PacBio) sequencing was performed targeting the flanking DNA of the vip3Aa20 element in MIR162. De novo assembly and Basic Local Alignment Search Tool searches were used to mimic UGMO identification. PacBio data resulted in relatively long contigs in the upstream (1,326 nucleotides (nt); 95 % identity) and downstream (1,135 nt; 92 % identity) regions, whereas Illumina data resulted in two smaller contigs of 858 and 1,038 nt with higher sequence identity (>99 % identity). Both approaches outperformed Sanger sequencing, underlining the potential for next-generation sequencing in UGMO identification.

Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio

2008-08-15

The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, onlymore » mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library.« less

The Danish STR sequence database: duplicate typing of 363 Danes with the ForenSeq™ DNA Signature Prep Kit.

PubMed

Hussing, C; Bytyci, R; Huber, C; Morling, N; Børsting, C

2018-05-24

Some STR loci have internal sequence variations, which are not revealed by the standard STR typing methods used in forensic genetics (PCR and fragment length analysis by capillary electrophoresis (CE)). Typing of STRs with next-generation sequencing (NGS) uncovers the sequence variation in the repeat region and in the flanking regions. In this study, 363 Danish individuals were typed for 56 STRs (26 autosomal STRs, 24 Y-STRs, and 6 X-STRs) using the ForenSeq™ DNA Signature Prep Kit to establish a Danish STR sequence database. Increased allelic diversity was observed in 34 STRs by the PCR-NGS assay. The largest increases were found in DYS389II and D12S391, where the numbers of sequenced alleles were around four times larger than the numbers of alleles determined by repeat length alone. Thirteen SNPs and one InDel were identified in the flanking regions of 12 STRs. Furthermore, 36 single positions and five longer stretches in the STR flanking regions were found to have dubious genotyping quality. The combined match probability of the 26 autosomal STRs was 10,000 times larger using the PCR-NGS assay than by using PCR-CE. The typical paternity indices for trios and duos were 500 and 100 times larger, respectively, than those obtained with PCR-CE. The assay also amplified 94 SNPs selected for human identification. Eleven of these loci were not in Hardy-Weinberg equilibrium in the Danish population, most likely because the minimum threshold for allele calling (30 reads) in the ForenSeq™ Universal Analysis Software was too low and frequent allele dropouts were not detected.

Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies.

PubMed

Haimon, Zhana; Volaski, Alon; Orthgiess, Johannes; Boura-Halfon, Sigalit; Varol, Diana; Shemer, Anat; Yona, Simon; Zuckerman, Binyamin; David, Eyal; Chappell-Maor, Louise; Bechmann, Ingo; Gericke, Martin; Ulitsky, Igor; Jung, Steffen

2018-06-01

Transcriptome profiling is widely used to infer functional states of specific cell types, as well as their responses to stimuli, to define contributions to physiology and pathophysiology. Focusing on microglia, the brain's macrophages, we report here a side-by-side comparison of classical cell-sorting-based transcriptome sequencing and the 'RiboTag' method, which avoids cell retrieval from tissue context and yields translatome sequencing information. Conventional whole-cell microglial transcriptomes were found to be significantly tainted by artifacts introduced by tissue dissociation, cargo contamination and transcripts sequestered from ribosomes. Conversely, our data highlight the added value of RiboTag profiling for assessing the lineage accuracy of Cre recombinase expression in transgenic mice. Collectively, this study indicates method-based biases, reveals observer effects and establishes RiboTag-based translatome profiling as a valuable complement to standard sorting-based profiling strategies.

Interactive Block Games for Assessing Children's Cognitive Skills: Design and Preliminary Evaluation.

PubMed

Lee, Kiju; Jeong, Donghwa; Schindler, Rachael C; Hlavaty, Laura E; Gross, Susan I; Short, Elizabeth J

2018-01-01

Background: This paper presents design and results from preliminary evaluation of Tangible Geometric Games (TAG-Games) for cognitive assessment in young children. The TAG-Games technology employs a set of sensor-integrated cube blocks, called SIG-Blocks, and graphical user interfaces for test administration and real-time performance monitoring. TAG-Games were administered to children from 4 to 8 years of age for evaluating preliminary efficacy of this new technology-based approach. Methods: Five different sets of SIG-Blocks comprised of geometric shapes, segmented human faces, segmented animal faces, emoticons, and colors, were used for three types of TAG-Games, including Assembly, Shape Matching, and Sequence Memory. Computational task difficulty measures were defined for each game and used to generate items with varying difficulty. For preliminary evaluation, TAG-Games were tested on 40 children. To explore the clinical utility of the information assessed by TAG-Games, three subtests of the age-appropriate Wechsler tests (i.e., Block Design, Matrix Reasoning, and Picture Concept) were also administered. Results: Internal consistency of TAG-Games was evaluated by the split-half reliability test. Weak to moderate correlations between Assembly and Block Design, Shape Matching and Matrix Reasoning, and Sequence Memory and Picture Concept were found. The computational measure of task complexity for each TAG-Game showed a significant correlation with participants' performance. In addition, age-correlations on TAG-Game scores were found, implying its potential use for assessing children's cognitive skills autonomously.

Interactive Block Games for Assessing Children's Cognitive Skills: Design and Preliminary Evaluation

PubMed Central

Lee, Kiju; Jeong, Donghwa; Schindler, Rachael C.; Hlavaty, Laura E.; Gross, Susan I.; Short, Elizabeth J.

2018-01-01

Background: This paper presents design and results from preliminary evaluation of Tangible Geometric Games (TAG-Games) for cognitive assessment in young children. The TAG-Games technology employs a set of sensor-integrated cube blocks, called SIG-Blocks, and graphical user interfaces for test administration and real-time performance monitoring. TAG-Games were administered to children from 4 to 8 years of age for evaluating preliminary efficacy of this new technology-based approach. Methods: Five different sets of SIG-Blocks comprised of geometric shapes, segmented human faces, segmented animal faces, emoticons, and colors, were used for three types of TAG-Games, including Assembly, Shape Matching, and Sequence Memory. Computational task difficulty measures were defined for each game and used to generate items with varying difficulty. For preliminary evaluation, TAG-Games were tested on 40 children. To explore the clinical utility of the information assessed by TAG-Games, three subtests of the age-appropriate Wechsler tests (i.e., Block Design, Matrix Reasoning, and Picture Concept) were also administered. Results: Internal consistency of TAG-Games was evaluated by the split-half reliability test. Weak to moderate correlations between Assembly and Block Design, Shape Matching and Matrix Reasoning, and Sequence Memory and Picture Concept were found. The computational measure of task complexity for each TAG-Game showed a significant correlation with participants' performance. In addition, age-correlations on TAG-Game scores were found, implying its potential use for assessing children's cognitive skills autonomously. PMID:29868520

Optimal use of tandem biotin and V5 tags in ChIP assays

PubMed Central

Kolodziej, Katarzyna E; Pourfarzad, Farzin; de Boer, Ernie; Krpic, Sanja; Grosveld, Frank; Strouboulis, John

2009-01-01

Background Chromatin immunoprecipitation (ChIP) assays coupled to genome arrays (Chip-on-chip) or massive parallel sequencing (ChIP-seq) lead to the genome wide identification of binding sites of chromatin associated proteins. However, the highly variable quality of antibodies and the availability of epitopes in crosslinked chromatin can compromise genomic ChIP outcomes. Epitope tags have often been used as more reliable alternatives. In addition, we have employed protein in vivo biotinylation tagging as a very high affinity alternative to antibodies. In this paper we describe the optimization of biotinylation tagging for ChIP and its coupling to a known epitope tag in providing a reliable and efficient alternative to antibodies. Results Using the biotin tagged erythroid transcription factor GATA-1 as example, we describe several optimization steps for the application of the high affinity biotin streptavidin system in ChIP. We find that the omission of SDS during sonication, the use of fish skin gelatin as blocking agent and choice of streptavidin beads can lead to significantly improved ChIP enrichments and lower background compared to antibodies. We also show that the V5 epitope tag performs equally well under the conditions worked out for streptavidin ChIP and that it may suffer less from the effects of formaldehyde crosslinking. Conclusion The combined use of the very high affinity biotin tag with the less sensitive to crosslinking V5 tag provides for a flexible ChIP platform with potential implications in ChIP sequencing outcomes. PMID:19196479

Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour

USDA-ARS?s Scientific Manuscript database

The complement of gamma gliadin genes expressed in the wheat cultivar Butte 86 was evaluated by analyzing publicly available expressed sequence tag (EST) data. Eleven contigs were assembled from 153 Butte 86 ESTs. Nine of the contigs encoded full-length proteins and four of the proteins contained an...

Endoprotease profiling with double-tagged peptide substrates: a new diagnostic approach in oncology.

PubMed

Peccerella, Teresa; Lukan, Nadine; Hofheinz, Ralf; Schadendorf, Dirk; Kostrezewa, Markus; Neumaier, Michael; Findeisen, Peter

2010-02-01

The measurement of disease-related proteolytic activity in complex biological matrices like serum is of emerging interest to improve the diagnosis of malignant diseases. We developed a mass spectrometry (MS)-based functional proteomic profiling approach that tracks degradation of artificial endoprotease substrates in serum specimens. The synthetic reporter peptides that are cleaved by tumor-associated endopeptidases were systematically optimized with regard to flanking affinity tags, linkers, and stabilizing elements. Serum specimens were incubated with reporter peptides under standardized conditions and the peptides subsequently extracted with affinity chromatography before MS. In a pilot study an optimized reporter peptide with the cleavage motif WKPYDAADL was added to serum specimens from colorectal tumor patients (n = 50) and healthy controls (n = 50). This reporter peptide comprised a known cleavage site for the cysteine-endopeptidase "cancer procoagulant." Serial affinity chromatography using biotin- and 6xHis tags was superior to the single affinity enrichment using only 6xHis tags. Furthermore, protease-resistant stop elements ensured signal accumulation after prolonged incubation. In contrast, signals from reporter peptides without stop elements vanished completely after prolonged incubation owing to their total degradation. Reporter-peptide spiking showed good reproducibility, and the difference in proteolytic activity between serum specimens from cancer patients and controls was highly significant (P < 0.001). The introduction of a few structural key elements (affinity tags, linkers, d-amino acids) into synthetic reporter peptides increases the diagnostic sensitivity for MS-based protease profiling of serum specimens. This new approach might lead to functional MS-based protease profiling for improved disease classification.

The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

PubMed

Holland, M J; Holland, J P; Thill, G P; Jackson, K A

1981-02-10

Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.

CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats.

PubMed

Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine

2007-07-01

Clustered regularly interspaced short palindromic repeats (CRISPRs) constitute a particular family of tandem repeats found in a wide range of prokaryotic genomes (half of eubacteria and almost all archaea). They consist of a succession of highly conserved regions (DR) varying in size from 23 to 47 bp, separated by similarly sized unique sequences (spacer) of usually viral origin. A CRISPR cluster is flanked on one side by an AT-rich sequence called the leader and assumed to be a transcriptional promoter. Recent studies suggest that this structure represents a putative RNA-interference-based immune system. Here we describe CRISPRFinder, a web service offering tools to (i) detect CRISPRs including the shortest ones (one or two motifs); (ii) define DRs and extract spacers; (iii) get the flanking sequences to determine the leader; (iv) blast spacers against Genbank database and (v) check if the DR is found elsewhere in prokaryotic sequenced genomes. CRISPRFinder is freely accessible at http://crispr.u-psud.fr/Server/CRISPRfinder.php.

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants.

PubMed

Rodovalho, Cynara M; Ferro, Milene; Fonseca, Fernando Pp; Antonio, Erik A; Guilherme, Ivan R; Henrique-Silva, Flávio; Bacci, Maurício

2011-06-17

Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters.

Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants

PubMed Central

2011-01-01

Background Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. Results The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. Conclusion The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters. PMID:21682882

Separation efficiency of free-solution conjugated electrophoresis with drag-tags incorporating a synthetic amino acid.

PubMed

Seo, Kyung-Ho; Chu, Hun-Su; Yoo, Tae Hyeon; Lee, Sun-Gu; Won, Jong-In

2016-03-01

DNA sequencing or separation by conventional capillary electrophoresis with a polymer matrix has some inherent drawbacks, such as the expense of polymer matrix and limitations in sequencing read length. As DNA fragments have a linear charge-to-friction ratio in free solution, DNA fragments cannot be separated by size. However, size-based separation of DNA is possible in free-solution conjugate electrophoresis (FSCE) if a "drag-tag" is attached to DNA fragments because the tag breaks the linear charge-to-friction scaling. Although several previous studies have demonstrated the feasibility of DNA separation by free-solution conjugated electrophoresis, generation of a monodisperse drag-tag and identification of a strong, site-specific conjugation method between a DNA fragment and a drag-tag are challenges that still remain. In this study, we demonstrate an efficient FSCE method by conjugating a biologically synthesized elastin-like polypeptide (ELP) and green fluorescent protein (GFP) to DNA fragments. In addition, to produce strong and site-specific conjugation, a methionine residue in drag-tags is replaced with homopropargylglycine (Hpg), which can be conjugated specifically to a DNA fragment with an azide site. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The presence of both negative and positive elements in the 5'-flanking sequence of the rat Na,K-ATPase alpha 3 subunit gene are required for brain expression in transgenic mice.

PubMed Central

Pathak, B G; Neumann, J C; Croyle, M L; Lingrel, J B

1994-01-01

The Na,K-ATPase is an integral plasma membrane protein consisting of alpha and beta subunits, each of which has discrete isoforms expressed in a tissue-specific manner. Of the three functional alpha isoform genes, the one encoding the alpha 3 isoform is the most tissue-restricted in its expression, being found primarily in the brain. To identify regions of the alpha 3 isoform gene that are involved in directing expression in the brain, a 1.6 kb 5'-flanking sequence was attached to a reporter gene, chloramphenicol acetyltransferase (CAT). The alpha 3-CAT chimeric gene construct was microinjected into fertilized mouse eggs, and transgenic mice were produced. Analysis of adult transgenic mice from different lines revealed that the transgene is expressed primarily in the brain. To further delineate regions that are needed for conferring expression in this tissue, systematic deletions of the 5'-flanking sequence of the alpha 3-CAT fusion constructs were made and analyzed, again using transgenic mice. The results from these analyses indicate that DNA sequences required for mediating brain-specific expression of the alpha 3 isoform gene are present within 210 bp upstream of the transcription initiation site. alpha 3-CAT promoter constructs containing scanning mutations in this region were also assayed in transgenic mice. These studies have identified both a functional neural-restrictive silencer element as well as a positively acting cis element. Images PMID:7984427

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Development of single-copy nuclear intron markers for species-level phylogenetics: Case study with Paullinieae (Sapindaceae).

PubMed

Chery, Joyce G; Sass, Chodon; Specht, Chelsea D

2017-09-01

We developed a bioinformatic pipeline that leverages a publicly available genome and published transcriptomes to design primers in conserved coding sequences flanking targeted introns of single-copy nuclear loci. Paullinieae (Sapindaceae) is used to demonstrate the pipeline. Transcriptome reads phylogenetically closer to the lineage of interest are aligned to the closest genome. Single-nucleotide polymorphisms are called, generating a "pseudoreference" closer to the lineage of interest. Several filters are applied to meet the criteria of single-copy nuclear loci with introns of a desired size. Primers are designed in conserved coding sequences flanking introns. Using this pipeline, we developed nine single-copy nuclear intron markers for Paullinieae. This pipeline is highly flexible and can be used for any group with available genomic and transcriptomic resources. This pipeline led to the development of nine variable markers for phylogenetic study without generating sequence data de novo.

Abseq: Ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding.

PubMed

Shahi, Payam; Kim, Samuel C; Haliburton, John R; Gartner, Zev J; Abate, Adam R

2017-03-14

Proteins are the primary effectors of cellular function, including cellular metabolism, structural dynamics, and information processing. However, quantitative characterization of proteins at the single-cell level is challenging due to the tiny amount of protein available. Here, we present Abseq, a method to detect and quantitate proteins in single cells at ultrahigh throughput. Like flow and mass cytometry, Abseq uses specific antibodies to detect epitopes of interest; however, unlike these methods, antibodies are labeled with sequence tags that can be read out with microfluidic barcoding and DNA sequencing. We demonstrate this novel approach by characterizing surface proteins of different cell types at the single-cell level and distinguishing between the cells by their protein expression profiles. DNA-tagged antibodies provide multiple advantages for profiling proteins in single cells, including the ability to amplify low-abundance tags to make them detectable with sequencing, to use molecular indices for quantitative results, and essentially limitless multiplexing.

Abseq: Ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding

NASA Astrophysics Data System (ADS)

Shahi, Payam; Kim, Samuel C.; Haliburton, John R.; Gartner, Zev J.; Abate, Adam R.

2017-03-01

Proteins are the primary effectors of cellular function, including cellular metabolism, structural dynamics, and information processing. However, quantitative characterization of proteins at the single-cell level is challenging due to the tiny amount of protein available. Here, we present Abseq, a method to detect and quantitate proteins in single cells at ultrahigh throughput. Like flow and mass cytometry, Abseq uses specific antibodies to detect epitopes of interest; however, unlike these methods, antibodies are labeled with sequence tags that can be read out with microfluidic barcoding and DNA sequencing. We demonstrate this novel approach by characterizing surface proteins of different cell types at the single-cell level and distinguishing between the cells by their protein expression profiles. DNA-tagged antibodies provide multiple advantages for profiling proteins in single cells, including the ability to amplify low-abundance tags to make them detectable with sequencing, to use molecular indices for quantitative results, and essentially limitless multiplexing.

Abseq: Ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding

PubMed Central

Shahi, Payam; Kim, Samuel C.; Haliburton, John R.; Gartner, Zev J.; Abate, Adam R.

2017-01-01

Proteins are the primary effectors of cellular function, including cellular metabolism, structural dynamics, and information processing. However, quantitative characterization of proteins at the single-cell level is challenging due to the tiny amount of protein available. Here, we present Abseq, a method to detect and quantitate proteins in single cells at ultrahigh throughput. Like flow and mass cytometry, Abseq uses specific antibodies to detect epitopes of interest; however, unlike these methods, antibodies are labeled with sequence tags that can be read out with microfluidic barcoding and DNA sequencing. We demonstrate this novel approach by characterizing surface proteins of different cell types at the single-cell level and distinguishing between the cells by their protein expression profiles. DNA-tagged antibodies provide multiple advantages for profiling proteins in single cells, including the ability to amplify low-abundance tags to make them detectable with sequencing, to use molecular indices for quantitative results, and essentially limitless multiplexing. PMID:28290550

A novel expression system for intracellular production and purification of recombinant affinity-tagged proteins in Aspergillus niger.

PubMed

Roth, Andreas H F J; Dersch, Petra

2010-03-01

A set of different integrative expression vectors for the intracellular production of recombinant proteins with or without affinity tag in Aspergillus niger was developed. Target genes can be expressed under the control of the highly efficient, constitutive pkiA promoter or the novel sucrose-inducible promoter of the beta-fructofuranosidase (sucA) gene of A. niger in the presence or absence of alternative carbon sources. All expression plasmids contain an identical multiple cloning sequence that allows parallel construction of N- or C-terminally His6- and StrepII-tagged versions of the target proteins. Production of two heterologous model proteins, the green fluorescence protein and the Thermobifida fusca hydrolase, proved the functionality of the vector system. Efficient production and easy detection of the target proteins as well as their fast purification by a one-step affinity chromatography, using the His6- or StrepII-tag sequence, was demonstrated.

A statistical method for assessing peptide identification confidence in accurate mass and time tag proteomics

PubMed Central

Stanley, Jeffrey R.; Adkins, Joshua N.; Slysz, Gordon W.; Monroe, Matthew E.; Purvine, Samuel O.; Karpievitch, Yuliya V.; Anderson, Gordon A.; Smith, Richard D.; Dabney, Alan R.

2011-01-01

Current algorithms for quantifying peptide identification confidence in the accurate mass and time (AMT) tag approach assume that the AMT tags themselves have been correctly identified. However, there is uncertainty in the identification of AMT tags, as this is based on matching LC-MS/MS fragmentation spectra to peptide sequences. In this paper, we incorporate confidence measures for the AMT tag identifications into the calculation of probabilities for correct matches to an AMT tag database, resulting in a more accurate overall measure of identification confidence for the AMT tag approach. The method is referred to as Statistical Tools for AMT tag Confidence (STAC). STAC additionally provides a Uniqueness Probability (UP) to help distinguish between multiple matches to an AMT tag and a method to calculate an overall false discovery rate (FDR). STAC is freely available for download as both a command line and a Windows graphical application. PMID:21692516

Telomere formation on macronuclear chromosomes of Oxytricha trifallax and O. fallax: alternatively processed regions have multiple telomere addition sites

PubMed Central

Williams, Kevin R; Doak, Thomas G; Herrick, Glenn

2002-01-01

Background Ciliates employ massive chromatid breakage and de novo telomere formation during generation of the somatic macronucleus. Positions flanking the 81-MAC locus are reproducibly cut. But those flanking the Common Region are proposed to often escape cutting, generating three nested macronuclear chromosomes, two retaining "arms" still appended to the Common Region. Arm-distal positions must differ (in cis) from the Common Region flanks. Results The Common-Region-flanking positions also differ from the arm-distal positions in that they are "multi-TAS" regions: anchored PCR shows heterogeneous patterns of telomere addition sites, but arm-distal sites do not. The multi-TAS patterns are reproducible, but are sensitive to the sequence of the allele being processed. Thus, random degradation following chromatid cutting does not create this heterogeneity; these telomere addition sites also must be dictated by cis-acting sequences. Conclusions Most ciliates show such micro-heterogeneity in the precise positions of telomere addition sites. Telomerase is believed to be tightly associated with, and act in concert with, the chromatid-cutting nuclease: heterogeneity must be the result of intervening erosion activity. Our "weak-sites" hypothesis explains the correlation between alternative chromatid cutting at the Common Region boundaries and their multi-TAS character: when the chromatid-breakage machine encounters either a weak binding site or a weak cut site at these regions, then telomerase dissociates prematurely, leaving the new end subject to erosion by an exonuclease, which pauses at cis-acting sequences; telomerase eventually heals these resected termini. Finally, we observe TAS positioning influenced by trans-allelic interactions, reminiscent of transvection. PMID:12199911

Multiple cis-acting elements involved in up-regulation of a cytochrome P450 gene conferring resistance to deltamethrin in smal brown planthopper, Laodelphax striatellus (Fallén).

PubMed

Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun

2016-11-01

As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.

Depositional environments, sequence stratigraphy, and trapping mechanisms of Fall River Formation in Donkey Creek and Coyote Creek oil fields, Powder River basin, Wyoming

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knox, P.R.

1989-09-01

Donkey Creek and Coyote Creek fields contain combined reserves of approximately 35 million bbl of oil and are within a trend of fields on the eastern flank of the Powder River basin that totals over 100 million bbl of reserves. The principal producing formation is the Lower Cretaceous Fall River Sandstone. A study of 45 cores and 248 logs from the three pools in the Donkey Creek and Coyote fields has shown that the Fall River is composed of three progradational deltaic units deposited during a period of rising relative sea level. These are locally eroded and are filled bymore » a fluvial point-bar complex deposited following a lowering of relative sea level. Four important depositional facies have been recognized: the delta-front and distributary-channel sandstone of the highstand deltaic sequence and the point-bar sandstone and channel-abandonment of the lowstand fluvial sequence. Stratigraphic traps in Coyote Creek and south Donkey Creek pools are the result of permeable (250 md) point-bar sandstone (250 bbl oil/day ip) bounded updip by impermeable (0.1 md) channel abandonment mudstone. Most of the oil in the central Donkey Creek pool is produced from permeable (76 md) distributary-channel sandstone (150 bbl oil/day ip), which is restricted to the western flank of a structural nose. Lesser production, on the crest and upper western flank of the structure, is obtained from the less permeable (2.8 md) delta-front sandstone (50 bbl oil/day ip). Production is possibly limited to the crest and western flank by hydrodynamic processes.« less

Magnetic Resonance Arterial Spin Tagging for Non-Invasive Pharmacokinetic Analysis of Breast Cancer

DTIC Science & Technology

2000-10-01

sequence software that we had developed for this project. In addition, we revised the pulse sequences to utilize the high performance gradients (40 mT/ m ...peak, 150 mT/ m /ms rise) of the system. We believe these revised sequences will provide better arterial spin tagged data for perfusion measurement. All...U.... ...... ... -- v p I _1 i-:F~ ----- ! - .Ag Jig. H aI .. M e fI6lo 3 ~ ~ 2 0’,~- A.11. I 1 1 9 - HP ~ ~ IM I 15 L 1 1 8 = NIAt I C J1 5

The transcription factor GCN4 regulates PHM8 and alters triacylglycerol metabolism in Saccharomyces cerevisiae.

PubMed

Yadav, Kamlesh Kumar; Rajasekharan, Ram

2016-11-01

PHM8 is a very important enzyme in nonpolar lipid metabolism because of its role in triacylglycerol (TAG) biosynthesis under phosphate stress conditions. It is positively regulated by the PHO4 transcription factor under low phosphate conditions; however, its regulation has not been explored under normal physiological conditions. General control nonderepressible (GCN4), a basic leucine-zipper transcription factor activates the transcription of amino acids, purine biosynthesis genes and many stress response genes under various stress conditions. In this study, we demonstrate that the level of TAG is regulated by the transcription factor GCN4. GCN4 directly binds to its consensus recognition sequence (TGACTC) in the PHM8 promoter and controls its expression. The analysis of cells expressing the P PHM8 -lacZ reporter gene showed that mutations (TGACTC-GGGCCC) in the GCN4-binding sequence caused a significant increase in β-galactosidase activity. Mutation in the GCN4 binding sequence causes an increase in PHM8 expression, lysophosphatidic acid phosphatase activity and TAG level. PHM8, in conjunction with DGA1, a mono- and diacylglycerol transferase, controls the level of TAG. These results revealed that GCN4 negatively regulates PHM8 and that deletion of GCN4 causes de-repression of PHM8, which is responsible for the increased TAG content in gcn4∆ cells.

Probing the potential of CnaB-type domains for the design of tag/catcher systems

PubMed Central

Pröschel, Marlene; Kraner, Max E.; Horn, Anselm H. C.; Schäfer, Lena; Sonnewald, Uwe

2017-01-01

Building proteins into larger, post-translational assemblies in a defined and stable way is still a challenging task. A promising approach relies on so-called tag/catcher systems that are fused to the proteins of interest and allow a durable linkage via covalent intermolecular bonds. Tags and catchers are generated by splitting protein domains that contain intramolecular isopeptide or ester bonds that form autocatalytically under physiological conditions. There are already numerous biotechnological and medical applications that demonstrate the usefulness of covalent linkages mediated by these systems. Additional covalent tag/catcher systems would allow creating more complex and ultra-stable protein architectures and networks. Two of the presently available tag/catcher systems were derived from closely related CnaB-domains of Streptococcus pyogenes and Streptococcus dysgalactiae proteins. However, it is unclear whether domain splitting is generally tolerated within the CnaB-family or only by a small subset of these domains. To address this point, we have selected a set of four CnaB domains of low sequence similarity and characterized the resulting tag/catcher systems by computational and experimental methods. Experimental testing for intermolecular isopeptide bond formation demonstrated two of the four systems to be functional. For these two systems length and sequence variations of the peptide tags were investigated revealing only a relatively small effect on the efficiency of the reaction. Our study suggests that splitting into tag and catcher moieties is tolerated by a significant portion of the naturally occurring CnaB-domains, thus providing a large reservoir for the design of novel tag/catcher systems. PMID:28654665

Structural evolution of Arsia Mons, Pavonis Mons, and Ascreus Mons Tharsis region of Mars

NASA Technical Reports Server (NTRS)

Crumpler, L. S.; Aubele, J. C.

1978-01-01

Analysis of Viking Orbiter data suggests that Arsia Mons, Pavonis Mons, and Ascreus Mons, three large shield volcanoes of the Tharsis volcanoes of Mars, have had similar evolutionary trends. Arsia Mons appears to have developed in the following sequence: (1) construction of a main shield volcano, (2) outbreak of parasitic eruption centers on the northeast and southwest flanks, (3) volcano-tectonic subsidence of the summit and formation of concentric fractures and grabens, possibly by evacuation of an underlying magma chamber during eruption of copious lavas from parasitic eruption centers on the northeast and southwest flanks, and (4) continued volcanism along a fissure or rift bisecting the main shield, resulting in flooding of the floor of the volcano-tectonic depression and inundation of the northeast and southwest flanks by voluminous lavas locally forming parasitic shields. In terms of this sequence Pavonis Mons has developed to stage (3) and Ascreus Mons has evolved to stage (2). This interpretation is supported by crater frequency-diameter distributions in the 0.1- to 3.0-km diameter range.

PH dependent adhesive peptides

DOEpatents

Tomich, John; Iwamoto, Takeo; Shen, Xinchun; Sun, Xiuzhi Susan

2010-06-29

A novel peptide adhesive motif is described that requires no receptor or cross-links to achieve maximal adhesive strength. Several peptides with different degrees of adhesive strength have been designed and synthesized using solid phase chemistries. All peptides contain a common hydrophobic core sequence flanked by positively or negatively charged amino acids sequences.

Development of expressed sequence tag-simple sequence repeat markers for genetic characterization and population structure analysis of Praxelis clematidea (Asteraceae).

PubMed

Wang, Q Z; Huang, M; Downie, S R; Chen, Z X

2016-05-23

Invasive plants tend to spread aggressively in new habitats and an understanding of their genetic diversity and population structure is useful for their management. In this study, expressed sequence tag-simple sequence repeat (EST-SSR) markers were developed for the invasive plant species Praxelis clematidea (Asteraceae) from 5548 Stevia rebaudiana (Asteraceae) expressed sequence tags (ESTs). A total of 133 microsatellite-containing ESTs (2.4%) were identified, of which 56 (42.1%) were hexanucleotide repeat motifs and 50 (37.6%) were trinucleotide repeat motifs. Of the 24 primer pairs designed from these 133 ESTs, 7 (29.2%) resulted in significant polymorphisms. The number of alleles per locus ranged from 5 to 9. The relatively high genetic diversity (H = 0.2667, I = 0.4212, and P = 100%) of P. clematidea was related to high gene flow (Nm = 1.4996) among populations. The coefficient of population differentiation (GST = 0.2500) indicated that most genetic variation occurred within populations. A Mantel test suggested that there was significant correlation between genetic distance and geographical distribution (r = 0.3192, P = 0.012). These results further support the transferability of EST-SSR markers between closely related genera of the same family.

Gapped Spectral Dictionaries and Their Applications for Database Searches of Tandem Mass Spectra*

PubMed Central

Jeong, Kyowon; Kim, Sangtae; Bandeira, Nuno; Pevzner, Pavel A.

2011-01-01

Generating all plausible de novo interpretations of a peptide tandem mass (MS/MS) spectrum (Spectral Dictionary) and quickly matching them against the database represent a recently emerged alternative approach to peptide identification. However, the sizes of the Spectral Dictionaries quickly grow with the peptide length making their generation impractical for long peptides. We introduce Gapped Spectral Dictionaries (all plausible de novo interpretations with gaps) that can be easily generated for any peptide length thus addressing the limitation of the Spectral Dictionary approach. We show that Gapped Spectral Dictionaries are small thus opening a possibility of using them to speed-up MS/MS searches. Our MS-GappedDictionary algorithm (based on Gapped Spectral Dictionaries) enables proteogenomics applications (such as searches in the six-frame translation of the human genome) that are prohibitively time consuming with existing approaches. MS-GappedDictionary generates gapped peptides that occupy a niche between accurate but short peptide sequence tags and long but inaccurate full length peptide reconstructions. We show that, contrary to conventional wisdom, some high-quality spectra do not have good peptide sequence tags and introduce gapped tags that have advantages over the conventional peptide sequence tags in MS/MS database searches. PMID:21444829

Geology of natural gas reservoir: Upper Travis Peak Formation, western flank of Sabine Uplift, east Texas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fracasso, M.A.

The Travis Peak Formation (Lower Cretaceous) in the eastern East Texas basin represents a sand-rich, fluvial-deltaic depositional system. This lobate, high-constructive deltaic system prograded radially to the southeast from an Upshur County locus. Regional studies of the Travis Peak established a threefold internal stratigraphic framework: a middle sand-rich fluvial and delta-plain sequence is gradationally overlain and underlain by a marine-influenced delta-fringe zone with a higher mud content. The entire Travis Peak succession thins over the Bethany dome on the western flank of the Sabine uplift. However, the delta-fringe sequences are relatively thicker over the structure because of a disproportionately greatermore » thinning of the middle sandy fluvial-deltaic sequence. Lesser sand deposition over the Bethany dome reflects an active structural control over facies distribution. Gas production in the Bethany field and surrounding area is concentrated in thin zones (5-15 ft) of the upper delta-fringe sequence. This distribution probably reflects the increased abundance of mudstone beds in the upper delta-fringe interval, which may have served as source rocks or barriers to upward gas migration, or as both. The predominant trapping mechanism in this region is stratigraphic sand pinch-out in a structurally updip direction on the flanks of major structures. Studies of core and closely spaced electric logs west of the Bethany dome help define the depositional systems in the upper delta-fringe producing interval. This sequence comprises a complex mosaic of continental and marine facies, and exhibits an overall upward trend of increasing marine influence that spans a gradual transition into transgressive carbonates of the Sligo Formation.« less

Sequence-dependent DNA deformability studied using molecular dynamics simulations.

PubMed

Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori

2007-01-01

Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.

High-resolution mapping of the 11q13 amplicon and identification of a gene, TAOS1, that is amplified and overexpressed in oral cancer cells

PubMed Central

Huang, Xin; Gollin, Susanne M.; Raja, Siva; Godfrey, Tony E.

2002-01-01

Amplification of chromosomal band 11q13 is a common event in human cancer. It has been reported in about 45% of head and neck carcinomas and in other cancers including esophageal, breast, liver, lung, and bladder cancer. To understand the mechanism of 11q13 amplification and to identify the potential oncogene(s) driving it, we have fine-mapped the structure of the amplicon in oral squamous cell carcinoma cell lines and localized the proximal and distal breakpoints. A 5-Mb physical map of the region has been prepared from which sequence is available. We quantified copy number of sequence-tagged site markers at 42–550 kb intervals along the length of the amplicon and defined the amplicon core and breakpoints by using TaqMan-based quantitative microsatellite analysis. The core of the amplicon maps to a 1.5-Mb region. The proximal breakpoint localizes to two intervals between sequence-tagged site markers, 550 kb and 160 kb in size, and the distal breakpoint maps to a 250 kb interval. The cyclin D1 gene maps to the amplicon core, as do two new expressed sequence tag clusters. We have analyzed one of these expressed sequence tag clusters and now report that it contains a previously uncharacterized gene, TAOS1 (tumor amplified and overexpressed sequence 1), which is both amplified and overexpressed in oral cancer cells. The data suggest that TAOS1 may be an amplification-dependent candidate oncogene with a role in the development and/or progression of human tumors, including oral squamous cell carcinomas. The approach described here should be useful for characterizing amplified genomic regions in a wide variety of tumors. PMID:12172009

Evaluating information content of SNPs for sample-tagging in re-sequencing projects.

PubMed

Hu, Hao; Liu, Xiang; Jin, Wenfei; Hilger Ropers, H; Wienker, Thomas F

2015-05-15

Sample-tagging is designed for identification of accidental sample mix-up, which is a major issue in re-sequencing studies. In this work, we develop a model to measure the information content of SNPs, so that we can optimize a panel of SNPs that approach the maximal information for discrimination. The analysis shows that as low as 60 optimized SNPs can differentiate the individuals in a population as large as the present world, and only 30 optimized SNPs are in practice sufficient in labeling up to 100 thousand individuals. In the simulated populations of 100 thousand individuals, the average Hamming distances, generated by the optimized set of 30 SNPs are larger than 18, and the duality frequency, is lower than 1 in 10 thousand. This strategy of sample discrimination is proved robust in large sample size and different datasets. The optimized sets of SNPs are designed for Whole Exome Sequencing, and a program is provided for SNP selection, allowing for customized SNP numbers and interested genes. The sample-tagging plan based on this framework will improve re-sequencing projects in terms of reliability and cost-effectiveness.

Isolation of centromeric-tandem repetitive DNA sequences by chromatin affinity purification using a HaloTag7-fused centromere-specific histone H3 in tobacco.

PubMed

Nagaki, Kiyotaka; Shibata, Fukashi; Kanatani, Asaka; Kashihara, Kazunari; Murata, Minoru

2012-04-01

The centromere is a multi-functional complex comprising centromeric DNA and a number of proteins. To isolate unidentified centromeric DNA sequences, centromere-specific histone H3 variants (CENH3) and chromatin immunoprecipitation (ChIP) have been utilized in some plant species. However, anti-CENH3 antibody for ChIP must be raised in each species because of its species specificity. Production of the antibodies is time-consuming and costly, and it is not easy to produce ChIP-grade antibodies. In this study, we applied a HaloTag7-based chromatin affinity purification system to isolate centromeric DNA sequences in tobacco. This system required no specific antibody, and made it possible to apply a highly stringent wash to remove contaminated DNA. As a result, we succeeded in isolating five tandem repetitive DNA sequences in addition to the centromeric retrotransposons that were previously identified by ChIP. Three of the tandem repeats were centromere-specific sequences located on different chromosomes. These results confirm the validity of the HaloTag7-based chromatin affinity purification system as an alternative method to ChIP for isolating unknown centromeric DNA sequences. The discovery of more than two chromosome-specific centromeric DNA sequences indicates the mosaic structure of tobacco centromeres. © Springer-Verlag 2011

Innate Immune Complexity in the Purple Sea Urchin: Diversity of the Sp185/333 System

PubMed Central

Smith, L. Courtney

2012-01-01

The California purple sea urchin, Strongylocentrotus purpuratus, is a long-lived echinoderm with a complex and sophisticated innate immune system. There are several large gene families that function in immunity in this species including the Sp185/333 gene family that has ∼50 (±10) members. The family shows intriguing sequence diversity and encodes a broad array of diverse yet similar proteins. The genes have two exons of which the second encodes the mature protein and has repeats and blocks of sequence called elements. Mosaics of element patterns plus single nucleotide polymorphisms-based variants of the elements result in significant sequence diversity among the genes yet maintains similar structure among the members of the family. Sequence of a bacterial artificial chromosome insert shows a cluster of six, tightly linked Sp185/333 genes that are flanked by GA microsatellites. The sequences between the GA microsatellites in which the Sp185/333 genes and flanking regions are located, are much more similar to each other than are the sequences outside the microsatellites suggesting processes such as gene conversion, recombination, or duplication. However, close linkage does not correspond with greater sequence similarity compared to randomly cloned and sequenced genes that are unlikely to be linked. There are three segmental duplications that are bounded by GAT microsatellites and include three almost identical genes plus flanking regions. RNA editing is detectible throughout the mRNAs based on comparisons to the genes, which, in combination with putative post-translational modifications to the proteins, results in broad arrays of Sp185/333 proteins that differ among individuals. The mature proteins have an N-terminal glycine-rich region, a central RGD motif, and a C-terminal histidine-rich region. The Sp185/333 proteins are localized to the cell surface and are found within vesicles in subsets of polygonal and small phagocytes. The coelomocyte proteome shows full-length and truncated proteins, including some with missense sequence. Current results suggest that both native Sp185/333 proteins and a recombinant protein bind bacteria and are likely important in sea urchin innate immunity. PMID:22566951

Genome-Wide Analysis of Oleosin Gene Family in 22 Tree Species: An Accelerator for Metabolic Engineering of BioFuel Crops and Agrigenomics Industrial Applications?

PubMed Central

2015-01-01

Abstract Trees contribute to enormous plant oil reserves because many trees contain 50%–80% of oil (triacylglycerols, TAGs) in the fruits and kernels. TAGs accumulate in subcellular structures called oil bodies/droplets, in which TAGs are covered by low-molecular-mass hydrophobic proteins called oleosins (OLEs). The OLEs/TAGs ratio determines the size and shape of intracellular oil bodies. There is a lack of comprehensive sequence analysis and structural information of OLEs among diverse trees. The objectives of this study were to identify OLEs from 22 tree species (e.g., tung tree, tea-oil tree, castor bean), perform genome-wide analysis of OLEs, classify OLEs, identify conserved sequence motifs and amino acid residues, and predict secondary and three-dimensional structures in tree OLEs and OLE subfamilies. Data mining identified 65 OLEs with perfect conservation of the “proline knot” motif (PX5SPX3P) from 19 trees. These OLEs contained >40% hydrophobic amino acid residues. They displayed similar properties and amino acid composition. Genome-wide phylogenetic analysis and multiple sequence alignment demonstrated that these proteins could be classified into five OLE subfamilies. There were distinct patterns of sequence conservation among the OLE subfamilies and within individual tree species. Computational modeling indicated that OLEs were composed of at least three α-helixes connected with short coils without any β-strand and that they exhibited distinct 3D structures and ligand binding sites. These analyses provide fundamental information in the similarity and specificity of diverse OLE isoforms within the same subfamily and among the different species, which should facilitate studying the structure-function relationship and identify critical amino acid residues in OLEs for metabolic engineering of tree TAGs. PMID:26258573

Genome-Wide Analysis of Oleosin Gene Family in 22 Tree Species: An Accelerator for Metabolic Engineering of BioFuel Crops and Agrigenomics Industrial Applications?

PubMed

Cao, Heping

2015-09-01

Trees contribute to enormous plant oil reserves because many trees contain 50%-80% of oil (triacylglycerols, TAGs) in the fruits and kernels. TAGs accumulate in subcellular structures called oil bodies/droplets, in which TAGs are covered by low-molecular-mass hydrophobic proteins called oleosins (OLEs). The OLEs/TAGs ratio determines the size and shape of intracellular oil bodies. There is a lack of comprehensive sequence analysis and structural information of OLEs among diverse trees. The objectives of this study were to identify OLEs from 22 tree species (e.g., tung tree, tea-oil tree, castor bean), perform genome-wide analysis of OLEs, classify OLEs, identify conserved sequence motifs and amino acid residues, and predict secondary and three-dimensional structures in tree OLEs and OLE subfamilies. Data mining identified 65 OLEs with perfect conservation of the "proline knot" motif (PX5SPX3P) from 19 trees. These OLEs contained >40% hydrophobic amino acid residues. They displayed similar properties and amino acid composition. Genome-wide phylogenetic analysis and multiple sequence alignment demonstrated that these proteins could be classified into five OLE subfamilies. There were distinct patterns of sequence conservation among the OLE subfamilies and within individual tree species. Computational modeling indicated that OLEs were composed of at least three α-helixes connected with short coils without any β-strand and that they exhibited distinct 3D structures and ligand binding sites. These analyses provide fundamental information in the similarity and specificity of diverse OLE isoforms within the same subfamily and among the different species, which should facilitate studying the structure-function relationship and identify critical amino acid residues in OLEs for metabolic engineering of tree TAGs.

Application of an E. coli signal sequence as a versatile inclusion body tag.

PubMed

Jong, Wouter S P; Vikström, David; Houben, Diane; van den Berg van Saparoea, H Bart; de Gier, Jan-Willem; Luirink, Joen

2017-03-21

Heterologous protein production in Escherichia coli often suffers from bottlenecks such as proteolytic degradation, complex purification procedures and toxicity towards the expression host. Production of proteins in an insoluble form in inclusion bodies (IBs) can alleviate these problems. Unfortunately, the propensity of heterologous proteins to form IBs is variable and difficult to predict. Hence, fusing the target protein to an aggregation prone polypeptide or IB-tag is a useful strategy to produce difficult-to-express proteins in an insoluble form. When screening for signal sequences that mediate optimal targeting of heterologous proteins to the periplasmic space of E. coli, we observed that fusion to the 39 amino acid signal sequence of E. coli TorA (ssTorA) did not promote targeting but rather directed high-level expression of the human proteins hEGF, Pla2 and IL-3 in IBs. Further analysis revealed that ssTorA even mediated IB formation of the highly soluble endogenous E. coli proteins TrxA and MBP. The ssTorA also induced aggregation when fused to the C-terminus of target proteins and appeared functional as IB-tag in E. coli K-12 as well as B strains. An additive effect on IB-formation was observed upon fusion of multiple ssTorA sequences in tandem, provoking almost complete aggregation of TrxA and MBP. The ssTorA-moiety was successfully used to produce the intrinsically unstable hEGF and the toxic fusion partner SymE, demonstrating its applicability as an IB-tag for difficult-to-express and toxic proteins. We present proof-of-concept for the use of ssTorA as a small, versatile tag for robust E. coli-based expression of heterologous proteins in IBs.

DNA Barcode Sequence Identification Incorporating Taxonomic Hierarchy and within Taxon Variability

PubMed Central

Little, Damon P.

2011-01-01

For DNA barcoding to succeed as a scientific endeavor an accurate and expeditious query sequence identification method is needed. Although a global multiple–sequence alignment can be generated for some barcoding markers (e.g. COI, rbcL), not all barcoding markers are as structurally conserved (e.g. matK). Thus, algorithms that depend on global multiple–sequence alignments are not universally applicable. Some sequence identification methods that use local pairwise alignments (e.g. BLAST) are unable to accurately differentiate between highly similar sequences and are not designed to cope with hierarchic phylogenetic relationships or within taxon variability. Here, I present a novel alignment–free sequence identification algorithm–BRONX–that accounts for observed within taxon variability and hierarchic relationships among taxa. BRONX identifies short variable segments and corresponding invariant flanking regions in reference sequences. These flanking regions are used to score variable regions in the query sequence without the production of a global multiple–sequence alignment. By incorporating observed within taxon variability into the scoring procedure, misidentifications arising from shared alleles/haplotypes are minimized. An explicit treatment of more inclusive terminals allows for separate identifications to be made for each taxonomic level and/or for user–defined terminals. BRONX performs better than all other methods when there is imperfect overlap between query and reference sequences (e.g. mini–barcode queries against a full–length barcode database). BRONX consistently produced better identifications at the genus–level for all query types. PMID:21857897

A family of cellular proteins related to snake venom disintegrins.

PubMed

Weskamp, G; Blobel, C P

1994-03-29

Disintegrins are short soluble integrin ligands that were initially identified in snake venom. A previously recognized cellular protein with a disintegrin domain was the guinea pig sperm protein PH-30, a protein implicated in sperm-egg membrane binding and fusion. Here we present peptide sequences that are characteristic for several cellular disintegrin-domain proteins. These peptide sequences were deduced from cDNA sequence tags that were generated by polymerase chain reaction from various mouse tissue and a mouse muscle cell line. Northern blot analysis with four sequence tags revealed distinct mRNA expression patterns. Evidently, cellular proteins containing a disintegrin domain define a superfamily of potential integrin ligands that are likely to function in important cell-cell and cell-matrix interactions.

The repeating nucleotide sequence in the repetitive mitochondrial DNA from a "low-density" petite mutant of yeast.

PubMed Central

Van Kreijl, C F; Bos, J L

1977-01-01

The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740

Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

PubMed Central

Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

2018-01-01

Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

Homologous recombination within the capsid gene of porcine circovirus type 2 subgroup viruses via natural co-infection

USDA-ARS?s Scientific Manuscript database

Several studies had reported homologous recombination between porcine circovirus type 2 (PCV2)-group 1 (Gp1) and -group 2 (Gp2) viruses. Interestingly, the recombination events described thus far mapped either within the Rep gene sequences or the sequences flanking the Rep gene region. Previously, ...

Intergenic Sequence Ribotyping using a region neighboring dkgB links genovar to Kauffman-White serotype of Salmonella enterica

USDA-ARS?s Scientific Manuscript database

Previous research identified that the 5S ribosomal (rrn) gene and associated flanking sequences that are closely linked to the dkgB gene of Salmonella enterica were highly variable between serotypes, but not between subpopulations within the same serotype (PMID: 17005008). The degree of variability ...

Use of Intragenic Sequence Ribotyping (ISR) for serotyping Salmonella obtained from poultry and their environment

USDA-ARS?s Scientific Manuscript database

BACKGROUND: The dkgB-linked ribosomal region of Salmonella enterica flanking a 5S gene shows genetic heterogeneity that distinguishes closely related serovars such as Enteritidis, Dublin, Gallinarum and Pullorum (Morales et al, 2006). We wanted to know how sequence-based ISR compared to the traditio...

Characterization of the two intracellular lipases of Y. lipolytica encoded by TGL3 and TGL4 genes: new insights into the role of intracellular lipases and lipid body organisation.

PubMed

Dulermo, Thierry; Tréton, Brigitte; Beopoulos, Athanasios; Kabran Gnankon, Affoué Philomène; Haddouche, Ramdane; Nicaud, Jean-Marc

2013-09-01

Eukaryotes store lipids in a specialised organelle, the lipid body (LB), mainly as triglycerides (TAGs). Both the rates of synthesis and degradation contribute to the control of the accumulation of TAGs. The synthesis of TAGs in yeasts has been well documented, especially in the model yeast Saccharomyces cerevisiae and in the oleaginous yeast Yarrowia lipolytica. However, descriptions of the processes involved in TAG degradation are more scarce and mostly for S. cerevisiae. Here, we report the characterisation of two Y. lipolytica genes, YlTGL3 and YlTGL4, encoding intracellular lipases involved in TAG degradation. The two proteins are localised in lipid bodies, and YlTgl4 was mainly found at the interface between LBs. Surprisingly, the spatial organisation of YlTgl3 and YlTgl4 depends on the culture medium and on the physiological phase of the cell. Inactivation of one or both genes doubles the lipid accumulation capacity of Y. lipolytica, increasing the cell's capacity to accumulate TAGs. The amino acid sequence of YlTgl4 contains the consensus sequence motif (G/A)XSXG, typical of serine hydrolases, whereas YlTgl3 does not. Single and double mutants are unable to degrade TAGs, and higher expression of YlTgl4 correlates with TAG degradation. Therefore, we propose that YlTgl4 is the main lipase responsible for TAG degradation and that YlTgl3 may act as a positive regulator of YlTgl4 rather than a functional lipase. Thus, contrary to S. cerevisiae, Y. lipolytica possesses two intracellular lipases with distinct roles and with distinct localisations in the LB. © 2013. Published by Elsevier B.V. All rights reserved.

A Phylogenomic Perspective on the Radiation of Ray-Finned Fishes Based upon Targeted Sequencing of Ultraconserved Elements (UCEs)

PubMed Central

Sorenson, Laurie; Santini, Francesco

2013-01-01

Ray-finned fishes constitute the dominant radiation of vertebrates with over 32,000 species. Although molecular phylogenetics has begun to disentangle major evolutionary relationships within this vast section of the Tree of Life, there is no widely available approach for efficiently collecting phylogenomic data within fishes, leaving much of the enormous potential of massively parallel sequencing technologies for resolving major radiations in ray-finned fishes unrealized. Here, we provide a genomic perspective on longstanding questions regarding the diversification of major groups of ray-finned fishes through targeted enrichment of ultraconserved nuclear DNA elements (UCEs) and their flanking sequence. Our workflow efficiently and economically generates data sets that are orders of magnitude larger than those produced by traditional approaches and is well-suited to working with museum specimens. Analysis of the UCE data set recovers a well-supported phylogeny at both shallow and deep time-scales that supports a monophyletic relationship between Amia and Lepisosteus (Holostei) and reveals elopomorphs and then osteoglossomorphs to be the earliest diverging teleost lineages. Our approach additionally reveals that sequence capture of UCE regions and their flanking sequence offers enormous potential for resolving phylogenetic relationships within ray-finned fishes. PMID:23824177

A mutation in protein phosphatase 2A regulatory subunit A affects auxin transport in Arabidopsis

NASA Technical Reports Server (NTRS)

Garbers, C.; DeLong, A.; Deruere, J.; Bernasconi, P.; Soll, D.; Evans, M. L. (Principal Investigator)

1996-01-01

The phytohormone auxin controls processes such as cell elongation, root hair development and root branching. Tropisms, growth curvatures triggered by gravity, light and touch, are also auxin-mediated responses. Auxin is synthesized in the shoot apex and transported through the stem, but the molecular mechanism of auxin transport is not well understood. Naphthylphthalamic acid (NPA) and other inhibitors of auxin transport block tropic curvature responses and inhibit root and shoot elongation. We have isolated a novel Arabidopsis thaliana mutant designated roots curl in NPA (rcn1). Mutant seedlings exhibit altered responses to NPA in root curling and hypocotyl elongation. Auxin efflux in mutant seedlings displays increased sensitivity to NPA. The rcn1 mutation was transferred-DNA (T-DNA) tagged and sequences flanking the T-DNA insert were cloned. Analysis of the RCN1 cDNA reveals that the T-DNA insertion disrupts a gene for the regulatory A subunit of protein phosphatase 2A (PP2A-A). The RCN1 gene rescues the rcn1 mutant phenotype and also complements the temperature-sensitive phenotype of the Saccharomyces cerevisiae PP2A-A mutation, tpd3-1. These data implicate protein phosphatase 2A in the regulation of auxin transport in Arabidopsis.

A normalization strategy for comparing tag count data

PubMed Central

2012-01-01

Background High-throughput sequencing, such as ribonucleic acid sequencing (RNA-seq) and chromatin immunoprecipitation sequencing (ChIP-seq) analyses, enables various features of organisms to be compared through tag counts. Recent studies have demonstrated that the normalization step for RNA-seq data is critical for a more accurate subsequent analysis of differential gene expression. Development of a more robust normalization method is desirable for identifying the true difference in tag count data. Results We describe a strategy for normalizing tag count data, focusing on RNA-seq. The key concept is to remove data assigned as potential differentially expressed genes (DEGs) before calculating the normalization factor. Several R packages for identifying DEGs are currently available, and each package uses its own normalization method and gene ranking algorithm. We compared a total of eight package combinations: four R packages (edgeR, DESeq, baySeq, and NBPSeq) with their default normalization settings and with our normalization strategy. Many synthetic datasets under various scenarios were evaluated on the basis of the area under the curve (AUC) as a measure for both sensitivity and specificity. We found that packages using our strategy in the data normalization step overall performed well. This result was also observed for a real experimental dataset. Conclusion Our results showed that the elimination of potential DEGs is essential for more accurate normalization of RNA-seq data. The concept of this normalization strategy can widely be applied to other types of tag count data and to microarray data. PMID:22475125

Mass spectrometry-based protein identification by integrating de novo sequencing with database searching.

PubMed

Wang, Penghao; Wilson, Susan R

2013-01-01

Mass spectrometry-based protein identification is a very challenging task. The main identification approaches include de novo sequencing and database searching. Both approaches have shortcomings, so an integrative approach has been developed. The integrative approach firstly infers partial peptide sequences, known as tags, directly from tandem spectra through de novo sequencing, and then puts these sequences into a database search to see if a close peptide match can be found. However the current implementation of this integrative approach has several limitations. Firstly, simplistic de novo sequencing is applied and only very short sequence tags are used. Secondly, most integrative methods apply an algorithm similar to BLAST to search for exact sequence matches and do not accommodate sequence errors well. Thirdly, by applying these methods the integrated de novo sequencing makes a limited contribution to the scoring model which is still largely based on database searching. We have developed a new integrative protein identification method which can integrate de novo sequencing more efficiently into database searching. Evaluated on large real datasets, our method outperforms popular identification methods.

Molecular definition of 22q11 deletions in 151 velo-cardio-facial syndrome patients.

PubMed Central

Carlson, C; Sirotkin, H; Pandita, R; Goldberg, R; McKie, J; Wadey, R; Patanjali, S R; Weissman, S M; Anyane-Yeboa, K; Warburton, D; Scambler, P; Shprintzen, R; Kucherlapati, R; Morrow, B E

1997-01-01

Velo-cardio-facial syndrome (VCFS) is a relatively common developmental disorder characterized by craniofacial anomalies and conotruncal heart defects. Many VCFS patients have hemizygous deletions for a part of 22q11, suggesting that haploinsufficiency in this region is responsible for its etiology. Because most cases of VCFS are sporadic, portions of 22q11 may be prone to rearrangement. To understand the molecular basis for chromosomal deletions, we defined the extent of the deletion, by genotyping 151 VCFS patients and performing haplotype analysis on 105, using 15 consecutive polymorphic markers in 22q11. We found that 83% had a deletion and >90% of these had a similar approximately 3 Mb deletion, suggesting that sequences flanking the common breakpoints are susceptible to rearrangement. We found no correlation between the presence or size of the deletion and the phenotype. To further define the chromosomal breakpoints among the VCFS patients, we developed somatic hybrid cell lines from a set of VCFS patients. An 11-kb resolution physical map of a 1,080-kb region that includes deletion breakpoints was constructed, incorporating genes and expressed sequence tags (ESTs) isolated by the hybridization selection method. The ordered markers were used to examine the two separated copies of chromosome 22 in the somatic hybrid cell lines. In some cases, we were able to map the chromosome breakpoints within a single cosmid. A 480-kb critical region for VCFS has been delineated, including the genes for GSCL, CTP, CLTD, HIRA, and TMVCF, as well as a number of novel ordered ESTs. PMID:9326327

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

A dual tag system for facilitated detection of surface expressed proteins in Escherichia coli

PubMed Central

2012-01-01

Background The discovery of the autotransporter family has provided a mechanism for surface expression of proteins in laboratory strains of Escherichia coli. We have previously reported the use of the AIDA-I autotransport system to express the Salmonella enterica serovar Enteritidis proteins SefA and H:gm. The SefA protein was successfully exposed to the medium, but the orientation of H:gm in the outer membrane could not be determined due to proteolytic cleavage of the N-terminal detection-tag. The goal of the present work was therefore to construct a vector containing elements that facilitates analysis of surface expression, especially for proteins that are sensitive to proteolysis or otherwise difficult to express. Results The surface expression system pAIDA1 was created with two detection tags flanking the passenger protein. Successful expression of SefA and H:gm on the surface of E. coli was confirmed with fluorescently labeled antibodies specific for the N-terminal His6-tag and the C-terminal Myc-tag. While both tags were detected during SefA expression, only the Myc-tag could be detected for H:gm. The negative signal indicates a proteolytic cleavage of this protein that removes the His6-tag facing the medium. Conclusions Expression levels from pAIDA1 were comparable to or higher than those achieved with the formerly used vector. The presence of the Myc- but not of the His6-tag on the cell surface during H:gm expression allowed us to confirm the hypothesis that this fusion protein was present on the surface and oriented towards the cell exterior. Western blot analysis revealed degradation products of the same molecular weight for SefA and H:gm. The size of these fragments suggests that both fusion proteins have been cleaved at a specific site close to the C-terminal end of the passenger. This proteolysis was concluded to take place either in the outer membrane or in the periplasm. Since H:gm was cleaved to a much greater extent then the three times smaller SefA, it is proposed that the longer translocation time for the larger H:gm makes it more susceptible to proteolysis. PMID:22943700

COL1A1 transgene expression in stably transfected osteoblastic cells. Relative contributions of first intron, 3'-flanking sequences, and sequences derived from the body of the human COL1A1 minigene

NASA Technical Reports Server (NTRS)

Breault, D. T.; Lichtler, A. C.; Rowe, D. W.

1997-01-01

Collagen reporter gene constructs have be used to identify cell-specific sequences needed for transcriptional activation. The elements required for endogenous levels of COL1A1 expression, however, have not been elucidated. The human COL1A1 minigene is expressed at high levels and likely harbors sequence elements required for endogenous levels of activity. Using stably transfected osteoblastic Py1a cells, we studied a series of constructs (pOBColCAT) designed to characterize further the elements required for high level of expression. pOBColCAT, which contains the COL1A1 first intron, was expressed at 50-100-fold higher levels than ColCAT 3.6, which lacks the first intron. This difference is best explained by improved mRNA processing rather than a transcriptional effect. Furthermore, variation in activity observed with the intron deletion constructs is best explained by altered mRNA splicing. Two major regions of the human COL1A1 minigene, the 3'-flanking sequences and the minigene body, were introduced into pOBColCAT to assess both transcriptional enhancing activity and the effect on mRNA stability. Analysis of the minigene body, which includes the first five exons and introns fused with the terminal six introns and exons, revealed an orientation-independent 5-fold increase in CAT activity. In contrast the 3'-flanking sequences gave rise to a modest 61% increase in CAT activity. Neither region increased the mRNA half-life of the parent construct, suggesting that CAT-specific mRNA instability elements may serve as dominant negative regulators of stability. This study suggests that other sites within the body of the COL1A1 minigene are important for high expression, e.g. during periods of rapid extracellular matrix production.

A phylogenetic framework facilitates Y-STR variant discovery and classification via massively parallel sequencing.

PubMed

Huszar, Tunde I; Jobling, Mark A; Wetton, Jon H

2018-04-12

Short tandem repeats on the male-specific region of the Y chromosome (Y-STRs) are permanently linked as haplotypes, and therefore Y-STR sequence diversity can be considered within the robust framework of a phylogeny of haplogroups defined by single nucleotide polymorphisms (SNPs). Here we use massively parallel sequencing (MPS) to analyse the 23 Y-STRs in Promega's prototype PowerSeq™ Auto/Mito/Y System kit (containing the markers of the PowerPlex® Y23 [PPY23] System) in a set of 100 diverse Y chromosomes whose phylogenetic relationships are known from previous megabase-scale resequencing. Including allele duplications and alleles resulting from likely somatic mutation, we characterised 2311 alleles, demonstrating 99.83% concordance with capillary electrophoresis (CE) data on the same sample set. The set contains 267 distinct sequence-based alleles (an increase of 58% compared to the 169 detectable by CE), including 60 novel Y-STR variants phased with their flanking sequences which have not been reported previously to our knowledge. Variation includes 46 distinct alleles containing non-reference variants of SNPs/indels in both repeat and flanking regions, and 145 distinct alleles containing repeat pattern variants (RPV). For DYS385a,b, DYS481 and DYS390 we observed repeat count variation in short flanking segments previously considered invariable, and suggest new MPS-based structural designations based on these. We considered the observed variation in the context of the Y phylogeny: several specific haplogroup associations were observed for SNPs and indels, reflecting the low mutation rates of such variant types; however, RPVs showed less phylogenetic coherence and more recurrence, reflecting their relatively high mutation rates. In conclusion, our study reveals considerable additional diversity at the Y-STRs of the PPY23 set via MPS analysis, demonstrates high concordance with CE data, facilitates nomenclature standardisation, and places Y-STR sequence variants in their phylogenetic context. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Short range spread-spectrum radiolocation system and method

DOEpatents

Smith, Stephen F.

2003-04-29

A short range radiolocation system and associated methods that allow the location of an item, such as equipment, containers, pallets, vehicles, or personnel, within a defined area. A small, battery powered, self-contained tag is provided to an item to be located. The tag includes a spread-spectrum transmitter that transmits a spread-spectrum code and identification information. A plurality of receivers positioned about the area receive signals from a transmitting tag. The position of the tag, and hence the item, is located by triangulation. The system employs three different ranging techniques for providing coarse, intermediate, and fine spatial position resolution. Coarse positioning information is provided by use of direct-sequence code phase transmitted as a spread-spectrum signal. Intermediate positioning information is provided by the use of a difference signal transmitted with the direct-sequence spread-spectrum code. Fine positioning information is provided by use of carrier phase measurements. An algorithm is employed to combine the three data sets to provide accurate location measurements.

Expanding the versatility of phage display I: efficient display of peptide-tags on protein VII of the filamentous phage.

PubMed

Løset, Geir Åge; Bogen, Bjarne; Sandlie, Inger

2011-02-24

Phage display is a platform for selection of specific binding molecules and this is a clear-cut motivation for increasing its performance. Polypeptides are normally displayed as fusions to the major coat protein VIII (pVIII), or the minor coat protein III (pIII). Display on other coat proteins such as pVII allows for display of heterologous peptide sequences on the virions in addition to those displayed on pIII and pVIII. In addition, pVII display is an alternative to pIII or pVIII display. Here we demonstrate how standard pIII or pVIII display phagemids are complemented with a helper phage which supports production of virions that are tagged with octa FLAG, HIS(6) or AviTag on pVII. The periplasmic signal sequence required for pIII and pVIII display, and which has been added to pVII in earlier studies, is omitted altogether. Tagging on pVII is an important and very useful add-on feature to standard pIII and pVII display. Any phagemid bearing a protein of interest on either pIII or pVIII can be tagged with any of the tags depending simply on choice of helper phage. We show in this paper how such tags may be utilized for immobilization and separation as well as purification and detection of monoclonal and polyclonal phage populations.

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Treesearch

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Expressed sequence tags (ESTs) from immune tissues of turbot (Scophthalmus maximus) challenged with pathogens

PubMed Central

Pardo, Belén G; Fernández, Carlos; Millán, Adrián; Bouza, Carmen; Vázquez-López, Araceli; Vera, Manuel; Alvarez-Dios, José A; Calaza, Manuel; Gómez-Tato, Antonio; Vázquez, María; Cabaleiro, Santiago; Magariños, Beatriz; Lemos, Manuel L; Leiro, José M; Martínez, Paulino

2008-01-01

Background The turbot (Scophthalmus maximus; Scophthalmidae; Pleuronectiformes) is a flatfish species of great relevance for marine aquaculture in Europe. In contrast to other cultured flatfish, very few genomic resources are available in this species. Aeromonas salmonicida and Philasterides dicentrarchi are two pathogens that affect turbot culture causing serious economic losses to the turbot industry. Little is known about the molecular mechanisms for disease resistance and host-pathogen interactions in this species. In this work, thousands of ESTs for functional genomic studies and potential markers linked to ESTs for mapping (microsatellites and single nucleotide polymorphisms (SNPs)) are provided. This information enabled us to obtain a preliminary view of regulated genes in response to these pathogens and it constitutes the basis for subsequent and more accurate microarray analysis. Results A total of 12584 cDNAs partially sequenced from three different cDNA libraries of turbot (Scophthalmus maximus) infected with Aeromonas salmonicida, Philasterides dicentrarchi and from healthy fish were analyzed. Three immune-relevant tissues (liver, spleen and head kidney) were sampled at several time points in the infection process for library construction. The sequences were processed into 9256 high-quality sequences, which constituted the source for the turbot EST database. Clustering and assembly of these sequences, revealed 3482 different putative transcripts, 1073 contigs and 2409 singletons. BLAST searches with public databases detected significant similarity (e-value ≤ 1e-5) in 1766 (50.7%) sequences and 816 of them (23.4%) could be functionally annotated. Two hundred three of these genes (24.9%), encoding for defence/immune-related proteins, were mostly identified for the first time in turbot. Some ESTs showed significant differences in the number of transcripts when comparing the three libraries, suggesting regulation in response to these pathogens. A total of 191 microsatellites, with 104 having sufficient flanking sequences for primer design, and 1158 putative SNPs were identified from these EST resources in turbot. Conclusion A collection of 9256 high-quality ESTs was generated representing 3482 unique turbot sequences. A large proportion of defence/immune-related genes were identified, many of them regulated in response to specific pathogens. Putative microsatellites and SNPs were identified. These genome resources constitute the basis to develop a microarray for functional genomics studies and marker validation for genetic linkage and QTL analysis in turbot. PMID:18817567

Chromosomal arrangement of leghemoglobin genes in soybean.

PubMed Central

Lee, J S; Brown, G G; Verma, D P

1983-01-01

A cluster of four different leghemoglobin (Lb) genes was isolated from AluI-HaeIII and EcoRI genomic libraries of soybean in a set of overlapping clones which together include 45 kilobases (kb) of contiguous DNA. These four genes, including a pseudogene, are present in the same orientation and are arranged in the order: 5'-Lba-Lbc1-Lb psi-Lbc3-3'. The intergenic regions average 2.5 kb. In addition to this main Lb locus, there are other Lb genes which do not appear to be contiguous to this locus. A sequence probably common to the 3' region of Lb loci was found flanking the Lbc3 gene. The 3' flanking region of the main Lb locus also contains a sequence that appears to be expressed more abundantly in root tissue. Another sequence which is primarily expressed in root and leaf is found 5' to two Lb loci. Overall, the main leghemoglobin locus is similar in structure to the mammalian globin gene loci. Images PMID:6310504

Phylogeny and strain typing of Escherichia coli, inferred from variation at mononucleotide repeat loci.

PubMed

Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M; Kashi, Yechezkel

2004-04-01

Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria.

Phylogeny and Strain Typing of Escherichia coli, Inferred from Variation at Mononucleotide Repeat Loci

PubMed Central

Diamant, Eran; Palti, Yniv; Gur-Arie, Riva; Cohen, Helit; Hallerman, Eric M.; Kashi, Yechezkel

2004-01-01

Multilocus sequencing of housekeeping genes has been used previously for bacterial strain typing and for inferring evolutionary relationships among strains of Escherichia coli. In this study, we used shorter intergenic sequences that contained simple sequence repeats (SSRs) of repeating mononucleotide motifs (mononucleotide repeats [MNRs]) to infer the phylogeny of pathogenic and commensal E. coli strains. Seven noncoding loci (four MNRs and three non-SSRs) were sequenced in 27 strains, including enterohemorrhagic (six isolates of O157:H7), enteropathogenic, enterotoxigenic, B, and K-12 strains. The four MNRs were also sequenced in 20 representative strains of the E. coli reference (ECOR) collection. Sequence polymorphism was significantly higher at the MNR loci, including the flanking sequences, indicating a higher mutation rate in the sequences flanking the MNR tracts. The four MNR loci were amplifiable by PCR in the standard ECOR A, B1, and D groups, but only one (yaiN) in the B2 group was amplified, which is consistent with previous studies that suggested that B2 is the most ancient group. High sequence compatibility was found between the four MNR loci, indicating that they are in the same clonal frame. The phylogenetic trees that were constructed from the sequence data were in good agreement with those of previous studies that used multilocus enzyme electrophoresis. The results demonstrate that MNR loci are useful for inferring phylogenetic relationships and provide much higher sequence variation than housekeeping genes. Therefore, the use of MNR loci for multilocus sequence typing should prove efficient for clinical diagnostics, epidemiology, and evolutionary study of bacteria. PMID:15066845

Structure-function analysis of diacylglycerol acyltransferase sequences for metabolic engineering and drug discovery

USDA-ARS?s Scientific Manuscript database

Diacylglycerol acyltransferase families (DGATs) catalyze the final and rate-limiting step of triacylglycerol (TAG) biosynthesis in eukaryotic organisms. DGAT knockout mice are resistant to diet-induced obesity and lack milk secretion. Over-expression of DGATs increases TAG in plants. Therefore, unde...

Transcriptome profile analysis of young floral buds of fertile and sterile plants from the self-pollinated offspring of the hybrid between novel restorer line NR1 and Nsa CMS line in Brassica napus

PubMed Central

2013-01-01

Background The fertile and sterile plants were derived from the self-pollinated offspring of the F1 hybrid between the novel restorer line NR1 and the Nsa CMS line in Brassica napus. To elucidate gene expression and regulation caused by the A and C subgenomes of B. napus, as well as the alien chromosome and cytoplasm from Sinapis arvensis during the development of young floral buds, we performed a genome-wide high-throughput transcriptomic sequencing for young floral buds of sterile and fertile plants. Results In this study, equal amounts of total RNAs taken from young floral buds of sterile and fertile plants were sequenced using the Illumina/Solexa platform. After filtered out low quality data, a total of 2,760,574 and 2,714,441 clean tags were remained in the two libraries, from which 242,163 (Ste) and 253,507 (Fer) distinct tags were obtained. All distinct sequencing tags were annotated using all possible CATG+17-nt sequences of the genome and transcriptome of Brassica rapa and those of Brassica oleracea as the reference sequences, respectively. In total, 3231 genes of B. rapa and 3371 genes of B. oleracea were detected with significant differential expression levels. GO and pathway-based analyses were performed to determine and further to understand the biological functions of those differentially expressed genes (DEGs). In addition, there were 1089 specially expressed unknown tags in Fer, which were neither mapped to B. oleracea nor to B. rapa, and these unique tags were presumed to arise basically from the added alien chromosome of S. arvensis. Fifteen genes were randomly selected and their expression levels were confirmed by quantitative RT-PCR, and fourteen of them showed consistent expression patterns with the digital gene expression (DGE) data. Conclusions A number of genes were differentially expressed between the young floral buds of sterile and fertile plants. Some of these genes may be candidates for future research on CMS in Nsa line, fertility restoration and improved agronomic traits in NR1 line. Further study of the unknown tags which were specifically expressed in Fer will help to explore desirable agronomic traits from wild species. PMID:23324545

Transcriptome profile analysis of young floral buds of fertile and sterile plants from the self-pollinated offspring of the hybrid between novel restorer line NR1 and Nsa CMS line in Brassica napus.

PubMed

Yan, Xiaohong; Dong, Caihua; Yu, Jingyin; Liu, Wanghui; Jiang, Chenghong; Liu, Jia; Hu, Qiong; Fang, Xiaoping; Wei, Wenhui

2013-01-16

The fertile and sterile plants were derived from the self-pollinated offspring of the F1 hybrid between the novel restorer line NR1 and the Nsa CMS line in Brassica napus. To elucidate gene expression and regulation caused by the A and C subgenomes of B. napus, as well as the alien chromosome and cytoplasm from Sinapis arvensis during the development of young floral buds, we performed a genome-wide high-throughput transcriptomic sequencing for young floral buds of sterile and fertile plants. In this study, equal amounts of total RNAs taken from young floral buds of sterile and fertile plants were sequenced using the Illumina/Solexa platform. After filtered out low quality data, a total of 2,760,574 and 2,714,441 clean tags were remained in the two libraries, from which 242,163 (Ste) and 253,507 (Fer) distinct tags were obtained. All distinct sequencing tags were annotated using all possible CATG+17-nt sequences of the genome and transcriptome of Brassica rapa and those of Brassica oleracea as the reference sequences, respectively. In total, 3231 genes of B. rapa and 3371 genes of B. oleracea were detected with significant differential expression levels. GO and pathway-based analyses were performed to determine and further to understand the biological functions of those differentially expressed genes (DEGs). In addition, there were 1089 specially expressed unknown tags in Fer, which were neither mapped to B. oleracea nor to B. rapa, and these unique tags were presumed to arise basically from the added alien chromosome of S. arvensis. Fifteen genes were randomly selected and their expression levels were confirmed by quantitative RT-PCR, and fourteen of them showed consistent expression patterns with the digital gene expression (DGE) data. A number of genes were differentially expressed between the young floral buds of sterile and fertile plants. Some of these genes may be candidates for future research on CMS in Nsa line, fertility restoration and improved agronomic traits in NR1 line. Further study of the unknown tags which were specifically expressed in Fer will help to explore desirable agronomic traits from wild species.

RAD tag sequencing as a source of SNP markers in Cynara cardunculus L

PubMed Central

2012-01-01

Background The globe artichoke (Cynara cardunculus L. var. scolymus) genome is relatively poorly explored, especially compared to those of the other major Asteraceae crops sunflower and lettuce. No SNP markers are in the public domain. We have combined the recently developed restriction-site associated DNA (RAD) approach with the Illumina DNA sequencing platform to effect the rapid and mass discovery of SNP markers for C. cardunculus. Results RAD tags were sequenced from the genomic DNA of three C. cardunculus mapping population parents, generating 9.7 million reads, corresponding to ~1 Gbp of sequence. An assembly based on paired ends produced ~6.0 Mbp of genomic sequence, separated into ~19,000 contigs (mean length 312 bp), of which ~21% were fragments of putative coding sequence. The shared sequences allowed for the discovery of ~34,000 SNPs and nearly 800 indels, equivalent to a SNP frequency of 5.6 per 1,000 nt, and an indel frequency of 0.2 per 1,000 nt. A sample of heterozygous SNP loci was mapped by CAPS assays and this exercise provided validation of our mining criteria. The repetitive fraction of the genome had a high representation of retrotransposon sequence, followed by simple repeats, AT-low complexity regions and mobile DNA elements. The genomic k-mers distribution and CpG rate of C. cardunculus, compared with data derived from three whole genome-sequenced dicots species, provided a further evidence of the random representation of the C. cardunculus genome generated by RAD sampling. Conclusion The RAD tag sequencing approach is a cost-effective and rapid method to develop SNP markers in a highly heterozygous species. Our approach permitted to generate a large and robust SNP datasets by the adoption of optimized filtering criteria. PMID:22214349

Nucleic acid constructs containing orthogonal site selective recombinases (OSSRs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmore, Joshua M.; Anderson, J. Christopher; Dueber, John E.

The present invention provides for a recombinant nucleic acid comprising a nucleotide sequence comprising a plurality of constructs, wherein each construct independently comprises a nucleotide sequence of interest flanked by a pair of recombinase recognition sequences. Each pair of recombinase recognition sequences is recognized by a distinct recombinase. Optionally, each construct can, independently, further comprise one or more genes encoding a recombinase capable of recognizing the pair of recombinase recognition sequences of the construct. The recombinase can be an orthogonal (non-cross reacting), site-selective recombinase (OSSR).

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

A SSR-based genetic linkage map of cultivated peanut (Arachis hypogaea L.)

USDA-ARS?s Scientific Manuscript database

The objective of this study was to construct a molecular linkage map of cultivated tetraploid peanut using simple sequence repeat (SSR) markers derived primarily from peanut genomic sequences, expressed sequence tags (ESTs), and by "data mining" sequences released in GenBank. Three recombinant inbre...

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

Improved serial analysis of V1 ribosomal sequence tags (SARST-V1) provides a rapid, comprehensive, sequence-based characterization of bacterial diversity and community composition.

PubMed

Yu, Zhongtang; Yu, Marie; Morrison, Mark

2006-04-01

Serial analysis of ribosomal sequence tags (SARST) is a recently developed technology that can generate large 16S rRNA gene (rrs) sequence data sets from microbiomes, but there are numerous enzymatic and purification steps required to construct the ribosomal sequence tag (RST) clone libraries. We report here an improved SARST method, which still targets the V1 hypervariable region of rrs genes, but reduces the number of enzymes, oligonucleotides, reagents, and technical steps needed to produce the RST clone libraries. The new method, hereafter referred to as SARST-V1, was used to examine the eubacterial diversity present in community DNA recovered from the microbiome resident in the ovine rumen. The 190 sequenced clones contained 1055 RSTs and no less than 236 unique phylotypes (based on > or = 95% sequence identity) that were assigned to eight different eubacterial phyla. Rarefaction and monomolecular curve analyses predicted that the complete RST clone library contains 99% of the 353 unique phylotypes predicted to exist in this microbiome. When compared with ribosomal intergenic spacer analysis (RISA) of the same community DNA sample, as well as a compilation of nine previously published conventional rrs clone libraries prepared from the same type of samples, the RST clone library provided a more comprehensive characterization of the eubacterial diversity present in rumen microbiomes. As such, SARST-V1 should be a useful tool applicable to comprehensive examination of diversity and composition in microbiomes and offers an affordable, sequence-based method for diversity analysis.

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

Flank vents and graben as indicators of Late Amazonian volcanotectonic activity on Olympus Mons

NASA Astrophysics Data System (ADS)

Peters, S. I.; Christensen, P. R.

2017-03-01

Previous studies have focused on large-scale features on Olympus Mons, such as its flank terraces, the summit caldera complex, and the basal escarpment and aureole deposits. Here we identify and characterize previously unrecognized and unmapped small scale features to help further understand the volcanotectonic evolution of this enormous volcano. Using Context Camera, High Resolution Imaging Science Experiment, Thermal Emission Imaging System, High Resolution Stereo Camera Digital Terrain Model, and Mars Orbiter Laser Altimeter data, we identified and characterized the morphology and distribution of 60 flank vents and 84 grabens on Olympus Mons. We find that effusive eruptions have dominated volcanic activity on Olympus Mons in the Late Amazonian. Explosive eruptions were rare, implying volatile-poor magmas and/or a lack of magma-water interactions during the Late Amazonian. The distribution of flank vents suggests dike propagation of hundreds of kilometers and shallow magma storage. Small grabens, not previously observed in lower-resolution data, occur primarily on the lower flanks of Olympus Mons and indicate late-stage extensional tectonism. Based on superposition relationships, we have concluded two stages of development for Olympus Mons during the Late Amazonian: (1) primarily effusive resurfacing and formation of flank vents followed by (2) waning effusive volcanism and graben formation and/or reactivation. This developmental sequence resembles that proposed for Ascraeus Mons and other large Martian shields, suggesting a similar geologic evolution for these volcanoes.

Structural characterization of copia-type retrotransposons leads to insights into the marker development in a biofuel crop, Jatropha curcas L.

PubMed Central

2013-01-01

Background Recently, Jatropha curcas L. has attracted worldwide attention for its potential as a source of biodiesel. However, most DNA markers have demonstrated high levels of genetic similarity among and within jatropha populations around the globe. Despite promising features of copia-type retrotransposons as ideal genetic tools for gene tagging, mutagenesis, and marker-assisted selection, they have not been characterized in the jatropha genome yet. Here, we examined the diversity, evolution, and genome-wide organization of copia-type retrotransposons in the Asian, African, and Mesoamerican accessions of jatropha, then introduced a retrotransposon-based marker for this biofuel crop. Results In total, 157 PCR fragments that were amplified using the degenerate primers for the reverse transcriptase (RT) domain of copia-type retroelements were sequenced and aligned to construct the neighbor-joining tree. Phylogenetic analysis demonstrated that isolated copia RT sequences were classified into ten families, which were then grouped into three lineages. An in-depth study of the jatropha genome for the RT sequences of each family led to the characterization of full consensus sequences of the jatropha copia-type families. Estimated copy numbers of target sequences were largely different among families, as was presence of genes within 5 kb flanking regions for each family. Five copia-type families were as appealing candidates for the development of DNA marker systems. A candidate marker from family Jc7 was particularly capable of detecting genetic variation among different jatropha accessions. Fluorescence in situ hybridization (FISH) to metaphase chromosomes reveals that copia-type retrotransposons are scattered across chromosomes mainly located in the distal part regions. Conclusion This is the first report on genome-wide analysis and the cytogenetic mapping of copia-type retrotransposons of jatropha, leading to the discovery of families bearing high potential as DNA markers. Distinct dynamics of individual copia-type families, feasibility of a retrotransposon-based insertion polymorphism marker system in examining genetic variability, and approaches for the development of breeding strategies in jatropha using copia-type retrotransposons are discussed. PMID:24020916

A new fusion protein platform for quantitatively measuring activity of multiple proteases

PubMed Central

2014-01-01

Background Recombinant proteins fused with specific cleavage sequences are widely used as substrate for quantitatively analyzing the activity of proteases. Here we propose a new fusion platform for multiple proteases, by using diaminopropionate ammonia-lyase (DAL) as the fusion protein. It was based on the finding that a fused His6-tag could significantly decreases the activities of DAL from E. coli (eDAL) and Salmonella typhimurium (sDAL). Previously, we have shown that His6GST-tagged eDAL could be used to determine the activity of tobacco etch virus protease (TEVp) under different temperatures or in the denaturant at different concentrations. In this report, we will assay different tags and cleavage sequences on DAL for expressing yield in E. coli, stability of the fused proteins and performance of substrate of other common proteases. Results We tested seven different protease cleavage sequences (rhinovirus 3C, TEV protease, factor Xa, Ssp DnaB intein, Sce VMA1 intein, thrombin and enterokinase), three different tags (His6, GST, CBD and MBP) and two different DALs (eDAL and sDAL), for their performance as substrate to the seven corresponding proteases. Among them, we found four active DAL-fusion substrates suitable for TEVp, factor Xa, thrombin and DnaB intein. Enterokinase cleaved eDAL at undesired positions and did not process sDAL. Substitution of GST with MBP increase the expression level of the fused eDAL and this fusion protein was suitable as a substrate for analyzing activity of rhinovirus 3C. We demonstrated that SUMO protease Ulp1 with a N-terminal His6-tag or MBP tag displayed different activity using the designed His6SUMO-eDAL as substrate. Finally, owing to the high level of the DAL-fusion protein in E. coli, these protein substrates can also be detected directly from the crude extract. Conclusion The results show that our designed DAL-fusion proteins can be used to quantify the activities of both sequence- and conformational-specific proteases, with sufficient substrate specificity. PMID:24649897

Microsatellite DNA in genomic survey sequences and UniGenes of loblolly pine

Treesearch

Craig S Echt; Surya Saha; Dennis L Deemer; C Dana Nelson

2011-01-01

Genomic DNA sequence databases are a potential and growing resource for simple sequence repeat (SSR) marker development in loblolly pine (Pinus taeda L.). Loblolly pine also has many expressed sequence tags (ESTs) available for microsatellite (SSR) marker development. We compared loblolly pine SSR densities in genome survey sequences (GSSs) to those in non-redundant...

A microsphere-based assay for mutation analysis of the biotinidase gene using dried blood spots

PubMed Central

Lindau-Shepard, Barbara; Janik, David K.; Pass, Kenneth A.

2012-01-01

Biotinidase deficiency is an autosomal recessive syndrome caused by defects in the biotinidase gene, the product of which affects biotin metabolism. Newborn screening (NBS) for biotinidase deficiency can identify affected infants prior to onset of symptoms; biotin supplementation can resolve or prevent the clinical features. In NBS, dry blood spots (DBS) are usually tested for biotinidase enzyme activity by colorimetric analysis. By taking advantage of the multiplexing capabilities of the Luminex platform, we have developed a microsphere-based array genotyping method for the simultaneous detection of six disease causing mutations in the biotinidase gene, thereby permitting a second tier of molecular analysis. Genomic DNA was extracted from 3.2 mm DBS. Biotinidase gene sequences, containing the mutations of interest, were amplified by multiplexed polymerase chain reaction, followed by multiplexed allele-specific primer extension using universally tagged genotyping primers. The products were then hybridized to anti-tag carrying xTAG microspheres and detected on the Luminex platform. Genotypes were verified by sequencing. Genotyping results of 22 known biotinidase deficient samples by our xTAG biotinidase assay was in concordance with the results obtained from DNA sequencing, for all 6 mutations used in our panel. These results indicate that genotyping by an xTAG microsphere-based array is accurate, flexible, and can be adapted for high-throughput. Since NBS for biotinidase deficiency is by enzymatic assay, less than optimal quality of the DBS itself can compromise enzyme activity, while the DNA from these samples mostly remains unaffected. This assay warrants evaluation as a viable complement to the biotinidase semi-quantitative colorimetric assay. PMID:27625817

Andean analogue for Late Carboniferous volcanic arc and arc flank environments of the western New England Orogen, New South Wales, Australia

NASA Astrophysics Data System (ADS)

McPhei, J.

1987-07-01

Late Carboniferous continental conglomerates interbedded with silicic ignimbrite sheets outcrop along more than 400 km of the western margin of the southern portion of the New England Orogen. Farther east, the coeval sedimentary facies are volcanogenic shallow marine and turbidite deposits. The volcanic source terrain, no longer exposed, was located to the west of the existing conglomerate-ignimbrite sequences and was underlain by continental crust which is, in part, represented by the northern Lachlan Fold Belt. The regional Late Carboniferous palaeogeography was similar to that of the present-day western continental margin of South America. The geology of the oceanward-flank of the Andean arc in northern Chile and a section of the Late Carboniferous continental sequence near Currabubula are comparable in detail. The Andean stratovolcanoes and ignimbrite centres thus provide the means of reconstruction of the Late Carboniferous volcanic source terrain. The geological record of both of these continental margin volcanic arcs, preserved in deposits of the arc flanks, is shaped by volcanism, especially the eruption of voluminous ignimbrites, and by uplift, deformation and glaciation centered on the arc. For the arc sections considered, diversity in the flank sequences arises because these controls vary in importance spatially and during the life of the arc (20-30 Ma). For the entire Andean arc, arc-parallel variations in the sites of active volcanism and its character appear to be related to differences in the continental crust thickness and the circumstances of subduction of oceanic crust, particularly the dip of the Benioff Zone. By analogy, variation in the age, duration and style of volcanic activity along the late Palaeozoic magmatic arc of the western New England Orogen perhaps reflects the former existence of significant differences in crust thickness and in the angle of subduction.

SEAN: SNP prediction and display program utilizing EST sequence clusters.

PubMed

Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek

2006-02-15

SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.

DNA sequence responsible for the amplification of adjacent genes.

PubMed

Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

1987-10-01

A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

Increased complexity of circRNA expression during species evolution.

PubMed

Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li

2017-08-03

Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.

Inventory of high-abundance mRNAs in skeletal muscle of normal men.

PubMed

Welle, S; Bhatt, K; Thornton, C A

1999-05-01

G42875rial analysis of gene expression (SAGE) method was used to generate a catalog of 53,875 short (14 base) expressed sequence tags from polyadenylated RNA obtained from vastus lateralis muscle of healthy young men. Over 12,000 unique tags were detected. The frequency of occurrence of each tag reflects the relative abundance of the corresponding mRNA. The mRNA species that were detected 10 or more times, each comprising >/=0.02% of the mRNA population, accounted for 64% of the mRNA mass but <10% of the total number of mRNA species detected. Almost all of the abundant tags matched mRNA or EST sequences cataloged in GenBank. Mitochondrial transcripts accounted for approximately 20% of the polyadenylated RNA. Transcripts encoding proteins of the myofibrils were the most abundant nuclear-encoded mRNAs. Transcripts encoding ribosomal proteins, and those encoding proteins involved in energy metabolism, also were very abundant. The database can be used as a reference for investigations of alterations in gene expression associated with conditions that influence muscle function, such as muscular dystrophies, aging, and exercise.

Rapid Covalent Fluorescence Labeling of Membrane Proteins on Live Cells via Coiled-Coil Templated Acyl Transfer.

PubMed

Reinhardt, Ulrike; Lotze, Jonathan; Mörl, Karin; Beck-Sickinger, Annette G; Seitz, Oliver

2015-10-21

Fluorescently labeled proteins enable the microscopic imaging of protein localization and function in live cells. In labeling reactions targeted against specific tag sequences, the size of the fluorophore-tag is of major concern. The tag should be small to prevent interference with protein function. Furthermore, rapid and covalent labeling methods are desired to enable the analysis of fast biological processes. Herein, we describe the development of a method in which the formation of a parallel coiled coil triggers the transfer of a fluorescence dye from a thioester-linked coil peptide conjugate onto a cysteine-modified coil peptide. This labeling method requires only small tag sequences (max 23 aa) and occurs with high tag specificity. We show that size matching of the coil peptides and a suitable thioester reactivity allow the acyl transfer reaction to proceed within minutes (rather than hours). We demonstrate the versatility of this method by applying it to the labeling of different G-protein coupled membrane receptors including the human neuropeptide Y receptors 1, 2, 4, 5, the neuropeptide FF receptors 1 and 2, and the dopamine receptor 1. The labeled receptors are fully functional and able to bind the respective ligand with high affinity. Activity is not impaired as demonstrated by activation, internalization, and recycling experiments.

Deep sequencing reveals exceptional diversity and modes of transmission for bacterial sponge symbionts.

PubMed

Webster, Nicole S; Taylor, Michael W; Behnam, Faris; Lücker, Sebastian; Rattei, Thomas; Whalan, Stephen; Horn, Matthias; Wagner, Michael

2010-08-01

Marine sponges contain complex bacterial communities of considerable ecological and biotechnological importance, with many of these organisms postulated to be specific to sponge hosts. Testing this hypothesis in light of the recent discovery of the rare microbial biosphere, we investigated three Australian sponges by massively parallel 16S rRNA gene tag pyrosequencing. Here we show bacterial diversity that is unparalleled in an invertebrate host, with more than 250,000 sponge-derived sequence tags being assigned to 23 bacterial phyla and revealing up to 2996 operational taxonomic units (95% sequence similarity) per sponge species. Of the 33 previously described 'sponge-specific' clusters that were detected in this study, 48% were found exclusively in adults and larvae - implying vertical transmission of these groups. The remaining taxa, including 'Poribacteria', were also found at very low abundance among the 135,000 tags retrieved from surrounding seawater. Thus, members of the rare seawater biosphere may serve as seed organisms for widely occurring symbiont populations in sponges and their host association might have evolved much more recently than previously thought. © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.

Deep sequencing reveals exceptional diversity and modes of transmission for bacterial sponge symbionts

PubMed Central

Webster, Nicole S; Taylor, Michael W; Behnam, Faris; Lücker, Sebastian; Rattei, Thomas; Whalan, Stephen; Horn, Matthias; Wagner, Michael

2010-01-01

Marine sponges contain complex bacterial communities of considerable ecological and biotechnological importance, with many of these organisms postulated to be specific to sponge hosts. Testing this hypothesis in light of the recent discovery of the rare microbial biosphere, we investigated three Australian sponges by massively parallel 16S rRNA gene tag pyrosequencing. Here we show bacterial diversity that is unparalleled in an invertebrate host, with more than 250 000 sponge-derived sequence tags being assigned to 23 bacterial phyla and revealing up to 2996 operational taxonomic units (95% sequence similarity) per sponge species. Of the 33 previously described ‘sponge-specific’ clusters that were detected in this study, 48% were found exclusively in adults and larvae – implying vertical transmission of these groups. The remaining taxa, including ‘Poribacteria’, were also found at very low abundance among the 135 000 tags retrieved from surrounding seawater. Thus, members of the rare seawater biosphere may serve as seed organisms for widely occurring symbiont populations in sponges and their host association might have evolved much more recently than previously thought. PMID:21966903

cis-Acting elements important for retroviral RNA packaging specificity.

PubMed

Beasley, Benjamin E; Hu, Wei-Shau

2002-05-01

Spleen necrosis virus (SNV) proteins can package RNA from distantly related murine leukemia virus (MLV), whereas MLV proteins cannot package SNV RNA efficiently. We used this nonreciprocal recognition to investigate regions of packaging signals that influence viral RNA encapsidation specificity. Although the MLV and SNV packaging signals (Psi and E, respectively) do not contain significant sequence homology, they both contain a pair of hairpins. This hairpin pair was previously proposed to be the core element in MLV Psi. In the present study, MLV-based vectors were generated to contain chimeric SNV/MLV packaging signals in which the hairpins were replaced with the heterologous counterpart. The interactions between these chimeras and MLV or SNV proteins were examined by virus replication and RNA analyses. SNV proteins recognized all of the chimeras, indicating that these chimeras were functional. We found that replacing the hairpin pair did not drastically alter the ability of MLV proteins to package these chimeras. These results indicate that, despite the important role of the hairpin pair in RNA packaging, it is not the major motif responsible for the ability of MLV proteins to discriminate between the MLV and SNV packaging signals. To determine the role of sequences flanking the hairpins in RNA packaging specificity, vectors with swapped flanking regions were generated and evaluated. SNV proteins packaged all of these chimeras efficiently. In contrast, MLV proteins strongly favored chimeras with the MLV 5'-flanking regions. These data indicated that MLV Gag recognizes multiple elements in the viral packaging signal, including the hairpin structure and flanking regions.

Developmental staging of male murine embryonic gonad by SAGE analysis

PubMed Central

Lee, Tin-Lap; Li, Yunmin; Alba, Diana; Vong, Queenie P.; Wu, Shao-Ming; Baxendale, Vanessa; Rennert, Owen M.; Lau, Yun-Fai Chris; Chan, Wai-Yee

2012-01-01

Despite the identification of key genes such as Sry integral to embryonic gonadal development, the genomic classification and identification of chromosomal activation of this process is still poorly understood. To better understand the genetic regulation of gonadal development, we performed Serial Analysis of Gene Expression (SAGE) to profile the genes and novel transcripts, and an average of 152,000 tags from male embryonic gonads at E10.5 (embryonic day 10.5), E11.5, E12.5, E13.5, E15.5 and E17.5 were analyzed. A total of 275,583 non-singleton tags that do not map to any annotated sequence were identified in the six gonad libraries, and 47,255 tags were mapped to 24,975 annotated sequences, among which 987 sequences were uncharacterized. Utilizing an unsupervised pattern identification technique, we established molecular staging of male gonadal development. Rather than providing a static descriptive analysis, we developed algorithms to cluster the SAGE data and assign SAGE tags to a corresponding chromosomal position; these data are displayed in chromosome graphic format. A prominent increase in global genomic activity from E10.5 to E17.5 was observed. Important chromosomal regions related to the developmental processes were identified and validated based on established mouse models with developmental disorders. These regions may represent markers for early diagnosis for disorders of male gonad development as well as potential treatment targets. PMID:19376482

Analysis of SSR information in EST resources of sugarcane

USDA-ARS?s Scientific Manuscript database

Expressed sequence tags ( ESTs) offer the opportunity to exploit single, low -copy, conserved sequence motifs for the development of simple sequence repeats ( SSRs). The total of 262 113 ESTs of sugarcane (Saccharum officinarum) in the database of NCBI were downloaded and analyzed, which resulted in...

Characterization of microbial associations with methanotrophic archaea and sulfate-reducing bacteria through statistical comparison of nested Magneto-FISH enrichments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trembath-Reichert, Elizabeth; Case, David H.; Orphan, Victoria J.

Methane seep systems along continental margins host diverse and dynamic microbial assemblages, sustained in large part through the microbially mediated process of sulfate-coupled Anaerobic Oxidation of Methane (AOM). This methanotrophic metabolism has been linked to consortia of anaerobic methane-oxidizing archaea (ANME) and sulfate-reducing bacteria (SRB). These two groups are the focus of numerous studies; however, less is known about the wide diversity of other seep associated microorganisms. We selected a hierarchical set of FISH probes targeting a range ofDeltaproteobacteriadiversity. Using the Magneto-FISH enrichment technique, we then magnetically captured CARD-FISH hybridized cells and their physically associated microorganisms from a methane seepmore » sediment incubation. DNA from nested Magneto-FISH experiments was analyzed using Illumina tag 16S rRNA gene sequencing (iTag). Enrichment success and potential bias with iTag was evaluated in the context of full-length 16S rRNA gene clone libraries, CARD-FISH, functional gene clone libraries, and iTag mock communities. We determined commonly used Earth Microbiome Project (EMP) iTAG primers introduced bias in some common methane seep microbial taxa that reduced the ability to directly compare OTU relative abundances within a sample, but comparison of relative abundances between samples (in nearly all cases) and whole community-based analyses were robust. The iTag dataset was subjected to statistical co-occurrence measures of the most abundant OTUs to determine which taxa in this dataset were most correlated across all samples. In addition, many non-canonical microbial partnerships were statistically significant in our co-occurrence network analysis, most of which were not recovered with conventional clone library sequencing, demonstrating the utility of combining Magneto-FISH and iTag sequencing methods for hypothesis generation of associations within complex microbial communities. Network analysis pointed to many co-occurrences containing putatively heterotrophic, candidate phyla such as OD1, Atribacteria, MBG-B, and Hyd24-12 and the potential for complex sulfur cycling involving Epsilon-, Delta-, and Gammaproteobacteria in methane seep ecosystems.« less

Characterization of microbial associations with methanotrophic archaea and sulfate-reducing bacteria through statistical comparison of nested Magneto-FISH enrichments

DOE PAGES

Trembath-Reichert, Elizabeth; Case, David H.; Orphan, Victoria J.

2016-04-18

Methane seep systems along continental margins host diverse and dynamic microbial assemblages, sustained in large part through the microbially mediated process of sulfate-coupled Anaerobic Oxidation of Methane (AOM). This methanotrophic metabolism has been linked to consortia of anaerobic methane-oxidizing archaea (ANME) and sulfate-reducing bacteria (SRB). These two groups are the focus of numerous studies; however, less is known about the wide diversity of other seep associated microorganisms. We selected a hierarchical set of FISH probes targeting a range ofDeltaproteobacteriadiversity. Using the Magneto-FISH enrichment technique, we then magnetically captured CARD-FISH hybridized cells and their physically associated microorganisms from a methane seepmore » sediment incubation. DNA from nested Magneto-FISH experiments was analyzed using Illumina tag 16S rRNA gene sequencing (iTag). Enrichment success and potential bias with iTag was evaluated in the context of full-length 16S rRNA gene clone libraries, CARD-FISH, functional gene clone libraries, and iTag mock communities. We determined commonly used Earth Microbiome Project (EMP) iTAG primers introduced bias in some common methane seep microbial taxa that reduced the ability to directly compare OTU relative abundances within a sample, but comparison of relative abundances between samples (in nearly all cases) and whole community-based analyses were robust. The iTag dataset was subjected to statistical co-occurrence measures of the most abundant OTUs to determine which taxa in this dataset were most correlated across all samples. In addition, many non-canonical microbial partnerships were statistically significant in our co-occurrence network analysis, most of which were not recovered with conventional clone library sequencing, demonstrating the utility of combining Magneto-FISH and iTag sequencing methods for hypothesis generation of associations within complex microbial communities. Network analysis pointed to many co-occurrences containing putatively heterotrophic, candidate phyla such as OD1, Atribacteria, MBG-B, and Hyd24-12 and the potential for complex sulfur cycling involving Epsilon-, Delta-, and Gammaproteobacteria in methane seep ecosystems.« less

Characterization of microbial associations with methanotrophic archaea and sulfate-reducing bacteria through statistical comparison of nested Magneto-FISH enrichments.

PubMed

Trembath-Reichert, Elizabeth; Case, David H; Orphan, Victoria J

2016-01-01

Methane seep systems along continental margins host diverse and dynamic microbial assemblages, sustained in large part through the microbially mediated process of sulfate-coupled Anaerobic Oxidation of Methane (AOM). This methanotrophic metabolism has been linked to consortia of anaerobic methane-oxidizing archaea (ANME) and sulfate-reducing bacteria (SRB). These two groups are the focus of numerous studies; however, less is known about the wide diversity of other seep associated microorganisms. We selected a hierarchical set of FISH probes targeting a range of Deltaproteobacteria diversity. Using the Magneto-FISH enrichment technique, we then magnetically captured CARD-FISH hybridized cells and their physically associated microorganisms from a methane seep sediment incubation. DNA from nested Magneto-FISH experiments was analyzed using Illumina tag 16S rRNA gene sequencing (iTag). Enrichment success and potential bias with iTag was evaluated in the context of full-length 16S rRNA gene clone libraries, CARD-FISH, functional gene clone libraries, and iTag mock communities. We determined commonly used Earth Microbiome Project (EMP) iTAG primers introduced bias in some common methane seep microbial taxa that reduced the ability to directly compare OTU relative abundances within a sample, but comparison of relative abundances between samples (in nearly all cases) and whole community-based analyses were robust. The iTag dataset was subjected to statistical co-occurrence measures of the most abundant OTUs to determine which taxa in this dataset were most correlated across all samples. Many non-canonical microbial partnerships were statistically significant in our co-occurrence network analysis, most of which were not recovered with conventional clone library sequencing, demonstrating the utility of combining Magneto-FISH and iTag sequencing methods for hypothesis generation of associations within complex microbial communities. Network analysis pointed to many co-occurrences containing putatively heterotrophic, candidate phyla such as OD1, Atribacteria, MBG-B, and Hyd24-12 and the potential for complex sulfur cycling involving Epsilon-, Delta-, and Gammaproteobacteria in methane seep ecosystems.

Microchannel DNA Sequencing by End-Labelled Free Solution Electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barron, A.

2005-09-29

The further development of End-Labeled Free-Solution Electrophoresis will greatly simplify DNA separation and sequencing on microfluidic devices. The development and optimization of drag-tags is critical to the success of this research.

Differential expression of a novel gene during seed triacylglycerol accumulation in lupin species ( Lupinus angustifolius L. and L. mutabilis L.).

PubMed

Francki, Michael G; Whitaker, Peta; Smith, Penelope M; Atkins, Craig A

2002-11-01

Seed triacylglycerols (TAGs) are stored as energy reserves and extracted for various end-product uses. In lupins, seed oil content varies from 16% in Lupinus mutabilisto 8% in L. angustifolius. We have shown that TAGs rapidly accumulate during mid-stages of seed development in L. mutabilis compared to the lower seed oil species, L. angustifolius. In this study, we have targeted the key enzymes of the lipid biosynthetic pathway, acetyl-CoA carboxylase (ACCase) and diacylglycerol acyltransferase (DAGAT), to determine factors regulating TAG accumulation between two lupin species. A twofold increase in ACCase activity was observed in L. mutabilis relative to L. angustifolius and correlated with rapid TAG accumulation. No difference in DAGAT activity was detected. We have identified, cloned and partially characterised a novel gene differentially expressed during TAG accumulation between L. angustifolius and L. mutabilis. The gene has some identity to the glucose dehydrogenase family previously described in barley and bacteria and the significance of its expression levels during seed development in relation to TAG accumulation is discussed. DNA sequence analysis of the promoter in both L. angustifolius and L. mutabilis identified putative matrix attachment regions and recognition sequences for transcription binding sites similar to those found in the Adh1 gene from Arabidopsis. The identical promoter regions between species indicate that differential gene expression is controlled by alternative transcription factors, accessibility to binding sites or a combination of both.

Tab2, a novel recombinant polypeptide tag offering sensitive and specific protein detection and reliable affinity purification.

PubMed

Crusius, Kerstin; Finster, Silke; McClary, John; Xia, Wei; Larsen, Brent; Schneider, Douglas; Lu, Hong-Tao; Biancalana, Sara; Xuan, Jian-Ai; Newton, Alicia; Allen, Debbie; Bringmann, Peter; Cobb, Ronald R

2006-10-01

The detection and purification of proteins are often time-consuming and frequently involve complicated protocols. The addition of a peptide tag to recombinant proteins can make this process more efficient. Many of the commonly used tags, such as Flagtrade mark, Myc, HA and V5 are recognized by specific monoclonal antibodies and therefore, allow immunoaffinity-based purification. Enhancing the current scope of flexibility in using diverse peptide tags, we report here the development of a novel, short polypeptide tag (Tab2) for detection and purification of recombinant proteins. The Tab2 epitope corresponds to the NH2-terminal seven amino acid residues of human TGFalpha. A monoclonal anti-Tab2 antibody was raised and characterized. To investigate the potential of this peptide sequence as a novel tag for recombinant proteins, we expressed several different recombinant proteins containing this tag in E. coli, baculovirus, and mammalian cells. The data presented demonstrates the Tab2 tag-anti-Tab2 antibody combination is a reliable tool enabling specific Western blot detection, FACS analysis, and immunoprecipitation as well as non-denaturing protein affinity purification.

Cytogenetic and molecular markers for detecting Aegilops uniaristata chromosomes in a wheat background.

PubMed

Gong, Wenping; Li, Guangrong; Zhou, Jianping; Li, Genying; Liu, Cheng; Huang, Chengyan; Zhao, Zhendong; Yang, Zujun

2014-09-01

Aegilops uniaristata has many agronomically useful traits that can be used for wheat breeding. So far, a Triticum turgidum - Ae. uniaristata amphiploid and one set of Chinese Spring (CS) - Ae. uniaristata addition lines have been produced. To guide Ae. uniaristata chromatin transformation from these lines into cultivated wheat through chromosome engineering, reliable cytogenetic and molecular markers specific for Ae. uniaristata chromosomes need to be developed. Standard C-banding shows that C-bands mainly exist in the centromeric regions of Ae. uniaristata but rarely at the distal ends. Fluorescence in situ hybridization (FISH) using (GAA)8 as a probe showed that the hybridization signal of chromosomes 1N-7N are different, thus (GAA)8 can be used to identify all Ae. uniaristata chromosomes in wheat background simultaneously. Moreover, a total of 42 molecular markers specific for Ae. uniaristata chromosomes were developed by screening expressed sequence tag - sequence tagged site (EST-STS), expressed sequence tag - simple sequence repeat (EST-SSR), and PCR-based landmark unique gene (PLUG) primers. The markers were subsequently localized using the CS - Ae. uniaristata addition lines and different wheat cultivars as controls. The cytogenetic and molecular markers developed herein will be helpful for screening and identifying wheat - Ae. uniaristata progeny.

DNA sequencing using fluorescence background electroblotting membrane

DOEpatents

Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.

1992-01-01

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

DNA sequencing using fluorescence background electroblotting membrane

DOEpatents

Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

1992-05-12

A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

Geologic Mapping Investigations of Alba Mons, Mars

NASA Astrophysics Data System (ADS)

Crown, D. A.; Berman, D. C.; Scheidt, S. P.; Hauber, E.

2018-06-01

Geologic mapping of the summit region and western flank of Alba Mons at 1:1M-scale is revealing sequences of volcanic, tectonic, impact, and degradation processes that have formed and modified the northernmost of the Tharsis volcanoes.

Polycythemia in transgenic mice expressing the human erythropoietin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Semenza, G.L.; Traystman, M.D.; Gearhart, J.D.

1989-04-01

Erythropoietin is a glycoprotein hormone that regulates mammalian erythropoiesis. To study the expression of the human erythropoietin gene, EPO, 4 kilobases of DNA encompassing the gene with 0.4 kilobase of 5{prime} flanking sequence and 0.7 kilobase of 3{prime} flanking sequence was microinjected into fertilized mouse eggs. Transgenic mice were generated that are polycythemic, with increased erythrocytic indices in peripheral blood, increased numbers of erythroid precursors in hematopoietic tissue, and increased serum erythropoietin levels. Transgenic homozygotes show a greater degree of polycythemia than do heterozygotes as well as striking extramedullary erythropoiesis. Human erythropoietin RNA was found not only in fetal liver,more » adult liver, and kidney but also in all other transgenic tissues analyzed. Anemia induced increased human erythropoietin RNA levels in liver but not kidney. These transgenic mice represent a unique model of polycythemia due to increased erythropoietin levels.« less

Characterizing the Specificity and Co-operation of Aminopeptidases in the Cytosol and ER During MHC Class I antigen Presentation1

PubMed Central

Hearn, Arron; York, Ian A.; Bishop, Courtney; Rock, Kenneth L.

2010-01-01

Many MHC class I binding peptides are generated as N-extended precursors during protein degradation by the proteasome. These peptides can be subsequently trimmed by aminopeptidases in the cytosol and/or the ER to produce mature epitope. However, the contribution and specificity of each of these subcellular compartments in removing N-terminal amino acids for antigen presentation is not well defined. Here we investigate this issue for antigenic precursors that are expressed in the cytosol. By systematically varying the N-terminal flanking sequences of peptides we show that the amino acids upstream of an epitope precursor are a major determinant of the amount of antigen presentation. In many cases MHC class I binding peptides are produced through sequential trimming in both the cytosol and ER. Trimming of flanking residues in the cytosol contributes most to sequences that are poorly trimmed in the ER. Since N-terminal trimming has different specificity in the cytosol and ER, the cleavage of peptides in both of these compartments serves to broaden the repertoire of sequences that are presented. PMID:20351195

RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

PubMed

Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A

2017-01-01

CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

Conditional protein splicing: a new tool to control protein structure and function in vitro and in vivo.

PubMed

Mootz, Henning D; Blum, Elyse S; Tyszkiewicz, Amy B; Muir, Tom W

2003-09-03

Protein splicing is a naturally occurring process in which an intervening intein domain excises itself out of a precursor polypeptide in an autocatalytic fashion with concomitant linkage of the two flanking extein sequences by a native peptide bond. We have recently reported an engineered split VMA intein whose splicing activity in trans between two polypeptides can be triggered by the small molecule rapamycin. In this report, we show that this conditional protein splicing (CPS) system can be used in mammalian cells. Two model constructs harboring maltose-binding protein (MBP) and a His-tag as exteins were expressed from a constitutive promoter after transient transfection. The splicing product MBP-His was detected by Western blotting and immunoprecipitation in cells treated with rapamycin or a nontoxic analogue thereof. No background splicing in the absence of the small-molecule inducer was observed over a 24-h time course. Product formation could be detected within 10 min of addition of rapamycin, indicating the advantage of the posttranslational nature of CPS for quick responses. The level of protein splicing was dose dependent and could be competitively attenuated with the small molecule ascomycin. In related studies, the geometric flexibility of the CPS components was investigated with a series of purified proteins. The FKBP and FRB domains, which are dimerized by rapamycin and thereby induce the reconstitution of the split intein, were fused to the extein sequences of the split intein halves. CPS was still triggered by rapamycin when FKBP and FRB occupied one or both of the extein positions. This finding suggests yet further applications of CPS in the area of proteomics. In summary, CPS holds great promise to become a powerful new tool to control protein structure and function in vitro and in living cells.

Molecular mapping and marker development for the Triticum dicoccoides-derived stripe rust resistance gene YrSM139-1B in bread wheat cv. Shaanmai 139.

PubMed

Zhang, Hong; Zhang, Lu; Wang, Changyou; Wang, Yajuan; Zhou, Xinli; Lv, Shikai; Liu, Xinlun; Kang, Zhensheng; Ji, Wanquan

2016-02-01

YrSM139-1B maybe a new gene for effective resistance to stripe rust and useful flanking markers for marker-assisted selection were developed. Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important foliar disease of wheat. Two dominant stripe rust resistant genes YrSM139-1B and YrSM139-2D were pyramided in bread wheat cultivar Shaanmai 139; one from wild emmer and the other from Thinopyrum intermedium. Three near-isogenic F7:8 line pairs (contrasting RILs), N122-1013R/S, N122-185R/S, and N122-1812R/S, independently derived from different F2 plants and differing at the YrSM139-1B locus were generated from the cross Shaanmai 139 × Hu 901-19 through marker-assisted selection. A large F2:3 population from cross N122-1013R × N122-1013S tested for stripe rust response and subjected to analysis with markers in the 1BS10-0.5 bin region using SSR expressed sequence tags (EST) and site-specific sequence markers developed from the 90 K Illumina iSelect SNP array. Five EST-STS markers and four allele-specific PCR markers were mapped to the YrSM139-1B region. The 30.5 cM genetic map for YrSM139-1B consisted of nine markers, two of which were closer to YrSM139-1B than Xgwm273, which was used in producing the contrasting RIL pairs. Race response data and allelism tests showed that YrSM139-1B is different from Yr10, Yr15, and Yr24/26/CH42.

First Complete Genome Sequence of Zika Virus (Flaviviridae, Flavivirus) from an Autochthonous Transmission in Brazil

PubMed Central

Cunha, Mariana Sequetin; Esposito, Danillo Lucas Alves; Rocco, Iray Maria; Maeda, Adriana Yurika; Vasami, Fernanda Gisele Silva; Nogueira, Juliana Silva; de Souza, Renato Pereira; Suzuki, Akemi; Addas-Carvalho, Marcelo; Barjas-Castro, Maria de Lourdes; Resende, Mariângela Ribeiro; Stucchi, Raquel Silveira Bello; Boin, Ilka de Fátima Santana Ferreira; Katz, Gizelda; Angerami, Rodrigo Nogueira

2016-01-01

We report here the genome sequence of Zika virus, strain ZikaSPH2015, containing all structural and nonstructural proteins flanked by the 5′ and 3′ untranslated region. It was isolated in São Paulo state, Brazil, in 2015, from a patient who received a blood transfusion from an asymptomatic donor at the time of donation. PMID:26941134

Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

PubMed Central

Janecek, S.

1996-01-01

The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins. PMID:8762144

Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

PubMed

Janecek, S

1996-06-01

The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins.

Insight into the coordination and the binding sites of Cu(2+) by the histidyl-6-tag using experimental and computational tools.

PubMed

Watly, Joanna; Simonovsky, Eyal; Wieczorek, Robert; Barbosa, Nuno; Miller, Yifat; Kozlowski, Henryk

2014-07-07

His-tags are specific sequences containing six to nine subsequent histydyl residues, and they are used for purification of recombinant proteins by use of IMAC chromatography. Such polyhistydyl tags, often used in molecular biology, can be also found in nature. Proteins containing histidine-rich domains play a critical role in many life functions in both prokaryote and eukaryote organisms. Binding mode and the thermodynamic properties of the system depend on the specific metal ion and the histidine sequence. Despite the wide application of the His-tag for purification of proteins, little is known about the properties of metal-binding to such tag domains. This inspired us to undertake detailed studies on the coordination of Cu(2+) ion to hexa-His-tag. Experiments were performed using the potentiometric, UV-visible, CD, and EPR techniques. In addition, molecular dynamics (MD) simulations and density functional theory (DFT) calculations were applied. The experimental studies have shown that the Cu(2+) ion binds most likely to two imidazoles and one, two, or three amide nitrogens, depending on the pH. The structures and stabilities of the complexes for the Cu(2+)-Ac-(His)6-NH2 system using experimental and computational tools were established. Polymorphic binding states are suggested, with a possibility of the formation of α-helix structure induced by metal ion coordination. Metal ion is bound to various pairs of imidazole moieties derived from the tag with different efficiencies. The coordination sphere around the metal ion is completed by molecules of water. Finally, the Cu(2+) binding by Ac-(His)6-NH2 is much more efficient compared to other multihistidine protein domains.

Flanking signal and mature peptide residues influence signal peptide cleavage

PubMed Central

Choo, Khar Heng; Ranganathan, Shoba

2008-01-01

Background Signal peptides (SPs) mediate the targeting of secretory precursor proteins to the correct subcellular compartments in prokaryotes and eukaryotes. Identifying these transient peptides is crucial to the medical, food and beverage and biotechnology industries yet our understanding of these peptides remains limited. This paper examines the most common type of signal peptides cleavable by the endoprotease signal peptidase I (SPase I), and the residues flanking the cleavage sites of three groups of signal peptide sequences, namely (i) eukaryotes (Euk) (ii) Gram-positive (Gram+) bacteria, and (iii) Gram-negative (Gram-) bacteria. Results In this study, 2352 secretory peptide sequences from a variety of organisms with amino-terminal SPs are extracted from the manually curated SPdb database for analysis based on physicochemical properties such as pI, aliphatic index, GRAVY score, hydrophobicity, net charge and position-specific residue preferences. Our findings show that the three groups share several similarities in general, but they display distinctive features upon examination in terms of their amino acid compositions and frequencies, and various physico-chemical properties. Thus, analysis or prediction of their sequences should be separated and treated as distinct groups. Conclusion We conclude that the peptide segment recognized by SPase I extends to the start of the mature protein to a limited extent, upon our survey of the amino acid residues surrounding the cleavage processing site. These flanking residues possibly influence the cleavage processing and contribute to non-canonical cleavage sites. Our findings are applicable in defining more accurate prediction tools for recognition and identification of cleavage site of SPs. PMID:19091014

Sediment routing through channel confluences: RFID tracer experiments from a gravel-bed river headwaters

NASA Astrophysics Data System (ADS)

Imhoff, K.; Wilcox, A. C.

2014-12-01

Tributary confluences may significantly impact large-scale patterns of sediment transport because of their role in connecting individual streams in a network. These unique locations feature complex flow structures and geomorphic features, and may represent ecological hotspots. Sediment transport across confluences is poorly understood, however. We present research on coarse sediment transport and dispersion through confluences using sediment tracers in the East Fork Bitterroot River, Montana, USA. We tagged a range of gravel (>40 mm) and cobble particles with Radio Frequency Identification (RFID) tags and painted smaller (10-40 mm) gravels, and then we traced them through confluences in a montane river's headwaters. We measured the effects of confluences on dispersion, path length, and depositional location and compare properties of sediment routing with a non-confluence control reach. We also measured topographic change through repeat bed surveys and combined topography, hydraulics, and tracer measurements to calculate basal shear and critical Shields stresses for different grain sizes. Field observations suggest that tagged particles in confluences routed along flanks of scour holes in confluences, with sediment depositing further downstream along bank-lateral bars than within the channel thalweg. Travel distances of RFID-tagged particles ranged up to 35 meters from original seeding points, with initial recovery rates of RFID-tagged tracers ranging between 84-89%. In both confluence and control reaches only partial mobility was observed within the entire tracer population, suggesting a hiding effect imposed by the roughness of the bed. Particles seeded in the channel thalweg experienced further travel distances than those seeded towards the banks and on bars. Differences in dispersion between confluence and control reaches are implied by field observation. This study quantified patterns of sediment routing within confluences and provided insight to the importance of confluences in large-scale sediment transport through gravel-bed rivers.

Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

PubMed

Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

2004-05-01

Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

Analysis and functional annotation of expressed sequence tags from the fall armyworm Spodoptera frugiperda

PubMed Central

Deng, Youping; Dong, Yinghua; Thodima, Venkata; Clem, Rollie J; Passarelli, A Lorena

2006-01-01

Background Little is known about the genome sequences of lepidopteran insects, although this group of insects has been studied extensively in the fields of endocrinology, development, immunity, and pathogen-host interactions. In addition, cell lines derived from Spodoptera frugiperda and other lepidopteran insects are routinely used for baculovirus foreign gene expression. This study reports the results of an expressed sequence tag (EST) sequencing project in cells from the lepidopteran insect S. frugiperda, the fall armyworm. Results We have constructed an EST database using two cDNA libraries from the S. frugiperda-derived cell line, SF-21. The database consists of 2,367 ESTs which were assembled into 244 contigs and 951 singlets for a total of 1,195 unique sequences. Conclusion S. frugiperda is an agriculturally important pest insect and genomic information will be instrumental for establishing initial transcriptional profiling and gene function studies, and for obtaining information about genes manipulated during infections by insect pathogens such as baculoviruses. PMID:17052344

Illuminator, a desktop program for mutation detection using short-read clonal sequencing.

PubMed

Carr, Ian M; Morgan, Joanne E; Diggle, Christine P; Sheridan, Eamonn; Markham, Alexander F; Logan, Clare V; Inglehearn, Chris F; Taylor, Graham R; Bonthron, David T

2011-10-01

Current methods for sequencing clonal populations of DNA molecules yield several gigabases of data per day, typically comprising reads of < 100 nt. Such datasets permit widespread genome resequencing and transcriptome analysis or other quantitative tasks. However, this huge capacity can also be harnessed for the resequencing of smaller (gene-sized) target regions, through the simultaneous parallel analysis of multiple subjects, using sample "tagging" or "indexing". These methods promise to have a huge impact on diagnostic mutation analysis and candidate gene testing. Here we describe a software package developed for such studies, offering the ability to resolve pooled samples carrying barcode tags and to align reads to a reference sequence using a mutation-tolerant process. The program, Illuminator, can identify rare sequence variants, including insertions and deletions, and permits interactive data analysis on standard desktop computers. It facilitates the effective analysis of targeted clonal sequencer data without dedicated computational infrastructure or specialized training. Copyright © 2011 Elsevier Inc. All rights reserved.

A universal TagModule collection for parallel genetic analysis of microorganisms

PubMed Central

Oh, Julia; Fung, Eula; Price, Morgan N.; Dehal, Paramvir S.; Davis, Ronald W.; Giaever, Guri; Nislow, Corey; Arkin, Adam P.; Deutschbauer, Adam

2010-01-01

Systems-level analyses of non-model microorganisms are limited by the existence of numerous uncharacterized genes and a corresponding over-reliance on automated computational annotations. One solution to this challenge is to disrupt gene function using DNA tag technology, which has been highly successful in parallelizing reverse genetics in Saccharomyces cerevisiae and has led to discoveries in gene function, genetic interactions and drug mechanism of action. To extend the yeast DNA tag methodology to a wide variety of microorganisms and applications, we have created a universal, sequence-verified TagModule collection. A hallmark of the 4280 TagModules is that they are cloned into a Gateway entry vector, thus facilitating rapid transfer to any compatible genetic system. Here, we describe the application of the TagModules to rapidly generate tagged mutants by transposon mutagenesis in the metal-reducing bacterium Shewanella oneidensis MR-1 and the pathogenic yeast Candida albicans. Our results demonstrate the optimal hybridization properties of the TagModule collection, the flexibility in applying the strategy to diverse microorganisms and the biological insights that can be gained from fitness profiling tagged mutant collections. The publicly available TagModule collection is a platform-independent resource for the functional genomics of a wide range of microbial systems in the post-genome era. PMID:20494978

Exploiting EST databases for the development and characterisation of 3425 gene-tagged CISP markers in biofuel crop sugarcane and their transferability in cereals and orphan tropical grasses.

PubMed

Chandra, Amaresh; Jain, Radha; Solomon, Sushil; Shrivastava, Shiksha; Roy, Ajoy K

2013-02-04

Sugarcane is an important cash crop, providing 70% of the global raw sugar as well as raw material for biofuel production. Genetic analysis is hindered in sugarcane because of its large and complex polyploid genome and lack of sufficiently informative gene-tagged markers. Modern genomics has produced large amount of ESTs, which can be exploited to develop molecular markers based on comparative analysis with EST datasets of related crops and whole rice genome sequence, and accentuate their cross-technical functionality in orphan crops like tropical grasses. Utilising 246,180 Saccharum officinarum EST sequences vis-à-vis its comparative analysis with ESTs of sorghum and barley and the whole rice genome sequence, we have developed 3425 novel gene-tagged markers - namely, conserved-intron scanning primers (CISP) - using the web program GeMprospector. Rice orthologue annotation results indicated homology of 1096 sequences with expressed proteins, 491 with hypothetical proteins. The remaining 1838 were miscellaneous in nature. A total of 367 primer-pairs were tested in diverse panel of samples. The data indicate amplification of 41% polymorphic bands leading to 0.52 PIC and 3.50 MI with a set of sugarcane varieties and Saccharum species. In addition, a moderate technical functionality of a set of such markers with orphan tropical grasses (22%) and fodder cum cereal oat (33%) is observed. Developed gene-tagged CISP markers exhibited considerable technical functionality with varieties of sugarcane and unexplored species of tropical grasses. These markers would thus be particularly useful in identifying the economical traits in sugarcane and developing conservation strategies for orphan tropical grasses.

A complete YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13) and refined localization of the SNRPN gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mutirangura, A.; Jayakumar, A.; Sutcliffe, J.S.

1993-12-01

Since a previous report of a partial YAC contig of the Prader-Willi/Angelman chromosome region (15q11-q13), a complete contig spanning approximately 3.5 Mb has been developed. YACs were isolated from two human genomic libraries by PCR and hybridization screening methods. Twenty-three sequence-tagged sites (STSs) were mapped within the contig, a density of [approximately]1 per 200 kb. Overlaps between YAC clones were identified by Alu-PCR dot-blot analysis and confirmed by STS mapping or hybridization with ends of YAC inserts. The gene encoding small nuclear ribonucleoprotein-associated peptide N (SNRPN), recently identified as a candidate gene for Prader-Willi syndrome, was localized within this contigmore » between markers PW71 and TD3-21. Loci mapped within and immediately flanking the Prader-Willi/Angelman chromosome region contig are ordered as follows: cen-IR39-ML34-IR4-3R-TD189-1-PW71-SNRPN-TD3-21-LS6-1-GABRB3,D15S97-GABRA5-IR10-1-CMW1-tel. This YAC contig will be a useful resource for more detailed physical mapping of the region, for generation of new DNA markers, and for mapping or cloning candidate genes for the Prader-Willi and Angelman syndromes. 36 refs., 2 figs., 2 tabs.« less

Multiple tag labeling method for DNA sequencing

DOEpatents

Mathies, Richard A.; Huang, Xiaohua C.; Quesada, Mark A.

1995-01-01

A DNA sequencing method described which uses single lane or channel electrophoresis. Sequencing fragments are separated in said lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radio-isotope labels.

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Rapid in silico cloning of genes using expressed sequence tags (ESTs).

PubMed

Gill, R W; Sanseau, P

2000-01-01

Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

Genome-Wide Analysis of Differentially Expressed Genes Relevant to Rhizome Formation in Lotus Root (Nelumbo nucifera Gaertn)

PubMed Central

Yin, Jingjing; Li, Liangjun; Chen, Xuehao

2013-01-01

Lotus root is a popular wetland vegetable which produces edible rhizome. At the molecular level, the regulation of rhizome formation is very complex, which has not been sufficiently addressed in research. In this study, to identify differentially expressed genes (DEGs) in lotus root, four libraries (L1 library: stolon stage, L2 library: initial swelling stage, L3 library: middle swelling stage, L4: later swelling stage) were constructed from the rhizome development stages. High-throughput tag-sequencing technique was used which is based on Solexa Genome Analyzer Platform. Approximately 5.0 million tags were sequenced, and 4542104, 4474755, 4777919, and 4750348 clean tags including 151282, 137476, 215872, and 166005 distinct tags were obtained after removal of low quality tags from each library respectively. More than 43% distinct tags were unambiguous tags mapping to the reference genes, and 40% were unambiguous tag-mapped genes. From L1, L2, L3, and L4, total 20471, 18785, 23448, and 21778 genes were annotated, after mapping their functions in existing databases. Profiling of gene expression in L1/L2, L2/L3, and L3/L4 libraries were different among most of the selected 20 DEGs. Most of the DEGs in L1/L2 libraries were relevant to fiber development and stress response, while in L2/L3 and L3/L4 libraries, major of the DEGs were involved in metabolism of energy and storage. All up-regulated transcriptional factors in four libraries and 14 important rhizome formation-related genes in four libraries were also identified. In addition, the expression of 9 genes from identified DEGs was performed by qRT-PCR method. In a summary, this study provides a comprehensive understanding of gene expression during the rhizome formation in lotus root. PMID:23840598

Evaluation of the arrestin gene in patients with retinitis pigmentosa or an allied disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

DeStefano, D.J.; Berson, E.L.; Dryja, T.P.

1994-09-01

Arrestin, also called 48K protein or S-antigen, plays a role in deactivating rhodopsin, the photosensitive, seven-helix, G-protein receptor found in rod photoreceptors. In Drosophila, null mutations in arrestin genes cause a light-dependent photoreceptor degeneration. It is possible that a comparable photoreceptor degeneration in humans is caused by defects in the rod arrestin gene. In order to evaluate this possibility, we are characterizing the human arrestin locus on chromosome 2q. We screened a genomic library (5 million plaques) using an arrestin cDNA clone. Sixty-eight hybridizing clones were identified; portions of 7 clones were sequenced to determine the intron sequence flanking themore » exons. We are using SSCP analysis and direct genomic sequencing to screen the entire coding region, splice donor and acceptor sites, and the promoter region of the arrestin gene in 188 patients with autosomal dominant and 104 patients with autosomal recessive retinitis pigmentosa. We have already obtained flanking intron sequences necessary for SSCP analysis for 13 of 16 exons. So far, we have identified 4 silent base changes at codons 67 (TGC-to-TGT), 107 (CTG-to-CTC), 163 (GCC-to-GCT), and 288 (CTG-to-TGT), all with allele frequencies at 1% or less. Several other variant bands detected by SSCP analysis are currently being sequenced.« less

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

PubMed Central

Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

2013-01-01

The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays

PubMed Central

Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel

2006-01-01

Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921

Developing expressed sequence tag libraries and the discovery of simple sequence repeat markers for two species of raspberry (Rubus L.)

USDA-ARS?s Scientific Manuscript database

Background: Due to a relatively high level of codominant inheritance and transferability within and among taxonomic groups, simple sequence repeat (SSR) markers are important elements in comparative mapping and delineation of genomic regions associated with traits of economic importance. Expressed S...

Development of an Expressed Sequence Tag (EST) Resource for Wheat (Triticum aestivum L.)

PubMed Central

Lazo, G. R.; Chao, S.; Hummel, D. D.; Edwards, H.; Crossman, C. C.; Lui, N.; Matthews, D. E.; Carollo, V. L.; Hane, D. L.; You, F. M.; Butler, G. E.; Miller, R. E.; Close, T. J.; Peng, J. H.; Lapitan, N. L. V.; Gustafson, J. P.; Qi, L. L.; Echalier, B.; Gill, B. S.; Dilbirligi, M.; Randhawa, H. S.; Gill, K. S.; Greene, R. A.; Sorrells, M. E.; Akhunov, E. D.; Dvořák, J.; Linkiewicz, A. M.; Dubcovsky, J.; Hossain, K. G.; Kalavacharla, V.; Kianian, S. F.; Mahmoud, A. A.; Miftahudin; Ma, X.-F.; Conley, E. J.; Anderson, J. A.; Pathan, M. S.; Nguyen, H. T.; McGuire, P. E.; Qualset, C. O.; Anderson, O. D.

2004-01-01

This report describes the rationale, approaches, organization, and resource development leading to a large-scale deletion bin map of the hexaploid (2n = 6x = 42) wheat genome (Triticum aestivum L.). Accompanying reports in this issue detail results from chromosome bin-mapping of expressed sequence tags (ESTs) representing genes onto the seven homoeologous chromosome groups and a global analysis of the entire mapped wheat EST data set. Among the resources developed were the first extensive public wheat EST collection (113,220 ESTs). Described are protocols for sequencing, sequence processing, EST nomenclature, and the assembly of ESTs into contigs. These contigs plus singletons (unassembled ESTs) were used for selection of distinct sequence motif unigenes. Selected ESTs were rearrayed, validated by 5′ and 3′ sequencing, and amplified for probing a series of wheat aneuploid and deletion stocks. Images and data for all Southern hybridizations were deposited in databases and were used by the coordinators for each of the seven homoeologous chromosome groups to validate the mapping results. Results from this project have established the foundation for future developments in wheat genomics. PMID:15514037

DSAP: deep-sequencing small RNA analysis pipeline.

PubMed

Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

2010-07-01

DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

PubMed

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Characterization of circulating transfer RNA-derived RNA fragments in cattle

PubMed Central

Casas, Eduardo; Cai, Guohong; Neill, John D.

2015-01-01

The objective was to characterize naturally occurring circulating transfer RNA-derived RNA fragments (tRFs) in cattle1. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences aligned to transfer RNA (tRNA) genes or their flanking sequences were characterized. Sequences aligned to the beginning of 5′ end of the mature tRNA were classified as tRF5; those aligned to the 3′ end of mature tRNA were classified as tRF3; and those aligned to the beginning of the 3′ end flanking sequences were classified as tRF1. There were 3,190,962 sequences that mapped to transfer RNA and small non-coding RNAs in the bovine genome. Of these, 2,323,520 were identified as tRF5s, 562 were tRF3s, and 81 were tRF1s. There were 866,799 sequences identified as other small non-coding RNAs (microRNA, rRNA, snoRNA, etc.) and were excluded from the study. The tRF5s ranged from 28 to 40 nucleotides; and 98.7% ranged from 30 to 34 nucleotides in length. The tRFs with the greatest number of sequences were derived from tRNA of histidine, glutamic acid, lysine, glycine, and valine. There was no association between number of codons for each amino acid and number of tRFs in the samples. The reason for tRF5s being the most abundant can only be explained if these sequences are associated with function within the animal. PMID:26379699

Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

USDA-ARS?s Scientific Manuscript database

The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

Digital gene expression analysis with sample multiplexing and PCR duplicate detection: A straightforward protocol.

PubMed

Rozenberg, Andrey; Leese, Florian; Weiss, Linda C; Tollrian, Ralph

2016-01-01

Tag-Seq is a high-throughput approach used for discovering SNPs and characterizing gene expression. In comparison to RNA-Seq, Tag-Seq eases data processing and allows detection of rare mRNA species using only one tag per transcript molecule. However, reduced library complexity raises the issue of PCR duplicates, which distort gene expression levels. Here we present a novel Tag-Seq protocol that uses the least biased methods for RNA library preparation combined with a novel approach for joint PCR template and sample labeling. In our protocol, input RNA is fragmented by hydrolysis, and poly(A)-bearing RNAs are selected and directly ligated to mixed DNA-RNA P5 adapters. The P5 adapters contain i5 barcodes composed of sample-specific (moderately) degenerate base regions (mDBRs), which later allow detection of PCR duplicates. The P7 adapter is attached via reverse transcription with individual i7 barcodes added during the amplification step. The resulting libraries can be sequenced on an Illumina sequencer. After sample demultiplexing and PCR duplicate removal with a free software tool we designed, the data are ready for downstream analysis. Our protocol was tested on RNA samples from predator-induced and control Daphnia microcrustaceans.

First Complete Genome Sequence of Zika Virus (Flaviviridae, Flavivirus) from an Autochthonous Transmission in Brazil.

PubMed

Cunha, Mariana Sequetin; Esposito, Danillo Lucas Alves; Rocco, Iray Maria; Maeda, Adriana Yurika; Vasami, Fernanda Gisele Silva; Nogueira, Juliana Silva; de Souza, Renato Pereira; Suzuki, Akemi; Addas-Carvalho, Marcelo; Barjas-Castro, Maria de Lourdes; Resende, Mariângela Ribeiro; Stucchi, Raquel Silveira Bello; Boin, Ilka de Fátima Santana Ferreira; Katz, Gizelda; Angerami, Rodrigo Nogueira; da Fonseca, Benedito Antonio Lopes

2016-03-03

We report here the genome sequence of Zika virus, strain ZikaSPH2015, containing all structural and nonstructural proteins flanked by the 5' and 3' untranslated region. It was isolated in São Paulo state, Brazil, in 2015, from a patient who received a blood transfusion from an asymptomatic donor at the time of donation. Copyright © 2016 Cunha et al.

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

Agouti sequence polymorphisms in coyotes, wolves and dogs suggest hybridization.

PubMed

Schmutz, Sheila M; Berryere, Thomas G; Barta, Jodi L; Reddick, Kimberley D; Schmutz, Josef K

2007-01-01

Domestic dogs have been shown to have multiple alleles of the Agouti Signal Peptide (ASIP) in exon 4 and we wished to determine the level of polymorphism in the common wild canids of Canada, wolves and coyotes, in comparison. All Canadian coyotes and most wolves have banded hairs. The ASIP coding sequence of the wolf did not vary from the domestic dog but one variant was detected in exon 4 of coyotes that did not alter the arginine at this position. Two other differences were found in the sequence flanking exon 4 of coyotes compared with the 45 dogs and 1 wolf. The coyotes also demonstrated a relatively common polymorphism in the 3' UTR sequence that could be used for population studies. One of the ASIP alleles (R96C) in domestic dogs causes a solid black coat color in homozygotes. Although some wolves are melanistic, this phenotype does not appear to be caused by this same mutation. However, one wolf, potentially a dog-wolf hybrid or descendant thereof, was heterozygous for this allele. Likewise 2 coyotes, potentially dog-coyote or wolf-coyote hybrid descendants, were heterozygous for the several polymorphisms in and flanking exon 4. We could conclude that these were coyote-dog hybrids because both were heterozygous for 2 mutations causing fawn coat color in dogs.

The Specificity of Trimming of MHC Class I-Presented Peptides in the Endoplasmic Reticulum1

PubMed Central

Hearn, Arron; York, Ian A.; Rock, Kenneth L.

2010-01-01

Aminopeptidases in the endoplasmic reticulum (ER) can cleave antigenic peptides and in so doing either create or destroy MHC class I-presented epitopes. However the specificity of this trimming process overall and of the major ER aminopeptidase ERAP1 in particular is not well understood. This issue is important because peptide trimming influences the magnitude and specificity of CD8 T cell responses. By systematically varying the N-terminal flanking sequences of peptides in a cell free biochemical system and in intact cells, we elucidated the specificity of ERAP1 and of ER trimming overall. ERAP1 can cleave after many amino acids on the N-terminus of epitope precursors but does so at markedly different rates. The specificity seen with purified ERAP1 is similar to that observed for trimming and presentation of epitopes in the ER of intact cells. We define N-terminal sequences that are favorable or unfavorable for antigen presentation in ways that are independent from the epitopes core sequence. When databases of known presented peptides were analyzed, the residues that were preferred for the trimming of model peptide precursors were found to be overrepresented in N-terminal flanking sequences of epitopes generally. These data define key determinants in the specificity of antigen processing. PMID:19828632

bpRNA: large-scale automated annotation and analysis of RNA secondary structure.

PubMed

Danaee, Padideh; Rouches, Mason; Wiley, Michelle; Deng, Dezhong; Huang, Liang; Hendrix, David

2018-05-09

While RNA secondary structure prediction from sequence data has made remarkable progress, there is a need for improved strategies for annotating the features of RNA secondary structures. Here, we present bpRNA, a novel annotation tool capable of parsing RNA structures, including complex pseudoknot-containing RNAs, to yield an objective, precise, compact, unambiguous, easily-interpretable description of all loops, stems, and pseudoknots, along with the positions, sequence, and flanking base pairs of each such structural feature. We also introduce several new informative representations of RNA structure types to improve structure visualization and interpretation. We have further used bpRNA to generate a web-accessible meta-database, 'bpRNA-1m', of over 100 000 single-molecule, known secondary structures; this is both more fully and accurately annotated and over 20-times larger than existing databases. We use a subset of the database with highly similar (≥90% identical) sequences filtered out to report on statistical trends in sequence, flanking base pairs, and length. Both the bpRNA method and the bpRNA-1m database will be valuable resources both for specific analysis of individual RNA molecules and large-scale analyses such as are useful for updating RNA energy parameters for computational thermodynamic predictions, improving machine learning models for structure prediction, and for benchmarking structure-prediction algorithms.

Stable isotope, site-specific mass tagging for protein identification

DOEpatents

Chen, Xian

2006-10-24

Proteolytic peptide mass mapping as measured by mass spectrometry provides an important method for the identification of proteins, which are usually identified by matching the measured and calculated m/z values of the proteolytic peptides. A unique identification is, however, heavily dependent upon the mass accuracy and sequence coverage of the fragment ions generated by peptide ionization. The present invention describes a method for increasing the specificity, accuracy and efficiency of the assignments of particular proteolytic peptides and consequent protein identification, by the incorporation of selected amino acid residue(s) enriched with stable isotope(s) into the protein sequence without the need for ultrahigh instrumental accuracy. Selected amino acid(s) are labeled with .sup.13C/.sup.15N/.sup.2H and incorporated into proteins in a sequence-specific manner during cell culturing. Each of these labeled amino acids carries a defined mass change encoded in its monoisotopic distribution pattern. Through their characteristic patterns, the peptides with mass tag(s) can then be readily distinguished from other peptides in mass spectra. The present method of identifying unique proteins can also be extended to protein complexes and will significantly increase data search specificity, efficiency and accuracy for protein identifications.

Isolation and mapping of telomeric pentanucleotide (TAACC)n repeats of the Pacific whiteleg shrimp, Penaeus vannamei, using fluorescence in situ hybridization.

PubMed

Alcivar-Warren, Acacia; Meehan-Meola, Dawn; Wang, Yongping; Guo, Ximing; Zhou, Linghua; Xiang, Jianhai; Moss, Shaun; Arce, Steve; Warren, William; Xu, Zhenkang; Bell, Kireina

2006-01-01

To develop genetic and physical maps for shrimp, accurate information on the actual number of chromosomes and a large number of genetic markers is needed. Previous reports have shown two different chromosome numbers for the Pacific whiteleg shrimp, Penaeus vannamei, the most important penaeid shrimp species cultured in the Western hemisphere. Preliminary results obtained by direct sequencing of clones from a Sau3A-digested genomic library of P. vannamei ovary identified a large number of (TAACC/GGTTA)-containing SSRs. The objectives of this study were to (1) examine the frequency of (TAACC)n repeats in 662 P. vannamei genomic clones that were directly sequenced, and perform homology searches of these clones, (2) confirm the number of chromosomes in testis of P. vannamei, and (3) localize the TAACC repeats in P. vannamei chromosome spreads using fluorescence in situ hybridization (FISH). Results for objective 1 showed that 395 out of the 662 clones sequenced contained single or multiple SSRs with three or more repeat motifs, 199 of which contained variable tandem repeats of the pentanucleotide (TAACC/GGTTA)n, with 3 to 14 copies per sequence. The frequency of (TAACC)n repeats in P. vannamei is 4.68 kb for SSRs with five or more repeat motifs. Sequence comparisons using the BLASTN nonredundant and expressed sequence tag (EST) databases indicated that most of the TAACC-containing clones were similar to either the core pentanucleotide repeat in PVPENTREP locus (GenBank accession no. X82619) or portions of 28S rRNA. Transposable elements (transposase for Tn1000 and reverse transcriptase family members), hypothetical or unnamed protein products, and genes of known function such as 18S and 28S rRNAs, heat shock protein 70, and thrombospondin were identified in non-TAACC-containing clones. For objective 2, the meiotic chromosome number of P. vannamei was confirmed as N = 44. For objective 3, four FISH probes (P1 to P4) containing different numbers of TAACC repeats produced positive signals on telomeres of P. vannamei chromosomes. A few chromosomes had positive signals interstitially. Probe signal strength and chromosome coverage differed in the general order of P1>P2>P3>P4, which correlated with the length of TAACC repeats within the probes: 83, 66, 35, and 30 bp, respectively, suggesting that the TAACC repeats, and not the flanking sequences, produced the TAACC signals at chromosome ends and TAACC is likely the telomere sequence for P. vannamei.

An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

PubMed

Itzhaki, H; Maxson, J M; Woodson, W R

1994-09-13

The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

Multiple tag labeling method for DNA sequencing

DOEpatents

Mathies, R.A.; Huang, X.C.; Quesada, M.A.

1995-07-25

A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

PubMed Central

de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

2000-01-01

Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

Studies of a biochemical factory: tomato trichome deep expressed sequence tag sequencing and proteomics.

PubMed

Schilmiller, Anthony L; Miner, Dennis P; Larson, Matthew; McDowell, Eric; Gang, David R; Wilkerson, Curtis; Last, Robert L

2010-07-01

Shotgun proteomics analysis allows hundreds of proteins to be identified and quantified from a single sample at relatively low cost. Extensive DNA sequence information is a prerequisite for shotgun proteomics, and it is ideal to have sequence for the organism being studied rather than from related species or accessions. While this requirement has limited the set of organisms that are candidates for this approach, next generation sequencing technologies make it feasible to obtain deep DNA sequence coverage from any organism. As part of our studies of specialized (secondary) metabolism in tomato (Solanum lycopersicum) trichomes, 454 sequencing of cDNA was combined with shotgun proteomics analyses to obtain in-depth profiles of genes and proteins expressed in leaf and stem glandular trichomes of 3-week-old plants. The expressed sequence tag and proteomics data sets combined with metabolite analysis led to the discovery and characterization of a sesquiterpene synthase that produces beta-caryophyllene and alpha-humulene from E,E-farnesyl diphosphate in trichomes of leaf but not of stem. This analysis demonstrates the utility of combining high-throughput cDNA sequencing with proteomics experiments in a target tissue. These data can be used for dissection of other biochemical processes in these specialized epidermal cells.

Studies of a Biochemical Factory: Tomato Trichome Deep Expressed Sequence Tag Sequencing and Proteomics1[W][OA

PubMed Central

Schilmiller, Anthony L.; Miner, Dennis P.; Larson, Matthew; McDowell, Eric; Gang, David R.; Wilkerson, Curtis; Last, Robert L.

2010-01-01

Shotgun proteomics analysis allows hundreds of proteins to be identified and quantified from a single sample at relatively low cost. Extensive DNA sequence information is a prerequisite for shotgun proteomics, and it is ideal to have sequence for the organism being studied rather than from related species or accessions. While this requirement has limited the set of organisms that are candidates for this approach, next generation sequencing technologies make it feasible to obtain deep DNA sequence coverage from any organism. As part of our studies of specialized (secondary) metabolism in tomato (Solanum lycopersicum) trichomes, 454 sequencing of cDNA was combined with shotgun proteomics analyses to obtain in-depth profiles of genes and proteins expressed in leaf and stem glandular trichomes of 3-week-old plants. The expressed sequence tag and proteomics data sets combined with metabolite analysis led to the discovery and characterization of a sesquiterpene synthase that produces β-caryophyllene and α-humulene from E,E-farnesyl diphosphate in trichomes of leaf but not of stem. This analysis demonstrates the utility of combining high-throughput cDNA sequencing with proteomics experiments in a target tissue. These data can be used for dissection of other biochemical processes in these specialized epidermal cells. PMID:20431087

High Throughput Biological Analysis Using Multi-bit Magnetic Digital Planar Tags

NASA Astrophysics Data System (ADS)

Hong, B.; Jeong, J.-R.; Llandro, J.; Hayward, T. J.; Ionescu, A.; Trypiniotis, T.; Mitrelias, T.; Kopper, K. P.; Steinmuller, S. J.; Bland, J. A. C.

2008-06-01

We report a new magnetic labelling technology for high-throughput biomolecular identification and DNA sequencing. Planar multi-bit magnetic tags have been designed and fabricated, which comprise a magnetic barcode formed by an ensemble of micron-sized thin film Ni80Fe20 bars encapsulated in SU8. We show that by using a globally applied magnetic field and magneto-optical Kerr microscopy the magnetic elements in the multi-bit magnetic tags can be addressed individually and encoded/decoded remotely. The critical steps needed to show the feasibility of this technology are demonstrated, including fabrication, flow transport, remote writing and reading, and successful functionalization of the tags as verified by fluorescence detection. This approach is ideal for encoding information on tags in microfluidic flow or suspension, for such applications as labelling of chemical precursors during drug synthesis and combinatorial library-based high-throughput multiplexed bioassays.

The volcanotectonic structures of Ascraeus Mons

NASA Astrophysics Data System (ADS)

Byrne, Paul; van Wyk de Vries, Benjamin; Murray, John; Troll, Valentin

2010-05-01

Ascraeus Mons is the tallest of three large volcanoes situated to the NE of the Tharsis Rise and aligned parallel to a NE-SW regional structural trend. With a vertical relief of 14.9 km and an E-W diameter of 400 km, the main shield has a convex-upward morphology and a summit plateau, whilst significantly younger lava rift aprons issue from expansive embayments on its lower flanks onto the surrounding plains. The volcano hosts several types of well-preserved surface structures, and so has served as a basis for understanding Martian volcano geodynamics. Previous studies have not incorporated the full set of structures on Ascraeus Mons, however, and have been limited by photogeological data of lower resolution than that available today. We have used a GIS of MOLA, HRSC, and CTX data to map the spatial and temporal distributions of the most pronounced structures on Ascraeus Mons — its summit calderas, flank terraces, arcuate graben, and pit craters — to develop as comprehensive an evolutionary sequence for this volcano as possible. We summarise our mapping results here. · The 55-km wide caldera complex consists of at least three NE-SW-aligned depressions, with a possible fourth caldera on the periphery. Depths range from 818 m for the shallowest caldera to 3,110 m for the deepest. Whilst most lavas on the volcano are summit-derived, even the latest flows are cut by post-caldera formation subsidence and fracturing. · Flank terraces, topographically subtle outward-verging, convex-upward structures, encircle Ascraeus Mons in an imbricate, fish-scale pattern. 142 terraces in total extend from immediately below the summit to the basal plains, but do not occur on the rift aprons. The mean circumferential length for terraces is 31.9 km, though terraces over 60 km long lie on the NW and SE flanks. · Arcuate graben crosscut the NW flanks and surrounding plains, and extend for ca. 90° concentric to the volcano. These structures vary in width from 400 m to 1,200 m, and are between 10 and 100 m deep. They are shallower and more laterally continuous than the pit troughs observed elsewhere on the flanks (described below), although pits do occur nearby, and in places are laterally contiguous with graben. · Pit craters are circular or ovoid rimless depressions, between 190 and 3,000 m in diameter and several 100s m deep, that are superposed upon the latest lavas on the volcano. Rows of pits form crater chains, whilst chains can merge to form troughs. We mapped 4,166 pits across the volcano, trending circumferential near the summit to radial low on the NE and SW flanks; here, chains and troughs coalesce to form the embayments. Caldera formation is likely the result of evacuation of an underlying magma chamber. Recent work indicates that flank terraces are compressive structures, formed by upper flank shortening of a volcano as it flexes the supporting lithosphere; flexure could also account for the arcuate graben concentric to the shield. In contrast, pit craters are probably extensional structures, formed by collapse into subsurface voids. A developmental sequence for Ascraeus Mons, therefore, needs to account for the disparate formation mechanisms proposed for these spatially coincident structures. Incorporating our findings with earlier studies of this volcano, we conclude that Ascraeus has experienced a history of rapid shield building, coeval with magma chamber evacuation, which initiated sustained lithospheric flexure and led to the formation of flank terraces and concentric graben. Main shield construction was followed by a period of repose before rift apron volcanism initiated on the lower flanks along the NE-SW regional lineament. Ultimately, the dominant tectonic regime upon the volcano's flanks changed from compressional to extensional, resulting in the development of pit craters. This model may help establish a framework for understanding the volcanotectonic histories of large shields across Mars.

The 3'-end region of the human PDGFR-β core promoter nuclease hypersensitive element forms a mixture of two unique end-insertion G-quadruplexes.

PubMed

Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou

2018-04-01

While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.

Structural and functional differences in the dio1 gene in mice with inherited type 1 deiodinase deficiency.

PubMed

Maia, A L; Berry, M J; Sabbag, R; Harney, J W; Larsen, P R

1995-08-01

The type 1 deiodinase (D1) provides the major portion of the circulating T3 in vertebrates. In C3H and certain other inbred mice, liver and kidney D1 activity is 5- to 10-fold lower than in the common phenotype, C57. The lower D1 levels are paralleled by a decreased normal-sized dio1 mRNA and hyperthyroxinemia. Low activity cosegregates with a restriction fragment length variant (RFLV) in both inbred and recombinant strains, indicating it is due to differences in the dio1 gene. The exonic structure and the deduced amino acid sequences are identical for both strains and highly homologous to that of the rat. The RFLV is due to an approximately 150-base pair expansion of repetitive sequences in the second intron of the C3H gene, but this segment does not differentially affect the transient expression of a human GH gene. The promoter and 5'-flanking regions of the C3H and C57 dio1 genes are very similar and are GC rich without TATA or CCAAT boxes. However, functional assays of 1.5-kilobase 5'-flanking dio1-CAT constructs showed 2- to 3-fold higher activity of the C57-CAT constructs. Deletion mutants showed that sequences between -705 and -162 were the cause of this. In this region, the only major difference between the two genes is a 21-base pair insert containing five CTG repeats in the C3H promoter. This difference also cosegregates with low D1 activity and the intron RFLV in four other mouse strains. The correlation of the CTG repeat insert with both in vitro and in vivo expression and the absence of other significant sequence differences in the 5'-flanking region argue that this is the major explanation for the impaired expression of the dio1 gene and the resulting hyperthyroxinemia of the C3H mouse.

Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

PubMed

Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

2016-01-01

The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

Multiple splicing defects in an intronic false exon.

PubMed

Sun, H; Chasin, L A

2000-09-01

Splice site consensus sequences alone are insufficient to dictate the recognition of real constitutive splice sites within the typically large transcripts of higher eukaryotes, and large numbers of pseudoexons flanked by pseudosplice sites with good matches to the consensus sequences can be easily designated. In an attempt to identify elements that prevent pseudoexon splicing, we have systematically altered known splicing signals, as well as immediately adjacent flanking sequences, of an arbitrarily chosen pseudoexon from intron 1 of the human hprt gene. The substitution of a 5' splice site that perfectly matches the 5' consensus combined with mutation to match the CAG/G sequence of the 3' consensus failed to get this model pseudoexon included as the central exon in a dhfr minigene context. Provision of a real 3' splice site and a consensus 5' splice site and removal of an upstream inhibitory sequence were necessary and sufficient to confer splicing on the pseudoexon. This activated context also supported the splicing of a second pseudoexon sequence containing no apparent enhancer. Thus, both the 5' splice site sequence and the polypyrimidine tract of the pseudoexon are defective despite their good agreement with the consensus. On the other hand, the pseudoexon body did not exert a negative influence on splicing. The introduction into the pseudoexon of a sequence selected for binding to ASF/SF2 or its replacement with beta-globin exon 2 only partially reversed the effect of the upstream negative element and the defective polypyrimidine tract. These results support the idea that exon-bridging enhancers are not a prerequisite for constitutive exon definition and suggest that intrinsically defective splice sites and negative elements play important roles in distinguishing the real splicing signal from the vast number of false splicing signals.

Detection of novel mutations that cause autosomal dominant retinitis pigmentosa in candidate genes by long-range PCR amplification and next-generation sequencing

PubMed Central

Dias, Miguel de Sousa; Hernan, Imma; Pascual, Beatriz; Borràs, Emma; Mañé, Begoña; Gamundi, Maria José

2013-01-01

Purpose To devise an effective method for detecting mutations in 12 genes (CA4, CRX, IMPDH1, NR2E3, RP9, PRPF3, PRPF8, PRPF31, PRPH2, RHO, RP1, and TOPORS) commonly associated with autosomal dominant retinitis pigmentosa (adRP) that account for more than 95% of known mutations. Methods We used long-range PCR (LR-PCR) amplification and next-generation sequencing (NGS) performed in a GS Junior 454 benchtop sequencing platform. Twenty LR-PCR fragments, between 3,000 and 10,000 bp, containing all coding exons and flanking regions of the 12 genes, were obtained from DNA samples of patients with adRP. Sequencing libraries were prepared with an enzymatic (Fragmentase technology) method. Results Complete coverage of the coding and flanking sequences of the 12 genes assayed was obtained with NGS, with an average sequence depth of 380× (ranging from 128× to 1,077×). Five previous known mutations in the adRP genes were detected with a sequence variation percentage between 35% and 65%. We also performed a parallel sequence analysis of four samples, three of them new patients with index adRP, in which two novel mutations were detected in RHO (p.Asn73del) and PRPF31 (p.Ile109del). Conclusions The results demonstrate that genomic LR-PCR amplification together with NGS is an effective method for analyzing individual patient samples for mutations in a monogenic heterogeneous disease such as adRP. This approach proved effective for the parallel analysis of adRP and has been introduced as routine. Additionally, this approach could be extended to other heterogeneous genetic diseases. PMID:23559859

The human tartrate-resistant acid phosphatase (TRAP): involvement of the hemin responsive elements (HRE) in transcriptional regulation.

PubMed

Fleckenstein, E C; Dirks, W G; Drexler, H G

2000-02-01

The biochemical properties and protein structure of the tartrate-resistant acid phosphatase (TRAP), an iron-containing lysosomal glycoprotein in cells of the mononuclear phagocyte system, are well known. In contrast, little is known about the physiology and genic structure of this unique enzyme. In some diseases, like hairy cell leukemia, Gaucher's disease and osteoclastoma, cytochemically detected TRAP expression is used as a disease-associated marker. In order to begin to elucidate the regulation of this gene we generated different deletion constructs of the TRAP 5'-flanking region, placed them upstream of the luciferase reporter gene and assayed them for their ability to direct luciferase expression in human 293 cells. Treatment of these cells with the iron-modulating reagents transferrin and hemin causes opposite effects on the TRAP promoter activity. Two regulatory GAGGC tandem repeat sequences (the hemin responsive elements, HRE) within the 5'-flanking region of the human TRAP gene were identified. Studies with specific HRE-deletion constructs of the human TRAP 5'-flanking region upstream of the luciferase reporter gene document the functionality of these HRE-sequences which are apparently responsible for mediating transcriptional inhibition upon exposure to hemin. In addition to the previously published functional characterization of the murine TRAP HRE motifs, these results provide the first description of a new iron/hemin-responsive transcriptional regulation in the human TRAP gene.

Chaperones in Polyglutamine Aggregation: Beyond the Q-Stretch

PubMed Central

Kuiper, E. F. E.; de Mattos, Eduardo P.; Jardim, Laura B.; Kampinga, Harm H.; Bergink, Steven

2017-01-01

Expanded polyglutamine (polyQ) stretches in at least nine unrelated proteins lead to inherited neuronal dysfunction and degeneration. The expansion size in all diseases correlates with age at onset (AO) of disease and with polyQ protein aggregation, indicating that the expanded polyQ stretch is the main driving force for the disease onset. Interestingly, there is marked interpatient variability in expansion thresholds for a given disease. Between different polyQ diseases the repeat length vs. AO also indicates the existence of modulatory effects on aggregation of the upstream and downstream amino acid sequences flanking the Q expansion. This can be either due to intrinsic modulation of aggregation by the flanking regions, or due to differential interaction with other proteins, such as the components of the cellular protein quality control network. Indeed, several lines of evidence suggest that molecular chaperones have impact on the handling of different polyQ proteins. Here, we review factors differentially influencing polyQ aggregation: the Q-stretch itself, modulatory flanking sequences, interaction partners, cleavage of polyQ-containing proteins, and post-translational modifications, with a special focus on the role of molecular chaperones. By discussing typical examples of how these factors influence aggregation, we provide more insight on the variability of AO between different diseases as well as within the same polyQ disorder, on the molecular level. PMID:28386214

PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

PubMed Central

Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

2015-01-01

The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

Expressed sequence tag (EST) analysis of two subspecies of Metarhizium anisopliae reveals a plethora of secreted proteins with potential activity in insect hosts.

PubMed

Freimoser, Florian M; Screen, Steven; Bagga, Savita; Hu, Gang; St Leger, Raymond J

2003-01-01

Expressed sequence tag (EST) libraries for Metarhizium anisopliae, the causative agent of green muscardine disease, were developed from the broad host-range pathogen Metarhizium anisopliae sf. anisopliae and the specific grasshopper pathogen, M. anisopliae sf. acridum. Approximately 1,700 5' end sequences from each subspecies were generated from cDNA libraries representing fungi grown under conditions that maximize secretion of cuticle-degrading enzymes. Both subspecies had ESTs for virtually all pathogenicity-related genes cloned to date from M. anisopliae, but many novel genes encoding potential virulence factors were also tagged. Enzymes with potential targets in the insect host included proteases, chitinases, phospholipases, lipases, esterases, phosphatases and enzymes producing toxic secondary metabolites. A diverse array of proteases composed 36 % of all M. anisopliae sf. anisopliae ESTs. Eighty percent of the ESTs that could be clustered into functional groups had significant matches (E<10(-5)) in other ascomycete fungi. These included genes reported to have specific roles in pathogens with plant or vertebrate hosts. Many of the remaining ESTs had their best BLAST match among animal, plant and bacterial sequences. These include genes with plant and microbial counterparts that produce potent antimicrobials. The abundance of transcripts discovered for different functional groups varied between the two subspecies of M. anisopliae in a manner consistent with ecological adaptations of the two pathogens. By hastening gene discovery this project has enhanced development of improved mycoinsecticides. In addition, the M. anisopliae ESTs represent a significant contribution to the extensive database of sequences from ascomycetes that are saprophytes or plant and vertebrate pathogens. Comparative analyses of these sequences is providing important information about the biology and evolutionary history of this clade.

Whale phylogeny and rapid radiation events revealed using novel retroposed elements and their flanking sequences.

PubMed

Chen, Zhuo; Xu, Shixia; Zhou, Kaiya; Yang, Guang

2011-10-27

A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future.

The interaction of polyglutamine peptides with lipid membranes is regulated by flanking sequences associated with huntingtin.

PubMed

Burke, Kathleen A; Kauffman, Karlina J; Umbaugh, C Samuel; Frey, Shelli L; Legleiter, Justin

2013-05-24

Huntington disease (HD) is caused by an expanded polyglutamine (poly(Q)) repeat near the N terminus of the huntingtin (htt) protein. Expanded poly(Q) facilitates formation of htt aggregates, eventually leading to deposition of cytoplasmic and intranuclear inclusion bodies containing htt. Flanking sequences directly adjacent to the poly(Q) domain, such as the first 17 amino acids on the N terminus (Nt17) and the polyproline (poly(P)) domain on the C-terminal side of the poly(Q) domain, heavily influence aggregation. Additionally, htt interacts with a variety of membraneous structures within the cell, and Nt17 is implicated in lipid binding. To investigate the interaction between htt exon1 and lipid membranes, a combination of in situ atomic force microscopy, Langmuir trough techniques, and vesicle permeability assays were used to directly monitor the interaction of a variety of synthetic poly(Q) peptides with different combinations of flanking sequences (KK-Q35-KK, KK-Q35-P10-KK, Nt17-Q35-KK, and Nt17-Q35-P10-KK) on model membranes and surfaces. Each peptide aggregated on mica, predominately forming extended, fibrillar aggregates. In contrast, poly(Q) peptides that lacked the Nt17 domain did not appreciably aggregate on or insert into lipid membranes. Nt17 facilitated the interaction of peptides with lipid surfaces, whereas the poly(P) region enhanced this interaction. The aggregation of Nt17-Q35-P10-KK on the lipid bilayer closely resembled that of a htt exon1 construct containing 35 repeat glutamines. Collectively, this data suggests that the Nt17 domain plays a critical role in htt binding and aggregation on lipid membranes, and this lipid/htt interaction can be further modulated by the presence of the poly(P) domain.

Relevance of sodium/glucose cotransporter-1 (SGLT1) to diabetes mellitus and obesity in dogs.

PubMed

Batchelor, D J; German, A J; Shirazi-Beechey, S P

2013-04-01

Glucose transport across the enterocyte brush border membrane by sodium/glucose cotransporter-1 (SGLT1, coded by Slc5a1) is the rate-limiting step for intestinal glucose transport. The relevance of SGLT1 expression in predisposition to diabetes mellitus and to obesity was investigated in dogs. Cultured Caco-2/TC7 cells were shown to express SGLT1 in vitro. A 2-kbp fragment of the Slc5a1 5' flanking region was cloned from canine genomic DNA, ligated into reporter gene plasmids, and shown to drive reporter gene expression in these cells above control (P < 0.001). To determine the effect of the 3 known SNPs in this region on promoter function, new promoter/reporter constructs (all permutations of these 3 SNPs) were created by site-directed mutagenesis. No significant differences in promoter function were seen, suggesting that these SNPs do not have a significant effect on the constitutive transcription of SGLT1 mRNA in dogs. A search for novel SNPs in this region in dogs was made in 2 breeds predisposed to diabetes mellitus (Samoyed and cairn terrier), 2 breeds that rarely develop diabetes (boxer and German shepherd), and 2 breeds predisposed to obesity (Labrador retriever and cocker spaniel). The Slc5a1 5' flanking region was amplified from 10 healthy individuals of each of these breeds by high-fidelity PCR with the use of breed-labeled primers and sequenced by pyrosequencing. The sequence of the Slc5a1 5' flanking region in all individuals of all breeds tested was identical. On this evidence, variations in Slc5a1 promoter sequence between dogs do not influence the pathogenesis of diabetes mellitus or obesity in these breeds. Copyright © 2013 Elsevier Inc. All rights reserved.

Whale phylogeny and rapid radiation events revealed using novel retroposed elements and their flanking sequences

PubMed Central

2011-01-01

Background A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. Results An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Conclusions Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future. PMID:22029548

Comparison of Sanger and next generation sequencing performance for genotyping Cryptosporidium isolates at the 18S rRNA and actin loci.

PubMed

Paparini, Andrea; Gofton, Alexander; Yang, Rongchang; White, Nicole; Bunce, Michael; Ryan, Una M

2015-01-01

Cryptosporidium is an important enteric pathogen that infects a wide range of humans and animals. Rapid and reliable detection and characterisation methods are essential for understanding the transmission dynamics of the parasite. Sanger sequencing, and high-throughput sequencing (HTS) on an Ion Torrent platform, were compared with each other for their sensitivity and accuracy in detecting and characterising 25 Cryptosporidium-positive human and animal faecal samples. Ion Torrent reads (n = 123,857) were obtained at both 18S rRNA and actin loci for 21 of the 25 samples. Of these, one isolate at the actin locus (Cattle 05) and three at the 18S rRNA locus (HTS 10, HTS 11 and HTS 12), suffered PCR drop-out (i.e. PCR failures) when using fusion-tagged PCR. Sanger sequences were obtained for both loci for 23 of the 25 samples and showed good agreement with Ion Torrent-based genotyping. Two samples both from pythons (SK 02 and SK 05) produced mixed 18S and actin chromatograms by Sanger sequencing but were clearly identified by Ion Torrent sequencing as C. muris. One isolate (SK 03) was typed as C. muris by Sanger sequencing but was identified as a mixed C. muris and C. tyzzeri infection by HTS. 18S rRNA Type B sequences were identified in 4/6 C. parvum isolates when deep sequenced but were undetected in Sanger sequencing. Sanger was cheaper than Ion Torrent when sequencing a small numbers of samples, but when larger numbers of samples are considered (n = 60), the costs were comparative. Fusion-tagged amplicon based approaches are a powerful way of approaching mixtures, the only draw-back being the loss of PCR efficiency on low-template samples when using primers coupled to MID tags and adaptors. Taken together these data show that HTS has excellent potential for revealing the "true" composition of species/types in a Cryptosporidium infection, but that HTS workflows need to be carefully developed to ensure sensitivity, accuracy and contamination are controlled. Copyright © 2015 Elsevier Inc. All rights reserved.

A Preliminary Study on a Specifically Expressed Arabidopsis Promotor in Vascular Bundle

NASA Astrophysics Data System (ADS)

Yun-hong, Gu; Chuan-xiao, Xie; Li-fang, Wu; Zeng-liang, Yu; Guang-yong, Qin; Yu-ping, Huo

2003-04-01

From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonatrated through transformation.

Database-independent Protein Sequencing (DiPS) Enables Full-length de Novo Protein and Antibody Sequence Determination.

PubMed

Savidor, Alon; Barzilay, Rotem; Elinger, Dalia; Yarden, Yosef; Lindzen, Moshit; Gabashvili, Alexandra; Adiv Tal, Ophir; Levin, Yishai

2017-06-01

Traditional "bottom-up" proteomic approaches use proteolytic digestion, LC-MS/MS, and database searching to elucidate peptide identities and their parent proteins. Protein sequences absent from the database cannot be identified, and even if present in the database, complete sequence coverage is rarely achieved even for the most abundant proteins in the sample. Thus, sequencing of unknown proteins such as antibodies or constituents of metaproteomes remains a challenging problem. To date, there is no available method for full-length protein sequencing, independent of a reference database, in high throughput. Here, we present Database-independent Protein Sequencing, a method for unambiguous, rapid, database-independent, full-length protein sequencing. The method is a novel combination of non-enzymatic, semi-random cleavage of the protein, LC-MS/MS analysis, peptide de novo sequencing, extraction of peptide tags, and their assembly into a consensus sequence using an algorithm named "Peptide Tag Assembler." As proof-of-concept, the method was applied to samples of three known proteins representing three size classes and to a previously un-sequenced, clinically relevant monoclonal antibody. Excluding leucine/isoleucine and glutamic acid/deamidated glutamine ambiguities, end-to-end full-length de novo sequencing was achieved with 99-100% accuracy for all benchmarking proteins and the antibody light chain. Accuracy of the sequenced antibody heavy chain, including the entire variable region, was also 100%, but there was a 23-residue gap in the constant region sequence. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Development and application of SINE multilocus and quantitative genetic markers to study oilseed rape (Brassica napus L.) crops.

PubMed

Allnutt, T R; Roper, K; Henry, C

2008-01-23

A genetic marker system based on the S1 Short Interspersed Elements (SINEs) in the important commercial crop, oilseed rape ( Brassica napus L.) has been developed. SINEs provided a successful multilocus, dominant marker system that was capable of clearly delineating winter- and spring-type crop varieties. Sixteen of 20 varieties tested showed unique profiles from the 17 polymorphic SINE markers generated. The 3' or 5' flank region of nine SINE markers were cloned, and DNA was sequenced. In addition, one putative pre-transposition SINE allele was cloned and sequenced. Two SINE flanking sequences were used to design real-time PCR assays. These quantitative SINE assays were applied to study the genetic structure of eight fields of oilseed rape crops. Studied fields were more genetically diverse than expected for the chosen loci (mean H T = 0.23). The spatial distribution of SINE marker frequencies was highly structured in some fields, suggesting locations of volunteer impurities within the crop. In one case, the assay identified a mislabeling of the crop variety. SINE markers were a useful tool for crop genetics, phylogenetics, variety identification, and purity analysis. The use and further application of quantitative, real-time PCR markers are discussed.

Identification and characterization of the highly polymorphic locus D14S739 in the Han Chinese population

PubMed Central

Shao, Chengchen; Zhang, Yaqi; Zhou, Yueqin; Zhu, Wei; Xu, Hongmei; Liu, Zhiping; Tang, Qiqun; Shen, Yiwen; Xie, Jianhui

2015-01-01

Aim To systemically select and evaluate short tandem repeats (STRs) on the chromosome 14 and obtain new STR loci as expanded genotyping markers for forensic application. Methods STRs on the chromosome 14 were filtered from Tandem Repeats Database and further selected based on their positions on the chromosome, repeat patterns of the core sequences, sequence homology of the flanking regions, and suitability of flanking regions in primer design. The STR locus with the highest heterozygosity and polymorphism information content (PIC) was selected for further analysis of genetic polymorphism, forensic parameters, and the core sequence. Results Among 26 STR loci selected as candidates, D14S739 had the highest heterozygosity (0.8691) and PIC (0.8432), and showed no deviation from the Hardy-Weinberg equilibrium. 14 alleles were observed, ranging in size from 21 to 34 tetranucleotide units in the core region of (GATA)9-18 (GACA)7-12 GACG (GACA)2 GATA. Paternity testing showed no mutations. Conclusion D14S739 is a highly informative STR locus and could be a suitable genetic marker for forensic applications in the Han Chinese population. PMID:26526885

The Bxb1 recombination system demonstrates heritable transmission of site-specific excision in Arabidopsis

PubMed Central

2012-01-01

Background The mycobacteriophage large serine recombinase Bxb1 catalyzes site-specific recombination between its corresponding attP and attB recognition sites. Previously, we and others have shown that Bxb1 has catalytic activity in various eukaryotic species including Nicotiana tabacum, Schizosaccharomyces pombe, insects and mammalian cells. Results In this work, the Bxb1 recombinase gene was transformed and constitutively expressed in Arabidopsis thaliana plants harboring a chromosomally integrated attP and attB-flanked target sequence. The Bxb1 recombinase successfully excised the target sequence in a conservative manner and the resulting recombination event was heritably transmitted to subsequent generations in the absence of the recombinase transgene. In addition, we also show that Bxb1 recombinase expressing plants can be manually crossed with att-flanked target transgenic plants to generate excised progeny. Conclusion The Bxb1 large serine recombinase performs site-specific recombination in Arabidopsis thaliana germinal tissue, producing stable lines free of unwanted DNA. The precise site-specific deletion produced by Bxb1 in planta demonstrates that this enzyme can be a useful tool for the genetic engineering of plants without selectable marker transgenes or other undesirable exogenous sequences. PMID:22436504

Spatial and Temporal Strain Distribution Along the Central Red Sea Rift - A Study of the Hamd-Jizil Basin in Saudi Arabia

NASA Astrophysics Data System (ADS)

Szymanski, E.; Stockli, D.; Johnson, P.; Kattan, F. H.; Al Shamari, A.

2006-12-01

Numerous models exploring the rupturing modes and mechanisms of continental lithosphere are based on geological evidence from the Red Sea/Gulf of Suez rift system. Individually, the Red Sea basin is the prototype for many models of orthogonal continental rifting. Despite being a classic example of continental extension, many temporal and spatial strain distribution aspects, as well as the dynamic evolution of the rift architecture of the Red Sea, remain poorly constrained. Critical data come mostly from the Gulf of Suez and the Egyptian and Yemeni margins of the Red Sea; the rift flanks in Sudan and Saudi Arabia have remained largely unstudied, leaving a large information gap along the central portions of the rift system. Improving continental lithosphere rupture models requires an absolute understanding of the timing and magnitude of strain partitioning along the full rift flank. This study focuses on the development of extensional structures, syn- extensional sedimentary deposits, and rift-related Tertiary basaltic volcanism along the central flank of the rift system in Saudi Arabia. Geo- and thermochronometric techniques are used to elucidate the evolution of inboard and outboard strain markers manifested by structurally-controlled extensional basins that parallel the trend of the main Red Sea rift. Constraints on the dynamics of rift flank deformation are achieved through the collection of thermochronometric transects that traverse both the entire Arabian shield and individual normal faults that bound inland basins. Preliminary results show inland basins as asymmetric half-grabens filled by tilted Cenozoic sedimentary strata and separated by exhumed basement fault blocks. The most prominent extensional basin is the NW-trending Hamd-Jizil basin, located north of Madinah, measuring ~200 km along strike and up to 20 km in width. The Hamd-Jizil basin is structurally characterized by two half-grabens exposing a series of syn-rift siliciclastic sedimentary sections below Tertiary basalts. In certain areas, thick basalt sequences provide basin infill and appear faulted by a younger series of normal faults. Work continues on the production of further geo- and thermochronologic data for the Tertiary basalt sequences as well as the entire rift flank region.

Generation and analysis of expressed sequence tags from a cDNA library of the fruiting body of Ganoderma lucidum

PubMed Central

2010-01-01

Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644

Genotyping variability of computationally categorized peach microsatellite markers

USDA-ARS?s Scientific Manuscript database

Numerous expressed sequence tag (EST) simple sequence repeat (SSR) primers can be easily mined out. The obstacle to develop them into usable markers is how to optimally select downsized subsets of the primers for genotyping, which accordingly reduces amplification failure and monomorphism often occu...

Development, characterization and cross species amplification of polymorphic microsatellite markers from expressed sequence tags of turmeric (Curcuma longa L.).

PubMed

Siju, S; Dhanya, K; Syamkumar, S; Sasikumar, B; Sheeja, T E; Bhat, A I; Parthasarathy, V A

2010-02-01

Expressed sequence tags (ESTs) from turmeric (Curcuma longa L.) were used for the screening of type and frequency of Class I (hypervariable) simple sequence repeats (SSRs). A total of 231 microsatellite repeats were detected from 12,593 EST sequences of turmeric after redundancy elimination. The average density of Class I SSRs accounts to one SSR per 17.96 kb of EST. Mononucleotides were the most abundant class of microsatellite repeat in turmeric ESTs followed by trinucleotides. A robust set of 17 polymorphic EST-SSRs were developed and used for evaluating 20 turmeric accessions. The number of alleles detected ranged from 3 to 8 per loci. The developed markers were also evaluated in 13 related species of C. longa confirming high rate (100%) of cross species transferability. The polymorphic microsatellite markers generated from this study could be used for genetic diversity analysis and resolving the taxonomic confusion prevailing in the genus.

Application of the High Resolution Melting analysis for genetic mapping of Sequence Tagged Site markers in narrow-leafed lupin (Lupinus angustifolius L.).

PubMed

Kamel, Katarzyna A; Kroc, Magdalena; Święcicki, Wojciech

2015-01-01

Sequence tagged site (STS) markers are valuable tools for genetic and physical mapping that can be successfully used in comparative analyses among related species. Current challenges for molecular markers genotyping in plants include the lack of fast, sensitive and inexpensive methods suitable for sequence variant detection. In contrast, high resolution melting (HRM) is a simple and high-throughput assay, which has been widely applied in sequence polymorphism identification as well as in the studies of genetic variability and genotyping. The present study is the first attempt to use the HRM analysis to genotype STS markers in narrow-leafed lupin (Lupinus angustifolius L.). The sensitivity and utility of this method was confirmed by the sequence polymorphism detection based on melting curve profiles in the parental genotypes and progeny of the narrow-leafed lupin mapping population. Application of different approaches, including amplicon size and a simulated heterozygote analysis, has allowed for successful genetic mapping of 16 new STS markers in the narrow-leafed lupin genome.

The rescue and evaluation of FLAG and HIS epitope-tagged Asia 1 type foot-and-mouth disease viruses.

PubMed

Yang, Bo; Yang, Fan; Zhang, Yan; Liu, Huanan; Jin, Ye; Cao, Weijun; Zhu, Zixiang; Zheng, Haixue; Yin, Hong

2016-02-02

The VP1 G-H loop of the foot-and-mouth disease virus (FMDV) contains the primary antigenic site, as well as an Arg-Gly-Asp (RGD) binding motif for the αv-integrin family of cell surface receptors. We anticipated that introducing a foreign epitope tag sequence downstream of the RGD motif would be tolerated by the viral capsid and would not destroy the antigenic site of FMDV. In this study, we have designed, generated, and characterized two recombinant FMDVs with a FLAG tag or histidine (HIS) inserted in the VP1 G-H loop downstream of the RGD motif +9 position. The tagged viruses were genetically stable and exhibited similar growth properties with their parental virus. What is more, the recombinant viruses rFMDV-FLAG and rFMDV-HIS showed neutralization sensitivity to FMDV type Asia1-specific mAbs, as well as to polyclonal antibodies. Additionally, the r1 values of the recombinant viruses were similar to that of the parental virus, indicating that the insertion of FLAG or HIS tag sequences downstream of the RGD motif +9 position do not eradicate the antigenic site of FMDV and do not affect its antigenicity. These results indicated that the G-H loop of Asia1 FMDV is able to effectively display the foreign epitopes, making this a potential approach for novel FMDV vaccines development. Copyright © 2015 Elsevier B.V. All rights reserved.

Cloning and Characterization of 5′ Flanking Regulatory Sequences of AhLEC1B Gene from Arachis Hypogaea L.

PubMed Central

Tang, Guiying; Xu, Pingli; Liu, Wei; Liu, Zhanji; Shan, Lei

2015-01-01

LEAFY COTYLEDON1 (LEC1) is a B subunit of Nuclear Factor Y (NF-YB) transcription factor that mainly accumulates during embryo development. We cloned the 5′ flanking regulatory sequence of AhLEC1B gene, a homolog of Arabidopsis LEC1, and analyzed its regulatory elements using online software. To identify the crucial regulatory region, we generated a series of GUS expression frameworks driven by different length promoters with 5′ terminal and/or 3′ terminal deletion. We further characterized the GUS expression patterns in the transgenic Arabidopsis lines. Our results show that both the 65bp proximal promoter region and the 52bp 5′ UTR of AhLEC1B contain the key motifs required for the essential promoting activity. Moreover, AhLEC1B is preferentially expressed in the embryo and is co-regulated by binding of its upstream genes with both positive and negative corresponding cis-regulatory elements. PMID:26426444

Varicella-zoster virus (VZV) origin of DNA replication oriS influences origin-dependent DNA replication and flanking gene transcription.

PubMed

Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M

2015-07-01

The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.

Chromosomal localization and sequence analysis of a human episomal sequence with in vitro differentiating activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boccaccio, C.; Deshatrette, J.; Meunier-Rotival, M.

1994-05-01

The genomic fragment carrying the human activator of liver function, previously described as an episome capable of inducing differentiation upon transfection into a dedifferentiated rat hepatoma cell line, was mapped on human chromosome 12q24.2-12q24.3. This chromosomal location was indistinguishable by in situ hybridization from that of the gene coding for the hepatic transcription factor HNF1. The sequence of the integrated form of the episome as well as its flanking sequences show that it is rich in retroposons. It contains a human ribosomal protein L21 processed pseudogene, one truncated L1Hs sequence, and 10 Alu repeats, which belong to different subfamilies.

Association between hMLH1 hypermethylation and JC virus (JCV) infection in human colorectal cancer (CRC).

PubMed

Vilkin, Alex; Niv, Yaron

2011-04-01

Incorporation of viral DNA may interfere with the normal sequence of human DNA bases on the genetic level or cause secondary epigenetic changes such as gene promoter methylation or histone acetylation. Colorectal cancer (CRC) is the second leading cause of cancer mortality in the USA. Chromosomal instability (CIN) was established as the key mechanism in cancer development. Later, it was found that CRC results not only from the progressive accumulation of genetic alterations but also from epigenetic changes. JC virus (JCV) is a candidate etiologic factor in sporadic CRC. It may act by stabilizing β-catenin, facilitating its entrance to the cell nucleus, initialing proliferation and cancer development. Diploid CRC cell lines transfected with JCV-containing plasmids developed CIN. This result provides direct experimental evidence for the ability of JCV T-Ag to induce CIN in the genome of colonic epithelial cells. The association of CRC hMLH1 methylation and tumor positivity for JCV was recently documented. JC virus T-Ag DNA sequences were found in 77% of CRCs and are associated with promoter methylation of multiple genes. hMLH1 was methylated in 25 out of 80 CRC patients positive for T-Ag (31%) in comparison with only one out of 11 T-Ag negative cases (9%). Thus, JCV can mediate both CIN and aberrant methylation in CRC. Like other viruses, chronic infection with JCV may induce CRC by different mechanisms which should be further investigated. Thus, gene promoter methylation induced by JCV may be an important process in CRC and the polyp-carcinoma sequence.

DNA methylation at hepatitis B viral integrants is associated with methylation at flanking human genomic sequences

PubMed Central

Watanabe, Yoshiyuki; Yamamoto, Hiroyuki; Oikawa, Ritsuko; Toyota, Minoru; Yamamoto, Masakazu; Kokudo, Norihiro; Tanaka, Shinji; Arii, Shigeki; Yotsuyanagi, Hiroshi; Koike, Kazuhiko; Itoh, Fumio

2015-01-01

Integration of DNA viruses into the human genome plays an important role in various types of tumors, including hepatitis B virus (HBV)–related hepatocellular carcinoma. However, the molecular details and clinical impact of HBV integration on either human or HBV epigenomes are unknown. Here, we show that methylation of the integrated HBV DNA is related to the methylation status of the flanking human genome. We developed a next-generation sequencing-based method for structural methylation analysis of integrated viral genomes (denoted G-NaVI). This method is a novel approach that enables enrichment of viral fragments for sequencing using unique baits based on the sequence of the HBV genome. We detected integrated HBV sequences in the genome of the PLC/PRF/5 cell line and found variable levels of methylation within the integrated HBV genomes. Allele-specific methylation analysis revealed that the HBV genome often became significantly methylated when integrated into highly methylated host sites. After integration into unmethylated human genome regions such as promoters, however, the HBV DNA remains unmethylated and may eventually play an important role in tumorigenesis. The observed dynamic changes in DNA methylation of the host and viral genomes may functionally affect the biological behavior of HBV. These findings may impact public health given that millions of people worldwide are carriers of HBV. We also believe our assay will be a powerful tool to increase our understanding of the various types of DNA virus-associated tumorigenesis. PMID:25653310

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Transcript Profile of the Response of Two Soybean Genotypes to Potassium Deficiency

PubMed Central

Hao, QingNan; Sha, AiHua; Shan, ZhiHui; Chen, LiMiao; Zhou, Rong; Zhi, HaiJian; Zhou, XinAn

2012-01-01

The macronutrient potassium (K) is essential to plant growth and development. Crop yield potential is often affected by lack of soluble K. The molecular regulation mechanism of physiological and biochemical responses to K starvation in soybean roots and shoots is not fully understood. In the present study, two soybean varieties were subjected to low-K stress conditions: a low-K-tolerant variety (You06-71) and a low-K-sensitive variety (HengChun04-11). Eight libraries were generated for analysis: 2 genotypes ×2 tissues (roots and shoots) ×2 time periods [short term (0.5 to 12 h) and long term (3 to 12 d)]. RNA derived from the roots and shoots of these two varieties across two periods (short term and long term) were sequenced and the transcriptomes were compared using high-throughput tag-sequencing. To this end, a large number of clean tags (tags used for analysis after removal of dirty tags) corresponding to distinct tags (all types of clean tags) were identified in eight libraries (L1, You06-71-root short term; L2, HengChun04-11-root short term; L3, You06-71-shoot short term; L4, HengChun04-11-shoot short term; L5, You06-71-root long term; L6, HengChun04-11-root long term; L7, You06-71-shoot long term; L8, HengChun04-11-shoot long term). All clean tags were mapped to the available soybean (Glycine max) transcript database (http://www.soybase.org). Many genes showed substantial differences in expression across the libraries. In total, 5,440 transcripts involved in 118 KEGG pathways were either up- or down-regulated. Fifteen genes were randomly selected and their expression levels were confirmed using quantitative RT-PCR. Our results provide preliminary information on the molecular mechanism of potassium absorption and transport under low-K stress conditions in different soybean tissues. PMID:22792192

Transcriptome Analysis of Gene Expression during Chinese Water Chestnut Storage Organ Formation

PubMed Central

Chen, Sainan; Wang, Yan; Yu, Meizhen; Chen, Xuehao; Li, Liangjun; Yin, Jingjing

2016-01-01

The product organ (storage organ; corm) of the Chinese water chestnut has become a very popular food in Asian countries because of its unique nutritional value. Corm formation is a complex biological process, and extensive whole genome analysis of transcripts during corm development has not been carried out. In this study, four corm libraries at different developmental stages were constructed, and gene expression was identified using a high-throughput tag sequencing technique. Approximately 4.9 million tags were sequenced, and 4,371,386, 4,372,602, 4,782,494, and 5,276,540 clean tags, including 119,676, 110,701, 100,089, and 101,239 distinct tags, respectively, were obtained after removal of low-quality tags from each library. More than 39% of the distinct tags were unambiguous and could be mapped to reference genes, while 40% were unambiguous tag-mapped genes. After mapping their functions in existing databases, a total of 11,592, 10,949, 10,585, and 7,111 genes were annotated from the B1, B2, B3, and B4 libraries, respectively. Analysis of the differentially expressed genes (DEGs) in B1/B2, B2/B3, and B3/B4 libraries showed that most of the DEGs at the B1/B2 stages were involved in carbohydrate and hormone metabolism, while the majority of DEGs were involved in energy metabolism and carbohydrate metabolism at the B2/B3 and B3/B4 stages. All of the upregulated transcription factors and 9 important genes related to product organ formation in the above four stages were also identified. The expression changes of nine of the identified DEGs were validated using a quantitative PCR approach. This study provides a comprehensive understanding of gene expression during corm formation in the Chinese water chestnut. PMID:27716802

openSputnik--a database to ESTablish comparative plant genomics using unsaturated sequence collections.

PubMed

Rudd, Stephen

2005-01-01

The public expressed sequence tag collections are continually being enriched with high-quality sequences that represent an ever-expanding range of taxonomically diverse plant species. While these sequence collections provide biased insight into the populations of expressed genes available within individual species and their associated tissues, the information is conceivably of wider relevance in a comparative context. When we consider the available expressed sequence tag (EST) collections of summer 2004, most of the major plant taxonomic clades are at least superficially represented. Investigation of the five million available plant ESTs provides a wealth of information that has applications in modelling the routes of plant genome evolution and the identification of lineage-specific genes and gene families. Over four million ESTs from over 50 distinct plant species have been collated within an EST analysis pipeline called openSputnik. The ESTs were resolved down into approximately one million unigene sequences. These have been annotated using orthology-based annotation transfer from reference plant genomes and using a variety of contemporary bioinformatics methods to assign peptide, structural and functional attributes. The openSputnik database is available at http://sputnik.btk.fi.

Stability of Tandem Repeats in the Drosophila Melanogaster HSR-Omega Nuclear RNA

PubMed Central

Hogan, N. C.; Slot, F.; Traverse, K. L.; Garbe, J. C.; Bendena, W. G.; Pardue, M. L.

1995-01-01

The Drosophila melanogaster Hsr-omega locus produces a nuclear RNA containing >5 kb of tandem repeat sequences. These repeats are unique to Hsr-omega and show concerted evolution similar to that seen with classical satellite DNAs. In D. melanogaster the monomer is ~280 bp. Sequences of 191/2 monomers differ by 8 +/- 5% (mean +/- SD), when all pairwise comparisons are considered. Differences are single nucleotide substitutions and 1-3 nucleotide deletions/insertions. Changes appear to be randomly distributed over the repeat unit. Outer repeats do not show the decrease in monomer homogeneity that might be expected if homogeneity is maintained by recombination. However, just outside the last complete repeat at each end, there are a few fragments of sequence similar to the monomer. The sequences in these flanking regions are not those predicted for sequences decaying in the absence of recombination. Instead, the fragmentation of the sequence homology suggests that flanking regions have undergone more severe disruptions, possibly during an insertion or amplification event. Hsr-omega alleles differing in the number of repeats are detected and appear to be stable over a few thousand generations; however, both increases and decreases in repeat numbers have been observed. The new alleles appear to be as stable as their predecessors. No alleles of less than ~5 kb nor more than ~16 kb of repeats were seen in any stocks examined. The evidence that there is a limit on the minimum number of repeats is consistent with the suggestion that these repeats are important in the function of the unusual Hsr-omega nuclear RNA. PMID:7540581

Single-step affinity and cost-effective purification of recombinant proteins using the Sepharose-binding lectin-tag from the mushroom Laetiporus sulphureus as fusion partner.

PubMed

Li, Xiao-Jing; Liu, Jin-Ling; Gao, Dong-Sheng; Wan, Wen-Yan; Yang, Xia; Li, Yong-Tao; Chang, Hong-Tao; Chen, Lu; Wang, Chuan-Qing; Zhao, Jun

2016-03-01

Previous research showed that a lectin from the mushroom Laetiporus sulphureus, designed LSL, bound to Sepharose and could be eluted by lactose. In this study, by taking advantage of the strong affinity of LSL-tag for Sepharose, we developed a single-step purification method for LSL-tagged fusion proteins. We utilized unmodified Sepharose-4B as a specific adsorbent and 0.2 M lactose solution as an elution buffer. Fusion proteins of LSL-tag and porcine circovirus capsid protein, designated LSL-Cap was recovered with purity of 90 ± 4%, and yield of 87 ± 3% from crude extract of recombinant Escherichia coli. To enable the remove of LSL-tag, tobacco etch virus (TEV) protease recognition sequence was placed downstream of LSL-tag in the expression vector, and LSL-tagged TEV protease, designated LSL-TEV, was also expressed in E. coli., and was recovered with purity of 82 ± 5%, and yield of 85 ± 2% from crude extract of recombinant E. coli. After digestion of LSL-tagged recombinant proteins with LSL-TEV, the LSL tag and LSL-TEV can be easily removed by passing the digested products through the Sepharose column. It is of worthy noting that the Sepharose can be reused after washing with PBS. The LSL affinity purification method enables rapid and inexpensive purification of LSL-tagged fusion proteins and scale-up production of native proteins. Copyright © 2015 Elsevier Inc. All rights reserved.

Relative ages of lava flows at Alba Patera, Mars

NASA Technical Reports Server (NTRS)

Schneeberger, Dale M.; Pieri, David C.

1987-01-01

Many large lava flows on the flanks of Alba Patera are astonishing in their volume and length. As a suite, these flows suggest tremendously voluminous and sustained eruptions, and provide dimensional boundary conditions typically a factor of 100 larger than terrestrial flows. One of the most striking features associated with Alba Patera is the large, radially oriented lava flows that exhibit a variety of flow morphologies. These include sheet flows, tube fed and tube channel flows, and undifferentiated flows. Three groups of flows were studied; flows on the northwest flank, southeast flank, and the intracaldera region. The lava flows discussed probably were erupted as a group during the same major volcanic episode as suggested by the data presented. Absolute ages are poorly constrained for both the individual flows and shield, due in part to disagreement as to which absolute age curve is representative for Mars. A relative age sequence is implied but lacks precision due to the closeness of the size frequency curves.

Cyclic flank-vent and central-vent eruption patterns

NASA Astrophysics Data System (ADS)

Takada, Akira

Many basaltic and andesitic polygenetic volcanoes have cyclic eruptive activity that alternates between a phase dominated by flank eruptions and a phase dominated by eruptions from a central vent. This paper proposes the use of time-series diagrams of eruption sites on each polygenetic volcano and intrusion distances of dikes to evaluate volcano growth, to qualitatively reconstruct the stress history within the volcano, and to predict the next eruption site. In these diagrams the position of an eruption site is represented by the distance from the center of the volcano and the clockwise azimuth from north. Time-series diagrams of Mauna Loa, Kilauea, Kliuchevskoi, Etna, Sakurajima, Fuji, Izu-Oshima, and Hekla volcanoes indicate that fissure eruption sites of these volcanoes migrated toward the center of the volcano linearly, radially, or spirally with damped oscillation, occasionally forming a hierarchy in convergence-related features. At Krafla, terminations of dikes also migrated toward the center of the volcano with time. Eruption sites of Piton de la Fournaise did not converge but oscillated around the center. After the convergence of eruption sites with time, the central eruption phase is started. The intrusion sequence of dikes is modeled, applying crack interaction theory. Variation in convergence patterns is governed by the regional stress and the magma supply. Under the condition that a balance between regional extension and magma supply is maintained, the central vent convergence time during the flank eruption phase is 1-10 years, whereas the flank vent recurrence time during the central eruption phase is greater than 100 years owing to an inferred decrease in magma supply. Under the condition that magma supply prevails over regional extension, the central vent convergence time increases, whereas the flank vent recurrence time decreases owing to inferred stress relaxation. Earthquakes of M>=6 near a volcano during the flank eruption phase extend the central vent convergence time. Earthquakes during the central eruption phase promote recurrence of flank eruptions. Asymmetric distribution of eruption sites around the flanks of a volcano can be caused by local stress sources such as an adjacent volcano.

Analysis of ER Resident Proteins in S. cerevisiae: Implementation of H/KDEL Retrieval Sequences

PubMed Central

Young, Carissa L.; Raden, David L.; Robinson, Anne S.

2013-01-01

An elaborate quality control system regulates ER homeostasis by ensuring the fidelity of protein synthesis and maturation. In budding yeast, genomic analyses and high-throughput proteomic studies have identified ER resident proteins that restore homeostasis following local perturbations. Yet, how these folding factors modulate stress has been largely unexplored. In this study, we designed a series of PCR-based modules including codon-optimized epitopes and FP variants complete with C-terminal H/KDEL retrieval motifs. These conserved sequences are inherent to most soluble ER resident proteins. To monitor multiple proteins simultaneously, H/KDEL cassettes are available with six different selection markers, providing optimal flexibility for live-cell imaging and multicolor labeling in vivo. A single pair of PCR primers can be used for the amplification of these 26 modules, enabling numerous combinations of tags and selection markers. The versatility of pCY H/KDEL cassettes was demonstrated by labeling BiP/Kar2p, Pdi1p, and Scj1p with all novel tags, thus providing a direct comparison among FP variants. Furthermore, to advance in vitro studies of yeast ER proteins, Strep-tag II was engineered with a C-terminal retrieval sequence. Here, an efficient purification strategy was established for BiP under physiological conditions. PMID:23324027

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Monitoring Arthrobacter protophormiae RKJ100 in a 'tag and chase' method during p-nitrophenol bio-remediation in soil microcosms.

PubMed

Pandey, Gunjan; Pandey, Janmejay; Jain, Rakesh K

2006-05-01

Monitoring of micro-organisms released deliberately into the environment is essential to assess their movement during the bio-remediation process. During the last few years, DNA-based genetic methods have emerged as the preferred method for such monitoring; however, their use is restricted in cases where organisms used for bio-remediation are not well characterized or where the public domain databases do not provide sufficient information regarding their sequence. For monitoring of such micro-organisms, alternate approaches have to be undertaken. In this study, we have specifically monitored a p-nitrophenol (PNP)-degrading organism, Arthrobacter protophormiae RKJ100, using molecular methods during PNP degradation in soil microcosm. Cells were tagged with a transposon-based foreign DNA sequence prior to their introduction into PNP-contaminated microcosms. Later, this artificially introduced DNA sequence was PCR-amplified to distinguish the bio-augmented organism from the indigenous microflora during PNP bio-remediation.

Distorted Immunodominance by Linker Sequences or other Epitopes from a Second Protein Antigen During Antigen-Processing

PubMed Central

Kim, AeRyon; Boronina, Tatiana N.; Cole, Robert N.; Darrah, Erika; Sadegh-Nasseri, Scheherazade

2017-01-01

The immune system focuses on and responds to very few representative immunodominant epitopes from pathogenic insults. However, due to the complexity of the antigen processing, understanding the parameters that lead to immunodominance has proved difficult. In an attempt to uncover the determinants of immunodominance among several dominant epitopes, we utilized a cell free antigen processing system and allowed the system to identify the hierarchies among potential determinants. We then tested the results in vivo; in mice and in human. We report here, that immunodominance of known sequences in a given protein can change if two or more proteins are being processed and presented simultaneously. Surprisingly, we find that new spacer/tag sequences commonly added to proteins for purification purposes can distort the capture of the physiological immunodominant epitopes. We warn against adding tags and spacers to candidate vaccines, or recommend cleaving it off before using for vaccination. PMID:28422163

ScanRanker: Quality Assessment of Tandem Mass Spectra via Sequence Tagging

PubMed Central

Ma, Ze-Qiang; Chambers, Matthew C.; Ham, Amy-Joan L.; Cheek, Kristin L.; Whitwell, Corbin W.; Aerni, Hans-Rudolf; Schilling, Birgit; Miller, Aaron W.; Caprioli, Richard M.; Tabb, David L.

2011-01-01

In shotgun proteomics, protein identification by tandem mass spectrometry relies on bioinformatics tools. Despite recent improvements in identification algorithms, a significant number of high quality spectra remain unidentified for various reasons. Here we present ScanRanker, an open-source tool that evaluates the quality of tandem mass spectra via sequence tagging with reliable performance in data from different instruments. The superior performance of ScanRanker enables it not only to find unassigned high quality spectra that evade identification through database search, but also to select spectra for de novo sequencing and cross-linking analysis. In addition, we demonstrate that the distribution of ScanRanker scores predicts the richness of identifiable spectra among multiple LC-MS/MS runs in an experiment, and ScanRanker scores assist the process of peptide assignment validation to increase confident spectrum identifications. The source code and executable versions of ScanRanker are available from http://fenchurch.mc.vanderbilt.edu. PMID:21520941

Distant sequences determine 5′ end formation of cox3 transcripts in Arabidopsis thaliana ecotype C24

PubMed Central

Forner, Joachim; Weber, Bärbel; Wiethölter, Caterina; Meyer, Rhonda C.; Binder, Stefan

2005-01-01

The genomic environments and the transcripts of the mitochondrial cox3 gene are investigated in three Arabidopsis thaliana ecotypes. While the proximate 5′ sequences up to nucleotide position −584, the coding regions and the 3′ flanking regions are identical in Columbia (Col), C24 and Landsberg erecta (Ler), genomic variation is detected in regions further upstream. In the mitochondrial DNA of Col, a 1790 bp fragment flanked by a nonanucleotide direct repeat is present beyond position −584 with respect to the ATG. While in Ler only part of this insertion is conserved, this sequence is completely absent in C24, except for a single copy of the nonanucleotide direct repeat. Northern hybridization reveals identical major transcripts in the three ecotypes, but identifies an additional abundant 60 nt larger mRNA species in C24. The extremities of the most abundant mRNA species are identical in the three ecotypes. In C24, an extra major 5′ end is abundant. This terminus and the other major 5′ ends are located in identical sequence regions. Inspection of Atcox3 transcripts in C24/Col hybrids revealed a female inheritance of the mRNA species with the extra 5′ terminus. Thus, a mitochondrially encoded factor determines the generation of an extra 5′ mRNA end. PMID:16107557

Molecular dynamics simulations of certain RGD-based peptides from Kistrin provide insight into the higher activity of REI-RGD34 protein at higher temperature.

PubMed

Upadhyay, Sanjay K

2014-05-01

To determine the bioactive conformation required to bind with receptor aIIbb3, the peptide sequence RIPRGDMP from Kistrin was inserted into CDR 1 loop region of REI protein, resulting in REI-RGD34. The activity of REI-RGD34 was observed to increase at higher temperature towards the receptor aIIbb3. It could be justified in either way: the modified complex forces the restricted peptide to adapt bioactive conformation or it unfolds the peptide in a way that opens its binding surface with high affinity for receptor. Here, we model the conformational preference of RGD sequence in RIPRGDMP at 25 and 42 °C using multiple MD simulations. Further, we model the peptide sequence RGD, PRGD and PRGDMP from kistrin to observe the effect of flanking residues on conformational sampling of RGD. The presence of flanking residues around RGD peptide greatly influenced the conformational sampling. A transition from bend to turn conformation was observed for RGD sequence at 42 °C. The turn conformation shows pharmacophoric parameters required to recognize the receptor aIIbb3. Thus, the temperaturedependent activity of RIPRGDMP when inserted into the loop region of REI can be explained by the presence of the turn conformation. This study will help in designing potential antagonist for the receptor aIIbb3.

Analyses of Expressed Sequence Tags from Apple1

PubMed Central

Newcomb, Richard D.; Crowhurst, Ross N.; Gleave, Andrew P.; Rikkerink, Erik H.A.; Allan, Andrew C.; Beuning, Lesley L.; Bowen, Judith H.; Gera, Emma; Jamieson, Kim R.; Janssen, Bart J.; Laing, William A.; McArtney, Steve; Nain, Bhawana; Ross, Gavin S.; Snowden, Kimberley C.; Souleyre, Edwige J.F.; Walton, Eric F.; Yauk, Yar-Khing

2006-01-01

The domestic apple (Malus domestica; also known as Malus pumila Mill.) has become a model fruit crop in which to study commercial traits such as disease and pest resistance, grafting, and flavor and health compound biosynthesis. To speed the discovery of genes involved in these traits, develop markers to map genes, and breed new cultivars, we have produced a substantial expressed sequence tag collection from various tissues of apple, focusing on fruit tissues of the cultivar Royal Gala. Over 150,000 expressed sequence tags have been collected from 43 different cDNA libraries representing 34 different tissues and treatments. Clustering of these sequences results in a set of 42,938 nonredundant sequences comprising 17,460 tentative contigs and 25,478 singletons, together representing what we predict are approximately one-half the expressed genes from apple. Many potential molecular markers are abundant in the apple transcripts. Dinucleotide repeats are found in 4,018 nonredundant sequences, mainly in the 5′-untranslated region of the gene, with a bias toward one repeat type (containing AG, 88%) and against another (repeats containing CG, 0.1%). Trinucleotide repeats are most common in the predicted coding regions and do not show a similar degree of sequence bias in their representation. Bi-allelic single-nucleotide polymorphisms are highly abundant with one found, on average, every 706 bp of transcribed DNA. Predictions of the numbers of representatives from protein families indicate the presence of many genes involved in disease resistance and the biosynthesis of flavor and health-associated compounds. Comparisons of some of these gene families with Arabidopsis (Arabidopsis thaliana) suggest instances where there have been duplications in the lineages leading to apple of biosynthetic and regulatory genes that are expressed in fruit. This resource paves the way for a concerted functional genomics effort in this important temperate fruit crop. PMID:16531485

Sequencing degraded DNA from non-destructively sampled museum specimens for RAD-tagging and low-coverage shotgun phylogenetics.

PubMed

Tin, Mandy Man-Ying; Economo, Evan Philip; Mikheyev, Alexander Sergeyevich

2014-01-01

Ancient and archival DNA samples are valuable resources for the study of diverse historical processes. In particular, museum specimens provide access to biotas distant in time and space, and can provide insights into ecological and evolutionary changes over time. However, archival specimens are difficult to handle; they are often fragile and irreplaceable, and typically contain only short segments of denatured DNA. Here we present a set of tools for processing such samples for state-of-the-art genetic analysis. First, we report a protocol for minimally destructive DNA extraction of insect museum specimens, which produced sequenceable DNA from all of the samples assayed. The 11 specimens analyzed had fragmented DNA, rarely exceeding 100 bp in length, and could not be amplified by conventional PCR targeting the mitochondrial cytochrome oxidase I gene. Our approach made these samples amenable to analysis with commonly used next-generation sequencing-based molecular analytic tools, including RAD-tagging and shotgun genome re-sequencing. First, we used museum ant specimens from three species, each with its own reference genome, for RAD-tag mapping. Were able to use the degraded DNA sequences, which were sequenced in full, to identify duplicate reads and filter them prior to base calling. Second, we re-sequenced six Hawaiian Drosophila species, with millions of years of divergence, but with only a single available reference genome. Despite a shallow coverage of 0.37 ± 0.42 per base, we could recover a sufficient number of overlapping SNPs to fully resolve the species tree, which was consistent with earlier karyotypic studies, and previous molecular studies, at least in the regions of the tree that these studies could resolve. Although developed for use with degraded DNA, all of these techniques are readily applicable to more recent tissue, and are suitable for liquid handling automation.

The bovine lactation genome: Insights into the evolution of mammalian milk

USDA-ARS?s Scientific Manuscript database

The newly assembled Bos Taurus genome sequence enables the linkage of bovine milk and lactation data with other mammalian genomes. Using publicly available milk proteome data and mammary expressed sequence tags, 197 milk protein genes and over 6,000 mammary genes were identified in the bovine genome...

Differential transferability of EST-SSR primers developed from diploid species Pseudoroegneria spicata, Thinopyrum bessarabicum, and Th. elongatum

USDA-ARS?s Scientific Manuscript database

Simple sequence repeat technology based on expressed sequence tag (EST-SSR) is a useful genomic tool for genome mapping, characterizing plant species relationships, elucidating genome evolution, and tracing genes on alien chromosome segments. EST-SSR primers developed from three perennial diploid T...

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

PubMed

Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

2016-06-01

As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

Characteristics of the Lotus japonicus gene repertoire deduced from large-scale expressed sequence tag (EST) analysis.

PubMed

Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi

2004-02-01

To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.

Scar-less multi-part DNA assembly design automation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hillson, Nathan J.

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

Programmable polyproteams built using twin peptide superglues

PubMed Central

Veggiani, Gianluca; Nakamura, Tomohiko; Brenner, Michael D.; Yan, Jun; Robinson, Carol V.; Howarth, Mark

2016-01-01

Programmed connection of amino acids or nucleotides into chains introduced a revolution in control of biological function. Reacting proteins together is more complex because of the number of reactive groups and delicate stability. Here we achieved sequence-programmed irreversible connection of protein units, forming polyprotein teams by sequential amidation and transamidation. SpyTag peptide is engineered to spontaneously form an isopeptide bond with SpyCatcher protein. By engineering the adhesin RrgA from Streptococcus pneumoniae, we developed the peptide SnoopTag, which formed a spontaneous isopeptide bond to its protein partner SnoopCatcher with >99% yield and no cross-reaction to SpyTag/SpyCatcher. Solid-phase attachment followed by sequential SpyTag or SnoopTag reaction between building-blocks enabled iterative extension. Linear, branched, and combinatorial polyproteins were synthesized, identifying optimal combinations of ligands against death receptors and growth factor receptors for cancer cell death signal activation. This simple and modular route to programmable “polyproteams” should enable exploration of a new area of biological space. PMID:26787909

Programmable polyproteams built using twin peptide superglues.

PubMed

Veggiani, Gianluca; Nakamura, Tomohiko; Brenner, Michael D; Gayet, Raphaël V; Yan, Jun; Robinson, Carol V; Howarth, Mark

2016-02-02

Programmed connection of amino acids or nucleotides into chains introduced a revolution in control of biological function. Reacting proteins together is more complex because of the number of reactive groups and delicate stability. Here we achieved sequence-programmed irreversible connection of protein units, forming polyprotein teams by sequential amidation and transamidation. SpyTag peptide is engineered to spontaneously form an isopeptide bond with SpyCatcher protein. By engineering the adhesin RrgA from Streptococcus pneumoniae, we developed the peptide SnoopTag, which formed a spontaneous isopeptide bond to its protein partner SnoopCatcher with >99% yield and no cross-reaction to SpyTag/SpyCatcher. Solid-phase attachment followed by sequential SpyTag or SnoopTag reaction between building-blocks enabled iterative extension. Linear, branched, and combinatorial polyproteins were synthesized, identifying optimal combinations of ligands against death receptors and growth factor receptors for cancer cell death signal activation. This simple and modular route to programmable "polyproteams" should enable exploration of a new area of biological space.

Molecular epidemiology of infectious laryngotracheitis: a review

USDA-ARS?s Scientific Manuscript database

Falconid herpesvirus type 1 (FHV-1) is the causative agent of falcon inclusion body disease, an acute, highly contagious disease of raptors. The complete nucleotide sequence of the genome of FHV-1 has been determined. The genome is arranged as a D-type genome with large inverted repeats flanking a ...

PRIMARY STRUCTURE OF THE P450 LANOSTEROL DEMETHYLASE GENE FROM SACCHAROMYCES CEREVISIAE

EPA Science Inventory

We have sequenced the structural gene and flanking regions for lanosterol 14 alpha-demethylase (14DM) from Saccharomyces cerevisiae. An open reading frame of 530 codons encodes a 60.7-kDa protein. When this gene is disrupted by integrative transformation, the resulting strain req...

Refined mapping and YAC contig construction of the X-linked cleft palate and ankyloglossia locus (CPX) including the proximal X-Y homology breakpoint within Xq21.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Forbes, S.A.; Brennan, L.; Richardson, M.

1996-01-01

The gene for X-linked cleft palate (CPX) has previously been mapped in an Icelandic kindred between the unordered proximal markers DXS1002/DXS349/DXS95 and the distal marker DXYS1X, which maps to the proximal end of the X-Y homology region in Xq21.3. Using six sequence-tagged sites (STSs) within the region, a total of 91 yeast artificial chromosome (YAC) clones were isolated and overlapped in a single contig that spans approximately 3.1 Mb between DXS1002 and DXYS1X. The order of microsatellite and STS markers in this was established as DXS1002-DXS1168-DXS349-DXS95-DXS364-DXS1196-DXS472-DXS1217-DXYS1X. A long-range restriction map of this region was created using eight nonchimeric, overlapping YACmore » clones. Analysis of newly positioned polymorphic markers in recombinant individuals from the Icelandic family has enabled us to identify DXS1196 and DXS1217 as the flanking markers for CPX. The maximum physical distance containing the CPX gene has been estimated to be 2.0 Mb, which is spanned by a minimum set of five nonchimeric YAC clones. In addition, YAC end clone and STS analyses have pinpointed the location of the proximal boundary of the X-Y homology region within the map. 40 refs., 2 figs., 2 tabs.« less

Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

PubMed

Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

2016-01-01

In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. © 2015 John Wiley & Sons Ltd.

The application of new software tools to quantitative protein profiling via isotope-coded affinity tag (ICAT) and tandem mass spectrometry: I. Statistically annotated datasets for peptide sequences and proteins identified via the application of ICAT and tandem mass spectrometry to proteins copurifying with T cell lipid rafts.

PubMed

von Haller, Priska D; Yi, Eugene; Donohoe, Samuel; Vaughn, Kelly; Keller, Andrew; Nesvizhskii, Alexey I; Eng, Jimmy; Li, Xiao-jun; Goodlett, David R; Aebersold, Ruedi; Watts, Julian D

2003-07-01

Lipid rafts were prepared according to standard protocols from Jurkat T cells stimulated via T cell receptor/CD28 cross-linking and from control (unstimulated) cells. Co-isolating proteins from the control and stimulated cell preparations were labeled with isotopically normal (d0) and heavy (d8) versions of the same isotope-coded affinity tag (ICAT) reagent, respectively. Samples were combined, proteolyzed, and resultant peptides fractionated via cation exchange chromatography. Cysteine-containing (ICAT-labeled) peptides were recovered via the biotin tag component of the ICAT reagents by avidin-affinity chromatography. On-line micro-capillary liquid chromatography tandem mass spectrometry was performed on both avidin-affinity (ICAT-labeled) and flow-through (unlabeled) fractions. Initial peptide sequence identification was by searching recorded tandem mass spectrometry spectra against a human sequence data base using SEQUEST software. New statistical data modeling algorithms were then applied to the SEQUEST search results. These allowed for discrimination between likely "correct" and "incorrect" peptide assignments, and from these the inferred proteins that they collectively represented, by calculating estimated probabilities that each peptide assignment and subsequent protein identification was a member of the "correct" population. For convenience, the resultant lists of peptide sequences assigned and the proteins to which they corresponded were filtered at an arbitrarily set cut-off of 0.5 (i.e. 50% likely to be "correct") and above and compiled into two separate datasets. In total, these data sets contained 7667 individual peptide identifications, which represented 2669 unique peptide sequences, corresponding to 685 proteins and related protein groups.

Tissue-specific expression of human CD4 in transgenic mice.

PubMed Central

Gillespie, F P; Doros, L; Vitale, J; Blackwell, C; Gosselin, J; Snyder, B W; Wadsworth, S C

1993-01-01

The gene for the human CD4 glycoprotein, which serves as the receptor for human immunodeficiency virus type 1, along with approximately 23 kb of sequence upstream of the translational start site, was cloned. The ability of 5' flanking sequences to direct tissue-specific expression was tested in cell culture and in transgenic mice. A 5' flanking region of 6 kb was able to direct transcription of the CD4 gene in NIH 3T3 cells but did not result in detectable expression in the murine T-cell line EL4 or in four lines of transgenic mice. A larger 5' flanking region of approximately 23 kb directed high-level CD4 transcription in the murine T-cell line EL4 and in three independent lines of transgenic mice. Human CD4 expression in all tissues analyzed was tightly correlated with murine CD4 expression; the highest levels of human CD4 RNA expression were found in the thymus and spleen, with relatively low levels detected in other tissues. Expression of human CD4 protein in peripheral blood mononuclear cells was examined by flow cytometry in these transgenic animals and found to be restricted to the murine CD4+ subset of lymphocytes. Human CD4 protein, detected with an anti-human CD4 monoclonal antibody, was present on the surface of 45 to 50% of the peripheral blood mononuclear cells from all transgenic lines. Images PMID:8474453

Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips.

PubMed

Rotenberg, D; Whitfield, A E

2010-08-01

Thrips are members of the insect order Thysanoptera and Frankliniella occidentalis (the western flower thrips) is the most economically important pest within this order. F. occidentalis is both a direct pest of crops and an efficient vector of plant viruses, including Tomato spotted wilt virus (TSWV). Despite the world-wide importance of thrips in agriculture, there is little knowledge of the F. occidentalis genome or gene functions at this time. A normalized cDNA library was constructed from first instar thrips and 13 839 expressed sequence tags (ESTs) were obtained. Our EST data assembled into 894 contigs and 11 806 singletons (12 700 nonredundant sequences). We found that 31% of these sequences had significant similarity (E< or = 10(-10)) to protein sequences in the National Center for Biotechnology Information nonredundant (nr) protein database, and 25% were functionally annotated using Blast 2GO. We identified 74 sequences with putative homology to proteins associated with insect innate immunity. Sixteen sequences had significant similarity to proteins associated with small RNA-mediated gene silencing pathways (RNA interference; RNAi), including the antiviral pathway (short interfering RNA-mediated pathway). Our EST collection provides new sequence resources for characterizing gene functions in F. occidentalis and other thrips species with regards to vital biological processes, studying the mechanism of interactions with the viruses harboured and transmitted by the vector, and identifying new insect gene-centred targets for plant disease and insect control.

Survey of duckweed diversity in Lake Chao and total fatty acid, triacylglycerol, profiles of representative strains.

PubMed

Tang, J; Li, Y; Ma, J; Cheng, J J

2015-09-01

Lemnaceae (duckweeds) are widely distributed aquatic flowering plants. Their high growth rate, starch content and suitability for bioremediation make them potential feedstock for biofuels. However, few natural duckweed resources have been investigated in China, and there is no information about total fatty acid (TFA) and triacylglycerol (TAG) composition of duckweeds from China. Here, the genetic diversity of a natural duckweed population collected from Lake Chao, China, was investigated using multilocus sequence typing (MLST). The 54 strains were categorised into four species in four genera, representing 12 distinct sequence types. Strains representing Lemna aequinoctialis and Spirodela polyrhiza were predominant. Interestingly, a surprisingly high degree of genetic diversification within L. aequinoctialis was observed. The four duckweed species revealed a uniform fatty acid composition, with three fatty acids, palmitic acid, linoleic acid and linolenic acid, accounting for more than 80% of the TFA. The TFA in biomass varied among species, ranging from 1.05% (of dry weight, DW) for L. punctata and S. polyrhiza to 1.62% for Wolffia globosa. The four duckweed species contained similar TAG contents, 0.02% mg · DW(-1). The fatty acid profiles of TAG were different from those of TFA, and also varied among the four species. The survey investigated the genetic diversity of duckweeds from Lake Chao, and provides an initial insight into TFA and TAG of four duckweed species, indicating that intraspecific and interspecific variations exist in the content and composition of both TFA and TAG in comparison with other studies. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.

In-plane "superresolution" MRI with phaseless sub-pixel encoding.

PubMed

Hennel, Franciszek; Tian, Rui; Engel, Maria; Pruessmann, Klaas P

2018-04-15

Acquisition of high-resolution imaging data using multiple excitations without the sensitivity to fluctuations of the transverse magnetization phase, which is a major problem of multi-shot MRI. The concept of superresolution MRI based on microscopic tagging is analyzed using an analogy with the optical method of structured illumination. Sinusoidal tagging is shown to provide subpixel resolution by mixing of neighboring spatial frequency (k-space) bands. It represents a phaseless modulation added on top of the standard Fourier encoding, which allows the phase fluctuations to be discarded at an intermediate reconstruction step. Improvements are proposed to correct for tag distortions due to magnetic field inhomogeneity and to avoid the propagation of Gibbs ringing from intermediate low-resolution images to the final image. The method was applied to diffusion-weighted EPI. Artifact-free superresolution images can be obtained despite a finite duration of the tagging sequence and related pattern distortions by a field map based phase correction of band-wise reconstructed images. The ringing effect present in the intermediate images can be suppressed by partial overlapping of the mixed k-space bands in combination with an adapted filter. High-resolution diffusion-weighted images of the human head were obtained with a three-shot EPI sequence despite motion-related phase fluctuations between the shots. Due to its phaseless character, tagging-based sub-pixel encoding is an alternative to k-space segmenting in the presence of unknown phase fluctuations, in particular those due to motion under strong diffusion gradients. Proposed improvements render the method practicable in realistic conditions. © 2018 International Society for Magnetic Resonance in Medicine.

Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation.

PubMed

Rowland, Lisa J; Alkharouf, Nadim; Darwish, Omar; Ogden, Elizabeth L; Polashock, James J; Bassil, Nahla V; Main, Dorrie

2012-04-02

There has been increased consumption of blueberries in recent years fueled in part because of their many recognized health benefits. Blueberry fruit is very high in anthocyanins, which have been linked to improved night vision, prevention of macular degeneration, anti-cancer activity, and reduced risk of heart disease. Very few genomic resources have been available for blueberry, however. Further development of genomic resources like expressed sequence tags (ESTs), molecular markers, and genetic linkage maps could lead to more rapid genetic improvement. Marker-assisted selection could be used to combine traits for climatic adaptation with fruit and nutritional quality traits. Efforts to sequence the transcriptome of the commercial highbush blueberry (Vaccinium corymbosum) cultivar Bluecrop and use the sequences to identify genes associated with cold acclimation and fruit development and develop SSR markers for mapping studies are presented here. Transcriptome sequences were generated from blueberry fruit at different stages of development, flower buds at different stages of cold acclimation, and leaves by next-generation Roche 454 sequencing. Over 600,000 reads were assembled into approximately 15,000 contigs and 124,000 singletons. The assembled sequences were annotated and functionally mapped to Gene Ontology (GO) terms. Frequency of the most abundant sequences in each of the libraries was compared across all libraries to identify genes that are potentially differentially expressed during cold acclimation and fruit development. Real-time PCR was performed to confirm their differential expression patterns. Overall, 14 out of 17 of the genes examined had differential expression patterns similar to what was predicted from their reads alone. The assembled sequences were also mined for SSRs. From these sequences, 15,886 blueberry EST-SSR loci were identified. Primers were designed from 7,705 of the SSR-containing sequences with adequate flanking sequence. One hundred primer pairs were tested for amplification and polymorphism among parents of two blueberry populations currently being used for genetic linkage map construction. The tetraploid mapping population was based on a cross between the highbush cultivars Draper and Jewel (V. darrowii is also in the background of 'Jewel'). The diploid mapping population was based on a cross between an F1 hybrid of V. darrowii and diploid V. corymbosum and another diploid V. corymbosum. The overall amplification rate of the SSR primers was 68% and the polymorphism rate was 43%. These results indicate that this large collection of 454 ESTs will be a valuable resource for identifying genes that are potentially differentially expressed and play important roles in flower bud development, cold acclimation, chilling unit accumulation, and fruit development in blueberry and related species. In addition, the ESTs have already proved useful for the development of SSR and EST-PCR markers, and are currently being used for construction of genetic linkage maps in blueberry.

Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation

PubMed Central

2012-01-01

Background There has been increased consumption of blueberries in recent years fueled in part because of their many recognized health benefits. Blueberry fruit is very high in anthocyanins, which have been linked to improved night vision, prevention of macular degeneration, anti-cancer activity, and reduced risk of heart disease. Very few genomic resources have been available for blueberry, however. Further development of genomic resources like expressed sequence tags (ESTs), molecular markers, and genetic linkage maps could lead to more rapid genetic improvement. Marker-assisted selection could be used to combine traits for climatic adaptation with fruit and nutritional quality traits. Results Efforts to sequence the transcriptome of the commercial highbush blueberry (Vaccinium corymbosum) cultivar Bluecrop and use the sequences to identify genes associated with cold acclimation and fruit development and develop SSR markers for mapping studies are presented here. Transcriptome sequences were generated from blueberry fruit at different stages of development, flower buds at different stages of cold acclimation, and leaves by next-generation Roche 454 sequencing. Over 600,000 reads were assembled into approximately 15,000 contigs and 124,000 singletons. The assembled sequences were annotated and functionally mapped to Gene Ontology (GO) terms. Frequency of the most abundant sequences in each of the libraries was compared across all libraries to identify genes that are potentially differentially expressed during cold acclimation and fruit development. Real-time PCR was performed to confirm their differential expression patterns. Overall, 14 out of 17 of the genes examined had differential expression patterns similar to what was predicted from their reads alone. The assembled sequences were also mined for SSRs. From these sequences, 15,886 blueberry EST-SSR loci were identified. Primers were designed from 7,705 of the SSR-containing sequences with adequate flanking sequence. One hundred primer pairs were tested for amplification and polymorphism among parents of two blueberry populations currently being used for genetic linkage map construction. The tetraploid mapping population was based on a cross between the highbush cultivars Draper and Jewel (V. darrowii is also in the background of 'Jewel'). The diploid mapping population was based on a cross between an F1 hybrid of V. darrowii and diploid V. corymbosum and another diploid V. corymbosum. The overall amplification rate of the SSR primers was 68% and the polymorphism rate was 43%. Conclusions These results indicate that this large collection of 454 ESTs will be a valuable resource for identifying genes that are potentially differentially expressed and play important roles in flower bud development, cold acclimation, chilling unit accumulation, and fruit development in blueberry and related species. In addition, the ESTs have already proved useful for the development of SSR and EST-PCR markers, and are currently being used for construction of genetic linkage maps in blueberry. PMID:22471859

hSAGEing: an improved SAGE-based software for identification of human tissue-specific or common tumor markers and suppressors.

PubMed

Yang, Cheng-Hong; Chuang, Li-Yeh; Shih, Tsung-Mu; Chang, Hsueh-Wei

2010-12-17

SAGE (serial analysis of gene expression) is a powerful method of analyzing gene expression for the entire transcriptome. There are currently many well-developed SAGE tools. However, the cross-comparison of different tissues is seldom addressed, thus limiting the identification of common- and tissue-specific tumor markers. To improve the SAGE mining methods, we propose a novel function for cross-tissue comparison of SAGE data by combining the mathematical set theory and logic with a unique "multi-pool method" that analyzes multiple pools of pair-wise case controls individually. When all the settings are in "inclusion", the common SAGE tag sequences are mined. When one tissue type is in "inclusion" and the other types of tissues are not in "inclusion", the selected tissue-specific SAGE tag sequences are generated. They are displayed in tags-per-million (TPM) and fold values, as well as visually displayed in four kinds of scales in a color gradient pattern. In the fold visualization display, the top scores of the SAGE tag sequences are provided, along with cluster plots. A user-defined matrix file is designed for cross-tissue comparison by selecting libraries from publically available databases or user-defined libraries. The hSAGEing tool provides a combination of friendly cross-tissue analysis and an interface for comparing SAGE libraries for the first time. Some up- or down-regulated genes with tissue-specific or common tumor markers and suppressors are identified computationally. The tool is useful and convenient for in silico cancer transcriptomic studies and is freely available at http://bio.kuas.edu.tw/hSAGEing.

Cloning and characterisation of cDNA sequences encoding for anti-lipopolysaccharide factors (ALFs) in Brazilian palaemonid and penaeid shrimps.

PubMed

Rosa, Rafael Diego; Stoco, Patricia Hermes; Barracco, Margherita Anna

2008-11-01

Anti-lipopolysaccharide factors (ALFs) are antimicrobial peptides found in limulids and crustaceans that have a potent and broad range of antimicrobial activity. We report here the identification and molecular characterisation of new sequences encoding for ALFs in the haemocytes of the freshwater prawn Macrobrachium olfersi and also in two Brazilian penaeid species, Farfantepenaeus paulensis and Litopenaeus schmitti. All obtained sequences encoded for highly cationic peptides containing two conserved cysteine residues flanking a putative LPS-binding domain. They exhibited a significant amino acid similarity with crustacean and limulid ALF sequences, especially with those of penaeid shrimps. This is the first identification of ALF in a freshwater prawn.

Generation of Recombinant Polioviruses Harboring RNA Affinity Tags in the 5′ and 3′ Noncoding Regions of Genomic RNAs

PubMed Central

Flather, Dylan; Cathcart, Andrea L.; Cruz, Casey; Baggs, Eric; Ngo, Tuan; Gershon, Paul D.; Semler, Bert L.

2016-01-01

Despite being intensely studied for more than 50 years, a complete understanding of the enterovirus replication cycle remains elusive. Specifically, only a handful of cellular proteins have been shown to be involved in the RNA replication cycle of these viruses. In an effort to isolate and identify additional cellular proteins that function in enteroviral RNA replication, we have generated multiple recombinant polioviruses containing RNA affinity tags within the 3′ or 5′ noncoding region of the genome. These recombinant viruses retained RNA affinity sequences within the genome while remaining viable and infectious over multiple passages in cell culture. Further characterization of these viruses demonstrated that viral protein production and growth kinetics were unchanged or only slightly altered relative to wild type poliovirus. However, attempts to isolate these genetically-tagged viral genomes from infected cells have been hindered by high levels of co-purification of nonspecific proteins and the limited matrix-binding efficiency of RNA affinity sequences. Regardless, these recombinant viruses represent a step toward more thorough characterization of enterovirus ribonucleoprotein complexes involved in RNA replication. PMID:26861382

New features of triacylglycerol biosynthetic pathways of peanut seeds in early developmental stages.

PubMed

Yu, Mingli; Liu, Fengzhen; Zhu, Weiwei; Sun, Meihong; Liu, Jiang; Li, Xinzheng

2015-11-01

The peanut (Arachis hypogaea L.) is one of the three most important oil crops in the world due to its high average oil content (50 %). To reveal the biosynthetic pathways of seed oil in the early developmental stages of peanut pods with the goal of improving the oil quality, we presented a method combining deep sequencing analysis of the peanut pod transcriptome and quantitative real-time PCR (RT-PCR) verification of seed oil-related genes. From the sequencing data, approximately 1500 lipid metabolism-associated Unigenes were identified. The RT-PCR results quantified the different expression patterns of these triacylglycerol (TAG) synthesis-related genes in the early developmental stages of peanut pods. Based on these results and analysis, we proposed a novel construct of the metabolic pathways involved in the biosynthesis of TAG, including the Kennedy pathway, acyl-CoA-independent pathway and proposed monoacylglycerol pathway. It showed that the biosynthetic pathways of TAG in the early developmental stages of peanut pods were much more complicated than a simple, unidirectional, linear pathway.

Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

PubMed

Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

2003-01-01

A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

Expressed sequence tags from the plant trypanosomatid Phytomonas serpens.

PubMed

Pappas, Georgios J; Benabdellah, Karim; Zingales, Bianca; González, Antonio

2005-08-01

We have generated 2190 expressed sequence tags (ESTs) from a cDNA library of the plant trypanosomatid Phytomonas serpens. Upon processing and clustering the set of 1893 accepted sequences was reduced to 697 clusters consisting of 452 singletons and 245 contigs. Functional categories were assigned based on BLAST searches against a database of the eukaryotic orthologous groups of proteins (KOG). Thirty six percent of the generated sequences showed no hits against the KOG database and 39.6% presented similarity to the KOG classes corresponding to translation, ribosomal structure and biogenesis. The most populated cluster contained 45 ESTs homologous to members of the glucose transporter family. This fact can be immediately correlated to the reported Phytomonas dependence on anaerobic glycolytic ATP production due to the lack of cytochrome-mediated respiratory chain. In this context, not only a number of enzymes of the glycolytic pathway were identified but also of the Krebs cycle as well as specific components of the respiratory chain. The data here reported, including a few hundred unique sequences and the description of tandemly repeated motifs and putative transcript stability motifs at untranslated mRNA ends, represent an initial approach to overcome the lack of information on the molecular biology of this organism.

Poly(A)-tag deep sequencing data processing to extract poly(A) sites.

PubMed

Wu, Xiaohui; Ji, Guoli; Li, Qingshun Quinn

2015-01-01

Polyadenylation [poly(A)] is an essential posttranscriptional processing step in the maturation of eukaryotic mRNA. The advent of next-generation sequencing (NGS) technology has offered feasible means to generate large-scale data and new opportunities for intensive study of polyadenylation, particularly deep sequencing of the transcriptome targeting the junction of 3'-UTR and the poly(A) tail of the transcript. To take advantage of this unprecedented amount of data, we present an automated workflow to identify polyadenylation sites by integrating NGS data cleaning, processing, mapping, normalizing, and clustering. In this pipeline, a series of Perl scripts are seamlessly integrated to iteratively map the single- or paired-end sequences to the reference genome. After mapping, the poly(A) tags (PATs) at the same genome coordinate are grouped into one cleavage site, and the internal priming artifacts removed. Then the ambiguous region is introduced to parse the genome annotation for cleavage site clustering. Finally, cleavage sites within a close range of 24 nucleotides and from different samples can be clustered into poly(A) clusters. This procedure could be used to identify thousands of reliable poly(A) clusters from millions of NGS sequences in different tissues or treatments.

An efficient tag derived from the common epitope of tospoviral NSs proteins for monitoring recombinant proteins expressed in both bacterial and plant systems.

PubMed

Cheng, Hao-Wen; Chen, Kuan-Chun; Raja, Joseph A J; Li, Jian-Xian; Yeh, Shyi-Dong

2013-04-15

NSscon (23 aa), a common epitope in the gene silencing suppressor NSs proteins of the members of the Watermelon silver mottle virus (WSMoV) serogroup, was previously identified. In this investigation, we expressed different green fluorescent protein (GFP)-fused deletions of NSscon in bacteria and reacted with NSscon monoclonal antibody (MAb). Our results indicated that the core 9 amino acids, "(109)KFTMHNQIF(117)", denoted as "nss", retain the reactivity of NSscon. In bacterial pET system, four different recombinant proteins labeled with nss, either at N- or C-extremes, were readily detectable without position effects, with sensitivity superior to that for the polyhistidine-tag. When the nss-tagged Zucchini yellow mosaic virus (ZYMV) helper component-protease (HC-Pro) and WSMoV nucleocapsid protein were transiently expressed by agroinfiltration in tobacco, they were readily detectable and the tag's possible efficacy for gene silencing suppression was not noticed. Co-immunoprecipitation of nss-tagged and non-tagged proteins expressed from bacteria confirmed the interaction of potyviral HC-Pro and coat protein. Thus, we conclude that this novel nss sequence is highly valuable for tagging recombinant proteins in both bacterial and plant expression systems. Copyright © 2013 Elsevier B.V. All rights reserved.

HIP1 propagates in cyanobacterial DNA via nucleotide substitutions but promotes excision at similar frequencies in Escherichia coli and Synechococcus PCC 7942.

PubMed

Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J

1997-04-01

The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.

Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

PubMed

Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

2015-12-01

Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

Identification and characterization of TCRgamma and TCRdelta chains in channel catfish, Ictalurus punctatus

USDA-ARS?s Scientific Manuscript database

Channel catfish, Ictalurus punctatus, T cell receptors (TCR) gamma and delta were identified by mining of expressed sequence tag databases and full length sequences were obtained by 5'-RACE and RT-PCR protocols. cDNAs for each of these TCR chains encode typical variable (V), (diversity; D), joining ...

Characterization of genic microsatellite markers derived from expressed sequence tags in Pacific abalone ( Haliotis discus hannai)

NASA Astrophysics Data System (ADS)

Li, Qi; Shu, Jing; Zhao, Cui; Liu, Shikai; Kong, Lingfeng; Zheng, Xiaodong

2010-01-01

Simple sequence repeat (SSR) markers were developed from the expressed sequence tags (ESTs) of Pacific abalone ( Haliotis discus hannai). Repeat motifs were found in 4.95% of the ESTs at a frequency of one repeat every 10.04 kb of EST sequences, after redundancy elimination. Seventeen polymorphic EST-SSRs were developed. The number of alleles per locus varied from 2-17, with an average of 6.8 alleles per locus. The expected and observed heterozygosities ranged from 0.159 to 0.928 and from 0.132 to 0.922, respectively. Twelve of the 17 loci (70.6%) were successfully amplified in H. diversicolor. Seventeen loci segregated in three families, with three showing the presence of null alleles (17.6%). The adequate level of variability and low frequency of null alleles observed in H. discus hannai, together with the high rate of transportability across Haliotis species, make this set of EST-SSR markers an important tool for comparative mapping, marker-assisted selection, and evolutionary studies, not only in the Pacific abalone, but also in related species.

Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

PubMed Central

Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

2012-01-01

Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

Cell-free translational screening of an expression sequence tag library of Clonorchis sinensis for novel antigen discovery.

PubMed

Kasi, Devi; Catherine, Christy; Lee, Seung-Won; Lee, Kyung-Ho; Kim, Yu Jung; Ro Lee, Myeong; Ju, Jung Won; Kim, Dong-Myung

2017-05-01

The rapidly evolving cloning and sequencing technologies have enabled understanding of genomic structure of parasite genomes, opening up new ways of combatting parasite-related diseases. To make the most of the exponentially accumulating genomic data, however, it is crucial to analyze the proteins encoded by these genomic sequences. In this study, we adopted an engineered cell-free protein synthesis system for large-scale expression screening of an expression sequence tag (EST) library of Clonorchis sinensis to identify potential antigens that can be used for diagnosis and treatment of clonorchiasis. To allow high-throughput expression and identification of individual genes comprising the library, a cell-free synthesis reaction was designed such that both the template DNA and the expressed proteins were co-immobilized on the same microbeads, leading to microbead-based linkage of the genotype and phenotype. This reaction configuration allowed streamlined expression, recovery, and analysis of proteins. This approach enabled us to identify 21 antigenic proteins. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:832-837, 2017. © 2017 American Institute of Chemical Engineers.

PET-Tool: a software suite for comprehensive processing and managing of Paired-End diTag (PET) sequence data.

PubMed

Chiu, Kuo Ping; Wong, Chee-Hong; Chen, Qiongyu; Ariyaratne, Pramila; Ooi, Hong Sain; Wei, Chia-Lin; Sung, Wing-Kin Ken; Ruan, Yijun

2006-08-25

We recently developed the Paired End diTag (PET) strategy for efficient characterization of mammalian transcriptomes and genomes. The paired end nature of short PET sequences derived from long DNA fragments raised a new set of bioinformatics challenges, including how to extract PETs from raw sequence reads, and correctly yet efficiently map PETs to reference genome sequences. To accommodate and streamline data analysis of the large volume PET sequences generated from each PET experiment, an automated PET data process pipeline is desirable. We designed an integrated computation program package, PET-Tool, to automatically process PET sequences and map them to the genome sequences. The Tool was implemented as a web-based application composed of four modules: the Extractor module for PET extraction; the Examiner module for analytic evaluation of PET sequence quality; the Mapper module for locating PET sequences in the genome sequences; and the Project Manager module for data organization. The performance of PET-Tool was evaluated through the analyses of 2.7 million PET sequences. It was demonstrated that PET-Tool is accurate and efficient in extracting PET sequences and removing artifacts from large volume dataset. Using optimized mapping criteria, over 70% of quality PET sequences were mapped specifically to the genome sequences. With a 2.4 GHz LINUX machine, it takes approximately six hours to process one million PETs from extraction to mapping. The speed, accuracy, and comprehensiveness have proved that PET-Tool is an important and useful component in PET experiments, and can be extended to accommodate other related analyses of paired-end sequences. The Tool also provides user-friendly functions for data quality check and system for multi-layer data management.

Candidate Genes Expressed in Tolerant Common Wheat With Resistant to English Grain Aphid.

PubMed

Luo, Kun; Zhang, Gaisheng; Wang, Chunping; Ouellet, Thérèse; Wu, Jingjing; Zhu, Qidi; Zhao, Huiyan

2014-10-01

The English grain aphid, Sitobion avenae (F.) (Hemiptera: Aphididae), is a common worldwide pest of wheat (Triticum aestivum L.). The use of improved resistant cultivars by the farmers is the most effective and environmentally friendly method to control this aphid in the field. The winter wheat genotypes 98-10-35 and Amigo are resistant to S. avenae. To identify genes responsible for resistance to S. avenae in these genotypes, differential-display reverse transcription-polymerase chain reaction was used to identify the corresponding differentially expressed sequences in current study. Two backcross progenies were obtained by crossing the two resistant genotypes with the susceptible genotype 1376. Six potential expected-differential bands were sequenced. Lengths of the expressed sequence tags ranged from 128 to 532 bp. Although these expressed sequences were likely associated with S. avenae resistance, there was one expressed sequence tag located on 7DL chromosome, and its potential function may associate with the ability to maintain photosynthesis in wheat. That serves as an active way for tolerant common wheat with resistant to S. avenae. Cloning the full length of these sequences would help us thoroughly understand the mechanism of wheat resistance to S. avenae and be valuable for breeding cultivars with S. avenae resistance. © 2014 Entomological Society of America.

Profiling cellular protein complexes by proximity ligation with dual tag microarray readout.

PubMed

Hammond, Maria; Nong, Rachel Yuan; Ericsson, Olle; Pardali, Katerina; Landegren, Ulf

2012-01-01

Patterns of protein interactions provide important insights in basic biology, and their analysis plays an increasing role in drug development and diagnostics of disease. We have established a scalable technique to compare two biological samples for the levels of all pairwise interactions among a set of targeted protein molecules. The technique is a combination of the proximity ligation assay with readout via dual tag microarrays. In the proximity ligation assay protein identities are encoded as DNA sequences by attaching DNA oligonucleotides to antibodies directed against the proteins of interest. Upon binding by pairs of antibodies to proteins present in the same molecular complexes, ligation reactions give rise to reporter DNA molecules that contain the combined sequence information from the two DNA strands. The ligation reactions also serve to incorporate a sample barcode in the reporter molecules to allow for direct comparison between pairs of samples. The samples are evaluated using a dual tag microarray where information is decoded, revealing which pairs of tags that have become joined. As a proof-of-concept we demonstrate that this approach can be used to detect a set of five proteins and their pairwise interactions both in cellular lysates and in fixed tissue culture cells. This paper provides a general strategy to analyze the extent of any pairwise interactions in large sets of molecules by decoding reporter DNA strands that identify the interacting molecules.

Electrostatically driven immobilization of peptides onto (Maleic anhydride-alt-methyl vinyl ether) copolymers in aqueous media.

PubMed

Ladavière, C; Lorenzo, C; Elaïssari, A; Mandrand, B; Delair, T

2000-01-01

The covalent immobilization of a model peptide onto the MAMVE copolymer, via the formation of amide bonds, occurred in moderate yields in aqueous conditions. The improvement of the grafting reaction was achieved by adding at the amino terminus of the model peptide a sequence (tag) of three positively charged amino acids, lysine or arginine, and by taking profit of electrostatic attractive interactions between the negatively charged copolymer and the tagged peptides. The arginine tag was more efficient than the lysine tag for enhancing the immobilization reaction, proving that the effect was due to an electrostic driving force. On the basis of these results, a tentative mechanism is discussed, and Scatchard plots pointed out two regimes of binding. With the first, at low polymer load (up to 50% of saturation for a lysine tag and 60-70% for an arginine tag), the binding occurred with a positive cooperative effect, the already bound peptide participating to the binding of others. A second one for higher coverages, for which the binding occurred with a negative cooperativity, and saturation was reached in the presence of a large excess of peptide.

Serial analysis of gene expression in the silkworm, Bombyx mori.

PubMed

Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping

2005-08-01

The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.

The complete chloroplast genome sequence of Citrus sinensis (L.) Osbeck var 'Ridge Pineapple': organization and phylogenetic relationships to other angiosperms

PubMed Central

Bausher, Michael G; Singh, Nameirakpam D; Lee, Seung-Bum; Jansen, Robert K; Daniell, Henry

2006-01-01

Background The production of Citrus, the largest fruit crop of international economic value, has recently been imperiled due to the introduction of the bacterial disease Citrus canker. No significant improvements have been made to combat this disease by plant breeding and nuclear transgenic approaches. Chloroplast genetic engineering has a number of advantages over nuclear transformation; it not only increases transgene expression but also facilitates transgene containment, which is one of the major impediments for development of transgenic trees. We have sequenced the Citrus chloroplast genome to facilitate genetic improvement of this crop and to assess phylogenetic relationships among major lineages of angiosperms. Results The complete chloroplast genome sequence of Citrus sinensis is 160,129 bp in length, and contains 133 genes (89 protein-coding, 4 rRNAs and 30 distinct tRNAs). Genome organization is very similar to the inferred ancestral angiosperm chloroplast genome. However, in Citrus the infA gene is absent. The inverted repeat region has expanded to duplicate rps19 and the first 84 amino acids of rpl22. The rpl22 gene in the IRb region has a nonsense mutation resulting in 9 stop codons. This was confirmed by PCR amplification and sequencing using primers that flank the IR/LSC boundaries. Repeat analysis identified 29 direct and inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Comparison of protein-coding sequences with expressed sequence tags revealed six putative RNA edits, five of which resulted in non-synonymous modifications in petL, psbH, ycf2 and ndhA. Phylogenetic analyses using maximum parsimony (MP) and maximum likelihood (ML) methods of a dataset composed of 61 protein-coding genes for 30 taxa provide strong support for the monophyly of several major clades of angiosperms, including monocots, eudicots, rosids and asterids. The MP and ML trees are incongruent in three areas: the position of Amborella and Nymphaeales, relationship of the magnoliid genus Calycanthus, and the monophyly of the eurosid I clade. Both MP and ML trees provide strong support for the monophyly of eurosids II and for the placement of Citrus (Sapindales) sister to a clade including the Malvales/Brassicales. Conclusion This is the first complete chloroplast genome sequence for a member of the Rutaceae and Sapindales. Expansion of the inverted repeat region to include rps19 and part of rpl22 and presence of two truncated copies of rpl22 is unusual among sequenced chloroplast genomes. Availability of a complete Citrus chloroplast genome sequence provides valuable information on intergenic spacer regions and endogenous regulatory sequences for chloroplast genetic engineering. Phylogenetic analyses resolve relationships among several major clades of angiosperms and provide strong support for the monophyly of the eurosid II clade and the position of the Sapindales sister to the Brassicales/Malvales. PMID:17010212

De Novo Transcriptomic Analysis of an Oleaginous Microalga: Pathway Description and Gene Discovery for Production of Next-Generation Biofuels

PubMed Central

Wan, LingLin; Han, Juan; Sang, Min; Li, AiFen; Wu, Hong; Yin, ShunJi; Zhang, ChengWu

2012-01-01

Background Eustigmatos cf. polyphem is a yellow-green unicellular soil microalga belonging to the eustimatophyte with high biomass and considerable production of triacylglycerols (TAGs) for biofuels, which is thus referred to as an oleaginous microalga. The paucity of microalgae genome sequences, however, limits development of gene-based biofuel feedstock optimization studies. Here we describe the sequencing and de novo transcriptome assembly for a non-model microalgae species, E. cf. polyphem, and identify pathways and genes of importance related to biofuel production. Results We performed the de novo assembly of E. cf. polyphem transcriptome using Illumina paired-end sequencing technology. In a single run, we produced 29,199,432 sequencing reads corresponding to 2.33 Gb total nucleotides. These reads were assembled into 75,632 unigenes with a mean size of 503 bp and an N50 of 663 bp, ranging from 100 bp to >3,000 bp. Assembled unigenes were subjected to BLAST similarity searches and annotated with Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) orthology identifiers. These analyses identified the majority of carbohydrate, fatty acids, TAG and carotenoids biosynthesis and catabolism pathways in E. cf. polyphem. Conclusions Our data provides the construction of metabolic pathways involved in the biosynthesis and catabolism of carbohydrate, fatty acids, TAG and carotenoids in E. cf. polyphem and provides a foundation for the molecular genetics and functional genomics required to direct metabolic engineering efforts that seek to enhance the quantity and character of microalgae-based biofuel feedstock. PMID:22536352

Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants.

PubMed

Wistow, Graeme; Bernstein, Steven L; Wyatt, M Keith; Fariss, Robert N; Behal, Amita; Touchman, Jeffrey W; Bouffard, Gerald; Smith, Don; Peterson, Katherine

2002-06-15

The retinal pigment epithelium (RPE) and choroid comprise a functional unit of the eye that is essential to normal retinal health and function. Here we describe expressed sequence tag (EST) analysis of human RPE/choroid as part of a project for ocular bioinformatics. A cDNA library (cs) was made from human RPE/choroid and sequenced. Data were analyzed and assembled using the program GRIST (GRouping and Identification of Sequence Tags). Complete sequencing, Northern and Western blots, RH mapping, peptide antibody synthesis and immunofluorescence (IF) have been used to examine expression patterns and genome location for selected transcripts and proteins. Ten thousand individual sequence reads yield over 6300 unique gene clusters of which almost half have no matches with named genes. One of the most abundant transcripts is from a gene (named "alpha") that maps to the BBS1 region of chromosome 11. A number of tissue preferred transcripts are common to both RPE/choroid and iris. These include oculoglycan/opticin, for which an alternative splice form is detected in RPE/choroid, and "oculospanin" (Ocsp), a novel tetraspanin that maps to chromosome 17q. Antiserum to Ocsp detects expression in RPE, iris, ciliary body, and retinal ganglion cells by IF. A newly identified gene for a zinc-finger protein (TIRC) maps to 19q13.4. Variant transcripts of several genes were also detected. Most notably, the predominant form of Bestrophin represented in cs contains a longer open reading frame as a result of splice junction skipping. The unamplified cs library gives a view of the transcriptional repertoire of the adult RPE/choroid. A large number of potentially novel genes and splice forms and candidates for genetic diseases are revealed. Clones from this collection are being included in a large, nonredundant set for cDNA microarray construction.

Fluorescence turn-on detection of target sequence DNA based on silicon nanodot-mediated quenching.

PubMed

Zhang, Yanan; Ning, Xinping; Mao, Guobin; Ji, Xinghu; He, Zhike

2018-05-01

We have developed a new enzyme-free method for target sequence DNA detection based on the dynamic quenching of fluorescent silicon nanodots (SiNDs) toward Cy5-tagged DNA probe. Fascinatingly, the water-soluble SiNDs can quench the fluorescence of cyanine (Cy5) in Cy5-tagged DNA probe in homogeneous solution, and the fluorescence of Cy5-tagged DNA probe can be restored in the presence of target sequence DNA (the synthetic target miRNA-27a). Based on this phenomenon, a SiND-featured fluorescent sensor has been constructed for "turn-on" detection of the synthetic target miRNA-27a for the first time. This newly developed approach possesses the merits of low cost, simple design, and convenient operation since no enzymatic reaction, toxic reagents, or separation procedures are involved. The established method achieves a detection limit of 0.16 nM, and the relative standard deviation of this method is 9% (1 nM, n = 5). The linear range is 0.5-20 nM, and the recoveries in spiked human fluids are in the range of 90-122%. This protocol provides a new tactic in the development of the nonenzymic miRNA biosensors and opens a promising avenue for early diagnosis of miRNA-associated disease. Graphical abstract The SiND-based fluorescent sensor for detection of S-miR-27a.

Transcriptome-wide analysis of WRKY transcription factors in wheat and their leaf rust responsive expression profiling.

PubMed

Satapathy, Lopamudra; Singh, Dharmendra; Ranjan, Prashant; Kumar, Dhananjay; Kumar, Manish; Prabhu, Kumble Vinod; Mukhopadhyay, Kunal

2014-12-01

WRKY, a plant-specific transcription factor family, has important roles in pathogen defense, abiotic cues and phytohormone signaling, yet little is known about their roles and molecular mechanism of function in response to rust diseases in wheat. We identified 100 TaWRKY sequences using wheat Expressed Sequence Tag database of which 22 WRKY sequences were novel. Identified proteins were characterized based on their zinc finger motifs and phylogenetic analysis clustered them into six clades consisting of class IIc and class III WRKY proteins. Functional annotation revealed major functions in metabolic and cellular processes in control plants; whereas response to stimuli, signaling and defense in pathogen inoculated plants, their major molecular function being binding to DNA. Tag-based expression analysis of the identified genes revealed differential expression between mock and Puccinia triticina inoculated wheat near isogenic lines. Gene expression was also performed with six rust-related microarray experiments at Gene Expression Omnibus database. TaWRKY10, 15, 17 and 56 were common in both tag-based and microarray-based differential expression analysis and could be representing rust specific WRKY genes. The obtained results will bestow insight into the functional characterization of WRKY transcription factors responsive to leaf rust pathogenesis that can be used as candidate genes in molecular breeding programs to improve biotic stress tolerance in wheat.

Parallel tagged next-generation sequencing on pooled samples - a new approach for population genetics in ecology and conservation.

PubMed

Zavodna, Monika; Grueber, Catherine E; Gemmell, Neil J

2013-01-01

Next-generation sequencing (NGS) on pooled samples has already been broadly applied in human medical diagnostics and plant and animal breeding. However, thus far it has been only sparingly employed in ecology and conservation, where it may serve as a useful diagnostic tool for rapid assessment of species genetic diversity and structure at the population level. Here we undertake a comprehensive evaluation of the accuracy, practicality and limitations of parallel tagged amplicon NGS on pooled population samples for estimating species population diversity and structure. We obtained 16S and Cyt b data from 20 populations of Leiopelma hochstetteri, a frog species of conservation concern in New Zealand, using two approaches - parallel tagged NGS on pooled population samples and individual Sanger sequenced samples. Data from each approach were then used to estimate two standard population genetic parameters, nucleotide diversity (π) and population differentiation (FST), that enable population genetic inference in a species conservation context. We found a positive correlation between our two approaches for population genetic estimates, showing that the pooled population NGS approach is a reliable, rapid and appropriate method for population genetic inference in an ecological and conservation context. Our experimental design also allowed us to identify both the strengths and weaknesses of the pooled population NGS approach and outline some guidelines and suggestions that might be considered when planning future projects.

High-resolution melt analysis to identify and map sequence-tagged site anchor points onto linkage maps: a white lupin (Lupinus albus) map as an exemplar.

PubMed

Croxford, Adam E; Rogers, Tom; Caligari, Peter D S; Wilkinson, Michael J

2008-01-01

* The provision of sequence-tagged site (STS) anchor points allows meaningful comparisons between mapping studies but can be a time-consuming process for nonmodel species or orphan crops. * Here, the first use of high-resolution melt analysis (HRM) to generate STS markers for use in linkage mapping is described. This strategy is rapid and low-cost, and circumvents the need for labelled primers or amplicon fractionation. * Using white lupin (Lupinus albus, x = 25) as a case study, HRM analysis was applied to identify 91 polymorphic markers from expressed sequence tag (EST)-derived and genomic libraries. Of these, 77 generated STS anchor points in the first fully resolved linkage map of the species. The map also included 230 amplified fragment length polymorphisms (AFLP) loci, spanned 1916 cM (84.2% coverage) and divided into the expected 25 linkage groups. * Quantitative trait loci (QTL) analyses performed on the population revealed genomic regions associated with several traits, including the agronomically important time to flowering (tf), alkaloid synthesis and stem height (Ph). Use of HRM-STS markers also allowed us to make direct comparisons between our map and that of the related crop, Lupinus angustifolius, based on the conversion of RFLP, microsatellite and single nucleotide polymorphism (SNP) markers into HRM markers.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

A high-resolution whole genome radiation hybrid map of human chromosome 17q22-q25.3 across the genes for GH and TK

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foster, J.W.; Schafer, A.J.; Critcher, R.

1996-04-15

We have constructed a whole genome radiation hybrid (WG-RH) map across a region of human chromosome 17q, from growth hormone (GH) to thymidine kinase (TK). A panel of 128 WG-RH hybrid cell lines generated by X-irradiation and fusion has been tested for the retention of 39 sequence-tagged site (STS) markers by the polymerase chain reaction. This genome mapping technique has allowed the integration of existing VNTR and microsatellite markers with additional new markers and existing STS markers previously mapped to this region by other means. The WG-RH map includes eight expressed sequence tag (EST) and three anonymous markers developed formore » this study, together with 23 anonymous microsatellites and five existing ESTs. Analysis of these data resulted in a high-density comprehensive map across this region of the genome. A subset of these markers has been used to produce a framework map consisting of 20 loci ordered with odds greater than 1000:1. The markers are of sufficient density to build a YAC contig across this region based on marker content. We have developed sequence tags for both ends of a 2.1-Mb YAC and mapped these using the WG-RH panel, allowing a direct comparison of cRay{sub 6000} to physical distance. 31 refs., 3 figs., 2 tabs.« less

Genome sequence determination and metagenomic characterization of a Dehalococcoides mixed culture grown on cis-1,2-dichloroethene.

PubMed

Yohda, Masafumi; Yagi, Osami; Takechi, Ayane; Kitajima, Mizuki; Matsuda, Hisashi; Miyamura, Naoaki; Aizawa, Tomoko; Nakajima, Mutsuyasu; Sunairi, Michio; Daiba, Akito; Miyajima, Takashi; Teruya, Morimi; Teruya, Kuniko; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Juan, Ayaka; Nakano, Kazuma; Aoyama, Misako; Terabayashi, Yasunobu; Satou, Kazuhito; Hirano, Takashi

2015-07-01

A Dehalococcoides-containing bacterial consortium that performed dechlorination of 0.20 mM cis-1,2-dichloroethene to ethene in 14 days was obtained from the sediment mud of the lotus field. To obtain detailed information of the consortium, the metagenome was analyzed using the short-read next-generation sequencer SOLiD 3. Matching the obtained sequence tags with the reference genome sequences indicated that the Dehalococcoides sp. in the consortium was highly homologous to Dehalococcoides mccartyi CBDB1 and BAV1. Sequence comparison with the reference sequence constructed from 16S rRNA gene sequences in a public database showed the presence of Sedimentibacter, Sulfurospirillum, Clostridium, Desulfovibrio, Parabacteroides, Alistipes, Eubacterium, Peptostreptococcus and Proteocatella in addition to Dehalococcoides sp. After further enrichment, the members of the consortium were narrowed down to almost three species. Finally, the full-length circular genome sequence of the Dehalococcoides sp. in the consortium, D. mccartyi IBARAKI, was determined by analyzing the metagenome with the single-molecule DNA sequencer PacBio RS. The accuracy of the sequence was confirmed by matching it to the tag sequences obtained by SOLiD 3. The genome is 1,451,062 nt and the number of CDS is 1566, which includes 3 rRNA genes and 47 tRNA genes. There exist twenty-eight RDase genes that are accompanied by the genes for anchor proteins. The genome exhibits significant sequence identity with other Dehalococcoides spp. throughout the genome, but there exists significant difference in the distribution RDase genes. The combination of a short-read next-generation DNA sequencer and a long-read single-molecule DNA sequencer gives detailed information of a bacterial consortium. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Molecular characterization of the complete genome of falconid herpesvirus strain S-18

USDA-ARS?s Scientific Manuscript database

Falconid herpesvirus type 1 (FHV-1) is the causative agent of falcon inclusion body disease, an acute, highly contagious disease of raptors. The complete nucleotide sequence of the genome of FHV-1 has been determined. The genome is arranged as a D-type genome with large inverted repeats flanking a ...

Resequencing IRS2 reveals rare variants for obesity but not fasting glucose homeostasis in Hispanic children

USDA-ARS?s Scientific Manuscript database

Our objective was to resequence insulin receptor substrate 2 (IRS2) to identify variants associated with obesity- and diabetes-related traits in Hispanic children. Exonic and intronic segments, 5' and 3' flanking regions of IRS2 (approx. 14.5 kb), were bidirectionally sequenced for single nucleotide...

“Scanning mutagenesis” of the amino acid sequences flanking phosphorylation site 1 of the mitochondrial pyruvate dehydrogenase complex

USDA-ARS?s Scientific Manuscript database

The mitochondrial pyruvate dehydrogenase complex is regulated by reversible seryl-phosphorylation of the E1alpha subunit by a dedicated, intrinsic kinase. The phospho-complex is reactivated when dephosphorylated by an intrinsic PP2C-type protein phosphatase. Both the position of the phosphorylated...

Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.

PubMed

Ponce, M R; Quesada, V; Micol, J L

1998-05-01

An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.

E74-like factor 2 regulates valosin-containing protein expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Binglin; Tomita, Yasuhiko; Qiu, Ying

2007-05-11

Enhanced expression of valosin-containing protein (VCP) correlates with invasion and metastasis of cancers. To clarify the transcription mechanism of VCP, human and mouse genomic sequence was compared, revealing a 260 bp DNA sequence in the 5'-flanking region of VCP gene to be highly conserved between the two, in which binding motif of E74-like factor 2/new Ets-related factor (ELF2/NERF) was identified. Chromatin immunoprecipitation assay showed binding of ELF2/NERF to the 5'-flanking region of VCP gene. Knock-down of ELF2/NERF by siRNA decreased expression level of VCP. Viability of cells under tumor necrosis factor-alpha treatment significantly reduced in ELF2/NERF-knock-down breast cancer cell line.more » Immunohistochemical analysis on clinical breast cancer specimens showed a correlation of nuclear ELF2/NERF expression with VCP expression and proliferative activity of cells shown by Ki-67 immunohistochemistry. These findings indicate that ELF2/NERF promotes VCP transcription and that ELF2/NERF-VCP pathway might be important for cell survival and proliferation under cytokine stress.« less

Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

PubMed

Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

2015-10-01

Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

Retroposon analysis of major cetacean lineages: The monophyly of toothed whales and the paraphyly of river dolphins

PubMed Central

Nikaido, Masato; Matsuno, Fumio; Hamilton, Healy; Brownell, Robert L.; Cao, Ying; Ding, Wang; Zuoyan, Zhu; Shedlock, Andrew M.; Fordyce, R. Ewan; Hasegawa, Masami; Okada, Norihiro

2001-01-01

SINE (short interspersed element) insertion analysis elucidates contentious aspects in the phylogeny of toothed whales and dolphins (Odontoceti), especially river dolphins. Here, we characterize 25 informative SINEs inserted into unique genomic loci during evolution of odontocetes to construct a cladogram, and determine a total of 2.8 kb per taxon of the flanking sequences of these SINE loci to estimate divergence times among lineages. We demonstrate that: (i) Odontocetes are monophyletic; (ii) Ganges River dolphins, beaked whales, and ocean dolphins diverged (in this order) after sperm whales; (iii) three other river dolphin taxa, namely the Amazon, La Plata, and Yangtze river dolphins, form a monophyletic group with Yangtze River dolphins being the most basal; and (iv) the rapid radiation of extant cetacean lineages occurred some 28–33 million years B.P., in strong accord with the fossil record. The combination of SINE and flanking sequence analysis suggests a topology and set of divergence times for odontocete relationships, offering alternative explanations for several long-standing problems in cetacean evolution. PMID:11416211

The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats

PubMed Central

Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine

2007-01-01

Background In Archeae and Bacteria, the repeated elements called CRISPRs for "clustered regularly interspaced short palindromic repeats" are believed to participate in the defence against viruses. Short sequences called spacers are stored in-between repeated elements. In the current model, motifs comprising spacers and repeats may target an invading DNA and lead to its degradation through a proposed mechanism similar to RNA interference. Analysis of intra-species polymorphism shows that new motifs (one spacer and one repeated element) are added in a polarised fashion. Although their principal characteristics have been described, a lot remains to be discovered on the way CRISPRs are created and evolve. As new genome sequences become available it appears necessary to develop automated scanning tools to make available CRISPRs related information and to facilitate additional investigations. Description We have produced a program, CRISPRFinder, which identifies CRISPRs and extracts the repeated and unique sequences. Using this software, a database is constructed which is automatically updated monthly from newly released genome sequences. Additional tools were created to allow the alignment of flanking sequences in search for similarities between different loci and to build dictionaries of unique sequences. To date, almost six hundred CRISPRs have been identified in 475 published genomes. Two Archeae out of thirty-seven and about half of Bacteria do not possess a CRISPR. Fine analysis of repeated sequences strongly supports the current view that new motifs are added at one end of the CRISPR adjacent to the putative promoter. Conclusion It is hoped that availability of a public database, regularly updated and which can be queried on the web will help in further dissecting and understanding CRISPR structure and flanking sequences evolution. Subsequent analyses of the intra-species CRISPR polymorphism will be facilitated by CRISPRFinder and the dictionary creator. CRISPRdb is accessible at PMID:17521438

The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome

PubMed Central

Camargo, Anamaria A.; Samaia, Helena P. B.; Dias-Neto, Emmanuel; Simão, Daniel F.; Migotto, Italo A.; Briones, Marcelo R. S.; Costa, Fernando F.; Aparecida Nagai, Maria; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; Sonati, Maria de Fátima; Tajara, Eloiza H.; Valentini, Sandro R.; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Arnaldi, Liliane A. T.; de Assis, Angela M.; Bengtson, Mário Henrique; Bergamo, Nadia Aparecida; Bombonato, Vanessa; de Camargo, Maria E. R.; Canevari, Renata A.; Carraro, Dirce M.; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Corrêa, Rosana F. R.; Costa, Maria Cristina R.; Curcio, Cyntia; Hokama, Paula O. M.; Ferreira, Ari J. S.; Furuzawa, Gilberto K.; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Krieger, José E.; Leite, Luciana C. C.; Majumder, Paromita; Marins, Mozart; Marques, Everaldo R.; Melo, Analy S. A.; Melo, Monica; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana G.; Prevedel, Aline C.; Rahal, Paula; Rainho, Claudia A.; Reis, Eduardo M. R.; Ribeiro, Marcelo L.; da Rós, Nancy; de Sá, Renata G.; Sales, Magaly M.; Sant'anna, Simone Cristina; dos Santos, Mariana L.; da Silva, Aline M.; da Silva, Neusa P.; Silva, Wilson A.; da Silveira, Rosana A.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Soares, Fernando; Moreira, Eloisa S.; Nunes, Diana N.; Correa, Ricardo G.; Zalcberg, Heloisa; Carvalho, Alex F.; Reis, Luis F. L.; Brentani, Ricardo R.; Simpson, Andrew J. G.; de Souza, Sandro J.

2001-01-01

Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription–PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning. PMID:11593022

The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome.

PubMed

Camargo, A A; Samaia, H P; Dias-Neto, E; Simão, D F; Migotto, I A; Briones, M R; Costa, F F; Nagai, M A; Verjovski-Almeida, S; Zago, M A; Andrade, L E; Carrer, H; El-Dorry, H F; Espreafico, E M; Habr-Gama, A; Giannella-Neto, D; Goldman, G H; Gruber, A; Hackel, C; Kimura, E T; Maciel, R M; Marie, S K; Martins, E A; Nobrega, M P; Paco-Larson, M L; Pardini, M I; Pereira, G G; Pesquero, J B; Rodrigues, V; Rogatto, S R; da Silva, I D; Sogayar, M C; Sonati, M F; Tajara, E H; Valentini, S R; Alberto, F L; Amaral, M E; Aneas, I; Arnaldi, L A; de Assis, A M; Bengtson, M H; Bergamo, N A; Bombonato, V; de Camargo, M E; Canevari, R A; Carraro, D M; Cerutti, J M; Correa, M L; Correa, R F; Costa, M C; Curcio, C; Hokama, P O; Ferreira, A J; Furuzawa, G K; Gushiken, T; Ho, P L; Kimura, E; Krieger, J E; Leite, L C; Majumder, P; Marins, M; Marques, E R; Melo, A S; Melo, M B; Mestriner, C A; Miracca, E C; Miranda, D C; Nascimento, A L; Nobrega, F G; Ojopi, E P; Pandolfi, J R; Pessoa, L G; Prevedel, A C; Rahal, P; Rainho, C A; Reis, E M; Ribeiro, M L; da Ros, N; de Sa, R G; Sales, M M; Sant'anna, S C; dos Santos, M L; da Silva, A M; da Silva, N P; Silva, W A; da Silveira, R A; Sousa, J F; Stecconi, D; Tsukumo, F; Valente, V; Soares, F; Moreira, E S; Nunes, D N; Correa, R G; Zalcberg, H; Carvalho, A F; Reis, L F; Brentani, R R; Simpson, A J; de Souza, S J; Melo, M

2001-10-09

Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription-PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning.

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

A novel nonsteroidal antifibrotic oligo decoy containing the TGF-beta element found in the COL1A1 gene which regulates murine schistosomiasis liver fibrosis.

PubMed

Boros, D L; Singh, K P; Gerard, H C; Hudson, A P; White, S L; Cutroneo, K R

2005-08-01

Schistosomiasis mansoni disseminated worm eggs in mice and humans induce granulomatous inflammations and cumulative fibrosis causing morbidity and possibly mortality. In this study, intrahepatic and I.V. injections of a double-stranded oligodeoxynucleotide decoy containing the TGF-beta regulatory element found in the distal promoter of the COL1A1 gene into worm-infected mice suppressed TGF-beta1, COL1A1, tissue inhibitor of metalloproteinase-1, and decreased COL3A1 mRNAs to a lesser extent. Sequence comparisons within the mouse genome found homologous sequences within the COL3A1, TGF-beta1, and TIMP-1 5' flanking regions. Cold competition gel mobility shift assays using these homologous sequences with 5' and 3' flanking regions found in the natural COL1A1 gene showed competition. Competitive gel mobility assays in a separate experiment showed no competition using a 5-base mutated or scrambled sequence. Explanted liver granulomas from saline-injected mice incorporated 10.45 +/- 1.7% (3)H-proline into newly synthesized collagen, whereas decoy-treated mice showed no collagen synthesis. Compared with the saline control schistosomiasis mice phosphorothioate double-stranded oligodeoxynucleotide treatment decreased total liver collagen content (i.e. hydroxy-4-proline) by 34%. This novel molecular approach has the potential to be employed as a novel antifibrotic treatment modality. (c) 2005 Wiley-Liss, Inc.

Three-dimensional P-wave velocity structure and precise earthquake relocation at Great Sitkin Volcano, Alaska

USGS Publications Warehouse

Pesicek, Jeremy; Thurber, Clifford H.; DeShon, Heather R.; Prejean, Stephanie G.; Zhang, Haijiang

2008-01-01

Waveform cross-correlation with bispectrum verification is combined with double-difference tomography to increase the precision of earthquake locations and constrain regional 3D P-wave velocity heterogeneity at Great Sitkin volcano, Alaska. From 1999 through 2005, the Alaska Volcano Observatory (AVO) recorded ∼1700 earthquakes in the vicinity of Great Sitkin, including two ML 4.3 earthquakes that are among the largest events in the AVO catalog. The majority of earthquakes occurred during 2002 and formed two temporally and spatially separate event sequences. The first sequence began on 17 March 2002 and was centered ∼20 km west of the volcano. The second sequence occurred on the southeast flank of Great Sitkin and began 28 May 2002. It was preceded by two episodes of volcanic tremor. Earthquake relocations of this activity on the southeast flank define a vertical planar feature oriented radially from the summit and in the direction of the assumed regional maximum compressive stress due to convergence along the Alaska subduction zone. This swarm may have been caused or accompanied by the emplacement of a dike. Relocations of the mainshock–aftershock sequence occurring west of Great Sitkin are consistent with rupture on a strike-slip fault. Tomographic images support the presence of a vertically dipping fault striking parallel to the direction of convergence in this region. The remaining catalog hypocenters relocate along discrete features beneath the volcano summit; here, low P-wave velocities possibly indicate the presence of magma beneath the volcano.

Agrobacterium tumefaciens-mediated transformation for investigating pathogenicity genes of the phytopathogenic fungus Colletotrichum sansevieriae.

PubMed

Nakamura, Masayuki; Kuwahara, Hideto; Onoyama, Keisuke; Iwai, Hisashi

2012-08-01

Agrobacterium tumefaciens-mediated transformation (AtMT) has become a common technique for DNA transformation of yeast and filamentous fungi. In this study, we first established a protocol of AtMT for the phytopathogenic fungus Colletotrichum sansevieriae. Binary T-DNA vector containing the hygromycin B phosphotransferase gene controlled by the Aspergillus nidulans gpdA promoter and the trpC terminator was constructed with pCAMBIA0380 and used with three different strains LBA4404, GV3101, and GV2260 of A. tumefaciens. Transformants were most effectively obtained when GV2260 and C. sansevieriae Sa-1-2 were co-cultivated; there were about 320 transformants per 10(6) spores. When 1,048 transformants were inoculated on Sansevieria trifasciata, three transformants were found to have completely lost their pathogenicity and two transformants displayed reduced pathogenicity. All of the five transformants had a single copy of T-DNA in their genomes. The three pathogenicity-deficient transformants were subjected to thermal asymmetric interlaced polymerase chain reaction and the reaction allowed us to amplify the sequences flanking the left and/or right borders. The flanking sequences of the two transformants, M154 and M875, showed no homology to any sequences in databases, but the sequences of M678 contained motifs of alpha-1,3-glucan synthase, suggesting that the gene might contribute to the pathogenicity of C. sansevieriae. This study describes a useful method for investigating pathogenicity genes in C. sansevieriae.

Myocardial tagging by Cardiovascular Magnetic Resonance: evolution of techniques--pulse sequences, analysis algorithms, and applications

PubMed Central

2011-01-01

Cardiovascular magnetic resonance (CMR) tagging has been established as an essential technique for measuring regional myocardial function. It allows quantification of local intramyocardial motion measures, e.g. strain and strain rate. The invention of CMR tagging came in the late eighties, where the technique allowed for the first time for visualizing transmural myocardial movement without having to implant physical markers. This new idea opened the door for a series of developments and improvements that continue up to the present time. Different tagging techniques are currently available that are more extensive, improved, and sophisticated than they were twenty years ago. Each of these techniques has different versions for improved resolution, signal-to-noise ratio (SNR), scan time, anatomical coverage, three-dimensional capability, and image quality. The tagging techniques covered in this article can be broadly divided into two main categories: 1) Basic techniques, which include magnetization saturation, spatial modulation of magnetization (SPAMM), delay alternating with nutations for tailored excitation (DANTE), and complementary SPAMM (CSPAMM); and 2) Advanced techniques, which include harmonic phase (HARP), displacement encoding with stimulated echoes (DENSE), and strain encoding (SENC). Although most of these techniques were developed by separate groups and evolved from different backgrounds, they are in fact closely related to each other, and they can be interpreted from more than one perspective. Some of these techniques even followed parallel paths of developments, as illustrated in the article. As each technique has its own advantages, some efforts have been made to combine different techniques together for improved image quality or composite information acquisition. In this review, different developments in pulse sequences and related image processing techniques are described along with the necessities that led to their invention, which makes this article easy to read and the covered techniques easy to follow. Major studies that applied CMR tagging for studying myocardial mechanics are also summarized. Finally, the current article includes a plethora of ideas and techniques with over 300 references that motivate the reader to think about the future of CMR tagging. PMID:21798021

Quantitative Tracking of Salmonella Enteritidis Transmission Routes Using Barcode-Tagged Isogenic Strains in Chickens: Proof-of-Concept Study

PubMed Central

Yang, Yichao; Ricke, Steven C.; Tellez, Guillermo; Kwon, Young Min

2017-01-01

Salmonella is an important foodborne bacterial pathogen, however, a fundamental understanding on Salmonella transmission routes within a poultry flock remains unclear. In this study, a series of barcode-tagged strains were constructed by inserting six random nucleotides into a functionally neutral region on the chromosome of S. Enteritidis as a tool for quantitative tracking of Salmonella transmission in chickens. Six distinct barcode-tagged strains were used for infection or contamination at either low dose (103 CFUs; three strains) or high dose (105 CFUs; three strains) in three independent experiments (Experiment 1 oral gavage; Experiment 2 contaminated feed; Experiment 3 contaminated water). For all chick experiments, cecal and foot-wash samples were collected from a subset of the chickens at days 7 or/and 14, from which genomic DNA was extracted and used to amplify the barcode regions. After the resulting PCR amplicons were pooled and analyzed by MiSeq sequencing, a total of approximately 1.5 million reads containing the barcode sequences were analyzed to determine the relative frequency of every barcode-tagged strain in each sample. In Experiment 1, the high dose of oral infection was correlated with greater dominance of the strains in the ceca of the respective seeder chickens and also in the contact chickens yet at lesser degrees. When chicks were exposed to contaminated feed (Experiment 2) or water (Experiment 3), there were no clear patterns of the barcode-tagged strains in relation to the dosage, except that the strains introduced at low dose required a longer time to colonize the ceca with contaminated feed. Most foot-wash samples contained only one to three strains for the majority of the samples, suggesting potential existence of an unknown mechanism(s) for strain exclusion. These results demonstrated the proof of concept of using barcode tagged to investigate transmission dynamics of Salmonella in chickens in a quantitative manner. PMID:28261587

Highly Selective End-Tagged Antimicrobial Peptides Derived from PRELP

PubMed Central

Malmsten, Martin; Kasetty, Gopinath; Pasupuleti, Mukesh; Alenfall, Jan; Schmidtchen, Artur

2011-01-01

Background Antimicrobial peptides (AMPs) are receiving increasing attention due to resistance development against conventional antibiotics. Pseudomonas aeruginosa and Staphylococcus aureus are two major pathogens involved in an array of infections such as ocular infections, cystic fibrosis, wound and post-surgery infections, and sepsis. The goal of the study was to design novel AMPs against these pathogens. Methodology and Principal Findings Antibacterial activity was determined by radial diffusion, viable count, and minimal inhibitory concentration assays, while toxicity was evaluated by hemolysis and effects on human epithelial cells. Liposome and fluorescence studies provided mechanistic information. Protease sensitivity was evaluated after subjection to human leukocyte elastase, staphylococcal aureolysin and V8 proteinase, as well as P. aeruginosa elastase. Highly active peptides were evaluated in ex vivo skin infection models. C-terminal end-tagging by W and F amino acid residues increased antimicrobial potency of the peptide sequences GRRPRPRPRP and RRPRPRPRP, derived from proline arginine-rich and leucine-rich repeat protein (PRELP). The optimized peptides were antimicrobial against a range of Gram-positive S. aureus and Gram-negative P. aeruginosa clinical isolates, also in the presence of human plasma and blood. Simultaneously, they showed low toxicity against mammalian cells. Particularly W-tagged peptides displayed stability against P. aeruginosa elastase, and S. aureus V8 proteinase and aureolysin, and the peptide RRPRPRPRPWWWW-NH2 was effective against various “superbugs” including vancomycin-resistant enterococci, multi-drug resistant P. aeruginosa, and methicillin-resistant S. aureus, as well as demonstrated efficiency in an ex vivo skin wound model of S. aureus and P. aeruginosa infection. Conclusions/Significance Hydrophobic C-terminal end-tagging of the cationic sequence RRPRPRPRP generates highly selective AMPs with potent activity against multiresistant bacteria and efficiency in ex vivo wound infection models. A precise “tuning” of toxicity and proteolytic stability may be achieved by changing tag-length and adding W- or F-amino acid tags. PMID:21298015

SNP marker discovery, linkage map construction and identification of QTLs for enhanced salinity tolerance in field pea (Pisum sativum L.)

PubMed Central

2013-01-01

Background Field pea (Pisum sativum L.) is a self-pollinating, diploid, cool-season food legume. Crop production is constrained by multiple biotic and abiotic stress factors, including salinity, that cause reduced growth and yield. Recent advances in genomics have permitted the development of low-cost high-throughput genotyping systems, allowing the construction of saturated genetic linkage maps for identification of quantitative trait loci (QTLs) associated with traits of interest. Genetic markers in close linkage with the relevant genomic regions may then be implemented in varietal improvement programs. Results In this study, single nucleotide polymorphism (SNP) markers associated with expressed sequence tags (ESTs) were developed and used to generate comprehensive linkage maps for field pea. From a set of 36,188 variant nucleotide positions detected through in silico analysis, 768 were selected for genotyping of a recombinant inbred line (RIL) population. A total of 705 SNPs (91.7%) successfully detected segregating polymorphisms. In addition to SNPs, genomic and EST-derived simple sequence repeats (SSRs) were assigned to the genetic map in order to obtain an evenly distributed genome-wide coverage. Sequences associated with the mapped molecular markers were used for comparative genomic analysis with other legume species. Higher levels of conserved synteny were observed with the genomes of Medicago truncatula Gaertn. and chickpea (Cicer arietinum L.) than with soybean (Glycine max [L.] Merr.), Lotus japonicus L. and pigeon pea (Cajanus cajan [L.] Millsp.). Parents and RIL progeny were screened at the seedling growth stage for responses to salinity stress, imposed by addition of NaCl in the watering solution at a concentration of 18 dS m-1. Salinity-induced symptoms showed normal distribution, and the severity of the symptoms increased over time. QTLs for salinity tolerance were identified on linkage groups Ps III and VII, with flanking SNP markers suitable for selection of resistant cultivars. Comparison of sequences underpinning these SNP markers to the M. truncatula genome defined genomic regions containing candidate genes associated with saline stress tolerance. Conclusion The SNP assays and associated genetic linkage maps developed in this study permitted identification of salinity tolerance QTLs and candidate genes. This constitutes an important set of tools for marker-assisted selection (MAS) programs aimed at performance enhancement of field pea cultivars. PMID:24134188

SNP marker discovery, linkage map construction and identification of QTLs for enhanced salinity tolerance in field pea (Pisum sativum L.).

PubMed

Leonforte, Antonio; Sudheesh, Shimna; Cogan, Noel O I; Salisbury, Philip A; Nicolas, Marc E; Materne, Michael; Forster, John W; Kaur, Sukhjiwan

2013-10-17

Field pea (Pisum sativum L.) is a self-pollinating, diploid, cool-season food legume. Crop production is constrained by multiple biotic and abiotic stress factors, including salinity, that cause reduced growth and yield. Recent advances in genomics have permitted the development of low-cost high-throughput genotyping systems, allowing the construction of saturated genetic linkage maps for identification of quantitative trait loci (QTLs) associated with traits of interest. Genetic markers in close linkage with the relevant genomic regions may then be implemented in varietal improvement programs. In this study, single nucleotide polymorphism (SNP) markers associated with expressed sequence tags (ESTs) were developed and used to generate comprehensive linkage maps for field pea. From a set of 36,188 variant nucleotide positions detected through in silico analysis, 768 were selected for genotyping of a recombinant inbred line (RIL) population. A total of 705 SNPs (91.7%) successfully detected segregating polymorphisms. In addition to SNPs, genomic and EST-derived simple sequence repeats (SSRs) were assigned to the genetic map in order to obtain an evenly distributed genome-wide coverage. Sequences associated with the mapped molecular markers were used for comparative genomic analysis with other legume species. Higher levels of conserved synteny were observed with the genomes of Medicago truncatula Gaertn. and chickpea (Cicer arietinum L.) than with soybean (Glycine max [L.] Merr.), Lotus japonicus L. and pigeon pea (Cajanus cajan [L.] Millsp.). Parents and RIL progeny were screened at the seedling growth stage for responses to salinity stress, imposed by addition of NaCl in the watering solution at a concentration of 18 dS m-1. Salinity-induced symptoms showed normal distribution, and the severity of the symptoms increased over time. QTLs for salinity tolerance were identified on linkage groups Ps III and VII, with flanking SNP markers suitable for selection of resistant cultivars. Comparison of sequences underpinning these SNP markers to the M. truncatula genome defined genomic regions containing candidate genes associated with saline stress tolerance. The SNP assays and associated genetic linkage maps developed in this study permitted identification of salinity tolerance QTLs and candidate genes. This constitutes an important set of tools for marker-assisted selection (MAS) programs aimed at performance enhancement of field pea cultivars.

Final technical report for: Insertional Mutagenesis of Brachypodium distachyon DE-AI02-07ER64452

DOE Office of Scientific and Technical Information (OSTI.GOV)

John, Vogel P.

Several bioenergy grasses are poised to become a major source of energy in the United States. Despite their increasing importance, we know little about the basic biology underlying the traits that control the utility of grasses as energy crops. Better knowledge of grass biology (e.g. identification of the genes that control cell wall composition, plant architecture, cell size, cell division, reproduction, nutrient uptake, carbon flux, etc.) could be used to design rational strategies for crop improvement and shorten the time required to domesticate these species. The use of an appropriate model system is an efficient way to gain this knowledge.more » Brachypodium distachyon is a small annual grass with all the attributes needed to be a modern model organism including simple growth requirements, fast generation time, small stature, small genome size and self-fertility. These attributes led to the recommendation in the DOE’s “Breaking the Biological Barriers to Cellulosic Ethanol: A Joint Research Agenda” report to propose developing and using B. distachyon as a model for energy crops to accelerate their domestication. Strategic investments (e.g. genome sequencing) in B. distachyon by the DOE are now bearing fruit and B. distachyon is being used as a model grass by hundreds of laboratories worldwide. Sequence indexed insertional mutants are an extremely powerful tool for both forward and reverse genetics. They allow researchers to order mutants in any gene tagged in the collection by simply emailing a request. The goal of this project was to create a collection of sequence indexed insertional mutants (T-DNA lines) for the model grass Brachypodium distachyon in order to facilitate research by the scientific community. During the course of this grant we created a collection of 23,649 B. distachyon T-DNA lines and identified 26,112 unique insertion sites. The collection can be queried through the project website (http://jgi.doe.gov/our-science/science-programs/plant-genomics/brachypodium/brachypodium-t-dna-collection/) and through the Phytozome genome browser (http://phytozome.jgi.doe.gov/pz/portal.html). The collection has been heavily utilized by the research community and, as of October 23, 2015, 223 orders for 12,069 seeds packets have been filled. In addition to creating this resource, we also optimized methods for transformation and sequencing DNA flanking insertion sites.« less

Coexistence of Two blaNDM-5 Genes on an IncF Plasmid as Revealed by Nanopore Sequencing.

PubMed

Feng, Yu; Liu, Lu; McNally, Alan; Zong, Zhiyong

2018-05-01

In a carbapenem-resistant Escherichia coli clinical isolate of sequence type 167, two copies of bla NDM-5 were found on a 144,225-bp IncF self-transmissible plasmid of the F36:A4:B - type. Both bla NDM-5 genes were located in 11,065-bp regions flanked by two copies of IS 26 The two regions were identical in sequence but were present at different locations on the plasmid, suggesting a duplication of the same region. This study highlights the complex genetic contexts of bla NDM-5 . Copyright © 2018 American Society for Microbiology.

Isolation and characterization of major histocompatibility complex class II B genes in cranes.

PubMed

Kohyama, Tetsuo I; Akiyama, Takuya; Nishida, Chizuko; Takami, Kazutoshi; Onuma, Manabu; Momose, Kunikazu; Masuda, Ryuichi

2015-11-01

In this study, we isolated and characterized the major histocompatibility complex (MHC) class II B genes in cranes. Genomic sequences spanning exons 1 to 4 were amplified and determined in 13 crane species and three other species closely related to cranes. In all, 55 unique sequences were identified, and at least two polymorphic MHC class II B loci were found in most species. An analysis of sequence polymorphisms showed the signature of positive selection and recombination. A phylogenetic reconstruction based on exon 2 sequences indicated that trans-species polymorphism has persisted for at least 10 million years, whereas phylogenetic analyses of the sequences flanking exon 2 revealed a pattern of concerted evolution. These results suggest that both balancing selection and recombination play important roles in the crane MHC evolution.

Length and sequence variability in mitochondrial control region of the milkfish, Chanos chanos.

PubMed

Ravago, Rachel G; Monje, Virginia D; Juinio-Meñez, Marie Antonette

2002-01-01

Extensive length variability was observed in the mitochondrial control region of the milkfish, Chanos chanos. The nucleotide sequence of the control region and flanking regions was determined. Length variability and heteroplasmy was due to the presence of varying numbers of a 41-bp tandemly repeated sequence and a 48-bp insertion/deletion (indel). The structure and organization of the milkfish control region is similar to that of other teleost fish and vertebrates. However, extensive variation in the copy number of tandem repeats (4-20 copies) and the presence of a relatively large (48-bp) indel, are apparently uncommon in teleost fish control region sequences reported to date. High sequence variability of control region peripheral domains indicates the potential utility of selected regions as markers for population-level studies.

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

Regional Spread of CTX-M-2-Producing Proteus mirabilis with the Identical Genetic Structure in Japan.

PubMed

Kato, Karin; Matsumura, Yasufumi; Yamamoto, Masaki; Nagao, Miki; Takakura, Shunji; Ichiyama, Satoshi

2017-07-01

In this study, we analyzed the molecular epidemiology of extended-spectrum β-lactamase (ESBL)-producing Proteus mirabilis isolates collected from the central region of Japan. Between 2005 and 2012, 820 clinical P. mirabilis isolates were obtained from ten acute care hospitals in Japan. We characterized ESBL confirmatory test-positive isolates by sequencing the ESBL genes and their flanking regions, detecting plasmid replicons, and performing pulsed-field gel electrophoresis (PFGE). Ninety-six isolates (12%) were positive according to the ESBL confirmatory test; all these isolates possessed bla CTX-M-2 with the same flanking structure of upstream ΔISEcp1 and a downstream region identical to downstream bla KLUA-1 . IncT was the prevalent, and only, replicon found in 63 isolates. PFGE analysis detected eight clusters with more than one isolate, among which three included 56 isolates and six included isolates from multiple hospitals. CTX-M-2-producing P. mirabilis with an identical genetic structure flanking bla CTX-M-2 is dominant in this Japanese region, and there is evidence for the clonal spread of isolates.

Characterization by Suppression Subtractive Hybridization of Transcripts That Are Differentially Expressed in Leaves of Anthracnose-Resistant Ramie Cultivar.

PubMed

Xuxia, Wang; Jie, Chen; Bo, Wang; Lijun, Liu; Hui, Jiang; Diluo, Tang; Dingxiang, Peng

2012-01-01

For the purpose of screening putative anthracnose resistance-related genes of ramie ( Boehmeria nivea L. Gaud), a cDNA library was constructed by suppression subtractive hybridization using anthracnose-resistant cultivar Huazhu no. 4. The cDNAs from Huazhu no. 4, which were infected with Colletotrichum gloeosporioides , were used as the tester and cDNAs from uninfected Huazhu no. 4 as the driver. Sequencing analysis and homology searching showed that these clones represented 132 single genes, which were assigned to functional categories, including 14 putative cellular functions, according to categories established for Arabidopsis . These 132 genes included 35 disease resistance and stress tolerance-related genes including putative heat-shock protein 90, metallothionein, PR-1.2 protein, catalase gene, WRKY family genes, and proteinase inhibitor-like protein. Partial disease-related genes were further analyzed by reverse transcription PCR and RNA gel blot. These expressed sequence tags are the first anthracnose resistance-related expressed sequence tags reported in ramie.

Construction of a Lotus japonicus late nodulin expressed sequence tag library and identification of novel nodule-specific genes.

PubMed Central

Szczyglowski, K; Hamburger, D; Kapranov, P; de Bruijn, F J

1997-01-01

A range of novel expressed sequence tags (ESTs) associated with late developmental events during nodule organogenesis in the legume Lotus japonicus were identified using mRNA differential display; 110 differentially displayed polymerase chain reaction products were cloned and analyzed. Of 88 unique cDNAs obtained, 22 shared significant homology to DNA/protein sequences in the respective databases. This group comprises, among others, a nodule-specific homolog of protein phosphatase 2C, a peptide transporter protein, and a nodule-specific form of cytochrome P450. RNA gel-blot analysis of 16 differentially displayed ESTs confirmed their nodule-specific expression pattern. The kinetics of mRNA accumulation of the majority of the ESTs analyzed were found to resemble the expression pattern observed for the L. japonicus leghemoglobin gene. These results indicate that the newly isolated molecular markers correspond to genes induced during late developmental stages of L. japonicus nodule organogenesis and provide important, novel tools for the study of nodulation. PMID:9276951

Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation.

PubMed

Shore, Sabrina; Henderson, Jordana M; Lebedev, Alexandre; Salcedo, Michelle P; Zon, Gerald; McCaffrey, Anton P; Paul, Natasha; Hogrefe, Richard I

2016-01-01

For most sample types, the automation of RNA and DNA sample preparation workflows enables high throughput next-generation sequencing (NGS) library preparation. Greater adoption of small RNA (sRNA) sequencing has been hindered by high sample input requirements and inherent ligation side products formed during library preparation. These side products, known as adapter dimer, are very similar in size to the tagged library. Most sRNA library preparation strategies thus employ a gel purification step to isolate tagged library from adapter dimer contaminants. At very low sample inputs, adapter dimer side products dominate the reaction and limit the sensitivity of this technique. Here we address the need for improved specificity of sRNA library preparation workflows with a novel library preparation approach that uses modified adapters to suppress adapter dimer formation. This workflow allows for lower sample inputs and elimination of the gel purification step, which in turn allows for an automatable sRNA library preparation protocol.

Identification and characterization of 43 microsatellite markers derived from expressed sequence tags of the sea cucumber ( Apostichopus japonicus)

NASA Astrophysics Data System (ADS)

Jiang, Qun; Li, Qi; Yu, Hong; Kong, Lingfeng

2011-06-01

The sea cucumber Apostichopus japonicus is a commercially and ecologically important species in China. A total of 3056 potential unigenes were generated after assembling 7597 A. japonicus expressed sequence tags (ESTs) downloaded from Gen-Bank. Two hundred and fifty microsatellite-containing ESTs (8.18%) and 299 simple sequence repeats (SSRs) were detected. The average density of SSRs was 1 per 7.403 kb of EST after redundancy elimination. Di-nucleotide repeat motifs appeared to be the most abundant type with a percentage of 69.90%. Of the 126 primer pairs designed, 90 amplified the expected products and 43 showed polymorphism in 30 individuals tested. The number of alleles per locus ranged from 2 to 26 with an average of 7.0 alleles, and the observed and expected heterozygosities varied from 0.067 to 1.000 and from 0.066 to 0.959, respectively. These new EST-derived microsatellite markers would provide sufficient polymorphism for population genetic studies and genome mapping of this sea cucumber species.

JC Virus Mediates Invasion and Migration in Colorectal Metastasis

PubMed Central

Link, Alexander; Shin, Sung Kwan; Nagasaka, Takeshi; Balaguer, Francesc; Koi, Minoru; Jung, Barbara; Boland, C. Richard; Goel, Ajay

2009-01-01

Introduction JC Virus (JCV), a human polyomavirus, is frequently present in colorectal cancers (CRCs). JCV large T-Ag (T-Ag) expressed in approximately half of all CRC's, however, its functional role in CRC is poorly understood. We hypothesized that JCV T-Ag may mediate metastasis in CRC cells through increased migration and invasion. Material and Methods CRC cell lines (HCT116 and SW837) were stably transfected with JCV early transcript sequences cloned into pCR3 or empty vectors. Migration and invasion assays were performed using Boyden chambers. Global gene expression analysis was performed to identify genetic targets and pathways altered by T-Ag expression. Microarray results were validated by qRT-PCR, protein expression analyses and immunohistochemistry. Matching primary CRCs and liver metastases from 33 patients were analyzed for T-Ag expression by immunohistochemistry. Results T-Ag expressing cell lines showed 2 to 3-fold increase in migration and invasion compared to controls. JCV T-Ag expression resulted in differential expression of several genetic targets, including genes that mediate cell migration and invasion. Pathway analysis suggested a significant involvement of these genes with AKT and MAPK signaling. Treatment with selective PI3K/AKT and MAPK pathway inhibitors resulted in reduced migration and invasion. In support of our in-vitro results, immunohistochemical staining of the advanced stage tumors revealed frequent JCV T-Ag expression in metastatic primary tumors (92%) as well as in their matching liver metastasis (73%). Conclusion These data suggest that JCV T-Ag expression in CRC associates with a metastatic phenotype, which may partly be mediated through the AKT/MAPK signaling pathway. Frequent expression of JCV T-Ag in CRC liver metastasis provides further clues supporting a mechanistic role for JCV as a possible mediator of cellular motility and invasion in CRC. PMID:19997600

GSyellow, a Multifaceted Tag for Functional Protein Analysis in Monocot and Dicot Plants.

PubMed

Besbrugge, Nienke; Van Leene, Jelle; Eeckhout, Dominique; Cannoot, Bernard; Kulkarni, Shubhada R; De Winne, Nancy; Persiau, Geert; Van De Slijke, Eveline; Bontinck, Michiel; Aesaert, Stijn; Impens, Francis; Gevaert, Kris; Van Damme, Daniel; Van Lijsebettens, Mieke; Inzé, Dirk; Vandepoele, Klaas; Nelissen, Hilde; De Jaeger, Geert

2018-06-01

The ability to tag proteins has boosted the emergence of generic molecular methods for protein functional analysis. Fluorescent protein tags are used to visualize protein localization, and affinity tags enable the mapping of molecular interactions by, for example, tandem affinity purification or chromatin immunoprecipitation. To apply these widely used molecular techniques on a single transgenic plant line, we developed a multifunctional tandem affinity purification tag, named GS yellow , which combines the streptavidin-binding peptide tag with citrine yellow fluorescent protein. We demonstrated the versatility of the GS yellow tag in the dicot Arabidopsis ( Arabidopsis thaliana ) using a set of benchmark proteins. For proof of concept in monocots, we assessed the localization and dynamic interaction profile of the leaf growth regulator ANGUSTIFOLIA3 (AN3), fused to the GS yellow tag, along the growth zone of the maize ( Zea mays ) leaf. To further explore the function of ZmAN3, we mapped its DNA-binding landscape in the growth zone of the maize leaf through chromatin immunoprecipitation sequencing. Comparison with AN3 target genes mapped in the developing maize tassel or in Arabidopsis cell cultures revealed strong conservation of AN3 target genes between different maize tissues and across monocots and dicots, respectively. In conclusion, the GS yellow tag offers a powerful molecular tool for distinct types of protein functional analyses in dicots and monocots. As this approach involves transforming a single construct, it is likely to accelerate both basic and translational plant research. © 2018 American Society of Plant Biologists. All rights reserved.

Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127.

PubMed

Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao

2011-12-28

For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.

High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF(II)30 affect estrogen receptor-mediated transcriptional activation.

PubMed

Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F

1997-07-01

The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.

Genetic variation patterns of American chestnut populations at EST-SSRs

Treesearch

Oliver Gailing; C. Dana Nelson

2017-01-01

The objective of this study is to analyze patterns of genetic variation at genic expressed sequence tag - simple sequence repeats (EST-SSRs) and at chloroplast DNA markers in populations of American chestnut (Castanea dentata Borkh.) to assist in conservation and breeding efforts. Allelic diversity at EST-SSRs decreased significantly from southwest to northeast along...

Identification of genotyping-by-sequencing sequence tags associated with milling performance and end-use quality traits in hard red spring wheat (Triticum aestivum L.)

USDA-ARS?s Scientific Manuscript database

Wheat quality is defined by culinary end-uses and processing characteristics. Wheat breeders are interested to identify quantitative trait loci for grain, milling, and end-use quality traits because it is imperative to understand the genetic complexity underlying quantitatively inherited traits to ...

Genome Comparisons Reveal a Dominant Mechanism of Chromosome Number Reduction in Grasses and Accelerated Genome Evolution in Triticeae

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphism was employed in the construction of a high-resolution, expressed sequence tag (EST) map of Aegilops tauschii, the diploid source of the wheat D genome. Comparison of the map with the rice and sorghum genome sequences revealed 50 inversions and translocations; 2, 8, and...

Passive wireless tags for tongue controlled assistive technology interfaces.

PubMed

Rakibet, Osman O; Horne, Robert J; Kelly, Stephen W; Batchelor, John C

2016-03-01

Tongue control with low profile, passive mouth tags is demonstrated as a human-device interface by communicating values of tongue-tag separation over a wireless link. Confusion matrices are provided to demonstrate user accuracy in targeting by tongue position. Accuracy is found to increase dramatically after short training sequences with errors falling close to 1% in magnitude with zero missed targets. The rate at which users are able to learn accurate targeting with high accuracy indicates that this is an intuitive device to operate. The significance of the work is that innovative very unobtrusive, wireless tags can be used to provide intuitive human-computer interfaces based on low cost and disposable mouth mounted technology. With the development of an appropriate reading system, control of assistive devices such as computer mice or wheelchairs could be possible for tetraplegics and others who retain fine motor control capability of their tongues. The tags contain no battery and are intended to fit directly on the hard palate, detecting tongue position in the mouth with no need for tongue piercings.

An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries

PubMed Central

Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M

2004-01-01

Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051

Delimiting regulatory sequences of the Drosophila melanogaster Ddc gene.

PubMed Central

Hirsh, J; Morgan, B A; Scholnick, S B

1986-01-01

We delimited sequences necessary for in vivo expression of the Drosophila melanogaster dopa decarboxylase gene Ddc. The expression of in vitro-altered genes was assayed following germ line integration via P-element vectors. Sequences between -209 and -24 were necessary for normally regulated expression, although genes lacking these sequences could be expressed at 10 to 50% of wild-type levels at specific developmental times. These genes showed components of normal developmental expression, which suggests that they retain some regulatory elements. All Ddc genes lacking the normal immediate 5'-flanking sequences were grossly deficient in larval central nervous system expression. Thus, this upstream region must contain at least one element necessary for this expression. A mutated Ddc gene without a normal TATA boxlike sequence used the normal RNA start points, indicating that this sequences is not required for start point specificity. Images PMID:3099170

AmpliVar: mutation detection in high-throughput sequence from amplicon-based libraries.

PubMed

Hsu, Arthur L; Kondrashova, Olga; Lunke, Sebastian; Love, Clare J; Meldrum, Cliff; Marquis-Nicholson, Renate; Corboy, Greg; Pham, Kym; Wakefield, Matthew; Waring, Paul M; Taylor, Graham R

2015-04-01

Conventional means of identifying variants in high-throughput sequencing align each read against a reference sequence, and then call variants at each position. Here, we demonstrate an orthogonal means of identifying sequence variation by grouping the reads as amplicons prior to any alignment. We used AmpliVar to make key-value hashes of sequence reads and group reads as individual amplicons using a table of flanking sequences. Low-abundance reads were removed according to a selectable threshold, and reads above this threshold were aligned as groups, rather than as individual reads, permitting the use of sensitive alignment tools. We show that this approach is more sensitive, more specific, and more computationally efficient than comparable methods for the analysis of amplicon-based high-throughput sequencing data. The method can be extended to enable alignment-free confirmation of variants seen in hybridization capture target-enrichment data. © 2015 WILEY PERIODICALS, INC.

EST-PAC a web package for EST annotation and protein sequence prediction

PubMed Central

Strahm, Yvan; Powell, David; Lefèvre, Christophe

2006-01-01

With the decreasing cost of DNA sequencing technology and the vast diversity of biological resources, researchers increasingly face the basic challenge of annotating a larger number of expressed sequences tags (EST) from a variety of species. This typically consists of a series of repetitive tasks, which should be automated and easy to use. The results of these annotation tasks need to be stored and organized in a consistent way. All these operations should be self-installing, platform independent, easy to customize and amenable to using distributed bioinformatics resources available on the Internet. In order to address these issues, we present EST-PAC a web oriented multi-platform software package for expressed sequences tag (EST) annotation. EST-PAC provides a solution for the administration of EST and protein sequence annotations accessible through a web interface. Three aspects of EST annotation are automated: 1) searching local or remote biological databases for sequence similarities using Blast services, 2) predicting protein coding sequence from EST data and, 3) annotating predicted protein sequences with functional domain predictions. In practice, EST-PAC integrates the BLASTALL suite, EST-Scan2 and HMMER in a relational database system accessible through a simple web interface. EST-PAC also takes advantage of the relational database to allow consistent storage, powerful queries of results and, management of the annotation process. The system allows users to customize annotation strategies and provides an open-source data-management environment for research and education in bioinformatics. PMID:17147782

Variation of genomic islands and flanking fragments in Vibrio parahaemolyticus isolates from environmental and clinical sources in Taiwan.

PubMed

Chi, Po-Shen; Wong, Hin-Chung

2017-10-16

Vibrio parahaemolyticus is a halophilic foodborne pathogenic bacterium that causes gastroenteritis; it has become an issue of global concern since the emergence and spread of pandemic O3:K6 strains. This study evaluated the role of Vibrio pathogenicity island (VPaI)-associated fragments in the genetic variation and grouping of this pathogen. Distribution of some VPaI fragments and flanking fragments (VPaI-1, VPaI-4, VPaI-5, VPaI-6 and VPaI-7) was determined in a total of 53 V. parahaemolyticus isolates from environmental and clinical sources in Taiwan, and supported by the sequences of seven fragments of VPaI-4 and its flanking fragment VP2145. As determined from the distribution of these VPaI-associated fragments, the clinical pandemic isolates were closely related in a single cluster; the clinical nonpandemic isolates were grouped into several clusters, while the environmental isolates were comparatively highly diversified. The profiles of virulence-associated genes of environmental pathogenic isolates varied, and were closer to those of clinical nonpandemic isolates than those of pandemic isolates. Isolates with atypical profiles of the VPaI-associated fragments and virulence-associated genes were identified. Sequences of VP2145 exhibited a close phylogenetic relationship among these local isolates, which were distinct from most V. parahaemolyticus strains from other geographic regions. This investigation demonstrated the application of VPaI-associated fragments in studying the genetic variation and clustering of V. parahaemolyticus isolates from different sources. Copyright © 2017. Published by Elsevier B.V.

Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

PubMed

Meng, C X; Wei, W; Su, Z- L; Qin, S

2006-10-01

Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

Development of a strategy and computational application to select candidate protein analogues with reduced HLA binding and immunogenicity.

PubMed

Dhanda, Sandeep Kumar; Grifoni, Alba; Pham, John; Vaughan, Kerrie; Sidney, John; Peters, Bjoern; Sette, Alessandro

2018-01-01

Unwanted immune responses against protein therapeutics can reduce efficacy or lead to adverse reactions. T-cell responses are key in the development of such responses, and are directed against immunodominant regions within the protein sequence, often associated with binding to several allelic variants of HLA class II molecules (promiscuous binders). Herein, we report a novel computational strategy to predict 'de-immunized' peptides, based on previous studies of erythropoietin protein immunogenicity. This algorithm (or method) first predicts promiscuous binding regions within the target protein sequence and then identifies residue substitutions predicted to reduce HLA binding. Further, this method anticipates the effect of any given substitution on flanking peptides, thereby circumventing the creation of nascent HLA-binding regions. As a proof-of-principle, the algorithm was applied to Vatreptacog α, an engineered Factor VII molecule associated with unintended immunogenicity. The algorithm correctly predicted the two immunogenic peptides containing the engineered residues. As a further validation, we selected and evaluated the immunogenicity of seven substitutions predicted to simultaneously reduce HLA binding for both peptides, five control substitutions with no predicted reduction in HLA-binding capacity, and additional flanking region controls. In vitro immunogenicity was detected in 21·4% of the cultures of peptides predicted to have reduced HLA binding and 11·4% of the flanking regions, compared with 46% for the cultures of the peptides predicted to be immunogenic. This method has been implemented as an interactive application, freely available online at http://tools.iedb.org/deimmunization/. © 2017 John Wiley & Sons Ltd.

Depositional systems and diagenesis of Travis Peak tight gas sandstone reservoirs, Sabine Uplift Area, Texas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fracasso, M.A.; Dutton, S.P.; Finley, R.J.

The Travis Peak formation (lower Cretaceous) in the eastern East Texas basin is a fluvio-deltaic depositional system divided into large-scale facies packages: a middle sandstone-rich fluvial and delta-plain sequence that is gradationally overlain and underlain by a marine-influenced delta-fringe zone with a higher mudstone content. Domes and structural terraces on the west flank of the Sabine Uplift influenced deposition of Travis Peak sediments, and most Travis Peak gas production in this area is from thin sandstones (<25 ft(<7.6 m) thick) in the upper delta-fringe facies. The trapping mechanism is stratigraphic pinch-out of sandstones or porosity zones within sandstone, or both,more » on the flanks of structures. Detailed mapping of producing sandstone sequences in the uppermost upper delta-fringe on the western flank of the Bethany structure has delineated fluvial channelways, distributary or tidal channels, and barrier of distributary-mouth bars. Most Travis Peak gas production in the Bethany West area is from the bases of channel sandstones in a marine-influenced facies belt. Travis Peak sandstones in the eastern East Texas basin have undergone a complex series of diagenetic modifications. Precipitation of authigenic quartz, ankerite, dolomite, illite, and chlorite and the introduction of reservoir bitumen were the most important causes of occlusion of primary porosity and reduction of permeability. Permeability decreases with depth in the Travis Peak, which suggests that the diagenetic processes that caused extensive cementation and resultant low permeability throughout most of the formation operated less completely on sediments deposited near the top of the succession.« less

Distinguishing aspartic and isoaspartic acids in peptides by several mass spectrometric fragmentation methods

PubMed Central

DeGraan-Weber, Nick; Zhang, Jun; Reilly, James P.

2016-01-01

Six ion fragmentation techniques that can distinguish aspartic acid from its isomer, isoaspartic acid, were compared. MALDI post source decay (PSD), MALDI 157 nm photodissociation, TMPP charge tagging in PSD and photodissociation, ESI collision-induced dissociation (CID), electron transfer dissociation (ETD), and free-radical initiated peptide sequencing (FRIPS) with CID were applied to peptides containing either aspartic or isoaspartic acid. Diagnostic ions, such as the y-46 and b+H2O, are present in PSD, photodissociation, and charge tagging. c•+57 and z-57 ions are observed in ETD and FRIPS experiments. For some molecules, aspartic and isoaspartic acid yield ion fragments with significantly different intensities. ETD and charge tagging appear to be most effective at distinguishing these residues. PMID:27613306

OSIRIS-REx Touch-And-Go (TAG) Mission Design and Analysis

NASA Technical Reports Server (NTRS)

Berry, Kevin; Sutter, Brian; May, Alex; Williams, Ken; Barbee, Brent W.; Beckman, Mark; Williams, Bobby

2013-01-01

The Origins Spectral Interpretation Resource Identification Security Regolith Explorer (OSIRIS-REx) mission is a NASA New Frontiers mission launching in 2016 to rendezvous with the near-Earth asteroid (101955) 1999 RQ36 in late 2018. After several months in formation with and orbit about the asteroid, OSIRIS-REx will fly a Touch-And-Go (TAG) trajectory to the asteroid s surface to obtain a regolith sample. This paper describes the mission design of the TAG sequence and the propulsive maneuvers required to achieve the trajectory. This paper also shows preliminary results of orbit covariance analysis and Monte-Carlo analysis that demonstrate the ability to arrive at a targeted location on the surface of RQ36 within a 25 meter radius with 98.3% confidence.

Frequency tagging to track the neural processing of contrast in fast, continuous sound sequences.

PubMed

Nozaradan, Sylvie; Mouraux, André; Cousineau, Marion

2017-07-01

The human auditory system presents a remarkable ability to detect rapid changes in fast, continuous acoustic sequences, as best illustrated in speech and music. However, the neural processing of rapid auditory contrast remains largely unclear, probably due to the lack of methods to objectively dissociate the response components specifically related to the contrast from the other components in response to the sequence of fast continuous sounds. To overcome this issue, we tested a novel use of the frequency-tagging approach allowing contrast-specific neural responses to be tracked based on their expected frequencies. The EEG was recorded while participants listened to 40-s sequences of sounds presented at 8Hz. A tone or interaural time contrast was embedded every fifth sound (AAAAB), such that a response observed in the EEG at exactly 8 Hz/5 (1.6 Hz) or harmonics should be the signature of contrast processing by neural populations. Contrast-related responses were successfully identified, even in the case of very fine contrasts. Moreover, analysis of the time course of the responses revealed a stable amplitude over repetitions of the AAAAB patterns in the sequence, except for the response to perceptually salient contrasts that showed a buildup and decay across repetitions of the sounds. Overall, this new combination of frequency-tagging with an oddball design provides a valuable complement to the classic, transient, evoked potentials approach, especially in the context of rapid auditory information. Specifically, we provide objective evidence on the neural processing of contrast embedded in fast, continuous sound sequences. NEW & NOTEWORTHY Recent theories suggest that the basis of neurodevelopmental auditory disorders such as dyslexia might be an impaired processing of fast auditory changes, highlighting how the encoding of rapid acoustic information is critical for auditory communication. Here, we present a novel electrophysiological approach to capture in humans neural markers of contrasts in fast continuous tone sequences. Contrast-specific responses were successfully identified, even for very fine contrasts, providing direct insight on the encoding of rapid auditory information. Copyright © 2017 the American Physiological Society.

Refined δ13C trend of the Dal'nyaya Taiga series of the Ura uplift (Vendian, southern part of Middle Siberia)

NASA Astrophysics Data System (ADS)

Rud'ko, S. V.; Petrov, P. Yu.; Kuznetsov, A. B.; Shatsillo, A. V.; Petrov, O. L.

2017-12-01

New data were obtained on δ13Ccarb and δ18O variations in the sequence of deposits of the Dal'nyaya Taiga series at the western and eastern flanks of the Ura anticline. The summary δ13C curve was plotted in view of the correlation of sequence-stratigraphic data of the basin analysis. A series of positive anomalies was found within the succession. Alternatives for global chemostratigraphic correlation of the Dal'nyaya Taiga series of the Ura uplift were considered.

Compositional correlations in the chicken genome.

PubMed

Musto, H; Romero, H; Zavala, A; Bernardi, G

1999-09-01

This paper analyses the compositional correlations that hold in the chicken genome. Significant linear correlations were found among the regions studied-coding sequences (and their first, second, and third codon positions), flanking regions (5' and 3'), and introns-as is the case in the human genome. We found that these compositional correlations are not limited to global GC levels but even extend to individual bases. Furthermore, an analysis of 1037 coding sequences has confirmed a correlation among GC(3), GC(2), and GC(1). The implications of these results are discussed.

Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

PubMed Central

2012-01-01

Background In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin) as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA) sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Results Twenty informative plants from a cross of RxS (disease resistant x susceptible) in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM), and are now replacing the markers previously developed by a traditional DNA fingerprinting method for marker-assisted selection in the Australian national lupin breeding program. Conclusions We demonstrated that more than 30 molecular markers linked to a target gene of agronomic trait of interest can be identified from a small portion (1/8) of one sequencing run on HiSeq2000 by applying NGS based RAD sequencing in marker development. The markers developed by the strategy described in this study are all co-dominant SNP markers, which can readily be converted into high throughput multiplex format or low-cost, simple PCR-based markers desirable for large scale marker implementation in plant breeding programs. The high density and closely linked molecular markers associated with a target trait help to overcome a major bottleneck for implementation of molecular markers on a wide range of germplasm in breeding programs. We conclude that application of NGS based RAD sequencing as DNA fingerprinting is a very rapid and cost-effective strategy for marker development in molecular plant breeding. The strategy does not require any prior genome knowledge or molecular information for the species under investigation, and it is applicable to other plant species. PMID:22805587

Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

PubMed

Yang, Huaan; Tao, Ye; Zheng, Zequn; Li, Chengdao; Sweetingham, Mark W; Howieson, John G

2012-07-17

In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin) as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA) sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Twenty informative plants from a cross of RxS (disease resistant x susceptible) in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM), and are now replacing the markers previously developed by a traditional DNA fingerprinting method for marker-assisted selection in the Australian national lupin breeding program. We demonstrated that more than 30 molecular markers linked to a target gene of agronomic trait of interest can be identified from a small portion (1/8) of one sequencing run on HiSeq2000 by applying NGS based RAD sequencing in marker development. The markers developed by the strategy described in this study are all co-dominant SNP markers, which can readily be converted into high throughput multiplex format or low-cost, simple PCR-based markers desirable for large scale marker implementation in plant breeding programs. The high density and closely linked molecular markers associated with a target trait help to overcome a major bottleneck for implementation of molecular markers on a wide range of germplasm in breeding programs. We conclude that application of NGS based RAD sequencing as DNA fingerprinting is a very rapid and cost-effective strategy for marker development in molecular plant breeding. The strategy does not require any prior genome knowledge or molecular information for the species under investigation, and it is applicable to other plant species.

A resource of large-scale molecular markers for monitoring Agropyron cristatum chromatin introgression in wheat background based on transcriptome sequences.

PubMed

Zhang, Jinpeng; Liu, Weihua; Lu, Yuqing; Liu, Qunxing; Yang, Xinming; Li, Xiuquan; Li, Lihui

2017-09-20

Agropyron cristatum is a wild grass of the tribe Triticeae and serves as a gene donor for wheat improvement. However, very few markers can be used to monitor A. cristatum chromatin introgressions in wheat. Here, we reported a resource of large-scale molecular markers for tracking alien introgressions in wheat based on transcriptome sequences. By aligning A. cristatum unigenes with the Chinese Spring reference genome sequences, we designed 9602 A. cristatum expressed sequence tag-sequence-tagged site (EST-STS) markers for PCR amplification and experimental screening. As a result, 6063 polymorphic EST-STS markers were specific for the A. cristatum P genome in the single-receipt wheat background. A total of 4956 randomly selected polymorphic EST-STS markers were further tested in eight wheat variety backgrounds, and 3070 markers displaying stable and polymorphic amplification were validated. These markers covered more than 98% of the A. cristatum genome, and the marker distribution density was approximately 1.28 cM. An application case of all EST-STS markers was validated on the A. cristatum 6 P chromosome. These markers were successfully applied in the tracking of alien A. cristatum chromatin. Altogether, this study provided a universal method of large-scale molecular marker development to monitor wild relative chromatin in wheat.

Hyperdiversity of ectomycorrhizal fungus assemblages on oak seedlings in mixed forests in the southern Appalachian Mountains

Treesearch

John F. Walker; Orson K. Miller; Jonathan L. Horton

2005-01-01

Diversity of ectotrophic mycobionts on outplanted seedlings of two oak species (Quercus rubra and Quercus prinus) was estimated at two sites in mature mixed forests in the southern Appalachian Mountains by sequencing nuclear 5.8S rRNA genes and the flanking internal transcribed spacer regions I and II (ITS). The...

Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

Cancer.gov

Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in

PRIMARY STRUCTURE OF THE CYTOCHROME P450 LANOSTEROL 14A-DEMETHYLASE GENE FROM CANDIDA TROPICALIS

EPA Science Inventory

We report the nucleotide sequence of the gene and flanking DNA for the cytochrome P450 lanosterol 14 alpha-demethylase (14DM) from the yeast Candida tropicalis ATCC750. An open reading frame (ORF) of 528 codons encoding a 60.9-kD protein is identified. This ORF includes a charact...

Analysis of beta-carotene hydroxylase gene cDNA isolated from the American oil-palm (Elaeis oleifera) mesocarp tissue cDNA library

PubMed Central

Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H

2010-01-01

It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789

Cloning, analysis and functional annotation of expressed sequence tags from the Earthworm Eisenia fetida

PubMed Central

Pirooznia, Mehdi; Gong, Ping; Guan, Xin; Inouye, Laura S; Yang, Kuan; Perkins, Edward J; Deng, Youping

2007-01-01

Background Eisenia fetida, commonly known as red wiggler or compost worm, belongs to the Lumbricidae family of the Annelida phylum. Little is known about its genome sequence although it has been extensively used as a test organism in terrestrial ecotoxicology. In order to understand its gene expression response to environmental contaminants, we cloned 4032 cDNAs or expressed sequence tags (ESTs) from two E. fetida libraries enriched with genes responsive to ten ordnance related compounds using suppressive subtractive hybridization-PCR. Results A total of 3144 good quality ESTs (GenBank dbEST accession number EH669363–EH672369 and EL515444–EL515580) were obtained from the raw clone sequences after cleaning. Clustering analysis yielded 2231 unique sequences including 448 contigs (from 1361 ESTs) and 1783 singletons. Comparative genomic analysis showed that 743 or 33% of the unique sequences shared high similarity with existing genes in the GenBank nr database. Provisional function annotation assigned 830 Gene Ontology terms to 517 unique sequences based on their homology with the annotated genomes of four model organisms Drosophila melanogaster, Mus musculus, Saccharomyces cerevisiae, and Caenorhabditis elegans. Seven percent of the unique sequences were further mapped to 99 Kyoto Encyclopedia of Genes and Genomes pathways based on their matching Enzyme Commission numbers. All the information is stored and retrievable at a highly performed, web-based and user-friendly relational database called EST model database or ESTMD version 2. Conclusion The ESTMD containing the sequence and annotation information of 4032 E. fetida ESTs is publicly accessible at . PMID:18047730

Genetic variations of VDR/NR1I1 encoding vitamin D receptor in a Japanese population.

PubMed

Ukaji, Maho; Saito, Yoshiro; Fukushima-Uesaka, Hiromi; Maekawa, Keiko; Katori, Noriko; Kaniwa, Nahoko; Yoshida, Teruhiko; Nokihara, Hiroshi; Sekine, Ikuo; Kunitoh, Hideo; Ohe, Yuichiro; Yamamoto, Noboru; Tamura, Tomohide; Saijo, Nagahiro; Sawada, Jun-ichi

2007-12-01

The vitamin D receptor (VDR) is a transcriptional factor responsive to 1alpha,25-dihydroxyvitamin D(3) and lithocholic acid, and induces expression of drug metabolizing enzymes CYP3A4, CYP2B6 and CYP2C9. In this study, the promoter regions, 14 exons (including 6 exon 1's) and their flanking introns of VDR were comprehensively screened for genetic variations in 107 Japanese subjects. Sixty-one genetic variations including 25 novel ones were found: 9 in the 5'-flanking region, 2 in the 5'-untranslated region (UTR), 7 in the coding exons (5 synonymous and 2 nonsynonymous variations), 12 in the 3'-UTR, 19 in the introns between the exon 1's, and 12 in introns 2 to 8. Of these, one novel nonsynonymous variation, 154A>G (Met52Val), was detected with an allele frequency of 0.005. The single nucleotide polymorphisms (SNPs) that increase VDR expression or activity, -29649G>A, 2T>C and 1592((*)308)C>A tagging linked variations in the 3'-UTR, were detected at 0.430, 0.636, and 0.318 allele frequencies, respectively. Another SNP, -26930A>G, with reduced VDR transcription was found at a 0.028 frequency. These findings would be useful for association studies on VDR variations in Japanese.

Traceless splicing enabled by substrate-induced activation of the Nostoc punctiforme Npu DnaE intein after mutation of a catalytic cysteine to serine.

PubMed

Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine

2014-12-12

Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.

Breakpoint structure of the Anopheles gambiae 2Rb chromosomal inversion.

PubMed

Lobo, Neil F; Sangaré, Djibril M; Regier, Allison A; Reidenbach, Kyanne R; Bretz, David A; Sharakhova, Maria V; Emrich, Scott J; Traore, Sekou F; Costantini, Carlo; Besansky, Nora J; Collins, Frank H

2010-10-25

Alternative arrangements of chromosome 2 inversions in Anopheles gambiae are important sources of population structure, and are associated with adaptation to environmental heterogeneity. The forces responsible for their origin and maintenance are incompletely understood. Molecular characterization of inversion breakpoints provides insight into how they arose, and provides the basis for development of molecular karyotyping methods useful in future studies. Sequence comparison of regions near the cytological breakpoints of 2Rb allowed the molecular delineation of breakpoint boundaries. Comparisons were made between the standard 2R+b arrangement in the An. gambiae PEST reference genome and the inverted 2Rb arrangements in the An. gambiae M and S genome assemblies. Sequence differences between alternative 2Rb arrangements were exploited in the design of a PCR diagnostic assay, which was evaluated against the known chromosomal banding pattern of laboratory colonies and field-collected samples from Mali and Cameroon. The breakpoints of the 7.55 Mb 2Rb inversion are flanked by extensive runs of the same short (72 bp) tandemly organized sequence, which was likely responsible for chromosomal breakage and rearrangement. Application of the molecular diagnostic assay suggested that 2Rb has a single common origin in An. gambiae and its sibling species, Anopheles arabiensis, and also that the standard arrangement (2R+b) may have arisen twice through breakpoint reuse. The molecular diagnostic was reliable when applied to laboratory colonies, but its accuracy was lower in natural populations. The complex repetitive sequence flanking the 2Rb breakpoint region may be prone to structural and sequence-level instability. The 2Rb molecular diagnostic has immediate application in studies based on laboratory colonies, but its usefulness in natural populations awaits development of complementary molecular tools.

Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

PubMed

Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

2017-03-01

Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

Transcriptome sequencing and de novo analysis of the copepod Calanus sinicus using 454 GS FLX.

PubMed

Ning, Juan; Wang, Minxiao; Li, Chaolun; Sun, Song

2013-01-01

Despite their species abundance and primary economic importance, genomic information about copepods is still limited. In particular, genomic resources are lacking for the copepod Calanus sinicus, which is a dominant species in the coastal waters of East Asia. In this study, we performed de novo transcriptome sequencing to produce a large number of expressed sequence tags for the copepod C. sinicus. Copepodid larvae and adults were used as the basic material for transcriptome sequencing. Using 454 pyrosequencing, a total of 1,470,799 reads were obtained, which were assembled into 56,809 high quality expressed sequence tags. Based on their sequence similarity to known proteins, about 14,000 different genes were identified, including members of all major conserved signaling pathways. Transcripts that were putatively involved with growth, lipid metabolism, molting, and diapause were also identified among these genes. Differentially expressed genes related to several processes were found in C. sinicus copepodid larvae and adults. We detected 284,154 single nucleotide polymorphisms (SNPs) that provide a resource for gene function studies. Our data provide the most comprehensive transcriptome resource available for C. sinicus. This resource allowed us to identify genes associated with primary physiological processes and SNPs in coding regions, which facilitated the quantitative analysis of differential gene expression. These data should provide foundation for future genetic and genomic studies of this and related species.

Defining the transcriptome assembly and its use for genome dynamics and transcriptome profiling studies in pigeonpea (Cajanus cajan L.).

PubMed

Dubey, Anuja; Farmer, Andrew; Schlueter, Jessica; Cannon, Steven B; Abernathy, Brian; Tuteja, Reetu; Woodward, Jimmy; Shah, Trushar; Mulasmanovic, Benjamin; Kudapa, Himabindu; Raju, Nikku L; Gothalwal, Ragini; Pande, Suresh; Xiao, Yongli; Town, Chris D; Singh, Nagendra K; May, Gregory D; Jackson, Scott; Varshney, Rajeev K

2011-06-01

This study reports generation of large-scale genomic resources for pigeonpea, a so-called 'orphan crop species' of the semi-arid tropic regions. FLX/454 sequencing carried out on a normalized cDNA pool prepared from 31 tissues produced 494 353 short transcript reads (STRs). Cluster analysis of these STRs, together with 10 817 Sanger ESTs, resulted in a pigeonpea trancriptome assembly (CcTA) comprising of 127 754 tentative unique sequences (TUSs). Functional analysis of these TUSs highlights several active pathways and processes in the sampled tissues. Comparison of the CcTA with the soybean genome showed similarity to 10 857 and 16 367 soybean gene models (depending on alignment methods). Additionally, Illumina 1G sequencing was performed on Fusarium wilt (FW)- and sterility mosaic disease (SMD)-challenged root tissues of 10 resistant and susceptible genotypes. More than 160 million sequence tags were used to identify FW- and SMD-responsive genes. Sequence analysis of CcTA and the Illumina tags identified a large new set of markers for use in genetics and breeding, including 8137 simple sequence repeats, 12 141 single-nucleotide polymorphisms and 5845 intron-spanning regions. Genomic resources developed in this study should be useful for basic and applied research, not only for pigeonpea improvement but also for other related, agronomically important legumes.

High-resolution phylogenetic microbial community profiling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, Esther; Coleman-Derr, Devin; Bowman, Brett

2014-03-17

The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less

Anchoring 9,371 Maize Expressed Sequence Tagged Unigenes to the Bacterial Artificial Chromosome Contig Map by Two-Dimensional Overgo Hybridization1

PubMed Central

Gardiner, Jack; Schroeder, Steven; Polacco, Mary L.; Sanchez-Villeda, Hector; Fang, Zhiwei; Morgante, Michele; Landewe, Tim; Fengler, Kevin; Useche, Francisco; Hanafey, Michael; Tingey, Scott; Chou, Hugh; Wing, Rod; Soderlund, Carol; Coe, Edward H.

2004-01-01

Our goal is to construct a robust physical map for maize (Zea mays) comprehensively integrated with the genetic map. We have used a two-dimensional 24 × 24 overgo pooling strategy to anchor maize expressed sequence tagged (EST) unigenes to 165,888 bacterial artificial chromosomes (BACs) on high-density filters. A set of 70,716 public maize ESTs seeded derivation of 10,723 EST unigene assemblies. From these assemblies, 10,642 overgo sequences of 40 bp were applied as hybridization probes. BAC addresses were obtained for 9,371 overgo probes, representing an 88% success rate. More than 96% of the successful overgo probes identified two or more BACs, while 5% identified more than 50 BACs. The majority of BACs identified (79%) were hybridized with one or two overgos. A small number of BACs hybridized with eight or more overgos, suggesting that these BACs must be gene rich. Approximately 5,670 overgos identified BACs assembled within one contig, indicating that these probes are highly locus specific. A total of 1,795 megabases (Mb; 87%) of the total 2,050 Mb in BAC contigs were associated with one or more overgos, which are serving as sequence-tagged sites for single nucleotide polymorphism development. Overgo density ranged from less than one overgo per megabase to greater than 20 overgos per megabase. The majority of contigs (52%) hit by overgos contained three to nine overgos per megabase. Analysis of approximately 1,022 Mb of genetically anchored BAC contigs indicates that 9,003 of the total 13,900 overgo-contig sites are genetically anchored. Our results indicate overgos are a powerful approach for generating gene-specific hybridization probes that are facilitating the assembly of an integrated genetic and physical map for maize. PMID:15020742

A High-Throughput Data Mining of Single Nucleotide Polymorphisms in Coffea Species Expressed Sequence Tags Suggests Differential Homeologous Gene Expression in the Allotetraploid Coffea arabica1[W

PubMed Central

Vidal, Ramon Oliveira; Mondego, Jorge Maurício Costa; Pot, David; Ambrósio, Alinne Batista; Andrade, Alan Carvalho; Pereira, Luiz Filipe Protasio; Colombo, Carlos Augusto; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães

2010-01-01

Polyploidization constitutes a common mode of evolution in flowering plants. This event provides the raw material for the divergence of function in homeologous genes, leading to phenotypic novelty that can contribute to the success of polyploids in nature or their selection for use in agriculture. Mounting evidence underlined the existence of homeologous expression biases in polyploid genomes; however, strategies to analyze such transcriptome regulation remained scarce. Important factors regarding homeologous expression biases remain to be explored, such as whether this phenomenon influences specific genes, how paralogs are affected by genome doubling, and what is the importance of the variability of homeologous expression bias to genotype differences. This study reports the expressed sequence tag assembly of the allopolyploid Coffea arabica and one of its direct ancestors, Coffea canephora. The assembly was used for the discovery of single nucleotide polymorphisms through the identification of high-quality discrepancies in overlapped expressed sequence tags and for gene expression information indirectly estimated by the transcript redundancy. Sequence diversity profiles were evaluated within C. arabica (Ca) and C. canephora (Cc) and used to deduce the transcript contribution of the Coffea eugenioides (Ce) ancestor. The assignment of the C. arabica haplotypes to the C. canephora (CaCc) or C. eugenioides (CaCe) ancestral genomes allowed us to analyze gene expression contributions of each subgenome in C. arabica. In silico data were validated by the quantitative polymerase chain reaction and allele-specific combination TaqMAMA-based method. The presence of differential expression of C. arabica homeologous genes and its implications in coffee gene expression, ontology, and physiology are discussed. PMID:20864545

A scalable strategy for high-throughput GFP tagging of endogenous human proteins.

PubMed

Leonetti, Manuel D; Sekine, Sayaka; Kamiyama, Daichi; Weissman, Jonathan S; Huang, Bo

2016-06-21

A central challenge of the postgenomic era is to comprehensively characterize the cellular role of the ∼20,000 proteins encoded in the human genome. To systematically study protein function in a native cellular background, libraries of human cell lines expressing proteins tagged with a functional sequence at their endogenous loci would be very valuable. Here, using electroporation of Cas9 nuclease/single-guide RNA ribonucleoproteins and taking advantage of a split-GFP system, we describe a scalable method for the robust, scarless, and specific tagging of endogenous human genes with GFP. Our approach requires no molecular cloning and allows a large number of cell lines to be processed in parallel. We demonstrate the scalability of our method by targeting 48 human genes and show that the resulting GFP fluorescence correlates with protein expression levels. We next present how our protocols can be easily adapted for the tagging of a given target with GFP repeats, critically enabling the study of low-abundance proteins. Finally, we show that our GFP tagging approach allows the biochemical isolation of native protein complexes for proteomic studies. Taken together, our results pave the way for the large-scale generation of endogenously tagged human cell lines for the proteome-wide analysis of protein localization and interaction networks in a native cellular context.

A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

PubMed

Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

2000-06-30

For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

Sorting Out the Ocean Crust Deep Biosphere with Single Cell Omics Approaches

NASA Astrophysics Data System (ADS)

Orcutt, B.; D'Angelo, T.; Goordial, J.; Jones, R. M.; Carr, S. A.

2017-12-01

Although oceanic crust comprises a large habitat for subsurface life, the structure, function, and dynamics of microbial communities living on rocks in the subsurface are poorly understood. Single cell level approaches can overcome limitations of low biomass in subsurface systems. Coupled with incubation experiments with amino acid orthologs, single cell level sorting can reveal high resolution information about identity, functional potential, and growth. Leveraging collaboration with the Single Cell Genomics Center and the Facility for Aquatic Cytometry at Bigelow Laboratory, we present recent results from single cell level sorting and -omics sequencing from several crustal environments, including the Atlantis Massif and the Juan de Fuca Ridge flank. We will also highlight new experiments conducted with samples recovered from the flank of the Mid-Atlantic Ridge.

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

SSR allelic variation in almond (Prunus dulcis Mill.).

PubMed

Xie, Hua; Sui, Yi; Chang, Feng-Qi; Xu, Yong; Ma, Rong-Cai

2006-01-01

Sixteen SSR markers including eight EST-SSR and eight genomic SSRs were used for genetic diversity analysis of 23 Chinese and 15 international almond cultivars. EST- and genomic SSR markers previously reported in species of Prunus, mainly peach, proved to be useful for almond genetic analysis. DNA sequences of 117 alleles of six of the 16 SSR loci were analysed to reveal sequence variation among the 38 almond accessions. For the four SSR loci with AG/CT repeats, no insertions or deletions were observed in the flanking regions of the 98 alleles sequenced. Allelic size variation of these loci resulted exclusively from differences in the structures of repeat motifs, which involved interruptions or occurrences of new motif repeats in addition to varying number of AG/CT repeats. Some alleles had a high number of uninterrupted repeat motifs, indicating that SSR mutational patterns differ among alleles at a given SSR locus within the almond species. Allelic homoplasy was observed in the SSR loci because of base substitutions, interruptions or compound repeat motifs. Substitutions in the repeat regions were found at two SSR loci, suggesting that point mutations operate on SSRs and hinder the further SSR expansion by introducing repeat interruptions to stabilize SSR loci. Furthermore, it was shown that some potential point mutations in the flanking regions are linked with new SSR repeat motif variation in almond and peach.